WorldWideScience

Sample records for c-p lyase operon

  1. Five phosphonate operon gene products as components of a multi-subunit complex of the carbon-phosphorus lyase pathway

    DEFF Research Database (Denmark)

    Jochimsen, Bjarne; Lolle, Signe; McSorley, Fern R.

    2011-01-01

    Organophosphonate utilization by Escherichia coli requires the 14 cistrons of the phnCDEFGHIJKLMNOP operon, of which the carbon-phosphorus lyase has been postulated to consist of the seven polypeptides specified by phnG to phnM. A 5,660-bp DNA fragment encompassing phnGHIJKLM is cloned, followed...

  2. Structural insights into RipC, a putative citrate lyase β subunit from a Yersinia pestis virulence operon

    International Nuclear Information System (INIS)

    Torres, Rodrigo; Chim, Nicholas; Sankaran, Banumathi; Pujol, Céline; Bliska, James B.; Goulding, Celia W.

    2011-01-01

    Comparison of the 2.45 Å resolution crystal structure of homotrimeric RipC, a putative citrate lyase β subunit from Y. pestis, with structural homologs reveals conserved RipC residues that are implicated in CoA binding. Yersinia pestis remains a threat, with outbreaks of plague occurring in rural areas and its emergence as a weapon of bioterrorism; thus, an improved understanding of its various pathogenicity pathways is warranted. The rip (required for intracellular proliferation) virulence operon is required for Y. pestis survival in interferon-γ-treated macrophages and has been implicated in lowering macrophage-produced nitric oxide levels. RipC, one of three gene products from the rip operon, is annotated as a citrate lyase β subunit. Furthermore, the Y. pestis genome lacks genes that encode citrate lyase α and γ subunits, suggesting a unique functional role of RipC in the Y. pestisrip-mediated survival pathway. Here, the 2.45 Å resolution crystal structure of RipC revealed a homotrimer in which each monomer consists of a (β/α) 8 TIM-barrel fold. Furthermore, the trimeric state was confirmed in solution by size-exclusion chromatography. Through sequence and structure comparisons with homologous proteins, it is proposed that RipC is a putative CoA- or CoA-derivative binding protein

  3. C P Gopalakrishnan

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education. C P Gopalakrishnan. Articles written in Resonance – Journal of Science Education. Volume 9 Issue 6 June 2004 pp 74-85 Classroom. The Real Effects of Pseudo Forces · P Chaitanya Das G Srinivasa Murthy C P Gopalakrishnan P C Deshmukh · More Details ...

  4. c p chaudhari

    Indian Academy of Sciences (India)

    C P CHAUDHARI. Articles written in Bulletin of Materials Science. Volume 41 Issue 1 February 2018 pp 24. A logical explanation of structurally unfit X-ray diffraction peaks in nanoferroelectrics · C M DUDHE B K SAKHARE S S PANCHBHAI S J KHAMBADKAR N V DHOKE C P CHAUDHARI U A PALIKUNDWAR.

  5. C P Anil Kumar

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Earth System Science. C P Anil Kumar. Articles written in Journal of Earth System Science. Volume 124 Issue 8 December 2015 pp 1721-1733. Variation of surface electric field during geomagnetic disturbed period at Maitri, Antarctica · N Jeni Victor C Panneerselvam C P Anil Kumar.

  6. C P Vinod

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. C P Vinod. Articles written in Bulletin of Materials Science. Volume 25 Issue 3 June 2002 pp 247-249 Experimental Techniques. A method employing STM for the estimation of relative changes in the work function of modified metal tips · R B Sharma C P Vinod G U Kulkarni.

  7. C P Singh

    Indian Academy of Sciences (India)

    ... Simon-Gillo C P Singh V Singh M Sivertz A Soldatov R A Soltz S Sorensen P W Stankus N Starinsky P Steinberg E Stenlund A Ster S P Stoll M Sugioka T Sugitate J P Sullivan Y Sumi Z Sun M Suzuki E M Takagui A Taketani M Tamai K H Tanaka Y Tanaka E Taniguchi M J Tannenbaum J Thomas J H Thomas T L Thomas ...

  8. Studies on pectin lyase

    NARCIS (Netherlands)

    Houdenhoven, van F.E.A.

    1975-01-01

    The pectin lyase activity in the commercial enzyme preparation Ultrazym originates from more then one type of enzyme; two of them, accounting for 95 % of the total activity, have been completely purified. As purity criteria specific activity, polyacrylamide disc gel electrophoresis and SDS

  9. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2005-11-18

    Operons are a major feature of all prokaryotic genomes, but how and why operon structures vary is not well understood. To elucidate the life-cycle of operons, we compared gene order between Escherichia coli K12 and its relatives and identified the recently formed and destroyed operons in E. coli. This allowed us to determine how operons form, how they become closely spaced, and how they die. Our findings suggest that operon evolution is driven by selection on gene expression patterns. First, both operon creation and operon destruction lead to large changes in gene expression patterns. For example, the removal of lysA and ruvA from ancestral operons that contained essential genes allowed their expression to respond to lysine levels and DNA damage, respectively. Second, some operons have undergone accelerated evolution, with multiple new genes being added during a brief period. Third, although most operons are closely spaced because of a neutral bias towards deletion and because of selection against large overlaps, highly expressed operons tend to be widely spaced because of regulatory fine-tuning by intervening sequences. Although operon evolution seems to be adaptive, it need not be optimal: new operons often comprise functionally unrelated genes that were already in proximity before the operon formed.

  10. Structural Insights Into The Bacterial Carbon-Phosphorus Lyase Machinery

    DEFF Research Database (Denmark)

    Brodersen, Ditlev Egeskov

    the proteins encoded in the phn operon act in concert to catabolise phosphonate remain unknown. We have determined the crystal structure of a 240 kDa Escherichia coli carbon-phosphorus lyase core complex at 1.7 Å and show that it comprises a highly intertwined network of subunits with several unexpected......Phosphonate compounds act as a nutrient source for some microorganisms when phosphate is limiting but require a specialised enzymatic machinery due to the presence of the highly stable carbon-phosphorus bond. Despite the fundamental importance to microbial metabolism, the details of how...... structural features. The complex contains at least two different active sites and suggest a revision of current models of carbon-phosphorus bond cleavage. Using electron microscopy, we map the binding site of an additional protein subunit, which may use ATP for driving conformational changes during...

  11. Evidence against the selfish operon theory.

    Science.gov (United States)

    Pál, Csaba; Hurst, Laurence D

    2004-06-01

    According to the selfish operon hypothesis, the clustering of genes and their subsequent organization into operons is beneficial for the constituent genes because it enables the horizontal gene transfer of weakly selected, functionally coupled genes. The majority of these are expected to be non-essential genes. From our analysis of the Escherichia coli genome, we conclude that the selfish operon hypothesis is unlikely to provide a general explanation for clustering nor can it account for the gene composition of operons. Contrary to expectations, essential genes with related functions have an especially strong tendency to cluster, even if they are not in operons. Moreover, essential genes are particularly abundant in operons.

  12. The Life-cycle of Operons

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Arkin, Adam P.; Alm, Eric J.

    2007-03-15

    Operons are a major feature of all prokaryotic genomes, buthow and why operon structures vary is not well understood. To elucidatethe life-cycle of operons, we compared gene order between Escherichiacoli K12 and its relatives and identified the recently formed anddestroyed operons in E. coli. This allowed us to determine how operonsform, how they become closely spaced, and how they die. Our findingssuggest that operon evolution may be driven by selection on geneexpression patterns. First, both operon creation and operon destructionlead to large changes in gene expression patterns. For example, theremoval of lysA and ruvA from ancestral operons that contained essentialgenes allowed their expression to respond to lysine levels and DNAdamage, respectively. Second, some operons have undergone acceleratedevolution, with multiple new genes being added during a brief period.Third, although genes within operons are usually closely spaced becauseof a neutral bias toward deletion and because of selection against largeoverlaps, genes in highly expressed operons tend to be widely spacedbecause of regulatory fine-tuning by intervening sequences. Althoughoperon evolution may be adaptive, it need not be optimal: new operonsoften comprise functionally unrelated genes that were already inproximity before the operon formed.

  13. Problem-Solving Test: Tryptophan Operon Mutants

    Science.gov (United States)

    Szeberenyi, Jozsef

    2010-01-01

    This paper presents a problem-solving test that deals with the regulation of the "trp" operon of "Escherichia coli." Two mutants of this operon are described: in mutant A, the operator region of the operon carries a point mutation so that it is unable to carry out its function; mutant B expresses a "trp" repressor protein unable to bind…

  14. The relative value of operon predictions

    NARCIS (Netherlands)

    Brouwer, Rutger W. W.; Kuipers, Oscar P.; van Hijum, Sacha A. F. T.

    For most organisms, computational operon predictions are the only source of genome-wide operon information. Operon prediction methods described in literature are based on (a combination of) the following five criteria: (i) intergenic distance, (ii) conserved gene clusters, (iii) functional relation,

  15. Detecting uber-operons in prokaryotic genomes.

    Science.gov (United States)

    Che, Dongsheng; Li, Guojun; Mao, Fenglou; Wu, Hongwei; Xu, Ying

    2006-01-01

    We present a study on computational identification of uber-operons in a prokaryotic genome, each of which represents a group of operons that are evolutionarily or functionally associated through operons in other (reference) genomes. Uber-operons represent a rich set of footprints of operon evolution, whose full utilization could lead to new and more powerful tools for elucidation of biological pathways and networks than what operons have provided, and a better understanding of prokaryotic genome structures and evolution. Our prediction algorithm predicts uber-operons through identifying groups of functionally or transcriptionally related operons, whose gene sets are conserved across the target and multiple reference genomes. Using this algorithm, we have predicted uber-operons for each of a group of 91 genomes, using the other 90 genomes as references. In particular, we predicted 158 uber-operons in Escherichia coli K12 covering 1830 genes, and found that many of the uber-operons correspond to parts of known regulons or biological pathways or are involved in highly related biological processes based on their Gene Ontology (GO) assignments. For some of the predicted uber-operons that are not parts of known regulons or pathways, our analyses indicate that their genes are highly likely to work together in the same biological processes, suggesting the possibility of new regulons and pathways. We believe that our uber-operon prediction provides a highly useful capability and a rich information source for elucidation of complex biological processes, such as pathways in microbes. All the prediction results are available at our Uber-Operon Database: http://csbl.bmb.uga.edu/uber, the first of its kind.

  16. The post-transcriptional operon

    DEFF Research Database (Denmark)

    Tenenbaum, Scott A.; Christiansen, Jan; Nielsen, Henrik

    2011-01-01

    model (PTO) is used to describe data from an assortment of methods (e.g. RIP-Chip, CLIP-Chip, miRNA profiling, ribosome profiling) that globally address the functionality of mRNA. Several examples of post-transcriptional operons have been documented in the literature and demonstrate the usefulness...... of the model in identifying new participants in cellular pathways as well as in deepening our understanding of cellular responses....

  17. REMap: Operon Map of M. tuberculosis

    Science.gov (United States)

    Xia, Fang Fang; Stevens, Rick L.; Bishai, William R.; Lamichhane, Gyanu

    2016-01-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. PMID:27450008

  18. One-step purification and characterization of alginate lyase from a clinical Pseudomonas aeruginosa with destructive activity on bacterial biofilm

    Directory of Open Access Journals (Sweden)

    Parinaz Ghadam

    2017-05-01

    Full Text Available Objective(s: Pseudomonas aeruginosais a Gram-negative and aerobic rod bacterium that displays mucoid and non-mucoid phenotype. Mucoid strains secrete alginate, which is the main agent of biofilms in chronic P. aeruginosa infections, show high resistance to antibiotics; consequently, the biological disruption of mucoid P. aeruginosa biofilms is an attractive area of study for researchers. Alginate lyase gene (algl is a member of alginate producing operon which by glycosidase activity produces primer for other enzymes in this cluster. Also this activity can destroy the extracellular alginate; therefore this enzyme participates in alginate production and destruction pathway. Alginate lyase causes detachment of a biofilm by reducing its adhesion to the surfaces, and increases phagocytosis and antibiotic susceptibility. In this study, alginate lyase was purified in just one step and its properties were investigated. Materials and Methods: The purification was done by affinity chromatography, analysed by SDS-PAGE, and its effect on P. aeruginosa biofilms was surveyed by micro titer plate assay and SEM. The substrate specificity of the enzyme was determined by PCR. Results: Alginate lyase from isolate 48 was purified in one step. It is more thermally resistant than alginate lyase from Pseudomonas aeruginosa PAO1 and poly M, poly G and poly MG alginate were the substrate of this enzyme. Moreover, it has an eradication effect on biofilms from P. aeruginosa 48 and PAO1. Conclusion: In this study an alginate lyase with many characteristics suitable in medicine such as thermal stability, effective on poly M alginate, and bacterial biofilm destructive was introduced and purified.

  19. Prenatal diagnosis in adenylosuccinate lyase deficiency

    NARCIS (Netherlands)

    Marie, S.; Flipsen, J. W.; Duran, M.; Poll-The, B. T.; Beemer, F. A.; Bosschaart, A. N.; Vincent, M. F.; van den Berghe, G.

    2000-01-01

    Adenylosuccinate lyase deficiency, an autosomal recessive inborn error of purine synthesis, provokes accumulation in body fluids of succinylaminoimidazolecarboxamide riboside and succinyladenosine, the dephosphorylated derivatives of the two substrates of the enzyme. Most patients display severe

  20. V2 and cP/CP

    DEFF Research Database (Denmark)

    Vikner, Sten; Christensen, Ken Ramshøj; Nyvad, Anne Mette

    2017-01-01

    As in Nyvad et al. (2017), we will explore a particular derivation of (embedded) V2, in terms of a cP/CP-distinction, which may be seen as a version of the CP-recursion analysis (de Haan & Weerman 1986; Vikner 1995 and many others). e idea is that because embedded V2 clauses do not allow extraction......, whereas other types of CP-recursion clauses do (Christensen et al. 2013a; 2013b; Christensen & Nyvad 2014), CP-recursion in embedded V2 is assumed to be fundamentally di erent from other kinds of CP-recursion, in that main clause V2 and embedded V2 involve a CP (“big CP”), whereas other clausal...... projections above IP are instances of cP (“little cP”)....

  1. Enhancing RGI lyase thermostability by targeted single point mutations

    DEFF Research Database (Denmark)

    Silva, Inês R.; Larsen, Dorte Møller; Jers, Carsten

    2013-01-01

    Rhamnogalacturonan I lyase (RGI lyase) (EC 4.2.2.-) catalyzes the cleavage of rhamnogalacturonan I in pectins by β-elimination. In this study the thermal stability of a RGI lyase (PL 11) originating from Bacillus licheniformis DSM 13/ATCC14580 was increased by a targeted protein engineering...

  2. Measurements of the branching fractions of Lambda(+)(c) -> p pi(-)pi(+), Lambda(+)(c) -> pK(-)K(+), and Lambda(+)(c) -> p pi K--(+)

    NARCIS (Netherlands)

    Aaij, R.; Adeva, B.; Adinolfi, M.; Ajaltouni, Z.; Akar, S.; Albrecht, J.; Alessio, F.; Dufour, L.; Mulder, M; Onderwater, C. J. G.; Pellegrino, A.; Tolk, S.; van Veghel, M.

    2018-01-01

    The ratios of the branching fractions of the decays do Lambda(+)(c) -> , p pi(-)pi(+), Lambda(+->)(c) pK(-)K(+), and Lambda(+)(c) -> p pi K--(+) with respect to the Cabibbo-favoured Lambda(+)(c) -> pK(-)pi(+) decay are measured using proton-proton collision data collected with the LHCb experiment at

  3. Stochastic simulations of the tetracycline operon

    Directory of Open Access Journals (Sweden)

    Kaznessis Yiannis N

    2011-01-01

    Full Text Available Abstract Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the

  4. Stochastic simulations of the tetracycline operon

    Science.gov (United States)

    2011-01-01

    Background The tetracycline operon is a self-regulated system. It is found naturally in bacteria where it confers resistance to antibiotic tetracycline. Because of the performance of the molecular elements of the tetracycline operon, these elements are widely used as parts of synthetic gene networks where the protein production can be efficiently turned on and off in response to the presence or the absence of tetracycline. In this paper, we investigate the dynamics of the tetracycline operon. To this end, we develop a mathematical model guided by experimental findings. Our model consists of biochemical reactions that capture the biomolecular interactions of this intriguing system. Having in mind that small biological systems are subjects to stochasticity, we use a stochastic algorithm to simulate the tetracycline operon behavior. A sensitivity analysis of two critical parameters embodied this system is also performed providing a useful understanding of the function of this system. Results Simulations generate a timeline of biomolecular events that confer resistance to bacteria against tetracycline. We monitor the amounts of intracellular TetR2 and TetA proteins, the two important regulatory and resistance molecules, as a function of intrecellular tetracycline. We find that lack of one of the promoters of the tetracycline operon has no influence on the total behavior of this system inferring that this promoter is not essential for Escherichia coli. Sensitivity analysis with respect to the binding strength of tetracycline to repressor and of repressor to operators suggests that these two parameters play a predominant role in the behavior of the system. The results of the simulations agree well with experimental observations such as tight repression, fast gene expression, induction with tetracycline, and small intracellular TetR2 amounts. Conclusions Computer simulations of the tetracycline operon afford augmented insight into the interplay between its molecular

  5. Teaching the Big Ideas of Biology with Operon Models

    Science.gov (United States)

    Cooper, Robert A.

    2015-01-01

    This paper presents an activity that engages students in model-based reasoning, requiring them to predict the behavior of the trp and lac operons under different environmental conditions. Students are presented six scenarios for the "trp" operon and five for the "lac" operon. In most of the scenarios, specific mutations have…

  6. Impact of different alginate lyases on combined cellulase–lyase saccharification of brown seaweed

    DEFF Research Database (Denmark)

    Manns, Dirk Martin; Nyffenegger, Christian; Saake, B.

    2016-01-01

    -guluronic acid. When applied together with a fungal cellulase preparation (Cellic®CTec2) at pH 6 and 40 °C on a glucan rich brown seaweed Laminaria digitata the viscosity decreased in the initial minutes while measurable alginate degradation occurred primarily within the first 1–2 hours of reaction. Whereas FALy......, indicating that the degradation of mannuronic acid blocks inhibited cellulase catalyzed glucose release from L. digitata. Nevertheless, combined alginate lyase and cellulase treatment for 24 hours released all potential glucose regardless of the applied lyase. The enzymatic treatment moreover induced...

  7. Transcriptome dynamics-based operon prediction in prokaryotes.

    Science.gov (United States)

    Fortino, Vittorio; Smolander, Olli-Pekka; Auvinen, Petri; Tagliaferri, Roberto; Greco, Dario

    2014-05-16

    Inferring operon maps is crucial to understanding the regulatory networks of prokaryotic genomes. Recently, RNA-seq based transcriptome studies revealed that in many bacterial species the operon structure vary with the change of environmental conditions. Therefore, new computational solutions that use both static and dynamic data are necessary to create condition specific operon predictions. In this work, we propose a novel classification method that integrates RNA-seq based transcriptome profiles with genomic sequence features to accurately identify the operons that are expressed under a measured condition. The classifiers are trained on a small set of confirmed operons and then used to classify the remaining gene pairs of the organism studied. Finally, by linking consecutive gene pairs classified as operons, our computational approach produces condition-dependent operon maps. We evaluated our approach on various RNA-seq expression profiles of the bacteria Haemophilus somni, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica. Our results demonstrate that, using features depending on both transcriptome dynamics and genome sequence characteristics, we can identify operon pairs with high accuracy. Moreover, the combination of DNA sequence and expression data results in more accurate predictions than each one alone. We present a computational strategy for the comprehensive analysis of condition-dependent operon maps in prokaryotes. Our method can be used to generate condition specific operon maps of many bacterial organisms for which high-resolution transcriptome data is available.

  8. ProOpDB: Prokaryotic Operon DataBase.

    Science.gov (United States)

    Taboada, Blanca; Ciria, Ricardo; Martinez-Guerrero, Cristian E; Merino, Enrique

    2012-01-01

    The Prokaryotic Operon DataBase (ProOpDB, http://operons.ibt.unam.mx/OperonPredictor) constitutes one of the most precise and complete repositories of operon predictions now available. Using our novel and highly accurate operon identification algorithm, we have predicted the operon structures of more than 1200 prokaryotic genomes. ProOpDB offers diverse alternatives by which a set of operon predictions can be retrieved including: (i) organism name, (ii) metabolic pathways, as defined by the KEGG database, (iii) gene orthology, as defined by the COG database, (iv) conserved protein domains, as defined by the Pfam database, (v) reference gene and (vi) reference operon, among others. In order to limit the operon output to non-redundant organisms, ProOpDB offers an efficient method to select the most representative organisms based on a precompiled phylogenetic distances matrix. In addition, the ProOpDB operon predictions are used directly as the input data of our Gene Context Tool to visualize their genomic context and retrieve the sequence of their corresponding 5' regulatory regions, as well as the nucleotide or amino acid sequences of their genes.

  9. Metazoan operons accelerate recovery from growth arrested states

    Science.gov (United States)

    Zaslaver, Alon; Baugh, L. Ryan; Sternberg, Paul W.

    2011-01-01

    Summary Existing theories explain why operons are advantageous in prokaryotes, but their occurrence in metazoans is an enigma. Nematode operon genes, typically consisting of growth genes, are significantly up-regulated during recovery from growth-arrested states. This expression pattern is anti-correlated to non-operon genes consistent with a competition for transcriptional resources. We find that transcriptional resources are initially limiting during recovery, and that recovering animals are highly sensitive to any additional decrease in transcriptional resources. Operons become advantageous because by clustering growth genes into operons, fewer promoters compete for the limited transcriptional machinery, effectively increasing the concentration of transcriptional resources, and accelerating recovery. Mathematical modeling reveals how a moderate increase in transcriptional resources can substantially enhance transcription rate and recovery. This design principle occurs in different nematodes and the chordate C. intestinalis. As transition from arrest to rapid growth is shared by many metazoans, operons could have evolved to facilitate these processes. PMID:21663799

  10. Xylella fastidiosa esterase rather than hydroxynitrile lyase.

    Science.gov (United States)

    Torrelo, Guzman; Ribeiro de Souza, Fayene Zeferino; Carrilho, Emanuel; Hanefeld, Ulf

    2015-03-02

    In 2009, we reported that the product of the gene SCJ21.16 (XFa0032) from Xylella fastidiosa, a xylem-restricted plant pathogen that causes a range of diseases in several important crops, encodes a protein (XfHNL) with putative hydroxynitrile lyase activity. Sequence analysis and activity tests indicated that XfHNL exhibits an α/β-hydrolase fold and could be classified as a member of the family of FAD-independent HNLs. Here we provide a more detailed sequence analysis and new experimental data. Using pure heterologously expressed XfHNL we show that this enzyme cannot catalyse the cleavage/synthesis of mandelonitrile and that this protein is in fact a non-enantioselective esterase. Homology modelling and ligand docking simulations were used to study the active site and support these results. This finding could help elucidate the common ancestor of esterases and hydroxynitrile lyases with an α/β -hydrolase fold. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Archaeal rRNA operons, intron splicing and homing endonucleases, RNA polymerase operons and phylogeny

    DEFF Research Database (Denmark)

    Garrett, Roger Antony; Aagaard, Claus Sindbjerg; Andersen, Morten

    1994-01-01

    Over the past decade our laboratory has had a strong interest in defining the phylogenetic status of the archaea. This has involved determining and analysing the sequences of operons of both rRNAs and RNA polymerases and it led to the discovery of the first archaeal rRNA intron. What follows...

  12. Effector Overlap between the lac and mel Operons of Escherichia coli: Induction of the mel Operon with β-Galactosides.

    Science.gov (United States)

    Narang, Atul; Oehler, Stefan

    2017-05-01

    The lac (lactose) operon (which processes β-galactosides) and the mel (melibiose) operon (which processes α-galactosides) of Escherichia coli have a close historical connection. A number of shared substrates and effectors of the permeases and regulatory proteins have been reported over the years. Until now, β-thiogalactosides like TMG (methyl-β-d-thiogalactopyranoside) and IPTG (isopropyl-β-d-thiogalactopyranoside) have not generally been considered to be inducers of the mel operon. The same is true for β-galactosides such as lactose [β-d-galactopyranosyl-(1→4)-d-glucose], which is a substrate but is not itself an inducer of the lac operon. This report shows that all three sugars can induce the mel operon significantly when they are accumulated in the cell by Lac permease. Strong induction by β-thiogalactosides is observed in the presence of Lac permease, and strong induction by lactose (more than 200-fold) is observed in the absence of β-galactosidase. This finding calls for reevaluation of TMG uptake experiments as assays for Lac permease that were performed with mel + strains. IMPORTANCE The typical textbook picture of bacterial operons is that of stand-alone units of genetic information that perform, in a regulated manner, well-defined cellular functions. Less attention is given to the extensive interactions that can be found between operons. Well-described examples of such interactions are the effector molecules shared by the lac and mel operons. Here, we show that this set has to be extended to include β-galactosides, which have been, until now, considered not to effect the expression of the mel operon. That they can be inducers of the mel operon as well as the lac operon has not been noted in decades of research because of the Escherichia coli genetic background used in previous studies. Copyright © 2017 American Society for Microbiology.

  13. Overexpression of Enterococcus faecalis elr operon protects from phagocytosis.

    Science.gov (United States)

    Cortes-Perez, Naima G; Dumoulin, Romain; Gaubert, Stéphane; Lacoux, Caroline; Bugli, Francesca; Martin, Rebeca; Chat, Sophie; Piquand, Kevin; Meylheuc, Thierry; Langella, Philippe; Sanguinetti, Maurizio; Posteraro, Brunella; Rigottier-Gois, Lionel; Serror, Pascale

    2015-05-25

    Mechanisms underlying the transition from commensalism to virulence in Enterococcus faecalis are not fully understood. We previously identified the enterococcal leucine-rich protein A (ElrA) as a virulence factor of E. faecalis. The elrA gene is part of an operon that comprises four other ORFs encoding putative surface proteins of unknown function. In this work, we compared the susceptibility to phagocytosis of three E. faecalis strains, including a wild-type (WT), a ΔelrA strain, and a strain overexpressing the whole elr operon in order to understand the role of this operon in E. faecalis virulence. While both WT and ΔelrA strains were efficiently phagocytized by RAW 264.7 mouse macrophages, the elr operon-overexpressing strain showed a decreased capability to be internalized by the phagocytic cells. Consistently, the strain overexpressing elr operon was less adherent to macrophages than the WT strain, suggesting that overexpression of the elr operon could confer E. faecalis with additional anti-adhesion properties. In addition, increased virulence of the elr operon-overexpressing strain was shown in a mouse peritonitis model. Altogether, our results indicate that overexpression of the elr operon facilitates the E. faecalis escape from host immune defenses.

  14. Sequence and features of the tryptophan operon of Vibrio parahemolyticus.

    Science.gov (United States)

    Crawford, I P; Han, C Y; Silverman, M

    1991-01-01

    The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.

  15. The hydroxynitrile lyase from almond: crystal structure and mechanistical studies

    International Nuclear Information System (INIS)

    Dreveny, Ingrid

    2001-09-01

    Cyanogenesis is a defense process of several thousand plant species. Hydroxynitrile lyase (HNL), a key enzyme of this process, cleaves a cyanohydrin precursor into hydrocyanic acid and the corresponding aldehyde or ketone. The reverse reaction constitutes an important tool in industrial biocatalysis. Different classes of hydroxynitrile lyases have convergently evolved from FAD-dependent oxidoreductases, α/β hydrolases and alcohol dehydrogenases. The FAD-dependent hydroxynitrile lyases (FAD-HNLs) carry a flavin cofactor whose redox properties appear to be unimportant for catalysis. The high resolution crystal structure of the hydroxynitrile lyase from almond (Prunus amygdalus), PaHNL1, has been determined and constitutes the first 3D structure of an FAD-HNL. The overall fold and the architecture of the active site region showed that PaHNL1 belongs to the glucose-methanol-choline-oxidoreductase family, with closest structural similarity to glucose oxidase. There is strong evidence from the sequence and the reaction product that FAD-dependent hydroxynitrile lyases have evolved from an aryl alcohol oxidizing precursor. Structures of PaHNL1 in complex with its natural substrate mandelonitrile and the competitive inhibitor benzyl alcohol provided insight into the residues involved in catalysis and a mechanism without participation of the cofactor could be suggested. Although the catalytic residues differ between the α/β-hydrolase-type HNLs and PaHNL1, common general features relevant for hydroxynitrile lyase activity could be proposed. (author)

  16. Selfish operons: the evolutionary impact of gene clustering in prokaryotes and eukaryotes.

    Science.gov (United States)

    Lawrence, J

    1999-12-01

    The Selfish Operon Model postulates that the organization of bacterial genes into operons is beneficial to the constituent genes in that proximity allows horizontal cotransfer of all genes required for a selectable phenotype; eukaryotic operons formed for very different reasons. Horizontal transfer of selfish operons most probably promotes bacterial diversification.

  17. Better Higgs-C P tests through information geometry

    Science.gov (United States)

    Brehmer, Johann; Kling, Felix; Plehn, Tilman; Tait, Tim M. P.

    2018-05-01

    Measuring the C P symmetry in the Higgs sector is one of the key tasks of the LHC and a crucial ingredient for precision studies, for example in the language of effective Lagrangians. We systematically analyze which LHC signatures offer dedicated C P measurements in the Higgs-gauge sector and discuss the nature of the information they provide. Based on the Fisher information measure, we compare the maximal reach for C P -violating effects in weak boson fusion, associated Z H production, and Higgs decays into four leptons. We find a subtle balance between more theory-independent approaches and more powerful analysis channels, indicating that rigorous evidence for C P violation in the Higgs-gauge sector will likely require a multistep process.

  18. Evolution and Biophysics of the Escherichia coli lac Operon

    Science.gov (United States)

    Ray, J. Christian; Igoshin, Oleg; Quan, Selwyn; Monds, Russell; Cooper, Tim; Balázsi, Gábor

    2011-03-01

    To understand, predict, and control the evolution of living organisms, we consider biophysical effects and molecular network architectures. The lactose utilization system of E. coli is among the most well-studied molecular networks in biology, making it an ideal candidate for such studies. Simulations show how the genetic architecture of the wild-type operon attenuates large metabolic intermediate fluctuations that are predicted to occur in an equivalent system with the component genes on separate operons. Quantification of gene expression in the lac operon evolved in growth conditions containing constant lactose, alternating with glucose, or constant glucose, shows characteristic gene expression patterns depending on conditions. We are simulating these conditions to show context-dependent biophysical sources and costs of different lac operon architectures.

  19. Regulation of potassium dependent ATPase (kdp) operon of Deinococcus radiodurans.

    Science.gov (United States)

    Dani, Pratiksha; Ujaoney, Aman Kumar; Apte, Shree Kumar; Basu, Bhakti

    2017-01-01

    The genome of D. radiodurans harbors genes for structural and regulatory proteins of Kdp ATPase, in an operon pattern, on Mega plasmid 1. Organization of its two-component regulatory genes is unique. Here we demonstrate that both, the structural as well as regulatory components of the kdp operon of D. radiodurans are expressed quickly as the cells experience potassium limitation but are not expressed upon increase in osmolarity. The cognate DNA binding response regulator (RR) effects the expression of kdp operon during potassium deficiency through specific interaction with the kdp promoter. Deletion of the gene encoding RR protein renders the mutant D. radiodurans (ΔRR) unable to express kdp operon under potassium limitation. The ΔRR D. radiodurans displays no growth defect when grown on rich media or when exposed to oxidative or heat stress but shows reduced growth following gamma irradiation. The study elucidates the functional and regulatory aspects of the novel kdp operon of this extremophile, for the first time.

  20. LARVICIDAL BENZOQUINONE FROM EMBELIA SCHIMPERI C.P. ...

    African Journals Online (AJOL)

    a

    C.P. Kiprono1*, J.O. Midiwo2, P.K. Kipkemboi1 and Santino Ladogana3. 1Department of Chemistry, Moi University, P.O. Box 1125, Eldoret, Kenya. 2Department of Chemistry, University of Nairobi, P.O. Box 30197, Nairobi, Kenya. 3Department of Chemistry and Physics, Southeastern Louisiana University, Hammond, LA,.

  1. Molecular characterization of a Penicillium chrysogenum exo-rhamnogalacturonan lyase that is structurally distinct from other polysaccharide lyase family proteins.

    Science.gov (United States)

    Iwai, Marin; Kawakami, Takuya; Ikemoto, Takeshi; Fujiwara, Daisuke; Takenaka, Shigeo; Nakazawa, Masami; Ueda, Mitsuhiro; Sakamoto, Tatsuji

    2015-10-01

    We previously described an endo-acting rhamnogalacturonan (RG) lyase, termed PcRGL4A, of Penicillium chrysogenum 31B. Here, we describe a second RG lyase, called PcRGLX. We determined the cDNA sequence of the Pcrglx gene, which encodes PcRGLX. Based on analyses using a BLAST search and a conserved domain search, PcRGLX was found to be structurally distinct from known RG lyases and might belong to a new polysaccharide lyase family together with uncharacterized fungal proteins of Nectria haematococca, Aspergillus oryzae, and Fusarium oxysporum. The Pcrglx cDNA gene product (rPcRGLX) expressed in Escherichia coli demonstrated specific activity against RG but not against homogalacturonan. Divalent cations were not essential for the enzymatic activity of rPcRGLX. rPcRGLX mainly released unsaturated galacturonosyl rhamnose (ΔGR) from RG backbones used as the substrate from the initial stage of the reaction, indicating that the enzyme can be classified as an exo-acting RG lyase (EC 4.2.2.24). This is the first report of an RG lyase with this mode of action in Eukaryota. rPcRGLX acted synergistically with PcRGL4A to degrade soybean RG and released ΔGR. This ΔGR was partially decorated with galactose (Gal) residues, indicating that rPcRGLX preferred oligomeric RGs to polymeric RGs, that the enzyme did not require Gal decoration of RG backbones for degradation, and that the enzyme bypassed the Gal side chains of RG backbones. These characteristics of rPcRGLX might be useful in the determination of complex structures of pectins.

  2. Biomolecular Mechanisms of Mercury Transfers and Transformations by Proteins of the Mer Operon

    Science.gov (United States)

    Miller, S. M.; Hong, B.; Nauss, R.; Momany, C.; Summers, A. O.; Feng, X.; Harwood, I.; Stroud, R.

    2008-12-01

    Aerobic bacteria exhibiting resistance to the toxic effects of Hg(II) and organomercurials [RHg(I), e.g. MeHg(I)] and are widely found in both pristine and mercury contaminated environments. Resistance, afforded by a plasmid- or transposon-associated mer operon, involves an unusual pathway where Hg(II) and organomercurials [RHg(I)] undergo facilitated entry into the bacterial cytoplasm via an integral membrane transport protein (MerT) and are then "detoxified" by the concerted effort of two enzymes, organomercurial lyase (MerB), which catalyzes dealkylation (i.e., demethylation) of RHg(I) to Hg(II) and a hydrocarbon, and mercuric ion reductase (MerA), which catalyzes reduction of Hg(II) to Hg(0) as the ultimate detoxification for the organism. With a widespread distribution, these bacterial transformations play a significant role in the fate of mercury in the environment. Our focus is on elucidation of the molecular mechanisms for the transport and catalytic transformations of RHg(I) and Hg(II) by these proteins and the factors that influence the overall efficiency of the process. Current efforts are focused primarily on elucidating details of RHg(I) binding and dealkylation by MerB as well as the mechanism for transfer of the Hg(II) product to MerA. Key findings include the demonstration of a non-cysteine residue as essential for the catalytic activity and demonstration that direct transfer of Hg(II) to MerA proceeds more rapidly and more completely than transfer to small MW thiols such as cysteines or glutathione. Reuslts of these studies as well as an overview of our current understanding of the whole system will be presented.

  3. CONDOP: an R package for CONdition-Dependent Operon Predictions.

    Science.gov (United States)

    Fortino, Vittorio; Tagliaferri, Roberto; Greco, Dario

    2016-10-15

    The use of high-throughput RNA sequencing to predict dynamic operon structures in prokaryotic genomes has recently gained popularity in bioinformatics. We provide the R implementation of a novel method that uses transcriptomic features extracted from RNA-seq transcriptome profiles to develop ensemble classifiers for condition-dependent operon predictions. The CONDOP package provides a deeper insight into RNA-seq data analysis and allows scientists to highlight the operon organization in the context of transcriptional regulation with a few lines of code. CONDOP is implemented in R and is freely available at CRAN. vittorio.fortino@helsinki.fiSupplementary information: Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. Operon Gene Order Is Optimized for Ordered Protein Complex Assembly

    Science.gov (United States)

    Wells, Jonathan N.; Bergendahl, L. Therese; Marsh, Joseph A.

    2016-01-01

    Summary The assembly of heteromeric protein complexes is an inherently stochastic process in which multiple genes are expressed separately into proteins, which must then somehow find each other within the cell. Here, we considered one of the ways by which prokaryotic organisms have attempted to maximize the efficiency of protein complex assembly: the organization of subunit-encoding genes into operons. Using structure-based assembly predictions, we show that operon gene order has been optimized to match the order in which protein subunits assemble. Exceptions to this are almost entirely highly expressed proteins for which assembly is less stochastic and for which precisely ordered translation offers less benefit. Overall, these results show that ordered protein complex assembly pathways are of significant biological importance and represent a major evolutionary constraint on operon gene organization. PMID:26804901

  5. Phenylalanine ammonia-lyase (PAL) gene activity in response to ...

    African Journals Online (AJOL)

    Phenylalanine ammonia-lyase (PAL) catalyzes the biosynthesis of rosmarinic acid (RA), tyrosine and phenylalanine are the precursors of RA, while proline drives metabolite precursors toward Shikimate and phenylpropanoid pathway ending with the production of RA. The aim of this study was to investigate the PAL gene ...

  6. Cystathionine .gamma.-lyase: Clinical, metabolic, genetic, and structural studies

    Czech Academy of Sciences Publication Activity Database

    Kraus, J. P.; Hašek, Jindřich; Kožich, V.; Collard, R.; Venezia, S.; Janošíková, B.; Wang, J.; Stabler, S. P.; Allen, R. H.; Jakobs, C.; Finn, C. T.; Chien, Y. H.; Hwu, W. L.; Hegele, R. A.; Mudd, S. H.

    2009-01-01

    Roč. 97, č. 4 (2009), s. 250-259 ISSN 1096-7192 R&D Projects: GA ČR GA305/07/1073 Institutional research plan: CEZ:AV0Z40500505 Keywords : cystathionine gamma-lyase * cystathioninuria * hypercystathioninemia Subject RIV: CD - Macromolecular Chemistry Impact factor: 2.897, year: 2009

  7. Correlation between the cystathionine-r-lyase (CES) and the ...

    African Journals Online (AJOL)

    Background: The infection of Helicobacter pylori (H. pylori) is one of the most important causes of gastric ulcer disease. The role of hydrogen sulfide (H2S) production in H. pylori-induced gastric ulcer disease. Aim: The expression of cystathionine-γ-lyase (CSE) was determined, and correlated with the severity of gastric ulcer ...

  8. Priming ammonia lyases and aminomutases for industrial and therapeutic applications

    NARCIS (Netherlands)

    Heberling, Matthew M.; Wu, Bian; Bartsch, Sebastian; Janssen, Dick B.

    Ammonia lyases (AL) and aminomutases (AM) are emerging in green synthetic routes to chiral amines and an AL is being explored as an enzyme therapeutic for treating phenylketonuria and cancer. Although the restricted substrate range of the wild-type enzymes limits their widespread application, the

  9. In Silico Characterization of Pectate Lyase Protein Sequences from Different Source Organisms

    Directory of Open Access Journals (Sweden)

    Amit Kumar Dubey

    2010-01-01

    Full Text Available A total of 121 protein sequences of pectate lyases were subjected to homology search, multiple sequence alignment, phylogenetic tree construction, and motif analysis. The phylogenetic tree constructed revealed different clusters based on different source organisms representing bacterial, fungal, plant, and nematode pectate lyases. The multiple accessions of bacterial, fungal, nematode, and plant pectate lyase protein sequences were placed closely revealing a sequence level similarity. The multiple sequence alignment of these pectate lyase protein sequences from different source organisms showed conserved regions at different stretches with maximum homology from amino acid residues 439–467, 715–816, and 829–910 which could be used for designing degenerate primers or probes specific for pectate lyases. The motif analysis revealed a conserved Pec_Lyase_C domain uniformly observed in all pectate lyases irrespective of variable sources suggesting its possible role in structural and enzymatic functions.

  10. Dynamic model of gene regulation for the lac operon

    Energy Technology Data Exchange (ETDEWEB)

    Angelova, Maia; Ben-Halim, Asma, E-mail: maia.angelova@northumbria.ac.uk, E-mail: asma.benhalim@northumbria.ac.uk [Intelligent Modelling Lab, School of Computing, Engineering and Information Sciences, Northumbria University, Newcastle upon Tyne NE2 1XE (United Kingdom)

    2011-03-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  11. Dynamic model of gene regulation for the lac operon

    International Nuclear Information System (INIS)

    Angelova, Maia; Ben-Halim, Asma

    2011-01-01

    Gene regulatory network is a collection of DNA which interact with each other and with other matter in the cell. The lac operon is an example of a relatively simple genetic network and is one of the best-studied structures in the Escherichia coli bacteria. In this work we consider a deterministic model of the lac operon with a noise term, representing the stochastic nature of the regulation. The model is written in terms of a system of simultaneous first order differential equations with delays. We investigate an analytical and numerical solution and analyse the range of values for the parameters corresponding to a stable solution.

  12. Operon Formation is Driven by Co-Regulation and Not by Horizontal Gene Transfer

    Energy Technology Data Exchange (ETDEWEB)

    Price, Morgan N.; Huang, Katherine H.; Arkin, Adam P.; Alm, Eric J.

    2005-04-12

    Although operons are often subject to horizontal gene transfer (HGT), non-HGT genes are particularly likely to be in operons. To resolve this apparent discrepancy and to determine whether HGT is involved in operon formation, we examined the evolutionary history of the genes and operons in Escherichia coli K12. We show that genes that have homologs in distantly related bacteria but not in close relatives of E. coli (indicating HGTi) form new operons at about the same rates as native genes. Furthermore, genes in new operons are no more likely than other genes to have phylogenetic trees that are inconsistent with the species tree. In contrast, essential genes and ubiquitous genes without paralogs (genes believed to undergo HGT rarely) often form new operons. We conclude that HGT is not associated with operon formation, but instead promotes the prevalence of pre-existing operons. To explain operon formation, we propose that new operons reduce the amount of regulatory information required to specify optimal expression patterns. Consistent with this hypothesis, operons have greater amounts of conserved regulatory sequences than do individually transcribed genes.

  13. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae

    NARCIS (Netherlands)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase

  14. Role of leader peptide synthesis in tryptophanase operon expression in Escherichia coli K-12.

    OpenAIRE

    Stewart, V; Yanofsky, C

    1986-01-01

    We used site-directed mutagenesis to replace the Escherichia coli tryptophanase (tna) operon leader peptide start codon with AUC. This change greatly decreased the uninduced rate of tna operon expression, and it also lowered the response to inducer. We conclude that leader peptide synthesis plays an essential role in tna operon expression.

  15. Molecular analysis of the UV-inducible pili operon from Sulfolobus acidocaldarius

    NARCIS (Netherlands)

    Wolferen, Marleen van; Ajon, Małgorzata; Driessen, Arnold J.M.; Albers, Sonja-Verena

    2013-01-01

    Upon ultraviolet (UV) stress, hyperthermophilic Sulfolobus species show a highly induced transcription of a gene cluster responsible for pili biogenesis: the UV-inducible pili operon (ups operon). This operon is involved in UV-induced pili assembly, cellular aggregation, and subsequent DNA exchange

  16. Sequence analysis of the Legionella micdadei groELS operon

    DEFF Research Database (Denmark)

    Hindersson, P; Høiby, N; Bangsborg, Jette Marie

    1991-01-01

    shock expression signals were identified upstream of the L. micdadei groEL gene. Further upstream, a poly-T region, also a feature of the sigma 32-regulated Escherichia coli groELS heat shock operon, was found. Despite the high degree of homology of the expression signals in E. coli and L. micdadei...

  17. Rapid customised operon assembly by yeast recombinational cloning.

    Science.gov (United States)

    Liu, Michael A; Kenyon, Johanna J; Lee, Jason; Reeves, Peter R

    2017-06-01

    We have developed a system called the Operon Assembly Protocol (OAP), which takes advantage of the homologous recombination DNA repair pathway in Saccharomyces cerevisiae to assemble full-length operons from a series of overlapping PCR products into a specially engineered yeast-Escherichia coli shuttle vector. This flexible, streamlined system can be used to assemble several operon clones simultaneously, and each clone can be expressed in the same E. coli tester strain to facilitate direct functional comparisons. We demonstrated the utility of the OAP by assembling and expressing a series of E. coli O1A O-antigen gene cluster clones containing various gene deletions or replacements. We then used these constructs to assess the substrate preferences of several Wzx flippases, which are responsible for translocation of oligosaccharide repeat units (O units) across the inner membrane during O-antigen biosynthesis. We were able to identify several O unit structural features that appear to be important determinants of Wzx substrate preference. The OAP system should be broadly applicable for the genetic manipulation of any bacterial operon and can be modified for use in other host species. It could also have potential uses in fields such as glycoengineering.

  18. Eucaryotic operon genes can define highly conserved syntenies

    Czech Academy of Sciences Publication Activity Database

    Trachtulec, Zdeněk

    2004-01-01

    Roč. 50, - (2004), s. 1-6 ISSN 0015-5500 R&D Projects: GA ČR GA204/01/0997; GA MŠk LN00A079 Institutional research plan: CEZ:AV0Z5052915 Keywords : eukaryotic operon * conserved synteny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 0.507, year: 2004

  19. Discrete symmetries (C,P,T) in noncommutative field theories

    International Nuclear Information System (INIS)

    Sheikh-Jabbari, M.M.

    2000-01-01

    In this paper we study the invariance of the noncommutative gauge theories tinder C, P and T transformations. For the noncommutative space (when only the spatial part of θ is non-zero) we show that NCQED is Parity invariant. In addition, we show that under charge conjugation the theory on noncommutative R θ 4 is transformed to the theory on R -θ 4 , so NCQED is a CP violating theory. The theory remains invariant under time reversal if, together with proper changes in fields, we also change θ by -θ. Hence altogether NCQED is CPT invariant. Moreover we show that the CPT invariance holds for general noncommutative space-time. (author)

  20. Experimental prospects for C, P, T, CP, and CPT tests

    International Nuclear Information System (INIS)

    Bevan, Adrian

    2015-01-01

    Discrete symmetry violation in the weak interaction is central to the Standard Model of particle physics, however the origin of these violations is not well understood. Nor are we able to provide a satisfactory explanation of the Universal dominance of matter over antimatter, an issue related to CP violation. As a result study of discrete symmetry violation remains a topic of broad interest. These proceedings discuss experimental prospects of studying C, P, T, CP and CPT symmetries in a number of contexts, including the use of triple product asymmetries and entangled neutral meson systems. (paper)

  1. Analysis of expression profile of mce operon genes (mce1, mce2, mce3 operon) in different Mycobacterium tuberculosis isolates at different growth phases.

    Science.gov (United States)

    Singh, Pratibha; Katoch, V M; Mohanty, K K; Chauhan, Devendra Singh

    2016-04-01

    Mycobacterium tuberculosis (M. tuberculosis) has four homologous mammalian cell entry (mce) operons (mce1-4) that encode exported proteins and have a possible role in the virulence mechanism of this pathogen. The expression of mce operon is considered to be complex and not completely understood. Although expression of mce operon at different in vitro growth phases has been studied earlier, its expression in different M. tuberculosis isolates under different growth phases is not yet studied. The present preliminary study was conducted on a limited number of isolates to know the trend of expression pattern of mce operon genes in different M. tuberculosis isolates under different growth stages. In this study, we monitored the transcriptional profile of selected mce operon genes (mce1A, mce1D, mce2A, mce2D, mce3A, mce3C) in different M.tuberculosis isolates (MDR1, MDR2, and sensitive isolate) at early exponential and stationary phases using real-time quantitative PCR. The expression ratio of all selected mce operon genes in all M. tuberculosis isolates was reduced at the initial phase and increased substantially at a later phase of growth. Higher expression of mce1 operon genes was found in all M. tuberculosis isolates as compared to other mce operon genes (mce2 and mce3 operons) at stationary growth phase. the higher expression of mce operon genes at stationary phase (as compared to early exponential phase) suggested growth phase dependent expression of mce operon genes. This indicated that the mce operon genes might have a role in M. tuberculosis survival and adaptation on the onset of adverse condition like stationary phase. Identification of differentially expressed genes will add to our understanding of the bacilli involved in adaptation to different growth conditions.

  2. Crystallization and preliminary X-ray analysis of an exotype alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, a member of polysaccharide lyase family 15

    International Nuclear Information System (INIS)

    Ochiai, Akihito; Yamasaki, Masayuki; Mikami, Bunzo; Hashimoto, Wataru; Murata, Kousaku

    2006-01-01

    The crystallization and preliminary X-ray characterization of a family PL-15 exotype alginate lyase are presented. Almost all alginate lyases depolymerize alginate in an endolytical fashion via a β-elimination reaction. The alginate lyase Atu3025 from Agrobacterium tumefaciens strain C58, consisting of 776 amino-acid residues, is a novel exotype alginate lyase classified into polysaccharide lyase family 15. The enzyme was crystallized at 293 K by sitting-drop vapour diffusion with polyethylene glycol 4000 as a precipitant. Preliminary X-ray analysis showed that the Atu3025 crystal belonged to space group P2 1 and diffracted to 2.8 Å resolution, with unit-cell parameters a = 107.7, b = 108.3, c = 149.5 Å, β = 91.5°

  3. Quantitation of heparosan with heparin lyase III and spectrophotometry.

    Science.gov (United States)

    Huang, Haichan; Zhao, Yingying; Lv, Shencong; Zhong, Weihong; Zhang, Fuming; Linhardt, Robert J

    2014-02-15

    Heparosan is Escherichia coli K5 capsule polysaccharide, which is the key precursor for preparing bioengineered heparin. A rapid and effective quantitative method for detecting heparosan is important in the large-scale production of heparosan. Heparin lyase III (Hep III) effectively catalyzes the heparosan depolymerization, forming unsaturated disaccharides that are measurable using a spectrophotometer at 232 nm. We report a new method for the quantitative detection of heparosan with heparin lyase III and spectrophotometry that is safer and more specific than the traditional carbazole assay. In an optimized detection system, heparosan at a minimum concentration of 0.60 g/L in fermentation broth can be detected. Copyright © 2013 Elsevier Inc. All rights reserved.

  4. A radiometric technique for the measurement of adenylosuccinate lyase

    International Nuclear Information System (INIS)

    Park, K.W.; Tyagi, A.K.; Cooney, D.A.

    1980-01-01

    When radioactive adenylosuccinic acid (AMP-S) is metabolized to AMP and fumaric acid by the enzyme adenylosuccinate lyase (EC 4.3.2.2), a proton is released to the solvent as 3 H 2 O. This removal is believed to be stereospecifically identical to that catalyzed by the enzyme, L-aspartase, and therefore entails the loss of a proton from C-3 of the dicarboxylic acid moiety of the nucleotide. Advantage has been taken of this fact in the design of a facile assay for this enzyme. The assay permits the simultaneous estimation of the lyase activity in a large battery of samples; it is not interfered with by opalescent or proteinaceous suspensions; it is accurate and outstandingly sensitive. (Auth.)

  5. Refeeding syndrome in a young woman with argininosuccinate lyase deficiency.

    Science.gov (United States)

    Stuy, M; Chen, G-F; Masonek, J M; Scharschmidt, B F

    2015-09-01

    A severely chronically protein and calorie restricted young woman with argininosuccinate lyase deficiency developed transient refeeding syndrome (RFS) and hyperammonemia after modest diet liberalization following initiation of glycerol phenylbutyrate (GPB). The patient required IV supportive care and supplementation with potassium, magnesium and calcium. She is now doing well on GPB and an appropriate maintenance diet. Susceptibility to RFS should be considered in chronically nutritionally restricted patients with metabolic disorders after liberalization of diet.

  6. Refeeding syndrome in a young woman with argininosuccinate lyase deficiency

    Directory of Open Access Journals (Sweden)

    M. Stuy

    2015-09-01

    Full Text Available A severely chronically protein and calorie restricted young woman with argininosuccinate lyase deficiency developed transient refeeding syndrome (RFS and hyperammonemia after modest diet liberalization following initiation of glycerol phenylbutyrate (GPB. The patient required IV supportive care and supplementation with potassium, magnesium and calcium. She is now doing well on GPB and an appropriate maintenance diet. Susceptibility to RFS should be considered in chronically nutritionally restricted patients with metabolic disorders after liberalization of diet.

  7. Refeeding syndrome in a young woman with argininosuccinate lyase deficiency☆

    Science.gov (United States)

    Stuy, M.; Chen, G.-F.; Masonek, J.M.; Scharschmidt, B.F.

    2015-01-01

    A severely chronically protein and calorie restricted young woman with argininosuccinate lyase deficiency developed transient refeeding syndrome (RFS) and hyperammonemia after modest diet liberalization following initiation of glycerol phenylbutyrate (GPB). The patient required IV supportive care and supplementation with potassium, magnesium and calcium. She is now doing well on GPB and an appropriate maintenance diet. Susceptibility to RFS should be considered in chronically nutritionally restricted patients with metabolic disorders after liberalization of diet. PMID:26937403

  8. Fucose-Mediated Transcriptional Activation of the fcs Operon by FcsR in Streptococcus pneumoniae.

    Science.gov (United States)

    Manzoor, Irfan; Shafeeq, Sulman; Afzal, Muhammad; Kuipers, Oscar P

    2015-01-01

    In this study, we explore the impact of fucose on the transcriptome of S. pneumoniae D39. The expression of various genes and operons, including the fucose uptake PTS and utilization operon (fcs operon) was altered in the presence of fucose. By means of quantitative RT-PCR and β-galactosidase analysis, we demonstrate the role of the transcriptional regulator FcsR, present upstream of the fcs operon, as a transcriptional activator of the fcs operon. We also predict a 19-bp putative FcsR regulatory site (5'-ATTTGAACATTATTCAAGT-3') in the promoter region of the fcs operon. The functionality of this predicted FcsR regulatory site was further confirmed by promoter-truncation experiments, where deletion of half of the FscR regulatory site or full deletion led to the abolition of expression of the fcs operon. © 2015 S. Karger AG, Basel.

  9. Chondroitin Sulfate (CS) Lyases: Structure, Function and Application in Therapeutics.

    Science.gov (United States)

    Rani, Aruna; Patel, Seema; Goyal, Arun

    2018-01-01

    Glycosaminoglycans (GAGs) such as chondroitin sulfate (CS) are the chief natural polysaccharides which reside in biological tissues mainly in extracellular matrix. These CS along with adhesion molecules and growth factors are involved in central nervous system (CNS) development, cell progression and pathogenesis. The chondroitin lyases are the enzyme that degrade and alter the CS chains and hence modify various signalling pathways involving CS chains. These CS lyases are substrate specific, can precisely manipulate the CS polysaccharides and have various biotechnological, medical and therapeutic applications. These enzymes can be used to produce the unsaturated oligosaccharides, which have immune-modulatory, anti-inflammatory and neuroprotective properties. This review focuses on the major breakthrough of the chondroitin sulfate degrading enzymes, their structures and functioning mechanism. This also provides comprehensive information regarding production, purification, characterization of CS lyases and their major applications, both established as well as emerging ones such as neural development. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  10. Utilization of Aspergillus oryzae to produce pectin lyase from various agro-industrial residues

    OpenAIRE

    Koser, Safia; Anwar, Zahid; Iqbal, Zafar; Anjum, Awais; Aqil, Tahir; Mehmood, Sajid; Irshad, Muhammad

    2014-01-01

    The present study was aimed to investigate the culture influence on pectin lyase production potential of fungal strain Aspergillus oryzae. The enzyme profile of A. oryzae showed highest activity of pectin lyase after 3rd day of incubation on lemon peel waste under solid state fermentation conditions. To induce the pectin lyase synthesis capability of A. oryzae at optimal level various culture variables including physical and nutritional parameters were optimized by adopting classical optimiza...

  11. Noncommutative GUTs, Standard Model and C,P,T

    International Nuclear Information System (INIS)

    Aschieri, P.; Jurco, B.; Schupp, P.; Wess, J.

    2003-01-01

    Noncommutative Yang-Mills theories are sensitive to the choice of the representation that enters in the gauge kinetic term. We constrain this ambiguity by considering grand unified theories. We find that at first order in the noncommutativity parameter θ, SU(5) is not truly a unified theory, while SO(10) has a unique noncommutative generalization. In view of these results we discuss the noncommutative SM theory that is compatible with SO(10) GUT and find that there are no modifications to the SM gauge kinetic term at lowest order in θ. We study in detail the reality, Hermiticity and C,P,T properties of the Seiberg-Witten map and of the resulting effective actions expanded in ordinary fields. We find that in models of GUTs (or compatible with GUTs) right-handed fermions and left-handed ones appear with opposite Seiberg-Witten map

  12. Noncommutative GUTs, Standard Model and C,P,T

    Energy Technology Data Exchange (ETDEWEB)

    Aschieri, P. E-mail: aschieri@theorie.physik.uni-muenchen.de; Jurco, B. E-mail: jurco@theorie.physik.uni-muenchen.de; Schupp, P. E-mail: p.schupp@iu-bremen.de; Wess, J. E-mail: wess@theorie.physik.uni-muenchen.de

    2003-02-17

    Noncommutative Yang-Mills theories are sensitive to the choice of the representation that enters in the gauge kinetic term. We constrain this ambiguity by considering grand unified theories. We find that at first order in the noncommutativity parameter {theta}, SU(5) is not truly a unified theory, while SO(10) has a unique noncommutative generalization. In view of these results we discuss the noncommutative SM theory that is compatible with SO(10) GUT and find that there are no modifications to the SM gauge kinetic term at lowest order in {theta}. We study in detail the reality, Hermiticity and C,P,T properties of the Seiberg-Witten map and of the resulting effective actions expanded in ordinary fields. We find that in models of GUTs (or compatible with GUTs) right-handed fermions and left-handed ones appear with opposite Seiberg-Witten map.

  13. C P -odd sector and θ dynamics in holographic QCD

    Science.gov (United States)

    Areán, Daniel; Iatrakis, Ioannis; Järvinen, Matti; Kiritsis, Elias

    2017-07-01

    The holographic model of V-QCD is used to analyze the physics of QCD in the Veneziano large-N limit. An unprecedented analysis of the C P -odd physics is performed going beyond the level of effective field theories. The structure of holographic saddle points at finite θ is determined, as well as its interplay with chiral symmetry breaking. Many observables (vacuum energy and higher-order susceptibilities, singlet and nonsinglet masses and mixings) are computed as functions of θ and the quark mass m . Wherever applicable the results are compared to those of chiral Lagrangians, finding agreement. In particular, we recover the Witten-Veneziano formula in the small x →0 limit, we compute the θ dependence of the pion mass, and we derive the hyperscaling relation for the topological susceptibility in the conformal window in terms of the quark mass.

  14. Structure and Mechanism of PhnP, a Phosphodiesterase of the Carbon-Phosphorus Lyase Pathway

    DEFF Research Database (Denmark)

    He, Shu-Mei; Wathier, Matthew; Podzelinska, Kateryna

    2011-01-01

    PhnP is a phosphodiesterase that plays an important role within the bacterial carbon-phosphorus lyase (CP-lyase) pathway by recycling a "dead-end" intermediate, 5-phospho-α-d-ribosyl 1,2-cyclic phosphate, that is formed during organophosphonate catabolism. As a member of the metallo-β-lactamase s......PhnP is a phosphodiesterase that plays an important role within the bacterial carbon-phosphorus lyase (CP-lyase) pathway by recycling a "dead-end" intermediate, 5-phospho-α-d-ribosyl 1,2-cyclic phosphate, that is formed during organophosphonate catabolism. As a member of the metallo...

  15. Structural characterization of the Salmonella typhimurium LT2 umu operon

    International Nuclear Information System (INIS)

    Thomas, S.M.; Crowne, H.M.; Pidsley, S.C.; Sedgwick, S.G.

    1990-01-01

    The umuDC operon of Escherichia coli encodes functions required for mutagenesis induced by radiation and a wide variety of chemicals. The closely related organism Salmonella typhimurium is markedly less mutable than E. coli, but a umu homolog has recently been identified and cloned from the LT2 subline. In this study the nucleotide sequence and structure of the S. typhimurium LT2 umu operon have been determined and its gene products have been identified so that the molecular basis of umu activity might be understood more fully. S. typhimurium LT2 umu consists of a smaller 417-base-pair (bp) umuD gene ending 2 bp upstream of a larger 1,266-bp umuC gene. The only apparent structural difference between the two operons is the lack of gene overlap. An SOS box identical to that found in E. coli is present in the promoter region upstream of umuD. The calculated molecular masses of the umuD and umuC gene products were 15.3 and 47.8 kilodaltons, respectively, which agree with figures determined by transpositional disruption and maxicell analysis. The S. typhimurium and E. coli umuD sequences were 68% homologous and encoded products with 71% amino acid identity; the umuC sequences were 71% homologous and encoded products with 83% amino acid identity. Furthermore, the potential UmuD cleavage site and associated catalytic sites could be identified. Thus the very different mutagenic responses of S. typhimurium LT2 and E. coli cannot be accounted for by gross differences in operon structure or gene products. Rather, the ability of the cloned S. typhimurium umuD gene to give stronger complementation of E. coli umuD77 mutants in the absence of a functional umuC gene suggests that Salmonella UmuC protein normally constrains UmuD protein activity

  16. Elucidation of Operon Structures across Closely Related Bacterial Genomes

    Science.gov (United States)

    Li, Guojun

    2014-01-01

    About half of the protein-coding genes in prokaryotic genomes are organized into operons to facilitate co-regulation during transcription. With the evolution of genomes, operon structures are undergoing changes which could coordinate diverse gene expression patterns in response to various stimuli during the life cycle of a bacterial cell. Here we developed a graph-based model to elucidate the diversity of operon structures across a set of closely related bacterial genomes. In the constructed graph, each node represents one orthologous gene group (OGG) and a pair of nodes will be connected if any two genes, from the corresponding two OGGs respectively, are located in the same operon as immediate neighbors in any of the considered genomes. Through identifying the connected components in the above graph, we found that genes in a connected component are likely to be functionally related and these identified components tend to form treelike topology, such as paths and stars, corresponding to different biological mechanisms in transcriptional regulation as follows. Specifically, (i) a path-structure component integrates genes encoding a protein complex, such as ribosome; and (ii) a star-structure component not only groups related genes together, but also reflects the key functional roles of the central node of this component, such as the ABC transporter with a transporter permease and substrate-binding proteins surrounding it. Most interestingly, the genes from organisms with highly diverse living environments, i.e., biomass degraders and animal pathogens of clostridia in our study, can be clearly classified into different topological groups on some connected components. PMID:24959722

  17. Growth and sporulation defects in Bacillus subtilis mutants with a single rrn operon can be suppressed by amplification of the rrn operon.

    Science.gov (United States)

    Yano, Koichi; Masuda, Kenta; Akanuma, Genki; Wada, Tetsuya; Matsumoto, Takashi; Shiwa, Yuh; Ishige, Taichiro; Yoshikawa, Hirofumi; Niki, Hironori; Inaoka, Takashi; Kawamura, Fujio

    2016-01-01

    The genome of Bacillus subtilis strain 168 encodes ten rRNA (rrn) operons. We previously reported that strains with only a single rrn operon had a decreased growth and sporulation frequency. We report here the isolation and characterization of suppressor mutants from seven strains that each have a single rrn operon (rrnO, A, J, I, E, D or B). The suppressor mutants for strain RIK656 with a single rrnO operon had a higher frequency of larger colonies. These suppressor mutants had not only increased growth rates, but also increased sporulation frequencies and ribosome levels compared to the parental mutant strain RIK656. Quantitative PCR analyses showed that all these suppressor mutants had an increased number of copies of the rrnO operon. Suppressor mutants were also isolated from the six other strains with single rrn operons (rrnA, J, I, E, D or B). Next generation and capillary sequencing showed that all of the suppressor mutants had tandem repeats of the chromosomal locus containing the remaining rrn operon (amplicon). These amplicons varied in size from approximately 9 to 179 kb. The amplifications were likely to be initiated by illegitimate recombination between non- or micro-homologous sequences, followed by unequal crossing-over during DNA replication. These results are consistent with our previous report that rrn operon copy number has a major role in cellular processes such as cell growth and sporulation.

  18. Prevalence of transcription promoters within archaeal operons and coding sequences.

    Science.gov (United States)

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  19. The two umuDC-like operons, samAB and umuDCST, in Salmonella typhimurium: The umuDCST operon may reduce UV-mutagenesis-promoting ability of the samAB operon

    International Nuclear Information System (INIS)

    Nohmi, Takehiko; Hakura, Atsushi; Watanabe, Masahiko; Yamada, Masami; Sofuni, Toshio; Nakai, Yasuharu; Murayama, Somay Y.

    1993-01-01

    Salmonella typhimurium, especially its derivatives containing pKM101 plasmid, has been widely used in the Ames test for the detection of environmental mutagens and carcinogens. It is known, however, that if the pKM101 plasmid is eliminated, S. typhimurium itself shows a much weaker mutagenic response to UV and some chemical mutagens than does Escherichia coli. In fact, certain potent base-change type mutagens, such as furylfuramide and aflatoxin B 1 , are nonmutagenic to S. typhimurium in the absence of pKM101, whereas they are strongly mutagenic to S. typhimurium in the presence of pKM101 plasmid as well as to E. coli. The low mutability can be restored to levels comparable to E. coli by introducing the plasmid carrying the E. coli umuDC operon or the pKM101 plasmid carrying mucAB operon. Salmonella typhimurium has an SOS regulatory system which resembles that of E. coli. Thus, it was suggested that S. typhimurium is deficient in the function of umuDC operon, which plays an essential role in UV and most chemical mutagenesis in E. coli. In order to clarify the implications of umuDC genes in mutagenesis and antimutagenesis in typhimurium, we have independently screened the umuDC-like genes of S. typhimurium TA1538. Consequently, we have cloned another umuDC-like operon which is 40% diverged from the aforementioned umuDC operon of S. typhimurium LT2 at the nucleotide level (16). We have termed the cloned DNA the samAB (Salmonella; mutagenesis) operon, and tentatively referred to the umuDC operon cloned from S. typhimurium LT2 (27,31) as the umuDC ST operon. Based on the results of the Southern hybridization experiment, we concluded that the two sets of umuDC-like operons reside in the same cells of S. typhimurium LT2 and TA1538. Our results also suggested that the umuDC ST operon reduces the UV-mutagenesis promoting ability of the samAB operon when the two operons are present on the same multi-copy number plasmid

  20. Alfalfa contains substantial 9-hydroperoxide lyase activity and a 3Z:2E-enal isomerase

    NARCIS (Netherlands)

    Vliegenthart, J.F.G.; Noordermeer, M.A.; Veldink, G.A.

    1999-01-01

    Fatty acid hydroperoxides formed by lipoxygenase can be cleaved by hydroperoxide lyase resulting in the formation of short-chain aldehydes and omega-oxo acids. Plant hydroperoxide lyases use 13- or 9-hydroperoxy linoleic and linolenic acid as substrates. Alfalfa (Medicago sativa L.) has been

  1. Hematopoietic Sphingosine 1-Phosphate Lyase Deficiency Decreases Atherosclerotic Lesion Development in LDL-Receptor Deficient Mice

    NARCIS (Netherlands)

    Bot, Martine; Van Veldhoven, Paul P.; de Jager, Saskia C. A.; Johnson, Jason; Nijstad, Niels; Van Santbrink, Peter J.; Westra, Marijke M.; Van Der Hoeven, Gerd; Gijbels, Marion J.; Mueller-Tidow, Carsten; Varga, Georg; Tietge, Uwe J. F.; Kuiper, Johan; Van Berkel, Theo J. C.; Nofer, Jerzy-Roch; Bot, Ilze; Biessen, Erik A. L.

    2013-01-01

    Aims: Altered sphingosine 1-phosphate (S1P) homeostasis and signaling is implicated in various inflammatory diseases including atherosclerosis. As S1P levels are tightly controlled by S1P lyase, we investigated the impact of hematopoietic S1P lyase (Sgpl1(-/-)) deficiency on leukocyte subsets

  2. Hematopoietic Sphingosine 1-Phosphate Lyase Deficiency Decreases Atherosclerotic Lesion Development in LDL-Receptor Deficient Mice

    NARCIS (Netherlands)

    Bot, M.; Veldhoven, van P.P.; Jager, de S.C.; Johnson, J.; Nijstad, N.; van, Santbrink P.J.; Westra, M.M.; Hoeven, van der G.; Gijbels, M.J.; Muller-Tidow, C.; Varga, G.; Tietge, U.J.; Kuiper, J.; Berkel, van T.J.; Nofer, J.R.; Bot, I.; Biessen, E.A.

    2013-01-01

    Abstract Aims Altered sphingosine 1-phosphate (S1P) homeostasis and signaling is implicated in various inflammatory diseases including atherosclerosis. As S1P levels are tightly controlled by S1P lyase, we investigated the impact of hematopoietic S1P lyase (Sgpl1−/−) deficiency on leukocyte

  3. Hematopoietic sphingosine 1-phosphate lyase deficiency decreases atherosclerotic lesion development in LDL-receptor deficient mice

    NARCIS (Netherlands)

    Bot, Martine; van Veldhoven, Paul P.; de Jager, Saskia C. A.; Johnson, Jason; Nijstad, Niels; van Santbrink, Peter J.; Westra, Marijke M.; van der Hoeven, Gerd; Gijbels, Marion J.; Müller-Tidow, Carsten; Varga, Georg; Tietge, Uwe J. F.; Kuiper, Johan; van Berkel, Theo J. C.; Nofer, Jerzy-Roch; Bot, Ilze; Biessen, Erik A. L.

    2013-01-01

    Altered sphingosine 1-phosphate (S1P) homeostasis and signaling is implicated in various inflammatory diseases including atherosclerosis. As S1P levels are tightly controlled by S1P lyase, we investigated the impact of hematopoietic S1P lyase (Sgpl1(-/-)) deficiency on leukocyte subsets relevant to

  4. A novel gene encoding xanthan lyase of Paenibacillus alginolyticus strain XL-1

    NARCIS (Netherlands)

    Ruijssenaars, H.J.; Hartmans, S.; Verdoes, J.C.

    2000-01-01

    Xanthan-modifying enzymes are powerful tools in studying structure-function relationships of this polysaccharide. One of these modifying enzymes is xanthan lyase, which removes the terminal side chain residue of xanthan. In this paper, the cloning and sequencing of the first xanthan lyase-encoding

  5. Structural insights into the bacterial carbon - phosphorus lyase machinery

    DEFF Research Database (Denmark)

    Seweryn, Paulina; Van, Lan Bich; Kjeldgaard, Morten

    2015-01-01

    Phosphorus is required for all life and microorganisms can extract it from their environment through several metabolic pathways. When phosphate is in limited supply, some bacteria are able to use phosphonate compounds, which require specialized enzymatic machinery to break the stable carbon......–phosphorus (C–P) bond. Despite its importance, the details of how this machinery catabolizes phosphonates remain unknown. Here we determine the crystal structure of the 240-kilodalton Escherichia coli C–P lyase core complex (PhnG–PhnH–PhnI–PhnJ; PhnGHIJ), and show that it is a two-fold symmetric hetero...

  6. Interplay of Noisy Gene Expression and Dynamics Explains Patterns of Bacterial Operon Organization

    Science.gov (United States)

    Igoshin, Oleg

    2011-03-01

    Bacterial chromosomes are organized into operons -- sets of genes co-transcribed into polycistronic messenger RNA. Hypotheses explaining the emergence and maintenance of operons include proportional co-regulation, horizontal transfer of intact ``selfish'' operons, emergence via gene duplication, and co-production of physically interacting proteins to speed their association. We hypothesized an alternative: operons can reduce or increase intrinsic gene expression noise in a manner dependent on the post-translational interactions, thereby resulting in selection for or against operons in depending on the network architecture. We devised five classes of two-gene network modules and show that the effects of operons on intrinsic noise depend on class membership. Two classes exhibit decreased noise with co-transcription, two others reveal increased noise, and the remaining one does not show a significant difference. To test our modeling predictions we employed bioinformatic analysis to determine the relationship gene expression noise and operon organization. The results confirm the overrepresentation of noise-minimizing operon architectures and provide evidence against other hypotheses. Our results thereby suggest a central role for gene expression noise in selecting for or maintaining operons in bacterial chromosomes. This demonstrates how post-translational network dynamics may provide selective pressure for organizing bacterial chromosomes, and has practical consequences for designing synthetic gene networks. This work is supported by National Institutes of Health grant 1R01GM096189-01.

  7. Engineered ribosomal RNA operon copy-number variants of E. coli reveal the evolutionary trade-offs shaping rRNA operon number

    Science.gov (United States)

    Gyorfy, Zsuzsanna; Draskovits, Gabor; Vernyik, Viktor; Blattner, Frederick F.; Gaal, Tamas; Posfai, Gyorgy

    2015-01-01

    Ribosomal RNA (rrn) operons, characteristically present in several copies in bacterial genomes (7 in E. coli), play a central role in cellular physiology. We investigated the factors determining the optimal number of rrn operons in E. coli by constructing isogenic variants with 5–10 operons. We found that the total RNA and protein content, as well as the size of the cells reflected the number of rrn operons. While growth parameters showed only minor differences, competition experiments revealed a clear pattern: 7–8 copies were optimal under conditions of fluctuating, occasionally rich nutrient influx and lower numbers were favored in stable, nutrient-limited environments. We found that the advantages of quick adjustment to nutrient availability, rapid growth and economic regulation of ribosome number all contribute to the selection of the optimal rrn operon number. Our results suggest that the wt rrn operon number of E. coli reflects the natural, ‘feast and famine’ life-style of the bacterium, however, different copy numbers might be beneficial under different environmental conditions. Understanding the impact of the copy number of rrn operons on the fitness of the cell is an important step towards the creation of functional and robust genomes, the ultimate goal of synthetic biology. PMID:25618851

  8. Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.

    Science.gov (United States)

    Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L

    2014-07-08

    We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are

  9. Expression of the entire polyhydroxybutyrate operon of Ralstonia eutropha in plants.

    Science.gov (United States)

    Mozes-Koch, Rita; Tanne, Edna; Brodezki, Alexandra; Yehuda, Ran; Gover, Ofer; Rabinowitch, Haim D; Sela, Ilan

    2017-01-01

    Previously we demonstrated that an entire bacterial operon (the PRN operon) is expressible in plants when driven by the Tomato -yellow-leaf-curl-virus (TYLCV) -derived universal vector IL-60.Petroleum-derived plastics are not degradable, and are therefore harmful to the environment. Fermentation of bacteria carrying operons for polyhydroxyalkanoates (PHAs) produces degradable bioplastics which are environmentally friendly. However, bacterial production of bioplastics is not cost-effective, and attention is turning to their production in plants. Such "green" plastics would be less expensive and environmentally friendly. Hence, attempts are being made to substitute petroleum-derived plastics with "green" plastics. However, transformation of plants with genes of operons producing bioplastics has deleterious effects. Transformation of plastids does not cause deleterious effects, however it is a complicated procedures. We have developed another TYLCV-based vector (SE100) and show that yet another bacterial operon (the phaCAB operon) when driven by SE100 is also expressed in plants. We employed the combination of SE100 and the phaCAB operon to drive the operon to the plastids and produce in plants a biodegradable plastic [polyhydroxybutyrate (PHB)].Here we indicate that the bacterial operon (phaCAB), when driven by the newly developed universal plant vector SE100 is directed to chloroplasts and produces in plants PHB, a leading PHA. The PHB-producing plants circumvent the need for complicated technical procedures. The viral vector system SE100 facilitated the production of the bio-plastic poly-3-hydroxybutyrate. This was achieved by using the full pha-CAB operon indicating that TYLCV based system can transcribe and translate genes from bacterial operons controlled by a single cis element. Our data hints to the participation of the chloroplasts in these processes.

  10. Circadian Rhythmicity in the Activities of Phenylalanine Ammonia-Lyase from Lemna perpusilla and Spirodela polyrhiza 1

    Science.gov (United States)

    Gordon, William R.; Koukkari, Willard L.

    1978-01-01

    The oscillations in phenylalanine ammonia-lyase activity from Spirodela polyrhiza and phenylalanine ammonia-lyase and tyrosine ammonia-lyase activities from Lemna perpusilla displayed a circadian rhythm under continuous light. Rhythmicity in enzymic activity could not be detected in continuous darkness since under this condition phenylalanine ammonia-lyase activity remains at a fairly constantly low level. Results from our studies of the oscillatory pattern of the respective activities of phenylalanine and tyrosine ammonia-lyase support their “inseparability.” PMID:16660569

  11. Cloning and expression of isocitrate lyase from human round worm Strongyloides stercoralis

    Directory of Open Access Journals (Sweden)

    Siddiqui A.A.

    2000-09-01

    Full Text Available A full length cDNA (1463 bp encoding isocitrate lyase (EC 4.1.3.1 of Strongyloides stercoralis is described. The nucleotide sequence of this insert identified a cDNA coding for the isocitrate lyase. The conceptually translated amino acid sequence of the open reading frame for S. stercoralis isocitrate lyase encodes a 450 amino acid residue protein with an apparent molecular weight of 50 kDa and a predicted pl of 6.39. The sequence is 69 % A/T, reflecting a characteristic A/T codon bias of S. stercoralis. The amino acid sequence of S. stercoralis isocitrate lyase is compared with bifunctional glyoxylate cycle protein of Caenorhabditis elegans and isocitrate lyases from Chlamydomonas reinhardtii and Myxococcus xanthus. The full length cDNA of S. stercoralis was expressed in pRSET vector and bacteriophage T7 promoter based expression system. S. stercoralis lyase recombinant protein, purified via immobilized metal affinity chromatography, showed a molecular mass of 50 kDa on polyacrylamide gels. The role of isocitrate lyase in the glyoxylate cycle and energy metabolism of S. stercoralis is also discussed.

