
Sample records for burster lmxb xb

  1. Uhuru observations of the Norma X-ray burster (United States)

    Grindlay, J.; Gursky, H.


    Four X-ray bursts consistent with a single source in Norma are reported which were discovered by reexamining Uhuru data obtained between 1970 and 1973. The temporal and spectral characteristics of the bursts are described and shown to be similar to those displayed by bursts from the globular cluster NGC 6224. An error box of the source location is given, and it is found that both the position and intensity of the four bursts are consistent with those of 10 bursts detected by the Vela satellites in 1976. It is concluded that the source is the same as that observed by the Vela and is an X-ray burster with characteristics similar to those of certain other bursters. XB 1608-52 is suggested as the designation of this burster, possible burst models are considered, and it is noted that the error box of the present source contains an identified globular cluster.

  2. Recent activity of the Rapid Burster (MXB 1730-335)

    NARCIS (Netherlands)

    Kuulkers, E.; Brandt, S.; Markwardt, C.; Remillard, R.A.; Shaw, S.; Beckmann, V.; Chenevez, J.; Courvoisier, T.J.L.; Domingo, A.; Ebisawa, K.; Jonker, P.; Kretschmar, P.; Oosterbroek, T.; Paizis, A.; Risquez, D.; Sanchez-Fernandez, C.; Wijnands, R.


    Observations taken as part of the INTEGRAL Galactic bulge monitoring program (see ATel #1385) on 2008, February 23 13:32-17:13 (UT) showed bursting activity from the X-ray transient, the Rapid Burster (MXB 1730-335). During one of the 1800-sec pointings when the source was in the field- of-view of

  3. Recent activity of the Rapid Burster (MXB 1730-335)

    DEFF Research Database (Denmark)

    Kuulkers, E.; Brandt, Søren Kristian; Markwardt, C.


    Observations taken as part of the INTEGRAL Galactic bulge monitoring program (see ATel #1385) on 2008, February 23 13:32-17:13 (UT) showed bursting activity from the X-ray transient, the Rapid Burster (MXB 1730-335). During one of the 1800-sec pointings when the source was in the field- of-view o...

  4. INTEGRAL monitoring of the X-ray burster XTE J1739-285

    DEFF Research Database (Denmark)

    Sánchez-Fernández, C.; Kuulkers, E.; Chenevez, Jérôme


    XTE J1739-285 is a recurrent X-ray transient first discovered by INTEGRAL as an X-ray burster. We have carried out a systematic search for X-ray bursts at various levels of accretion rate onto the Neutron Star surface during the source outbursts in 2005 and 2006. A total of 25 X-ray bursts were...

  5. Improving noise resistance of intrinsic rhythms in a square-wave burster model. (United States)

    Kohno, Takashi; Aihara, Kazuyuki


    The square-wave burster (Wang and Rinzel, 2003) is a class of autonomous bursting cells that share a bifurcation structure. It is known that this class of cells is involved in the generation of various life-supporting rhythms. In our research to realize an electronic circuit that mimics the rhythm generating mechanism in the square-wave burster, our circuit experimentally exhibited severe fluctuations in its rhythmic activity. We have found a noise-sensitive region in the phase portrait of the ideal model and have proposed modifications of the model that can reduce this fluctuation. A possible modification to ionic-conductance neuron models (Kohno and Aihara, 2011) was inspired by them. This modification, however, cannot be applied to a group of square-wave bursters, including the Butera-Rinzel-Smith model (Butera et al., 1999; Del Negro et al., 2001), which is a model of the pre-Bötzinger complex bursting neuron that plays a crucial role in the generation of respiration rhythms, because this modification premises that the slow dynamics originates from an activation gate variable of a hyperpolarizing ionic current. However, in some square-wave bursters, they are controlled by an inactivation gate variable of a depolarizing ionic current. In this study, we proposed a similar modification with a completely different mechanism that can be applied to this group of square-wave bursters. In the presence of noises, the modified Butera-Rinzel-Smith model can generate rhythmic activity that is more stable and similar to biological observations than the original model. The mechanisms underlying this modification are explained with noisy bifurcation diagrams. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.


    Energy Technology Data Exchange (ETDEWEB)

    Sala, G.; Jose, J.; Parikh, A.; Longland, R. [Departament de Fisica i Enginyeria Nuclear, EUETIB, Universitat Politecnica de Catalunya, c/ Comte d' Urgell 187, E-08036 Barcelona (Spain); Haberl, F. [Max-Planck-Institut fuer extraterrestrische Physik, Giessenbachstrasse, D-85748 Garching (Germany); Pardo, L. C. [Grup de Caracteritzacio de Materials, Departament de Fisica i Enginyeria Nuclear, ETSEIB, Universitat Politecnica de Catalunya, Diagonal 647, E-08028 Barcelona, Catalonia (Spain); Andersen, M. [Research and Scientific Support Department, European Space Agency, ESTEC, Keplerlaan 1, NL-2200 AG Noordwijk (Netherlands)


    The Rapid Burster (MXB 1730-335) is a unique object, showing both type I and type II X-ray bursts. A type I burst of the Rapid Burster was observed with Swift/X-Ray Telescope on 2009 March 5, showing photospheric radius expansion (PRE) for the first time in this source. We report here on the mass and radius determination from this PRE burst using a Bayesian approach. After marginalization over the likely distance of the system (5.8-10 kpc), we obtain M = 1.1 {+-} 0.3 M{sub Sun} and R = 9.6 {+-} 1.5 km (1{sigma} uncertainties) for the compact object, ruling out the stiffest equations of state for the neutron star. We study the sensitivity of the results to the distance, the color correction factor, and the hydrogen mass fraction in the envelope. We find that only the distance plays a crucial role.

  7. Evidence for a Broad Relativistic Iron Line from the Neutron Star LMXB Ser X-1 (United States)

    Bhattacharyya, Sudip; Strohmayer, Tod E.


    We report on an analysis of XMM-Newton data from the neutron star low mass X-ray binary (LMXB) Serpens X-1 (Ser X-1). Spectral analysis of EPIC PN data indicates that the previously known broad iron Ka emission line in this source has a significantly skewed structure with a moderately extended red wing. The asymmetric shape of the line is well described with the laor and diskline models in XSPEC, which strongly supports an inner accretion disk origin of the line. To our knowledge this is the first strong evidence for a relativistic line in a neutron star LMXB. This finding suggests that the broad lines seen in other neutron star LMXBs likely originate from the inner disk as well. Detailed study of such lines opens up a new way to probe neutron star parameters and their strong gravitational fields. The laor model describes the line from Ser X-1 somewhat better than diskline, and suggests that the inner accretion disk radius is less than 6GM/c(exp 2). This is consistent with the weak magnetic fields of LMXBs, and may point towards a high compactness and rapid spin of the neutron star. Finally, the inferred source inclination angle in the approximate range 50-60 deg is consistent with the lack of dipping from Ser X-1.

  8. XB130 translocation to microfilamentous structures mediates NNK-induced migration of human bronchial epithelial cells. (United States)

    Wu, Qifei; Nadesalingam, Jeya; Moodley, Serisha; Bai, Xiaohui; Liu, Mingyao


    Cigarette smoking contributes to the pathogenesis of chronic obstructive pulmonary disease and lung cancer. Nicotine-derived nitrosamine ketone (NNK) is the most potent carcinogen among cigarette smoking components, and is known to enhance migration of cancer cells. However, the effect of NNK on normal human bronchial epithelial cells is not well studied. XB130 is a member of actin filament associated protein family and is involved in cell morphology changes, cytoskeletal rearrangement and outgrowth formation, as well as cell migration. We hypothesized that XB130 mediates NNK-induced migration of normal human bronchial epithelial cells. Our results showed that, after NNK stimulation, XB130 was translocated to the cell periphery and enriched in cell motility-associated structures, such as lamellipodia, in normal human bronchial epithelial BEAS2B cells. Moreover, overexpression of XB130 significantly enhanced NNK-induced migration, which requires both the N- and C-termini of XB130. Overexpression of XB130 enhanced NNK-induced protein tyrosine phosphorylation and promoted matrix metalloproteinase-14 translocation to cell motility-associated cellular structures after NNK stimulation. XB130-mediated NNK-induced cell migration may contribute to airway epithelial repair; however, it may also be involved in cigarette smoking-related chronic obstructive pulmonary disease and lung cancer.

  9. On the dosimetric impact of inhomogeneity management in the Acuros XB algorithm for breast treatment

    Directory of Open Access Journals (Sweden)

    Vanetti Eugenio


    Full Text Available Abstract Background A new algorithm for photon dose calculation, Acuros XB, has been recently introduced in the Eclipse, Varian treatment planning system, allowing, similarly to the classic Monte Carlo methods, for accurate modelling of dose deposition in media. Aim of the present study was the assessment of its behaviour in clinical cases. Methods Datasets from ten breast patients scanned under different breathing conditions (free breathing and deep inspiration were used to calculate dose plans using the simple two tangential field setting, with Acuros XB (in its versions 10 and 11 and the Anisotropic Analytical Algorithm (AAA for a 6MV beam. Acuros XB calculations were performed as dose-to-medium distributions. This feature was investigated to appraise the capability of the algorithm to distinguish between different elemental compositions in the human body: lobular vs. adipose tissue in the breast, lower (deep inspiration condition vs. higher (free breathing condition densities in the lung. Results The analysis of the two breast structures presenting densities compatible with muscle and with adipose tissue showed an average difference in dose calculation between Acuros XB and AAA of 1.6%, with AAA predicting higher dose than Acuros XB, for the muscle tissue (the lobular breast; while the difference for adipose tissue was negligible. From histograms of the dose difference plans between AAA and Acuros XB (version 10, the dose of the lung portion inside the tangential fields presented an average difference of 0.5% in the free breathing conditions, increasing to 1.5% for the deep inspiration cases, with AAA predicting higher doses than Acuros XB. In lung tissue significant differences are found also between Acuros XB version 10 and 11 for lower density lung. Conclusions Acuros XB, differently from AAA, is capable to distinguish between the different elemental compositions of the body, and suggests the possibility to further improve the accuracy of

  10. XB130 promotes bronchioalveolar stem cell and Club cell proliferation in airway epithelial repair and regeneration. (United States)

    Toba, Hiroaki; Wang, Yingchun; Bai, Xiaohui; Zamel, Ricardo; Cho, Hae-Ra; Liu, Hongmei; Lira, Alonso; Keshavjee, Shaf; Liu, Mingyao


    Proliferation of bronchioalveolar stem cells (BASCs) is essential for epithelial repair. XB130 is a novel adaptor protein involved in the regulation of epithelial cell survival, proliferation and migration through the PI3K/Akt pathway. To determine the role of XB130 in airway epithelial injury repair and regeneration, a naphthalene-induced airway epithelial injury model was used with XB130 knockout (KO) mice and their wild type (WT) littermates. In XB130 KO mice, at days 7 and 14, small airway epithelium repair was significantly delayed with fewer number of Club cells (previously called Clara cells). CCSP (Club cell secreted protein) mRNA expression was also significantly lower in KO mice at day 7. At day 5, there were significantly fewer proliferative epithelial cells in the KO group, and the number of BASCs significantly increased in WT mice but not in KO mice. At day 7, phosphorylation of Akt, GSK-3β, and the p85α subunit of PI3K was observed in airway epithelial cells in WT mice, but to a much lesser extent in KO mice. Microarray data also suggest that PI3K/Akt-related signals were regulated differently in KO and WT mice. An inhibitory mechanism for cell proliferation and cell cycle progression was suggested in KO mice. XB130 is involved in bronchioalveolar stem cell and Club cell proliferation, likely through the PI3K/Akt/GSK-3β pathway.


    Energy Technology Data Exchange (ETDEWEB)

    Ji, Long; Zhang, Shu; Chen, YuPeng; Zhang, Shuang-Nan; Chang, Zhi [Laboratory for Particle Astrophysics, Institute of High Energy Physics, Beijing 100049 (China); Torres, Diego F. [Institució Catalana de Recerca i Estudis Avançats (ICREA), E-08010 Barcelona (Spain); Kretschmar, Peter; Kuulkers, Erik [European Space Astronomy Centre (ESA/ESAC), Science Operations Department, Villanueva de la Cañada (Madrid) (Spain); Li, Jian [Institute of Space Sciences (CSIC–IEEC), Campus UAB, Carrer de Can Magrans, s/n E-08193, Barcelona (Spain)


    Type I X-ray bursts on the surface of a neutron star are a unique probe into accretion in X-ray binary systems. However, we know little about the feedback of the burst emission on accretion. Hard X-ray shortages and enhancements of the persistent emission at soft X-rays have been observed. To put these findings in context with the aim of understanding the possible mechanism underneath, we investigated 68 bursts seen by the Rossi X-ray Timing Explorer from the clocked burster GS 1826-238. We diagnosed jointly the burst influence of both soft and hard X-rays, and we found that the observations can be described by the CompTT model with variable normalization, electron temperature, and optical depth. Putting these results in a scenario of coronal Compton cooling via the burst emission would lead to a shortage of cooling power, which may suggest that additional considerations, like the influence of the burst on corona formation, should be accounted for as well.

  12. LMXB and IMXB Evolution: I. The Binary Radio Pulsar PSR J1614-2230 (United States)

    Lin, Jinrong; Rappaport, S.; Podsiadlowski, Ph.; Nelson, L.; Paxton, B.; Todorov, P.


    We have computed an extensive grid of binary evolution tracks to represent low- and intermediate-mass X-ray binaries (LMXBs and IMXBs). The grid includes 42,000 models which cover 60 initial donor masses over the range of 1-4 M sun and, for each of these, 700 initial orbital periods over the range of 10-250 hr. These results can be applied to understanding LMXBs and IMXBs: those that evolve analogously to cataclysmic variables, that form ultracompact binaries with P orb in the range of 6-50 minutes, and that lead to wide orbits with giant donors. We also investigate the relic binary recycled radio pulsars into which these systems evolve. To evolve the donor stars in this study, we utilized a newly developed stellar evolution code called "MESA" that was designed, among other things, to be able to handle very low mass and degenerate donors. This first application of the results is aimed at an understanding of the newly discovered pulsar PSR J1614-2230 which has a 1.97 M sun neutron star, P orb = 8.7 days, and a companion star of 0.5 M sun. We show that (1) this system is a cousin to the LMXB Cyg X-2; (2) for neutron stars of canonical birth mass 1.4 M sun, the initial donor stars which produce the closest relatives to PSR J1614-2230 have a mass between 3.4 and 3.8 M sun; (3) neutron stars as massive as 1.97 M sun are not easy to produce in spite of the initially high mass of the donor star, unless they were already born as relatively massive neutron stars; (4) to successfully produce a system like PSR J1614-2230 requires a minimum initial neutron-star mass of at least 1.6 ± 0.1 M sun, as well as initial donor masses and P orb of ~4.25 ± 0.10 M sun and ~49 ± 2 hr, respectively; and (5) the current companion star is largely composed of CO, but should have a surface H abundance of ~10%-15%.

  13. Review of semileptonic $b$-hadron decays excluding the $| V_{ xb} |$ and $R$$(D^{(*)})$ measurements

    CERN Document Server

    Owen, Patrick


    A review of other semileptonic b -hadron decays that are not related to R ( D ( ∗ ) ) and | V xb | anomalies are presented. A couple of long-standing puzzles in B → D ∗∗ ` ν decays are revisited and potential issues and advantages of studying B 0 s and Λ 0 b semileptonic decays are discussed.

  14. Probing the MSP Prenatal Stage: The Optical Identification of the X-Ray Burster EXO 1745-248 in Terzan 5

    NARCIS (Netherlands)

    Ferraro, F. R.; Pallanca, C.; Lanzoni, B.; Cadelano, M.; Massari, D.; Dalessandro, E.; Mucciarelli, A.

    We report on the optical identification of the neutron star burster EXO 1745-248 in Terzan 5. The identification was performed by exploiting Hubble Space Telescope/Advanced Camera for Surveys images acquired in Director's Discretionary Time shortly after (approximately one month) the Swift detection

  15. Anti-inflammatory properties of gastric-derived Lactobacillus plantarum XB7 in the context of Helicobacter pylori infection. (United States)

    Thiraworawong, Thien; Spinler, Jennifer K; Werawatganon, Duangporn; Klaikeaw, Naruemon; Venable, Susan F; Versalovic, James; Tumwasorn, Somying


    Helicobacter pylori colonization of the gastric epithelium induces interleukin-8 (IL-8) production and inflammation leading to host cell damage. We searched for gastric-derived Lactobacillus with the ability to suppress H. pylori-induced inflammation. Conditioned media from gastric-derived Lactobacillus spp. were tested for the ability to suppress H. pylori-induced IL-8 production in AGS gastric epithelial cells. IL-8 protein and mRNA levels were measured by ELISA and qPCR, respectively. The changes on host cell signaling pathway were analyzed by Western blotting and the anti-inflammatory effect was tested in a Sprague-Dawley rat model. Conditioned media from L. salivarius B101, L. rhamnosus B103, and L. plantarum XB7 suppressed IL-8 production and IL-8 mRNA expression in H. pylori-induced AGS cells without inhibiting H. pylori growth. Conditioned media from LS-B101, LR-B103, and LP-XB7 suppressed the activation of NF-κB in AGS cells, while strain LP-XB7 also suppressed c-Jun activation. The anti-inflammatory effect of LP-XB7 was further assessed in vivo using a H. pylori-infected Sprague-Dawley rat model. Strain LP-XB7 contributed to a delay in the detection and colonization of H. pylori in rat stomachs, attenuated gastric inflammation, and ameliorated gastric histopathology. Additionally, the administration of LP-XB7 correlated with the suppression of TNF-α and CINC-1 in sera, and suppression of CINC-1 in the gastric mucosa of H. pylori-infected rats. These results suggest that L. plantarum XB7 produces secreted factors capable of modulating inflammation during H. pylori infection, and this probiotic Lactobacillus strain shows promise as an adjunctive therapy for treating H. pylori-associated disease. © 2014 John Wiley & Sons Ltd.

  16. ROSAT and follow-up infrared observations of the X-ray burster KS 1731-260 (United States)

    Barret, Didier; Motch, Christian; Predehl, Peter


    We report on the ROSAT HRI (High Resolution Imager) observation of the X-ray burster KS 1731-260. The observation was split in two parts; the first took place in 1995, March 16 lasting for ~ 1 kilosecond and the second one between September 3rd and 14th, 1996 for about 5 kiloseconds. In both observations, KS 1731-260 was clearly detected with a count rate of 0.82 and 7.9ctss respectively. From the first observation we found that the X-ray source is located at a position alpha = 17() h 34() mn 13.5() s and delta = -26() deg 05' 16.8'' (equinox 2000) with an associated error radius of 10.1 arcsec (90% confidence level combining the attitude and centroid uncertainties). The position derived from the second part of the observation is consistent with the previous one. The ROSAT HRI position rules out the two counterparts that have been proposed so far. Our CFHT J and H infrared imaging of the HRI error box reveals at least 13 possible candidates. As expected from a comparison with other X-ray bursters, the upper limits derived for the infrared brightness of KS 1731-260 imply the presence of a low mass companion for the neutron star. We also report on a refined spectral analysis of the PSPC data taken during the all sky survey in September 1990. These data, together with data recorded by TTM and PCA/RXTE indicate that the column density towards KS 1731-260 varies between ~ 1 to 6 x 10(22) H atoms cm(-2) ; thus suggesting that the source is characterized by variable intrinsic absorption. The change in the HRI count rate could be better explained by a change in the column density between the two observations rather than by a true source intensity variation. The numerous detections of the source since its discovery in 1988 together with its recent monitoring by the RXTE/ASM show that KS 1731-260 is a persistent source rather than a soft X-ray transient, as originally thought.

  17. NuSTAR and XMM-Newton Observations of 1E1743.1-2843: Indications of a Neutron Star LMXB Nature of the Compact Object (United States)

    Lotti, Simone; Natalucci, Lorenzo; Mori, Kaya; Baganoff, Frederick K.; Boggs, Steven E.; Christensen, Finn E.; Craig, William W.; Hailey, Charles J.; Harrison, Fiona A.; Hong, Jaesub; hide


    We report on the results of NuSTAR and XMM-Newton observations of the persistent X-ray source 1E1743.1-2843, located in the Galactic Center region. The source was observed between 2012 September and October by NuSTAR and XMM-Newton, providing almost simultaneous observations in the hard and soft X-ray bands. The high X-ray luminosity points to the presence of an accreting compact object. We analyze the possibilities of this accreting compact object being either a neutron star (NS) or a black hole, and conclude that the joint XMM-Newton and NuSTAR spectrum from 0.3 to 40 keV fits a blackbody spectrum with kT approximately 1.8 keV emitted from a hot spot or an equatorial strip on an NS surface. This spectrum is thermally Comptonized by electrons with kTe approximately 4.6 keV. Accepting this NS hypothesis, we probe the low-mass X-ray binary (LMXB) or high-mass X-ray binary (HMXB) nature of the source. While the lack of Type-I bursts can be explained in the LMXB scenario, the absence of pulsations in the 2 MHz-49 Hz frequency range, the lack of eclipses and of an IR companion, and the lack of a Kaline from neutral or moderately ionized iron strongly disfavor interpreting this source as a HMXB. We therefore conclude that 1E1743.1-2843 is most likely an NS-LMXB located beyond the Galactic Center. There is weak statistical evidence for a soft X-ray excess which may indicate thermal emission from an accretion disk. However, the disk normalization remains unconstrained due to the high hydrogen column density (N(sub H) approximately 1.6 x 10(exp 23) cm(exp -2)).

  18. Accuracy of Mass and Radius Determination for Neutron Stars in X-ray Bursters from Simulated LOFT Spectra (United States)

    Majczyna, A.; Madej, J.; Różańska, A.; Należyty, M.


    We present a simulation of an X-ray spectrum of a hot neutron star, as would be seen by the LAD detector on board of LOFT satellite. We also compute a grid of theoretical spectra corresponding to a range of effective temperatures Teff and surface gravities log g with values corresponding to compact stars in Type I X-ray bursters. A neutron star with the mass M=1.64 M⊙ and the radius R=11.95 km (which yields the surface gravity log g=14.30 [cgs] and the surface redshift z=0.30) is used in simulation. Accuracy of mass and radius determination by fitting theoretical spectra to the observed one is found to be M=1.64+0.16-0.02 M⊙ and R=11.95+1.57-0.40 km (2σ). The confidence contours for these two variables are narrow but elongated, and therefore the resulting constraints on the EOS cannot be strong. Note, that in this paper we aim to discuss error contours of NS mass and radius, whereas discussion of EOS is beyond the scope of this work.

  19. Measured Sonic Boom Signatures Above and Below the XB-70 Airplane Flying at Mach 1.5 and 37,000 Feet (United States)

    Maglieri, Domenic J.; Henderson, Herbert R.; Tinetti, Ana F.


    During the 1966-67 Edwards Air Force Base (EAFB) National Sonic Boom Evaluation Program, a series of in-flight flow-field measurements were made above and below the USAF XB-70 using an instrumented NASA F-104 aircraft with a specially designed nose probe. These were accomplished in the three XB-70 flights at about Mach 1.5 at about 37,000 ft. and gross weights of about 350,000 lbs. Six supersonic passes with the F-104 probe aircraft were made through the XB-70 shock flow-field; one above and five below the XB-70. Separation distances ranged from about 3000 ft. above and 7000 ft. to the side of the XB-70 and about 2000 ft. and 5000 ft. below the XB-70. Complex near-field "sawtooth-type" signatures were observed in all cases. At ground level, the XB-70 shock waves had not coalesced into the two-shock classical sonic boom N-wave signature, but contained three shocks. Included in this report is a description of the generating and probe airplanes, the in-flight and ground pressure measuring instrumentation, the flight test procedure and aircraft positioning, surface and upper air weather observations, and the six in-flight pressure signatures from the three flights.

  20. Plasma heating due to X-B mode conversion in a cylindrical ECR plasma system

    Energy Technology Data Exchange (ETDEWEB)

    Yadav, V.K.; Bora, D. [Institute for Plasma Research, Bhat, Gandhinagar, Gujarat (India)


    Extra Ordinary (X) mode conversion to Bernstein wave near Upper Hybrid Resonance (UHR) layer plays an important role in plasma heating through cyclotron resonance. Wave generation at UHR and parametric decay at high power has been observed during Electron Cyclotron Resonance (ECR) heating experiments in toroidal magnetic fusion devices. A small linear system with ECR and UHR layer within the system has been used to conduct experiments on X-B conversion and parametric decay process as a function of system parameters. Direct probing in situ is conducted and plasma heating is evidenced by soft x-ray emission measurement. Experiments are performed with hydrogen plasma produced with 160-800 W microwave power at 2.45 GHz of operating frequency at 10{sup -3} mbar pressure. The axial magnetic field required for ECR is such that the resonant surface (B = 875 G) is situated at the geometrical axis of the plasma system. Experimental results will be presented in the paper. (authors)

  1. A soft X-ray spectral episode for the Clocked Burster, GS 1826-24 as measured by Swift and NuSTAR

    DEFF Research Database (Denmark)

    Chenevez, J.; Galloway, D.K.; in ’t Zand, J.J.M.


    Edd within the range of previous observations. However, the best-fit spectral model, adopting the double Comptonization used previously, exhibits significantly softer components. We detect seven type-I X-ray bursts, all significantly weaker (and with shorter rise and decay times) than observed previously......We report on NuSTAR and Swift observations of a soft state of the neutron star low-mass X-ray binary GS 1826–24, commonly known as the "clocked" burster. The transition to the soft state was recorded in 2014 June through an increase of the 2–20 keV source intensity measured by MAXI, simultaneous...

  2. Direct observation of the E- resonant state in GaA s1 -xB ix (United States)

    Alberi, K.; Beaton, D. A.; Mascarenhas, A.


    Bismuth-derived resonant states with T2 symmetry are detected in the valence band of GaA s1 -xB ix using electromodulated reflectance. A doublet is located 42 meV below the valence-band edge of GaAs that is split by local strain around isolated Bi impurity atoms. A transition associated with a singlet is also observed just above the GaAs spin-orbit split-off band. These states move deeper into the valence band with increasing Bi concentration but at a much slower rate than the well-known giant upward movement of the valence-band edge in GaA s1 -xB ix . Our results provide key insight for clarifying the mechanisms by which isovalent impurities alter the band structure of the host semiconductor.

  3. Localization behavior at bound Bi complex states in GaA s1 -xB ix (United States)

    Alberi, K.; Christian, T. M.; Fluegel, B.; Crooker, S. A.; Beaton, D. A.; Mascarenhas, A.


    While bismuth-related states are known to localize carriers in GaA s1 -xB ix alloys, the localization behavior of distinct Bi pair, triplet, and cluster states bound above the valence band is less well understood. We probe localization at three different Bi complex states in dilute GaA s1 -xB ix alloys using magnetophotoluminescence and time-resolved photoluminescence spectroscopy. The mass of electrons Coulomb-bound to holes trapped at Bi pair states is found to increase relative to the average electron mass in the alloy. This increase is attributed to enhanced local compressive strain in the immediate vicinity of the pairs. The dependence of energy transfer between these states on composition is also explored.

  4. Monte Carlo evaluation of Acuros XB dose calculation Algorithm for intensity modulated radiation therapy of nasopharyngeal carcinoma (United States)

    Yeh, Peter C. Y.; Lee, C. C.; Chao, T. C.; Tung, C. J.


    Intensity-modulated radiation therapy is an effective treatment modality for the nasopharyngeal carcinoma. One important aspect of this cancer treatment is the need to have an accurate dose algorithm dealing with the complex air/bone/tissue interface in the head-neck region to achieve the cure without radiation-induced toxicities. The Acuros XB algorithm explicitly solves the linear Boltzmann transport equation in voxelized volumes to account for the tissue heterogeneities such as lungs, bone, air, and soft tissues in the treatment field receiving radiotherapy. With the single beam setup in phantoms, this algorithm has already been demonstrated to achieve the comparable accuracy with Monte Carlo simulations. In the present study, five nasopharyngeal carcinoma patients treated with the intensity-modulated radiation therapy were examined for their dose distributions calculated using the Acuros XB in the planning target volume and the organ-at-risk. Corresponding results of Monte Carlo simulations were computed from the electronic portal image data and the BEAMnrc/DOSXYZnrc code. Analysis of dose distributions in terms of the clinical indices indicated that the Acuros XB was in comparable accuracy with Monte Carlo simulations and better than the anisotropic analytical algorithm for dose calculations in real patients.

  5. SU-E-T-529: Dosimetric Evaluation with Heterogeneity in Acuros XB Advanced Dose Calculation Algorithm and Anisotropic Analytical Algorithm (AAA). (United States)

    Rana, S; Rogers, K


    To evaluate accuracy of Acuros XB Advanced Dose Calculation Algorithm and Anisotropic Analytical Algorithm (AAA) with measurements in predicting doses beyond air gaps. Three virtual phantoms with layers were created in Eclipse Treatment Planning System. Each layer in phantoms was assigned in terms of water (top), air (middle) and water (bottom) medium. Central axis depth dose in water (bottom medium) beyond 2, 4 and 6 cm air gaps were computed for 5 cm water equivalent material positioned before air gaps. Dose computation was performed for 6MV photon beam with 3×3 and 5×5 cm(2) field sizes at 100 cm SSD to surface of phantoms using AAA_10.0.28 and Acuros XB_10.0.28. Next, solid water and Styrofoam were manufactured to mimic virtual phantoms. By keeping identical field, beam parameters, and geometries that were used for dose computation, 100 MUs were delivered to phantoms, and measurements at selected depths were acquired with cylindrical ionization chamber. Measured central axis depth doses were compared against calculated central axis depth doses computed from Acuros XB and AAA. Acuros XB predicted doses within ±2% of measured doses except at 1cm depth in phantoms with 4 cm air gap (-2.4%) and 6 cm air gap (-2.8%) for field size 3×3cm(2) . Acuros XB showed better dose prediction compared to AAA at all measured depths. Smallest test field size in phantom with largest air gap produced highest range (between depths 1 and 5 cm) in percentage dose difference (AAA: -2.9% to -9.9% and Acuros XB: -2.8% to 1.5%). Improper modeling of primary beam attenuation or lateral scatter (or combination of both) within air gap may have resulted into dose discrepancies. The findings suggest Acuros XB is more accurate to use in dose predictions when tumor is located beyond small air cavity (heterogeneity) within the patient. © 2012 American Association of Physicists in Medicine.

  6. SU-E-T-464: Implementation and Validation of 4D Acuros XB Dose Calculations

    Energy Technology Data Exchange (ETDEWEB)

    Thomas, S; Yuen, C [BC Cancer Agency, Vancouver, BC (Canada); Huang, V [BC Cancer Agency, Surrey, BC (United Kingdom); Milette, M; Teke, T [BC Cancer Agency-Southern Interior, Kelowna, BC (Canada)


    Purpose: In this abstract we implement and validate a 4D VMAT Acuros XB dose calculation using Gafchromic film. Special attention is paid to the physical material assignment in the CT dataset and to reported dose to water and dose to medium. Methods: A QUASAR phantom with a 3 cm sinusoidal tumor motion and 5 second period was scanned using 4D computed tomography. A CT was also obtained of the static QUASAR phantom with the tumor at the central position. A VMAT plan was created on the average CT dataset and was delivered on a Varian TrueBeam linear accelerator. The trajectory log file from this treatment was acquired and used to create 10 VMAT subplans (one for each portion of the breathing cycle). Motion for each subplan was simulated by moving the beam isocentre in the superior/inferior direction in the Treatment Planning System on the static CT scan. The 10 plans were calculated (both dose to medium and dose to water) and summed for 1) the original HU values from the static CT scan and 2) the correct physical material assignment in the CT dataset. To acquire a breathing phase synchronized film measurements the trajectory log was used to create a VMAT delivery plan which includes dynamic couch motion using the Developer Mode. Three different treatment start phases were investigated (mid inhalation, full inhalation and full exhalation). Results: For each scenario the coronal dose distributions were measured using Gafchromic film and compared to the corresponding calculation with Film QA Pro Software using a Gamma test with a 3%/3mm distance to agreement criteria. Good agreement was found between calculation and measurement. No statistically significant difference in agreement was found between calculations to original HU values vs calculations to over-written (material-assigned) HU values. Conclusion: The investigated 4D dose calculation method agrees well with measurement.

  7. Updating the orbital ephemeris of the dipping source XB 1254-690 and the distance to the source (United States)

    Gambino, Angelo F.; Iaria, Rosario; Di Salvo, Tiziana; Matranga, Marco; Burderi, Luciano; Pintore, Fabio; Riggio, Alessandro; Sanna, Andrea


    XB 1254-690 is a dipping low mass X-ray binary system hosting a neutron star and showing type I X-ray bursts. We aim at obtaining a more accurate orbital ephemeris and at constraining the orbital period derivative of the system for the first time. In addition, we want to better constrain the distance to the source in order to locate the system in a well defined evolutive scenario. We apply, for the first time, an orbital timing technique to XB 1254-690, using the arrival times of the dips present in the light curves that have been collected during 26 yr of X-ray pointed observations acquired from different space missions. We estimate the dip arrival times using a statistical method that weights the count-rate inside the dip with respect to the level of persistent emission outside the dip. We fit the obtained delays as a function of the orbital cycles both with a linear and a quadratic function. We infer the orbital ephemeris of XB 1254-690, improving the accuracy of the orbital period with respect to previous estimates. We infer a mass of M 2 = 0.42 ± 0.04 M ʘ for the donor star, in agreement with estimations already present in literature, assuming that the star is in thermal equilibrium while it transfers part of its mass via the inner Lagrangian point, and assuming a neutron star mass of 1.4 M ʘ. Using these assumptions, we also constrain the distance to the source, finding a value of 7.6 ± 0.8 kpc. Finally, we discuss the evolution of the system, suggesting that it is compatible with a conservative mass transfer driven by magnetic braking.

  8. Measurement of the inelastic branch of the $^{14}$O(α,p)$^{17}$F reaction Implications for explosive burning in novae and x-ray bursters

    CERN Document Server

    He, J J; Davinson, T; Aliotta, M; Büscher, J; Clement, E; Delahaye, P; Hass, M; Jenkins, D G; Kumar, V; Murphy, A St J; Neyskens, P; Raabe, R; Robinson, A P; Voulot, D; van der Walle, J; Warr, N; Wenander, F


    A measurement of the inelastic component of the key astrophysical resonance in the 14O(α,p)17F reaction for burning and breakout from hot carbon-nitrogen-oxygen (CNO) cycles is reported. The inelastic component is found to be comparable to the ground-state branch and will enhance the 14O(α,p)17F reaction rate. The current results for the reaction rate confirm that the 14O(α,p)17F reaction is unlikely to contribute substantially to burning and breakout from the CNO cycles under novae conditions. The reaction can, however, contribute strongly to the breakout from the hot CNO cycles under the more extreme conditions found in x-ray bursters.

  9. Dosimetric comparison of Acuros XB, AAA, and XVMC in stereotactic body radiotherapy for lung cancer. (United States)

    Tsuruta, Yusuke; Nakata, Manabu; Nakamura, Mitsuhiro; Matsuo, Yukinori; Higashimura, Kyoji; Monzen, Hajime; Mizowaki, Takashi; Hiraoka, Masahiro


    To compare the dosimetric performance of Acuros XB (AXB), anisotropic analytical algorithm (AAA), and x-ray voxel Monte Carlo (XVMC) in heterogeneous phantoms and lung stereotactic body radiotherapy (SBRT) plans. Water- and lung-equivalent phantoms were combined to evaluate the percentage depth dose and dose profile. The radiation treatment machine Novalis (BrainLab AG, Feldkirchen, Germany) with an x-ray beam energy of 6 MV was used to calculate the doses in the composite phantom at a source-to-surface distance of 100 cm with a gantry angle of 0°. Subsequently, the clinical lung SBRT plans for the 26 consecutive patients were transferred from the iPlan (ver. 4.1; BrainLab AG) to the Eclipse treatment planning systems (ver. 11.0.3; Varian Medical Systems, Palo Alto, CA). The doses were then recalculated with AXB and AAA while maintaining the XVMC-calculated monitor units and beam arrangement. Then the dose-volumetric data obtained using the three different radiation dose calculation algorithms were compared. The results from AXB and XVMC agreed with measurements within ± 3.0% for the lung-equivalent phantom with a 6 × 6 cm(2) field size, whereas AAA values were higher than measurements in the heterogeneous zone and near the boundary, with the greatest difference being 4.1%. AXB and XVMC agreed well with measurements in terms of the profile shape at the boundary of the heterogeneous zone. For the lung SBRT plans, AXB yielded lower values than XVMC in terms of the maximum doses of ITV and PTV; however, the differences were within ± 3.0%. In addition to the dose-volumetric data, the dose distribution analysis showed that AXB yielded dose distribution calculations that were closer to those with XVMC than did AAA. Means ± standard deviation of the computation time was 221.6 ± 53.1 s (range, 124-358 s), 66.1 ± 16.0 s (range, 42-94 s), and 6.7 ± 1.1 s (range, 5-9 s) for XVMC, AXB, and AAA, respectively. In the phantom evaluations, AXB and XVMC agreed better with

  10. Sci-Thur AM: Planning - 01: Experimental and Monte Carlo verification of Acuros XB calculations near low and high density heterogeneities. (United States)

    Alhakeem, E; AlShaikh, S; Rosenfeld, A B; Zavgorodni, S


    The purpose of this study was to examine the accuracy of AcurosXB and AAA algorithms near low and high density heterogeneities of different densities using EBT2 film, MOSFET detector "MOSkin" and Monte Carlo calculations using BEAMnrc/DOSXYZnrc. Three different interfaces were used that included a solid water phantom with 2×2×30cm(3) rectangular air gap, rectangular steel insert, and a slab of water embedded between two slabs of lung material. 6MV photon beam with field size of 10×10cm(2) was used for the first two geometries and a 3×3cm(2) -field was used for the third. Percentage Depth Doses were measured and calculated at the beam central axis. Calculation voxel of 0.1×0.1×0.1cm(3) was used by all three algorithms. For all configurations, AcurosXB and AAA agreed to within ±1.3% with MC before the inhomogeneity. The PDD measurements using MOSkin and EBT2 in water, apart from 0.2cm layer near heterogeneity, agreed with the MC within ±2.2%. Within 0.1cm before the water-air interface AcurosXB and AAA overestimated the dose by 4.7% and 1.6%, respectively. Whereas, in the 0.1cm beyond the air-water interface, AcurosXB and AAA overestimated the dose by 2.4% and 16.2% respectively. In the 0.1cm before the water-steel interface, AcurosXB overestimated the dose by 4.7% and AAA underestimated the dose by 9.5%; beyond the steel-water interface AcurosXB and AAA overestimated the dose by 3.6% and 7.7% respectively. For the lung phantom configuration, AcurosXB and AAA were in agreement with MC within 2% throughout the phantom. These results demonstrate improved performance of AcurosXB as compared to AAA in considered conditions. © 2012 American Association of Physicists in Medicine.

  11. Altitude-Wind-Tunnel Investigation of Westinghouse 19B-2 19B-8, and 19XB-1 Jet-Propulsion Engines. Part 1; Operational Characteristics (United States)

    Fleming, William A.


    An investigation was conducted in the NACA Cleveland altitude wind tunnel to determine the operational characteristics of the Westinghouse 19B-2, 19B-8, and 19XB-l jet-propulsion engines. The 19B engine is one af the earliest experimental Westinghouse axial flow engines. The 19XB-1 engine is an experimental prototype of the Westinghouse 15 series, having a rated thrust of 1400 pounds. Improvements in performance and operational characteristics have resulted in the 19XB-2B engine with a rated thrust of 1600 pounds. The operational characteristics were determined over a range of simulated altitudes from 5000 to 30,000 feet for the 19B engines and from 5000 to 35000 feet for the 19XB-l engine at airspeed from 20 to 380 miles per hour. The affects of altitude and airspeed on such operating characteristics as operating range, stability of combustion, starting, acceleration, and functioning of the fuel-control system are discussed. Damage to the engines that occurred during the investigation is also briefly discussed. The changes made in the combustion-chamber configuration to improve the operating we are described.

  12. A comparison of two dose calculation algorithms-anisotropic analytical algorithm and Acuros XB-for radiation therapy planning of canine intranasal tumors. (United States)

    Nagata, Koichi; Pethel, Timothy D


    Although anisotropic analytical algorithm (AAA) and Acuros XB (AXB) are both radiation dose calculation algorithms that take into account the heterogeneity within the radiation field, Acuros XB is inherently more accurate. The purpose of this retrospective method comparison study was to compare them and evaluate the dose discrepancy within the planning target volume (PTV). Radiation therapy (RT) plans of 11 dogs with intranasal tumors treated by radiation therapy at the University of Georgia were evaluated. All dogs were planned for intensity-modulated radiation therapy using nine coplanar X-ray beams that were equally spaced, then dose calculated with anisotropic analytical algorithm. The same plan with the same monitor units was then recalculated using Acuros XB for comparisons. Each dog's planning target volume was separated into air, bone, and tissue and evaluated. The mean dose to the planning target volume estimated by Acuros XB was 1.3% lower. It was 1.4% higher for air, 3.7% lower for bone, and 0.9% lower for tissue. The volume of planning target volume covered by the prescribed dose decreased by 21% when Acuros XB was used due to increased dose heterogeneity within the planning target volume. Anisotropic analytical algorithm relatively underestimates the dose heterogeneity and relatively overestimates the dose to the bone and tissue within the planning target volume for the radiation therapy planning of canine intranasal tumors. This can be clinically significant especially if the tumor cells are present within the bone, because it may result in relative underdosing of the tumor. © 2017 American College of Veterinary Radiology.

  13. Temperature dependence of the electrical resistivity of amorphous Co 80-xEr xB 20 alloys (United States)

    Touraghe, O.; Khatami, M.; Menny, A.; Lassri, H.; Nouneh, K.


    The temperature dependence of the electrical resistivity of amorphous Co 80-xEr xB 20 alloys with x=0, 3.9, 7.5 and 8.6 prepared by melt spinning in pure argon atmosphere was studied. All amorphous alloys investigated here are found to exhibit a resistivity minimum at low temperature. The electrical resistivity exhibits logarithmic temperature dependence below the temperature of resistivity minimum Tmin. In addition, the resistivity shows quadratic temperature behavior in the interval Tmin< T<77 K. At high temperature, the electrical resistivity was discussed by the extended Ziman theory. For the whole series of alloys, the composition dependence of the temperature coefficient of electrical resistivity α shows a change in structural short range occurring in the composition range 8-9 at%.

  14. The {P,Q,k+1}-Reflexive Solution to System of Matrix Equations AX=C, XB=D

    Directory of Open Access Journals (Sweden)

    Chang-Zhou Dong


    Full Text Available Let P∈Cm×m and Q∈Cn×n be Hermitian and {k+1}-potent matrices; that is, Pk+1=P=P⁎ and Qk+1=Q=Q⁎, where ·⁎ stands for the conjugate transpose of a matrix. A matrix X∈Cm×n is called {P,Q,k+1}-reflexive (antireflexive if PXQ=X (PXQ=-X. In this paper, the system of matrix equations AX=C and XB=D subject to {P,Q,k+1}-reflexive and antireflexive constraints is studied by converting into two simpler cases: k=1 and k=2. We give the solvability conditions and the general solution to this system; in addition, the least squares solution is derived; finally, the associated optimal approximation problem for a given matrix is considered.

  15. Phosphatidylinositol 3-Kinase-Associated Protein (PI3KAP)/XB130 Crosslinks Actin Filaments through Its Actin Binding and Multimerization Properties In Vitro and Enhances Endocytosis in HEK293 Cells. (United States)

    Yamanaka, Daisuke; Akama, Takeshi; Chida, Kazuhiro; Minami, Shiro; Ito, Koichi; Hakuno, Fumihiko; Takahashi, Shin-Ichiro


    Actin-crosslinking proteins control actin filament networks and bundles and contribute to various cellular functions including regulation of cell migration, cell morphology, and endocytosis. Phosphatidylinositol 3-kinase-associated protein (PI3KAP)/XB130 has been reported to be localized to actin filaments (F-actin) and required for cell migration in thyroid carcinoma cells. Here, we show a role for PI3KAP/XB130 as an actin-crosslinking protein. First, we found that the carboxyl terminal region of PI3KAP/XB130 containing amino acid residues 830-840 was required and sufficient for localization to F-actin in NIH3T3 cells, and this region is directly bound to F-actin in vitro. Moreover, actin-crosslinking assay revealed that recombinant PI3KAP/XB130 crosslinked F-actin. In general, actin-crosslinking proteins often multimerize to assemble multiple actin-binding sites. We then investigated whether PI3KAP/XB130 could form a multimer. Blue native-PAGE analysis showed that recombinant PI3KAP/XB130 was detected at 250-1200 kDa although the molecular mass was approximately 125 kDa, suggesting that PI3KAP/XB130 formed multimers. Furthermore, we found that the amino terminal 40 amino acids were required for this multimerization by co-immunoprecipitation assay in HEK293T cells. Deletion mutants of PI3KAP/XB130 lacking the actin-binding region or the multimerizing region did not crosslink actin filaments, indicating that actin binding and multimerization of PI3KAP/XB130 were necessary to crosslink F-actin. Finally, we examined roles of PI3KAP/XB130 on endocytosis, an actin-related biological process. Overexpression of PI3KAP/XB130 enhanced dextran uptake in HEK 293 cells. However, most of the cells transfected with the deletion mutant lacking the actin-binding region incorporated dextran to a similar extent as control cells. Taken together, these results demonstrate that PI3KAP/XB130 crosslinks F-actin through both its actin-binding region and multimerizing region and plays

  16. Phosphatidylinositol 3-kinase-associated protein (PI3KAP/XB130 crosslinks actin filaments through its actin binding and multimerization properties in vitro and enhances endocytosis in HEK293 cells.

    Directory of Open Access Journals (Sweden)

    Daisuke Yamanaka


    Full Text Available Actin-crosslinking proteins control actin filament networks and bundles and contribute to various cellular functions including regulation of cell migration, cell morphology and endocytosis. Phosphatidylinositol 3-kinase-associated protein (PI3KAP/XB130 has been reported to be localized to actin filaments (F-actin and required for cell migration in thyroid carcinoma cells. Here we show a role for PI3KAP/XB130 as an actin-crosslinking protein. First, we found that the carboxyl terminal region of PI3KAP/XB130 containing amino acid residues 830-840 was required and sufficient for localization to F-actin in NIH3T3 cells and this region directly bound to F-actin in vitro. Moreover, actin crosslinking assay revealed that recombinant PI3KAP/XB130 crosslinked F-actin. In general, actin-crosslinking proteins often multimerize to assemble multiple actin-binding sites. We then investigated whether PI3KAP/XB130 could form a multimer. Blue native (BN-PAGE analysis showed that recombinant PI3KAP/XB130 was detected at 250 kDa-1200 kDa although the molecular mass was approximately 125 kDa, suggesting that PI3KAP/XB130 formed multimers. Furthermore, we found that the amino terminal 40 amino acids were required for this multimerization by co-immunoprecipitation assay in HEK293T cells. Deletion mutants of PI3KAP/XB130 lacking the actin-binding region or the multimerizing region did not crosslink actin filaments, indicating that actin binding and multimerization of PI3KAP/XB130 were necessary to crosslink F-actin. Finally, we examined roles of PI3KAP/XB130 on endocytosis, an actin-related biological process. Overexpression of PI3KAP/XB130 enhanced dextran uptake in human embryonic kidney (HEK 293 cells. However, most of the cells transfected with the deletion mutant lacking the actin-binding region incorporated dextran to a similar extent as control cells. Taken together, these results demonstrate that PI3KAP/XB130 crosslinks F-actin through both its actin


    Energy Technology Data Exchange (ETDEWEB)

    Ferraro, F. R.; Pallanca, C.; Lanzoni, B.; Cadelano, M.; Dalessandro, E.; Mucciarelli, A. [Dipartimento di Fisica e Astronomia, Università degli Studi di Bologna, v.le Berti Pichat 6/2, I-40127 Bologna (Italy); Massari, D. [INAF-Osservatorio Astronomico di Bologna, via Ranzani 1, I-40127 Bologna (Italy)


    We report on the optical identification of the neutron star burster EXO 1745-248 in Terzan 5. The identification was performed by exploiting Hubble Space Telescope/Advanced Camera for Surveys images acquired in Director's Discretionary Time shortly after (approximately one month) the Swift detection of the X-ray burst. The comparison between these images and previous archival data revealed the presence of a star that is currently brightened by ∼3 mag, consistent with expectations during an X-ray outburst. The centroid of this object well agrees with the position, in the archival images, of a star located in the turn-off/sub-giant-branch region of Terzan 5. This supports the scenario that the companion should have recently filled its Roche Lobe. Such a system represents the prenatal stage of a millisecond pulsar, an evolutionary phase during which heavy mass accretion on the compact object occurs, thus producing X-ray outbursts and re-accelerating the neutron star.

  18. Altitude-Wind-Tunnel Investigation of the 19B-2, 19B-8 and 19XB-1 Jet- Propulsion Engines. 4; Analysis of Compressor Performance (United States)

    Dietz, Robert O.; Kuenzig, John K.


    Investigations were conducted in the Cleveland altitude wind tunnel to determine the performance and operational characteristics of the 19B-2, 19B-8, and 19XS-1 turbojet engines. One objective was to determine the effect of altitude, flight Mach number, and tail-pipe-nozzle area on the performance characteristics of the six-stage and ten-stage axial-flow compressors of the 19B-8 and 19XB-1 engines, respectively, The data were obtained over a range of simulated altitudes and flight Mach numbers. At each simulated flight condition the engine was run over its full operable range of speeds. Performance characteristics of the 19B-8 and 19XB-1 compressors for the range of operation obtainable in the turboJet-engine installation are presented. Compressor characteristics are presented as functions of air flow corrected to sea-level conditions, compressor Mach number, and compressor load coefficient. For the range of compressor operation investigated, changes in Reynolds number had no measurable effect on the relations among compressor Mach number, corrected air flow, compressor load coefficient, compressor pressure ratio, and compressor efficiency. The operating lines for the 19B-8 compressor lay on the low-air-flow side of the region of maximum compressor efficiency; the 19B-8 compressor operated at higher average pressure coefficients per stage and produced a lower over-all pressure ratio than did the 19XB-1 compressor.

  19. A Soft X-Ray Spectral Episode for the Clocked Burster, GS 1826-24 as Measured by Swift and NuSTAR (United States)

    Chenvez, J.; Galloway, D. K.; Zand, J. J. M. In 'T; Tomsick, J. A.; Barret, D.; Chakrabarty, D.; Fuerst, F.; Boggs, S. E.; Christensen, F. E.; Craig, W. W.; hide


    We report on NuSTAR and Swift observations of a soft state of the neutron star low-mass X-ray binary GS 1826-24, commonly known as the "clocked" burster. The transition to the soft state was recorded in 2014 June through an increase of the 2-20 keV source intensity measured by MAXI, simultaneous with a decrease of the 15-50 keV intensity measured by Swift/BAT. The episode lasted approximately two months, after which the source returned to its usual hard state. We analyze the broadband spectrum measured by Swift/XRT and NuSTAR and estimate the accretion rate during the soft episode to be approximately equal to 13% m(sub Edd), within the range of previous observations. However, the best-fit spectral model, adopting the double Comptonization used previously, exhibits significantly softer components. We detect seven type-I X-ray bursts, all significantly weaker (and with shorter rise and decay times) than observed previously. The burst profiles and recurrence times vary significantly, ruling out the regular bursts that are typical for this source. One burst exhibited photospheric radius expansion?and we estimate the source distance as (5.7 +/- 0.2) xi(sub b)(exp -1/2) kpc, where xi(sub b) parameterizes the possible anisotropy of the burst emission. The observed soft state may most likely be interpreted as a change in accretion geometry at about similar bolometric luminosity as in the hard state. The different burst behavior can therefore be attributed to this change in accretion flow geometry, but the fundamental cause and process for this effect remain unclear.

  20. Kinetic simulations of X-B and O-X-B mode conversion and its deterioration at high input power (United States)

    Arefiev, A. V.; Dodin, I. Y.; Köhn, A.; Du Toit, E. J.; Holzhauer, E.; Shevchenko, V. F.; Vann, R. G. L.


    Spherical tokamak plasmas are typically overdense and thus inaccessible to externally-injected microwaves in the electron cyclotron range. The electrostatic electron Bernstein wave (EBW), however, provides a method to access the plasma core for heating and diagnostic purposes. Understanding the details of the coupling process to electromagnetic waves is thus important both for the interpretation of microwave diagnostic data and for assessing the feasibility of EBW heating and current drive. While the coupling is reasonably well-understood in the linear regime, nonlinear physics arising from high input power has not been previously quantified. To tackle this problem, we have performed one- and two-dimensional fully kinetic particle-in-cell simulations of the two possible coupling mechanisms, namely X-B and O-X-B mode conversion. We find that the ion dynamics has a profound effect on the field structure in the nonlinear regime, as high amplitude short-scale oscillations of the longitudinal electric field are excited in the region below the high-density cut-off prior to the arrival of the EBW. We identify this effect as the instability of the X wave with respect to resonant scattering into an EBW and a lower-hybrid wave. We calculate the instability rate analytically and find this basic theory to be in reasonable agreement with our simulation results.

  1. Altitude-Wind-Tunnel Investigation of the 19B-2, 19B-8, and 19XB-1 Jet Propulsion Engines. 3; Performance and Windmilling Drag Characteristics (United States)

    Fleming, WIlliam A.; Dietz, Robert O., Jr.


    The performance characteristics of the 19B-8 and 19XB-1 turbojet engines and the windmilling-drag characteristics of the 19B-6 engine were determined in the Cleveland altitude wind tunnel. The investigations were conducted on the 19B-8 engine at simulated altitudes from 5000 to 25,000 feet with various free-stream ram-pressure ratios and on the 19XB--1 engine at simulated altitudes from 5000 to 30,000 feet with approximately static free-stream conditions. Data for these two engines are presented to show the effect of altitude, free-stream ram-pressure ratio, and tail-pipe-nozzle area on engine performance. A 21-percent reduction in tail-pipe-nozzle area of the 19B-8 engine increased the let thrust 43 percent the net thrust 72 percent, and the fuel consumption 64 percent. An increase in free-stream ram-pressure ratio raised the jet thrust and the air flow and lowered the net thrust throughout the entire range of engine speeds for the 19B-8 engine. At similar operating conditions, the corrected jet thrust and corrected air flow were approximately the same for both engines, and the corrected specific fuel consumption based on jet thrust was lower for the 19XB-1 engine than for the 19B-8 engine. The thrust and air-flow data obtained with both engines at various altitudes for a given free-stream rampressure ratio were generalized to standard sea-level atmospheric conditions. The performance parameters involving fuel consumption generalized only at high engine speeds at simulated altitudes as high as 15,000 feet. The windmilling drag of the 19B-8 engine increased rapidly as the airspeed was increased.