  12. REMap: Operon map of M. tuberculosis based on RNA sequence data.

    Science.gov (United States)

    Pelly, Shaaretha; Winglee, Kathryn; Xia, Fang Fang; Stevens, Rick L; Bishai, William R; Lamichhane, Gyanu

    2016-07-01

    A map of the transcriptional organization of genes of an organism is a basic tool that is necessary to understand and facilitate a more accurate genetic manipulation of the organism. Operon maps are largely generated by computational prediction programs that rely on gene conservation and genome architecture and may not be physiologically relevant. With the widespread use of RNA sequencing (RNAseq), the prediction of operons based on actual transcriptome sequencing rather than computational genomics alone is much needed. Here, we report a validated operon map of Mycobacterium tuberculosis, developed using RNAseq data from both the exponential and stationary phases of growth. At least 58.4% of M. tuberculosis genes are organized into 749 operons. Our prediction algorithm, REMap (RNA Expression Mapping of operons), considers the many cases of transcription coverage of intergenic regions, and avoids dependencies on functional annotation and arbitrary assumptions about gene structure. As a result, we demonstrate that REMap is able to more accurately predict operons, especially those that contain long intergenic regions or functionally unrelated genes, than previous operon prediction programs. The REMap algorithm is publicly available as a user-friendly tool that can be readily modified to predict operons in other bacteria. Copyright © 2016 Elsevier Ltd. All rights reserved.

  13. The mbo operon is specific and essential for biosynthesis of mangotoxin in Pseudomonas syringae.

    Science.gov (United States)

    Carrión, Víctor J; Arrebola, Eva; Cazorla, Francisco M; Murillo, Jesús; de Vicente, Antonio

    2012-01-01

    Mangotoxin is an antimetabolite toxin produced by certain Pseudomonas syringae pv. syringae strains. This toxin is an oligopeptide that inhibits ornithine N-acetyl transferase, a key enzyme in the biosynthesis of ornithine and arginine. Previous studies have reported the involvement of the putative nonribosomal peptide synthetase MgoA in virulence and mangotoxin production. In this study, we analyse a new chromosomal region of P. syringae pv. syringae UMAF0158, which contains six coding sequences arranged as an operon (mbo operon). The mbo operon was detected in only mangotoxin-producing strains, and it was shown to be essential for the biosynthesis of this toxin. Mutants in each of the six ORFs of the mbo operon were partially or completely impaired in the production of the toxin. In addition, Pseudomonas spp. mangotoxin non-producer strains transformed with the mbo operon gained the ability to produce mangotoxin, indicating that this operon contains all the genetic information necessary for mangotoxin biosynthesis. The generation of a single transcript for the mbo operon was confirmed and supported by the allocation of a unique promoter and Rho-independent terminator. The phylogenetic analysis of the P. syringae strains harbouring the mbo operon revealed that these strains clustered together.

  14. Vulnerabilities in Yersinia pestis caf operon are unveiled by a Salmonella vector.

    Science.gov (United States)

    Cao, Ling; Lim, Timothy; Jun, SangMu; Thornburg, Theresa; Avci, Recep; Yang, Xinghong

    2012-01-01

    During infection, Yersinia pestis uses its F1 capsule to enhance survival and cause virulence to mammalian host. Since F1 is produced in large quantities and secreted into the host tissues, it also serves as a major immune target. To hold this detrimental effect under proper control, Y. pestis expresses the caf operon (encoding the F1 capsule) in a temperature-dependent manner. However, additional properties of the caf operon limit its expression. By overexpressing the caf operon in wild-type Salmonella enterica serovar Typhimurium under a potent promoter, virulence of Salmonella was greatly attenuated both in vitro and in vivo. In contrast, expression of the caf operon under the regulation of its native promoter exhibited negligible impairment of Salmonellae virulence. In-depth investigation revealed all individual genes in the caf operon attenuated Salmonella when overexpressed. The deleterious effects of caf operon and the caf individual genes were further confirmed when they were overexpressed in Y. pestis KIM6+. This study suggests that by using a weak inducible promoter, the detrimental effects of the caf operon are minimally manifested in Y. pestis. Thus, through tight regulation of the caf operon, Y. pestis precisely balances its capsular anti-phagocytic properties with the detrimental effects of caf during interaction with mammalian host.

  15. Characterization of the Escherichia coli codBA operon encoding cytosine permease and cytosine deaminase

    DEFF Research Database (Denmark)

    Danielsen, S; Kilstrup, M; Barilla, K

    1992-01-01

    . A two-codon overlap between the two reading frames indicates that they constitute an operon. Transcription of the operon was found to be regulated by exogenous purines. Polypeptides specified by each of the two reading frames were expressed in minicells, and the codB gene product was found to be highly...

  16. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Nine major transfer RNA (tRNA) gene clusters were analysed in various Vibrio cholerae strains. Of these, only the tRNA operon I was found to differ significantly in V. cholerae classical (sixth pandemic) and El Tor (seventh pandemic) strains. Amongst the sixteen tRNA genes contained in this operon, genes for tRNA Gln3 ...

  17. The pyrimidine operon pyrRPB-carA from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Schallert, J.; Andersen, Birgit

    2001-01-01

    The four genes pyrR, pyrP, pyrB, and carA were found to constitute an operon in Lactococcus lactis subsp, lactis MG1363. The functions of the different genes were established by mutational analysis. The first gene in the operon is the pyrimidine regulatory gene, pyrR, which is responsible...

  18. Sequence analysis and overexpression of a pectin lyase gene (pel1) from Aspergillus oryzae KBN616.

    Science.gov (United States)

    Kitamoto, N; Yoshino-Yasuda, S; Ohmiya, K; Tsukagoshi, N

    2001-01-01

    A gene (pel1) encoding pectin lyase (Pel1) was isolated from a shoyu koji mold, Aspergillus oryzae KBN616, and characterized. The structural gene comprised 1,196 bp with a single intron. The ORF encoded 381 amino acids with a signal peptide of 20 amino acids. The deduced amino acid sequence showed high similarity to those of Aspergillus niger pectin lyases and Glomerella cingulata PnlA. The pel1 gene was successfully overexpressed under the promoter of the A. oryzae TEF1 gene. The molecular mass of the recombinant pectin lyase substantially coincided with that calculated based on nucleotide sequence.

  19. The htpAB operon of Legionella pneumophila cannot be deleted in the presence of the groE chaperonin operon of Escherichia coli.

    Science.gov (United States)

    Nasrallah, Gheyath K; Gagnon, Elizabeth; Orton, Dennis J; Garduño, Rafael A

    2011-11-01

    HtpB, the chaperonin of the intracellular bacterial pathogen Legionella pneumophila , displays several virulence-related functions in vitro. To confirm HtpB's role in vivo, host infections with an htpB deletion mutant would be required. However, we previously reported that the htpAB operon (encoding co-chaperonin and chaperonin) is essential. We attempted here to delete htpAB in a L. pneumophila strain carrying the groE operon (encoding the Escherichia coli co-chaperonin and chaperonin). The groE operon was inserted into the chromosome of L. pneumophila Lp02, and then allelic replacement of htpAB with a gentamicin resistance cassette was attempted. Although numerous potential postallelic replacement transformants showed a correct selection phenotype, we still detected htpAB by PCR and full-size HtpB by immunoblot. Southern blot and PCR analysis indicated that the gentamicin resistance cassette had apparently integrated in a duplicated htpAB region. However, we showed by Southern blot that strain Lp02, and the Lp02 derivative carrying the groE operon, have only one copy of htpAB. These results confirmed that the htpAB operon cannot be deleted, not even in the presence of the groE operon, and suggested that attempts to delete htpAB under strong phenotypic selection result in aberrant genetic recombinations that could involve duplication of the htpAB locus.

  20. Evolution of mal ABC transporter operons in the Thermococcales and Thermotogales

    Directory of Open Access Journals (Sweden)

    Gogarten J Peter

    2008-01-01

    Full Text Available Abstract Background The mal genes that encode maltose transporters have undergone extensive lateral transfer among ancestors of the archaea Thermococcus litoralis and Pyrococcus furiosus. Bacterial hyperthermophiles of the order Thermotogales live among these archaea and so may have shared in these transfers. The genome sequence of Thermotoga maritima bears evidence of extensive acquisition of archaeal genes, so its ancestors clearly had the capacity to do so. We examined deep phylogenetic relationships among the mal genes of these hyperthermophiles and their close relatives to look for evidence of shared ancestry. Results We demonstrate that the two maltose ATP binding cassette (ABC transporter operons now found in Tc. litoralis and P. furiosus (termed mal and mdx genes, respectively are not closely related to one another. The Tc. litoralis and P. furiosus mal genes are most closely related to bacterial mal genes while their respective mdx genes are archaeal. The genes of the two mal operons in Tt. maritima are not related to genes in either of these archaeal operons. They are highly similar to one another and belong to a phylogenetic lineage that includes mal genes from the enteric bacteria. A unique domain of the enteric MalF membrane spanning proteins found also in these Thermotogales MalF homologs supports their relatively close relationship with these enteric proteins. Analyses of genome sequence data from other Thermotogales species, Fervidobacterium nodosum, Thermosipho melanesiensis, Thermotoga petrophila, Thermotoga lettingae, and Thermotoga neapolitana, revealed a third apparent mal operon, absent from the published genome sequence of Tt. maritima strain MSB8. This third operon, mal3, is more closely related to the Thermococcales' bacteria-derived mal genes than are mal1 and mal2. F. nodosum, Ts. melanesiensis, and Tt. lettingae have only one of the mal1-mal2 paralogs. The mal2 operon from an unknown species of Thermotoga appears to

  1. Cytochrome c and c1 heme lyases are essential in Plasmodium berghei.

    Science.gov (United States)

    Posayapisit, Navaporn; Songsungthong, Warangkhana; Koonyosying, Pongpisid; Falade, Mofolusho O; Uthaipibull, Chairat; Yuthavong, Yongyuth; Shaw, Philip J; Kamchonwongpaisan, Sumalee

    Malaria parasites possess a de novo heme synthetic pathway. Interestingly, this pathway is dispensable during the blood stages of development in mammalian hosts. The assembly of the two most important hemeproteins, cytochromes c and c1, is mediated by cytochrome heme lyase enzymes. Plasmodium spp. possess two cytochrome heme lyases encoded by separate genes. Given the redundancy of heme synthesis, we sought to determine if heme lyase function also exhibits redundancy. To answer this question, we performed gene knockout experiments. We found that the PBANKA_143950 and PBANKA_0602600 Plasmodium berghei genes encoding cytochrome c (Pbcchl) and cytochrome c1 (Pbcc 1 hl) heme lyases, respectively, can only be disrupted when a complementary gene is present. In contrast, four genes in the de novo heme synthesis pathway can be disrupted without complementation. This work provides evidence that Pbcchl and Pbcc 1 hl are both essential and thus may be antimalarial targets. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Regulation of gene expression: Cryptic β-glucoside (bgl operon of Escherichia coli as a paradigm

    Directory of Open Access Journals (Sweden)

    Dharmesh Harwani

    2014-12-01

    Full Text Available Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP phenotype to Bgl+ cells and exerts its regulation on at least twelve downstream target genes.

  3. An insight into the regulation of mce4 operon of Mycobacterium tuberculosis.

    Science.gov (United States)

    Rathor, Nisha; Chandolia, Amita; Saini, Neeraj Kumar; Sinha, Rajesh; Pathak, Rakesh; Garima, Kushal; Singh, Satendra; Varma-Basil, Mandira; Bose, Mridula

    2013-07-01

    The mce4 operon is reported to be involved in cholesterol utilization and intracellular survival of Mycobacterium tuberculosis (M. tuberculosis). The regulatory mechanism of this important operon was unknown so far. Here we report detection of the promoter region and regulatory factors of the mce4 operon. The in silico analyzed putative promoter region was cloned in promoter selection vector and promoter strength was measured by O-Nitrophenyl-β-D-galactopyranosidase (ONPG) assay. The transcription start site was determined by 5' Rapid amplification of C terminal end (5'RACE). Surface stress, hypoxia and presence of cholesterol, were found to be stimulatory for mce4 operon promoter induction. Pull down assay coupled with 2D gel electrophoresis resolved many proteins; few prominent spots were processed for identification. MALDI TOF-TOF identified proteins of M. tuberculosis which supported the regulatory function of the identified promoter region and cholesterol utilization of mce4 operon. Since mce4 operon is involved in cholesterol utilization and intracellular survival of M. tuberculosis in the later phase of infection, identification of the promoter sequence as reported in the present communication may facilitate development of effective inhibitors to regulate expression of mce4 operon which may prove to be a good drug target to prevent latency in tuberculosis. Copyright © 2013 Elsevier Ltd. All rights reserved.

  4. Molecular and functional analysis of the mce4 operon in Mycobacterium smegmatis.

    Science.gov (United States)

    García-Fernández, Julia; Papavinasasundaram, Kadamba; Galán, Beatriz; Sassetti, Christopher M; García, José L

    2017-09-01

    Mycobacterium smegmatis contains 6 homologous mce (mammalian cell entry) operons which have been proposed to encode ABC-like import systems. The mce operons encode up to 10 different proteins of unknown function that are not present in conventional ABC transporters. We have analysed the consequences of individually deleting each of the genes of the mce4 operon of M. smegmatis, which mediates the transport of cholesterol. None of the mce4 mutants were able to grow in cholesterol suggesting that all these genes are required for its uptake and that none of them can be replaced by the homologous genes of the other mce operons. This result suggests that different mce operons do not provide redundant capabilities and that M. smegmatis, in contrast with Mycobacterium tuberculosis, is not able to use alternative systems to import cholesterol in the analysed culture conditions. Either deletion of the entire mce4 operon or single point mutations that eliminate the transport function cause a phenotype similar to the one observed in a mutant lacking all 6 mce operons suggesting a pleiotropic role for this system. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

  5. Regulation of gene expression: cryptic β-glucoside (bgl) operon of Escherichia coli as a paradigm.

    Science.gov (United States)

    Harwani, Dharmesh

    2014-01-01

    Bacteria have evolved various mechanisms to extract utilizable substrates from available resources and consequently acquire fitness advantage over competitors. One of the strategies is the exploitation of cryptic cellular functions encoded by genetic systems that are silent under laboratory conditions, such as the bgl (β-glucoside) operon of E. coli. The bgl operon of Escherichia coli, involved in the uptake and utilization of aromatic β-glucosides salicin and arbutin, is maintained in a silent state in the wild type organism by the presence of structural elements in the regulatory region. This operon can be activated by mutations that disrupt these negative elements. The fact that the silent bgl operon is retained without accumulating deleterious mutations seems paradoxical from an evolutionary view point. Although this operon appears to be silent, specific physiological conditions might be able to regulate its expression and/or the operon might be carrying out function(s) apart from the utilization of aromatic β-glucosides. This is consistent with the observations that the activated operon confers a Growth Advantage in Stationary Phase (GASP) phenotype to Bgl(+) cells and exerts its regulation on at least twelve downstream target genes.

  6. Interplay of Gene Expression Noise and Ultrasensitive Dynamics Affects Bacterial Operon Organization

    Science.gov (United States)

    Ray, J. Christian J; Igoshin, Oleg A.

    2012-01-01

    Bacterial chromosomes are organized into polycistronic cotranscribed operons, but the evolutionary pressures maintaining them are unclear. We hypothesized that operons alter gene expression noise characteristics, resulting in selection for or against maintaining operons depending on network architecture. Mathematical models for 6 functional classes of network modules showed that three classes exhibited decreased noise and 3 exhibited increased noise with same-operon cotranscription of interacting proteins. Noise reduction was often associated with a decreased chance of reaching an ultrasensitive threshold. Stochastic simulations of the lac operon demonstrated that the predicted effects of transcriptional coupling hold for a complex network module. We employed bioinformatic analysis to find overrepresentation of noise-minimizing operon organization compared with randomized controls. Among constitutively expressed physically interacting protein pairs, higher coupling frequencies appeared at lower expression levels, where noise effects are expected to be dominant. Our results thereby suggest an important role for gene expression noise, in many cases interacting with an ultrasensitive switch, in maintaining or selecting for operons in bacterial chromosomes. PMID:22956903

  7. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  8. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  9. Characterization of AlgMsp, an alginate lyase from Microbulbifer sp. 6532A.

    Directory of Open Access Journals (Sweden)

    Steven M Swift

    Full Text Available Alginate is a polysaccharide produced by certain seaweeds and bacteria that consists of mannuronic acid and guluronic acid residues. Seaweed alginate is used in food and industrial chemical processes, while the biosynthesis of bacterial alginate is associated with pathogenic Pseudomonas aeruginosa. Alginate lyases cleave this polysaccharide into short oligo-uronates and thus have the potential to be utilized for both industrial and medicinal applications. An alginate lyase gene, algMsp, from Microbulbifer sp. 6532A, was synthesized as an E.coli codon-optimized clone. The resulting 37 kDa recombinant protein, AlgMsp, was expressed, purified and characterized. The alginate lyase displayed highest activity at pH 8 and 0.2 M NaCl. Activity of the alginate lyase was greatest at 50°C; however the enzyme was not stable over time when incubated at 50°C. The alginate lyase was still highly active at 25°C and displayed little or no loss of activity after 24 hours at 25°C. The activity of AlgMsp was not dependent on the presence of divalent cations. Comparing activity of the lyase against polymannuronic acid and polyguluronic acid substrates showed a higher turnover rate for polymannuronic acid. However, AlgMSP exhibited greater catalytic efficiency with the polyguluronic acid substrate. Prolonged AlgMsp-mediated degradation of alginate produced dimer, trimer, tetramer, and pentamer oligo-uronates.

  10. Utilization of Aspergillus oryzae to produce pectin lyase from various agro-industrial residues

    Directory of Open Access Journals (Sweden)

    Safia Koser

    2014-07-01

    Full Text Available The present study was aimed to investigate the culture influence on pectin lyase production potential of fungal strain Aspergillus oryzae. The enzyme profile of A. oryzae showed highest activity of pectin lyase after 3rd day of incubation on lemon peel waste under solid state fermentation conditions. To induce the pectin lyase synthesis capability of A. oryzae at optimal level various culture variables including physical and nutritional parameters were optimized by adopting classical optimization technique. Therefore, through fermentation process optimization the production of pectin lyase was substantially induced up to the level of 875 U/mL, when fermentation medium of lemon peel waste inoculated with 5 mL spore suspension of A. oryzae. The optimal fermentation conditions for maximum pectin lyase yield were as: optimum pH 5, 70% moisture level and incubated at 40 °C in addition with 1% sterile glucose solution as readily available carbon source and 0.2% yeast extract as an inexpensive nitrogen supplement (1%. The results obtained in current investigation so far demonstrated that culture conditions have great influence on the pectin lyase production potential of A. oryzae.

  11. The Genomic Pattern of tDNA Operon Expression in E. coli.

    Directory of Open Access Journals (Sweden)

    2005-06-01

    Full Text Available In fast-growing microorganisms, a tRNA concentration profile enriched in major isoacceptors selects for the biased usage of cognate codons. This optimizes translational rate for the least mass invested in the translational apparatus. Such translational streamlining is thought to be growth-regulated, but its genetic basis is poorly understood. First, we found in reanalysis of the E. coli tRNA profile that the degree to which it is translationally streamlined is nearly invariant with growth rate. Then, using least squares multiple regression, we partitioned tRNA isoacceptor pools to predicted tDNA operons from the E. coli K12 genome. Co-expression of tDNAs in operons explains the tRNA profile significantly better than tDNA gene dosage alone. Also, operon expression increases significantly with proximity to the origin of replication, oriC, at all growth rates. Genome location explains about 15% of expression variation in a form, at a given growth rate, that is consistent with replication-dependent gene concentration effects. Yet the change in the tRNA profile with growth rate is less than would be expected from such effects. We estimated per-copy expression rates for all tDNA operons that were consistent with independent estimates for rDNA operons. We also found that tDNA operon location, and the location dependence of expression, were significantly different in the leading and lagging strands. The operonic organization and genomic location of tDNA operons are significant factors influencing their expression. Nonrandom patterns of location and strandedness shown by tDNA operons in E. coli suggest that their genomic architecture may be under selection to satisfy physiological demand for tRNA expression at high growth rates.

  12. Ancient origin of the tryptophan operon and the dynamics of evolutionary change.

    Science.gov (United States)

    Xie, Gary; Keyhani, Nemat O; Bonner, Carol A; Jensen, Roy A

    2003-09-01

    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  13. Ancient Origin of the Tryptophan Operon and the Dynamics of Evolutionary Change†

    Science.gov (United States)

    Xie, Gary; Keyhani, Nemat O.; Bonner; Jensen, Roy A.

    2003-01-01

    The seven conserved enzymatic domains required for tryptophan (Trp) biosynthesis are encoded in seven genetic regions that are organized differently (whole-pathway operons, multiple partial-pathway operons, and dispersed genes) in prokaryotes. A comparative bioinformatics evaluation of the conservation and organization of the genes of Trp biosynthesis in prokaryotic operons should serve as an excellent model for assessing the feasibility of predicting the evolutionary histories of genes and operons associated with other biochemical pathways. These comparisons should provide a better understanding of possible explanations for differences in operon organization in different organisms at a genomics level. These analyses may also permit identification of some of the prevailing forces that dictated specific gene rearrangements during the course of evolution. Operons concerned with Trp biosynthesis in prokaryotes have been in a dynamic state of flux. Analysis of closely related organisms among the Bacteria at various phylogenetic nodes reveals many examples of operon scission, gene dispersal, gene fusion, gene scrambling, and gene loss from which the direction of evolutionary events can be deduced. Two milestone evolutionary events have been mapped to the 16S rRNA tree of Bacteria, one splitting the operon in two, and the other rejoining it by gene fusion. The Archaea, though less resolved due to a lesser genome representation, appear to exhibit more gene scrambling than the Bacteria. The trp operon appears to have been an ancient innovation; it was already present in the common ancestor of Bacteria and Archaea. Although the operon has been subjected, even in recent times, to dynamic changes in gene rearrangement, the ancestral gene order can be deduced with confidence. The evolutionary history of the genes of the pathway is discernible in rough outline as a vertical line of descent, with events of lateral gene transfer or paralogy enriching the analysis as interesting

  14. Design of thermostable rhamnogalacturonan lyase mutants from Bacillus licheniformis by combination of targeted single point mutations

    DEFF Research Database (Denmark)

    da Silva, Ines Isabel Cardoso Rodrigues; Jers, Carsten; Otten, Harm

    2014-01-01

    Rhamnogalacturonan I lyases (RGI lyases) (EC 4.2.2.-) catalyze cleavage of α-1,4 bonds between rhamnose and galacturonic acid in the backbone of pectins by β-elimination. In the present study, targeted improvement of the thermostability of a PL family 11 RGI lyase from Bacillus licheniformis (DSM......, were obtained due to additive stabilizing effects of single amino acid mutations (E434L, G55V, and G326E) compared to the wild type. The crystal structure of the B. licheniformis wild-type RGI lyase was also determined; the structural analysis corroborated that especially mutation of charged amino...

  15. Production and Purification of a Novel Xanthan Lyase from a Xanthan-Degrading Microbacterium sp. Strain XT11

    Directory of Open Access Journals (Sweden)

    Fan Yang

    2014-01-01

    Full Text Available A xanthan lyase was produced and purified from the culture supernatant of an excellent xanthan-modifying strain Microbacterium sp. XT11. Xanthan lyase was induced by xanthan but was inhibited by its structural monomer glucose. Its production by strain XT11 is much higher than that by all other reported strains. The purified xanthan lyase has a molecular mass of 110 kDa and a specific activity of 28.2 U/mg that was much higher than that of both Paenibacillus and Bacillus lyases. It was specific on the pyruvated mannosyl residue in the intact xanthan molecule, but about 50% lyase activity remained when xanthan was partially depyruvated. Xanthan lyase was optimally active at pH 6.0–6.5 and 40°C and alkali-tolerant at a high pH value of 11.0. The metal ions including K+, Ca2+, Na+, Mg2+, Mn2+, and Li+ strongly stimulated xanthan lyase activity but ions Zn2+ and Cu2+ were its inhibitor. Xanthan lyase should be a novel enzyme different from the other xanthan lyases ever reported.

  16. Sexual Dimorphism in the Selenocysteine Lyase Knockout Mouse.

    Science.gov (United States)

    Ogawa-Wong, Ashley N; Hashimoto, Ann C; Ha, Herena; Pitts, Matthew W; Seale, Lucia A; Berry, Marla J

    2018-01-31

    Selenium (Se) is an essential micronutrient known for its antioxidant properties and health benefits, attributed to its presence in selenoproteins as the amino acid, selenocysteine. Selenocysteine lyase (Scly) catalyzes hydrolysis of selenocysteine to selenide and alanine, facilitating re-utilization of Se for de novo selenoprotein synthesis. Previously, it was reported that male Scly -/- mice develop increased body weight and body fat composition, and altered lipid and carbohydrate metabolism, compared to wild type mice. Strikingly, females appeared to present with a less severe phenotype, suggesting the relationship between Scly and energy metabolism may be regulated in a sex-specific manner. Here, we report that while body weight and body fat gain occur in both male and female Scly -/- mice, strikingly, males are susceptible to developing glucose intolerance, whereas female Scly -/- mice are protected. Because Se is critical for male reproduction, we hypothesized that castration would attenuate the metabolic dysfunction observed in male Scly -/- mice by eliminating sequestration of Se in testes. We report that fasting serum insulin levels were significantly reduced in castrated males compared to controls, but islet area was unchanged between groups. Finally, both male and female Scly -/- mice exhibit reduced hypothalamic expression of selenoproteins S, M, and glutathione peroxidase 1.

  17. Phenylalanine ammonia-lyase through evolution: A bioinformatic approach

    Directory of Open Access Journals (Sweden)

    Shiva Hemmati

    2015-03-01

    Full Text Available Phenylalanine ammonia-lyase (PAL is the first entry enzyme of the phenylpropanoid pathway that converts phenylalanine to cinnamic acid which is the precursor of various secondary metabolites. PAL is recently formulated for phenylketonuric patients in pegylated forms; therefore, screening a PAL with the highest affinity to the substrate is of a great importance. PAL exists in all higher plants and some fungi and few bacteria. Ancestors of land plants have been adopted by evolving metabolic pathways. A multi-gene family encodes PAL by gene duplication events in most plants. In this study, the taxonomic distribution and phylogeny of pal gene found in land plants, fungi and bacteria have been analyzed. It seems that the ancestor of plants acquired a pal gene via horizontal gene transfer in symbioses with bacteria and fungi. Gymnosperms have kept a diverse set of pal genes that arose from gene duplication events. In angiosperms, after the divergence of dicotyledons from monocots, pal genes were duplicated many times. The close paralogues of pal genes in some species indicate expansion of gene families after the divergence in plant pal gene evolution. Interestingly, some of the plant pals clustered by species in a way that pals within one species are more closely related to each other than to homologs in the other species which indicates this duplication event occurred more recently.

  18. Genomic Characterization of Phenylalanine Ammonia Lyase Gene in Buckwheat.

    Directory of Open Access Journals (Sweden)

    Karthikeyan Thiyagarajan

    Full Text Available Phenylalanine Ammonia Lyase (PAL gene which plays a key role in bio-synthesis of medicinally important compounds, Rutin/quercetin was sequence characterized for its efficient genomics application. These compounds possessing anti-diabetic and anti-cancer properties and are predominantly produced by Fagopyrum spp. In the present study, PAL gene was sequenced from three Fagopyrum spp. (F. tataricum, F. esculentum and F. dibotrys and showed the presence of three SNPs and four insertion/deletions at intra and inter specific level. Among them, the potential SNP (position 949th bp G>C with Parsimony Informative Site was selected and successfully utilised to individuate the zygosity/allelic variation of 16 F. tataricum varieties. Insertion mutations were identified in coding region, which resulted the change of a stretch of 39 amino acids on the putative protein. Our Study revealed that autogamous species (F. tataricum has lower frequency of observed SNPs as compared to allogamous species (F. dibotrys and F. esculentum. The identified SNPs in F. tataricum didn't result to amino acid change, while in other two species it caused both conservative and non-conservative variations. Consistent pattern of SNPs across the species revealed their phylogenetic importance. We found two groups of F. tataricum and one of them was closely related with F. dibotrys. Sequence characterization information of PAL gene reported in present investigation can be utilized in genetic improvement of buckwheat in reference to its medicinal value.

  19. Requirement of argininosuccinate lyase for systemic nitric oxide production.

    Science.gov (United States)

    Erez, Ayelet; Nagamani, Sandesh C S; Shchelochkov, Oleg A; Premkumar, Muralidhar H; Campeau, Philippe M; Chen, Yuqing; Garg, Harsha K; Li, Li; Mian, Asad; Bertin, Terry K; Black, Jennifer O; Zeng, Heng; Tang, Yaoping; Reddy, Anilkumar K; Summar, Marshall; O'Brien, William E; Harrison, David G; Mitch, William E; Marini, Juan C; Aschner, Judy L; Bryan, Nathan S; Lee, Brendan

    2011-11-13

    Nitric oxide (NO) is crucial in diverse physiological and pathological processes. We show that a hypomorphic mouse model of argininosuccinate lyase (encoded by Asl) deficiency has a distinct phenotype of multiorgan dysfunction and NO deficiency. Loss of Asl in both humans and mice leads to reduced NO synthesis, owing to both decreased endogenous arginine synthesis and an impaired ability to use extracellular arginine for NO production. Administration of nitrite, which can be converted into NO in vivo, rescued the manifestations of NO deficiency in hypomorphic Asl mice, and a nitric oxide synthase (NOS)-independent NO donor restored NO-dependent vascular reactivity in humans with ASL deficiency. Mechanistic studies showed that ASL has a structural function in addition to its catalytic activity, by which it contributes to the formation of a multiprotein complex required for NO production. Our data demonstrate a previously unappreciated role for ASL in NOS function and NO homeostasis. Hence, ASL may serve as a target for manipulating NO production in experimental models, as well as for the treatment of NO-related diseases.

  20. Sexual Dimorphism in the Selenocysteine Lyase Knockout Mouse

    Directory of Open Access Journals (Sweden)

    Ashley N. Ogawa-Wong

    2018-01-01

    Full Text Available Selenium (Se is an essential micronutrient known for its antioxidant properties and health benefits, attributed to its presence in selenoproteins as the amino acid, selenocysteine. Selenocysteine lyase (Scly catalyzes hydrolysis of selenocysteine to selenide and alanine, facilitating re-utilization of Se for de novo selenoprotein synthesis. Previously, it was reported that male Scly−/− mice develop increased body weight and body fat composition, and altered lipid and carbohydrate metabolism, compared to wild type mice. Strikingly, females appeared to present with a less severe phenotype, suggesting the relationship between Scly and energy metabolism may be regulated in a sex-specific manner. Here, we report that while body weight and body fat gain occur in both male and female Scly−/− mice, strikingly, males are susceptible to developing glucose intolerance, whereas female Scly−/− mice are protected. Because Se is critical for male reproduction, we hypothesized that castration would attenuate the metabolic dysfunction observed in male Scly−/− mice by eliminating sequestration of Se in testes. We report that fasting serum insulin levels were significantly reduced in castrated males compared to controls, but islet area was unchanged between groups. Finally, both male and female Scly−/− mice exhibit reduced hypothalamic expression of selenoproteins S, M, and glutathione peroxidase 1.

  1. Structural organization of the transfer RNA operon I of Vibrio cholerae

    Indian Academy of Sciences (India)

    Unknown

    [Ghatak A, Majumdar A and Ghosh R K 2005 Structural organization of the transfer RNA operon I of Vibrio cholerae: Differences ..... clonal relationship are of utmost importance. ... rately derived from environmental, nontoxigenic, non-O1.

  2. Incorporation of a horizontally transferred gene into an operon during cnidarian evolution.

    Directory of Open Access Journals (Sweden)

    Catherine E Dana

    Full Text Available Genome sequencing has revealed examples of horizontally transferred genes, but we still know little about how such genes are incorporated into their host genomes. We have previously reported the identification of a gene (flp that appears to have entered the Hydra genome through horizontal transfer. Here we provide additional evidence in support of our original hypothesis that the transfer was from a unicellular organism, and we show that the transfer occurred in an ancestor of two medusozoan cnidarian species. In addition we show that the gene is part of a bicistronic operon in the Hydra genome. These findings identify a new animal phylum in which trans-spliced leader addition has led to the formation of operons, and define the requirements for evolution of an operon in Hydra. The identification of operons in Hydra also provides a tool that can be exploited in the construction of transgenic Hydra strains.

  3. 50 CFR 660.160 - Catcher/processor (C/P) Coop Program.

    Science.gov (United States)

    2010-10-01

    ... Pacific whiting, canary rockfish, darkblotched rockfish, Pacific Ocean perch, widow rockfish; (ii) Species... issuance for C/P endorsement—(i) Eligibility criteria for C/P endorsement. Only current owners of a current... with the current limited entry trawl permit accrues to the current permit owner. NMFS will not...

  4. Construction and Expression of Pet Operon Using Shuttle Vector for Mesophilic and Thermophilic Bacteria

    OpenAIRE

    Riyanti, Eny Ida; Rogers, Peter L

    2009-01-01

    Keuntungan fermentasi etanol pada suhu tinggi mendorong penelitian perakitan bakteri termofilik etalogenik. Selain itu, kemampuan bakteri termofilik dalam penggunaan gula pentosa hasil degradasi biomasa memberi peluang untuk menekan biaya produksi bioetanol. Tujuan dari penelitian ini adalah untuk mengkonstruksi pet (production of ethanol) operon dengan menggunakan shuttle vector pMK18 dan melihat ekspresinya dalam bakteri mesofilik dan termofilik. Konstruksi dan ekspresi pet operon dengan me...

  5. Relative expression of the products of glyoxylate bypass operon: contributions of transcription and translation.

    OpenAIRE

    Chung, T; Resnik, E; Stueland, C; LaPorte, D C

    1993-01-01

    Although the genes of the aceBAK operon are expressed from the same promoter, the relative cellular levels of their products are approximately 0.3:1:0.003. Gene and operon fusions with lacZ were constructed to characterize this differential expression. The upshift in expression between aceB and aceA resulted from differences in translational efficiency. In contrast, inefficient translation and premature transcriptional termination contributed to the downshift in expression between aceA and ac...

  6. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    OpenAIRE

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L.?acidophilus?NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP - amy - pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and gro...

  7. Solving a discrete model of the lac operon using Z3

    Science.gov (United States)

    Gutierrez, Natalia A.

    2014-05-01

    A discrete model for the Lcac Operon is solved using the SMT-solver Z3. Traditionally the Lac Operon is formulated in a continuous math model. This model is a system of ordinary differential equations. Here, it was considerated as a discrete model, based on a Boolean red. The biological problem of Lac Operon is enunciated as a problem of Boolean satisfiability, and it is solved using an STM-solver named Z3. Z3 is a powerful solver that allows understanding the basic dynamic of the Lac Operon in an easier and more efficient way. The multi-stability of the Lac Operon can be easily computed with Z3. The code that solves the Boolean red can be written in Python language or SMT-Lib language. Both languages were used in local version of the program as online version of Z3. For future investigations it is proposed to solve the Boolean red of Lac Operon using others SMT-solvers as cvc4, alt-ergo, mathsat and yices.

  8. Bacterial cellulose biosynthesis: diversity of operons, subunits, products and functions

    Science.gov (United States)

    Römling, Ute; Galperin, Michael Y.

    2015-01-01

    Summary Recent studies of bacterial cellulose biosynthesis, including structural characterization of a functional cellulose synthase complex, provided the first mechanistic insight into this fascinating process. In most studied bacteria, just two subunits, BcsA and BcsB, are necessary and sufficient for the formation of the polysaccharide chain in vitro. Other subunits – which differ among various taxa – affect the enzymatic activity and product yield in vivo by modulating expression of biosynthesis apparatus, export of the nascent β-D-glucan polymer to the cell surface, and the organization of cellulose fibers into a higher-order structure. These auxiliary subunits play key roles in determining the quantity and structure of the resulting biofilm, which is particularly important for interactions of bacteria with higher organisms that lead to rhizosphere colonization and modulate virulence of cellulose-producing bacterial pathogens inside and outside of host cells. Here we review the organization of four principal types of cellulose synthase operons found in various bacterial genomes, identify additional bcs genes that encode likely components of the cellulose biosynthesis and secretion machinery, and propose a unified nomenclature for these genes and subunits. We also discuss the role of cellulose as a key component of biofilms formed by a variety of free-living and pathogenic bacteria and, for the latter, in the choice between acute infection and persistence in the host. PMID:26077867

  9. Solvent Isotope-induced Equilibrium Perturbation for Isocitrate Lyase

    Science.gov (United States)

    Quartararo, Christine E.; Hadi, Timin; Cahill, Sean M.; Blanchard, John S.

    2014-01-01

    Isocitrate lyase (ICL) catalyzes the reversible retro-aldol cleavage of isocitrate to generate glyoxylate and succinate. ICL is the first enzyme of the glyoxylate shunt, which allows for the anaplerosis of citric acid cycle intermediates under nutrient limiting conditions. In Mycobacterium tuberculosis, the source of ICL for these studies, ICL is vital for the persistence phase of the bacteria’s life cycle. Solvent kinetic isotope effects (KIEs) in the direction of isocitrate cleavage of D2OV = 2.0 ± 0.1 and D2O[V/Kisocitrate] = 2.2 ± 0.3 arise from the initial deprotonation of the C2 hydroxyl group of isocitrate or the protonation of the aci-acid of succinate product of the isocitrate aldol cleavage by a solvent-derived proton. This KIE suggested that an equilibrium mixture of all protiated isocitrate, glyoxylate and succinate prepared in D2O, would undergo transient changes in equilibrium concentrations as a result of the solvent KIE and solvent-derived deuterium incorporation into both succinate and isocitrate. No change in the isotopic composition of glyoxylate was expected or observed. We have directly monitored the changing concentrations of all isotopic species of all reactants and products using a combination of NMR spectroscopy and mass spectrometry. Continuous monitoring of glyoxylate by 1H NMR spectroscopy shows a clear equilibrium perturbation in D2O. The final equilibrium isotopic composition of reactants in D2O revealed di-deuterated succinate, protiated glyoxylate, and mono-deuterated isocitrate, with the transient appearance and disappearance of mono-deuterated succinate. A model for the equilibrium perturbation of substrate species, and their time-dependent isotopic composition is presented. PMID:24261638

  10. Probing the structure of glucan lyases – the lytic members of GH31 - by sequence analysis, circular dichroism and proteolysis

    DEFF Research Database (Denmark)

    Ernst, Heidi; Lo Leggio, Leila; Yu, Shukun

    2005-01-01

    Glucan lyase (GL) is a polysaccharide lyase with unique characteristics. It is involved in an alternative pathway for the degradation of alpha-glucans, the anhydrofructose pathway. Sequence similarity suggests that this lytic enzyme belongs to glycoside hydrolase family 31, for which until very r...

  11. Induction of the mar operon by miscellaneous groceries.

    Science.gov (United States)

    Rickard, A H; Lindsay, S; Lockwood, G B; Gilbert, P

    2004-01-01

    To investigate the potential of non-antibacterial consumer products to act as inducers of the multiple antibiotic resistance (mar) operon of Escherichia coli SPC105. Wells were cut into chemically defined agar medium (CDM) contained within Petri dishes. Molten agar slurries were prepared by mixing known quantities of 35 consumer products with molten CDM and these were pipetted into each well. Plates were overlaid with molten CDM (5 ml), containing 40 microg ml(-1) X-gal and approx. 1000 CFU ml(-1) of an overnight culture of E. coli SPC105 containing a chromosomal marOII::lacZ fusion. After incubation (37 degrees C, 24 h), plates were examined for zones of growth inhibition and the presence of a blue coloration, indicative of mar (marOII::lacZ) induction. Of the 35 products tested (nine herbs and spices, 19 food and drinks and seven household products), 24 (69%) of the items produced inhibitory zones and 22 (63%) of the items induced mar expression. Apple puree was inhibitory but did not induce marOII::lacZ. Mustard, chilli and garlic were shown to be powerful inducers of marOII::lacZ. Overall six products were shown to be powerful marOII::lacZ inducers. None of these made hygiene claims. In addition to induction by specific biocides and antibiotics, mar is induced by the exposure of bacteria to natural substances, many of which are common to a domiciliary setting. Concern that the overuse of antibacterials within consumer products might select for mar-mediated resistance is shortsighted and fails to recognize the ubiquity of inducers in our environment.

  12. The nif Gene Operon of the Methanogenic Archaeon Methanococcus maripaludis

    Science.gov (United States)

    Kessler, Peter S.; Blank, Carrine; Leigh, John A.

    1998-01-01

    Nitrogen fixation occurs in two domains, Archaea and Bacteria. We have characterized a nif (nitrogen fixation) gene cluster in the methanogenic archaeon Methanococcus maripaludis. Sequence analysis revealed eight genes, six with sequence similarity to known nif genes and two with sequence similarity to glnB. The gene order, nifH, ORF105 (similar to glnB), ORF121 (similar to glnB), nifD, nifK, nifE, nifN, and nifX, was the same as that found in part in other diazotrophic methanogens and except for the presence of the glnB-like genes, also resembled the order found in many members of the Bacteria. Using transposon insertion mutagenesis, we determined that an 8-kb region required for nitrogen fixation corresponded to the nif gene cluster. Northern analysis revealed the presence of either a single 7.6-kb nif mRNA transcript or 10 smaller mRNA species containing portions of the large transcript. Polar effects of transposon insertions demonstrated that all of these mRNAs arose from a single promoter region, where transcription initiated 80 bp 5′ to nifH. Distinctive features of the nif gene cluster include the presence of the six primary nif genes in a single operon, the placement of the two glnB-like genes within the cluster, the apparent physical separation of the cluster from any other nif genes that might be in the genome, the fragmentation pattern of the mRNA, and the regulation of expression by a repression mechanism described previously. Our study and others with methanogenic archaea reporting multiple mRNAs arising from gene clusters with only a single putative promoter sequence suggest that mRNA processing following transcription may be a common occurrence in methanogens. PMID:9515920

  13. On the knock-out mechanism for the 12C(P,α)9B reaction

    International Nuclear Information System (INIS)

    Hassan, M.Y.M.; Ismail, E.H.; Rabie, A.

    1978-01-01

    The mechanism of the reaction 12 C(P,α) 9 B is studied using zero range distorted wave Born approximation. The knock out mechanism is assumed to represent this reaction both in the forward and backward angles. (orig.) [de

  14. Domain walls and the C P anomaly in softly broken supersymmetric QCD

    Science.gov (United States)

    Draper, Patrick

    2018-04-01

    In ordinary QCD with light, degenerate, fundamental flavors, C P symmetry is spontaneously broken at θ =π , and domain wall solutions connecting the vacua can be constructed in chiral perturbation theory. In some cases the breaking of C P saturates a 't Hooft anomaly, and anomaly inflow requires nontrivial massless excitations on the domain walls. Analogously, C P can be spontaneously broken in supersymmetric QCD (SQCD) with light flavors and small soft breaking parameters. We study C P breaking and domain walls in softly broken SQCD with Nfcomputed at leading order in the soft breaking parameters, producing a phase diagram for the stable wall trajectory. We also comment on domain walls in the similar case of QCD with an adjoint and fundamental flavors, and on the impact of adding an axion in this theory.

  15. Processes for the production of hydroxycinnamic acids using polypeptides having tyrosine ammonia lyase activity

    DEFF Research Database (Denmark)

    2016-01-01

    The present invention generally relates to the field of biotechnology as it applies to the production of hydroxycinnamic acids using polypeptides having tyrosine ammonia lyase activity. More particularly, the present invention pertains to polypeptides having tyrosine ammonia lyase activity and high...... substrate specificity towards tyrosine, which makes them particularly suitable in the production of p-coumaric acid and other hydroxycinnamic acids. The present invention thus provides processes for the production of p-coumaric acid and other hydroxycinnamic acids employing these polypeptides as well...

  16. Studies of $C\\!P$-violation in charmless three-body $b$-hadron decays

    CERN Document Server

    AUTHOR|(INSPIRE)INSPIRE-00401396

    Violation of combined charge and parity inversion ($C\\!P$) is a property of the Standard Model that results in a fundamental difference between particles and anti-particles. The single source of $C\\!P$-violation in the Standard Model is insufficient to explain the dominance of matter over anti-matter in the contemporary universe, however, thus far, there has been no clear observation of $C\\!P$-violation beyond the Standard Model. Constraints on various $C\\!P$-violating observables are now precise enough that these represent sensitive tests for physics beyond the Standard Model. This thesis firstly documents the observation of two three-body $b$-baryon decays, and measurements of their phase-space integrated $C\\!P$-asymmetries, which are some of the first to be performed on baryon decays. These measurements provide useful information on hadronisation in $b$-baryon decays, on the intermediate decay dynamics, and give a potential avenue to search for $C\\!P$-violation in baryon decays. An amplitude analysis of th...

  17. Cop-like operon: Structure and organization in species of the Lactobacillale order

    Directory of Open Access Journals (Sweden)

    ANGÉLICA REYES

    2006-01-01

    Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

  18. Identification of an operon, Pil-Chp, that controls twitching motility and virulence in Xylella fastidiosa.

    Science.gov (United States)

    Cursino, Luciana; Galvani, Cheryl D; Athinuwat, Dusit; Zaini, Paulo A; Li, Yaxin; De La Fuente, Leonardo; Hoch, Harvey C; Burr, Thomas J; Mowery, Patricia

    2011-10-01

    Xylella fastidiosa is an important phytopathogenic bacterium that causes many serious plant diseases, including Pierce's disease of grapevines. Disease manifestation by X. fastidiosa is associated with the expression of several factors, including the type IV pili that are required for twitching motility. We provide evidence that an operon, named Pil-Chp, with genes homologous to those found in chemotaxis systems, regulates twitching motility. Transposon insertion into the pilL gene of the operon resulted in loss of twitching motility (pilL is homologous to cheA genes encoding kinases). The X. fastidiosa mutant maintained the type IV pili, indicating that the disrupted pilL or downstream operon genes are involved in pili function, and not biogenesis. The mutated X. fastidiosa produced less biofilm than wild-type cells, indicating that the operon contributes to biofilm formation. Finally, in planta the mutant produced delayed and less severe disease, indicating that the Pil-Chp operon contributes to the virulence of X. fastidiosa, presumably through its role in twitching motility.

  19. A novel marRAB operon contributes to the rifampicin resistance in Mycobacterium smegmatis.

    Science.gov (United States)

    Zhang, Haiwei; Gao, Long; Zhang, Jiaoling; Li, Weihui; Yang, Min; Zhang, Hua; Gao, Chunhui; He, Zheng-Guo

    2014-01-01

    The multiple-antibiotic resistance regulator (MarR) plays an important role in modulating bacterial antibiotic resistance. However, the regulatory model of the marRAB operon in mycobacteria remains to be characterized. Here we report that a MarR, encoded by Ms6508, and its marRAB operon specifically contribute to rifampicin (RIF) resistance in Mycobacterium smegmatis. We show that the MarR recognizes a conserved 21-bp palindromic motif and negatively regulates the expression of two ABC transporters in the operon, encoded by Ms6509-6510. Unlike other known drug efflux pumps, overexpression of these two ABC transporters unexpectedly increased RIF sensitivity and deletion of these two genes increased mycobacterial resistance to the antibiotic. No change can be detected for the sensitivity of recombinant mycobacterial strains to three other anti-TB drugs. Furthermore, HPLC experiments suggested that Ms6509-Ms6510 could pump RIF into the mycobacterial cells. These findings indicated that the mycobacterial MarR functions as a repressor and constitutively inhibits the expression of the marRAB operon, which specifically contributes to RIF resistance in M. smegmatis. Therefore, our data suggest a new regulatory mechanism of RIF resistance and also provide the new insight into the regulatory model of a marRAB operon in mycobacteria.

  20. Burkholderia contaminans Biofilm Regulating Operon and Its Distribution in Bacterial Genomes.

    Science.gov (United States)

    Voronina, Olga L; Kunda, Marina S; Ryzhova, Natalia N; Aksenova, Ekaterina I; Semenov, Andrey N; Romanova, Yulia M; Gintsburg, Alexandr L

    2016-01-01

    Biofilm formation by Burkholderia spp. is a principal cause of lung chronic infections in cystic fibrosis patients. A "lacking biofilm production" (LBP) strain B. contaminans GIMC4587:Bct370-19 has been obtained by insertion modification of clinical strain with plasposon mutagenesis. It has an interrupted transcriptional response regulator (RR) gene. The focus of our investigation was a two-component signal transduction system determination, including this RR. B. contaminans clinical and LBP strains were analyzed by whole genome sequencing and bioinformatics resources. A four-component operon (BiofilmReg) has a key role in biofilm formation. The relative location (i.e., by being separated by another gene) of RR and histidine kinase genes is unique in BiofilmReg. Orthologs were found in other members of the Burkholderiales order. Phylogenetic analysis of strains containing BiofilmReg operons demonstrated evidence for earlier inheritance of a three-component operon. During further evolution one lineage acquired a fourth gene, whereas others lost the third component of the operon. Mutations in sensor domains have created biodiversity which is advantageous for adaptation to various ecological niches. Different species Burkholderia and Achromobacter strains all demonstrated similar BiofilmReg operon structure. Therefore, there may be an opportunity to develop a common drug which is effective for treating all these causative agents.

  1. Artificial citrate operon and Vitreoscilla hemoglobin gene enhanced mineral phosphate solubilizing ability of Enterobacter hormaechei DHRSS.

    Science.gov (United States)

    Yadav, Kavita; Kumar, Chanchal; Archana, G; Kumar, G Naresh

    2014-10-01

    Mineral phosphate solubilization by bacteria is mediated through secretion of organic acids, among which citrate is one of the most effective. To overproduce citrate in bacterial systems, an artificial citrate operon comprising of genes encoding NADH-insensitive citrate synthase of E. coli and Salmonella typhimurium sodium-dependent citrate transporter was constructed. In order to improve its mineral phosphate solubilizing (MPS) ability, the citrate operon was incorporated into E. hormaechei DHRSS. The artificial citrate operon transformant secreted 7.2 mM citric acid whereas in the native strain, it was undetectable. The transformant released 0.82 mM phosphate in flask studies in buffered medium containing rock phosphate as sole P source. In fermenter studies, similar phenotype was observed under aerobic conditions. However, under microaerobic conditions, no citrate was detected and P release was not observed. Therefore, an artificial citrate gene cluster containing Vitreoscilla hemoglobin (vgb) gene under its native promoter, along with artificial citrate operon under constitutive tac promoter, was constructed and transformed into E. hormaechei DHRSS. This transformant secreted 9 mM citric acid under microaerobic conditions and released 1.0 mM P. Thus, incorporation of citrate operon along with vgb gene improves MPS ability of E. hormaechei DHRSS under buffered, microaerobic conditions mimicking rhizospheric environment.

  2. Reduced phenylalanine ammonia-lyase and tyrosine ammonia-lyase activities and lignin synthesis in wheat grown under low pressure sodium lamps

    Science.gov (United States)

    Guerra, D.; Anderson, A. J.; Salisbury, F. B.

    1985-01-01

    Wheat (Triticum aestivum L. cv Fremont) grown in hydroponic culture under 24-hour continuous irradiation at 560 to 580 micromoles per square meter per second from either metalhalide (MH), high pressure sodium (HPS), or low pressure sodium (LPS) lamps reached maturity in 70 days. Grain yields were similar under all three lamps, although LPS-grown plants lodged at maturity. Phenylalanine ammonia-lyase (PAL) and a tyrosine ammonia lyase (TAL) with lesser activity were detected in all extracts of leaf, inflorescence, and stem. Ammonia-lyase activities increased with age of the plant, and plants grown under the LPS lamp displayed PAL and TAL activities lower than wheat cultured under MH and HPS radiation. Greenhouse solar-grown wheat had the highest PAL and TAL activities. Lignin content of LPS-grown wheat was also significantly reduced from that of plants grown under MH or HPS lamps or in the greenhouse, showing a correlation with the reduced PAL and TAL activities. Ratios of far red-absorbing phytochrome to total phytochrome were similar for all three lamps, but the data do not yet warrant a conclusion about specific wavelengths missing from the LPS lamps that might have induced PAL and TAL activities in plants under the other lamps.

  3. Footprints of Optimal Protein Assembly Strategies in the Operonic Structure of Prokaryotes

    Directory of Open Access Journals (Sweden)

    Jan Ewald

    2015-04-01

    Full Text Available In this work, we investigate optimality principles behind synthesis strategies for protein complexes using a dynamic optimization approach. We show that the cellular capacity of protein synthesis has a strong influence on optimal synthesis strategies reaching from a simultaneous to a sequential synthesis of the subunits of a protein complex. Sequential synthesis is preferred if protein synthesis is strongly limited, whereas a simultaneous synthesis is optimal in situations with a high protein synthesis capacity. We confirm the predictions of our optimization approach through the analysis of the operonic organization of protein complexes in several hundred prokaryotes. Thereby, we are able to show that cellular protein synthesis capacity is a driving force in the dissolution of operons comprising the subunits of a protein complex. Thus, we also provide a tested hypothesis explaining why the subunits of many prokaryotic protein complexes are distributed across several operons despite the presumably less precise co-regulation.

  4. Catalytic Mechanisms and Biocatalytic Applications of Aspartate and Methylaspartate Ammonia Lyases

    NARCIS (Netherlands)

    de Villiers, Marianne; Veetil, Vinod Puthan; Raj, Hans; de Villiers, Jandre; Poelarends, Gerrit J.

    2012-01-01

    Ammonia lyases catalyze the formation of alpha-beta-unsaturated bonds by the elimination of ammonia from their substrates. This conceptually straightforward reaction has been the emphasis of many studies, with the main focus on the catalytic mechanism of these enzymes and/or the use of these enzymes

  5. Characterization of the N-linked glycosylation site of recombinant pectate lyase

    NARCIS (Netherlands)

    Colangelo, J.; Licon, V.; Benen, J.A.E.; Visser, J.; Bergmann, C.; Orlando, R.

    1999-01-01

    Recombinant pectate lyase from Aspergillus niger was overexpressed in Aspergillus nidulans. The two recombinant proteins produced differed in molecular mass by 1200 Da, which suggested that the larger molecular weight protein was glycosylated. The deduced amino acid sequence was searched for

  6. Mode of action of pectin lyase A of Aspergillus niger on differently C6-substituted oligogalacturonides

    NARCIS (Netherlands)

    Alebeek, van G.J.W.M.; Christensen, T.M.I.E.; Schols, H.A.; Mikkelsen, J.D.; Voragen, A.G.J.

    2002-01-01

    A thorough investigation of the mode of action of Aspergillus niger (4M-147) pectin lyase A (PLA) on differently C6-substituted oligogalacturonides is described. PLA appeared to be very specific for fully methyl-esterified oligogalacturonides: removal of the methyl-ester or changing the type of

  7. Genetic and molecular analyses of Escherichia coli N-acetylneuraminate lyase gene.

    OpenAIRE

    Kawakami, B; Kudo, T; Narahashi, Y; Horikoshi, K

    1986-01-01

    Two plasmids containing the N-acetylneuraminate lyase (NALase) gene (nanA) of Escherichia coli, pNL1 and pNL4, were constructed. Immunoprecipitation analysis indicated that the 35,000-dalton protein encoded in pNL4 was NALase. The synthesis of NALase in E. coli carrying these plasmids was constitutive.

  8. Hematopoietic sphingosine 1-phosphate lyase deficiency decreases atherosclerotic lesion development in LDL-receptor deficient mice.

    Directory of Open Access Journals (Sweden)

    Martine Bot

    Full Text Available AIMS: Altered sphingosine 1-phosphate (S1P homeostasis and signaling is implicated in various inflammatory diseases including atherosclerosis. As S1P levels are tightly controlled by S1P lyase, we investigated the impact of hematopoietic S1P lyase (Sgpl1(-/- deficiency on leukocyte subsets relevant to atherosclerosis. METHODS AND RESULTS: LDL receptor deficient mice that were transplanted with Sgpl1(-/- bone marrow showed disrupted S1P gradients translating into lymphopenia and abrogated lymphocyte mitogenic and cytokine response as compared to controls. Remarkably however, Sgpl1(-/- chimeras displayed mild monocytosis, due to impeded stromal retention and myelopoiesis, and plasma cytokine and macrophage expression patterns, that were largely compatible with classical macrophage activation. Collectively these two phenotypic features of Sgpl1 deficiency culminated in diminished atherogenic response. CONCLUSIONS: Here we not only firmly establish the critical role of hematopoietic S1P lyase in controlling S1P levels and T cell trafficking in blood and lymphoid tissue, but also identify leukocyte Sgpl1 as critical factor in monocyte macrophage differentiation and function. Its, partly counterbalancing, pro- and anti-inflammatory activity spectrum imply that intervention in S1P lyase function in inflammatory disorders such as atherosclerosis should be considered with caution.

  9. Biocatalytic Enantioselective Synthesis of N-Substituted Aspartic Acids by Aspartate Ammonia Lyase

    NARCIS (Netherlands)

    Weiner, Barbara; Poelarends, Gerrit J.; Janssen, Dick B.; Feringa, Ben L.

    2008-01-01

    The gene encoding aspartate ammonia lyase (aspB) from Bacillus sp. YM55-1 has been cloned and overexpressed, and the recombinant enzyme containing a C-terminal His6 tag has been purified to homogeneity and subjected to kinetic characterization. Kinetic studies have shown that the His6 tag does not

  10. Engineering methylaspartate ammonia lyase for the asymmetric synthesis of unnatural amino acids

    NARCIS (Netherlands)

    Raj, Hans; Szymanski, Wiktor; de Villiers, Jandre; Rozeboom, Henriëtte J.; Puthan Veetil, Vinod; Reis, Carlos R.; Villiers, Marianne de; Dekker, Frank J.; Wildeman, Stefaan de; Quax, Wim J.; Thunnissen, Andy-Mark W.H.; Feringa, Ben L.; Janssen, Dick B.; Poelarends, Gerrit J.

    The redesign of enzymes to produce catalysts for a predefined transformation remains a major challenge in protein engineering. Here, we describe the structure-based engineering of methylaspartate ammonia lyase (which in nature catalyses the conversion of 3-methylaspartate to ammonia and

  11. Kinetic Resolution and Stereoselective Synthesis of 3-Substituted Aspartic Acids by Using Engineered Methylaspartate Ammonia Lyases

    NARCIS (Netherlands)

    Raj, Hans; Szymanski, Wiktor; Villiers, Jandré de; Puthan Veetil, Vinod; Quax, Wim J.; Shimamoto, Keiko; Janssen, Dick B.; Feringa, Ben L.; Poelarends, Gerrit J.

    2013-01-01

    Kinetic resolution and asymmetric synthesis of various valuable 3-substituted aspartic acids, which were obtained in fair to good yields with diastereomeric ratio values of up to >98:2 and enantiomeric excess values of up to >99 %, by using engineered methylaspartate ammonia lyases are described.

  12. Characterization of two bacterial hydroxynitrile lyases with high similarity to cupin superfamily proteins

    NARCIS (Netherlands)

    Hussain, Z.; Wiedner, R.; Steiner, K.; Hajek, T.; Avi, M.; Hecher, B.; Sessitsch, A.; Schwab, H.

    2012-01-01

    Hydroxynitrile lyases (HNLs) catalyze the cleavage of cyanohydrins. In the reverse reaction, they catalyze the formation of carbon-carbon bonds by enantioselective condensation of hydrocyanic acid with carbonyls. In this study, we describe two proteins from endophytic bacteria that display activity

  13. Novel Pectate Lyase Genes of Heterodera glycines Play Key Roles in the Early Stage of Parasitism.

    Directory of Open Access Journals (Sweden)

    Huan Peng

    Full Text Available Pectate lyases are known to play a key role in pectin degradation by catalyzing the random cleavage of internal polymer linkages (endo-pectinases. In this paper, four novel cDNAs, designated Hg-pel-3, Hg-pel-4, Hg-pel-6 and Hg-pel-7, that encode pectate lyases were cloned and characterized from the soybean cyst nematode, Heterodera glycines. The predicted protein sequences of HG-PEL-3, HG-PEL-4 and HG-PEL-6 differed significantly in both their amino acid sequences and their genomic structures from other pectate lyases of H. glycines (HG-PEL-1, HG-PEL-2 and HG-PEL-7. A phylogenetic study revealed that the pectate lyase proteins of H. glycines are clustered into distinct clades and have distinct numbers and positioning of introns, which suggests that the pectate lyase genes of H. glycines may have evolved from at least two ancestral genes. A Southern blot analysis revealed that multiple Hg-pel-6-like genes were present in the H. glycines genome. In situ hybridization showed that four novel pectate lyases (Hg-pel-3, Hg-pel-4, Hg-pel-6 and Hg-pel-7 were actively transcribed in the subventral esophageal gland cells. A semi-quantitative RT-PCR assay supported the finding that the expression of these genes was strong in the egg, pre-parasitic second-stage juvenile (J2 and early parasitic J2 stages and that it declined in further developmental stages of the nematode. This expression pattern suggests that these proteins play a role in the migratory phase of the nematode life cycle. Knocking down Hg-pel-6 using in vitro RNA interference resulted in a 46.9% reduction of the number of nematodes that invaded the plants and a 61.5% suppression of the development of H. glycines females within roots compared to the GFP-dsRNA control. Plant host-derived RNAi induced the silencing of the Hg-pel-6gene, which significantly reduced the nematode infection levels at 7 Days post inoculation (dpi. Similarly, this procedure reduced the number of female adults at 40 dpi

  14. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid

    NARCIS (Netherlands)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased

  15. The mangotoxin biosynthetic operon (mbo) is specifically distributed within Pseudomonas syringae genomospecies 1 and was acquired only once during evolution.

    Science.gov (United States)

    Carrión, Víctor J; Gutiérrez-Barranquero, José A; Arrebola, Eva; Bardaji, Leire; Codina, Juan C; de Vicente, Antonio; Cazorla, Francisco M; Murillo, Jesús

    2013-02-01

    Mangotoxin production was first described in Pseudomonas syringae pv. syringae strains. A phenotypic characterization of 94 P. syringae strains was carried out to determine the genetic evolution of the mangotoxin biosynthetic operon (mbo). We designed a PCR primer pair specific for the mbo operon to examine its distribution within the P. syringae complex. These primers amplified a 692-bp DNA fragment from 52 mangotoxin-producing strains and from 7 non-mangotoxin-producing strains that harbor the mbo operon, whereas 35 non-mangotoxin-producing strains did not yield any amplification. This, together with the analysis of draft genomes, allowed the identification of the mbo operon in five pathovars (pathovars aptata, avellanae, japonica, pisi, and syringae), all of which belong to genomospecies 1, suggesting a limited distribution of the mbo genes in the P. syringae complex. Phylogenetic analyses using partial sequences from housekeeping genes differentiated three groups within genomospecies 1. All of the strains containing the mbo operon clustered in groups I and II, whereas those lacking the operon clustered in group III; however, the relative branching order of these three groups is dependent on the genes used to construct the phylogeny. The mbo operon maintains synteny and is inserted in the same genomic location, with high sequence conservation around the insertion point, for all the strains in groups I and II. These data support the idea that the mbo operon was acquired horizontally and only once by the ancestor of groups I and II from genomospecies 1 within the P. syringae complex.

  16. GLYCOGEN IN BACILLUS-SUBTILIS - MOLECULAR CHARACTERIZATION OF AN OPERON ENCODING ENZYMES INVOLVED IN GLYCOGEN BIOSYNTHESIS AND DEGRADATION

    NARCIS (Netherlands)

    KIEL, JAKW; BOELS, JM; BELDMAN, G; VENEMA, G

    Although it has never been reported that Bacillus subtilis is capable of accumulating glycogen, we have isolated a region from the chromosome of B. subtilis containing a glycogen operon. The operon is located directly downstream from trnB, which maps at 275 degrees on the B. subtilis chromosome. It

  17. Crystal structure and characterization of a novel L-serine ammonia-lyase from Rhizomucor miehei

    Energy Technology Data Exchange (ETDEWEB)

    Qin, Zhen [College of Food Science and Nutritional Engineering, Beijing Advanced Innovation Center of Food Nutrition and Human Health, China Agricultural University, Beijing 100083 (China); Yan, Qiaojuan [College of Engineering, China Agricultural University, Beijing 100083 (China); Ma, Qingjun [Key Laboratory of Experimental Marine Biology, Institute of Oceanology, Chinese Academy of Sciences, Qingdao 266071 (China); Jiang, Zhengqiang, E-mail: zhqjiang@cau.edu.cn [College of Food Science and Nutritional Engineering, Beijing Advanced Innovation Center of Food Nutrition and Human Health, China Agricultural University, Beijing 100083 (China)

    2015-10-23

    L-serine ammonia-lyase, as a member of the β-family of pyridoxal-5′-phosphate (PLP) dependent enzymes, catalyzes the conversion of L-serine (L-threonine) to pyruvate (α-ketobutyrate) and ammonia. The crystal structure of L-serine ammonia-lyase from Rhizomucor miehei (RmSDH) was solved at 1.76 Å resolution by X-ray diffraction method. The overall structure of RmSDH had the characteristic β-family PLP dependent enzyme fold. It consisted of two distinct domains, both of which show the typical open twisted α/β structure. A PLP cofactor was located in the crevice between the two domains, which was attached to Lys52 by a Schiff-base linkage. Unique residue substitutions (Gly78, Pro79, Ser146, Ser147 and Thr312) were discovered at the catalytic site of RmSDH by comparison of structures of RmSDH and other reported eukaryotic L-serine ammonia-lyases. Optimal pH and temperature of the purified RmSDH were 7.5 and 40 °C, respectively. It was stable in the pH range of 7.0–9.0 and at temperatures below 40 °C. This is the first crystal structure of a fungal L-serine ammonia-lyase. It will be useful to study the catalytic mechanism of β-elimination enzymes and will provide a basis for further enzyme engineering. - Highlights: • The crystal structure of a fungal L-serine ammonia-lyase (RmSDH) was solved. • Five unique residue substitutions are found at the catalytic site of RmSDH. • RmSDH was expressed in Pichia. pastoris and biochemically characterized. • RmSDH has potential application in splitting D/L-serine.

  18. Characterization of a Novel Alginate Lyase from Marine Bacterium Vibrio furnissii H1

    Directory of Open Access Journals (Sweden)

    Xiaoyan Zhu

    2018-01-01

    Full Text Available Alginate lyases show great potential for industrial and medicinal applications, especially as an attractive biocatalyst for the production of oligosaccharides with special bioactivities. A novel alginate lyase, AlyH1, from the marine bacterium Vibrio furnissii H1, which has been newly isolated from rotten seaweed, was purified and characterized. The purified enzyme showed the specific activity of 2.40 U/mg. Its molecular mass was 35.8 kDa. The optimal temperature and pH were 40 °C and pH 7.5, respectively. AlyH1 maintained stability at neutral pH (7.0–8.0 and temperatures below 30 °C. Metal ions Na+, Mg2+, and K+ increased the activity of the enzyme. With sodium alginate as the substrate, the Km and Vmax values of AlyH1 were 2.28 mg/mL and 2.81 U/mg, respectively. AlyH1 exhibited activities towards both polyguluronate and polymannuronate, and preferentially degraded polyguluronate. Products prepared from sodium alginate by AlyH1 were displayed to be di-, tri-, and tetra-alginate oligosaccharides. A partial amino acid sequence (190 aa of AlyH1 analysis suggested that AlyH1 was an alginate lyase of polysaccharide lyase family 7. The sequence showed less than 77% identity to the reported alginate lyases. These data demonstrated that AlyH1 could be as a novel and potential candidate in application of alginate oligosaccharides production with low polymerization degrees.

  19. Structure-based functional annotation of putative conserved proteins having lyase activity from Haemophilus influenzae.

    Science.gov (United States)

    Shahbaaz, Mohd; Ahmad, Faizan; Imtaiyaz Hassan, Md

    2015-06-01

    Haemophilus influenzae is a small pleomorphic Gram-negative bacteria which causes several chronic diseases, including bacteremia, meningitis, cellulitis, epiglottitis, septic arthritis, pneumonia, and empyema. Here we extensively analyzed the sequenced genome of H. influenzae strain Rd KW20 using protein family databases, protein structure prediction, pathways and genome context methods to assign a precise function to proteins whose functions are unknown. These proteins are termed as hypothetical proteins (HPs), for which no experimental information is available. Function prediction of these proteins would surely be supportive to precisely understand the biochemical pathways and mechanism of pathogenesis of Haemophilus influenzae. During the extensive analysis of H. influenzae genome, we found the presence of eight HPs showing lyase activity. Subsequently, we modeled and analyzed three-dimensional structure of all these HPs to determine their functions more precisely. We found these HPs possess cystathionine-β-synthase, cyclase, carboxymuconolactone decarboxylase, pseudouridine synthase A and C, D-tagatose-1,6-bisphosphate aldolase and aminodeoxychorismate lyase-like features, indicating their corresponding functions in the H. influenzae. Lyases are actively involved in the regulation of biosynthesis of various hormones, metabolic pathways, signal transduction, and DNA repair. Lyases are also considered as a key player for various biological processes. These enzymes are critically essential for the survival and pathogenesis of H. influenzae and, therefore, these enzymes may be considered as a potential target for structure-based rational drug design. Our structure-function relationship analysis will be useful to search and design potential lead molecules based on the structure of these lyases, for drug design and discovery.

  20. Catalytically important amino-acid residues of abalone alginate lyase HdAly assessed by site-directed mutagenesis

    OpenAIRE

    Yamamoto, Sayo; Sahara, Takehiko; Sato, Daisuke; Kawasaki, Kosei; Ohgiya, Satoru; Inoue, Akira; Ojima, Takao

    2008-01-01

    Alginate lyase is an enzyme that degrades alginate chains via β-elimination and has been used for the production of alginate oligosaccharides and protoplasts from brown algae. Previously, we deduced the amino-acid sequence of an abalone alginate lyase, HdAly, from its cDNA sequence and, through multiple amino-acid sequence alignment, found that several basic amino-acid residues were highly conserved among the polysaccharide-lyase family 14 (PL-14) enzymes including HdAly. In the present study...

  1. Measurement of the $C\\!P$ asymmetry in $B^+ \\rightarrow K^+ \\mu^+ \\mu^-$ decays

    CERN Document Server

    Aaij, R.; Adinolfi, M.; Adrover, C.; Affolder, A.; Ajaltouni, Z.; Albrecht, J.; Alessio, F.; Alexander, M.; Ali, S.; Alkhazov, G.; Alvarez Cartelle, P.; Alves Jr, A.A.; Amato, S.; Amerio, S.; Amhis, Y.; Anderlini, L.; Anderson, J.; Andreassen, R.; Andrews, J.E.; Appleby, R.B.; Aquines Gutierrez, O.; Archilli, F.; Artamonov, A.; Artuso, M.; Aslanides, E.; Auriemma, G.; Baalouch, M.; Bachmann, S.; Back, J.J.; Baesso, C.; Balagura, V.; Baldini, W.; Barlow, R.J.; Barschel, C.; Barsuk, S.; Barter, W.; Bauer, Th.; Bay, A.; Beddow, J.; Bedeschi, F.; Bediaga, I.; Belogurov, S.; Belous, K.; Belyaev, I.; Ben-Haim, E.; Bencivenni, G.; Benson, S.; Benton, J.; Berezhnoy, A.; Bernet, R.; Bettler, M.O.; van Beuzekom, M.; Bien, A.; Bifani, S.; Bird, T.; Bizzeti, A.; Bjornstad, P.M.; Blake, T.; Blanc, F.; Blouw, J.; Blusk, S.; Bocci, V.; Bondar, A.; Bondar, N.; Bonivento, W.; Borghi, S.; Borgia, A.; Bowcock, T.J.V.; Bowen, E.; Bozzi, C.; Brambach, T.; van den Brand, J.; Bressieux, J.; Brett, D.; Britsch, M.; Britton, T.; Brook, N.H.; Brown, H.; Burducea, I.; Bursche, A.; Busetto, G.; Buytaert, J.; Cadeddu, S.; Callot, O.; Calvi, M.; Calvo Gomez, M.; Camboni, A.; Campana, P.; Campora Perez, D.; Carbone, A.; Carboni, G.; Cardinale, R.; Cardini, A.; Carranza-Mejia, H.; Carson, L.; Carvalho Akiba, K.; Casse, G.; Garcia, L.Castillo; Cattaneo, M.; Cauet, Ch.; Cenci, R.; Charles, M.; Charpentier, Ph.; Chen, P.; Chiapolini, N.; Chrzaszcz, M.; Ciba, K.; Cid Vidal, X.; Ciezarek, G.; Clarke, P.E.L.; Clemencic, M.; Cliff, H.V.; Closier, J.; Coca, C.; Coco, V.; Cogan, J.; Cogneras, E.; Collins, P.; Comerma-Montells, A.; Contu, A.; Cook, A.; Coombes, M.; Coquereau, S.; Corti, G.; Couturier, B.; Cowan, G.A.; Cowie, E.; Craik, D.C.; Cunliffe, S.; Currie, R.; D'Ambrosio, C.; David, P.; David, P.N.Y.; Davis, A.; De Bonis, I.; De Bruyn, K.; De Capua, S.; De Cian, M.; de Miranda, J.M.; De Paula, L.; De Silva, W.; De Simone, P.; Decamp, D.; Deckenhoff, M.; Del Buono, L.; Deleage, N.; Derkach, D.; Deschamps, O.; Dettori, F.; Di Canto, A.; Dijkstra, H.; Dogaru, M.; Donleavy, S.; Dordei, F.; Dosil Suarez, A.; Dossett, D.; Dovbnya, A.; Dupertuis, F.; Durante, P.; Dzhelyadin, R.; Dziurda, A.; Dzyuba, A.; Easo, S.; Egede, U.; Egorychev, V.; Eidelman, S.; van Eijk, D.; Eisenhardt, S.; Eitschberger, U.; Ekelhof, R.; Eklund, L.; El Rifai, I.; Elsasser, Ch.; Falabella, A.; Farber, C.; Fardell, G.; Farinelli, C.; Farry, S.; Ferguson, D.; Fernandez Albor, V.; Ferreira Rodrigues, F.; Ferro-Luzzi, M.; Filippov, S.; Fiore, M.; Fitzpatrick, C.; Fontana, M.; Fontanelli, F.; Forty, R.; Francisco, O.; Frank, M.; Frei, C.; Frosini, M.; Furcas, S.; Furfaro, E.; Gallas Torreira, A.; Galli, D.; Gandelman, M.; Gandini, P.; Gao, Y.; Garofoli, J.; Garosi, P.; Garra Tico, J.; Garrido, L.; Gaspar, C.; Gauld, R.; Gersabeck, E.; Gersabeck, M.; Gershon, T.; Ghez, Ph.; Gibson, V.; Giubega, L.; Gligorov, V.V.; Gobel, C.; Golubkov, D.; Golutvin, A.; Gomes, A.; Gorbounov, P.; Gordon, H.; Gotti, C.; Grabalosa Gandara, M.; Graciani Diaz, R.; Granado Cardoso, L.A.; Grauges, E.; Graziani, G.; Grecu, A.; Greening, E.; Gregson, S.; Griffith, P.; Grunberg, O.; Gui, B.; Gushchin, E.; Guz, Yu.; Gys, T.; Hadjivasiliou, C.; Haefeli, G.; Haen, C.; Haines, S.C.; Hall, S.; Hamilton, B.; Hampson, T.; Hansmann-Menzemer, S.; Harnew, N.; Harnew, S.T.; Harrison, J.; Hartmann, T.; He, J.; Head, T.; Heijne, V.; Hennessy, K.; Henrard, P.; Hernando Morata, J.A.; van Herwijnen, E.; Hess, M.; Hicheur, A.; Hicks, E.; Hill, D.; Hoballah, M.; Hombach, C.; Hopchev, P.; Hulsbergen, W.; Hunt, P.; Huse, T.; Hussain, N.; Hutchcroft, D.; Hynds, D.; Iakovenko, V.; Idzik, M.; Ilten, P.; Jacobsson, R.; Jaeger, A.; Jans, E.; Jaton, P.; Jawahery, A.; Jing, F.; John, M.; Johnson, D.; Jones, C.R.; Joram, C.; Jost, B.; Kaballo, M.; Kandybei, S.; Kanso, W.; Karacson, M.; Karbach, T.M.; Kenyon, I.R.; Ketel, T.; Keune, A.; Khanji, B.; Kochebina, O.; Komarov, I.; Koopman, R.F.; Koppenburg, P.; Korolev, M.; Kozlinskiy, A.; Kravchuk, L.; Kreplin, K.; Kreps, M.; Krocker, G.; Krokovny, P.; Kruse, F.; Kucharczyk, M.; Kudryavtsev, V.; Kurek, K.; Kvaratskheliya, T.; La Thi, V.N.; Lacarrere, D.; Lafferty, G.; Lai, A.; Lambert, D.; Lambert, R.W.; Lanciotti, E.; Lanfranchi, G.; Langenbruch, C.; Latham, T.; Lazzeroni, C.; Le Gac, R.; van Leerdam, J.; Lees, J.P.; Lefevre, R.; Leflat, A.; Lefrancois, J.; Leo, S.; Leroy, O.; Lesiak, T.; Leverington, B.; Li, Y.; Li Gioi, L.; Liles, M.; Lindner, R.; Linn, C.; Liu, B.; Liu, G.; Lohn, S.; Longstaff, I.; Lopes, J.H.; Lopez-March, N.; Lu, H.; Lucchesi, D.; Luisier, J.; Luo, H.; Machefert, F.; Machikhiliyan, I.V.; Maciuc, F.; Maev, O.; Malde, S.; Manca, G.; Mancinelli, G.; Maratas, J.; Marconi, U.; Marino, P.; Marki, R.; Marks, J.; Martellotti, G.; Martens, A.; Martin Sanchez, A.; Martinelli, M.; Martinez Santos, D.; Martins Tostes, D.; Martynov, A.; Massafferri, A.; Matev, R.; Mathe, Z.; Matteuzzi, C.; Maurice, E.; Mazurov, A.; McCarthy, J.; McNab, A.; McNulty, R.; McSkelly, B.; Meadows, B.; Meier, F.; Meissner, M.; Merk, M.; Milanes, D.A.; Minard, M.N.; Molina Rodriguez, J.; Monteil, S.; Moran, D.; Morawski, P.; Morda, A.; Morello, M.J.; Mountain, R.; Mous, I.; Muheim, F.; Muller, K.; Muresan, R.; Muryn, B.; Muster, B.; Naik, P.; Nakada, T.; Nandakumar, R.; Nasteva, I.; Needham, M.; Neubert, S.; Neufeld, N.; Nguyen, A.D.; Nguyen, T.D.; Nguyen-Mau, C.; Nicol, M.; Niess, V.; Niet, R.; Nikitin, N.; Nikodem, T.; Nomerotski, A.; Novoselov, A.; Oblakowska-Mucha, A.; Obraztsov, V.; Oggero, S.; Ogilvy, S.; Okhrimenko, O.; Oldeman, R.; Orlandea, M.; Otalora Goicochea, J.M.; Owen, P.; Oyanguren, A.; Pal, B.K.; Palano, A.; Palczewski, T.; Palutan, M.; Panman, J.; Papanestis, A.; Pappagallo, M.; Parkes, C.; Parkinson, C.J.; Passaleva, G.; Patel, G.D.; Patel, M.; Patrick, G.N.; Patrignani, C.; Pavel-Nicorescu, C.; Pazos Alvarez, A.; Pellegrino, A.; Penso, G.; Pepe Altarelli, M.; Perazzini, S.; Perez Trigo, E.; Perez-Calero Yzquierdo, A.; Perret, P.; Perrin-Terrin, M.; Pescatore, L.; Pesen, E.; Petridis, K.; Petrolini, A.; Phan, A.; Picatoste Olloqui, E.; Pietrzyk, B.; Pilar, T.; Pinci, D.; Playfer, S.; Plo Casasus, M.; Polci, F.; Polok, G.; Poluektov, A.; Polycarpo, E.; Popov, A.; Popov, D.; Popovici, B.; Potterat, C.; Powell, A.; Prisciandaro, J.; Pritchard, A.; Prouve, C.; Pugatch, V.; Puig Navarro, A.; Punzi, G.; Qian, W.; Rademacker, J.H.; Rakotomiaramanana, B.; Rangel, M.S.; Raniuk, I.; Rauschmayr, N.; Raven, G.; Redford, S.; Reid, M.M.; dos Reis, A.C.; Ricciardi, S.; Richards, A.; Rinnert, K.; Rives Molina, V.; Roa Romero, D.A.; Robbe, P.; Roberts, D.A.; Rodrigues, E.; Rodriguez Perez, P.; Roiser, S.; Romanovsky, V.; Vidal, A.Romero; Rouvinet, J.; Ruf, T.; Ruffini, F.; Ruiz, H.; Valls, P.Ruiz; Sabatino, G.; Saborido Silva, J.J.; Sagidova, N.; Sail, P.; Saitta, B.; Salustino Guimaraes, V.; Sanmartin Sedes, B.; Sannino, M.; Santacesaria, R.; Santamarina Rios, C.; Santovetti, E.; Sapunov, M.; Sarti, A.; Satriano, C.; Satta, A.; Savrie, M.; Savrina, D.; Schaack, P.; Schiller, M.; Schindler, H.; Schlupp, M.; Schmelling, M.; Schmidt, B.; Schneider, O.; Schopper, A.; Schune, M.H.; Schwemmer, R.; Sciascia, B.; Sciubba, A.; Seco, M.; Semennikov, A.; Senderowska, K.; Sepp, I.; Serra, N.; Serrano, J.; Seyfert, P.; Shapkin, M.; Shapoval, I.; Shatalov, P.; Shcheglov, Y.; Shears, T.; Shekhtman, L.; Shevchenko, O.; Shevchenko, V.; Shires, A.; Coutinho, R.Silva; Sirendi, M.; Skidmore, N.; Skwarnicki, T.; Smith, N.A.; Smith, E.; Smith, J.; Smith, M.; Sokoloff, M.D.; Soler, F.J.P.; Soomro, F.; Souza, D.; Souza De Paula, B.; Spaan, B.; Sparkes, A.; Spradlin, P.; Stagni, F.; Stahl, S.; Steinkamp, O.; Stevenson, S.; Stoica, S.; Stone, S.; Storaci, B.; Straticiuc, M.; Straumann, U.; Subbiah, V.K.; Sun, L.; Swientek, S.; Syropoulos, V.; Szczekowski, M.; Szczypka, P.; Szumlak, T.; T'Jampens, S.; Teklishyn, M.; Teodorescu, E.; Teubert, F.; Thomas, C.; Thomas, E.; van Tilburg, J.; Tisserand, V.; Tobin, M.; Tolk, S.; Tonelli, D.; Topp-Joergensen, S.; Torr, N.; Tournefier, E.; Tourneur, S.; Tran, M.T.; Tresch, M.; Tsaregorodtsev, A.; Tsopelas, P.; Tuning, N.; Garcia, M.Ubeda; Ukleja, A.; Urner, D.; Ustyuzhanin, A.; Uwer, U.; Vagnoni, V.; Valenti, G.; Vallier, A.; Van Dijk, M.; Vazquez Gomez, R.; Vazquez Regueiro, P.; Vazquez Sierra, C.; Vecchi, S.; Velthuis, J.J.; Veltri, M.; Veneziano, G.; Vesterinen, M.; Viaud, B.; Vieira, D.; Vilasis-Cardona, X.; Vollhardt, A.; Volyanskyy, D.; Voong, D.; Vorobyev, A.; Vorobyev, V.; Voss, C.; Voss, H.; Waldi, R.; Wallace, C.; Wallace, R.; Wandernoth, S.; Wang, J.; Ward, D.R.; Watson, N.K.; Webber, A.D.; Websdale, D.; Whitehead, M.; Wicht, J.; Wiechczynski, J.; Wiedner, D.; Wiggers, L.; Wilkinson, G.; Williams, M.P.; Williams, M.; Wilson, F.F.; Wimberley, J.; Wishahi, J.; Wislicki, W.; Witek, M.; Wotton, S.A.; Wright, S.; Wu, S.; Wyllie, K.; Xie, Y.; Xing, Z.; Yang, Z.; Young, R.; Yuan, X.; Yushchenko, O.; Zangoli, M.; Zavertyaev, M.; Zhang, F.; Zhang, L.; Zhang, W.C.; Zhang, Y.; Zhelezov, A.; Zhokhov, A.; Zhong, L.; Zvyagin, A.

    2013-01-01

    A measurement of the $C\\!P$ asymmetry in $B^+ \\rightarrow K^+ \\mu^+ \\mu^-$ decays is presented using $pp$ collision data, corresponding to an integrated luminosity of 1.0 fb $^{-1}$, recorded by the LHCb experiment during 2011 at a centre-of-mass energy of 7 TeV. The measurement is performed in seven bins of $\\mu^+ \\mu^-$ invariant mass squared in the range 0.05 < $q^{2}$ < 22.00 GeV$^{2}/c^4$, excluding the ${J\\mskip -3mu/\\mskip -2mu \\psi\\mskip 2mu}$ and $\\psi{(2S)}$ resonance regions. Production and detection asymmetries are corrected for using the $B^+ \\rightarrow J\\mskip -3mu/\\mskip -2mu \\psi\\mskip 2mu K^+$ decay as a control mode. Averaged over all the bins, the $C\\!P$ asymmetry is found to be ${{\\cal A}_{C\\!P} = 0.000\\pm 0.033\\mbox{ (stat.)} \\pm0.005 \\mbox{ (syst.)} \\pm 0.007\\mbox{ }(J\\mskip -3mu/\\mskip -2mu \\psi\\mskip 2mu K^+)}$, where the third uncertainty is due to the $C\\!P$ asymmetry of the control mode. This is consistent with the Standard Model prediction.

  2. The clinical value of detecting INS and C - P in essential hypertension

    International Nuclear Information System (INIS)

    Huang Jianmin; Sun Shuqiang; Liu Xiaomei

    2001-01-01

    In order to explore the clinical value of insulin (INS) and C - peptide (C-P) in essential hypertension patients (EH), concentrations of blood glucose, serum INS and serum C - P both during fasting and 2 - hour postprandial time were measured in 32 non-diabetic patients with EH and 40 healthy persons, and the ISI of each group was calculated and compared. The results showed that with the exception of fasting blood glucose level being of no difference between two groups, all the other parameters observed, including concentrations of 2 hour postprandial glucose, both fasting and 2 hour postprandial INS and C - P were significantly higher than those of healthy control group (P < 0.01). The proportions of patients with insulin resistance and hyperinsulinemia in EH group were both significantly higher than those of control group (P < 0.01). These results suggest that EH patients may coexist with some metabolic disorders at the same time, thus INS and C - P detection may have other wider applications in non-diabetic diseases

  3. Religious development : C.P. Tiele's paradigm of science of religion

    NARCIS (Netherlands)

    Molendijk, Arie

    2004-01-01

    This essay explores C.P. Tiele's fundamental notion of religious development and, in a certain respect, it complements my earlier paper on his concept of religion, which he ultimately locates "in the innermost depths of our souls" (Numen 46 [1999]). The present article argues that the mere

  4. C. P. Snow's "The Two Cultures": Michael Polanyi's Response and Context

    Science.gov (United States)

    Jacobs, Struan

    2011-01-01

    C. P. Snow's "The Two Cultures" controversially contrasted science and literature, suggesting that neither scientists nor literary intellectuals have much in common with, and seldom bother speaking to, the other. Responding to Snow, Michael Polanyi argued that specialization has made modern culture, not twofold but manifold. In his major work,…

  5. Selective amplification and sequencing of cyclic phosphate-containing RNAs by the cP-RNA-seq method.

    Science.gov (United States)

    Honda, Shozo; Morichika, Keisuke; Kirino, Yohei

    2016-03-01

    RNA digestions catalyzed by many ribonucleases generate RNA fragments that contain a 2',3'-cyclic phosphate (cP) at their 3' termini. However, standard RNA-seq methods are unable to accurately capture cP-containing RNAs because the cP inhibits the adapter ligation reaction. We recently developed a method named cP-RNA-seq that is able to selectively amplify and sequence cP-containing RNAs. Here we describe the cP-RNA-seq protocol in which the 3' termini of all RNAs, except those containing a cP, are cleaved through a periodate treatment after phosphatase treatment; hence, subsequent adapter ligation and cDNA amplification steps are exclusively applied to cP-containing RNAs. cP-RNA-seq takes ∼6 d, excluding the time required for sequencing and bioinformatics analyses, which are not covered in detail in this protocol. Biochemical validation of the existence of cP in the identified RNAs takes ∼3 d. Even though the cP-RNA-seq method was developed to identify angiogenin-generating 5'-tRNA halves as a proof of principle, the method should be applicable to global identification of cP-containing RNA repertoires in various transcriptomes.

  6. msaABCR operon positively regulates biofilm development by repressing proteases and autolysis in Staphylococcus aureus.

    Science.gov (United States)

    Sahukhal, Gyan S; Batte, Justin L; Elasri, Mohamed O

    2015-02-01

    Staphylococcus aureus is an important human pathogen that causes nosocomial and community-acquired infections. One of the most important aspects of staphylococcal infections is biofilm development within the host, which renders the bacterium resistant to the host's immune response and antimicrobial agents. Biofilm development is very complex and involves several regulators that ensure cell survival on surfaces within the extracellular polymeric matrix. Previously, we identified the msaABCR operon as an additional positive regulator of biofilm formation. In this study, we define the regulatory pathway by which msaABCR controls biofilm formation. We demonstrate that the msaABCR operon is a negative regulator of proteases. The control of protease production mediates the processing of the major autolysin, Atl, and thus regulates the rate of autolysis. In the absence of the msaABCR operon, Atl is processed by proteases at a high rate, leading to increased cell death and a defect in biofilm maturation. We conclude that the msaABCR operon plays a key role in maintaining the balance between autolysis and growth within the staphylococcal biofilm. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Characterization of the Leptospira interrogans S10-spc-alpha operon

    NARCIS (Netherlands)

    Zuerner, R. L.; Hartskeerl, R. A.; van de Kemp, H.; Bal, A. E.

    2000-01-01

    A ribosomal protein gene cluster from the spirochaete Leptospira interrogans was characterized. This locus is homologous to the Escherichia coli S10, spc, and alpha operons. Analysis of L. interrogans RNA showed that the ribosomal protein genes within this cluster are co-transcribed, thus forming an

  8. Klebsiella pneumoniae yfiRNB operon affects biofilm formation, polysaccharide production and drug susceptibility.

    Science.gov (United States)

    Huertas, Mónica G; Zárate, Lina; Acosta, Iván C; Posada, Leonardo; Cruz, Diana P; Lozano, Marcela; Zambrano, María M

    2014-12-01

    Klebsiella pneumoniae is an opportunistic pathogen important in hospital-acquired infections, which are complicated by the rise of drug-resistant strains and the capacity of cells to adhere to surfaces and form biofilms. In this work, we carried out an analysis of the genes in the K. pneumoniae yfiRNB operon, previously implicated in biofilm formation. The results indicated that in addition to the previously reported effect on type 3 fimbriae expression, this operon also affected biofilm formation due to changes in cellulose as part of the extracellular matrix. Deletion of yfiR resulted in enhanced biofilm formation and an altered colony phenotype indicative of cellulose overproduction when grown on solid indicator media. Extraction of polysaccharides and treatment with cellulase were consistent with the presence of cellulose in biofilms. The enhanced cellulose production did not, however, correlate with virulence as assessed using a Caenorhabditis elegans assay. In addition, cells bearing mutations in genes of the yfiRNB operon varied with respect to the WT control in terms of susceptibility to the antibiotics amikacin, ciprofloxacin, imipenem and meropenem. These results indicated that the yfiRNB operon is implicated in the production of exopolysaccharides that alter cell surface characteristics and the capacity to form biofilms--a phenotype that does not necessarily correlate with properties related with survival, such as resistance to antibiotics. © 2014 The Authors.

  9. The ntp operon encoding the Na+V-ATPase of the thermophile Caloramator fervidus

    NARCIS (Netherlands)

    Ubbink-Kok, Trees; Nijland, Jeroen; Slotboom, Dirk-Jan; Lolkema, Juke S.

    2006-01-01

    The V-type ATPase of the thermophile Caloramator fervidus is an ATP-driven Na+ pump. The nucleotide sequence of the ntpFIKECGABD operon containing the structural genes coding for the nine subunits of the enzyme complex was determined. The identity of the proteins in two pairs of subunits (D, E and

  10. clpC operon regulates cell architecture and sporulation in Bacillus anthracis.

    Science.gov (United States)

    Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra

    2015-03-01

    The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen. © 2014 Society for Applied Microbiology and John Wiley & Sons Ltd.

  11. Analysis of catRABC operon for catechol degradation from phenol-degrading Rhodococcus erythropolis

    Czech Academy of Sciences Publication Activity Database

    Veselý, Martin; Knoppová, Monika; Nešvera, Jan; Pátek, Miroslav

    2007-01-01

    Roč. 76, - (2007), s. 159-168 ISSN 0175-7598 R&D Projects: GA ČR GA526/04/0542 Institutional research plan: CEZ:AV0Z50200510 Keywords : rhodococcus erythropolis * catrabc operon * catechol degradation Subject RIV: EE - Microbiology, Virology Impact factor: 2.475, year: 2007

  12. Decreases in average bacterial community rRNA operon copy number during succession.

    Science.gov (United States)

    Nemergut, Diana R; Knelman, Joseph E; Ferrenberg, Scott; Bilinski, Teresa; Melbourne, Brett; Jiang, Lin; Violle, Cyrille; Darcy, John L; Prest, Tiffany; Schmidt, Steven K; Townsend, Alan R

    2016-05-01

    Trait-based studies can help clarify the mechanisms driving patterns of microbial community assembly and coexistence. Here, we use a trait-based approach to explore the importance of rRNA operon copy number in microbial succession, building on prior evidence that organisms with higher copy numbers respond more rapidly to nutrient inputs. We set flasks of heterotrophic media into the environment and examined bacterial community assembly at seven time points. Communities were arrayed along a geographic gradient to introduce stochasticity via dispersal processes and were analyzed using 16 S rRNA gene pyrosequencing, and rRNA operon copy number was modeled using ancestral trait reconstruction. We found that taxonomic composition was similar between communities at the beginning of the experiment and then diverged through time; as well, phylogenetic clustering within communities decreased over time. The average rRNA operon copy number decreased over the experiment, and variance in rRNA operon copy number was lowest both early and late in succession. We then analyzed bacterial community data from other soil and sediment primary and secondary successional sequences from three markedly different ecosystem types. Our results demonstrate that decreases in average copy number are a consistent feature of communities across various drivers of ecological succession. Importantly, our work supports the scaling of the copy number trait over multiple levels of biological organization, ranging from cells to populations and communities, with implications for both microbial ecology and evolution.

  13. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, Markéta; Zima, Jan; Štenclová, L.; Hauer, Tomáš

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 R&D Projects: GA ČR(CZ) GA15-11912S Institutional support: RVO:67985939 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Plant sciences, botany Impact factor: 2.806, year: 2016

  14. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria)

    Czech Academy of Sciences Publication Activity Database

    Johansen, J. R.; Mareš, Jan; Pietrasiak, N.; Bohunická, M.; Zima Jr., J.; Štenclová, Lenka; Hauer, T.

    2017-01-01

    Roč. 12, č. 10 (2017), č. článku e0186393. E-ISSN 1932-6203 Institutional support: RVO:60077344 Keywords : rRNA operon * heterogenita * Scytonema hyalinum Subject RIV: EF - Botanics OBOR OECD: Microbiology Impact factor: 2.806, year: 2016

  15. Unity in organisation and regulation of catabolic operons in Lactobacillus plantarum, Lactococcus lactis and Listeria monocytogenes

    NARCIS (Netherlands)

    Andersson, U.; Molenaar, D.; Radstrom, P.; Vos, de W.M.

    2005-01-01

    Global regulatory circuits together with more specific local regulators play a notable role when cells are adapting to environmental changes. Lactococcus lactis is a lactic acid bacterium abundant in nature fermenting most mono- and disaccharides. Comparative genomics analysis of the operons

  16. [Construction and high-density fermentation of alkaline pectate lyase high-yield yeast].

    Science.gov (United States)

    Wang, Xiaowen; Xiang, La; Xu, Ting; Lu, Zhenghui; Zhang, Guimin

    2017-12-25

    Pectate lyase is widely applied in ramie degumming and fabric bioscouring in the textile industry. Compared to conventional processes that involve high alkaline and high temperature treatment, enzyme based treatments have significant advantages in fibers protectiveness, improved efficiency of refining, reduced energy consumption and pollution. Hence, it would be highly desirable to construct high-yield alkaline pectate lyase engineered strains and reduce the pectate lyase production cost. In the previous study, pectate lyase gene pel from Bacillus subtilis168 was expressed in Pichia pastoris GS115 after codon usage optimization based on the vector pHBM905A. To improve the expression level, the vector pHBM905BDM with optimized promoter and signal peptide was used to express the optimized gene pels in GS115. The transformant had increased activity from 68 U/mL to 100 U/mL with the improvement in the transcription level by 27% measured by qPCR. The transformants were further screened on pectin plates, where higher halo forming strains were picked for shake-flask fermentation and strain GS115-pHBM905BDM-pels4 showed the highest activity of 536 U/mL. Then plasmid pPIC9K-pels was constructed and electroporated into the GS115-pHBM905BDM-pels4 cells. Subsequently, high-copy transformant was screened by using the medium containing antibiotics G418, strain GS115-pHBM905BDMpPIC9K- pels1 was identified with increased activity of 770 U/mL and the copy number of pels was 7 confirmed by qPCR. Finally, the activity of pectate lyase produced by GS115-pHBM905BDM-pPIC9K-pels1reached to 2 271 U/mL in a 5-L fermentor. The activity of pectate lyase in our study reached the highest level of expression in P. pastoris, showing good application potential in the textile industry.

  17. Expression profile of mce4 operon of Mycobacterium tuberculosis following environmental stress.

    Science.gov (United States)

    Rathor, Nisha; Garima, Kushal; Sharma, Naresh Kumar; Narang, Anshika; Varma-Basil, Mandira; Bose, Mridula

    2016-09-01

    The mce4 operon is one of the four mce operons with eight genes (yrbE4A, yrbE4B, mce4A, mce4B, mce4C, mce4D, mce4E and mce4F) of Mycobacterium tuberculosis. It expresses in the later phase of infection and imports cholesterol for long term survival of the bacilli. To cause latent infection, M. tuberculosis undergoes metabolic reprogramming of its genes to survive in the hostile environment like low availability of oxygen and nutrition depletion inside the host. To analyze real time expression profile of mce4 operon under various stress conditions. M. tuberculosis H37Rv was exposed to surface stress (0.1% SDS for 30min and 90min in late log and stationary phase of culture), hypoxia (5, 10, 15 and 20days) and grown in the presence of either glycerol or cholesterol as sole source of carbon. The expression profile of genes of mce4 operon was analyzed by real time PCR. Surface stress induced expression of mce4C and yrbE4B in late log phase on 30min and 90min exposure respectively. The SDS exposure for 30min induced mce4C, mce4D and mce4F in stationary phase. All eight genes were induced significantly on 10th and 15th days of hypoxia and in the presence of cholesterol. Hypoxia and cholesterol are potent factors for the expression of mce4 operon of M. tuberculosis. Copyright © 2016. Published by Elsevier Ltd.

  18. Stationary phase expression of the arginine biosynthetic operon argCBH in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Sun Yuan

    2006-02-01

    Full Text Available Abstract Background Arginine biosynthesis in Escherichia coli is elevated in response to nutrient limitation, stress or arginine restriction. Though control of the pathway in response to arginine limitation is largely modulated by the ArgR repressor, other factors may be involved in increased stationary phase and stress expression. Results In this study, we report that expression of the argCBH operon is induced in stationary phase cultures and is reduced in strains possessing a mutation in rpoS, which encodes an alternative sigma factor. Using strains carrying defined argR, and rpoS mutations, we evaluated the relative contributions of these two regulators to the expression of argH using operon-lacZ fusions. While ArgR was the main factor responsible for modulating expression of argCBH, RpoS was also required for full expression of this biosynthetic operon at low arginine concentrations (below 60 μM L-arginine, a level at which growth of an arginine auxotroph was limited by arginine. When the argCBH operon was fully de-repressed (arginine limited, levels of expression were only one third of those observed in ΔargR mutants, indicating that the argCBH operon is partially repressed by ArgR even in the absence of arginine. In addition, argCBH expression was 30-fold higher in ΔargR mutants relative to levels found in wild type, fully-repressed strains, and this expression was independent of RpoS. Conclusion The results of this study indicate that both derepression and positive control by RpoS are required for full control of arginine biosynthesis in stationary phase cultures of E. coli.

  19. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  20. Crystallization and preliminary X-ray analysis of βC–S lyases from two oral streptococci

    International Nuclear Information System (INIS)

    Kezuka, Yuichiro; Yoshida, Yasuo; Nonaka, Takamasa

    2009-01-01

    The βC-S lyases from two oral bacteria, Streptococcus anginosus and S. gordonii, were cloned, overproduced, purified and crystallized. The obtained crystals were characterized by X-ray diffraction. Hydrogen sulfide, which causes oral malodour, is generally produced from l-cysteine by the action of βC–S lyase from oral bacteria. The βC–S lyases from two oral bacteria, Streptococcus anginosus and S. gordonii, have been cloned, overproduced, purified and crystallized. X-ray diffraction data were collected from the two types of crystals using synchrotron radiation. The crystal of S. anginosus βC–S lyase belonged to the orthorhombic space group P2 1 2 1 2 1 , with unit-cell parameters a = 67.0, b = 111.1, c = 216.4 Å, and the crystal of S. gordonii βC–S lyase belonged to the same space group, with unit-cell parameters a = 58.0, b = 73.9. c = 187.6 Å. The structures of the βC–S lyases were solved by molecular-replacement techniques

  1. New lupane triterpenoids from Solidago canadensis that inhibit the lyase activity of DNA polymerase beta.

    Science.gov (United States)

    Chaturvedula, V S Prakash; Zhou, Bing-Nan; Gao, Zhijie; Thomas, Shannon J; Hecht, Sidney M; Kingston, David G I

    2004-12-01

    Bioassay-directed fractionation of a methyl ethyl ketone extract of Solidago canadensis L. (Asteraceae), using an assay to detect the lyase activity of DNA polymerase beta, resulted in the isolation of the four new lupane triterpenoids 1-4 and the seven known compounds lupeol, lupeyl acetate, ursolic acid, cycloartenol, cycloartenyl palmitate, alpha-amyrin acetate, and stigmasterol. The structures of the new compounds were established as 3beta-(3R-acetoxyhexadecanoyloxy)-lup-20(29)-ene (1), 3beta-(3-ketohexadecanoyloxy)-lup-20(29)-ene (2), 3beta-(3R-acetoxyhexadecanoyloxy)-29-nor-lupan-20-one (3), and 3beta-(3-hetohexadecanoyloxy)-29-nor-lupan-20-one (4), respectively, on the basis of extensive 1D and 2D NMR spectroscopic interpretation and chemical modification studies. All 11 compounds were inhibitory to the lyase activity of DNA polymerase beta.

  2. Mechanism of Cytochrome P450 17A1-Catalyzed Hydroxylase and Lyase Reactions

    DEFF Research Database (Denmark)

    Bonomo, Silvia; Jorgensen, Flemming Steen; Olsen, Lars

    2017-01-01

    Cytochrome P450 17A1 (CYP17A1) catalyzes C17 hydroxylation of pregnenolone and progesterone and the subsequent C17–C20 bond cleavage (lyase reaction) to form androgen precursors. Compound I (Cpd I) and peroxo anion (POA) are the heme-reactive species underlying the two reactions. We have characte...... the concept that the selectivity of the steroidogenic CYPs is ruled by direct interactions with the enzyme, in contrast to the selectivity of drug-metabolizing CYPs, where the reactivity of the substrates dominates....... characterized the reaction path for both the hydroxylase and lyase reactions using density functional theory (DFT) calculations and the enzyme–substrate interactions by molecular dynamics (MD) simulations. Activation barriers for positions subject to hydroxylase reaction have values close to each other and span...

  3. Crystallization and preliminary X-ray analysis of argininosuccinate lyase from Streptococcus mutans

    International Nuclear Information System (INIS)

    Cao, Yan-Li; Li, Gui-Lan; Wang, Kai-Tuo; Zhang, Hong-Yin; Li, Lan-Fen

    2011-01-01

    Crystals of argininosuccinate lyase from S. mutans were obtained and X-ray data were collected to 2.5 Å resolution in space group R3. Argininosuccinate lyase (ASL) is an important enzyme in arginine synthesis and the urea cycle, which are highly conserved from bacteria to eukaryotes. The gene encoding Streptococcus mutans ASL (smASL) was amplified and cloned into expression vector pET28a. The recombinant smASL protein was expressed in a soluble form in Escherichia coli strain BL21 (DE3) and purified to homogeneity by two-step column chromatography. Crystals suitable for X-ray analysis were obtained and X-ray diffraction data were collected to a resolution of 2.5 Å. The crystals belonged to space group R3, with unit-cell parameters a = b = 254.5, c = 78.3 Å

  4. Predictions for the Dirac C P -violating phase from sum rules

    Science.gov (United States)

    Delgadillo, Luis A.; Everett, Lisa L.; Ramos, Raymundo; Stuart, Alexander J.

    2018-05-01

    We explore the implications of recent results relating the Dirac C P -violating phase to predicted and measured leptonic mixing angles within a standard set of theoretical scenarios in which charged lepton corrections are responsible for generating a nonzero value of the reactor mixing angle. We employ a full set of leptonic sum rules as required by the unitarity of the lepton mixing matrix, which can be reduced to predictions for the observable mixing angles and the Dirac C P -violating phase in terms of model parameters. These sum rules are investigated within a given set of theoretical scenarios for the neutrino sector diagonalization matrix for several known classes of charged lepton corrections. The results provide explicit maps of the allowed model parameter space within each given scenario and assumed form of charged lepton perturbations.

  5. Measurement of the $C\\!P$ asymmetry in $B^0 \\to K^{*0} \\mu^+ \\mu^-$ decays

    CERN Document Server

    Aaij, R; Adametz, A; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amhis, Y; Anderlini, L; Anderson, J; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bates, A; Bauer, Th; Bay, A; Beddow, J; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blanks, C; Blouw, J; Blusk, S; Bobrov, A; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Büchler-Germann, A; Burducea, I; Bursche, A; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Cauet, Ch; Charles, M; Charpentier, Ph; Chen, P; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Corti, G; Couturier, B; Cowan, G A; Craik, D; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Simone, P; Decamp, D; Deckenhoff, M; Degaudenzi, H; Del Buono, L; Deplano, C; Derkach, D; Deschamps, O; Dettori, F; Dickens, J; Dijkstra, H; Diniz Batista, P; Domingo Bonal, F; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisele, F; Eisenhardt, S; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Elsby, D; Esperante Pereira, D; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garnier, J-C; Garofoli, J; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Harrison, P F; Hartmann, T; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Hill, D; Hoballah, M; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Huston, R S; Hutchcroft, D; Hynds, D; Iakovenko, V; Ilten, P; Imong, J; Jacobsson, R; Jaeger, A; Jahjah Hussein, M; Jans, E; Jansen, F; Jaton, P; Jean-Marie, B; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kaballo, M; Kandybei, S; Karacson, M; Karbach, M; Keaveney, J; Kenyon, I R; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kim, Y M; Kochebina, O; Komarov, I; Komarov, V; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leroy, O; Lesiak, T; Li, L; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; von Loeben, J; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Lu, H; Luisier, J; Mac Raighne, A; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Magnin, J; Maino, M; Malde, S; Manca, G; Mancinelli, G; Mangiafave, N; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Massafferri, A; Mathe, Z; Matteuzzi, C; Matveev, M; Maurice, E; Mazurov, A; McCarthy, J; McGregor, G; McNulty, R; Meissner, M; Merk, M; Merkel, J; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Mylroie-Smith, J; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neufeld, N; Nguyen, A D; Nguyen-Mau, C; Nicol, M; Niess, V; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Pal, B K; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pie Valls, B; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodriguez Perez, P; Rogers, G J; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruiz, H; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sanmartin Sedes, B; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santinelli, R; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schleich, S; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skwarnicki, T; Smith, N A; Smith, E; Smith, M; Sobczak, K; Soler, F J P; Solomin, A; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Swientek, S; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tsaregorodtsev, A; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urner, D; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Videau, I; Vieira, D; Vilasis-Cardona, X; Visniakov, J; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voss, H; Voß, C; Waldi, R; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Witzeling, W; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhong, L; Zvyagin, A

    2013-01-01

    A measurement of the $C\\!P$ asymmetry in $B^0 \\rightarrow K^{*0} \\mu^+ \\mu^-$ decays is presented, based on 1.0$\\mbox{\\,fb}^{-1}$ of $pp$ collision data recorded by the LHCb experiment during 2011. The measurement is performed in six bins of invariant mass squared of the $\\mu^+\\mu^-$ pair, excluding the $\\mathrm{J}\\mskip -3mu/\\mskip -2mu\\psi\\mskip 2mu$ and $\\psi(2S)$ resonance regions. Production and detection asymmetries are removed using the $B^0 \\rightarrow \\mathrm{J}\\mskip -3mu/\\mskip -2mu\\psi\\mskip 2mu K^{*0}$ decay as a control mode. The integrated $C\\!P$ asymmetry is found to be $-0.072 \\pm 0.040 \\,(\\mbox{stat.}) \\pm 0.005 \\,(\\mbox{syst.})$, consistent with the Standard Model.

  6. Measurement of $C\\!P$ violation in $B^{0}\\to D^{\\mp}\\pi^{\\pm}$ decays

    CERN Document Server

    Aaij, Roel; LHCb Collaboration; Adinolfi, Marco; Ajaltouni, Ziad; Akar, Simon; Albicocco, Pietro; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Alfonso Albero, Alejandro; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Archilli, Flavio; d'Argent, Philippe; Arnau Romeu, Joan; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Atzeni, Michele; Auriemma, Giulio; Bachmann, Sebastian; Back, John; Baker, Sophie; Balagura, Vladislav; Baldini, Wander; Baranov, Alexander; Barlow, Roger; Barsuk, Sergey; Barter, William; Baryshnikov, Fedor; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Beiter, Andrew; Bel, Lennaert; Beliy, Nikita; Bellee, Violaine; Belloli, Nicoletta; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Beranek, Sarah; Berezhnoy, Alexander; Bernet, Roland; Berninghoff, Daniel; Bertholet, Emilie; Bertolin, Alessandro; Betancourt, Christopher; Betti, Federico; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bezshyiko, Iaroslava; Bifani, Simone; Billoir, Pierre; Birnkraut, Alex; Bizzeti, Andrea; Bjørn, Mikkel; Blake, Thomas; Blanc, Frederic; Blusk, Steven; Bocci, Valerio; Boente Garcia, Oscar; Boettcher, Thomas; Bondar, Alexander; Bondar, Nikolay; Borghi, Silvia; Borisyak, Maxim; Borsato, Martino; Bossu, Francesco; Boubdir, Meriem; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Brodski, Michael; Brodzicka, Jolanta; Brundu, Davide; Buchanan, Emma; Burr, Christopher; Bursche, Albert; Buytaert, Jan; Byczynski, Wiktor; Cadeddu, Sandro; Cai, Hao; Calabrese, Roberto; Calladine, Ryan; Calvi, Marta; Calvo Gomez, Miriam; Camboni, Alessandro; Campana, Pierluigi; Campora Perez, Daniel Hugo; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Cattaneo, Marco; Cavallero, Giovanni; Cenci, Riccardo; Chamont, David; Chapman, Matthew George; Charles, Matthew; Charpentier, Philippe; Chatzikonstantinidis, Georgios; Chefdeville, Maximilien; Chen, Shanzhen; Chitic, Stefan-Gabriel; Chobanova, Veronika; Chrzaszcz, Marcin; Chubykin, Alexsei; Ciambrone, Paolo; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collins, Paula; Colombo, Tommaso; Comerma-Montells, Albert; Contu, Andrea; Coombs, George; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Costa Sobral, Cayo Mar; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Currie, Robert; D'Ambrosio, Carmelo; Da Cunha Marinho, Franciole; Da Silva, Cesar Luiz; Dall'Occo, Elena; Dalseno, Jeremy; Danilina, Anna; Davis, Adam; De Aguiar Francisco, Oscar; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Serio, Marilisa; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Del Buono, Luigi; Delaney, Blaise; Dembinski, Hans Peter; Demmer, Moritz; Dendek, Adam; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Di Nezza, Pasquale; Didenko, Sergey; Dijkstra, Hans; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Douglas, Lauren; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Durante, Paolo; Durham, John Matthew; Dutta, Deepanwita; Dzhelyadin, Rustem; Dziewiecki, Michal; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; Ely, Scott; Ene, Alexandru; Escher, Stephan; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Farley, Nathanael; Farry, Stephen; Fazzini, Davide; Federici, Luca; Fernandez, Gerard; Fernandez Declara, Placido; Fernandez Prieto, Antonio; Ferrari, Fabio; Ferreira Lopes, Lino; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fini, Rosa Anna; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fleuret, Frederic; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Franco Lima, Vinicius; Frank, Markus; Frei, Christoph; Fu, Jinlin; Funk, Wolfgang; Färber, Christian; Gabriel, Emmy; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; Garcia Martin, Luis Miguel; Garcia Plana, Beatriz; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Gascon, David; Gaspar, Clara; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gizdov, Konstantin; Gligorov, Vladimir; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gorelov, Igor Vladimirovich; Gotti, Claudio; Govorkova, Ekaterina; Grabowski, Jascha Peter; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Greim, Roman; Griffith, Peter; Grillo, Lucia; Gruber, Lukas; Gruberg Cazon, Barak Raimond; Grünberg, Oliver; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Göbel, Carla; Hadavizadeh, Thomas; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hamilton, Brian; Han, Xiaoxue; Hancock, Thomas Henry; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Hasse, Christoph; Hatch, Mark; He, Jibo; Hecker, Malte; Heinicke, Kevin; Heister, Arno; Hennessy, Karol; Henry, Louis; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hopchev, Plamen Hristov; Hu, Wenhua; Huang, Wenqian; Huard, Zachary; Hulsbergen, Wouter; Humair, Thibaud; Hushchyn, Mikhail; Hutchcroft, David; Ibis, Philipp; Idzik, Marek; Ilten, Philip; Ivshin, Kuzma; Jacobsson, Richard; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jiang, Feng; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Karacson, Matthias; Kariuki, James Mwangi; Karodia, Sarah; Kazeev, Nikita; Kecke, Matthieu; Keizer, Floris; Kelsey, Matthew; Kenzie, Matthew; Ketel, Tjeerd; Khairullin, Egor; Khanji, Basem; Khurewathanakul, Chitsanu; Kim, Kyung Eun; Kirn, Thomas; Klaver, Suzanne; Klimaszewski, Konrad; Klimkovich, Tatsiana; Koliiev, Serhii; Kolpin, Michael; Kopecna, Renata; Koppenburg, Patrick; Kotriakhova, Sofia; Kozeiha, Mohamad; Kravchuk, Leonid; Kreps, Michal; Kress, Felix Johannes; Krokovny, Pavel; Krupa, Wojciech; Krzemien, Wojciech; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kvaratskheliya, Tengiz; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lanfranchi, Gaia; Langenbruch, Christoph; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; Leflat, Alexander; Lefrançois, Jacques; Lefèvre, Regis; Lemaitre, Florian; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Pei-Rong; Li, Tenglin; Li, Zhuoming; Liang, Xixin; Likhomanenko, Tatiana; Lindner, Rolf; Lionetto, Federica; Lisovskyi, Vitalii; Liu, Xuesong; Loh, David; Loi, Angelo; Longstaff, Iain; Lopes, Jose; Lucchesi, Donatella; Lucio Martinez, Miriam; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Lusiani, Alberto; Lyu, Xiao-Rui; Machefert, Frederic; Maciuc, Florin; Macko, Vladimir; Mackowiak, Patrick; Maddrell-Mander, Samuel; Maev, Oleg; Maguire, Kevin; Maisuzenko, Dmitrii; Majewski, Maciej Witold; Malde, Sneha; Malecki, Bartosz; Malinin, Alexander; Maltsev, Timofei; Manca, Giulia; Mancinelli, Giampiero; Marangotto, Daniele; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marinangeli, Matthieu; Marino, Pietro; Marks, Jörg; Martellotti, Giuseppe; Martin, Morgan; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Massafferri, André; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Mauri, Andrea; Maurice, Emilie; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McNab, Andrew; McNulty, Ronan; Mead, James Vincent; Meadows, Brian; Meaux, Cedric; Meier, Frank; Meinert, Nis; Melnychuk, Dmytro; Merk, Marcel; Merli, Andrea; Michielin, Emanuele; Milanes, Diego Alejandro; Millard, Edward James; Minard, Marie-Noelle; Minzoni, Luca; Mitzel, Dominik Stefan; Mogini, Andrea; Molina Rodriguez, Josue; Mombächer, Titus; Monroy, Igancio Alberto; Monteil, Stephane; Morandin, Mauro; Morello, Gianfranco; Morello, Michael Joseph; Morgunova, Olga; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Mulder, Mick; Müller, Dominik; Müller, Janine; Müller, Katharina; Müller, Vanessa; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nandi, Anita; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Thi Dung; Nguyen-Mau, Chung; Nieswand, Simon; Niet, Ramon; Nikitin, Nikolay; Nogay, Alla; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Oldeman, Rudolf; Onderwater, Gerco; Ossowska, Anna; Otalora Goicochea, Juan Martin; Owen, Patrick; Oyanguren, Maria Aranzazu; Pais, Preema Rennee; Palano, Antimo; Palutan, Matteo; Panshin, Gennady; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parker, William; Parkes, Christopher; Passaleva, Giovanni; Pastore, Alessandra; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Pereima, Dmitrii; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petrov, Aleksandr; Petruzzo, Marco; Pietrzyk, Boleslaw; Pietrzyk, Guillaume; Pikies, Malgorzata; Pinci, Davide; Pisani, Flavio; Pistone, Alessandro; Piucci, Alessio; Placinta, Vlad-Mihai; Playfer, Stephen; Plo Casasus, Maximo; Polci, Francesco; Poli Lener, Marco; Poluektov, Anton; Polukhina, Natalia; Polyakov, Ivan; Polycarpo, Erica; Pomery, Gabriela Johanna; Ponce, Sebastien; Popov, Alexander; Popov, Dmitry; Poslavskii, Stanislav; Potterat, Cédric; Price, Eugenia; Prisciandaro, Jessica; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Pullen, Hannah Louise; Punzi, Giovanni; Qian, Wenbin; Qin, Jia-Jia; Quagliani, Renato; Quintana, Boris; Rachwal, Bartlomiej; Rademacker, Jonas; Rama, Matteo; Ramos Pernas, Miguel; Rangel, Murilo; Ratnikov, Fedor; Raven, Gerhard; Ravonel Salzgeber, Melody; Reboud, Meril; Redi, Federico; Reichert, Stefanie; dos Reis, Alberto; Remon Alepuz, Clara; Renaudin, Victor; Ricciardi, Stefania; Richards, Sophie; Rinnert, Kurt; Robbe, Patrick; Robert, Arnaud; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rogozhnikov, Alexey; Roiser, Stefan; Rollings, Alexandra Paige; Romanovskiy, Vladimir; Romero Vidal, Antonio; Rotondo, Marcello; Ruf, Thomas; Ruiz Vidal, Joan; Saborido Silva, Juan Jose; Sagidova, Naylya; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarpis, Gediminas; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Savrina, Darya; Schael, Stefan; Schellenberg, Margarete; Schiller, Manuel; Schindler, Heinrich; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schreiner, HF; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sepulveda, Eduardo Enrique; Sergi, Antonino; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Siddi, Benedetto Gianluca; Silva Coutinho, Rafael; Silva de Oliveira, Luiz Gustavo; Simi, Gabriele; Simone, Saverio; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Iwan Thomas; Smith, Mark; Soares Lavra, Lais; Sokoloff, Michael; Soler, Paul; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Stefko, Pavol; Stefkova, Slavomira; Steinkamp, Olaf; Stemmle, Simon; Stenyakin, Oleg; Stepanova, Margarita; Stevens, Holger; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Stramaglia, Maria Elena; Straticiuc, Mihai; Straumann, Ulrich; Strokov, Sergey; Sun, Jiayin; Sun, Liang; Swientek, Krzysztof; Syropoulos, Vasileios; Szumlak, Tomasz; Szymanski, Maciej Pawel; T'Jampens, Stephane; Tang, Zhipeng; Tayduganov, Andrey; Tekampe, Tobias; Tellarini, Giulia; Teubert, Frederic; Thomas, Eric; van Tilburg, Jeroen; Tilley, Matthew James; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Tourinho Jadallah Aoude, Rafael; Tournefier, Edwige; Traill, Murdo; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tully, Alison; Tuning, Niels; Ukleja, Artur; Usachov, Andrii; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagner, Alexander; Vagnoni, Vincenzo; Valassi, Andrea; Valat, Sebastien; Valenti, Giovanni; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vecchi, Stefania; van Veghel, Maarten; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Venkateswaran, Aravindhan; Verlage, Tobias Anton; Vernet, Maxime; Vesterinen, Mika; Viana Barbosa, Joao Vitor; Vieira, Daniel; Vieites Diaz, Maria; Viemann, Harald; Vilasis-Cardona, Xavier; Vitkovskiy, Arseniy; Vitti, Marcela; Volkov, Vladimir; Vollhardt, Achim; Voneki, Balazs; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Vázquez Sierra, Carlos; Waldi, Roland; Walsh, John; Wang, Jianchun; Wang, Mengzhen; Wang, Yilong; Wang, Zhenzi; Ward, David; Wark, Heather Mckenzie; Watson, Nigel; Websdale, David; Weiden, Andreas; Weisser, Constantin; Whitehead, Mark; Wicht, Jean; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Winn, Michael Andreas; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wyllie, Kenneth; Xiao, Dong; Xie, Yuehong; Xu, Ao; Xu, Menglin; Xu, Qingnian; Xu, Zehua; Xu, Zhirui; Yang, Zhenwei; Yang, Zishuo; Yao, Yuezhe; Yin, Hang; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zarebski, Kristian Alexander; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Wen Chao; Zhang, Yanxi; Zhelezov, Alexey; Zheng, Yangheng; Zhu, Xianglei; Zhukov, Valery; Zonneveld, Jennifer Brigitta; Zucchelli, Stefano

    2018-01-01

    A measurement of the $C\\!P$ asymmetries $S_{f}$ and $S_{\\bar{f}}$ in $B^0\\to D^{\\mp}\\pi^{\\pm}$ decays is reported. The decays are reconstructed in a dataset collected with the LHCb experiment in proton-proton collisions at centre-of-mass energies of 7 and 8 TeV and corresponding to an integrated luminosity of 3.0 $\\rm{fb}^{-1}$. The $C\\!P$ asymmetries are measured to be $S_{f} = 0.058 \\pm 0.020 (\\rm{stat}) \\pm 0.011(\\rm{syst})$ and $S_{\\bar{f}} = 0.038\\pm 0.020 (\\text{stat})\\pm 0.007 (\\text{syst})$. These results are in agreement with, and more precise than, previous determinations. They are used to constrain $|\\sin\\left(2\\beta+\\gamma\\right)|$ and $\\gamma$ to intervals that are consistent with the current world-average values.

  7. Pretreated high lipid serum method and its significance before determine INS C-P by RIA

    International Nuclear Information System (INIS)

    Wan Guangxia; Zhu Liqiang; Wu Yufang

    2004-01-01

    The method of predigest high lipid serum before determine INS and C-P for elimination of the high lipid in serum was studied. The specimen was divided into two groups, one was directly tested, the other was pretreated, then determined(including INS and QC of serum, normal and high lipid serum, pretreating serum). The results were compared by examine and analysed correlatively. Results show that INS and C-P of the specimens pretreated by PEG, were no statistic difference in relation to direct tested (P>0.05) and those were close correlatively (P<0.001) in normal. The results of high lipid serum after the specimens were predigest by PEG were marked by decrease in relation to direct tested (P<0.001). High lipid and INS antibody were eliminated by PEG so that was increased the results nicety. (authors)

  8. Grain refinement of AZ31 by (SiC)P: Theoretical calculation and experiment

    International Nuclear Information System (INIS)

    Guenther, R.; Hartig, Ch.; Bormann, R.

    2006-01-01

    Grain refinement of gravity die-cast Mg-alloys can be achieved via two methods: in situ refinement by primary precipitated metallic or intermetallic phases, and inoculation of the melt via ceramic particles that remain stable in the melt due to their high thermodynamic stability. In order to clarify grain refinement mechanisms and optimize possible potent refiners in Mg-alloys, a simulation method for heterogeneous nucleation based on a free growth model has been developed. It allows the prediction of the grain size as a function of the particle size distribution, the volumetric content of ceramic inoculants, the cooling rate and the alloy constitution. The model assumptions were examined experimentally by a study of the grain refinement of (SiC) P in AZ31. Additions of (SiC) P result in significant grain refinement, if appropriate parameters for ceramic particles are chosen. The model makes quantitatively correct predictions for the grain size and its variation with cooling rate

  9. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  10. vanO, a new glycopeptide resistance operon in environmental Rhodococcus equi isolates

    DEFF Research Database (Denmark)

    Gudeta, Dereje Dadi; Moodley, Arshnee; Bortolaia, Valeria

    2014-01-01

    We describe sequence and gene organization of a new glycopeptide resistance operon (vanO) in Rhodococcus equi from soil. The vanO operon has low homology to enterococccal van operons and harbors a vanHOX cluster transcribed in opposite direction to the vanS-vanR regulatory system and comprised be...... between three open reading frames with unknown function. This finding has clinical interest since glycopeptides are used to treat R. equi infections and resistance has been reported in clinical isolates....

  11. Coherent pion production in 12C(p,nπ) at 800MeV

    International Nuclear Information System (INIS)

    Gilman, R.; Brash, E.; Edwards, G.; Glashausser, C.; Jones, M.K.; Baker, F.T.; Bastea, S.; Beatty, D.P.; Bimbot, L.; Brusoe, J.; Chiba, J.; Cooper, D.; Kumbartzki, G.; Mauger, C.; Nagae, T.; Park, B.; Prout, D.; Ransome, R.D.; Rawool-Sullivan, M.; Rutt, P.; Storm, B.; Sugarbaker, E.; Taddeucci, T.; Zumbro, J.

    1994-01-01

    Studies of the production of the Δ resonance in hadronic charge exchange reactions show a shift in the Δ peak position. Measurements looking also at the Δ decay products give some evidence for coherent pion production. We have recently completed a new measurement of the 12 C(p,n) reaction leading to the Δ resonance, including a higher resolution coincidence measurement of decay π's in the forward direction. We describe the experiment and some aspects of the preliminary analysis. ((orig.))

  12. UV induction of the LT-Toxin operon with respect to the genes lexA, recA, and umuD

    International Nuclear Information System (INIS)

    Tiganova, I.G.; Rusina, O.Yu.; Andreeva, I.V.; Brukhanskii, G.V.; Skavronskaya, A.G.

    1994-01-01

    UV induction of the elt operon (the LT-toxin operon in Escherichia coli) was demonstrated in experiments using fusion of elt::lac operons with the help of Mud1(Ap lac) phage. UV induction of the elt operon is lexA-dependent; thus, the possibility of SOS regulation of this process may be assumed. However, UV induction of the elt operon turned out to be recA-independent, which makes it impossible to consider this induction as a typical SOS response. UV induction of the elt operon is also observed in Salmonella typhimurium, which differs from E. coli in the product of umuD, which suggests that the UV induction of the elt operon is umuD independent

  13. Cloning and study of the pectate lyase gene of Erwinia carotovora

    International Nuclear Information System (INIS)

    Bukanov, N.O.; Fonshtein, M.Yu.; Evtushenkov, A.N.; Syarinskii, M.A.; Strel'chenko, P.P.; Yankovski, N.K.; Alikhanyan, S.I.; Fomichev, Yu.K.; Debabov, V.G.

    1986-01-01

    The cloning of the gene of a secretable protein of Erwinia carotovora, pectate lyase, in Escherichia coli was described. Primary cloning was conducted using the phage vector λ 47.1. In the gene library of E. carotovora obtained, eight phages carrying the gene sought were identified according to the appearance of enzymatic activity of the gene product, pectate lyase, in situ. The BamHI fragment of DNA, common to all these phages, was recloned on the plasmid pUC19. It was shown that the cloned pectate lyase gene is represented on the E. carotovora chromosome in one copy. Methods of production of representative gene libraries on phage vectors from no less than 1 μg of cloned DNA even for the genomes of eukaryotes have now been developed. Vectors have been created, for example, λ 47.1, permitting the selection only of hybrid molecules. A number of methods have been developed for the search for a required gene in the library, depending on whether the cloned gene can be expressed or not, and if it can, what properties it will impart to the hybrid clone containing it

  14. Contribution of the Chromosomal ccdAB Operon to Bacterial Drug Tolerance.

    Science.gov (United States)

    Gupta, Kritika; Tripathi, Arti; Sahu, Alishan; Varadarajan, Raghavan

    2017-10-01

    One of the first identified and best-studied toxin-antitoxin (TA) systems in Escherichia coli is the F-plasmid-based CcdAB system. This system is involved in plasmid maintenance through postsegregational killing. More recently, ccdAB homologs have been found on the chromosome, including in pathogenic strains of E. coli and other bacteria. However, the functional role of chromosomal ccdAB genes, if any, has remained unclear. We show that both the native ccd operon of the E. coli O157 strain ( ccd O157 ) and the ccd operon from the F plasmid ( ccd F ), when inserted on the E. coli chromosome, lead to protection from cell death under multiple antibiotic stress conditions through formation of persisters, with the O157 operon showing higher protection. While the plasmid-encoded CcdB toxin is a potent gyrase inhibitor and leads to bacterial cell death even under fully repressed conditions, the chromosomally encoded toxin leads to growth inhibition, except at high expression levels, where some cell death is seen. This was further confirmed by transiently activating the chromosomal ccd operon through overexpression of an active-site inactive mutant of F-plasmid-encoded CcdB. Both the ccd F and ccd O157 operons may share common mechanisms for activation under stress conditions, eventually leading to multidrug-tolerant persister cells. This study clearly demonstrates an important role for chromosomal ccd systems in bacterial persistence. IMPORTANCE A large number of free-living and pathogenic bacteria are known to harbor multiple toxin-antitoxin systems, on plasmids as well as on chromosomes. The F-plasmid CcdAB system has been extensively studied and is known to be involved in plasmid maintenance. However, little is known about the function of its chromosomal counterpart, found in several pathogenic E. coli strains. We show that the native chromosomal ccd operon of the E. coli O157 strain is involved in drug tolerance and confers protection from cell death under multiple

  15. Molecular cloning, purification, and characterization of a novel polyMG-specific alginate lyase responsible for alginate MG block degradation in Stenotrophomas maltophilia KJ-2

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Su In; Kim, Hee Sook [Kyungsung Univ., Busan (Korea, Republic of). Dept. of Food Science and Biotechnology; Choi, Sung Hee; Lee, Eun Yeol [Kyung Hee Univ., Gyeonggi-do (Korea, Republic of). Dept. of Chemical Engineering

    2012-09-15

    A gene for a polyMG-specific alginate lyase possessing a novel structure was identified and cloned from Stenotrophomas maltophilia KJ-2 by using PCR with homologous nucleotide sequences-based primers. The recombinant alginate lyase consisting of 475 amino acids was purified on Ni-Sepharose column and exhibited the highest activity at pH 8 and 40 C. Interestingly, the recombinant alginate lyase was expected to have a similar catalytic active site of chondroitin B lyase but did not show chondroitin lyase activity. In the test of substrate specificity, the recombinant alginate lyase preferentially degraded the glycosidic bond of polyMG-block than polyM-block and polyG-block. The chemical structures of the degraded alginate oligosaccharides were elucidated to have mannuronate (M) at the reducing end on the basis of NMR analysis, supporting that KJ-2 polyMG-specific alginate lyase preferably degraded the glycosidic bond in M-G linkage than that in G-M linkage. The KJ-2 polyMG-specific alginate lyase can be used in combination with other alginate lyases for a synergistic saccharification of alginate. (orig.)

  16. Spontaneous C P -violation in the simplest little Higgs model and its future collider tests: The scalar sector

    Science.gov (United States)

    Mao, Ying-nan

    2018-04-01

    We propose spontaneous C P violation in the simplest little Higgs model. In this model, the pseudoscalar field can acquire a nonzero vacuum expectation value. This leads to a mixing between the two scalars with different C P charge, which means that spontaneous C P violation occurs. It is also a connection between the composite Higgs mechanism and C P violation. Facing the experimental constraints, the model is still viable for both scenarios in which the extra scalar appears below or around the electroweak scale. We also discuss the future collider tests of C P violation in the scalar sector through measuring h2Z Z and h1h2Z' vertices (see the definitions of the particles in the text), which provide new motivations for future e+e- and p p colliders. This also shows the importance of the vector-vector-scalar- and vector-scalar-scalar-type vertices in discovering C P -violation effects in the scalar sector.

  17. The dnd operon for DNA phosphorothioation modification system in Escherichia coli is located in diverse genomic islands.

    Science.gov (United States)

    Ho, Wing Sze; Ou, Hong-Yu; Yeo, Chew Chieng; Thong, Kwai Lin

    2015-03-17

    Strains of Escherichia coli that are non-typeable by pulsed-field gel electrophoresis (PFGE) due to in-gel degradation can influence their molecular epidemiological data. The DNA degradation phenotype (Dnd(+)) is mediated by the dnd operon that encode enzymes catalyzing the phosphorothioation of DNA, rendering the modified DNA susceptible to oxidative cleavage during a PFGE run. In this study, a PCR assay was developed to detect the presence of the dnd operon in Dnd(+) E. coli strains and to improve their typeability. Investigations into the genetic environments of the dnd operon in various E. coli strains led to the discovery that the dnd operon is harboured in various diverse genomic islands. The dndBCDE genes (dnd operon) were detected in all Dnd(+) E. coli strains by PCR. The addition of thiourea improved the typeability of Dnd(+) E. coli strains to 100% using PFGE and the Dnd(+) phenotype can be observed in both clonal and genetically diverse E. coli strains. Genomic analysis of 101 dnd operons from genome sequences of Enterobacteriaceae revealed that the dnd operons of the same bacterial species were generally clustered together in the phylogenetic tree. Further analysis of dnd operons of 52 E. coli genomes together with their respective immediate genetic environments revealed a total of 7 types of genetic organizations, all of which were found to be associated with genomic islands designated dnd-encoding GIs. The dnd-encoding GIs displayed mosaic structure and the genomic context of the 7 islands (with 1 representative genome from each type of genetic organization) were also highly variable, suggesting multiple recombination events. This is also the first report where two dnd operons were found within a strain although the biological implication is unknown. Surprisingly, dnd operons were frequently found in pathogenic E. coli although their link with virulence has not been explored. Genomic islands likely play an important role in facilitating the horizontal

  18. Overexpression, purification and crystallization of the tetrameric form of SorC sorbitol operon regulator

    International Nuclear Information System (INIS)

    Sanctis, Daniele de; Rêgo, Ana T.; Marçal, David; McVey, Colin E.; Carrondo, Maria A.; Enguita, Francisco J.

    2007-01-01

    The sorbitol operon regulator from K. pneumoniae has been overexpressed in E. coli, purified and crystallized. Diffraction data were collected to 3.2 Å. The sorbitol operon regulator (SorC) regulates the metabolism of l-sorbose in Klebsiella pneumonia. SorC was overexpressed in Escherichia coli and purified, and crystals were obtained of a tetrameric form. A single crystal showed X-ray diffraction to 3.20 Å. The crystal belongs to space group P2 1 2 1 2 1 , with unit-cell parameters a = 91.6, b = 113.3, c = 184.1 Å. Analysis of the molecular-replacement solution indicates the presence of four SorC molecules in the asymmetric unit

  19. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    Science.gov (United States)

    Jansen, M. D.; Bosch, T.; Jansen, W. T. M.; Schouls, L.; Jonker, M. J.; Boel, C. H. E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted to the hospital environment by rRNA operon loss (six to five copies) due to antibiotic pressure. Early CA-MRSA, in contrast, results from wild-type methicillin-susceptible S. aureus (MSSA) that acquired mecA without loss of an rRNA operon. Of the HA-MRSA isolates (n = 77), 67.5% had five rRNA operon copies, compared to 23.2% of the CA-MRSA isolates (n = 69) and 7.7% of MSSA isolates (n = 195) (P operon copies. For all subsets, a correlation between resistance profile and rRNA copy number was found. Furthermore, we showed that in vitro antibiotic pressure may result in rRNA operon copy loss. We also showed that without antibiotic pressure, S. aureus isolates containing six rRNA copies are more fit than isolates with five copies. We conclude that HA-MRSA and cystic fibrosis isolates most likely have adapted to an environment with high antibiotic pressure by the loss of an rRNA operon copy. This loss has facilitated resistance development, which promoted survival in these niches. However, strain fitness decreased, which explains their lack of success in the community. In contrast, CA-MRSA isolates retained six rRNA operon copies, rendering them fitter and thereby able to survive and spread in the community. PMID:27671073

  20. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions

    OpenAIRE

    Burbank, Lindsey P.; Van Horn, Christopher R.

    2017-01-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa, but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb, putatively encoding a conjugative type IV secretion system, are foun...

  1. Horizontal transfers of two types of puf operons among phototrophic members of the Roseobacter clade

    Czech Academy of Sciences Publication Activity Database

    Koblížek, Michal; Moulisová, Vladimíra; Muroňová, Markéta; Oborník, Miroslav

    2015-01-01

    Roč. 60, č. 1 (2015), s. 37-43 ISSN 0015-5632 R&D Projects: GA MŠk ED2.1.00/03.0110; GA ČR GAP501/10/0221; GA ČR GBP501/12/G055 Institutional support: RVO:61388971 Keywords : Rosebacter * horizontal transfer * puf operon s Subject RIV: EE - Microbiology, Virology Impact factor: 1.335, year: 2015

  2. Structural Insight into the Gene Expression Profiling of the hcn Operon in Pseudomonas aeruginosa.

    Science.gov (United States)

    Chowdhury, Nilkanta; Bagchi, Angshuman

    2017-07-01

    Pseudomonas aeruginosa is a common opportunistic human pathogen. It generally attacks immunosuppressed patients like AIDS, cancer, cystic fibrosis, etc. The virulence of P. aeruginosa is mediated by various virulence factors. One of such potential virulence factors is HCN synthesized by HCN synthase enzyme, which is encoded by the hcnABC operon. The expressions of the genes of this operon are regulated by three transcriptional regulators, viz., LasR, ANR, and RhlR. In our previous work, we analyzed the molecular details of the functionalities of LasR. In this work, we focused on ANR. ANR is a regulatory protein which belongs to the FNR family and works in anaerobic condition. ANR binds to the promoter DNA, named ANR box, as a dimer. The dimerization of this ANR protein is regulated by Fe 4 S 4 , an iron-sulfur cluster. This dimer of ANR (ANR-Fe 4 S 4 /ANR-Fe 4 S 4 ) recognizes and binds the promoter DNA sequence and regulates the transcription of this hcnABC operon. Till date, the biomolecular details of the interactions of ANR dimer with the promoter DNA are not fully understood. Thus, we built the molecular model of ANR-Fe 4 S 4 /ANR-Fe 4 S 4 . We docked the complex with the corresponding promoter DNA region. We analyzed the mode of interactions with the promoter DNA under different conditions. Thus, we tried to analyze the functionality of the ANR protein during the expressions of the genes of the hcnABC operon. So far, this is the first report to detail the molecular mechanism of the gene expression in P. aeruginosa.

  3. Cloning and properties of the Salmonella typhimurium tricarboxylate transport operon in Escherichia coli

    International Nuclear Information System (INIS)

    Widenhorn, K.A.; Boos, W.; Somers, J.M.; Kay, W.W.

    1988-01-01

    The tricarboxylate transport operon (tctI) was cloned in Escherichia coli as a 12-kilobase (kb) fragment from an EcoRI library of the Salmonella typhimurium chromosome in λgtWES. It was further subcloned as a 12-kb fragment into pACYC184 and as an 8-kb fragment into pBR322. By insertional mutagenesis mediated by λTn5, restriction mapping, and phenotypic testing, the tctI operon was localized to a 4.5-kb region. The tctC gene which encodes a periplasmic binding protein (C-protein) was located near the center of the insert. E. coli/tctI clones on either multicopy or single-copy vectors grew on the same tricarboxylates as S. typhimurium, although unusually long growth lags were observed. E. coli/tctI clones exhibited similar [ 14 C] fluorocitrate transport kinetics to those of S. typhimurium, whereas E. coli alone was virtually impermeable to [ 14 C] fluorocitrate. The periplasmic C proteins (C1 and C2 isoelectric forms) were produced in prodigious quantities from the cloned strains. Motile E. coli/tctI clones were not chemotactic toward citrate, whereas tctI deletion mutants of S. typhimurium were. Taken together, these observations indicate that tctI is not an operon involved in chemotaxis

  4. OpWise: Operons aid the identification of differentially expressed genes in bacterial microarray experiments

    Directory of Open Access Journals (Sweden)

    Arkin Adam P

    2006-01-01

    Full Text Available Abstract Background Differentially expressed genes are typically identified by analyzing the variation between replicate measurements. These procedures implicitly assume that there are no systematic errors in the data even though several sources of systematic error are known. Results OpWise estimates the amount of systematic error in bacterial microarray data by assuming that genes in the same operon have matching expression patterns. OpWise then performs a Bayesian analysis of a linear model to estimate significance. In simulations, OpWise corrects for systematic error and is robust to deviations from its assumptions. In several bacterial data sets, significant amounts of systematic error are present, and replicate-based approaches overstate the confidence of the changers dramatically, while OpWise does not. Finally, OpWise can identify additional changers by assigning genes higher confidence if they are consistent with other genes in the same operon. Conclusion Although microarray data can contain large amounts of systematic error, operons provide an external standard and allow for reasonable estimates of significance. OpWise is available at http://microbesonline.org/OpWise.

  5. Cloning, sequencing, and expression of dnaK-operon proteins from the thermophilic bacterium Thermus thermophilus.

    Science.gov (United States)

    Osipiuk, J; Joachimiak, A

    1997-09-12

    We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.

  6. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Directory of Open Access Journals (Sweden)

    Kathleen Jwanoswki

    Full Text Available Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  7. Bacterial clade with the ribosomal RNA operon on a small plasmid rather than the chromosome.

    Science.gov (United States)

    Anda, Mizue; Ohtsubo, Yoshiyuki; Okubo, Takashi; Sugawara, Masayuki; Nagata, Yuji; Tsuda, Masataka; Minamisawa, Kiwamu; Mitsui, Hisayuki

    2015-11-17

    rRNA is essential for life because of its functional importance in protein synthesis. The rRNA (rrn) operon encoding 16S, 23S, and 5S rRNAs is located on the "main" chromosome in all bacteria documented to date and is frequently used as a marker of chromosomes. Here, our genome analysis of a plant-associated alphaproteobacterium, Aureimonas sp. AU20, indicates that this strain has its sole rrn operon on a small (9.4 kb), high-copy-number replicon. We designated this unusual replicon carrying the rrn operon on the background of an rrn-lacking chromosome (RLC) as the rrn-plasmid. Four of 12 strains close to AU20 also had this RLC/rrn-plasmid organization. Phylogenetic analysis showed that those strains having the RLC/rrn-plasmid organization represented one clade within the genus Aureimonas. Our finding introduces a previously unaddressed viewpoint into studies of genetics, genomics, and evolution in microbiology and biology in general.

  8. Artificial Citrate Operon Confers Mineral Phosphate Solubilization Ability to Diverse Fluorescent Pseudomonads

    Science.gov (United States)

    Adhikary, Hemanta; Sanghavi, Paulomi B.; Macwan, Silviya R.; Archana, Gattupalli; Naresh Kumar, G.

    2014-01-01

    Citric acid is a strong acid with good cation chelating ability and can be very efficient in solubilizing mineral phosphates. Only a few phosphate solubilizing bacteria and fungi are known to secrete citric acids. In this work, we incorporated artificial citrate operon containing NADH insensitive citrate synthase (gltA1) and citrate transporter (citC) genes into the genome of six-plant growth promoting P. fluorescens strains viz., PfO-1, Pf5, CHAO1, P109, ATCC13525 and Fp315 using MiniTn7 transposon gene delivery system. Comprehensive biochemical characterization of the genomic integrants and their comparison with plasmid transformants of the same operon in M9 minimal medium reveals the highest amount of ∼7.6±0.41 mM citric and 29.95±2.8 mM gluconic acid secretion along with ∼43.2±3.24 mM intracellular citrate without affecting the growth of these P. fluorescens strains. All genomic integrants showed enhanced citric and gluconic acid secretion on Tris-Cl rock phosphate (TRP) buffered medium, which was sufficient to release 200–1000 µM Pi in TRP medium. This study demonstrates that MPS ability could be achieved in natural fluorescent pseudomonads by incorporation of artificial citrate operon not only as plasmid but also by genomic integration. PMID:25259527

  9. The Legionella pneumophila GIG operon responds to gold and copper in planktonic and biofilm cultures.

    Science.gov (United States)

    Jwanoswki, Kathleen; Wells, Christina; Bruce, Terri; Rutt, Jennifer; Banks, Tabitha; McNealy, Tamara L

    2017-01-01

    Legionella pneumophila contaminates man-made water systems and creates numerous exposure risks for Legionnaires' Disease. Because copper/silver ionization is commonly used to control L. pneumophila, its mechanisms of metal response and detoxification are of significant interest. Here we describe an L. pneumophila operon with significant similarity to the GIG operon of Cupriavidus metallidurans. The Legionella GIG operon is present in a subset of strains and has been acquired as part of the ICE-βox 65-kB integrative conjugative element. We assessed GIG promoter activity following exposure of L. pneumophila to multiple concentrations of HAuCl4, CuSO4 and AgNO3. At 37°C, control stationary phase cultures exhibited GIG promoter activity. This activity increased significantly in response to 20 and 50uM HAuCl4 and CuSO4 but not in response to AgNO3. Conversely, at 26°C, cultures exhibited decreased promoter response to copper. GIG promoter activity was also induced by HAuCl4 or CuSO4 during early biofilm establishment at both temperatures. When an L. pneumophila GIG promoter construct was transformed into E. coli DH5α, cultures showed baseline expression levels that did not increase following metal addition. Analysis of L. pneumophila transcriptional regulatory mutants suggested that GIG up-regulation in the presence of metal ions may be influenced by the stationary phase sigma factor, RpoS.

  10. Comparative metabolic profiling of mce1 operon mutant vs wild-type Mycobacterium tuberculosis strains.

    Science.gov (United States)

    Queiroz, Adriano; Medina-Cleghorn, Daniel; Marjanovic, Olivera; Nomura, Daniel K; Riley, Lee W

    2015-11-01

    Mycobacterium tuberculosis disrupted in a 13-gene operon (mce1) accumulates free mycolic acids (FM) in its cell wall and causes accelerated death in mice. Here, to more comprehensively analyze differences in their cell wall lipid composition, we used an untargeted metabolomics approach to compare the lipid profiles of wild-type and mce1 operon mutant strains. By liquid chromatography-mass spectrometry, we identified >400 distinct lipids significantly altered in the mce1 mutant compared to wild type. These lipids included decreased levels of saccharolipids and glycerophospholipids, and increased levels of alpha-, methoxy- and keto mycolic acids (MA), and hydroxyphthioceranic acid. The mutant showed reduced expression of mmpL8, mmpL10, stf0, pks2 and papA2 genes involved in transport and metabolism of lipids recognized to induce proinflammatory response; these lipids were found to be decreased in the mutant. In contrast, the transcripts of mmpL3, fasI, kasA, kasB, acpM and RV3451 involved in MA transport and metabolism increased; MA inhibits inflammatory response in macrophages. Since the mce1 operon is known to be regulated in intracellular M. tuberculosis, we speculate that the differences we observed in cell wall lipid metabolism and composition may affect host response to M. tuberculosis infection and determine the clinical outcome of such an infection. © FEMS 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. Organization and post-transcriptional processing of the psb B operon from chloroplasts of Populus deltoides.

    Science.gov (United States)

    Dixit, R; Trivedi, P K; Nath, P; Sane, P V

    1999-09-01

    Chloroplast genes are typically organized into polycistronic transcription units that give rise to complex sets of mono- and oligo-cistronic overlapping RNAs through a series of processing steps. The psbB operon contains genes for the PSII (psbB, psbT, psbH) and cytochrome b(6)f (petB and petD) complexes which are needed in different amounts during chloroplast biogenesis. The functional significance of gene organization in this polycistronic unit, containing information for two different complexes, is not known and is of interest. To determine the organization and expression of these complexes, studies have been carried out on crop plants by different groups, but not much information is known about trees. We present the nucleotide sequences of PSII genes and RNA profiles of the genes located in the psbB operon from Populus deltoides, a tree species. Although the gene organization of this operon in P. deltoides is similar to that in other species, a few variations have been observed in the processing scheme.

  12. C P asymmetry in Bd → φ KS: Standard model pollution

    International Nuclear Information System (INIS)

    Grossman, Y.; Worah, M. P.; Seattle, Univ. of Washington

    1997-09-01

    The difference in the time dependent C P asymmetries between the modes B → ψ K S and B d → φ K S is a clean signal for physics beyond the Standard Model. this interpretation could fail if there is a large enhancement of the matrix element of the b → u u-bar s operator between the B d initial state and the φ K S final state. They argue against this possibility and propose some experimental tests that could shed light on the situation

  13. Observation of $C\\!P$ violation in $B^\\pm \\to D K^\\pm$ decays

    CERN Document Server

    Aaij, R; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amhis, Y; Anderson, J; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bates, A; Bauer, C; Bauer, Th; Bay, A; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Bernet, R; Bettler, M-O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blanks, C; Blouw, J; Blusk, S; Bobrov, A; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Büchler-Germann, A; Burducea, I; Bursche, A; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Cauet, Ch; Charles, M; Charpentier, Ph; Chiapolini, N; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Corti, G; Couturier, B; Cowan, G A; Currie, R; D'Ambrosio, C; David, P; David, P N Y; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Simone, P; Decamp, D; Deckenhoff, M; Degaudenzi, H; Del Buono, L; Deplano, C; Derkach, D; Deschamps, O; Dettori, F; Dickens, J; Dijkstra, H; Diniz Batista, P; Domingo Bonal, F; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisele, F; Eisenhardt, S; Ekelhof, R; Eklund, L; Elsasser, Ch; Elsby, D; Esperante Pereira, D; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Fernandez Albor, V; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garnier, J-C; Garofoli, J; Garra Tico, J; Garrido, L; Gascon, D; Gaspar, C; Gauld, R; Gauvin, N; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hampson, T; Hansmann-Menzemer, S; Harji, R; Harnew, N; Harrison, J; Harrison, P F; Hartmann, T; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Holubyev, K; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Huston, R S; Hutchcroft, D; Hynds, D; Iakovenko, V; Ilten, P; Imong, J; Jacobsson, R; Jaeger, A; Jahjah Hussein, M; Jans, E; Jansen, F; Jaton, P; Jean-Marie, B; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kaballo, M; Kandybei, S; Karacson, M; Karbach, T M; Keaveney, J; Kenyon, I R; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kim, Y M; Knecht, M; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kruzelecki, K; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J-P; Lefèvre, R; Leflat, A; Lefrançois, J; Leroy, O; Lesiak, T; Li, L; Li Gioi, L; Lieng, M; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; von Loeben, J; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Lu, H; Luisier, J; Mac Raighne, A; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Magnin, J; Malde, S; Mamunur, R M D; Manca, G; Mancinelli, G; Mangiafave, N; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Massafferri, A; Mathe, Z; Matteuzzi, C; Matveev, M; Maurice, E; Maynard, B; Mazurov, A; McGregor, G; McNulty, R; Meissner, M; Merk, M; Merkel, J; Miglioranzi, S; Milanes, D A; Minard, M-N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Mylroie-Smith, J; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neufeld, N; Nguyen, A D; Nguyen-Mau, C; Nicol, M; Niess, V; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Pal, B K; Palacios, J; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Paterson, S K; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pie Valls, B; Pietrzyk, B; Pilař, T; Pinci, D; Plackett, R; Playfer, S; Plo Casasus, M; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodrigues, F; Rodriguez Perez, P; Rogers, G J; Roiser, S; Romanovsky, V; Rosello, M; Rouvinet, J; Ruf, T; Ruiz, H; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santinelli, R; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schleich, S; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M-H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skwarnicki, T; Smith, N A; Smith, E; Sobczak, K; Soler, F J P; Solomin, A; Soomro, F; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Swientek, S; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tsaregorodtsev, A; Tuning, N; Ubeda Garcia, M; Ukleja, A; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Viaud, B; Videau, I; Vieira, D; Vilasis-Cardona, X; Visniakov, J; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voss, H; Waldi, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Witzeling, W; Wotton, S A; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhong, L; Zvyagin, A

    2012-01-01

    An analysis of $B^{\\pm}\\to DK^{\\pm}$ and $B^{\\pm}\\to D\\pi^{\\pm}$ decays is presented where the $D$ meson is reconstructed in the two-body final states:$K^{\\pm}\\pi^{\\mp}$, $K^+K^-$, $\\pi^+\\pi^-$ and $\\pi^{\\pm}K^{\\mp}$. Using $1.0{\\rm \\,fb}^{-1}$ of LHCb data, measurements of several observables are made including the first observation of the suppressed mode $B^{\\pm}\\to[\\pi^{\\pm}K^{\\mp}]_DK^{\\pm}$. $C\\!P$ violation in $B^{\\pm}\\to DK^{\\pm}$ decays is observed with $5.8\\,\\sigma$ significance.

  14. Propiedades superficiales del Ti c.p., esterilizado y rugoso, para aplicaciones biomédicas

    OpenAIRE

    López Requejo, Sergio

    2005-01-01

    La capacidad de osteointegración (integración en el hueso) de un biomaterial, depende de la naturaleza físico-química de su superficie. Esta, es esencial en los procesos de adhesión proteica que determinan el crecimiento del tejido celular envolvente. En el presente proyecto se ha estudiado el cambio en las propiedades energéticas y superficiales de muestras de Ti c.p. de grado 2, debido a distintos tratamientos superficiales de rugosidad y a distintos métodos de esterilización...

  15. Transcription and translation of the rpsJ, rplN and rRNA operons of the tubercle bacillus.

    Science.gov (United States)

    Cortes, Teresa; Cox, Robert Ashley

    2015-04-01

    Several species of the genus Mycobacterium are human pathogens, notably the tubercle bacillus (Mycobacterium tuberculosis). The rate of proliferation of a bacterium is reflected in the rate of ribosome synthesis. This report describes a quantitative analysis of the early stages of the synthesis of ribosomes of M. tuberculosis. Specifically, the roles of three large operons, namely: the rrn operon (1.7 microns) encoding rrs (16S rRNA), rrl (23S rRNA) and rrf (5S rRNA); the rpsJ operon (1.93 microns), which encodes 11 ribosomal proteins; and the rplN operon (1.45 microns), which encodes 10 ribosomal proteins. A mathematical framework based on properties of population-average cells was developed to identify the number of transcripts of the rpsJ and rplN operons needed to maintain exponential growth. The values obtained were supported by RNaseq data. The motif 5'-gcagac-3' was found close to 5' end of transcripts of mycobacterial rplN operons, suggesting it may form part of the RpsH feedback binding site because the same motif is present in the ribosome within the region of rrs that forms the binding site for RpsH. Medical Research Council.

  16. Plasticity of regulation of mannitol phosphotransferase system operon by CRP-cAMP complex in Vibrio cholerae.

    Science.gov (United States)

    Zhou, Yan Yan; Zhang, Hong Zhi; Liang, Wei Li; Zhang, Li Juan; Zhu, Jun; Kan, Biao

    2013-10-01

    The complex of the cyclic AMP receptor protein (CRP) and cAMP is an important transcriptional regulator of numerous genes in prokaryotes. The transport of mannitol through the phosphotransferase systems (PTS) is regulated by the CRP-cAMP complex. The aim of the study is to investigate how the CRP-cAMP complex acting on the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype. The crp mutant strain was generated by homologous recombination to assess the need of CRP to activate the mannitol PTS operon of V. cholerae El Tor. Electrophoretic mobility shift assays (EMSA) and the reporter plasmid pBBRlux were used to confirm the role that the CRP-cAMP complex playing on the mannitol PTS operon mtl. In this study, we confirmed that CRP is strictly needed for the activation of the mtl operon. We further experimentally identified five CRP binding sites within the promoter region upstream of the mannitol PTS operon mtl of the Vibrio cholerae El Tor biotype and found that these sites display different affinities for CRP and provide different contributions to the activation of the operon. The five binding sites collectively confer the strong activation of mannitol transfer by CRP in V. cholerae, indicating an elaborate and subtle CRP activation mechanism. Copyright © 2013 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.