  2. Search for the $X_b$ and other hidden-beauty states in the $\\pi^+ \\pi^- \\Upsilon(1 \\rm S)$ channel at ATLAS

    CERN Document Server

    Aad, Georges; Abdallah, Jalal; Abdel Khalek, Samah; Abdinov, Ovsat; Aben, Rosemarie; Abi, Babak; Abolins, Maris; AbouZeid, Ossama; Abramowicz, Halina; Abreu, Henso; Abreu, Ricardo; Abulaiti, Yiming; Acharya, Bobby Samir; Adamczyk, Leszek; Adams, David; Adelman, Jahred; Adomeit, Stefanie; Adye, Tim; Agatonovic-Jovin, Tatjana; Aguilar-Saavedra, Juan Antonio; Agustoni, Marco; Ahlen, Steven; Ahmadov, Faig; Aielli, Giulio; Akerstedt, Henrik; Åkesson, Torsten Paul Ake; Akimoto, Ginga; Akimov, Andrei; Alberghi, Gian Luigi; Albert, Justin; Albrand, Solveig; Alconada Verzini, Maria Josefina; Aleksa, Martin; Aleksandrov, Igor; Alexa, Calin; Alexander, Gideon; Alexandre, Gauthier; Alexopoulos, Theodoros; Alhroob, Muhammad; Alimonti, Gianluca; Alio, Lion; Alison, John; Allbrooke, Benedict; Allison, Lee John; Allport, Phillip; Almond, John; Aloisio, Alberto; Alonso, Alejandro; Alonso, Francisco; Alpigiani, Cristiano; Altheimer, Andrew David; Alvarez Gonzalez, Barbara; Alviggi, Mariagrazia; Amako, Katsuya; Amaral Coutinho, Yara; Amelung, Christoph; Amidei, Dante; Amor Dos Santos, Susana Patricia; Amorim, Antonio; Amoroso, Simone; Amram, Nir; Amundsen, Glenn; Anastopoulos, Christos; Ancu, Lucian Stefan; Andari, Nansi; Andeen, Timothy; Anders, Christoph Falk; Anders, Gabriel; Anderson, Kelby; Andreazza, Attilio; Andrei, George Victor; Anduaga, Xabier; Angelidakis, Stylianos; Angelozzi, Ivan; Anger, Philipp; Angerami, Aaron; Anghinolfi, Francis; Anisenkov, Alexey; Anjos, Nuno; Annovi, Alberto; Antonaki, Ariadni; Antonelli, Mario; Antonov, Alexey; Antos, Jaroslav; Anulli, Fabio; Aoki, Masato; Aperio Bella, Ludovica; Apolle, Rudi; Arabidze, Giorgi; Aracena, Ignacio; Arai, Yasuo; Araque, Juan Pedro; Arce, Ayana; Arguin, Jean-Francois; Argyropoulos, Spyridon; Arik, Metin; Armbruster, Aaron James; Arnaez, Olivier; Arnal, Vanessa; Arnold, Hannah; Arratia, Miguel; Arslan, Ozan; Artamonov, Andrei; Artoni, Giacomo; Asai, Shoji; Asbah, Nedaa; Ashkenazi, Adi; Åsman, Barbro; Asquith, Lily; Assamagan, Ketevi; Astalos, Robert; Atkinson, Markus; Atlay, Naim Bora; Auerbach, Benjamin; Augsten, Kamil; Aurousseau, Mathieu; Avolio, Giuseppe; Azuelos, Georges; Azuma, Yuya; Baak, Max; Baas, Alessandra; Bacci, Cesare; Bachacou, Henri; Bachas, Konstantinos; Backes, Moritz; Backhaus, Malte; Backus Mayes, John; Badescu, Elisabeta; Bagiacchi, Paolo; Bagnaia, Paolo; Bai, Yu; Bain, Travis; Baines, John; Baker, Oliver Keith; Balek, Petr; Balli, Fabrice; Banas, Elzbieta; Banerjee, Swagato; Bannoura, Arwa A E; Bansal, Vikas; Bansil, Hardeep Singh; Barak, Liron; Baranov, Sergei; Barberio, Elisabetta Luigia; Barberis, Dario; Barbero, Marlon; Barillari, Teresa; Barisonzi, Marcello; Barklow, Timothy; Barlow, Nick; Barnett, Bruce; Barnett, Michael; Barnovska, Zuzana; Baroncelli, Antonio; Barone, Gaetano; Barr, Alan; Barreiro, Fernando; Barreiro Guimarães da Costa, João; Bartoldus, Rainer; Barton, Adam Edward; Bartos, Pavol; Bartsch, Valeria; Bassalat, Ahmed; Basye, Austin; Bates, Richard; Batley, Richard; Battaglia, Marco; Battistin, Michele; Bauer, Florian; Bawa, Harinder Singh; Beattie, Michael David; Beau, Tristan; Beauchemin, Pierre-Hugues; Beccherle, Roberto; Bechtle, Philip; Beck, Hans Peter; Becker, Anne Kathrin; Becker, Sebastian; Beckingham, Matthew; Becot, Cyril; Beddall, Andrew; Beddall, Ayda; Bedikian, Sourpouhi; Bednyakov, Vadim; Bee, Christopher; Beemster, Lars; Beermann, Thomas; Begel, Michael; Behr, Katharina; Belanger-Champagne, Camille; Bell, Paul; Bell, William; Bella, Gideon; Bellagamba, Lorenzo; Bellerive, Alain; Bellomo, Massimiliano; Belotskiy, Konstantin; Beltramello, Olga; Benary, Odette; Benchekroun, Driss; Bendtz, Katarina; Benekos, Nektarios; Benhammou, Yan; Benhar Noccioli, Eleonora; Benitez Garcia, Jorge-Armando; Benjamin, Douglas; Bensinger, James; Benslama, Kamal; Bentvelsen, Stan; Berge, David; Bergeaas Kuutmann, Elin; Berger, Nicolas; Berghaus, Frank; Beringer, Jürg; Bernard, Clare; Bernat, Pauline; Bernius, Catrin; Bernlochner, Florian Urs; Berry, Tracey; Berta, Peter; Bertella, Claudia; Bertoli, Gabriele; Bertolucci, Federico; Bertsche, Carolyn; Bertsche, David; Besana, Maria Ilaria; Besjes, Geert-Jan; Bessidskaia, Olga; Bessner, Martin Florian; Besson, Nathalie; Betancourt, Christopher; Bethke, Siegfried; Bhimji, Wahid; Bianchi, Riccardo-Maria; Bianchini, Louis; Bianco, Michele; Biebel, Otmar; Bieniek, Stephen Paul; Bierwagen, Katharina; Biesiada, Jed; Biglietti, Michela; Bilbao De Mendizabal, Javier; Bilokon, Halina; Bindi, Marcello; Binet, Sebastien; Bingul, Ahmet; Bini, Cesare; Black, Curtis; Black, James; Black, Kevin; Blackburn, Daniel; Blair, Robert; Blanchard, Jean-Baptiste; Blazek, Tomas; Bloch, Ingo; Blocker, Craig; Blum, Walter; Blumenschein, Ulrike; Bobbink, Gerjan; Bobrovnikov, Victor; Bocchetta, Simona Serena; Bocci, Andrea; Bock, Christopher; Boddy, Christopher Richard; Boehler, Michael; Boek, Thorsten Tobias; Bogaerts, Joannes Andreas; Bogdanchikov, Alexander; Bogouch, Andrei; Bohm, Christian; Bohm, Jan; Boisvert, Veronique; Bold, Tomasz; Boldea, Venera; Boldyrev, Alexey; Bomben, Marco; Bona, Marcella; Boonekamp, Maarten; Borisov, Anatoly; Borissov, Guennadi; Borri, Marcello; Borroni, Sara; Bortfeldt, Jonathan; Bortolotto, Valerio; Bos, Kors; Boscherini, Davide; Bosman, Martine; Boterenbrood, Hendrik; Boudreau, Joseph; Bouffard, Julian; Bouhova-Thacker, Evelina Vassileva; Boumediene, Djamel Eddine; Bourdarios, Claire; Bousson, Nicolas; Boutouil, Sara; Boveia, Antonio; Boyd, James; Boyko, Igor; Bozic, Ivan; Bracinik, Juraj; Brandt, Andrew; Brandt, Gerhard; Brandt, Oleg; Bratzler, Uwe; Brau, Benjamin; Brau, James; Braun, Helmut; Brazzale, Simone Federico; Brelier, Bertrand; Brendlinger, Kurt; Brennan, Amelia Jean; Brenner, Richard; Bressler, Shikma; Bristow, Kieran; Bristow, Timothy Michael; Britton, Dave; Brochu, Frederic; Brock, Ian; Brock, Raymond; Bromberg, Carl; Bronner, Johanna; Brooijmans, Gustaaf; Brooks, Timothy; Brooks, William; Brosamer, Jacquelyn; Brost, Elizabeth; Brown, Jonathan; Bruckman de Renstrom, Pawel; Bruncko, Dusan; Bruneliere, Renaud; Brunet, Sylvie; Bruni, Alessia; Bruni, Graziano; Bruschi, Marco; Bryngemark, Lene; Buanes, Trygve; Buat, Quentin; Bucci, Francesca; Buchholz, Peter; Buckingham, Ryan; Buckley, Andrew; Buda, Stelian Ioan; Budagov, Ioulian; Buehrer, Felix; Bugge, Lars; Bugge, Magnar Kopangen; Bulekov, Oleg; Bundock, Aaron Colin; Burckhart, Helfried; Burdin, Sergey; Burghgrave, Blake; Burke, Stephen; Burmeister, Ingo; Busato, Emmanuel; Büscher, Daniel; Büscher, Volker; Bussey, Peter; Buszello, Claus-Peter; Butler, Bart; Butler, John; Butt, Aatif Imtiaz; Buttar, Craig; Butterworth, Jonathan; Butti, Pierfrancesco; Buttinger, William; Buzatu, Adrian; Byszewski, Marcin; Cabrera Urbán, Susana; Caforio, Davide; Cakir, Orhan; Calafiura, Paolo; Calandri, Alessandro; Calderini, Giovanni; Calfayan, Philippe; Calkins, Robert; Caloba, Luiz; Calvet, David; Calvet, Samuel; Camacho Toro, Reina; Camarda, Stefano; Cameron, David; Caminada, Lea Michaela; Caminal Armadans, Roger; Campana, Simone; Campanelli, Mario; Campoverde, Angel; Canale, Vincenzo; Canepa, Anadi; Cano Bret, Marc; Cantero, Josu; Cantrill, Robert; Cao, Tingting; Capeans Garrido, Maria Del Mar; Caprini, Irinel; Caprini, Mihai; Capua, Marcella; Caputo, Regina; Cardarelli, Roberto; Carli, Tancredi; Carlino, Gianpaolo; Carminati, Leonardo; Caron, Sascha; Carquin, Edson; Carrillo-Montoya, German D; Carter, Janet; Carvalho, João; Casadei, Diego; Casado, Maria Pilar; Casolino, Mirkoantonio; Castaneda-Miranda, Elizabeth; Castelli, Angelantonio; Castillo Gimenez, Victoria; Castro, Nuno Filipe; Catastini, Pierluigi; Catinaccio, Andrea; Catmore, James; Cattai, Ariella; Cattani, Giordano; Caudron, Julien; Cavaliere, Viviana; Cavalli, Donatella; Cavalli-Sforza, Matteo; Cavasinni, Vincenzo; Ceradini, Filippo; Cerio, Benjamin; Cerny, Karel; Santiago Cerqueira, Augusto; Cerri, Alessandro; Cerrito, Lucio; Cerutti, Fabio; Cerv, Matevz; Cervelli, Alberto; Cetin, Serkant Ali; Chafaq, Aziz; Chakraborty, Dhiman; Chalupkova, Ina; Chang, Philip; Chapleau, Bertrand; Chapman, John Derek; Charfeddine, Driss; Charlton, Dave; Chau, Chav Chhiv; Chavez Barajas, Carlos Alberto; Cheatham, Susan; Chegwidden, Andrew; Chekanov, Sergei; Chekulaev, Sergey; Chelkov, Gueorgui; Chelstowska, Magda Anna; Chen, Chunhui; Chen, Hucheng; Chen, Karen; Chen, Liming; Chen, Shenjian; Chen, Xin; Chen, Ye; Chen, Yujiao; Cheng, Hok Chuen; Cheng, Yangyang; Cheplakov, Alexander; Cherkaoui El Moursli, Rajaa; Chernyatin, Valeriy; Cheu, Elliott; Chevalier, Laurent; Chiarella, Vitaliano; Chiefari, Giovanni; Childers, John Taylor; Chilingarov, Alexandre; Chiodini, Gabriele; Chisholm, Andrew; Chislett, Rebecca Thalatta; Chitan, Adrian; Chizhov, Mihail; Chouridou, Sofia; Chow, Bonnie Kar Bo; Chromek-Burckhart, Doris; Chu, Ming-Lee; Chudoba, Jiri; Chwastowski, Janusz; Chytka, Ladislav; Ciapetti, Guido; Ciftci, Abbas Kenan; Ciftci, Rena; Cinca, Diane; Cindro, Vladimir; Ciocio, Alessandra; Cirkovic, Predrag; Citron, Zvi Hirsh; Citterio, Mauro; Ciubancan, Mihai; Clark, Allan G; Clark, Philip James; Clarke, Robert; Cleland, Bill; Clemens, Jean-Claude; Clement, Christophe; Coadou, Yann; Cobal, Marina; Coccaro, Andrea; Cochran, James H; Coffey, Laurel; Cogan, Joshua Godfrey; Coggeshall, James; Cole, Brian; Cole, Stephen; Colijn, Auke-Pieter; Collot, Johann; Colombo, Tommaso; Colon, German; Compostella, Gabriele; Conde Muiño, Patricia; Coniavitis, Elias; Conidi, Maria Chiara; Connell, Simon Henry; Connelly, Ian; Consonni, Sofia Maria; Consorti, Valerio; Constantinescu, Serban; Conta, Claudio; Conti, Geraldine; Conventi, Francesco; Cooke, Mark; Cooper, Ben; Cooper-Sarkar, Amanda; Cooper-Smith, Neil; Copic, Katherine; Cornelissen, Thijs; Corradi, Massimo; Corriveau, Francois; Corso-Radu, Alina; Cortes-Gonzalez, Arely; Cortiana, Giorgio; Costa, Giuseppe; Costa, María José; Costanzo, Davide; Côté, David; Cottin, Giovanna; Cowan, Glen; Cox, Brian; Cranmer, Kyle; Cree, Graham; Crépé-Renaudin, Sabine; Crescioli, Francesco; Cribbs, Wayne Allen; Crispin Ortuzar, Mireia; Cristinziani, Markus; Croft, Vince; Crosetti, Giovanni; Cuciuc, Constantin-Mihai; Cuhadar Donszelmann, Tulay; Cummings, Jane; Curatolo, Maria; Cuthbert, Cameron; Czirr, Hendrik; Czodrowski, Patrick; Czyczula, Zofia; D'Auria, Saverio; D'Onofrio, Monica; Da Cunha Sargedas De Sousa, Mario Jose; Da Via, Cinzia; Dabrowski, Wladyslaw; Dafinca, Alexandru; Dai, Tiesheng; Dale, Orjan; Dallaire, Frederick; Dallapiccola, Carlo; Dam, Mogens; Daniells, Andrew Christopher; Dano Hoffmann, Maria; Dao, Valerio; Darbo, Giovanni; Darmora, Smita; Dassoulas, James; Dattagupta, Aparajita; Davey, Will; David, Claire; Davidek, Tomas; Davies, Eleanor; Davies, Merlin; Davignon, Olivier; Davison, Adam; Davison, Peter; Davygora, Yuriy; Dawe, Edmund; Dawson, Ian; Daya-Ishmukhametova, Rozmin; De, Kaushik; de Asmundis, Riccardo; De Castro, Stefano; De Cecco, Sandro; De Groot, Nicolo; de Jong, Paul; De la Torre, Hector; De Lorenzi, Francesco; De Nooij, Lucie; De Pedis, Daniele; De Salvo, Alessandro; De Sanctis, Umberto; De Santo, Antonella; De Vivie De Regie, Jean-Baptiste; Dearnaley, William James; Debbe, Ramiro; Debenedetti, Chiara; Dechenaux, Benjamin; Dedovich, Dmitri; Deigaard, Ingrid; Del Peso, Jose; Del Prete, Tarcisio; Deliot, Frederic; Delitzsch, Chris Malena; Deliyergiyev, Maksym; Dell'Acqua, Andrea; Dell'Asta, Lidia; Dell'Orso, Mauro; Della Pietra, Massimo; della Volpe, Domenico; Delmastro, Marco; Delsart, Pierre-Antoine; Deluca, Carolina; Demers, Sarah; Demichev, Mikhail; Demilly, Aurelien; Denisov, Sergey; Derendarz, Dominik; Derkaoui, Jamal Eddine; Derue, Frederic; Dervan, Paul; Desch, Klaus Kurt; Deterre, Cecile; Deviveiros, Pier-Olivier; Dewhurst, Alastair; Dhaliwal, Saminder; Di Ciaccio, Anna; Di Ciaccio, Lucia; Di Domenico, Antonio; Di Donato, Camilla; Di Girolamo, Alessandro; Di Girolamo, Beniamino; Di Mattia, Alessandro; Di Micco, Biagio; Di Nardo, Roberto; Di Simone, Andrea; Di Sipio, Riccardo; Di Valentino, David; Dias, Flavia; Diaz, Marco Aurelio; Diehl, Edward; Dietrich, Janet; Dietzsch, Thorsten; Diglio, Sara; Dimitrievska, Aleksandra; Dingfelder, Jochen; Dionisi, Carlo; Dita, Petre; Dita, Sanda; Dittus, Fridolin; Djama, Fares; Djobava, Tamar; Djuvsland, Julia Isabell; Barros do Vale, Maria Aline; Do Valle Wemans, André; Dobos, Daniel; Doglioni, Caterina; Doherty, Tom; Dohmae, Takeshi; Dolejsi, Jiri; Dolezal, Zdenek; Dolgoshein, Boris; Donadelli, Marisilvia; Donati, Simone; Dondero, Paolo; Donini, Julien; Dopke, Jens; Doria, Alessandra; Dova, Maria-Teresa; Doyle, Tony; Dris, Manolis; Dubbert, Jörg; Dube, Sourabh; Dubreuil, Emmanuelle; Duchovni, Ehud; Duckeck, Guenter; Ducu, Otilia Anamaria; Duda, Dominik; Dudarev, Alexey; Dudziak, Fanny; Duflot, Laurent; Duguid, Liam; Dührssen, Michael; Dunford, Monica; Duran Yildiz, Hatice; Düren, Michael; Durglishvili, Archil; Dwuznik, Michal; Dyndal, Mateusz; Ebke, Johannes; Edson, William; Edwards, Nicholas Charles; Ehrenfeld, Wolfgang; Eifert, Till; Eigen, Gerald; Einsweiler, Kevin; Ekelof, Tord; El Kacimi, Mohamed; Ellert, Mattias; Elles, Sabine; Ellinghaus, Frank; Ellis, Nicolas; Elmsheuser, Johannes; Elsing, Markus; Emeliyanov, Dmitry; Enari, Yuji; Endner, Oliver Chris; Endo, Masaki; Engelmann, Roderich; Erdmann, Johannes; Ereditato, Antonio; Eriksson, Daniel; Ernis, Gunar; Ernst, Jesse; Ernst, Michael; Ernwein, Jean; Errede, Deborah; Errede, Steven; Ertel, Eugen; Escalier, Marc; Esch, Hendrik; Escobar, Carlos; Esposito, Bellisario; Etienvre, Anne-Isabelle; Etzion, Erez; Evans, Hal; Ezhilov, Alexey; Fabbri, Laura; Facini, Gabriel; Fakhrutdinov, Rinat; Falciano, Speranza; Falla, Rebecca Jane; Faltova, Jana; Fang, Yaquan; Fanti, Marcello; Farbin, Amir; Farilla, Addolorata; Farooque, Trisha; Farrell, Steven; Farrington, Sinead; Farthouat, Philippe; Fassi, Farida; Fassnacht, Patrick; Fassouliotis, Dimitrios; Favareto, Andrea; Fayard, Louis; Federic, Pavol; Fedin, Oleg; Fedorko, Wojciech; Fehling-Kaschek, Mirjam; Feigl, Simon; Feligioni, Lorenzo; Feng, Cunfeng; Feng, Eric; Feng, Haolu; Fenyuk, Alexander; Fernandez Perez, Sonia; Ferrag, Samir; Ferrando, James; Ferrari, Arnaud; Ferrari, Pamela; Ferrari, Roberto; Ferreira de Lima, Danilo Enoque; Ferrer, Antonio; Ferrere, Didier; Ferretti, Claudio; Ferretto Parodi, Andrea; Fiascaris, Maria; Fiedler, Frank; Filipčič, Andrej; Filipuzzi, Marco; Filthaut, Frank; Fincke-Keeler, Margret; Finelli, Kevin Daniel; Fiolhais, Miguel; Fiorini, Luca; Firan, Ana; Fischer, Adam; Fischer, Julia; Fisher, Wade Cameron; Fitzgerald, Eric Andrew; Flechl, Martin; Fleck, Ivor; Fleischmann, Philipp; Fleischmann, Sebastian; Fletcher, Gareth Thomas; Fletcher, Gregory; Flick, Tobias; Floderus, Anders; Flores Castillo, Luis; Florez Bustos, Andres Carlos; Flowerdew, Michael; Formica, Andrea; Forti, Alessandra; Fortin, Dominique; Fournier, Daniel; Fox, Harald; Fracchia, Silvia; Francavilla, Paolo; Franchini, Matteo; Franchino, Silvia; Francis, David; Franconi, Laura; Franklin, Melissa; Franz, Sebastien; Fraternali, Marco; French, Sky; Friedrich, Conrad; Friedrich, Felix; Froidevaux, Daniel; Frost, James; Fukunaga, Chikara; Fullana Torregrosa, Esteban; Fulsom, Bryan Gregory; Fuster, Juan; Gabaldon, Carolina; Gabizon, Ofir; Gabrielli, Alessandro; Gabrielli, Andrea; Gadatsch, Stefan; Gadomski, Szymon; Gagliardi, Guido; Gagnon, Pauline; Galea, Cristina; Galhardo, Bruno; Gallas, Elizabeth; Gallo, Valentina Santina; Gallop, Bruce; Gallus, Petr; Galster, Gorm Aske Gram Krohn; Gan, KK; Gao, Jun; Gao, Yongsheng; Garay Walls, Francisca; Garberson, Ford; García, Carmen; García Navarro, José Enrique; Garcia-Sciveres, Maurice; Gardner, Robert; Garelli, Nicoletta; Garonne, Vincent; Gatti, Claudio; Gaudio, Gabriella; Gaur, Bakul; Gauthier, Lea; Gauzzi, Paolo; Gavrilenko, Igor; Gay, Colin; Gaycken, Goetz; Gazis, Evangelos; Ge, Peng; Gecse, Zoltan; Gee, Norman; Geerts, Daniël Alphonsus Adrianus; Geich-Gimbel, Christoph; Gellerstedt, Karl; Gemme, Claudia; Gemmell, Alistair; Genest, Marie-Hélène; Gentile, Simonetta; George, Matthias; George, Simon; Gerbaudo, Davide; Gershon, Avi; Ghazlane, Hamid; Ghodbane, Nabil; Giacobbe, Benedetto; Giagu, Stefano; Giangiobbe, Vincent; Giannetti, Paola; Gianotti, Fabiola; Gibbard, Bruce; Gibson, Stephen; Gilchriese, Murdock; Gillam, Thomas; Gillberg, Dag; Gilles, Geoffrey; Gingrich, Douglas; Giokaris, Nikos; Giordani, MarioPaolo; Giordano, Raffaele; Giorgi, Filippo Maria; Giorgi, Francesco Michelangelo; Giraud, Pierre-Francois; Giugni, Danilo; Giuliani, Claudia; Giulini, Maddalena; Gjelsten, Børge Kile; Gkaitatzis, Stamatios; Gkialas, Ioannis; Gladilin, Leonid; Glasman, Claudia; Glatzer, Julian; Glaysher, Paul; Glazov, Alexandre; Glonti, George; Goblirsch-Kolb, Maximilian; Goddard, Jack Robert; Godlewski, Jan; Goeringer, Christian; Goldfarb, Steven; Golling, Tobias; Golubkov, Dmitry; Gomes, Agostinho; Gomez Fajardo, Luz Stella; Gonçalo, Ricardo; Goncalves Pinto Firmino Da Costa, Joao; Gonella, Laura; González de la Hoz, Santiago; Gonzalez Parra, Garoe; Gonzalez-Sevilla, Sergio; Goossens, Luc; Gorbounov, Petr Andreevich; Gordon, Howard; Gorelov, Igor; Gorini, Benedetto; Gorini, Edoardo; Gorišek, Andrej; Gornicki, Edward; Goshaw, Alfred; Gössling, Claus; Gostkin, Mikhail Ivanovitch; Gouighri, Mohamed; Goujdami, Driss; Goulette, Marc Phillippe; Goussiou, Anna; Goy, Corinne; Gozpinar, Serdar; Grabas, Herve Marie Xavier; Graber, Lars; Grabowska-Bold, Iwona; Grafström, Per; Grahn, Karl-Johan; Gramling, Johanna; Gramstad, Eirik; Grancagnolo, Sergio; Grassi, Valerio; Gratchev, Vadim; Gray, Heather; Graziani, Enrico; Grebenyuk, Oleg; Greenwood, Zeno Dixon; Gregersen, Kristian; Gregor, Ingrid-Maria; Grenier, Philippe; Griffiths, Justin; Grillo, Alexander; Grimm, Kathryn; Grinstein, Sebastian; Gris, Philippe Luc Yves; Grishkevich, Yaroslav; Grivaz, Jean-Francois; Grohs, Johannes Philipp; Grohsjean, Alexander; Gross, Eilam; Grosse-Knetter, Joern; Grossi, Giulio Cornelio; Groth-Jensen, Jacob; Grout, Zara Jane; Guan, Liang; Guenther, Jaroslav; Guescini, Francesco; Guest, Daniel; Gueta, Orel; Guicheney, Christophe; Guido, Elisa; Guillemin, Thibault; Guindon, Stefan; Gul, Umar; Gumpert, Christian; Guo, Jun; Gupta, Shaun; Gutierrez, Phillip; Gutierrez Ortiz, Nicolas Gilberto; Gutschow, Christian; Guttman, Nir; Guyot, Claude; Gwenlan, Claire; Gwilliam, Carl; Haas, Andy; Haber, Carl; Hadavand, Haleh Khani; Haddad, Nacim; Haefner, Petra; Hageböck, Stephan; Hajduk, Zbigniew; Hakobyan, Hrachya; Haleem, Mahsana; Hall, David; Halladjian, Garabed; Hamacher, Klaus; Hamal, Petr; Hamano, Kenji; Hamer, Matthias; Hamilton, Andrew; Hamilton, Samuel; Hamity, Guillermo Nicolas; Hamnett, Phillip George; Han, Liang; Hanagaki, Kazunori; Hanawa, Keita; Hance, Michael; Hanke, Paul; Hanna, Remie; Hansen, Jørgen Beck; Hansen, Jorn Dines; Hansen, Peter Henrik; Hara, Kazuhiko; Hard, Andrew; Harenberg, Torsten; Hariri, Faten; Harkusha, Siarhei; Harper, Devin; Harrington, Robert; Harris, Orin; Harrison, Paul Fraser; Hartjes, Fred; Hasegawa, Makoto; Hasegawa, Satoshi; Hasegawa, Yoji; Hasib, A; Hassani, Samira; Haug, Sigve; Hauschild, Michael; Hauser, Reiner; Havranek, Miroslav; Hawkes, Christopher; Hawkings, Richard John; Hawkins, Anthony David; Hayashi, Takayasu; Hayden, Daniel; Hays, Chris; Hayward, Helen; Haywood, Stephen; Head, Simon; Heck, Tobias; Hedberg, Vincent; Heelan, Louise; Heim, Sarah; Heim, Timon; Heinemann, Beate; Heinrich, Lukas; Hejbal, Jiri; Helary, Louis; Heller, Claudio; Heller, Matthieu; Hellman, Sten; Hellmich, Dennis; Helsens, Clement; Henderson, James; Henderson, Robert; Heng, Yang; Hengler, Christopher; Henrichs, Anna; Henriques Correia, Ana Maria; Henrot-Versille, Sophie; Herbert, Geoffrey Henry; Hernández Jiménez, Yesenia; Herrberg-Schubert, Ruth; Herten, Gregor; Hertenberger, Ralf; Hervas, Luis; Hesketh, Gavin Grant; Hessey, Nigel; Hickling, Robert; Higón-Rodriguez, Emilio; Hill, Ewan; Hill, John; Hiller, Karl Heinz; Hillert, Sonja; Hillier, Stephen; Hinchliffe, Ian; Hines, Elizabeth; Hirose, Minoru; Hirschbuehl, Dominic; Hobbs, John; Hod, Noam; Hodgkinson, Mark; Hodgson, Paul; Hoecker, Andreas; Hoeferkamp, Martin; Hoenig, Friedrich; Hoffman, Julia; Hoffmann, Dirk; Hohlfeld, Marc; Holmes, Tova Ray; Hong, Tae Min; Hooft van Huysduynen, Loek; Hopkins, Walter; Horii, Yasuyuki; Hostachy, Jean-Yves; Hou, Suen; Hoummada, Abdeslam; Howard, Jacob; Howarth, James; Hrabovsky, Miroslav; Hristova, Ivana; Hrivnac, Julius; Hryn'ova, Tetiana; Hsu, Catherine; Hsu, Pai-hsien Jennifer; Hsu, Shih-Chieh; Hu, Diedi; Hu, Xueye; Huang, Yanping; Hubacek, Zdenek; Hubaut, Fabrice; Huegging, Fabian; Huffman, Todd Brian; Hughes, Emlyn; Hughes, Gareth; Huhtinen, Mika; Hülsing, Tobias Alexander; Hurwitz, Martina; Huseynov, Nazim; Huston, Joey; Huth, John; Iacobucci, Giuseppe; Iakovidis, Georgios; Ibragimov, Iskander; Iconomidou-Fayard, Lydia; Ideal, Emma; Idrissi, Zineb; Iengo, Paolo; Igonkina, Olga; Iizawa, Tomoya; Ikegami, Yoichi; Ikematsu, Katsumasa; Ikeno, Masahiro; Ilchenko, Iurii; Iliadis, Dimitrios; Ilic, Nikolina; Inamaru, Yuki; Ince, Tayfun; Ioannou, Pavlos; Iodice, Mauro; Iordanidou, Kalliopi; Ippolito, Valerio; Irles Quiles, Adrian; Isaksson, Charlie; Ishino, Masaya; Ishitsuka, Masaki; Ishmukhametov, Renat; Issever, Cigdem; Istin, Serhat; Iturbe Ponce, Julia Mariana; Iuppa, Roberto; Ivarsson, Jenny; Iwanski, Wieslaw; Iwasaki, Hiroyuki; Izen, Joseph; Izzo, Vincenzo; Jackson, Brett; Jackson, Matthew; Jackson, Paul; Jaekel, Martin; Jain, Vivek; Jakobs, Karl; Jakobsen, Sune; Jakoubek, Tomas; Jakubek, Jan; Jamin, David Olivier; Jana, Dilip; Jansen, Eric; Jansen, Hendrik; Janssen, Jens; Janus, Michel; Jarlskog, Göran; Javadov, Namig; Javůrek, Tomáš; Jeanty, Laura; Jejelava, Juansher; Jeng, Geng-yuan; Jennens, David; Jenni, Peter; Jentzsch, Jennifer; Jeske, Carl; Jézéquel, Stéphane; Ji, Haoshuang; Jia, Jiangyong; Jiang, Yi; Jimenez Belenguer, Marcos; Jin, Shan; Jinaru, Adam; Jinnouchi, Osamu; Joergensen, Morten Dam; Johansson, Erik; Johansson, Per; Johns, Kenneth; Jon-And, Kerstin; Jones, Graham; Jones, Roger; Jones, Tim; Jongmanns, Jan; Jorge, Pedro; Joshi, Kiran Daniel; Jovicevic, Jelena; Ju, Xiangyang; Jung, Christian; Jungst, Ralph Markus; Jussel, Patrick; Juste Rozas, Aurelio; Kaci, Mohammed; Kaczmarska, Anna; Kado, Marumi; Kagan, Harris; Kagan, Michael; Kajomovitz, Enrique; Kalderon, Charles William; Kama, Sami; Kamenshchikov, Andrey; Kanaya, Naoko; Kaneda, Michiru; Kaneti, Steven; Kantserov, Vadim; Kanzaki, Junichi; Kaplan, Benjamin; Kapliy, Anton; Kar, Deepak; Karakostas, Konstantinos; Karastathis, Nikolaos; Kareem, Mohammad Jawad; Karnevskiy, Mikhail; Karpov, Sergey; Karpova, Zoya; Karthik, Krishnaiyengar; Kartvelishvili, Vakhtang; Karyukhin, Andrey; Kashif, Lashkar; Kasieczka, Gregor; Kass, Richard; Kastanas, Alex; Kataoka, Yousuke; Katre, Akshay; Katzy, Judith; Kaushik, Venkatesh; Kawagoe, Kiyotomo; Kawamoto, Tatsuo; Kawamura, Gen; Kazama, Shingo; Kazanin, Vassili; Kazarinov, Makhail; Keeler, Richard; Kehoe, Robert; Keil, Markus; Keller, John; Kempster, Jacob Julian; Keoshkerian, Houry; Kepka, Oldrich; Kerševan, Borut Paul; Kersten, Susanne; Kessoku, Kohei; Keung, Justin; Khalil-zada, Farkhad; Khandanyan, Hovhannes; Khanov, Alexander; Khodinov, Alexander; Khomich, Andrei; Khoo, Teng Jian; Khoriauli, Gia; Khoroshilov, Andrey; Khovanskiy, Valery; Khramov, Evgeniy; Khubua, Jemal; Kim, Hee Yeun; Kim, Hyeon Jin; Kim, Shinhong; Kimura, Naoki; Kind, Oliver; King, Barry; King, Matthew; King, Robert Steven Beaufoy; King, Samuel Burton; Kirk, Julie; Kiryunin, Andrey; Kishimoto, Tomoe; Kisielewska, Danuta; Kiss, Florian; Kittelmann, Thomas; Kiuchi, Kenji; Kladiva, Eduard; Klein, Max; Klein, Uta; Kleinknecht, Konrad; Klimek, Pawel; Klimentov, Alexei; Klingenberg, Reiner; Klinger, Joel Alexander; Klioutchnikova, Tatiana; Klok, Peter; Kluge, Eike-Erik; Kluit, Peter; Kluth, Stefan; Kneringer, Emmerich; Knoops, Edith; Knue, Andrea; Kobayashi, Dai; Kobayashi, Tomio; Kobel, Michael; Kocian, Martin; Kodys, Peter; Koevesarki, Peter; Koffas, Thomas; Koffeman, Els; Kogan, Lucy Anne; Kohlmann, Simon; Kohout, Zdenek; Kohriki, Takashi; Koi, Tatsumi; Kolanoski, Hermann; Koletsou, Iro; Koll, James; Komar, Aston; Komori, Yuto; Kondo, Takahiko; Kondrashova, Nataliia; Köneke, Karsten; König, Adriaan; König, Sebastian; Kono, Takanori; Konoplich, Rostislav; Konstantinidis, Nikolaos; Kopeliansky, Revital; Koperny, Stefan; Köpke, Lutz; Kopp, Anna Katharina; Korcyl, Krzysztof; Kordas, Kostantinos; Korn, Andreas; Korol, Aleksandr; Korolkov, Ilya; Korolkova, Elena; Korotkov, Vladislav; Kortner, Oliver; Kortner, Sandra; Kostyukhin, Vadim; Kotov, Vladislav; Kotwal, Ashutosh; Kourkoumelis, Christine; Kouskoura, Vasiliki; Koutsman, Alex; Kowalewski, Robert Victor; Kowalski, Tadeusz; Kozanecki, Witold; Kozhin, Anatoly; Kral, Vlastimil; Kramarenko, Viktor; Kramberger, Gregor; Krasnopevtsev, Dimitriy; Krasny, Mieczyslaw Witold; Krasznahorkay, Attila; Kraus, Jana; Kravchenko, Anton; Kreiss, Sven; Kretz, Moritz; Kretzschmar, Jan; Kreutzfeldt, Kristof; Krieger, Peter; Kroeninger, Kevin; Kroha, Hubert; Kroll, Joe; Kroseberg, Juergen; Krstic, Jelena; Kruchonak, Uladzimir; Krüger, Hans; Kruker, Tobias; Krumnack, Nils; Krumshteyn, Zinovii; Kruse, Amanda; Kruse, Mark; Kruskal, Michael; Kubota, Takashi; Kucuk, Hilal; Kuday, Sinan; Kuehn, Susanne; Kugel, Andreas; Kuhl, Andrew; Kuhl, Thorsten; Kukhtin, Victor; Kulchitsky, Yuri; Kuleshov, Sergey; Kuna, Marine; Kunkle, Joshua; Kupco, Alexander; Kurashige, Hisaya; Kurochkin, Yurii; Kurumida, Rie; Kus, Vlastimil; Kuwertz, Emma Sian; Kuze, Masahiro; Kvita, Jiri; La Rosa, Alessandro; La Rotonda, Laura; Lacasta, Carlos; Lacava, Francesco; Lacey, James; Lacker, Heiko; Lacour, Didier; Lacuesta, Vicente Ramón; Ladygin, Evgueni; Lafaye, Remi; Laforge, Bertrand; Lagouri, Theodota; Lai, Stanley; Laier, Heiko; Lambourne, Luke; Lammers, Sabine; Lampen, Caleb; Lampl, Walter; Lançon, Eric; Landgraf, Ulrich; Landon, Murrough; Lang, Valerie Susanne; Lankford, Andrew; Lanni, Francesco; Lantzsch, Kerstin; Laplace, Sandrine; Lapoire, Cecile; Laporte, Jean-Francois; Lari, Tommaso; Lasagni Manghi, Federico; Lassnig, Mario; Laurelli, Paolo; Lavrijsen, Wim; Law, Alexander; Laycock, Paul; Le Dortz, Olivier; Le Guirriec, Emmanuel; Le Menedeu, Eve; LeCompte, Thomas; Ledroit-Guillon, Fabienne Agnes Marie; Lee, Claire Alexandra; Lee, Hurng-Chun; Lee, Jason; Lee, Shih-Chang; Lee, Lawrence; Lefebvre, Guillaume; Lefebvre, Michel; Legger, Federica; Leggett, Charles; Lehan, Allan; Lehmacher, Marc; Lehmann Miotto, Giovanna; Lei, Xiaowen; Leight, William Axel; Leisos, Antonios; Leister, Andrew Gerard; Leite, Marco Aurelio Lisboa; Leitner, Rupert; Lellouch, Daniel; Lemmer, Boris; Leney, Katharine; Lenz, Tatjana; Lenzen, Georg; Lenzi, Bruno; Leone, Robert; Leone, Sandra; Leonidopoulos, Christos; Leontsinis, Stefanos; Leroy, Claude; Lester, Christopher; Lester, Christopher Michael; Levchenko, Mikhail; Levêque, Jessica; Levin, Daniel; Levinson, Lorne; Levy, Mark; Lewis, Adrian; Lewis, George; Leyko, Agnieszka; Leyton, Michael; Li, Bing; Li, Bo; Li, Haifeng; Li, Ho Ling; Li, Lei; Li, Liang; Li, Shu; Li, Yichen; Liang, Zhijun; Liao, Hongbo; Liberti, Barbara; Lichard, Peter; Lie, Ki; Liebal, Jessica; Liebig, Wolfgang; Limbach, Christian; Limosani, Antonio; Lin, Simon; Lin, Tai-Hua; Linde, Frank; Lindquist, Brian Edward; Linnemann, James; Lipeles, Elliot; Lipniacka, Anna; Lisovyi, Mykhailo; Liss, Tony; Lissauer, David; Lister, Alison; Litke, Alan; Liu, Bo; Liu, Dong; Liu, Jianbei; Liu, Kun; Liu, Lulu; Liu, Miaoyuan; Liu, Minghui; Liu, Yanwen; Livan, Michele; Livermore, Sarah; Lleres, Annick; Llorente Merino, Javier; Lloyd, Stephen; Lo Sterzo, Francesco; Lobodzinska, Ewelina; Loch, Peter; Lockman, William; Loebinger, Fred; Loevschall-Jensen, Ask Emil; Loginov, Andrey; Lohse, Thomas; Lohwasser, Kristin; Lokajicek, Milos; Lombardo, Vincenzo Paolo; Long, Brian Alexander; Long, Jonathan; Long, Robin Eamonn; Lopes, Lourenco; Lopez Mateos, David; Lopez Paredes, Brais; Lopez Paz, Ivan; Lorenz, Jeanette; Lorenzo Martinez, Narei; Losada, Marta; Loscutoff, Peter; Lou, XinChou; Lounis, Abdenour; Love, Jeremy; Love, Peter; Lowe, Andrew; Lu, Feng; Lu, Nan; Lubatti, Henry; Luci, Claudio; Lucotte, Arnaud; Luehring, Frederick; Lukas, Wolfgang; Luminari, Lamberto; Lundberg, Olof; Lund-Jensen, Bengt; Lungwitz, Matthias; Lynn, David; Lysak, Roman; Lytken, Else; Ma, Hong; Ma, Lian Liang; Maccarrone, Giovanni; Macchiolo, Anna; Machado Miguens, Joana; Macina, Daniela; Madaffari, Daniele; Madar, Romain; Maddocks, Harvey Jonathan; Mader, Wolfgang; Madsen, Alexander; Maeno, Mayuko; Maeno, Tadashi; Maevskiy, Artem; Magradze, Erekle; Mahboubi, Kambiz; Mahlstedt, Joern; Mahmoud, Sara; Maiani, Camilla; Maidantchik, Carmen; Maier, Andreas Alexander; Maio, Amélia; Majewski, Stephanie; Makida, Yasuhiro; Makovec, Nikola; Mal, Prolay; Malaescu, Bogdan; Malecki, Pawel; Maleev, Victor; Malek, Fairouz; Mallik, Usha; Malon, David; Malone, Caitlin; Maltezos, Stavros; Malyshev, Vladimir; Malyukov, Sergei; Mamuzic, Judita; Mandelli, Beatrice; Mandelli, Luciano; Mandić, Igor; Mandrysch, Rocco; Maneira, José; Manfredini, Alessandro; Manhaes de Andrade Filho, Luciano; Manjarres Ramos, Joany Andreina; Mann, Alexander; Manning, Peter; Manousakis-Katsikakis, Arkadios; Mansoulie, Bruno; Mantifel, Rodger; Mapelli, Livio; March, Luis; Marchand, Jean-Francois; Marchiori, Giovanni; Marcisovsky, Michal; Marino, Christopher; Marjanovic, Marija; Marques, Carlos; Marroquim, Fernando; Marsden, Stephen Philip; Marshall, Zach; Marti, Lukas Fritz; Marti-Garcia, Salvador; Martin, Brian; Martin, Brian Thomas; Martin, Tim; Martin, Victoria Jane; Martin dit Latour, Bertrand; Martinez, Homero; Martinez, Mario; Martin-Haugh, Stewart; Martyniuk, Alex; Marx, Marilyn; Marzano, Francesco; Marzin, Antoine; Masetti, Lucia; Mashimo, Tetsuro; Mashinistov, Ruslan; Masik, Jiri; Maslennikov, Alexey; Massa, Ignazio; Massa, Lorenzo; Massol, Nicolas; Mastrandrea, Paolo; Mastroberardino, Anna; Masubuchi, Tatsuya; Mättig, Peter; Mattmann, Johannes; Maurer, Julien; Maxfield, Stephen; Maximov, Dmitriy; Mazini, Rachid; Mazzaferro, Luca; Mc Goldrick, Garrin; Mc Kee, Shawn Patrick; McCarn, Allison; McCarthy, Robert; McCarthy, Tom; McCubbin, Norman; McFarlane, Kenneth; Mcfayden, Josh; Mchedlidze, Gvantsa; McMahon, Steve; McPherson, Robert; Mechnich, Joerg; Medinnis, Michael; Meehan, Samuel; Mehlhase, Sascha; Mehta, Andrew; Meier, Karlheinz; Meineck, Christian; Meirose, Bernhard; Melachrinos, Constantinos; Mellado Garcia, Bruce Rafael; Meloni, Federico; Mengarelli, Alberto; Menke, Sven; Meoni, Evelin; Mercurio, Kevin Michael; Mergelmeyer, Sebastian; Meric, Nicolas; Mermod, Philippe; Merola, Leonardo; Meroni, Chiara; Merritt, Frank; Merritt, Hayes; Messina, Andrea; Metcalfe, Jessica; Mete, Alaettin Serhan; Meyer, Carsten; Meyer, Christopher; Meyer, Jean-Pierre; Meyer, Jochen; Middleton, Robin; Migas, Sylwia; Mijović, Liza; Mikenberg, Giora; Mikestikova, Marcela; Mikuž, Marko; Milic, Adriana; Miller, David; Mills, Corrinne; Milov, Alexander; Milstead, David; Milstein, Dmitry; Minaenko, Andrey; Minami, Yuto; Minashvili, Irakli; Mincer, Allen; Mindur, Bartosz; Mineev, Mikhail; Ming, Yao; Mir, Lluisa-Maria; Mirabelli, Giovanni; Mitani, Takashi; Mitrevski, Jovan; Mitsou, Vasiliki A; Mitsui, Shingo; Miucci, Antonio; Miyagawa, Paul; Mjörnmark, Jan-Ulf; Moa, Torbjoern; Mochizuki, Kazuya; Mohapatra, Soumya; Mohr, Wolfgang; Molander, Simon; Moles-Valls, Regina; Mönig, Klaus; Monini, Caterina; Monk, James; Monnier, Emmanuel; Montejo Berlingen, Javier; Monticelli, Fernando; Monzani, Simone; Moore, Roger; Morange, Nicolas; Moreno, Deywis; Moreno Llácer, María; Morettini, Paolo; Morgenstern, Marcus; Morii, Masahiro; Moritz, Sebastian; Morley, Anthony Keith; Mornacchi, Giuseppe; Morris, John; Morvaj, Ljiljana; Moser, Hans-Guenther; Mosidze, Maia; Moss, Josh; Motohashi, Kazuki; Mount, Richard; Mountricha, Eleni; Mouraviev, Sergei; Moyse, Edward; Muanza, Steve; Mudd, Richard; Mueller, Felix; Mueller, James; Mueller, Klemens; Mueller, Thibaut; Mueller, Timo; Muenstermann, Daniel; Munwes, Yonathan; Murillo Quijada, Javier Alberto; Murray, Bill; Musheghyan, Haykuhi; Musto, Elisa; Myagkov, Alexey; Myska, Miroslav; Nackenhorst, Olaf; Nadal, Jordi; Nagai, Koichi; Nagai, Ryo; Nagai, Yoshikazu; Nagano, Kunihiro; Nagarkar, Advait; Nagasaka, Yasushi; Nagel, Martin; Nairz, Armin Michael; Nakahama, Yu; Nakamura, Koji; Nakamura, Tomoaki; Nakano, Itsuo; Namasivayam, Harisankar; Nanava, Gizo; Narayan, Rohin; Nattermann, Till; Naumann, Thomas; Navarro, Gabriela; Nayyar, Ruchika; Neal, Homer; Nechaeva, Polina; Neep, Thomas James; Nef, Pascal Daniel; Negri, Andrea; Negri, Guido; Negrini, Matteo; Nektarijevic, Snezana; Nellist, Clara; Nelson, Andrew; Nelson, Timothy Knight; Nemecek, Stanislav; Nemethy, Peter; Nepomuceno, Andre Asevedo; Nessi, Marzio; Neubauer, Mark; Neumann, Manuel; Neves, Ricardo; Nevski, Pavel; Newman, Paul; Nguyen, Duong Hai; Nickerson, Richard; Nicolaidou, Rosy; Nicquevert, Bertrand; Nielsen, Jason; Nikiforou, Nikiforos; Nikiforov, Andriy; Nikolaenko, Vladimir; Nikolic-Audit, Irena; Nikolics, Katalin; Nikolopoulos, Konstantinos; Nilsson, Paul; Ninomiya, Yoichi; Nisati, Aleandro; Nisius, Richard; Nobe, Takuya; Nodulman, Lawrence; Nomachi, Masaharu; Nomidis, Ioannis; Norberg, Scarlet; Nordberg, Markus; Novgorodova, Olga; Nowak, Sebastian; Nozaki, Mitsuaki; Nozka, Libor; Ntekas, Konstantinos; Nunes Hanninger, Guilherme; Nunnemann, Thomas; Nurse, Emily; Nuti, Francesco; O'Brien, Brendan Joseph; O'grady, Fionnbarr; O'Neil, Dugan; O'Shea, Val; Oakham, Gerald; Oberlack, Horst; Obermann, Theresa; Ocariz, Jose; Ochi, Atsuhiko; Ochoa, Ines; Oda, Susumu; Odaka, Shigeru; Ogren, Harold; Oh, Alexander; Oh, Seog; Ohm, Christian; Ohman, Henrik; Okamura, Wataru; Okawa, Hideki; Okumura, Yasuyuki; Okuyama, Toyonobu; Olariu, Albert; Olchevski, Alexander; Olivares Pino, Sebastian Andres; Oliveira Damazio, Denis; Oliver Garcia, Elena; Olszewski, Andrzej; Olszowska, Jolanta; Onofre, António; Onyisi, Peter; Oram, Christopher; Oreglia, Mark; Oren, Yona; Orestano, Domizia; Orlando, Nicola; Oropeza Barrera, Cristina; Orr, Robert; Osculati, Bianca; Ospanov, Rustem; Otero y Garzon, Gustavo; Otono, Hidetoshi; Ouchrif, Mohamed; Ouellette, Eric; Ould-Saada, Farid; Ouraou, Ahmimed; Oussoren, Koen Pieter; Ouyang, Qun; Ovcharova, Ana; Owen, Mark; Ozcan, Veysi Erkcan; Ozturk, Nurcan; Pachal, Katherine; Pacheco Pages, Andres; Padilla Aranda, Cristobal; Pagáčová, Martina; Pagan Griso, Simone; Paganis, Efstathios; Pahl, Christoph; Paige, Frank; Pais, Preema; Pajchel, Katarina; Palacino, Gabriel; Palestini, Sandro; Palka, Marek; Pallin, Dominique; Palma, Alberto; Palmer, Jody; Pan, Yibin; Panagiotopoulou, Evgenia; Panduro Vazquez, William; Pani, Priscilla; Panikashvili, Natalia; Panitkin, Sergey; Pantea, Dan; Paolozzi, Lorenzo; Papadopoulou, Theodora; Papageorgiou, Konstantinos; Paramonov, Alexander; Paredes Hernandez, Daniela; Parker, Michael Andrew; Parodi, Fabrizio; Parsons, John; Parzefall, Ulrich; Pasqualucci, Enrico; Passaggio, Stefano; Passeri, Antonio; Pastore, Fernanda; Pastore, Francesca; Pásztor, Gabriella; Pataraia, Sophio; Patel, Nikhul; Pater, Joleen; Patricelli, Sergio; Pauly, Thilo; Pearce, James; Pedersen, Lars Egholm; Pedersen, Maiken; Pedraza Lopez, Sebastian; Pedro, Rute; Peleganchuk, Sergey; Pelikan, Daniel; Peng, Haiping; Penning, Bjoern; Penwell, John; Perepelitsa, Dennis; Perez Codina, Estel; Pérez García-Estañ, María Teresa; Perez Reale, Valeria; Perini, Laura; Pernegger, Heinz; Perrella, Sabrina; Perrino, Roberto; Peschke, Richard; Peshekhonov, Vladimir; Peters, Krisztian; Peters, Yvonne; Petersen, Brian; Petersen, Troels; Petit, Elisabeth; Petridis, Andreas; Petridou, Chariclia; Petrolo, Emilio; Petrucci, Fabrizio; Pettersson, Nora Emilia; Pezoa, Raquel; Phillips, Peter William; Piacquadio, Giacinto; Pianori, Elisabetta; Picazio, Attilio; Piccaro, Elisa; Piccinini, Maurizio; Piegaia, Ricardo; Pignotti, David; Pilcher, James; Pilkington, Andrew; Pina, João Antonio; Pinamonti, Michele; Pinder, Alex; Pinfold, James; Pingel, Almut; Pinto, Belmiro; Pires, Sylvestre; Pitt, Michael; Pizio, Caterina; Plazak, Lukas; Pleier, Marc-Andre; Pleskot, Vojtech; Plotnikova, Elena; Plucinski, Pawel; Poddar, Sahill; Podlyski, Fabrice; Poettgen, Ruth; Poggioli, Luc; Pohl, David-leon; Pohl, Martin; Polesello, Giacomo; Policicchio, Antonio; Polifka, Richard; Polini, Alessandro; Pollard, Christopher Samuel; Polychronakos, Venetios; Pommès, Kathy; Pontecorvo, Ludovico; Pope, Bernard; Popeneciu, Gabriel Alexandru; Popovic, Dragan; Poppleton, Alan; Portell Bueso, Xavier; Pospisil, Stanislav; Potamianos, Karolos; Potrap, Igor; Potter, Christina; Potter, Christopher; Poulard, Gilbert; Poveda, Joaquin; Pozdnyakov, Valery; Pralavorio, Pascal; Pranko, Aliaksandr; Prasad, Srivas; Pravahan, Rishiraj; Prell, Soeren; Price, Darren; Price, Joe; Price, Lawrence; Prieur, Damien; Primavera, Margherita; Proissl, Manuel; Prokofiev, Kirill; Prokoshin, Fedor; Protopapadaki, Eftychia-sofia; Protopopescu, Serban; Proudfoot, James; Przybycien, Mariusz; Przysiezniak, Helenka; Ptacek, Elizabeth; Puddu, Daniele; Pueschel, Elisa; Puldon, David; Purohit, Milind; Puzo, Patrick; Qian, Jianming; Qin, Gang; Qin, Yang; Quadt, Arnulf; Quarrie, David; Quayle, William; Queitsch-Maitland, Michaela; Quilty, Donnchadha; Qureshi, Anum; Radeka, Veljko; Radescu, Voica; Radhakrishnan, Sooraj Krishnan; Radloff, Peter; Rados, Pere; Ragusa, Francesco; Rahal, Ghita; Rajagopalan, Srinivasan; Rammensee, Michael; Randle-Conde, Aidan Sean; Rangel-Smith, Camila; Rao, Kanury; Rauscher, Felix; Rave, Tobias Christian; Ravenscroft, Thomas; Raymond, Michel; Read, Alexander Lincoln; Readioff, Nathan Peter; Rebuzzi, Daniela; Redelbach, Andreas; Redlinger, George; Reece, Ryan; Reeves, Kendall; Rehnisch, Laura; Reisin, Hernan; Relich, Matthew; Rembser, Christoph; Ren, Huan; Ren, Zhongliang; Renaud, Adrien; Rescigno, Marco; Resconi, Silvia; Rezanova, Olga; Reznicek, Pavel; Rezvani, Reyhaneh; Richter, Robert; Ridel, Melissa; Rieck, Patrick; Rieger, Julia; Rijssenbeek, Michael; Rimoldi, Adele; Rinaldi, Lorenzo; Ritsch, Elmar; Riu, Imma; Rizatdinova, Flera; Rizvi, Eram; Robertson, Steven; Robichaud-Veronneau, Andree; Robinson, Dave; Robinson, James; Robson, Aidan; Roda, Chiara; Rodrigues, Luis; Roe, Shaun; Røhne, Ole; Rolli, Simona; Romaniouk, Anatoli; Romano, Marino; Romero Adam, Elena; Rompotis, Nikolaos; Ronzani, Manfredi; Roos, Lydia; Ros, Eduardo; Rosati, Stefano; Rosbach, Kilian; Rose, Matthew; Rose, Peyton; Rosendahl, Peter Lundgaard; Rosenthal, Oliver; Rossetti, Valerio; Rossi, Elvira; Rossi, Leonardo Paolo; Rosten, Rachel; Rotaru, Marina; Roth, Itamar; Rothberg, Joseph; Rousseau, David; Royon, Christophe; Rozanov, Alexandre; Rozen, Yoram; Ruan, Xifeng; Rubbo, Francesco; Rubinskiy, Igor; Rud, Viacheslav; Rudolph, Christian; Rudolph, Matthew Scott; Rühr, Frederik; Ruiz-Martinez, Aranzazu; Rurikova, Zuzana; Rusakovich, Nikolai; Ruschke, Alexander; Rutherfoord, John; Ruthmann, Nils; Ryabov, Yury; Rybar, Martin; Rybkin, Grigori; Ryder, Nick; Saavedra, Aldo; Sacerdoti, Sabrina; Saddique, Asif; Sadeh, Iftach; Sadrozinski, Hartmut; Sadykov, Renat; Safai Tehrani, Francesco; Sakamoto, Hiroshi; Sakurai, Yuki; Salamanna, Giuseppe; Salamon, Andrea; Saleem, Muhammad; Salek, David; Sales De Bruin, Pedro Henrique; Salihagic, Denis; Salnikov, Andrei; Salt, José; Salvatore, Daniela; Salvatore, Pasquale Fabrizio; Salvucci, Antonio; Salzburger, Andreas; Sampsonidis, Dimitrios; Sanchez, Arturo; Sánchez, Javier; Sanchez Martinez, Victoria; Sandaker, Heidi; Sandbach, Ruth Laura; Sander, Heinz Georg; Sanders, Michiel; Sandhoff, Marisa; Sandoval, Tanya; Sandoval, Carlos; Sandstroem, Rikard; Sankey, Dave; Sansoni, Andrea; Santoni, Claudio; Santonico, Rinaldo; Santos, Helena; Santoyo Castillo, Itzebelt; Sapp, Kevin; Sapronov, Andrey; Saraiva, João; Sarrazin, Bjorn; Sartisohn, Georg; Sasaki, Osamu; Sasaki, Yuichi; Sauvage, Gilles; Sauvan, Emmanuel; Savard, Pierre; Savu, Dan Octavian; Sawyer, Craig; Sawyer, Lee; Saxon, David; Saxon, James; Sbarra, Carla; Sbrizzi, Antonio; Scanlon, Tim; Scannicchio, Diana; Scarcella, Mark; Scarfone, Valerio; Schaarschmidt, Jana; Schacht, Peter; Schaefer, Douglas; Schaefer, Ralph; Schaepe, Steffen; Schaetzel, Sebastian; Schäfer, Uli; Schaffer, Arthur; Schaile, Dorothee; Schamberger, R~Dean; Scharf, Veit; Schegelsky, Valery; Scheirich, Daniel; Schernau, Michael; Scherzer, Max; Schiavi, Carlo; Schieck, Jochen; Schillo, Christian; Schioppa, Marco; Schlenker, Stefan; Schmidt, Evelyn; Schmieden, Kristof; Schmitt, Christian; Schmitt, Sebastian; Schneider, Basil; Schnellbach, Yan Jie; Schnoor, Ulrike; Schoeffel, Laurent; Schoening, Andre; Schoenrock, Bradley Daniel; Schorlemmer, Andre Lukas; Schott, Matthias; Schouten, Doug; Schovancova, Jaroslava; Schramm, Steven; Schreyer, Manuel; Schroeder, Christian; Schuh, Natascha; Schultens, Martin Johannes; Schultz-Coulon, Hans-Christian; Schulz, Holger; Schumacher, Markus; Schumm, Bruce; Schune, Philippe; Schwanenberger, Christian; Schwartzman, Ariel; Schwarz, Thomas Andrew; Schwegler, Philipp; Schwemling, Philippe; Schwienhorst, Reinhard; Schwindling, Jerome; Schwindt, Thomas; Schwoerer, Maud; Sciacca, Gianfranco; Scifo, Estelle; Sciolla, Gabriella; Scott, Bill; Scuri, Fabrizio; Scutti, Federico; Searcy, Jacob; Sedov, George; Sedykh, Evgeny; Seidel, Sally; Seiden, Abraham; Seifert, Frank; Seixas, José; Sekhniaidze, Givi; Sekula, Stephen; Selbach, Karoline Elfriede; Seliverstov, Dmitry; Sellers, Graham; Semprini-Cesari, Nicola; Serfon, Cedric; Serin, Laurent; Serkin, Leonid; Serre, Thomas; Seuster, Rolf; Severini, Horst; Sfiligoj, Tina; Sforza, Federico; Sfyrla, Anna; Shabalina, Elizaveta; Shamim, Mansoora; Shan, Lianyou; Shang, Ruo-yu; Shank, James; Shapiro, Marjorie; Shatalov, Pavel; Shaw, Kate; Shehu, Ciwake Yusufu; Sherwood, Peter; Shi, Liaoshan; Shimizu, Shima; Shimmin, Chase Owen; Shimojima, Makoto; Shiyakova, Mariya; Shmeleva, Alevtina; Shochet, Mel; Short, Daniel; Shrestha, Suyog; Shulga, Evgeny; Shupe, Michael; Shushkevich, Stanislav; Sicho, Petr; Sidiropoulou, Ourania; Sidorov, Dmitri; Sidoti, Antonio; Siegert, Frank; Sijacki, Djordje; Silva, José; Silver, Yiftah; Silverstein, Daniel; Silverstein, Samuel; Simak, Vladislav; Simard, Olivier; Simic, Ljiljana; Simion, Stefan; Simioni, Eduard; Simmons, Brinick; Simoniello, Rosa; Simonyan, Margar; Sinervo, Pekka; Sinev, Nikolai; Sipica, Valentin; Siragusa, Giovanni; Sircar, Anirvan; Sisakyan, Alexei; Sivoklokov, Serguei; Sjölin, Jörgen; Sjursen, Therese; Skottowe, Hugh Philip; Skovpen, Kirill; Skubic, Patrick; Slater, Mark; Slavicek, Tomas; Sliwa, Krzysztof; Smakhtin, Vladimir; Smart, Ben; Smestad, Lillian; Smirnov, Sergei; Smirnov, Yury; Smirnova, Lidia; Smirnova, Oxana; Smith, Kenway; Smizanska, Maria; Smolek, Karel; Snesarev, Andrei; Snidero, Giacomo; Snyder, Scott; Sobie, Randall; Socher, Felix; Soffer, Abner; Soh, Dart-yin; Solans, Carlos; Solar, Michael; Solc, Jaroslav; Soldatov, Evgeny; Soldevila, Urmila; Solodkov, Alexander; Soloshenko, Alexei; Solovyanov, Oleg; Solovyev, Victor; Sommer, Philip; Song, Hong Ye; Soni, Nitesh; Sood, Alexander; Sopczak, Andre; Sopko, Bruno; Sopko, Vit; Sorin, Veronica; Sosebee, Mark; Soualah, Rachik; Soueid, Paul; Soukharev, Andrey; South, David; Spagnolo, Stefania; Spanò, Francesco; Spearman, William Robert; Spettel, Fabian; Spighi, Roberto; Spigo, Giancarlo; Spiller, Laurence Anthony; Spousta, Martin; Spreitzer, Teresa; Spurlock, Barry; St Denis, Richard Dante; Staerz, Steffen; Stahlman, Jonathan; Stamen, Rainer; Stamm, Soren; Stanecka, Ewa; Stanek, Robert; Stanescu, Cristian; Stanescu-Bellu, Madalina; Stanitzki, Marcel Michael; Stapnes, Steinar; Starchenko, Evgeny; Stark, Jan; Staroba, Pavel; Starovoitov, Pavel; Staszewski, Rafal; Stavina, Pavel; Steinberg, Peter; Stelzer, Bernd; Stelzer, Harald Joerg; Stelzer-Chilton, Oliver; Stenzel, Hasko; Stern, Sebastian; Stewart, Graeme; Stillings, Jan Andre; Stockton, Mark; Stoebe, Michael; Stoicea, Gabriel; Stolte, Philipp; Stonjek, Stefan; Stradling, Alden; Straessner, Arno; Stramaglia, Maria Elena; Strandberg, Jonas; Strandberg, Sara; Strandlie, Are; Strauss, Emanuel; Strauss, Michael; Strizenec, Pavol; Ströhmer, Raimund; Strom, David; Stroynowski, Ryszard; Strubig, Antonia; Stucci, Stefania Antonia; Stugu, Bjarne; Styles, Nicholas Adam; Su, Dong; Su, Jun; Subramaniam, Rajivalochan; Succurro, Antonella; Sugaya, Yorihito; Suhr, Chad; Suk, Michal; Sulin, Vladimir; Sultansoy, Saleh; Sumida, Toshi; Sun, Siyuan; Sun, Xiaohu; Sundermann, Jan Erik; Suruliz, Kerim; Susinno, Giancarlo; Sutton, Mark; Suzuki, Yu; Svatos, Michal; Swedish, Stephen; Swiatlowski, Maximilian; Sykora, Ivan; Sykora, Tomas; Ta, Duc; Taccini, Cecilia; Tackmann, Kerstin; Taenzer, Joe; Taffard, Anyes; Tafirout, Reda; Taiblum, Nimrod; Takai, Helio; Takashima, Ryuichi; Takeda, Hiroshi; Takeshita, Tohru; Takubo, Yosuke; Talby, Mossadek; Talyshev, Alexey; Tam, Jason; Tan, Kong Guan; Tanaka, Junichi; Tanaka, Reisaburo; Tanaka, Satoshi; Tanaka, Shuji; Tanasijczuk, Andres Jorge; Tannenwald, Benjamin Bordy; Tannoury, Nancy; Tapprogge, Stefan; Tarem, Shlomit; Tarrade, Fabien; Tartarelli, Giuseppe Francesco; Tas, Petr; Tasevsky, Marek; Tashiro, Takuya; Tassi, Enrico; Tavares Delgado, Ademar; Tayalati, Yahya; Taylor, Frank; Taylor, Geoffrey; Taylor, Wendy; Teischinger, Florian Alfred; Teixeira Dias Castanheira, Matilde; Teixeira-Dias, Pedro; Temming, Kim Katrin; Ten Kate, Herman; Teng, Ping-Kun; Teoh, Jia Jian; Terada, Susumu; Terashi, Koji; Terron, Juan; Terzo, Stefano; Testa, Marianna; Teuscher, Richard; Therhaag, Jan; Theveneaux-Pelzer, Timothée; Thomas, Juergen; Thomas-Wilsker, Joshuha; Thompson, Emily; Thompson, Paul; Thompson, Peter; Thompson, Ray; Thompson, Stan; Thomsen, Lotte Ansgaard; Thomson, Evelyn; Thomson, Mark; Thong, Wai Meng; Thun, Rudolf; Tian, Feng; Tibbetts, Mark James; Tikhomirov, Vladimir; Tikhonov, Yury; Timoshenko, Sergey; Tiouchichine, Elodie; Tipton, Paul; Tisserant, Sylvain; Todorov, Theodore; Todorova-Nova, Sharka; Toggerson, Brokk; Tojo, Junji; Tokár, Stanislav; Tokushuku, Katsuo; Tollefson, Kirsten; Tolley, Emma; Tomlinson, Lee; Tomoto, Makoto; Tompkins, Lauren; Toms, Konstantin; Topilin, Nikolai; Torrence, Eric; Torres, Heberth; Torró Pastor, Emma; Toth, Jozsef; Touchard, Francois; Tovey, Daniel; Tran, Huong Lan; Trefzger, Thomas; Tremblet, Louis; Tricoli, Alessandro; Trigger, Isabel Marian; Trincaz-Duvoid, Sophie; Tripiana, Martin; Trischuk, William; Trocmé, Benjamin; Troncon, Clara; Trottier-McDonald, Michel; Trovatelli, Monica; True, Patrick; Trzebinski, Maciej; Trzupek, Adam; Tsarouchas, Charilaos; Tseng, Jeffrey; Tsiareshka, Pavel; Tsionou, Dimitra; Tsipolitis, Georgios; Tsirintanis, Nikolaos; Tsiskaridze, Shota; Tsiskaridze, Vakhtang; Tskhadadze, Edisher; Tsukerman, Ilya; Tsulaia, Vakhtang; Tsuno, Soshi; Tsybychev, Dmitri; Tudorache, Alexandra; Tudorache, Valentina; Tuna, Alexander Naip; Tupputi, Salvatore; Turchikhin, Semen; Turecek, Daniel; Turk Cakir, Ilkay; Turra, Ruggero; Tuts, Michael; Tykhonov, Andrii; Tylmad, Maja; Tyndel, Mike; Uchida, Kirika; Ueda, Ikuo; Ueno, Ryuichi; Ughetto, Michael; Ugland, Maren; Uhlenbrock, Mathias; Ukegawa, Fumihiko; Unal, Guillaume; Undrus, Alexander; Unel, Gokhan; Ungaro, Francesca; Unno, Yoshinobu; Unverdorben, Christopher; Urbaniec, Dustin; Urquijo, Phillip; Usai, Giulio; Usanova, Anna; Vacavant, Laurent; Vacek, Vaclav; Vachon, Brigitte; Valencic, Nika; Valentinetti, Sara; Valero, Alberto; Valery, Loic; Valkar, Stefan; Valladolid Gallego, Eva; Vallecorsa, Sofia; Valls Ferrer, Juan Antonio; Van Den Wollenberg, Wouter; Van Der Deijl, Pieter; van der Geer, Rogier; van der Graaf, Harry; Van Der Leeuw, Robin; van der Ster, Daniel; van Eldik, Niels; van Gemmeren, Peter; Van Nieuwkoop, Jacobus; van Vulpen, Ivo; van Woerden, Marius Cornelis; Vanadia, Marco; Vandelli, Wainer; Vanguri, Rami; Vaniachine, Alexandre; Vankov, Peter; Vannucci, Francois; Vardanyan, Gagik; Vari, Riccardo; Varnes, Erich; Varol, Tulin; Varouchas, Dimitris; Vartapetian, Armen; Varvell, Kevin; Vazeille, Francois; Vazquez Schroeder, Tamara; Veatch, Jason; Veloso, Filipe; Velz, Thomas; Veneziano, Stefano; Ventura, Andrea; Ventura, Daniel; Venturi, Manuela; Venturi, Nicola; Venturini, Alessio; Vercesi, Valerio; Verducci, Monica; Verkerke, Wouter; Vermeulen, Jos; Vest, Anja; Vetterli, Michel; Viazlo, Oleksandr; Vichou, Irene; Vickey, Trevor; Vickey Boeriu, Oana Elena; Viehhauser, Georg; Viel, Simon; Vigne, Ralph; Villa, Mauro; Villaplana Perez, Miguel; Vilucchi, Elisabetta; Vincter, Manuella; Vinogradov, Vladimir; Virzi, Joseph; Vivarelli, Iacopo; Vives Vaque, Francesc; Vlachos, Sotirios; Vladoiu, Dan; Vlasak, Michal; Vogel, Adrian; Vogel, Marcelo; Vokac, Petr; Volpi, Guido; Volpi, Matteo; von der Schmitt, Hans; von Radziewski, Holger; von Toerne, Eckhard; Vorobel, Vit; Vorobev, Konstantin; Vos, Marcel; Voss, Rudiger; Vossebeld, Joost; Vranjes, Nenad; Vranjes Milosavljevic, Marija; Vrba, Vaclav; Vreeswijk, Marcel; Vu Anh, Tuan; Vuillermet, Raphael; Vukotic, Ilija; Vykydal, Zdenek; Wagner, Peter; Wagner, Wolfgang; Wahlberg, Hernan; Wahrmund, Sebastian; Wakabayashi, Jun; Walder, James; Walker, Rodney; Walkowiak, Wolfgang; Wall, Richard; Waller, Peter; Walsh, Brian; Wang, Chao; Wang, Chiho; Wang, Fuquan; Wang, Haichen; Wang, Hulin; Wang, Jike; Wang, Jin; Wang, Kuhan; Wang, Rui; Wang, Song-Ming; Wang, Tan; Wang, Xiaoxiao; Wanotayaroj, Chaowaroj; Warburton, Andreas; Ward, Patricia; Wardrope, David Robert; Warsinsky, Markus; Washbrook, Andrew; Wasicki, Christoph; Watkins, Peter; Watson, Alan; Watson, Ian; Watson, Miriam; Watts, Gordon; Watts, Stephen; Waugh, Ben; Webb, Samuel; Weber, Michele; Weber, Stefan Wolf; Webster, Jordan S; Weidberg, Anthony; Weigell, Philipp; Weinert, Benjamin; Weingarten, Jens; Weiser, Christian; Weits, Hartger; Wells, Phillippa; Wenaus, Torre; Wendland, Dennis; Weng, Zhili; Wengler, Thorsten; Wenig, Siegfried; Wermes, Norbert; Werner, Matthias; Werner, Per; Wessels, Martin; Wetter, Jeffrey; Whalen, Kathleen; White, Andrew; White, Martin; White, Ryan; White, Sebastian; Whiteson, Daniel; Wicke, Daniel; Wickens, Fred; Wiedenmann, Werner; Wielers, Monika; Wienemann, Peter; Wiglesworth, Craig; Wiik-Fuchs, Liv Antje Mari; Wijeratne, Peter Alexander; Wildauer, Andreas; Wildt, Martin Andre; Wilkens, Henric George; Will, Jonas Zacharias; Williams, Hugh; Williams, Sarah; Willis, Christopher; Willocq, Stephane; Wilson, Alan; Wilson, John; Wingerter-Seez, Isabelle; Winklmeier, Frank; Winter, Benedict Tobias; Wittgen, Matthias; Wittig, Tobias; Wittkowski, Josephine; Wollstadt, Simon Jakob; Wolter, Marcin Wladyslaw; Wolters, Helmut; Wosiek, Barbara; Wotschack, Jorg; Woudstra, Martin; Wozniak, Krzysztof; Wright, Michael; Wu, Mengqing; Wu, Sau Lan; Wu, Xin; Wu, Yusheng; Wulf, Evan; Wyatt, Terry Richard; Wynne, Benjamin; Xella, Stefania; Xiao, Meng; Xu, Da; Xu, Lailin; Yabsley, Bruce; Yacoob, Sahal; Yakabe, Ryota; Yamada, Miho; Yamaguchi, Hiroshi; Yamaguchi, Yohei; Yamamoto, Akira; Yamamoto, Kyoko; Yamamoto, Shimpei; Yamamura, Taiki; Yamanaka, Takashi; Yamauchi, Katsuya; Yamazaki, Yuji; Yan, Zhen; Yang, Haijun; Yang, Hongtao; Yang, Un-Ki; Yang, Yi; Yanush, Serguei; Yao, Liwen; Yao, Weiming; Yasu, Yoshiji; Yatsenko, Elena; Yau Wong, Kaven Henry; Ye, Jingbo; Ye, Shuwei; Yeletskikh, Ivan; Yen, Andy L; Yildirim, Eda; Yilmaz, Metin; Yoosoofmiya, Reza; Yorita, Kohei; Yoshida, Rikutaro; Yoshihara, Keisuke; Young, Charles; Young, Christopher John; Youssef, Saul; Yu, David Ren-Hwa; Yu, Jaehoon; Yu, Jiaming; Yu, Jie; Yuan, Li; Yurkewicz, Adam; Yusuff, Imran; Zabinski, Bartlomiej; Zaidan, Remi; Zaitsev, Alexander; Zaman, Aungshuman; Zambito, Stefano; Zanello, Lucia; Zanzi, Daniele; Zeitnitz, Christian; Zeman, Martin; Zemla, Andrzej; Zengel, Keith; Zenin, Oleg; Ženiš, Tibor; Zerwas, Dirk; Zevi della Porta, Giovanni; Zhang, Dongliang; Zhang, Fangzhou; Zhang, Huaqiao; Zhang, Jinlong; Zhang, Lei; Zhang, Xueyao; Zhang, Zhiqing; Zhao, Zhengguo; Zhemchugov, Alexey; Zhong, Jiahang; Zhou, Bing; Zhou, Lei; Zhou, Ning; Zhu, Cheng Guang; Zhu, Hongbo; Zhu, Junjie; Zhu, Yingchun; Zhuang, Xuai; Zhukov, Konstantin; Zibell, Andre; Zieminska, Daria; Zimine, Nikolai; Zimmermann, Christoph; Zimmermann, Robert; Zimmermann, Simone; Zimmermann, Stephanie; Zinonos, Zinonas; Ziolkowski, Michael; Zobernig, Georg; Zoccoli, Antonio; zur Nedden, Martin; Zurzolo, Giovanni; Zutshi, Vishnu; Zwalinski, Lukasz


    This Letter presents a search for a hidden-beauty counterpart of the $X(3872)$ in the mass ranges 10.05--10.31 GeV and 10.40--11.00 GeV, in the channel $X_b \\to \\pi^{+} \\pi^{-} \\Upsilon(1 \\rm S)(\\rightarrow\\mu^+\\mu^-)$, using 16.2 fb$^{-1}$ of $\\sqrt{s}=8$ TeV $pp$ collision data collected by the ATLAS detector at the LHC. No evidence for new narrow states is found, and upper limits are set on the product of the $X_b$ cross section and branching fraction, relative to those of the $\\Upsilon(2 \\rm S)$, at the 95% confidence level using the CL$_S$ approach. These limits range from 0.8% to 4.0%, depending on mass. For masses above 10.1 GeV, the expected upper limits from this analysis are the most restrictive to date. Searches for production of the $\\Upsilon(1^3 \\rm{D}$$_J)$, $\\Upsilon(10860)$, and $\\Upsilon(11020)$ states also reveal no significant signals.