  17. Kinetic and thermodynamic properties of alginate lyase and cellulase co-produced by Exiguobacterium species Alg-S5.

    Science.gov (United States)

    Mohapatra, Bidyut R

    2017-05-01

    In an effort to screen out the alginolytic and cellulolytic bacteria from the putrefying invasive seaweed Sargassum species accumulated off Barbados' coast, a potent bacterial strain was isolated. This bacterium, which simultaneously produced alginate lyase and cellulase, was identified as Exiguobacterium sp. Alg-S5 via the phylogenetic approach targeting the 16S rRNA gene. The co-produced alginate lyase and cellulase exhibited maximal enzymatic activity at pH 7.5 and at 40°C and 45°C, respectively. The K m and V max values recorded as 0.91mg/mL and 21.8U/mg-protein, respectively, for alginate lyase, and 10.9mg/mL and 74.6U/mg-protein, respectively, for cellulase. First order kinetic analysis of the thermal denaturation of the co-produced alginate lyase and cellulase in the temperature range from 40°C to 55°C revealed that both the enzymes were thermodynamically efficient by displaying higher activation energy and enthalpy of denaturation. These enzymatic properties indicate the potential industrial importance of this bacterium in algal biomass conversion. This appears to be the first report on assessing the efficacy of a bacterium for the co-production of alginate lyase and cellulase. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Ammonia lyases and aminomutases as biocatalysts for the synthesis of α-amino and β-amino acids.

    Science.gov (United States)

    Turner, Nicholas J

    2011-04-01

    Ammonia lyases catalyse the reversible addition of ammonia to cinnamic acid (1: R=H) and p-hydroxycinnamic (1: R=OH) to generate L-phenylalanine (2: R=H) and L-tyrosine (2: R=OH) respectively (Figure 1a). Both phenylalanine ammonia lyase (PAL) and tyrosine ammonia lyase (TAL) are widely distributed in plants, fungi and prokaryotes. Recently there has been interest in the use of these enzymes for the synthesis of a broader range of L-arylalanines. Aminomutases catalyse a related reaction, namely the interconversion of α-amino acids to β-amino acids (Figure 1b). In the case of L-phenylalanine, this reaction is catalysed by phenylalanine aminomutase (PAM) and proceeds stereospecifically via the intermediate cinnamic acid to generate β-Phe 3. Ammonia lyases and aminomutases are related in sequence and structure and share the same active site cofactor 4-methylideneimidazole-5-one (MIO). There is currently interest in the possibility of using these biocatalysts to prepare a wide range of enantiomerically pure l-configured α-amino and β-amino acids. Recent reviews have focused on the mechanism of these MIO containing enzymes. The aim of this review is to review recent progress in the application of ammonia lyase and aminomutase enzymes to prepare enantiomerically pure α-amino and β-amino acids. Copyright © 2010 Elsevier Ltd. All rights reserved.

  19. Proportional Counter Calibration and Analysis for 12C + p Resonance Scattering

    Science.gov (United States)

    Nelson, Austin; Rogachev, Grigory; Uberseder, Ethan; Hooker, Josh; Koshchiy, Yevgen

    2014-09-01

    Light exotic nuclei provide a unique opportunity to test the predictions of modern ab initio theoretical calculations near the drip line. In ab initio approaches, nuclear structure is described starting from bare nucleon-nucleon and three-nucleon interactions. Calculations are very heavy and can only be performed for the lightest nuclei (A objective of this project was to test the performance and perform position calibration of this proportional counter array. The test was done using 12C beam. The excitation function for 12C + p elastic scattering was measured and calibration of the proportional counter was performed using known resonances in 13N. The method of calibration, including solid angle calculations, normalization corrections, and position calibration will be presented. Light exotic nuclei provide a unique opportunity to test the predictions of modern ab initio theoretical calculations near the drip line. In ab initio approaches, nuclear structure is described starting from bare nucleon-nucleon and three-nucleon interactions. Calculations are very heavy and can only be performed for the lightest nuclei (A objective of this project was to test the performance and perform position calibration of this proportional counter array. The test was done using 12C beam. The excitation function for 12C + p elastic scattering was measured and calibration of the proportional counter was performed using known resonances in 13N. The method of calibration, including solid angle calculations, normalization corrections, and position calibration will be presented. Funded by DOE and NSF-REU Program; Grant No. PHY-1263281.

  20. C -P -T anomaly matching in bosonic quantum field theory and spin chains

    Science.gov (United States)

    Sulejmanpasic, Tin; Tanizaki, Yuya

    2018-04-01

    We consider the O (3 ) nonlinear sigma model with the θ term and its linear counterpart in 1+1D. The model has discrete time-reflection and space-reflection symmetries at any θ , and enjoys the periodicity in θ →θ +2 π . At θ =0 ,π it also has a charge-conjugation C symmetry. Gauging the discrete space-time reflection symmetries is interpreted as putting the theory on the nonorientable R P2 manifold, after which the 2 π periodicity of θ and the C symmetry at θ =π are lost. We interpret this observation as a mixed 't Hooft anomaly among charge-conjugation C , parity P , and time-reversal T symmetries when θ =π . Anomaly matching implies that in this case the ground state cannot be trivially gapped, as long as C ,P , and T are all good symmetries of the theory. We make several consistency checks with various semiclassical regimes, and with the exactly solvable XYZ model. We interpret this anomaly as an anomaly of the corresponding spin-half chains with translational symmetry, parity, and time reversal [but not involving the SO(3)-spin symmetry], requiring that the ground state is never trivially gapped, even if SO(3) spin symmetry is explicitly and completely broken. We also consider generalizations to C PN -1 models and show that the C -P -T anomaly exists for even N .

  1. Search for $C\\!P$ violation in $\\Lambda^0_b \\to p K^- \\mu^+ \\mu^-$ decays at LHCb

    CERN Multimedia

    Marangotto, Daniele

    2017-01-01

    A search for $C\\!P$ violation in the rare decay $\\Lambda^0_b \\to p K^- \\mu^+ \\mu^-$ is presented. This decay is mediated by flavour-changing neutral-current transitions in the Standard Model and is potentially sensitive to new sources of $C\\!P$ violation. The study is based on a data sample of proton-proton collisions recorded with the LHCb experiment, corresponding to an integrated luminosity of $3\\mathrm{fb}^{-1}$. Two observables that are sensitive to different manifestations of $C\\!P$ violation are measured, $\\Delta\\mathcal{A}_{C\\!P} \\equiv \\mathcal{A}_{C\\!P}(\\Lambda^0_b \\to p K^- \\mu^+ \\mu^-)-\\mathcal{A}_{C\\!P}(\\Lambda^0_b\\to pK^- J/\\psi)$ and $a_{C\\!P}^{\\widehat{T}_{\\mathrm{odd}}}$, where the latter is based on asymmetries in the angle between the $\\mu^+\\mu^-$ and $p K^-$ decay planes. No evidence for $C\\!P$ violation is found.

  2. Sphingosine-1-Phosphate Lyase Deficient Cells as a Tool to Study Protein Lipid Interactions.

    Directory of Open Access Journals (Sweden)

    Mathias J Gerl

    Full Text Available Cell membranes contain hundreds to thousands of individual lipid species that are of structural importance but also specifically interact with proteins. Due to their highly controlled synthesis and role in signaling events sphingolipids are an intensely studied class of lipids. In order to investigate their metabolism and to study proteins interacting with sphingolipids, metabolic labeling based on photoactivatable sphingoid bases is the most straightforward approach. In order to monitor protein-lipid-crosslink products, sphingosine derivatives containing a reporter moiety, such as a radiolabel or a clickable group, are used. In normal cells, degradation of sphingoid bases via action of the checkpoint enzyme sphingosine-1-phosphate lyase occurs at position C2-C3 of the sphingoid base and channels the resulting hexadecenal into the glycerolipid biosynthesis pathway. In case the functionalized sphingosine looses the reporter moiety during its degradation, specificity towards sphingolipid labeling is maintained. In case degradation of a sphingosine derivative does not remove either the photoactivatable or reporter group from the resulting hexadecenal, specificity towards sphingolipid labeling can be achieved by blocking sphingosine-1-phosphate lyase activity and thus preventing sphingosine derivatives to be channeled into the sphingolipid-to-glycerolipid metabolic pathway. Here we report an approach using clustered, regularly interspaced, short palindromic repeats (CRISPR-associated nuclease Cas9 to create a sphingosine-1-phosphate lyase (SGPL1 HeLa knockout cell line to disrupt the sphingolipid-to-glycerolipid metabolic pathway. We found that the lipid and protein compositions as well as sphingolipid metabolism of SGPL1 knock-out HeLa cells only show little adaptations, which validates these cells as model systems to study transient protein-sphingolipid interactions.

  3. Targeting sphingosine-1-phosphate lyase as an anabolic therapy for bone loss.

    Science.gov (United States)

    Weske, Sarah; Vaidya, Mithila; Reese, Alina; von Wnuck Lipinski, Karin; Keul, Petra; Bayer, Julia K; Fischer, Jens W; Flögel, Ulrich; Nelsen, Jens; Epple, Matthias; Scatena, Marta; Schwedhelm, Edzard; Dörr, Marcus; Völzke, Henry; Moritz, Eileen; Hannemann, Anke; Rauch, Bernhard H; Gräler, Markus H; Heusch, Gerd; Levkau, Bodo

    2018-05-01

    Sphingosine-1-phosphate (S1P) signaling influences bone metabolism, but its therapeutic potential in bone disorders has remained unexplored. We show that raising S1P levels in adult mice through conditionally deleting or pharmacologically inhibiting S1P lyase, the sole enzyme responsible for irreversibly degrading S1P, markedly increased bone formation, mass and strength and substantially decreased white adipose tissue. S1P signaling through S1P 2 potently stimulated osteoblastogenesis at the expense of adipogenesis by inversely regulating osterix and PPAR-γ, and it simultaneously inhibited osteoclastogenesis by inducing osteoprotegerin through newly discovered p38-GSK3β-β-catenin and WNT5A-LRP5 pathways. Accordingly, S1P 2 -deficient mice were osteopenic and obese. In ovariectomy-induced osteopenia, S1P lyase inhibition was as effective as intermittent parathyroid hormone (iPTH) treatment in increasing bone mass and was superior to iPTH in enhancing bone strength. Furthermore, lyase inhibition in mice successfully corrected severe genetic osteoporosis caused by osteoprotegerin deficiency. Human data from 4,091 participants of the SHIP-Trend population-based study revealed a positive association between serum levels of S1P and bone formation markers, but not resorption markers. Furthermore, serum S1P levels were positively associated with serum calcium , negatively with PTH , and curvilinearly with body mass index. Bone stiffness, as determined through quantitative ultrasound, was inversely related to levels of both S1P and the bone formation marker PINP, suggesting that S1P stimulates osteoanabolic activity to counteract decreasing bone quality. S1P-based drugs should be considered as a promising therapeutic avenue for the treatment of osteoporotic diseases.

  4. Highly Active and Specific Tyrosine Ammonia-Lyases from Diverse Origins Enable Enhanced Production of Aromatic Compounds in Bacteria and Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Jendresen, Christian Bille; Stahlhut, Steen Gustav; Li, Mingji

    2015-01-01

    Phenylalanine and tyrosine ammonia-lyases form cinnamic acid and p-coumaric acid, which are precursors of a wide range of aromatic compounds of biotechnological interest. Lack of highly active and specific tyrosine ammonia-lyases has previously been a limitation in metabolic engineering approaches...

  5. Pectinolytic bacteria and their secreted pectate lyases: agents for the maceration and solubilization of phytomass for fuels production

    Energy Technology Data Exchange (ETDEWEB)

    Preston, J.F. III; Rice, J.D.; Chow, M.C. (Florida Univ., Gainesville, FL (United States). Dept. of Microbiology and Cell Science)

    1993-01-01

    The objectives of this research have been to identify the pectinolytic enzymes secreted by bacteria and apply these towards the enhanced maceration and solubilization of plant material, focusing on the pectate lyases secreted by the phytopathogenic strains of Erwinia chrysanthemi, the ruminant resident Lachnospira multiparus, and the wood digestor isolate, Clostridium populeti. An HPLC approach has been developed that permits the kinetic analysis of each enzyme with respect to the formation of individual products during the pectate depolymerization process. This approach has demonstrated that each of these organisms secretes a nonrandom trimer-generating pectate lyase with a combination of endolytic and exolytic depolymerizing mechanisms. Two different strains of E. chrysanthemi secrete a battery of pectate lyases that include random endolytic as well as nonrandom dimer - and nonrandom trimer-generating endolytic/exolytic mechanisms. (author)

  6. Microbial β-etherases and glutathione lyases for lignin valorisation in biorefineries: current state and future perspectives.

    Science.gov (United States)

    Husarcíková, Jana; Voß, Hauke; Domínguez de María, Pablo; Schallmey, Anett

    2018-05-04

    Lignin is the major aromatic biopolymer in nature, and it is considered a valuable feedstock for the future supply of aromatics. Hence, its valorisation in biorefineries is of high importance, and various chemical and enzymatic approaches for lignin depolymerisation have been reported. Among the enzymes known to act on lignin, β-etherases offer the possibility for a selective cleavage of the β-O-4 aryl ether bonds present in lignin. These enzymes, together with glutathione lyases, catalyse a reductive, glutathione-dependent ether bond cleavage displaying high stereospecificity. β-Etherases and glutathione lyases both belong to the superfamily of glutathione transferases, and several structures have been solved recently. Additionally, different approaches for their application in lignin valorisation have been reported in the last years. This review gives an overview on the current knowledge on β-etherases and glutathione lyases, their biochemical and structural features, and critically discusses their potential for application in biorefineries.

  7. [Sudden death of a patient with 3-hydroxy-3-methylglutaryl coenzyme A lyase deficiency].

    Science.gov (United States)

    Vilaseca Busca, M A; Ribes Rubio, A; Briones Godino, P; Cusi Sánchez, V; Baraíbar Castelló, R; Gairi Taull, J M

    1990-02-01

    A new case of neonatal 3-hydroxy-3-methylglutaric aciduria is described. 3-hydroxy-3-methylglutaryl CoA lyase activities in leukocytes demonstrated the patient's homozygosity and the heterozygous character of the parents and two other members of the family. Dietetic management with low fat high carbohydrate diet together with protein restriction and carnitine resulted in a good control of the metabolic acidosis, the hypoglycemia, and the physical and neurological development. Nevertheless, sudden death occurred at the age thirteen months without any previous apparent trouble and the necropsia showed neither signs of infection nor hepatic or cardiac derangement.

  8. Evaluation of the hydroxynitrile lyase activity in cell cultures of capulin (Prunus serotina).

    Science.gov (United States)

    Hernández, Liliana; Luna, Héctor; Navarro-Ocaña, Arturo; Olivera-Flores, Ma Teresa de Jesús; Ayala, Ivon

    2008-07-01

    Enzymatic preparations obtained from young plants and cell cultures of capulin were screened for hydroxynitrile lyase activity. The three week old plants, grown under sterile conditions, were used to establish a solid cell culture. Crude preparations obtained from this plant material were evaluated for the transformation of benzaldehyde to the corresponding cyanohydrin (mandelonitrile). The results show that the crude material from roots, stalks, and leaves of young plants and calli of roots, stalks, internodes and petioles biocatalyzed the addition of hydrogen cyanide (HCN) to benzaldehyde with a modest to excellent enantioselectivity.

  9. Kinetic resolution and stereoselective synthesis of 3-substituted aspartic acids by using engineered methylaspartate ammonia lyases.

    Science.gov (United States)

    Raj, Hans; Szymanski, Wiktor; de Villiers, Jandré; Puthan Veetil, Vinod; Quax, Wim J; Shimamoto, Keiko; Janssen, Dick B; Feringa, Ben L; Poelarends, Gerrit J

    2013-08-19

    Enzymatic amino acid synthesis: Kinetic resolution and asymmetric synthesis of various valuable 3-substituted aspartic acids, which were obtained in fair to good yields with diastereomeric ratio values of up to >98:2 and enantiomeric excess values of up to >99 %, by using engineered methylaspartate ammonia lyases are described. These biocatalytic methodologies for the selective preparation of aspartic acid derivatives appear to be attractive alternatives for existing chemical methods. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  10. C P -violation in the two Higgs doublet model: From the LHC to EDMs

    Science.gov (United States)

    Chen, Chien-Yi; Li, Hao-Lin; Ramsey-Musolf, Michael

    2018-01-01

    We study the prospective sensitivity to C P -violating two Higgs doublet models from the 14 TeV LHC and future electric dipole moment (EDM) experiments. We concentrate on the search for a resonant heavy Higgs that decays to a Z boson and a SM-like Higgs h , leading to the Z (ℓℓ)h (b b ¯ ) final state. The prospective LHC reach is analyzed using the Boosted Decision Tree method. We illustrate the complementarity between the LHC and low energy EDM measurements and study the dependence of the physics reach on the degree of deviation from the alignment limit. In all cases, we find that there exists a large part of parameter space that is sensitive to both EDMs and LHC searches.

  11. Overview of $C\\!P$V parameter $\\phi_{s}$ determination

    CERN Document Server

    Batozskaya, Varvara

    2018-01-01

    The one of main goals of the LHCb experiment is the measurement of the mixing-induced $C\\!P$-violating phase $\\phi_{s}$ in the $B^{0}_{s}-\\bar{B}^{0}_{s}$ system. It has been measured exploiting the Run~I data set, using several decay channels. The most recent results obtained analyzing $B^{0}_{s}\\to J/\\psi K^{+}K^{-}$ candidates in the $K^{+}K^{-}$ mass region above the $\\phi(1020)$ resonance are presented. The measurements using the same final state with the $m(K^{+}K^{-})$ at the $\\phi(1020)$ and $B^{0}_{s}\\to J/\\psi \\pi^{+}\\pi^{-}$, as well as using the $B^{0}_{s}\\to \\psi(2S)\\phi$ decay are discussed.

  12. Measurements of the $C\\!P$-violating phase $\\phi_{s}$ at LHCb

    CERN Document Server

    Batozskaya, Varvara

    2018-01-01

    The measurement of the mixing-induced $C\\!P$-violating phase $\\phi_{s}$ in the $B^{0}_{s}-\\bar{B}^{0}_{s}$ system is one of the key goals of the LHCb experiment. It has been measured at the LHCb collaboration exploiting the Run~I data set and using several decay channels. In particular, the most recent Run~I result has been obtained analyzing $B^{0}_{s}\\to J/\\psi K^{+}K^{-}$ candidates in the mass region above the $\\phi(1020)$ resonance. Despite the large improvements in the sensitivity of $\\phi_{s}$ during the last decade, the precision is still limited by the available statistics.

  13. Study of the reaction 14 C (p,p) 14 C

    International Nuclear Information System (INIS)

    Murillo, G.; Ramirez, J.; Avila, O.; Fernandez, M.; Darden, S.E.; Prior, R.P.; Sen, S.

    1991-04-01

    The study of the elastic scattering of polarized protons in 14 C, it has been very limited. Some angular distributions exists to low energy, as well as measures of excitation functions to several angles for the differential section and the vectorial analyzer power. A detailed study of the elastic scattering of protons by 14 C, it give us experimental information of the excited states in 15 N. The study of these states, is since of considerable interest it is not very easy to obtain a target of 14 C also in a reaction 14 C (p,p) 14 C is possible to obtain information of levels in 15 N to an excitation energy E X >14.95 MeV. (Author)

  14. Induction of phospholipase- and flagellar synthesis in Serratia liquefaciens is controlled by expression of the flagellar master operon flhD

    DEFF Research Database (Denmark)

    Givskov, M; Eberl, L; Christiansen, Gunna

    1995-01-01

    . Expression of flagella is demonstrated to follow a growth-phase-dependent pattern. Cloning, complementation studies and DNA-sequencing analysis has identified a genetic region in Serratia liquefaciens which exhibits extensive homology to the Escherichia coli flhD flagellar master operon. Interruption...... of the chromosomal flhD operon in S. liquefaciens results in non-flagellated and phospholipase-negative cells, but the synthesis of other exoenzymes is not affected. By placing the flhD operon under the control of a foreign inducible promoter we have shown that increased transcription through the flhD operon leads...

  15. CcpA affects expression of the groESL and dnaK operons in Lactobacillus plantarum

    Directory of Open Access Journals (Sweden)

    Marasco Rosangela

    2006-11-01

    Full Text Available Abstract Background Lactic acid bacteria (LAB are widely used in food industry and their growth performance is important for the quality of the fermented product. During industrial processes changes in temperature may represent an environmental stress to be overcome by starters and non-starters LAB. Studies on adaptation to heat shock have shown the involvement of the chaperon system-proteins in various Gram-positive bacteria. The corresponding operons, namely the dnaK and groESL operons, are controlled by a negative mechanism involving the HrcA repressor protein binding to the cis acting element CIRCE. Results We studied adaptation to heat shock in the lactic acid bacterium Lactobacillus plantarum. The LM3-2 strain, carrying a null mutation in the ccpA gene, encoding the catabolite control protein A (CcpA, showed a lower percent of survival to high temperature with respect to the LM3 wild type strain. Among proteins differentially expressed in the two strains, the GroES chaperon was more abundant in the wild type strain compared to the mutant strain under standard growth conditions. Transcriptional studies showed that class I heat shock operons were differentially expressed upon heat shock in both strains. Indeed, the dnaK and groESL operons were induced about two times more in the LM3 strain compared to the LM3-2 strain. Analysis of the regulatory region of the two operons showed the presence of cre sequences, putative binding sites for the CcpA protein. Conclusion The L. plantarum dnaK and groESL operons are characterized by the presence of the cis acting sequence CIRCE in the promoter region, suggesting a negative regulation by the HrcA/CIRCE system, which is a common type of control among the class I heat shock operons of Gram-positive bacteria. We found an additional system of regulation, based on a positive control exerted by the CcpA protein, which would interact with cre sequences present in the regulatory region of the dnaK and gro

  16. Involvement of the ribose operon repressor RbsR in regulation of purine nucleotide synthesis in Escherichia coli.

    Science.gov (United States)

    Shimada, Tomohiro; Kori, Ayako; Ishihama, Akira

    2013-07-01

    Escherichia coli is able to utilize d-ribose as its sole carbon source. The genes for the transport and initial-step metabolism of d-ribose form a single rbsDACBK operon. RbsABC forms the ABC-type high-affinity d-ribose transporter, while RbsD and RbsK are involved in the conversion of d-ribose into d-ribose 5-phosphate. In the absence of inducer d-ribose, the ribose operon is repressed by a LacI-type transcription factor RbsR, which is encoded by a gene located downstream of this ribose operon. At present, the rbs operon is believed to be the only target of regulation by RbsR. After Genomic SELEX screening, however, we have identified that RbsR binds not only to the rbs promoter but also to the promoters of a set of genes involved in purine nucleotide metabolism. Northern blotting analysis indicated that RbsR represses the purHD operon for de novo synthesis of purine nucleotide but activates the add and udk genes involved in the salvage pathway of purine nucleotide synthesis. Taken together, we propose that RbsR is a global regulator for switch control between the de novo synthesis of purine nucleotides and its salvage pathway. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  17. UlaR activates expression of the ula operon in Streptococcus pneumoniae in the presence of ascorbic acid.

    Science.gov (United States)

    Afzal, Muhammad; Shafeeq, Sulman; Henriques-Normark, Birgitta; Kuipers, Oscar P

    2015-01-01

    In this study, the regulatory mechanism of the ula (utilization of l-ascorbic acid) operon, putatively responsible for transport and utilization of ascorbic acid in Streptococcus pneumoniae strain D39, is studied. β-Galactosidase assay data demonstrate that expression of the ula operon is increased in the presence of ascorbic acid as compared with the effects of other sugar sources including glucose. The ula operon consists of nine genes, including a transcriptional regulator UlaR, and is transcribed as a single transcriptional unit. We demonstrate the role of the transcriptional regulator UlaR as a transcriptional activator of the ula operon in the presence of ascorbic acid and show that activation of the ula operon genes by UlaR is CcpA-independent. Furthermore, we predict a 16 bp regulatory site (5'-AACAGTCCGCTGTGTA-3') for UlaR in the promoter region of ulaA. Deletion of the half or full UlaR regulatory site in PulaA confirmed that the UlaR regulatory site present in PulaA is functional. © 2015 The Authors.

  18. Utilization of Glyphosate as Phosphate Source: Biochemistry and Genetics of Bacterial Carbon-Phosphorus Lyase

    Science.gov (United States)

    Zechel, David L.; Jochimsen, Bjarne

    2014-01-01

    SUMMARY After several decades of use of glyphosate, the active ingredient in weed killers such as Roundup, in fields, forests, and gardens, the biochemical pathway of transformation of glyphosate phosphorus to a useful phosphorus source for microorganisms has been disclosed. Glyphosate is a member of a large group of chemicals, phosphonic acids or phosphonates, which are characterized by a carbon-phosphorus bond. This is in contrast to the general phosphorus compounds utilized and metabolized by microorganisms. Here phosphorus is found as phosphoric acid or phosphate ion, phosphoric acid esters, or phosphoric acid anhydrides. The latter compounds contain phosphorus that is bound only to oxygen. Hydrolytic, oxidative, and radical-based mechanisms for carbon-phosphorus bond cleavage have been described. This review deals with the radical-based mechanism employed by the carbon-phosphorus lyase of the carbon-phosphorus lyase pathway, which involves reactions for activation of phosphonate, carbon-phosphorus bond cleavage, and further chemical transformation before a useful phosphate ion is generated in a series of seven or eight enzyme-catalyzed reactions. The phn genes, encoding the enzymes for this pathway, are widespread among bacterial species. The processes are described with emphasis on glyphosate as a substrate. Additionally, the catabolism of glyphosate is intimately connected with that of aminomethylphosphonate, which is also treated in this review. Results of physiological and genetic analyses are combined with those of bioinformatics analyses. PMID:24600043

  19. Isolation and characterization of an Antarctic Flavobacterium strain with agarase and alginate lyase activities

    Directory of Open Access Journals (Sweden)

    Lavín Paris

    2016-09-01

    Full Text Available Several bacteria that are associated with macroalgae can use phycocolloids as a carbon source. Strain INACH002, isolated from decomposing Porphyra (Rhodophyta, in King George Island, Antarctica, was screened and characterized for the ability to produce agarase and alginate-lyase enzymatic activities. Our strain INACH002 was identified as a member of the genus Flavobacterium, closely related to Flavobacterium faecale, using 16S rRNA gene analysis. The INACH002 strain was characterized as psychrotrophic due to its optimal temperature (17ºC and maximum temperature (20°C of growth. Agarase and alginate-lyase displayed enzymatic activities within a range of 10°C to 50°C, with differences in the optimal temperature to hydrolyze agar (50°C, agarose (50°C and alginate (30°C during the first 30 min of activity. Strain Flavobacterium INACH002 is a promising Antarctic biotechnological resource; however, further research is required to illustrate the structural and functional bases of the enzymatic performance observed during the degradation of different substrates at different temperatures.

  20. Enantioselective Synthesis of Various Cyanohydrins Using Covalently Immobilized Preparations of Hydroxynitrile Lyase from Prunus dulcis.

    Science.gov (United States)

    Alagöz, Dilek; Tükel, S Seyhan; Yildirim, Deniz

    2015-11-01

    The carrier-based and carrier-free (cross-linked enzyme aggregate) covalent immobilizations of Prunus dulcis hydroxynitrile lyase were investigated. The immobilized preparations were tested for enantioselective carbon-carbon bond formation activity in the biphasic medium. Of the tested preparations, only cross-linked enzyme aggregate of P. dulcis hydroxynitrile lyase (PdHNL-CLEA) achieved the synthesis of (R)-mandelonitrile with 93% yield and 99% enantiopurity. PdHNL-CLEA was also used in the synthesis of various (R)-cyanohydrins from corresponding aldehydes/ketones and hydrocyanic acid. When 4-methoxybenzaldehyde, 4-methyl benzaldehyde, and 4-hydroxybenzaldehyde were used as substrates, the yield-enantiomeric excess of corresponding (R)-cyanohydrins were obtained as 95-95, 85-79, and 2-25%, respectively, after 96 h at pH 4.0 and 5 °C. For acetophenone, 4-fluoroacetophenone, 4-chloroacetophenone, 4-bromoacetophenone, and 4-iodoacetophenone, the yield-enantiomeric excess of corresponding (R)-cyanohydrins were 1-99, 20-84, 11-95, 5-99, and 3-24%, respectively at the same conditions. The results demonstrate PdHNL-CLEA can be effectively used in the synthesis of (R)-mandelonitrile.

  1. Abundance and genetic diversity of microbial polygalacturonase and pectate lyase in the sheep rumen ecosystem.

    Directory of Open Access Journals (Sweden)

    Peng Yuan

    Full Text Available Efficient degradation of pectin in the rumen is necessary for plant-based feed utilization. The objective of this study was to characterize the diversity, abundance, and functions of pectinases from microorganisms in the sheep rumen.A total of 103 unique fragments of polygalacturonase (PF00295 and pectate lyase (PF00544 and PF09492 genes were retrieved from microbial DNA in the rumen of a Small Tail Han sheep, and 66% of the sequences of these fragments had low identities (<65% with known sequences. Phylogenetic tree building separated the PF00295, PF00544, and PF09492 sequences into five, three, and three clades, respectively. Cellulolytic and noncellulolytic Butyrivibrio, Prevotella, and Fibrobacter species were the major sources of the pectinases. The two most abundant pectate lyase genes were cloned, and their protein products, expressed in Escherichia coli, were characterized. Both enzymes probably act extracellularly as their nucleotide sequences contained signal sequences, and they had optimal activities at the ruminal physiological temperature and complementary pH-dependent activity profiles.This study reveals the specificity, diversity, and abundance of pectinases in the rumen ecosystem and provides two additional ruminal pectinases for potential industrial use under physiological conditions.

  2. Expression and properties of the highly alkalophilic phenylalanine ammonia-lyase of thermophilic Rubrobacter xylanophilus.

    Directory of Open Access Journals (Sweden)

    Klaudia Kovács

    Full Text Available The sequence of a phenylalanine ammonia-lyase (PAL; EC: 4.3.1.24 of the thermophilic and radiotolerant bacterium Rubrobacter xylanophilus (RxPAL was identified by screening the genomes of bacteria for members of the phenylalanine ammonia-lyase family. A synthetic gene encoding the RxPAL protein was cloned and overexpressed in Escherichia coli TOP 10 in a soluble form with an N-terminal His6-tag and the recombinant RxPAL protein was purified by Ni-NTA affinity chromatography. The activity assay of RxPAL with l-phenylalanine at various pH values exhibited a local maximum at pH 8.5 and a global maximum at pH 11.5. Circular dichroism (CD studies showed that RxPAL is associated with an extensive α-helical character (far UV CD and two distinctive near-UV CD peaks. These structural characteristics were well preserved up to pH 11.0. The extremely high pH optimum of RxPAL can be rationalized by a three-dimensional homology model indicating possible disulfide bridges, extensive salt-bridge formation and an excess of negative electrostatic potential on the surface. Due to these properties, RxPAL may be a candidate as biocatalyst in synthetic biotransformations leading to unnatural l- or d-amino acids or as therapeutic enzyme in treatment of phenylketonuria or leukemia.

  3. Sugar-cane juice induces pectin lyase and polygalacturonase in Penicillium griseoroseum

    Directory of Open Access Journals (Sweden)

    Minussi Rosana Cristina

    1998-01-01

    Full Text Available The use of other inducers as substitutes for pectin was studied aiming to reduce the production costs of pectic enzymes. The effects of sugar-cane juice on the production of pectin lyase (PL and polygalacturonase (PG by Penicillium griseoroseum were investigated. The fungus was cultured in a mineral medium (pH 6.3 in a rotary shaker (150 rpm for 48 h at 25oC. Culture media were supplemented with yeast extract and sucrose or sugar-cane juice. Sugar-cane juice added singly to the medium promoted higher PL activity and mycelial dry weight when compared to pectin and the use of sugar-cane juice and yeast extract yielded levels of PG activity that were similar to those obtained with sucrose-yeast extract or pectin. The results indicated that, even at low concentrations, sugar-cane juice was capable of inducing pectin lyase and polygalacturonase with no cellulase activity in P. griseoroseum.

  4. The effect of stochasticity on the lac operon: an evolutionary perspective.

    Directory of Open Access Journals (Sweden)

    Milan van Hoek

    2007-06-01

    Full Text Available The role of stochasticity on gene expression is widely discussed. Both potential advantages and disadvantages have been revealed. In some systems, noise in gene expression has been quantified, in among others the lac operon of Escherichia coli. Whether stochastic gene expression in this system is detrimental or beneficial for the cells is, however, still unclear. We are interested in the effects of stochasticity from an evolutionary point of view. We study this question in the lac operon, taking a computational approach: using a detailed, quantitative, spatial model, we evolve through a mutation-selection process the shape of the promoter function and therewith the effective amount of stochasticity. We find that noise values for lactose, the natural inducer, are much lower than for artificial, nonmetabolizable inducers, because these artificial inducers experience a stronger positive feedback. In the evolved promoter functions, noise due to stochasticity in gene expression, when induced by lactose, only plays a very minor role in short-term physiological adaptation, because other sources of population heterogeneity dominate. Finally, promoter functions evolved in the stochastic model evolve to higher repressed transcription rates than those evolved in a deterministic version of the model. This causes these promoter functions to experience less stochasticity in gene expression. We show that a high repression rate and hence high stochasticity increases the delay in lactose uptake in a variable environment. We conclude that the lac operon evolved such that the impact of stochastic gene expression is minor in its natural environment, but happens to respond with much stronger stochasticity when confronted with artificial inducers. In this particular system, we have shown that stochasticity is detrimental. Moreover, we demonstrate that in silico evolution in a quantitative model, by mutating the parameters of interest, is a promising way to unravel

  5. Fate of the H-NS-repressed bgl operon in evolution of Escherichia coli.

    Directory of Open Access Journals (Sweden)

    T Sabari Sankar

    2009-03-01

    Full Text Available In the enterobacterial species Escherichia coli and Salmonella enterica, expression of horizontally acquired genes with a higher than average AT content is repressed by the nucleoid-associated protein H-NS. A classical example of an H-NS-repressed locus is the bgl (aryl-beta,D-glucoside operon of E. coli. This locus is "cryptic," as no laboratory growth conditions are known to relieve repression of bgl by H-NS in E. coli K12. However, repression can be relieved by spontaneous mutations. Here, we investigated the phylogeny of the bgl operon. Typing of bgl in a representative collection of E. coli demonstrated that it evolved clonally and that it is present in strains of the phylogenetic groups A, B1, and B2, while it is presumably replaced by a cluster of ORFans in the phylogenetic group D. Interestingly, the bgl operon is mutated in 20% of the strains of phylogenetic groups A and B1, suggesting erosion of bgl in these groups. However, bgl is functional in almost all B2 isolates and, in approximately 50% of them, it is weakly expressed at laboratory growth conditions. Homologs of bgl genes exist in Klebsiella, Enterobacter, and Erwinia species and also in low GC-content Gram-positive bacteria, while absent in E. albertii and Salmonella sp. This suggests horizontal transfer of bgl genes to an ancestral Enterobacterium. Conservation and weak expression of bgl in isolates of phylogenetic group B2 may indicate a functional role of bgl in extraintestinal pathogenic E. coli.

  6. Role of Tellurite Resistance Operon in Filamentous Growth of Yersinia pestis in Macrophages.

    Science.gov (United States)

    Ponnusamy, Duraisamy; Clinkenbeard, Kenneth D

    2015-01-01

    Yersinia pestis initiates infection by parasitism of host macrophages. In response to macrophage infections, intracellular Y. pestis can assume a filamentous cellular morphology which may mediate resistance to host cell innate immune responses. We previously observed the expression of Y. pestis tellurite resistance proteins TerD and TerE from the terZABCDE operon during macrophage infections. Others have observed a filamentous response associated with expression of tellurite resistance operon in Escherichia coli exposed to tellurite. Therefore, in this study we examine the potential role of Y. pestis tellurite resistance operon in filamentous cellular morphology during macrophage infections. In vitro treatment of Y. pestis culture with sodium tellurite (Na2TeO3) caused the bacterial cells to assume a filamentous phenotype similar to the filamentous phenotype observed during macrophage infections. A deletion mutant for genes terZAB abolished the filamentous morphologic response to tellurite exposure or intracellular parasitism, but without affecting tellurite resistance. However, a terZABCDE deletion mutant abolished both filamentous morphologic response and tellurite resistance. Complementation of the terZABCDE deletion mutant with terCDE, but not terZAB, partially restored tellurite resistance. When the terZABCDE deletion mutant was complemented with terZAB or terCDE, Y. pestis exhibited filamentous morphology during macrophage infections as well as while these complemented genes were being expressed under an in vitro condition. Further in E. coli, expression of Y. pestis terZAB, but not terCDE, conferred a filamentous phenotype. These findings support the role of Y. pestis terZAB mediation of the filamentous response phenotype; whereas, terCDE confers tellurite resistance. Although the beneficial role of filamentous morphological responses by Y. pestis during macrophage infections is yet to be fully defined, it may be a bacterial adaptive strategy to macrophage

  7. A fluorescent bioreporter for acetophenone and 1-phenylethanol derived from a specifically induced catabolic operon

    Directory of Open Access Journals (Sweden)

    Enrico eMuhr

    2016-01-01

    Full Text Available The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosomal DNA of A. aromaticum. The mCherry fusion protein indeed responded consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence based flow cytometry and immunoblot analysis, the recorded amounts of mCherry production were found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 µM (detection limit to 250 µM after 12 and 24 hours. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with application potentials reaching from environmental monitoring to petroleum prospecting.

  8. A Fluorescent Bioreporter for Acetophenone and 1-Phenylethanol derived from a Specifically Induced Catabolic Operon.

    Science.gov (United States)

    Muhr, Enrico; Leicht, Oliver; González Sierra, Silvia; Thanbichler, Martin; Heider, Johann

    2015-01-01

    The β-proteobacterium Aromatoleum aromaticum degrades the aromatic ketone acetophenone, a key intermediate of anaerobic ethylbenzene metabolism, either aerobically or anaerobically via a complex ATP-dependent acetophenone carboxylase and a benzoylacetate-CoA ligase. The genes coding for these enzymes (apcABCDE and bal) are organized in an apparent operon and are expressed in the presence of the substrate acetophenone. To study the conditions under which this operon is expressed in more detail, we constructed a reporter strain by inserting a gene fusion of apcA, the first gene of the apc-bal operon, with the gene for the fluorescent protein mCherry into the chromosome of A. aromaticum. The fusion protein indeed accumulated consistently with the expression pattern of the acetophenone-metabolic enzymes under various growth conditions. After evaluating and quantifying the data by fluorescence microscopy, fluorescence-based flow cytometry and immunoblot analysis, mCherry production was found to be proportional to the applied acetophenone concentrations. The reporter strain allowed quantification of acetophenone within a concentration range of 50 μM (detection limit) to 250 μM after 12 and 24 h. Moreover, production of the Apc-mCherry fusion protein in the reporter strain was highly specific and responded to acetophenone and both enantiomers of 1-phenylethanol, which are easily converted to acetophenone. Other analogous substrates showed either a significantly weaker response or none at all. Therefore, the reporter strain provides a basis for the development of a specific bioreporter system for acetophenone with an application potential reaching from environmental monitoring to petroleum prospecting.

  9. Transcriptional activation of the tad type IVb pilus operon by PypB in Yersinia enterocolitica.

    Science.gov (United States)

    Schilling, Jennifer; Wagner, Karin; Seekircher, Stephanie; Greune, Lilo; Humberg, Verena; Schmidt, M Alexander; Heusipp, Gerhard

    2010-07-01

    Type IV pili are virulence factors in various bacteria and mediate, among other functions, the colonization of diverse surfaces. Various subclasses of type IV pili have been identified, but information on pilus expression, biogenesis, and the associated phenotypes is sparse for the genus Yersinia. We recently described the identification of PypB as a transcriptional regulator in Yersinia enterocolitica. Here we show that the pypB gene is associated with the tad locus, a genomic island that is widespread among bacterial and archaeal species. The genetic linkage of pypB with the tad locus is conserved throughout the yersiniae but is not found among other bacteria carrying the tad locus. We show that the genes of the tad locus form an operon in Y. enterocolitica that is controlled by PypB and that pypB is part of this operon. The tad genes encode functions necessary for the biogenesis of the Flp subfamily of type IVb pili initially described for Aggregatibacter actinomycetemcomitans to mediate a tight-adherence phenotype. In Y. enterocolitica, the Flp pilin protein shows some peculiarities in its amino acid sequence that imply similarities as well as differences compared to typical motifs found in the Flp subtype of type IVb pili. Flp is expressed and processed after PypB overproduction, resulting in microcolony formation but not in increased adherence to biotic or abiotic surfaces. Our data describe the transcriptional regulation of the tad type IVb pilus operon by PypB in Y. enterocolitica but fail to show most previously described phenotypes associated with this type of pilus in other bacteria.

  10. fbpABC gene cluster in Neisseria meningitidis is transcribed as an operon.

    Science.gov (United States)

    Khun, H H; Deved, V; Wong, H; Lee, B C

    2000-12-01

    The neisserial fbpABC locus has been proposed to constitute a single transcriptional unit. To confirm this operonic arrangement, transcription assays using reverse transcriptase PCR amplification were conducted with Neisseria meningitidis. The presence of fbpAB and fbpBC transcripts obtained by priming cDNA synthesis with an fbpC-sequence-specific oligonucleotide indicates that fbpABC is organized as a single expression unit. The ratio of fbpA to fbpABC mRNA was approximately between 10- to 20-fold, as determined by real-time quantitative PCR.

  11. The atlA Operon of Streptococcus mutans: Role in Autolysin Maturation and Cell Surface Biogenesis

    OpenAIRE

    Ahn, Sang-Joon; Burne, Robert A.

    2006-01-01

    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C term...

  12. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Directory of Open Access Journals (Sweden)

    Lindblad Peter

    2008-04-01

    Full Text Available Abstract Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the

  13. Transcription of the extended hyp-operon in Nostoc sp. strain PCC 7120

    Science.gov (United States)

    Agervald, Åsa; Stensjö, Karin; Holmqvist, Marie; Lindblad, Peter

    2008-01-01

    Background The maturation of hydrogenases into active enzymes is a complex process and e.g. a correctly assembled active site requires the involvement of at least seven proteins, encoded by hypABCDEF and a hydrogenase specific protease, encoded either by hupW or hoxW. The N2-fixing cyanobacterium Nostoc sp. strain PCC 7120 may contain both an uptake and a bidirectional hydrogenase. The present study addresses the presence and expression of hyp-genes in Nostoc sp. strain PCC 7120. Results RT-PCRs demonstrated that the six hyp-genes together with one ORF may be transcribed as a single operon. Transcriptional start points (TSPs) were identified 280 bp upstream from hypF and 445 bp upstream of hypC, respectively, demonstrating the existence of several transcripts. In addition, five upstream ORFs located in between hupSL, encoding the small and large subunits of the uptake hydrogenase, and the hyp-operon, and two downstream ORFs from the hyp-genes were shown to be part of the same transcript unit. A third TSP was identified 45 bp upstream of asr0689, the first of five ORFs in this operon. The ORFs are annotated as encoding unknown proteins, with the exception of alr0692 which is identified as a NifU-like protein. Orthologues of the four ORFs asr0689-alr0692, with a highly conserved genomic arrangement positioned between hupSL, and the hyp genes are found in several other N2-fixing cyanobacteria, but are absent in non N2-fixing cyanobacteria with only the bidirectional hydrogenase. Short conserved sequences were found in six intergenic regions of the extended hyp-operon, appearing between 11 and 79 times in the genome. Conclusion This study demonstrated that five ORFs upstream of the hyp-gene cluster are co-transcribed with the hyp-genes, and identified three TSPs in the extended hyp-gene cluster in Nostoc sp. strain PCC 7120. This may indicate a function related to the assembly of a functional uptake hydrogenase, hypothetically in the assembly of the small subunit of

  14. Role of P27 -P55 operon from Mycobacterium tuberculosis in the resistance to toxic compounds

    Directory of Open Access Journals (Sweden)

    Cataldi Angel A

    2011-07-01

    Full Text Available Abstract Background The P27-P55 (lprG-Rv1410c operon is crucial for the survival of Mycobacterium tuberculosis, the causative agent of human tuberculosis, during infection in mice. P55 encodes an efflux pump that has been shown to provide Mycobacterium smegmatis and Mycobacterium bovis BCG with resistance to several drugs, while P27 encodes a mannosylated glycoprotein previously described as an antigen that modulates the immune response against mycobacteria. The objective of this study was to determine the individual contribution of the proteins encoded in the P27-P55 operon to the resistance to toxic compounds and to the cell wall integrity of M. tuberculosis. Method In order to test the susceptibility of a mutant of M. tuberculosis H37Rv in the P27-P55 operon to malachite green, sodium dodecyl sulfate, ethidium bromide, and first-line antituberculosis drugs, this strain together with the wild type strain and a set of complemented strains were cultivated in the presence and in the absence of these drugs. In addition, the malachite green decolorization rate of each strain was obtained from decolorization curves of malachite green in PBS containing bacterial suspensions. Results The mutant strain decolorized malachite green faster than the wild type strain and was hypersensitive to both malachite green and ethidium bromide, and more susceptible to the first-line antituberculosis drugs: isoniazid and ethambutol. The pump inhibitor reserpine reversed M. tuberculosis resistance to ethidium bromide. These results suggest that P27-P55 functions through an efflux-pump like mechanism. In addition, deletion of the P27-P55 operon made M. tuberculosis susceptible to sodium dodecyl sulfate, suggesting that the lack of both proteins causes alterations in the cell wall permeability of the bacterium. Importantly, both P27 and P55 are required to restore the wild type phenotypes in the mutant. Conclusions The results clearly indicate that P27 and P55 are

  15. Spontaneous mutations in the flhD operon generate motility heterogeneity in Escherichia coli biofilm.

    Science.gov (United States)

    Horne, Shelley M; Sayler, Joseph; Scarberry, Nicholas; Schroeder, Meredith; Lynnes, Ty; Prüß, Birgit M

    2016-11-08

    Heterogeneity and niche adaptation in bacterial biofilm involve changes to the genetic makeup of the bacteria and gene expression control. We hypothesized that i) spontaneous mutations in the flhD operon can either increase or decrease motility and that ii) the resulting motility heterogeneity in the biofilm might lead to a long-term increase in biofilm biomass. We allowed the highly motile E. coli K-12 strain MC1000 to form seven- and fourteen-day old biofilm, from which we recovered reduced motility isolates at a substantially greater frequency (5.4 %) than from a similar experiment with planktonic bacteria (0.1 %). Biofilms formed exclusively by MC1000 degraded after 2 weeks. In contrast, biofilms initiated with a 1:1 ratio of MC1000 and its isogenic flhD::kn mutant remained intact at 4 weeks and the two strains remained in equilibrium for at least two weeks. These data imply that an 'optimal' biofilm may contain a mixture of motile and non-motile bacteria. Twenty-eight of the non-motile MC1000 isolates contained an IS1 element in proximity to the translational start of FlhD or within the open reading frames for FlhD or FlhC. Two isolates had an IS2 and one isolate had an IS5 in the open reading frame for FlhD. An additional three isolates contained deletions that included the RNA polymerase binding site, five isolates contained point mutations and small deletions in the open reading frame for FlhC. The locations of all these mutations are consistent with the lack of motility and further downstream within the flhD operon than previously published IS elements that increased motility. We believe that the location of the mutation within the flhD operon determines whether the effect on motility is positive or negative. To test the second part of our hypothesis where motility heterogeneity in a biofilm may lead to a long-term increase in biofilm biomass, we quantified biofilm biomass by MC1000, MC1000 flhD::kn, and mixtures of the two strains at ratios of 1:1, 10

  16. Purification and crystallization of Phd, the antitoxin of the phd/doc operon

    International Nuclear Information System (INIS)

    Garcia-Pino, Abel; Sterckx, Yann; Vandenbussche, Guy; Loris, Remy

    2010-01-01

    The antitoxin Phd from the phd/doc operon of bacteriophage P1 was crystallized in two distinct crystal forms. The antitoxin Phd from the phd/doc module of bacteriophage P1 was crystallized in two distinct crystal forms. Crystals of His-tagged Phd contain a C-terminally truncated version of the protein and diffract to 2.20 Å resolution. Crystals of untagged Phd purified from the Phd–Doc complex diffract to 2.25 Å resolution. These crystals are partially merohedrally twinned and contain the full-length version of the protein

  17. Hopf Bifurcation and Delay-Induced Turing Instability in a Diffusive lac Operon Model

    Science.gov (United States)

    Cao, Xin; Song, Yongli; Zhang, Tonghua

    In this paper, we investigate the dynamics of a lac operon model with delayed feedback and diffusion effect. If the system is without delay or the delay is small, the positive equilibrium is stable so that there are no spatial patterns formed; while the time delay is large enough the equilibrium becomes unstable so that rich spatiotemporal dynamics may occur. We have found that time delay can not only incur temporal oscillations but also induce imbalance in space. With different initial values, the system may have different spatial patterns, for instance, spirals with one head, four heads, nine heads, and even microspirals.

  18. Transcriptional and post-transcriptional regulation of pst2 operon expression in Vibrio cholerae O1.

    Science.gov (United States)

    da C Leite, Daniel M; Barbosa, Livia C; Mantuano, Nathalia; Goulart, Carolina L; Veríssimo da Costa, Giovani C; Bisch, Paulo M; von Krüger, Wanda M A

    2017-07-01

    One of the most abundant proteins in V. cholerae O1 cells grown under inorganic phosphate (Pi) limitation is PstS, the periplasmic Pi-binding component of the high-affinity Pi transport system Pst2 (PstSCAB), encoded in pst2 operon (pstS-pstC2-pstA2-pstB2). Besides its role in Pi uptake, Pst2 has been also associated with V. cholerae virulence. However, the mechanisms regulating pst2 expression and the non-stoichiometric production of the Pst2 components under Pi-limitation are unknown. A computational-experimental approach was used to elucidate the regulatory mechanisms behind pst2 expression in V. cholerae O1. Bioinformatics analysis of pst2 operon nucleotide sequence revealed start codons for pstS and pstC genes distinct from those originally annotated, a regulatory region upstream pstS containing potential PhoB-binding sites and a pstS-pstC intergenic region longer than predicted. Analysis of nucleotide sequence between pstS-pstC revealed inverted repeats able to form stem-loop structures followed by a potential RNAse E-cleavage site. Another putative RNase E recognition site was identified within the pstA-pstB intergenic sequence. In silico predictions of pst2 operon expression regulation were subsequently tested using cells grown under Pi limitation by promoter-lacZ fusion, gel electrophoresis mobility shift assay and quantitative RT-PCR. The experimental and in silico results matched very well and led us to propose a pst2 promoter sequence upstream of pstS gene distinct from the previously annotated. Furthermore, V. cholerae O1 pst2 operon transcription is PhoB-dependent and generates a polycistronic mRNA molecule that is rapidly processed into minor transcripts of distinct stabilities. The most stable was the pstS-encoding mRNA, which correlates with PstS higher levels relative to other Pst2 components in Pi-starved cells. The relatively higher stability of pstS and pstB transcripts seems to rely on the secondary structures at their 3' untranslated regions

  19. First evidence of direct $C\\!P$ violation in charmless two-body decays of $B^0_s$ mesons

    CERN Document Server

    Aaij, R; Adeva, B; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amhis, Y; Anderson, J; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Arrabito, L; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Bachmann, S; Back, J J; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bates, A; Bauer, C; Bauer, Th; Bay, A; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Benayoun, M; Bencivenni, G; Benson, S; Benton, J; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blanks, C; Blouw, J; Blusk, S; Bobrov, A; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Büchler-Germann, A; Burducea, I; Bursche, A; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carson, L; Carvalho Akiba, K; Casse, G; Cattaneo, M; Cauet, Ch; Charles, M; Charpentier, Ph; Chiapolini, N; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Corti, G; Couturier, B; Cowan, G A; Currie, R; D'Ambrosio, C; David, P; David, P N Y; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Lorenzi, F; De Miranda, J M; De Paula, L; De Simone, P; Decamp, D; Deckenhoff, M; Degaudenzi, H; Del Buono, L; Deplano, C; Derkach, D; Deschamps, O; Dettori, F; Dickens, J; Dijkstra, H; Diniz Batista, P; Domingo Bonal, F; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Dzhelyadin, R; Dziurda, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisele, F; Eisenhardt, S; Ekelhof, R; Eklund, L; Elsasser, Ch; Elsby, D; Esperante Pereira, D; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Fave, V; Fernandez Albor, V; Ferro-Luzzi, M; Filippov, S; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garnier, J-C; Garofoli, J; Garra Tico, J; Garrido, L; Gascon, D; Gaspar, C; Gauld, R; Gauvin, N; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gordon, H; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hampson, T; Hansmann-Menzemer, S; Harji, R; Harnew, N; Harrison, J; Harrison, P F; Hartmann, T; He, J; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hicks, E; Holubyev, K; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Huston, R S; Hutchcroft, D; Hynds, D; Iakovenko, V; Ilten, P; Imong, J; Jacobsson, R; Jaeger, A; Jahjah Hussein, M; Jans, E; Jansen, F; Jaton, P; Jean-Marie, B; Jing, F; John, M; Johnson, D; Jones, C R; Jost, B; Kaballo, M; Kandybei, S; Karacson, M; Karbach, T M; Keaveney, J; Kenyon, I R; Kerzel, U; Ketel, T; Keune, A; Khanji, B; Kim, Y M; Knecht, M; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kruzelecki, K; Kucharczyk, M; Kudryavtsev, V; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leroy, O; Lesiak, T; Li, L; Li Gioi, L; Lieng, M; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; von Loeben, J; Lopes, J H; Lopez Asamar, E; Lopez-March, N; Lu, H; Luisier, J; Mac Raighne, A; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Magnin, J; Malde, S; Mamunur, R M D; Manca, G; Mancinelli, G; Mangiafave, N; Marconi, U; Märki, R; Marks, J; Martellotti, G; Martens, A; Martin, L; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Massafferri, A; Mathe, Z; Matteuzzi, C; Matveev, M; Maurice, E; Maynard, B; Mazurov, A; McGregor, G; McNulty, R; Meissner, M; Merk, M; Merkel, J; Miglioranzi, S; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Mylroie-Smith, J; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neufeld, N; Nguyen, A D; Nguyen-Mau, C; Nicol, M; Niess, V; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Pal, B K; Palacios, J; Palano, A; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Paterson, S K; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perego, D L; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pessina, G; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pie Valls, B; Pietrzyk, B; Pilař, T; Pinci, D; Plackett, R; Playfer, S; Plo Casasus, M; Polok, G; Poluektov, A; Polycarpo, E; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pugatch, V; Puig Navarro, A; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Roa Romero, D A; Robbe, P; Rodrigues, E; Rodrigues, F; Rodriguez Perez, P; Rogers, G J; Roiser, S; Romanovsky, V; Rosello, M; Rouvinet, J; Ruf, T; Ruiz, H; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salzmann, C; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santinelli, R; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schleich, S; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Skwarnicki, T; Smith, N A; Smith, E; Sobczak, K; Soler, F J P; Solomin, A; Soomro, F; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Swientek, S; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tsaregorodtsev, A; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urquijo, P; Uwer, U; Vagnoni, V; Valenti, G; Vazquez Gomez, R; Vazquez Regueiro, P; Vecchi, S; Velthuis, J J; Veltri, M; Viaud, B; Videau, I; Vieira, D; Vilasis-Cardona, X; Visniakov, J; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voss, H; Waldi, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wishahi, J; Witek, M; Witzeling, W; Wotton, S A; Wyllie, K; Xie, Y; Xing, F; Xing, Z; Yang, Z; Young, R; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhong, L; Zvyagin, A

    2012-01-01

    Using a data sample corresponding to an integrated luminosity of 0.35 $\\mathrm{fb}^{-1}$ collected by LHCb in 2011, we report the first evidence of $C\\!P$ violation in the decays of $B^0_s$ mesons to $K^\\pm \\pi^\\mp$ pairs, $A_{C\\!P}(B^0_s \\rightarrow K \\pi)=0.27 \\pm 0.08\\,\\mathrm{(stat)} \\pm 0.02\\,\\mathrm{(syst)}$, with a significance of 3.3$\\sigma$. Furthermore, we report the first observation of $C\\!P$ violation in $B^0$ decays at a hadron collider, $A_{C\\!P}(B^0 \\rightarrow K\\pi)=-0.088 \\pm 0.011\\,\\mathrm{(stat)} \\pm 0.008\\,\\mathrm{(syst)}$, with a significance exceeding 6$\\sigma$.

  20. Partial characterization of ribosomal operons of Lactobacillus delbrueckii UFV H2b20 Caracterização parcial de operons ribossomais de Lactobacillus delbrueckii UFV H2b20

    Directory of Open Access Journals (Sweden)

    Juliana Teixeira de Magalhães

    2005-06-01

    Full Text Available Ribosomal operons are great tools for microbe community characterization and for microorganisms relationship study, particularly in the case of the acid lactic bacteria. The ribosomal operon of the probiotic strain Lactobacillus delbrueckii UFV H2b20 was partially characterized. A genomic library of this strain was constructed and the clones with partial ribosomal operon were sub-cloned using the shot-gun method for subsequent sequencing with the forward primer. The sequence analysis revealed that the 3' end of the rDNA 16S was following by the short spacer region 1 (16S-23S and that the 3' end of the rDNA 23S was following by the short spacer region 2 (23S-5S, which preceded the rDNA 5S. In the flanking region of the rDNA 5S gene of this operon rrn, a region encoding six tRNAs was detected.Operons ribossomais têm sido instrumentos importantes na caracterização de comunidades microbianas e no estudo de relacionamentos entre microrganismos, principalmente em bactérias do ácido láctico. Operons ribossomais da linhagem probiótica, Lactobacillus delbrueckii UFV H2b20, foram parcialmente caracterizados. Um banco genômico da linhagem foi construído e os clones, contendo parte do operon ribossomal, foram subclonados pelo método de "shot gun", para em seguida serem seqüenciados com primer "forward". As seqüências indicaram a presença da extremidade 3' do rDNA 16S seguida da região espaçadora curta 1 (16S-23S e a presença da extremidade 3' do rDNA 23S seguido da região espaçadora 2 (23S-5S, que por sua vez precedia o rDNA 5S. Adjacente ao gene rDNA 5S deste operon rrn uma região codificadora de 6 tRNAs foi detectada.

  1. THE TWO CULTURES OF C. P. SNOW. A CRITICAL APPROACH FROM THE ANTROPOLOGYST

    Directory of Open Access Journals (Sweden)

    Silfredo Rodríguez Bassó

    2009-12-01

    Full Text Available A critical approach to the conference given by C P Snow on May 1959, at Cambridge University from the Cuban story teller vision of Dr. José Núñez Jover, in his article “Returning to the two cultures “, allow us to open our look from a new view point of the antropology discussion as a science or as an art. Science and art get a dimension with the study of alterity, in which the researcher interact with a complex reality in movement, making him to build and rebuild the theory and method of his science to dilute inside the ambiguous border between science with art and viceverse. The three phases in which the Brazilian antropologyst Roberto Cardoso synthezied this office, may be possible through this review, to sustain that the office of the antropologyst during investigation, integrates armonically the solution of social problem of the systematic, rational, exact and verifiable knowledge, on one side; and the experience, imagination, vision and abilities and values during his academic and practice excersise, on the other.

  2. Astrophysical S factor for 13C(p,γ)14N and asymptotic normalization coefficients

    International Nuclear Information System (INIS)

    Mukhamedzhanov, A.M.; Azhari, A.; Gagliardi, C.A.; Sattarov, A.; Tang, X.; Trache, L.; Tribble, R.E.; Burjan, V.; Kroha, V.

    2002-01-01

    We reanalyze the 13 C(p,γ) 14 N radiative capture reaction within the R-matrix approach. The low-energy astrophysical S factor has important contributions from both resonant and onresonant captures. The normalization of the nonresonant component of the transition to a particular 14 N bound state is expressed in terms of the asymptotic normalization coefficient (ANC). In the analysis we use the experimental ANC's inferred from the 13 C( 14 N, 13 C) 14 N and 13 C( 3 He,d) 14 N reactions. The fits of the calculated S factors to the experimental data are sensitive to the ANC values and are used to test the extracted ANC's. We find that for transitions to all the states in 14 N, except the third excited state, the ANC's determined from the transfer reactions provide the best fit. The astrophysical factor we obtain, S(0)=7.7±1.1 keV b, is in excellent agreement with previous results

  3. Phenomenology of the spontaneous C P violation in SU(3)L x U(1)Y electroweak models

    International Nuclear Information System (INIS)

    Epele, Luis N.; Gomez Dumm, Daniel A.

    1994-01-01

    This work studies the phenomenological consequence of the spontaneous C P violation in a SU(3) L x U(1) Y model with three Higgs triplets and one sextuplet, which has been recently proposed. Since this C P-violating effects are due to the presence of complex vacuum expectation values in the Higgs sector, our analysis requires a detailed study of the enlarged potential

  4. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  5. Functional characterization of a conserved archaeal viral operon revealing single-stranded DNA binding, annealing and nuclease activities

    DEFF Research Database (Denmark)

    Guo, Yang; Kragelund, Birthe Brandt; White, Malcolm F.

    2015-01-01

    encoding proteins of unknown function and forming an operon with ORF207 (gp19). SIRV2 gp17 was found to be a single-stranded DNA (ssDNA) binding protein different in structure from all previously characterized ssDNA binding proteins. Mutagenesis of a few conserved basic residues suggested a U......-shaped binding path for ssDNA. The recombinant gp18 showed an ssDNA annealing activity often associated with helicases and recombinases. To gain insight into the biological role of the entire operon, we characterized SIRV2 gp19 and showed it to possess a 5'→3' ssDNA exonuclease activity, in addition...... for rudiviruses and the close interaction among the ssDNA binding, annealing and nuclease proteins strongly point to a role of the gene operon in genome maturation and/or DNA recombination that may function in viral DNA replication/repair....

  6. Genomic analysis of a xylose operon and characterization of novel xylose isomerase and xylulokinase from Bacillus coagulans NL01.

    Science.gov (United States)

    Zheng, Zhaojuan; Lin, Xi; Jiang, Ting; Ye, Weihua; Ouyang, Jia

    2016-08-01

    To investigate the xylose operon and properties of xylose isomerase and xylulokinase in Bacillus coagulans that can effectively ferment xylose to lactic acid. The xylose operon is widely present in B. coagulans. It is composed of four putative ORFs. Novel xylA and xylB from B. coagulans NL01 were cloned and expressed in Escherichia coli. Sequence of xylose isomerase was more conserved than that of xylulokinase. Both the enzymes exhibited maximum activities at pH 7-8 but with a high temperature maximum of 80-85 °C, divalent metal ion was prerequisite for their activation. Xylose isomerase and xylulokinase were most effectively activated by Ni(2+) and Co(2+), respectively. Genomic analysis of xylose operon has contributed to understanding xylose metabolism in B. coagulans and the novel xylose isomerase and xylulokinase might provide new alternatives for metabolic engineering of other strains to improve their fermentation performance on xylose.

  7. A 5-methylcytosine DNA glycosylase/lyase demethylates the retrotransposon Tos17 and promotes its transposition in rice

    KAUST Repository

    La, Honggui; Ding, Bo; Mishra, Gyan Prakash; Zhou, Bo; Yang, Hongmei; Bellizzi, Maria Del Rosario; Chen, Songbiao; Meyers, Blake C.; Peng, Zhaohua; Zhu, Jian-Kang; Wang, Guoliang

    2011-01-01

    DNA 5-methylcytosine (5-meC) is an important epigenetic mark for transcriptional gene silencing in many eukaryotes. In Arabidopsis, 5-meC DNA glycosylase/lyases actively remove 5-meC to counter-act transcriptional gene silencing in a locus-specific manner, and have been suggested to maintain the expression of transposons. However, it is unclear whether plant DNA demethylases can promote the transposition of transposons. Here we report the functional characterization of the DNA glycosylase/lyase DNG701 in rice. DNG701 encodes a large (1,812 amino acid residues) DNA glycosylase domain protein. Recombinant DNG701 protein showed 5-meC DNA glycosylase and lyase activities in vitro. Knockout or knockdown of DNG701 in rice plants led to DNA hypermethylation and reduced expression of the retrotransposon Tos17. Tos17 showed less transposition in calli derived from dng701 knockout mutant seeds compared with that in wild-type calli. Overexpression of DNG701 in both rice calli and transgenic plants substantially reduced DNA methylation levels of Tos17 and enhanced its expression. The overexpression also led to more frequent transposition of Tos17 in calli. Our results demonstrate that rice DNG701 is a 5-meC DNA glycosylase/lyase responsible for the demethylation of Tos17 and this DNA demethylase plays a critical role in promoting Tos17 transposition in rice calli.

  8. The ketogenic diet is well tolerated and can be effective in patients with argininosuccinate lyase deficiency and refractory epilepsy

    NARCIS (Netherlands)

    Peuscher, Rosanne; Dijsselhof, Monique E.; Abeling, Nico G.; van Rijn, Margreet; van Spronsen, Francjan J.; Bosch, Annet M.

    2012-01-01

    Argininosuccinate lyase (ASL) deficiency (MIM 608310, McKusick 207900) is a rare disorder of the urea cycle, which leads to a deficiency of arginine and hyperammonemia. Epilepsy is a frequent complication of this disorder. A ketogenic diet (KD) can be a very effective therapy for refractory

  9. One Year Experience of Pheburane® (Sodium Phenylbutyrate) Treatment in a Patient with Argininosuccinate Lyase Deficiency

    OpenAIRE

    Uçar, Sema Kalkan; Ozbaran, Burcu; Altinok, Yasemin Atik; Kose, Melis; Canda, Ebru; Kagnici, Mehtap; Coker, Mahmut

    2015-01-01

    Argininosuccinate lyase deficiency (ASLD) is a urea cycle disorder (UCD) treated with dietary adjustment and nitrogen scavenging agents. “Pheburane®” is a new tasteless and odour-free formulation of sodium phenylbutyrate, indicated in the treatment of UCD.

  10. C12 derivatives of the hydroperoxide lyase pathway are produced by product recycling through lipoxygenase-2 in Nicotiana attenuata leaves

    NARCIS (Netherlands)

    Kallenbach, M.; Gilardoni, P.A.; Allmann, S.; Baldwin, I.T.; Bonaventure, G.

    2011-01-01

    In response to diverse stresses, the hydroperoxide lyase (HPL) pathway produces C(6) aldehydes and 12-oxo-(9Z )-dodecenoic acid ((9Z )-traumatin). Since the original characterization of (10E )-traumatin and traumatic acid, little has been added to our knowledge of the metabolism and fluxes

  11. Crystal Structure of α-1,4-Glucan Lyase, a Unique Glycoside Hydrolase Family Member with a Novel Catalytic Mechanism

    NARCIS (Netherlands)

    Rozeboom, Henriëtte J.; Yu, Shukun; Madrid, Susan; Kalk, Kor H.; Zhang, Ran; Dijkstra, Bauke W.

    2013-01-01

    α-1,4-Glucan lyase (EC 4.2.2.13) from the red seaweed Gracilariopsis lemaneiformis cleaves α-1,4-glucosidic linkages in glycogen, starch, and malto-oligosaccharides, yielding the keto-monosaccharide 1,5-anhydro-D-fructose. The enzyme belongs to glycoside hydrolase family 31 (GH31) but degrades

  12. Identification, expression, and characterization of a novel bacterial RGI Lyase enzyme for the production of bio-functional fibers

    DEFF Research Database (Denmark)

    da Silva, Ines Isabel Cardoso Rodrigues; Larsen, Dorte Møller; Meyer, Anne S.

    2011-01-01

    A gene encoding a putative rhamnogalacturonan I (RGI) Lyase (EC 4.2.2.-) from Bacillus licheniformis (DSM13) was selected after a homology search and phylogenetic analysis and optimized with respect to codon usage. The designed gene was transformed into Pichia pastoris and the enzyme was produced...

  13. A 5-methylcytosine DNA glycosylase/lyase demethylates the retrotransposon Tos17 and promotes its transposition in rice

    KAUST Repository

    La, Honggui

    2011-09-06

    DNA 5-methylcytosine (5-meC) is an important epigenetic mark for transcriptional gene silencing in many eukaryotes. In Arabidopsis, 5-meC DNA glycosylase/lyases actively remove 5-meC to counter-act transcriptional gene silencing in a locus-specific manner, and have been suggested to maintain the expression of transposons. However, it is unclear whether plant DNA demethylases can promote the transposition of transposons. Here we report the functional characterization of the DNA glycosylase/lyase DNG701 in rice. DNG701 encodes a large (1,812 amino acid residues) DNA glycosylase domain protein. Recombinant DNG701 protein showed 5-meC DNA glycosylase and lyase activities in vitro. Knockout or knockdown of DNG701 in rice plants led to DNA hypermethylation and reduced expression of the retrotransposon Tos17. Tos17 showed less transposition in calli derived from dng701 knockout mutant seeds compared with that in wild-type calli. Overexpression of DNG701 in both rice calli and transgenic plants substantially reduced DNA methylation levels of Tos17 and enhanced its expression. The overexpression also led to more frequent transposition of Tos17 in calli. Our results demonstrate that rice DNG701 is a 5-meC DNA glycosylase/lyase responsible for the demethylation of Tos17 and this DNA demethylase plays a critical role in promoting Tos17 transposition in rice calli.

  14. Purification and Characterization of a Unique Pectin Lyase from Aspergillus giganteus Able to Release Unsaturated Monogalacturonate during Pectin Degradation

    Directory of Open Access Journals (Sweden)

    Danielle Biscaro Pedrolli

    2014-01-01

    Full Text Available A pectin lyase, named PLIII, was purified to homogeneity from the culture filtrate of Aspergillus giganteus grown in submerged culture containing orange peel waste as carbon source. PLIII was able to digest apple pectin and citrus pectins with different degrees of methyl esterification. Interestingly, the PLIII activity was stimulated in the presence of some divalent cations including Pb2+ and was not significantly affected by Hg2+. Like other pectin lyases, PLIII is stimulated by but is not dependent on Ca2+. The main soluble product released during the degradation of pectic substances promoted by the PLIII is compatible with an unsaturated monogalacturonate. PLIII is a unique enzyme able to release unsaturated monogalacturonate as the only soluble product during the degradation of pectic substances; therefore, PLIII was classified as an exo-pectin lyase. To our knowledge, this is the first characterization of an exo-pectin lyase. The PLIII described in this work is potentially useful for ethanol production from pectin-rich biomass, besides other common applications for alkaline pectinases like preparation of textile fibers, coffee and tea fermentation, vegetable oil extraction, and the treatment of pulp in papermaking.

  15. Cooperative functioning between phenylalanine ammonia lyase and isochorishmate synthase activities contributes to salicylic acid biosynthesis in soybean

    Science.gov (United States)

    Salicylic acid (SA), an essential regulator of plant defense, is derived from chorismate via either the phenylalanine ammonia lyase (PAL), or the isochorishmate synthase (ICS) catalyzed steps. The ICS pathway is thought to be the primary contributor of defense-related SA, at least in Arabidopsis. We...

  16. Possible regulatory role of phenylalanine ammonia-lyase in the production of anthocyanins in asparagus (Asparagus officinalis L)

    NARCIS (Netherlands)

    Flores, F.B.; Oosterhaven, J.; Martinez-Madrid, M.C.; Romojaro, F.

    2005-01-01

    The regulatory role of phenylalanine ammonia-lyase (PAL) in the light-induced accumulation of anthocyanins in the epidermis of asparagus spears has been analysed. A correlation between the stimulation of PAL activity and the rise in total anthocyanin content has been observed. Light radiation

  17. Increased protein expression of LHCG receptor and 17a-hydroxylase/17,20-lyase in human polycystic ovaries

    NARCIS (Netherlands)

    Comim, F.V.; Teerds, K.J.; Hardy, K.; Franks, S.

    2013-01-01

    STUDY QUESTION Does the expression of LHCG receptor (LHCGR) protein and key enzymes in the androgen biosynthetic pathway differ in normal human versus polycystic ovarian tissue? SUMMARY ANSWER LHCGR and 17a-hydroxylase/17-20-lyase (CYP17A1) protein levels are increased in polycystic ovaries (PCOs).

  18. The anaerobic chytridiomycete fungus Piromyces sp. E2 produces ethanol via pyruvate:formate lyase and an alcohol dehydrogenase E.

    NARCIS (Netherlands)

    Boxma, B.; Voncken, F.L.M.; Jannink, S.A.; Alen, T.A. van; Akhmanova, A.S.; Weelden, S.W. van; Hellemond, J.J. van; Ricard, G.N.S.; Huynen, M.A.; Tielens, A.G.; Hackstein, J.H.P.

    2004-01-01

    Anaerobic chytridiomycete fungi possess hydrogenosomes, which generate hydrogen and ATP, but also acetate and formate as end-products of a prokaryotic-type mixed-acid fermentation. Notably, the anaerobic chytrids Piromyces and Neocallimastix use pyruvate:formate lyase (PFL) for the catabolism of

  19. Search for $C\\!P$ violation in $\\Lambda_b\\to pK^-\\mu^+\\mu^-$ decays

    CERN Document Server

    AUTHOR|(CDS)2091898; Neri, Nicola

    In this thesis the first search for $C\\!P$-violation on rare heavy beauty baryon $\\Lambda_b\\to pK^-\\mu^+\\mu^-$ decays is described. This analysis is carried out on the whole dataset recorded by the LHCb experiment during 2011 and 2012. The $C\\!P$ symmetry violation study is one of the most promising method for searching physics beyond the standard model, as the measured amount of $C\\!P$-violation in high-energy physics experiments, even though compatible with standard model expectations, is not sufficient for explaining the observed matter-antimatter asymmetry of our universe. The $\\Lambda_b\\to pK^-\\mu^+\\mu^-$ decays occur via electroweak loop diagrams which allow possible new physics fields to give this process a sensible contribution. For the $\\Lambda_b\\to pK^-\\mu^+\\mu^-$ decay a limited quantity of $C\\!P$-violation is expected in the standard model, making this transition suited to look for beyond standard model physics. In this thesis, $C\\!P$-violation is searched exploiting direct $C\\!P$ asymmetries and ...

  20. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis

    Science.gov (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms. PMID:28617843

  1. The effect of iatrogenic Staphylococcus epidermidis intercellar adhesion operon on the formation of bacterial biofilm on polyvinyl chloride surfaces.

    Science.gov (United States)

    Lianhua, Ye; Yunchao, Huang; Guangqiang, Zhao; Kun, Yang; Xing, Liu; Fengli, Guo

    2014-12-01

    The intercellular adhesion gene (ica) of Staphylococcus epidermidis is a key factor for bacterial aggregation. This study explored the effect of ica on the formation of bacterial biofilm on polyvinyl chloride (PVC) surfaces. Genes related to bacterial biofilm formation, including 16S rRNA, autolysin (atlE), fibrinogen binding protein gene (fbe), and ica were identified and sequenced from 112 clinical isolates of iatrogenic S. epidermidis by polymerase chain reaction (PCR) and gene sequencing. Based on the sequencing result, ica operon-positive (icaADB+/atlE+/fbe+) and ica operon-negative (icaADB-/atlE+/fbe+) strains were separated and co-cultivated with PVC material. After 6, 12, 18, 24, and 30 h of co-culture, the thickness of the bacterial biofilm and quantity of bacterial colony on the PVC surface were measured under the confocal laser scanning microscope and scanning electron microscope. The positive rate of S. epidermidis-specific 16SrRNA in 112 iatrogenic strains was 100% (112/112). The genotype of ica-positive (icaADB+/atlE+/fbe+) strains accounted for 57.1% (64/112), and genotype of ica-negative (icaADB-/atlE+/fbe+) strains accounted for 37.5% (42/112). During 30 h of co-culture, no obvious bacterial biofilm formed on the surface of PVC in the ica-positive group, however, mature bacterial biofilm structure formed after 24 h. For all time points, thickness of bacterial biofilm and quantity of bacterial colony on PVC surfaces in the ica operon-positive group were significantly higher than those in ica operon-negative group (poperon-negative and ica operon-positive strains. The ica operon plays an important role in bacterial biofilm formation and bacterial multiplication on PVC material.

  2. Characterization of the regulation of a plant polysaccharide utilization operon and its role in biofilm formation in Bacillus subtilis.

    Science.gov (United States)

    Habib, Cameron; Yu, Yiyang; Gozzi, Kevin; Ching, Carly; Shemesh, Moshe; Chai, Yunrong

    2017-01-01

    The soil bacterium Bacillus subtilis is often found in association with plants in the rhizosphere. Previously, plant polysaccharides have been shown to stimulate formation of root-associated multicellular communities, or biofilms, in this bacterium, yet the underlying mechanism is not fully understood. A five-gene gan operon (ganSPQAB) in B. subtilis has recently been shown to be involved in utilization of the plant-derived polysaccharide galactan. Despite these findings, molecular details about the regulation of the operon and the role of the operon in biofilm formation remain elusive. In this study, we performed comprehensive genetic analyses on the regulation of the gan operon. We show that this operon is regulated both by a LacI-like transcription repressor (GanR), which directly binds to pairs of inverted DNA repeats in the promoter region of the operon, and by the catabolite control protein A (CcpA). Derepression can be triggered by the presence of the inducer β-1,4-galactobiose, a hydrolysis product of galactan, or in situ when B. subtilis cells are associated with plant roots. In addition to the transcriptional regulation, the encoded ß-galactosidase GanA (by ganA), which hydrolyzes ß-1,4-galactobiose into galactose, is inhibited at the enzymatic level by the catalytic product galactose. Thus, the galactan utilization pathway is under complex regulation involving both positive and negative feedback mechanisms in B. subtilis. We discuss about the biological significance of such complex regulation as well as a hypothesis of biofilm induction by galactan via multiple mechanisms.

  3. Identification and characterization of an operon, msaABCR, that controls virulence and biofilm development in Staphylococcus aureus.

    Science.gov (United States)

    Sahukhal, Gyan S; Elasri, Mohamed O

    2014-06-11

    Community-acquired, methicillin-resistant Staphylococcus aureus strains often cause localized infections in immunocompromised hosts, but some strains show enhanced virulence leading to severe infections even among healthy individuals with no predisposing risk factors. The genetic basis for this enhanced virulence has yet to be determined. S. aureus possesses a wide variety of virulence factors, the expression of which is carefully coordinated by a variety of regulators. Several virulence regulators have been well characterized, but others have yet to be thoroughly investigated. Previously, we identified the msa gene as a regulator of several virulence genes, biofilm development, and antibiotic resistance. We also found evidence of the involvement of upstream genes in msa function. To investigate the mechanism of regulation of the msa gene (renamed msaC), we examined the upstream genes whose expression was affected by its deletion. We showed that msaC is part of a newly defined four-gene operon (msaABCR), in which msaC is a non-protein-coding RNA that is essential for the function of the operon. Furthermore, we found that an antisense RNA (msaR) is complementary to the 5' end of the msaB gene and is expressed in a growth phase-dependent manner suggesting that it is involved in regulation of the operon. These findings allow us to define a new operon that regulates fundamental phenotypes in S. aureus such as biofilm development and virulence. Characterization of the msaABCR operon will allow us to investigate the mechanism of function of this operon and the role of the individual genes in regulation and interaction with its targets. This study identifies a new element in the complex regulatory circuits in S. aureus, and our findings may be therapeutically relevant.

  4. Activities of methionine-γ-lyase in the acidophilic archaeon “Ferroplasma acidarmanus” strain fer1

    Directory of Open Access Journals (Sweden)

    Khan MA

    2013-04-01

    Full Text Available M A Khan,1 Madeline M López-Muñoz,2 Charles W Kaspar,3 Kai F Hung1 1Department of Biological Sciences, Eastern Illinois University, Charleston, IL, USA; 2Department of Biology, Universidad de Puerto Rico, Mayaguez, Puerto Rico; 3Bacteriology Department, University of Wisconsin, Madison, WI, USA Abstract: Biogeochemical processes on exposed pyrite ores result in extremely high levels of sulfuric acid at these locations. Acidophiles that thrive in these conditions must overcome significant challenges, including an environment with proton concentrations at pH 3 or below. The role of sulfur metabolism in the archaeon “Ferroplasma acidarmanus” strain fer1's ability to thrive in this environment was investigated due to its growth-dependent production of methanethiol, a volatile organic sulfur compound. Two putative sequences for methionine-γ-lyase (EC 4.4.1.11, an enzyme known to carry out α, γ-elimination on L-methionine to produce methanethiol, were identified in fer1. Bioinformatic analyses identified a conserved pyridoxal-5'-phosphate (PLP binding domain and a partially conserved catalytic domain in both putative sequences. Detection of PLP-dependent and L-methionine-dependent production of α-keto compounds and thiol groups in fer1 confirmed the presence of methionine-γ-lyase activity. Further, fer1 lysate was capable of processing related substrates, including D-methionine, L-cysteine, L-cystathionine, and L/D-homocysteine. When the two putative fer1 methionine-γ-lyase gene-coded proteins were expressed in Escherichia coli cells, one sequence demonstrated an ability to carry out α, γ-elimination activity, while the other exhibited γ-replacement activity. These fer1 methionine-γ-lyases also exhibited optimum pH, substrate specificity, and catalytic preferences that are different from methionine-γ-lyases from other organisms. These differences are discussed in the context of molecular phylogeny constructed using a maximum

  5. Glucose & sodium chloride induced biofilm production & ica operon in clinical isolates of staphylococci

    Directory of Open Access Journals (Sweden)

    Astha Agarwal

    2013-01-01

    Full Text Available Background & objectives: All colonizing and invasive staphylococcal isolates may not produce biofilm but may turn biofilm producers in certain situations due to change in environmental factors. This study was done to test the hypothesis that non biofilm producing clinical staphylococci isolates turn biofilm producers in presence of sodium chloride (isotonic and high concentration of glucose, irrespective of presence or absence of ica operon. Methods: Clinical isolates of 100 invasive, 50 colonizing and 50 commensal staphylococci were tested for biofilm production by microtiter plate method in different culture media (trypticase soy broth alone or supplemented with 0.9% NaCl/ 5 or 10% glucose. All isolates were tested for the presence of ica ADBC genes by PCR. Results: Biofilm production significantly increased in the presence of glucose and saline, most, when both glucose and saline were used together. All the ica positive staphylococcal isolates and some ica negative isolates turned biofilm producer in at least one of the tested culture conditions. Those remained biofilm negative in different culture conditions were all ica negative. Interpretation & conclusions: The present results showed that the use of glucose or NaCl or combination of both enhanced biofilm producing capacity of staphylococcal isolates irrespective of presence or absence of ica operon.

  6. Characterization of a Mycobacterium avium subsp. avium Operon Associated with Virulence and Drug Detoxification

    Directory of Open Access Journals (Sweden)

    Mariana Noelia Viale

    2014-01-01

    Full Text Available The lprG-p55 operon of Mycobacterium tuberculosis and Mycobacterium bovis is involved in the transport of toxic compounds. P55 is an efflux pump that provides resistance to several drugs, while LprG is a lipoprotein that modulates the host's immune response against mycobacteria. The knockout mutation of this operon severely reduces the replication of both mycobacterial species during infection in mice and increases susceptibility to toxic compounds. In order to gain insight into the function of LprG in the Mycobacterium avium complex, in this study, we assayed the effect of the deletion of lprG gene in the D4ER strain of Mycobacterium avium subsp. avium. The replacement of lprG gene with a hygromycin cassette caused a polar effect on the expression of p55. Also, a twofold decrease in ethidium bromide susceptibility was observed and the resistance to the antibiotics rifampicin, amikacin, linezolid, and rifabutin was impaired in the mutant strain. In addition, the mutation decreased the virulence of the bacteria in macrophages in vitro and in a mice model in vivo. These findings clearly indicate that functional LprG and P55 are necessary for the correct transport of toxic compounds and for the survival of MAA in vitro and in vivo.

  7. Expression, purification and functional characterization of AmiA of acetamidase operon of Mycobacterium smegmatis.

    Science.gov (United States)

    Sundararaman, Balaji; Palaniyandi, Kannan; Venkatesan, Arunkumar; Narayanan, Sujatha

    2014-11-01

    Regulation of gene expression is one of the mechanisms of virulence in pathogenic organisms. In this context, we would like to understand the gene regulation of acetamidase enzyme of Mycobacterium smegmatis, which is the first reported inducible enzyme in mycobacteria. The acetamidase is highly inducible and the expression of this enzyme is increased 100-fold when the substrate acetamide is added. The acetamidase structural gene (amiE) is found immediately downstream of three predicted open reading frames (ORFs). Three of these genes along with a divergently expressed ORF are predicted to form an operon and involved in the regulation of acetamidase enzyme. Here we report expression, purification and functional characterization of AmiA which is one of these predicted ORFs. Electrophoretic mobility shift assays showed that AmiA binds to the region between the amiA and amiD near the predicted promoter (P2). Over-expression of AmiA significantly lowered the expression of acetamidase compared to the wild type as demonstrated by qRT-PCR and SDS-PAGE. We conclude that AmiA binds near P2 promoter and acts as a repressor in the regulation of acetamidase operon. The described work is a further step forward toward broadening the knowledge on understanding of the complex gene regulatory mechanism of Mycobacterium sp. Copyright © 2014 Elsevier GmbH. All rights reserved.

  8. The Cry Toxin Operon of Clostridium bifermentans subsp. malaysia Is Highly Toxic to Aedes Larval Mosquitoes

    Science.gov (United States)

    Qureshi, Nadia; Chawla, Swati; Likitvivatanavong, Supaporn; Lee, Han Lim

    2014-01-01

    The management and control of mosquito vectors of human disease currently rely primarily on chemical insecticides. However, larvicidal treatments can be effective, and if based on biological insecticides, they can also ameliorate the risk posed to human health by chemical insecticides. The aerobic bacteria Bacillus thuringiensis and Lysinibacillus sphaericus have been used for vector control for a number of decades. But a more cost-effective use would be an anaerobic bacterium because of the ease with which these can be cultured. More recently, the anaerobic bacterium Clostridium bifermentans subsp. malaysia has been reported to have high mosquitocidal activity, and a number of proteins were identified as potentially mosquitocidal. However, the cloned proteins showed no mosquitocidal activity. We show here that four toxins encoded by the Cry operon, Cry16A, Cry17A, Cbm17.1, and Cbm17.2, are all required for toxicity, and these toxins collectively show remarkable selectivity for Aedes rather than Anopheles mosquitoes, even though C. bifermentans subsp. malaysia is more toxic to Anopheles. Hence, toxins that target Anopheles are different from those expressed by the Cry operon. PMID:25002432

  9. Dynamics and bistability in a reduced model of the lac operon

    Science.gov (United States)

    Yildirim, Necmettin; Santillán, Moisés; Horike, Daisuke; Mackey, Michael C.

    2004-06-01

    It is known that the lac operon regulatory pathway is capable of showing bistable behavior. This is an important complex feature, arising from the nonlinearity of the involved mechanisms, which is essential to understand the dynamic behavior of this molecular regulatory system. To find which of the mechanisms involved in the regulation of the lac operon is the origin of bistability, we take a previously published model which accounts for the dynamics of mRNA, lactose, allolactose, permease and β-galactosidase involvement and simplify it by ignoring permease dynamics (assuming a constant permease concentration). To test the behavior of the reduced model, three existing sets of data on β-galactosidase levels as a function of time are simulated and we obtain a reasonable agreement between the data and the model predictions. The steady states of the reduced model were numerically and analytically analyzed and it was shown that it may indeed display bistability, depending on the extracellular lactose concentration and growth rate.

  10. Downstream element determines RNase Y cleavage of the saePQRS operon in Staphylococcus aureus.

    Science.gov (United States)

    Marincola, Gabriella; Wolz, Christiane

    2017-06-02

    In gram-positive bacteria, RNase J1, RNase J2 and RNase Y are thought to be major contributors to mRNA degradation and maturation. In Staphylococcus aureus, RNase Y activity is restricted to regulating the mRNA decay of only certain transcripts. Here the saePQRS operon was used as a model to analyze RNase Y specificity in living cells. A RNase Y cleavage site is located in an intergenic region between saeP and saeQ. This cleavage resulted in rapid degradation of the upstream fragment and stabilization of the downstream fragment. Thereby, the expression ratio of the different components of the operon was shifted towards saeRS, emphasizing the regulatory role of RNase Y activity. To assess cleavage specificity different regions surrounding the sae CS were cloned upstream of truncated gfp, and processing was analyzed in vivo using probes up- and downstream of CS. RNase Y cleavage was not determined by the cleavage site sequence. Instead a 24-bp double-stranded recognition structure was identified that was required to initiate cleavage 6 nt upstream. The results indicate that RNase Y activity is determined by secondary structure recognition determinants, which guide cleavage from a distance. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  11. Culex pipiens crossing type diversity is governed by an amplified and polymorphic operon of Wolbachia.

    Science.gov (United States)

    Bonneau, Manon; Atyame, Celestine; Beji, Marwa; Justy, Fabienne; Cohen-Gonsaud, Martin; Sicard, Mathieu; Weill, Mylène

    2018-01-22

    Culex pipiens mosquitoes are infected with Wolbachia (wPip) that cause an important diversity of cytoplasmic incompatibilities (CIs). Functional transgenic studies have implicated the cidA-cidB operon from wPip and its homolog in wMel in CI between infected Drosophila males and uninfected females. However, the genetic basis of the CI diversity induced by different Wolbachia strains was unknown. We show here that the remarkable diversity of CI in the C. pipiens complex is due to the presence, in all tested wPip genomes, of several copies of the cidA-cidB operon, which undergoes diversification through recombination events. In 183 isofemale lines of C. pipiens collected worldwide, specific variations of the cidA-cidB gene repertoires are found to match crossing types. The diversification of cidA-cidB is consistent with the hypothesis of a toxin-antitoxin system in which the gene cidB co-diversifies with the gene cidA, particularly in putative domains of reciprocal interactions.

  12. A functional glycogen biosynthesis pathway in Lactobacillus acidophilus: expression and analysis of the glg operon

    Science.gov (United States)

    Goh, Yong Jun; Klaenhammer, Todd R

    2013-01-01

    Glycogen metabolism contributes to energy storage and various physiological functions in some prokaryotes, including colonization persistence. A role for glycogen metabolism is proposed on the survival and fitness of Lactobacillus acidophilus, a probiotic microbe, in the human gastrointestinal environment. L. acidophilus NCFM possesses a glycogen metabolism (glg) operon consisting of glgBCDAP-amy-pgm genes. Expression of the glg operon and glycogen accumulation were carbon source- and growth phase-dependent, and were repressed by glucose. The highest intracellular glycogen content was observed in early log-phase cells grown on trehalose, which was followed by a drastic decrease of glycogen content prior to entering stationary phase. In raffinose-grown cells, however, glycogen accumulation gradually declined following early log phase and was maintained at stable levels throughout stationary phase. Raffinose also induced an overall higher temporal glg expression throughout growth compared with trehalose. Isogenic ΔglgA (glycogen synthase) and ΔglgB (glycogen-branching enzyme) mutants are glycogen-deficient and exhibited growth defects on raffinose. The latter observation suggests a reciprocal relationship between glycogen synthesis and raffinose metabolism. Deletion of glgB or glgP (glycogen phosphorylase) resulted in defective growth and increased bile sensitivity. The data indicate that glycogen metabolism is involved in growth maintenance, bile tolerance and complex carbohydrate utilization in L. acidophilus. PMID:23879596

  13. Deregulation of the arginine deiminase (arc) operon in penicillin-tolerant mutants of Streptococcus gordonii.

    Science.gov (United States)

    Caldelari, I; Loeliger, B; Langen, H; Glauser, M P; Moreillon, P

    2000-10-01

    Penicillin tolerance is an incompletely understood phenomenon that allows bacteria to resist drug-induced killing. Tolerance was studied with independent Streptococcus gordonii mutants generated by cyclic exposure to 500 times the MIC of penicillin. Parent cultures lost 4 to 5 log(10) CFU/ml of viable counts/24 h. In contrast, each of four independent mutant cultures lost bacteria and were encoded by an operon that was >80% similar to the arginine-deiminase (arc) operon of these organisms. Partial nucleotide sequencing and insertion inactivation of the S. gordonii arc locus indicated that tolerance was not a direct consequence of arc alteration. On the other hand, genetic transformation of tolerance by Tol1 DNA always conferred arc deregulation. In nontolerant recipients, arc was repressed during exponential growth and up-regulated during postexponential growth. In tolerant transformants, arc was constitutively expressed. Tol1 DNA transformed tolerance at the same rate as transformation of a point mutation (10(-2) to 10(-3)). The tolerance mutation mapped on a specific chromosomal fragment but was physically distant from arc. Importantly, arc deregulation was observed in most (6 of 10) of additional independent penicillin-tolerant mutants. Thus, although not exclusive, the association between arc deregulation and tolerance was not fortuitous. Since penicillin selection mimicked the antibiotic pressure operating in the clinical environment, arc deregulation might be an important correlate of naturally occurring tolerance and help in understanding the mechanism(s) underlying this clinically problematic phenotype.

  14. Differential decay of RNA of the CFA/I fimbrial operon and control of relative gene expression.

    OpenAIRE

    Jordi, B J; op den Camp, I E; de Haan, L A; van der Zeijst, B A; Gaastra, W

    1993-01-01

    CFA/I fimbriae on human enterotoxigenic Escherichia coli are composed of the CfaB protein, the product of the second gene of the CFA/I operon. We show here that CfaB is expressed at a higher level than other proteins of the CFA/I operon. mRNA encoding the CfaB protein is much more abundant than mRNA encoding CfaA, the first protein, together with CfaB or mRNA encoding CfaA only. Only one promoter, upstream of cfaA, is present. These data indicate that a primary transcript containing cfaA and ...

  15. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Winson, MK; Sternberg, C

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate......, and hyperflagellated cells that were indistinguishable from swarm cells isolated from the edge of a swarm colony. Thus, expression of the flhD master operon appears to play a central role in the process of swarm cell differentiation....

  16. Differentiation of Serratia liquefaciens into swarm cells is controlled by the expression of the flhD master operon

    DEFF Research Database (Denmark)

    Eberl, L; Christiansen, Gunna; Molin, S

    1996-01-01

    The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate, and hyperflag......The velocity with which a swarming colony of Serratia liquefaciens colonizes the surface of a suitable solid substratum was controlled by modulating the expression of the flhD master operon. In liquid medium, the stimulation of flhD expression resulted in filamentous, multinucleate...

  17. Understanding Which Residues of the Active Site and Loop Structure of a Tyrosine Aminomutase Define Its Mutase and Lyase Activities.

    Science.gov (United States)

    Attanayake, Gayanthi; Walter, Tyler; Walker, Kevin D

    2018-05-30

    Site-directed mutations and substrate analogues were used to gain insights into the branch-point reaction of the 3,5-dihydro-5-methylidene-4 H-imidazol-4-one (MIO)-tyrosine aminomutase from Oryza sativa ( OsTAM). Exchanging the active residues of OsTAM (Y125C/N446K) for those in a phenylalanine aminomutase TcPAM altered its substrate specificity from tyrosine to phenylalanine. The aminomutase mechanism of OsTAM surprisingly changed almost exclusively to that of an ammonia lyase making cinnamic acid (>95%) over β-phenylalanine [Walter, T., et al. (2016) Biochemistry 55, 3497-3503]. We hypothesized that the missing electronics or sterics on the aryl ring of the phenylalanine substrate, compared with the sizable electron-donating hydroxyl of the natural tyrosine substrate, influenced the unexpected lyase reactivity of the OsTAM mutant. The double mutant was incubated with 16 α-phenylalanine substituent analogues of varying electronic strengths and sterics. The mutant converted each analogue principally to its acrylate with ∼50% conversion of the p-Br substrate, making only a small amount of the β-amino acid. The inner loop structure over the entrance to the active site was also mutated to assess how the lyase and mutase activities are affected. An OsTAM loop mutant, matching the loop residues of TcPAM, still chiefly made >95% of the acrylate from each substrate. A combined active site:loop mutant was most reactive but remained a lyase, making 10-fold more acrylates than other mutants did. While mutations within the active site changed the substrate specificity of OsTAM, continued exploration is needed to fully understand the interplay among the inner loop, the substrate, and the active site in defining the mutase and lyase activities.

  18. Biochemical, Kinetic, and Spectroscopic Characterization of Ruegeria pomeroyi DddW--A Mononuclear Iron-Dependent DMSP Lyase.

    Directory of Open Access Journals (Sweden)

    Adam E Brummett

    Full Text Available The osmolyte dimethylsulfoniopropionate (DMSP is a key nutrient in marine environments and its catabolism by bacteria through enzymes known as DMSP lyases generates dimethylsulfide (DMS, a gas of importance in climate regulation, the sulfur cycle, and signaling to higher organisms. Despite the environmental significance of DMSP lyases, little is known about how they function at the mechanistic level. In this study we biochemically characterize DddW, a DMSP lyase from the model roseobacter Ruegeria pomeroyi DSS-3. DddW is a 16.9 kDa enzyme that contains a C-terminal cupin domain and liberates acrylate, a proton, and DMS from the DMSP substrate. Our studies show that as-purified DddW is a metalloenzyme, like the DddQ and DddP DMSP lyases, but contains an iron cofactor. The metal cofactor is essential for DddW DMSP lyase activity since addition of the metal chelator EDTA abolishes its enzymatic activity, as do substitution mutations of key metal-binding residues in the cupin motif (His81, His83, Glu87, and His121. Measurements of metal binding affinity and catalytic activity indicate that Fe(II is most likely the preferred catalytic metal ion with a nanomolar binding affinity. Stoichiometry studies suggest DddW requires one Fe(II per monomer. Electronic absorption and electron paramagnetic resonance (EPR studies show an interaction between NO and Fe(II-DddW, with NO binding to the EPR silent Fe(II site giving rise to an EPR active species (g = 4.29, 3.95, 2.00. The change in the rhombicity of the EPR signal is observed in the presence of DMSP, indicating that substrate binds to the iron site without displacing bound NO. This work provides insight into the mechanism of DMSP cleavage catalyzed by DddW.

  19. Lepton C P violation in a ν 2 HDM with flavor

    Science.gov (United States)

    Barradas-Guevara, E.; Félix-Beltrán, O.; Gonzalez-Canales, F.; Zeleny-Mora, M.

    2018-02-01

    In this work we propose an extension to the Standard Model in which we consider a type-III two-Higgs-doublet model (2HDM) plus massive neutrinos and the horizontal flavor symmetry S3 (ν 2 HDM ⊗S3 ). In the above framework and with the explicit breaking of flavor symmetry S3, the Yukawa matrices in the flavor-adapted basis are represented by means of a matrix with two texture zeros. Also, the active neutrinos are considered as Majorana particles and their masses are generated through the type-I seesaw mechanism. The unitary matrices that diagonalize the mass matrices, as well as the flavor-mixing matrices, are expressed in terms of fermion mass ratios. Consequently, in the mass basis the entries of the Yukawa matrices naturally acquire the form of the so-called Cheng-Sher ansatz. For the leptonic sector of ν 2 HDM ⊗S3, we compare, through a χ2 likelihood test, the theoretical expressions of the flavor-mixing angles with the masses and flavor-mixing leptons current experimental data. The results obtained in this χ2 analysis are in very good agreement with the current experimental data. We also obtain allowed value ranges for the "Dirac-like" phase factor, as well as for the two Majorana phase factors. Furthermore, we study the phenomenological implications of these numerical values of the C P -violation phases on the neutrinoless double-beta decay, and for long baseline neutrino oscillation experiments such as T2K, NO ν A , and DUNE.

  20. Mini-review: recent developments in hydroxynitrile lyases for industrial biotechnology.

    Science.gov (United States)

    Lanfranchi, Elisa; Steiner, Kerstin; Glieder, Anton; Hajnal, Ivan; Sheldon, Roger A; van Pelt, Sander; Winkler, Margit

    2013-12-01

    Hydroxynitrile lyases (HNLs) catalyze the cleavage as well as the formation of cyanohydrins. The latter reaction is valuable for the stereoselective C-C bond formation by condensation of HCN with carbonyl compounds. The resulting cyanohydrins serve as versatile building blocks for a broad range of chemical and enzymatic follow-up reactions. A significant number of (R)- and (S)-selective HNLs are known today and the number is still increasing. HNLs not only exhibit varying substrate scope but also differ in sequence and structure. Tailor-made enzymes for large-scale manufacturing of cyanohydrins with improved yield and enantiomeric excess are very interesting targets, which is reflected in a solid number of patents. This review will complement and extend our recent review with a strong focus on applications of HNLs for the synthesis of highly functionalized, chiral compounds with newest literature, recent and current patent literature.

  1. Gene deletion of cytosolic ATP: citrate lyase leads to altered organic acid production in Aspergillus niger

    DEFF Research Database (Denmark)

    Meijer, Susan Lisette; Nielsen, Michael Lynge; Olsson, Lisbeth

    2009-01-01

    With the availability of the genome sequence of the filamentous fungus Aspergillus niger, the use of targeted genetic modifications has become feasible. This, together with the fact that A. niger is well established industrially, makes this fungus an attractive micro-organism for creating a cell...... factory platform for production of chemicals. Using molecular biology techniques, this study focused on metabolic engineering of A. niger to manipulate its organic acid production in the direction of succinic acid. The gene target for complete gene deletion was cytosolic ATP: citrate lyase (acl), which...... the acl gene. Additionally, the total amount of organic acids produced in the deletion strain was significantly increased. Genome-scale stoichiometric metabolic model predictions can be used for identifying gene targets. Deletion of the acl led to increased succinic acid production by A. niger....

  2. The Skin Bacterium Propionibacterium acnes Employs Two Variants of Hyaluronate Lyase with Distinct Properties

    DEFF Research Database (Denmark)

    Nazipi, Seven; Stødkilde-Jørgensen, Kristian; Scavenius, Carsten

    2017-01-01

    Hyaluronic acid (HA) and other glycosaminoglycans are extracellular matrix components in the human epidermis and dermis. One of the most prevalent skin microorganisms, Propionibacterium acnes, possesses HA-degrading activity, possibly conferred by the enzyme hyaluronate lyase (HYL). In this study......, we identified the HYL of P. acnes and investigated the genotypic and phenotypic characteristics. Investigations include the generation of a P. acneshyl knockout mutant and HYL activity assays to determine the substrate range and formed products. We found that P. acnes employs two distinct variants...... of the observed differences between P. acnes phylotype IA and IB/II strains. Whereas type IA strains are primarily found on the skin surface and associated with acne vulgaris, type IB/II strains are more often associated with soft and deep tissue infections, which would require elaborate tissue invasion...

  3. Molecular cloning and characterization of l-methionine γ-lyase from Streptomyces avermitilis.

    Science.gov (United States)

    Kudou, Daizou; Yasuda, Eri; Hirai, Yoshiyuki; Tamura, Takashi; Inagaki, Kenji

    2015-10-01

    A pyridoxal 5'-phosphate-dependent methionine γ-lyase (MGL) was cloned from Streptomyces avermitilis catalyzed the degradation of methionine to α-ketobutyrate, methanethiol, and ammonia. The sav7062 gene (1,242 bp) was corresponded to 413 amino acid residues with a molecular mass of 42,994 Da. The deduced amino acid sequence showed a high degree of similarity to those of other MGL enzymes. The sav7062 gene was overexpressed in Escherichia coli. The enzyme was purified to homogeneity and exhibited the MGL catalytic activities. We cloned the enzyme that has the MGL activity in Streptomyces for the first time. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  4. Cloning, expression and characterization of phenylalanine ammonia-lyase from Rhodotorula glutinis.

    Science.gov (United States)

    Zhu, Longbao; Cui, Wenjing; Fang, Yueqin; Liu, Yi; Gao, Xinxing; Zhou, Zhemin

    2013-05-01

    The industrial-scale production of phenylalanine ammonia-lyase (PAL) mainly uses strains of Rhodotorula. However, the PAL gene from Rhodotorula has not been cloned. Here, the full-length gene of PAL from Rhodotorula glutinis was isolated. It was 2,121 bp, encoding a polypeptide with 706 amino acids and a calculated MW of 75.5 kDa. Though R. glutinis is an anamorph of Rhodosporium toruloides, the amino acid sequences of PALs them are not the same (about 74 % identity). PAL was expressed in E. coli and characterized. Its specific activity was 4.2 U mg(-1) and the k cat/K m was 1.9 × 10(4) mM(-1) s(-1), exhibiting the highest catalytic ability among the reported PALs. The genetic and biochemical information reported here should facilitate future application in industry.

  5. Stabilization of Phenylalanine Ammonia Lyase from Rhodotorula glutinis by Encapsulation in Polyethyleneimine-Mediated Biomimetic Silica.

    Science.gov (United States)

    Cui, Jiandong; Liang, Longhao; Han, Cong; Lin Liu, Rong

    2015-06-01

    Phenylalanine ammonia lyase (PAL) from Rhodotorula glutinis was encapsulated within polyethyleneimine-mediated biomimetic silica. The main factors in the preparation of biomimetic silica were optimized by response surface methodology (RSM). Compared to free PAL (about 2 U), the encapsulated PAL retained more than 43 % of their initial activity after 1 h of incubation time at 60 °C, whereas free PAL lost most of activity in the same conditions. It was clearly indicated that the thermal stability of PAL was improved by encapsulation. Moreover, the encapsulated PAL exhibited the excellent stability of the enzyme against denaturants and storage stability, and pH stability was improved by encapsulation. Operational stability of 7 reaction cycles showed that the encapsulated PAL was stable. Nevertheless, the K m value of encapsulated PAL in biomimetic silica was higher than that of the free PAL due to lower total surface area and increased mass transfer resistance.

  6. Sphingosine 1-phosphate lyase enzyme assay using a BODIPY-labeled substrate

    International Nuclear Information System (INIS)

    Bandhuvula, Padmavathi; Li Zaiguo; Bittman, Robert; Saba, Julie D.

    2009-01-01

    Sphingosine 1-phosphate lyase (SPL) is responsible for the irreversible catabolism of sphingosine 1-phosphate, which signals through five membrane receptors to mediate cell stress responses, angiogenesis, and lymphocyte trafficking. The standard assay for SPL activity utilizes a radioactive dihydrosphingosine 1-phosphate substrate and is expensive and cumbersome. In this study, we describe an SPL assay that employs an ω-labeled BODIPY-sphingosine 1-phosphate substrate, allowing fluorescent product detection by HPLC and incorporating advantages of the BODIPY fluorophore. The major aldehyde product is confirmed by reaction with 2,4-dinitrophenylhydrazine. The SPL-catalyzed reaction is linear over a 30 min time period and yields a K m of 35 μM for BODIPY-sphingosine 1-phosphate.

  7. Paraffin as oxygen vector modulates tyrosine phenol lyase production by Citrobacter freundii MTCC 2424.

    Science.gov (United States)

    Azmi, Wamik; Kumar, Ajay; Dev, Varun

    2013-06-01

    The efficiency of three oxygen-vectors liquid paraffin, silicone oil and n-dodecane in the production of tyrosine phenol lyase (TPL) by Citrobacter freundii MTCC 2424 was evaluated at 4% (v/v) concentration. The liquid paraffin as oxygenvectors was found to exhibit a stimulatory effect on TPL synthesis. The liquid paraffin at 6% (v/v) resulted in 34% increase in the TPL synthesis accompanied by a 13% increase in the production of cell mass at a 10 L scale. This improvement in TPL and cell mass production in the presence of liquid paraffin can be related to the fact that liquid paraffin was capable of maintaining dissolved O2 concentration above 28% throughout the course of the fermentation. Maintenance of the dissolved O2 concentration above 28% could be viewed in terms of an adequate oxygen supply to the rapidly dividing cells of the bacterium, which in turn resulted in enhanced synthesis of TPL and cell mass.

  8. Synthesis of d‐ and l‐Phenylalanine Derivatives by Phenylalanine Ammonia Lyases: A Multienzymatic Cascade Process†

    Science.gov (United States)

    Parmeggiani, Fabio; Lovelock, Sarah L.; Weise, Nicholas J.; Ahmed, Syed T.

    2015-01-01

    Abstract The synthesis of substituted d‐phenylalanines in high yield and excellent optical purity, starting from inexpensive cinnamic acids, has been achieved with a novel one‐pot approach by coupling phenylalanine ammonia lyase (PAL) amination with a chemoenzymatic deracemization (based on stereoselective oxidation and nonselective reduction). A simple high‐throughput solid‐phase screening method has also been developed to identify PALs with higher rates of formation of non‐natural d‐phenylalanines. The best variants were exploited in the chemoenzymatic cascade, thus increasing the yield and ee value of the d‐configured product. Furthermore, the system was extended to the preparation of those l‐phenylalanines which are obtained with a low ee value using PAL amination. PMID:27478261

  9. Synthesis of d- and l-Phenylalanine Derivatives by Phenylalanine Ammonia Lyases: A Multienzymatic Cascade Process**

    Science.gov (United States)

    Parmeggiani, Fabio; Lovelock, Sarah L; Weise, Nicholas J; Ahmed, Syed T; Turner, Nicholas J

    2015-01-01

    The synthesis of substituted d-phenylalanines in high yield and excellent optical purity, starting from inexpensive cinnamic acids, has been achieved with a novel one-pot approach by coupling phenylalanine ammonia lyase (PAL) amination with a chemoenzymatic deracemization (based on stereoselective oxidation and nonselective reduction). A simple high-throughput solid-phase screening method has also been developed to identify PALs with higher rates of formation of non-natural d-phenylalanines. The best variants were exploited in the chemoenzymatic cascade, thus increasing the yield and ee value of the d-configured product. Furthermore, the system was extended to the preparation of those l-phenylalanines which are obtained with a low ee value using PAL amination. PMID:25728350

  10. Occurrence of adhesin-encoding operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis Ocorrência de operons codificadores de adesinas em Escherichia coli isolada de aves reprodutoras com salpingite e de pintinhos com onfalite

    Directory of Open Access Journals (Sweden)

    Terezinha Knöbl

    2006-06-01

    Full Text Available The occurrence of fim, pap and sfa operons in Escherichia coli isolated from breeders with salpingitis and chicks with omphalitis was evaluated. Analysis of 100 E. coli isolates, by colony hybridization tests, showed that 78 (78% were fim+, one (1% was sfa+, seven (7% were fim+ associated with pap+, eigth (8% were fim+ and sfa+, one (1% was fim+pap+sfa+ and five (5% isolates did not hybridize with any probe. These results suggest that fim adhesion-encoding operon plays an important role in pathogenesis of E. coli infection in chickens with salpingitis and omphalitis.Ocorrência dos operons fim, pap e sfa em amostras de Escherichia coli isoladas de reprodutoras com salpingite e pintinhos com onfalite foi avaliada. A análise de 100 amostras através dos testes de hibridização de colônia mostrou que 78 (78% amostras eram fim+, uma (1% era sfa+, sete (7% eram fim+ associada a pap+, oito (8% eram fim+ e uma (1% era fim+pap+sfa+ e cinco (5% amostras não hibridizaram com nenhuma sonda. Estes resultados sugerem que o operon fim pode ter um importante papel na patogenia da infecção de Escherichia coli em reprodutoras com salpingite e pintinhos com onfalite.

  11. Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1.

    Directory of Open Access Journals (Sweden)

    Qinna Cui

    Full Text Available Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1 and phz2 (phzA2B2C2D2E2F2G2] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1.

  12. Monovalent Cation Activation of the Radical SAM Enzyme Pyruvate Formate-Lyase Activating Enzyme.

    Science.gov (United States)

    Shisler, Krista A; Hutcheson, Rachel U; Horitani, Masaki; Duschene, Kaitlin S; Crain, Adam V; Byer, Amanda S; Shepard, Eric M; Rasmussen, Ashley; Yang, Jian; Broderick, William E; Vey, Jessica L; Drennan, Catherine L; Hoffman, Brian M; Broderick, Joan B

    2017-08-30

    Pyruvate formate-lyase activating enzyme (PFL-AE) is a radical S-adenosyl-l-methionine (SAM) enzyme that installs a catalytically essential glycyl radical on pyruvate formate-lyase. We show that PFL-AE binds a catalytically essential monovalent cation at its active site, yet another parallel with B 12 enzymes, and we characterize this cation site by a combination of structural, biochemical, and spectroscopic approaches. Refinement of the PFL-AE crystal structure reveals Na + as the most likely ion present in the solved structures, and pulsed electron nuclear double resonance (ENDOR) demonstrates that the same cation site is occupied by 23 Na in the solution state of the as-isolated enzyme. A SAM carboxylate-oxygen is an M + ligand, and EPR and circular dichroism spectroscopies reveal that both the site occupancy and the identity of the cation perturb the electronic properties of the SAM-chelated iron-sulfur cluster. ENDOR studies of the PFL-AE/[ 13 C-methyl]-SAM complex show that the target sulfonium positioning varies with the cation, while the observation of an isotropic hyperfine coupling to the cation by ENDOR measurements establishes its intimate, SAM-mediated interaction with the cluster. This monovalent cation site controls enzyme activity: (i) PFL-AE in the absence of any simple monovalent cations has little-no activity; and (ii) among monocations, going down Group 1 of the periodic table from Li + to Cs + , PFL-AE activity sharply maximizes at K + , with NH 4 + closely matching the efficacy of K + . PFL-AE is thus a type I M + -activated enzyme whose M + controls reactivity by interactions with the cosubstrate, SAM, which is bound to the catalytic iron-sulfur cluster.

  13. Measurements of $C\\!P$ violation in the three-body phase space of charmless $B^{\\pm}$ decays

    CERN Document Server

    Aaij, Roel; Adinolfi, Marco; Affolder, Anthony; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Anderson, Jonathan; Andreassen, Rolf; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Aquines Gutierrez, Osvaldo; Archilli, Flavio; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Belogurov, Sergey; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bien, Alexander; Bifani, Simone; Bird, Thomas; Bizzeti, Andrea; Bjørnstad, Pål Marius; Blake, Thomas; Blanc, Frédéric; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borghi, Silvia; Borgia, Alessandra; Borsato, Martino; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Brambach, Tobias; van den Brand, Johannes; Bressieux, Joël; Brett, David; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Brook, Nicholas; Brown, Henry; Bursche, Albert; Busetto, Giovanni; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Campana, Pierluigi; Campora Perez, Daniel; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chiapolini, Nicola; Chrzaszcz, Marcin; Ciba, Krzystof; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cojocariu, Lucian; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombes, Matthew; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Counts, Ian; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Dalseno, Jeremy; David, Pascal; David, Pieter; Davis, Adam; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Silva, Weeraddana; De Simone, Patrizia; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Déléage, Nicolas; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Di Canto, Angelo; Dijkstra, Hans; Donleavy, Stephanie; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dossett, David; Dovbnya, Anatoliy; Dreimanis, Karlis; Dujany, Giulio; Dupertuis, Frederic; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; El Rifai, Ibrahim; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Färber, Christian; Farinelli, Chiara; Farley, Nathanael; Farry, Stephen; Fay, Robert; Ferguson, Dianne; Fernandez Albor, Victor; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Francisco, Oscar; Frank, Markus; Frei, Christoph; Frosini, Maddalena; Fu, Jinlin; Furfaro, Emiliano; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; García Pardiñas, Julián; Garofoli, Justin; Garra Tico, Jordi; Garrido, Lluis; Gaspar, Clara; Gauld, Rhorry; Gavardi, Laura; Gavrilov, Gennadii; Geraci, Angelo; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianelle, Alessio; Giani', Sebastiana; Gibson, Valerie; Giubega, Lavinia-Helena; Gligorov, Vladimir; Göbel, Carla; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gotti, Claudio; Grabalosa Gándara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graziani, Giacomo; Grecu, Alexandru; Greening, Edward; Gregson, Sam; Griffith, Peter; Grillo, Lucia; Grünberg, Oliver; Gui, Bin; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hall, Samuel; Hamilton, Brian; Hampson, Thomas; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; He, Jibo; Head, Timothy; Heijne, Veerle; Hennessy, Karol; Henrard, Pierre; Henry, Louis; Hernando Morata, Jose Angel; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hoballah, Mostafa; Hombach, Christoph; Hulsbergen, Wouter; Hunt, Philip; Hussain, Nazim; Hutchcroft, David; Hynds, Daniel; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jaton, Pierre; Jawahery, Abolhassan; Jing, Fanfan; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kaballo, Michael; Kandybei, Sergii; Kanso, Walaa; Karacson, Matthias; Karbach, Moritz; Karodia, Sarah; Kelsey, Matthew; Kenyon, Ian; Ketel, Tjeerd; Khanji, Basem; Khurewathanakul, Chitsanu; Klaver, Suzanne; Klimaszewski, Konrad; Kochebina, Olga; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Korolev, Mikhail; Kozlinskiy, Alexandr; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krocker, Georg; Krokovny, Pavel; Kruse, Florian; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kurek, Krzysztof; Kvaratskheliya, Tengiz; La Thi, Viet Nga; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lambert, Dean; Lambert, Robert W; Lanfranchi, Gaia; Langenbruch, Christoph; Langhans, Benedikt; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Lees, Jean-Pierre; Lefèvre, Regis; Leflat, Alexander; Lefrançois, Jacques; Leo, Sabato; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Yiming; Likhomanenko, Tatiana; Liles, Myfanwy; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Bo; Lohn, Stefan; Longstaff, Iain; Lopes, Jose; Lopez-March, Neus; Lowdon, Peter; Lu, Haiting; Lucchesi, Donatella; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Machefert, Frederic; Machikhiliyan, Irina V; Maciuc, Florin; Maev, Oleg; Malde, Sneha; Malinin, Alexander; Manca, Giulia; Mancinelli, Giampiero; Mapelli, Alessandro; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marino, Pietro; Märki, Raphael; Marks, Jörg; Martellotti, Giuseppe; Martens, Aurelien; Martín Sánchez, Alexandra; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massafferri, André; Matev, Rosen; Mathe, Zoltan; Matteuzzi, Clara; Mazurov, Alexander; McCann, Michael; McCarthy, James; McNab, Andrew; McNulty, Ronan; McSkelly, Ben; Meadows, Brian; Meier, Frank; Meissner, Marco; Merk, Marcel; Milanes, Diego Alejandro; Minard, Marie-Noelle; Moggi, Niccolò; Molina Rodriguez, Josue; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Müller, Katharina; Mussini, Manuel; Muster, Bastien; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Anh Duc; Nguyen, Thi-Dung; Nguyen-Mau, Chung; Nicol, Michelle; Niess, Valentin; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Oggero, Serena; Ogilvy, Stephen; Okhrimenko, Oleksandr; Oldeman, Rudolf; Onderwater, Gerco; Orlandea, Marius; Osorio Rodrigues, Bruno; Otalora Goicochea, Juan Martin; Owen, Patrick; Oyanguren, Maria Arantza; Pal, Bilas Kanti; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Panman, Jacob; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parkes, Christopher; Parkinson, Christopher John; Passaleva, Giovanni; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pazos Alvarez, Antonio; Pearce, Alex; Pellegrino, Antonio; Pepe Altarelli, Monica; Perazzini, Stefano; Perez Trigo, Eliseo; Perret, Pascal; Perrin-Terrin, Mathieu; Pescatore, Luca; Pesen, Erhan; Petridis, Konstantin; Petrolini, Alessandro; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pilař, Tomas; Pinci, Davide; Pistone, Alessandro; Playfer, Stephen; Plo Casasus, Maximo; Polci, Francesco; Poluektov, Anton; Polycarpo, Erica; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Potterat, Cédric; Price, Eugenia; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Rachwal, Bartolomiej; Rademacker, Jonas; Rakotomiaramanana, Barinjaka; Rama, Matteo; Rangel, Murilo; Raniuk, Iurii; Rauschmayr, Nathalie; Raven, Gerhard; Reichert, Stefanie; Reid, Matthew; dos Reis, Alberto; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vincente; Roa Romero, Diego; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Perez, Pablo; Roiser, Stefan; Romanovsky, Vladimir; Romero Vidal, Antonio; Rotondo, Marcello; Rouvinet, Julien; Ruf, Thomas; Ruiz, Hugo; Ruiz Valls, Pablo; Saborido Silva, Juan Jose; Sagidova, Naylya; Sail, Paul; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santovetti, Emanuele; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrie, Mauro; Savrina, Darya; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Seco, Marcos; Semennikov, Alexander; Sepp, Indrek; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Shires, Alexander; Silva Coutinho, Rafael; Simi, Gabriele; Sirendi, Marek; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Anthony; Smith, Edmund; Smith, Eluned; Smith, Jackson; Smith, Mark; Snoek, Hella; Sokoloff, Michael; Soler, Paul; Soomro, Fatima; Souza, Daniel; Souza De Paula, Bruno; Spaan, Bernhard; Sparkes, Ailsa; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Steinkamp, Olaf; Stenyakin, Oleg; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Stroili, Roberto; Subbiah, Vijay Kartik; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Swientek, Stefan; Syropoulos, Vasileios; Szczekowski, Marek; Szczypka, Paul; Szilard, Daniela; Szumlak, Tomasz; T'Jampens, Stephane; Teklishyn, Maksym; Tellarini, Giulia; Teubert, Frederic; Thomas, Christopher; Thomas, Eric; van Tilburg, Jeroen; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Torr, Nicholas; Tournefier, Edwige; Tourneur, Stephane; Tran, Minh Tâm; Tresch, Marco; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tuning, Niels; Ubeda Garcia, Mario; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vagnoni, Vincenzo; Valenti, Giovanni; Vallier, Alexis; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vázquez Sierra, Carlos; Vecchi, Stefania; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Vesterinen, Mika; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Vilasis-Cardona, Xavier; Vollhardt, Achim; Volyanskyy, Dmytro; Voong, David; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; Voss, Helge; de Vries, Jacco; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wandernoth, Sebastian; Wang, Jianchun; Ward, David; Watson, Nigel; Websdale, David; Whitehead, Mark; Wicht, Jean; Wiedner, Dirk; Wilkinson, Guy; Williams, Matthew; Williams, Mike; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wright, Simon; Wu, Suzhi; Wyllie, Kenneth; Xie, Yuehong; Xing, Zhou; Xu, Zhirui; Yang, Zhenwei; Yuan, Xuhao; Yushchenko, Oleg; Zangoli, Maria; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Wen Chao; Zhang, Yanxi; Zhelezov, Alexey; Zhokhov, Anatoly; Zhong, Liang; Zvyagin, Alexander

    2014-01-01

    The charmless three-body decay modes $B^{\\pm} \\rightarrow K^{\\pm} \\pi^{+} \\pi^{-}$, $B^{\\pm} \\rightarrow K^{\\pm} K^{+} K^{-}$, $B^{\\pm} \\rightarrow \\pi^{\\pm} K^{+} K^{-}$ and $B^{\\pm} \\rightarrow \\pi^{\\pm} \\pi^{+} \\pi^{-}$ are reconstructed using data, corresponding to an integrated luminosity of 3.0 fb$^{-1}$, collected by the LHCb detector. The inclusive $C\\!P$ asymmetries of these modes are measured to be \\begin{eqnarray} A_{C\\!P}(B^{\\pm} \\rightarrow K^{\\pm} \\pi^{+} \\pi^{-})= +0.025 \\pm 0.004 \\pm 0.004 \\pm 0.007, \\end{eqnarray} \\begin{eqnarray} A_{C\\!P}(B^{\\pm} \\rightarrow K^{\\pm} K^{+} K^{-}) = -0.036 \\pm 0.004 \\pm 0.002 \\pm 0.007, \\end{eqnarray} \\begin{eqnarray} A_{C\\!P}(B^{\\pm} \\rightarrow \\pi^{\\pm} \\pi^{+} \\pi^{-})= +0.058 \\pm 0.008 \\pm 0.009 \\pm 0.007, \\end{eqnarray} \\begin{eqnarray} A_{C\\!P}(B^{\\pm} \\rightarrow \\pi^{\\pm} K^{+} K^{-})= -0.123 \\pm 0.017 \\pm 0.012 \\pm 0.007, \

  14. Observation of the decay $\\Lambda_b^0 \\to \\Lambda_c^+ p \\overline{p} \\pi^-$

    CERN Document Server

    Aaij, Roel; LHCb Collaboration; Adinolfi, Marco; Ajaltouni, Ziad; Akar, Simon; Albicocco, Pietro; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Alfonso Albero, Alejandro; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Archilli, Flavio; d'Argent, Philippe; Arnau Romeu, Joan; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Atzeni, Michele; Auriemma, Giulio; Bachmann, Sebastian; Back, John; Baker, Sophie; Balagura, Vladislav; Baldini, Wander; Baranov, Alexander; Barlow, Roger; Barsuk, Sergey; Barter, William; Baryshnikov, Fedor; Batozskaya, Varvara; Battista, Vincenzo; Bay, Aurelio; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Beiter, Andrew; Bel, Lennaert; Beliy, Nikita; Bellee, Violaine; Belloli, Nicoletta; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Beranek, Sarah; Berezhnoy, Alexander; Bernet, Roland; Berninghoff, Daniel; Bertholet, Emilie; Bertolin, Alessandro; Betancourt, Christopher; Betti, Federico; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bezshyiko, Iaroslava; Bifani, Simone; Billoir, Pierre; Birnkraut, Alex; Bizzeti, Andrea; Bjørn, Mikkel; Blake, Thomas; Blanc, Frederic; Blusk, Steven; Bocci, Valerio; Boente Garcia, Oscar; Boettcher, Thomas; Bondar, Alexander; Bondar, Nikolay; Borghi, Silvia; Borisyak, Maxim; Borsato, Martino; Bossu, Francesco; Boubdir, Meriem; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Brodski, Michael; Brodzicka, Jolanta; Brundu, Davide; Buchanan, Emma; Burr, Christopher; Bursche, Albert; Buytaert, Jan; Byczynski, Wiktor; Cadeddu, Sandro; Cai, Hao; Calabrese, Roberto; Calladine, Ryan; Calvi, Marta; Calvo Gomez, Miriam; Camboni, Alessandro; Campana, Pierluigi; Campora Perez, Daniel Hugo; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Cattaneo, Marco; Cavallero, Giovanni; Cenci, Riccardo; Chamont, David; Chapman, Matthew George; Charles, Matthew; Charpentier, Philippe; Chatzikonstantinidis, Georgios; Chefdeville, Maximilien; Chen, Shanzhen; Chitic, Stefan-Gabriel; Chobanova, Veronika; Chrzaszcz, Marcin; Chubykin, Alexsei; Ciambrone, Paolo; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collins, Paula; Colombo, Tommaso; Comerma-Montells, Albert; Contu, Andrea; Coombs, George; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Costa Sobral, Cayo Mar; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Currie, Robert; D'Ambrosio, Carmelo; Da Cunha Marinho, Franciole; Da Silva, Cesar Luiz; Dall'Occo, Elena; Dalseno, Jeremy; Danilina, Anna; Davis, Adam; De Aguiar Francisco, Oscar; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Serio, Marilisa; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Del Buono, Luigi; Delaney, Blaise; Dembinski, Hans Peter; Demmer, Moritz; Dendek, Adam; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Di Nezza, Pasquale; Didenko, Sergey; Dijkstra, Hans; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Douglas, Lauren; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Durante, Paolo; Durham, John Matthew; Dutta, Deepanwita; Dzhelyadin, Rustem; Dziewiecki, Michal; Dziurda, Agnieszka; Dzyuba, Alexey; Easo, Sajan; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; Ely, Scott; Ene, Alexandru; Escher, Stephan; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Farley, Nathanael; Farry, Stephen; Fazzini, Davide; Federici, Luca; Fernandez, Gerard; Fernandez Declara, Placido; Fernandez Prieto, Antonio; Ferrari, Fabio; Ferreira Lopes, Lino; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fini, Rosa Anna; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fleuret, Frederic; Fontana, Marianna; Fontanelli, Flavio; Forty, Roger; Franco Lima, Vinicius; Frank, Markus; Frei, Christoph; Fu, Jinlin; Funk, Wolfgang; Färber, Christian; Gabriel, Emmy; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; Garcia Martin, Luis Miguel; Garcia Plana, Beatriz; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Gascon, David; Gaspar, Clara; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gizdov, Konstantin; Gligorov, Vladimir; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gorelov, Igor Vladimirovich; Gotti, Claudio; Govorkova, Ekaterina; Grabowski, Jascha Peter; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Greim, Roman; Griffith, Peter; Grillo, Lucia; Gruber, Lukas; Gruberg Cazon, Barak Raimond; Grünberg, Oliver; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Göbel, Carla; Hadavizadeh, Thomas; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hamilton, Brian; Han, Xiaoxue; Hancock, Thomas Henry; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Hasse, Christoph; Hatch, Mark; He, Jibo; Hecker, Malte; Heinicke, Kevin; Heister, Arno; Hennessy, Karol; Henry, Louis; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hopchev, Plamen Hristov; Hu, Wenhua; Huang, Wenqian; Huard, Zachary; Hulsbergen, Wouter; Humair, Thibaud; Hushchyn, Mikhail; Hutchcroft, David; Ibis, Philipp; Idzik, Marek; Ilten, Philip; Ivshin, Kuzma; Jacobsson, Richard; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jiang, Feng; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Karacson, Matthias; Kariuki, James Mwangi; Karodia, Sarah; Kazeev, Nikita; Kecke, Matthieu; Keizer, Floris; Kelsey, Matthew; Kenzie, Matthew; Ketel, Tjeerd; Khairullin, Egor; Khanji, Basem; Khurewathanakul, Chitsanu; Kim, Kyung Eun; Kirn, Thomas; Klaver, Suzanne; Klimaszewski, Konrad; Klimkovich, Tatsiana; Koliiev, Serhii; Kolpin, Michael; Kopecna, Renata; Koppenburg, Patrick; Kotriakhova, Sofia; Kozeiha, Mohamad; Kravchuk, Leonid; Kreps, Michal; Kress, Felix Johannes; Krokovny, Pavel; Krupa, Wojciech; Krzemien, Wojciech; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kvaratskheliya, Tengiz; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lanfranchi, Gaia; Langenbruch, Christoph; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; Leflat, Alexander; Lefrançois, Jacques; Lefèvre, Regis; Lemaitre, Florian; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Pei-Rong; Li, Tenglin; Li, Zhuoming; Liang, Xixin; Likhomanenko, Tatiana; Lindner, Rolf; Lionetto, Federica; Lisovskyi, Vitalii; Liu, Xuesong; Loh, David; Loi, Angelo; Longstaff, Iain; Lopes, Jose; Lucchesi, Donatella; Lucio Martinez, Miriam; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Lusiani, Alberto; Lyu, Xiao-Rui; Machefert, Frederic; Maciuc, Florin; Macko, Vladimir; Mackowiak, Patrick; Maddrell-Mander, Samuel; Maev, Oleg; Maguire, Kevin; Maisuzenko, Dmitrii; Majewski, Maciej Witold; Malde, Sneha; Malecki, Bartosz; Malinin, Alexander; Maltsev, Timofei; Manca, Giulia; Mancinelli, Giampiero; Marangotto, Daniele; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marinangeli, Matthieu; Marino, Pietro; Marks, Jörg; Martellotti, Giuseppe; Martin, Morgan; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Massafferri, André; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Mauri, Andrea; Maurice, Emilie; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McNab, Andrew; McNulty, Ronan; Mead, James Vincent; Meadows, Brian; Meaux, Cedric; Meier, Frank; Meinert, Nis; Melnychuk, Dmytro; Merk, Marcel; Merli, Andrea; Michielin, Emanuele; Milanes, Diego Alejandro; Millard, Edward James; Minard, Marie-Noelle; Minzoni, Luca; Mitzel, Dominik Stefan; Mogini, Andrea; Molina Rodriguez, Josue; Mombächer, Titus; Monroy, Igancio Alberto; Monteil, Stephane; Morandin, Mauro; Morello, Gianfranco; Morello, Michael Joseph; Morgunova, Olga; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Mulder, Mick; Müller, Dominik; Müller, Janine; Müller, Katharina; Müller, Vanessa; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nandi, Anita; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Thi Dung; Nguyen-Mau, Chung; Nieswand, Simon; Niet, Ramon; Nikitin, Nikolay; Nogay, Alla; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Oldeman, Rudolf; Onderwater, Gerco; Ossowska, Anna; Otalora Goicochea, Juan Martin; Owen, Patrick; Oyanguren, Maria Aranzazu; Pais, Preema Rennee; Palano, Antimo; Palutan, Matteo; Panshin, Gennady; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parker, William; Parkes, Christopher; Passaleva, Giovanni; Pastore, Alessandra; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Pereima, Dmitrii; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petrov, Aleksandr; Petruzzo, Marco; Pietrzyk, Boleslaw; Pietrzyk, Guillaume; Pikies, Malgorzata; Pinci, Davide; Pisani, Flavio; Pistone, Alessandro; Piucci, Alessio; Placinta, Vlad-Mihai; Playfer, Stephen; Plo Casasus, Maximo; Polci, Francesco; Poli Lener, Marco; Poluektov, Anton; Polukhina, Natalia; Polyakov, Ivan; Polycarpo, Erica; Pomery, Gabriela Johanna; Ponce, Sebastien; Popov, Alexander; Popov, Dmitry; Poslavskii, Stanislav; Potterat, Cédric; Price, Eugenia; Prisciandaro, Jessica; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Pullen, Hannah Louise; Punzi, Giovanni; Qian, Wenbin; Qin, Jia-Jia; Quagliani, Renato; Quintana, Boris; Rachwal, Bartlomiej; Rademacker, Jonas; Rama, Matteo; Ramos Pernas, Miguel; Rangel, Murilo; Ratnikov, Fedor; Raven, Gerhard; Ravonel Salzgeber, Melody; Reboud, Meril; Redi, Federico; Reichert, Stefanie; dos Reis, Alberto; Remon Alepuz, Clara; Renaudin, Victor; Ricciardi, Stefania; Richards, Sophie; Rinnert, Kurt; Robbe, Patrick; Robert, Arnaud; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rogozhnikov, Alexey; Roiser, Stefan; Rollings, Alexandra Paige; Romanovskiy, Vladimir; Romero Vidal, Antonio; Rotondo, Marcello; Rudolph, Matthew Scott; Ruf, Thomas; Ruiz Vidal, Joan; Saborido Silva, Juan Jose; Sagidova, Naylya; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarpis, Gediminas; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schael, Stefan; Schellenberg, Margarete; Schiller, Manuel; Schindler, Heinrich; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schreiner, HF; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sepulveda, Eduardo Enrique; Sergi, Antonino; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Siddi, Benedetto Gianluca; Silva Coutinho, Rafael; Silva de Oliveira, Luiz Gustavo; Simi, Gabriele; Simone, Saverio; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Iwan Thomas; Smith, Mark; Soares Lavra, Lais; Sokoloff, Michael; Soler, Paul; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Stefko, Pavol; Stefkova, Slavomira; Steinkamp, Olaf; Stemmle, Simon; Stenyakin, Oleg; Stepanova, Margarita; Stevens, Holger; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Stramaglia, Maria Elena; Straticiuc, Mihai; Straumann, Ulrich; Strokov, Sergey; Sun, Jiayin; Sun, Liang; Swientek, Krzysztof; Syropoulos, Vasileios; Szumlak, Tomasz; Szymanski, Maciej Pawel; T'Jampens, Stephane; Tang, Zhipeng; Tayduganov, Andrey; Tekampe, Tobias; Tellarini, Giulia; Teubert, Frederic; Thomas, Eric; van Tilburg, Jeroen; Tilley, Matthew James; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Tourinho Jadallah Aoude, Rafael; Tournefier, Edwige; Traill, Murdo; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tully, Alison; Tuning, Niels; Ukleja, Artur; Usachov, Andrii; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagner, Alexander; Vagnoni, Vincenzo; Valassi, Andrea; Valat, Sebastien; Valenti, Giovanni; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vecchi, Stefania; van Veghel, Maarten; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Venkateswaran, Aravindhan; Verlage, Tobias Anton; Vernet, Maxime; Vesterinen, Mika; Viana Barbosa, Joao Vitor; Vieira, Daniel; Vieites Diaz, Maria; Viemann, Harald; Vilasis-Cardona, Xavier; Vitkovskiy, Arseniy; Vitti, Marcela; Volkov, Vladimir; Vollhardt, Achim; Voneki, Balazs; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Vázquez Sierra, Carlos; Waldi, Roland; Walsh, John; Wang, Jianchun; Wang, Mengzhen; Wang, Yilong; Wang, Zhenzi; Ward, David; Wark, Heather Mckenzie; Watson, Nigel; Websdale, David; Weiden, Andreas; Weisser, Constantin; Whitehead, Mark; Wicht, Jean; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Winn, Michael Andreas; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wyllie, Kenneth; Xiao, Dong; Xie, Yuehong; Xu, Ao; Xu, Menglin; Xu, Qingnian; Xu, Zehua; Xu, Zhirui; Yang, Zhenwei; Yang, Zishuo; Yao, Yuezhe; Yin, Hang; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zarebski, Kristian Alexander; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Yanxi; Zhelezov, Alexey; Zheng, Yangheng; Zhu, Xianglei; Zhukov, Valery; Zonneveld, Jennifer Brigitta; Zucchelli, Stefano; Aaij, Roel

    2018-01-01

    The decay $\\Lambda_b^0 \\to \\Lambda_c^+ p \\overline{p} \\pi^-$ is observed using $pp$ collision data collected with the LHCb detector at centre-of-mass energies of $\\sqrt{s}=$ 7 and 8 TeV, corresponding to an integrated luminosity of 3 $fb^{-1}$. The ratio of branching fractions between $\\Lambda_b^0 \\to \\Lambda_c^+ p \\overline{p} \\pi^-$ and $\\Lambda_b^0 \\to \\Lambda_c^+ \\pi^-$ decays is measured to be \\begin{equation*} \\frac{\\mathcal{B}(\\Lambda_b^0 \\to \\Lambda_c^+ p \\overline{p}\\pi^-)}{\\mathcal{B}(\\Lambda_b^0 \\to \\Lambda_c^+ \\pi^-)} = 0.0540 \\pm 0.0023 \\pm 0.0032. \\end{equation*} Two resonant structures are observed in the $ \\Lambda_c^+ \\pi^-$ mass spectrum of the ${\\Lambda_b^0 \\to \\Lambda_c^+ p\\overline{p} \\pi^-}$ decays, corresponding to the $\\Sigma_c(2455)^0$ and $\\Sigma_c^{*}(2520)^0$ states. The ratios of branching fractions with respect to the decay $\\Lambda_b^0 \\to \\Lambda_c^+ p \\overline{p} \\pi^-$ are \\begin{align*} \\frac{\\mathcal{B} (\\Lambda_b^0 \\to \\Sigma_c^0 p\\overline{p})\\times\\mathcal{B}(\\Sigma_c^0\\...

  15. Measurements of charm mixing and $C\\!P$ violation using $D^0 \\to K^\\pm \\pi^\\mp$ decays

    CERN Document Server

    Aaij, Roel; Adinolfi, Marco; Ajaltouni, Ziad; Akar, Simon; Albrecht, Johannes; Alessio, Federico; Alexander, Michael; Ali, Suvayu; Alkhazov, Georgy; Alvarez Cartelle, Paula; Alves Jr, Antonio Augusto; Amato, Sandra; Amerio, Silvia; Amhis, Yasmine; An, Liupan; Anderlini, Lucio; Andreassi, Guido; Andreotti, Mirco; Andrews, Jason; Appleby, Robert; Archilli, Flavio; d'Argent, Philippe; Arnau Romeu, Joan; Artamonov, Alexander; Artuso, Marina; Aslanides, Elie; Auriemma, Giulio; Baalouch, Marouen; Babuschkin, Igor; Bachmann, Sebastian; Back, John; Badalov, Alexey; Baesso, Clarissa; Baker, Sophie; Baldini, Wander; Barlow, Roger; Barschel, Colin; Barsuk, Sergey; Barter, William; Baszczyk, Mateusz; Batozskaya, Varvara; Batsukh, Baasansuren; Battista, Vincenzo; Bay, Aurelio; Beaucourt, Leo; Beddow, John; Bedeschi, Franco; Bediaga, Ignacio; Bel, Lennaert; Bellee, Violaine; Belloli, Nicoletta; Belous, Konstantin; Belyaev, Ivan; Ben-Haim, Eli; Bencivenni, Giovanni; Benson, Sean; Benton, Jack; Berezhnoy, Alexander; Bernet, Roland; Bertolin, Alessandro; Betti, Federico; Bettler, Marc-Olivier; van Beuzekom, Martinus; Bezshyiko, Iaroslava; Bifani, Simone; Billoir, Pierre; Bird, Thomas; Birnkraut, Alex; Bitadze, Alexander; Bizzeti, Andrea; Blake, Thomas; Blanc, Frederic; Blouw, Johan; Blusk, Steven; Bocci, Valerio; Boettcher, Thomas; Bondar, Alexander; Bondar, Nikolay; Bonivento, Walter; Borgheresi, Alessio; Borghi, Silvia; Borisyak, Maxim; Borsato, Martino; Bossu, Francesco; Boubdir, Meriem; Bowcock, Themistocles; Bowen, Espen Eie; Bozzi, Concezio; Braun, Svende; Britsch, Markward; Britton, Thomas; Brodzicka, Jolanta; Buchanan, Emma; Burr, Christopher; Bursche, Albert; Buytaert, Jan; Cadeddu, Sandro; Calabrese, Roberto; Calvi, Marta; Calvo Gomez, Miriam; Camboni, Alessandro; Campana, Pierluigi; Campora Perez, Daniel; Campora Perez, Daniel Hugo; Capriotti, Lorenzo; Carbone, Angelo; Carboni, Giovanni; Cardinale, Roberta; Cardini, Alessandro; Carniti, Paolo; Carson, Laurence; Carvalho Akiba, Kazuyoshi; Casse, Gianluigi; Cassina, Lorenzo; Castillo Garcia, Lucia; Cattaneo, Marco; Cauet, Christophe; Cavallero, Giovanni; Cenci, Riccardo; Charles, Matthew; Charpentier, Philippe; Chatzikonstantinidis, Georgios; Chefdeville, Maximilien; Chen, Shanzhen; Cheung, Shu-Faye; Chobanova, Veronika; Chrzaszcz, Marcin; Cid Vidal, Xabier; Ciezarek, Gregory; Clarke, Peter; Clemencic, Marco; Cliff, Harry; Closier, Joel; Coco, Victor; Cogan, Julien; Cogneras, Eric; Cogoni, Violetta; Cojocariu, Lucian; Collazuol, Gianmaria; Collins, Paula; Comerma-Montells, Albert; Contu, Andrea; Cook, Andrew; Coombs, George; Coquereau, Samuel; Corti, Gloria; Corvo, Marco; Costa Sobral, Cayo Mar; Couturier, Benjamin; Cowan, Greig; Craik, Daniel Charles; Crocombe, Andrew; Cruz Torres, Melissa Maria; Cunliffe, Samuel; Currie, Robert; D'Ambrosio, Carmelo; Da Cunha Marinho, Franciole; Dall'Occo, Elena; Dalseno, Jeremy; David, Pieter; Davis, Adam; De Aguiar Francisco, Oscar; De Bruyn, Kristof; De Capua, Stefano; De Cian, Michel; De Miranda, Jussara; De Paula, Leandro; De Serio, Marilisa; De Simone, Patrizia; Dean, Cameron Thomas; Decamp, Daniel; Deckenhoff, Mirko; Del Buono, Luigi; Demmer, Moritz; Derkach, Denis; Deschamps, Olivier; Dettori, Francesco; Dey, Biplab; Di Canto, Angelo; Dijkstra, Hans; Dordei, Francesca; Dorigo, Mirco; Dosil Suárez, Alvaro; Dovbnya, Anatoliy; Dreimanis, Karlis; Dufour, Laurent; Dujany, Giulio; Dungs, Kevin; Durante, Paolo; Dzhelyadin, Rustem; Dziurda, Agnieszka; Dzyuba, Alexey; Déléage, Nicolas; Easo, Sajan; Ebert, Marcus; Egede, Ulrik; Egorychev, Victor; Eidelman, Semen; Eisenhardt, Stephan; Eitschberger, Ulrich; Ekelhof, Robert; Eklund, Lars; Elsasser, Christian; Ely, Scott; Esen, Sevda; Evans, Hannah Mary; Evans, Timothy; Falabella, Antonio; Farley, Nathanael; Farry, Stephen; Fay, Robert; Fazzini, Davide; Ferguson, Dianne; Fernandez Albor, Victor; Fernandez Prieto, Antonio; Ferrari, Fabio; Ferreira Rodrigues, Fernando; Ferro-Luzzi, Massimiliano; Filippov, Sergey; Fini, Rosa Anna; Fiore, Marco; Fiorini, Massimiliano; Firlej, Miroslaw; Fitzpatrick, Conor; Fiutowski, Tomasz; Fleuret, Frederic; Fohl, Klaus; Fontana, Marianna; Fontanelli, Flavio; Forshaw, Dean Charles; Forty, Roger; Franco Lima, Vinicius; Frank, Markus; Frei, Christoph; Fu, Jinlin; Furfaro, Emiliano; Färber, Christian; Gallas Torreira, Abraham; Galli, Domenico; Gallorini, Stefano; Gambetta, Silvia; Gandelman, Miriam; Gandini, Paolo; Gao, Yuanning; Garcia Martin, Luis Miguel; García Pardiñas, Julián; Garra Tico, Jordi; Garrido, Lluis; Garsed, Philip John; Gascon, David; Gaspar, Clara; Gavardi, Laura; Gazzoni, Giulio; Gerick, David; Gersabeck, Evelina; Gersabeck, Marco; Gershon, Timothy; Ghez, Philippe; Gianì, Sebastiana; Gibson, Valerie; Girard, Olivier Göran; Giubega, Lavinia-Helena; Gizdov, Konstantin; Gligorov, Vladimir; Golubkov, Dmitry; Golutvin, Andrey; Gomes, Alvaro; Gorelov, Igor Vladimirovich; Gotti, Claudio; Grabalosa Gándara, Marc; Graciani Diaz, Ricardo; Granado Cardoso, Luis Alberto; Graugés, Eugeni; Graverini, Elena; Graziani, Giacomo; Grecu, Alexandru; Griffith, Peter; Grillo, Lucia; Gruberg Cazon, Barak Raimond; Grünberg, Oliver; Gushchin, Evgeny; Guz, Yury; Gys, Thierry; Göbel, Carla; Hadavizadeh, Thomas; Hadjivasiliou, Christos; Haefeli, Guido; Haen, Christophe; Haines, Susan; Hall, Samuel; Hamilton, Brian; Han, Xiaoxue; Hansmann-Menzemer, Stephanie; Harnew, Neville; Harnew, Samuel; Harrison, Jonathan; Hatch, Mark; He, Jibo; Head, Timothy; Heister, Arno; Hennessy, Karol; Henrard, Pierre; Henry, Louis; Hernando Morata, Jose Angel; van Herwijnen, Eric; Heß, Miriam; Hicheur, Adlène; Hill, Donal; Hombach, Christoph; Hopchev, P H; Hulsbergen, Wouter; Humair, Thibaud; Hushchyn, Mikhail; Hussain, Nazim; Hutchcroft, David; Idzik, Marek; Ilten, Philip; Jacobsson, Richard; Jaeger, Andreas; Jalocha, Pawel; Jans, Eddy; Jawahery, Abolhassan; Jiang, Feng; John, Malcolm; Johnson, Daniel; Jones, Christopher; Joram, Christian; Jost, Beat; Jurik, Nathan; Kandybei, Sergii; Kanso, Walaa; Karacson, Matthias; Kariuki, James Mwangi; Karodia, Sarah; Kecke, Matthieu; Kelsey, Matthew; Kenyon, Ian; Kenzie, Matthew; Ketel, Tjeerd; Khairullin, Egor; Khanji, Basem; Khurewathanakul, Chitsanu; Kirn, Thomas; Klaver, Suzanne; Klimaszewski, Konrad; Koliiev, Serhii; Kolpin, Michael; Komarov, Ilya; Koopman, Rose; Koppenburg, Patrick; Kosmyntseva, Alena; Kozachuk, Anastasiia; Kozeiha, Mohamad; Kravchuk, Leonid; Kreplin, Katharina; Kreps, Michal; Krokovny, Pavel; Kruse, Florian; Krzemien, Wojciech; Kucewicz, Wojciech; Kucharczyk, Marcin; Kudryavtsev, Vasily; Kuonen, Axel Kevin; Kurek, Krzysztof; Kvaratskheliya, Tengiz; Lacarrere, Daniel; Lafferty, George; Lai, Adriano; Lambert, Dean; Lanfranchi, Gaia; Langenbruch, Christoph; Latham, Thomas; Lazzeroni, Cristina; Le Gac, Renaud; van Leerdam, Jeroen; Lees, Jean-Pierre; Leflat, Alexander; Lefrançois, Jacques; Lefèvre, Regis; Lemaitre, Florian; Lemos Cid, Edgar; Leroy, Olivier; Lesiak, Tadeusz; Leverington, Blake; Li, Yiming; Likhomanenko, Tatiana; Lindner, Rolf; Linn, Christian; Lionetto, Federica; Liu, Bo; Liu, Xuesong; Loh, David; Longstaff, Iain; Lopes, Jose; Lucchesi, Donatella; Lucio Martinez, Miriam; Luo, Haofei; Lupato, Anna; Luppi, Eleonora; Lupton, Oliver; Lusiani, Alberto; Lyu, Xiao-Rui; Machefert, Frederic; Maciuc, Florin; Maev, Oleg; Maguire, Kevin; Malde, Sneha; Malinin, Alexander; Maltsev, Timofei; Manca, Giulia; Mancinelli, Giampiero; Manning, Peter Michael; Maratas, Jan; Marchand, Jean François; Marconi, Umberto; Marin Benito, Carla; Marino, Pietro; Marks, Jörg; Martellotti, Giuseppe; Martin, Morgan; Martinelli, Maurizio; Martinez Santos, Diego; Martinez Vidal, Fernando; Martins Tostes, Danielle; Massacrier, Laure Marie; Massafferri, André; Matev, Rosen; Mathad, Abhijit; Mathe, Zoltan; Matteuzzi, Clara; Mauri, Andrea; Maurin, Brice; Mazurov, Alexander; McCann, Michael; McCarthy, James; McNab, Andrew; McNulty, Ronan; Meadows, Brian; Meier, Frank; Meissner, Marco; Melnychuk, Dmytro; Merk, Marcel; Merli, Andrea; Michielin, Emanuele; Milanes, Diego Alejandro; Minard, Marie-Noelle; Mitzel, Dominik Stefan; Mogini, Andrea; Molina Rodriguez, Josue; Monroy, Ignacio Alberto; Monteil, Stephane; Morandin, Mauro; Morawski, Piotr; Mordà, Alessandro; Morello, Michael Joseph; Moron, Jakub; Morris, Adam Benjamin; Mountain, Raymond; Muheim, Franz; Mulder, Mick; Mussini, Manuel; Müller, Dominik; Müller, Janine; Müller, Katharina; Müller, Vanessa; Naik, Paras; Nakada, Tatsuya; Nandakumar, Raja; Nandi, Anita; Nasteva, Irina; Needham, Matthew; Neri, Nicola; Neubert, Sebastian; Neufeld, Niko; Neuner, Max; Nguyen, Anh Duc; Nguyen-Mau, Chung; Nieswand, Simon; Niet, Ramon; Nikitin, Nikolay; Nikodem, Thomas; Novoselov, Alexey; O'Hanlon, Daniel Patrick; Oblakowska-Mucha, Agnieszka; Obraztsov, Vladimir; Ogilvy, Stephen; Oldeman, Rudolf; Onderwater, Gerco; Otalora Goicochea, Juan Martin; Otto, Adam; Owen, Patrick; Oyanguren, Maria Aranzazu; Pais, Preema Rennee; Palano, Antimo; Palombo, Fernando; Palutan, Matteo; Panman, Jacob; Papanestis, Antonios; Pappagallo, Marco; Pappalardo, Luciano; Parker, William; Parkes, Christopher; Passaleva, Giovanni; Pastore, Alessandra; Patel, Girish; Patel, Mitesh; Patrignani, Claudia; Pearce, Alex; Pellegrino, Antonio; Penso, Gianni; Pepe Altarelli, Monica; Perazzini, Stefano; Perret, Pascal; Pescatore, Luca; Petridis, Konstantinos; Petrolini, Alessandro; Petrov, Aleksandr; Petruzzo, Marco; Picatoste Olloqui, Eduardo; Pietrzyk, Boleslaw; Pikies, Malgorzata; Pinci, Davide; Pistone, Alessandro; Piucci, Alessio; Playfer, Stephen; Plo Casasus, Maximo; Poikela, Tuomas; Polci, Francesco; Poluektov, Anton; Polyakov, Ivan; Polycarpo, Erica; Pomery, Gabriela Johanna; Popov, Alexander; Popov, Dmitry; Popovici, Bogdan; Poslavskii, Stanislav; Potterat, Cédric; Price, Eugenia; Price, Joseph David; Prisciandaro, Jessica; Pritchard, Adrian; Prouve, Claire; Pugatch, Valery; Puig Navarro, Albert; Punzi, Giovanni; Qian, Wenbin; Quagliani, Renato; Rachwal, Bartolomiej; Rademacker, Jonas; Rama, Matteo; Ramos Pernas, Miguel; Rangel, Murilo; Raniuk, Iurii; Raven, Gerhard; Redi, Federico; Reichert, Stefanie; dos Reis, Alberto; Remon Alepuz, Clara; Renaudin, Victor; Ricciardi, Stefania; Richards, Sophie; Rihl, Mariana; Rinnert, Kurt; Rives Molina, Vicente; Robbe, Patrick; Rodrigues, Ana Barbara; Rodrigues, Eduardo; Rodriguez Lopez, Jairo Alexis; Rodriguez Perez, Pablo; Rogozhnikov, Alexey; Roiser, Stefan; Rollings, Alexandra Paige; Romanovskiy, Vladimir; Romero Vidal, Antonio; Ronayne, John William; Rotondo, Marcello; Rudolph, Matthew Scott; Ruf, Thomas; Ruiz Valls, Pablo; Saborido Silva, Juan Jose; Sadykhov, Elnur; Sagidova, Naylya; Saitta, Biagio; Salustino Guimaraes, Valdir; Sanchez Mayordomo, Carlos; Sanmartin Sedes, Brais; Santacesaria, Roberta; Santamarina Rios, Cibran; Santimaria, Marco; Santovetti, Emanuele; Sarti, Alessio; Satriano, Celestina; Satta, Alessia; Saunders, Daniel Martin; Savrina, Darya; Schael, Stefan; Schellenberg, Margarete; Schiller, Manuel; Schindler, Heinrich; Schlupp, Maximilian; Schmelling, Michael; Schmelzer, Timon; Schmidt, Burkhard; Schneider, Olivier; Schopper, Andreas; Schubert, Konstantin; Schubiger, Maxime; Schune, Marie Helene; Schwemmer, Rainer; Sciascia, Barbara; Sciubba, Adalberto; Semennikov, Alexander; Sergi, Antonino; Serra, Nicola; Serrano, Justine; Sestini, Lorenzo; Seyfert, Paul; Shapkin, Mikhail; Shapoval, Illya; Shcheglov, Yury; Shears, Tara; Shekhtman, Lev; Shevchenko, Vladimir; Shires, Alexander; Siddi, Benedetto Gianluca; Silva Coutinho, Rafael; Silva de Oliveira, Luiz Gustavo; Simi, Gabriele; Simone, Saverio; Sirendi, Marek; Skidmore, Nicola; Skwarnicki, Tomasz; Smith, Eluned; Smith, Iwan Thomas; Smith, Jackson; Smith, Mark; Snoek, Hella; Sokoloff, Michael; Soler, Paul; Souza De Paula, Bruno; Spaan, Bernhard; Spradlin, Patrick; Sridharan, Srikanth; Stagni, Federico; Stahl, Marian; Stahl, Sascha; Stefko, Pavol; Stefkova, Slavorima; Steinkamp, Olaf; Stemmle, Simon; Stenyakin, Oleg; Stevenson, Scott; Stoica, Sabin; Stone, Sheldon; Storaci, Barbara; Stracka, Simone; Straticiuc, Mihai; Straumann, Ulrich; Sun, Liang; Sutcliffe, William; Swientek, Krzysztof; Syropoulos, Vasileios; Szczekowski, Marek; Szumlak, Tomasz; T'Jampens, Stephane; Tayduganov, Andrey; Tekampe, Tobias; Teklishyn, Maksym; Tellarini, Giulia; Teubert, Frederic; Thomas, Eric; van Tilburg, Jeroen; Tilley, Matthew James; Tisserand, Vincent; Tobin, Mark; Tolk, Siim; Tomassetti, Luca; Tonelli, Diego; Topp-Joergensen, Stig; Toriello, Francis; Tournefier, Edwige; Tourneur, Stephane; Trabelsi, Karim; Traill, Murdo; Tran, Minh Tâm; Tresch, Marco; Trisovic, Ana; Tsaregorodtsev, Andrei; Tsopelas, Panagiotis; Tully, Alison; Tuning, Niels; Ukleja, Artur; Ustyuzhanin, Andrey; Uwer, Ulrich; Vacca, Claudia; Vagnoni, Vincenzo; Valassi, Andrea; Valat, Sebastien; Valenti, Giovanni; Vallier, Alexis; Vazquez Gomez, Ricardo; Vazquez Regueiro, Pablo; Vecchi, Stefania; van Veghel, Maarten; Velthuis, Jaap; Veltri, Michele; Veneziano, Giovanni; Venkateswaran, Aravindhan; Vernet, Maxime; Vesterinen, Mika; Viaud, Benoit; Vieira, Daniel; Vieites Diaz, Maria; Vilasis-Cardona, Xavier; Volkov, Vladimir; Vollhardt, Achim; Voneki, Balazs; Vorobyev, Alexey; Vorobyev, Vitaly; Voß, Christian; de Vries, Jacco; Vázquez Sierra, Carlos; Waldi, Roland; Wallace, Charlotte; Wallace, Ronan; Walsh, John; Wang, Jianchun; Ward, David; Wark, Heather Mckenzie; Watson, Nigel; Websdale, David; Weiden, Andreas; Whitehead, Mark; Wicht, Jean; Wilkinson, Guy; Wilkinson, Michael; Williams, Mark Richard James; Williams, Matthew; Williams, Mike; Williams, Timothy; Wilson, Fergus; Wimberley, Jack; Wishahi, Julian; Wislicki, Wojciech; Witek, Mariusz; Wormser, Guy; Wotton, Stephen; Wraight, Kenneth; Wright, Simon; Wyllie, Kenneth; Xie, Yuehong; Xing, Zhou; Xu, Zhirui; Yang, Zhenwei; Yin, Hang; Yu, Jiesheng; Yuan, Xuhao; Yushchenko, Oleg; Zarebski, Kristian Alexander; Zavertyaev, Mikhail; Zhang, Liming; Zhang, Yanxi; Zhang, Yu; Zhelezov, Alexey; Zheng, Yangheng; Zhokhov, Anatoly; Zhu, Xianglei; Zhukov, Valery; Zucchelli, Stefano

    2017-03-23

    Measurements of charm mixing and $C\\!P$ violation parameters from the decay-time-dependent ratio of $ D^0 \\to K^+ \\pi^- $ to $ D^0 \\to K^- \\pi^+ $ decay rates and the charge-conjugate ratio are reported. The analysis uses $\\overline{B}\\to D^{*+} \\mu^- X$, and charge-conjugate decays, where $D^{*+}\\to D^0 \\pi^+$, and $D^0\\to K^{\\mp} \\pi^{\\pm}$. The $pp$ collision data are recorded by the LHCb experiment at center-of-mass energies $\\sqrt{s}$ = 7 and 8 TeV, corresponding to an integrated luminosity of 3 fb$^{-1}$. The data are analyzed under three hypotheses: (i) mixing assuming $C\\!P$ symmetry, (ii) mixing assuming no direct $C\\!P$ violation in the Cabibbo-favored or doubly Cabibbo-suppressed decay amplitudes, and (iii) mixing allowing either direct $C\\!P$ violation and/or $C\\!P$ violation in the superpositions of flavor eigenstates defining the mass eigenstates. The data are also combined with those from a previous LHCb study of $D^0\\to K \\pi$ decays from a disjoint set of $ D^{*+} $ candidates produced direct...