  3. Structure and superconductivity of double-doped Mg1-x(Al0.5Li0.5)xB2

    DEFF Research Database (Denmark)

    Xu, G.J.; Grivel, Jean-Claude; Abrahamsen, A.B.


    A series of polycrystalline samples of Mg1-x(Al0.5Li0.5)(x)B-2 (0less than or equal toxless than or equal to0.6) were prepared by a solid state reaction method and their structure, superconducting transition temperature and magneto-transport properties were investigated by means of X-ray diffract......A series of polycrystalline samples of Mg1-x(Al0.5Li0.5)(x)B-2 (0less than or equal toxless than or equal to0.6) were prepared by a solid state reaction method and their structure, superconducting transition temperature and magneto-transport properties were investigated by means of X......-ray diffraction (XRD), ac-susceptibility and resistance in varied magnetic fields. The double doping leads to decreases in both the lattice parameters a and c. The superconducting transition temperature (T-c) decreases with double doping, but the T-c is systematically higher than that of the single Al......-doped samples. It is suggested that the hole band filling has little effect on T-c at high doping level, while the disorder induced by doping plays an important role in suppressing T-c. A systematic comparison with Al-doped MgB2 of the structure, superconducting transition and irreversibility field is made. (C...

  4. Cosmological Gamma-Ray Bursters (United States)

    Tamblyn, P.; Melia, F.


    The distribution of gamma-ray burst sources detected with BATSE is iso\\-tro\\-pic yet non-uniform. There is a deficit of weak events which is commonly expressed by a \\vvm less than the 0.5 expected for a uniform Eu\\-clid\\-ean distribution. It has been argued (e.g., Mao and Paczynski 1992) that this may be a signature of a Cosmological expansion in a FRW universe with a uniform, co-moving distribution of sources. However, a comparison of the \\vvm and burst detection rates of several experiments presents an apparent paradox: e.g., Konus detected the bursts more frequently than SMM, implying a better sensitivity and larger sampling volume, yet its measured \\vvm was ~ 0.45 compared to SMM's value of ~ 0.40, suggesting instead a lesser deviation from Eu\\-clid\\-ean space. We point out that this apparent conflict stems from the assumption that all bursts have a standard spectrum with a single power law. But realistic spectra often exhibit broken power laws, with a break energy 100;keV ~ lessepsilon_b ~ less 3 MeV. \\ Thus, the flux measured by a particular instrument depends on both the redshift of the source and the energy window of the detector. In other words, for a given energy window, the flux of a more distant burst will be further decreased below the value expected from the Cosmological model due to the red-shifting of epsilon_b across the window. We show that the inclusion of an intrinsic epsilon_b ( ~ 500 keV) and a consideration of the different detector energy responses and sensitivities can self-consistently account for the rates and \\vvm of the Konus, PVO, SMM, and BATSE datasets. Because of the dependence of the observed characteristics on the energy window, a subset of the BATSE catalog, based solely on the burst fluence in the higher energy (i.e., 4{th}) channel, provides an additional ``data'' point in the \\vvm versus rate plane. In particular, Konus's higher rate for a larger value of \\vvm is due to its better sensitivity, but smaller and lower energy window than SMM. \\ In the context of this improved model, BATSE is apparently sampling a source distribution out to a redshift zmax ~ 1.3, whereas Konus was limited to zmax ~ 0.5, SMM to ~ 0.3, and PVO to ~ 0.2.

  5. Structure, elastic stiffness, and hardness of Os 1- xRu xB 2 solid solution transition-metal diborides

    KAUST Repository

    Kanoun, Mohammed


    On the basis of recent experiments, the solid solution transition-metal diborides were proposed to be new ultra-incompressible hard materials. We investigate using density functional theory based methods the structural and mechanical properties, electronic structure, and hardness of Os 1-xRu xB 2 solid solutions. A difference in chemical bonding occurs between OsB 2 and RuB 2 diborides, leading to significantly different elastic properties: a large bulk, shear moduli, and hardness for Os-rich diborides and relatively small bulk, shear moduli, and hardness for Ru-rich diborides. The electronic structure and bonding characterization are also analyzed as a function of Ru-dopant concentration in the OsB 2 lattice. © 2012 American Chemical Society.

  6. Crystal structure and magnetic properties of Ce{sub 2}Fe{sub 14−x}Co{sub x}B alloys

    Energy Technology Data Exchange (ETDEWEB)

    Skoug, Eric J.; Meyer, M.S.; Pinkerton, F.E. [Chemical and Materials Systems Laboratory, General Motors Research and Development Center, Mail Code 480-106-224, Warren, MI 48090-9055 (United States); Tessema, Misle M. [Optimal CAE, Inc., 14492 Sheldon Road, Plymouth, MI 48170 (United States); Haddad, Daad [MEDA Engineering and Technical Services, LLC, 17515 West Nine Mile Road, Southfield, MI 48075 (United States); Herbst, J.F., E-mail: [Chemical and Materials Systems Laboratory, General Motors Research and Development Center, Mail Code 480-106-224, Warren, MI 48090-9055 (United States)


    Highlights: •Annealed melt-spun Ce{sub 3}Fe{sub 14−x}Co{sub x}B or Ce{sub 2.55}Fe{sub 14−x}Co{sub x}B{sub 1.27} ribbons maintain the Ce{sub 2}Fe{sub 14}B crystal structure only for x ⩽ 5. •In contrast to many other R{sub 2}Fe{sub 14}B materials, we find no evidence for the formation of Ce{sub 2}Co{sub 14}B. •The Curie temperature increases rapidly with increasing cobalt content x, reaching ∼660 K for x = 5. •Ce{sub 3}Fe{sub 12}Co{sub 2}B offers significant improvement in T{sub c}, B{sub r}, and (BH){sub max} relative to its Co-free analog with only modest H{sub ci} loss. -- Abstract: Permanent magnet materials based on the R{sub 2}Fe{sub 14}B phase (R = rare earth element) are essential to a wide variety of applications, among them automotive traction motors. Current state-of-the-art materials rely on R = Nd and Dy, for both of which there are supply uncertainties and rapidly rising costs. A possible alternative is R = Ce, the most abundant rare earth, but Ce{sub 2}Fe{sub 14}B has several disadvantages, including a low Curie temperature (T{sub c}) that limits its maximum operating point to well below that required for some automotive uses. Here we systematically investigate the Ce{sub 2}Fe{sub 14−x}Co{sub x}B system by exploring Co substitution for Fe in melt-spun ribbons as a means of increasing T{sub c}. In addition to T{sub c} we report the solubility of Co in Ce{sub 2}Fe{sub 14}B and its effect on the crystal structure and hard magnetic properties.

  7. Search for the Xb and other hidden-beauty states in the π+π−ϒ(1S channel at ATLAS

    Directory of Open Access Journals (Sweden)

    G. Aad


    Full Text Available This Letter presents a search for a hidden-beauty counterpart of the X(3872 in the mass ranges of 10.05–10.31 GeV and 10.40–11.00 GeV, in the channel Xb→π+π−ϒ(1S(→μ+μ−, using 16.2 fb−1 of s=8 TeV pp collision data collected by the ATLAS detector at the LHC. No evidence for new narrow states is found, and upper limits are set on the product of the Xb cross section and branching fraction, relative to those of the ϒ(2S, at the 95% confidence level using the CLS approach. These limits range from 0.8% to 4.0%, depending on mass. For masses above 10.1 GeV, the expected upper limits from this analysis are the most restrictive to date. Searches for production of the ϒ(13DJ, ϒ(10860, and ϒ(11020 states also reveal no significant signals.

  8. Equivalent Longitudinal Area Distributions of the B-58 and XB-70-1 Airplanes for Use in Wave Drag and Sonic Boom Calculations (United States)

    Tinetti, Ana F.; Maglieri, Domenic J.; Driver, Cornelius; Bobbitt, Percy J.


    A detailed geometric description, in wave drag format, has been developed for the Convair B-58 and North American XB-70-1 delta wing airplanes. These descriptions have been placed on electronic files, the contents of which are described in this paper They are intended for use in wave drag and sonic boom calculations. Included in the electronic file and in the present paper are photographs and 3-view drawings of the two airplanes, tabulated geometric descriptions of each vehicle and its components, and comparisons of the electronic file outputs with existing data. The comparisons include a pictorial of the two airplanes based on the present geometric descriptions, and cross-sectional area distributions for both the normal Mach cuts and oblique Mach cuts above and below the vehicles. Good correlation exists between the area distributions generated in the late 1950s and 1960s and the present files. The availability of these electronic files facilitates further validation of sonic boom prediction codes through the use of two existing data bases on these airplanes, which were acquired in the 1960s and have not been fully exploited.

  9. Luminescence properties of single-phase color-tunable CeZn1-x(B5O10):xMn2+ phosphor (United States)

    Lu, Yixuan; Li, Chenxia; Deng, Degang; Hua, Yu; Wang, Le; Jin, Leisheng; Xu, Shiqing


    In this work, a transition metal doped Ce3+-based borate CeZn1-x(B5O10):Mn2+ was synthesized by utilizing conventional solid-state reaction method. The lattice structure and particularly the luminescence properties of the synthesized phosphors were carefully studied. By analyzing the results, it is revealed that Mn2+ only occupies Zn sites, and it only contributes the light emitting peaked at 615 nm under the excitation of 371 nm. While the emitting peak at 437 nm under the same excitation is verified to be caused by the 5d-4f (2F5/2 and 2F7/2) transitions of Ce3+-based. Furthermore, by conducting a comprehensive investigation on overlap of emission, excitation spectra and variation of fluorescence decay lifetimes, we make it clear that the energy transfer from Ce3+ to Mn2+ is virtually via a resonance-type mechanism. Last but not the least, we can realize color-tunable light emitting by adjusting the concentration of Mn2+ in our proposed phosphor and using excitation of ultraviolet (UV) light. In addition, close to white light can be realized when doping the Mn2+ ions to a certain extent.

  10. Competing anisotropies on 3d sub-lattice of YNi{sub 4–x}Co{sub x}B compounds

    Energy Technology Data Exchange (ETDEWEB)

    Caraballo Vivas, R. J.; Rocco, D. L.; Reis, M. S. [Instituto de Física, Universidade Federal Fluminense, Av. Gal. Milton Tavares de Souza s/n, 24210-346 Niterói, RJ (Brazil); Costa Soares, T. [Instituto de Física, Universidade Federal Fluminense, Av. Gal. Milton Tavares de Souza s/n, 24210-346 Niterói, RJ (Brazil); IF Sudeste MG Campus de Juiz de Fora-Núcleo de Física, 36080-001 Juiz de Fora, MG (Brazil); Caldeira, L. [IF Sudeste MG Campus de Juiz de Fora-Núcleo de Física, 36080-001 Juiz de Fora, MG (Brazil); Coelho, A. A. [Instituto de Física Gleb Wataghin, Universidade Estadual de Campinas-Unicamp, Caixa postal 6165, 13083-859 Campinas, SP (Brazil)


    The magnetic anisotropy of 3d sub-lattices has an important rule on the overall magnetic properties of hard magnets. Intermetallics alloys with boron (R-Co/Ni-B, for instance) belong to those hard magnets family and are useful objects to help to understand the magnetic behavior of 3d sub-lattice, specially when the rare earth ions R do not have magnetic nature, like YCo{sub 4}B ferromagnetic material. Interestingly, YNi{sub 4}B is a paramagnetic material and Ni ions do not contribute to the magnetic anisotropy. We focused therefore our attention to YNi{sub 4–x}Co{sub x}B series, with x = 0, 1, 2, 3, and 4. The magnetic anisotropy of these compounds is deeper described using statistical and preferential models of Co occupation among the possible Wyckoff positions into the CeCo{sub 4}B type hexagonal structure. We found that the preferential model is the most suitable to explain the magnetization experimental data.

  11. SU-E-T-290: Dosimetric Accuracy of Acuros XB and Analytical Anisotropic Algorithm in Stereotactic Ablative Radiotherapy of Small Lung Lesions

    Energy Technology Data Exchange (ETDEWEB)

    Yu, Amy S; Yang, Y; Bush, K; Fahimian, B; Hsu, A [Stanford University, Stanford, CA (United States)


    Purpose: The accuracy of dose calculation for lung stereotactic ablative radiotherapy (SABR) of small lesions critically depends on the proper modeling of the lateral scatter in heterogeneous media. In recent years, grid-based Boltzman solvers such as Acuros XB (AXB) have been introduced for enhanced modeling of radiation transport in heterogeneous media. The purpose of this study is to evaluate the dosimetric impact of dose calculation between AXB and convolution-superposition algorithms such as analytical anisotropic algorithm (AAA) for small lesion sizes and different beam energies. Methods: Five lung SABR VMAT cases with GTV ranged from 0.8cm to 2.5cm in diameter were studied. For each case, doses were calculated by AAA, AXB (V11031) and Monte Carlo simulation (MC) with the same plan parameters for 10MV and 6MV. The dose calculation accuracy were evaluated by comparing DVHs and dose distributions with MC as the benchmark. The accuracy of calculated dose was also validated by EBT3 film measurement with a field size of 3cmx3cm in a thorax phantom. Results: For 10MV and GTV less than 1cm, dose calculated by AXB agrees well with MC compared to AAA. Dose difference calculated with AXB and AAA could be up to 30%. For GTV greater than 2cm, calculation results of AXB and AAA agree within 5% in GTV. For 6MV, the difference between calculated doses by AXB and AAA is less 10% for GTV less than 1cm. Based on film measurements, lung dose was overestimated 10% and 20% by AAA for 6MV and 10MV. Conclusion: Lateral scatter and transport is modeled more accurately by AXB than AAA in heterogeneous media, especially for small field size and high energy beams. The accuracy depends on the assigned material in calculation. If grid-based Boltzman solvers or MC are not available for calculation, lower energy beams should be used for treatment.


    Energy Technology Data Exchange (ETDEWEB)

    Barnard, R.; Garcia, M. R.; Murray, S. S. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States)


    The M31 globular cluster X-ray binary XB158 (a.k.a. Bo 158) exhibits intensity dips on a 2.78 hr period in some observations, but not others. The short period suggests a low mass ratio, and an asymmetric, precessing disk due to additional tidal torques from the donor star since the disk crosses the 3:1 resonance. Previous theoretical three-dimensional smoothed particle hydrodynamical modeling suggested a super-orbital disk precession period 29 ± 1 times the orbital period, i.e., ∼81 ± 3 hr. We conducted a Swift monitoring campaign of 30 observations over ∼1 month in order to search for evidence of such a super-orbital period. Fitting the 0.3-10 keV Swift X-Ray Telescope luminosity light curve with a sinusoid yielded a period of 5.65 ± 0.05 days, and a >5σ improvement in χ{sup 2} over the best fit constant intensity model. A Lomb-Scargle periodogram revealed that periods of 5.4-5.8 days were detected at a >3σ level, with a peak at 5.6 days. We consider this strong evidence for a 5.65 day super-orbital period, ∼70% longer than the predicted period. The 0.3-10 keV luminosity varied by a factor of ∼5, consistent with variations seen in long-term monitoring from Chandra. We conclude that other X-ray binaries exhibiting similar long-term behavior are likely to also be X-ray binaries with low mass ratios and super-orbital periods.

  13. SU-F-T-449: Dosimetric Comparison of Acuros XB, Adaptive Convolve in Intensity Modulated Radiotherapy for Head and Neck Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Uehara, R [National Cancer Center Hospital East, Kashiwa, Chiba (Japan); Tachibana, H [National Cancer Center, Kashiwa, Chiba (Japan)


    Purpose: There have been several publications focusing on dose calculation in lung for a new dose calculation algorithm of Acuros XB (AXB). AXB could contribute to dose calculation for high-density media for bone and dental prosthesis rather than in lung. We compared the dosimetric performance of AXB, Adaptive Convolve (AC) in head and neck IMRT plans. Methods: In a phantom study, the difference in depth profile between AXB and AC was evaluated using Kodak EDR2 film sandwiched with tough water phantoms. 6 MV x-ray using the TrueBeam was irradiated. In a patient study, 20 head and neck IMRT plans had been clinically approved in Pinnacle3 and were transferred to Eclipse. Dose distribution was recalculated using AXB in Eclipse while maintaining AC-calculated monitor units and MLC sequence planned in Pinnacle. Subsequently, both the dose-volumetric data obtained using the two different calculation algorithms were compared. Results: The results in the phantom evaluation for the shallow area ahead of the build-up region shows over-dose for AXB and under-dose for AC, respectively. In the patient plans, AXB shows more hot spots especially around the high-density media than AC in terms of PTV (Max difference: 4.0%) and OAR (Max. difference: 1.9%). Compared to AC, there were larger dose deviations in steep dose gradient region and higher skin-dose. Conclusion: In head and neck IMRT plans, AXB and AC show different dosimetric performance for the regions inside the target volume around high-density media, steep dose gradient regions and skin-surface. There are limitations in skin-dose and complex anatomic condition using even inhomogeneous anthropomorphic phantom Thus, there is the potential for an increase of hot-spot in AXB, and an underestimation of dose in substance boundaries and skin regions in AC.

  14. SU-F-T-600: Influence of Acuros XB and AAA Dose Calculation Algorithms On Plan Quality Metrics and Normal Lung Doses in Lung SBRT

    Energy Technology Data Exchange (ETDEWEB)

    Yaparpalvi, R; Mynampati, D; Kuo, H; Garg, M; Tome, W; Kalnicki, S [Montefiore Medical Center, Bronx, NY (United States)


    Purpose: To study the influence of superposition-beam model (AAA) and determinant-photon transport-solver (Acuros XB) dose calculation algorithms on the treatment plan quality metrics and on normal lung dose in Lung SBRT. Methods: Treatment plans of 10 Lung SBRT patients were randomly selected. Patients were prescribed to a total dose of 50-54Gy in 3–5 fractions (10?5 or 18?3). Doses were optimized accomplished with 6-MV using 2-arcs (VMAT). Doses were calculated using AAA algorithm with heterogeneity correction. For each plan, plan quality metrics in the categories- coverage, homogeneity, conformity and gradient were quantified. Repeat dosimetry for these AAA treatment plans was performed using AXB algorithm with heterogeneity correction for same beam and MU parameters. Plan quality metrics were again evaluated and compared with AAA plan metrics. For normal lung dose, V{sub 20} and V{sub 5} to (Total lung- GTV) were evaluated. Results: The results are summarized in Supplemental Table 1. PTV volume was mean 11.4 (±3.3) cm{sup 3}. Comparing RTOG 0813 protocol criteria for conformality, AXB plans yielded on average, similar PITV ratio (individual PITV ratio differences varied from −9 to +15%), reduced target coverage (−1.6%) and increased R50% (+2.6%). Comparing normal lung doses, the lung V{sub 20} (+3.1%) and V{sub 5} (+1.5%) were slightly higher for AXB plans compared to AAA plans. High-dose spillage ((V105%PD - PTV)/ PTV) was slightly lower for AXB plans but the % low dose spillage (D2cm) was similar between the two calculation algorithms. Conclusion: AAA algorithm overestimates lung target dose. Routinely adapting to AXB for dose calculations in Lung SBRT planning may improve dose calculation accuracy, as AXB based calculations have been shown to be closer to Monte Carlo based dose predictions in accuracy and with relatively faster computational time. For clinical practice, revisiting dose-fractionation in Lung SBRT to correct for dose overestimates

  15. Dose-to-medium vs. dose-to-water: Dosimetric evaluation of dose reporting modes in Acuros XB for prostate, lung and breast cancer

    Directory of Open Access Journals (Sweden)

    Suresh Rana


    Full Text Available Purpose: Acuros XB (AXB dose calculation algorithm is available for external beam photon dose calculations in Eclipse treatment planning system (TPS. The AXB can report the absorbed dose in two modes: dose-to-water (Dw and dose-to-medium (Dm. The main purpose of this study was to compare the dosimetric results of the AXB_Dm with that of AXB_Dw on real patient treatment plans. Methods: Four groups of patients (prostate cancer, stereotactic body radiation therapy (SBRT lung cancer, left breast cancer, and right breast cancer were selected for this study, and each group consisted of 5 cases. The treatment plans of all cases were generated in the Eclipse TPS. For each case, treatment plans were computed using AXB_Dw and AXB_Dm for identical beam arrangements. Dosimetric evaluation was done by comparing various dosimetric parameters in the AXB_Dw plans with that of AXB_Dm plans for the corresponding patient case. Results: For the prostate cancer, the mean planning target volume (PTV dose in the AXB_Dw plans was higher by up to 1.0%, but the mean PTV dose was within ±0.3% for the SBRT lung cancer. The analysis of organs at risk (OAR results in the prostate cancer showed that AXB_Dw plans consistently produced higher values for the bladder and femoral heads but not for the rectum. In the case of SBRT lung cancer, a clear trend was seen for the heart mean dose and spinal cord maximum dose, with AXB_Dw plans producing higher values than the AXB_Dm plans. However, the difference in the lung doses between the AXB_Dm and AXB_Dw plans did not always produce a clear trend, with difference ranged from -1.4% to 2.9%. For both the left and right breast cancer, the AXB_Dm plans produced higher maximum dose to the PTV for all cases. The evaluation of the maximum dose to the skin showed higher values in the AXB_Dm plans for all 5 left breast cancer cases, whereas only 2 cases had higher maximum dose to the skin in the AXB_Dm plans for the right breast cancer

  16. SU-E-T-519: Experimental Evaluation of Deterministic Acuros XB Radiation Transport Algorithm for Heterogeneity Dose Calculation Using the Radiological Physics Center's Lung Phantom. (United States)

    Han, T; Mourtada, F; Repchak, R; Tonigan, J; Mikell, J; Howell, R; Salehpour, M; Molineu, A; Followill, D


    To evaluate the heterogeneity corrected dose calculations from the Acuros XB (AXB), a novel deterministic dose calculation algorithm based on grid-based Boltzmann transport equation solver (GBBS), for IMRT and VMAT plans. The Radiological Physics Center's lung phantom was used to create clinically equivalent IMRT and VMAT plans (RapidArc) with the Eclipse planning system 10.0 that were delivered using a Varian 23 iX. Absolute doses and relative dose distributions were measured with thermoluminescent dosimeters (TLDs) and radiochromic film. The measured dose distributions were compared with calculated doses from both AXB (11.0.3) and AAA (10.0.24) dose calculation algorithms. The AXB calculated dose-to-water and dose-to-medium were both compared to measurements. Gamma analysis (±7%/4mm, ±5%/3mm, and ±3%/3mm) was used to quantify correspondence between AXB dose distributions and the film measurements. The computation time between AAA and AXB were also evaluated. For TLD point doses, both AAA and AXB heterogeneity corrected dose calculations are within 5% inside the PTV for both IMRT and VMAT plans. The agreements observed between the measured and calculated doses for both AXB dose reporting methods are better than those observed with the AAA algorithm. The gamma analysis showed that the differences between AAA, AXB and film measurement met the RPC ±7%/4 mm criteria. The percent of pixels passing rate for both the AXB dose to medium and AXB dose to water are higher than AAA. The computation time between AAA and AXB are comparable for IMRT plans but AXB is significantly faster (4 times) than AAA for VMAT plans. The AXB implemented in the Eclipse planning system calculates a more accurate heterogeneity corrected dose than the AAA algorithm as compared to measurement in lung and improve the calculation speed for VMAT radiotherapy. Work supported by grants CA10953, CA81647, 2R44CA105806-02, CA016672 (NCI, DHHS). © 2012 American Association of Physicists in Medicine.

  17. Complex phase dynamics in coupled bursters

    DEFF Research Database (Denmark)

    Postnov, D.E.; Sosnovtseva, Olga; Malova, S.Y.


    The phenomenon of phase multistability in the synchronization of two coupled oscillatory systems typically arises when the systems individually display complex wave forms associated, for instance, with the presence of subharmonic components. Alternatively, phase multistability can be caused...... by variations of the phase velocity along the orbit of the individual oscillator. Focusing on the mechanisms underlying the appearance of phase multistability, the paper examines a variety of phase-locked patterns in the bursting behavior of a model of coupled pancreatic cells. In particular, we show how...... the number of spikes per train and the proximity of a neighboring equilibrium point can influence the formation of coexisting regimes....

  18. Effect of Ga addition on the valence state of Ce and magnetic properties of melt-spun Ce17Fe78-xB6Gax (x = 0-1.0 ribbons

    Directory of Open Access Journals (Sweden)

    Qingzheng Jiang


    Full Text Available The Ce17Fe78-xB6Gax (x=0-1.0 ribbons were fabricated by a melt-spinning technique in order to study the mechanism of the valence variation of Ce and their magnetic properties as well as improve the thermal stability of Ce-based rare earth permanent magnets. The systematic investigations of the Ce17Fe78-xB6Gax (x=0-1.0 alloys show that the room-temperature coercivity increases significantly from 352 kA/m at x = 0 to 492 kA/m at x = 1.0. The Curie temperature (Tc increases monotonically from 424.5 K to 433.6 K, and the temperature coefficients of remanence (α and coercivity (β of the ribbons are better off from -0.56 %/K, -0.75 %/K for x = 0 to -0.45 %/K, -0.65 %/K for x = 0.75 in the temperature range of 300–400 K, respectively. The Ce L3-edge X-ray absorption near edge structure (XANES spectrums reveal that there is more Ce4+ in ribbons under total electron yield than fluorescence yield as Ce has a high affinity with oxygen. The weight of Ce3+ increases while the weight of Ce4+ decreases in Ga-added alloys. The refined grain size and a more uniform microstructure are mainly attributed to the improved magnetic properties and thermal stability with Ga doping. This paper may serve as a reference for further developing the so-called gap magnets and the effective utilization of the rare earth resources.

  19. Effects of the substitution of P2O5 by B2O3 on the structure and dielectric properties in (90-x) P2O5-xB2O3-10Fe2O3 glasses. (United States)

    Sdiri, N; Elhouichet, H; Dhaou, H; Mokhtar, F


    90%[xB2O3 (1-x) P2O5] 10%Fe2O3, glass systems where (x=0 mol%, 5 mol%, 10 mol%, 15 mol%, 20 mol%) was prepared via a melt quenching technique. The structure of glass is investigated at room temperature by, Raman and EPR spectroscopy. Raman studies have been performed on these glasses to examine the distribution of different borate and phosphate structural groups. We have noted an increase from 3 to 4 in the coordination number of the boron atoms from 3 to 4, i.e., the conversion of the BO3 triangular structural units into BO4 tetrahedra. The samples have been investigated by means of electron paramagnetic resonance (EPR). The results obtained from the gef=4.28 EPR line are typical of the occurrence of iron (III) occupying substitutional sites. Moreover, the dielectric sizes such as ε'(ω), ε″(ω), imaginary parts of the electrical modulus, M(*)(ω) and the loss tanδ, their variation with frequency at room temperature show a decrease in relaxation intensity with an increase in the concentration of (B2O3). On the present work, we have found a weak extinction index with our new glass. Copyright © 2013. Published by Elsevier B.V.

  20. Observation of $e^+e^- \\to \\pi^+ \\pi^- \\pi^0 \\chi_{bJ}$ and search for $X_b \\to \\omega \\Upsilon(1S)$ at $\\sqrt{s}\\sim 10.867$ GeV

    CERN Document Server

    He, X H; Yuan, C Z; Ban, Y; Abdesselam, A; Adachi, I; Aihara, H; Asner, D M; Aulchenko, V; Aushev, T; Ayad, R; Bahinipati, S; Bakich, A M; Bansal, V; Bhuyan, B; Bondar, A; Bonvicini, G; Bozek, A; Browder, T E; Červenkov, D; Chang, P; Chekelian, V; Chen, A; Cheon, B G; Chilikin, K; Chistov, R; Cho, K; Chobanova, V; Choi, S -K; Choi, Y; Cinabro, D; Dalseno, J; Danilov, M; Doležal, Z; Drásal, Z; Drutskoy, A; Eidelman, S; Farhat, H; Fast, J E; Ferber, T; Gaur, V; Gabyshev, N; Ganguly, S; Garmash, A; Gillard, R; Glattauer, R; Goh, Y M; Grzymkowska, O; Haba, J; Hayasaka, K; Hayashii, H; Hou, W -S; Iijima, T; Ishikawa, A; Itoh, R; Iwasaki, Y; Jaegle, I; Joo, K K; Julius, T; Kato, E; Kawasaki, T; Kim, D Y; Kim, M J; Kim, Y J; Kinoshita, K; Ko, B R; Kodyš, P; Korpar, S; Križan, P; Krokovny, P; Kumita, T; Kwon, Y -J; Li, Y; Libby, J; Liventsev, D; Matvienko, D; Miyata, H; Mizuk, R; Mohanty, G B; Moll, A; Mussa, R; Nakano, E; Nakao, M; Nanut, T; Natkaniec, Z; Nedelkovska, E; Nisar, N K; Nishida, S; Ogawa, S; Okuno, S; Pakhlov, P; Pakhlova, G; Park, H; Pedlar, T K; Pestotnik, R; Petrič, M; Piilonen, L E; Ritter, M; Rostomyan, A; Sakai, Y; Sandilya, S; Santelj, L; Sanuki, T; Sato, Y; Savinov, V; Schneider, O; Schnell, G; Schwanda, C; Semmler, D; Senyo, K; Sevior, M E; Shebalin, V; Shibata, T -A; Shiu, J -G; Shwartz, B; Sibidanov, A; Simon, F; Sohn, Y -S; Sokolov, A; Solovieva, E; Starič, M; Steder, M; Sumisawa, K; Sumiyoshi, T; Tamponi, U; Tanida, K; Tatishvili, G; Teramoto, Y; Thorne, F; Trabelsi, K; Uchida, M; Uehara, S; Uglov, T; Unno, Y; Uno, S; Urquijo, P; Vahsen, S E; Van Hulse, C; Vanhoefer, P; Varner, G; Vinokurova, A; Vorobyev, V; Wagner, M N; Wang, C H; Wang, M -Z; Wang, P; Wang, X L; Watanabe, M; Watanabe, Y; Wehle, S; Williams, K M; Won, E; Yamaoka, J; Yashchenko, S; Yook, Y; Yusa, Y; Zhang, Z P; Zhilich, V; Zhulanov, V; Zupanc, A


    The $e^+e^- \\to \\pi^+ \\pi^- \\pi^0 \\chi_{bJ}$ ($J=0,~1,~2$) processes are studied using a 118~fb$^{-1}$ data sample collected at a center-of-mass energy of 10.867 GeV, in the $\\Upsilon(10860)$ energy range, with the Belle detector. The $\\pi^+ \\pi^- \\pi^0 \\chi_{b1}$, $\\pi^+\\pi^-\\pi^0\\chi_{b2}$, $\\omega\\chi_{b1}$ signals and the evidence of $\\omega\\chi_{b2}$ are observed for the first time and the cross sections are measured. No significant $\\pi^+\\pi^-\\pi^0\\chi_{b0}$ or $\\omega\\chi_{b0}$ signal is observed and 90\\% confidence level upper limits on the cross sections for these two processes are obtained. In the $\\pi^+\\pi^-\\pi^0$ invariant mass spectrum, significant non-$\\omega$ signals are also observed. We search for the $X(3872)$-like state with a hidden $b\\bar{b}$ component (named $X_b$) decaying into $\\omega \\Upsilon(1S)$; no significant signal is observed with a mass between $10.55$ and $10.65$ GeV/$c^2$.

  1. Ionic conductivity of mixed glass former 0.35Na(2)O + 0.65[xB(2)O(3) + (1 - x)P(2)O(5)] glasses. (United States)

    Christensen, Randilynn; Olson, Garrett; Martin, Steve W


    The mixed glass former effect (MGFE) is defined as a nonlinear and nonadditive change in the ionic conductivity with changing glass former fraction at constant modifier composition between two binary glass forming compositions. In this study, mixed glass former (MGF) sodium borophosphate glasses, 0.35Na2O + 0.65[xB2O3 + (1 - x)P2O5], 0 ≤ x ≤ 1, have been prepared, and their sodium ionic conductivity has been studied. The ionic conductivity exhibits a strong, positive MGFE that is caused by a corresponding strongly negative nonlinear, nonadditive change in the conductivity activation energy with changing glass former content, x. We describe a successful model of the MGFE in the conductivity activation energy terms of the underlying short-range order (SRO) phosphate and borate glass former structures present in these glasses. To do this, we have developed a modified Anderson-Stuart (A-S) model to explain the decrease in the activation energy in terms of the atomic level composition dependence (x) of the borate and phosphate SRO structural groups, the Na(+) ion concentration, and the Na(+) mobility. In our revision of the A-S model, we carefully improve the treatment of the cation jump distance and incorporate an effective Madelung constant to account for many body coulomb potential effects. Using our model, we are able to accurately reproduce the composition dependence of the activation energy with a single adjustable parameter, the effective Madelung constant, that changes systematically with composition, x, and varies by no more than 10% from values typical of oxide ceramics. Our model suggests that the decreasing columbic binding energies that govern the concentration of the mobile cations are sufficiently strong in these glasses to overcome the increasing volumetric strain energies (mobility) caused by strongly increasing glass-transition temperatures combined with strongly decreasing molar volumes of these glasses. The dependence of the columbic binding

  2. Structural studies of mixed glass former 0.35Na2O + 0.65[xB2O3 + (1 - x)P2O5] glasses by Raman and 11B and 31P magic angle spinning nuclear magnetic resonance spectroscopies. (United States)

    Christensen, Randilynn; Olson, Garrett; Martin, Steve W


    The mixed glass former (MGF) effect (MGFE) is defined as a nonlinear and nonadditive change in the ionic conductivity with changing glass former composition at constant modifier composition. In this study, sodium borophosphate 0.35Na(2)O + 0.65[xB(2)O(3) + (1 - x)P(2)O(5)], 0 ≤ x ≤ 1, glasses which have been shown to exhibit a positive MGFE have been prepared and examined using Raman and (11)B and (31)P magic angle spinning nuclear magnetic resonance (MAS NMR) spectroscopies. Through examination of the short-range order (SRO) structures found in the ternary glasses, it was determined that the minority glass former, B for 0.1 ≤ x ≤ 0.7 and P for 0.7 ≤ x ≤ 0.9, is "overmodified" and contains more Na(+) ions than would be expected from simple linear mixing of the binary sodium borate, x = 1, and sodium phosphate, x = 0, glasses, respectively. Changes in the intermediate range order (IRO) structures were suggested by changes in the NMR spectral chemical shifts and Raman spectra wavenumber shifts over the full composition range x in the Raman and MAS NMR spectra. The changes observed in the chemical shifts of (31)P MAS NMR spectra with x are found to be too large to be caused solely by changing sodium modification of the phosphate SRO structural groups, and this indicates that internetwork bonding between phosphorus and boron through bridging oxygens (BOs), P-O-B, must be a major contributor to the IRO structure of these glasses. While not fully developed, a first-order thermodynamic analysis based upon the Gibbs free energies of formation of the various SRO structural units in this system has been developed and can be used to account for the preferential formation of tetrahedral boron groups, B(4), by the reaction of B(3) with P(2) groups to form B(4) and P(3) groups, respectively, where the superscript denotes the number of BOs on these units, in these glasses. This preference for B(4) units appears to be a predominate cause of the changing modifier to

  3. Radio Imaging Observations of PSR J1023+0038 in an LMXB State

    NARCIS (Netherlands)

    Deller, A.T.; Moldon, J.; Miller-Jones, J.C.A.; Patruno, A.; Hessels, J.W.T.; Archibald, A.M.; Paragi, Z.; Heald, G.; Vilchez, N.


    The transitional millisecond pulsar (MSP) binary system PSR J1023+0038 re-entered an accreting state in 2013 June in which it bears many similarities to low-mass X-ray binaries (LMXBs) in quiescence or near-quiescence. At a distance of just 1.37 kpc, PSR J1023+0038 offers an unsurpassed ability to

  4. The puzzling orbital period evolution of the LMXB AX J1745.6-2901 (United States)

    Ponti, G.; De, K.; Munoz-Darias, T.; Stella, L.; Nandra, K.


    The discovery of gravitational waves through mergers of binary black holes raises the question of how such compact systems form, renewing issues related to the orbital evolution of binary systems. Eclipsing X-ray binaries are excellent tools to constrain the orbital period evolution and how the system loses angular momentum. I will present an X-ray eclipse timing analysis (spanning an interval of more than 20 yr) of one of such objects, AX J1745.6-2901. Its orbital period is decreasing at a rate Pdotorb=-4.03+-0.32 e-11 s s-1, at least one order of magnitude larger than expected from conservative mass transfer and angular momentum losses due to gravitational waves and magnetic braking, and it might result from either non-conservative mass transfer or magnetic activity changing the quadrupole moment of the companion star. I will also show that imprinted on the long-term evolution of the orbit, there are highly significant eclipse leads delays of 10-30 s, characterized by a clear state dependence in which, on average, eclipses occur earlier during the hard state. Finally, I will discuss whether accretion disc winds might have an impact onto the orbital evolution.

  5. Voltage interval mappings for activity transitions in neuron models for elliptic bursters (United States)

    Wojcik, Jeremy; Shilnikov, Andrey


    We performed a thorough bifurcation analysis of a mathematical elliptic bursting model, using a computer-assisted reduction to equationless, one-dimensional Poincaré mappings for a voltage interval. Using the interval mappings, we were able to examine in detail the bifurcations that underlie the complex activity transitions between: tonic spiking and bursting, bursting and mixed-mode oscillations, and finally mixed-mode oscillations and quiescence in the FitzHugh-Nagumo-Rinzel model. We illustrate the wealth of information, qualitative and quantitative, that was derived from the Poincaré mappings, for the neuronal models and for similar (electro)chemical systems.

  6. Making a Swim Central Pattern Generator Out of Latent Parabolic Bursters (United States)

    Alaçam, Deniz; Shilnikov, Andrey


    We study the rhythmogenesis of oscillatory patterns emerging in network motifs composed of inhibitory coupled tonic spiking neurons represented by the Plant model of R15 nerve cells. Such motifs are argued to be used as building blocks for a larger central pattern generator network controlling swim locomotion of sea slug Melibe leonina.

  7. Swift follow-up of the newly discovered burster millisecond pulsar IGR J17511-3057

    NARCIS (Netherlands)

    Bozzo, E.; Ferrigno, C.; Kuulkers, E.; Falanga, M.; Chenevez, J.; Brandt, S.; Beckmann, V.; Bird, A.; Domingo, A.; Ebisawa, K.; Jonker, P.; Kretschmar, P.; Markwardt, C.; Oosterbroek, T.; Paizis, A.; Risquez, D.; Sanchez-Fernandez, C.; Shaw, S.; Wijnands, R.


    Following the discovery of the new hard X-ray transient IGR J17511-3057 by INTEGRAL (Atel #2196) and its classification as a millisecond pulsar by RXTE (Atel #2197), a Swift ToO was performed. Swift/XRT observed IGR J17511-3057 on 2009-09-13 at 19:53:31 for a total exposure time of 4 ks. The first

  8. RXTE confirms persistent activity of burster IGR J17473-2721

    NARCIS (Netherlands)

    Markwardt, C.B.; Altamirano, D.; Swank, J.H.; in 't Zand, J.


    Following reports of bursting activity of IGR J17473-2721 (= XTE J1747-274) by the AGILE team (Del Monte et al., ATEL #1445) and from Swift (Altamirano et al., ATEL #1459), we note that RXTE PCA monitoring scans of the source also reveal persistent activity. Scans on 2008-03-28 at 18:50 UT and

  9. Canards in a minimal piecewise-linear square-wave burster

    Energy Technology Data Exchange (ETDEWEB)

    Desroches, M.; Krupa, M. [Inria Sophia-Antipolis Méditerranée Research Centre, MathNeuro Project-Team 2004 route des Lucioles BP 93, 06902 Valbonne Cedex (France); Fernández-García, S., E-mail: [Departamento EDAN, University of Seville, Facultad de Matemáticas C/ Tarfia, s/n., 41012 Sevilla (Spain)


    We construct a piecewise-linear (PWL) approximation of the Hindmarsh-Rose (HR) neuron model that is minimal, in the sense that the vector field has the least number of linearity zones, in order to reproduce all the dynamics present in the original HR model with classical parameter values. This includes square-wave bursting and also special trajectories called canards, which possess long repelling segments and organise the transitions between stable bursting patterns with n and n + 1 spikes, also referred to as spike-adding canard explosions. We propose a first approximation of the smooth HR model, using a continuous PWL system, and show that its fast subsystem cannot possess a homoclinic bifurcation, which is necessary to obtain proper square-wave bursting. We then relax the assumption of continuity of the vector field across all zones, and we show that we can obtain a homoclinic bifurcation in the fast subsystem. We use the recently developed canard theory for PWL systems in order to reproduce the spike-adding canard explosion feature of the HR model as studied, e.g., in Desroches et al., Chaos 23(4), 046106 (2013).

  10. Swift follow-up of the newly discovered burster millisecond pulsar IGR J17511-3057

    DEFF Research Database (Denmark)

    Bozzo, E.; Ferrigno, C.; Kuulkers, E.


    Following the discovery of the new hard X-ray transient IGR J17511-3057 by INTEGRAL (Atel #2196) and its classification as a millisecond pulsar by RXTE (Atel #2197), a Swift ToO was performed. Swift/XRT observed IGR J17511-3057 on 2009-09-13 at 19:53:31 for a total exposure time of 4 ks. The first...

  11. Noise, transient dynamics, and the generation of realistic interspike interval variation in square-wave burster neurons (United States)

    Marin, Bóris; Pinto, Reynaldo Daniel; Elson, Robert C.; Colli, Eduardo


    First return maps of interspike intervals for biological neurons that generate repetitive bursts of impulses can display stereotyped structures (neuronal signatures). Such structures have been linked to the possibility of multicoding and multifunctionality in neural networks that produce and control rhythmical motor patterns. In some cases, isolating the neurons from their synaptic network reveals irregular, complex signatures that have been regarded as evidence of intrinsic, chaotic behavior. We show that incorporation of dynamical noise into minimal neuron models of square-wave bursting (either conductance-based or abstract) produces signatures akin to those observed in biological examples, without the need for fine tuning of parameters or ad hoc constructions for inducing chaotic activity. The form of the stochastic term is not strongly constrained and can approximate several possible sources of noise, e.g., random channel gating or synaptic bombardment. The cornerstone of this signature generation mechanism is the rich, transient, but deterministic dynamics inherent in the square-wave (saddle-node and homoclinic) mode of neuronal bursting. We show that noise causes the dynamics to populate a complex transient scaffolding or skeleton in state space, even for models that (without added noise) generate only periodic activity (whether in bursting or tonic spiking mode).

  12. Observational evidence for strange matter in compact objects from the x-ray burster 4U 1820-30

    Energy Technology Data Exchange (ETDEWEB)

    Bombaci, I. [Dipartimento di Fisica, Universita di Pisa and INFN Sezione di Pisa, Piazza Torricelli 2, I-56100 Pisa (Italy)


    We present systematic calculations of the mass-radius (MR) relation of a neutron star (NS) using a large variety of modern equations of state (EOS) of dense matter. The role of strangeness on the EOS and on the MR relation is particularly emphasized. Theoretical results are then compared with the semiempirical MR relation recently extracted for the x-ray burst source 4U 1820-30. Based on this comparison, we propose that the compact object in 4U 1820-30 is a kaon-condensed nucleon star or a strange star. {copyright} {ital 1997} {ital The American Physical Society}

  13. IGR J17445-2747—Yet another X-ray burster in the galactic bulge (United States)

    Mereminskiy, I. A.; Grebenev, S. A.; Sunyaev, R. A.


    The discovery of a type I X-ray burst from the faint unidentified transient source IGR J17445-2747 in the Galactic bulge by the JEM-X telescope onboard the INTEGRAL observatory is reported. Type I bursts are believed to be associated with thermonuclear explosions of accreted matter on the surface of a neutron star with a weak magnetic field in a low-mass X-ray binary. Thus, this observation allows the nature of this source to be established.

  14. Data of evolutionary structure change: 1TUXA-2Q8XB [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available 499908447266 -6.618000030517578 117.447998046875 > 0.1469999998807...86 -0.32899999618530273 > 3.485690116882324 7.434614181518555...3281 6.438000202178955 99.05000305175781 n> 0.11599999666213989...y> -0.027000000700354576 > 2.066138982772827 4.147003173828125 71.23400115966797 11.675999641418457 84.49700164794922 > 0

  15. XbD Video 3, The SEEing process of qualitative data analysis

    DEFF Research Database (Denmark)


    This is the third video in the Experience-based Designing series. It presents a live classroom demonstration of a nine step qualitative data analysis process called SEEing: The process is useful for uncovering or discovering deeper layers of 'meaning' and meaning structures in an experience...

  16. Data of evolutionary structure change: 1F3XB-3GQYD [Confc[Archive

    Lifescience Database Archive (English)


  17. Data of evolutionary structure change: 1F3XB-3GR4C [Confc[Archive

    Lifescience Database Archive (English)


  18. Data of evolutionary structure change: 1F3XB-3G2GB [Confc[Archive

    Lifescience Database Archive (English)


  19. Data of evolutionary structure change: 1F3XB-3H6OB [Confc[Archive

    Lifescience Database Archive (English)


  20. Data of evolutionary structure change: 1F3XB-3GQYA [Confc[Archive

    Lifescience Database Archive (English)


  1. Data of evolutionary structure change: 1E0XB-1CLXC [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available 94599914550781 -27.075000762939453 > -0.8320000171661377 -0.34700000286102295...871999979019165 -0.47600001096725464 > 2.2291390895843506 4.535857200622559...71299743652344 -11.255999565124512 > -0.8479999899864197 -0.3490000069141388...8349999785423279 -0.5429999828338623 > 1.3961290121078491 2.4157309532165527...45099639892578 -62.17100143432617 > -0.6359999775886536 -0.4429999887943268

  2. XbD Video 2, Taxonomy of Experience (ToE) [Online

    DEFF Research Database (Denmark)


    This is the second video in the Experience-based Designing series: It describes the Taxonomy of Experience, a structural way of looking at human experiences of almost any kind.This hierarchical model is useful to researchers and decision makers as a general method or tool for guiding the collection......, processing and categorisation of field data about an everyday experience. Researchers using this model often referred to the process as 'doing a ToE'...

  3. Dosimetric comparison of peripheral NSCLC SBRT using Acuros XB and AAA calculation algorithms. (United States)

    Ong, Chloe C H; Ang, Khong Wei; Soh, Roger C X; Tin, Kah Ming; Yap, Jerome H H; Lee, James C L; Bragg, Christopher M


    There is a concern for dose calculation in highly heterogenous environments such as the thorax region. This study compares the quality of treatment plans of peripheral non-small cell lung cancer (NSCLC) stereotactic body radiation therapy (SBRT) using 2 calculation algorithms, namely, Eclipse Anisotropic Analytical Algorithm (AAA) and Acuros External Beam (AXB), for 3-dimensional conformal radiation therapy (3DCRT) and volumetric-modulated arc therapy (VMAT). Four-dimensional computed tomography (4DCT) data from 20 anonymized patients were studied using Varian Eclipse planning system, AXB, and AAA version 10.0.28. A 3DCRT plan and a VMAT plan were generated using AAA and AXB with constant plan parameters for each patient. The prescription and dose constraints were benchmarked against Radiation Therapy Oncology Group (RTOG) 0915 protocol. Planning parameters of the plan were compared statistically using Mann-Whitney U tests. Results showed that 3DCRT and VMAT plans have a lower target coverage up to 8% when calculated using AXB as compared with AAA. The conformity index (CI) for AXB plans was 4.7% lower than AAA plans, but was closer to unity, which indicated better target conformity. AXB produced plans with global maximum doses which were, on average, 2% hotter than AAA plans. Both 3DCRT and VMAT plans were able to achieve D95%. VMAT plans were shown to be more conformal (CI = 1.01) and were at least 3.2% and 1.5% lower in terms of PTV maximum and mean dose, respectively. There was no statistically significant difference for doses received by organs at risk (OARs) regardless of calculation algorithms and treatment techniques. In general, the difference in tissue modeling for AXB and AAA algorithm is responsible for the dose distribution between the AXB and the AAA algorithms. The AXB VMAT plans could be used to benefit patients receiving peripheral NSCLC SBRT. Copyright © 2017 American Association of Medical Dosimetrists. Published by Elsevier Inc. All rights reserved.

  4. Data of evolutionary structure change: 1G9XB-2FGKA [Confc[Archive

    Lifescience Database Archive (English)

    Full Text Available 03 10.933 1.00 6.79 C -map> ASP LEU> LYS CA 6.04 5.68 3.83 ALA CA 6.44 3.80 LEU CA 3.79 ASP CA ...44 -19.492 1.00 52.71 C -map> ASP LEU ILE VAL PRO SER ASP PRO LYS...ine>ILE CA 6.39 3.79 LEU CA 3.80 ASP CA -map> PHE ...957 1.00 4.24 C ATOM 3759 CA VAL B1225 23.647 79.729 24.464 1.00 7.08 C

  5. NuSTAR and XMM-Newton observations of 1e1743.1-2843: indications of a neutron star LMXB nature of the compact object

    DEFF Research Database (Denmark)

    Lotti, Simone; Natalucci, Lorenzo; Mori, Kaya


    We report on the results of NuSTAR and XMM-Newton observations of the persistent X-ray source 1E1743.1-2843, located in the Galactic Center region. The source was observed between 2012 September and October by NuSTAR and XMM-Newton, providing almost simultaneous observations in the hard and soft X......-ray bands. The high X-ray luminosity points to the presence of an accreting compact object. We analyze the possibilities of this accreting compact object being either a neutron star (NS) or a black hole, and conclude that the joint XMM-Newton and NuSTAR spectrum from 0.3 to 40 keV fits a blackbody spectrum...

  6. Acuros XB: Impact dosimetric heterogeneous geometric appliance low density AXB represents a step forward in terms of algorithms of calculation for the planning of treatments; Acuros XB: impacto dosimetrico de artefactos geometricos heterogeneos de baja densidad

    Energy Technology Data Exchange (ETDEWEB)

    Jurado Bruggeman, D.; Munoz Montplet, C.; Agramunt Chaler, S.; Bueno Vizcarra, M.; Duch Guillen, M. A.


    In some situations, the dose distributions which provides are significantly different from those obtained with other marketed algorithms, which entails new challenges for evaluation and optimization of the treatment. (Author)

  7. Designing for 'meaningful' patient experience using Xperience-based designing (XbD): A new twist on a familiar approach

    DEFF Research Database (Denmark)

    Coxon, Ian Robert


    ); standard observational/conversational techniques (with a technological twist) and hermeneutic meaning analysis methods (The SEEing process - Coxon, 2008) that elevate the deep meaning structures within field data. Based on the understandings so produced, we ‘design’ a process for sharing insights...... to practitioners who value the patient experience as an important aspect of designing-4-health in terms of products, services and systems...... requires a heavy reliance on welfare technology solutions currently being developed that promote outpatient self-management and home-care. In the rush to accomplish these admirable goals the patient experience of existing and proposed services and products in most cases, has been largely overlooked...

  8. Inpatients’ opinions on a hospital in Portugal [v1; ref status: indexed,

    Directory of Open Access Journals (Sweden)

    Carina C Silva


    Full Text Available Background: Little is known about the relationship between the opinions of inpatients and the degree to which hospitals are improving in performance over time. The aim of this study was to determine the personal assessment level of inpatients or their representatives regarding aspects of health care in an internal medicine ward. Methods: We carried out a questionnaire in September 2011 with 284 discharged patients and patient representatives, focusing on their opinions about the department, health professionals and amenities, with response options ranging from 1 (very bad to 5 (very good. The relationships between domains from the questionnaire and socio-demographic factors were examined using a t-test and one-way ANOVA. Results: The response rate was 78%. The patients showed a slightly higher mean score (m for factors in the medical care domain than did the patient representatives (m = 4.51 vs. m = 4.27; p = 0.014. The mean score of all the items in all domains was 4.24; this allowed us to determine the difference from the overall mean (DIFM for medical care (DIFM = 0.18; p = 0.000, foods (DIFM = –0.31; p = 0.000, diagnostic tests (DIFM = –0.15; p = 0.036 and transport (DIFM = –0.41; p = 0.000. Respondents with a medium or higher educational level gave lower scores to the domains food (m = 3.74; p = 0.004, diagnostic tests (m = 3.72; p = 0.04 and transport (m = 3.62; p = 0.025 than those with lower educational levels. The domains facilities (m = 2.4; p = 0.04 and diagnostic tests (m = 3.63; p = 0.009 were given lower scores by those aged <50 years compared with older respondents. Conclusions: Our findings suggest that the evaluation of the responders will allow the hospital management to make improvements in the quality of care.

  9. $X_{b}$ Search and Measurement of the $Y(1)$, $(2S)$ and $Y(3S)$ Polarization

    Energy Technology Data Exchange (ETDEWEB)

    Marino, Claudia [Karlsruhe Inst. of Technology (KIT) (Germany)


    There are two studies presented in this analysis. The rst one is the measurement of the Υ(1S), Υ(2S) and Υ(3S) polarization in two orthogonal frames: the helicity and the Collins-Soper frame. The second is the search for a possible bottom counterpart of the X(3872) which would show up as a narrow resonance in the Υ(1S)π+ π- nal state.

  10. Investigação experimental do veículo hipersônico aeroespacial 14-XB


    Martos, João Felipe de Araújo


    Orientador: Prof. Dr. João Felipe de Araújo Martos Dissertação (mestrado) - Universidade Federal do ABC, Programa de Pós-Graduação em Engenharia Mecânica, 2014. O veículo hipersônico aeroespacial brasileiro 14-X B (VHA 14-X B) é um demonstrador tecnológico do sistema de propulsão hipersônica aspirada com base em combustão supersônica (scramjet) projetado para voar na atmosfera da Terra a 30 quilômetros de altitude e número de Mach 7. O VHA 14-X B encontra-se em desenvolvimento no Labora...

  11. Preparation and Characterization of Mg1-xB2 Bulk Samples and Cu/Nb Sheathed Wires with Low Grade Amorphous Boron Powder

    DEFF Research Database (Denmark)

    Grivel, Jean-Claude; Alexiou, Aikaterini; Rubesova, Katerina


    MgB2 bulk and wire samples were prepared using cheap, low grade amorphous boron powders. Based on chemical analysis performed on the starting reagents, three nominal stoichiometries were studied. It was found that the structural and superconducting properties of the bulk samples were not affected...


    Energy Technology Data Exchange (ETDEWEB)

    Burke, Mark J.; Raychaudhury, Somak [School of Physics and Astronomy, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom); Kraft, Ralph P.; Forman, William R.; Jones, Christine; Murray, Stephen S.; Birkinshaw, Mark; Evans, Daniel A.; Jordan, Andres [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Maccarone, Thomas J.; Croston, Judith H. [School of Physics and Astronomy, University of Southampton, Southampton SO17 1BJ (United Kingdom); Brassington, Nicola J.; Hardcastle, Martin J.; Goodger, Joanna L. [School of Physics, Astronomy, and Mathematics, University of Hertfordshire, Hatfield AL10 9AB (United Kingdom); Kainulainen, Jouni [Max-Planck-Institute for Astronomy, Koenigstuhl 17, D-69117 Heidelberg (Germany); Woodley, Kristin A. [Department of Physics and Astronomy, University of British Columbia, Vancouver BC V6T 1Z1 (Canada); Sivakoff, Gregory R. [Department of Physics, University of Alberta, Edmonton, Alberta T6G 2E1 (Canada); Gilfanov, Marat [Max-Planck-Institut fuer Astrophysik, Karl-Schwarzschild-Str. 1, D-85741, Garching (Germany); Sarazin, Craig L. [Department of Astronomy, University of Virginia, P.O. Box 400325, Charlottesville, VA 22904-4325 (United States); Voss, Rasmus, E-mail: [Department of Astrophysics/IMAPP, Radboud, University Nijmegen, P.O. Box 9010, NL-6500 GL Nijmegen (Netherlands); and others


    We present a spectral investigation of X-ray binaries (XBs) in NGC 5128 (Cen A), using six 100 ks Chandra observations taken over two months in 2007. We divide our sample into thermally and non-thermally dominated states based on the behavior of the fitted absorption column N{sub H}, and present the spectral parameters of sources with L{sub x} {approx}> 2 Multiplication-Sign 10{sup 37} erg s{sup -1}. The majority of sources are consistent with being neutron star low-mass X-ray binaries (NS LMXBs) and we identify three transient black hole (BH) LMXB candidates coincident with the dust lane, which is the remnant of a small late-type galaxy. Our results also provide tentative support for the apparent 'gap' in the mass distribution of compact objects between {approx}2-5 M{sub Sun }. We propose that BH LMXBs are preferentially found in the dust lane, and suggest this is because of the younger stellar population. The majority ({approx}70%-80%) of potential Roche lobe filling donors in the Cen A halo are {approx}> 12 Gyr old, while BH LMXBs require donors {approx}> 1 M{sub Sun} to produce the observed peak luminosities. This requirement for more massive donors may also explain recent results that claim a steepening of the X-ray luminosity function with age at L{sub x} {>=} 5 Multiplication-Sign 10{sup 38} erg s{sup -1} for the XB population of early-type galaxies; for older stellar populations, there are fewer stars {approx}> 1 M{sub Sun }, which are required to form the more luminous sources.

  13. Phantom bursting is highly sensitive to noise and unlikely to account for slow bursting in beta-cells

    DEFF Research Database (Denmark)

    Pedersen, Morten Gram


    Pancreatic beta-cells show bursting electrical activity with a wide range of burst periods ranging from a few seconds, often seen in isolated cells, over tens of seconds (medium bursting), usually observed in intact islets, to several minutes. The phantom burster model [Bertram, R., Previte, J......., Sherman, A., Kinard, T.A., Satin, L.S., 2000. The phantom burster model for pancreatic beta-cells. Biophys. J. 79, 2880-2892] provided a framework, which covered this span, and gave an explanation of how to obtain medium bursting combining two processes operating on different time scales. However, single...... cells are subjected to stochastic fluctuations in plasma membrane currents, which are likely to disturb the bursting mechanism and transform medium bursters into spikers or very fast bursters. We present a polynomial, minimal, phantom burster model and show that noise modifies the plateau fraction...

  14. Drug: D07980 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available LOGICALS D07 CORTICOSTEROIDS, DERMATOLOGICAL PREPARATIONS D07A CORTICOSTEROIDS, PLAIN D07AB Corticosteroids,... COMBINATIONS D07XB Corticosteroids, moderately potent, other combinations D07XB0

  15. New technique for a simultaneous estimation of the level density and radiative strength functions of dipole transitions at E sub e sub x<=B sub n -0.5 MeV

    CERN Document Server

    Khitrov, V A


    The new, model-independent method to estimate simultaneously the level densities excited in the (n,gamma) reaction and the radiative strength functions of dipole transitions is developed. The method can be applied for any nucleus and reaction followed by cascade gamma-emission. It is just necessary to measure the intensities of two-step gamma-cascades depopulating one or several high-excited states and determine the quanta ordering in the main portion of the observed cascades. The method provides a sufficiently narrow interval of most probable densities of levels with given J suppi and radiative strength functions of dipole transitions populating them.

  16. Studies on formation of unconfined detonable vapor cloud using explosive means. (United States)

    Apparao, A; Rao, C R; Tewari, S P


    Certain organic liquid fuels like hydrocarbons, hydrocarbon oxides, when dispersed in air in the form of small droplets, mix with surrounding atmosphere forming vapor cloud (aerosol) and acquire explosive properties. This paper describes the studies on establishment of conditions for dispersion of fuels in air using explosive means resulting in formation of detonable aerosols of propylene oxide and ethylene oxide. Burster charges based on different explosives were evaluated for the capability to disperse the fuels without causing ignition. Parameters like design of canister, burster tube, burster charge type, etc. have been studied based on dispersion experiments. The detonability of the aerosol formed by the optimized burster charge system was also tested. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. A very rare triple-peaked type-I X-ray burst in the low-mass X-ray binary 4U 1636-53

    NARCIS (Netherlands)

    Zhang, Guobao; Mendez, Mariano; Altamirano, Diego; Belloni, Tomaso M.; Homan, Jeroen


    We have discovered a triple-peaked X-ray burst from the low-mass X-ray binary (LMXB) 4U 1636-53 with the Rossi X-ray Timing Explorer (RXTE). This is the first triple-peaked burst reported from any LMXB using RXTE, and it is only the second burst of this kind observed from any source. (The previous

  18. Drug: D08423 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available c Same as: C07402 ATC code: L01XB01 Anatomical Therapeutic Chemical (ATC) classification [BR:br08303] L ANTINEOPLASTIC... AND IMMUNOMODULATING AGENTS L01 ANTINEOPLASTIC AGENTS L01X OTHER ANTINEOPLASTIC AGENTS L01XB Meth

  19. Drug: D00478 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available oride (JP16/USP) Anatomical Therapeutic Chemical (ATC) classification [BR:br08303] L ANTINEOPLASTIC AND IMMU...NOMODULATING AGENTS L01 ANTINEOPLASTIC AGENTS L01X OTHER ANTINEOPLASTIC AGENTS L01XB Methylhydrazines L01XB0

  20. Drug: D06483 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available 6483.gif ATC code: B05XB01 Anatomical Therapeutic Chemical (ATC) classification [BR:br08303] B BLOOD AND BLOOD FORMING ORGANS B05 BLO...OD SUBSTITUTES AND PERFUSION SOLUTIONS B05X I.V. SOLUTION ADDITIVES B05XB Amino aci

  1. Effects of a blend of essential oils and an enzyme combination on nutrient digestibility, ileum histology and expression of inflammatory mediators in weaned piglets. (United States)

    Jiang, X R; Awati, A; Agazzi, A; Vitari, F; Ferrari, A; Bento, H; Crestani, M; Domeneghini, C; Bontempo, V


    The aim of this study was to test the hypothesis of an improved gut environment of post-weaning piglets when administered a blend of essential oils (EO; thymol and cinnamaldehyde) and an enzyme combination (xylanase and β-glucanase (XB)) either alone or in combination. To assess the effect of dietary treatments, faecal nutrient digestibility and microbial counts, as well as ileum histology and gene expression of inflammatory mediators were evaluated. One hundred and ninety-two weaned piglets were allocated into four experimental treatments, and fed the basal diet (CTRL) either without or with EO, XB or their combination (EO+XB) for a 42-day period. The experiment concerning digestibility was designed with two periods (period I: days 15 to 21; period II: days 29 to 35) and the faeces were collected on days 20, 21, 34 and 35. On day 42, six piglets from each treatment were slaughtered. It was found that EO, XB and EO+XB supplementation did not affect (P>0.05) the growth performance of the piglets from days 0 to 42. Moreover, no dietary effect on faecal score was observed. Faecal digestibility of dry matter, organic matter, ash, dietary fibre, lipid, CP and NDF were increased from period I to period II (P0.05) of EO, XB or their combination on the faecal digestibility was observed at both periods. Compared with the CTRL diet, dietary XB reduced the faecal Lactobacillus and Escherichia coli counts but increased the Lactobacillus to Coliforms ratio on day 42 (P=0.02, 0.03 and 0.03, respectively), and all the additives supplementations decreased the counts of faecal Coliforms on day 42 (Ppiglets treated with EO+XB compared with the EO group (P=0.02). In conclusion, the administration of EO, XB or their combination was effective in improving ileum histology, and EO+XB supplementation might benefit the modulation of the expression of ileum inflammatory cytokines in piglets.

  2. Designer Metallic Acceptor-Containing Halogen Bonds: General Strategies. (United States)

    Zhang, Xinxing; Bowen, Kit


    Being electrostatic interactions in nature, hydrogen bonding (HB) and halogen bonding (XB) are considered to be two parallel worlds. In principle, all the applications that HB have could also be applied to XB. However, there has been no report on an anionic, metallic XB acceptor, but metal anions have been observed to be good HB acceptors. This missing mosaic piece of XB theory is because common metal anions are reactive for XB donors. In view of this, two strategies are proposed for designing metallic acceptor-containing XB using ab initio calculations. The first one is to utilize a metal cluster anion with a high electron detachment energy, such as the superatom, Al13- as the XB acceptor. The second strategy is to design a ligand-passivated/protected metal core that can maintain the negative charge; several exotic clusters, such as PtH5- , PtZnH5- , and PtMgH5- , are used as examples. Based on these two strategies, it is anticipated that more metallic acceptor-containing XBs will be discovered. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.


    Energy Technology Data Exchange (ETDEWEB)

    Li, K. L.; Kong, A. K. H.; Tam, P. H. T.; Jin, Ruolan [Institute of Astronomy and Department of Physics, National Tsing Hua University, Hsinchu 30013, Taiwan (China); Takata, J.; Cheng, K. S. [Department of Physics, University of Hong Kong, Pokfulam Road (Hong Kong); Hui, C. Y., E-mail:, E-mail:, E-mail: [Department of Astronomy and Space Science, Chungnam National University, Daejeon (Korea, Republic of)


    We report the first hard X-ray (3-79 keV) observations of the millisecond pulsar (MSP) binary PSR J1023+0038 using NuSTAR. This system has been shown transiting between a low-mass X-ray binary (LMXB) state and a rotation-powered MSP state. The NuSTAR observations were taken in both LMXB state and rotation-powered state. The source is clearly seen in both states up to ∼79 keV. During the LMXB state, the 3-79 keV flux is about a factor of 10 higher than in the rotation-powered state. The hard X-rays show clear orbital modulation during the X-ray faint rotation-powered state but the X-ray orbital period is not detected in the X-ray bright LMXB state. In addition, the X-ray spectrum changes from a flat power-law spectrum during the rotation-powered state to a steeper power-law spectrum in the LMXB state. We suggest that the hard X-rays are due to the intrabinary shock from the interaction between the pulsar wind and the injected material from the low-mass companion star. During the rotation-powered MSP state, the X-ray orbital modulation is due to Doppler boosting of the shocked pulsar wind. At the LMXB state, the evaporating matter of the accretion disk due to the gamma-ray irradiation from the pulsar stops almost all the pulsar wind, resulting in the disappearance of the X-ray orbital modulation.

  4. Multivariate Linear Predictive Spectral Analysis Employing Weighted Forward and Backward Averaging: A Generalization of Burg’s Algorithm (United States)


    TR 5501 14. R. E. Hartwig, "Resultants and the Solution of AX-XB : -C," SIAM J. Appl. Math., vol. 23, no. 1, July 1972, pp. 104-117. 15. V. Kucera ...34The Matrix Equation AX+XB = C," SIAM J. Appl. Math., vol. 26, no. 1, Jan . 1974, pD. 15-25. 16. R. E. Hartwig, "AX-XB = C, Resultants and Generalized...Inverses," SIAM J. Appl. Math., vol. 28, no. 1, Jan . 1975, pp. 154-183. 17. S. Barnett, "Simplification of Certain Linear Matrix Equations," IEEE Trans

  5. Scientific and Engineering Studies: Spectral Estimation (United States)


    and the Solution of AX-XB = -C," SIAM J. Appl. Math., vol. 23, no. 1, July 1972, pp. 104-117. 15. V, Kucera , "The Matrix Equation AX+XB = C," SIAM...J. Appl. Math., vol. 26, no. 1, Jan . 1974, pp. 15-25. ’ 16. R. E. Hartwig, "AX-XB = C, Resultants and Generalized Inverses," SIAM J. Appl...Math., vol. 28, no. 1. Jan . 1975, pp. 154-183. 17. S. Barnett, "Simplification of Certain Linear Matrix Equations," IEEE Trans on Automatic Control

  6. Late evolution of very low mass X-ray binaries sustained by radiation from their primaries (United States)

    Ruderman, M.; Shaham, J.; Tavani, M.; Eichler, D.


    The accretion-powered radiation from the X-ray pulsar system Her X-1 (McCray et al. 1982) is studied. The changes in the soft X-ray and gamma-ray flux and in the accompanying electron-positron wind are discussed. These are believed to be associated with the inward movement of the inner edge of the accretion disk corresponding to the boundary with the neutron star's corotating magnetosphere (Alfven radius). LMXB evolution which is self-sustained by secondary winds intercepting the radiation emitted near an LMXB neutron star is investigated as well.

  7. Late evolution of very low mass X-ray binaries sustained by radiation from their primaries

    Energy Technology Data Exchange (ETDEWEB)

    Ruderman, M.; Shaham, J.; Tavani, M.; Eichler, D. (Columbia Univ., New York, NY (USA); Maryland Univ., College Park (USA); Negev Univ., Beersheba (Israel))


    The accretion-powered radiation from the X-ray pulsar system Her X-1 (McCray et al. 1982) is studied. The changes in the soft X-ray and gamma-ray flux and in the accompanying electron-positron wind are discussed. These are believed to be associated with the inward movement of the inner edge of the accretion disk corresponding to the boundary with the neutron star's corotating magnetosphere (Alfven radius). LMXB evolution which is self-sustained by secondary winds intercepting the radiation emitted near an LMXB neutron star is investigated as well. 59 refs.

  8. Scientific Goals of the IceCube Neutrino Detector at the South Pole

    CERN Document Server

    Goldschmidt, A


    IceCube is a proposed ice-Cherenkov kilometer scale neutrino telescope, to be located at the South Pole. Its science potential covers a wide range of topics from Active Galatic Nuclei and Gamma Ray Bursters neutrino emission to WIMP annihilation into neutrinos.

  9. Dance of the double stars

    Energy Technology Data Exchange (ETDEWEB)

    Theokas, A.


    The paper concerns pairs of stars orbiting one another. The evolutionary path model for close binary stars, involving a mass transfer of gases between the stars, is described. The life history of a single star; cataclysmic variables; the algol paradox, matter and lagranges' point; x-ray binaries and bursters; and pulsars; are all briefly discussed.

  10. Hubble Space Telescope STIS Observations of GRB 000301C: CCD Imaging and Near-Ultraviolet MAMA Spectroscopy

    NARCIS (Netherlands)

    Smette, A.; Fruchter, A.S.; Gull, Th.R.; Sahu, K.C.; Petro, L.; Ferguson, H.; Rhoads, J.; Lindler, D.J.; Wijers, R.A.M.J.


    We present Space Telescope Imaging Spectrograph observations of the optical transient (OT) counterpart of the gamma-ray burster GRB 000301C obtained 5 days after the burst, on 2000 March 6. CCD clear-aperture imaging reveals a R~=21.50+/-0.15 source with no apparent host galaxy. An 8000 s, 1150

  11. INTEGRAL finds renewed X-ray activity of the Neutron star X-ray transient SAX J1750.8-2900

    DEFF Research Database (Denmark)

    Sanchez-Fernandez, Celia; Chenevez, Jérôme; Kuulkers, Erik


    INTEGRAL Galactic bulge monitoring observations (ATel #438) on UT 13 September 2015 18:50-22:32 reveal renewed X-ray activity from the low-mass X-ray binary transient and Type I X-ray burster SAX J1750.8-2900 (IAU Circ. #6597). The last outburst from this source was reported in 2011 (ATels #3170,...

  12. Dangerous Substance Advisor: Een Expert Systeem voor het Classificeren van Gevaarlijke Stoffen (Dangerous Substance Advisor: An Expert System for the Classification of Dangerous Substances) (United States)


    voorkomen. Ammunition Contrivances Bomb Detonating Booster Detonator Burster Explosive Cartridge Firework Charged Flare Charges Flash Indien de...00 0 000 00 00 00 00 0 00 Amomonium 00 00 20 00 00 00 00 00 00 00 00 0 Antimony 00 00 00 0 000 00 0 022 00 00 20 0 Boron 0 060 00 0 000 0 00 000 000

  13. Hubble Space Telescope STIS observations of GRB 000301C: CCD imaging and near-ultraviolet MAMA spectroscopy

    DEFF Research Database (Denmark)

    Smette, A.; Fruchter, A.S.; Gull, T.R.


    We present Space Telescope Imaging Spectrograph observations of the optical transient (OT) counterpart of the c-ray burster GRB 000301C obtained 5 days after the burst, on 2000 March 6. CCD clear-aperture imaging reveals a R similar or equal to 21.50 +/- 0.15 source with no apparent host galaxy. ...

  14. Long tails on thermonuclear X-ray bursts from neutron stars : a signature of inward heating?

    NARCIS (Netherlands)

    Zand, J. J. M. in't; Keek, L.; Cumming, A.; Heger, A.; Homan, J.; Mendez, M.

    We report the discovery of one-hour long tails on the few- minutes long X- ray bursts from the " clocked burster" GS 1826- 24. We propose that the tails are due to enduring thermal radiation from the neutron star envelope. The enduring emission can be explained by cooling of deeper neutron star

  15. Astrophysical Applications of Relativistic Shear Flows (United States)

    Liang, Edison


    We review recent PIC simulation results of relativistic collisionless shear flows in both 2D and 3D. We apply these results to spine-sheath jet models of blazars and gamma-ray-bursters, and to shear flows near the horizon of rapidly spinning black holes. We will discuss magnetic field generation, particle energization and radiation processes, and their observational consequences.

  16. Characterization of Halogen Bonded Adducts in Solution by Advanced NMR Techniques

    Directory of Open Access Journals (Sweden)

    Gianluca Ciancaleoni


    Full Text Available In the last 20 years, a huge volume of experimental work into halogen bonding (XB has been produced. Most of the systems have been characterized by solid state X-ray crystallography, whereas in solution the only routine technique is titration (by using 1H and 19F nuclear magnetic resonance (NMR, infrared (IR, ultraviolet–visible (UV–Vis or Raman spectroscopies, depending on the nature of the system, with the aim of characterizing the strength of the XB interaction. Unfortunately, titration techniques have many intrinsic limitations and they should be coupled with other, more sophisticated techniques to provide an accurate and detailed description of the geometry and stoichiometry of the XB adduct in solution. This review will show how crucial information about XB adducts can be obtained by advanced NMR techniques, nuclear Overhauser effect-based spectroscopies (NOESY, ROESY, HOESY… and diffusion NMR techniques (PGSE or DOSY.

  17. Drug: D07201 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available L PREPARATIONS D07A CORTICOSTEROIDS, PLAIN D07AB Corticosteroids, moderately potent (group II) D07AB07 Flupr...ednidene D07201 Fluprednidene (INN) D07X CORTICOSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids, moderate

  18. Drug: D04208 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available EPARATIONS D07A CORTICOSTEROIDS, PLAIN D07AB Corticosteroids, moderately potent (group II) D07AB03 D04208 Flumethasone (USAN); Flumetasone (INN) D07X CORTICOSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids

  19. X(3872) and the search for its bottomonium counterpart at the LHC

    CERN Document Server

    Toms, Konstantin; The ATLAS collaboration


    X(3872) history and theoretical status overview. ATLAS study of the ψ(2S) and X(3872) production. Search for X(3872) bottomonium counterpart by ATLAS. Search for Xb at CMS. Determination of X(3872) quantum numbers at LHCb.

  20. Alternativas para favorecer la polinización y producción de semilla del híbrido h-311 de maíz

    Directory of Open Access Journals (Sweden)

    Alejandro Espinosa


    Full Text Available Alternativas para favorecer la polinización y producción de semilla del híbrido H-311 de maíz. En la producción de semilla de híbridos de maíz es fundamental la coincidencia en floración de los progenitores y la disposición de los estigmas con respecto a las panojas que emiten polen. El híbrido de maíz H-311, se recomienda en México para siembras de riego, en alturas de 1200 a 1800 msnm. El orden de cruza inicial fue: (B16XB17 X (B32XB33; sin embargo, se cambio al orden inverso, es decir, (B32XB33 X (B16XB17, debido a mayor productividad y semilla de buena calidad física. La cruza simple (B16XB17 es enana (braquítico, al no haber suficiente viento en la época de polinización, se dificulta el cruzamiento y se requiere levantar el polen con mochilas de motor, la cruza simple B16XB17, rinde de 4,5 a 5,5 t/ha de semilla contra 6,0 a 7,5 t/ha de la cruza simple B32XB33; La cruza simple B16XB17, responde con alargamiento del porte por la influencia del tratamientos, con ácido giberélico (Activol, 20, 40 y 60 ppm, dos dosis de Cloruro de Mepiquat (PIX, 1 y 2 lt/ha, así como tres niveles de fertilización (400-70-30, 150-70-30 y 150- 300-30. En rendimiento hubo un efecto positivo por el manejo de ambos progenitores con diferentes fertilizaciones así como aplicación de fitohormonas, al aplicar ácido giberélico (20 ppm, el rendimiento se incrementó en 250,3% y 211,8% para las cruzas simples B32XB33 y B16XB17 respectivamente. La altura de planta de B16XB17 fue ligeramente afectada (106,0% con ácido giberélico, 40 ppm

  1. Global analysis of ankyrin repeat domain C3HC4-type RING finger gene family in plants.

    Directory of Open Access Journals (Sweden)

    Xiaowei Yuan

    Full Text Available Ankyrin repeat (ANK C3HC4-type RING finger (RF genes comprise a large family in plants and play important roles in various physiological processes of plant life. In this study, we identified 187 ANK C3HC4-type RF proteins from 29 species with complete genomes and named the ANK C3HC4-type RF proteins the XB3-like proteins because they are structurally related to the rice (Oryza sativa XB3. A phylogenetic relationship analysis suggested that the XB3-like genes originated from ferns, and the encoded proteins fell into 3 major groups. Among these groups, we found that the spacing between the metal ligand position 6 and 7, and the conserved residues, which was in addition to the metal ligand amino acids, in the C3HC4-type RF were different. Using a wide range of protein structural analyses, protein models were established, and all XB3-like proteins were found to contain two to seven ANKs and a C3HC4-type RF. The microarray data for the XB3-like genes of Arabidopsis, Oryza sative, Zea mays and Glycine max revealed that the expression of XB3-like genes was in different tissues and during different life stages. The preferential expression of XB3-like genes in specified tissues and the response to phytohormone and abiotic stress treatments of Arabidopsis and Zea mays not only confirmed the microarray analysis data but also demonstrated that the XB3-like proteins play roles in plant growth and development as well as in stress responses. Our data provide a very useful reference for the identification and functional analysis of members of this gene family and also provide a new method for the genome-wide analysis of gene families.

  2. Metabolically engineered soybean seed with enhanced threonine levels: biochemical characterization and seed-specific expression of lysine-insensitive variants of aspartate kinases from the enteric bacterium Xenorhabdus bovienii. (United States)

    Qi, Qungang; Huang, Jintai; Crowley, James; Ruschke, Lisa; Goldman, Barry S; Wen, Li; Rapp, William D


    Threonine (Thr) is one of a few limiting essential amino acids (EAAs) in the animal feed industry, and its level in feed rations can impact production of important meat sources, such as swine and poultry. Threonine as well as EAAs lysine (Lys) and methionine (Met) are all synthesized via the aspartate family pathway. Here, we report a successful strategy to produce high free threonine soybean seed via identification of a feedback-resistant aspartate kinase (AK) enzyme that can be over-expressed in developing soybean seed. Towards this goal, we have purified and biochemically characterized AK from the enteric bacterium Xenorhabdus bovienii (Xb). Site-directed mutagenesis of XbAK identified two key regulatory residues Glu-257 and Thr-359 involved in lysine inhibition. Three feedback-resistant alleles, XbAK_T359I, XbAK_E257K and XbAK_E257K/T359I, have been generated. This study is the first to kinetically characterize the XbAK enzyme and provide biochemical and transgenic evidence that Glu-257 near the catalytic site is a critical residue for the allosteric regulation of AK. Furthermore, seed-specific expression of the feedback-resistant XbAK_T359I or XbAK_E257K allele results in increases of free Thr levels of up to 100-fold in R(1) soybean seed when compared to wild-type. Expression of feedback-sensitive wild-type AK did not substantially impact seed Thr content. In addition to high Thr, transgenic seed also showed substantial increases in other major free amino acid (FAA) levels, resulting in an up to 3.5-fold increase in the total FAA content. The transgenic seed was normal in appearance and germinated well under greenhouse conditions. © 2010 Monsanto Technology LLC. Plant Biotechnology Journal © 2010 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

  3. Generalized module extension Banach algebras: Derivations and ...

    African Journals Online (AJOL)

    Let A and X be Banach algebras and let X be an algebraic Banach A-module. Then the ℓ-1direct sum A x X equipped with the multiplication (a; x)(b; y) = (ab; ay + xb + xy) (a; b ∈ A; x; y ∈ X) is a Banach algebra, denoted by A ⋈ X, which will be called "a generalized module extension Banach algebra". Module extension ...

  4. Is a Go-Getter Better Off ?

    Indian Academy of Sciences (India)

    IAS Admin

    alent to assigning them tokens 1;2; :::; n: We can now simulate the following experiment. Consider three fair coins labeled A, B and C. We toss them independently and note down the outcomes as XA;XB and XC; respec- tively. Consider the triplet (XA;XB;XC): Let 1 denote heads and 0 denote tails. Identify players 1;2 and 3 ...

  5. Global analysis of ankyrin repeat domain C3HC4-type RING finger gene family in plants. (United States)

    Yuan, Xiaowei; Zhang, Shizhong; Liu, Shiyang; Yu, Mingli; Su, Hongyan; Shu, Huairui; Li, Xinzheng


    Ankyrin repeat (ANK) C3HC4-type RING finger (RF) genes comprise a large family in plants and play important roles in various physiological processes of plant life. In this study, we identified 187 ANK C3HC4-type RF proteins from 29 species with complete genomes and named the ANK C3HC4-type RF proteins the XB3-like proteins because they are structurally related to the rice (Oryza sativa) XB3. A phylogenetic relationship analysis suggested that the XB3-like genes originated from ferns, and the encoded proteins fell into 3 major groups. Among these groups, we found that the spacing between the metal ligand position 6 and 7, and the conserved residues, which was in addition to the metal ligand amino acids, in the C3HC4-type RF were different. Using a wide range of protein structural analyses, protein models were established, and all XB3-like proteins were found to contain two to seven ANKs and a C3HC4-type RF. The microarray data for the XB3-like genes of Arabidopsis, Oryza sative, Zea mays and Glycine max revealed that the expression of XB3-like genes was in different tissues and during different life stages. The preferential expression of XB3-like genes in specified tissues and the response to phytohormone and abiotic stress treatments of Arabidopsis and Zea mays not only confirmed the microarray analysis data but also demonstrated that the XB3-like proteins play roles in plant growth and development as well as in stress responses. Our data provide a very useful reference for the identification and functional analysis of members of this gene family and also provide a new method for the genome-wide analysis of gene families.

  6. Search for a new bottomonium state decaying to $\\Upsilon(1S)\\pi^+ \\pi^-$ in pp collisions at $\\sqrt{s}$ = 8 TeV

    CERN Document Server

    Chatrchyan, Serguei; Sirunyan, Albert M; Tumasyan, Armen; Adam, Wolfgang; Bergauer, Thomas; Dragicevic, Marko; Erö, Janos; Fabjan, Christian; Friedl, Markus; Fruehwirth, Rudolf; Ghete, Vasile Mihai; Hörmann, Natascha; Hrubec, Josef; Jeitler, Manfred; Kiesenhofer, Wolfgang; Knünz, Valentin; Krammer, Manfred; Krätschmer, Ilse; Liko, Dietrich; Mikulec, Ivan; Rabady, Dinyar; Rahbaran, Babak; Rohringer, Christine; Rohringer, Herbert; Schöfbeck, Robert; Strauss, Josef; Taurok, Anton; Treberer-Treberspurg, Wolfgang; Waltenberger, Wolfgang; Wulz, Claudia-Elisabeth; Mossolov, Vladimir; Shumeiko, Nikolai; Suarez Gonzalez, Juan; Alderweireldt, Sara; Bansal, Monika; Bansal, Sunil; Cornelis, Tom; De Wolf, Eddi A; Janssen, Xavier; Knutsson, Albert; Luyckx, Sten; Mucibello, Luca; Ochesanu, Silvia; Roland, Benoit; Rougny, Romain; Staykova, Zlatka; Van Haevermaet, Hans; Van Mechelen, Pierre; Van Remortel, Nick; Van Spilbeeck, Alex; Blekman, Freya; Blyweert, Stijn; D'Hondt, Jorgen; Kalogeropoulos, Alexis; Keaveney, James; Lowette, Steven; Maes, Michael; Olbrechts, Annik; Tavernier, Stefaan; Van Doninck, Walter; Van Mulders, Petra; Van Onsem, Gerrit Patrick; Villella, Ilaria; Caillol, Cécile; Clerbaux, Barbara; De Lentdecker, Gilles; Favart, Laurent; Gay, Arnaud; Hreus, Tomas; Léonard, Alexandre; Marage, Pierre Edouard; Mohammadi, Abdollah; Perniè, Luca; Reis, Thomas; Seva, Tomislav; Thomas, Laurent; Vander Velde, Catherine; Vanlaer, Pascal; Wang, Jian; Adler, Volker; Beernaert, Kelly; Benucci, Leonardo; Cimmino, Anna; Costantini, Silvia; Dildick, Sven; Garcia, Guillaume; Klein, Benjamin; Lellouch, Jérémie; Marinov, Andrey; Mccartin, Joseph; Ocampo Rios, Alberto Andres; Ryckbosch, Dirk; Sigamani, Michael; Strobbe, Nadja; Thyssen, Filip; Tytgat, Michael; Walsh, Sinead; Yazgan, Efe; Zaganidis, Nicolas; Basegmez, Suzan; Beluffi, Camille; Bruno, Giacomo; Castello, Roberto; Caudron, Adrien; Ceard, Ludivine; Da Silveira, Gustavo Gil; Delaere, Christophe; Du Pree, Tristan; Favart, Denis; Forthomme, Laurent; Giammanco, Andrea; Hollar, Jonathan; Jez, Pavel; Lemaitre, Vincent; Liao, Junhui; Militaru, Otilia; Nuttens, Claude; Pagano, Davide; Pin, Arnaud; Piotrzkowski, Krzysztof; Popov, Andrey; Selvaggi, Michele; Vidal Marono, Miguel; Vizan Garcia, Jesus Manuel; Beliy, Nikita; Caebergs, Thierry; Daubie, Evelyne; Hammad, Gregory Habib; Alves, Gilvan; Correa Martins Junior, Marcos; Martins, Thiago; Pol, Maria Elena; Henrique Gomes E Souza, Moacyr; Aldá Júnior, Walter Luiz; Carvalho, Wagner; Chinellato, Jose; Custódio, Analu; Melo Da Costa, Eliza; De Jesus Damiao, Dilson; De Oliveira Martins, Carley; Fonseca De Souza, Sandro; Malbouisson, Helena; Malek, Magdalena; Matos Figueiredo, Diego; Mundim, Luiz; Nogima, Helio; Prado Da Silva, Wanda Lucia; Santoro, Alberto; Sznajder, Andre; Tonelli Manganote, Edmilson José; Vilela Pereira, Antonio; Bernardes, Cesar Augusto; De Almeida Dias, Flavia; Tomei, Thiago; De Moraes Gregores, Eduardo; Lagana, Caio; Mercadante, Pedro G; Novaes, Sergio F; Padula, Sandra; Genchev, Vladimir; Iaydjiev, Plamen; Piperov, Stefan; Rodozov, Mircho; Sultanov, Georgi; Vutova, Mariana; Dimitrov, Anton; Hadjiiska, Roumyana; Kozhuharov, Venelin; Litov, Leander; Pavlov, Borislav; Petkov, Peicho; Bian, Jian-Guo; Chen, Guo-Ming; Chen, He-Sheng; Jiang, Chun-Hua; Liang, Dong; Liang, Song; Meng, Xiangwei; Tao, Junquan; Wang, Xianyou; Wang, Zheng; Asawatangtrakuldee, Chayanit; Ban, Yong; Guo, Yifei; Li, Qiang; Li, Wenbo; Liu, Shuai; Mao, Yajun; Qian, Si-Jin; Wang, Dayong; Zhang, Linlin; Zou, Wei; Avila, Carlos; Carrillo Montoya, Camilo Andres; Chaparro Sierra, Luisa Fernanda; Gomez, Juan Pablo; Gomez Moreno, Bernardo; Sanabria, Juan Carlos; Godinovic, Nikola; Lelas, Damir; Plestina, Roko; Polic, Dunja; Puljak, Ivica; Antunovic, Zeljko; Kovac, Marko; Brigljevic, Vuko; Kadija, Kreso; Luetic, Jelena; Mekterovic, Darko; Morovic, Srecko; Tikvica, Lucija; Attikis, Alexandros; Mavromanolakis, Georgios; Mousa, Jehad; Nicolaou, Charalambos; Ptochos, Fotios; Razis, Panos A; Finger, Miroslav; Finger Jr, Michael; Assran, Yasser; Elgammal, Sherif; Ellithi Kamel, Ali; Kuotb Awad, Alaa Metwaly; Mahmoud, Mohammed; Radi, Amr; Kadastik, Mario; Müntel, Mait; Murumaa, Marion; Raidal, Martti; Rebane, Liis; Tiko, Andres; Eerola, Paula; Fedi, Giacomo; Voutilainen, Mikko; Härkönen, Jaakko; Karimäki, Veikko; Kinnunen, Ritva; Kortelainen, Matti J; Lampén, Tapio; Lassila-Perini, Kati; Lehti, Sami; Lindén, Tomas; Luukka, Panja-Riina; Mäenpää, Teppo; Peltola, Timo; Tuominen, Eija; Tuominiemi, Jorma; Tuovinen, Esa; Wendland, Lauri; Tuuva, Tuure; Besancon, Marc; Couderc, Fabrice; Dejardin, Marc; Denegri, Daniel; Fabbro, Bernard; Faure, Jean-Louis; Ferri, Federico; Ganjour, Serguei; Givernaud, Alain; Gras, Philippe; Hamel de Monchenault, Gautier; Jarry, Patrick; Locci, Elizabeth; Malcles, Julie; Millischer, Laurent; Nayak, Aruna; Rander, John; Rosowsky, André; Titov, Maksym; Baffioni, Stephanie; Beaudette, Florian; Benhabib, Lamia; Bluj, Michal; Busson, Philippe; Charlot, Claude; Daci, Nadir; Dahms, Torsten; Dalchenko, Mykhailo; Dobrzynski, Ludwik; Florent, Alice; Granier de Cassagnac, Raphael; Haguenauer, Maurice; Miné, Philippe; Mironov, Camelia; Naranjo, Ivo Nicolas; Nguyen, Matthew; Ochando, Christophe; Paganini, Pascal; Sabes, David; Salerno, Roberto; Sirois, Yves; Veelken, Christian; Zabi, Alexandre; Agram, Jean-Laurent; Andrea, Jeremy; Bloch, Daniel; Brom, Jean-Marie; Chabert, Eric Christian; Collard, Caroline; Conte, Eric; Drouhin, Frédéric; Fontaine, Jean-Charles; Gelé, Denis; Goerlach, Ulrich; Goetzmann, Christophe; Juillot, Pierre; Le Bihan, Anne-Catherine; Van Hove, Pierre; Gadrat, Sébastien; Beauceron, Stephanie; Beaupere, Nicolas; Boudoul, Gaelle; Brochet, Sébastien; Chasserat, Julien; Chierici, Roberto; Contardo, Didier; Depasse, Pierre; El Mamouni, Houmani; Fan, Jiawei; Fay, Jean; Gascon, Susan; Gouzevitch, Maxime; Ille, Bernard; Kurca, Tibor; Lethuillier, Morgan; Mirabito, Laurent; Perries, Stephane; Sgandurra, Louis; Sordini, Viola; Vander Donckt, Muriel; Verdier, Patrice; Viret, Sébastien; Xiao, Hong; Tsamalaidze, Zviad; Autermann, Christian; Beranek, Sarah; Bontenackels, Michael; Calpas, Betty; Edelhoff, Matthias; Feld, Lutz; Heracleous, Natalie; Hindrichs, Otto; Klein, Katja; Ostapchuk, Andrey; Perieanu, Adrian; Raupach, Frank; Sammet, Jan; Schael, Stefan; Sprenger, Daniel; Weber, Hendrik; Wittmer, Bruno; Zhukov, Valery; Ata, Metin; Caudron, Julien; Dietz-Laursonn, Erik; Duchardt, Deborah; Erdmann, Martin; Fischer, Robert; Güth, Andreas; Hebbeker, Thomas; Heidemann, Carsten; Hoepfner, Kerstin; Klingebiel, Dennis; Knutzen, Simon; Kreuzer, Peter; Merschmeyer, Markus; Meyer, Arnd; Olschewski, Mark; Padeken, Klaas; Papacz, Paul; Pieta, Holger; Reithler, Hans; Schmitz, Stefan Antonius; Sonnenschein, Lars; Steggemann, Jan; Teyssier, Daniel; Thüer, Sebastian; Weber, Martin; Cherepanov, Vladimir; Erdogan, Yusuf; Flügge, Günter; Geenen, Heiko; Geisler, Matthias; Haj Ahmad, Wael; Hoehle, Felix; Kargoll, Bastian; Kress, Thomas; Kuessel, Yvonne; Lingemann, Joschka; Nowack, Andreas; Nugent, Ian Michael; Perchalla, Lars; Pooth, Oliver; Stahl, Achim; Asin, Ivan; Bartosik, Nazar; Behr, Joerg; Behrenhoff, Wolf; Behrens, Ulf; Bell, Alan James; Bergholz, Matthias; Bethani, Agni; Borras, Kerstin; Burgmeier, Armin; Cakir, Altan; Calligaris, Luigi; Campbell, Alan; Choudhury, Somnath; Costanza, Francesco; Diez Pardos, Carmen; Dooling, Samantha; Dorland, Tyler; Eckerlin, Guenter; Eckstein, Doris; Flucke, Gero; Geiser, Achim; Glushkov, Ivan; Grebenyuk, Anastasia; Gunnellini, Paolo; Habib, Shiraz; Hauk, Johannes; Hellwig, Gregor; Horton, Dean; Jung, Hannes; Kasemann, Matthias; Katsas, Panagiotis; Kleinwort, Claus; Kluge, Hannelies; Krämer, Mira; Krücker, Dirk; Kuznetsova, Ekaterina; Lange, Wolfgang; Leonard, Jessica; Lipka, Katerina; Lohmann, Wolfgang; Lutz, Benjamin; Mankel, Rainer; Marfin, Ihar; Melzer-Pellmann, Isabell-Alissandra; Meyer, Andreas Bernhard; Mnich, Joachim; Mussgiller, Andreas; Naumann-Emme, Sebastian; Novgorodova, Olga; Nowak, Friederike; Olzem, Jan; Perrey, Hanno; Petrukhin, Alexey; Pitzl, Daniel; Placakyte, Ringaile; Raspereza, Alexei; Ribeiro Cipriano, Pedro M; Riedl, Caroline; Ron, Elias; Sahin, Mehmet Özgür; Salfeld-Nebgen, Jakob; Schmidt, Ringo; Schoerner-Sadenius, Thomas; Sen, Niladri; Stein, Matthias; Walsh, Roberval; Wissing, Christoph; Aldaya Martin, Maria; Blobel, Volker; Enderle, Holger; Erfle, Joachim; Garutti, Erika; Gebbert, Ulla; Görner, Martin; Gosselink, Martijn; Haller, Johannes; Heine, Kristin; Höing, Rebekka Sophie; Kaussen, Gordon; Kirschenmann, Henning; Klanner, Robert; Kogler, Roman; Lange, Jörn; Marchesini, Ivan; Peiffer, Thomas; Pietsch, Niklas; Rathjens, Denis; Sander, Christian; Schettler, Hannes; Schleper, Peter; Schlieckau, Eike; Schmidt, Alexander; Schröder, Matthias; Schum, Torben; Seidel, Markus; Sibille, Jennifer; Sola, Valentina; Stadie, Hartmut; Steinbrück, Georg; Thomsen, Jan; Troendle, Daniel; Usai, Emanuele; Vanelderen, Lukas; Barth, Christian; Baus, Colin; Berger, Joram; Böser, Christian; Butz, Erik; Chwalek, Thorsten; De Boer, Wim; Descroix, Alexis; Dierlamm, Alexander; Feindt, Michael; Guthoff, Moritz; Hartmann, Frank; Hauth, Thomas; Held, Hauke; Hoffmann, Karl-Heinz; Husemann, Ulrich; Katkov, Igor; Komaragiri, Jyothsna Rani; Kornmayer, Andreas; Lobelle Pardo, Patricia; Martschei, Daniel; Mozer, Matthias Ulrich; Müller, Thomas; Niegel, Martin; Nürnberg, Andreas; Oberst, Oliver; Ott, Jochen; Quast, Gunter; Rabbertz, Klaus; Ratnikov, Fedor; Röcker, Steffen; Schilling, Frank-Peter; Schott, Gregory; Simonis, Hans-Jürgen; Stober, Fred-Markus Helmut; Ulrich, Ralf; Wagner-Kuhr, Jeannine; Wayand, Stefan; Weiler, Thomas; Zeise, Manuel; Anagnostou, Georgios; Daskalakis, Georgios; Geralis, Theodoros; Kesisoglou, Stilianos; Kyriakis, Aristotelis; Loukas, Demetrios; Markou, Athanasios; Markou, Christos; Ntomari, Eleni; Topsis-giotis, Iasonas; Gouskos, Loukas; Panagiotou, Apostolos; Saoulidou, Niki; Stiliaris, Efstathios; Aslanoglou, Xenofon; Evangelou, Ioannis; Flouris, Giannis; Foudas, Costas; Kokkas, Panagiotis; Manthos, Nikolaos; Papadopoulos, Ioannis; Paradas, Evangelos; Bencze, Gyorgy; Hajdu, Csaba; Hidas, Pàl; Horvath, Dezso; Sikler, Ferenc; Veszpremi, Viktor; Vesztergombi, Gyorgy; Zsigmond, Anna Julia; Beni, Noemi; Czellar, Sandor; Molnar, Jozsef; Palinkas, Jozsef; Szillasi, Zoltan; Karancsi, János; Raics, Peter; Trocsanyi, Zoltan Laszlo; Ujvari, Balazs; Swain, Sanjay Kumar; Beri, Suman Bala; Bhatnagar, Vipin; Dhingra, Nitish; Gupta, Ruchi; Kaur, Manjit; Mehta, Manuk Zubin; Mittal, Monika; Nishu, Nishu; Sharma, Archana; Singh, Jasbir; Kumar, Ashok; Kumar, Arun; Ahuja, Sudha; Bhardwaj, Ashutosh; Choudhary, Brajesh C; Kumar, Ajay; Malhotra, Shivali; Naimuddin, Md; Ranjan, Kirti; Saxena, Pooja; Sharma, Varun; Shivpuri, Ram Krishen; Banerjee, Sunanda; Bhattacharya, Satyaki; Chatterjee, Kalyanmoy; Dutta, Suchandra; Gomber, Bhawna; Jain, Sandhya; Jain, Shilpi; Khurana, Raman; Modak, Atanu; Mukherjee, Swagata; Roy, Debarati; Sarkar, Subir; Sharan, Manoj; Singh, Anil; Abdulsalam, Abdulla; Dutta, Dipanwita; Kailas, Swaminathan; Kumar, Vineet; Mohanty, Ajit Kumar; Pant, Lalit Mohan; Shukla, Prashant; Topkar, Anita; Aziz, Tariq; Chatterjee, Rajdeep Mohan; Ganguly, Sanmay; Ghosh, Saranya; Guchait, Monoranjan; Gurtu, Atul; Kole, Gouranga; Kumar, Sanjeev; Maity, Manas; Majumder, Gobinda; Mazumdar, Kajari; Mohanty, Gagan Bihari; Parida, Bibhuti; Sudhakar, Katta; Wickramage, Nadeesha; Banerjee, Sudeshna; Dugad, Shashikant; Arfaei, Hessamaddin; Bakhshiansohi, Hamed; Etesami, Seyed Mohsen; Fahim, Ali; Jafari, Abideh; Khakzad, Mohsen; Mohammadi Najafabadi, Mojtaba; Paktinat Mehdiabadi, Saeid; Safarzadeh, Batool; Zeinali, Maryam; Grunewald, Martin; Abbrescia, Marcello; Barbone, Lucia; Calabria, Cesare; Chhibra, Simranjit Singh; Colaleo, Anna; Creanza, Donato; De Filippis, Nicola; De Palma, Mauro; Fiore, Luigi; Iaselli, Giuseppe; Maggi, Giorgio; Maggi, Marcello; Marangelli, Bartolomeo; My, Salvatore; Nuzzo, Salvatore; Pacifico, Nicola; Pompili, Alexis; Pugliese, Gabriella; Selvaggi, Giovanna; Silvestris, Lucia; Singh, Gurpreet; Venditti, Rosamaria; Verwilligen, Piet; Zito, Giuseppe; Abbiendi, Giovanni; Benvenuti, Alberto; Bonacorsi, Daniele; Braibant-Giacomelli, Sylvie; Brigliadori, Luca; Campanini, Renato; Capiluppi, Paolo; Castro, Andrea; Cavallo, Francesca Romana; Codispoti, Giuseppe; Cuffiani, Marco; Dallavalle, Gaetano-Marco; Fabbri, Fabrizio; Fanfani, Alessandra; Fasanella, Daniele; Giacomelli, Paolo; Grandi, Claudio; Guiducci, Luigi; Marcellini, Stefano; Masetti, Gianni; Meneghelli, Marco; Montanari, Alessandro; Navarria, Francesco; Odorici, Fabrizio; Perrotta, Andrea; Primavera, Federica; Rossi, Antonio; Rovelli, Tiziano; Siroli, Gian Piero; Tosi, Nicolò; Travaglini, Riccardo; Albergo, Sebastiano; Cappello, Gigi; Chiorboli, Massimiliano; Costa, Salvatore; Giordano, Ferdinando; Potenza, Renato; Tricomi, Alessia; Tuve, Cristina; Barbagli, Giuseppe; Ciulli, Vitaliano; Civinini, Carlo; D'Alessandro, Raffaello; Focardi, Ettore; Frosali, Simone; Gallo, Elisabetta; Gonzi, Sandro; Gori, Valentina; Lenzi, Piergiulio; Meschini, Marco; Paoletti, Simone; Sguazzoni, Giacomo; Tropiano, Antonio; Benussi, Luigi; Bianco, Stefano; Fabbri, Franco; Piccolo, Davide; Fabbricatore, Pasquale; Ferretti, Roberta; Ferro, Fabrizio; Lo Vetere, Maurizio; Musenich, Riccardo; Robutti, Enrico; Tosi, Silvano; Benaglia, Andrea; Dinardo, Mauro Emanuele; Fiorendi, Sara; Gennai, Simone; Ghezzi, Alessio; Govoni, Pietro; Lucchini, Marco Toliman; Malvezzi, Sandra; Manzoni, Riccardo Andrea; Martelli, Arabella; Menasce, Dario; Moroni, Luigi; Paganoni, Marco; Pedrini, Daniele; Ragazzi, Stefano; Redaelli, Nicola; Tabarelli de Fatis, Tommaso; Buontempo, Salvatore; Cavallo, Nicola; De Cosa, Annapaola; Fabozzi, Francesco; Iorio, Alberto Orso Maria; Lista, Luca; Meola, Sabino; Merola, Mario; Paolucci, Pierluigi; Azzi, Patrizia; Bacchetta, Nicola; Bisello, Dario; Branca, Antonio; Carlin, Roberto; Checchia, Paolo; Dorigo, Tommaso; Fantinel, Sergio; Galanti, Mario; Gasparini, Fabrizio; Gasparini, Ugo; Giubilato, Piero; Gozzelino, Andrea; Gulmini, Michele; Kanishchev, Konstantin; Lacaprara, Stefano; Lazzizzera, Ignazio; Margoni, Martino; Maron, Gaetano; Meneguzzo, Anna Teresa; Pazzini, Jacopo; Pozzobon, Nicola; Ronchese, Paolo; Simonetto, Franco; Torassa, Ezio; Tosi, Mia; Vanini, Sara; Zotto, Pierluigi; Zucchetta, Alberto; Zumerle, Gianni; Gabusi, Michele; Ratti, Sergio P; Riccardi, Cristina; Vitulo, Paolo; Biasini, Maurizio; Bilei, Gian Mario; Fanò, Livio; Lariccia, Paolo; Mantovani, Giancarlo; Menichelli, Mauro; Nappi, Aniello; Romeo, Francesco; Saha, Anirban; Santocchia, Attilio; Spiezia, Aniello; Androsov, Konstantin; Azzurri, Paolo; Bagliesi, Giuseppe; Bernardini, Jacopo; Boccali, Tommaso; Broccolo, Giuseppe; Castaldi, Rino; Ciocci, Maria Agnese; D'Agnolo, Raffaele Tito; Dell'Orso, Roberto; Fiori, Francesco; Foà, Lorenzo; Giassi, Alessandro; Grippo, Maria Teresa; Kraan, Aafke; Ligabue, Franco; Lomtadze, Teimuraz; Martini, Luca; Messineo, Alberto; Moon, Chang-Seong; Palla, Fabrizio; Rizzi, Andrea; Savoy-Navarro, Aurore; Serban, Alin Titus; Spagnolo, Paolo; Squillacioti, Paola; Tenchini, Roberto; Tonelli, Guido; Venturi, Andrea; Verdini, Piero Giorgio; Vernieri, Caterina; Barone, Luciano; Cavallari, Francesca; Del Re, Daniele; Diemoz, Marcella; Grassi, Marco; Longo, Egidio; Margaroli, Fabrizio; Meridiani, Paolo; Micheli, Francesco; Nourbakhsh, Shervin; Organtini, Giovanni; Paramatti, Riccardo; Rahatlou, Shahram; Rovelli, Chiara; Soffi, Livia; Amapane, Nicola; Arcidiacono, Roberta; Argiro, Stefano; Arneodo, Michele; Bellan, Riccardo; Biino, Cristina; Cartiglia, Nicolo; Casasso, Stefano; Costa, Marco; Degano, Alessandro; Demaria, Natale; Mariotti, Chiara; Maselli, Silvia; Migliore, Ernesto; Monaco, Vincenzo; Musich, Marco; Obertino, Maria Margherita; Pastrone, Nadia; Pelliccioni, Mario; Potenza, Alberto; Romero, Alessandra; Ruspa, Marta; Sacchi, Roberto; Solano, Ada; Staiano, Amedeo; Tamponi, Umberto; Belforte, Stefano; Candelise, Vieri; Casarsa, Massimo; Cossutti, Fabio; Della Ricca, Giuseppe; Gobbo, Benigno; La Licata, Chiara; Marone, Matteo; Montanino, Damiana; Penzo, Aldo; Schizzi, Andrea; Zanetti, Anna; Chang, Sunghyun; Kim, Tae Yeon; Nam, Soon-Kwon; Kim, Dong Hee; Kim, Gui Nyun; Kim, Ji Eun; Kong, Dae Jung; Lee, Sangeun; Oh, Young Do; Park, Hyangkyu; Son, Dong-Chul; Kim, Jae Yool; Kim, Zero Jaeho; Song, Sanghyeon; Choi, Suyong; Gyun, Dooyeon; Hong, Byung-Sik; Jo, Mihee; Kim, Hyunchul; Kim, Tae Jeong; Lee, Kyong Sei; Park, Sung Keun; Roh, Youn; Choi, Minkyoo; Kim, Ji Hyun; Park, Chawon; Park, Inkyu; Park, Sangnam; Ryu, Geonmo; Choi, Young-Il; Choi, Young Kyu; Goh, Junghwan; Kim, Min Suk; Kwon, Eunhyang; Lee, Byounghoon; Lee, Jongseok; Lee, Sungeun; Seo, Hyunkwan; Yu, Intae; Grigelionis, Ignas; Juodagalvis, Andrius; Castilla-Valdez, Heriberto; De La Cruz-Burelo, Eduard; Heredia-de La Cruz, Ivan; Lopez-Fernandez, Ricardo; Martínez-Ortega, Jorge; Sánchez Hernández, Alberto; Villasenor-Cendejas, Luis Manuel; Carrillo Moreno, Salvador; Vazquez Valencia, Fabiola; Salazar Ibarguen, Humberto Antonio; Casimiro Linares, Edgar; Morelos Pineda, Antonio; Reyes-Santos, Marco A; Krofcheck, David; Butler, Philip H; Doesburg, Robert; Reucroft, Steve; Silverwood, Hamish; Ahmad, Muhammad; Asghar, Muhammad Irfan; Butt, Jamila; Hoorani, Hafeez R; Khalid, Shoaib; Khan, Wajid Ali; Khurshid, Taimoor; Qazi, Shamona; Shah, Mehar Ali; Shoaib, Muhammad; Bialkowska, Helena; Boimska, Bożena; Frueboes, Tomasz; Górski, Maciej; Kazana, Malgorzata; Nawrocki, Krzysztof; Romanowska-Rybinska, Katarzyna; Szleper, Michal; Wrochna, Grzegorz; Zalewski, Piotr; Brona, Grzegorz; Bunkowski, Karol; Cwiok, Mikolaj; Dominik, Wojciech; Doroba, Krzysztof; Kalinowski, Artur; Konecki, Marcin; Krolikowski, Jan; Misiura, Maciej; Wolszczak, Weronika; Almeida, Nuno; Bargassa, Pedrame; Beirão Da Cruz E Silva, Cristóvão; Faccioli, Pietro; Ferreira Parracho, Pedro Guilherme; Gallinaro, Michele; Nguyen, Federico; Rodrigues Antunes, Joao; Seixas, Joao; Varela, Joao; Vischia, Pietro; Afanasiev, Serguei; Bunin, Pavel; Gavrilenko, Mikhail; Golutvin, Igor; Gorbunov, Ilya; Kamenev, Alexey; Karjavin, Vladimir; Konoplyanikov, Viktor; Lanev, Alexander; Malakhov, Alexander; Matveev, Viktor; Moisenz, Petr; Palichik, Vladimir; Perelygin, Victor; Shmatov, Sergey; Skatchkov, Nikolai; Smirnov, Vitaly; Zarubin, Anatoli; Evstyukhin, Sergey; Golovtsov, Victor; Ivanov, Yury; Kim, Victor; Levchenko, Petr; Murzin, Victor; Oreshkin, Vadim; Smirnov, Igor; Sulimov, Valentin; Uvarov, Lev; Vavilov, Sergey; Vorobyev, Alexey; Vorobyev, Andrey; Andreev, Yuri; Dermenev, Alexander; Gninenko, Sergei; Golubev, Nikolai; Kirsanov, Mikhail; Krasnikov, Nikolai; Pashenkov, Anatoli; Tlisov, Danila; Toropin, Alexander; Epshteyn, Vladimir; Erofeeva, Maria; Gavrilov, Vladimir; Lychkovskaya, Natalia; Popov, Vladimir; Safronov, Grigory; Semenov, Sergey; Spiridonov, Alexander; Stolin, Viatcheslav; Vlasov, Evgueni; Zhokin, Alexander; Andreev, Vladimir; Azarkin, Maksim; Dremin, Igor; Kirakosyan, Martin; Leonidov, Andrey; Mesyats, Gennady; Rusakov, Sergey V; Vinogradov, Alexey; Belyaev, Andrey; Boos, Edouard; Dubinin, Mikhail; Dudko, Lev; Ershov, Alexander; Gribushin, Andrey; Klyukhin, Vyacheslav; Kodolova, Olga; Lokhtin, Igor; Markina, Anastasia; Obraztsov, Stepan; Petrushanko, Sergey; Savrin, Viktor; Snigirev, Alexander; Azhgirey, Igor; Bayshev, Igor; Bitioukov, Sergei; Kachanov, Vassili; Kalinin, Alexey; Konstantinov, Dmitri; Krychkine, Victor; Petrov, Vladimir; Ryutin, Roman; Sobol, Andrei; Tourtchanovitch, Leonid; Troshin, Sergey; Tyurin, Nikolay; Uzunian, Andrey; Volkov, Alexey; Adzic, Petar; Djordjevic, Milos; Ekmedzic, Marko; Krpic, Dragomir; Milosevic, Jovan; Aguilar-Benitez, Manuel; Alcaraz Maestre, Juan; Battilana, Carlo; Calvo, Enrique; Cerrada, Marcos; Chamizo Llatas, Maria; Colino, Nicanor; De La Cruz, Begona; Delgado Peris, Antonio; Domínguez Vázquez, Daniel; Fernandez Bedoya, Cristina; Fernández Ramos, Juan Pablo; Ferrando, Antonio; Flix, Jose; Fouz, Maria Cruz; Garcia-Abia, Pablo; Gonzalez Lopez, Oscar; Goy Lopez, Silvia; Hernandez, Jose M; Josa, Maria Isabel; Merino, Gonzalo; Navarro De Martino, Eduardo; Puerta Pelayo, Jesus; Quintario Olmeda, Adrián; Redondo, Ignacio; Romero, Luciano; Santaolalla, Javier; Senghi Soares, Mara; Willmott, Carlos; Albajar, Carmen; de Trocóniz, Jorge F; Brun, Hugues; Cuevas, Javier; Fernandez Menendez, Javier; Folgueras, Santiago; Gonzalez Caballero, Isidro; Lloret Iglesias, Lara; Piedra Gomez, Jonatan; Brochero Cifuentes, Javier Andres; Cabrillo, Iban Jose; Calderon, Alicia; Chuang, Shan-Huei; Duarte Campderros, Jordi; Fernandez, Marcos; Gomez, Gervasio; Gonzalez Sanchez, Javier; Graziano, Alberto; Jorda, Clara; Lopez Virto, Amparo; Marco, Jesus; Marco, Rafael; Martinez Rivero, Celso; Matorras, Francisco; Munoz Sanchez, Francisca Javiela; Rodrigo, Teresa; Rodríguez-Marrero, Ana Yaiza; Ruiz-Jimeno, Alberto; Scodellaro, Luca; Vila, Ivan; Vilar Cortabitarte, Rocio; Abbaneo, Duccio; Auffray, Etiennette; Auzinger, Georg; Bachtis, Michail; Baillon, Paul; Ball, Austin; Barney, David; Bendavid, Joshua; Benitez, Jose F; Bernet, Colin; Bianchi, Giovanni; Bloch, Philippe; Bocci, Andrea; Bonato, Alessio; Bondu, Olivier; Botta, Cristina; Breuker, Horst; Camporesi, Tiziano; Cerminara, Gianluca; Christiansen, Tim; Coarasa Perez, Jose Antonio; Colafranceschi, Stefano; D'Alfonso, Mariarosaria; D'Enterria, David; Dabrowski, Anne; David Tinoco Mendes, Andre; De Guio, Federico; De Roeck, Albert; De Visscher, Simon; Di Guida, Salvatore; Dobson, Marc; Dupont-Sagorin, Niels; Elliott-Peisert, Anna; Eugster, Jürg; Franzoni, Giovanni; Funk, Wolfgang; Georgiou, Georgios; Giffels, Manuel; Gigi, Dominique; Gill, Karl; Giordano, Domenico; Girone, Maria; Giunta, Marina; Glege, Frank; Gomez-Reino Garrido, Robert; Gowdy, Stephen; Guida, Roberto; Hammer, Josef; Hansen, Magnus; Harris, Philip; Hartl, Christian; Hinzmann, Andreas; Innocente, Vincenzo; Janot, Patrick; Karavakis, Edward; Kousouris, Konstantinos; Krajczar, Krisztian; Lecoq, Paul; Lee, Yen-Jie; Lourenco, Carlos; Magini, Nicolo; Malgeri, Luca; Mannelli, Marcello; Masetti, Lorenzo; Meijers, Frans; Mersi, Stefano; Meschi, Emilio; Moser, Roland; Mulders, Martijn; Musella, Pasquale; Nesvold, Erik; Orsini, Luciano; Palencia Cortezon, Enrique; Perez, Emmanuelle; Perrozzi, Luca; Petrilli, Achille; Pfeiffer, Andreas; Pierini, Maurizio; Pimiä, Martti; Piparo, Danilo; Plagge, Michael; Quertenmont, Loic; Racz, Attila; Reece, William; Rolandi, Gigi; Rovere, Marco; Sakulin, Hannes; Santanastasio, Francesco; Schäfer, Christoph; Schwick, Christoph; Sekmen, Sezen; Sharma, Archana; Siegrist, Patrice; Silva, Pedro; Simon, Michal; Sphicas, Paraskevas; Spiga, Daniele; Stieger, Benjamin; Stoye, Markus; Tsirou, Andromachi; Veres, Gabor Istvan; Vlimant, Jean-Roch; Wöhri, Hermine Katharina; Worm, Steven; Zeuner, Wolfram Dietrich; Bertl, Willi; Deiters, Konrad; Erdmann, Wolfram; Gabathuler, Kurt; Horisberger, Roland; Ingram, Quentin; Kaestli, Hans-Christian; König, Stefan; Kotlinski, Danek; Langenegger, Urs; Renker, Dieter; Rohe, Tilman; Bachmair, Felix; Bäni, Lukas; Bianchini, Lorenzo; Bortignon, Pierluigi; Buchmann, Marco-Andrea; Casal, Bruno; Chanon, Nicolas; Deisher, Amanda; Dissertori, Günther; Dittmar, Michael; Donegà, Mauro; Dünser, Marc; Eller, Philipp; Freudenreich, Klaus; Grab, Christoph; Hits, Dmitry; Lecomte, Pierre; Lustermann, Werner; Mangano, Boris; Marini, Andrea Carlo; Martinez Ruiz del Arbol, Pablo; Meister, Daniel; Mohr, Niklas; Moortgat, Filip; Nägeli, Christoph; Nef, Pascal; Nessi-Tedaldi, Francesca; Pandolfi, Francesco; Pape, Luc; Pauss, Felicitas; Peruzzi, Marco; Quittnat, Milena; Ronga, Frederic Jean; Rossini, Marco; Sala, Leonardo; Sanchez, Ann - Karin; Starodumov, Andrei; Takahashi, Maiko; Tauscher, Ludwig; Thea, Alessandro; Theofilatos, Konstantinos; Treille, Daniel; Urscheler, Christina; Wallny, Rainer; Weber, Hannsjoerg Artur; Amsler, Claude; Chiochia, Vincenzo; Favaro, Carlotta; Ivova Rikova, Mirena; Kilminster, Benjamin; Millan Mejias, Barbara; Robmann, Peter; Snoek, Hella; Taroni, Silvia; Verzetti, Mauro; Yang, Yong; Cardaci, Marco; Chen, Kuan-Hsin; Ferro, Cristina; Kuo, Chia-Ming; Li, Syue-Wei; Lin, Willis; Lu, Yun-Ju; Volpe, Roberta; Yu, Shin-Shan; Bartalini, Paolo; Chang, Paoti; Chang, You-Hao; Chang, Yu-Wei; Chao, Yuan; Chen, Kai-Feng; Dietz, Charles; Grundler, Ulysses; Hou, George Wei-Shu; Hsiung, Yee; Kao, Kai-Yi; Lei, Yeong-Jyi; Lu, Rong-Shyang; Majumder, Devdatta; Petrakou, Eleni; Shi, Xin; Shiu, Jing-Ge; Tzeng, Yeng-Ming; Wang, Minzu; Asavapibhop, Burin; Suwonjandee, Narumon; Adiguzel, Aytul; Bakirci, Mustafa Numan; Cerci, Salim; Dozen, Candan; Dumanoglu, Isa; Eskut, Eda; Girgis, Semiray; Gokbulut, Gul; Gurpinar, Emine; Hos, Ilknur; Kangal, Evrim Ersin; Kayis Topaksu, Aysel; Onengut, Gulsen; Ozdemir, Kadri; Ozturk, Sertac; Polatoz, Ayse; Sogut, Kenan; Sunar Cerci, Deniz; Tali, Bayram; Topakli, Huseyin; Vergili, Mehmet; Akin, Ilina Vasileva; Aliev, Takhmasib; Bilin, Bugra; Bilmis, Selcuk; Deniz, Muhammed; Gamsizkan, Halil; Guler, Ali Murat; Karapinar, Guler; Ocalan, Kadir; Ozpineci, Altug; Serin, Meltem; Sever, Ramazan; Surat, Ugur Emrah; Yalvac, Metin; Zeyrek, Mehmet; Gülmez, Erhan; Isildak, Bora; Kaya, Mithat; Kaya, Ozlem; Ozkorucuklu, Suat; Sonmez, Nasuf; Bahtiyar, Hüseyin; Barlas, Esra; Cankocak, Kerem; Günaydin, Yusuf Oguzhan; Vardarli, Fuat Ilkehan; Yücel, Mete; Levchuk, Leonid; Sorokin, Pavel; Brooke, James John; Clement, Emyr; Cussans, David; Flacher, Henning; Frazier, Robert; Goldstein, Joel; Grimes, Mark; Heath, Greg P; Heath, Helen F; Kreczko, Lukasz; Lucas, Chris; Meng, Zhaoxia; Metson, Simon; Newbold, Dave M; Nirunpong, Kachanon; Paramesvaran, Sudarshan; Poll, Anthony; Senkin, Sergey; Smith, Vincent J; Williams, Thomas; Bell, Ken W; Belyaev, Alexander; Brew, Christopher; Brown, Robert M; Cockerill, David JA; Coughlan, John A; Harder, Kristian; Harper, Sam; Ilic, Jelena; Olaiya, Emmanuel; Petyt, David; Radburn-Smith, Benjamin Charles; Shepherd-Themistocleous, Claire; Tomalin, Ian R; Womersley, William John; Bainbridge, Robert; Buchmuller, Oliver; Burton, Darren; Colling, David; Cripps, Nicholas; Cutajar, Michael; Dauncey, Paul; Davies, Gavin; Della Negra, Michel; Ferguson, William; Fulcher, Jonathan; Futyan, David; Gilbert, Andrew; Guneratne Bryer, Arlo; Hall, Geoffrey; Hatherell, Zoe; Hays, Jonathan; Iles, Gregory; Jarvis, Martyn; Karapostoli, Georgia; Kenzie, Matthew; Lane, Rebecca; Lucas, Robyn; Lyons, Louis; Magnan, Anne-Marie; Marrouche, Jad; Mathias, Bryn; Nandi, Robin; Nash, Jordan; Nikitenko, Alexander; Pela, Joao; Pesaresi, Mark; Petridis, Konstantinos; Pioppi, Michele; Raymond, David Mark; Rogerson, Samuel; Rose, Andrew; Seez, Christopher; Sharp, Peter; Sparrow, Alex; Tapper, Alexander; Vazquez Acosta, Monica; Virdee, Tejinder; Wakefield, Stuart; Wardle, Nicholas; Chadwick, Matthew; Cole, Joanne; Hobson, Peter R; Khan, Akram; Kyberd, Paul; Leggat, Duncan; Leslie, Dawn; Martin, William; Reid, Ivan; Symonds, Philip; Teodorescu, Liliana; Turner, Mark; Dittmann, Jay; Hatakeyama, Kenichi; Kasmi, Azeddine; Liu, Hongxuan; Scarborough, Tara; Charaf, Otman; Cooper, Seth; Henderson, Conor; Rumerio, Paolo; Avetisyan, Aram; Bose, Tulika; Fantasia, Cory; Heister, Arno; Lawson, Philip; Lazic, Dragoslav; Rohlf, James; Sperka, David; St John, Jason; Sulak, Lawrence; Alimena, Juliette; Bhattacharya, Saptaparna; Christopher, Grant; Cutts, David; Demiragli, Zeynep; Ferapontov, Alexey; Garabedian, Alex; Heintz, Ulrich; Jabeen, Shabnam; Kukartsev, Gennadiy; Laird, Edward; Landsberg, Greg; Luk, Michael; Narain, Meenakshi; Segala, Michael; Sinthuprasith, Tutanon; Speer, Thomas; Breedon, Richard; Breto, Guillermo; Calderon De La Barca Sanchez, Manuel; Chauhan, Sushil; Chertok, Maxwell; Conway, John; Conway, Rylan; Cox, Peter Timothy; Erbacher, Robin; Gardner, Michael; Houtz, Rachel; Ko, Winston; Kopecky, Alexandra; Lander, Richard; Miceli, Tia; Pellett, Dave; Pilot, Justin; Ricci-Tam, Francesca; Rutherford, Britney; Searle, Matthew; Smith, John; Squires, Michael; Tripathi, Mani; Wilbur, Scott; Yohay, Rachel; Andreev, Valeri; Cline, David; Cousins, Robert; Erhan, Samim; Everaerts, Pieter; Farrell, Chris; Felcini, Marta; Hauser, Jay; Ignatenko, Mikhail; Jarvis, Chad; Rakness, Gregory; Schlein, Peter; Takasugi, Eric; Traczyk, Piotr; Valuev, Vyacheslav; Weber, Matthias; Babb, John; Clare, Robert; Ellison, John Anthony; Gary, J William; Hanson, Gail; Heilman, Jesse; Jandir, Pawandeep; Liu, Hongliang; Long, Owen Rosser; Luthra, Arun; Malberti, Martina; Nguyen, Harold; Shrinivas, Amithabh; Sturdy, Jared; Sumowidagdo, Suharyo; Wilken, Rachel; Wimpenny, Stephen; Andrews, Warren; Branson, James G; Cerati, Giuseppe Benedetto; Cittolin, Sergio; Evans, David; Holzner, André; Kelley, Ryan; Lebourgeois, Matthew; Letts, James; Macneill, Ian; Padhi, Sanjay; Palmer, Christopher; Petrucciani, Giovanni; Pieri, Marco; Sani, Matteo; Sharma, Vivek; Simon, Sean; Sudano, Elizabeth; Tadel, Matevz; Tu, Yanjun; Vartak, Adish; Wasserbaech, Steven; Würthwein, Frank; Yagil, Avraham; Yoo, Jaehyeok; Barge, Derek; Campagnari, Claudio; Danielson, Thomas; Flowers, Kristen; Geffert, Paul; George, Christopher; Golf, Frank; Incandela, Joe; Justus, Christopher; Kovalskyi, Dmytro; Krutelyov, Vyacheslav; Magaña Villalba, Ricardo; Mccoll, Nickolas; Pavlunin, Viktor; Richman, Jeffrey; Rossin, Roberto; Stuart, David; To, Wing; West, Christopher; Apresyan, Artur; Bornheim, Adolf; Bunn, Julian; Chen, Yi; Di Marco, Emanuele; Duarte, Javier; Kcira, Dorian; Ma, Yousi; Mott, Alexander; Newman, Harvey B; Pena, Cristian; Rogan, Christopher; Spiropulu, Maria; Timciuc, Vladlen; Veverka, Jan; Wilkinson, Richard; Xie, Si; Zhu, Ren-Yuan; Azzolini, Virginia; Calamba, Aristotle; Carroll, Ryan; Ferguson, Thomas; Iiyama, Yutaro; Jang, Dong Wook; Liu, Yueh-Feng; Paulini, Manfred; Russ, James; Vogel, Helmut; Vorobiev, Igor; Cumalat, John Perry; Drell, Brian Robert; Ford, William T; Gaz, Alessandro; Luiggi Lopez, Eduardo; Nauenberg, Uriel; Smith, James; Stenson, Kevin; Ulmer, Keith; Wagner, Stephen Robert; Alexander, James; Chatterjee, Avishek; Eggert, Nicholas; Gibbons, Lawrence Kent; Hopkins, Walter; Khukhunaishvili, Aleko; Kreis, Benjamin; Mirman, Nathan; Nicolas Kaufman, Gala; Patterson, Juliet Ritchie; Ryd, Anders; Salvati, Emmanuele; Sun, Werner; Teo, Wee Don; Thom, Julia; Thompson, Joshua; Tucker, Jordan; Weng, Yao; Winstrom, Lucas; Wittich, Peter; Winn, Dave; Abdullin, Salavat; Albrow, Michael; Anderson, Jacob; Apollinari, Giorgio; Bauerdick, Lothar AT; Beretvas, Andrew; Berryhill, Jeffrey; Bhat, Pushpalatha C; Burkett, Kevin; Butler, Joel Nathan; Chetluru, Vasundhara; Cheung, Harry; Chlebana, Frank; Cihangir, Selcuk; Elvira, Victor Daniel; Fisk, Ian; Freeman, Jim; Gao, Yanyan; Gottschalk, Erik; Gray, Lindsey; Green, Dan; Gutsche, Oliver; Hare, Daryl; Harris, Robert M; Hirschauer, James; Hooberman, Benjamin; Jindariani, Sergo; Johnson, Marvin; Joshi, Umesh; Kaadze, Ketino; Klima, Boaz; Kunori, Shuichi; Kwan, Simon; Linacre, Jacob; Lincoln, Don; Lipton, Ron; Lykken, Joseph; Maeshima, Kaori; Marraffino, John Michael; Martinez Outschoorn, Verena Ingrid; Maruyama, Sho; Mason, David; McBride, Patricia; Mishra, Kalanand; Mrenna, Stephen; Musienko, Yuri; Newman-Holmes, Catherine; O'Dell, Vivian; Prokofyev, Oleg; Ratnikova, Natalia; Sexton-Kennedy, Elizabeth; Sharma, Seema; Spalding, William J; Spiegel, Leonard; Taylor, Lucas; Tkaczyk, Slawek; Tran, Nhan Viet; Uplegger, Lorenzo; Vaandering, Eric Wayne; Vidal, Richard; Whitmore, Juliana; Wu, Weimin; Yang, Fan; Yun, Jae Chul; Acosta, Darin; Avery, Paul; Bourilkov, Dimitri; Chen, Mingshui; Cheng, Tongguang; Das, Souvik; De Gruttola, Michele; Di Giovanni, Gian Piero; Dobur, Didar; Drozdetskiy, Alexey; Field, Richard D; Fisher, Matthew; Fu, Yu; Furic, Ivan-Kresimir; Hugon, Justin; Kim, Bockjoo; Konigsberg, Jacobo; Korytov, Andrey; Kropivnitskaya, Anna; Kypreos, Theodore; Low, Jia Fu; Matchev, Konstantin; Milenovic, Predrag; Mitselmakher, Guenakh; Muniz, Lana; Remington, Ronald; Rinkevicius, Aurelijus; Skhirtladze, Nikoloz; Snowball, Matthew; Yelton, John; Zakaria, Mohammed; Gaultney, Vanessa; Hewamanage, Samantha; Linn, Stephan; Markowitz, Pete; Martinez, German; Rodriguez, Jorge Luis; Adams, Todd; Askew, Andrew; Bochenek, Joseph; Chen, Jie; Diamond, Brendan; Haas, Jeff; Hagopian, Sharon; Hagopian, Vasken; Johnson, Kurtis F; Prosper, Harrison; Veeraraghavan, Venkatesh; Weinberg, Marc; Baarmand, Marc M; Dorney, Brian; Hohlmann, Marcus; Kalakhety, Himali; Yumiceva, Francisco; Adams, Mark Raymond; Apanasevich, Leonard; Bazterra, Victor Eduardo; Betts, Russell Richard; Bucinskaite, Inga; Callner, Jeremy; Cavanaugh, Richard; Evdokimov, Olga; Gauthier, Lucie; Gerber, Cecilia Elena; Hofman, David Jonathan; Khalatyan, Samvel; Kurt, Pelin; Lacroix, Florent; Moon, Dong Ho; O'Brien, Christine; Silkworth, Christopher; Strom, Derek; Turner, Paul; Varelas, Nikos; Akgun, Ugur; Albayrak, Elif Asli; Bilki, Burak; Clarida, Warren; Dilsiz, Kamuran; Duru, Firdevs; Griffiths, Scott; Merlo, Jean-Pierre; Mermerkaya, Hamit; Mestvirishvili, Alexi; Moeller, Anthony; Nachtman, Jane; Newsom, Charles Ray; Ogul, Hasan; Onel, Yasar; Ozok, Ferhat; Sen, Sercan; Tan, Ping; Tiras, Emrah; Wetzel, James; Yetkin, Taylan; Yi, Kai; Barnett, Bruce Arnold; Blumenfeld, Barry; Bolognesi, Sara; Giurgiu, Gavril; Gritsan, Andrei; Hu, Guofan; Maksimovic, Petar; Martin, Christopher; Swartz, Morris; Whitbeck, Andrew; Baringer, Philip; Bean, Alice; Benelli, Gabriele; Kenny III, Raymond Patrick; Murray, Michael; Noonan, Daniel; Sanders, Stephen; Stringer, Robert; Wood, Jeffrey Scott; Barfuss, Anne-Fleur; Chakaberia, Irakli; Ivanov, Andrew; Khalil, Sadia; Makouski, Mikhail; Maravin, Yurii; Saini, Lovedeep Kaur; Shrestha, Shruti; Svintradze, Irakli; Gronberg, Jeffrey; Lange, David; Rebassoo, Finn; Wright, Douglas; Baden, Drew; Calvert, Brian; Eno, Sarah Catherine; Gomez, Jaime; Hadley, Nicholas John; Kellogg, Richard G; Kolberg, Ted; Lu, Ying; Marionneau, Matthieu; Mignerey, Alice; Pedro, Kevin; Peterman, Alison; Skuja, Andris; Temple, Jeffrey; Tonjes, Marguerite; Tonwar, Suresh C; Apyan, Aram; Bauer, Gerry; Busza, Wit; Cali, Ivan Amos; Chan, Matthew; Di Matteo, Leonardo; Dutta, Valentina; Gomez Ceballos, Guillelmo; Goncharov, Maxim; Gulhan, Doga; Kim, Yongsun; Klute, Markus; Lai, Yue Shi; Levin, Andrew; Luckey, Paul David; Ma, Teng; Nahn, Steve; Paus, Christoph; Ralph, Duncan; Roland, Christof; Roland, Gunther; Stephans, George; Stöckli, Fabian; Sumorok, Konstanty; Velicanu, Dragos; Wolf, Roger; Wyslouch, Bolek; Yang, Mingming; Yilmaz, Yetkin; Yoon, Sungho; Zanetti, Marco; Zhukova, Victoria; Dahmes, Bryan; De Benedetti, Abraham; Gude, Alexander; Haupt, Jason; Kao, Shih-Chuan; Klapoetke, Kevin; Kubota, Yuichi; Mans, Jeremy; Pastika, Nathaniel; Rusack, Roger; Sasseville, Michael; Singovsky, Alexander; Tambe, Norbert; Turkewitz, Jared; Acosta, John Gabriel; Cremaldi, Lucien Marcus; Kroeger, Rob; Oliveros, Sandra; Perera, Lalith; Rahmat, Rahmat; Sanders, David A; Summers, Don; Avdeeva, Ekaterina; Bloom, Kenneth; Bose, Suvadeep; Claes, Daniel R; Dominguez, Aaron; Eads, Michael; Gonzalez Suarez, Rebeca; Keller, Jason; Kravchenko, Ilya; Lazo-Flores, Jose; Malik, Sudhir; Meier, Frank; Snow, Gregory R; Dolen, James; Godshalk, Andrew; Iashvili, Ia; Jain, Supriya; Kharchilava, Avto; Kumar, Ashish; Rappoccio, Salvatore; Wan, Zongru; Alverson, George; Barberis, Emanuela; Baumgartel, Darin; Chasco, Matthew; Haley, Joseph; Massironi, Andrea; Nash, David; Orimoto, Toyoko; Trocino, Daniele; Wood, Darien; Zhang, Jinzhong; Anastassov, Anton; Hahn, Kristan Allan; Kubik, Andrew; Lusito, Letizia; Mucia, Nicholas; Odell, Nathaniel; Pollack, Brian; Pozdnyakov, Andrey; Schmitt, Michael Henry; Stoynev, Stoyan; Sung, Kevin; Velasco, Mayda; Won, Steven; Berry, Douglas; Brinkerhoff, Andrew; Chan, Kwok Ming; Hildreth, Michael; Jessop, Colin; Karmgard, Daniel John; Kolb, Jeff; Lannon, Kevin; Luo, Wuming; Lynch, Sean; Marinelli, Nancy; Morse, David Michael; Pearson, Tessa; Planer, Michael; Ruchti, Randy; Slaunwhite, Jason; Valls, Nil; Wayne, Mitchell; Wolf, Matthias; Antonelli, Louis; Bylsma, Ben; Durkin, Lloyd Stanley; Hill, Christopher; Hughes, Richard; Kotov, Khristian; Ling, Ta-Yung; Puigh, Darren; Rodenburg, Marissa; Smith, Geoffrey; Vuosalo, Carl; Winer, Brian L; Wolfe, Homer; Berry, Edmund; Elmer, Peter; Halyo, Valerie; Hebda, Philip; Hegeman, Jeroen; Hunt, Adam; Jindal, Pratima; Koay, Sue Ann; Lujan, Paul; Marlow, Daniel; Medvedeva, Tatiana; Mooney, Michael; Olsen, James; Piroué, Pierre; Quan, Xiaohang; Raval, Amita; Saka, Halil; Stickland, David; Tully, Christopher; Werner, Jeremy Scott; Zenz, Seth Conrad; Zuranski, Andrzej; Brownson, Eric; Lopez, Angel; Mendez, Hector; Ramirez Vargas, Juan Eduardo; Alagoz, Enver; Benedetti, Daniele; Bolla, Gino; Bortoletto, Daniela; De Mattia, Marco; Everett, Adam; Hu, Zhen; Jones, Matthew; Jung, Kurt; Koybasi, Ozhan; Kress, Matthew; Leonardo, Nuno; Lopes Pegna, David; Maroussov, Vassili; Merkel, Petra; Miller, David Harry; Neumeister, Norbert; Shipsey, Ian; Silvers, David; Svyatkovskiy, Alexey; Wang, Fuqiang; Xie, Wei; Xu, Lingshan; Yoo, Hwi Dong; Zablocki, Jakub; Zheng, Yu; Parashar, Neeti; Adair, Antony; Akgun, Bora; Ecklund, Karl Matthew; Geurts, Frank JM; Li, Wei; Michlin, Benjamin; Padley, Brian Paul; Redjimi, Radia; Roberts, Jay; Zabel, James; Betchart, Burton; Bodek, Arie; Covarelli, Roberto; de Barbaro, Pawel; Demina, Regina; Eshaq, Yossof; Ferbel, Thomas; Garcia-Bellido, Aran; Goldenzweig, Pablo; Han, Jiyeon; Harel, Amnon; Miner, Daniel Carl; Petrillo, Gianluca; Vishnevskiy, Dmitry; Zielinski, Marek; Bhatti, Anwar; Ciesielski, Robert; Demortier, Luc; Goulianos, Konstantin; Lungu, Gheorghe; Malik, Sarah; Mesropian, Christina; Arora, Sanjay; Barker, Anthony; Chou, John Paul; Contreras-Campana, Christian; Contreras-Campana, Emmanuel; Duggan, Daniel; Ferencek, Dinko; Gershtein, Yuri; Gray, Richard; Halkiadakis, Eva; Hidas, Dean; Lath, Amitabh; Panwalkar, Shruti; Park, Michael; Patel, Rishi; Rekovic, Vladimir; Robles, Jorge; Salur, Sevil; Schnetzer, Steve; Seitz, Claudia; Somalwar, Sunil; Stone, Robert; Thomas, Scott; Thomassen, Peter; Walker, Matthew; Cerizza, Giordano; Hollingsworth, Matthew; Rose, Keith; Spanier, Stefan; Yang, Zong-Chang; York, Andrew; Bouhali, Othmane; Eusebi, Ricardo; Flanagan, Will; Gilmore, Jason; Kamon, Teruki; Khotilovich, Vadim; Montalvo, Roy; Osipenkov, Ilya; Pakhotin, Yuriy; Perloff, Alexx; Roe, Jeffrey; Safonov, Alexei; Sakuma, Tai; Suarez, Indara; Tatarinov, Aysen; Toback, David; Akchurin, Nural; Cowden, Christopher; Damgov, Jordan; Dragoiu, Cosmin; Dudero, Phillip Russell; Kovitanggoon, Kittikul; Lee, Sung Won; Libeiro, Terence; Volobouev, Igor; Appelt, Eric; Delannoy, Andrés G; Greene, Senta; Gurrola, Alfredo; Johns, Willard; Maguire, Charles; Mao, Yaxian; Melo, Andrew; Sharma, Monika; Sheldon, Paul; Snook, Benjamin; Tuo, Shengquan; Velkovska, Julia; Arenton, Michael Wayne; Boutle, Sarah; Cox, Bradley; Francis, Brian; Goodell, Joseph; Hirosky, Robert; Ledovskoy, Alexander; Lin, Chuanzhe; Neu, Christopher; Wood, John; Gollapinni, Sowjanya; Harr, Robert; Karchin, Paul Edmund; Kottachchi Kankanamge Don, Chamath; Lamichhane, Pramod; Sakharov, Alexandre; Belknap, Donald; Borrello, Laura; Carlsmith, Duncan; Cepeda, Maria; Dasu, Sridhara; Duric, Senka; Friis, Evan; Grothe, Monika; Hall-Wilton, Richard; Herndon, Matthew; Hervé, Alain; Klabbers, Pamela; Klukas, Jeffrey; Lanaro, Armando; Loveless, Richard; Mohapatra, Ajit; Ojalvo, Isabel; Perry, Thomas; Pierro, Giuseppe Antonio; Polese, Giovanni; Ross, Ian; Sarangi, Tapas; Savin, Alexander; Smith, Wesley H; Swanson, Joshua