  16. Discovery of a thermally persistent h.c.p. solid-solution phase in the Ni-W system

    International Nuclear Information System (INIS)

    Kurz, S. J. B.; Leineweber, A.; Maisel, S. B.; Höfler, M.; Müller, S.; Mittemeijer, E. J.

    2014-01-01

    Although the accepted Ni-W phase diagram does not reveal the existence of h.c.p.-based phases, h.c.p.-like stacking sequences were observed in magnetron-co-sputtered Ni-W thin films at W contents of 20 to 25 at. %, by using transmission electron microscopy and X-ray diffraction. The occurrence of this h.c.p.-like solid-solution phase could be rationalized by first-principles calculations, showing that the vicinity of the system's ground-state line is populated with metastable h.c.p.-based superstructures in the intermediate concentration range from 20 to 50 at. % W. The h.c.p.-like stacking in Ni-W films was observed to be thermally persistent, up to temperatures as high as at least 850 K, as evidenced by extensive X-ray diffraction analyses on specimens before and after annealing treatments. The tendency of Ni-W for excessive planar faulting is discussed in the light of these new findings

  17. TENSILE PROPERTIES OF EXTRUDED SiC(P/Al-2124 BULK FUNCTIONALL Y GRADED MATERIALS

    Directory of Open Access Journals (Sweden)

    HÜSEYİN UZUN

    2000-06-01

    Full Text Available Fonksiyonel kademeli değişken malzemeler yeni bir kompozit malzeıne türü dür. Bu malzemeler, bir makine parçasının belirli bölgelerinde istenilen bir özelliğı elde etmek için dizayn edilmiş olup, malzeınenin kimyasal birleşimi, mikroyapısı ya süreklilik arz edecek şekilde yada kademelİ olarak makine parçasının bir bölgesinden diğer bir bölgesine doğru değişmesi söz konusudur. Bu çalışınada kullanılan fonksiyonel değişken ınalzeme ler, birbiri içinde dairesel kademeli bir forma sahip olup SiC(p/AI-2124 kompozit sistemi esasına göre 400°C 'de sıcak ekstrüzyon ile üretilmişlerdir. Üretilen fonksiyonel değişken malzemelerin dış yüzeyi, Al-2124 matrix içine SiC parçacıklarının takviye edilmesinden dolayı oldukça sert, göbek kısmı ise takviyesiz Al-2 124 alaşımından dolayı oldukça tok bir özellik gösterir. Bu çalışmada bu malzemelerin çekme mukavemeti özellikleri incelenm iştir. Elde edilen deneysel so nuçlar, teorik olarak geliştirilen fonnü 1lere göre hesaplanarak elde edilen sonuçlar ile karşılaştı rılmıştır. Sonuç olarak, geleneksel kompozit malzemeler ile karşılaştırıldığında, fonksiyonel değişken malzemelerin sünekliğinin artmış olduğu fakat hafifçe % 0.2 akma ve çekme mukavemetlerinde azalmanın mevcut olduğu tespit edilmiştir.

  18. The dev Operon Regulates the Timing of Sporulation during Myxococcus xanthus Development.

    Science.gov (United States)

    Rajagopalan, Ramya; Kroos, Lee

    2017-05-15

    Myxococcus xanthus undergoes multicellular development when starved. Thousands of rod-shaped cells coordinate their movements and aggregate into mounds in which cells differentiate into spores. Mutations in the dev operon impair development. The dev operon encompasses a clustered regularly interspaced short palindromic repeat-associated (CRISPR-Cas) system. Null mutations in devI , a small gene at the beginning of the dev operon, suppress the developmental defects caused by null mutations in the downstream devR and devS genes but failed to suppress defects caused by a small in-frame deletion in devT We provide evidence that the original mutant has a second-site mutation. We show that devT null mutants exhibit developmental defects indistinguishable from devR and devS null mutants, and a null mutation in devI suppresses the defects of a devT null mutation. The similarity of DevTRS proteins to components of the CRISPR-associated complex for antiviral defense (Cascade), together with our molecular characterization of dev mutants, support a model in which DevTRS form a Cascade-like subcomplex that negatively autoregulates dev transcript accumulation and prevents DevI overproduction that would strongly inhibit sporulation. Our results also suggest that DevI transiently inhibits sporulation when regulated normally. The mechanism of transient inhibition may involve MrpC, a key transcription factor, whose translation appears to be weakly inhibited by DevI. Finally, our characterization of a devI devS mutant indicates that very little exo transcript is required for sporulation, which is surprising since Exo proteins help form the polysaccharide spore coat. IMPORTANCE CRISPR-Cas systems typically function as adaptive immune systems in bacteria. The dev CRISPR-Cas system of M. xanthus has been proposed to prevent bacteriophage infection during development, but how dev controls sporulation has been elusive. Recent evidence supported a model in which DevR and DevS prevent

  19. Role of the ganSPQAB Operon in Degradation of Galactan by Bacillus subtilis.

    Science.gov (United States)

    Watzlawick, Hildegard; Morabbi Heravi, Kambiz; Altenbuchner, Josef

    2016-10-15

    Bacillus subtilis possesses different enzymes for the utilization of plant cell wall polysaccharides. This includes a gene cluster containing galactan degradation genes (ganA and ganB), two transporter component genes (ganQ and ganP), and the sugar-binding lipoprotein-encoding gene ganS (previously known as cycB). These genes form an operon that is regulated by GanR. The degradation of galactan by B. subtilis begins with the activity of extracellular GanB. GanB is an endo-β-1,4-galactanase and is a member of glycoside hydrolase (GH) family 53. This enzyme was active on high-molecular-weight arabinose-free galactan and mainly produced galactotetraose as well as galactotriose and galactobiose. These galacto-oligosaccharides may enter the cell via the GanQP transmembrane proteins of the galactan ABC transporter. The specificity of the galactan ABC transporter depends on the sugar-binding lipoprotein, GanS. Purified GanS was shown to bind galactotetraose and galactotriose using thermal shift assay. The energy for this transport is provided by MsmX, an ATP-binding protein. The transported galacto-oligosaccharides are further degraded by GanA. GanA is a β-galactosidase that belongs to GH family 42. The GanA enzyme was able to hydrolyze short-chain β-1,4-galacto-oligosaccharides as well as synthetic β-galactopyranosides into galactose. Thermal shift assay as well as electrophoretic mobility shift assay demonstrated that galactobiose is the inducer of the galactan operon regulated by GanR. DNase I footprinting revealed that the GanR protein binds to an operator overlapping the -35 box of the σ(A)-type promoter of Pgan, which is located upstream of ganS IMPORTANCE: Bacillus subtilis is a Gram-positive soil bacterium that utilizes different types of carbohydrates, such as pectin, as carbon sources. So far, most of the pectin degradation systems and enzymes have been thoroughly studied in B. subtilis Nevertheless, the B. subtilis utilization system of galactan, which is

  20. RbsR Activates Capsule but Represses the rbsUDK Operon in Staphylococcus aureus.

    Science.gov (United States)

    Lei, Mei G; Lee, Chia Y

    2015-12-01

    Staphylococcus aureus capsule is an important virulence factor that is regulated by a large number of regulators. Capsule genes are expressed from a major promoter upstream of the cap operon. A 10-bp inverted repeat (IR) located 13 bp upstream of the -35 region of the promoter was previously shown to affect capsule gene transcription. However, little is known about transcriptional activation of the cap promoter. To search for potential proteins which directly interact with the cap promoter region (Pcap), we directly analyzed the proteins interacting with the Pcap DNA fragment from shifted gel bands identified by electrophoretic mobility shift assay. One of these regulators, RbsR, was further characterized and found to positively regulate cap gene expression by specifically binding to the cap promoter region. Footprinting analyses showed that RbsR protected a DNA region encompassing the 10-bp IR. Our results further showed that rbsR was directly controlled by SigB and that RbsR was a repressor of the rbsUDK operon, involved in ribose uptake and phosphorylation. The repression of rbsUDK by RbsR could be derepressed by D-ribose. However, D-ribose did not affect RbsR activation of capsule. Staphylococcus aureus is an important human pathogen which produces a large number of virulence factors. We have been using capsule as a model virulence factor to study virulence regulation. Although many capsule regulators have been identified, the mechanism of regulation of most of these regulators is unknown. We show here that RbsR activates capsule by direct promoter binding and that SigB is required for the expression of rbsR. These results define a new pathway wherein SigB activates capsule through RbsR. Our results further demonstrate that RbsR inhibits the rbs operon involved in ribose utilization, thereby providing an example of coregulation of metabolism and virulence in S. aureus. Thus, this study further advances our understanding of staphylococcal virulence regulation

  1. Regulation of mtl operon promoter of Bacillus subtilis: requirements of its use in expression vectors

    Directory of Open Access Journals (Sweden)

    Altenbuchner Josef

    2011-10-01

    Full Text Available Abstract Background Several vector systems have been developed to express any gene desired to be studied in Bacillus subtilis. Among them, the transcriptionally regulated promoters involved in carbohydrate utilization are a research priority. Expression systems based on Bacillus promoters for xylose, maltose, and mannose utilization, as well as on the heterologous E. coli lactose promoter, have been successfully constructed. The promoter of the mtlAFD operon for utilization of mannitol is another promising candidate for its use in expression vectors. In this study, we investigated the regulation of the mtl genes in order to identify the elements needed to construct a strong mannitol inducible expression system in B. subtilis. Results Regulation of the promoters of mtlAFD operon (PmtlA and mtlR (PmtlR encoding the activator were investigated by fusion to lacZ. Identification of the PmtlA and PmtlR transcription start sites revealed the σA like promoter structures. Also, the operator of PmtlA was determined by shortening, nucleotide exchange, and alignment of PmtlA and PmtlR operator regions. Deletion of the mannitol-specific PTS genes (mtlAF resulted in PmtlA constitutive expression demonstrating the inhibitory effect of EIICBMtl and EIIAMtl on MtlR in the absence of mannitol. Disruption of mtlD made the cells sensitive to mannitol and glucitol. Both PmtlA and PmtlR were influenced by carbon catabolite repression (CCR. However, a CcpA deficient mutant showed only a slight reduction in PmtlR catabolite repression. Similarly, using PgroE as a constitutive promoter, putative cre sites of PmtlA and PmtlR slightly reduced the promoter activity in the presence of glucose. In contrast, glucose repression of PmtlA and PmtlR was completely abolished in a ΔptsG mutant and significantly reduced in a MtlR (H342D mutant. Conclusions The mtl operon promoter (PmtlA is a strong promoter that reached a maximum of 13,000 Miller units with lacZ as a reporter on

  2. Transformation and characterization of an arsenic gene operon from urease-positive thermophilic Campylobacter (UPTC) in Escherichia coli.

    Science.gov (United States)

    Matsuda, M; Kuribayashi, T; Yamamoto, S; Millar, B C; Moore, J E

    2016-01-01

    An arsenate susceptibility test was performed with transformed and cultured Escherichia coli DH5α cells, which carried recombinant DNA of full-length arsenic (ars) operon, namely a putative membrane permease, ArsP; a transcriptional repressor, ArsR; an arsenate reductase, ArsC; and an arsenical-resistance membrane transporter, Acr3, from the Japanese urease-positive thermophilic Campylobacter lari (UPTC) CF89-12. The E. coli DH5α transformant showed reduced susceptibility to arsenate (~1536 μg/mL), compared to the control. Thus, these ars four-genes from the UPTC CF89-12 strain cells could confer a reduced susceptibility to arsenate in the transformed and E. coli DH5α cells. E. coli transformants with truncated ars operons, acr3 (acr3) and arsC-acr3 (∆arsC-acr3), of the ars operon, showed an MIC value of 384 μg/mL (~384 μg/mL), similar to the E. coli cells which carried the pGEM-T vector (control). Reverse transcription PCR confirmed in vivo transcription of recombinant full-length ars operon and deletion variants (∆acr3 and ∆arsC-acr3) in the transformed E. coli cells.

  3. Cyanobacterial flv4-2 Operon-Encoded Proteins Optimize Light Harvesting and Charge Separation in Photosystem II.

    Science.gov (United States)

    Chukhutsina, Volha; Bersanini, Luca; Aro, Eva-Mari; van Amerongen, Herbert

    2015-05-01

    Photosystem II (PSII) complexes drive the water-splitting reaction necessary to transform sunlight into chemical energy. However, too much light can damage and disrupt PSII. In cyanobacteria, the flv4-2 operon encodes three proteins (Flv2, Flv4, and Sll0218), which safeguard PSII activity under air-level CO2 and in high light conditions. However, the exact mechanism of action of these proteins has not been clarified yet. We demonstrate that the PSII electron transfer properties are influenced by the flv4-2 operon-encoded proteins. Accelerated secondary charge separation kinetics was observed upon expression/overexpression of the flv4-2 operon. This is likely induced by docking of the Flv2/Flv4 heterodimer in the vicinity of the QB pocket of PSII, which, in turn, increases the QB redox potential and consequently stabilizes forward electron transfer. The alternative electron transfer route constituted by Flv2/Flv4 sequesters electrons from QB(-) guaranteeing the dissipation of excess excitation energy in PSII under stressful conditions. In addition, we demonstrate that in the absence of the flv4-2 operon-encoded proteins, about 20% of the phycobilisome antenna becomes detached from the reaction centers, thus decreasing light harvesting. Phycobilisome detachment is a consequence of a decreased relative content of PSII dimers, a feature observed in the absence of the Sll0218 protein. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

  4. A Quantitative bgl Operon Model for E. coli Requires BglF Conformational Change for Sugar Transport

    Science.gov (United States)

    Chopra, Paras; Bender, Andreas

    The bgl operon is responsible for the metabolism of β-glucoside sugars such as salicin or arbutin in E. coli. Its regulatory system involves both positive and negative feedback mechanisms and it can be assumed to be more complex than that of the more closely studied lac and trp operons. We have developed a quantitative model for the regulation of the bgl operon which is subject to in silico experiments investigating its behavior under different hypothetical conditions. Upon administration of 5mM salicin as an inducer our model shows 80-fold induction, which compares well with the 60-fold induction measured experimentally. Under practical conditions 5-10mM inducer are employed, which is in line with the minimum inducer concentration of 1mM required by our model. The necessity of BglF conformational change for sugar transport has been hypothesized previously, and in line with those hypotheses our model shows only minor induction if conformational change is not allowed. Overall, this first quantitative model for the bgl operon gives reasonable predictions that are close to experimental results (where measured). It will be further refined as values of the parameters are determined experimentally. The model was developed in Systems Biology Markup Language (SBML) and it is available from the authors and from the Biomodels repository [www.ebi.ac.uk/biomodels].

  5. Inactivation of protein translocation by cold-sensitive mutations in the yajC-secDF operon

    NARCIS (Netherlands)

    Nouwen, N; Driessen, AJM

    2005-01-01

    Most mutations in the yajC-secDF operon identified via genetic screens confer a cold-sensitive growth phenotype. Here we report that two of these mutations confer this cold-sensitive phenotype by inactivating the SecDF-YajC complex in protein translocation.

  6. rRNA Operon Copy Number Can Explain the Distinct Epidemiology of Hospital-Associated Methicillin-Resistant Staphylococcus aureus

    NARCIS (Netherlands)

    Fluit, A.C.; Jansen, M.D.; Bosch, T.; Jansen, W.T.M.; Schouls, L.; Jonker, M.J.; Boel, C.H.E.

    2016-01-01

    The distinct epidemiology of original hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and early community-associated MRSA (CA-MRSA) is largely unexplained. S. aureus carries either five or six rRNA operon copies. Evidence is provided for a scenario in which MRSA has adapted

  7. Mechanistic deductions from kinetic isotope effects and pH studies of pyridoxal phosphate dependent carbon-carbon lyases: Erwinia herbicola and Citrobacter freundii tyrosine phenol-lyase

    International Nuclear Information System (INIS)

    Kiick, D.M.; Phillips, R.S.

    1988-01-01

    The pH dependence of the kinetic parameters and primary deuterium isotope effects have been determined for tyrosine phenol-lyase from both Erwinia herbicola and Citrobacter freundii. The primary deuterium isotope effects indicate that proton abstraction from the 2-position of the substrate is partially rate-limiting for both enzymes. The C. freundii enzyme primary deuterium isotope effects [DV = 3.5 and D(V/Ktyr) = 2.5] are pH independent, indicating that tyrosine is not sticky (i.e., does not dissociate slower than it reacts to give products). Since Vmax for both tyrosine and the alternate substrate S-methyl-L-cysteine is also pH independent, substrate binds only to the correctly protonated form of the enzyme. For the E. herbicola enzyme, both Vmax and V/K for tyrosine or S-methyl-L-cysteine are pH dependent, as well as both DV and D(V/Ktyr). Thus, while both the protonated and unprotonated enzyme can bind substrate, and may be interconverted directly, only the unprotonated Michaelis complex is catalytically competent. At pH 9.5, DV = 2.5 and D(V/Ktyr) = 1.5. However, at pH 6.4 the isotope effect on both parameters is equal to 4.1. From these data, the forward commitment factor (cf = 5.2) and catalytic ratio (cvf = 1.1) for tyrosine and S-methyl-L-cysteine (cf = 2.2, cvf = 24) are calculated. Also, the Michaelis complex partition ratio (cf/cvf) for substrate and products is calculated to be 4.7 for tyrosine and 0.1 for S-methyl-L-cysteine

  8. No-Go Theorem for Nonstandard Explanations of the τ →KSπ ντ C P Asymmetry

    Science.gov (United States)

    Cirigliano, Vincenzo; Crivellin, Andreas; Hoferichter, Martin

    2018-04-01

    The C P asymmetry in τ →KSπ ντ , as measured by the BABAR collaboration, differs from the standard model prediction by 2.8 σ . Most nonstandard interactions do not allow for the required strong phase needed to produce a nonvanishing C P asymmetry, leaving only new tensor interactions as a possible mechanism. We demonstrate that, contrary to previous assumptions in the literature, the crucial interference between vector and tensor phases is suppressed by at least 2 orders of magnitude due to Watson's final-state-interaction theorem. Furthermore, we find that the strength of the relevant C P -violating tensor interaction is strongly constrained by bounds from the neutron electric dipole moment and D - D ¯ mixing. These observations together imply that it is extremely difficult to explain the current τ →KSπ ντ measurement in terms of physics beyond the standard model originating in the ultraviolet.

  9. Microbial C:P stoichiometry is shaped by redox conditions along an elevation gradient in humid tropical rainforests

    Science.gov (United States)

    Lin, Y.; Gross, A.; Silver, W. L.

    2017-12-01

    Elemental stoichiometry of microorganisms is intimately related to ecosystem carbon and nutrient fluxes and is ultimately controlled by the chemical (plant tissue, soil, redox) and physical (temperature, moisture, aeration) environment. Previous meta-analyses have shown that the C:P ratio of soil microbial biomass exhibits significant variations among and within biomes. Little is known about the underlying causes of this variability. We examined soil microbial C:P ratios along an elevation gradient in the Luquillo Experimental Forest in Puerto Rico. We analyzed soils from mixed forest paired with monodominant palm forest every 100 m from 300 m to 1000 m a.s.l.. Mean annual precipitation increased with increasing elevation, resulting in stronger reducing conditions and accumulation of soil Fe(II) at higher elevations. The mean value and variability of soil microbial C:P ratios generally increased with increasing elevation except at 1000 m. At high elevations (600-900 m), the average value of microbial C:P ratio (108±10:1) was significantly higher than the global average ( 55:1). We also found that soil organic P increased with increasing elevation, suggesting that an inhibition of organic P mineralization, not decreased soil P availability, may cause the high microbial C:P ratio. The soil microbial C:P ratio was positively correlated with soil HCl-extractable Fe(II), suggesting that reducing conditions may be responsible for the elevational changes observed. In a follow-up experiment, soils from mixed forests at four elevation levels (300, 500, 700, and 1000 m) were incubated under aerobic and anaerobic conditions for two weeks. We found that anaerobic incubation consistently increased the soil microbial C:P ratio relative to the aerobic incubation. Overall, our results indicate that redox conditions can shift the elemental composition of microbial biomass. The high microbial C:P ratios induced under anoxic conditions may reflect inhibition of microbial P

  10. Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Solem, Christian; Jensen, Peter Ruhdal

    2005-01-01

    control on glycolysis and growth rate but high negative control on formate production. We find that PFK and PK have zero control on glycolysis and growth rate at the wildtype enzyme level but both enzymes exert strong positive control on the glycolytic flux at reduced activities. PK has high positive...... coefficient increased towards 3. Increased las expression resulted in a slight decrease in the glycolytic flux. At the wildtype level the control was close to zero on both glycolysis and the pyruvate branches. The sum of control coefficients for the three enzymes individually was comparable to the control...... coefficient found for the entire operon; the strong positive control by PK almost cancels out the negative control by LDH on formate production. The analysis suggests that co-regulation of PFK and PK provides a very efficient way to regulate glycolysis, and co-regulating PK and LDH allows the cells...

  11. Control of MarRAB Operon in Escherichia coli via Autoactivation and Autorepression

    Science.gov (United States)

    Prajapat, Mahendra Kumar; Jain, Kirti; Saini, Supreet

    2015-01-01

    Choice of network topology for gene regulation has been a question of interest for a long time. How do simple and more complex topologies arise? In this work, we analyze the topology of the marRAB operon in Escherichia coli, which is associated with control of expression of genes associated with conferring resistance to low-level antibiotics to the bacterium. Among the 2102 promoters in E. coli, the marRAB promoter is the only one that encodes for an autoactivator and an autorepressor. What advantages does this topology confer to the bacterium? In this work, we demonstrate that, compared to control by a single regulator, the marRAB regulatory arrangement has the least control cost associated with modulating gene expression in response to environmental stimuli. In addition, the presence of dual regulators allows the regulon to exhibit a diverse range of dynamics, a feature that is not observed in genes controlled by a single regulator. PMID:26445450

  12. Characterization of the orf1glnKamtB operon of Herbaspirillum seropedicae.

    Science.gov (United States)

    Noindorf, Lilian; Rego, Fabiane G M; Baura, Valter A; Monteiro, Rose A; Wassem, Roseli; Cruz, Leonardo M; Rigo, Liu U; Souza, Emanuel M; Steffens, Maria B R; Pedrosa, Fabio O; Chubatsu, Leda S

    2006-03-01

    Herbaspirillum seropedicae is an endophytic nitrogen-fixing bacterium that colonizes economically important grasses. In this organism, the amtB gene is co-transcribed with two other genes: glnK that codes for a PII-like protein and orf1 that codes for a probable periplasmatic protein of unknown function. The expression of the orf1glnKamtB operon is increased under nitrogen-limiting conditions and is dependent on NtrC. An amtB mutant failed to transport methylammonium. Post-translational control of nitrogenase was also partially impaired in this mutant, since a complete switch-off of nitrogenase after ammonium addition was not observed. This result suggests that the AmtB protein is involved in the signaling pathway for the reversible inactivation of nitrogenase in H. seropedicae.

  13. Transcription analysis of the Streptomyces coelicolor A3(2) rrnA operon

    DEFF Research Database (Denmark)

    van Wezel, G P; Krab, I M; Douthwaite, S

    1994-01-01

    Transcription start sites and processing sites of the Streptomyces coelicolor A3(2) rrnA operon have been investigated by a combination of in vivo and in vitro transcription analyses. The data from these approaches are consistent with the existence of four in vivo transcription sites, corresponding...... to the promoters P1-P4. The transcription start sites are located at -597, -416, -334 and -254 relative to the start of the 16S rRNA gene. Two putative processing sites were identified, one of which is similar to a sequence reported earlier in S. coelicolor and other eubacteria. The P1 promoter is likely...... common to P2, P3 and P4 is not similar to any other known consensus promoter sequence. In fast-growing mycelium, P2 appears to be the most frequently used promoter. Transcription from all of the rrnA promoters decreased during the transition from exponential to stationary phase, although transcription...

  14. Role of Streptococcus pneumoniae OM001 operon in capsular polysaccharide production, virulence and survival in human saliva.

    Science.gov (United States)

    Ahmad, Zuleeza; Harvey, Richard M; Paton, James C; Standish, Alistair J; Morona, Renato

    2018-01-01

    Streptococcus pneumoniae is the leading cause of community-acquired pneumonia in all ages worldwide, and with ever-increasing antibiotic resistance, the understanding of its pathogenesis and spread is as important as ever. Recently, we reported the presence of a Low Molecular Weight Tyrosine Phosphatase (LMWPTP) Spd1837 in the pneumococcus. This protein is encoded in an operon, OM001 with two other genes, with previous work implicating this operon as important for pneumococcal virulence. Thus, we set out to investigate the role of the individual genes in the operon during pneumococcal pathogenesis. As LMWPTPs play a major role in capsular polysaccharide (CPS) biosynthesis in many bacteria, we tested the effect of mutating spd1837 and its adjacent genes, spd1836 and spd1838 on CPS levels. Our results suggest that individual deletion of the genes, including the LMWPTP, did not modulate CPS levels, in multiple conditions, and in different strain backgrounds. Following in vivo studies, Spd1836 was identified as a novel virulence factor during pneumococcal invasive disease, in both the lungs and blood, with this protein alone responsible for the effects of operon's role in virulence. We also showed that a deletion in spd1836, spd1838 or the overall OM001 operon reduced survival in human saliva during the conditions that mimic transmission compared to the wildtype strain. With studies suggesting that survival in human saliva may be important for transmission, this study identifies Spd1836 and Spd1838 as transmission factors, potentially facilitating the spread of the pneumococcus from person to person. Overall, this study hopes to further our understanding of the bacterial transmission that precedes disease and outbreaks.

  15. Comparative analysis of the mechanisms of sulfur anion oxidation and reduction by dsr operon to maintain environmental sulfur balance.

    Science.gov (United States)

    Ghosh, Semanti; Bagchi, Angshuman

    2015-12-01

    Sulfur metabolism is one of the oldest known redox geochemical cycles in our atmosphere. These redox processes utilize different sulfur anions and the reactions are performed by the gene products of dsr operon from phylogenetically diverse sets of microorganisms. The operon is involved in the maintenance of environmental sulfur balance. Interestingly, the dsr operon is found to be present in both sulfur anion oxidizing and reducing microorganisms and in both types of organisms DsrAB protein complex plays a vital role. Though there are various reports regarding the genetics of dsr operon there are practically no reports dealing with the structural aspects of sulfur metabolism by dsr operon. In our present study, we tried to compare the mechanisms of sulfur anion oxidation and reduction by Allochromatium vinosum and Desulfovibrio vulgaris respectively through DsrAB protein complex. We analyzed the modes of bindings of sulfur anions to the DsrAB protein complex and observed that for sulfur anion oxidizers, sulfide and thiosulfate are the best substrates whereas for reducers sulfate and sulfite have the best binding abilities. We analyzed the binding interaction pattern of the DsrA and DsrB proteins while forming the DsrAB protein complexes in Desulfovibrio vulgaris and Allochromatium vinosum. To our knowledge this is the first report that analyzes the differences in binding patterns of sulfur substrates with DsrAB protein from these two microorganisms. This study would therefore be essential to predict the biochemical mechanism of sulfur anion oxidation and reduction by these two microorganisms i.e., Desulfovibrio vulgaris (sulfur anion reducer) and Allochromatium vinosum (sulfur anion oxidizer). Our observations also highlight the mechanism of sulfur geochemical cycle which has important implications in future study of sulfur metabolism as it has a huge application in waste remediation and production of industrial bio-products viz. vitamins, bio-polyesters and bio

  16. RepA and RepB exert plasmid incompatibility repressing the transcription of the repABC operon.

    Science.gov (United States)

    Pérez-Oseguera, Angeles; Cevallos, Miguel A

    2013-11-01

    Rhizobium etli CFN42 has a multipartite genome composed of one chromosome and six large plasmids with low copy numbers, all belonging to the repABC plasmid family. All elements essential for replication and segregation of these plasmids are encoded within the repABC operon. RepA and RepB direct plasmid segregation and are involved in the transcriptional regulation of the operon, and RepC is the initiator protein of the plasmid. Here we show that in addition to RepA (repressor) and RepB (corepressor), full transcriptional repression of the operon located in the symbiotic plasmid (pRetCFN42d) of this strain requires parS, the centromere-like sequence, and the operator sequence. However, the co-expression of RepA and RepB is sufficient to induce the displacement of the parental plasmid. RepA is a Walker-type ATPase that self associates in vivo and in vitro and binds specifically to the operator region in its RepA-ADP form. In contrast, RepA-ATP is capable of binding to non-specific DNA. RepA and RepB form high molecular weight DNA-protein complexes in the presence of ATP and ADP. RepA carrying ATP-pocket motif mutations induce full repression of the repABC operon without the participation of RepB and parS. These mutants specifically bind the operator sequence in their ATP or ADP bound forms. In addition, their expression in trans exerts plasmid incompatibility against the parental plasmid. RepA and RepB expressed in trans induce plasmid incompatibility because of their ability to repress the repABC operon and not only by their capacity to distort the plasmid segregation process. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Identification of a protein glycosylation operon from Campylobacter jejuni JCM 2013 and its heterologous expression in Escherichia coli.

    Science.gov (United States)

    Srichaisupakit, Akkaraphol; Ohashi, Takao; Fujiyama, Kazuhito

    2014-09-01

    Campylobacter jejuni is a human enteropathogenic bacterium possessing an N-glycosylation system. In this work, a protein glycosylation (pgl) operon conferring prokaryotic N-glycosylation in C. jejuni JCM 2013 was cloned and identified. Fourteen open reading frames (ORFs) were found in the pgl operon. The operon organization was similar to that of C. jejuni NCTC 11168, with 98% and 99% identities in overall nucleotide sequence and amino acid sequence, respectively. The pgl operon was heterologously co-expressed with model protein CmeA in the Escherichia coli BL21 ΔwaaL mutant. The immuno- and lectin-blotting analysis indicated the protein glycosylation on the recombinant CmeA. In addition, to analyze the glycan composition, the recombinant CmeA was purified and subjected to in-gel trypsin digestion followed by mass spectrometry analysis. The mass spectrometry analysis showed the presence of the N-acetylhexosamine residue at the reducing end but not the predicted di-N-acetylbacillosamine (diNAcBac) residue. Further glycan structural study using the conventional fluorophore-labeling method revealed the GalNAcα-GalNAcα-(Hex-)HexNAc-HexNAc-HexNAc-HexNAc structure. Transcriptional analysis showed that UDP-diNAcBac synthases and diNAcBac transferase are transcribed but might not function in the constructed system. In conclusion, a pgl operon from C. jejuni JCM 2013 successfully functioned in E. coli, resulting in the observed prokaryotic glycosylation. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  18. Conjugative Plasmid Transfer in Xylella fastidiosa Is Dependent on tra and trb Operon Functions.

    Science.gov (United States)

    Burbank, Lindsey P; Van Horn, Christopher R

    2017-11-01

    The insect-transmitted plant pathogen Xylella fastidiosa is capable of efficient horizontal gene transfer (HGT) and recombination. Natural transformation occurs at high rates in X. fastidiosa , but there also is evidence that certain strains of X. fastidiosa carry native plasmids equipped with transfer and mobilization genes, suggesting conjugation as an additional mechanism of HGT in some instances. Two operons, tra and trb , putatively encoding a conjugative type IV secretion system, are found in some but not all X. fastidiosa isolates, often on native plasmids. X. fastidiosa strains that carry the conjugative transfer genes can belong to different subspecies and frequently differ in host ranges. Using X. fastidiosa strain M23 ( X. fastidiosa subsp. fastidiosa ) or Dixon ( X. fastidiosa subsp. multiplex ) as the donor strain and Temecula ( X. fastidiosa subsp. fastidiosa ) as the recipient strain, plasmid transfer was characterized using the mobilizable broad-host-range vector pBBR5pemIK. Transfer of plasmid pBBR5pemIK was observed under in vitro conditions with both donor strains and was dependent on both tra and trb operon functions. A conjugative mechanism likely contributes to gene transfer between diverse strains of X. fastidiosa , possibly facilitating adaptation to new environments or different hosts. IMPORTANCE Xylella fastidiosa is an important plant pathogen worldwide, infecting a wide range of different plant species. The emergence of new diseases caused by X. fastidiosa , or host switching of existing strains, is thought to be primarily due to the high frequency of HGT and recombination in this pathogen. Transfer of plasmids by a conjugative mechanism enables movement of larger amounts of genetic material at one time, compared with other routes of gene transfer such as natural transformation. Establishing the prevalence and functionality of this mechanism in X. fastidiosa contributes to a better understanding of HGT, adaptation, and disease emergence

  19. The atlA operon of Streptococcus mutans: role in autolysin maturation and cell surface biogenesis.

    Science.gov (United States)

    Ahn, Sang-Joon; Burne, Robert A

    2006-10-01

    The Smu0630 protein (AtlA) was recently shown to be involved in cell separation, biofilm formation, and autolysis. Here, transcriptional studies revealed that atlA is part of a multigene operon under the control of at least three promoters. The morphology and biofilm-forming capacity of a nonpolar altA mutant could be restored to that of the wild-type strain by adding purified AtlA protein to the medium. A series of truncated derivatives of AtlA revealed that full activity required the C terminus and repeat regions. AtlA was cell associated and readily extractable from with sodium dodecyl sulfate. Of particular interest, the surface protein profile of AtlA-deficient strains was dramatically altered compared to the wild-type strain, as was the nature of the association of the multifunctional adhesin P1 with the cell wall. In addition, AtlA-deficient strains failed to develop competence as effectively as the parental strain. Mutation of thmA, which can be cotranscribed with atlA and encodes a putative pore-forming protein, resulted in a phenotype very similar to that of the AtlA-deficient strain. ThmA was also shown to be required for efficient processing of AtlA to its mature form, and treatment of the thmA mutant strain with full-length AtlA protein did not restore normal cell separation and biofilm formation. The effects of mutating other genes in the operon on cell division, biofilm formation, or AtlA biogenesis were not as profound. This study reveals that AtlA is a surface-associated protein that plays a critical role in the network connecting cell surface biogenesis, biofilm formation, genetic competence, and autolysis.

  20. Role of the Escherichia coli glnALG operon in regulation of ammonium transport

    International Nuclear Information System (INIS)

    Jayakuman, A.; Schulman, I.; MacNeil, D.; Barnes, E.M. Jr.

    1986-01-01

    Escherichia coli expresses a specific ammonium (methylammonium) transport system (Amt) when cultured with glutamate or glutamine as the nitrogen source. Over 95% of this Amt activity is repressed by growth of wild-type cells on media containing ammonia. The control of Amt expression was studied with strains containing specific mutations in the glnALG operon. GlnA - (glutamine synthetase deficient) mutants, which contain polar mutations on glnL and glnG genes and therefore have the Reg - phenotype (fail to turn on nitrogen-regulated operons such as histidase), expressed less than 10% of the Amt activity observed for the parental strain. Similarly, low levels of Amt were found in GlnG mutants having the GlnA + Reg - phenotype. However, GlnA - RegC mutants (a phenotype constitutive for histidase) contained over 70% of the parental Amt activity. At steady-state levels, GlnA - RegC mutants accumulated chemically unaltered [ 14 C]methylammonium against a 60- to 80-fold concentration gradient, whereas the labeled substrate was trapped within parental cells as γ-glutamylmethylamide. GlnL Reg - mutants (normal glutamine synthetase regulation) had less than 4% of the Amt activity observed for the parental strain. However, the Amt activity of GlnL RegC mutants was slightly higher than that of the parental strain and was not repressed during growth of cells in media containing ammonia. These findings demonstrate that glutamine synthetase is not required for Amt in E. coli. The loss of Amt in certain GlnA - strains is due to polar effects on glnL nd glnG genes, whose products are involved in expression of nitrogen-regulated genes, including that for Amt

  1. HIV-1 Tat regulates the expression of the dcw operon and stimulates the proliferation of bacteria.

    Science.gov (United States)

    Wei, Jinsong; Zhang, Yumin; Knapp, Pamela E; Zhao, Tianyong

    2016-01-01

    Infections of pathogenic bacteria are very common in acquired immunodeficiency syndrome (AIDS) patients. However, the biological effects of HIV-1 Tat on bacteria are incompletely understood. In this study, HIV-1 Tat was expressed in Escherichia coli and Pseudomonas aeruginosa (PA01) to investigate its biological effects on bacteria. Bacterial cells expressing either HIV-1 Tat1-86 (Tat1-86) or HIV-1 Tat1-72 (Tat1-72) grow significantly faster than those with either only an empty vector or an unrelated control (GFP or Rluc). Supplementation of purified HIV-1 Tat1-86 or Tat1-101 protein into bacterial culture medium stimulated the growth of both E. coli and PA01. The expression profile of certain cell division-associated genes, such as those in the division cell wall (dcw) operon (ftsA, ftsQ, ftsW and ftsZ), yafO and zipA, was altered in HIV-1 Tat1-86 expressing E. coli BL21(DE3). Furthermore, the expression of firefly luciferase (Fluc) reporter gene, when engineered for control by the dcw promoter and terminator, was enhanced by HIV-1 Tat in E. coli, confirming that HIV-1 Tat transcriptionally regulates the expression of the dcw operon. The finding that HIV-1 Tat stimulates bacterial growth whether it is produced intracellularly or applied extracellularly may have relevance for HIV patients who are highly susceptible to opportunistic bacterial infections. Contents category: Viruses -Retroviruses. The GenBank accession number for the sequence of HIV-1 Tat1-86 is AF324439.1. Copyright © 2015 Elsevier Ltd. All rights reserved.

  2. A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.

    Science.gov (United States)

    Zhu, Y; Lin, E C

    1988-05-01

    L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.

  3. Contribution of the nos-pdt operon to virulence phenotypes in methicillin-sensitive Staphylococcus aureus.

    Directory of Open Access Journals (Sweden)

    April M Sapp

    Full Text Available Nitric oxide (NO is emerging as an important regulator of bacterial stress resistance, biofilm development, and virulence. One potential source of endogenous NO production in the pathogen Staphylococcus aureus is its NO-synthase (saNOS enzyme, encoded by the nos gene. Although a role for saNOS in oxidative stress resistance, antibiotic resistance, and virulence has been recently-described, insights into the regulation of nos expression and saNOS enzyme activity remain elusive. To this end, transcriptional analysis of the nos gene in S. aureus strain UAMS-1 was performed, which revealed that nos expression increases during low-oxygen growth and is growth-phase dependent. Furthermore, nos is co-transcribed with a downstream gene, designated pdt, which encodes a prephenate dehydratase (PDT enzyme involved in phenylalanine biosynthesis. Deletion of pdt significantly impaired the ability of UAMS-1 to grow in chemically-defined media lacking phenylalanine, confirming the function of this enzyme. Bioinformatics analysis revealed that the operon organization of nos-pdt appears to be unique to the staphylococci. As described for other S. aureus nos mutants, inactivation of nos in UAMS-1 conferred sensitivity to oxidative stress, while deletion of pdt did not affect this phenotype. The nos mutant also displayed reduced virulence in a murine sepsis infection model, and increased carotenoid pigmentation when cultured on agar plates, both previously-undescribed nos mutant phenotypes. Utilizing the fluorescent stain 4-Amino-5-Methylamino-2',7'-Difluorofluorescein (DAF-FM diacetate, decreased levels of intracellular NO/reactive nitrogen species (RNS were detected in the nos mutant on agar plates. These results reinforce the important role of saNOS in S. aureus physiology and virulence, and have identified an in vitro growth condition under which saNOS activity appears to be upregulated. However, the significance of the operon organization of nos-pdt and

  4. Targeted deletion of the ara operon of Salmonella typhimurium enhances L-arabinose accumulation and drives PBAD-promoted expression of anti-cancer toxins and imaging agents.

    Science.gov (United States)

    Hong, Hyun; Lim, Daejin; Kim, Geun-Joong; Park, Seung-Hwan; Sik Kim, Hyeon; Hong, Yeongjin; Choy, Hyon E; Min, Jung-Joon

    2014-01-01

    Tumor-specific expression of antitumor drugs can be achieved using attenuated Salmonella typhimurium harboring the PBAD promoter, which is induced by L-arabinose. However, L-arabinose does not accumulate because it is metabolized to D-xylulose-5-P by enzymes encoded by the ara operon in Salmonellae. To address this problem, we developed an engineered strain of S. typhimurium in which the ara operon is deleted. Linear DNA transformation was performed using λ red recombinase to exchange the ara operon with linear DNA carrying an antibiotic-resistance gene with homology to regions adjacent to the ara operon. The ara operon-deleted strain and its parental strain were transformed with a plasmid encoding Renilla luciferase variant 8 (RLuc8) or cytolysin A (clyA) under the control of the PBAD promoter. Luciferase assays demonstrated that RLuc8 expression was 49-fold higher in the ara operon-deleted S. typhimurium than in the parental strain after the addition of L-arabinose. In vivo bioluminescence imaging showed that the tumor tissue targeted by the ara operon-deleted Salmonella had a stronger imaging signal (~30-fold) than that targeted by the parental strain. Mice with murine colon cancer (CT26) that had been injected with the ara operon-deleted S. typhimurium expressing clyA showed significant tumor suppression. The present report demonstrates that deletion of the ara operon of S. typhimurium enhances L-arabinose accumulation and thereby drives PBAD-promoted expression of cytotoxic agents and imaging agents. This is a promising approach for tumor therapy and imaging.

  5. Measurement of continuum spectrum from {sup 12}C(p,p`x) at energy of 392 MeV

    Energy Technology Data Exchange (ETDEWEB)

    Yoshida, Hiroki; Konishi, Daisuke; Uozumi, Yusuke; Wakabayashi, Genichiro; Sakae, Takeji; Matoba, Masaru [Kyushu Univ., Fukuoka (Japan); Nohtomi, Akihiro; Maki, Takashi; Koori, Norihiko

    1998-03-01

    Continuum spectra from {sup 12}C(p,p`x) reaction at 392 MeV were measured by using plastic and GSO(Ce) scintillators. The spectra of energy-angle double differential cross sections are compared with that of Quantum Molecular Dynamics (QMD) simulation. Significant differences were found in the results at the forward angles. (author)

  6. Regulation of expression of pectate lyase genes pelA, pelD, and pelE in Erwinia chrysanthemi.

    Science.gov (United States)

    Reverchon, S; Robert-Baudouy, J

    1987-06-01

    The regulation of pelA, pelD, and pelE genes encoding three of the five major pectate lyase isoenzymes (PLa, PLd, and PLe) in Erwinia chrysanthemi B374 was analyzed by using genetic fusions to lacZ. These three genes are clustered on a 5-kilobase DNA fragment in the order pelD-pelE-pelA and constitute three independent transcriptional units. We localized the pelDEA cluster near the pro-1 marker on the genetic map of B374 by chromosomal mobilization with RP4::mini-Mu plasmid pULB110. Three classes of regulatory mutations responsible for constitutive pectate lyase synthesis have been described (kdgR, gpiR, and cri). We studied the effects of each mutation on pelE, pelD, and pelA expression independently. The mutations kdgR and gpiR mainly affect the expression of pelE and pelD, although PLa synthesis is slightly increased. The cri mutation results in a low level of constitutive expression of the three pel genes, but it is a pleiotropic mutation since other genes not involved in pectinolysis are also affected. In addition, we demonstrated that exuR, a negative regulatory gene governing the catabolism of hexuronates, does not modify the expression of pel genes. The frequency of gpiR or cri mutations (about 10(-8)) and the resulting constitutivity of pectate lyase synthesis suggest that these genes act as negative regulatory genes in addition to kdgR, which is already known to encode a repressor. Moreover, we found that expression of pel-lac fusions carried on pBR322 derivatives was higher in E. chrysanthemi than in Escherichia coli; this fact suggests the existence of positive regulation of pectate lyase synthesis in E. chrysanthemi.

  7. Lactic acid bacteria involved in cocoa beans fermentation from Ivory Coast: Species diversity and citrate lyase production.

    Science.gov (United States)

    Ouattara, Hadja D; Ouattara, Honoré G; Droux, Michel; Reverchon, Sylvie; Nasser, William; Niamke, Sébastien L

    2017-09-01

    Microbial fermentation is an indispensable process for high quality chocolate from cocoa bean raw material. lactic acid bacteria (LAB) are among the major microorganisms responsible for cocoa fermentation but their exact role remains to be elucidated. In this study, we analyzed the diversity of LAB in six cocoa producing regions of Ivory Coast. Ribosomal 16S gene sequence analysis showed that Lactobacillus plantarum and Leuconostoc mesenteroides are the dominant LAB species in these six regions. In addition, other species were identified as the minor microbial population, namely Lactobacillus curieae, Enterococcus faecium, Fructobacillus pseudoficulneus, Lactobacillus casei, Weissella paramesenteroides and Weissella cibaria. However, in each region, the LAB microbial population was composed of a restricted number of species (maximum 5 species), which varied between the different regions. LAB implication in the breakdown of citric acid was investigated as a fundamental property for a successful cocoa fermentation process. High citrate lyase producer strains were characterized by rapid citric acid consumption, as revealed by a 4-fold decrease in citric acid concentration in the growth medium within 12h, concomitant with an increase in acetic acid and lactic acid concentration. The production of citrate lyase was strongly dependent on environmental conditions, with optimum production at acidic pH (pHfermentation. This study reveals that one of the major roles of LAB in the cocoa fermentation process involves the breakdown of citric acid during the early stage of cocoa fermentation through the activity of citrate lyase. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. An Inducible Operon Is Involved in Inulin Utilization in Lactobacillus plantarum Strains, as Revealed by Comparative Proteogenomics and Metabolic Profiling.

    Science.gov (United States)

    Buntin, Nirunya; Hongpattarakere, Tipparat; Ritari, Jarmo; Douillard, François P; Paulin, Lars; Boeren, Sjef; Shetty, Sudarshan A; de Vos, Willem M

    2017-01-15

    The draft genomes of Lactobacillus plantarum strains isolated from Asian fermented foods, infant feces, and shrimp intestines were sequenced and compared to those of well-studied strains. Among 28 strains of L. plantarum, variations in the genomic features involved in ecological adaptation were elucidated. The genome sizes ranged from approximately 3.1 to 3.5 Mb, of which about 2,932 to 3,345 protein-coding sequences (CDS) were predicted. The food-derived isolates contained a higher number of carbohydrate metabolism-associated genes than those from infant feces. This observation correlated to their phenotypic carbohydrate metabolic profile, indicating their ability to metabolize the largest range of sugars. Surprisingly, two strains (P14 and P76) isolated from fermented fish utilized inulin. β-Fructosidase, the inulin-degrading enzyme, was detected in the supernatants and cell wall extracts of both strains. No activity was observed in the cytoplasmic fraction, indicating that this key enzyme was either membrane-bound or extracellularly secreted. From genomic mining analysis, a predicted inulin operon of fosRABCDXE, which encodes β-fructosidase and many fructose transporting proteins, was found within the genomes of strains P14 and P76. Moreover, pts1BCA genes, encoding sucrose-specific IIBCA components involved in sucrose transport, were also identified. The proteomic analysis revealed the mechanism and functional characteristic of the fosRABCDXE operon involved in the inulin utilization of L. plantarum The expression levels of the fos operon and pst genes were upregulated at mid-log phase. FosE and the LPXTG-motif cell wall anchored β-fructosidase were induced to a high abundance when inulin was present as a carbon source. Inulin is a long-chain carbohydrate that may act as a prebiotic, which provides many health benefits to the host by selectively stimulating the growth and activity of beneficial bacteria in the colon. While certain lactobacilli can catabolize

  9. AlgM4: A New Salt-Activated Alginate Lyase of the PL7 Family with Endolytic Activity

    Directory of Open Access Journals (Sweden)

    Guiyuan Huang

    2018-04-01

    Full Text Available Alginate lyases are a group of enzymes that catalyze the depolymerization of alginates into oligosaccharides or monosaccharides. These enzymes have been widely used for a variety of purposes, such as producing bioactive oligosaccharides, controlling the rheological properties of polysaccharides, and performing structural analyses of polysaccharides. The algM4 gene of the marine bacterium Vibrio weizhoudaoensis M0101 encodes an alginate lyase that belongs to the polysaccharide lyase family 7 (PL7. In this study, the kinetic constants Vmax (maximum reaction rate and Km (Michaelis constant of AlgM4 activity were determined as 2.75 nmol/s and 2.72 mg/mL, respectively. The optimum temperature for AlgM4 activity was 30 °C, and at 70 °C, AlgM4 activity dropped to 11% of the maximum observed activity. The optimum pH for AlgM4 activity was 8.5, and AlgM4 was completely inactive at pH 11. The addition of 1 mol/L NaCl resulted in a more than sevenfold increase in the relative activity of AlgM4. The secondary structure of AlgM4 was altered in the presence of NaCl, which caused the α-helical content to decrease from 12.4 to 10.8% and the β-sheet content to decrease by 1.7%. In addition, NaCl enhanced the thermal stability of AlgM4 and increased the midpoint of thermal denaturation (Tm by 4.9 °C. AlgM4 exhibited an ability to degrade sodium alginate, poly-mannuronic acid (polyM, and poly-guluronic acid (polyG, resulting in the production of oligosaccharides with a degree of polymerization (DP of 2–9. AlgM4 possessed broader substrate, indicating that it is a bifunctional alginate lyase. Thus, AlgM4 is a novel salt-activated and bifunctional alginate lyase of the PL7 family with endolytic activity.

  10. Probing Reversible Chemistry in Coenzyme B12-Dependent Ethanolamine Ammonia Lyase with Kinetic Isotope Effects

    Science.gov (United States)

    Jones, Alex R; Rentergent, Julius; Scrutton, Nigel S; Hay, Sam

    2015-01-01

    Coenzyme B12-dependent enzymes such as ethanolamine ammonia lyase have remarkable catalytic power and some unique properties that enable detailed analysis of the reaction chemistry and associated dynamics. By selectively deuterating the substrate (ethanolamine) and/or the β-carbon of the 5′-deoxyadenosyl moiety of the intrinsic coenzyme B12, it was possible to experimentally probe both the forward and reverse hydrogen atom transfers between the 5′-deoxyadenosyl radical and substrate during single-turnover stopped-flow measurements. These data are interpreted within the context of a kinetic model where the 5′-deoxyadenosyl radical intermediate may be quasi-stable and rearrangement of the substrate radical is essentially irreversible. Global fitting of these data allows estimation of the intrinsic rate constants associated with CoC homolysis and initial H-abstraction steps. In contrast to previous stopped-flow studies, the apparent kinetic isotope effects are found to be relatively small. PMID:25950663

  11. Diagnosis of adenylosuccinate lyase deficiency by metabolomic profiling in plasma reveals a phenotypic spectrum

    Directory of Open Access Journals (Sweden)

    Taraka R. Donti

    2016-09-01

    Full Text Available Adenylosuccinate lyase (ADSL deficiency is a rare autosomal recessive neurometabolic disorder that presents with a broad-spectrum of neurological and physiological symptoms. The ADSL gene produces an enzyme with binary molecular roles in de novo purine synthesis and purine nucleotide recycling. The biochemical phenotype of ADSL deficiency, accumulation of SAICAr and succinyladenosine (S-Ado in biofluids of affected individuals, serves as the traditional target for diagnosis with targeted quantitative urine purine analysis employed as the predominate method of detection. In this study, we report the diagnosis of ADSL deficiency using an alternative method, untargeted metabolomic profiling, an analytical scheme capable of generating semi-quantitative z-score values for over 1000 unique compounds in a single analysis of a specimen. Using this method to analyze plasma, we diagnosed ADSL deficiency in four patients and confirmed these findings with targeted quantitative biochemical analysis and molecular genetic testing. ADSL deficiency is part of a large a group of neurometabolic disorders, with a wide range of severity and sharing a broad differential diagnosis. This phenotypic similarity among these many inborn errors of metabolism (IEMs has classically stood as a hurdle in their initial diagnosis and subsequent treatment. The findings presented here demonstrate the clinical utility of metabolomic profiling in the diagnosis of ADSL deficiency and highlights the potential of this technology in the diagnostic evaluation of individuals with neurologic phenotypes.

  12. Cystathionine γ-lyase deficiency mediates neurodegeneration in Huntington’s disease

    Science.gov (United States)

    Paul, Bindu D.; Sbodio, Juan I.; Xu, Risheng; Vandiver, M. Scott; Cha, Jiyoung Y.; Snowman, Adele M.; Snyder, Solomon H.

    2015-01-01

    Huntington’s disease is an autosomal dominant disease associated with a mutation in the gene encoding huntingtin (Htt) leading to expanded polyglutamine repeats of mutant Htt (mHtt) that elicit oxidative stress, neurotoxicity, and motor and behavioural changes1. Huntington’s disease is characterized by highly selective and profound damage to the corpus striatum, which regulates motor function. Striatal selectivity of Huntington’s disease may reflect the striatally selective small G protein Rhes binding to mHtt and enhancing its neurotoxicity2. Specific molecular mechanisms by which mHtt elicits neurodegeneration have been hard to determine. Here we show a major depletion of cystathionine γ-lyase (CSE), the biosynthetic enzyme for cysteine, in Huntington’s disease tissues, which may mediate Huntington’s disease pathophysiology. The defect occurs at the transcriptional level and seems to reflect influences of mHtt on specificity protein 1, a transcriptional activator for CSE. Consistent with the notion of loss of CSE as a pathogenic mechanism, supplementation with cysteine reverses abnormalities in cultures of Huntington’s disease tissues and in intact mouse models of Huntington’s disease, suggesting therapeutic potential. PMID:24670645

  13. Potential Inhibitors for Isocitrate Lyase of Mycobacterium tuberculosis and Non-M. tuberculosis: A Summary

    Directory of Open Access Journals (Sweden)

    Yie-Vern Lee

    2015-01-01

    Full Text Available Isocitrate lyase (ICL is the first enzyme involved in glyoxylate cycle. Many plants and microorganisms are relying on glyoxylate cycle enzymes to survive upon downregulation of tricarboxylic acid cycle (TCA cycle, especially Mycobacterium tuberculosis (MTB. In fact, ICL is a potential drug target for MTB in dormancy. With the urge for new antitubercular drug to overcome tuberculosis treat such as multidrug resistant strain and HIV-coinfection, the pace of drug discovery has to be increased. There are many approaches to discovering potential inhibitor for MTB ICL and we hereby review the updated list of them. The potential inhibitors can be either a natural compound or synthetic compound. Moreover, these compounds are not necessary to be discovered only from MTB ICL, as it can also be discovered by a non-MTB ICL. Our review is categorized into four sections, namely, (a MTB ICL with natural compounds; (b MTB ICL with synthetic compounds; (c non-MTB ICL with natural compounds; and (d non-MTB ICL with synthetic compounds. Each of the approaches is capable of overcoming different challenges of inhibitor discovery. We hope that this paper will benefit the discovery of better inhibitor for ICL.

  14. Production of endo-pectate lyase by two stage cultivation of Erwinia carotovora

    Energy Technology Data Exchange (ETDEWEB)

    Fukuoka, Satoshi; Kobayashi, Yoshiaki

    1987-02-26

    The productivity of endo-pectate lyase from Erwinia carotovora GIR 1044 was found to be greatly improved by two stage cultivation: in the first stage the bacterium was grown with an inducing carbon source, e.g., pectin, and in the second stage it was cultivated with glycerol, xylose, or fructose with the addition of monosodium L-glutamate as nitrogen source. In the two stage cultivation using pectin or glycerol as the carbon source the enzyme activity reached 400 units/ml, almost 3 times as much as that of one stage cultivation in a 10 liter fermentor. Using two stage cultivation in the 200 liter fermentor improved enzyme productivity over that in the 10 liter fermentor, with 500 units/ml of activity. Compared with the cultivation in Erlenmeyer flasks, fermentor cultivation improved enzyme productivity. The optimum cultivating conditions were agitation of 480 rpm with aeration of 0.5 vvm at 28 /sup 0/C. (4 figs, 4 tabs, 14 refs)

  15. PECTATE LYASE-LIKE 9 from Brassica campestris is associated with intine formation.

    Science.gov (United States)

    Jiang, Jingjing; Yao, Lina; Yu, Youjian; Liang, Ying; Jiang, Jianxia; Ye, Nenghui; Miao, Ying; Cao, Jiashu

    2014-12-01

    Brassica campestris pectate lyase-like 9 (BcPLL9) was previously identified as a differentially expressed gene both in buds during late pollen developmental stage and in pistils during fertilization in Chinese cabbage. To characterize the gene's function, antisense-RNA lines of BcPLL9 (bcpll9) were constructed in Chinese cabbage. Self- and cross-fertilization experiments harvested half seed yields when bcpll9 lines were used as pollen donors. In vivo and in vitro pollen germination assays showed that nearly half of the pollen tubes in bcpll9 were irregular with shorter length and uneven surface. Aniline blue staining identified abnormal accumulation of a specific bright blue unknown material in the bcpll9 pollen portion. Scanning electron microscopy observation verified the abnormal outthrust material to be near the pollen germinal furrows. Transmission electron microscopy observation revealed the internal endintine layer was overdeveloped and predominantly occupied the intine. This abnormally formed intine likely induced the wavy structure and growth arrest of the pollen tube in half of the bcpll9 pollen grains, which resulted in less seed yields. Collectively, this study presented a novel PLL gene that has an important function in B. campestris intine formation. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  16. PECTATE LYASE-LIKE10 is associated with pollen wall development in Brassica campestris.

    Science.gov (United States)

    Jiang, Jingjing; Yao, Lina; Yu, Youjian; Lv, Meiling; Miao, Ying; Cao, Jiashu

    2014-11-01

    PECTATE LYASE-LIKE10 (PLL10) was previously identified as one of the differentially expressed genes both in microspores during the late pollen developmental stages and in pistils during the fertilization process in Chinese cabbage (Brassica campestris ssp. chinensis). Here, antisense-RNA was used to study the functions of BcPLL10 in Chinese cabbage. Abnormal pollen was identified in the transgenic lines (bcpll10-4, -5, and -6). In fertilization experiments, fewer seeds were harvested when the antisense-RNA lines were used as pollen donor. In vivo and in vitro pollen germination assays less germinated pollen tubes were observed in bcpll10 lines. Scanning electron microscopy observation verified that the tryphine materials were over accumulated around the pollen surface and sticked them together in bcpll10. Moreover, transmission electron microscopy observation revealed that the internal endintine was overdeveloped and predominantly occupied the intine, and disturbed the normal proportional distribution of the two layers in the non-germinal furrow region; and no obvious demarcation existed between them in the germinal furrow region in the bcpll10 pollen. Collectively, this study presented a novel PLL gene that played an important role during the pollen wall development in B. campestris, which may also possess potential importance for male sterility usage in agriculture. © 2014 Institute of Botany, Chinese Academy of Sciences.

  17. Control of phenylalanine ammonia-lyase gene promoters from pea by UV radiation

    International Nuclear Information System (INIS)

    Pluskota, W.E.; Michalczyk, D.J.; Gorecki, R.J.

    2005-01-01

    The gene fusion system was used to study UV light-control of PS PAL1 and PS PAL2 genes encoding phenylalanine ammonia-lyase of pea. The induction of pea PAL promoters was analysed in transgenic tobacco plants. Binary plasmids (derivatives of pBI101.2 vector) containing 5' regulatory fragments of PS PAL1 and PS PAL2 linked to reporter genes (GUS, LUC) were constructed. The analyses were performed with the use of single constructs (containing one variant of PS PAL promoter and one reporter gene) and dual constructs (containing both PS PAL1 and PS PAL2 promoters connected with different reporter genes). The use of dual constructs enabled the evaluation of both PS PAL promoters activity in the same plant. The analyses of in vitro grown plants have shown that both PAL promoters are strongly induced in leaves subjected to UV radiation. In some cases, the UV-stimulated expression exceeded the exposed areas. This phenomenon was observed more often in the leaves of plants containing the PS PAL1::GUS than PS PAL2::GUS construct. Removal of boxes 2, 4, 5 from PS PAL1 promoter and deletion of its 5' end region (-339 to -1394) decreases the level of gene expression but does not eliminate its responsiveness to UV

  18. Purification and characterization of selenocysteine beta-lyase from Citrobacter freundii

    International Nuclear Information System (INIS)

    Chocat, P.; Esaki, N.; Tanizawa, K.; Nakamura, K.; Tanaka, H.; Soda, K.

    1985-01-01

    The purification and characterization of bacterial selenocysteine beta-lyase, an enzyme which specifically catalyzes the cleavage of L-selenocysteine to L-alanine and Se0, are presented. The enzyme, purified to near homogeneity from Citrobacter freundii, is monomeric with a molecular weight of ca. 64,000 and contains 1 mol of pyridoxal 5'-phosphate as a cofactor per mol of enzyme. L-Selenocysteine is the sole substrate. L-Cysteine is a competitive inhibitor of the enzyme. The enzyme also catalyzes the alpha, beta elimination of beta-chloro-L-alanine to form NH 3 , pyruvate, and Cl- and is irreversibly inactivated during the reaction. The physicochemical properties, e.g., amino acid composition and subunit structure, of the bacterial enzyme are fairly different from those of the pig liver enzyme. However, the catalytic properties of both enzymes, e.g., substrate specificity and inactivation by the substrate or a mechanism-based inactivator, beta-chloro-L-alanine, are very similar

  19. Adenylosuccinate lyase (ADSL) and infantile autism: Absence of previously reported point mutation

    Energy Technology Data Exchange (ETDEWEB)

    Fon, E.A.; Sarrazin, J.; Rouleau, G.A. [Montreal General Hospital (Canada)] [and others

    1995-12-18

    Autism is a heterogeneous neuropsychiatric syndrome of unknown etiology. There is evidence that a deficiency in the enzyme adenylosuccinate lyase (ADSL), essential for de novo purine biosynthesis, could be involved in the pathogenesis of certain cases. A point mutation in the ADSL gene, resulting in a predicted serine-to-proline substitution and conferring structural instability to the mutant enzyme, has been reported previously in 3 affected siblings. In order to determine the prevalence of the mutation, we PCR-amplified the exon spanning the site of this mutation from the genomic DNA of patients fulfilling DSM-III-R criteria for autistic disorder. None of the 119 patients tested were found to have this mutation. Furthermore, on preliminary screening using single-strand conformation polymorphism (SSCP), no novel mutations were detected in the coding sequence of four ADSL exons, spanning approximately 50% of the cDNA. In light of these findings, it appears that mutations in the ADSL gene represent a distinctly uncommon cause of autism. 12 refs., 2 figs.

  20. An acidic pectin lyase from Aspergillus niger with favourable efficiency in fruit juice clarification.

    Science.gov (United States)

    Xu, S X; Qin, X; Liu, B; Zhang, D Q; Zhang, W; Wu, K; Zhang, Y H

    2015-02-01

    The pectin lyase gene pnl-zj5a from Aspergillus niger ZJ5 was identified and expressed in Pichia pastoris. PNL-ZJ5A was purified by ultrafiltration, anion exchange and gel chromatography. The Km and Vmax values determined using citrus pectin were 0.66 mg ml(-1) and 32.6 μmol min(-1) mg(-1) , respectively. PNL-ZJ5A exhibited optimal activity at 43°C and retained activity over 25-50°C. PNL-ZJ5A was optimally active at pH 5 and effective in apple juice clarification. Compared with controls, PNL-ZJ5A increased the fruit juice yield significantly. Furthermore, PNL-ZJ5A reduced the viscosity of apple juice by 38.8% and increased its transmittance by 86.3%. PNL-ZJ5A combined with a commercial pectin esterase resulted in higher juice volume. © 2014 The Society for Applied Microbiology.

  1. Synthesis of specifically labelled L-phenylalanines using phenylalanine ammonia lyase activity

    International Nuclear Information System (INIS)

    Haedener, A.; Tamm, Ch.

    1987-01-01

    Specifically labelled L-phenylalanines have been prepared using a variety of classical synthetic methods in combination with phenylalanine ammonia lyase (PAL) enzyme activity of the yeast Rhodosporidium toruloides ATCC 10788 or Rhodotorula glutinis IFO 0559, respectively. Thus, L-[2- 2 H]phenyl-[2- 2 H]alanine was formed from (E) -[2,2'- 2 H 2 ]cinnamic acid and ammonia in 46% yield, whereas L-phenyl-[2- 13 C, 15 N]alanine was obtained from (E)-[2- 13 C]cinnamic acid in 45% overall yield. Generally, labelled cinnamic acids were recovered in pure form from the reaction mixture, with a loss of 6-8%. Likewise, unchanged 15 NH 3 was reisolated as 15 NH 4 Cl after steam distillation with overall losses of less than 4%. Labelled cinnamic acids were prepared by Knoevenagel condensations between appropriately labelled benzaldehydes and malonic acids. [2- 2 H]Benzaldehyde was obtained from 2-bromotoluene by decomposition of the corresponding Grignard reagent with 2 H 2 O and subsequent oxidation. Since simple molecules, most of them commercially available in labelled form or otherwise easily accessible, may serve as starting material, and due to its defined stereochemistry, the reaction catalysed by PAL opens a short and attractive route to specifically labelled L-phenylalanines. (author)

  2. ATP-Citrate Lyase Controls a Glucose-to-Acetate Metabolic Switch

    Directory of Open Access Journals (Sweden)

    Steven Zhao

    2016-10-01

    Full Text Available Mechanisms of metabolic flexibility enable cells to survive under stressful conditions and can thwart therapeutic responses. Acetyl-coenzyme A (CoA plays central roles in energy production, lipid metabolism, and epigenomic modifications. Here, we show that, upon genetic deletion of Acly, the gene coding for ATP-citrate lyase (ACLY, cells remain viable and proliferate, although at an impaired rate. In the absence of ACLY, cells upregulate ACSS2 and utilize exogenous acetate to provide acetyl-CoA for de novo lipogenesis (DNL and histone acetylation. A physiological level of acetate is sufficient for cell viability and abundant acetyl-CoA production, although histone acetylation levels remain low in ACLY-deficient cells unless supplemented with high levels of acetate. ACLY-deficient adipocytes accumulate lipid in vivo, exhibit increased acetyl-CoA and malonyl-CoA production from acetate, and display some differences in fatty acid content and synthesis. Together, these data indicate that engagement of acetate metabolism is a crucial, although partial, mechanism of compensation for ACLY deficiency.

  3. ATP-Citrate Lyase Controls a Glucose-to-Acetate Metabolic Switch.

    Science.gov (United States)

    Zhao, Steven; Torres, AnnMarie; Henry, Ryan A; Trefely, Sophie; Wallace, Martina; Lee, Joyce V; Carrer, Alessandro; Sengupta, Arjun; Campbell, Sydney L; Kuo, Yin-Ming; Frey, Alexander J; Meurs, Noah; Viola, John M; Blair, Ian A; Weljie, Aalim M; Metallo, Christian M; Snyder, Nathaniel W; Andrews, Andrew J; Wellen, Kathryn E

    2016-10-18

    Mechanisms of metabolic flexibility enable cells to survive under stressful conditions and can thwart therapeutic responses. Acetyl-coenzyme A (CoA) plays central roles in energy production, lipid metabolism, and epigenomic modifications. Here, we show that, upon genetic deletion of Acly, the gene coding for ATP-citrate lyase (ACLY), cells remain viable and proliferate, although at an impaired rate. In the absence of ACLY, cells upregulate ACSS2 and utilize exogenous acetate to provide acetyl-CoA for de novo lipogenesis (DNL) and histone acetylation. A physiological level of acetate is sufficient for cell viability and abundant acetyl-CoA production, although histone acetylation levels remain low in ACLY-deficient cells unless supplemented with high levels of acetate. ACLY-deficient adipocytes accumulate lipid in vivo, exhibit increased acetyl-CoA and malonyl-CoA production from acetate, and display some differences in fatty acid content and synthesis. Together, these data indicate that engagement of acetate metabolism is a crucial, although partial, mechanism of compensation for ACLY deficiency. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  4. The Salmonella effector protein SpvC, a phosphothreonine lyase is functional in plant cells

    Directory of Open Access Journals (Sweden)

    Christina eNeumann

    2014-10-01

    Full Text Available Salmonella is one of the most prominent causes of food poisoning and growing evidence indicates that contaminated fruits and vegetables are an increasing concern for human health. Successful infection demands the suppression of the host immune system, which is often achieved via injection of bacterial effector proteins into host cells. In this report we present the function of Salmonella effector protein in plant cell, supporting the new concept of trans-kingdom competence of this bacterium. We screened a range of Salmonella Typhimurium effector proteins for interference with plant immunity. Among these, the phosphothreonine lyase SpvC attenuated the induction of immunity-related genes when present in plant cells. Using in vitro and in vivo systems we show that this effector protein interacts with and dephosphorylates activated Arabidopsis Mitogen-activated Protein Kinase 6 (MPK6, thereby inhibiting defense signaling. Moreover, the requirement of Salmonella SpvC was shown by the decreased proliferation of the ΔspvC mutant in Arabidopsis plants. These results suggest that some Salmonella effector proteins could have a conserved function during proliferation in different hosts. The fact that Salmonella and other Enterobacteriaceae use plants as hosts strongly suggests that plants represent a much larger reservoir for animal pathogens than so far estimated.

  5. Transcriptional regulation of Saccharomyces cerevisiaeCYS3 encoding cystathionine γ-lyase

    Science.gov (United States)

    Hiraishi, Hiroyuki; Miyake, Tsuyoshi

    2008-01-01

    In studying the regulation of GSH11, the structural gene of the high-affinity glutathione transporter (GSH-P1) in Saccharomyces cerevisiae, a cis-acting cysteine responsive element, CCGCCACAC (CCG motif), was detected. Like GSH-P1, the cystathionine γ-lyase encoded by CYS3 is induced by sulfur starvation and repressed by addition of cysteine to the growth medium. We detected a CCG motif (−311 to −303) and a CGC motif (CGCCACAC; −193 to −186), which is one base shorter than the CCG motif, in the 5′-upstream region of CYS3. One copy of the centromere determining element 1, CDE1 (TCACGTGA; −217 to −210), being responsible for regulation of the sulfate assimilation pathway genes, was also detected. We tested the roles of these three elements in the regulation of CYS3. Using a lacZ-reporter assay system, we found that the CCG/CGC motif is required for activation of CYS3, as well as for its repression by cysteine. In contrast, the CDE1 motif was responsible for only activation of CYS3. We also found that two transcription factors, Met4 and VDE, are responsible for activation of CYS3 through the CCG/CGC and CDE1 motifs. These observations suggest a dual regulation of CYS3 by factors that interact with the CDE1 motif and the CCG/CGC motifs. PMID:18317767

  6. Synthesis of specifically labelled L-phenylalanines using phenylalanine ammonia lyase activity

    Energy Technology Data Exchange (ETDEWEB)

    Haedener, A.; Tamm, Ch.

    1987-11-01

    Specifically labelled L-phenylalanines have been prepared using a variety of classical synthetic methods in combination with phenylalanine ammonia lyase (PAL) enzyme activity of the yeast Rhodosporidium toruloides ATCC 10788 or Rhodotorula glutinis IFO 0559, respectively. Thus, L-(2-/sup 2/H)phenyl-(2-/sup 2/H)alanine was formed from (E) -(2,2'-/sup 2/H/sub 2/)cinnamic acid and ammonia in 46% yield, whereas L-phenyl-(2-/sup 13/C, /sup 15/N)alanine was obtained from (E)-(2-/sup 13/C)cinnamic acid in 45% overall yield. Generally, labelled cinnamic acids were recovered in pure form from the reaction mixture, with a loss of 6-8%. Likewise, unchanged /sup 15/NH/sub 3/ was reisolated as /sup 15/NH/sub 4/Cl after steam distillation with overall losses of less than 4%. Labelled cinnamic acids were prepared by Knoevenagel condensations between appropriately labelled benzaldehydes and malonic acids. (2-/sup 2/H)Benzaldehyde was obtained from 2-bromotoluene by decomposition of the corresponding Grignard reagent with /sup 2/H/sub 2/O and subsequent oxidation. Since simple molecules, most of them commercially available in labelled form or otherwise easily accessible, may serve as starting material, and due to its defined stereochemistry, the reaction catalysed by PAL opens a short and attractive route to specifically labelled L-phenylalanines.

  7. Optimization of oligomeric enzyme activity in ionic liquids using Rhodotorula glutinis yeast phenylalanine ammonia lyase.

    Science.gov (United States)

    Barron, Christiaan C; Sponagle, Brandon J D; Arivalagan, Pugazhendhi; D'Cunha, Godwin B

    2017-01-01

    Phenylalanine ammonia lyase (E.C.4.3.1.24, PAL) activity of Rhodotorula glutinis yeast has been demonstrated in four commonly used ionic liquids. PAL forward reaction was carried out in 1-butyl-3-methylimidazolium methyl sulfate ([BMIM][MeSO 4 ]), 1-butyl-3-methylimidazolium tetrafluoroborate ([BMIM][BF 4 ]), 1-butyl-3-methylimidazolium hexafluorophosphate ([BMIM][PF 6 ]) and 1-butyl-3-methylimidazolium lactate ([BMIM][lactate]). Our experiments have revealed that PAL is catalytically active in ionic liquids and the enzyme activity in ([BMIM][PF 6 ]) is comparable to that obtained in aqueous buffer medium. Different conditions were optimized for maximal PAL forward activity including time of incubation (30.0min) L -phenylalanine substrate concentration (30.0mM), nature of buffer (50.0mM Tris-HCl), pH (9.0), temperature (37°C), and speed of agitation (100 rev min -1 ). Under these optimized conditions, about 83% conversion of substrate to product was obtained for the PAL forward reaction that was determined using UV spectroscopy at 290nm. PAL reverse reaction in ([BMIM][PF 6 ]) was determined spectrophotometrically at 520nm; and about 59% substrate conversion was obtained. This data provides further knowledge in enzyme biocatalysis in non-aqueous media, and may be of importance when studying the function of other oligomeric/multimeric proteins and enzymes in ionic liquids. Copyright © 2016 Elsevier Inc. All rights reserved.