    The results of a search for the bottomonium counterpart, denoted as $X_b$, of the exotic charmonium state X(3872) is presented. The analysis is based on a sample of pp collisions at $\\sqrt{s}$ = 8 TeV collected by the CMS experiment at the LHC, corresponding to an integrated luminosity of 20.7 inverse femtobarns. The search looks for the exclusive decay channel $X_b \\to \\Upsilon(1S) \\pi^+ \\pi^-$ followed by $\\Upsilon(1S) \\to \\mu^+ \\mu^-$. No evidence for an $X_b$ signal is observed. Upper limits are set at the 95% confidence level on the ratio of the inclusive production cross sections times the branching fractions to $\\Upsilon(1S) \\pi^+ \\pi^-$ of the $X_b$ and the $\\Upsilon$(2S). The upper limits on the ratio are in the range 0.9-5.4% for $X_b$ masses between 10 and 11 GeV. These are the first upper limits on the production of a possible $X_b$ at a hadron collider.

  7. Photoresponsive ionic liquid crystals assembled via halogen bond: en route towards light-controllable ion transporters. (United States)

    Saccone, Marco; Palacio, Francisco Fernandez; Cavallo, Gabriella; Dichiarante, Valentina; Virkki, Matti; Terraneo, Giancarlo; Priimagi, Arri; Metrangolo, Pierangelo


    We demonstrate that halogen bonding (XB) can offer a novel approach for the construction of photoresponsive ionic liquid crystals. In particular, we assembled two new supramolecular complexes based on 1-ethyl-3-methylimidazolium iodides and azobenzene derivatives containing an iodotetrafluoro-benzene ring as XB donor, where the iodide anion acted as an XB acceptor. DSC and X-ray diffraction analyses revealed that the preferred stoichiometry between the XB donors and acceptors is 2 : 1, and that the iodide anions act as bidentate XB-acceptors, binding two azobenzene derivatives. Due to the high directionality of the XB, calamitic superanions are obtained, while the segregation occurring between the charged and uncharged parts of the molecules gives rise to a layered structure in the crystal lattice. Despite the fact that the starting materials are non-mesomorphic, the halogen-bonded supramolecular complexes exhibited monotropic lamellar liquid-crystalline phases over broad temperature ranges, as confirmed with polarized optical microscopy. Due to the presence of the azobenzene moieties, the LCs were photoresponsive, and a LC-to-isotropic phase transition could be obtained by irradiation with UV light. We envisage that the light-induced phase transition, in combination with the ionic nature of the LC, provides a route towards light-induced control over ion transport and conductance in these supramolecular complexes.

  8. Search for a new bottomonium state decaying to Υ(1S)π+π- in pp collisions at s=8 TeV

    Energy Technology Data Exchange (ETDEWEB)

    Chatrchyan, Serguei; et al.


    The results of a search for the bottomonium counterpart, denoted as $X_b$, of the exotic charmonium state X(3872) is presented. The analysis is based on a sample of pp collisions at $\\sqrt{s}$ = 8 TeV collected by the CMS experiment at the LHC, corresponding to an integrated luminosity of 20.7 inverse femtobarns. The search looks for the exclusive decay channel $X_b \\to \\Upsilon(1S) \\pi^+ \\pi^-$ followed by $\\Upsilon(1S) \\to \\mu^+ \\mu^-$. No evidence for an $X_b$ signal is observed. Upper limits are set at the 95% confidence level on the ratio of the inclusive production cross sections times the branching fractions to $\\Upsilon(1S) \\pi^+ \\pi^-$ of the $X_b$ and the $\\Upsilon$(2S). The upper limits on the ratio are in the range 0.9-5.4% for $X_b$ masses between 10 and 11 GeV. These are the first upper limits on the production of a possible $X_b$ at a hadron collider.

  9. Relativistic Disc Line: A Tool to Constrain Neutron Star Equation of ...

    Indian Academy of Sciences (India)

    Relativistic iron Kα spectral emission line from the inner disc of a neutron star Low-Mass X-ray Binary (LMXB) was first detected in 2007. This discovery opened up new ways to probe strong gravity and dense matter. The past decade has seen detections of such a line from many neutron star LMXBs, and confirmation of this ...

  10. The Peculiar Evolutionary History of IGR J17480-2446 in Terzan 5

    NARCIS (Netherlands)

    Patruno, A.; Ali Alpar, M.; van der Klis, M.; van den Heuvel, E.P.J.


    The low-mass X-ray binary (LMXB) IGR J17480-2446 in the globular cluster Terzan 5 harbors an 11 Hz accreting pulsar. This is the first object discovered in a globular cluster with a pulsar spinning at such low rate. The accreting pulsar is anomalous because its characteristics are very different

  11. XTE J1701-407 INTEGRAL and Swift observations

    DEFF Research Database (Denmark)

    Soldi, S.; Beckmann, V.; Eckert, D.


    INTEGRAL has observed the Galactic center region starting September 18, 2008 through a long key program (KP) and several ToO observations of H1743-322. In the course of these observations, the neutron star LMXB XTE J1701-407 (Markwardt et al. 2008, ATel #1569 and ATel #1616, ATel #1621) has been ...

  12. Molecular effects of the myosin activator omecamtiv mecarbil on contractile properties of skinned myocardium lacking cardiac myosin binding protein-C. (United States)

    Mamidi, Ranganath; Gresham, Kenneth S; Li, Amy; dos Remedios, Cristobal G; Stelzer, Julian E


    Decreased expression of cardiac myosin binding protein-C (cMyBP-C) in the myocardium is thought to be a contributing factor to hypertrophic cardiomyopathy in humans, and the initial molecular defect is likely abnormal cross-bridge (XB) function which leads to impaired force generation, decreased contractile performance, and hypertrophy in vivo. The myosin activator omecamtiv mecarbil (OM) is a pharmacological drug that specifically targets the myosin XB and recent evidence suggests that OM induces a significant decrease in the in vivo motility velocity and an increase in the XB duty cycle. Thus, the molecular effects of OM maybe beneficial in improving contractile function in skinned myocardium lacking cMyBP-C because absence of cMyBP-C in the sarcomere accelerates XB kinetics and enhances XB turnover rate, which presumably reduces contractile efficiency. Therefore, parameters of XB function were measured in skinned myocardium lacking cMyBP-C prior to and following OM incubation. We measured ktr, the rate of force redevelopment as an index of XB transition from both the weakly- to strongly-bound state and from the strongly- to weakly-bound states and performed stretch activation experiments to measure the rates of XB detachment (krel) and XB recruitment (kdf) in detergent-skinned ventricular preparations isolated from hearts of wild-type (WT) and cMyBP-C knockout (KO) mice. Samples from donor human hearts were also used to assess the effects of OM in cardiac muscle expressing a slow β-myosin heavy chain (β-MHC). Incubation of skinned myocardium with OM produced large enhancements in steady-state force generation which were most pronounced at low levels of [Ca(2+)] activations, suggesting that OM cooperatively recruits additional XB's into force generating states. Despite a large increase in steady-state force generation following OM incubation, parallel accelerations in XB kinetics as measured by ktr were not observed, and there was a significant OM

  13. Blocks of autogenous bone versus xenografts for the rehabilitation of atrophic jaws with dental implants: preliminary data from a pilot randomised controlled trial. (United States)

    Pistilli, Roberto; Felice, Pietro; Piatelli, Maurizio; Nisii, Alessandro; Barausse, Carlo; Esposito, Marco


    To compare the effectiveness of onlay bone blocks of equine origin (test or XB group) with autogenous bone blocks (control or AB group) harvested from the ramus or the iliac crest for the rehabilitation of partially or fully edentulous atrophic jaws with implant supported prostheses. Forty patients with partially or fully edentulous atrophic jaws having less than 5 mm of residual crestal bone height and/or less than 3 mm of bone thickness, as measured on computerised tomography (CT) scans, were randomised into two groups according to a parallel group design, either to be augmented with autogenous onlay bone blocks (20 patients; AB group) from the mandibular ramus or the iliac crest, or with onlays blocks of spongious bone of equine origin (20 patients; XB group). Two centres treated 20 patients each. Six XB blocks were modelled on lithographic models of the jaws before grafting. The blocks were fixed with screws and osteosynthesis plates and were covered with resorbable barriers made of equine cortical bone and fixed with tacks. The autogenous bone grafts were left to heal for 4 months and the xenografts for 7 months before placing implants, which were submerged. After 4 months, either bar-retained overdentures or provisional reinforced acrylic prostheses were delivered. Provisional prostheses were replaced, after 4 months, by definitive fixed prostheses. Outcome measures were: prosthesis and implant failures; complications; patient satisfaction; pain recorded 3 and 10 days post-augmentation; number of days of hospitalisation, total and partial infirmity days. All patients were followed for 4 months after loading. All patients could be rehabilitated with implant-supported prostheses and none dropped out. Twenty-eight patients were augmented in the maxilla (15 with AB and 13 with XB) and 12 in the mandible (5 with AB and 7 with XB). No AB graft failed totally versus 10 XB grafts (difference = 0.5; 95% CI 0.23 to 0.68; P = 0.0004). In particular, all 7 XB mandibular

  14. Low serum concentration in bovine embryo culture enhances early blastocyst rates on Day-6 with quality traits in the expanded blastocyst stage similar to BSA-cultured embryos. (United States)

    Murillo, A; Muñoz, M; Martín-González, D; Carrocera, S; Martínez-Nistal, A; Gómez, E


    In bovine, single in vitro embryo culture in protein-free medium from Day-6 to Day-7 leads to expanded blastocyst (XB) with improved pregnancy and birth rates after cryopreservation. Under these conditions, early blastocysts (EB) progress to the XB stage at higher rates than morulae (M). However, embryo production with BSA in culture prior to Day-6 leads to low EB rates. We investigated whether a very low FCS concentration (0.1%) in culture from Day-1 to Day-6 would improve EB rates and, subsequently, increase XB rates on Day-7 after single culture in protein-free medium. The quality of embryos produced was evaluated in terms of survival to cryopreservation, apoptosis percentage, lipid accumulation and transfer to recipients. On Day-6, EB rates from embryos cultured with FCS were higher than with BSA (P=0.022). On Day-7, XB rates were higher in embryos from Day-6 EB than from Day-6M, both with and without FCS (Pvitrification/warming of Day-7 XB, 100% embryos survived at 24h in all treatments, and total cell number and apoptosis percentage were not affected by the presence of FCS or embryonic stage on Day-6. Cryopreserved and fresh embryos produced with FCS until Day-6, and then deprived of protein and cultured individually, led to pregnancies after ET. In conclusion, minute FCS concentration improves EB rates on Day-6 leading, after one-day single culture without protein, to more XBs. The quality of XB produced with FCS compares well with XB produced with BSA in terms of apoptosis, lipid accumulation and pregnancy. Copyright © 2017 Society for Biology of Reproduction & the Institute of Animal Reproduction and Food Research of Polish Academy of Sciences in Olsztyn. Published by Elsevier Urban & Partner Sp. z o.o. All rights reserved.

  15. Intermediate long X-ray bursts from the ultra-compact binary candidate SLX1737-282

    DEFF Research Database (Denmark)

    Falanga, M.; Chenevez, Jérôme; Cumming, A.


    Aims. The low persistent flux X-ray burster source SLX 1737-282 is classified as an ultra-compact binary candidate. We compare the data on SLX 1737-282 with the other similar objects and attempt to derive constraints on the physical processes responsible for the formation of intermediate long...... bursts. Methods: Up to now only four bursts, all with duration between ≃15{-}30 min, have been recorded for SLX 1737-282. The properties of three of these intermediate long X-ray bursts observed by INTEGRAL are investigated and compared to other burster sources. The broadband spectrum of the persistent...... emission in the 3-100 keV energy band is studied with the INTEGRAL data. Results: The persistent emission is measured to be 0.5% Eddington luminosity. From the photospheric radius expansion observed during at least one burst we derive the source distance at 7.3 kpc assuming a pure helium atmosphere...

  16. Radiation dynamics in X-ray binaries. I - Type 1 bursts. II - Type 2 bursts. III - Extremely compact objects (United States)

    Walker, Mark A.


    Equations describing the evolution of a thin, axisymmetric, viscous, relativistic, irradiated accretion disk are presented, as well as numerical solutions of these equations in the case where irradiation results from a thermonuclear flash on the surface of the accreting neutron star. These calculations verify the notion that the radiation torque induces a substantial increase in the accretion rate, during a type 1 X-ray burst, and provide insight into the factors which influence the dynamical response of the disk. A new model for the source XBT 1730-335, the rapid burster, is presented. Temporal and spectral properties are calculated. The rapid burster is found to be a nonmagnetic, 'critically compact', slowly rotating neutron star in a highly eccentric binary system with a period of 6 mo. The spectral modifications which arise from the scattering of photons by accretion disks around nonmagnetic neutron stars are calculated. The 'black hole candidates' are interpreted as extremely compact stars.

  17. Xylobiose, an Alternative Sweetener, Ameliorates Diabetes-Related Metabolic Changes by Regulating Hepatic Lipogenesis and miR-122a/33a in db/db Mice

    Directory of Open Access Journals (Sweden)

    Eunjin Lim


    Full Text Available Type 2 diabetes is a major public health concern worldwide. Xylobiose (XB consists of two molecules of d-xylose and is a major disaccharide in xylooligosaccharides that are used as prebiotics. We hypothesized that XB could regulate diabetes-related metabolic and genetic changes via microRNA expression in db/db mice. For six weeks, C57BL/KsJ-db/db mice received 5% XB as part of the total sucrose content of their diet. XB supplementation improved glucose tolerance with reduced levels of OGTT AUC, fasting blood glucose, HbA1c, insulin, and HOMA-IR. Furthermore, XB supplementation decreased the levels of total triglycerides, total cholesterol, and LDL-C. The expression levels of miR-122a and miR-33a were higher and lower in the XB group, respectively. In the liver, expressions of the lipogenic genes, including, fatty acid synthase (FAS, peroxisome proliferator activated receptor γ (PPARγ, sterol regulatory element-binding protein-1C (SREBP-1C, sterol regulatory element-binding protein-2 (SREBP-2, acetyl-CoA carboxylase (ACC, HMG-CoA reductase (HMGCR, ATP-binding cassette transporter G5/G8 (ABCG5/8, cholesterol 7 alpha-hydroxylase (CYP7A1, and sterol 12-alpha-hydroxylase (CYP8B1, as well as oxidative stress markers, including superoxide dismutase 1 (SOD1, superoxide dismutase 2 (SOD2, glutathione peroxidase (GPX, and catalase, were also regulated by XB supplementation. XB supplementation inhibited the mRNA expressions levels of the pro-inflammatory cytokines, tumor necrosis factor (TNF-α, interleukin (IL-1β, interleukin (IL-6, and monocyte chemoattractant protein (MCP-1, as well as phosphorylation of c-Jun N-terminal kinase/stress activated protein kinase (JNK/SAPK, p38 mitogen-activated protein kinases (MAPK, and extracellular signal-regulated kinases 1/2 (ERK1/2. These data demonstrate that XB exhibits anti-diabetic, hypolipogenic, and anti-inflammatory effects via regulation of the miR-122a/33a axis in db/db mice.

  18. Long-lasting modification of intrinsic discharge properties in subicular neurons following status epilepticus. (United States)

    Wellmer, Jörg; Su, Hailing; Beck, Heinz; Yaari, Yoel


    A single episode of status epilepticus (SE) induces neuropathological changes in the brain that may lead to the development of a permanent epileptic condition. Most studies of this plasticity have focused on the hippocampus, where both synaptic function and intrinsic neuronal excitability have been shown to be persistently modified by SE. However, many other brain structures are activated during SE and may also be involved in the subsequent epileptogenic process. Here we have investigated whether SE, induced in rats with pilocarpine and terminated after 40 min with diazepam, persistently modifies the intrinsic excitability of pyramidal neurons in the subiculum. Subicular slices were prepared from control and SE-experienced rats (2-5 weeks after SE). In the control group, only 4% of the neurons fired bursts in response to intrasomatic, threshold-straddling depolarizing current pulses (low-threshold bursters). The remaining neurons either fired bursts in response to strong (3x threshold) depolarizations (35%; high-threshold bursters) or fired in a completely regular mode (61%; nonbursters). In the SE-experienced group, the fractions of low- and high-threshold bursters markedly increased to 29% and 53%, respectively. This change in firing behaviour was associated with a marked increase in the size of the spike after depolarization, particularly in low-threshold bursters. Experimental suppression of Ca2+ currents selectively blocked low-threshold bursting but did not affect high-threshold bursting, suggesting that a dual Ca2+- dependent and Ca2+- independent mechanism controls bursting in these neurons. The persistent up-regulation of intrinsic bursting in the subiculum, in concert with similar changes in the hippocampus, undoubtedly contributes to epileptogenesis following pilocarpine-induced SE.

  19. Fermi-GBM detection of a thermonuclear burst from 4U 1608-52

    NARCIS (Netherlands)

    Jenke, P.; Linares, M.; Connaughton, V.; van der Horst, A.J.; Camero-Arranz, A.; Finger, M.; Wilson-Hodge, C.; Kouveliotou, C.


    We report the detection with Fermi-GBM (daily CTIME data, 12-25 keV band) of an X-ray burst from a location consistent with the neutron star low-mass X-ray binary and thermonuclear burster 4U 1608-52. The burst peak occurred on May 2, 2012 at 06:47:54 UTC. The Fermi-GBM location of the burst is

  20. Injection of Nucleate-Boiling Slug Flows into a Heat Exchange Chamber in Microgravity (United States)


    alternatives in case of unsatisfactory performance. At the same time we started preparing the software tools for the image processing and for the numerical...gas only) 15b) Burster Typ 8227 16 Pressure regulator valve Festo VPPM-6L-L-1-G18-0L2H-A4N 17 Air filter Festo LF-D-5M-MINI XN43 18 Pressured air

  1. INTEGRAL reports renewed activity from KS 1741-293

    DEFF Research Database (Denmark)

    Chenevez, Jérôme; Kuulkers, E.; Alfonso-Garzón, J.


    The low-mass X-ray binary and burster source KS 1741-293 has been detected during recent INTEGRAL Galactic bulge (see ATel #438) observations by the JEM-X instrument. On February 25, 2010, between UTC 13:04 and 14:08, KS 1741-293 was detected at a 3-10 keV flux of 9 +/- 4 mCrab, and an upper limi...

  2. Probes of Lorentz Violation

    CERN Document Server

    Ellis, John


    Lorentz invariance is such an important principle of fundamental physics that it should constantly be subjected to experimental scrutiny as well as theoretical questioning. Distant astrophysical sources of energetic photons with rapid time variations, such as active galactic nuclei (AGNs) and gamma-ray bursters (GRBs), provide ideal experimental opportunities for testing Lorentz invariance. The Cherenkov Telescope Array (CTA) is an excellent experimental tool for making such tests with sensitivities exceeding those possible using other detectors.

  3. Simultaneous optical/gamma-ray observations of GRBs (United States)

    Greiner, J.; Wenzel, W.; Hudec, R.; Moskalenko, E. I.; Metlov, V.; Chernych, N. S.; Getman, V. S.; Ziener, Rainer; Birkle, K.; Bade, N.


    Details on the project to search for serendipitous time correlated optical photographic observations of Gamma Ray Bursters (GRB's) are presented. The ongoing photographic observations at nine observatories are used to look for plates which were exposed simultaneously with a gamma ray burst detected by the gamma ray instrument team (BATSE) and contain the burst position. The results for the first two years of the gamma ray instrument team operation are presented.

  4. Inelastic Branch of the Stellar Reaction $^{14}$O$(\\alpha,p)^{17}$F

    CERN Multimedia

    Hass, M; Van duppen, P L E


    We propose to use the upgraded REX-ISOLDE beam energy to study the astrophysically important $^{14}$O($\\alpha$, p)$^{17}$F reaction in time reverse kinematics. In particular, we will use the highly efficient miniball + CD detection system to measure the previously undetermined inelastic proton branch of the 1$^-$ state at 6.15 MeV in $^{18}$Ne. This state dominates the reaction rate under X-ray burster conditions.

  5. Thermodynamic modelling of phase equilibria in Al–Ga–P–As system

    Indian Academy of Sciences (India)


    4. 18. 42. 17. 3. 32. 16. 2. 3. 2. 2. 15. 2. 3. 14. 32. 13. 4. 3. 2. 3. 4. 12. 2. 4. 3. 2. 2. 4. 11. 2. 4. 10. 4. 3. 2. 4. 9. 4. 3. 2. 3. 3. 8. 2. 4. 3. 2. 2. 3. 7. 2. 36. 4. 3. 2. 3. 5. 4. 3. 2. 4. 3. 2. 2. 2. 4. 2. 4. 3. 2. 4. 3. 2. 2. 3. 4. 3. 2. 2. 2. 4. 3. 2. 4. 3. 2. 1. 2 xxx xx x x x c x x x xxb x x x x x x xb x x x xb x x x xx b xxb xxb xxb xxb xxx b x x x xb x x x xxb.

  6. Parter, Periodic and Coperiodic Functions on Groups and their Characterization

    Directory of Open Access Journals (Sweden)

    M. H. Hooshmand


    Full Text Available Decomposer functional equations were introduced by the author and have been completely solved on arbitrary groups. Their solutions are as decomposer functions and play important role regarding to decomposition (factorization of groups by their two subsets. In this paper, we introduce an important class of strong decomposer functions, namely parter (or cyclic decomposer functions. As some important applications of this topic, we characterize all periodic , coperiodic functions in arbitrary groups and give general solution of their functional equations: f(bx = f(x , f(xb = f(x, f(bx = bf(x and f(xb = f(xb. Moreover, we characterize all parter functions in arbitrary groups and completely solve the decomposer equation with the condition which its ∗-range is a cyclic subgroup of G. Finally, we give some functional characterization for related projections and b-parts functions and also, we introduce some uniqueness conditions for b-parts of real numbers.

  7. Mathematical Analysis of Actuator Forces in a Scissor Lift (United States)


    12 = (xB x.4) 2 + (.B -..- ) 2 = [ (XBo-X.40 ) cosO + (xB90 - X49o) sinO] 2 + I (.BQO - ’.49o) sin0 + (YBo -- YAo) cosO] 2 ( acosO - bsinO) 2...csinO + dcoso) 2 (EQ 3) where Ui = XBO- Y = YB90--YAQ.90 b = xB90 - X4 9 0 d YBo-YAO • Taking the derivative of / with respect to h gives 21d [2 ( acosO ...bsinO) (-asinO + bcosO) + 2 (csinO + dcosO) (ccosO - dsinO) I LO h dh’ and solving for Lhresults in dI 2 1dh dl 2 ( acosO + bsinO) (-asinO ý- bcos0

  8. Noise interferometry in an inhomogeneous environment in the geometric limit. (United States)

    Brown, Michael G


    An approximation to the transient Green's function G(x(a)∣x(b),t) between points x(a) and x(b) can be estimated by taking the time derivative of the correlation function C(ab)(t) of records of ambient noise measured at locations x(a) and x(b). From the general relationship between C(ab)(t) and G(x(a)∣x(b),t) it is shown, using a stationary-phase-like argument, that in an inhomogeneous environment in the geometric limit C(ab)(t) consists of a superposition of signed step functions and two-sided logarithmic singularities that are delayed in time by the travel times of the rays connecting x(a) and x(b). © 2011 Acoustical Society of America

  9. A live attenuated BCG vaccine overexpressing multistage antigens Ag85B and HspX provides superior protection against Mycobacterium tuberculosis infection. (United States)

    Yuan, Xuefeng; Teng, Xindong; Jing, Yukai; Ma, Jilei; Tian, Maopeng; Yu, Qi; Zhou, Lei; Wang, Ruibo; Wang, Weihua; Li, Li; Fan, Xionglin


    Tuberculosis (TB) remains one of the most menacing infectious diseases, although attenuated Mycobacterium bovis Bacillus Calmette-Guerin (BCG) vaccine has been widely used to protect children against primary TB. There are increasing evidences that rapid growing and dormant Mycobacterium tuberculosis (M. tuberculosis) coexist in vivo after infection. However, BCG vaccine only elicits cell-mediated immune responses to secretory antigens expressed by rapid growing pathogen. BCG vaccine is thus unable to thwart the reactivation of latent tuberculosis infection (LTBI), and its protection wanes over age after neonatal immunization. In order to extend its ability for a durable protection, a novel recombinant BCG (rBCG) strain, named rBCG::XB, was constructed by overexpressing immunodominant multistage antigens of Ag85B and HspX, which are expressed by both rapid replicating and dormant M. tuberculosis. Long-term protective effect and immunogenicity of rBCG::XB were compared with the parental BCG in vaccinated C57BL/6 mice. Our results demonstrated that rBCG::XB provided the stronger and long-lasting protection against M. tuberculosis H37Rv intranasal infection than BCG. The rBCG::XB not only elicited the more durable multistage antigen-specific CD4(+)Th1-biased immune responses and specific polyfunctional CD4(+)T cells but also augmented the CD8(+) CTL effects against Ag85B in vivo. In particular, higher levels of CD4(+) TEM and CD8(+) TCM cells, dominated by IL2(+) CD4(+) and CD8(+) TCM cells, were obtained in the spleen of rBCG::XB vaccinated mice. Therefore, our findings indicate that rBCG::XB is a promising candidate to improve the efficacy of BCG.

  10. Do all millisecond pulsars share a common heritage?


    Kiziltan, Bulent; Thorsett, Stephen E.


    The discovery of millisecond pulsations from neutron stars in low mass X-ray binary (LMXB) systems has substantiated the theoretical prediction that links millisecond radio pulsars (MSRPs) and LMXBs. Since then, the process that produces millisecond radio pulsars from LMXBs, followed by spin-down due to dipole radiation has been conceived as the 'standard evolution' of millisecond pulsars. However, the question whether all the observed millisecond radio pulsars could be produced by LMXBs has ...

  11. Drug: D07802 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available hate D DERMATOLOGICALS D07 CORTICOSTEROIDS, DERMATOLOGICAL PREPARATIONS D07A CORTICOSTEROIDS, PLAIN D07AB Corticosteroids...OSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids, moderately potent, other combinations D07XB05 Dexametha...PARATIONS FOR TOPICAL USE D10AA Corticosteroids, combinations for treatment of acne D10AA03 Dexamethasone D0...01A DECONGESTANTS AND OTHER NASAL PREPARATIONS FOR TOPICAL USE R01AD Corticosteroids R01AD03 Dexamethasone D...LAMMATORY AGENTS S01BA Corticosteroids, plain S01BA01 Dexamethasone D07802 Dexamethasone phosphate S01C ANTI

  12. Drug: D00984 [KEGG MEDICUS

    Lifescience Database Archive (English)


  13. Drug: D01615 [KEGG MEDICUS

    Lifescience Database Archive (English)


  14. Drug: D07800 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available FOR TOPICAL USE C05AA Corticosteroids C05AA09 Dexamethasone D07800 Dexamethasone ...21-valerate D DERMATOLOGICALS D07 CORTICOSTEROIDS, DERMATOLOGICAL PREPARATIONS D07A CORTICOSTEROIDS, PLAIN D07AB Corticosteroids...7X CORTICOSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids, moderately potent, other combinations D07XB05 ...TI-ACNE PREPARATIONS FOR TOPICAL USE D10AA Corticosteroids, combinations for treatment of acne D10AA03 Dexam... PREPARATIONS R01A DECONGESTANTS AND OTHER NASAL PREPARATIONS FOR TOPICAL USE R01AD Corticosteroids R01AD03

  15. Drug: D01510 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available CAL PREPARATIONS A01AC Corticosteroids for local oral treatment A01AC02 Dexamethasone D01510 Dexamethasone m...ENTS FOR TREATMENT OF HEMORRHOIDS AND ANAL FISSURES FOR TOPICAL USE C05AA Corticosteroids C05AA09 Dexamethas...L PREPARATIONS D07A CORTICOSTEROIDS, PLAIN D07AB Corticosteroids, moderately pote..., OTHER COMBINATIONS D07XB Corticosteroids, moderately potent, other combinations D07XB05 Dexamethasone D015...NTI-ACNE PREPARATIONS FOR TOPICAL USE D10AA Corticosteroids, combinations for treatment of acne D10AA03 Dexa

  16. Drug: D01948 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available TRACT AND METABOLISM A01 STOMATOLOGICAL PREPARATIONS A01A STOMATOLOGICAL PREPARATIONS A01AC Corticosteroid... TOPICAL USE C05AA Corticosteroids C05AA09 Dexamethasone D01948 Dexamethasone valerate (JAN) D DERMATOLOGICA...LS D07 CORTICOSTEROIDS, DERMATOLOGICAL PREPARATIONS D07A CORTICOSTEROIDS, PLAIN D07AB Corticosteroids... D07X CORTICOSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids, moderately potent, other combinations D07XB...10A ANTI-ACNE PREPARATIONS FOR TOPICAL USE D10AA Corticosteroids, combinations for treatment of acne D10AA03

  17. Scientific and Engineering Studies; Spectral Estimation. (United States)


    1972, pp. 104-117. 15. V. Kucera , "The Matrix Equation AX+XB - C," SIAM J. App1. Math., vol. 26, no. 1, Jan . 1974, pp. 15-25. 16. R. E. Hartwig, "AX-XB...percent Overlap 33 TR 4767 0 - - - a- - -1.42 0 .. .. flI I, 246 256 266 Frequency (Hz) Figure 12. fo= 256 71/2 Hz amy -50-5.0 0 .u _ -S - 34 (I- - - -1O a...analytic expansions of (15) are not fruitful , in contrast with the earlier approach for MSC results. instead, we must adopt some convenient simple

  18. Stochastic invertible mappings between power law and Gaussian probability distributions


    Vignat, C.; Plastino, A.


    We construct "stochastic mappings" between power law probability distributions (PD's) and Gaussian ones. To a given vector $N$, Gaussian distributed (respectively $Z$, exponentially distributed), one can associate a vector $X$, "power law distributed", by multiplying $X$ by a random scalar variable $a$, $N= a X$. This mapping is "invertible": one can go via multiplication by another random variable $b$ from $X$ to $N$ (resp. from $X$ to $Z$), i.e., $X=b N$ (resp. $X=b Z$). Note that all the a...

  19. Xenomicrobiology

    DEFF Research Database (Denmark)

    G Acevedo-Rocha, Carlos; Budisa, Nediljko


    solutions to health, energy and environmental issues as well as unsustainable manufacturing processes in the frame of naturally existing chemical building blocks. Xenobiology (XB) goes a step further by implementing non-natural building blocks in living cells. In this context, genetic code engineering...... for potential applications in synthetic organic chemistry and biocontainment strategies for enhanced biosafety. In this perspective, we provide a brief history and evolution of the genetic code in the context of XB. We then discuss the latest efforts and challenges ahead for engineering the genetic code...... endowed with a 'genetic firewall' will also allow to study and understand the relation between code evolution and horizontal gene transfer....

  20. Vaporizing neutron stars in low-mass x-ray binaries and the statistics of millisecond pulsars

    Energy Technology Data Exchange (ETDEWEB)

    Tavani, M. (California Univ., Livermore, CA (United States). Inst. of Geophysics and Planetary Physics)


    Recent data on low-mass X-ray binaries (LMXBs) and msec pulsars (MSPs) pose a challenge to evolutionary which neglect the effects of disk and companion irradiation. Here we discuss the main features of a radiation-driven (RD) evolutionary model that may be applicable to several LMXBs. According to this model, irradiation from the accreting compact star LMXBs vaporizes'' the accretion disk and the companion star by driving a self-sustained mass loss until a sudden accretion-turn of occurs. The main characteristics of the RD-evolution are: (1) the lifetime of RD-LMXB's is of order 10{sup 7} years or less: (2) both the orbital period gap and the X-ray luminosity may be consequences of RD-evolution of LMXB's containing lower main sequence and degenerate companion stars; (3) the companion star may transfer mass to the primary even if it underfills its Roche lobe; (4) the recycled msec pulsar can continue to vaporize the low-mass companion star even after the accretion turn-off produced by a strong pulsar wind; (5) the RD-evolutionary model resolves the apparent statistical discrepancy between the number of MSP's and their LMXB progenitors. 14 refs., 1 fig., 1 tab.

  1. Radiation-driven evolution of low-mass x-ray binaries and the formation of millisecond pulsars

    Energy Technology Data Exchange (ETDEWEB)

    Tavani, M. (Lawrence Livermore National Lab., CA (United States) California Univ., Berkeley, CA (United States). Dept. of Astronomy)


    Recent data on low-mass X-ray binaries (LMXBs) and millisecond pulsars (MSPs) pose a challenge to evolutionary theories which neglect the effects of disk and comparison irradiation. Here we discuss the main features of a radiation-driven (RD) evolutionary model that may be applicable to several LMXBs. According to this model, radiation from the accreting compact star in LMXBs vaporizes'' the accretion disk and the companion star by driving a self-sustained mass loss until a sudden accretion-turn off occurs. The main characteristics of the RD-evolution are: (1) lifetime of RD-LMXB's is of order 10{sup 7} years or less; (2) both the orbital period gap and the X-ray luminosity may be consequences of RD-evolution of LMXB's containing lower main sequence and degeneration companion stars; (3) the companion star may transfer mass to the primary even if it underfills its Roche lobe; (4) a class of recycled MSPs can continue to vaporize the low-mass companions by a strong pulsar wind even after the accretion turn-off; (5) the RD-evolutionary model resolves the apparent statistical descrepancy between the number of MSPs and their LMXB progenitors in the Galaxy. We discuss the implications of the discovery of single MSPs in low-density globular clusters and the recent measurements of short orbital timescales of four LMXBs. 34 refs., 3 figs., 2 tabs.

  2. Asymmetric bifurcated halogen bonds. (United States)

    Novák, Martin; Foroutan-Nejad, Cina; Marek, Radek


    Halogen bonding (XB) is being extensively explored for its potential use in advanced materials and drug design. Despite significant progress in describing this interaction by theoretical and experimental methods, the chemical nature remains somewhat elusive, and it seems to vary with the selected system. In this work we present a detailed DFT analysis of three-center asymmetric halogen bond (XB) formed between dihalogen molecules and variously 4-substituted 1,2-dimethoxybenzene. The energy decomposition, orbital, and electron density analyses suggest that the contribution of electrostatic stabilization is comparable with that of non-electrostatic factors. Both terms increase parallel with increasing negative charge of the electron donor molecule in our model systems. Depending on the orientation of the dihalogen molecules, this bifurcated interaction may be classified as 'σ-hole - lone pair' or 'σ-hole - π' halogen bonds. Arrangement of the XB investigated here deviates significantly from a recent IUPAC definition of XB and, in analogy to the hydrogen bonding, the term bifurcated halogen bond (BXB) seems to be appropriate for this type of interaction.

  3. Project SQUID. Liquid Propellant Rockets. Volume 2, Part 2 (United States)


    problem-, directed tow ard droppable .JATO unit is being developed for the XB-45 the desiga or levelopment of a specific power plant. airplane. This...operations such as propellant dynamometer stand and absorb the thrust of the analysis and instrument calibration. rocket. In addition to these main

  4. Synthesis of diamonds in Fe-C systems using nitrogen and hydrogen co-doped impurities under HPHT (United States)

    Sun, Shi-Shuai; Xu, Zhi-Hui; Cui, Wen; Jia, Xiao-Peng; Ma, Hong-An


    Not Available Project supported by the National Natural Science Foundation of China (Grant Nos. 11504267, 11504269, and 51172089), the Open Project of State Key Laboratory of Superhard Materials, Jilin University, China (Grant No. 201504), and the Doctoral Fund of Tianjin Normal University, China (Grant No. 52XB1518).

  5. Muusika tuppa või õue / Harri Slip, Glen Pilvre

    Index Scriptorium Estoniae

    Slip, Harri


    Juhtmevabad kõlarid: Bose SoundLink Colour, Creative Roar 2, Denon Envaya Mini, JBL Charge 3, Klipsch Groove, Onkyo T3 Philips BT6600, Pioneer XW-BTSP70, Samsung Level Box Pro, Sony SRS-XB3, Ultimate Ears Boom 2. Etalon: Sony SRS-HG1

  6. On-Chip Out-of-Plane High-Q Inductors (United States)


    underneath the coil boosts the quality factor to 85 and should therefore further improve the phase noise by up to 6dB. I. INTRODUCTION Transistors ...process (X-FAB XB06, 2 metals, 15GHz fTx for the RF NPN BJT ). The out-of-plane coils were configured as in our first design with the return currents

  7. Dicty_cDB: Contig-U03667-1 [Dicty_cDB

    Lifescience Database Archive (English)

    Full Text Available re callus 7d ... 46 1.6 1 ( DY490191 ) sh1-xb10_l0.s2 adult sheep fracture callus p...9OML22049076HT OML2 Ovis aries cDNA, mRNA se... 46 1.6 1 ( DY496264 ) sh2P0018H02_F.ab1 adult sheep fractu

  8. Supporting information Composition dependent non-ideality in a ...

    Indian Academy of Sciences (India)

    Figure S1 shows single particle potential energy distribution of parent liquid for structure former binary mixture (model I) at mole fraction (xB) = 0.4 and temperature (T*) = 1 where as Figure S2 represents the corresponding single particle inherent structure energy distribution. The distribution (as shown in Figure S1) could be ...

  9. Modeling cooperative effects in halogen-bonded infinite linear chains. (United States)

    Adasme-Carreño, Francisco; Alzate-Morales, Jans; Ireta, Joel


    Non-additivity in noncovalent interactions is an important aspect of complex systems that can lead to stronger (cooperative) interactions when three or more molecular units influence each other. The halogen bond (XB) is a highly-directional noncovalent interaction that has been found to be cooperative. Here the strength and nature of cooperativity arising in X-bonded infinite linear chains of cyanogen halides and 4-halopyridines are investigated by means of density functional theory calculations. It is found that cyanogen halide chains are highly cooperative (up to 77%), whereas pyridines are only slightly cooperative (below 21%). It is demonstrated that XB and its non-additivity can be modeled as the sum of a local term, which depends on first nearest-neighbors only, and long-range effective dipole-dipole attractions. It is shown that the local term in cyanogen halides primarily accounts for repulsive short-range screened Coulomb interactions, whereas in 4-halopyridines such a term also includes attractive contributions, which are particularly sizeable in some elongated XB conformations. This outcome reveals differences in the nature of the XBs formed in these molecular systems. Nevertheless, it is shown that both systems behave as effective point dipoles regarding cooperative effects, at any point of the XB dissociation path. As such, these results are useful contributions for the understanding and modeling of non-additive effects of noncovalent interactions.

  10. On the Solutions of Some Linear Complex Quaternionic Equations (United States)

    İpek, Ahmet


    Some complex quaternionic equations in the type AX − XB = C are investigated. For convenience, these equations were called generalized Sylvester-quaternion equations, which include the Sylvester equation as special cases. By the real matrix representations of complex quaternions, the necessary and sufficient conditions for the solvability and the general expressions of the solutions are obtained. PMID:25101318

  11. On the Solutions of Some Linear Complex Quaternionic Equations

    Directory of Open Access Journals (Sweden)

    Cennet Bolat


    Full Text Available Some complex quaternionic equations in the type AX-XB=C are investigated. For convenience, these equations were called generalized Sylvester-quaternion equations, which include the Sylvester equation as special cases. By the real matrix representations of complex quaternions, the necessary and sufficient conditions for the solvability and the general expressions of the solutions are obtained.

  12. Diversity, biocontrol, and plant growth promoting abilities of xylem residing bacteria from solanaceous crops. (United States)

    Achari, Gauri A; Ramesh, Raman


    Eggplant (Solanum melongena L.) is one of the solanaceous crops of economic and cultural importance and is widely cultivated in the state of Goa, India. Eggplant cultivation is severely affected by bacterial wilt caused by Ralstonia solanacearum that colonizes the xylem tissue. In this study, 167 bacteria were isolated from the xylem of healthy eggplant, chilli, and Solanum torvum Sw. by vacuum infiltration and maceration. Amplified rDNA restriction analysis (ARDRA) grouped these xylem residing bacteria (XRB) into 38 haplotypes. Twenty-eight strains inhibited growth of R. solanacearum and produced volatile and diffusible antagonistic compounds and plant growth promoting substances in vitro. Antagonistic strains XB86, XB169, XB177, and XB200 recorded a biocontrol efficacy greater than 85% against BW and exhibited 12%-22 % increase in shoot length in eggplant in the greenhouse screening. 16S rRNA based identification revealed the presence of 23 different bacterial genera. XRB with high biocontrol and plant growth promoting activities were identified as strains of Staphylococcus sp., Bacillus sp., Streptomyces sp., Enterobacter sp., and Agrobacterium sp. This study is the first report on identity of bacteria from the xylem of solanaceous crops having traits useful in cultivation of eggplant.

  13. Diversity, Biocontrol, and Plant Growth Promoting Abilities of Xylem Residing Bacteria from Solanaceous Crops

    Directory of Open Access Journals (Sweden)

    Gauri A. Achari


    Full Text Available Eggplant (Solanum melongena L. is one of the solanaceous crops of economic and cultural importance and is widely cultivated in the state of Goa, India. Eggplant cultivation is severely affected by bacterial wilt caused by Ralstonia solanacearum that colonizes the xylem tissue. In this study, 167 bacteria were isolated from the xylem of healthy eggplant, chilli, and Solanum torvum Sw. by vacuum infiltration and maceration. Amplified rDNA restriction analysis (ARDRA grouped these xylem residing bacteria (XRB into 38 haplotypes. Twenty-eight strains inhibited growth of R. solanacearum and produced volatile and diffusible antagonistic compounds and plant growth promoting substances in vitro. Antagonistic strains XB86, XB169, XB177, and XB200 recorded a biocontrol efficacy greater than 85% against BW and exhibited 12%–22 % increase in shoot length in eggplant in the greenhouse screening. 16S rRNA based identification revealed the presence of 23 different bacterial genera. XRB with high biocontrol and plant growth promoting activities were identified as strains of Staphylococcus sp., Bacillus sp., Streptomyces sp., Enterobacter sp., and Agrobacterium sp. This study is the first report on identity of bacteria from the xylem of solanaceous crops having traits useful in cultivation of eggplant.

  14. 77 FR 13097 - Endangered Species; File Nos. 15661, 10027, and 15685 (United States)


    ... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF COMMERCE National Oceanic and Atmospheric Administration RIN 0648-XB053 Endangered Species; File Nos. 15661, 10027... authorized the AMNH to study the population biology and connectivity of green and hawksbill sea turtles...

  15. Experimental and theoretical studies on a novel helical architecture ...

    Indian Academy of Sciences (India)

    Helical supramolecular architecture; crystal structure; hydrogen bond; halogen bond; photoluminescence. 1. Introduction. As is well-known, crystal engineering comprises of an understanding of specific intermolecular interactions, such as hydrogen bonding (HB), halogen bonding (XB), electrostatic interaction and van der ...

  16. Drug: D02304 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available o Acid Same as: C00047 ATC code: B05XB03 Anatomical Therapeutic Chemical (ATC) classification [BR:br08303] B BLOOD AND BLOOD... FORMING ORGANS B05 BLOOD SUBSTITUTES AND PERFUSION SOLUTIONS B05X I.V. SOLUTION ADDITIVES B

  17. Assistance tool commissioner of new algorithms of systems planning of therapy with ionizing; Herramienta de asistencia en el comisionado de nuevos algoritmos de sistemas de planificacion de terapia con radiaciones ionizantes

    Energy Technology Data Exchange (ETDEWEB)

    Reinado, D.; Ricos, B.; Alonso, S.; Chinillach, N.; Bellido, P.; Tortosa, R.


    The Commissioner of a new scheduling algorithm is associated with a high number of hours of work and measures. In order to optimize the development of the Commissioner for the AAA algorithms and Acuros XB within planning Eclipse (V.10) system marketed by Varian and have developed a tool in Microsoft Excel format where the different tests have been included to perform. (Author)

  18. Learning Non-Adjacent Dependencies: A Mechanism for Language Acquisition

    NARCIS (Netherlands)

    Grama, I.C.|info:eu-repo/dai/nl/339459646


    This dissertation explores the human ability for non-adjacent dependency-learning, which allows adults and infants to detect the relationship between a and b in an aXb string. I use artificial grammar learning with adults and infants to investigate whether non-adjacent dependency-learning could

  19. 77 FR 14697 - Fisheries of the Northeastern United States; Northeast Multispecies Fishery; Trip Limit... (United States)


    ... possession limits for Georges Bank (GB) cod and Southern New England (SNE)/Mid-Atlantic (MA) yellowtail... National Oceanic and Atmospheric Administration 50 CFR Part 648 RIN 0648-XB059 Fisheries of the Northeastern United States; Northeast Multispecies Fishery; Trip Limit Adjustments for the Common Pool Fishery...