  8. S1P Lyase Regulation of Thymic Egress and Oncogenic Inflammatory Signaling

    Science.gov (United States)

    Kumar, Ashok; Zamora-Pineda, Jesus; Degagné, Emilie

    2017-01-01

    Sphingosine-1-phosphate (S1P) is a potent lipid signaling molecule that regulates pleiotropic biological functions including cell migration, survival, angiogenesis, immune cell trafficking, inflammation, and carcinogenesis. It acts as a ligand for a family of cell surface receptors. S1P concentrations are high in blood and lymph but low in tissues, especially the thymus and lymphoid organs. S1P chemotactic gradients are essential for lymphocyte egress and other aspects of physiological cell trafficking. S1P is irreversibly degraded by S1P lyase (SPL). SPL regulates lymphocyte trafficking, inflammation and other physiological and pathological processes. For example, SPL located in thymic dendritic cells acts as a metabolic gatekeeper that controls the normal egress of mature T lymphocytes from the thymus into the circulation, whereas SPL deficiency in gut epithelial cells promotes colitis and colitis-associated carcinogenesis (CAC). Recently, we identified a complex syndrome comprised of nephrosis, adrenal insufficiency, and immunological defects caused by inherited mutations in human SGPL1, the gene encoding SPL. In the present article, we review current evidence supporting the role of SPL in thymic egress, inflammation, and cancer. Lastly, we summarize recent progress in understanding other SPL functions, its role in inherited disease, and SPL targeting for therapeutic purposes. PMID:29333002

  9. Crystal structure and mechanism of the Staphylococcus cohnii virginiamycin B lyase (Vgb).

    Science.gov (United States)

    Lipka, Magdalena; Filipek, Renata; Bochtler, Matthias

    2008-04-08

    The semisynthetic streptogramin antibiotic quinupristin/dalfopristin (trade name Synercid, Aventis Pharma) is a mixture of the A-type streptogramin dalfopristin and the B-type streptogramin quinupristin, a capped hexapeptide macrolactone. Quinupristin/dalfopristin was developed to combat multidrug resistant pathogens, but suffers from its own problems with drug resistance. Virginiamycin B lyase (Vgb) inactivates the quinupristin component of Synercid by lactone ring opening. Remarkably, the enzyme promotes this reaction by intramolecular beta-elimination without the involvement of a water molecule. Recently, structures of S. aureus Vgb in the presence and absence of substrate were reported and used together with detailed mutagenesis data to suggest a catalytic mechanism. Here, we report an independent determination of the S. cohnii Vgb crystal structure and a biochemical characterization of the enzyme. As expected, the S. cohnii and S. aureus Vgb structures and active sites are very similar. Moreover, both enzymes catalyze quinupristin lactone ring opening with similar rate constants, albeit perhaps with different dependencies on divalent metal ions. Replacement of the conserved active site residues His228, Glu268, or His270 with alanine reduces or abolishes S. cohnii Vgb activity. Residue Lys285 in S. cohnii Vgb is spatially equivalent to the S. aureus Vgb active site residue Glu284. A glutamate but not an alanine residue can substitute for the lysine without significant loss of activity.

  10. The Salmonella effector protein SpvC, a phosphothreonine lyase is functional in plant cells

    KAUST Repository

    Neumann, Christina

    2014-10-17

    Salmonella is one of the most prominent causes of food poisoning and growing evidence indicates that contaminated fruits and vegetables are an increasing concern for human health. Successful infection demands the suppression of the host immune system, which is often achieved via injection of bacterial effector proteins into host cells. In this report we present the function of Salmonella effector protein in plant cell, supporting the new concept of trans-kingdom competence of this bacterium. We screened a range of Salmonella Typhimurium effector proteins for interference with plant immunity. Among these, the phosphothreonine lyase SpvC attenuated the induction of immunity-related genes when present in plant cells. Using in vitro and in vivo systems we show that this effector protein interacts with and dephosphorylates activated Arabidopsis Mitogen-activated Protein Kinase 6 (MPK6), thereby inhibiting defense signaling. Moreover, the requirement of Salmonella SpvC was shown by the decreased proliferation of the ΔspvC mutant in Arabidopsis plants. These results suggest that some Salmonella effector proteins could have a conserved function during proliferation in different hosts. The fact that Salmonella and other Enterobacteriaceae use plants as hosts strongly suggests that plants represent a much larger reservoir for animal pathogens than so far estimated.

  11. Cystathionine γ-Lyase-Produced Hydrogen Sulfide Controls Endothelial NO Bioavailability and Blood Pressure.

    Science.gov (United States)

    Szijártó, István András; Markó, Lajos; Filipovic, Milos R; Miljkovic, Jan Lj; Tabeling, Christoph; Tsvetkov, Dmitry; Wang, Ning; Rabelo, Luiza A; Witzenrath, Martin; Diedrich, André; Tank, Jens; Akahoshi, Noriyuki; Kamata, Shotaro; Ishii, Isao; Gollasch, Maik

    2018-06-01

    Hydrogen sulfide (H 2 S) and NO are important gasotransmitters, but how endogenous H 2 S affects the circulatory system has remained incompletely understood. Here, we show that CTH or CSE (cystathionine γ-lyase)-produced H 2 S scavenges vascular NO and controls its endogenous levels in peripheral arteries, which contribute to blood pressure regulation. Furthermore, eNOS (endothelial NO synthase) and phospho-eNOS protein levels were unaffected, but levels of nitroxyl were low in CTH-deficient arteries, demonstrating reduced direct chemical interaction between H 2 S and NO. Pretreatment of arterial rings from CTH-deficient mice with exogenous H 2 S donor rescued the endothelial vasorelaxant response and decreased tissue NO levels. Our discovery that CTH-produced H 2 S inhibits endogenous endothelial NO bioavailability and vascular tone is novel and fundamentally important for understanding how regulation of vascular tone is tailored for endogenous H 2 S to contribute to systemic blood pressure function. © 2018 American Heart Association, Inc.

  12. Molecular Cloning and Sequence Analysis of a Phenylalanine Ammonia-Lyase Gene from Dendrobium

    Science.gov (United States)

    Cai, Yongping; Lin, Yi

    2013-01-01

    In this study, a phenylalanine ammonia-lyase (PAL) gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748) has 2,458 bps and contains a complete open reading frame (ORF) of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum. PMID:23638048

  13. Molecular cloning and sequence analysis of a phenylalanine ammonia-lyase gene from dendrobium.

    Directory of Open Access Journals (Sweden)

    Qing Jin

    Full Text Available In this study, a phenylalanine ammonia-lyase (PAL gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748 has 2,458 bps and contains a complete open reading frame (ORF of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum.

  14. S1P Lyase Regulation of Thymic Egress and Oncogenic Inflammatory Signaling

    Directory of Open Access Journals (Sweden)

    Ashok Kumar

    2017-01-01

    Full Text Available Sphingosine-1-phosphate (S1P is a potent lipid signaling molecule that regulates pleiotropic biological functions including cell migration, survival, angiogenesis, immune cell trafficking, inflammation, and carcinogenesis. It acts as a ligand for a family of cell surface receptors. S1P concentrations are high in blood and lymph but low in tissues, especially the thymus and lymphoid organs. S1P chemotactic gradients are essential for lymphocyte egress and other aspects of physiological cell trafficking. S1P is irreversibly degraded by S1P lyase (SPL. SPL regulates lymphocyte trafficking, inflammation and other physiological and pathological processes. For example, SPL located in thymic dendritic cells acts as a metabolic gatekeeper that controls the normal egress of mature T lymphocytes from the thymus into the circulation, whereas SPL deficiency in gut epithelial cells promotes colitis and colitis-associated carcinogenesis (CAC. Recently, we identified a complex syndrome comprised of nephrosis, adrenal insufficiency, and immunological defects caused by inherited mutations in human SGPL1, the gene encoding SPL. In the present article, we review current evidence supporting the role of SPL in thymic egress, inflammation, and cancer. Lastly, we summarize recent progress in understanding other SPL functions, its role in inherited disease, and SPL targeting for therapeutic purposes.

  15. Phenylalanine ammonia lyase catalyzed synthesis of amino acids by an MIO-cofactor independent pathway.

    Science.gov (United States)

    Lovelock, Sarah L; Lloyd, Richard C; Turner, Nicholas J

    2014-04-25

    Phenylalanine ammonia lyases (PALs) belong to a family of 4-methylideneimidazole-5-one (MIO) cofactor dependent enzymes which are responsible for the conversion of L-phenylalanine into trans-cinnamic acid in eukaryotic and prokaryotic organisms. Under conditions of high ammonia concentration, this deamination reaction is reversible and hence there is considerable interest in the development of PALs as biocatalysts for the enantioselective synthesis of non-natural amino acids. Herein the discovery of a previously unobserved competing MIO-independent reaction pathway, which proceeds in a non-stereoselective manner and results in the generation of both L- and D-phenylalanine derivatives, is described. The mechanism of the MIO-independent pathway is explored through isotopic-labeling studies and mutagenesis of key active-site residues. The results obtained are consistent with amino acid deamination occurring by a stepwise E1 cB elimination mechanism. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. The extent of co-metabolism of glucose and galactose by L. lactis changes with the expression of the lacSZ operon from Streptococcus thermophilus

    DEFF Research Database (Denmark)

    Solem, Christian; Købmann, Brian Jensen; Jensen, Peter Ruhdal

    2008-01-01

    The lactose transporter and β-galactosidase from Streptococcus thermophilus, encoded by the lacSZ operon, were introduced into the lactose-negative strain Lactococcus lactis MG1363 and the expression of the lacSZ operon was modulated by substitution of the native promoter with randomized synthetic...... promoters. A series of strains with various expression levels of lacSZ were examined for their fermentation of lactose. Strains with a high expression level were found to metabolize lactose in a similar manner to S. thermophilus, i.e. the galactose moiety of lactose was excreted to the growth medium...... and only glucose was metabolized in glycolysis. Interestingly, strains with low expression of the operon showed a mixed acid metabolism and co-metabolism of galactose and glucose. The lactose flux increased gradually with increasing expression of the lacSZ operon until an optimum was observed...

  17. S1P lyase in thymic perivascular spaces promotes egress of mature thymocytes via up-regulation of S1P receptor 1.

    Science.gov (United States)

    Maeda, Yasuhiro; Yagi, Hideki; Takemoto, Kana; Utsumi, Hiroyuki; Fukunari, Atsushi; Sugahara, Kunio; Masuko, Takashi; Chiba, Kenji

    2014-05-01

    Sphingosine 1-phosphate (S1P) and S1P receptor 1 (S1P1) play an important role in the egress of mature CD4 or CD8 single-positive (SP) thymocytes from the thymus. Fingolimod hydrochloride (FTY720), an S1P1 functional antagonist, induced significant accumulation of CD62L(high)CD69(low) mature SP thymocytes in the thymic medulla. Immunohistochemical staining using anti-S1P1 antibody revealed that S1P1 is predominantly expressed on thymocytes in the thymic medulla and is strongly down-regulated even at 3h after FTY720 administration. 2-Acetyl-4-tetrahydroxybutylimidazole (THI), an S1P lyase inhibitor, also induced accumulation of mature SP thymocytes in the thymic medulla with an enlargement of the perivascular spaces (PVS). At 6h after THI administration, S1P1-expressing thymocytes reduced partially as if to form clusters and hardly existed in the proximity of CD31-expressing blood vessels in the thymic medulla, suggesting S1P lyase expression in the cells constructing thymic medullary PVS. To determine the cells expressing S1P lyase in the thymus, we newly established a mAb (YK19-2) specific for mouse S1P lyase. Immunohistochemical staining with YK19-2 revealed that S1P lyase is predominantly expressed in non-lymphoid thymic stromal cells in the thymic medulla. In the thymic medullary PVS, S1P lyase was expressed in ER-TR7-positive cells (reticular fibroblasts and pericytes) and CD31-positive vascular endothelial cells. Our findings suggest that S1P lyase expressed in the thymic medullary PVS keeps the tissue S1P concentration low around the vessels and promotes thymic egress via up-regulation of S1P1.

  18. Characterization of C-S lyase from Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 and its potential role in food flavour applications.

    Science.gov (United States)

    Allegrini, Alessandra; Astegno, Alessandra; La Verde, Valentina; Dominici, Paola

    2017-04-01

    Volatile thiols have substantial impact on the aroma of many beverages and foods. Thus, the control of their formation, which has been linked to C-S lyase enzymatic activities, is of great significance in industrial applications involving food flavours. Herein, we have carried out a spectroscopic and functional characterization of a putative pyridoxal 5'-phosphate (PLP)-dependent C-S lyase from the lactic acid bacterium Lactobacillus delbrueckii subsp. bulgaricus ATCC BAA-365 (LDB C-S lyase). Recombinant LDB C-S lyase exists as a tetramer in solution and shows spectral properties of enzymes containing PLP as cofactor. The enzyme has a broad substrate specificity toward sulphur-containing amino acids with aminoethyl-L-cysteine and L-cystine being the most effective substrates over L-cysteine and L-cystathionine. Notably, the protein also reveals cysteine-S-conjugate β-lyase activity in vitro, and is able to cleave a cysteinylated substrate precursor into the corresponding flavour-contributing thiol, with a catalytic efficiency higher than L-cystathionine. Contrary to similar enzymes of other lactic acid bacteria however, LDB C-S lyase is not capable of α,γ-elimination activity towards L-methionine to produce methanethiol, which is a significant compound in flavour development. Based on our results, future developments can be expected regarding the flavour-forming potential of Lactobacillus C-S lyase and its use in enhancing food flavours. © The Authors 2017. Published by Oxford University Press on behalf of the Japanese Biochemical Society. All rights reserved.

  19. LHCb: A measurement of the $C\\!P$ asymmetry in $B^0 \\rightarrow K^{*0} \\mu^+ \\mu^-$ decays

    CERN Multimedia

    Wright, S

    2013-01-01

    A measurement of the $C\\!P$ asymmetry in $B^0 \\rightarrow K^{*0} \\mu^+ \\mu^-$ decays is presented, based on 1.0 fb$^{-1}$ of $pp$ collision data recorded by the LHCb experiment during 2011. The measurement is performed in six bins of invariant mass squared of the $\\mu^+\\mu^-$ pair, excluding the $\\mathrm{J}\\mskip -3mu/\\mskip -2mu\\psi\\mskip 2mu$ and $\\psi(2S)$ resonance regions. Production and detection asymmetries are removed using the $B^0 \\rightarrow \\mathrm{J}\\mskip -3mu/\\mskip -2mu\\psi\\mskip 2mu K^{*0}$ decay as a control mode. The integrated $C\\!P$ asymmetry is found to be $-0.072 \\pm 0.040 \\mbox{ (stat.)} \\pm 0.005 \\mbox{ (syst.)}$, consistent with the Standard Model.

  20. A requiem for AdS4×C P3 fermionic self-T duality

    Science.gov (United States)

    O'Colgáin, E.; Pittelli, A.

    2016-11-01

    Strong evidence for dual superconformal symmetry in N =6 superconformal Chern-Simons theory has fueled expectations that the AdS /CFT dual geometry AdS4×C P3 is self-dual under T duality. We revisit the problem to identify commuting bosonic and fermionic isometries in a systematic fashion and show that fermionic T duality, a symmetry originally proposed by Berkovits and Maldacena, inevitably leads to a singularity in the dilaton transformation. We show that TsT deformations commute with fermionic T duality and comment on T duality in the corresponding sigma model. Our results rule out self-duality based on fermionic T duality for AdS4×C P3 or its TsT deformations but leave the door open for new possibilities.

  1. Repression of the pyr operon in Lactobacillus plantarum prevents its ability to grow at low carbon dioxide levels

    DEFF Research Database (Denmark)

    Nicoloff, Hervé; Elagöz, Aram; Arsène-Ploetze, Florence

    2005-01-01

    Carbamoyl phosphate is a precursor for both arginine and pyrimidine biosynthesis. In Lactobacillus plantarum, carbamoyl phosphate is synthesized from glutamine, ATP, and carbon dioxide by two sets of identified genes encoding carbamoyl phosphate synthase (CPS). The expression of the carAB operon...... to the pyr mRNA attenuation site in response to intracellular UMP/phosphoribosyl pyrophosphate pools. Intracellular pyrimidine triphosphate nucleoside pools were lower in mutant FB335 (carAB deletion) harboring only CPS-P than in the wild-type strain harboring both CPS-A and CPS-P. Thus, CPS-P activity...... compared to wild-type levels. Low pyrimidine-independent expression of the pyr operon was obtained by antiterminator site-directed mutagenesis. The resulting AE1023 strain had reduced UTP and CTP pools and had the phenotype of a high-CO2-requiring auxotroph, since it was able to synthesize sufficient...

  2. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG

    Directory of Open Access Journals (Sweden)

    Orlando Díaz-Hernández

    2010-07-01

    Full Text Available In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG. In accordance with previously published experimental results and computer simulations, our simulations predict that: (1 when the system is induced by TMG, the system shows a discernible bistable behavior while, (2 when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  3. Bistable behavior of the lac operon in E. coli when induced with a mixture of lactose and TMG.

    Science.gov (United States)

    Díaz-Hernández, Orlando; Santillán, Moisés

    2010-01-01

    In this work we investigate multistability in the lac operon of Escherichia coli when it is induced by a mixture of lactose and the non-metabolizable thiomethyl galactoside (TMG). In accordance with previously published experimental results and computer simulations, our simulations predict that: (1) when the system is induced by TMG, the system shows a discernible bistable behavior while, (2) when the system is induced by lactose, bistability does not disappear but excessively high concentrations of lactose would be required to observe it. Finally, our simulation results predict that when a mixture of lactose and TMG is used, the bistability region in the extracellular glucose concentration vs. extracellular lactose concentration parameter space changes in such a way that the model predictions regarding bistability could be tested experimentally. These experiments could help to solve a recent controversy regarding the existence of bistability in the lac operon under natural conditions.

  4. S-factor measurement of the 13C(p,γ)14N reaction in reverse kinematics

    International Nuclear Information System (INIS)

    Genard, G; Terwagne, G; Descouvemont, P

    2010-01-01

    We measure the S-factor of the 13 C(p,γ) 14 N reaction in reverse kinematics for energies ranging from 561 down to 225 keV with a low background experimental setup. The results are compared with previous measurements and an R-matrix treatment is applied to the data in order to obtain the properties of the 511 keV resonance that dominates the cross section at low energies.

  5. Evolutionary history, structural features and biochemical diversity of the NlpC/P60 superfamily of enzymes.

    Science.gov (United States)

    Anantharaman, Vivek; Aravind, L

    2003-01-01

    Peptidoglycan is hydrolyzed by a diverse set of enzymes during bacterial growth, development and cell division. The N1pC/P60 proteins define a family of cell-wall peptidases that are widely represented in various bacterial lineages. Currently characterized members are known to hydrolyze D-gamma-glutamyl-meso-diaminopimelate or N-acetylmuramate-L-alanine linkages. Detailed analysis of the N1pC/P60 peptidases showed that these proteins define a large superfamily encompassing several diverse groups of proteins. In addition to the well characterized P60-like proteins, this superfamily includes the AcmB/LytN and YaeF/YiiX families of bacterial proteins, the amidase domain of bacterial and kinetoplastid glutathionylspermidine synthases (GSPSs), and several proteins from eukaryotes, phages, poxviruses, positive-strand RNA viruses, and certain archaea. The eukaryotic members include lecithin retinol acyltransferase (LRAT), nematode developmental regulator Egl-26, and candidate tumor suppressor H-rev107. These eukaryotic proteins, along with the bacterial YaeF/poxviral G6R family, show a circular permutation of the catalytic domain. We identified three conserved residues, namely a cysteine, a histidine and a polar residue, that are involved in the catalytic activities of this superfamily. Evolutionary analysis of this superfamily shows that it comprises four major families, with diverse domain architectures in each of them. Several related, but distinct, catalytic activities, such as murein degradation, acyl transfer and amide hydrolysis, have emerged in the N1pC/P60 superfamily. The three conserved catalytic residues of this superfamily are shown to be equivalent to the catalytic triad of the papain-like thiol peptidases. The predicted structural features indicate that the N1pC/P60 enzymes contain a fold similar to the papain-like peptidases, transglutaminases and arylamine acetyltransferases.

  6. Lattice dynamics and thermophysical properties of h.c.p. Os and Ru from the quasi-harmonic approximation.

    Science.gov (United States)

    Palumbo, Mauro; Dal Corso, Andrea

    2017-10-04

    We report first-principles phonon frequencies and anharmonic thermodynamic properties of h.c.p. Os and Ru calculated within the quasi-harmonic approximation, including Grüneisen parameters, temperature-dependent lattice parameters, thermal expansion, and isobaric heat capacity. We discuss the differences between a full treatment of anisotropy and a simplified approach with a constant [Formula: see text] ratio. The results are systematically compared with the available theoretical and experimental data and an overall satisfactory agreement is obtained.

  7. stg fimbrial operon from S. Typhi STH2370 contributes to association and cell disruption of epithelial and macrophage-like cells.

    Science.gov (United States)

    Berrocal, Liliana; Fuentes, Juan A; Trombert, A Nicole; Jofré, Matías R; Villagra, Nicolás A; Valenzuela, Luis M; Mora, Guido C

    2015-07-07

    Salmonella enterica serovar Typhi (S. Typhi) stg operon, encoding a chaperone/usher fimbria (CU), contributes to an increased adherence to human epithelial cells. However, one report suggests that the presence of the Stg fimbria impairs the monocyte--bacteria association, as deduced by the lower level of invasion to macrophage-like cells observed when the stg fimbrial cluster was overexpressed. Nevertheless, since other CU fimbrial structures increase the entry of S. Typhi into macrophages, and considering that transcriptomic analyses revealed that stg operon is indeed expressed in macrophages, we reassessed the role of the stg operon in the interaction between S. Typhi strain STH2370 and human cells, including macrophage-like cells and mononuclear cells directly taken from human peripheral blood. We compared S. Typhi STH2370 WT, a Chilean clinical strain, and the S. Typhi STH2370 Δstg mutant with respect to association and invasion using epithelial and macrophage-like cells. We observed that deletion of stg operon reduced the association and invasion of S. Typhi, in both cellular types. The presence of the cloned stg operon restored the WT phenotype in all the cases. Moreover, we compared Salmonella enterica sv. Typhimurium 14028s (S. Typhimurium, a serovar lacking stg operon) and S. Typhimurium heterologously expressing S. Typhi stg. We found that the latter presents an increased cell disruption of polarized epithelial cells and an increased association in both epithelial and macrophage-like cells. S. Typhi stg operon encodes a functional adhesin that participates in the interaction bacteria-eukaryotic cells, including epithelial cells and macrophages-like cells. The phenotypes associated to stg operon include increased association and consequent invasion in bacteria-eukaryotic cells, and cell disruption.

  8. Prospects of light sterile neutrino oscillation and C P violation searches at the Fermilab Short Baseline Neutrino Facility

    Science.gov (United States)

    Cianci, D.; Furmanski, A.; Karagiorgi, G.; Ross-Lonergan, M.

    2017-09-01

    We investigate the ability of the short baseline neutrino (SBN) experimental program at Fermilab to test the globally-allowed (3 +N ) sterile neutrino oscillation parameter space. We explicitly consider the globally-allowed parameter space for the (3 +1 ), (3 +2 ), and (3 +3 ) sterile neutrino oscillation scenarios. We find that SBN can probe with 5 σ sensitivity more than 85%, 95% and 55% of the parameter space currently allowed at 99% confidence level for the (3 +1 ), (3 +2 ) and (3 +3 ) scenarios, respectively, with the (3 +N ) allowed space used in these studies closely resembling that of previous studies [J. M. Conrad, C. M. Ignarra, G. Karagiorgi, M. H. Shaevitz, and J. Spitz, Adv. High Energy Phys. 2013, 1 (2013)., 10.1155/2013/163897], calculated using the same methodology. In the case of the (3 +2 ) and (3 +3 ) scenarios, C P -violating phases appear in the oscillation probability terms, leading to observable differences in the appearance probabilities of neutrinos and antineutrinos. We explore SBN's sensitivity to those phases for the (3 +2 ) scenario through the currently planned neutrino beam running, and investigate potential improvements through additional antineutrino beam running. We show that, if antineutrino exposure is considered, for maximal values of the (3 +2 ) C P -violating phase ϕ54, SBN could be the first experiment to directly observe ˜2 σ hints of C P violation associated with an extended lepton sector.

  9. C and P in aquatic food chain: A review on C:P stoichiometry and PUFA regulation

    Directory of Open Access Journals (Sweden)

    Saikia S.K.

    2010-09-01

    Full Text Available Carbon (C and phosphorous (P regulation in aquatic food chains are transferred from lower to upper trophic levels primarily as polyunsaturated fatty acids (PUFAs and C:P stoichiometry. The majority of C is transferred through algal based pathway. Microbial loop, though optionally contributes to C transfer, highly constrained by P limitation and bacterial predator type. Lack of essential PUFAs in bacteria is also responsible for its low trophic transfer of C. The seston size and algal taxonomic variations directly affect herbivore through P-dependent food quality and de novo synthesis of PUFAs. Change in algal community over a gradient could therefore determine C transfer. Feeding nature (herbivorous or carnivorous and predator sizes also regulate transfer efficiency of C and P to upper trophic levels. As trophic levels move up, P-limitation becomes higher compared to autotrophs. For Daphnia, as mostly studied aquatic herbivore member, P limitation becomes critical at C:P > 300 indicating excess C is not always invited under P-deficient situations. However, as a part of homeostasis mechanism for trophic upgrading, conversion of algal-zooplankton interface from qualitative to quantitative could minimize such critical C:P regulation at higher trophic levels. Protists, in turn, with high clearance rate by zooplankton predator could also compensate qualitative effect.

  10. Subtle variation within conserved effector operon gene products contributes to T6SS-mediated killing and immunity.

    Science.gov (United States)

    Alteri, Christopher J; Himpsl, Stephanie D; Zhu, Kevin; Hershey, Haley L; Musili, Ninette; Miller, Jessa E; Mobley, Harry L T

    2017-11-01

    Type VI secretion systems (T6SS) function to deliver lethal payloads into target cells. Many studies have shown that protection against a single, lethal T6SS effector protein requires a cognate antidote immunity protein, both of which are often encoded together in a two-gene operon. The T6SS and an effector-immunity pair is sufficient for both killing and immunity. HereIn this paper we describe a T6SS effector operon that differs from conventional effector-immunity pairs in that eight genes are necessary for lethal effector function, yet can be countered by a single immunity protein. In this study, we investigated the role that the PefE T6SS immunity protein plays in recognition between two strains harboring nearly identical effector operons. Interestingly, despite containing seven of eight identical effector proteins, the less conserved immunity proteins only provided protection against their native effectors, suggesting that specificity and recognition could be dependent on variation within an immunity protein and one effector gene product. The variable effector gene product, PefD, is encoded upstream from pefE, and displays toxic activity that can be countered by PefE independent of T6SS-activity. Interestingly, while the entire pef operon was necessary to exert toxic activity via the T6SS in P. mirabilis, production of PefD and PefE alone was unable to exert this effector activity. Chimeric PefE proteins constructed from two P. mirabilis strains were used to localize immunity function to three amino acids. A promiscuous immunity protein was created using site-directed mutagenesis to change these residues from one variant to another. These findings support the notion that subtle differences between conserved effectors are sufficient for T6SS-mediated kin discrimination and that PefD requires additional factors to function as a T6SS-dependent effector.

  11. Characterisation of the mgo operon in Pseudomonas syringae pv. syringae UMAF0158 that is required for mangotoxin production

    Science.gov (United States)

    2012-01-01

    Background Mangotoxin is an antimetabolite toxin that is produced by strains of Pseudomonas syringae pv. syringae; mangotoxin-producing strains are primarily isolated from mango tissues with symptoms of bacterial apical necrosis. The toxin is an oligopeptide that inhibits ornithine N-acetyl transferase (OAT), a key enzyme in the biosynthetic pathway of the essential amino acids ornithine and arginine. The involvement of a putative nonribosomal peptide synthetase gene (mgoA) in mangotoxin production and virulence has been reported. Results In the present study, we performed a RT-PCR analysis, insertional inactivation mutagenesis, a promoter expression analysis and terminator localisation to study the gene cluster containing the mgoA gene. Additionally, we evaluated the importance of mgoC, mgoA and mgoD in mangotoxin production. A sequence analysis revealed an operon-like organisation. A promoter sequence was located upstream of the mgoB gene and was found to drive lacZ transcription. Two terminators were located downstream of the mgoD gene. RT-PCR experiments indicated that the four genes (mgoBCAD) constitute a transcriptional unit. This operon is similar in genetic organisation to those in the three other P. syringae pathovars for which complete genomes are available (P. syringae pv. syringae B728a, P. syringae pv. tomato DC3000 and P. syringae pv. phaseolicola 1448A). Interestingly, none of these three reference strains is capable of producing mangotoxin. Additionally, extract complementation resulted in a recovery of mangotoxin production when the defective mutant was complemented with wild-type extracts. Conclusions The results of this study confirm that mgoB, mgoC, mgoA and mgoD function as a transcriptional unit and operon. While this operon is composed of four genes, only the last three are directly involved in mangotoxin production. PMID:22251433

  12. Development and validation of an rDNA operon based primer walking strategy applicable to de novo bacterial genome finishing.

    Directory of Open Access Journals (Sweden)

    Alexander William Eastman

    2015-01-01

    Full Text Available Advances in sequencing technology have drastically increased the depth and feasibility of bacterial genome sequencing. However, little information is available that details the specific techniques and procedures employed during genome sequencing despite the large numbers of published genomes. Shotgun approaches employed by second-generation sequencing platforms has necessitated the development of robust bioinformatics tools for in silico assembly, and complete assembly is limited by the presence of repetitive DNA sequences and multi-copy operons. Typically, re-sequencing with multiple platforms and laborious, targeted Sanger sequencing are employed to finish a draft bacterial genome. Here we describe a novel strategy based on the identification and targeted sequencing of repetitive rDNA operons to expedite bacterial genome assembly and finishing. Our strategy was validated by finishing the genome of Paenibacillus polymyxa strain CR1, a bacterium with potential in sustainable agriculture and bio-based processes. An analysis of the 38 contigs contained in the P. polymyxa strain CR1 draft genome revealed 12 repetitive rDNA operons with varied intragenic and flanking regions of variable length, unanimously located at contig boundaries and within contig gaps. These highly similar but not identical rDNA operons were experimentally verified and sequenced simultaneously with multiple, specially designed primer sets. This approach also identified and corrected significant sequence rearrangement generated during the initial in silico assembly of sequencing reads. Our approach reduces the required effort associated with blind primer walking for contig assembly, increasing both the speed and feasibility of genome finishing. Our study further reinforces the notion that repetitive DNA elements are major limiting factors for genome finishing. Moreover, we provided a step-by-step workflow for genome finishing, which may guide future bacterial genome finishing

  13. Direct cloning from enrichment cultures, a reliable strategy for isolation of complete operons and genes from microbial consortia.

    Science.gov (United States)

    Entcheva, P; Liebl, W; Johann, A; Hartsch, T; Streit, W R

    2001-01-01

    Enrichment cultures of microbial consortia enable the diverse metabolic and catabolic activities of these populations to be studied on a molecular level and to be explored as potential sources for biotechnology processes. We have used a combined approach of enrichment culture and direct cloning to construct cosmid libraries with large (>30-kb) inserts from microbial consortia. Enrichment cultures were inoculated with samples from five environments, and high amounts of avidin were added to the cultures to favor growth of biotin-producing microbes. DNA was extracted from three of these enrichment cultures and used to construct cosmid libraries; each library consisted of between 6,000 and 35,000 clones, with an average insert size of 30 to 40 kb. The inserts contained a diverse population of genomic DNA fragments isolated from the consortia organisms. These three libraries were used to complement the Escherichia coli biotin auxotrophic strain ATCC 33767 Delta(bio-uvrB). Initial screens resulted in the isolation of seven different complementing cosmid clones, carrying biotin biosynthesis operons. Biotin biosynthesis capabilities and growth under defined conditions of four of these clones were studied. Biotin measured in the different culture supernatants ranged from 42 to 3,800 pg/ml/optical density unit. Sequencing the identified biotin synthesis genes revealed high similarities to bio operons from gram-negative bacteria. In addition, random sequencing identified other interesting open reading frames, as well as two operons, the histidine utilization operon (hut), and the cluster of genes involved in biosynthesis of molybdopterin cofactors in bacteria (moaABCDE).

  14. A distinct alleles and genetic recombination of pmrCAB operon in species of Acinetobacter baumannii complex isolates.

    Science.gov (United States)

    Kim, Dae Hun; Ko, Kwan Soo

    2015-07-01

    To investigate pmrCAB sequence divergence in 5 species of Acinetobacter baumannii complex, a total of 80 isolates from a Korean hospital were explored. We evaluated nucleotide and amino acid polymorphisms of pmrCAB operon, and phylogenetic trees were constructed for each gene of prmCAB operon. Colistin and polymyxin B susceptibility was determined for all isolates, and multilocus sequence typing was also performed for A. baumannii isolates. Our results showed that each species of A. baumannii complex has divergent pmrCAB operon sequences. We identified a distinct pmrCAB allele allied with Acinetobacter nosocomialis in gene trees. Different grouping in each gene tree suggests sporadic recombination or emergence of pmrCAB genes among Acinetobacter species. Sequence polymorphisms among Acinetobacter species might not be associated with colistin resistance. We revealed that a distinct pmrCAB allele may be widespread across the continents such as North America and Asia and that sporadic genetic recombination or emergence of pmrCAB genes might occur. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Daptomycin Tolerance in the Staphylococcus aureus pitA6 Mutant Is Due to Upregulation of the dlt Operon.

    Science.gov (United States)

    Mechler, Lukas; Bonetti, Eve-Julie; Reichert, Sebastian; Flötenmeyer, Matthias; Schrenzel, Jacques; Bertram, Ralph; François, Patrice; Götz, Friedrich

    2016-05-01

    Understanding the mechanisms of how bacteria become tolerant toward antibiotics during clinical therapy is a very important object. In a previous study, we showed that increased daptomycin (DAP) tolerance of Staphylococcus aureus was due to a point mutation in pitA (inorganic phosphate transporter) that led to intracellular accumulation of both inorganic phosphate (Pi) and polyphosphate (polyP). DAP tolerance in the pitA6 mutant differs from classical resistance mechanisms since there is no increase in the MIC. In this follow-up study, we demonstrate that DAP tolerance in the pitA6 mutant is not triggered by the accumulation of polyP. Transcriptome analysis revealed that 234 genes were at least 2.0-fold differentially expressed in the mutant. Particularly, genes involved in protein biosynthesis, carbohydrate and lipid metabolism, and replication and maintenance of DNA were downregulated. However, the most important change was the upregulation of the dlt operon, which is induced by the accumulation of intracellular Pi The GraXRS system, known as an activator of the dlt operon (d-alanylation of teichoic acids) and of the mprF gene (multiple peptide resistance factor), is not involved in DAP tolerance of the pitA6 mutant. In conclusion, DAP tolerance of the pitA6 mutant is due to an upregulation of the dlt operon, triggered directly or indirectly by the accumulation of Pi. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  16. Synthetic operon for (R,R)-2,3-butanediol production in Bacillus subtilis and Escherichia coli.

    Science.gov (United States)

    de Oliveira, Rafael R; Nicholson, Wayne L

    2016-01-01

    To reduce dependence on petroleum, an alternative route to production of the chemical feedstock 2,3-butanediol (2,3-BD) from renewable lignocellulosic sources is desirable. In this communication, the genes encoding the pathway from pyruvate to 2,3-BD (alsS, alsD, and bdhA encoding acetolactate synthase, acetolactate decarboxylase, and butanediol dehydrogenase, respectively) from Bacillus subtilis were engineered into a single tricistronic operon under control of the isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible Pspac promoter in a shuttle plasmid capable of replication and expression in either B. subtilis or Escherichia coli. We describe the construction and performance of a shuttle plasmid carrying the IPTG-inducible synthetic operon alsSDbdhA coding for 2,3-BD pathway capable of (i) expression in two important representative model microorganisms, the gram-positive B. subtilis and the gram-negative E. coli; (ii) increasing 2,3-BD production in B. subtilis; and (iii) successfully introducing the B. subtilis 2,3-BD pathway into E. coli. The synthetic alsSDbdhA operon constructed using B. subtilis native genes not only increased the 2,3-BD production in its native host but also efficiently expressed the pathway in the heterologous organism E. coli. Construction of an efficient shuttle plasmid will allow investigation of 2,3-BD production performance in related organisms with industrial potential for production of bio-based chemicals.

  17. An operon for production of bioactive gibberellin A4 phytohormone with wide distribution in the bacterial rice leaf streak pathogen Xanthomonas oryzae pv. oryzicola.

    Science.gov (United States)

    Nagel, Raimund; Turrini, Paula C G; Nett, Ryan S; Leach, Jan E; Verdier, Valérie; Van Sluys, Marie-Anne; Peters, Reuben J

    2017-05-01

    Phytopathogens have developed elaborate mechanisms to attenuate the defense response of their host plants, including convergent evolution of complex pathways for production of the GA phytohormones, which were actually first isolated from the rice fungal pathogen Gibberella fujikuroi. The rice bacterial pathogen Xanthomonas oryzae pv. oryzicola (Xoc) has been demonstrated to contain a biosynthetic operon with cyclases capable of producing the universal GA precursor ent-kaurene. Genetic (knock-out) studies indicate that the derived diterpenoid serves as a virulence factor for this rice leaf streak pathogen, serving to reduce the jasmonic acid-mediated defense response. Here the functions of the remaining genes in the Xoc operon are elucidated and the distribution of the operon in X. oryzae is investigated in over 100 isolates. The Xoc operon leads to production of the bioactive GA 4 , an additional step beyond production of the penultimate precursor GA 9 mediated by the homologous operons recently characterized from rhizobia. Moreover, this GA biosynthetic operon was found to be widespread in Xoc (> 90%), but absent in the other major X. oryzae pathovar. These results indicate selective pressure for production of GA 4 in the distinct lifestyle of Xoc, and the importance of GA to both fungal and bacterial pathogens of rice. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  18. Stress-responsively modulated ymdAB-clsC operon plays a role in biofilm formation and apramycin susceptibility in Escherichia coli.

    Science.gov (United States)

    Kim, Moonjeong; Kim, Kwang-Sun

    2017-07-06

    The YmdB protein, an inhibitor of biofilm formation and an inducer of apramycin susceptibility in Escherichia coli (E. coli), is part of a putative operon. However, transcription of this operon and its subsequent effects on biological pathways has not been fully studied. Here, we characterized the operon in terms of promoter activity, transcription and function. Promoter activity assays identified two new growth- and cold-shock-responsive upstream (PymdA) and inner (PclsC) promoters, respectively. Moreover, investigation of the operon-derived transcripts identified different polycistronic transcripts harboring multiple heterogeneous 3΄ ends. Overexpression of YmdA or ClsC proteins inhibited biofilm formation and affected apramycin susceptibility, a process dependent on the sucA gene, suggesting that the operon genes or their encoded proteins are functionally linked. Additional investigation of the effects of polycistronic transcripts on the response of E. coli cells to apramycin revealed that transcripts containing ymdA (-213 to +27) are required for apramycin susceptibility. Thus, ymdAB-clsC is a new stress-responsive operon that plays a role in inhibiting undesired biofilm forming and antibiotic-resistant bacterial populations. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Molecular study on the carAB operon reveals that carB gene is required for swimming and biofilm formation in Xanthomonas citri subsp. citri.

    Science.gov (United States)

    Zhuo, Tao; Rou, Wei; Song, Xue; Guo, Jing; Fan, Xiaojing; Kamau, Gicharu Gibson; Zou, Huasong

    2015-10-23

    The carA and carB genes code the small and large subunits of carbamoyl-phosphate synthase (CPS) that responsible for arginine and pyrimidine production. The purpose of this work was to study the gene organization and expression pattern of carAB operon, and the biological functions of carA and carB genes in Xanthomonas citri subsp. citri. RT-PCR method was employed to identify the full length of carAB operon transcript in X. citri subsp. citri. The promoter of carAB operon was predicted and analyzed its activity by fusing a GUS reporter gene. The swimming motility was tested on 0.25% agar NY plates with 1% glucose. Biofilm was measured by cell adhesion to polyvinyl chloride 96-well plate. The results indicated that carAB operon was composed of five gene members carA-orf-carB-greA-rpfE. A single promoter was predicted from the nucleotide sequence upstream of carAB operon, and its sensitivity to glutamic acid, uracil and arginine was confirmed by fusing a GUS reporter gene. Deletion mutagenesis of carB gene resulted in reduced abilities in swimming on soft solid media and in forming biofilm on polystyrene microtiter plates. From these results, we concluded that carAB operon was involved in multiple biological processes in X. citri subsp. citri.

  20. The VanE operon in Enterococcus faecalis N00-410 is found on a putative integrative and conjugative element, Tn6202.

    Science.gov (United States)

    Boyd, D A; Mulvey, M R

    2013-02-01

    To date no complete genetic structure of acquired DNA harbouring a d-Ala-d-Ser operon in an Enterococcus is known. We wished to characterize the acquired DNA harbouring the vanE operon located in the Enterococcus faecalis N00-410 chromosome. Whole genome sequencing of E. faecalis N00-410 was conducted by massively parallel sequencing. Two sequence contigs harbouring the vanE region were linked by PCR and the acquired DNA harbouring the vanE operon was completely characterized. Excision/integration of the region was determined by PCR and transfer attempted by conjugation. The regions flanking the vanE operon were analysed and a total of 42 open reading frames were identified in a region flanked by inverted terminal and direct repeats (Tn6202). Tn6202 could be excised from the chromosome, circularized and the target site rejoined, but transfer could not be demonstrated. The vanE operon was found on the putative integrative and conjugative element Tn6202 in the E. faecalis N00-410 chromosome. This represents the first characterization of acquired DNA harbouring a D-Ala-D-Ser operon.

  1. Insights into Substrate Specificity of NlpC/P60 Cell Wall Hydrolases Containing Bacterial SH3 Domains

    Energy Technology Data Exchange (ETDEWEB)

    Xu, Qingping; Mengin-Lecreulx, Dominique; Liu, Xueqian W.; Patin, Delphine; Farr, Carol L.; Grant, Joanna C.; Chiu, Hsiu-Ju; Jaroszewski, Lukasz; Knuth, Mark W.; Godzik, Adam; Lesley, Scott A.; Elsliger, Marc-André; Deacon, Ashley M.; Wilson, Ian A.

    2015-09-15

    ABSTRACT

    Bacterial SH3 (SH3b) domains are commonly fused with papain-like Nlp/P60 cell wall hydrolase domains. To understand how the modular architecture of SH3b and NlpC/P60 affects the activity of the catalytic domain, three putative NlpC/P60 cell wall hydrolases were biochemically and structurally characterized. These enzymes all have γ-d-Glu-A2pm (A2pm is diaminopimelic acid) cysteine amidase (ordl-endopeptidase) activities but with different substrate specificities. One enzyme is a cell wall lysin that cleaves peptidoglycan (PG), while the other two are cell wall recycling enzymes that only cleave stem peptides with an N-terminall-Ala. Their crystal structures revealed a highly conserved structure consisting of two SH3b domains and a C-terminal NlpC/P60 catalytic domain, despite very low sequence identity. Interestingly, loops from the first SH3b domain dock into the ends of the active site groove of the catalytic domain, remodel the substrate binding site, and modulate substrate specificity. Two amino acid differences at the domain interface alter the substrate binding specificity in favor of stem peptides in recycling enzymes, whereas the SH3b domain may extend the peptidoglycan binding surface in the cell wall lysins. Remarkably, the cell wall lysin can be converted into a recycling enzyme with a single mutation.

    IMPORTANCEPeptidoglycan is a meshlike polymer that envelops the bacterial plasma membrane and bestows structural integrity. Cell wall lysins and recycling enzymes are part of a set of lytic enzymes that target covalent bonds connecting the amino acid and amino sugar building blocks of the PG network. These hydrolases are involved in processes such as cell growth and division, autolysis, invasion, and PG turnover and recycling. To avoid cleavage of unintended substrates, these enzymes have very selective substrate specificities. Our biochemical and structural

  2. Exploiting rRNA operon copy number to investigate bacterial reproductive strategies.

    Science.gov (United States)

    Roller, Benjamin R K; Stoddard, Steven F; Schmidt, Thomas M

    2016-09-12

    The potential for rapid reproduction is a hallmark of microbial life, but microbes in nature must also survive and compete when growth is constrained by resource availability. Successful reproduction requires different strategies when resources are scarce and when they are abundant 1,2 , but a systematic framework for predicting these reproductive strategies in bacteria has not been available. Here, we show that the number of ribosomal RNA operons (rrn) in bacterial genomes predicts two important components of reproduction-growth rate and growth efficiency-which are favoured under contrasting regimes of resource availability 3,4 . We find that the maximum reproductive rate of bacteria doubles with a doubling of rrn copy number, and the efficiency of carbon use is inversely related to maximal growth rate and rrn copy number. We also identify a feasible explanation for these patterns: the rate and yield of protein synthesis mirror the overall pattern in maximum growth rate and growth efficiency. Furthermore, comparative analysis of genomes from 1,167 bacterial species reveals that rrn copy number predicts traits associated with resource availability, including chemotaxis and genome streamlining. Genome-wide patterns of orthologous gene content covary with rrn copy number, suggesting convergent evolution in response to resource availability. Our findings imply that basic cellular processes adapt in contrasting ways to long-term differences in resource availability. They also establish a basis for predicting changes in bacterial community composition in response to resource perturbations using rrn copy number measurements 5 or inferences 6,7 .

  3. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

    Directory of Open Access Journals (Sweden)

    Løvdal Irene S

    2012-03-01

    Full Text Available Abstract Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate.

  4. Role of the gerA operon in L-alanine germination of Bacillus licheniformis spores

    Science.gov (United States)

    2012-01-01

    Background The genome of Bacillus licheniformis DSM 13 harbours three neighbouring open reading frames showing protein sequence similarities to the proteins encoded from the Bacillus subtilis subsp. subtilis 168 gerA operon, GerAA, GerAB and GerAC. In B. subtilis, these proteins are assumed to form a germinant receptor involved in spore germination induced by the amino acid L-alanine. Results In this study we show that disruption of the gerAA gene in B. licheniformis MW3 hamper L-alanine and casein hydrolysate-triggered spore germination, measured by absorbance at 600 nm and confirmed by phase contrast microscopy. This ability was restored by complementation with a plasmid-borne copy of the gerA locus. Addition of D-alanine in the casein hydrolysate germination assay abolished germination of both B. licheniformis MW3 and the complementation mutant. Germination of both B. licheniformis MW3 and the gerA disruption mutant was induced by the non-nutrient germinant Ca2+-Dipicolinic acid. Conclusions These results demonstrate that the B. licheniformis MW3 gerA locus is involved in germination induced by L-alanine and potentially other components present in casein hydrolysate. PMID:22420404

  5. The Legionella pneumophila kai operon is implicated in stress response and confers fitness in competitive environments

    Science.gov (United States)

    Loza-Correa, Maria; Sahr, Tobias; Rolando, Monica; Daniels, Craig; Petit, Pierre; Skarina, Tania; Valero, Laura Gomez; Dervins-Ravault, Delphine; Honoré, Nadine; Savchenko, Aleksey; Buchrieser, Carmen

    2014-01-01

    Summary Legionella pneumophila uses aquatic protozoa as replication niche and protection from harsh environments. Although L. pneumophila is not known to have a circadian clock, it encodes homologues of the KaiBC proteins of Cyanobacteria that regulate circadian gene expression. We show that L. pneumophila kaiB, kaiC and the downstream gene lpp1114, are transcribed as a unit under the control of the stress sigma factor RpoS. KaiC and KaiB of L. pneumophila do not interact as evidenced by yeast and bacterial two-hybrid analyses. Fusion of the C-terminal residues of cyanobacterial KaiB to Legionella KaiB restores their interaction. In contrast, KaiC of L. pneumophila conserved autophosphorylation activity, but KaiB does not trigger the dephosphorylation of KaiC like in Cyanobacteria. The crystal structure of L. pneumophila KaiB suggests that it is an oxidoreductase-like protein with a typical thioredoxin fold. Indeed, mutant analyses revealed that the kai operon-encoded proteins increase fitness of L. pneumophila in competitive environments, and confer higher resistance to oxidative and sodium stress. The phylogenetic analysis indicates that L. pneumophila KaiBC resemble Synechosystis KaiC2B2 and not circadian KaiB1C1. Thus, the L. pneumophila Kai proteins do not encode a circadian clock, but enhance stress resistance and adaption to changes in the environments. PMID:23957615

  6. Regulation and Adaptive Evolution of Lactose Operon Expression in Lactobacillus delbrueckii

    Science.gov (United States)

    Lapierre, Luciane; Mollet, Beat; Germond, Jacques-Edouard

    2002-01-01

    Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis are both used in the dairy industry as homofermentative lactic acid bacteria in the production of fermented milk products. After selective pressure for the fast fermentation of milk in the manufacture of yogurts, L. delbrueckii subsp. bulgaricus loses its ability to regulate lac operon expression. A series of mutations led to the constitutive expression of the lac genes. A complex of insertion sequence (IS) elements (ISL4 inside ISL5), inserted at the border of the lac promoter, induced the loss of the palindromic structure of one of the operators likely involved in the binding of regulatory factors. A lac repressor gene was discovered downstream of the β-galactosidase gene of L. delbrueckii subsp. lactis and was shown to be inactivated by several mutations in L. delbrueckii subsp. bulgaricus. Regulatory mechanisms of the lac gene expression of L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis were compared by heterologous expression in Lactococcus lactis of the two lac promoters in front of a reporter gene (β-glucuronidase) in the presence or absence of the lac repressor gene. Insertion of the complex of IS elements in the lac promoter of L. delbrueckii subsp. bulgaricus increased the promoter's activity but did not prevent repressor binding; rather, it increased the affinity of the repressor for the promoter. Inactivation of the lac repressor by mutations was then necessary to induce the constitutive expression of the lac genes in L. delbrueckii subsp. bulgaricus. PMID:11807052

  7. The role of the Staphylococcal VraTSR regulatory system on vancomycin resistance and vanA operon expression in vancomycin-resistant Staphylococcus aureus.

    Science.gov (United States)

    Qureshi, Nadia K; Yin, Shaohui; Boyle-Vavra, Susan

    2014-01-01

    Vancomycin is often the preferred treatment for invasive methicillin-resistant Staphylococcus aureus (MRSA) infection. With the increase in incidence of MRSA infections, the use of vancomycin has increased and, as feared, isolates of vancomycin-resistant Staphylococcus aureus (VRSA) have emerged. VRSA isolates have acquired the entercoccal vanA operon contained on transposon (Tn) 1546 residing on a conjugal plasmid. VraTSR is a vancomycin and β-lactam-inducible three-component regulatory system encoded on the S. aureus chromosome that modulates the cell-wall stress response to cell-wall acting antibiotics. Mutation in vraTSR has shown to increase susceptibility to β-lactams and vancomycin in clinical VISA strains and in recombinant strain COLVA-200 which expresses a plasmid borne vanA operon. To date, the role of VraTSR in vanA operon expression in VRSA has not been demonstrated. In this study, the vraTSR operon was deleted from the first clinical VRSA strain (VRS1) by transduction with phage harvested from a USA300 vraTSR operon deletion strain. The absence of the vraTSR operon and presence of the vanA operon were confirmed in the transductant (VRS1Δvra) by PCR. Broth MIC determinations, demonstrated that the vancomycin MIC of VRS1Δvra (64 µg/ml) decreased by 16-fold compared with VRS1 (1024 µg/ml). The effect of the vraTSR operon deletion on expression of the van gene cluster (vanA, vanX and vanR) was examined by quantitative RT-PCR using relative quantification. A 2-5-fold decreased expression of the vanA operon genes occured in strain VRS1Δvra at stationary growth phase compared with the parent strain, VRS1. Both vancomycin resistance and vancomycin-induced expression of vanA and vanR were restored by complementation with a plasmid harboring the vraTSR operon. These findings demonstrate that expression in S. aureus of the horizontally acquired enterococcal vanA gene cluster is enhanced by the staphylococcal three-component cell wall stress regulatory

  8. Simultaneous determination of the lipoxygenase and hydroperxide lyase specificity in olive fruit pulp

    Directory of Open Access Journals (Sweden)

    Salas, Joaquín J.

    2000-06-01

    Full Text Available Olive pulp lipoxygenase regiospecificity and hydroperoxide lyase substrate specificity are important parameters in order to justify the volatile composition of olive oil. A new radiolabelling method to determine simultaneously these properties using only thin layer chromatography steps is described in the present work. The method involves incubation of an enzyme preparation from olive pulp with radiolabelled linoleate, followed by the fractionation of the resulting lipid products, previously treated with 2,4-dinitrophenyl hydrazine, on thin layer chromatography plates coated with polyethylenglycol 400. The results obtained are in agreement with previous studies carried out by other methods.La regioespecificidad de la lipoxigenasa y la especificidad del sustrato hidroperóxido liasa de pulpa de aceituna son parámetros importantes en la justificación de la composición en volátiles del aceite de oliva. En este trabajo se describe un nuevo método de marcaje radioactivo para determinar simultáneamente estas propiedades, usando solo etapas de cromatografía en capa fina. El método implica la incubación de una preparación enzimática de pulpa de aceituna con linoleato marcado, seguido del fraccionamiento de los productos lipídicos resultantes, previamente tratados con 2,4-dinitrofenil hidrazina, sobre placas de cromatografía en capa fina soportadas con polietilenglicol 400. Los resultados obtenidos están de acuerdo con estudios previos llevados a cabo con otros métodos.

  9. Molecular analysis of human argininosuccinate lyase: Mutant characterization and alternative splicing of the coding region

    International Nuclear Information System (INIS)

    Walker, D.C.; McCloskey, D.A.; Simard, L.R.; McInnes, R.R.

    1990-01-01

    Argininosuccinic acid lyase (ASAL) deficiency is a clinically heterogeneous autosomal recessive urea cycle disorder. The authors previously established by complementation analysis that 29 ASAL-deficient patients have heterogeneous mutations in a single gene. To prove that the ASAL structural gene is the affected locus, they sequenced polymerase chain reaction-amplified ASAL cDNA of a representative mutant from the single complementation group. Fibroblast strain 944 from a late-onset patient who was the product of a consanguineous mating, had only a single base-pair change in the coding region, a C-283→ T transition at a CpG dinucleotide in exon 3. This substitution converts Arg-95 to Cys (R95C), occurs in a stretch of 13 residues that is identical in yeast and human ASAL, and was present in both of the patient's alleles but not in 14 other mutant or 10 normal alleles. They observed that amplified cDNA from mutant 944 and normal cells (liver, keratinocytes, lymphoblasts, and fibroblasts) contained, in addition to the expected 5' 513-base-pair band, a prominent 318-base-pair ASAL band formed by the splicing of exon 2 from the transcript. The short transcript maintains the ASAL reading frame but removes Lys-51, a residue that may be essential for catalysis, since it binds the argininosuccinate substrate. They conclude (i) that the identification of the R95C mutation in strain 944 demonstrates that virtually all ASAL deficiency results from defects in the ASAL structural gene and (ii) that minor alternative splicing of the coding region occurs at the ASAL locus

  10. Unstable argininosuccinate lyase in variant forms of the urea cycle disorder argininosuccinic aciduria.

    Science.gov (United States)

    Hu, Liyan; Pandey, Amit V; Balmer, Cécile; Eggimann, Sandra; Rüfenacht, Véronique; Nuoffer, Jean-Marc; Häberle, Johannes

    2015-09-01

    Loss of function of the urea cycle enzyme argininosuccinate lyase (ASL) is caused by mutations in the ASL gene leading to ASL deficiency (ASLD). ASLD has a broad clinical spectrum ranging from life-threatening severe neonatal to asymptomatic forms. Different levels of residual ASL activity probably contribute to the phenotypic variability but reliable expression systems allowing clinically useful conclusions are not yet available. In order to define the molecular characteristics underlying the phenotypic variability, we investigated all ASL mutations that were hitherto identified in patients with late onset or mild clinical and biochemical courses by ASL expression in human embryonic kidney 293 T cells. We found residual activities >3% of ASL wild type (WT) in nine of 11 ASL mutations. Six ASL mutations (p.Arg95Cys, p.Ile100Thr, p.Val178Met, p.Glu189Gly, p.Val335Leu, and p.Arg379Cys) with residual activities ≥16% of ASL WT showed no significant or less than twofold reduced Km values, but displayed thermal instability. Computational structural analysis supported the biochemical findings by revealing multiple effects including protein instability, disruption of ionic interactions and hydrogen bonds between residues in the monomeric form of the protein, and disruption of contacts between adjacent monomeric units in the ASL tetramer. These findings suggest that the clinical and biochemical course in variant forms of ASLD is associated with relevant residual levels of ASL activity as well as instability of mutant ASL proteins. Since about 30% of known ASLD genotypes are affected by mutations studied here, ASLD should be considered as a candidate for chaperone treatment to improve mutant protein stability.

  11. Partial deficiency of sphingosine-1-phosphate lyase confers protection in experimental autoimmune encephalomyelitis.

    Directory of Open Access Journals (Sweden)

    Andreas Billich

    Full Text Available BACKGROUND: Sphingosine-1-phosphate (S1P regulates the egress of T cells from lymphoid organs; levels of S1P in the tissues are controlled by S1P lyase (Sgpl1. Hence, Sgpl1 offers a target to block T cell-dependent inflammatory processes. However, the involvement of Sgpl1 in models of disease has not been fully elucidated yet, since Sgpl1 KO mice have a short life-span. METHODOLOGY: We generated inducible Sgpl1 KO mice featuring partial reduction of Sgpl1 activity and analyzed them with respect to sphingolipid levels, T-cell distribution, and response in models of inflammation. PRINCIPAL FINDINGS: The partially Sgpl1 deficient mice are viable but feature profound reduction of peripheral T cells, similar to the constitutive KO mice. While thymic T cell development in these mice appears normal, mature T cells are retained in thymus and lymph nodes, leading to reduced T cell numbers in spleen and blood, with a skewing towards increased proportions of memory T cells and T regulatory cells. The therapeutic relevance of Sgpl1 is demonstrated by the fact that the inducible KO mice are protected in experimental autoimmune encephalomyelitis (EAE. T cell immigration into the CNS was found to be profoundly reduced. Since S1P levels in the brain of the animals are unchanged, we conclude that protection in EAE is due to the peripheral effect on T cells, leading to reduced CNS immigration, rather than on local effects in the CNS. SIGNIFICANCE: The data suggest Sgpl1 as a novel therapeutic target for the treatment of multiple sclerosis.

  12. Phycoerythrin-specific bilin lyase-isomerase controls blue-green chromatic acclimation in marine Synechococcus.

    Science.gov (United States)

    Shukla, Animesh; Biswas, Avijit; Blot, Nicolas; Partensky, Frédéric; Karty, Jonathan A; Hammad, Loubna A; Garczarek, Laurence; Gutu, Andrian; Schluchter, Wendy M; Kehoe, David M

    2012-12-04

    The marine cyanobacterium Synechococcus is the second most abundant phytoplanktonic organism in the world's oceans. The ubiquity of this genus is in large part due to its use of a diverse set of photosynthetic light-harvesting pigments called phycobiliproteins, which allow it to efficiently exploit a wide range of light colors. Here we uncover a pivotal molecular mechanism underpinning a widespread response among marine Synechococcus cells known as "type IV chromatic acclimation" (CA4). During this process, the pigmentation of the two main phycobiliproteins of this organism, phycoerythrins I and II, is reversibly modified to match changes in the ambient light color so as to maximize photon capture for photosynthesis. CA4 involves the replacement of three molecules of the green light-absorbing chromophore phycoerythrobilin with an equivalent number of the blue light-absorbing chromophore phycourobilin when cells are shifted from green to blue light, and the reverse after a shift from blue to green light. We have identified and characterized MpeZ, an enzyme critical for CA4 in marine Synechococcus. MpeZ attaches phycoerythrobilin to cysteine-83 of the α-subunit of phycoerythrin II and isomerizes it to phycourobilin. mpeZ RNA is six times more abundant in blue light, suggesting that its proper regulation is critical for CA4. Furthermore, mpeZ mutants fail to normally acclimate in blue light. These findings provide insights into the molecular mechanisms controlling an ecologically important photosynthetic process and identify a unique class of phycoerythrin lyase/isomerases, which will further expand the already widespread use of phycoerythrin in biotechnology and cell biology applications.

  13. Formulation and PEGylation optimization of the therapeutic PEGylated phenylalanine ammonia lyase for the treatment of phenylketonuria.

    Science.gov (United States)

    Bell, Sean M; Wendt, Dan J; Zhang, Yanhong; Taylor, Timothy W; Long, Shinong; Tsuruda, Laurie; Zhao, Bin; Laipis, Phillip; Fitzpatrick, Paul A

    2017-01-01

    Phenylketonuria (PKU) is a genetic metabolic disease in which the decrease or loss of phenylalanine hydroxylase (PAH) activity results in elevated, neurotoxic levels of phenylalanine (Phe). Due to many obstacles, PAH enzyme replacement therapy is not currently an option. Treatment of PKU with an alternative enzyme, phenylalanine ammonia lyase (PAL), was first proposed in the 1970s. However, issues regarding immunogenicity, enzyme production and mode of delivery needed to be overcome. Through the evaluation of PAL enzymes from multiple species, three potential PAL enzymes from yeast and cyanobacteria were chosen for evaluation of their therapeutic potential. The addition of polyethylene glycol (PEG, MW = 20,000), at a particular ratio to modify the protein surface, attenuated immunogenicity in an animal model of PKU. All three PEGylated PAL candidates showed efficacy in a mouse model of PKU (BTBR Pahenu2) upon subcutaneous injection. However, only PEGylated Anabaena variabilis (Av) PAL-treated mice demonstrated sustained low Phe levels with weekly injection and was the only PAL evaluated that maintained full enzymatic activity upon PEGylation. A PEGylated recombinant double mutant version of AvPAL (Cys503Ser/Cys565Ser), rAvPAL-PEG, was selected for drug development based on its positive pharmacodynamic profile and favorable expression titers. PEGylation was shown to be critical for rAvPAL-PEG efficacy as under PEGylated rAvPAL had a lower pharmacodynamic effect. rAvPAL and rAvPAL-PEG had poor stability at 4°C. L-Phe and trans-cinnamate were identified as activity stabilizing excipients. rAvPAL-PEG is currently in Phase 3 clinical trials to assess efficacy in PKU patients.

  14. Arsenic Demethylation by a C·As Lyase in Cyanobacterium Nostoc sp. PCC 7120.

    Science.gov (United States)

    Yan, Yu; Ye, Jun; Xue, Xi-Mei; Zhu, Yong-Guan

    2015-12-15

    Arsenic, a ubiquitous toxic substance, exists mainly as inorganic forms in the environment. It is perceived that organoarsenicals can be demethylated and degraded into inorganic arsenic by microorganisms. Few studies have focused on the mechanism of arsenic demethylation in bacteria. Here, we investigated arsenic demethylation in a typical freshwater cyanobacterium Nostoc sp. PCC 7120. This bacterium was able to demethylate monomethylarsenite [MAs(III)] rapidly to arsenite [As(III)] and also had the ability to demethylate monomethylarsenate [MAs(V)] to As(III). The NsarsI encoding a C·As lyase responsible for MAs(III) demethylation was cloned from Nostoc sp. PCC 7120 and heterologously expressed in an As-hypersensitive strain Escherichia coli AW3110 (ΔarsRBC). Expression of NsarsI was shown to confer MAs(III) resistance through arsenic demethylation. The purified NsArsI was further identified and functionally characterized in vitro. NsArsI existed mainly as the trimeric state, and the kinetic data were well-fit to the Hill equation with K0.5 = 7.55 ± 0.33 μM for MAs(III), Vmax = 0.79 ± 0.02 μM min(-1), and h = 2.7. Both of the NsArsI truncated derivatives lacking the C-terminal 10 residues (ArsI10) or 23 residues (ArsI23) had a reduced ability of MAs(III) demethylation. These results provide new insights for understanding the important role of cyanobacteria in arsenic biogeochemical cycling in the environment.

  15. Subcellular Targeting of Methylmercury Lyase Enhances Its Specific Activity for Organic Mercury Detoxification in Plants1

    Science.gov (United States)

    Bizily, Scott P.; Kim, Tehryung; Kandasamy, Muthugapatti K.; Meagher, Richard B.

    2003-01-01

    Methylmercury is an environmental pollutant that biomagnifies in the aquatic food chain with severe consequences for humans and other animals. In an effort to remove this toxin in situ, we have been engineering plants that express the bacterial mercury resistance enzymes organomercurial lyase MerB and mercuric ion reductase MerA. In vivo kinetics experiments suggest that the diffusion of hydrophobic organic mercury to MerB limits the rate of the coupled reaction with MerA (Bizily et al., 2000). To optimize reaction kinetics for organic mercury compounds, the merB gene was engineered to target MerB for accumulation in the endoplasmic reticulum and for secretion to the cell wall. Plants expressing the targeted MerB proteins and cytoplasmic MerA are highly resistant to organic mercury and degrade organic mercury at 10 to 70 times higher specific activity than plants with the cytoplasmically distributed wild-type MerB enzyme. MerB protein in endoplasmic reticulum-targeted plants appears to accumulate in large vesicular structures that can be visualized in immunolabeled plant cells. These results suggest that the toxic effects of organic mercury are focused in microenvironments of the secretory pathway, that these hydrophobic compartments provide more favorable reaction conditions for MerB activity, and that moderate increases in targeted MerB expression will lead to significant gains in detoxification. In summary, to maximize phytoremediation efficiency of hydrophobic pollutants in plants, it may be beneficial to target enzymes to specific subcellular environments. PMID:12586871

  16. Identification of the substrate radical intermediate derived from ethanolamine during catalysis by ethanolamine ammonia-lyase.

    Science.gov (United States)

    Bender, Güneş; Poyner, Russell R; Reed, George H

    2008-10-28

    Rapid-mix freeze-quench (RMFQ) methods and electron paramagnetic resonance (EPR) spectroscopy have been used to characterize the steady-state radical in the deamination of ethanolamine catalyzed by adenosylcobalamin (AdoCbl)-dependent ethanolamine ammonia-lyase (EAL). EPR spectra of the radical intermediates formed with the substrates, [1-13C]ethanolamine, [2-13C]ethanolamine, and unlabeled ethanolamine were acquired using RMFQ trapping methods from 10 ms to completion of the reaction. Resolved 13C hyperfine splitting in EPR spectra of samples prepared with [1-13C]ethanolamine and the absence of such splitting in spectra of samples prepared with [2-13C]ethanolamine show that the unpaired electron is localized on C1 (the carbinol carbon) of the substrate. The 13C splitting from C1 persists from 10 ms throughout the time course of substrate turnover, and there was no evidence of a detectable amount of a product like radical having unpaired spin on C2. These results correct an earlier assignment for this radical intermediate [Warncke, K., et al. (1999) J. Am. Chem. Soc. 121, 10522-10528]. The EPR signals of the substrate radical intermediate are altered by electron spin coupling to the other paramagnetic species, cob(II)alamin, in the active site. The dipole-dipole and exchange interactions as well as the 1-13C hyperfine splitting tensor were analyzed via spectral simulations. The sign of the isotropic exchange interaction indicates a weak ferromagnetic coupling of the two unpaired electrons. A Co2+-radical distance of 8.7 A was obtained from the magnitude of the dipole-dipole interaction. The orientation of the principal axes of the 13C hyperfine splitting tensor shows that the long axis of the spin-bearing p orbital on C1 of the substrate radical makes an angle of approximately 98 degrees with the unique axis of the d(z2) orbital of Co2+.

  17. Genome-wide characterization of phenylalanine ammonia-lyase gene family in watermelon (Citrullus lanatus).

    Science.gov (United States)

    Dong, Chun-Juan; Shang, Qing-Mao

    2013-07-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme in the phenylpropanoid pathway, plays a critical role in plant growth, development, and adaptation. PAL enzymes are encoded by a gene family in plants. Here, we report a genome-wide search for PAL genes in watermelon. A total of 12 PAL genes, designated ClPAL1-12, are identified . Nine are arranged in tandem in two duplication blocks located on chromosomes 4 and 7, and the other three ClPAL genes are distributed as single copies on chromosomes 2, 3, and 8. Both the cDNA and protein sequences of ClPALs share an overall high identity with each other. A phylogenetic analysis places 11 of the ClPALs into a separate cucurbit subclade, whereas ClPAL2, which belongs to neither monocots nor dicots, may serve as an ancestral PAL in plants. In the cucurbit subclade, seven ClPALs form homologous pairs with their counterparts from cucumber. Expression profiling reveals that 11 of the ClPAL genes are expressed and show preferential expression in the stems and male and female flowers. Six of the 12 ClPALs are moderately or strongly expressed in the fruits, particularly in the pulp, suggesting the potential roles of PAL in the development of fruit color and flavor. A promoter motif analysis of the ClPAL genes implies redundant but distinctive cis-regulatory structures for stress responsiveness. Finally, duplication events during the evolution and expansion of the ClPAL gene family are discussed, and the relationships between the ClPAL genes and their cucumber orthologs are estimated.

  18. Formulation and PEGylation optimization of the therapeutic PEGylated phenylalanine ammonia lyase for the treatment of phenylketonuria.

    Directory of Open Access Journals (Sweden)

    Sean M Bell

    Full Text Available Phenylketonuria (PKU is a genetic metabolic disease in which the decrease or loss of phenylalanine hydroxylase (PAH activity results in elevated, neurotoxic levels of phenylalanine (Phe. Due to many obstacles, PAH enzyme replacement therapy is not currently an option. Treatment of PKU with an alternative enzyme, phenylalanine ammonia lyase (PAL, was first proposed in the 1970s. However, issues regarding immunogenicity, enzyme production and mode of delivery needed to be overcome. Through the evaluation of PAL enzymes from multiple species, three potential PAL enzymes from yeast and cyanobacteria were chosen for evaluation of their therapeutic potential. The addition of polyethylene glycol (PEG, MW = 20,000, at a particular ratio to modify the protein surface, attenuated immunogenicity in an animal model of PKU. All three PEGylated PAL candidates showed efficacy in a mouse model of PKU (BTBR Pahenu2 upon subcutaneous injection. However, only PEGylated Anabaena variabilis (Av PAL-treated mice demonstrated sustained low Phe levels with weekly injection and was the only PAL evaluated that maintained full enzymatic activity upon PEGylation. A PEGylated recombinant double mutant version of AvPAL (Cys503Ser/Cys565Ser, rAvPAL-PEG, was selected for drug development based on its positive pharmacodynamic profile and favorable expression titers. PEGylation was shown to be critical for rAvPAL-PEG efficacy as under PEGylated rAvPAL had a lower pharmacodynamic effect. rAvPAL and rAvPAL-PEG had poor stability at 4°C. L-Phe and trans-cinnamate were identified as activity stabilizing excipients. rAvPAL-PEG is currently in Phase 3 clinical trials to assess efficacy in PKU patients.

  19. Measurement of the relative branching ratio BR(Ξc+-- >p+K- π+)/BR(Ξc+-->Ξ- π+π+)

    Science.gov (United States)

    FOCUS Collaboration; Link, J. M.; Reyes, M.; Yager, P. M.; Anjos, J. C.; Bediaga, I.; Göbel, C.; Magnin, J.; Massafferri, A.; de Miranda, J. M.; Pepe, I. M.; dos Reis, A. C.; Sima~o, F. R. A.; Carrillo, S.; Casimiro, E.; Sánchez-Hernández, A.; Uribe, C.; Vázquez, F.; Cinquini, L.; Cumalat, J. P.; O'Reilly, B.; Ramirez, J. E.; Vaandering, E. W.; Butler, J. N.; Cheung, H. W. K.; Gaines, I.; Garbincius, P. H.; Garren, L. A.; Gottschalk, E.; Kasper, P. H.; Kreymer, A. E.; Kutschke, R.; Bianco, S.; Fabbri, F. L.; Sarwar, S.; Zallo, A.; Cawlfield, C.; Kim, D. Y.; Rahimi, A.; Wiss, J.; Gardner, R.; Chung, Y. S.; Kang, J. S.; Ko, B. R.; Kwak, J. W.; Lee, K. B.; Park, H.; Alimonti, G.; Boschini, M.; Caccianiga, B.; D'Angelo, P.; DiCorato, M.; Dini, P.; Giammarchi, M.; Inzani, P.; Leveraro, F.; Malvezzi, S.; Menasce, D.; Mezzadri, M.; Milazzo, L.; Moroni, L.; Pedrini, D.; Pontoglio, C.; Prelz, F.; Rovere, M.; Sala, A.; Sala, S.; Davenport, T. F., III; Agostino, L.; Arena, V.; Boca, G.; Bonomi, G.; Gianini, G.; Liguori, G.; Merlo, M. M.; Pantea, D.; Ratti, S. P.; Riccardi, C.; Segoni, I.; Viola, L.; Vitulo, P.; Hernandez, H.; Lopez, A. M.; Mendez, H.; Mendez, L.; Mirles, A.; Montiel, E.; Olaya, D.; Paris, A.; Quinones, J.; Rivera, C.; Xiong, W.; Zhang, Y.; Wilson, J. R.; Cho, K.; Handler, T.; Engh, D.; Hosack, M.; Johns, W. E.; Nehring, M.; Sheldon, P. D.; Stenson, K.; Webster, M.; Sheaff, M.

    2001-07-01

    We report the observation of the Cabibbo suppressed decay Ξc+-->pK-π+ using data collected with the FOCUS spectrometer during the 1996-1997 Fermilab fixed target run. We find a Ξc+ signal peak of /202+/-35 events. We have measured the relative branching ratios BR(Ξ+c-->pK- π+)/BR(Ξ+c-->Ξ- π+π+)=0.234+/-0.047+/-0.022 and BR(Ξ+c-- >pK¯*(892)0)/BR(Ξ+c-->pK-π+)=0.54+/-0.09+/-0.05.

  20. Exploration of swapping enzymatic function between two proteins: A simulation study of chorismate mutase and isochorismate pyruvate lyase

    Science.gov (United States)

    Choutko, Alexandra; Eichenberger, Andreas P; Gunsteren, Wilfred F; Dolenc, Jožica

    2013-01-01

    The enzyme chorismate mutase EcCM from Escherichia coli catalyzes one of the few pericyclic reactions in biology, the transformation of chorismate to prephenate. The isochorismate pyruvate lyase PchB from Pseudomonas aeroginosa catalyzes another pericyclic reaction, the isochorismate to salicylate transformation. Interestingly, PchB possesses weak chorismate mutase activity as well thus being able to catalyze two distinct pericyclic reactions in a single active site. EcCM and PchB possess very similar folds, despite their low sequence identity. Using molecular dynamics simulations of four combinations of the two enzymes (EcCM and PchB) with the two substrates (chorismate and isochorismate) we show that the electrostatic field due to EcCM at atoms of chorismate favors the chorismate to prephenate transition and that, analogously, the electrostatic field due to PchB at atoms of isochorismate favors the isochorismate to salicylate transition. The largest differences between EcCM and PchB in electrostatic field strengths at atoms of the substrates are found to be due to residue side chains at distances between 0.6 and 0.8 nm from particular substrate atoms. Both enzymes tend to bring their non-native substrate in the same conformation as their native substrate. EcCM and to a lower extent PchB fail in influencing the forces on and conformations of the substrate such as to favor the other chemical reaction (isochorismate pyruvate lyase activity for EcCM and chorismate mutase activity for PchB). These observations might explain the difficulty of engineering isochorismate pyruvate lyase activity in EcCM by solely mutating active site residues. PMID:23595942

  1. Exploration of swapping enzymatic function between two proteins: a simulation study of chorismate mutase and isochorismate pyruvate lyase.

    Science.gov (United States)

    Choutko, Alexandra; Eichenberger, Andreas P; van Gunsteren, Wilfred F; Dolenc, Jožica

    2013-06-01

    The enzyme chorismate mutase EcCM from Escherichia coli catalyzes one of the few pericyclic reactions in biology, the transformation of chorismate to prephenate. The isochorismate pyruvate lyase PchB from Pseudomonas aeroginosa catalyzes another pericyclic reaction, the isochorismate to salicylate transformation. Interestingly, PchB possesses weak chorismate mutase activity as well thus being able to catalyze two distinct pericyclic reactions in a single active site. EcCM and PchB possess very similar folds, despite their low sequence identity. Using molecular dynamics simulations of four combinations of the two enzymes (EcCM and PchB) with the two substrates (chorismate and isochorismate) we show that the electrostatic field due to EcCM at atoms of chorismate favors the chorismate to prephenate transition and that, analogously, the electrostatic field due to PchB at atoms of isochorismate favors the isochorismate to salicylate transition. The largest differences between EcCM and PchB in electrostatic field strengths at atoms of the substrates are found to be due to residue side chains at distances between 0.6 and 0.8 nm from particular substrate atoms. Both enzymes tend to bring their non-native substrate in the same conformation as their native substrate. EcCM and to a lower extent PchB fail in influencing the forces on and conformations of the substrate such as to favor the other chemical reaction (isochorismate pyruvate lyase activity for EcCM and chorismate mutase activity for PchB). These observations might explain the difficulty of engineering isochorismate pyruvate lyase activity in EcCM by solely mutating active site residues. © 2013 The Protein Society.

  2. Effect of growth conditions on expression of the acid phosphatase (cyx-appA) operon and the appY gene, which encodes a transcriptional activator of Escherichia coli

    DEFF Research Database (Denmark)

    Brøndsted, Lone; Atlung, Tove

    1996-01-01

    The expression and transcriptional regulation of the Escherichia coli cyx-appA operon and the appY gene has been investigated during different environmental conditions using single copy transcriptional lacZ fusions. The cyx-appA operon encodes acid phosphatase and a putative cytochrome oxidase...... of the cyx-appA operon. The nitrate repression was partially dependent on NarL. A high expression of the operon was obtained in glucose medium supplemented with formate, where E.coli obtains energy by fermentation. The formate induction was independent of the fhlA gene product. The results presented...... in this paper indicate a clear difference in the regulation of the cyx-appA operon compared to the cyd operon, encoding the cytochrome d oxidase complex. The results suggest that cytochrome x oxidase has a function at even more oxygen limiting conditions than cytochrome d oxidase. The expression of the app...

  3. Sedimentology of the Teekloof formation to the east of Aberdeen (C.P.) with reference to uranium mineralization

    International Nuclear Information System (INIS)

    Simmonds, A.L.E.

    1982-01-01

    An area to the immediate east of Aberdeen (C.P.), banded in the north by the Rooiberge and to the east by the Sundays River, has been sedimentologically studied. A notable feature of the sediments investigated, is the presence of linear zones of increased sandstone. Some of the sediments also showed an exessive volume of argillaceous rocks. The sandstones cropping out in the Aberdeen District may be classified as lithic arkoses. Due to the manner in which the detrital grains appear to 'float' in calcite, an expansive growth mechanism is envisaged. This implies early crystallization of calcite, and emplacement of uranium

  4. Molecular cloning and characterization of an Erwinia carotovora subsp. carotovora pectin lyase gene that responds to DNA-damaging agents.

    OpenAIRE

    McEvoy, J L; Murata, H; Chatterjee, A K

    1990-01-01

    recA-mediated production of pectin lyase (PNL) and the bacteriocin carotovoricin occurs in Erwinia carotovora subsp. carotovora 71 when this organism is subjected to agents that damage or inhibit the synthesis of DNA. The structural gene pnlA was isolated from a strain 71 cosmid gene library following mobilization of the cosmids into a moderate PNL producer, strain 193. The cosmid complemented pnl::Tn5 but not ctv::Tn5 mutations. A constitutive level of PNL activity was detected in RecA+ and ...

  5. Molecular level biodegradation of phenol and its derivatives through dmp operon of Pseudomonas putida: A bio-molecular modeling and docking analysis.

    Science.gov (United States)

    Ray, Sujay; Banerjee, Arundhati

    2015-10-01

    Participation of Pseudomonas putida-derived methyl phenol (dmp) operon and DmpR protein in the biodegradation of phenol or other harmful, organic, toxic pollutants was investigated at a molecular level. Documentation documents that P. putida has DmpR protein which positively regulates dmp operon in the presence of inducers; like phenols. From the operon, phenol hydroxylase encoded by dmpN gene, participates in degrading phenols after dmp operon is expressed. For the purpose, the 3-D models of the four domains from DmpR protein and of the DNA sequences from the two Upstream Activation Sequences (UAS) present at the promoter region of the operon were demonstrated using discrete molecular modeling techniques. The best modeled structures satisfying their stereo-chemical properties were selected in each of the cases. To stabilize the individual structures, energy optimization was performed. In the presence of inducers, probable interactions among domains and then the two independent DNA structures with the fourth domain were perused by manifold molecular docking simulations. The complex structures were made to be stable by minimizing their overall energy. Responsible amino acid residues, nucleotide bases and binding patterns for the biodegradation, were examined. In the presence of the inducers, the biodegradation process is initiated by the interaction of phe50 from the first protein domain with the inducers. Only after the interaction of the last domain with the DNA sequences individually, the operon is expressed. This novel residue level study is paramount for initiating transcription in the operon; thereby leading to expression of phenol hydroxylase followed by phenol biodegradation. Copyright © 2015. Published by Elsevier B.V.

  6. Interplay of protein and DNA structure revealed in simulations of the lac operon.

    Directory of Open Access Journals (Sweden)

    Luke Czapla

    Full Text Available The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

  7. A four-gene operon in Bacillus cereus produces two rare spore-decorating sugars.

    Science.gov (United States)

    Li, Zi; Mukherjee, Thiya; Bowler, Kyle; Namdari, Sholeh; Snow, Zachary; Prestridge, Sarah; Carlton, Alexandra; Bar-Peled, Maor

    2017-05-05

    Bacterial glycan structures on cell surfaces are critical for cell-cell recognition and adhesion and in host-pathogen interactions. Accordingly, unraveling the sugar composition of bacterial cell surfaces can shed light on bacterial growth and pathogenesis. Here, we found that two rare sugars with a 3- C -methyl-6-deoxyhexose structure were linked to spore glycans in Bacillus cereus ATCC 14579 and ATCC 10876. Moreover, we identified a four-gene operon in B. cereus ATCC 14579 that encodes proteins with the following sequential enzyme activities as determined by mass spectrometry and one- and two-dimensional NMR methods: CTP:glucose-1-phosphate cytidylyltransferase, CDP-Glc 4,6-dehydratase, NADH-dependent SAM: C -methyltransferase, and NADPH-dependent CDP-3- C -methyl-6-deoxyhexose 4-reductase. The last enzyme predominantly yielded CDP-3- C -methyl-6-deoxygulose (CDP-cereose) and likely generated a 4-epimer CDP-3- C -methyl-6-deoxyallose (CDP-cillose). Some members of the B. cereus sensu lato group produce CDP-3- C -methyl-6-deoxy sugars for the formation of cereose-containing glycans on spores, whereas others such as Bacillus anthracis do not. Gene knockouts of the Bacillus C -methyltransferase and the 4-reductase confirmed their involvement in the formation of cereose-containing glycan on B. cereus spores. We also found that cereose represented 0.2-1% spore dry weight. Moreover, mutants lacking cereose germinated faster than the wild type, yet the mutants exhibited no changes in sporulation or spore resistance to heat. The findings reported here may provide new insights into the roles of the uncommon 3- C -methyl-6-deoxy sugars in cell-surface recognition and host-pathogen interactions of the genus Bacillus . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Identification of the Staphylococcus aureus vfrAB operon, a novel virulence factor regulatory locus.

    Science.gov (United States)

    Bose, Jeffrey L; Daly, Seth M; Hall, Pamela R; Bayles, Kenneth W

    2014-05-01

    During a screen of the Nebraska Transposon Mutant Library, we identified 71 mutations in the Staphylococcus aureus genome that altered hemolysis on blood agar medium. Although many of these mutations disrupted genes known to affect the production of alpha-hemolysin, two of them were associated with an apparent operon, designated vfrAB, that had not been characterized previously. Interestingly, a ΔvfrB mutant exhibited only minor effects on the transcription of the hla gene, encoding alpha-hemolysin, when grown in broth, as well as on RNAIII, a posttranscriptional regulatory RNA important for alpha-hemolysin translation, suggesting that VfrB may function at the posttranscriptional level. Indeed, a ΔvfrB mutant had increased aur and sspAB protease expression under these conditions. However, disruption of the known secreted proteases in the ΔvfrB mutant did not restore hemolytic activity in the ΔvfrB mutant on blood agar. Further analysis revealed that, in contrast to the minor effects of VfrB on hla transcription when strains were cultured in liquid media, the level of hla transcription was decreased 50-fold in the absence of VfrB on solid media. These results demonstrate that while VfrB represses protease expression when strains are grown in broth, hla regulation is highly responsive to factors associated with growth on solid media. Intriguingly, the ΔvfrB mutant displayed increased pathogenesis in a model of S. aureus dermonecrosis, further highlighting the complexity of VfrB-dependent virulence regulation. The results of this study describe a phenotype associated with a class of highly conserved yet uncharacterized proteins found in Gram-positive bacteria, and they shed new light on the regulation of virulence factors necessary for S. aureus pathogenesis.

  9. Untangling the transcription regulatory network of the bacitracin synthase operon in Bacillus licheniformis DW2.

    Science.gov (United States)

    Wang, Dong; Wang, Qin; Qiu, Yimin; Nomura, Christopher T; Li, Junhui; Chen, Shouwen

    The bacitracin synthetase gene cluster in Bacillus licheniformis DW2 is composed of the bacABC operon encoding a non-ribosomal peptide synthetase and bacT encoding a thioesterase. Although the bacitracin gene cluster has been well studied, little is known about how this gene cluster is regulated. This study provides insight into how the transcription factors Spo0A and AbrB regulate bacitracin biosynthesis. Deletion of spo0A resulted in drastically reduced expression of bacA and bacT, and subsequently bacitracin production. On the other hand, the expression of bacA and bacT increased significantly in B. licheniformis DW2ΔabrB and DW2Δ0AΔabrB compared to the wild-type strain DW2. The bacitracin yields on cell numbers (U/CFU) in DW2ΔabrB and DW2Δ0A/pHY300-0A-sad67 were 17.5% and 14.9% higher than that of the wild-type strain. An electrophoretic mobility shift assay (EMSA) further confirmed that AbrB could directly bind to the promoter regions of bacA and bacT. These results indicate that AbrB acts as a repressor of bacitracin biosynthesis by inhibiting bacA and bacT expression, while Spo0A indirectly promotes bacitracin biosynthesis by repressing abrB expression. Copyright © 2017 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  10. Interplay of protein and DNA structure revealed in simulations of the lac operon.

    Science.gov (United States)

    Czapla, Luke; Grosner, Michael A; Swigon, David; Olson, Wilma K

    2013-01-01

    The E. coli Lac repressor is the classic textbook example of a protein that attaches to widely spaced sites along a genome and forces the intervening DNA into a loop. The short loops implicated in the regulation of the lac operon suggest the involvement of factors other than DNA and repressor in gene control. The molecular simulations presented here examine two likely structural contributions to the in-vivo looping of bacterial DNA: the distortions of the double helix introduced upon association of the highly abundant, nonspecific nucleoid protein HU and the large-scale deformations of the repressor detected in low-resolution experiments. The computations take account of the three-dimensional arrangements of nucleotides and amino acids found in crystal structures of DNA with the two proteins, the natural rest state and deformational properties of protein-free DNA, and the constraints on looping imposed by the conformation of the repressor and the orientation of bound DNA. The predicted looping propensities capture the complex, chain-length-dependent variation in repression efficacy extracted from gene expression studies and in vitro experiments and reveal unexpected chain-length-dependent variations in the uptake of HU, the deformation of repressor, and the folding of DNA. Both the opening of repressor and the presence of HU, at levels approximating those found in vivo, enhance the probability of loop formation. HU affects the global organization of the repressor and the opening of repressor influences the levels of HU binding to DNA. The length of the loop determines whether the DNA adopts antiparallel or parallel orientations on the repressor, whether the repressor is opened or closed, and how many HU molecules bind to the loop. The collective behavior of proteins and DNA is greater than the sum of the parts and hints of ways in which multiple proteins may coordinate the packaging and processing of genetic information.

  11. Phylogenetic analysis of the lux operon distinguishes two evolutionarily distinct clades of Photobacterium leiognathi.

    Science.gov (United States)

    Ast, Jennifer C; Dunlap, Paul V

    2004-05-01

    The luminous marine bacterium Photobacterium mandapamensis was synonymized several years ago with Photobacterium leiognathi based on a high degree of phenotypic and genetic similarity. To test the possibility that P. leiognathi as now formulated, however, actually contains two distinct bacterial groups reflecting the earlier identification of P. mandapamensis and P. leiognathi as separate species, we compared P. leiognathi strains isolated from light-organ symbiosis with leiognathid fishes (i.e., ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1) with strains from seawater originally described as P. mandapamensis and later synonymized as P. leiognathi (i.e., ATCC 27561(T) and ATCC 33981) and certain strains initially identified as P. leiognathi (i.e., PL-721, PL-741, 554). Analysis of the 16S rRNA and gyrB genes did not resolve distinct clades, affirming a close relationship among these strains. However, strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 were found to bear a luxF gene in the lux operon ( luxABFE), whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 lack this gene ( luxABE). Phylogenetic analysis of the luxAB(F)E region confirmed this distinction. Furthermore, ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554 all produced a higher level of luminescence on high-salt medium, as previously described for PL-721, whereas ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1 all produced a higher level of luminescence on low-salt medium, a characteristic of P. leiognathi from leiognathid fish light organs. These results demonstrate that P. leiognathi contains two evolutionarily and phenotypically distinct clades, P. leiognathi subsp. leiognathi (strains ATCC 25521(T), ATCC 25587, lequu.1.1 and lleuc.1.1), and P. leiognathi subsp. mandapamensis (strains ATCC 27561(T), ATCC 33981, PL-721, PL-741 and 554).

  12. The cabABC Operon Essential for Biofilm and Rugose Colony Development in Vibrio vulnificus.

    Directory of Open Access Journals (Sweden)

    Jin Hwan Park

    2015-09-01

    Full Text Available A transcriptome analysis identified Vibrio vulnificus cabABC genes which were preferentially expressed in biofilms. The cabABC genes were transcribed as a single operon. The cabA gene was induced by elevated 3',5'-cyclic diguanylic acid (c-di-GMP and encoded a calcium-binding protein CabA. Comparison of the biofilms produced by the cabA mutant and its parent strain JN111 in microtiter plates using crystal-violet staining demonstrated that CabA contributed to biofilm formation in a calcium-dependent manner under elevated c-di-GMP conditions. Genetic and biochemical analyses revealed that CabA was secreted to the cell exterior through functional CabB and CabC, distributed throughout the biofilm matrix, and produced as the biofilm matured. These results, together with the observation that CabA also contributes to the development of rugose colony morphology, indicated that CabA is a matrix-associated protein required for maturation, rather than adhesion involved in the initial attachment, of biofilms. Microscopic comparison of the structure of biofilms produced by JN111 and the cabA mutant demonstrated that CabA is an extracellular matrix component essential for the development of the mature biofilm structures in flow cells and on oyster shells. Exogenously providing purified CabA restored the biofilm- and rugose colony-forming abilities of the cabA mutant when calcium was available. Circular dichroism and size exclusion analyses revealed that calcium binding induces CabA conformational changes which may lead to multimerization. Extracellular complementation experiments revealed that CabA can assemble a functional matrix only when exopolysaccharides coexist. Consequently, the combined results suggested that CabA is a structural protein of the extracellular matrix and multimerizes to a conformation functional in building robust biofilms, which may render V. vulnificus to survive in hostile environments and reach a concentrated infective dose.

  13. De hand van Romme. C.P.M. Romme als staatkundig hoofdredacteur van De Volkskrant (1945-1952

    Directory of Open Access Journals (Sweden)

    M. Broersma

    2000-01-01

    Full Text Available Romme's hand: The politician C.P.M. Romme as editor-in-chief of the 'De Volkskrant' (1945-1952Between 1945 and 1953, C.P.M. Romme held two posts simultaneously; he was both the political leader of the Katholieke Volkspartij (KVP and editor-in-chief of the newspaper 'De Volkskrant'. Many assumptions have been made about this joint position, mostly by theorists and researchers into the subject of 'pillarization'. However, Romme's actual influence on the content of the 'Volkskrant' has not yet been properly researched. This article explores the role that Romme the politician played during his editorship of the 'Volkskrant'. It aims to show how Romme used the newspaper to attain his political goals; especially with regard to maintaining Catholic political unity and social solidarity. He wrote leading articles to influence public opinion, acted in a censorial capacity and invited journalists and political supporters to contribute articles that supported his own views. In 1952, the owner of the newspaper, the 'Katholieke Arbeidersbeweging' (The Trade Union for Catholics, forced Romme to resign. Ironically, it was a conflict about maintaining Catholic political unity - Romme's main political goal – that ultimately led to his resignation.

  14. Variability of rRNA Operon Copy Number and Growth Rate Dynamics of Bacillus Isolated from an Extremely Oligotrophic Aquatic Ecosystem

    Science.gov (United States)

    Valdivia-Anistro, Jorge A.; Eguiarte-Fruns, Luis E.; Delgado-Sapién, Gabriela; Márquez-Zacarías, Pedro; Gasca-Pineda, Jaime; Learned, Jennifer; Elser, James J.; Olmedo-Alvarez, Gabriela; Souza, Valeria

    2016-01-01

    The ribosomal RNA (rrn) operon is a key suite of genes related to the production of protein synthesis machinery and thus to bacterial growth physiology. Experimental evidence has suggested an intrinsic relationship between the number of copies of this operon and environmental resource availability, especially the availability of phosphorus (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic ecosystem that contains an unusually high microbial diversity that is able to persist under highly oligotrophic conditions. These environmental conditions impose a variety of strong selective pressures that shape the genome dynamics of their inhabitants. The genus Bacillus is one of the most abundant cultivable bacterial groups in the CCB and usually possesses a relatively large number of rrn operon copies (6–15 copies). The main goal of this study was to analyze the variation in the number of rrn operon copies of Bacillus in the CCB and to assess their growth-related properties as well as their stoichiometric balance (N and P content). We defined 18 phylogenetic groups within the Bacilli clade and documented a range of from six to 14 copies of the rrn operon. The growth dynamic of these Bacilli was heterogeneous and did not show a direct relation to the number of operon copies. Physiologically, our results were not consistent with the Growth Rate Hypothesis, since the copies of the rrn operon were decoupled from growth rate. However, we speculate that the diversity of the growth properties of these Bacilli as well as the low P content of their cells in an ample range of rrn copy number is an adaptive response to oligotrophy of the CCB and could represent an ecological mechanism that allows these taxa to coexist. These findings increase the knowledge of the variability in the number of copies of the rrn operon in the genus Bacillus and give insights about the

  15. Comparison of expression, purification and characterization of a new pectate lyase from Phytophthora capsici using two different methods

    Directory of Open Access Journals (Sweden)

    Zhang Xiuguo

    2011-04-01

    Full Text Available Abstract Background Pectate lyases (PELs play an important role in the infection process of plant pathogens and also have a commercial significance in industrial applications. Most of the PELs were expressed as soluble recombinant proteins, while a few recombinant proteins were insoluble. The production of a large-scale soluble recombinant PEL would allow not only a more detailed structural and functional characterization of this enzyme but also may have important applications in the food industry. Results We cloned a new pectate lyase gene (Pcpel2 from Phytophthora capsici. Pcpel2 was constructed by pET system and pMAL system, and both constructs were used to express the PCPEL2 in Escherichia coli BL21 (DE3 pLysS. The expressed products were purified using affinity chromatography and gel filtration chromatography. The purity, specific activity and pathogenicity of the purified PCPEL2 expressed by the pMAL system were higher than the purified PCPEL2 expressed by the pET system. In addition, some other characteristics of the purified PCPEL2 differed from the two systems, such as crystallographic features. Purified PCPEL2 expressed by the pMAL system was crystallized by the hanging-drop vapour-diffusion method at 289 K, and initial crystals were grown. Conclusion The two different methods and comparison presented here would be highly valuable in obtaining an ideal enzyme for the downstream experiments, and supply an useful alternative to purify some insoluble recombinant proteins.

  16. Structural Snapshots of an Engineered Cystathionine-γ-lyase Reveal the Critical Role of Electrostatic Interactions in the Active Site

    Energy Technology Data Exchange (ETDEWEB)

    Yan, Wupeng; Stone, Everett; Zhang, Yan Jessie

    2017-02-01

    Enzyme therapeutics that can degrade l-methionine (l-Met) are of great interest as numerous malignancies are exquisitely sensitive to l-Met depletion. To exhaust the pool of methionine in human serum, we previously engineered an l-Met-degrading enzyme based on the human cystathionine-γ-lyase scaffold (hCGL-NLV) to circumvent immunogenicity and stability issues observed in the preclinical application of bacterially derived methionine-γ-lyases. To gain further insights into the structure–activity relationships governing the chemistry of the hCGL-NLV lead molecule, we undertook a biophysical characterization campaign that captured crystal structures (2.2 Å) of hCGL-NLV with distinct reaction intermediates, including internal aldimine, substrate-bound, gem-diamine, and external aldimine forms. Curiously, an alternate form of hCGL-NLV that crystallized under higher-salt conditions revealed a locally unfolded active site, correlating with inhibition of activity as a function of ionic strength. Subsequent mutational and kinetic experiments pinpointed that a salt bridge between the phosphate of the essential cofactor pyridoxal 5'-phosphate (PLP) and residue R62 plays an important role in catalyzing β- and γ-eliminations. Our study suggests that solvent ions such as NaCl disrupt electrostatic interactions between R62 and PLP, decreasing catalytic efficiency.

  17. The effect of cadmium on phenylalanine ammonia lyase activity and lipid peroxidation in pepper (Capsicum annuum L. seedlings

    Directory of Open Access Journals (Sweden)

    Esra Koç

    2015-04-01

    Full Text Available In this study, the effect on differrent concentrations (20, 40, 80µM ve 100 µM CdCl2 of cadmium (CdCl2 on the activity of phenylalanine ammonia-lyase (PAL and lipid peroxidation amount in leaf and stem of Kahramanmaraş- Hot (Capsicum annum L. pepper seedlings were researched. Activity of phenylalanine ammonia-lyase (PAL, the first enzyme in the phenylpropanoid biosynthetic pathway, was increased at 2 and 4 days in KM-Hot plants exposed to CdCl2 stress. The highest PAL activity was detected in 20 μM CdCl2 application, on the four day after the application in the leaves of KM-Hot pepper. Moreover, it was observed that treatment of pepper with Cd led to an increased the rate of lipid peroxidation (which is indicated by increasing MDA content in the leaf and stem tissues. The highest MDA content was detected in 80 μM CdCl2 application, on the four day after the application in the leaf tissues. These results suggest that the activation of PAL may be associated with increased production of MDA

  18. The use of a hands-on model in learning the regulation of an inducible operon and the development of a gene regulation concept inventory

    Science.gov (United States)

    Stefanski, Katherine M.

    A central concept in genetics is the regulation of gene expression. Inducible gene expression is often taught in undergraduate biology courses using the lac operon of Escherichia coli (E. coli ). With national calls for reform in undergraduate biology education and a body of literature that supports the use of active learning techniques including hands-on learning and analogies we were motivated to develop a hands-on analogous model of the lac operon. The model was developed over two iterations and was administered to genetics students. To determine the model's worth as a learning tool a concept inventory (CI) was developed using rigorous protocols. Concept inventories are valuable tools which can be used to assess students' understanding of a topic and pinpoint commonly held misconceptions as well as the value of educational tools. Through in-class testing (n =115) the lac operon concept inventory (LOCI) was demonstrated to be valid, predictive, and reliable (? coefficient = 0.994). LOCI scores for students who participated in the hands-on activity (n = 67) were 7.5% higher (t = -2.281, P operon. We were able to determine the efficacy of the activity and identify misconceptions held by students about the lac operon because of the use of a valid and reliable CI.

  19. HosA, a MarR Family Transcriptional Regulator, Represses Nonoxidative Hydroxyarylic Acid Decarboxylase Operon and Is Modulated by 4-Hydroxybenzoic Acid.

    Science.gov (United States)

    Roy, Ajit; Ranjan, Akash

    2016-02-23

    Members of the Multiple antibiotic resistance Regulator (MarR) family of DNA binding proteins regulate transcription of a wide array of genes required for virulence and pathogenicity of bacteria. The present study reports the molecular characterization of HosA (Homologue of SlyA), a MarR protein, with respect to its target gene, DNA recognition motif, and nature of its ligand. Through a comparative genomics approach, we demonstrate that hosA is in synteny with nonoxidative hydroxyarylic acid decarboxylase (HAD) operon and is present exclusively within the mutS-rpoS polymorphic region in nine different genera of Enterobacteriaceae family. Using molecular biology and biochemical approach, we demonstrate that HosA binds to a palindromic sequence downstream to the transcription start site of divergently transcribed nonoxidative HAD operon and represses its expression. Furthermore, in silico analysis showed that the recognition motif for HosA is highly conserved in the upstream region of divergently transcribed operon in different genera of Enterobacteriaceae family. A systematic chemical search for the physiological ligand revealed that 4-hydroxybenzoic acid (4-HBA) interacts with HosA and derepresses HosA mediated repression of the nonoxidative HAD operon. Based on our study, we propose a model for molecular mechanism underlying the regulation of nonoxidative HAD operon by HosA in Enterobacteriaceae family.

  20. Cell differentiation during sexual development of the fungus Sordaria macrospora requires ATP citrate lyase activity.

    Science.gov (United States)

    Nowrousian, M; Masloff, S; Pöggeler, S; Kück, U

    1999-01-01

    During sexual development, mycelial cells from most filamentous fungi differentiate into typical fruiting bodies. Here, we describe the isolation and characterization of the Sordaria macrospora developmental mutant per5, which exhibits a sterile phenotype with defects in fruiting body maturation. Cytological investigations revealed that the mutant strain forms only ascus precursors without any mature spores. Using an indexed cosmid library, we were able to complement the mutant to fertility by DNA-mediated transformation. A single cosmid clone, carrying a 3.5-kb region able to complement the mutant phenotype, has been identified. Sequencing of the 3.5-kb region revealed an open reading frame of 2.1 kb interrupted by a 66-bp intron. The predicted polypeptide (674 amino acids) shows significant homology to eukaryotic ATP citrate lyases (ACLs), with 62 to 65% amino acid identity, and the gene was named acl1. The molecular mass of the S. macrospora ACL1 polypeptide is 73 kDa, as was verified by Western blot analysis with a hemagglutinin (HA) epitope-tagged ACL1 polypeptide. Immunological in situ detection of the HA-tagged polypeptide demonstrated that ACL is located within the cytosol. Sequencing of the mutant acl1 gene revealed a 1-nucleotide transition within the coding region, resulting in an amino acid substitution within the predicted polypeptide. Further evidence that ACL1 is essential for fruiting body maturation comes from experiments in which truncated and mutated versions of the acl1 gene were used for transformation. None of these copies was able to reconstitute the fertile phenotype in transformed per5 recipient strains. ACLs are usually involved in the formation of cytosolic acetyl coenzyme A (acetyl-CoA), which is used for the biosynthesis of fatty acids and sterols. Protein extracts from the mutant strain showed a drastic reduction in enzymatic activity compared to values obtained from the wild-type strain. Investigation of the time course of ACL

  1. Structural And Biochemical Characterization of the Therapeutic A. Variabilis Phenylalanine Ammonia Lyase

    Energy Technology Data Exchange (ETDEWEB)

    Wang, L.; Gamez, A.; Archer, H.; Abola, E.E.; Sarkissian, C.N.; Fitzpatrick, P.; Wendt, D.; Zhang, Y.; Vellard, M.; Bliesath, J.; Bell, S.; Lemont, J.; Scriver, C.R.; Stevens, R.C.

    2009-05-26

    We have recently observed promising success in a mouse model for treating the metabolic disorder phenylketonuria with phenylalanine ammonia lyase (PAL) from Rhodosporidium toruloides and Anabaena variabilis. Both molecules, however, required further optimization in order to overcome problems with protease susceptibility, thermal stability, and aggregation. Previously, we optimized PAL from R. toruloides, and in this case we reduced aggregation of the A. variabilis PAL by mutating two surface cysteine residues (C503 and C565) to serines. Additionally, we report the structural and biochemical characterization of the A. variabilis PAL C503S/C565S double mutant and carefully compare this molecule with the R. toruloides engineered PAL molecule. Unlike previously published PAL structures, significant electron density is observed for the two active-site loops in the A. variabilis C503S/C565S double mutant, yielding a complete view of the active site. Docking studies and N-hydroxysuccinimide-biotin binding studies support a proposed mechanism in which the amino group of the phenylalanine substrate is attacked directly by the 4-methylidene-imidazole-5-one prosthetic group. We propose a helix-to-loop conformational switch in the helices flanking the inner active-site loop that regulates accessibility of the active site. Differences in loop stability among PAL homologs may explain the observed variation in enzyme efficiency, despite the highly conserved structure of the active site. A. variabilis C503S/C565S PAL is shown to be both more thermally stable and more resistant to proteolytic cleavage than R. toruloides PAL. Additional increases in thermal stability and protease resistance upon ligand binding may be due to enhanced interactions among the residues of the active site, possibly locking the active-site structure in place and stabilizing the tetramer. Examination of the A. variabilis C503S/C565S PAL structure, combined with analysis of its physical properties, provides

  2. Mode of action of pectin lyase A of Aspergillus niger on differently C(6)-substituted oligogalacturonides.

    Science.gov (United States)

    van Alebeek, Gert-Jan W M; Christensen, Tove M I E; Schols, Henk A; Mikkelsen, Jørn D; Voragen, Alphons G J

    2002-07-19

    A thorough investigation of the mode of action of Aspergillus niger (4M-147) pectin lyase A (PLA) on differently C(6)-substituted oligogalacturonides is described. PLA appeared to be very specific for fully methyl-esterified oligogalacturonides: removal of the methyl-ester or changing the type of ester (ethyl esterification) or transamidation resulted in (almost) complete loss of conversion. The PLA activity increased with increasing length of the substrate up to a degree of polymerization (DP) of 8 indicating the presence of at least eight subsites on the enzyme. Product analysis demonstrated the formation of several Delta 4,5 unsaturated products and their saturated counterparts. The Delta 4,5 unsaturated trimer was the main product up to DP 8. For DP 9 and 10 Delta 4,5 unsaturated tetramer was the major product. Based upon the bond cleavage frequencies, a provisional subsite map was calculated, which supports the presence of eight subsites. By limited alkaline de-esterification of fully methyl-esterified pentamer and hexamer two sets of partially methyl-esterified pentamers (x and y methyl groups) and hexamers (a and b methyl groups) were prepared. Matrix-assisted laser desorption/ionization time of flight mass spectroscopy (MALDI-TOF MS) analysis demonstrated that the methyl-ester distribution was fully random. Using these partially methyl-esterified oligogalacturonides as substrates for PLA a 10-fold decrease in reaction rate was recorded compared with the fully methyl-esterified counterparts. Analysis of the methyl-ester distribution of the products showed that PLA tolerates carboxyl groups in the substrate binding cleft. At either subsite +2, +4, or -1 to -4 a free carboxyl group could be tolerated, whereas methyl-esters were obligatory at subsite +1 and +3. So PLA is capable to cleave the bond between a methyl-esterified and a non-esterified galacturonic acid residue, where the newly formed Delta 4,5 unsaturated non-reducing end residue always contains a

  3. Long-range transcriptional control of an operon necessary for virulence-critical ESX-1 secretion in Mycobacterium tuberculosis.

    Science.gov (United States)

    Hunt, Debbie M; Sweeney, Nathan P; Mori, Luisa; Whalan, Rachael H; Comas, Iñaki; Norman, Laura; Cortes, Teresa; Arnvig, Kristine B; Davis, Elaine O; Stapleton, Melanie R; Green, Jeffrey; Buxton, Roger S

    2012-05-01

    The ESX-1 secretion system of Mycobacterium tuberculosis has to be precisely regulated since the secreted proteins, although required for a successful virulent infection, are highly antigenic and their continued secretion would alert the immune system to the infection. The transcription of a five-gene operon containing espACD-Rv3613c-Rv3612c, which is required for ESX-1 secretion and is essential for virulence, was shown to be positively regulated by the EspR transcription factor. Thus, transcription from the start site, found to be located 67 bp upstream of espA, was dependent upon EspR enhancer-like sequences far upstream (between 884 and 1,004 bp), which we term the espA activating region (EAR). The EAR contains one of the known binding sites for EspR, providing the first in vivo evidence that transcriptional activation at the espA promoter occurs by EspR binding to the EAR and looping out DNA between this site and the promoter. Regulation of transcription of this operon thus takes place over long regions of the chromosome. This regulation may differ in some members of the M. tuberculosis complex, including Mycobacterium bovis, since deletions of the intergenic region have removed the upstream sequence containing the EAR, resulting in lowered espA expression. Consequent differences in expression of ESX-1 in these bacteria may contribute to their various pathologies and host ranges. The virulence-critical nature of this operon means that transcription factors controlling its expression are possible drug targets.

  4. Biofilm plasmids with a rhamnose operon are widely distributed determinants of the 'swim-or-stick' lifestyle in roseobacters.

    Science.gov (United States)

    Michael, Victoria; Frank, Oliver; Bartling, Pascal; Scheuner, Carmen; Göker, Markus; Brinkmann, Henner; Petersen, Jörn

    2016-10-01

    Alphaproteobacteria of the metabolically versatile Roseobacter group (Rhodobacteraceae) are abundant in marine ecosystems and represent dominant primary colonizers of submerged surfaces. Motility and attachment are the prerequisite for the characteristic 'swim-or-stick' lifestyle of many representatives such as Phaeobacter inhibens DSM 17395. It has recently been shown that plasmid curing of its 65-kb RepA-I-type replicon with >20 genes for exopolysaccharide biosynthesis including a rhamnose operon results in nearly complete loss of motility and biofilm formation. The current study is based on the assumption that homologous biofilm plasmids are widely distributed. We analyzed 33 roseobacters that represent the phylogenetic diversity of this lineage and documented attachment as well as swimming motility for 60% of the strains. All strong biofilm formers were also motile, which is in agreement with the proposed mechanism of surface attachment. We established transposon mutants for the four genes of the rhamnose operon from P. inhibens and proved its crucial role in biofilm formation. In the Roseobacter group, two-thirds of the predicted biofilm plasmids represent the RepA-I type and their physiological role was experimentally validated via plasmid curing for four additional strains. Horizontal transfer of these replicons was documented by a comparison of the RepA-I phylogeny with the species tree. A gene content analysis of 35 RepA-I plasmids revealed a core set of genes, including the rhamnose operon and a specific ABC transporter for polysaccharide export. Taken together, our data show that RepA-I-type biofilm plasmids are essential for the sessile mode of life in the majority of cultivated roseobacters.

  5. Dynamic in vivo mutations within the ica operon during persistence of Staphylococcus aureus in the airways of cystic fibrosis patients.

    Directory of Open Access Journals (Sweden)

    Bianca Schwartbeck

    2016-11-01

    Full Text Available Cystic fibrosis (CF is associated with chronic bacterial airway infections leading to lung insufficiency and decreased life expectancy. Staphylococcus aureus is one of the most prevalent pathogens isolated from the airways of CF patients. Mucoid colony morphology has been described for Pseudomonas aeruginosa, the most common pathogen in CF, but not for S. aureus. From the airways of 8 of 313 CF patients (2.5% mucoid S. aureus isolates (n = 115 were cultured with a mean persistence of 29 months (range 1 month, 126 months. In contrast to non-mucoid S. aureus, mucoid isolates were strong biofilm formers. The upstream region of the ica operon, which encodes the proteins responsible for the synthesis of the polysaccharide intercellular adhesin (PIA, of mucoid isolates was sequenced. Spa-types of mucoid and non-mucoid strains were identical, but differed between patients. Mucoid isolates carried a 5 bp deletion in the intergenic region between icaR and icaA. During long-term persistence, from two patients subsequent non-mucoid isolates (n = 12 with 5 bp deletions were cultured, which did not produce biofilm. Sequencing of the entire ica operon identified compensatory mutations in various ica-genes including icaA (n = 7, icaD (n = 3 and icaC (n = 2. Six sequential isolates of each of these two patients with non-mucoid and mucoid phenotypes were subjected to whole genome sequencing revealing a very close relationship of the individual patient's isolates. Transformation of strains with vectors expressing the respective wild-type genes restored mucoidy. In contrast to the non-mucoid phenotype, mucoid strains were protected against neutrophilic killing and survived better under starvation conditions. In conclusion, the special conditions present in CF airways seem to facilitate ongoing mutations in the ica operon during S. aureus persistence.

  6. Test-retest reliability of the novel 5-HT1B receptor PET radioligand [11C]P943

    International Nuclear Information System (INIS)

    Saricicek, Aybala; Chen, Jason; Ruf, Barbara; Planeta, Beata; Labaree, David; Gallezot, Jean-Dominique; Huang, Yiyun; Subramanyam, Kalyani; Maloney, Kathleen; Matuskey, David; Deserno, Lorenz; Neumeister, Alexander; Krystal, John H.; Carson, Richard E.; Bhagwagar, Zubin

    2015-01-01

    [ 11 C]P943 is a novel, highly selective 5-HT 1B PET radioligand. The aim of this study was to determine the test-retest reliability of [ 11 C]P943 using two different modeling methods and to perform a power analysis with each quantification technique. Seven healthy volunteers underwent two PET scans on the same day. Regions of interest (ROIs) were the amygdala, hippocampus, pallidum, putamen, insula, frontal, anterior cingulate, parietal, temporal and occipital cortices, and cerebellum. Two multilinear radioligand quantification techniques were used to estimate binding potential: MA1, using arterial input function data, and the second version of the multilinear reference tissue model analysis (MRTM2), using the cerebellum as the reference region. Between-scan percent variability and intraclass correlation coefficients (ICC) were used to assess test-retest reliability. We also performed power analyses to determine the method that would allow the least number of subjects using within-subject or between-subject study designs. A voxel-wise ICC analysis for MRTM2 BP ND was performed for the whole brain and all the ROIs studied. Mean percent variability between two scans across regions ranged between 0.4 % and 12.4 % for MA1 BP ND , 0.5 % and 11.5 % for MA1 BP P , 16.7 % and 28.3 % for MA1 BP F , and between 0.2 % and 5.4 % for MRTM2 BP ND . The power analyses showed a greater number of subjects were required using MA1 BP F compared with other outcome measures for both within-subject and between-subject study designs. ICC values were the highest using MRTM2 BP ND and the lowest with MA1 BP F in ten ROIs. Small regions and regions with low binding had lower ICC values than large regions and regions with high binding. Reliable measures of 5-HT 1B receptor binding can be obtained using the novel PET radioligand [ 11 C]P943. Quantification of 5-HT 1B receptor binding with MRTM2 BP ND and with MA1 BP P provided the least variability and optimal power for within-subject and

  7. Corrosion resistance of a new AL 6013-20 SiC(P) in salt spray chamber

    Science.gov (United States)

    Ahmad, Zaki; Aleem, B. J. Abdul

    2000-06-01

    Aluminum 6013 alloy (0.82Si, 0.95Mg, and 0.35Mn) is finding increasing usage in new aircraft designs, automotives, and structural applications due to its good stretch forming character in T4 temper (solution heat treated and naturally aged to a substantially stable conditions) compared to alloy 2024 (4.4Cu, 0.6Mn, 1.5Mg, and balance Al) and Al6061 (Si0.51 to 0.71, Fe0.35, Cu0.15, Mn0.85, Mg0.15, 0.25Cr, 0.15Zn, and balanced Al). The newly developed A1 6013 reinforced with 20 vol.% SiC(P) has a higher strength than its unreinforced counterpart. Whereas the corrosion behavior of A1 6013 has been reported in literature, there is no previous data on A1 6013 reinforced with SiC(P). A knowledge of the corrosion behavior of this alloy is crucial to its applications in aerospace, structural, and automotive industry. The first results of corrosion study of this alloy in 3.5 wt.% Na Cl in a salt spray chamber are presented. Three tempers F (as fabricated), O (annealed), and T4 (age hardened and stabilized at room temperature) of the alloy A1 6013-30 SiC(P) were exposed to environmental chamber in accordance with ASTM recommended practice. The corrosion rate of the alloy showed a decrease with increased exposure period and after 800 h of exposure no appreciable change in the rate of corrosion was observed. The lowest rate of corrosion (4.83 mdd) was shown by temper T4 followed by tempers F and O after 1200 h of exposure in the increasing order of corrosion rate. Fluctuations in the corrosion rate with time are related to the kinetics of growth and dissolution of Al(OH)3 film, which was detected by fourier transformation infrared (FTIR) spectroscopy (FTIS). The film was composed of an inner compact layer and outer bulk layer dependent on the refreshment rate from the bulk solution. Micrograph examination by scanning electron microscopy (SEM) showed the presence of pits covered by aluminum hydroxide gel, which isolates the pit from the bulk solution. The acidic conditions of

  8. The Small Protein HemP Is a Transcriptional Activator for the Hemin Uptake Operon in Burkholderia multivorans ATCC 17616.

    Science.gov (United States)

    Sato, Takuya; Nonoyama, Shouta; Kimura, Akane; Nagata, Yuji; Ohtsubo, Yoshiyuki; Tsuda, Masataka

    2017-08-15

    Iron and heme play very important roles in various metabolic functions in bacteria, and their intracellular homeostasis is maintained because high concentrations of free forms of these molecules greatly facilitate the Fenton reaction-mediated production of large amounts of reactive oxygen species that severely damage various biomolecules. The ferric uptake regulator (Fur) from Burkholderia multivorans ATCC 17616 is an iron-responsive global transcriptional regulator, and its fur deletant exhibits pleiotropic phenotypes. In this study, we found that the phenotypes of the fur deletant were suppressed by an additional mutation in hemP The transcription of hemP was negatively regulated by Fur under iron-replete conditions and was constitutive in the fur deletant. Growth of a hemP deletant was severely impaired in a medium containing hemin as the sole iron source, demonstrating the important role of HemP in hemin utilization. HemP was required as a transcriptional activator that specifically binds the promoter-containing region upstream of a Fur-repressive hmuRSTUV operon, which encodes the proteins for hemin uptake. A hmuR deletant was still able to grow using hemin as the sole iron source, albeit at a rate clearly lower than that of the wild-type strain. These results strongly suggested (i) the involvement of HmuR in hemin uptake and (ii) the presence in ATCC 17616 of at least part of other unknown hemin uptake systems whose expression depends on the HemP function. Our in vitro analysis also indicated high-affinity binding of HemP to hemin, and such a property might modulate transcriptional activation of the hmu operon. IMPORTANCE Although the hmuRSTUV genes for the utilization of hemin as a sole iron source have been identified in a few Burkholderia strains, the regulatory expression of these genes has remained unknown. Our analysis in this study using B. multivorans ATCC 17616 showed that its HemP protein is required for expression of the hmuRSTUV operon, and the

  9. First measurement of time-dependent $C\\!P$ violation in $B^0_s \\to K^+K^-$ decays

    CERN Document Server

    Aaij, R; Adinolfi, M; Adrover, C; Affolder, A; Ajaltouni, Z; Albrecht, J; Alessio, F; Alexander, M; Ali, S; Alkhazov, G; Alvarez Cartelle, P; Alves Jr, A A; Amato, S; Amerio, S; Amhis, Y; Anderlini, L; Anderson, J; Andreassen, R; Andrews, J E; Appleby, R B; Aquines Gutierrez, O; Archilli, F; Artamonov, A; Artuso, M; Aslanides, E; Auriemma, G; Baalouch, M; Bachmann, S; Back, J J; Baesso, C; Balagura, V; Baldini, W; Barlow, R J; Barschel, C; Barsuk, S; Barter, W; Bauer, Th; Bay, A; Beddow, J; Bedeschi, F; Bediaga, I; Belogurov, S; Belous, K; Belyaev, I; Ben-Haim, E; Bencivenni, G; Benson, S; Benton, J; Berezhnoy, A; Bernet, R; Bettler, M -O; van Beuzekom, M; Bien, A; Bifani, S; Bird, T; Bizzeti, A; Bjørnstad, P M; Blake, T; Blanc, F; Blouw, J; Blusk, S; Bocci, V; Bondar, A; Bondar, N; Bonivento, W; Borghi, S; Borgia, A; Bowcock, T J V; Bowen, E; Bozzi, C; Brambach, T; van den Brand, J; Bressieux, J; Brett, D; Britsch, M; Britton, T; Brook, N H; Brown, H; Burducea, I; Bursche, A; Busetto, G; Buytaert, J; Cadeddu, S; Callot, O; Calvi, M; Calvo Gomez, M; Camboni, A; Campana, P; Campora Perez, D; Carbone, A; Carboni, G; Cardinale, R; Cardini, A; Carranza-Mejia, H; Carson, L; Carvalho Akiba, K; Casse, G; Castillo Garcia, L; Cattaneo, M; Cauet, Ch; Cenci, R; Charles, M; Charpentier, Ph; Chen, P; Chiapolini, N; Chrzaszcz, M; Ciba, K; Cid Vidal, X; Ciezarek, G; Clarke, P E L; Clemencic, M; Cliff, H V; Closier, J; Coca, C; Coco, V; Cogan, J; Cogneras, E; Collins, P; Comerma-Montells, A; Contu, A; Cook, A; Coombes, M; Coquereau, S; Corti, G; Couturier, B; Cowan, G A; Cowie, E; Craik, D C; Cunliffe, S; Currie, R; D'Ambrosio, C; David, P; David, P N Y; Davis, A; De Bonis, I; De Bruyn, K; De Capua, S; De Cian, M; De Miranda, J M; De Paula, L; De Silva, W; De Simone, P; Decamp, D; Deckenhoff, M; Del Buono, L; Déléage, N; Derkach, D; Deschamps, O; Dettori, F; Di Canto, A; Dijkstra, H; Dogaru, M; Donleavy, S; Dordei, F; Dosil Suárez, A; Dossett, D; Dovbnya, A; Dupertuis, F; Durante, P; Dzhelyadin, R; Dziurda, A; Dzyuba, A; Easo, S; Egede, U; Egorychev, V; Eidelman, S; van Eijk, D; Eisenhardt, S; Eitschberger, U; Ekelhof, R; Eklund, L; El Rifai, I; Elsasser, Ch; Falabella, A; Färber, C; Fardell, G; Farinelli, C; Farry, S; Ferguson, D; Fernandez Albor, V; Ferreira Rodrigues, F; Ferro-Luzzi, M; Filippov, S; Fiore, M; Fitzpatrick, C; Fontana, M; Fontanelli, F; Forty, R; Francisco, O; Frank, M; Frei, C; Frosini, M; Furcas, S; Furfaro, E; Gallas Torreira, A; Galli, D; Gandelman, M; Gandini, P; Gao, Y; Garofoli, J; Garosi, P; Garra Tico, J; Garrido, L; Gaspar, C; Gauld, R; Gersabeck, E; Gersabeck, M; Gershon, T; Ghez, Ph; Gibson, V; Giubega, L; Gligorov, V V; Göbel, C; Golubkov, D; Golutvin, A; Gomes, A; Gorbounov, P; Gordon, H; Gotti, C; Grabalosa Gándara, M; Graciani Diaz, R; Granado Cardoso, L A; Graugés, E; Graziani, G; Grecu, A; Greening, E; Gregson, S; Griffith, P; Grünberg, O; Gui, B; Gushchin, E; Guz, Yu; Gys, T; Hadjivasiliou, C; Haefeli, G; Haen, C; Haines, S C; Hall, S; Hamilton, B; Hampson, T; Hansmann-Menzemer, S; Harnew, N; Harnew, S T; Harrison, J; Hartmann, T; He, J; Head, T; Heijne, V; Hennessy, K; Henrard, P; Hernando Morata, J A; van Herwijnen, E; Hess, M; Hicheur, A; Hicks, E; Hill, D; Hoballah, M; Hombach, C; Hopchev, P; Hulsbergen, W; Hunt, P; Huse, T; Hussain, N; Hutchcroft, D; Hynds, D; Iakovenko, V; Idzik, M; Ilten, P; Jacobsson, R; Jaeger, A; Jans, E; Jaton, P; Jawahery, A; Jing, F; John, M; Johnson, D; Jones, C R; Joram, C; Jost, B; Kaballo, M; Kandybei, S; Kanso, W; Karacson, M; Karbach, T M; Kenyon, I R; Ketel, T; Keune, A; Khanji, B; Kochebina, O; Komarov, I; Koopman, R F; Koppenburg, P; Korolev, M; Kozlinskiy, A; Kravchuk, L; Kreplin, K; Kreps, M; Krocker, G; Krokovny, P; Kruse, F; Kucharczyk, M; Kudryavtsev, V; Kurek, K; Kvaratskheliya, T; La Thi, V N; Lacarrere, D; Lafferty, G; Lai, A; Lambert, D; Lambert, R W; Lanciotti, E; Lanfranchi, G; Langenbruch, C; Latham, T; Lazzeroni, C; Le Gac, R; van Leerdam, J; Lees, J -P; Lefèvre, R; Leflat, A; Lefrançois, J; Leo, S; Leroy, O; Lesiak, T; Leverington, B; Li, Y; Li Gioi, L; Liles, M; Lindner, R; Linn, C; Liu, B; Liu, G; Lohn, S; Longstaff, I; Lopes, J H; Lopez-March, N; Lu, H; Lucchesi, D; Luisier, J; Luo, H; Machefert, F; Machikhiliyan, I V; Maciuc, F; Maev, O; Malde, S; Manca, G; Mancinelli, G; Maratas, J; Marconi, U; Marino, P; Märki, R; Marks, J; Martellotti, G; Martens, A; Martín Sánchez, A; Martinelli, M; Martinez Santos, D; Martins Tostes, D; Martynov, A; Massafferri, A; Matev, R; Mathe, Z; Matteuzzi, C; Maurice, E; Mazurov, A; McCarthy, J; McNab, A; McNulty, R; McSkelly, B; Meadows, B; Meier, F; Meissner, M; Merk, M; Milanes, D A; Minard, M -N; Molina Rodriguez, J; Monteil, S; Moran, D; Morawski, P; Mordà, A; Morello, M J; Mountain, R; Mous, I; Muheim, F; Müller, K; Muresan, R; Muryn, B; Muster, B; Naik, P; Nakada, T; Nandakumar, R; Nasteva, I; Needham, M; Neubert, S; Neufeld, N; Nguyen, A D; Nguyen, T D; Nguyen-Mau, C; Nicol, M; Niess, V; Niet, R; Nikitin, N; Nikodem, T; Nomerotski, A; Novoselov, A; Oblakowska-Mucha, A; Obraztsov, V; Oggero, S; Ogilvy, S; Okhrimenko, O; Oldeman, R; Orlandea, M; Otalora Goicochea, J M; Owen, P; Oyanguren, A; Pal, B K; Palano, A; Palczewski, T; Palutan, M; Panman, J; Papanestis, A; Pappagallo, M; Parkes, C; Parkinson, C J; Passaleva, G; Patel, G D; Patel, M; Patrick, G N; Patrignani, C; Pavel-Nicorescu, C; Pazos Alvarez, A; Pellegrino, A; Penso, G; Pepe Altarelli, M; Perazzini, S; Perez Trigo, E; Pérez-Calero Yzquierdo, A; Perret, P; Perrin-Terrin, M; Pescatore, L; Pesen, E; Petridis, K; Petrolini, A; Phan, A; Picatoste Olloqui, E; Pietrzyk, B; Pilař, T; Pinci, D; Playfer, S; Plo Casasus, M; Polci, F; Polok, G; Poluektov, A; Polycarpo, E; Popov, A; Popov, D; Popovici, B; Potterat, C; Powell, A; Prisciandaro, J; Pritchard, A; Prouve, C; Pugatch, V; Puig Navarro, A; Punzi, G; Qian, W; Rademacker, J H; Rakotomiaramanana, B; Rangel, M S; Raniuk, I; Rauschmayr, N; Raven, G; Redford, S; Reid, M M; dos Reis, A C; Ricciardi, S; Richards, A; Rinnert, K; Rives Molina, V; Roa Romero, D A; Robbe, P; Roberts, D A; Rodrigues, E; Rodriguez Perez, P; Roiser, S; Romanovsky, V; Romero Vidal, A; Rouvinet, J; Ruf, T; Ruffini, F; Ruiz, H; Ruiz Valls, P; Sabatino, G; Saborido Silva, J J; Sagidova, N; Sail, P; Saitta, B; Salustino Guimaraes, V; Sanmartin Sedes, B; Sannino, M; Santacesaria, R; Santamarina Rios, C; Santovetti, E; Sapunov, M; Sarti, A; Satriano, C; Satta, A; Savrie, M; Savrina, D; Schaack, P; Schiller, M; Schindler, H; Schlupp, M; Schmelling, M; Schmidt, B; Schneider, O; Schopper, A; Schune, M -H; Schwemmer, R; Sciascia, B; Sciubba, A; Seco, M; Semennikov, A; Senderowska, K; Sepp, I; Serra, N; Serrano, J; Seyfert, P; Shapkin, M; Shapoval, I; Shatalov, P; Shcheglov, Y; Shears, T; Shekhtman, L; Shevchenko, O; Shevchenko, V; Shires, A; Silva Coutinho, R; Sirendi, M; Skidmore, N; Skwarnicki, T; Smith, N A; Smith, E; Smith, J; Smith, M; Sokoloff, M D; Soler, F J P; Soomro, F; Souza, D; Souza De Paula, B; Spaan, B; Sparkes, A; Spradlin, P; Stagni, F; Stahl, S; Steinkamp, O; Stevenson, S; Stoica, S; Stone, S; Storaci, B; Straticiuc, M; Straumann, U; Subbiah, V K; Sun, L; Swientek, S; Syropoulos, V; Szczekowski, M; Szczypka, P; Szumlak, T; T'Jampens, S; Teklishyn, M; Teodorescu, E; Teubert, F; Thomas, C; Thomas, E; van Tilburg, J; Tisserand, V; Tobin, M; Tolk, S; Tonelli, D; Topp-Joergensen, S; Torr, N; Tournefier, E; Tourneur, S; Tran, M T; Tresch, M; Tsaregorodtsev, A; Tsopelas, P; Tuning, N; Ubeda Garcia, M; Ukleja, A; Urner, D; Ustyuzhanin, A; Uwer, U; Vagnoni, V; Valenti, G; Vallier, A; Van Dijk, M; Vazquez Gomez, R; Vazquez Regueiro, P; Vázquez Sierra, C; Vecchi, S; Velthuis, J J; Veltri, M; Veneziano, G; Vesterinen, M; Viaud, B; Vieira, D; Vilasis-Cardona, X; Vollhardt, A; Volyanskyy, D; Voong, D; Vorobyev, A; Vorobyev, V; Voß, C; Voss, H; Waldi, R; Wallace, C; Wallace, R; Wandernoth, S; Wang, J; Ward, D R; Watson, N K; Webber, A D; Websdale, D; Whitehead, M; Wicht, J; Wiechczynski, J; Wiedner, D; Wiggers, L; Wilkinson, G; Williams, M P; Williams, M; Wilson, F F; Wimberley, J; Wishahi, J; Wislicki, W; Witek, M; Wotton, S A; Wright, S; Wu, S; Wyllie, K; Xie, Y; Xing, Z; Yang, Z; Young, R; Yuan, X; Yushchenko, O; Zangoli, M; Zavertyaev, M; Zhang, F; Zhang, L; Zhang, W C; Zhang, Y; Zhelezov, A; Zhokhov, A; Zhong, L; Zvyagin, A

    2013-01-01

    Direct and mixing-induced $C\\!P$-violating asymmetries in $B^0_s \\to K^+K^-$ decays are measured for the first time using a data sample of $pp$ collisions, corresponding to an integrated luminosity of $1.0~\\mathrm{fb}^{-1}$, collected with the LHCb detector at a centre-of-mass energy of $7~\\mathrm{TeV}$. The results are $C_{KK} = 0.14 \\pm 0.11 \\pm 0.03$ and $S_{KK} = 0.30 \\pm 0.12 \\pm 0.04$, where the first uncertainties are statistical and the second systematic. The corresponding quantities are also determined for $B^0 \\to \\pi^+\\pi^-$ decays to be $C_{\\pi\\pi} = -0.38 \\pm 0.15 \\pm 0.02$ and $S_{\\pi\\pi} = -0.71 \\pm 0.13 \\pm 0.02$, in good agreement with existing measurements.

  10. Calculation of astrophysical S-factor and reaction rate in 12C(p, γ)13N reaction

    Science.gov (United States)

    Moghadasi, A.; Sadeghi, H.; Pourimani, R.

    2018-02-01

    The 12C(p, γ)13N reaction is the first process in the CNO cycle. Also it is a source of low-energy solar neutrinos in various neutrino experiments. Therefore, it is of high interest to gain data of the astrophysical S-factor in low energies. By applying Faddeev's method, we calculated wave functions for the bound state of 13N. Then the cross sections for resonance and non-resonance were calculated through using Breit-Wigner and direct capture cross section formulae, respectively. After that, we calculated the total S-factor and compared it with previous experimental data, revealing a good agreement altogether. Then, we extrapolated the S-factor in zero energy and the result was 1.32 ± 0.19 (keV.b). In the end, we calculated reaction rate and compared it with NACRE data.

  11. Calculation of astrophysical S-factor in reaction ^{13}C(p,γ )^{14}N for first resonance levels

    Science.gov (United States)

    Moghadasi, A.; Sadeghi, H.; Pourimani, R.

    2018-01-01

    The ^{13}C(p,γ )^{14}N reaction is one of the important reactions in the CNO cycle, which is a key process in nucleosynthesis. We first calculated wave functions for the bound state of ^{14}N with Faddeev's method. In this method, the considered reaction components are ^{12}C+n+p. Then, by using direct capture cross section and Breit-Wigner formulae, the non-resonant and resonant cross sections were calculated, respectively. In the next step, we calculated the total S-factor and compared it with experimental data, which showed good agreement between them. Next, we extrapolated the S-factor for the transition to the ground state at zero energy and obtained S(0)=5.8 ± 0.7 (keV b) and then calculate reaction rate. These ones are in agreement with previous reported results.

  12. Designing 4H-SiC P-shielding trench gate MOSFET to optimize on-off electrical characteristics

    Science.gov (United States)

    Kyoung, Sinsu; Hong, Young-sung; Lee, Myung-hwan; Nam, Tae-jin

    2018-02-01

    In order to enhance specific on-resistance (Ron,sp), the trench gate structure was also introduced into 4H-SiC MOSFET as Si MOSFET. But the 4H-SiC trench gate has worse off-state characteristics than the Si trench gate due to the incomplete gate oxidation process (Šimonka et al., 2017). In order to overcome this problem, P-shielding trench gate MOSFET (TMOS) was proposed and researched in previous studies. But P-shielding has to be designed with minimum design rule in order to protect gate oxide effectively. P-shielding TMOS also has the drawback of on-state characteristics degradation corresponding to off state improvement for minimum design rule. Therefore optimized design is needed to satisfy both on and off characteristics. In this paper, the design parameters were analyzed and optimized so that the 4H-SiC P-shielding TMOS satisfies both on and off characteristics. Design limitations were proposed such that P-shielding is able to defend the gate oxide. The P-shielding layer should have the proper junction depth and concentration to defend the electric field to gate oxide during the off-state. However, overmuch P-shielding junction depth disturbs the on-state current flow, a problem which can be solved by increasing the trench depth. As trench depth increases, however, the breakdown voltage decreases. Therefore, trench depth should be designed with due consideration for on-off characteristics. For this, design conditions and modeling were proposed which allow P-shielding to operate without degradation of on-state characteristics. Based on this proposed model, the 1200 V 4H-SiC P-shielding trench gate MOSFET was designed and optimized.

  13. The replicative DNA polymerase of herpes simplex virus 1 exhibits apurinic/apyrimidinic and 5′-deoxyribose phosphate lyase activities

    Science.gov (United States)

    Bogani, Federica; Boehmer, Paul E.

    2008-01-01

    Base excision repair (BER) is essential for maintaining genome stability both to counter the accumulation of unusual bases and to protect from base loss in the DNA. Herpes simplex virus 1 (HSV-1) is a large dsDNA virus that encodes its own DNA replication machinery, including enzymes involved in nucleotide metabolism. We report on a replicative family B and a herpesvirus-encoded DNA Pol that possesses DNA lyase activity. We have discovered that the catalytic subunit of the HSV-1 DNA polymerase (Pol) (UL30) exhibits apurinic/apyrimidinic (AP) and 5′-deoxyribose phosphate (dRP) lyase activities. These activities are integral to BER and lead to DNA cleavage on the 3′ side of abasic sites and 5′-dRP residues that remain after cleavage by 5′-AP endonuclease. The UL30-catalyzed reaction occurs independently of divalent cation and proceeds via a Schiff base intermediate, indicating that it occurs via a lyase mechanism. Partial proteolysis of the Schiff base shows that the DNA lyase activity resides in the Pol domain of UL30. These observations together with the presence of a virus-encoded uracil DNA glycosylase indicates that HSV-1 has the capacity to perform critical steps in BER. These findings have implications on the role of BER in viral genome maintenance during lytic replication and reactivation from latency. PMID:18695225

  14. Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis

    Science.gov (United States)

    Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel

    2015-01-01

    The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. PMID:26150539

  15. Prediction of operon-like gene clusters in the Arabidopsis thaliana genome based on co-expression analysis of neighboring genes.

    Science.gov (United States)

    Wada, Masayoshi; Takahashi, Hiroki; Altaf-Ul-Amin, Md; Nakamura, Kensuke; Hirai, Masami Y; Ohta, Daisaku; Kanaya, Shigehiko

    2012-07-15

    Operon-like arrangements of genes occur in eukaryotes ranging from yeasts and filamentous fungi to nematodes, plants, and mammals. In plants, several examples of operon-like gene clusters involved in metabolic pathways have recently been characterized, e.g. the cyclic hydroxamic acid pathways in maize, the avenacin biosynthesis gene clusters in oat, the thalianol pathway in Arabidopsis thaliana, and the diterpenoid momilactone cluster in rice. Such operon-like gene clusters are defined by their co-regulation or neighboring positions within immediate vicinity of chromosomal regions. A comprehensive analysis of the expression of neighboring genes therefore accounts a crucial step to reveal the complete set of operon-like gene clusters within a genome. Genome-wide prediction of operon-like gene clusters should contribute to functional annotation efforts and provide novel insight into evolutionary aspects acquiring certain biological functions as well. We predicted co-expressed gene clusters by comparing the Pearson correlation coefficient of neighboring genes and randomly selected gene pairs, based on a statistical method that takes false discovery rate (FDR) into consideration for 1469 microarray gene expression datasets of A. thaliana. We estimated that A. thaliana contains 100 operon-like gene clusters in total. We predicted 34 statistically significant gene clusters consisting of 3 to 22 genes each, based on a stringent FDR threshold of 0.1. Functional relationships among genes in individual clusters were estimated by sequence similarity and functional annotation of genes. Duplicated gene pairs (determined based on BLAST with a cutoff of EOperon-like clusters tend to include genes encoding bio-machinery associated with ribosomes, the ubiquitin/proteasome system, secondary metabolic pathways, lipid and fatty-acid metabolism, and the lipid transfer system. Copyright © 2012 Elsevier B.V. All rights reserved.

  16. Evaluation of the Role of the opgGH Operon in Yersinia pseudotuberculosis and Its Deletion during the Emergence of Yersinia pestis.

    Science.gov (United States)

    Quintard, Kévin; Dewitte, Amélie; Reboul, Angéline; Madec, Edwige; Bontemps-Gallo, Sébastien; Dondeyne, Jacqueline; Marceau, Michaël; Simonet, Michel; Lacroix, Jean-Marie; Sebbane, Florent

    2015-09-01

    The opgGH operon encodes glucosyltransferases that synthesize osmoregulated periplasmic glucans (OPGs) from UDP-glucose, using acyl carrier protein (ACP) as a cofactor. OPGs are required for motility, biofilm formation, and virulence in various bacteria. OpgH also sequesters FtsZ in order to regulate cell size according to nutrient availability. Yersinia pestis (the agent of flea-borne plague) lost the opgGH operon during its emergence from the enteropathogen Yersinia pseudotuberculosis. When expressed in OPG-negative strains of Escherichia coli and Dickeya dadantii, opgGH from Y. pseudotuberculosis restored OPGs synthesis, motility, and virulence. However, Y. pseudotuberculosis did not produce OPGs (i) under various growth conditions or (ii) when overexpressing its opgGH operon, its galUF operon (governing UDP-glucose), or the opgGH operon or Acp from E. coli. A ΔopgGH Y. pseudotuberculosis strain showed normal motility, biofilm formation, resistance to polymyxin and macrophages, and virulence but was smaller. Consistently, Y. pestis was smaller than Y. pseudotuberculosis when cultured at ≥ 37°C, except when the plague bacillus expressed opgGH. Y. pestis expressing opgGH grew normally in serum and within macrophages and was fully virulent in mice, suggesting that small cell size was not advantageous in the mammalian host. Lastly, Y. pestis expressing opgGH was able to infect Xenopsylla cheopis fleas normally. Our results suggest an evolutionary scenario whereby an ancestral Yersinia strain lost a factor required for OPG biosynthesis but kept opgGH (to regulate cell size). The opgGH operon was presumably then lost because OpgH-dependent cell size control became unnecessary. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  17. Kynurenine aminotransferase III and glutamine transaminase L are identical enzymes that have cysteine S-conjugate β-lyase activity and can transaminate L-selenomethionine.

    Science.gov (United States)

    Pinto, John T; Krasnikov, Boris F; Alcutt, Steven; Jones, Melanie E; Dorai, Thambi; Villar, Maria T; Artigues, Antonio; Li, Jianyong; Cooper, Arthur J L

    2014-11-07

    Three of the four kynurenine aminotransferases (KAT I, II, and IV) that synthesize kynurenic acid, a neuromodulator, are identical to glutamine transaminase K (GTK), α-aminoadipate aminotransferase, and mitochondrial aspartate aminotransferase, respectively. GTK/KAT I and aspartate aminotransferase/KAT IV possess cysteine S-conjugate β-lyase activity. The gene for the former enzyme, GTK/KAT I, is listed in mammalian genome data banks as CCBL1 (cysteine conjugate beta-lyase 1). Also listed, despite the fact that no β-lyase activity has been assigned to the encoded protein in the genome data bank, is a CCBL2 (synonym KAT III). We show that human KAT III/CCBL2 possesses cysteine S-conjugate β-lyase activity, as does mouse KAT II. Thus, depending on the nature of the substrate, all four KATs possess cysteine S-conjugate β-lyase activity. These present studies show that KAT III and glutamine transaminase L are identical enzymes. This report also shows that KAT I, II, and III differ in their ability to transaminate methyl-L-selenocysteine (MSC) and L-selenomethionine (SM) to β-methylselenopyruvate (MSP) and α-ketomethylselenobutyrate, respectively. Previous studies have identified these seleno-α-keto acids as potent histone deacetylase inhibitors. Methylselenol (CH3SeH), also purported to have chemopreventive properties, is the γ-elimination product of SM and the β-elimination product of MSC catalyzed by cystathionine γ-lyase (γ-cystathionase). KAT I, II, and III, in part, can catalyze β-elimination reactions with MSC generating CH3SeH. Thus, the anticancer efficacy of MSC and SM will depend, in part, on the endogenous expression of various KAT enzymes and cystathionine γ-lyase present in target tissue coupled with the ability of cells to synthesize in situ either CH3SeH and/or seleno-keto acid metabolites. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. UV light-induced mutability in Salmonella strains containing the umuDC or the mucAB operon

    International Nuclear Information System (INIS)

    Herrera, G.; Urios, A.; Aleixandre, V.; Blanco, M.

    1988-01-01

    Multicopy plasmids carrying either the umuDC operon of Escherichia coli or its analog mucAB operon, were introduced into Ames Salmonella strains in order to analyze the influence of UmuDC and MucAB proteins on repair and mutability after UV irradiation. It was found that in uvr + bacteria, plasmid pICV80:mucAB increased the frequency of UV-induced His + revertants whereas pSE117:umuDC caused a smaller increase in UV mutagenesis. In ΔuvrB bacteria, the protective role of pSE117 against UV killing was weak, and there was a great reduction in the mutant yield. In contrast, in these cells, pICV80 led to a large increase in both cell survival and mutation frequency. These results suggest that in Salmonella, as in E. coli, MucAB proteins mediate UV mutagenesis more efficiently than UmuDC proteins do. Plasmid pICV84:umuD + C - significantly increased UV mutagenesis of TA2659:ΔuvrB cells whereas in them, pICV77:mucA + B - had no effect on mutability indicating the presence in Salmonella TA2659 of a gene functionally homologous to umuC. 18 refs.; 1 figure; 3 tabs

  19. Attenuation in the rph-pyrE operon of Escherichia coli and processing of the dicistronic mRNA

    DEFF Research Database (Denmark)

    Poulsen, Peter; Jensen, Kaj Frank

    1992-01-01

    We have substituted on a plasmid the native promoter of the Escherichia coli rph-pyrE operon with an inducible transcription-initiation signal. The plasmid was used to study the mRNA chains derived from the operon at different intracellular concentrations of UTP and as a function of time following...... induction of transcription. The results showed that dicistronic rph-pyrE mRNA was formed when the UTP pool was low, and that a monocistronic rph mRNA was the major transcription product in high-UTP pools, thus supporting an UTP-controlled attenuation mechanism for regulation of pyrE gene expression. However......, the dicistronic rph-pyrE transcript was rapidly processed into two monocistronic mRNA units, and a cleavage site was mapped near the attenuator in the intercistronic region, close to the site where transcription was terminated in high-UTP pools. Furthermore, the major 3' end of the pyrE mRNA was mapped near...

  20. Use of the Operon Structure of the C. elegans Genome as a Tool to Identify Functionally Related Proteins

    Directory of Open Access Journals (Sweden)

    Silvia Dossena

    2013-12-01

    Full Text Available One of the most pressing challenges in the post genomic era is the identification and characterization of protein-protein interactions (PPIs, as these are essential in understanding the cellular physiology of health and disease. Experimental techniques suitable for characterizing PPIs (X-ray crystallography or nuclear magnetic resonance spectroscopy, among others are usually laborious, time-consuming and often difficult to apply to membrane proteins, and therefore require accurate prediction of the candidate interacting partners. High-throughput experimental methods (yeast two-hybrid and affinity purification succumb to the same shortcomings, and can also lead to high rates of false positive and negative results. Therefore, reliable tools for predicting PPIs are needed. The use of the operon structure in the eukaryote Caenorhabditis elegans genome is a valuable, though underserved, tool for identifying physically or functionally interacting proteins. Based on the concept that genes organized in the same operon may encode physically or functionally related proteins, this algorithm is easy to be applied and, importantly, gives a limited number of candidate partners of a given protein, allowing for focused experimental verification. Moreover, this approach can be successfully used to predict PPIs in the human system, including those of membrane proteins.

  1. The TorR High-Affinity Binding Site Plays a Key Role in Both torR Autoregulation and torCAD Operon Expression in Escherichia coli

    OpenAIRE

    Ansaldi, Mireille; Simon, Gwénola; Lepelletier, Michèle; Méjean, Vincent

    2000-01-01

    In the presence of trimethylamine N-oxide (TMAO), the TorS-TorR two-component regulatory system induces the torCAD operon, which encodes the TMAO respiratory system of Escherichia coli. The sensor protein TorS detects TMAO and transphosphorylates the response regulator TorR which, in turn, activates transcription of torCAD. The torR gene and the torCAD operon are divergently transcribed, and the short torR-torC intergenic region contains four direct repeats (the tor boxes) which proved to be ...

  2. The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans

    Science.gov (United States)

    Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.

    2015-01-01

    ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans

  3. The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans.

    Science.gov (United States)

    Singh, Kamna; Senadheera, Dilani B; Lévesque, Céline M; Cvitkovitch, Dennis G

    2015-08-01

    In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans Cop

  4. Functional analysis of the pediocin operon of Pediococcus acidilactici PAC1.0 : PedB is the immunity protein and PedD is the precursor processing enzyme

    NARCIS (Netherlands)

    Venema, Konraad; Kok, Jan; Marugg, Joey D.; Toonen, Marjolein Y.; Ledeboer, Aat M.; Venema, Gerhardus; Chikindas, Michael L.

    The bacteriocin pediocin PA-1 operon of Pediococcus acidilactici PAC1.0 encompasses four genes: pedA, pedB, pedC and pedD. Transcription of the operon results in the formation of two overlapping transcripts, probably originating from a single promoter upstream of pedA. The major transcript comprises

  5. High-Level Expression of a Thermally Stable Alginate Lyase Using Pichia pastoris, Characterization and Application in Producing Brown Alginate Oligosaccharide

    Directory of Open Access Journals (Sweden)

    Haifeng Li

    2018-05-01

    Full Text Available An alginate lyase encoding gene sagl from Flavobacterium sp. H63 was codon optimized and recombinantly expressed at high level in P.pastoris through high cell-density fermentation. The highest yield of recombinant enzyme of sagl (rSAGL in yeast culture supernatant reached 226.4 μg/mL (915.5 U/mL. This was the highest yield record of recombinant expression of alginate lyase so far. The rSAGL was confirmed as a partially glycosylated protein through EndoH digestion. The optimal reaction temperature and pH of this enzyme were 45 °C and 7.5; 80 mM K+ ions could improve the catalytic activity of the enzyme by 244% at most. rSAGL was a thermal stable enzyme with T5015 of 57–58 °C and T5030 of 53–54 °C. Its thermal stability was better than any known alginate lyase. In 100 mM phosphate buffer of pH 6.0, rSAGL could retain 98.8% of the initial activity after incubation at 50 °C for 2 h. Furthermore, it could retain 61.6% of the initial activity after 48 h. The specific activity of the purified rSAGL produced by P. pastoris attained 4044 U/mg protein, which was the second highest record of alginate lyase so far. When the crude enzyme of the rSAGL was directly used in transformation of sodium alginate with 40 g/L, 97.2% of the substrate was transformed to di, tri, tetra brown alginate oligosaccharide after 32 h of incubation at 50 °C, and the final concentration of reducing sugar in mixture reached 9.51 g/L. This is the first report of high-level expression of thermally stable alginate lyase using P. pastoris system.

  6. Production of Pectate Lyase by Penicillium viridicatum RFC3 in Solid-State and Submerged Fermentation

    Science.gov (United States)

    Ferreira, Viviani; da Silva, Roberto; Silva, Dênis; Gomes, Eleni

    2010-01-01

    Pectate lyase (PL) was produced by the filamentous fungus Penicillium viridicatum RFC3 in solid-state cultures of a mixture of orange bagasse and wheat bran (1 : 1 w/w), or orange bagasse, wheat bran and sugarcane bagasse (1 : 1 : 0.5 w/w), and in a submerged liquid culture with orange bagasse and wheat bran (3%) as the carbon source. PL production was highest (1,500 U  mL−1 or 300 Ug−1 of substrate) in solid-state fermentation (SSF) on wheat bran and orange bagasse at 96 hours. PL production in submerged fermentation (SmF) was influenced by the initial pH of the medium. With the initial pH adjusted to 4.5, 5.0, and 5.5, the peak activity was observed after 72, 48, and 24 hours of fermentation, respectively, when the pH of the medium reached the value 5.0. PL from SSF and SmF were loaded on Sephadex-G75 columns and six activity peaks were obtained from crude enzyme from SSF and designated PL I, II, III, IV, V, and VI, while five peaks were obtained from crude enzyme from SmF and labeled PL  I′, II′, III′, IV′, and VII′. Crude enzyme and fraction III from each fermentative process were tested further. The optimum pH for crude PL from either process was 5.5, while that for PL III was 8.0. The maximum activity of enzymes from SSF was observed at 35°C, but crude enzyme was more thermotolerant than PL III, maintaining its maximum activity up to 45°C. Crude enzyme from SmF and PL III′ showed thermophilic profiles of activity, with maximum activity at 60 and 55°C, respectively. In the absence of substrate, the crude enzyme from SSF was stable over the pH range 3.0–10.0 and PL III was most stable in the pH range 4.0–7.0. Crude enzyme from SmF retained 70%–80% of its maximum activity in the acid-neutral pH range (4.0–7.0), but PIII showed high stability at alkaline pH (7.5–9.5). PL from SSF was more thermolabile than that from SmF. The latter maintained 60% of its initial activity after 1 h at 55°C. The differing

  7. Production of Pectate Lyase by Penicillium viridicatum RFC3 in Solid-State and Submerged Fermentation

    Directory of Open Access Journals (Sweden)

    Viviani Ferreira

    2010-01-01

    Full Text Available Pectate lyase (PL was produced by the filamentous fungus Penicillium viridicatum RFC3 in solid-state cultures of a mixture of orange bagasse and wheat bran (1 : 1 w/w, or orange bagasse, wheat bran and sugarcane bagasse (1 : 1 : 0.5 w/w, and in a submerged liquid culture with orange bagasse and wheat bran (3% as the carbon source. PL production was highest (1,500 U  mL−1 or 300 Ug−1 of substrate in solid-state fermentation (SSF on wheat bran and orange bagasse at 96 hours. PL production in submerged fermentation (SmF was influenced by the initial pH of the medium. With the initial pH adjusted to 4.5, 5.0, and 5.5, the peak activity was observed after 72, 48, and 24 hours of fermentation, respectively, when the pH of the medium reached the value 5.0. PL from SSF and SmF were loaded on Sephadex-G75 columns and six activity peaks were obtained from crude enzyme from SSF and designated PL I, II, III, IV, V, and VI, while five peaks were obtained from crude enzyme from SmF and labeled PL  I′, II′, III′, IV′, and VII′. Crude enzyme and fraction III from each fermentative process were tested further. The optimum pH for crude PL from either process was 5.5, while that for PL III was 8.0. The maximum activity of enzymes from SSF was observed at 35∘C, but crude enzyme was more thermotolerant than PL III, maintaining its maximum activity up to 45∘C. Crude enzyme from SmF and PL   III′ showed thermophilic profiles of activity, with maximum activity at 60 and 55∘C, respectively. In the absence of substrate, the crude enzyme from SSF was stable over the pH range 3.0–10.0 and PL III was most stable in the pH range 4.0–7.0. Crude enzyme from SmF retained 70%–80% of its maximum activity in the acid-neutral pH range (4.0–7.0, but PIII showed high stability at alkaline pH (7.5–9.5. PL from SSF was more thermolabile than that from SmF. The latter maintained 60% of its initial activity after 1 h at 55

  8. One Year Experience of Pheburane(®) (Sodium Phenylbutyrate) Treatment in a Patient with Argininosuccinate Lyase Deficiency.

    Science.gov (United States)

    Uçar, Sema Kalkan; Ozbaran, Burcu; Altinok, Yasemin Atik; Kose, Melis; Canda, Ebru; Kagnici, Mehtap; Coker, Mahmut

    2015-01-01

    Argininosuccinate lyase deficiency (ASLD) is a urea cycle disorder (UCD) treated with dietary adjustment and nitrogen scavenging agents. "Pheburane(®)" is a new tasteless and odour-free formulation of sodium phenylbutyrate, indicated in the treatment of UCD.A male patient diagnosed with ASLD was put on treatment with the new formulation of sodium phenylbutyrate (granules) for a period of one year, at 500 mg/kg orally in 3 intakes/day. Plasma glutamine, arginine, citrulline, argininosuccinate, serum sodium, potassium, liver function tests and urine orotate all remained unchanged over this period. There was no difference in mean ammonia levels before and after treatment, and no hyperammonemia episode occurred during treatment with Pheburane(®). An improvement in a measurement of quality of life (QOL) was noted after treatment with Pheburane(®). Good metabolic control and improved QOL were achieved throughout the treatment period.

  9. Generation of 2-Furfurylthiol by Carbon-Sulfur Lyase from the Baijiu Yeast Saccharomyces cerevisiae G20.

    Science.gov (United States)

    Zha, Musu; Sun, Baoguo; Yin, Sheng; Mehmood, Arshad; Cheng, Lei; Wang, Chengtao

    2018-03-07

    2-Furfurylthiol is the representative aroma compound of Chinese sesame-flavored baijiu. Previous studies demonstrated that baijiu yeasts could generate 2-furfurylthiol using furfural and l-cysteine as precursors and that the Saccharomyces cerevisiae genes STR3 and CYS3 are closely related to 2-furfurylthiol biosynthesis. To confirm the mechanism of the STR3- and CYS3-gene products on 2-furfurylthiol biosynthesis, their encoded proteins were purified, and we confirmed their activities as carbon-sulfur lyases. Str3p and Cys3p were able to cleave the cysteine-furfural conjugate to release 2-furfurylthiol. Moreover, the characterization of the enzymatic properties of the purified proteins shows good thermal stabilities and wide pH tolerances, which enable their strong potential for various applications. These data provide direct evidence that yeast Str3p and Cys3p release 2-furfurylthiol in vitro, which can be applied to improve baijiu flavor.

  10. Preliminary structural investigations of the Eut-L shell protein of the ethanolamine ammonia-lyase metabolosome of Escherichia coli