  20. 77 FR 14349 - Availability of Report: California Eelgrass Mitigation Policy (United States)


    ... and NEPA reviews throughout California. It is also contemplated that this policy inform SWR's position... areas within California, with considerably more information and history with eelgrass habitat management... National Oceanic and Atmospheric Administration RIN 0648-XB068 Availability of Report: California Eelgrass...

  1. 77 FR 19563 - 2012 Accountability Measures for Gulf of Mexico Commercial Greater Amberjack and Closure of the... (United States)


    ... National Oceanic and Atmospheric Administration 50 CFR Part 622 RIN 0648-XB074 2012 Accountability Measures... (NOAA), Commerce. ACTION: Temporary rule; closure. SUMMARY: NMFS implements accountability measures (AMs... not occur in the fishery, including measures to ensure accountability. On July 3, 2008, NMFS issued a...

  2. 77 FR 12574 - Schedules for Atlantic Shark Identification Workshops and Protected Species Safe Handling... (United States)


    ... National Oceanic and Atmospheric Administration RIN 0648-XB037 Schedules for Atlantic Shark Identification... of public workshops. SUMMARY: Free Atlantic Shark Identification Workshops and Protected Species Safe... fishermen and shark dealers are required to attend a workshop to meet regulatory requirements and maintain...

  3. 77 FR 33444 - Marine Mammals; File No. 17217 (United States)


    ... National Oceanic and Atmospheric Administration RIN 0648-XB159 Marine Mammals; File No. 17217 AGENCY... Mammal Protection Act of 1972, as amended (16 U.S.C. 1361 et seq.) and the regulations governing the taking and importing of marine mammals (50 CFR part 216). In compliance with the National Environmental...

  4. 77 FR 14352 - Marine Mammals (United States)


    ... National Oceanic and Atmospheric Administration RIN 0648-XB065 Marine Mammals AGENCY: National Marine... permit has been issued under the authority of the Marine Mammal Protection Act of 1972, as amended (16 U.S.C. 1361 et seq.), the regulations governing the taking and importing of marine mammals (50 CFR...

  5. Mapping QTLs for Fertility Restoration of Different Cytoplasmic Male Sterility Types in Rice Using Two Oryza sativa ×O. rufipogon Backcross Inbred Line Populations. (United States)

    Hu, Biao-Lin; Xie, Jian-Kun; Wan, Yong; Zhang, Jin-Wei; Zhang, Fan-Tao; Li, Xia


    Hybrid rice breeding using cytoplasmic male sterility/fertility restoration (CMS/Rf) systems plays an important role in ensuring global food security. Two backcross inbred line (BIL) populations derived from either Xieqingzao B (XB)//XB/Dongxiang wild rice (DWR) (XXD) or XB//DWR/XB (XDX) were used to detect quantitative trait loci (QTLs) for fertility restoration of Dwarf wild abortive- (DA-), Indonesia Paddy- (ID-), and DWR-type CMS in rice. Lines with ID- and DA-type CMS were testcrossed with both the XXD- and XDX-BILs, while the line with DWR-type CMS was testcrossed with the XDX-BILs only. A total of 16 QTLs for fertility restoration of CMS systems were identified, including three for DWR-type CMS, six for DA-type CMS, and seven for ID-type CMS. All of the additive alleles in the QTLs were derived from Oryza rufipogon. Eleven QTLs were clustered in five chromosomal regions, indicating that common Rf loci restored different CMS systems, and the favorable O. rufipogon alleles could be used to develop restorer lines for various CMS types by marker-assisted selection.

  6. Magnetic surface anisotropy of amorphous Fe-B ultrathin films (United States)

    Zhang, L.; Rado, G. T.; Liou, S. H.; Chien, C. L.


    The magnetic surface anisotropy constants KS of amorphous Fe xB 100- x was determined by performing ferromagnetic resonance (FMR) measurements on ultrathin films and adapting a recent FMR theory to amorphous materials. For a given Fe content x the same value of KS is obtained at two frequencies and two FMR configurations.

  7. 77 FR 25408 - International Whaling Commission; 64th Annual Meeting; Announcement of Public Meetings (United States)


    ... annual International Whaling Commission (IWC) meeting. DATES: The public meeting will be held June 5... National Oceanic and Atmospheric Administration RIN 0648-XB150 International Whaling Commission; 64th Annual Meeting; Announcement of Public Meetings AGENCY: National Marine Fisheries Service (NMFS...

  8. QTL Information Table: 492 [Q-TARO

    Lifescience Database Archive (English)

    Full Text Available qSB-9 Resistance or Tolerance Sheath blight resistance Sheath blight response ratin...L., Pan, X.B., Chen, X.L., and Zhang, Q.F. (2002). Mapping QTLs for horizontal resistance to sheath blight in an elite rice restorer line, Minghui 63. Yi Chuan Xue Bao 29, 622-626. ...

  9. ORF Alignment: NC_003047 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_003047 gi|15966073 >1a9xB 3 377 13 393 e-119 ... emb|CAC46899.1| PROBABLE CARBAMOY...L-PHOSPHATE SYNTHETASE, GLUTAMINE-HYDROLYZING ... PROTEIN [Sinorhizobium meliloti] ref|NP_386426.1| ... PROBABLE CARBAM...eliloti ... 1021] sp|Q92N95|CARA_RHIME Carbamoyl-phosphate synthase ... small chain (Carbam

  10. ORF Alignment: NC_003295 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available NC_003295 gi|17546238 >1a9xB 3 378 7 378 e-131 ... emb|CAD15221.1| PROBABLE CARBAMOYL...-PHOSPHATE SYNTHASE (SMALL CHAIN) PROTEIN ... [Ralstonia solanacearum] ref|NP_519640.1| PROBABLE ... CARBAM...Z85|CARA_RALSO ... Carbamoyl-phosphate synthase small chain ... (Carbam

  11. Spectra polarimetry of the motional Stark effect at TEXTOR-94

    NARCIS (Netherlands)

    R. Jaspers,; Elzendoorn, B. S. Q.; Donne, A. J. H.; Soetens, T.


    The Balmer-alpha light emitted by neutral particles injected into tokamaks is polarized with respect to the Lorentz electric field experienced by these atoms: E-l = nu xB, known as the motional Stark effect (MSE). On TEXTOR-94 a new MSE system is under development which exploits the full spectral

  12. 77 FR 22678 - Fisheries of the Northeastern United States; Atlantic Mackerel, Squid, and Butterfish Fisheries... (United States)


    ... National Oceanic and Atmospheric Administration 50 CFR Part 648 RIN 0648- XB145 Fisheries of the Northeastern United States; Atlantic Mackerel, Squid, and Butterfish Fisheries; Closure of the Trimester 1 Longfin Squid Fishery AGENCY: National Marine Fisheries Service (NMFS), National Oceanic and Atmospheric...

  13. Morphology and mycelial growth rate of Pleurotus spp. strains from the Mexican mixtec region

    Directory of Open Access Journals (Sweden)

    P.C. Guadarrama-Mendoza


    Full Text Available Two native Pleurotus spp. strains (white LB-050 and pale pink LB-051 were isolated from rotten tree trunks of cazahuate (Ipomoea murucoides from the Mexican Mixtec Region. Both strains were chemically dedikaryotized to obtain their symmetrical monokaryotic components (neohaplonts. This was achieved employing homogenization time periods from 60 to 65 s, and 3 day incubation at 28 °C in a peptone-glucose solution (PGS. Pairing of compatible neohaplonts resulted in 56 hybrid strains which were classified into the four following hybrid types: (R1-n xB1-n, R1-n xB2-1, R2-n xB1-n and R2-n xB2-1. The mycelial growth of Pleurotus spp. monokaryotic and dikaryotic strains showed differences in texture (cottony or floccose, growth (scarce, regular or abundant, density (high, regular or low, and pigmentation (off-white, white or pale pink. To determine the rate and the amount of mycelium growth in malt extract agar at 28 °C, the diameter of the colony was measured every 24 h until the Petri dish was completely colonized. A linear model had the best fit to the mycelial growth kinetics. A direct relationship between mycelial morphology and growth rate was observed. Cottony mycelium presented significantly higher growth rates (p < 0.01 in comparison with floccose mycelium. Thus, mycelial morphology can be used as criterion to select which pairs must be used for optimizing compatible-mating studies. Hybrids resulting from cottony neohaplonts maintained the characteristically high growth rates of their parental strains with the hybrid R1-n xB1-n being faster than the latter.

  14. Mixed-mode synchronization between two inhibitory neurons with post-inhibitory rebound (United States)

    Nagornov, Roman; Osipov, Grigory; Komarov, Maxim; Pikovsky, Arkady; Shilnikov, Andrey


    We study an array of activity rhythms generated by a half-center oscillator (HCO), represented by a pair of reciprocally coupled neurons with post-inhibitory rebounds (PIR). Such coupling-induced bursting possesses two time scales, one for fast spiking and another for slow quiescent periods, is shown to exhibit an array of synchronization properties. We discuss several HCO configurations constituted by two endogenous bursters, by tonic-spiking and quiescent neurons, as well as mixed-mode configurations composed of neurons of different type. We demonstrate that burst synchronization can be accompanied by complex, often chaotic, interactions of fast spikes within synchronized bursts.

  15. Beasts in Lambda-CDM zoo (United States)

    Dolgov, A. D.


    Recent astronomical discoveries of supermassive black holes (quasars), gamma-bursters, super-novae, and dust at high redshifts, z = (5-10), are reviewed. Such a dense population of the early universe is at odds with the conventional mechanisms of its possible origin. Similar data from the contemporary universe, which are also in conflict with natural expectations, are considered too. Two possible mechanisms are suggested, at least one of which can potentially solve all these problems. As a by-product of the last model, an abundant cosmological antimatter may be created.

  16. Phase Multistability in Coupled Oscillator Systems

    DEFF Research Database (Denmark)

    Mosekilde, Erik; Postnov, D.E.; Sosnovtseva, Olga


    The phenomenon of phase multistability arises in connection with the synchronization of coupled oscillator systems when the systems individually display complex wave forms associated, for instance, with the presence of subharmonic components or with significant variations of the phase velocity...... along the orbit of the individual oscillator. Focusing on the mechanisms underlying the appearance of phase multistability, the paper examines a variety of phase-locked patterns. In particular we demonstrate the nested structure of synchronization regions for oscillations with multicrest wave forms...... and investigate how the number of spikes per train and the proximity of a neighboring equilibrium point can influence the formation of coexisting regimes in coupled bursters....

  17. INTEGRAL monitoring of unusually long X-ray bursts

    DEFF Research Database (Denmark)

    Chenevez, Jérôme; Falanga, M.; Kuulkers, E.


    X-ray bursts are thermonuclear explosions on the surface of accreting neutron stars in X-ray binaries. As most of the known X-ray bursters are frequently observed by INTEGRAL, an international collaboration have been taking advantage of its instrumentation to specifically monitor the occurrence...... of exceptional burst events lasting more than ~10 minutes. Half of the dozen so-called intermediate long bursts registered so far have been observed by INTEGRAL. The goal is to derive a comprehensive picture of the relationship between the nuclear ignition processes and the accretion states of the system leading...

  18. First superburst observed by INTEGRAL/JEM-X

    DEFF Research Database (Denmark)

    Chenevez, Jérôme

    X-ray bursters are neutron stars in low mass X-ray binaries where hydrogen and/or helium accretes on the surface, and explodes in recurrent thermonuclear runaways. Such type I X-ray bursts, characterized by a black-body emission, generally display a fast rise time followed by an exponential cooling...... carbon shell flashes in the layers below the surface of the neutron star, while the intermediately long bursts are generally explained by the unstable burning of a thick atmospheric layer of pure helium. On February 13, 2011, the Danish-built X-ray monitor JEM-X onboard the INTEGRAL satellite observed...

  19. Half-life determination of T{sub z} = -1 and T{sub z} = -(1)/(2) proton-rich nuclei and the β decay of {sup 58}Zn

    Energy Technology Data Exchange (ETDEWEB)

    Kucuk, L.; Oktem, Y.; Cakirli, R.B.; Ganioglu, E.; Susoy, G. [Istanbul University, Department of Physics, Istanbul (Turkey); Orrigo, S.E.A.; Montaner-Piza, A.; Rubio, B. [CSIC-Universidad de Valencia, Instituto de Fisica Corpuscular, Valencia (Spain); Fujita, Y. [Osaka University, Department of Physics, Toyonaka, Osaka (Japan); Osaka University, Research Center for Nuclear Physics, Ibaraki, Osaka (Japan); Gelletly, W. [CSIC-Universidad de Valencia, Instituto de Fisica Corpuscular, Valencia (Spain); University of Surrey, Department of Physics, Guildford, Surrey (United Kingdom); Blank, B.; Ascher, P.; Giovinazzo, J.; Grevy, S. [Centre d' Etudes Nucleaires de Bordeaux Gradignan, CNRS/IN2P3 - Universite de Bordeaux, Gradignan (France); Adachi, T.; Fujita, H.; Tamii, A. [Osaka University, Research Center for Nuclear Physics, Ibaraki, Osaka (Japan); Algora, A. [CSIC-Universidad de Valencia, Instituto de Fisica Corpuscular, Valencia (Spain); Inst. of Nuclear Research of the Hung. Acad. of Sciences, Debrecen (Hungary); France, G. de; Oliveira Santos, F. de; Thomas, J.C. [Grand Accelerateur National d' Ions Lourds (GANIL), CEA/DRF-CNRS/IN2P3, Caen (France); Marques, F.M. [Laboratoire de Physique Corpusculaire de Caen, ENSICAEN, UNICAEN, IN2P3/CNRS, Caen (France); Molina, F. [CSIC-Universidad de Valencia, Instituto de Fisica Corpuscular, Valencia (Spain); Comision Chilena de Energia Nuclear, Casilla 188-D, Santiago (Chile); Perrot, L. [IPN Orsay, Orsay (France); Raabe, R. [Grand Accelerateur National d' Ions Lourds (GANIL), CEA/DRF-CNRS/IN2P3, Caen (France); KU Leuven, Instituut voor Kern- en Stralingsfysica, Leuven (Belgium); Srivastava, P.C. [Grand Accelerateur National d' Ions Lourds (GANIL), CEA/DRF-CNRS/IN2P3, Caen (France); Indian Institute of Technology, Department of Physics, Roorkee (India)


    We have measured the β-decay half-lives of 16 neutron-deficient nuclei with T{sub z} = -1/2 and -1, ranging from chromium to germanium. They were produced in an experiment carried out at GANIL and optimized for the production of {sup 58}Zn, for which in addition we present the decay scheme and absolute Fermi and Gamow-Teller transition strengths. Since all of these nuclei lie on the rp-process pathway, the T{sub 1/2} values are important ingredients for the rp-process reaction flow calculations and for models of X-ray bursters. (orig.)

  20. Exploding superstars understanding supernovae and gamma-ray bursts

    CERN Document Server

    Mazure, Alain


    The exceptional cosmic history and the fabulous destinies of exploding stars – supernovae and gamma-ray bursters – are highly fertile areas of research and are also very special tools to further our understanding of the universe. In this book, cosmologists Dr Alain Mazure and Dr Stéphane Basa throw light on the assemblage of facts, hypotheses and cosmological conclusions and show how these ‘beacons’ illuminate their immediate surroundings and allow us to study the vast cosmos, like searchlights revealing the matter comprising our universe.

  1. New Eyes on the Universe Twelve Cosmic Mysteries and the Tools We Need to Solve Them

    CERN Document Server

    Webb, Stephen


    "New Eyes on the Universe -- Twelve Cosmic Mysteries and the Tools We Need to Solve Them" gives an up-to-date broad overview of some of the key issues in modern astronomy and cosmology. It describes the vast amount of observational data that the new generation of observatories and telescopes are currently producing, and how that data might solve some of the outstanding puzzles inherent in our emerging world view. Included are questions such as: What is causing the Universe to blow itself apart? What could be powering the luminous gamma-ray bursters? Where is all the matter in the Uni

  2. Are Gravitational Waves Spinning Down PSR J1023+0038? (United States)

    Haskell, B; Patruno, A


    The pulsar J1023+0038 rotates with a frequency ν≈592  Hz and has been observed to transition between a radio state, during which it is visible as a millisecond radio pulsar, and a low-mass x-ray binary (LMXB) state, during which accretion powered x-ray pulsations are visible. Timing during the two phases reveals that during the LMXB phase the neutron star is spinning down at a rate of ν[over ˙]≈-3×10^{-15}  Hz/s, which is approximately 27% faster than the rate measured during the radio phase, ν[over ˙]≈-2.4×10^{-15}  Hz/s, and is at odds with the predictions of accretion models. We suggest that the increase in spin-down rate is compatible with gravitational wave emission, particularly with the creation of a "mountain" during the accretion phase. We show that asymmetries in pycnonuclear reaction rates in the crust can lead to a large enough mass quadrupole to explain the observed spin-down rate, which thus far has no other self-consistent explanation. We also suggest two observational tests of this scenario, involving radio timing at the onset of the next millisecond radio pulsar phase, when the mountain should dissipate, and accurate timing during the next LMXB phase to track the increase in torque as the mountain builds up. Another possibility is that an unstable r mode with an amplitude α≈5×10^{-8} may be present in the system.

  3. The Evolution of Normal Galaxy X-Ray Emission Through Cosmic History: Constraints from the 6 MS Chandra Deep Field-South (United States)

    Lehmer, B. D.; Basu-Zych, A. R.; Mineo, S.; Brandt, W. N.; Eurfrasio, R. T.; Fragos, T.; Hornschemeier, A. E.; Lou, B.; Xue, Y. Q.; Bauer, F. E.; hide


    We present measurements of the evolution of normal-galaxy X-ray emission from z (is) approx. 0-7 using local galaxies and galaxy samples in the approx. 6 Ms Chandra Deep Field-South (CDF-S) survey. The majority of the CDF-S galaxies are observed at rest-frame energies above 2 keV, where the emission is expected to be dominated by X-ray binary (XRB) populations; however, hot gas is expected to provide small contributions to the observed-frame (is) less than 1 keV emission at z (is) less than 1. We show that a single scaling relation between X-ray luminosity (L(sub x)) and star-formation rate (SFR) literature, is insufficient for characterizing the average X-ray emission at all redshifts. We establish that scaling relations involving not only SFR, but also stellar mass and redshift, provide significantly improved characterizations of the average X-ray emission from normal galaxy populations at z (is) approx. 0-7. We further provide the first empirical constraints on the redshift evolution of X-ray emission from both low-mass XRB (LMXB) and high-mass XRB (HMXB) populations and their scalings with stellar mass and SFR, respectively. We find L2 -10 keV(LMXB)/stellar mass alpha (1+z)(sub 2-3) and L2 -10 keV(HMXB)/SFR alpha (1+z), and show that these relations are consistent with XRB population-synthesis model predictions, which attribute the increase in LMXB and HMXB scaling relations with redshift as being due to declining host galaxy stellar ages and metallicities, respectively. We discuss how emission from XRBs could provide an important source of heating to the intergalactic medium in the early universe, exceeding that of active galactic nuclei.

  4. The X-Ray Luminosity Functions of Field Low-Mass X-Ray Binaries in Early-Type Galaxies: Evidence for a Stellar Age Dependence (United States)

    Lehmer, B. D.; Berkeley, M.; Zezas, A.; Alexander, D. M.; Basu-Zych, A.; Bauer, F. E.; Brandt, W. N.; Fragos, T.; Hornschemeier, A. E.; Kalogera, V.; hide


    We present direct constraints on how the formation of low-mass X-ray binary (LMXB) populations in galactic fields depends on stellar age. In this pilot study, we utilize Chandra and Hubble Space Telescope (HST) data to detect and characterize the X-ray point source populations of three nearby early-type galaxies: NGC 3115, 3379, and 3384. The luminosity-weighted stellar ages of our sample span approximately equal to 3-10 Gyr. X-ray binary population synthesis models predict that the field LMXBs associated with younger stellar populations should be more numerous and luminous per unit stellar mass than older populations due to the evolution of LMXB donor star masses. Crucially, the combination of deep Chandra and HST observations allows us to test directly this prediction by identifying and removing counterparts to X-ray point sources that are unrelated to the field LMXB populations, including LMXBs that are formed dynamically in globular clusters, Galactic stars, and background AGN/galaxies. We find that the "young" early-type galaxy NGC 3384 (approximately equals 2-5 Gyr) has an excess of luminous field LMXBs (L(sub x) approximately greater than (5-10) × 10(exp 37) erg s(exp -1)) per unit K-band luminosity (L(sub K); a proxy for stellar mass) than the "old" early-type galaxies NGC 3115 and 3379 (approximately equals 8-10 Gyr), which results in a factor of 2-3 excess of L(sub X)/L(sub K) for NGC 3384. This result is consistent with the X-ray binary population synthesis model predictions; however, our small galaxy sample size does not allow us to draw definitive conclusions on the evolution field LMXBs in general. We discuss how future surveys of larger galaxy samples that combine deep Chandra and HST data could provide a powerful new benchmark for calibrating X-ray binary population synthesis models.

  5. Spectral-Timing Analysis of Kilohetrz Quasi-Periodic Osciallations in Neutron Star Low-Mass X-ray Binaries (United States)

    Cackett, Edward; Troyer, Jon; Peille, Philippe; Barret, Didier


    Kilohertz quasi-periodic oscillations or kHz QPOs are intensity variations that occur in the X-ray band observed in neutron star low-mass X-ray binary (LMXB) systems. In such systems, matter is transferred from a secondary low-mass star to a neutron star via the process of accretion. kHz QPOs occur on the timescale of the inner accretion flow and may carry signatures of the physics of strong gravity (c2 ~ GM/R) and possibly clues to constraining the neutron star equation of state (EOS). Both the timing behavior of kHz QPOs and the time-averaged spectra of these systems have been studied extensively. No model derived from these techniques has been able to illuminate the origin of kHz QPOs. Spectral-timing is an analysis technique that can be used to derive information about the nature of physical processes occurring within the accretion flow on the timescale of the kHz QPO. To date, kHz QPOs of (4) neutron star LMXB systems have been studied with spectral-timing techniques. We present a comprehensive study of spectral-timing products of kHz QPOs from systems where data is available in the RXTE archive to demonstrate the promise of this technique to gain insights regarding the origin of kHz QPOs. Using data averaged over the entire RXTE archive, we show correlated time-lags as a function of QPO frequency and energy, as well as energy-dependent covariance spectra for the various LMXB systems where spectral-timing analysis is possible. We find similar trends in all average spectral-timing products for the objects studied. This suggests a common origin of kHz QPOs.

  6. Fast X-ray transient, IGR J17464-2811 detected with INTEGRAL

    DEFF Research Database (Denmark)

    Brandt, Søren; Budtz-Jørgensen, Carl; Chenevez, Jérôme


    A fast X-ray transient, possibly a Type-I X-ray burster has been discovered in public INTEGRAL data. The burst occurred at 07:55:33 (UTC) on March 22, 2005, and was detected in the JEM-X X-ray monitor. The position of the source, designated IGR J17464-2811, was determined in the 3-30 keV energy...... interval to be RA = 266.810 deg, DEC = -28.185 (J2000), with a 90% error radius of 1 arcmin. In the 3-8 keV band the burst showed a fast rise and an exponential decay with a time constant of about 70 seconds. In the 8-30 keV band the burst showed a gradual rise over 25 seconds followed by an exponential...... decay with a time constant of about 30 seconds, indicating a spectral softening characteristic of Type-I X-ray bursters. The burst reached a peak flux of 1.0 Crab in the JEM-X 3-30 keV band. The outburst was also clearly detected and localized with ISGRI up to 30 keV. 10 weak sources are found within...

  7. Gloria, Op.18 ("Et in Arcadia ego: An Apotheosis")\\ud (from 'Missa Temporis Perditi')


    Little, Jonathan D.


    For a cappella SATB Double Choir, with 2 x SA Soloists (completed November 2016):\\ud 1. SATB Choir 1: 2xS, 2xA, 2xT, 2xB (8) = min.2 voices per line for divisi (SSAATTBB)* (stage left side) +\\ud 2. SATB Choir 2: 2xS, 2xA, 2xT, 2xB (8) = min.2 voices per line for divisi (SSAATTBB)* (stage right side) +\\ud 3. Gallery/Distant Soloists 1: 1xS + 1xA (2) (SA) (at a distance or in a gallery, and set antiphonally to:)\\ud 4. Gallery/Distant Soloists 2: 1xS + 1xA (2) (SA) (at a distance or in a gallery...

  8. The strength of the R - T exchange coupling in R sub 2 Fe sub 14 B compounds; an approach based on high-field magnetization measurements

    Energy Technology Data Exchange (ETDEWEB)

    Verhoef, R.; Quang, P.H.; Franse, J.J.M.; Radwanski, R.J. (Natuurkundig Laboratorium der Universiteit van Amsterdam, Valckenierstraat 65, 1018 XE Amsterdam, The Netherlands (NL))


    By performing high-field magnetization measurements on Gd{sub 2}Fe{sub 14{minus}{ital x}}Mn{sub {ital x}}B and Tb{sub 2}Fe{sub 14{minus}{ital x}}Mn{sub {ital x}}B powdered samples that are oriented in the sample holder by the applied field it is possible to improve the accuracy of earlier reported values for the {ital R}-{ital T} exchange-coupling constant of these R{sub 2}Fe{sub 14}B compounds. In addition, the two-sublattice model that has been applied previously has been extended to a three-sublattice model with two magnetic rare-earth sublattices for the Er and Tm compounds in an attempt to describe the experimentally observed low-field susceptibility. It turns out however, that mainly the iron-manganese sublattice is responsible for this susceptibility.

  9. The Real and Complex Hermitian Solutions to a System of Quaternion Matrix Equations with Applications

    Directory of Open Access Journals (Sweden)

    Shao-Wen Yu


    Full Text Available We establish necessary and sufficient conditions for the existence of and the expressions for the general real and complex Hermitian solutions to the classical system of quaternion matrix equations A1X=C1,XB1=C2, and  A3XA3*=C3. Moreover, formulas of the maximal and minimal ranks of four real matrices X1,X2,X3, and X4 in solution X=X1+X2i+X3j+X4k to the system mentioned above are derived. As applications, we give necessary and sufficient conditions for the quaternion matrix equations A1X=C1,XB1=C2,A3XA3*=C3, and  A4XA4*=C4 to have real and complex Hermitian solutions.

  10. Strong and Selective Halide Anion Binding by Neutral Halogen-Bonding [2]Rotaxanes in Wet Organic Solvents. (United States)

    Lim, Jason Y C; Bunchuay, Thanthapatra; Beer, Paul D


    The design and construction of neutral interlocked host molecules for anion recognition are rare. Using an active-metal template approach, the preparation of a family of neutral halogen bonding (XB) rotaxanes containing two, three and four iodotriazole groups integrated into the macrocycle and axle components is achieved. In spite of the interlocked hosts' neutrality, such rotaxane systems are capable of binding halide anions strongly and selectively in wet organic solvent mixtures. Importantly, halide-binding strength and selectivity can be modulated by varying the number and position of the halogen bond donor iodotriazole groups within the interlocked cavity; the rotaxane containing the largest number of halogen bond donor groups exhibits the highest halide anion-binding affinities. By varying the percentage of water content in the solvent, neutral XB donor-mediated anion-binding strength is also demonstrated to be highly sensitive to solvent polarity. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Measurement of the transverse target-spin asymmetry associated with deeply virtual Compton scattering on the proton

    CERN Document Server

    Ye, Z


    Measurements of deeply virtual Compton scattering (DVCS) made at HERMES using 27.6 GeV $e^\\pm$ beams and various internal polarized or unpolarized gaseous targets are discussed. Results are reported on the transverse target-spin asymmetry (TTSA) associated with DVCS, extracted from data accumulated in 2002-2004 with the $e^+$ beam on a transversely polarized hydrogen target. TTSA amplitudes leading in twist and $\\alpha_S$ are given as a function of $-t$, $x_B$ and $Q^2$ in the kinematic range $|t|<0.7$ GeV$^2$, $0.03<x_B<0.35$ and $1

  12. Working with the ineffable: Toward a process of understanding and communicating qualitative research knowledge and experience through design

    DEFF Research Database (Denmark)

    Coxon, Ian Robert


    The work described in this paper addresses the conference call for "New processes, tools or approaches that facilitate knowledge exchange and collaboration" between academia and creative people. It introduces a research-for-design program that we at the Experience-based Designing Centre in Denmark...... have been working on and with for the past year. It will present a program of teaching, research and industry collaboration that is essentially a knowledge gathering and information exchange program that is in itself a work-in-progress. We refer to this work as the four pillars of Experience......-based Designing (XbD). The discussion will centre on XbD as we currently practice it with a view to exploring new opportunities for improvement within the whole Experience-based Designing process. The four pillars involving Exploring, Understanding, Sharing and Showing How are staging points for the input of new...

  13. A flavor dependent gauge symmetry, predictive radiative seesaw and LHCb anomalies

    Directory of Open Access Journals (Sweden)

    P. Ko


    Full Text Available We propose a predictive radiative seesaw model at one-loop level with a flavor dependent gauge symmetry U(1xB3−xe−μ+τ and Majorana fermion dark matter. For the neutrino mass matrix, we obtain an A1 type texture (with two zeros that provides us several predictions such as the normal ordering for the neutrino masses. We analyze the constraints from lepton flavor violations, relic density of dark matter, and collider physics for the new U(1xB3−xe−μ+τ gauge boson. Within the allowed region, the LHCb anomalies in B→K⁎μ+μ− and B→Kℓ+ℓ− with ℓ=e or μ can be resolved, and such Z′ could be also observed at the LHC.

  14. Nature of the guest-host interactions for dibromine in the T, P, and H clathrate cages (United States)

    Batista-Romero, Fidel A.; Pajón-Suárez, Pedro; Roncero, Octavio; Hernández-Lamoneda, Ramón


    The guest-host intermolecular potentials for the ground states of Br2 in the tetrakaidecahedral (T), pentakaidecahedral (P), and hexakaidecahedral clathrate (H) cages have been calculated using ab initio local correlation methods. Applying the local correlation energy partitioning analysis together with first-order symmetry adapted perturbation theory, we obtain a detailed understanding of the nature of the interactions. In particular, the debated question concerning the possible presence of halogen bonding (XB) is carefully analyzed. In the case of the T cage, given its smaller size, the Br-O distance is too short leading to a larger exchange-repulsion for XB orientations which therefore do not represent minima. For the other two cages, the Br-O distance is too large leading to little orbital overlap effects and thus weaker donor-acceptor interactions; however, these orientations coincide with the global minima.

  15. Re4As6S3, a thio-spinel-related cluster system

    DEFF Research Database (Denmark)

    Besnard, Celine; Svensson, Christer; Ståhl, Kenny


    . The rhenium atoms form tetrahedral clusters linked via tetrahedral arsenic clusters to produce an NaCl-type arrangement. The oxidation state of rhenium is IV and the number of electrons shared by the rhenium atoms in the cluster is 12. The structure is based on an ordered defect thio-spinel A((1-x))B(2)X(4......) where the B-type atoms form tetrahedral clusters....

  16. Delivering More Than Bombs: The Utility of Long-Range Strike Platforms (United States)


    naval forces approaching the shores and fly from the west coast to defend Hawaii and Alaska, the XB- 17 gained favor when it surpassed the 2,000-mile...mission, they provided continuous 24-hour airborne nuclear alert as aircraft carrying nuclear weapons flew Chrome Dome missions over the Arctic...Headquarters, United States Air Force, Mar 2011), 2. 2 Stephen Peter Rosen, Winning the Next War: Innovation and the Modern Military (Cornell Studies in

  17. Development and Production of Array Barrier Detectors at SCD (United States)

    Klipstein, P. C.; Avnon, E.; Benny, Y.; Berkowicz, E.; Cohen, Y.; Dobromislin, R.; Fraenkel, R.; Gershon, G.; Glozman, A.; Hojman, E.; Ilan, E.; Karni, Y.; Klin, O.; Kodriano, Y.; Krasovitsky, L.; Langof, L.; Lukomsky, I.; Nevo, I.; Nitzani, M.; Pivnik, I.; Rappaport, N.; Rosenberg, O.; Shtrichman, I.; Shkedy, L.; Snapi, N.; Talmor, R.; Tessler, R.; Weiss, E.; Tuito, A.


    XB n or XB p barrier detectors exhibit diffusion-limited dark currents comparable with mercury cadmium telluride Rule-07 and high quantum efficiencies. In 2011, SemiConductor Devices (SCD) introduced "HOT Pelican D", a 640 × 512/15- μm pitch InAsSb/AlSbAs XB n mid-wave infrared (MWIR) detector with a 4.2- μm cut-off and an operating temperature of ˜150 K. Its low power (˜3 W), high pixel operability (>99.5%) and long mean time to failure make HOT Pelican D a highly reliable integrated detector-cooler product with a low size, weight and power. More recently, "HOT Hercules" was launched with a 1280 × 1024/15- μm format and similar advantages. A 3-megapixel, 10- μm pitch version ("HOT Blackbird") is currently completing development. For long-wave infrared applications, SCD's 640 × 512/15- μm pitch "Pelican-D LW" XB p type II superlattice (T2SL) detector has a ˜9.3- μm cut-off wavelength. The detector contains InAs/GaSb and InAs/AlSb T2SLs, and is fabricated into focal plane array (FPA) detectors using standard production processes including hybridization to a digital silicon read-out integrated circuit (ROIC), glue underfill and substrate thinning. The ROIC has been designed so that the complete detector closely follows the interfaces of SCD's MWIR Pelican-D detector family. The Pelican-D LW FPA has a quantum efficiency of ˜50%, and operates at 77 K with a pixel operability of >99% and noise equivalent temperature difference of 13 mK at 30 Hz and F/2.7.

  18. Ocean Remote Sensing Using Ambient Noise (United States)


    1 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. Ocean Remote Sensing Using Ambient Noise Michael G...approximation to the transient Green’s function G(xA|xB, t) between locations xA and xB is estimated by cross-correlating records of ambient noise...Williams, N. A. Zabotin, L. Zabotina and G. J. Banker, 2014, Acoustic Green’s function extraction from ambient noise in a coastal ocean environment

  19. Page 1 Intensity of diffuse streaks 501 measure the point intensities ...

    Indian Academy of Sciences (India)

    y; = –Č(cos basin on 4-sin be coso a cos XB)+cos(ps sin Xp z; = &sin (bs sin Xp+! cos Xs - (4). Let u and v be the horizontal and vertical divergences in the incident beam, then the coordinates of the centers C and C1 (the middle and one extremity of the continuous range of Ewald spheres) can be written as 1/2, 0, 0 and 1/2 ...

  20. Mineral Separation in a CELSS by Ion-exchange Chromatography (United States)

    Ballou, E. V.; Spitze, L. A.; Wong, F. W.; Wydeven, T.; Johnson, C. C.


    Operational parameters pertinent to ion exchange chromatography separation were identified. The experiments were performed with 9 mm diameter ion exchange columns and conventional column accessories. The cation separation beds were packed with AG 50W-X2 strong acid cation exchange resin in H(+) form and 200-400 dry mesh particle size. The stripper beds used in some experiments were packed with AG 1-XB strong base cation exchange resin in OH(-) form and 200-400 dry mesh particle size.

  1. High field magnetization process in Er sub 2 (Fe, Al) sub 14 B

    Energy Technology Data Exchange (ETDEWEB)

    Kohashi, T.; Kindo, K.; Date, M. (Dept. of Physics, Osaka Univ. (Japan)); Boer, F.R. de; Radwanski, R.J.; Zhong, X.P. (Natuurkundig Lab., Univ. Amsterdam (Netherlands)); Yamagishi, A. (Research Center for Extreme Materials, Osaka Univ. (Japan))


    A magnetization study in pulsed high magnetic fields up to 50 T has been performed on magnetically aligned powder samples of ferrimagnetic Er{sub 2}Fe{sub 14-x}Al{sub x}B (x = 0, 1, 2) compounds and field-induced transitions have been observed. Free-energy calculations with one Fe and four Er sublattices have been performed and the field-induced transitions can satisfactorily be explained. (orig.).

  2. Analysis list: Hoxb4 [Chip-atlas[Archive

    Lifescience Database Archive (English)

    Full Text Available Hoxb4 Pluripotent stem cell + mm9

  3. GenBank blastx search result: AK111921 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK111921 001-013-A10 U35369.1 Enterococcus faecalis vancomycin resistance genes, response regulator (van...RB), protein histidine kinase (vanSB), D,D-carboxypeptidase (vanYB), putative D-2-hydroxyacid dehydrogenase (van...HB), D-Ala:D-Lac ligase (vanB), and putative D,D-dipeptidase (vanXB) genes, complete cds.|BCT BCT 7e-11 +1 ...

  4. Evolution of gluon TMDs from small to moderate x

    Energy Technology Data Exchange (ETDEWEB)

    Tarasov, Andrey [Thomas Jefferson National Accelerator Facility (TJNAF), Newport News, VA (United States)


    Recently we obtained an evolution equation of gluon TMDs, which addresses a problem of unification of different kinematic regimes. It describes evolution in the whole range of Bjorken $x_B$ and the whole range of transverse momentum $k_\\perp$. In this notes I study different limits of this evolution equation and show how it yields several well-known and some previously unknown results.

  5. 12038_2015_9572_Article_Supplementary 1..4

    Indian Academy of Sciences (India)

    Supplementary figure 1. Gel confirmation pictures of the final 12 clones named p44F, p44R, p47F, p47R, p47FL, p47RL,. p74F, p74R, p77FL, p77RL, p74FL and p74RL. All of them were confirmed by cutting at internal sites with restriction enzymes indicated above each lane (Eg= EagI, Bg =BglII, Xb=XbaI, Xh =XhoI, ...

  6. Federal Logistics Information System (FLIS) Procedures Manual, Volume 1, Change 1 (United States)


    any combination thereof used to I represent a data item. For example. the data codes X KX. and XB represent the data items: Strategic Systems Project...requirements determination. procurement, inspections, quality control, packaging. storage, distribution, disposal. maintenance, mobilization planning ...Se- 2 KAT Add FLIS Data Base Data 1 curity Classified Characteristics KDZ Delete Logistics Transfer 3 Data KFA Match Through Association I KFC File

  7. Federal Logistics Information System (FLIS) Procedures Manual. General and Administrative Information. Volume 1. (United States)


    or any combination thereof used to 1 represent a data item. For example, the data codes JV, KX, and XB represent the data items: Strategic Systems... planning . Encompasses materiel control, inventory control, inventory management, and supply management. Materiel Management Aggregation Code - AF (MMAC...Logistics Transfer 3 Data KFA Match Through Association 1 KFC File Data Minus Security Classi- 1 Note 1: Output DICs other than Search and Inter- fled

  8. Tryptophan-induced pathogenesis of breast cancer

    African Journals Online (AJOL)

    DOI: Cite as: Cao Z-G, Qin X-B, Liu F-F, Zhou L-L. Tryptophan-induced pathogenesis of breast cancer. Afri Health Sci. 2015;15(3):982-5. doi: Introduction. Breast cancer, developing from breast tissue, remains the top reason for death of women.

  9. ORF Alignment: NC_000921 [GENIUS II[Archive

    Lifescience Database Archive (English)

    Full Text Available se small ... chain (Carbamoyl-phosphate synthetase glutamine chain) ... gb|AAD06735.1| CARBAMO... NC_000921 gi|15612223 >1a9xB 6 376 4 375 2e-91 ... ref|NP_223876.1| CARBAMOYL-PHOSPHA...TE SYNTHASE SMALL CHAIN [Helicobacter pylori J99] ... sp|Q9ZJY9|CARA_HELPJ Carbamoyl-phosphate syntha

  10. Measurement of Exclusive $π^0$ Electroproduction Structure Functions and their Relationship to Transverse Generalized Parton Distributions

    Energy Technology Data Exchange (ETDEWEB)

    Bedlinskiy, Ivan; Niccolai, Silvia; Stoler, Paul; Adhikari, Krishna; Aghasyan, Mher; Amaryan, Moskov; Anghinolfi, Marco; Avagyan, Harutyun; Baghdasaryan, Hovhannes; Ball, Jacques; Baltzell, Nathan; Battaglieri, Marco; Bennett, Robert; Biselli, Angela; Bookwalter, Craig; Boyarinov, Sergey; Briscoe, William; Brooks, Williams; Burkert, Volker; Carman, Daniel; Celentano, Andrea; Chandavar, Shloka; Charles, Gabriel; Contalbrigo, Marco; Crede, Volker; D& #x27; Angelo, Annalisa; Daniel, Aji; Dashyan, Natalya; De Vita, Raffaella; De Sanctis, Enzo; Deur, Alexandre; Djalali, Chaden; Doughty, David; Dupre, Raphael; Egiyan, Hovanes; El Alaoui, Ahmed; Elfassi, Lamiaa; Elouadrhiri, Latifa; Eugenio, Paul; Fedotov, Gleb; Fegan, Stuart; Fleming, Jamie; Forest, Tony; Garcon, Michel; Gevorgyan, Nerses; Giovanetti, Kevin; Girod, Francoi-Xavier; Gohn, Wesley; Gothe, Ralf; Graham, Lewis; Griffioen, Keith; Guegan, Baptiste; Guidal, Michel; Guo, Lei; Hafidi, Kawtar; Hakobyan, Hayk; Hanretty, Charles; Heddle, David; Hicks, Kenneth; Holtrop, Maurik; Ilieva, Yordanka; Ireland, David; Ishkhanov, Boris; Isupov, Evgeny; Jo, Hyon-Suk; Joo, Kyungseon; Keller, Dustin; Khanddaker, Mahbubul; Khertarpal, Puneet; Kim, Andrey; Kim, Wooyoung; Klein, Franz; Koirala, Suman; Kubarovsky, A; Kuhn, Sebastian; Kuleshov, Sergey; Kvaltine, Nicholas; Livingston, Kenneth; Lu, Haiyun; MacGregor, Ian; Mao, Yuqing; Markov, Nikolai; Martinez, D; Mayer, Michael; McKinnon, Bryan; Meyer, Curtis; Mineeva, Taisiya; Mirazita, Marco; Mokeev, Viktor; Moutarde, Herve; Munevar Espitia, Edwin; Munoz Camacho, Carlos; Nadel-Turonski, Pawel; Niculescu, Gabriel; Niculescu, Maria-Ioana; Osipenko, Mikhail; Ostrovidov, Alexander; Pappalardo, Luciano; Permuzyan, Rafayel; Park, Kijun; Park, Sungkyun; Pasyuk, Eugene; Pereira, Sergio; Phelps, Evan; Pisano, Silvia; Pogorelko, Oleg; Pozdnyakov, Sergey; Price, John; Procureur, Sebastien; Prok, Yelena; Protopopescu, Dan; Puckett, Andrew; Raue, Brian; Ricco, Giovanni; Rimal, Dipak; Ripani, Marco; Rosner, Guenther; Rossi, Patrizia; Sabatie, Franck; Saini, Mukesh; Salgado, Carlos; Saylor, Nicholas; Schott, Diane; Schumacher, Reinhard; Seder, Erin; Seraydaryan, Heghine; Sharabian, Youri; Smith, Gregory; Sober, Daniel; Sokhan, Daria; Stepanyan, Samuel; Strauch, Steffen; Taiuti, Mauro; Tang, Wei; Taylor, Charles; Tian, Ye; Tkachenko, Svyatoslav; Ungaro, Maurizio; Vineyard, Michael; Vlasov, Alexander; Voskanyan, Hakob; Voutier, Eric; Walford, Natalie; Watts, Daniel; Weinstein, Lawrence; Weygan, Dennis; Wood, Michael; Zachariou, Nicholas; Zhang, Jixie; Zhao, Zhiwen


    Exclusive $\\pi^0$ electroproduction at a beam energy of 5.75 GeV has been measured with the Jefferson Lab CLAS spectrometer. Differential cross sections were measured at more than 1800 kinematic values in $Q^2$, $x_B$, $t$, and $\\phi_\\pi$, in the $Q^2$ range from 1.0 to 4.6 GeV$^2$,\\ $-t$ up to 2 GeV$^2$, and $x_B$ from 0.1 to 0.58. Structure functions $\\sigma_T +\\epsilon \\sigma_L, \\sigma_{TT}$ and $\\sigma_{LT}$ were extracted as functions of $t$ for each of 17 combinations of $Q^2$ and $x_B$. The data were compared directly with two handbag-based calculations including both longitudinal and transversity GPDs. Inclusion of only longitudinal GPDs very strongly underestimates $\\sigma_T +\\epsilon \\sigma_L$ and fails to account for $\\sigma_{TT}$ and $\\sigma_{LT}$, while inclusion of transversity GPDs brings the calculations into substantially better agreement with the data. There is very strong sensitivity to the relative contributions of nucleon helicity flip and helicity non-flip processes. The results confirm that exclusive $\\pi^0$ electroproduction offers direct experimental access to the transversity GPDs.

  11. Structure-Energy Relationships of Halogen Bonds in Proteins. (United States)

    Scholfield, Matthew R; Ford, Melissa Coates; Carlsson, Anna-Carin C; Butta, Hawera; Mehl, Ryan A; Ho, P Shing


    The structures and stabilities of proteins are defined by a series of weak noncovalent electrostatic, van der Waals, and hydrogen bond (HB) interactions. In this study, we have designed and engineered halogen bonds (XBs) site-specifically to study their structure-energy relationship in a model protein, T4 lysozyme. The evidence for XBs is the displacement of the aromatic side chain toward an oxygen acceptor, at distances that are equal to or less than the sums of their respective van der Waals radii, when the hydroxyl substituent of the wild-type tyrosine is replaced by a halogen. In addition, thermal melting studies show that the iodine XB rescues the stabilization energy from an otherwise destabilizing substitution (at an equivalent noninteracting site), indicating that the interaction is also present in solution. Quantum chemical calculations show that the XB complements an HB at this site and that solvent structure must also be considered in trying to design molecular interactions such as XBs into biological systems. A bromine substitution also shows displacement of the side chain, but the distances and geometries do not indicate formation of an XB. Thus, we have dissected the contributions from various noncovalent interactions of halogens introduced into proteins, to drive the application of XBs, particularly in biomolecular design.

  12. Description of Weak Halogen Bonding Using Various Levels of Symmetry-Adapted Perturbation Theory Combined with Effective Core Potentials

    Directory of Open Access Journals (Sweden)

    Piotr Matczak


    Full Text Available The present work starts with providing a description of the halogen bonding (XB interaction between the halogen atom of MH3X (where M = C–Pb and X = I, At and the N atom of HCN. This interaction leads to the formation of stable yet very weakly bound MH3X⋯NCH complexes for which the interaction energy (Eint between MH3X and HCN is calculated using various symmetry-adapted perturbation theory (SAPT methods combined with the def2-QZVPP basis set and midbond functions. This basis set assigns effective core potentials (ECPs not only to the I or At atom directly participating in the XB interaction with HCN but also to the M atom when substituted with Sn or Pb. Twelve SAPT methods (or levels are taken into consideration. According to the SAPT analysis of Eint, the XB interaction in the complexes shows mixed electrostatic-dispersion nature. Next, the accuracy of SAPT Eint is evaluated by comparing with CCSD(T reference data. This comparison reveals that high-order SAPT2+(3 method and the much less computationally demanding SAPT(DFT method perform very well in describing Eint of the complexes. However, the accuracy of these methods decreases dramatically if they are combined with the so-called Hartree-Fock correction.

  13. Ranks of a Constrained Hermitian Matrix Expression with Applications

    Directory of Open Access Journals (Sweden)

    Shao-Wen Yu


    Full Text Available We establish the formulas of the maximal and minimal ranks of the quaternion Hermitian matrix expression C4−A4XA4∗ where X is a Hermitian solution to quaternion matrix equations A1X=C1, XB1=C2, and A3XA3*=C3. As applications, we give a new necessary and sufficient condition for the existence of Hermitian solution to the system of matrix equations A1X=C1, XB1=C2, A3XA3*=C3, and A4XA4*=C4, which was investigated by Wang and Wu, 2010, by rank equalities. In addition, extremal ranks of the generalized Hermitian Schur complement C4−A4A3~A4∗ with respect to a Hermitian g-inverse A3~ of A3, which is a common solution to quaternion matrix equations A1X=C1 and XB1=C2, are also considered.

  14. Cadherin transfection of Xenopus XTC cells downregulates expression of substrate adhesion molecules. (United States)

    Finnemann, S; Kühl, M; Otto, G; Wedlich, D


    Cadherins are discussed not in terms of their adhesive function but rather as morphoregulatory proteins. Changes in gene expression following cadherin transfection of cells in culture or by overexpression in embryos have, until now, not been reported. We established a protocol for stable transfection of Xenopus XTC cells and generated cells bearing high levels of membrane-integrated mouse uvomorulin (E-cadherin) or Xenopus XB-cadherin. These cell lines showed drastically impaired substrate adhesion on fibronectin and laminin. In immunoblot and radioimmunoprecipitation experiments, we found that fibronectin and alpha 3/beta 1 integrin are downregulated. The reduced amounts of proteins result from a decrease of the respective mRNAs as proven by RNase protection assays. Coprecipitations revealed that transfected cadherin molecules are complexed with alpha-catenin and beta-catenin at plasma membranes. However, the alpha-catenin present in the XB-cadherin complex differs immunologically from that found in the uvomorulin complex. When a truncated form of XB-cadherin lacking 38 of the most C-terminal amino acids was expressed in XTC cells, complex formation with endogenous catenins was abolished. In these transfectants, substrate adhesion was not affected. These results prove that complex formation of transfected cadherins in XTC cells with endogenous beta-catenin correlates with altered synthesis of certain substrate adhesion molecules.

  15. Orthogonal hydrogen/halogen bonding in 1-(2-methoxyphenyl)-1H-imidazole-2(3H)-thione-I2 adduct: An experimental and theoretical study (United States)

    El-Sheshtawy, Hamdy S.; Ibrahim, Mohamed M.; El-Mehasseb, Ibrahim; El-Kemary, Maged


    The molecular complex between 1-(2-methoxyphenyl)-1H-imidazole-2(3H)-thione (HmimOMe) and iodine (I2) was investigated. Single crystal of [(HmimOMe)radI2] adduct was grown by slow evaporation technique from chloroform at room temperature. Spectroscopic techniques such as FT-IR and Raman techniques, as well as elemental and thermal analysis were used to characterize the complex. The crystal structure shows that the formed adduct stabilized by two noncovalent interactions, namely, hydrogen bond (HB) and halogen bond (XB). Orthogonal HB/XB associated with iodine atom (I) was observed and fully characterized. The ability of iodine to behave as hydrogen bond acceptor and halogen bond donor was held responsible for the orthogonal HB/XB presence. In addition, the structure of HmimOMeradI2 was investigated theoretically using MP2/aug-cc-pVDZ level of theory. Natural bond orbital analysis (NBO) was used to investigate the molecular orbitals interactions and orbitals stabilization energies.

  16. Shear bond strength evaluation of chemically-cured and light-cured orthodontic adhesives after enamel deproteinization with 5.25% sodium hypochlorite (United States)

    Salim, J. C.; Krisnawati; Purbiati, M.


    This study aimed to assess the effect of enamel deproteinization with 5.25% sodium hypochlorite (NaOCl) before etching on the shear bond strength (SBS) of Unite (UN; 3M Unitek) and Xihu-BIOM adhesive (XB). Fifty-two maxillary first premolars were divided into four groups: (1) UN and (2) XB according to manufacturer’s recommendation and (3) UN and (4) XB deproteinized with 5.25% NaOCl. Brackets were bonded, and a mechanical test was performed using a universal testing machine. The mean SBS value for groups A1, A2, B1, and B2 was 13.51 ± 2.552, 14.36 ± 2.902, 16.43 ± 2.615, and 13.05 ± 2.348 MPa, respectively. A statistically significant difference in SBSs was observed between chemically cured groups and between group B (p light-cured adhesive groups and between group A (p > 0.05). NaOCl enamel deproteinization before acid etching has a significant effect on the SBS of Unite adhesive, but not on that of the Xihu-BIOM adhesive. Furthermore, a significant difference in the SBS of Unite and Xihu-BIOM adhesives within the enamel deproteinization group was observed in this study.

  17. [Juvenile myasthenia gravis in sub-Saharan Africa: a case study of two consanguine sisters born from consanguinity in Togo]. (United States)

    Maneh, Nidain; Apetse, Kossivi; Diatewa, Bénédicte Marèbe; Domingo, Sidik Abou-Bakr; Agba, Aidé Isabelle; Ayena, Koffi Didier; Balogou, Koffi Agnon; Balo, Komi Patrice


    Myasthenia gravis is a rare acquired autoimmune pathology causing neuromuscular transmission impairment. Juvenile onset of myasthenia gravis is often characterized by ocular involvement. We report two cases of ocular juvenile myasthenia gravis (JMG) in two siblings. They were two young girls, XA and XB, aged 11 and 9 years, of Malian origin, residing in Togo, born from first-degree of consanguinity presenting to Ophthalmology due to progressive decrease in visual acuity. XA showed visual acuity 8/10 on both eyes while XB showed improvement in visual acuity from 3/10 to 7/10 using a pinhole occluder, suggesting ametropia. XA had a 2-year history of bilateral ptosis lifting the upper eyelid of 7 mm, while XB had a 3-year history of bilateral ptosis with no lifting of the upper eyelid. Ice pack test was strongly positive in both patients. They had Cogan's lid twitch with paresis of the oculomotor nerve without diplopia. The dosage of acetylcholine receptor autoantibodies was normal. The diagnosis of JMG associated with ametropia was suspected. Ametropia was corrected by glasses and a specific treatment with pyridostigmine was initiated, but both patients were lost to follow-up. Autoimmune myasthenia gravis with inaugural ophthalmologic manifestation is rare but it can occur among children living in sub-Saharan Africa. Studies should be conducted to establish the features of this disease.

  18. Application of a New Method to Study the Spin Equilibrium of Aql X-1: The Possibility of Gravitational Radiation (United States)

    Bhattacharyya, Sudip


    Accretion via disks can make neutron stars in low-mass X-ray binaries (LMXBs) fast spinning, and some of these stars are detected as millisecond pulsars. Here we report a practical way to find out if a neutron star in a transient LMXB has reached the spin equilibrium by disk-magnetosphere interaction alone, and if not, to estimate this spin equilibrium frequency. These can be done using specific measurable source luminosities, such as the luminosity corresponding to the transition between the accretion and propeller phases, and the known stellar spin rate. Such a finding can be useful to test if the spin distribution of millisecond pulsars, as well as an observed upper cutoff of their spin rates, can be explained using disk-magnetosphere interaction alone, or additional spin-down mechanisms, such as gravitational radiation, are required. Applying our method, we find that the neutron star in the transient LMXB Aql X-1 has not yet reached the spin equilibrium by disk-magnetosphere interaction alone. We also perform numerical computations, with and without gravitational radiation, to study the spin evolution of Aql X-1 through a series of outbursts and to constrain its properties. While we find that the gravitational wave emission from Aql X-1 cannot be established with certainty, our numerical results show that the gravitational radiation from Aql X-1 is possible, with a 1.6× {10}37 g cm2 upper limit of the neutron star misaligned mass quadrupole moment.

  19. Hidden Markov model tracking of continuous gravitational waves from a binary neutron star with wandering spin. II. Binary orbital phase tracking (United States)

    Suvorova, S.; Clearwater, P.; Melatos, A.; Sun, L.; Moran, W.; Evans, R. J.


    A hidden Markov model (HMM) scheme for tracking continuous-wave gravitational radiation from neutron stars in low-mass x-ray binaries (LMXBs) with wandering spin is extended by introducing a frequency-domain matched filter, called the J -statistic, which sums the signal power in orbital sidebands coherently. The J -statistic is similar but not identical to the binary-modulated F -statistic computed by demodulation or resampling. By injecting synthetic LMXB signals into Gaussian noise characteristic of the Advanced Laser Interferometer Gravitational-wave Observatory (Advanced LIGO), it is shown that the J -statistic HMM tracker detects signals with characteristic wave strain h0≥2 ×10-26 in 370 d of data from two interferometers, divided into 37 coherent blocks of equal length. When applied to data from Stage I of the Scorpius X-1 Mock Data Challenge organized by the LIGO Scientific Collaboration, the tracker detects all 50 closed injections (h0≥6.84 ×10-26), recovering the frequency with a root-mean-square accuracy of ≤1.95 ×10-5 Hz . Of the 50 injections, 43 (with h0≥1.09 ×10-25) are detected in a single, coherent 10 d block of data. The tracker employs an efficient, recursive HMM solver based on the Viterbi algorithm, which requires ˜105 CPU-hours for a typical broadband (0.5 kHz) LMXB search.

  20. Concentration, ozone formation potential and source analysis of volatile organic compounds (VOCs) in a thermal power station centralized area: A study in Shuozhou, China. (United States)

    Yan, Yulong; Peng, Lin; Li, Rumei; Li, Yinghui; Li, Lijuan; Bai, Huiling


    Volatile organic compounds (VOCs) from two sampling sites (HB and XB) in a power station centralized area, in Shuozhou city, China, were sampled by stainless steel canisters and measured by gas chromatography-mass selective detection/flame ionization detection (GC-MSD/FID) in the spring and autumn of 2014. The concentration of VOCs was higher in the autumn (HB, 96.87 μg/m3; XB, 58.94 μg/m3) than in the spring (HB, 41.49 μg/m3; XB, 43.46 μg/m3), as lower wind speed in the autumn could lead to pollutant accumulation, especially at HB, which is a new urban area surrounded by residential areas and a transportation hub. Alkanes were the dominant group at both HB and XB in both sampling periods, but the contribution of aromatic pollutants at HB in the autumn was much higher than that of the other alkanes (11.16-19.55%). Compared to other cities, BTEX pollution in Shuozhou was among the lowest levels in the world. Because of the high levels of aromatic pollutants, the ozone formation potential increased significantly at HB in the autumn. Using the ratio analyses to identify the age of the air masses and analyze the sources, the results showed that the atmospheric VOCs at XB were strongly influenced by the remote sources of coal combustion, while at HB in the spring and autumn were affected by the remote sources of coal combustion and local sources of vehicle emission, respectively. Source analysis conducted using the Positive Matrix Factorization (PMF) model at Shuozhou showed that coal combustion and vehicle emissions made the two largest contributions (29.98% and 21.25%, respectively) to atmospheric VOCs. With further economic restructuring, the influence of vehicle emissions on the air quality should become more significant, indicating that controlling vehicle emissions is key to reducing the air pollution. Copyright © 2017 Elsevier Ltd. All rights reserved.

  1. INTEGRAL/IBIS observations of the Galactic center region at the epoch of the short Fermi/LAT flare

    DEFF Research Database (Denmark)

    Fiocchi, M.; Sanchez-Fernandez, C.; Natalucci, L.


    of ~250mCrab in the 20-60 keV band. We have also analyzed two separate time slots of 6 and 7 pointings, respectively: (a) 2011 Feb. 10, 11:41-18:41 UT, and (b) 2011 Feb. 12, 04:09-10:09 UT. The retrieved data belong to the near-real time INTEGRAL archive. The first period includes the gamma-ray flare...... of the transient X-ray burster SAX J1750.8-2900. The average flux is 14.5 +/- 1.2 mCrab (20-60 keV) during both periods and the 90% c.l. position error is 2.2 arcmin. The IBIS survey catalog version 4 (Bird et al. 2010, ApJS 186, 1) lists a candidate transient source (classified as "blended"), IGR J17507...

  2. The mass transfer rate in X1916-053 - It is driven by gravitational radiation? (United States)

    Swank, J. H.; Taam, R. E.; White, N. E.


    A 50-minute period for a binary system harboring an X-ray burster would allow several alternatives for the mass-giving secondary, including an H-shell burning-plus-He degenerate core composite model. The burst properties of X1916-053 are presently used to argue against the He degenerate as well as the He main sequence solutions and to estimate whether, for any of the other solutions, the mass transfer rate could be consistent with that expected from gravitational radiation (GR). Within an uncertainty of a factor of 2, the transfer rate for the composite model solution is consistent with gravitational radiation, but enhancement by other mechanisms should be investigated.

  3. Long X-ray burst monitoring with INTEGRAL

    DEFF Research Database (Denmark)

    X-ray bursts are thermonuclear explosions on the surface of accreting neutron stars in low mass X-ray binary systems. In the frame of the INTEGRAL observational Key Programme over the Galactic Center a good number of the known X-ray bursters are frequently being monitored. An international...... collaboration lead by the JEM-X team at the Danish National Space Center has proposed to exploit the improved sensitivity of the INTEGRAL instruments to investigate the observational properties and physics up to high energies of exceptional burst events lasting between a few tens of minutes and several hours....... Of special interest are low luminosity bursting sources that exhibit X-ray bursts of very different durations allowing to study the transition from a hydrogen-rich bursting regime to a pure helium regime and from helium burning to carbon burning. I will present results obtained from INTEGRAL archive data...

  4. INTEGRAL monitoring of unusually long X-ray bursts

    DEFF Research Database (Denmark)

    -rich bursting regime to a pure helium regime. Moreover, a handful of long bursts have shown, before the extended decay phase, an initial spike similar to a normal short X-ray burst. Such twofold bursts might be a sort of link between short and super-bursts, where the premature ignition of a carbon layer could......Thermonuclear bursts on the surface of accreting neutron stars in low mass X-ray binaries have been studied for many years and have in a few cases confirmed theoretical models of nuclear ignition and burning mechanisms. The large majority of X-ray bursts last less than 100s. A good number...... of the known X-ray bursters are frequently observed by INTEGRAL, in particular in the frame of the Key Programmes. Taking advantage of the INTEGRAL instrumentation, an international collaboration led by the JEM-X team at the Danish National Space Institute has been monitoring the occurrence of uncommon burst...

  5. What can NuSTAR do for X-ray bursts?

    DEFF Research Database (Denmark)

    Chenevez, Jérôme; Tomsick, J.; Chakrabarty, D.

    Unstable thermonuclear burning on the surface of accreting neutron stars is commonly observed as type I X-ray bursts. The flux released during some strong bursts can temporarily exceed the Eddington limit, driving the neutron star photosphere to such large radii that heavy-element ashes of nuclear...... nuclear ashes, and identify the corresponding heavy elements. A positive identification of such edges would probe the nuclear burning processes, and provide a measure of the expansion wind velocity as well as the gravitational redshift from the neutron star. Moreover, we expect that the high sensitivity...... burning are ejected in the burst expansion wind. We have investigated the possibility of observing with NuSTAR some X-ray bursters selected for their high burst rate and trend to exhibit so-called superexpansion bursts. Our main ambition is to detect the photoionization edges associated with the ejected...

  6. What can NuSTAR do for X-ray bursts?

    DEFF Research Database (Denmark)

    Chenevez, Jérôme; Tomsick, John; Chakrabarty, Deepto


    Unstable thermonuclear burning on the surface of accreting neutron stars is commonly observed as type I X-ray bursts. The flux released during some strong bursts can temporarily exceed the Eddington limit, driving the neutron star photosphere to such large radii that heavy-element ashes of nuclear...... nuclear ashes, and identify the corresponding heavy elements. A positive identification of such edges would probe the nuclear burning processes, and provide a measure of the expans ion wind velocity as well as the gravitational redshift from the neutron star. Moreover, we exp ect that the high sensitivity...... burning are ejected in the burst expansion wind. We have investigated the possibility of observing with NuSTAR some X-ray bursters selected for their high burst rate and trend to exhibit so-called superexpansion bursts. Our main ambition is to detect the photoionization edges associated with the ejected...

  7. Consistency of time dilation in temporal profiles and spectra of gamma-ray bursts (United States)

    Noriss, J. P.; Nemiroff, R. J.; Bonnell, J. T.; Scargle, J. D.; Davis, S. P.; Kouveliotou, C.; Pendleton, G.; Fishman, G. J.; Meegan, C. A.; Paciesas, W. S.


    If gamma-ray bursters are at cosmological distances-a possibility suggested by their isotropic distribution and spatial inhomogeneity-then the temporal profiles and spectra of more distant sources will be time dilated compared to those of relatively nearby sources. Analyses of bright and dim Burst and Transient Source Experiment (BATSE) gamma-ray bursts yield a relative time-dilation factor of 2.3 on timescales of pulses and event durations. We redshift the spectra of time intervals near the intensity peaks of the bright sample on a trial grid and compare with spectra of the dim sample. A redshift factor of order two-with wide latitude permitted-brings the spectra of the two brightness groups into alignment. Thus there is coarse agreement with the time-dilation factor found in the temporal domain.

  8. Compression and model reduction: A case study

    Energy Technology Data Exchange (ETDEWEB)

    LoFaro, T. [Washington State Univ., Pullman, WA (United States); Kopell, N. [Boston Univ., Boston, MA (United States)


    We discuss a method by which the dynamics of a network of coupled neurons can be captured in a one-dimensional map. The network used as an example of this technique consists of a pair of neurons, one of which is an endogenous burster and the other excitable, but not bursting in the absence of phasic input. The reduction is accomplished by decomposing the flow into fast and slow subsystems, each operating on a distinct time scale. A {open_quotes}map of knees{close_quotes} is constructed using singular perturbation techniques. A concise expression for this map is developed by introducing time coordinates to each stable branch of the slow manifold. The compression associated with the fast subsystem is used to determine the qualitative properties of the map.

  9. Larval biometry of Simulium rubrithorax (Diptera: Simuliidae and size comparison between populations in the states of Minas Gerais and Roraima, Brazil

    Directory of Open Access Journals (Sweden)

    Alvan-Aguilar Miriam Adriana


    Full Text Available The number of larval instars of Simulium (Hemicnetha rubrithorax Lutz (Diptera: Nematocera was determined using the lateral length of the head capsule. In this study 1,035 larvae, of different sizes, were measured (639 from the state of Roraima and 396 from the state of Minas Gerais. A frequency distribution analysis was carried out on the measurements of the lateral length of the head capsule to determine the number of larval instars. The limits of each instar were defined by the lower frequency of the measurements falling in a range of values, by the presence of the "egg burster" that characterizes the first larval instar, and by the developmental stage of the gill histoblast. The determination of the instar number was tested using a Student's t-test (p 0.05 were observed between them.

  10. Enhancement of the Triple Alpha Rate in a Hot Dense Medium (United States)

    Beard, Mary; Austin, Sam M.; Cyburt, Richard


    In a sufficiently hot and dense astrophysical environment the rate of the triple-alpha (3 α ) reaction can increase greatly over the value appropriate for helium burning stars owing to hadronically induced deexcitation of the Hoyle state. In this Letter we use a statistical model to evaluate the enhancement as a function of temperature and density. For a density of 106 g cm-3 enhancements can exceed a factor of 100. In high temperature or density situations, the enhanced 3 α rate is a better estimate of this rate and should be used in these circumstances. We then examine the effect of these enhancements on production of 12C in the neutrino wind following a supernova explosion and in an x-ray burster.

  11. Precision astrometry of pulsars and other compact radio sources in the globular cluster M15 (United States)

    Kirsten, Franz; Vlemmings, Wouter; Freire, Paulo; Kramer, Michael; Rottmann, Helge; Campbell, Robert M.


    The globular cluster (GC) M15 (NGC 7078) is host to at least eight pulsars and two low mass X-ray binaries (LMXBs), one of which is also visible in the radio regime. Here we present the results of a multi-epoch global very long baseline interferometry (VLBI) campaign aiming at i) measuring the proper motion of the known compact radio sources; ii) finding and classifying thus far undetected compact radio sources in the GC; and iii) detecting a signature of the putative intermediate mass black hole (IMBH) proposed to reside at the core of M15. We measure the sky motion in right ascension (μα) and declination (μδ) of the pulsars M15A and M15C and of the LMXB AC211 to be (μα,μδ)M15A = (-0.54 ± 0.14, -4.33 ± 0.25) mas yr-1, (μα,μδ)M15C = (-0.75 ± 0.09, -3.52 ± 0.13) mas yr-1, and (μα,μδ)AC211 = (-0.46 ± 0.08, - 4.31 ± 0.20) mas yr-1, respectively. Based on these measurements we estimate the global proper motion of M15 to be (μα,μδ) = (-0.58 ± 0.18, -4.05 ± 0.34) mas yr-1. We detect two previously known but unclassified compact sources within our field of view. Our observations indicate that one them is of extragalactic origin while the other one is a foreground source, quite likely an LMXB. The double neutron star system M15C became fainter during the observations, disappeared for one year and is now observable again - an effect possibly caused by geodetic precession. The LMXB AC211 shows a double lobed structure in one of the observations indicative of an outburst during this campaign. With the inclusion of the last two of a total of seven observations we confirm the upper mass limit for a putative IMBH to be M•< 500 M⊙.

  12. The formation of low-mass helium white dwarfs orbiting pulsars . Evolution of low-mass X-ray binaries below the bifurcation period (United States)

    Istrate, A. G.; Tauris, T. M.; Langer, N.


    Context. Millisecond pulsars (MSPs) are generally believed to be old neutron stars (NSs) that have been spun up to high rotation rates via accretion of matter from a companion star in a low-mass X-ray binary (LMXB). This scenario has been strongly supported by various pieces of observational evidence. However, many details of this recycling scenario remain to be understood. Aims: Here we investigate binary evolution in close LMXBs to study the formation of radio MSPs with low-mass helium white dwarf companions (He WDs) in tight binaries with orbital periods Porb ≃ 2-9h. In particular, we examine i) if the observed systems can be reproduced by theoretical modelling using standard prescriptions of orbital angular momentum losses (i.e. with respect to the nature and the strength of magnetic braking), ii) if our computations of the Roche-lobe detachments can match the observed orbital periods, and iii) if the correlation between WD mass and orbital period (MWD, Porb) is valid for systems with Porb< 2 days. Methods: Numerical calculations with a detailed stellar evolution code were used to trace the mass-transfer phase in ~400 close LMXB systems with different initial values of donor star mass, NS mass, orbital period, and the so-called γ-index of magnetic braking. Subsequently, we followed the orbital and the interior evolution of the detached low-mass (proto) He WDs, including stages with residual shell hydrogen burning. Results: We find that severe fine-tuning is necessary to reproduce the observed MSPs in tight binaries with He WD companions of mass <0.20 M⊙, which suggests that something needs to be modified or is missing in the standard input physics of LMXB modelling. Results from previous independent studies support this conclusion. We demonstrate that the theoretically calculated (MWD, Porb)-relation is in general also valid for systems with Porb< 2 days, although with a large scatter in He WD masses between 0.15-0.20 M⊙. The results of the thermal

  13. Relativistic Disc Line: A Tool to Constrain Neutron Star Equation of State Models (United States)

    Bhattacharyya, Sudip


    Relativistic iron Kα spectral emission line from the inner disc of a neutron star Low-Mass X-ray Binary (LMXB) was first detected in 2007. This discovery opened up new ways to probe strong gravity and dense matter. The past decade has seen detections of such a line from many neutron star LMXBs, and confirmation of this line from the same source with several X-ray satellites. These have firmly established the new field of relativistic disc line from neutron star systems in only a decade or so. Fitting the shape of such a line with an appropriate general relativistic model provides the accretion disc inner edge radius to the stellar mass ratio. In this review, we briefly discuss how an accurate measurement of this ratio with a future larger area X-ray instrument can be used to constrain neutron star equation of state models.

  14. Agronomic and chemical characteristics of hybrid corn to ensiling

    Directory of Open Access Journals (Sweden)

    Flávia Borges de Assis


    Full Text Available Our aim was to evaluate agronomic and chemical characteristics of corn hybrids to ensiling. It were evaluated nine corn hybrids (MX 300, RB 9308, 2B655, XB 6012, GNZ 2500, PL6890, PRE 32D10, PRE 22T10 e AG 1051, with three replicates. The higher fresh matter yield were observed in the hybrids PL6890 and PRE 32D10, while the dry matter yield was observed in the hybrid PRE 32D10 (13.43 t ha-1. The hybrids PRE 32D10 and PRE 22T10 stood out to present higher percent of leaf in relation to whole plant, while the lower percent of stems was found in the hybrids MX 300, 2B655 and XB 6012, however the higher leaves: stems relation was found in XB 6012 (0.49. There was higher CP content in the hybrid PRE 32D10 (9.10% of DM, while the lower NDF (57.78% of DM and cellulose content (24.27% of DM were observed in the hybrid GNZ 2500. The hybrid PL6890 presented higher ADF and lignin contents, the others hybrids had values lower. The lower NDIN content was observed in the hybrid RB 9308, while the lower AIDN content occurred on the hybrid 2B655. The lower buffer capacity was observed in the hybrid 2B655 (0.29. There are some differences on chemical composition among the corn hybrids used in this study, however, it is recommended to use the hybrids MX 300, PL6890 and PRE 32D10 for showing higher dry matter yield, which may reflect in the amortization of silage production costs.

  15. Incisor inclination changes produced by two compliance-free Class II correction protocols for the treatment of mild to moderate Class II malocclusions. (United States)

    Miller, Robert A; Tieu, Long; Flores-Mir, Carlos


    To compare the changes in incisor inclination between two compliance-free Class II correction protocols for the treatment of mild to moderate Class II malocclusions. Among Class II malocclusion patients a total of 38 consecutive patients treated with the Xbow appliance and later with full brackets (XB) were compared to 36 consecutive patients treated with Forsus connected to the archwire while on full brackets (FO). Evaluated cephalometric variables were overjet, overbite, skeletal Class II, lower incisor inclination, and upper incisor inclination. Factors that were analyzed were gender, treatment type, age at start of treatment (T1), and treatment length. Independent t-tests, χ(2), multiple analysis of variance, and Pearson correlations were applied. No differences in incisor inclination between both treatment protocols were identified. At T1 no statistical difference for any cephalometric variable was demonstrated with regard to gender and treatment type. Gender was also not associated with a different treatment time or age at T1. The mean treatment time was 24.2 months for XB and 30.2 months for the FO group (P  =  .037). XB patients averaged 10 fewer months of fixed edgewise appliances compared to FO patients. Neither gender nor treatment type had any influence on the changes of the evaluated dependent variables between T1 and the end of treatment. Lower incisors proclined more the longer the treatment (P  =  .005). Both overjet and upper incisor inclination were affected by age at T1 (P  =  .001 and P  =  .014, respectively). Both compliance-free Class II correction protocols for the treatment of mild to moderate Class II malocclusions appear to generate the same amount of incisor inclination. Large variability was identified.

  16. The ultracompact nature of the black hole candidate X-ray binary 47 Tuc X9 (United States)

    Bahramian, Arash; Heinke, Craig O.; Tudor, Vlad; Miller-Jones, James C. A.; Bogdanov, Slavko; Maccarone, Thomas J.; Knigge, Christian; Sivakoff, Gregory R.; Chomiuk, Laura; Strader, Jay; Garcia, Javier A.; Kallman, Timothy


    47 Tuc X9 is a low-mass X-ray binary (LMXB) in the globular cluster 47 Tucanae, and was previously thought to be a cataclysmic variable. However, Miller-Jones et al. recently identified a radio counterpart to X9 (inferring a radio/X-ray luminosity ratio consistent with black hole LMXBs), and suggested that the donor star might be a white dwarf. We report simultaneous observations of X9 performed by Chandra, NuSTAR and Australia Telescope Compact Array. We find a clear 28.18 ± 0.02-min periodic modulation in the Chandra data, which we identify as the orbital period, confirming this system as an ultracompact X-ray binary. Our X-ray spectral fitting provides evidence for photoionized gas having a high oxygen abundance in this system, which indicates a C/O white dwarf donor. We also identify reflection features in the hard X-ray spectrum, making X9 the faintest LMXB to show X-ray reflection. We detect an ˜6.8-d modulation in the X-ray brightness by a factor of 10, in archival Chandra, Swiftand ROSAT data. The simultaneous radio/X-ray flux ratio is consistent with either a black hole primary or a neutron star primary, if the neutron star is a transitional millisecond pulsar. Considering the measured orbital period (with other evidence of a white dwarf donor), and the lack of transitional millisecond pulsar features in the X-ray light curve, we suggest that this could be the first ultracompact black hole X-ray binary identified in our Galaxy.

  17. Variable spreading layer in 4U 1608-52 during thermonuclear X-ray bursts in the soft state (United States)

    Kajava, J. J. E.; Koljonen, K. I. I.; Nättilä, J.; Suleimanov, V.; Poutanen, J.


    Thermonuclear (type-I) X-ray bursts, observed from neutron star (NS) low-mass X-ray binaries (LMXB), provide constraints on NS masses and radii and consequently the equation of state of NS cores. In such analyses, various assumptions are made without knowing if they are justified. We have analysed X-ray burst spectra from the LMXB 4U 1608-52, with the aim of studying how the different persistent emission components react to the bursts. During some bursts in the soft spectral state we find that there are two variable components: one corresponding to the burst blackbody component and another optically thick Comptonized component. We interpret the latter as the spreading layer between the NS surface and the accretion disc, which is not present during the hard-state bursts. We propose that the spectral changes during the soft-state bursts are driven by the spreading layer that could cover almost the entire NS in the brightest phases due to the enhanced radiation pressure support provided by the burst, and that the layer subsequently returns to its original state during the burst decay. When deriving the NS mass and radius using the soft-state bursts two assumptions are therefore not met: the NS is not entirely visible and the burst emission is reprocessed in the spreading layer, causing distortions of the emitted spectrum. For these reasons, the NS mass and radius constraints using the soft-state bursts are different compared to the ones derived using the hard-state bursts.

  18. Discovery of a Neutron Star with Spin Frequency 530 Hz in A1744-361 (United States)

    Bhattacharyya, Sudip; Strohmayer, Tod E.; Markwardt, Craig B.; Swank, Jean H.; Bhattacharyya, Sudip


    We report the detection with the Rossi X-ray Timing Explorer (RXTE) Proportional Counter Array (PCA) of 530 Hz burst oscillations in a thermonuclear (Type I) burst from the transient X-ray source A1744-361. This is only the second burst ever observed from this source, and the first to be seen in any detail. Our results confirm that A1744-361 is a low mass X-ray binary (LMXB) system harboring a rapidly rotating neutron star. The oscillations are first detected along the rising edge of the burst, and show evidence for frequency evolution of a magnitude similar to that seen in other burst sources. The modulation amplitude and its increase with photon energy are also typical of burst oscillations. The lack of any strong indication of photospheric radius expansion during the burst suggests a 9 kpc upper limit of the source distance. We also find energy dependent dips, establishing A1744-361 as a high inclination, dipping LMXB. The timescale between the two episodes of observed dips suggests an orbital period of approx. 97 min. We have also detected a 2 - 4 Hz quasi-periodic-oscillation (QPO) for the first time from this source. This QPO appears consistent with approx. 1 Hz QPOs seen from other high inclination systems. We searched for kilohertz QPOs, and found a suggestive 2.3 sigma feature at 800 Hz in one observation. The frequency, strength and quality factor are consistent with that of a lower frequency kilohertz QPO, but the relatively low significance argues for caution, so we consider this a tentative detection requiring confirmation.

  19. The Ultracompact Nature of the Black Hole Candidate X-Ray Binary 47 Tuc X9 (United States)

    Bahramian, Arash; Heinke, Craig O.; Tudor, Vlad; Miller-Jones, James C. A.; Bogdanov, Slavko; Maccarone, Thomas J.; Knigge, Christian; Sivakoff, Gregory R.; Chomiuk, Laura; Strader, J.; hide


    47 Tuc X9 is a low-mass X-ray binary (LMXB) in the globular cluster 47 Tucanae, and was previously thought to be a cataclysmic variable. However, Miller-Jones et al. recently identified a radio counterpart to X9 (inferring a radio X-ray luminosity ratio consistent with black hole LMXBs), and suggested that the donor star might be a white dwarf. We report simultaneous observations of X9 performed by Chandra, NuSTAR and Australia Telescope Compact Array. We find a clear 28.18+/- 0.02-min periodic modulation in the Chandra data, which we identify as the orbital period, confirming this system as an ultracompact X-ray binary. Our X-ray spectral fitting provides evidence for photoionized gas having a high oxygen abundance in this system, which indicates a CO white dwarf donor. We also identify reflection features in the hard X-ray spectrum, making X9 the faintest LMXB to show X-ray reflection. We detect an approx. 6.8-d modulation in the X-ray brightness by a factor of 10, in archival Chandra, Swift and ROSAT data. The simultaneous radio X-ray flux ratio is consistent with either a black hole primary or a neutron star primary, if the neutron star is a transitional millisecond pulsar. Considering the measured orbital period (with other evidence of a white dwarf donor), and the lack of transitional millisecond pulsar features in the X-ray light curve, we suggest that this could be the first ultracompact black hole X-ray binary identified in our Galaxy.


    Energy Technology Data Exchange (ETDEWEB)

    Chakrabarty, Deepto; Nowak, Michael A. [MIT Kavli Institute for Astrophysics and Space Research, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Tomsick, John A.; Boggs, Steven E.; Craig, William W. [Space Sciences Laboratory, University of California, Berkeley, CA 94720 (United States); Grefenstette, Brian W.; Fürst, Felix; Harrison, Fiona A.; Rana, Vikram [Cahill Center for Astronomy and Astrophysics, California Institute of Technology, Pasadena, CA 91125 (United States); Psaltis, Dimitrios [Department of Astronomy, University of Arizona, Tucson, AZ 85721 (United States); Bachetti, Matteo; Barret, Didier [Observatoire Midi-Pyrénées, Université de Toulouse III - Paul Sabatier, F-31400 Toulouse (France); Christensen, Finn E. [Division of Astrophysics, National Space Institute, Technical University of Denmark, DK-2800 Lyngby (Denmark); Hailey, Charles J. [Columbia Astrophysics Laboratory, Columbia University, New York, NY 10027 (United States); Kaspi, Victoria M. [Department of Physics, McGill University, Montreal, PQ H3A 2T8 (Canada); Miller, Jon M. [Department of Astronomy, University of Michigan, Ann Arbor, MI 48109 (United States); Stern, Daniel [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States); Wik, Daniel R.; Zhang, William W. [Astrophysics Science Division, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States); Wilms, Jörn, E-mail: [Dr. Karl-Remeis-Sternwarte and Erlangen Centre for Astroparticle Physics, Universität Erlangen-Nürnberg, D-96049 Bamberg (Germany)


    The low-mass X-ray binary (LMXB) Cen X-4 is the brightest and closest (<1.2 kpc) quiescent neutron star transient. Previous 0.5-10 keV X-ray observations of Cen X-4 in quiescence identified two spectral components: soft thermal emission from the neutron star atmosphere and a hard power-law tail of unknown origin. We report here on a simultaneous observation of Cen X-4 with NuSTAR (3-79 keV) and XMM-Newton (0.3-10 keV) in 2013 January, providing the first sensitive hard X-ray spectrum of a quiescent neutron star transient. The 0.3-79 keV luminosity was 1.1×10{sup 33} D{sub kpc}{sup 2} erg s{sup –1}, with ≅60% in the thermal component. We clearly detect a cutoff of the hard spectral tail above 10 keV, the first time such a feature has been detected in this source class. We show that thermal Comptonization and synchrotron shock origins for the hard X-ray emission are ruled out on physical grounds. However, the hard X-ray spectrum is well fit by a thermal bremsstrahlung model with kT{sub e} = 18 keV, which can be understood as arising either in a hot layer above the neutron star atmosphere or in a radiatively inefficient accretion flow. The power-law cutoff energy may be set by the degree of Compton cooling of the bremsstrahlung electrons by thermal seed photons from the neutron star surface. Lower thermal luminosities should lead to higher (possibly undetectable) cutoff energies. We compare Cen X-4's behavior with PSR J1023+0038, IGR J18245–2452, and XSS J12270–4859, which have shown transitions between LMXB and radio pulsar modes at a similar X-ray luminosity.

  1. Spectral-timing Analysis of the Lower kHz QPO in the Low-mass X-Ray Binary Aquila X-1 (United States)

    Troyer, Jon S.; Cackett, Edward M.


    Spectral-timing products of kilohertz quasi-periodic oscillations (kHz QPOs) in low-mass X-ray binary (LMXB) systems, including energy- and frequency-dependent lags, have been analyzed previously in 4U 1608-52, 4U 1636-53, and 4U 1728-34. Here, we study the spectral-timing properties of the lower kHz QPO of the neutron star LMXB Aquila X-1 for the first time. We compute broadband energy lags as well as energy-dependent lags and the covariance spectrum using data from the Rossi X-ray Timing Explorer. We find characteristics similar to those of previously studied systems, including soft lags of ˜30 μs between the 3.0-8.0 keV and 8.0-20.0 keV energy bands at the average QPO frequency. We also find lags that show a nearly monotonic trend with energy, with the highest-energy photons arriving first. The covariance spectrum of the lower kHz QPO is well fit by a thermal Comptonization model, though we find a seed photon temperature higher than that of the mean spectrum, which was also seen in Peille et al. and indicates the possibility of a composite boundary layer emitting region. Lastly, we see in one set of observations an Fe K component in the covariance spectrum at 2.4-σ confidence, which may raise questions about the role of reverberation in the production of lags.

  2. Deregulation of miRNAs Contributes to Development and Progression of Prostate Cancer (United States)


    specific antigen by disrupting hAR amino- to carboxyl-terminal interaction. J Biol Chem 2001;276(42):38472–38479. 44. Shi XB, Gandour-Edwards R, Beckett LA...progress through S phase (the least radiosensitive) and are arrested in G2/M phase (the most radio - sensitive) or G1/S phase (intermediate sensitive...Cell Cycle 2008;7:1529–1538. 14. Scott S, Gumerlock PH, Beckett L, Li Y, Goldberg Z. Survival and cell cycle kinetics of humanprostate cancer cell

  3. Drug: D02592 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available AL PREPARATIONS A01AC Corticosteroids for local oral treatment A01AC02 Dexamethasone D02592 Dexamethasone be...T OF HEMORRHOIDS AND ANAL FISSURES FOR TOPICAL USE C05AA Corticosteroids C05AA09 Dexamethasone D02592 Dexame...oxil (USAN) D07X CORTICOSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids, moder...PARATIONS D10A ANTI-ACNE PREPARATIONS FOR TOPICAL USE D10AA Corticosteroids, combinations for treatment of a...ONS FOR TOPICAL USE R01AD Corticosteroids R01AD03 Dexamethasone D02592 Dexamethasone beloxil (USAN) S SENSOR

  4. Drug: D07798 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available OMATOLOGICAL PREPARATIONS A01A STOMATOLOGICAL PREPARATIONS A01AC Corticosteroids for local oral treatment A0... AGENTS FOR TREATMENT OF HEMORRHOIDS AND ANAL FISSURES FOR TOPICAL USE C05AA Corticosteroids...IDS, DERMATOLOGICAL PREPARATIONS D07A CORTICOSTEROIDS, PLAIN D07AB Corticosteroids, moderately potent (group... II) D07AB19 Dexamethasone D07798 Dexamethasone sodium hemisulfate D07X CORTICOSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids...e D07798 Dexamethasone sodium hemisulfate D10 ANTI-ACNE PREPARATIONS D10A ANTI-ACNE PREPARATIONS FOR TOPICAL USE D10AA Corticosteroid

  5. Drug: D04221 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available S FOR TREATMENT OF HEMORRHOIDS AND ANAL FISSURES FOR TOPICAL USE C05AA Corticosteroids C05AA06 Fluorometholo...ERMATOLOGICAL PREPARATIONS D07A CORTICOSTEROIDS, PLAIN D07AB Corticosteroids, moderately potent (group II) D...07AB06 Fluorometholone D04221 Fluorometholone acetate (USAN) D07X CORTICOSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids...4221 Fluorometholone acetate (USAN) D10 ANTI-ACNE PREPARATIONS D10A ANTI-ACNE PREPARATIONS FOR TOPICAL USE D10AA Corticosteroids...ate (USAN) S SENSORY ORGANS S01 OPHTHALMOLOGICALS S01B ANTIINFLAMMATORY AGENTS S01BA Corticosteroids, plain

  6. Drug: D07799 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available OGICAL PREPARATIONS A01A STOMATOLOGICAL PREPARATIONS A01AC Corticosteroids for local oral treatment A01AC02 ...REATMENT OF HEMORRHOIDS AND ANAL FISSURES FOR TOPICAL USE C05AA Corticosteroids C...PREPARATIONS D07A CORTICOSTEROIDS, PLAIN D07AB Corticosteroids, moderately potent (group II) D07AB19 Dexamet...hasone D07799 Dexamethasone 21-tebutate D07X CORTICOSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids, mode...ebutate D10 ANTI-ACNE PREPARATIONS D10A ANTI-ACNE PREPARATIONS FOR TOPICAL USE D10AA Corticosteroids, combin

  7. Drug: D06216 [KEGG MEDICUS

    Lifescience Database Archive (English)


  8. Drug: D01367 [KEGG MEDICUS

    Lifescience Database Archive (English)


  9. Drug: D00975 [KEGG MEDICUS

    Lifescience Database Archive (English)


  10. Drug: D07801 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ICAL PREPARATIONS A01AC Corticosteroids for local oral treatment A01AC02 Dexamethasone D07801 Dexamethasone ...AL FISSURES FOR TOPICAL USE C05AA Corticosteroids C05AA09 Dexamethasone D07801 De...STEROIDS, PLAIN D07AB Corticosteroids, moderately potent (group II) D07AB19 Dexamethasone D07801 phenylpropionate D07X CORTICOSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids, moderately potent, other...I-ACNE PREPARATIONS D10A ANTI-ACNE PREPARATIONS FOR TOPICAL USE D10AA Corticosteroids, combinations for trea

  11. Drug: D00985 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ABOLISM A01 STOMATOLOGICAL PREPARATIONS A01A STOMATOLOGICAL PREPARATIONS A01AC Corticosteroids for local ora...ICALS D07 CORTICOSTEROIDS, DERMATOLOGICAL PREPARATIONS D07A CORTICOSTEROIDS, PLAIN D07AB Corticosteroids...e (USP/INN) D07X CORTICOSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids, moderately potent, other combina...Y ORGANS S01 OPHTHALMOLOGICALS S01B ANTIINFLAMMATORY AGENTS S01BA Corticosteroids...acetonide (USP/INN) Respiratory Tract/Pulmonary Agents Anti-inflammatories, Inhaled Corticosteroids Triamcin

  12. Drug: D07797 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available REPARATIONS A01A STOMATOLOGICAL PREPARATIONS A01AC Corticosteroids for local oral treatment A01AC02 Dexameth...NT OF HEMORRHOIDS AND ANAL FISSURES FOR TOPICAL USE C05AA Corticosteroids C05AA09...ARATIONS D07A CORTICOSTEROIDS, PLAIN D07AB Corticosteroids, moderately potent (group II) D07AB19 D07797 Dexamethasone isonicotinate D07X CORTICOSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids, modera...otinate D10 ANTI-ACNE PREPARATIONS D10A ANTI-ACNE PREPARATIONS FOR TOPICAL USE D10AA Corticosteroids, combin

  13. Drug: D02174 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available ES FOR TOPICAL USE C05AA Corticosteroids C05AA09 Dexamethasone D02174 Dexamethaso...te (JAN/USP) D07X CORTICOSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids, moderately potent, other combin... PREPARATIONS D10A ANTI-ACNE PREPARATIONS FOR TOPICAL USE D10AA Corticosteroids, combinations for treatment ...P) R RESPIRATORY SYSTEM R01 NASAL PREPARATIONS R01A DECONGESTANTS AND OTHER NASAL PREPARATIONS FOR TOPICAL USE R01AD Corticosteroids...USP) S SENSORY ORGANS S01 OPHTHALMOLOGICALS S01B ANTIINFLAMMATORY AGENTS S01BA Corticosteroids, plain S01BA0

  14. Drug: D00385 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available EMORRHOIDS AND ANAL FISSURES FOR TOPICAL USE C05AA Corticosteroids C05AA12 Triamcinolone D00385 Triamcinolon...e (JP16/USP/INN) D DERMATOLOGICALS D07 CORTICOSTEROIDS, DERMATOLOGICAL PREPARATIONS D07A CORTICOSTEROIDS, PLAIN D07AB Corticosteroids.../INN) D07X CORTICOSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids, moderately ...FOR TOPICAL USE R01AD Corticosteroids R01AD11 Triamcinolone D00385 Triamcinolone (JP16/USP/INN) R03 DRUGS FO...1 OPHTHALMOLOGICALS S01B ANTIINFLAMMATORY AGENTS S01BA Corticosteroids, plain S01BA05 Triamcinolone D00385 T

  15. Drug: D00983 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available T AND METABOLISM A01 STOMATOLOGICAL PREPARATIONS A01A STOMATOLOGICAL PREPARATIONS A01AC Corticosteroids for ...OR TOPICAL USE C05AA Corticosteroids C05AA12 Triamcinolone D00983 Triamcinolone acetonide (JP16/USP) D DERMA...ide (JP16/USP) D07X CORTICOSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids, moderately potent, other comb...ANS S01 OPHTHALMOLOGICALS S01B ANTIINFLAMMATORY AGENTS S01BA Corticosteroids, pla...P) Respiratory Tract/Pulmonary Agents Anti-inflammatories, Inhaled Corticosteroids Triamcinolone D00983 Tria

  16. Drug: D02591 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available AND METABOLISM A01 STOMATOLOGICAL PREPARATIONS A01A STOMATOLOGICAL PREPARATIONS A01AC Corticosteroids...R TOPICAL USE C05AA Corticosteroids C05AA09 Dexamethasone D02591 Dexamethasone ac...te (USAN/INN) D07X CORTICOSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids, moderately potent, other combi...ACNE PREPARATIONS D10A ANTI-ACNE PREPARATIONS FOR TOPICAL USE D10AA Corticosteroids, combinations for treatm... TOPICAL USE R01AD Corticosteroids R01AD03 Dexamethasone D02591 Dexamethasone ace

  17. Drug: D07796 [KEGG MEDICUS

    Lifescience Database Archive (English)


  18. Drug: D07073 [KEGG MEDICUS

    Lifescience Database Archive (English)

    Full Text Available MATOLOGICAL PREPARATIONS A01AC Corticosteroids for local oral treatment A01AC02 D...TS FOR TREATMENT OF HEMORRHOIDS AND ANAL FISSURES FOR TOPICAL USE C05AA Corticosteroids C05AA09 Dexamethason...NS D07A CORTICOSTEROIDS, PLAIN D07AB Corticosteroids, moderately potent (group II...) D07AB19 Dexamethasone D07073 Dexamethasone cipecilate (JAN/INN) D07X CORTICOSTEROIDS, OTHER COMBINATIONS D07XB Corticosteroids... R01A DECONGESTANTS AND OTHER NASAL PREPARATIONS FOR TOPICAL USE R01AD Corticosteroids R01AD03 Dexamethasone

  19. Rosenbluth separation of the $\\pi^0$ Electroproduction Cross Section off the Neutron


    Mazouz, M.; Ahmed, Z.; H. Albataineh; Allada, K.; Aniol, K. A.; Bellini, V.; Benali, M; Boeglin, W.; Bertin, P.; M. Brossard; Camsonne, A.; Canan, M.; Chandavar, S.; Chen, C.; Chen, J. -P.


    We report the first longitudinal/transverse separation of the deeply virtual exclusive $\\pi^0$ electroproduction cross section off the neutron and coherent deuteron. The corresponding four structure functions $d\\sigma_L/dt$, $d\\sigma_T/dt$, $d\\sigma_{LT}/dt$ and $d\\sigma_{TT}/dt$ are extracted as a function of the momentum transfer to the recoil system at $Q^2$=1.75 GeV$^2$ and $x_B$=0.36. The $ed \\to ed\\pi^0$ cross sections are found compatible with the small values expected from theoretical...

  20. SU-E-T-91: Accuracy of Dose Calculation Algorithms for Patients Undergoing Stereotactic Ablative Radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Tajaldeen, A [RMIT university, Docklands, Vic (Australia); Ramachandran, P [Peter MacCallum Cancer Centre, Bendigo (Australia); Geso, M [RMIT University, Bundoora, Melbourne (Australia)


    Purpose: The purpose of this study was to investigate and quantify the variation in dose distributions in small field lung cancer radiotherapy using seven different dose calculation algorithms. Methods: The study was performed in 21 lung cancer patients who underwent Stereotactic Ablative Body Radiotherapy (SABR). Two different methods (i) Same dose coverage to the target volume (named as same dose method) (ii) Same monitor units in all algorithms (named as same monitor units) were used for studying the performance of seven different dose calculation algorithms in XiO and Eclipse treatment planning systems. The seven dose calculation algorithms include Superposition, Fast superposition, Fast Fourier Transform ( FFT) Convolution, Clarkson, Anisotropic Analytic Algorithm (AAA), Acurous XB and pencil beam (PB) algorithms. Prior to this, a phantom study was performed to assess the accuracy of these algorithms. Superposition algorithm was used as a reference algorithm in this study. The treatment plans were compared using different dosimetric parameters including conformity, heterogeneity and dose fall off index. In addition to this, the dose to critical structures like lungs, heart, oesophagus and spinal cord were also studied. Statistical analysis was performed using Prism software. Results: The mean±stdev with conformity index for Superposition, Fast superposition, Clarkson and FFT convolution algorithms were 1.29±0.13, 1.31±0.16, 2.2±0.7 and 2.17±0.59 respectively whereas for AAA, pencil beam and Acurous XB were 1.4±0.27, 1.66±0.27 and 1.35±0.24 respectively. Conclusion: Our study showed significant variations among the seven different algorithms. Superposition and AcurosXB algorithms showed similar values for most of the dosimetric parameters. Clarkson, FFT convolution and pencil beam algorithms showed large differences as compared to superposition algorithms. Based on our study, we recommend Superposition and AcurosXB algorithms as the first choice of

  1. New horizons for aerobic fitness normalization in children: Breaking the paradigm

    Directory of Open Access Journals (Sweden)

    Giovani dos Santos Cunha


    Full Text Available Traditional methods to normalize aerobic fitness (VO2max have been considered inadequate for not properly adjusting the effects of body size in children, adolescents and adults. Allometric scaling (Y=aXb has emerged as an efficient method to compare individuals of different body dimensions. Studies aimed to compare VO2max in individuals with different body sizes should use methodology that properly accounts for the body size effect, thereby avoiding misinterpretation and reaching the potentially wrong conclusion. The use of allometric scaling for studies aimed to compare aerobic fitness in children and adolescents who dramatically vary in body size is strongly recommended.

  2. ZnO-PbO-B2O3 glasses as gamma-ray shielding materials

    DEFF Research Database (Denmark)

    Singh, H.; Singh, K.; Gerward, Leif


    Values of the gamma-ray mass-attenuation coefficient, the photon mean free path (MFP), the effective atomic number and the effective electron density have been determined experimentally for xZnO.2xPbO.(1-3x)B2O3 (x = 0.1-0.26) glasses at photon energies 511, 662, 1173 and 1332 keV and compared...... with theoretical data. The specific volume of the glasses has been derived from density measurements and studied as a function of composition. It is pointed out that these glasses have potential applications in radiation shielding....

  3. Effects of gamma-ray irradiation on optical properties of ZnO-PbO-B2O3 glasses

    DEFF Research Database (Denmark)

    Sharma, G.; Thind, K.S.; Manupriya, -


    Effects of gamma-ray irradiation on some optical properties of xZnO(.)2xPbO(.)(1-3x)B2O3 glasses have been studied in the wavelength range 300-800 nm. Decrease in transmittance indicates the formation of color-center defects. Values for the energy-band gap, the width of the energy tail above...... the mobility gap and the cut-off wavelength have been measured before and after irradiation. Changes in the optical properties are explained in terms of radiation-induced structural defects and the composition of the glass....

  4. Strength of the rare-earth-transition-metal exchange coupling in hard magnetic materials, an experimental approach based on high-field magnetisation measurements: Application to Er sub 2 Fe sub 14 B

    Energy Technology Data Exchange (ETDEWEB)

    Verhoef, R.; Radwanski, R.J.; Franse, J.J.M. (Natuurkundig Lab., Univ. van Amsterdam (Netherlands))


    A new experimental technique is presented to determine the intersublattice molecular-field coefficient, n{sub RT}, in heavy rare-earth-transition-metal intermetallic compounds. The technique is based on high-field magnetisation measurements on finely powdered polycrystalline material that is free to rotate in the sampleholder. Experimental results are reported for a number of Er{sub 2}Fe{sub 14-x}Mn{sub x}B compounds. The strength of the R-T exchange coupling is not affected by the Mn substitution, and a value of 0.445 Tkg/Am{sup 2} has been deduced for the coefficient n{sub RT}. (orig.).

  5. Deeply Virtual Compton Scattering off the neutron

    CERN Document Server

    Mazouz, M; Ferdi, C; Gavalian, G; Kuchina, E; Amarian, M; Aniol, K A; Beaumel, M; Benaoum, H; Bertin, P; Brossard, M; Chen, J P; Chudakov, E; Craver, B; Cusanno, F; De Jager, C W; Deur, A; Feuerbach, R; Fieschi, J M; Frullani, S; Garçon, M; Garibaldi, F; Gayou, O; Gilman, R; Gómez, J; Gueye, P; Guichon, P A M; Guillon, B; Hansen, O; Hayes, D; Higinbotham, D; Holmstrom, T; Hyde, C E; Ibrahim, H; Igarashi, R; Jiang, X; Jo, H S; Kaufman, L J; Kelleher, A; Kolarkar, A; Kumbartzki, G; Laveissière, G; Le Rose, J J; Lindgren, R; Liyanage, N; Lu, H J; Margaziotis, D J; Meziani, Z E; McCormick, K; Michaels, R; Michel, B; Moffit, B; Monaghan, P; Nanda, S; Nelyubin, V; Potokar, M; Qiang, Y; Ransome, R D; Real, J S; Reitz, B; Roblin, Y; Roche, J; Sabatie, F; Saha, A; Sirca, S; Slifer, K; Solvignon, P; Subedi, R; Sulkosky, V; Ulmer, P E; Voutier, E; Wang, K; Weinstein, L B; Wojtsekhowski, B; Zheng, X; Zhu, L


    The present experiment exploits the interference between the Deeply Virtual Compton Scattering (DVCS) and the Bethe-Heitler processes to extract the imaginary part of DVCS amplitudes on the neutron and on the deuteron from the helicity-dependent D$({\\vec e},e'\\gamma)X$ cross section measured at $Q^2$=1.9 GeV$^2$ and $x_B$=0.36. We extract a linear combination of generalized parton distributions (GPDs) particularly sensitive to $E_q$, the least constrained GPD. A model dependent constraint on the contribution of the up and down quarks to the nucleon spin is deduced.

  6. An Optimization Problem for Predicting the Maximal Effect of Degradation of Mechanical Structures

    DEFF Research Database (Denmark)

    Achtziger, W.; Bendsøe, Martin P.; Taylor, J. E.


    -product, this gives insight in terms of a mechanical interpretation of the optimization problem. We derive an equivalent convex problem formulation and a convex dual problem, and for dyadic matrices A(i) a quadratic programming problem formulation is developed. A nontrivial numerical example is included, based......This paper deals with a nonlinear nonconvex optimization problem that models prediction of degradation in discrete or discretized mechanical structures. The mathematical difficulty lies in equality constraints of the form Σ(i=1)(m) 1/yi A(i) x=b, where A(i) are symmetric and positive semidefinite...

  7. 78 FR 41016 - Preliminary Theft Data; Motor Vehicle Theft Prevention Standard (United States)


    ... 136,721 1.1556 55 TOYOTA SCION XB 23 19,909 1.1553 56 VOLVO S40 5 4,352 1.1489 57 SUZUKI KIZASHI 7 6......... LINCOLN MKT....... 4 4,274 0.9359 73 VOLVO S80 4 4,281 0.9344 74 BMW M3 7 7,575 0.9241 75 GENERAL MOTORS.......... 12 13,171 0.9111 78 VOLVO C30 5 5,530 0.9042 79 JAGUAR LAND ROVER.. LAND ROVER LR2.... 3 3,333 0.9001...

  8. GenBank blastx search result: AK111921 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK111921 001-013-A10 AF310956.2 Enterococcus faecium response regulator (vanRB2), p...rotein histidine kinase (vanSB2), D,D-carboxypeptidase (vanYB2), VanWB2 (vanWB2), D-2-hydroxyacid dehydrogenase (van...HB2), D-alanine:D-lactate ligase (vanB2), and D,D-dipeptidase (vanXB2) genes, complete cds.|BCT BCT 6e-12 +1 ...

  9. GenBank blastx search result: AK104725 [KOME

    Lifescience Database Archive (English)

    Full Text Available AK104725 001-038-B08 AF310956.2 Enterococcus faecium response regulator (vanRB2), p...rotein histidine kinase (vanSB2), D,D-carboxypeptidase (vanYB2), VanWB2 (vanWB2), D-2-hydroxyacid dehydrogenase (van...HB2), D-alanine:D-lactate ligase (vanB2), and D,D-dipeptidase (vanXB2) genes, complete cds.|BCT BCT 3e-16 +1 ...

  10. Halogen-bonding in a new family of tris(haloanilato)metallate(III) magnetic molecular building blocks. (United States)

    Atzori, Matteo; Artizzu, Flavia; Sessini, Elisa; Marchiò, Luciano; Loche, Danilo; Serpe, Angela; Deplano, Paola; Concas, Giorgio; Pop, Flavia; Avarvari, Narcis; Mercuri, Maria Laura


    Here we report on new tris(haloanilato)metallate(III) complexes with general formula [A]3[M(X2An)3] (A = (n-Bu)4N(+), (Ph)4P(+); M = Cr(III), Fe(III); X2An = 3,6-dihalo derivatives of 2,5-dihydroxybenzoquinone (H4C6O4), chloranilate (Cl2An(2-)), bromanilate (Br2An(2-)) and iodanilate (I2An(2-))), obtained by a general synthetic strategy, and their full characterization. The crystal structures of these Fe(III) and Cr(III) haloanilate complexes consist of anions formed by homoleptic complexes formulated as [M(X2An)3](3-) and (Et)3NH(+), (n-Bu)4N(+), or (Ph4)P(+) cations. All complexes exhibit octahedral coordination geometry with metal ions surrounded by six oxygen atoms from three chelate ligands. These complexes are chiral according to the metal coordination of three bidentate ligands, and both Λ and Δ enantiomers are present in their crystal lattice. The packing of [(n-Bu)4N]3[Cr(I2An)3] (5a) shows that the complexes form supramolecular dimers that are held together by two symmetry related I···O interactions (3.092(8) Å), considerably shorter than the sum of iodine and oxygen van der Waals radii (3.50 Å). The I···O interaction can be regarded as a halogen bond (XB), where the iodine behaves as the XB donor and the oxygen atom as the XB acceptor. This is in agreement with the properties of the electrostatic potential for [Cr(I2An)3](3-) that predicts a negative charge accumulation on the peripheral oxygen atoms and a positive charge accumulation on the iodine. The magnetic behaviour of all complexes, except 5a, may be explained by considering a set of paramagnetic non-interacting Fe(III) or Cr(III) ions, taking into account the zero-field splitting effect. The presence of strong XB interactions in 5a are able, instead, to promote antiferromagnetic interactions among paramagnetic centers at low temperature, as shown by the fit with the Curie-Weiss law, in agreement with the formation of halogen-bonded supramolecular dimers.

  11. The biological effects of XTC-MIF: quantitative comparison with Xenopus bFGF. (United States)

    Green, J B; Howes, G; Symes, K; Cooke, J; Smith, J C


    Mesoderm in Xenopus and other amphibian embryos is induced by signals from the vegetal hemisphere acting on equatorial or animal hemisphere cells. These signals are diffusible and two classes of candidate signal molecule have been identified: the fibroblast growth factor (FGF) and transforming growth factor beta (TGF-beta) types. In this paper, we compare the effects of cloned Xenopus basic FGF (XbFGF) and electophoretically homogeneous XTC-MIF (a TGF-beta-like factor obtained from a Xenopus cell line) on animal pole explants. We find that they have a similar minimum active concentration (0.1-0.2 ng ml-1) but that, nonetheless, XTC-MIF is at least 40 times more active in inducing muscle. In general, we find that the two factors cause inductions of significantly different characters in terms of tissue type, morphology, gene expression and timing. At low concentrations (0.1-1.0 ng ml-1) both factors induce the differentiation of 'mesenchyme' and 'mesothelium' as well as blood-like cells. These latter cells do not, however, react with an antibody to Xenopus globin. This raised the possibility that the identification of red blood cells in other studies on mesoderm induction might have been mistaken, but combinations of animal pole regions with ventral vegetal pole regions confirmed that genuine erythrocytes are formed. The identity of the blood-like cells formed in response to the inducing factors remains unknown. At higher concentrations XTC-MIF induces neural tissue, notochord, pronephros and substantial and often segmented muscle. By contrast, XbFGF only induces significant amounts of muscle above 24 ng ml-1 and even then this is much less than that induced by XTC-MIF. For both factors an exposure of less than 30 min is effective. Competence of animal pole cells to respond to XbFGF is completely lost by the beginning of gastrulation (stage 10) while competence to XTC-MIF is detectable until somewhat later (stage 11). Since animal pole tissue is known to be able to

  12. Dosimetric Evaluation of VMAT, IMRT, and Proton Treatment Techniques Targeting Borderline Resectable Pancreatic Cancer Lesions (United States)

    Harpool, Kristyn Brenna

    Purpose: With the advent of Volumetric Modulated Arc Therapy (VMAT), clinicians opted to favor this technology assuming it a better form of treatment. It was of interest to investigate its benefits compared to Intensity Modulated Radiation Therapy (IMRT) when creating treatment plans for pancreatic cancer for which challenges are considered: target location, avoiding excess dose to surrounding organs, and keeping highest dose within the planned target volume. This study aimed to determine which technique offered the best dose conformity and healthy organ sparing based on dosimetry and radiobiology models to help the clinic distribute fairly the patient load to the most adequate treatment delivery machine. Materials and Methods: Twenty pancreatic cancer treatment plans were analyzed. Original plans were re-planned and calculated with Varian Eclipse treatment planning system using VMAT or IMRT to create paired data sets. IMRT plans utilized 6-9 fields and VMAT plans used two arc fields. Both techniques used 6 MV beams and prescription dose of 4950 cGy in 18 fractions. Plan evaluations were based on Conformity Index (CI) and normal tissue (kidneys, liver, spinal cord, and bowel) doses analyzed using QUANTEC; and radiobiology analysis using the Uncomplicated Tumor Control Probability (UTCP). Results: On average, VMAT resulted in 10.56% (p = 0.19) and 17.46% (p = 0.16) higher mean doses to the total kidneys and liver and 7.48% (p = 0.10) and 0.44% (p = 0.93) lower mean doses to the bowel and maximum spinal cord dose, respectively. Conclusions: VMAT has not shown to be a significantly superior technique at providing target coverage and sparing normal structures, thus determination of the treatment technique should be based on individual cases. Purpose: To examine dosimetric differences between AAA and Acuros XB mathematical treatment planning software in the treatment of pancreatic cancer. Materials and Methods: CT images from twelve pancreatic cancer patients were used

  13. Spectroscopic determination of inverse photon efficiencies of W atoms in the scrape-off layer of TEXTOR (United States)

    Brezinsek, S.; Laengner, M.; Coenen, J. W.; O’Mullane, M. G.; Pospieszczyk, A.; Sergienko, G.; Samm, U.


    Optical emission spectroscopy can be applied to determine in situ tungsten particle fluxes from erosion processes at plasma-facing materials. Inverse photon efficiencies convert photon fluxes of WI and WII line transitions into W and {{{W}}}+ particle fluxes, respectively, dependening on the local plasma conditions. Experiments in TEXTOR were carried out to determine effective conversion factors for different WI and WII transitions with the aid of WF6 injection into deuterium scrape-off layer plasmas in the electron temperature T e range between {T}{e}=20 {eV} and {T}{e}=82 {eV}. The inverse photon efficiencies or so-called effective \\tfrac{S}{{XB}}-values have been determined for WI lines at λ =400.9 {nm}, 429.5 nm, 488.7 nm, 498.3 nm, and 522.5 nm as well as for WII at λ =434.6 {nm} and compared with theoretical calculations from the ADAS data base. Moreover, a multi-machine scaling for the \\tfrac{S}{{XB}}-value in the range of T e between 2...100 {eV} has been determined for the most prominent WI line at λ =400.9 {nm} to \\tfrac{S}{{XB}}({T}{e})=53.63-56.07× {e}(0.045× {T{e}[{eV}])} considering experimental data from TEXTOR, ASDEX Upgrade, PSI and PISCES. Comparison with ADAS calculations for the same transition reveal a good qualitative agreement with the dependence on T e , but an underestimation of ADAS calculations of less than 25% over the full covered range of experimentally accessible T e in the multi-machine scaling. A good agreement within the experimental uncertainties is found between TEXTOR and ADAS \\tfrac{S}{{XB}}-values for WI at λ =429.5 {nm} and λ =488.7 {nm} whereas an underestimation of up to a factor two of ADAS values for WI at λ =522.5 {nm} and λ =498.3 {nm} was measured. Potentially, reasons for the discrepancy are an overestimation of applied ionisation rate coefficients in ADAS for neutral W and a stronger electron dependence n e for these transitions.

  14. Heavy exotic molecules (United States)

    Liu, Yizhuang; Zahed, Ismail

    We briefly review the formation of pion-mediated heavy-light exotic molecules with both charm and bottom, under the general structures of chiral and heavy quark symmetries. The charm isosinglet exotic molecules with JPC = 1++ binds, which we identify as the reported neutral X(3872). The bottom isotriplet exotic with JPC = 1+1 binds, and is identified as a mixed state of the reported charged exotics Zb+(10610) and Zb-(10650). The bound bottom isosinglet molecule with JPC = 1++ is a possible neutral Xb(10532) to be observed.

  15. Spectroscopy and decay properties with b-hadrons at the ATLAS experiment

    CERN Document Server

    Toms, Konstantin; The ATLAS collaboration


    We present the latest results from the ATLAS experiment on hadron decays and spectroscopy, including observation of the B_c(2S) state, production of the B_c+ meson, branching ratio measurements of B_c->J/psiD(), extraction of fragmentation fractions fs/fd via reconstructed Bs->J/psiPhi and Bd->J/psiK decays, and studies of the decay properties of the Lambda_b. We also present the results of searches for the Xb, the bottomonium counterpart to the X(3872) exotic charmonium state.

  16. Changes in the mRNA expression of structural proteins, hormone synthesis and secretion from bovine placentome sections after DDT and DDE treatment. (United States)

    Wojciechowska, A; Mlynarczuk, J; Kotwica, J


    Disorders in the barrier function and secretory activity of the placenta can be caused by xenobiotics (XB) present in the environment and their accumulation in tissues of living organisms. Thus, the aim of this study was to investigate the effect of 1,1,1-trichloro-2,2,-bis-4-chlorophenyl-ethane (DDT) and its metabolite 1,1-dichloro-2,2-bis-4-chlorophenyl-ethene (DDE) (for 24 or 48h) at doses of 1, 10 or 100ng/ml on the function of cow placentome sections in the second trimester of pregnancy. DDT and DDE affected neither (P>0.05) the viability nor hypoxia inducible factor 1 (HIF1α) mRNA expression of the sections. XB decreased (P0.05) keratin 8 (KRT8) mRNA expression. DDT and DDE also reduced (PDDT increased (PDDT and DDE increased (PDDT stimulated only 3β-hydroxysteroid dehydrogenase (3βHSD) and cholesterol side-chain cleavage enzyme (CYP11A1) mRNA expression (PDDT and DDE impaired the barrier function and secretory activity of the placenta. Thus, these compounds can disrupt trophoblast invasion, myometrium contractility and gas/nutrient exchange throughout pregnancy in cows. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  17. Dosimetric comparison between VMAT with different dose calculation algorithms and protons for soft-tissue sarcoma radiotherapy. (United States)

    Fogliata, Antonella; Scorsetti, Marta; Navarria, Piera; Catalano, Maddalena; Clivio, Alessandro; Cozzi, Luca; Lobefalo, Francesca; Nicolini, Giorgia; Palumbo, Valentina; Pellegrini, Chiara; Reggiori, Giacomo; Roggio, Antonella; Vanetti, Eugenio; Alongi, Filippo; Pentimalli, Sara; Mancosu, Pietro


    To appraise the potential of volumetric modulated arc therapy (VMAT, RapidArc) and proton beams to simultaneously achieve target coverage and enhanced sparing of bone tissue in the treatment of soft-tissue sarcoma with adequate target coverage. Ten patients presenting with soft-tissue sarcoma of the leg were collected for the study. Dose was prescribed to 66.5 Gy in 25 fractions to the planning target volume (PTV) while significant maximum dose to the bone was constrained to 50 Gy. Plans were optimised according to the RapidArc technique with 6 MV photon beams or for intensity modulated protons. RapidArc photon plans were computed with: 1) AAA; 2) Acuros XB as dose to medium; and 3) Acuros XB as dose to water. All plans acceptably met the criteria of target coverage (V95% >90-95%) and bone sparing (D(1 cm3) proton plans. Near-to-maximum dose to bone was similar for RapidArc and protons, while volume receiving medium/low dose levels was minimised with protons. Similar results were obtained for the remaining normal tissue. Dose distributions calculated with the dose to water option resulted ~5% higher than corresponding ones computed as dose to medium. High plan quality was demonstrated for both VMAT and proton techniques when applied to soft-tissue sarcoma.

  18. Modeling of plasma distortions by laser-induced ablation spectroscopy (LIAS) and implications for the interpretation of LIAS measurements (United States)

    Tokar, M. Z.; Gierse, N.; Philipps, V.; Samm, U.


    For the interpretation of the line radiation observed from laser induced ablation spectroscopy (LIAS) such parameters as the density and temperature of electrons within very compact clouds of atoms and singly charged ions of ablated material have to be known. Compared to the local plasma conditions prior to the laser pulse, these can be strongly changed during LIAS since new electrons are generated by the ionisation of particles ejected from the irradiated target. Because of their transience and spatial inhomogeneity it is technically difficult to measure disturbances induced in the plasma by LIAS. To overcome this uncertainty a numerical model has been elaborated, providing a self-consistent description for the spreading of ablated particles and accompanying modifications in the plasma. The results of calculations for LIAS performed on carbon-containing targets in Ohmic and additionally heated discharges in the tokamak TEXTOR are presented. Due to the increase in the electron density the ‘ionisation per photon’ ratio, S/XB factor, is significantly enhanced compared to unperturbed plasma conditions. The impact of the amount of material ablated and of the plasma conditions before LIAS on the level of the S/XB-enhancement is investigated.

  19. Large positive correlation between the effective electron mass and the multipolar fluctuation in the heavy-fermion metal Ce1-xLaxB6 (United States)

    Jang, Dongjin; Portnichenko, Pavlo Y.; Cameron, Alistair S.; Friemel, Gerd; Dukhnenko, Anatoliy V.; Shitsevalova, Natalya Y.; Filipov, Volodymyr B.; Schneidewind, Astrid; Ivanov, Alexandre; Inosov, Dmytro S.; Brando, Manuel


    For the last few decades, researchers have been intrigued by multipolar ordering phenomena and related quantum phase transitions in heavy-fermion Kondo systems. However, a criticality induced by substitution level (x), temperature (T), or magnetic field (B) is poorly understood even in the prototypical material, Ce1-xLaxB6, despite a large collection of experimental results is available. In this work, we present T-B, x-T, and x-B phase diagrams of Ce1-xLaxB6 (B || [110]). These are completed by investigating heat capacity, magnetocaloric effect (MCE), and elastic neutron scattering. A drastic increase of the Sommerfeld coefficient γ0, which is estimated from the heat capacity down to 0.05 K, is observed with increasing x. The precise T-B phase diagram including a high-entropy region is derived from the MCE analysis in which a knowledge beyond the equilibrium thermodynamics is involved. Finally, the x-B phase diagram at T = 0, which supports the existence of a quantum critical point at x > 0.75, is obtained by the same analysis. A detailed interpretation of phase diagrams strongly indicates positive correlation between the fluctuating multipoles and the effective electron mass.

  20. Interventricular comparison of the energetics of contraction of trabeculae carneae isolated from the rat heart. (United States)

    Han, June-Chiew; Taberner, Andrew J; Nielsen, Poul M F; Loiselle, Denis S


    We compare the energetics of right ventricular and left ventricular trabeculae carneae isolated from rat hearts. Using our work-loop calorimeter, we subjected trabeculae to stress-length work (W), designed to mimic the pressure-volume work of the heart. Simultaneous measurement of heat production (Q) allowed calculation of the accompanying change of enthalpy (H = W + Q). From the mechanical measurements (i.e. stress and change of length), we calculated work, shortening velocity and power. In combination with heat measurements, we calculated activation heat (Q(A)), crossbridge heat (Q(xb)) and two measures of cardiac efficiency: 'mechanical efficiency' ((mech) = W/H) and 'crossbridge efficiency' ((xb) = W/(H - Q(A))). With respect to their left ventricular counterparts, right venticular trabeculae have higher peak shortening velocity, and higher peak mechanical efficiency, but with no difference of stress development, twitch duration, work performance, shortening power or crossbridge efficiency. That is, the 35% greater maximum mechanical efficiency of right venticular than left ventricular trabeculae (13.6 vs. 10.2%) is offset by the greater metabolic cost of activation (Q(A)) in the latter. When corrected for this difference, crossbridge efficiency does not differ between the ventricles.

  1. Synthetic alienation of microbial organisms by using genetic code engineering: Why and how? (United States)

    Kubyshkin, Vladimir; Budisa, Nediljko


    The main goal of synthetic biology (SB) is the creation of biodiversity applicable for biotechnological needs, while xenobiology (XB) aims to expand the framework of natural chemistries with the non-natural building blocks in living cells to accomplish artificial biodiversity. Protein and proteome engineering, which overcome limitation of the canonical amino acid repertoire of 20 (+2) prescribed by the genetic code by using non-canonic amino acids (ncAAs), is one of the main focuses of XB research. Ideally, estranging the genetic code from its current form via systematic introduction of ncAAs should enable the development of bio-containment mechanisms in synthetic cells potentially endowing them with a "genetic firewall" i.e. orthogonality which prevents genetic information transfer to natural systems. Despite rapid progress over the past two decades, it is not yet possible to completely alienate an organism that would use and maintain different genetic code associations permanently. In order to engineer robust bio-contained life forms, the chemical logic behind the amino acid repertoire establishment should be considered. Starting from recent proposal of Hartman and Smith about the genetic code establishment in the RNA world, here the authors mapped possible biotechnological invasion points for engineering of bio-contained synthetic cells equipped with non-canonical functionalities. Copyright © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.


    Kelić, Katarina; Matić, Sanja; Marović, Danijela; Klarić, Eva; Tarle, Zrinka


    The aim of the study was to determine microhardness of high- and low-viscosity bulk-fill composite resins and compare it with conventional composite materials. Four materials of high-viscosity were tested, including three bulk-fills: QuiXfi l (QF), x-tra fi l (XTF) and Tetric EvoCeram Bulk Fill (TEBCF), while nanohybrid composite GrandioSO (GSO) served as control. The other four were low-viscosity composites, three bulk-fill materials: Smart Dentin Replacement (SDR), Venus Bulk Fill (VBF) and x-tra base (XB), and conventional control material X-Flow (XF). Composite samples (n=5) were polymerized for 20 s with Bluephase G2 curing unit. Vickers hardness was used to determine microhardness of each material at the surface, and at 2-mm and 4-mm depth. GSO on average recorded significantly higher microhardness values than bulk-fill materials (pcomposite XF revealed similar microhardness values as SDR, but significantly lower than XB (pmaterials was lower than microhardness of the conventional composite material (GSO). Surface microhardness of low-viscosity materials was generally even lower. The microhardness of all tested materials at 4 mm was not different from their surface values. However, additional capping layer was a necessity for low-viscosity bulk-fill materials due to their low microhardness.

  3. Dosimetric comparison between VMAT with different dose calculation algorithms and protons for soft-tissue sarcoma radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Fogliata, Antonella [Oncology Inst. of Southern Switzerland, Medical Physics Unit, Bellinzona (Switzerland)], e-mail:; Scorsetti, Marta; Navarria, Piera [IRCCS Instituto Clinico Humanitas, Radiation Oncology, Rozzano, Milan (Italy)] [and others


    Background: To appraise the potential of volumetric modulated arc therapy (VMAT, RapidArc) and proton beams to simultaneously achieve target coverage and enhanced sparing of bone tissue in the treatment of soft-tissue sarcoma with adequate target coverage. Material and methods: Ten patients presenting with soft-tissue sarcoma of the leg were collected for the study. Dose was prescribed to 66.5 Gy in 25 fractions to the planning target volume (PTV) while significant maximum dose to the bone was constrained to 50 Gy. Plans were optimised according to the RapidArc technique with 6 MV photon beams or for intensity modulated protons. RapidArc photon plans were computed with: 1) AAA; 2) Acuros XB as dose to medium; and 3) Acuros XB as dose to water. Results: All plans acceptably met the criteria of target coverage (V{sub 95%} >90-95%) and bone sparing (D{sub 1cm}{sup 3} <50 Gy). Significantly higher PTV dose homogeneity was found for proton plans. Near-to-maximum dose to bone was similar for RapidArc and protons, while volume receiving medium/low dose levels was minimised with protons. Similar results were obtained for the remaining normal tissue. Dose distributions calculated with the dose to water option resulted 5% higher than corresponding ones computed as dose to medium. Conclusion: High plan quality was demonstrated for both VMAT and proton techniques when applied to soft-tissue sarcoma.


    Sahatçiu-Meka, Vjollca; Rexhepi, Sylejman; Manxhuka-Kerliu, Suzana; Pallaska, Kelmend; Murtezani, Ardiana; Osmani-Vllasolli, Teuta; Rexhepi, Mjellma; Rexhepi, Blerta


    The purpose of this study was to explore the relationship between disability status and duration of morning stiffness in hands with regard to age, level of education, and gender in patients with rheumatoid arthritis (RA). Also, the authors wanted to investigate this relationship with regard to the presence of rheumatoid factor, i.e., the serological status. A retrospective study was conducted in 250 patients with the classic form of RA (186 females, s64 males, mean age Xb = 49.96 y ears, range 25-60 years, disease duration 1-27 years, Xb = 6.41) previously diagnosed with RA according to the ACR (American College of Rheumatology 1987 criteria). All patients were in Steinbrocker functional classes II and III. The probability level was expressed by p 0.05) seronegative, (r = 0.12, y = 0.00x + 2.30, p > 0.05) seropositive]. High positive values were obtained for the linear correlation coefficient between duration of the disease and functional class (p educational level, and was more pronounced in older age, regardless of RA serological status. With regard to serological status and sex, the differences were non-significant.

  5. Measurements of gross erosion of Al in the DIII-D divertor

    Energy Technology Data Exchange (ETDEWEB)

    Chrobak, C., E-mail: [General Atomics, P.O. Box 85608, San Diego, CA 92186-5608 (United States); Stangeby, P.C. [University of Toronto Institute for Aerospace Studies, Toronto M3H 5T6 (Canada); Leonard, A.W. [General Atomics, P.O. Box 85608, San Diego, CA 92186-5608 (United States); Rudakov, D.L. [University of California San Diego, 9500 Gilman Dr., La Jolla, CA 92093-0417 (United States); Wong, C.P.C. [General Atomics, P.O. Box 85608, San Diego, CA 92186-5608 (United States); McLean, A.G. [Lawrence Livermore National Laboratory, 700 East Ave, Livermore, CA 94550 (United States); Wright, G.M. [Massachusetts Institute of Technology, 77 Massachusetts Ave, Cambridge, MA 02139 (United States); Buchenauer, D.A.; Watkins, J.G.; Wampler, W.R. [Sandia National Laboratory, P.O. Box 5800, Albuquerque, NM 87185 (United States); Elder, J.D. [University of Toronto Institute for Aerospace Studies, Toronto M3H 5T6 (Canada); Doerner, R.P.; Nishijima, D.; Tynan, G.R. [University of California San Diego, 9500 Gilman Dr., La Jolla, CA 92093-0417 (United States)


    Aluminum (Al) is a convenient proxy for beryllium (Be) plasma material interaction studies since they have a number of physical and chemical similarities. Al samples were exposed at the lower outer strike point of an L-mode divertor plasma in DIII-D (conditions 7–11 × 10{sup 18} D-ions cm{sup −2} s{sup −1}, T{sub e} = 12–47 eV). The gross erosion rate was directly measured using post-mortem ion beam analysis of small 1 mm-sized samples where local re-deposition was determined to be negligible. The gross erosion rate was also calculated using spectroscopic methods, but these rates greatly underestimate the direct (i.e. non-spectroscopic) measurement. The direct measured erosion yields were within the range of published D{sup +} → Al ion beam sputtering yields. The ionizations per photon (S/XB) coefficients used in the spectroscopic analysis were determined in separate experiments using He plasmas at the PISCES-B linear plasma facility at UCSD. The measured S/XB coefficients were on average ∼6× higher than the theoretically calculated values.

  6. Gleaning Structure from Sound: The Role of Prosodic Contrast in Learning Non-adjacent Dependencies. (United States)

    Grama, Ileana C; Kerkhoff, Annemarie; Wijnen, Frank


    The ability to detect non-adjacent dependencies (i.e. between a and b in aXb) in spoken input may support the acquisition of morpho-syntactic dependencies (e.g. The princess is kiss ing the frog). Functional morphemes in morpho-syntactic dependencies are often marked by perceptual cues that render them distinct from lexical elements. We use an artificial grammar learning experiment with adults to investigate the role of perceptual cues in non-adjacent dependency learning, by manipulating the perceptual/prosodic properties of the a / b elements in aXb strings and testing participants' incidental learning of these dependencies. Our results show that non-adjacent dependencies are learned both when the dependent elements are perceptually prominent, and when they are perceptually reduced compared to the intervening material (in the same way that functional words are reduced compared to lexical words), but only if integrated into a natural prosodic contour. This result supports the idea that the prosodic properties of natural languages facilitate non-adjacent dependency learning.

  7. Chromatographic column evaluation for the untargeted profiling of glucosinolates in cauliflower by means of ultra-high performance liquid chromatography coupled to high resolution mass spectrometry. (United States)

    Capriotti, Anna Laura; Cavaliere, Chiara; La Barbera, Giorgia; Montone, Carmela Maria; Piovesana, Susy; Zenezini Chiozzi, Riccardo; Laganà, Aldo


    The untargeted profiling is a promising approach for the characterization of secondary metabolites in biological matrices. Thanks to the recent rapid development of high-resolution mass spectrometry (HRMS) instrumentations, the number of applications by untargeted approaches for biological samples profiling has widely increased in the recent years. Despite the high potentialities of HRMS, however, a major issue in natural products analysis often arises in the upstream process of compounds separation. A separation technique is necessary to avoid phenomena such as signal suppression, and it is especially needed in the presence of isomeric metabolites, which are otherwise indistinguishable. Glucosinolates (GLSs), a group of secondary metabolites widely distributed among plants, resulted to be associated to the prevention of some serious diseases, such as cancer. This led to the development of several methods for the analysis of GLSs in vegetables tissues. The issue of GLSs chromatographic separation has been widely studied in the past because of the difficulty in the analysis of this highly polar and variable class of compounds. Several alternatives to reversed phase (RP) chromatography, sometimes not compatible with the coupling of liquid chromatography with mass spectrometry, have been tested for the analysis of intact GLSs. However, the availability of new stationary phases, in the last years, could allow the re-evaluation of RP chromatography for the analysis of intact GLSs. In this work, a thorough evaluation of four RP chromatographic columns for the analysis of GLSs in cauliflower (Brassica oleracea L. var. botrytis) extracts by an ultra-high performance liquid chromatographic system coupled via electrospray source to a hybrid quadrupole-Orbitrap mass spectrometer is presented. The columns tested were the following: one column Luna Omega polar C18, one column Kinetex Biphenyl, one column Kinetex core-shell XB-C18, two columns Kinetex core-shell XB-C18. After a

  8. Evolution of surfaces properties for 100Cr6 steel by implantation and ionic mixing; Evolution des proprietes de surface de l`acier 100Cr6 par implantation et melange ioniques

    Energy Technology Data Exchange (ETDEWEB)

    Faussemagne, A.


    Physico-chemical characterizations performed on samples of 100Cr6 steel implanted both with boron and nitrogen revealed the formation of boron nitride along with the following new phases: Fe{sub 1-x}(B, N), Fe{sub 2-x}(B, N) and Fe{sub 3-x}(B, N). A thorough analysis of boron NITRIDE (5BN) indicates that a low ion current density (3 {mu}{sup -2}) in the case of the boron plus nitrogen sequence favours the formation of sp{sup 2} bonds (hexagonal-BN) while a higher ion current density (6{mu}{sup -2}) promotes sp{sup 3} bonds (cubic-BN) in the opposite sequence. Tribological tests carried out on these samples revealed that nitrogen and boron implantations do not lead to any significant improvement of friction and wear at variance with the results obtained by others authors. However, on a set samples accidentally contaminated with carbon during implantation, we noticed a considerable improvement of these tribological parameters. As this pollution is commonly encountered in surface treatment by ion beams, one can invoke this phenomenon to explain the origin of the discrepancy reported by the literature. Extensive investigations allowed us to conclude that surface carbon, whatever its origin (contamination, ion implantation or ion beam mixed coating), provided that its amount is sufficiently high ({>=}2 x 10{sup 16}{sup -2}), decreases the coefficient of friction by a factor 5 and reduces drastically ({approx} 100) the wear. A careful examination of the whole results led us to propose a theoretical model, based on the role of the asperities of the two bodies in contact, to explain the evolution of the coefficient of friction and wear with the amount of surface carbon. This analysis revealed that in order to improve friction and wear of 100Cr6 steel, one needs to coat this material with a well adherent carbon layer having a thickness higher than the asperity heights of the two bodies in contact. Finally, this study allowed us to develop a simple lower

  9. A model-based 3D patient-specific pre-treatment QA method for VMAT using the EPID (United States)

    McCowan, P. M.; Asuni, G.; van Beek, T.; van Uytven, E.; Kujanpaa, K.; McCurdy, B. M. C.


    This study reports the development and validation of a model-based, 3D patient dose reconstruction method for pre-treatment quality assurance using EPID images. The method is also investigated for sensitivity to potential MLC delivery errors. Each cine-mode EPID image acquired during plan delivery was processed using a previously developed back-projection dose reconstruction model providing a 3D dose estimate on the CT simulation data. Validation was carried out using 24 SBRT-VMAT patient plans by comparing: (1) ion chamber point dose measurements in a solid water phantom, (2) the treatment planning system (TPS) predicted 3D dose to the EPID reconstructed 3D dose in a solid water phantom, and (3) the TPS predicted 3D dose to the EPID and our forward predicted reconstructed 3D dose in the patient (CT data). AAA and AcurosXB were used for TPS predictions. Dose distributions were compared using 3%/3 mm (95% tolerance) and 2%/2 mm (90% tolerance) γ-tests in the planning target volume (PTV) and 20% dose volumes. The average percentage point dose differences between the ion chamber and the EPID, AcurosXB, and AAA were 0.73  ±  1.25%, 0.38  ±  0.96% and 1.06  ±  1.34% respectively. For the patient (CT) dose comparisons, seven (3%/3 mm) and nine (2%/2 mm) plans failed the EPID versus AAA. All plans passed the EPID versus Acuros XB and the EPID versus forward model γ-comparisons. Four types of MLC sensitive errors (opening, shifting, stuck, and retracting), of varying magnitude (0.2, 0.5, 1.0, 2.0 mm), were introduced into six different SBRT-VMAT plans. γ-comparisons of the erroneous EPID dose and original predicted dose were carried out using the same criteria as above. For all plans, the sensitivity testing using a 3%/3 mm γ-test in the PTV successfully determined MLC errors on the order of 1.0 mm, except for the single leaf retraction-type error. A 2%/2 mm criteria produced similar results with two more additional detected

  10. Myasthénie juvénile oculaire en Afrique Subsaharienne: cas de deux sœurs germaines issues d’un mariage consanguin au Togo (United States)

    Maneh, Nidain; Apetse, Kossivi; Diatewa, Bénédicte Marèbe; Domingo, Sidik Abou-Bakr; Agba, Aidé Isabelle; Ayena, Koffi Didier; Balogou, Koffi Agnon; Balo, Komi Patrice


    La myasthénie est une pathologie auto-immune acquise rare à l'origine de la déficience de la transmission neuro-musculaire dont la forme juvénile se manifeste souvent par une atteinte oculaire exclusive. Nous rapportons deux cas de myasthénie juvénile oculaire (MJO) au sein d'une même fratrie. il s'agit de deux fillettes XA et XB respectivement âgées de 11 et 9 ans d'origine malienne résidant au Togo, issues d'un mariage consanguin de 1er degré, amenées en consultation d'ophtalmologie, pour une baisse progressive de l'acuité visuelle (AV). XA avait aux deux yeux, une AV à 8/10 et XB, une AV de 3/10 améliorée au trou sténopéïque à 7/10 en faveur d'une amétropie. XA présentait un ptosis bilatéral qui remontait à l'âge de 2 ans avec une action du releveur de la paupière supérieure (RPS) à 7 mm et XB, un ptosis bilatéral remontant à l'âge de 3 ans avec une action du RPS nulle. Pour les deux, le test au glaçon était franchement positif, le signe de Cogan présent avec une parésie oculo motrice sans diplopie. Le dosage des auto-anticorps anti récepteurs de l'acéthylcholine était normal. Le diagnostic de MJO associée à une amétropie a été évoqué. Une correction optique de l'amétropie par des lunettes et un traitement spécifique par la pyridostigmine avait été instaurée mais les patientes ont été perdues de vue. la myasthénie auto-immune avec des manifestations ophtalmologiques inaugurales est rare mais possible chez l'enfant en Afrique subsaharienne où des études sont nécessaires pour y déterminer les éventuelles particularités de la maladie. PMID:29230265

  11. A model-based 3D patient-specific pre-treatment QA method for VMAT using the EPID. (United States)

    McCowan, P M; Asuni, G; van Beek, T; van Uytven, E; Kujanpaa, K; McCurdy, B M C


    This study reports the development and validation of a model-based, 3D patient dose reconstruction method for pre-treatment quality assurance using EPID images. The method is also investigated for sensitivity to potential MLC delivery errors. Each cine-mode EPID image acquired during plan delivery was processed using a previously developed back-projection dose reconstruction model providing a 3D dose estimate on the CT simulation data. Validation was carried out using 24 SBRT-VMAT patient plans by comparing: (1) ion chamber point dose measurements in a solid water phantom, (2) the treatment planning system (TPS) predicted 3D dose to the EPID reconstructed 3D dose in a solid water phantom, and (3) the TPS predicted 3D dose to the EPID and our forward predicted reconstructed 3D dose in the patient (CT data). AAA and AcurosXB were used for TPS predictions. Dose distributions were compared using 3%/3 mm (95% tolerance) and 2%/2 mm (90% tolerance) γ-tests in the planning target volume (PTV) and 20% dose volumes. The average percentage point dose differences between the ion chamber and the EPID, AcurosXB, and AAA were 0.73  ±  1.25%, 0.38  ±  0.96% and 1.06  ±  1.34% respectively. For the patient (CT) dose comparisons, seven (3%/3 mm) and nine (2%/2 mm) plans failed the EPID versus AAA. All plans passed the EPID versus Acuros XB and the EPID versus forward model γ-comparisons. Four types of MLC sensitive errors (opening, shifting, stuck, and retracting), of varying magnitude (0.2, 0.5, 1.0, 2.0 mm), were introduced into six different SBRT-VMAT plans. γ-comparisons of the erroneous EPID dose and original predicted dose were carried out using the same criteria as above. For all plans, the sensitivity testing using a 3%/3 mm γ-test in the PTV successfully determined MLC errors on the order of 1.0 mm, except for the single leaf retraction-type error. A 2%/2 mm criteria produced similar results with two more additional detected

  12. Monoterpenyl Glycosyltransferases Differentially Contribute to Production of Monoterpenyl Glycosides in Two Aromatic Vitis vinifera Varieties. (United States)

    Li, Xiang-Yi; Wen, Ya-Qin; Meng, Nan; Qian, Xu; Pan, Qiu-Hong


    HIGHLIGHTS A similar trend on accumulation of glycosidically bound monoterpenes was observed in both varietiesTwo VvGT7 alleles mutations occurred at key sites in Muscat blanc à PetitVvGT14 exerted a major role in production of monoterpenyl glycosides in both varieties Terpenoids are the major aroma components and generally exist as both free and glycosidically-bound forms, of which nonvolatile glycosides account for a large fraction in grape berries. Our previous study has indicated that differential accumulation of monoterpenyl glycosides in Vitis vinifera "Muscat blanc à Petit" between two regions is closely correlated to monoterpenyl glucosyltransferase (VvGT14, XM_002285734.2) transcript abundance. However, it has not been determined yet whether this correlation also exists in other Vitis vinifera varieties. This study investigated the evolution of free and glycosidically bound monoterpenes in two Vitis vinifera variety "Muscat blanc à Petit" and "Gewurztraminer" under two vintages, and further assessed the relation between the accumulation of bound monoterpenes and two monoterpenyl glycosyltransferase transcript levels. Results showed that free monoterpenes exhibited three evolution patterns in both varieties during berry development of two vintages, whereas glycosidically bound monoterpenes showed a concentration elevation with berry maturation. The Cis-rose oxide and geraniol were major components contributing to the aroma odors of "Gewürztraminer" grapes while linalool was major aroma contributor to the "Muscat blanc à Petit grain" grapes. The accumulation of glycosidically bound monoterpenes in both varieties was accompanied with the high expression of VvGT7 (XM_002276510.2) and VvGT14. Only one allele of VvGT7 was found in the variety "Gewürztraminer" and no mutation was observed in its enzyme active sites. XB-VvGT7-4 and XB-VvGT7-5 were two alleles of VvGT7 detected in "Muscat blanc à Petit grain." The mutation on its enzyme active site inhibited

  13. SU-D-204-07: Retrospective Correlation of Dose Accuracy with Regions of Local Failure for Early Stage Lung Cancer Patients Treated with Stereotactic Body Radiotherapy

    Energy Technology Data Exchange (ETDEWEB)

    Devpura, S; Li, H; Liu, C; Fraser, C; Ajlouni, M; Movsas, B; Chetty, I [Henry Ford Health System, Detroit, MI (United States)


    Purpose: To correlate dose distributions computed using six algorithms for recurrent early stage non-small cell lung cancer (NSCLC) patients treated with stereotactic body radiotherapy (SBRT), with outcome (local failure). Methods: Of 270 NSCLC patients treated with 12Gyx4, 20 were found to have local recurrence prior to the 2-year time point. These patients were originally planned with 1-D pencil beam (1-D PB) algorithm. 4D imaging was performed to manage tumor motion. Regions of local failures were determined from follow-up PET-CT scans. Follow-up CT images were rigidly fused to the planning CT (pCT), and recurrent tumor volumes (Vrecur) were mapped to the pCT. Dose was recomputed, retrospectively, using five algorithms: 3-D PB, collapsed cone convolution (CCC), anisotropic analytical algorithm (AAA), AcurosXB, and Monte Carlo (MC). Tumor control probability (TCP) was computed using the Marsden model (1,2). Patterns of failure were classified as central, in-field, marginal, and distant for Vrecur ≥95% of prescribed dose, 95–80%, 80–20%, and ≤20%, respectively (3). Results: Average PTV D95 (dose covering 95% of the PTV) for 3-D PB, CCC, AAA, AcurosXB, and MC relative to 1-D PB were 95.3±2.1%, 84.1±7.5%, 84.9±5.7%, 86.3±6.0%, and 85.1±7.0%, respectively. TCP values for 1-D PB, 3-D PB, CCC, AAA, AcurosXB, and MC were 98.5±1.2%, 95.7±3.0, 79.6±16.1%, 79.7±16.5%, 81.1±17.5%, and 78.1±20%, respectively. Patterns of local failures were similar for 1-D and 3D PB plans, which predicted that the majority of failures occur in centraldistal regions, with only ∼15% occurring distantly. However, with convolution/superposition and MC type algorithms, the majority of failures (65%) were predicted to be distant, consistent with the literature. Conclusion: Based on MC and convolution/superposition type algorithms, average PTV D95 and TCP were ∼15% lower than the planned 1-D PB dose calculation. Patterns of failure results suggest that MC and convolution

  14. X-ray Follow-ups of XSS J12270-4859: A Low-mass X-ray Binary with Gamma-ray Fermi-LAT Association (United States)

    deMartino, D.; Belloni, T.; Falanga, M.; Papitto, A.; Motta, S.; Pellizzoni, A.; Evangelista, Y.; Piano, G.; Masetti, N.; Mouchet, M.; hide


    Context. XSS J1227.0-4859 is a peculiar, hard X-ray source recently positionally associated to the Fermi-LAT source 1FGL J1227.9- 4852/2FGL J1227.7-4853. Multi-wavelength observations have added information on this source, indicating a low-luminosity lowmass X-ray binary (LMXB), but its nature is still unclear. Aims. To progress in our understanding, we present new X-ray data from a monitoring campaign performed in 2011 with the XMM-Newton, RXTE, and Swift satellites and combine them with new gamma-ray data from the Fermi and AGILE satellites. We complement the study with simultaneous near-UV photometry from XMM-Newton and with previous UV/optical and near-IR data. Methods. We analysed the temporal characteristics in the X-rays, near-UV, and gamma rays and studied the broad-band spectral energy distribution from radio to gamma rays. Results. The X-ray history of XSS J1227 over 7 yr shows a persistent and rather stable low-luminosity (6 × 1033 d2 1 kpcerg s-1) source, with flares and dips being peculiar and permanent characteristics. The associated Fermi-LAT source 2FGL J1227.7-4853 is also stable over an overlapping period of 4.7 yr. Searches for X-ray fast pulsations down to msec give upper limits to pulse fractional amplitudes of 15-25% that do not rule out a fast spinning pulsar. The combined UV/optical/near-IR spectrum reveals a hot component at approximately 13 kK and a cool one at approximately 4.6 kK. The latter would suggest a late-type K2-K5 companion star, a distance range of 1.4-3.6 kpc, and an orbital period of 7-9 h. A near-UV variability (6 h) also suggests a longer orbital period than previously estimated. Conclusions. The analysis shows that the X-ray and UV/optical/near-IR emissions are more compatible with an accretion-powered compact object than with a rotational powered pulsar. The X-ray to UV bolometric luminosity ratio could be consistent with a binary hosting a neutron star, but the uncertainties in the radio data may also allow an LMXB

  15. Evolution towards and beyond accretion-induced collapse of massive white dwarfs and formation of millisecond pulsars (United States)

    Tauris, T. M.; Sanyal, D.; Yoon, S.-C.; Langer, N.


    Context. Millisecond pulsars (MSPs) are generally believed to be old neutron stars (NSs), formed via type Ib/c core-collapse supernovae (SNe), which have been spun up to high rotation rates via accretion from a companion star in a low-mass X-ray binary (LMXB). In an alternative formation channel, NSs are produced via the accretion-induced collapse (AIC) of a massive white dwarf (WD) in a close binary. Aims: Here we investigate binary evolution leading to AIC and examine if NSs formed in this way can subsequently be recycled to form MSPs and, if so, how they can observationally be distinguished from pulsars formed via the standard core-collapse SN channel in terms of their masses, spins, orbital periods and space velocities. Methods: Numerical calculations with a detailed stellar evolution code were used for the first time to study the combined pre- and post-AIC evolution of close binaries. We investigated the mass transfer onto a massive WD (treated as a point mass) in 240 systems with three different types of non-degenerate donor stars: main-sequence stars, red giants, and helium stars. When the WD is able to accrete sufficient mass (depending on the mass-transfer rate and the duration of the accretion phase) we assumed it collapses to form a NS and we studied the dynamical effects of this implosion on the binary orbit. Subsequently, we followed the mass-transfer epoch which resumes once the donor star refills its Roche lobe and calculated the continued LMXB evolution until the end. Results: We show that recycled pulsars may form via AIC from all three types of progenitor systems investigated and find that the final properties of the resulting MSPs are, in general, remarkably similar to those of MSPs formed via the standard core-collapse SN channel. However, as a consequence of the fine-tuned mass-transfer rate necessary to make the WD grow in mass, the resultant MSPs created via the AIC channel preferentially form in certain orbital period intervals. In addition

  16. ANTARES: An Undersea Neutrino telescope

    CERN Multimedia


    The ANTARES (Astronomy with a Neutrino Telescope and ${Abyss}$ environmental RESearch) deep-sea neutrino telescope is designed to search for neutrinos of astrophysical origin. Neutrinos are unique probes of the high energy universe; being neutral they are not deflected by magnetic fields and interacting weakly they can readily escape from the densest regions of the universe. Potential sources of neutrino are galactic (e.g supernova remnants, micro-quasars) and extra-galactic (e.g active galactic nuclei, gamma-ray bursters). Annihilation of dark matter particles in the Sun or Galactic Centre is another well motivated potential source of extra terrestrial neutrinos. The ANTARES detector is located 40 km off the coast of Toulon (France) at a depth of 2475m in the Mediterranean Sea. Being located in the Northern hemisphere it studies the Southern sky and in particular has the Galactic Centre in its field of view. Since 2006, the detector has operated continuously in a partial configuration. The detector was compl...

  17. NuSTAR Observation Of A Type I X-Ray Burst From GRS 1741.9-2853

    DEFF Research Database (Denmark)

    Barriere, Nicolas M.; Krivonos, Roman; Tomsick, John A.


    s-1 in a second observation on 2013 August 3. A bright, 800 s long, H-triggered mixed H/He thermonuclear Type I burst with mild photospheric radius expansion (PRE) was present during the second observation. Assuming that the luminosity during the PRE was at the Eddington level, an H mass fraction X......We report on two NuSTAR observations of GRS 1741.9-2853, a faint neutron star (NS) low-mass X-ray binary burster located 10' away from the Galactic center. NuSTAR detected the source serendipitously as it was emerging from quiescence: its luminosity was 6x1034 erg s-1 on 2013 July 31 and 5x1035 erg...... of the burst, reminiscent of the detection by Waki et al. We propose that the line, if real, is formed in the wind above the photosphere of the NS by a resonant K alpha transition from H-like Cr gravitationally redshifted by a factor 1 + z = 1.09, corresponding to a radius range of 29.0-41.4 km for a mass...

  18. Protostellar Jets in Context

    CERN Document Server

    Tsinganos, Kanaris; Stute, Matthias


    This volume contains the proceedings of the Conference Protostellar Jets in Context held by the JETSET Marie Curie Research Training Network in July 2008. This meeting not only served to showcase some of the network's achievements but was also a platform to hear from, discuss and debate the recent findings of world-class astrophysicists in the field of protostellar jet research. Jets from young stars are of course not an isolated astrophysical phenomenon. It is known that objects as diverse as young brown dwarfs, planetary nebulae, symbiotic stars, micro-quasars, AGN, and gamma-ray bursters produce jets. Thus in a series of talks, protostellar jets were put in context by comparing them with their often much larger brethren and also by considering the ubiquitous accretion disks that seem to be necessary for their formation. With this spectrum of contributions on observations and the theory of astrophysical jets and accretion disks, this book serves as a comprehensive reference work for researchers and students...

  19. Time Domain Astronomy with Fermi GBM in the Multi-messenger Era (United States)

    Wilson-Hodge, Colleen A.; Fermi GBM team, GBM-LIGO team


    As the Multi-Messenger era begins with detections of gravitational waves with LIGO/Virgo and neutrinos with IceCube, the Fermi Gamma-ray Burst Monitor (GBM) provides context observations of gamma-ray transients between 8 keV and 40 MeV. Fermi GBM has a wide field of view, high uptime, and both in-orbit triggering and high time resolution continuous data enabling offline searches for weaker transients. GBM detects numerous gamma-ray bursts (GRBs), soft gamma-ray repeaters, X-ray bursters, solar flares and terrestrial gamma-ray flashes. Longer timescale transients, predominantly in our galaxy so far, are detected using the Earth occultation technique and epoch-folding for periodic sources. The GBM team has developed two ground-based searches to enhance detections of faint transients, especially short GRBs. The targeted search uses the time and location of an event detected with another instrument to coherently search the GBM data, increasing the sensitivity to a transient. The untargeted search agnostically searches the GBM data for all directions and times to find weaker transients. This search finds about 80 short GRBs per year, adding to the 40 per year triggered on-orbit. With its large field of view, high duty cycle and increasingly sophisticated detection methods, Fermi GBM is expected to have a major role in the Multi-Messenger era.

  20. Quantum-Gravity Analysis of Gamma-Ray Bursts using Wavelets

    CERN Document Server

    Ellis, Jonathan Richard; Nanopoulos, Dimitri V; Sakharov, Alexander S; Nanopoulos, Dimitri V; Mavromatos, Nikolaos E


    In some models of quantum gravity, space-time is thought to have a foamy structure with non-trivial optical properties. We probe the possibility that photons propagating in vacuum may exhibit a non-trivial refractive index, by analyzing the times of flight of radiation from gamma-ray bursters (GRBs) with known redshifts. We use a wavelet shrinkage procedure for noise removal and a wavelet `zoom' technique to define with high accuracy the timings of sharp transitions in GRB light curves, thereby optimizing the sensitivity of experimental probes of any energy dependence of the velocity of light. We apply these wavelet techniques to 64 ms and TTE data from BATSE, and also to OSSE data. A search for time lags between sharp transients in GRB light curves in different energy bands yields the lower limit $M \\ge 6.9 \\cdot 10^{15}$ GeV on the quantum-gravity scale in any model with a linear dependence of the velocity of light $~ E/M$. We also present a limit on any quadratic dependence.

  1. The Fermi-GBM Three-year X-Ray Burst Catalog (United States)

    Jenke, P. A.; Linares, M.; Connaughton, V.; Beklen, E.; Camero-Arranz, A.; Finger, M. H.; Wilson-Hodge, C. A.


    The Fermi Gamma-ray Burst Monitor (GBM) is an all-sky gamma-ray monitor well known in the gamma-ray burst (GRB) community. Although GBM excels in detecting the hard, bright extragalactic GRBs, its sensitivity above 8 keV and its all-sky view make it an excellent instrument for the detection of rare, short-lived Galactic transients. In 2010 March, we initiated a systematic search for transients using GBM data. We conclude this phase of the search by presenting a three-year catalog of 1084 X-ray bursts. Using spectral analysis, location, and spatial distributions we classified the 1084 events into 752 thermonuclear X-ray bursts, 267 transient events from accretion flares and X-ray pulses, and 65 untriggered gamma-ray bursts. All thermonuclear bursts have peak blackbody temperatures broadly consistent with photospheric radius expansion (PRE) bursts. We find an average rate of 1.4 PRE bursts per day, integrated over all Galactic bursters within about 10 kpc. These include 33 and 10 bursts from the ultra-compact X-ray binaries 4U 0614+09 and 2S 0918-549, respectively. We discuss these recurrence times and estimate the total mass ejected by PRE bursts in our Galaxy.

  2. SKYNET: an efficient and robust neural network training tool for machine learning in astronomy (United States)

    Graff, Philip; Feroz, Farhan; Hobson, Michael P.; Lasenby, Anthony


    We present the first public release of our generic neural network training algorithm, called SKYNET. This efficient and robust machine learning tool is able to train large and deep feed-forward neural networks, including autoencoders, for use in a wide range of supervised and unsupervised learning applications, such as regression, classification, density estimation, clustering and dimensionality reduction. SKYNET uses a `pre-training' method to obtain a set of network parameters that has empirically been shown to be close to a good solution, followed by further optimization using a regularized variant of Newton's method, where the level of regularization is determined and adjusted automatically; the latter uses second-order derivative information to improve convergence, but without the need to evaluate or store the full Hessian matrix, by using a fast approximate method to calculate Hessian-vector products. This combination of methods allows for the training of complicated networks that are difficult to optimize using standard backpropagation techniques. SKYNET employs convergence criteria that naturally prevent overfitting, and also includes a fast algorithm for estimating the accuracy of network outputs. The utility and flexibility of SKYNET are demonstrated by application to a number of toy problems, and to astronomical problems focusing on the recovery of structure from blurred and noisy images, the identification of gamma-ray bursters, and the compression and denoising of galaxy images. The SKYNET software, which is implemented in standard ANSI C and fully parallelized using MPI, is available at

  3. XXII SLAC summer institute on particle physics: Proceedings. Particle physics, astrophysics and cosmology

    Energy Technology Data Exchange (ETDEWEB)

    Chan, J; DePorcel, L [eds.


    The seven-day school portion of the Institute revolved around the question of dark matter: where is it and what is it? Reviews were given of microlensing searches for baryonic dark matter, of dark matter candidates in the form of neutrinos and exotic particles, and of low-noise detection techniques used to search for the latter. The history of the universe, from the Big Bang to the role of dark matter in the formation of large-scale structure, was also covered. Other lecture series described the astrophysics that might be done with x-ray timing experiments and through the detection of gravitational radiation. As in past years, the lectures each morning were followed by stimulating afternoon discussion sessions, in which students could pursue with the lecturers the topics that most interested them. The Institute concluded with a three-day topical conference covering recent developments in theory and experiment. Highlights from the astrophysical and cosmological arenas included observations of anisotropy in the cosmic microwave background, and of the mysterious gamma-ray bursters. From terrestrial accelerators came tantalizing hints of the top quark and marked improvements in precision electroweak measurements, among many other results. Selected papers are indexed separately for inclusion in the Energy Science and Technology Database.

  4. The rarity of soft gamma-ray repeaters deduced from reactivation of SGR1806-20 (United States)

    Kouveliotou, C.; Fishman, G. J.; Meegan, C. A.; Paciesas, W.S.; Paradijs, J. Van; Norris, J. P.; Preece, R. D.; Briggs, M. S.; Horack, J. M.; Pendleton, G. N.; hide


    Only two different types of gamma-ray transient sources are presently known: over one thousand Gamma-Ray Bursters (GRBs) and only three Soft Gamma-Ray repeaters (SGRs). The latter are distinguished by their propensity for recurrent burst behaviour, in contrast to the nonrepeating GRB sources. Recurrent emission from one of the repeaters, SGR1900 + 14, has been detected earlier by the Burst and Transient Source Experiment (BATSE) aboard the Compton Gamma-Ray Observatory. Here we report renewed burst activity from SGR1806 - 20, the most prolific of the three known SGRs. This detection of reactivation of this source has been rapidly followed by identification of an X-ray counterpart, which also coincides with a compact radio source now identified as a plerionic (pulsar-powered) supernova remnant. In combination, these results are leading to a convergence of ideas about the nature of SGRs, which can now be firmly identified as neutron stars. That BATSE has detected no new sources in its two and a half years of operation indicates that SGRs are rare in our Galaxy.

  5. BATSE Observations of Gamma-Ray Burst Tails (United States)

    Connaughton, Valerie


    With the observation of low-energy radiation coming from the site of gamma-ray bursts in the hours to weeks after the initial gamma ray burst, it appears that astronomers have discovered a cosmological imprint made by the burster on its surroundings. This paper discusses the phenomenon of postburst emission in Burst and Transient Source Experiment (BATSE) gamma-ray bursts at energies usually associated with prompt emission. After summing up the background-subtracted signals from hundreds of bursts, it is found that tails out to hundreds of seconds after the trigger could be a common feature of events of a duration greater than 2 seconds, and perhaps of the shorter bursts at a lower and shorter-lived level. The tail component may be softer and seems independent of the duration (within the long-GRB sample) and brightness of the prompt burst emission. Some individual bursts have visible tails at gamma-ray energies, and the spectrum in a few cases differs from that of the prompt emission. For one of these bursts, GRB 991216, afterglow at lower energies was detected, which raised the possibility of seeing afterglow observations over large energy ranges using the next generation of GRB detectors in addition to sensitive space- or ground-based telescopes.

  6. Flares from a new Integral hard X-ray source, IGR J17407-2808, likely associated with the ROSAT source SBM 10

    DEFF Research Database (Denmark)

    Kretschmar, P.; Mereghetti, S.; Hermsen, W.


    This new hard X-ray source, IGR J17407-2808, is positionally coincident with a faint ROSAT source listed as no. 10 in the catalogue of sources in the Galactic Center region by Sidoli, Belloni & Mereghetti 2001, A&A 368, 835 and as 2RXP J174040.9-280852 in the ROSAT Source Browser. No other......). The source was outside the FOV of the JEM-X and OMC monitor instruments during this flare. Note that the position of J17407-2808 is inconsistent with that of the X-ray burster SLX 1737-282 [AX J1740.7-2818] (in't Zand et al. 2002, A&A 389, L43), which is just ~11 arcmin away. The correct Integral attitude...... was not detected. The last flare, with peak fluxes of 0.8±0.1 Crab and 0.6±0.1 Crab in the energy ranges 20-40 keV and 40-60 keV respectively, triggered an automatic alert message of the Integral Burst Alert System (IBAS Alert #2010) which led to the discovery of the source (Gotz et al., GCN Circ. #2793...

  7. NICER Discovers mHz Oscillations and Marginally Stable Burning in GS 1826-24 (United States)

    Strohmayer, Tod E.; Gendreau, Keith C.; Keek, Laurens; Bult, Peter; Mahmoodifar, Simin; Chakrabarty, Deepto; Arzoumanian, Zaven; NICER Science Team


    To date, marginally stable thermonuclear burning, evidenced as mHz X-ray flux oscillations, has been observed in only five accreting neutron star binaries, 4U 1636-536, 4U 1608-52, Aql X-1, 4U 1323-619 and Terzan 5 X-2. Here we report the discovery with NASA's Neutron Star Interior Composition Explorer (NICER) of such oscillations from the well-known X-ray burster GS 1826-24. NICER observed GS 1826-24 on 9 September, 2017 for a total exposure of about 4 ksec. Timing analysis revealed highly significant oscillations at a frequency of 8.2 mHz in two successive pointings. The oscillations have a fractional modulation amplitude of approximately 3% for photon energies less than 6 keV. The observed frequency is consistent with the range observed in the other mHz QPO systems, and indeed is slightly higher than the frequency measured in 4U 1636-536 below which mHz oscillations ceased and unstable burning (X-ray bursts) resumed. We discuss the mass accretion rate dependence of the oscillations as well as the X-ray spectrum as a function of pulsation phase. We place the observations in the context of the current theory of marginally stable burning and briefly discuss the potential for constraining neutron star properties using mHz oscillations.

  8. Science from the first 10 months of observations from the Fermi Large Area Telescope

    CERN Document Server

    CERN. Geneva


    The Fermi observatory is an international, multi-agency satellite mission that was launched by NASA in june 2008 and has since then been exploring the high energy gamma-ray sky from 20 MeV to more than 300 GeV. This largely unexplored region of the electro-magnetic spectrum is home to emissions from the most energetic and mysterious objects in the cosmos, like black holes, active galactic nuclei, rapidly spinning neutron stars, supernovae remnants and gamma-ray bursters. Leveraging on the high instrument resolution and acceptance, and on an outstanding operation efficiency, the mission team has been able to record a remarkable variety of novel observations, spanning from astronomy to particle astrophysics with exciting implications on fundamental physics. At the same time the collaboration is preparing to deliver photon data and analysis tools to the public starting from the second year of operations, along with improved knowledge of the instrument performance. In this talk I will review some of the most inte...

  9. Intermittent synchronization in a network of bursting neurons. (United States)

    Park, Choongseok; Rubchinsky, Leonid L


    Synchronized oscillations in networks of inhibitory and excitatory coupled bursting neurons are common in a variety of neural systems from central pattern generators to human brain circuits. One example of the latter is the subcortical network of the basal ganglia, formed by excitatory and inhibitory bursters of the subthalamic nucleus and globus pallidus, involved in motor control and affected in Parkinson's disease. Recent experiments have demonstrated the intermittent nature of the phase-locking of neural activity in this network. Here, we explore one potential mechanism to explain the intermittent phase-locking in a network. We simplify the network to obtain a model of two inhibitory coupled elements and explore its dynamics. We used geometric analysis and singular perturbation methods for dynamical systems to reduce the full model to a simpler set of equations. Mathematical analysis was completed using three slow variables with two different time scales. Intermittently, synchronous oscillations are generated by overlapped spiking which crucially depends on the geometry of the slow phase plane and the interplay between slow variables as well as the strength of synapses. Two slow variables are responsible for the generation of activity patterns with overlapped spiking, and the other slower variable enhances the robustness of an irregular and intermittent activity pattern. While the analyzed network and the explored mechanism of intermittent synchrony appear to be quite generic, the results of this analysis can be used to trace particular values of biophysical parameters (synaptic strength and parameters of calcium dynamics), which are known to be impacted in Parkinson's disease.

  10. Flares from a candidate Galactic magnetar suggest a missing link to dim isolated neutron stars. (United States)

    Castro-Tirado, A J; de Ugarte Postigo, A; Gorosabel, J; Jelínek, M; Fatkhullin, T A; Sokolov, V V; Ferrero, P; Kann, D A; Klose, S; Sluse, D; Bremer, M; Winters, J M; Nuernberger, D; Pérez-Ramírez, D; Guerrero, M A; French, J; Melady, G; Hanlon, L; McBreen, B; Leventis, K; Markoff, S B; Leon, S; Kraus, A; Aceituno, F J; Cunniffe, R; Kubánek, P; Vítek, S; Schulze, S; Wilson, A C; Hudec, R; Durant, M; González-Pérez, J M; Shahbaz, T; Guziy, S; Pandey, S B; Pavlenko, L; Sonbas, E; Trushkin, S A; Bursov, N N; Nizhelskij, N A; Sánchez-Fernández, C; Sabau-Graziati, L


    Magnetars are young neutron stars with very strong magnetic fields of the order of 10(14)-10(15) G. They are detected in our Galaxy either as soft gamma-ray repeaters or anomalous X-ray pulsars. Soft gamma-ray repeaters are a rare type of gamma-ray transient sources that are occasionally detected as bursters in the high-energy sky. No optical counterpart to the gamma-ray flares or the quiescent source has yet been identified. Here we report multi-wavelength observations of a puzzling source, SWIFT J195509+261406. We detected more than 40 flaring episodes in the optical band over a time span of three days, and a faint infrared flare 11 days later, after which the source returned to quiescence. Our radio observations confirm a Galactic nature and establish a lower distance limit of approximately 3.7 kpc. We suggest that SWIFT J195509+261406 could be an isolated magnetar whose bursting activity has been detected at optical wavelengths, and for which the long-term X-ray emission is short-lived. In this case, a new manifestation of magnetar activity has been recorded and we can consider SWIFT J195509+261406 to be a link between the 'persistent' soft gamma-ray repeaters/anomalous X-ray pulsars and dim isolated neutron stars.

  11. The Hydraenidae of Cuba (Insecta: Coleoptera) II: Morphology of preimaginal stages of six species and notes on their biology. (United States)

    Deler-Hernández, Albert; Delgado, Juan A


    Preimaginal stages of the six species of Hydraenidae presently known from Cuba were obtained by rearing adults in the laboratory. Eggs of Hydraena perkinsi Spangler, 1980, H. decui Spangler, 1980 and H. franklyni Deler-Hernández & Delgado, 2012 are described and illustrated for the first time. The first instar larva of Gymnochthebius fossatus (LeConte, 1855) is redescribed, adding some new remarkable morphological characters including what could be the first abdominal egg-burster reported for this family. All larval instars of H. perkinsi, H. guadelupensis Orchymont, 1923 and Ochthebius attritus LeConte, 1878 are described and illustrated for the first time, with a special emphasis on their chaetotaxy. The second instar larva of G. fossatus along with first and third instar larvae of H. decui and H. franklyni are also studied for the first time. The pupal morphology and vestiture of a species belonging to the genus Hydraena are described for the first time, based on the pupa of H. perkinsi. Biological notes for several preimaginal stages of the studied species are also given.

  12. Gravitational redshift in Kerr-Newman geometry using gravity's rainbow (United States)

    Dubey, Anuj Kumar; Sen, A. K.; Mazumdar, Bijoy


    Gravitational redshift is generally reported by most of the authors without considering the influence of the energy of the test particle using various spacetime geometries such as Schwarzschild, Reissner-Nordstrom, Kerr and Kerr-Newman geometries for static, charged static, rotating and charged rotating objects respectively. In the present work, the general expression for the energy dependent gravitational redshift is derived for charged rotating body using the Kerr-Newman geometry along with the energy dependent gravity's rainbow function. It is found that the gravitational redshift is influenced by the energy of the photon. One may obtain greater correction in the value of gravitational redshift, using the high energy photons. Knowing the value of gravitational redshift from a high energy sources such as Gamma-ray Bursters (GRB), one may obtain the idea of upper bounds on the dimensionless rainbow function parameter (ξ). Also there may be a possibility to introduce a new physical scale of the order of ξ/E_{Pl}.

  13. Robust Limits on Lorentz Violation from Gamma-Ray Bursts

    CERN Document Server

    AUTHOR|(CDS)2108556; Nanopoulos, Dimitri V; Sakharov, Alexander S; Sarkisyan-Grinbaum, E; Ellis, John; Mavromatos, Nick E.; Nanopoulos, Dimitri V.; Sakharov, Alexander S.; Sarkisyan, Edward K.G.


    We constrain the possibility of a non-trivial refractive index in free space corresponding to an energy-dependent velocity of light: c(E) \\simeq c_0 (1 - E/M), where M is a mass scale that might represent effect of quantum-gravitational space-time foam, using the arrival times of sharp features observed in the intensities of radiation with different energies from a large sample of gamma-ray bursters (GRBs) with known redshifts. We use wavelet techniques to identify genuine features, which we confirm in simulations with artificial added noise. Using the weighted averages of the time-lags calculated using correlated features in all the GRB light curves, we find a systematic tendency for more energetic photons to arrive earlier. However, there is a very strong correlation between the parameters characterizing an intrinsic time-lag at the source and a distance-dependent propagation effect. Moreover, the significance of the earlier arrival times is less evident for a subsample of more robust spectral structures. A...

  14. Surveying the skies how astronomers map the universe

    CERN Document Server

    Wynn-Williams, Gareth


    Since the time of Galileo, astronomy has been driven by technological innovation. With each major advance has come the opportunity and enthusiasm to survey the sky in a way that was not possible before. It is these surveys of discovery that are the subject of this book. In the first few chapters the author discusses what astronomers learned from visible-light surveys, first with the naked eye, then using telescopes in the seventeenth century, and photography in the nineteenth century. He then moves to the second half of the twentieth century when the skies started to be swept by radio, infrared, ultraviolet, x-ray and gamma ray telescopes, many of which had to be flown in satellites above the Earth’s atmosphere. These surveys led to the discovery of pulsars, quasars, molecular clouds, protostars, bursters, and black holes. He then returns to Earth to describe several currently active large-scale projects that methodically collect images, photometry and spectra that are then stored in vast publicly-accessibl...

  15. Time Domain Astronomy with Fermi GBM in the Multi-messenger Era (United States)

    Wilson-Hodge, Colleen A.


    As the Multi-Messenger era begins with detections of gravitational waves with LIGO and neutrinos with IceCube, the Fermi Gamma-ray Burst Monitor provides context observations of gamma-ray transients between 8 keV and 40 MeV. Fermi GBM has a wide field of view, high uptime, and both in-orbit triggering and high time resolution continuous data enabling offline searches for weaker transients. GBM detects numerous gamma-ray bursts (GRBs), soft gamma-ray repeaters, X-ray bursters, solar flares and terrestrial gamma-ray flashes. Longer timescale transients, predominantly in our galaxy so far, are detected using the Earth occultation technique and epoch-folding for periodic sources. The GBM team has developed two ground-based searches to enhance detections of faint transients, especially short GRBs. The targeted search uses the time and location of an event detected with another instrument to coherently search the GBM data, increasing the sensitivity to a transient. The untargeted search agnostically searches the GBM data for all directions and times to find weaker transients. This search finds about 80 short GRBs per year, in addition to the 40 per year triggered on-orbit. With its large field of view, high duty cycle and increasingly sophisticated detection methods, Fermi GBM is expected to have a major role in the Multi-Messenger era.

  16. Frontiers in nuclear astrophysics (United States)

    Bertulani, C. A.; Kajino, T.


    The synthesis of nuclei in diverse cosmic scenarios is reviewed, with a summary of the basic concepts involved before a discussion of the current status in each case is made. We review the physics of the early universe, the proton to neutron ratio influence in the observed helium abundance, reaction networks, the formation of elements up to beryllium, the inhomogeneous Big Bang model, and the Big Bang nucleosynthesis constraints on cosmological models. Attention is paid to element production in stars, together with the details of the pp chain, the pp reaction, 3He formation and destruction, electron capture on 7Be, the importance of 8B formation and its relation to solar neutrinos, and neutrino oscillations. Nucleosynthesis in massive stars is also reviewed, with focus on the CNO cycle and its hot companion cycle, the rp-process, triple- α capture, and red giants and AGB stars. The stellar burning of carbon, neon, oxygen, and silicon is presented in a separate section, as well as the slow and rapid nucleon capture processes and the importance of medium modifications due to electrons also for pycnonuclear reactions. The nucleosynthesis in cataclysmic events such as in novae, X-ray bursters and in core-collapse supernovae, the role of neutrinos, and the supernova radioactivity and light-curve is further discussed, as well as the structure of neutron stars and its equation of state. A brief review of the element composition found in cosmic rays is made in the end.

  17. Thermal, structural and electrical studies of bismuth zinc borate glasses (United States)

    Shanmugavelu, B.; Ravi Kanth Kumar, V. V.


    Bismuth Zinc Borate glasses with compositions xBi2O3-30ZnO-(70 - x)B2O3 (where x = 30, 35, 40 and 45 mol %) have been prepared by melt quenching method. These glasses were characterized by X-ray diffraction (XRD), Differential Thermal Analysis (DTA), Fourier Transform Infrared Spectrometer (FTIR) and Broad Band Dielectric Spectrometer (BDS). DTA and FTIR analysis reveals that Non-Bridging Oxygens (NBOs) increase with increase of bismuth content in the glass. Electrical data have been analyzed in the framework of impedance and modulus formalisms. The activation energy for dc conductivity decreases with increase of bismuth concentration. The imaginary part of modulus spectra has been fitted to non-exponential Kohlrausch-Williams-Watts (KWW) function and the value of the stretched exponent (β) is found to be almost independent of temperature but slightly dependent on composition.

  18. The Boolean algebra of Galois algebras

    Directory of Open Access Journals (Sweden)

    Lianyong Xue


    Full Text Available Let B be a Galois algebra with Galois group G, Jg={b∈B|bx=g(xb for all x∈B} for each g∈G, and BJg=Beg for a central idempotent eg, Ba the Boolean algebra generated by {0,eg|g∈G}, e a nonzero element in Ba, and He={g∈G|eeg=e}. Then, a monomial e is characterized, and the Galois extension Be, generated by e with Galois group He, is investigated.

  19. Digital signal processor for silicon audio playback devices; Silicon audio saisei kikiyo digital signal processor

    Energy Technology Data Exchange (ETDEWEB)



    The digital audio signal processor (DSP) TC9446F series has been developed silicon audio playback devices with a memory medium of, e.g., flash memory, DVD players, and AV devices, e.g., TV sets. It corresponds to AAC (advanced audio coding) (2ch) and MP3 (MPEG1 Layer3), as the audio compressing techniques being used for transmitting music through an internet. It also corresponds to compressed types, e.g., Dolby Digital, DTS (digital theater system) and MPEG2 audio, being adopted for, e.g., DVDs. It can carry a built-in audio signal processing program, e.g., Dolby ProLogic, equalizer, sound field controlling, and 3D sound. TC9446XB has been lined up anew. It adopts an FBGA (fine pitch ball grid array) package for portable audio devices. (translated by NEDO)

  20. Parameter Identification (United States)


    dimensional search or any sequence such that 3k+1 kJk +1 J,= 0 ’ lim ak = . k=o k- 5) Set k=k+1. Go back to 2). For a single input (p=l) the spectral...r components of A in FE P vector in Eq. (B-2) Pcomponent of wB along XB Pi orthogonal transformation matrix P( kJk ) estimation error covariance matrix...most accurate prediction of X(k), i.e. X(klk-1) is computed according to: i( kjk -1) - (k-1I1k-1) + Um(k) T (3.156) The error e(kik-1) in the prediction

  1. Effects of atmospheric conditions on the operating characteristics of supersonic cruise aircraft (United States)

    Schweikhard, W. G.; Gilyard, G. B.; Talbot, J. E.; Brown, T. W.


    Since for maximum range a supersonic transport must cruise near its maximum Mach number, accurate flight control is needed, especially when severe atmospheric transients are encountered. This paper describes atmospheric transients that have been encountered by the XB-70, YF-12, and Concorde aircraft during supersonic flights and the ensuing responses of the aircraft propulsion and flight control systems. It was found that atmospheric conditions affected these supersonic cruise vehicles in much the same way, with minor differences according to the type of propulsion and flight control system. Onboard sensors are sufficiently accurate to provide data on the atmosphere, including turbulence over the route, that are accurate enough for entry in the climatic record and for use as inputs to the control systems. Nominal atmospheric transients can be satisfactorily controlled, but some problems remain for extreme cases.

  2. Investigation of Proton-Proton Short-Range Correlations via the 12C(e,e'pp) Reaction

    Energy Technology Data Exchange (ETDEWEB)

    J. Arrington; H. Benaoum; F. Benmokhtar; P. Bertin; W. Bertozzi; W. Boeglin; J. P. Chen; Seonho Choi; E. Chudakov; E. Cisbani; B. Craver; C. W. de Jager; R. Feuerbach; S. Frullani; F. Garibaldi; O. Gayou; S. Gilad; R. Gilman; O. Glamazdin; J. Gomez; O. Hansen; D. W. Higinbotham; T. Holmstrom; H. Ibrahim; R. Igarashi; E. Jans; X. Jiang; Y. Jiang; L. Kaufman; A. Kelleher; A. Kolarkar; E. Kuchina; G. Kumbartzki; J. J. LeRose; R. Lindgren; N. Liyanage; D. J. Margaziotis; P. Markowitz; S. Marrone; M. Mazouz; R. Michaels; B. Moffit; S. Nanda; C. F. Perdrisat; E. Piasetzky; M. Potokar; V. Punjabi; Y. Qiang; J. Reinhold; B. Reitz; G. Ron; G. Rosner; A. Saha; B. Sawatzky; A. Shahinyan; S. Sirca; K. Slifer; P. Solvignon; V. Sulkosky; N. Thompson; P. E. Ulmer; G. M. Urciuoli; E. Voutier; K. Wang; J. W. Watson


    We investigated simultaneously the 12C(e,e'p) and 12C(e,e'pp) reactions at Q2 = 2 [GeV/c]2, x_B = 1.2, and in an (e,e'p) missing-momentum range from 300 to 600 MeV/c. At these kinematics, with a missing-momentum greater than the Fermi momentum of nucleons in a nucleus and far from the delta excitation, short-range nucleon-nucleon correlations are predicted to dominate the reaction. For(9.5 +/- 2)% of the 12C(e,e'p) events, a recoiling partner proton was observed back-to-back to the 12C(e,e'p) missing momentum vector, an experimental signature of correlations.

  3. Modeling Aerobic Carbon Source Degradation Processes using Titrimetric Data and Combined Respirometric-Titrimetric Data: Structural and Practical Identifiability

    DEFF Research Database (Denmark)

    Gernaey, Krist; Petersen, B.; Dochain, D.


    The structural and practical identifiability of a model for description of respirometric-titrimetric data derived from aerobic batch substrate degradation experiments of a CxHyOz carbon source with activated sludge was evaluated. The model processes needed to describe titrimetric data included...... substrate uptake, CO2 production, and NH3 uptake for biomass growth. The structural identifiability was studied using the Taylor series method and a recently proposed generalization method. It showed that combining respirometric and titrimetric data allows structural identifiability of one extra parameter...... combination, the biomass yield, Y-H, compared to estimation on separate data sets, on condition that the nitrogen fraction in biomass (i(XB)) is known. However, data from short-term batch substrate degradation experiments were not sufficiently informative to allow practical identification of all structurally...

  4. A class of chemical pinning centers including two elements foreign to HTS (United States)

    Weinstein, Roy; Sawh, Ravi-Persad


    Very small deposits are formed when two foreign elements, A and B, are added to textured (RE)BCO. These deposits increase the Jc of samples and hence the maximum trapped field. Deposit sizes are generally in the range 200-400 nm. Their chemical composition is (A x,B y)(RE)Ba 2O 6, where x+ y=1 and x= y±0.1. Their structure is double perovskite. The deposits produce two types of pinning, one by refinement (e.g., of the Y211 phase) and the other due to the double perovskite deposits themselves. In those cases tested, the refinement increases Jc by factors exceeding 1.33, and the deposits increase Jc by factors exceeding 2, for a total increase by a factor exceeding 2.66. Element A can be U, W or Mo. Element B can be Pt or Zr. We speculate on possible additional elements in classes A and B.

  5. Forgery Detection by Local Correspondence (United States)


    W7X ...9* (QP X]R’Y¢a:W`�Y�o R’Y:P X!R’Y¢`�X!&!SkY¡XbWkY` W7X !\\’&!PX!RWX�h9SY`®P’SX�`!WX)(�`e^fVX]R’Y�`)_[S9SX!R’P’Y`!`a�&�(iX]Y:&)(QSP�S...o’k¨o’k R’Y7X!R’&!Y`)R’S*>hµ^§S& W7X !&bW2(QP9(QP’T�`)Y:XS^�¡(�``)R’S5o P



    Zhidong, YAO; Yong, DING; Tokuro, NANBA; Yoshinari, MIURA; The Graduate School of Natural Science and Technology, Okayama University; Faculty of Environmental Science and Technology, Okayama University


    In xNa_2O・(40-x)B_2O_3・60SiO_2(mol%)(x=5, 10, 15, 20, 25, 30)glasses with 0.25mol% Eu_2O_3 as additive, the local structure around Eu^3+ was explored by employing the phonon sideband spectra of Eu^3+ associated with the ^5D_2←^7F_0 transition. It was found that the types and fraction of the structural units around Eu^3+ varied with glass composition. Moreover, the B-O vibrational mode of BO_3 unit exists around Eu^3+ when x ≨ 15, which is not present in the same composition glasses free o...

  7. Cross Sections for the Exclusive Photon Electroproduction on the Proton and Generalized Parton Distributions (United States)

    Jo, H. S.; Girod, F. X.; Avakian, H.; Burkert, V. D.; Garçon, M.; Guidal, M.; Kubarovsky, V.; Niccolai, S.; Stoler, P.; Adhikari, K. P.; Adikaram, D.; Amaryan, M. J.; Anderson, M. D.; Anefalos Pereira, S.; Ball, J.; Baltzell, N. A.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Biselli, A. S.; Boiarinov, S.; Briscoe, W. J.; Brooks, W. K.; Carman, D. S.; Celentano, A.; Chandavar, S.; Charles, G.; Colaneri, L.; Cole, P. L.; Compton, N.; Contalbrigo, M.; Crede, V.; D'Angelo, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Dupre, R.; Alaoui, A. El; Fassi, L. El; Elouadrhiri, L.; Fedotov, G.; Fegan, S.; Filippi, A.; Fleming, J. A.; Garillon, B.; Gevorgyan, N.; Ghandilyan, Y.; Gilfoyle, G. P.; Giovanetti, K. L.; Goetz, J. T.; Golovatch, E.; Gothe, R. W.; Griffioen, K. A.; Guegan, B.; Guler, N.; Guo, L.; Hafidi, K.; Hakobyan, H.; Harrison, N.; Hattawy, M.; Hicks, K.; Hirlinger Saylor, N.; Ho, D.; Holtrop, M.; Hughes, S. M.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Jenkins, D.; Joo, K.; Joosten, S.; Keller, D.; Khachatryan, G.; Khandaker, M.; Kim, A.; Kim, W.; Klein, A.; Klein, F. J.; Kuhn, S. E.; Kuleshov, S. V.; Lenisa, P.; Livingston, K.; Lu, H. Y.; MacGregor, I. J. D.; McKinnon, B.; Meziani, Z. E.; Mirazita, M.; Mokeev, V.; Montgomery, R. A.; Moutarde, H.; Movsisyan, A.; Munevar, E.; Munoz Camacho, C.; Nadel-Turonski, P.; Net, L. A.; Niculescu, G.; Osipenko, M.; Ostrovidov, A. I.; Paolone, M.; Park, K.; Pasyuk, E.; Phillips, J. J.; Pisano, S.; Pogorelko, O.; Price, J. W.; Procureur, S.; Prok, Y.; Puckett, A. J. R.; Raue, B. A.; Ripani, M.; Rizzo, A.; Rosner, G.; Rossi, P.; Roy, P.; Sabatié, F.; Salgado, C.; Schott, D.; Schumacher, R. A.; Seder, E.; Simonyan, A.; Skorodumina, Iu.; Smith, G. D.; Sokhan, D.; Sparveris, N.; Stepanyan, S.; Strakovsky, I. I.; Strauch, S.; Sytnik, V.; Tian, Ye; Tkachenko, S.; Ungaro, M.; Voskanyan, H.; Voutier, E.; Walford, N. K.; Watts, D. P.; Wei, X.; Weinstein, L. B.; Wood, M. H.; Zachariou, N.; Zana, L.; Zhang, J.; Zhao, Z. W.; Zonta, I.; CLAS Collaboration


    Unpolarized and beam-polarized fourfold cross sections (d4σ /d Q2d xBd t d ϕ ) for the e p →e'p'γ reaction were measured using the CLAS detector and the 5.75-GeV polarized electron beam of the Jefferson Lab accelerator, for 110 (Q2,xB,t ) bins over the widest phase space ever explored in the valence-quark region. Several models of generalized parton distributions (GPDs) describe the data well at most of our kinematics. This increases our confidence that we understand the GPD H , expected to be the dominant contributor to these observables. Through a leading-twist extraction of Compton form factors, these results support the model predictions of a larger nucleon size at lower quark-momentum fraction xB.

  8. Exclusive η electroproduction at W >2 GeV with CLAS and transversity generalized parton distributions (United States)

    Bedlinskiy, I.; Kubarovsky, V.; Stoler, P.; Adhikari, K. P.; Akbar, Z.; Anefalos Pereira, S.; Avakian, H.; Ball, J.; Baltzell, N. A.; Battaglieri, M.; Batourine, V.; Biselli, A. S.; Boiarinov, S.; Briscoe, W. J.; Burkert, V. D.; Cao, T.; Carman, D. S.; Celentano, A.; Chandavar, S.; Charles, G.; Ciullo, G.; Clark, L.; Colaneri, L.; Cole, P. L.; Contalbrigo, M.; Crede, V.; D'Angelo, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Deur, A.; Djalali, C.; Dupre, R.; Alaoui, A. El; Fassi, L. El; Elouadrhiri, L.; Eugenio, P.; Fanchini, E.; Fedotov, G.; Fersch, R.; Filippi, A.; Fleming, J. A.; Forest, T. A.; Garçon, M.; Gevorgyan, N.; Ghandilyan, Y.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Gleason, C.; Golovatch, E.; Gothe, R. W.; Griffioen, K. A.; Guidal, M.; Guo, L.; Hafidi, K.; Hakobyan, H.; Hanretty, C.; Harrison, N.; Hattawy, M.; Hicks, K.; Hughes, S. M.; Hyde, C. E.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Isupov, E. L.; Jenkins, D.; Jiang, H.; Jo, H. S.; Joo, K.; Joosten, S.; Keller, D.; Khachatryan, G.; Khachatryan, M.; Khandaker, M.; Kim, A.; Kim, W.; Klein, F. J.; Kuhn, S. E.; Kuleshov, S. V.; Lanza, L.; Lenisa, P.; Livingston, K.; MacGregor, I. J. D.; Markov, N.; McKinnon, B.; Meziani, Z. E.; Mirazita, M.; Mokeev, V.; Montgomery, R. A.; Movsisyan, A.; Munoz Camacho, C.; Nadel-Turonski, P.; Net, L. A.; Ni, A.; Niccolai, S.; Niculescu, G.; Osipenko, M.; Ostrovidov, A. I.; Paolone, M.; Paremuzyan, R.; Park, K.; Pasyuk, E.; Peng, P.; Phelps, W.; Pisano, S.; Pogorelko, O.; Price, J. W.; Prok, Y.; Protopopescu, D.; Puckett, A. J. R.; Raue, B. A.; Ripani, M.; Rizzo, A.; Rosner, G.; Rossi, P.; Roy, P.; Sabatié, F.; Saini, M. S.; Salgado, C.; Schumacher, R. A.; Sharabian, Y. G.; Skorodumina, Iu.; Smith, G. D.; Sokhan, D.; Sparveris, N.; Stepanyan, S.; Strakovsky, I. I.; Strauch, S.; Taiuti, M.; Tian, Ye; Torayev, B.; Turisini, M.; Ungaro, M.; Voskanyan, H.; Voutier, E.; Walford, N. K.; Watts, D. P.; Wei, X.; Weinstein, L. B.; Wood, M. H.; Yurov, M.; Zachariou, N.; Zhang, J.; Zonta, I.; CLAS Collaboration


    The cross section of the exclusive η electroproduction reaction e p →e'p'η was measured at Jefferson Laboratory with a 5.75 GeV electron beam and the CLAS detector. Differential cross sections d4σ /d t d Q2d xBd ϕη and structure functions σU=σT+ɛ σL,σT T , and σL T, as functions of t , were obtained over a wide range of Q2 and xB. The η structure functions are compared with those previously measured for π0 at the same kinematics. At low t , both π0 and η are described reasonably well by generalized parton distributions (GPDs) in which chiral-odd transversity GPDs are dominant. The π0 and η data, when taken together, can facilitate the flavor decomposition of the transversity GPDs.

  9. Peculiar structure and tensile strength of WB4: nonstoichiometric origin

    Directory of Open Access Journals (Sweden)

    Huiyang Gou


    Full Text Available Tungsten tetraboride (WB4 is experimentally considered as potentially superhard material and is therefore expected to have highly structural stability and enhanced resistance against plastic deformation and failure. The examinations of bond-deformation mechanism suggest a significantly soft bond-deformation pattern induced by ionic W-B bonding for nominal WB4 in experiments, largely responsible for the limitation of its strength and structural integrity. Computations on the structures and mechanical properties for WB4 show a novel thermodynamically favored MoB4-type phase with excellent mechanical properties and remarkable incompressibility along c direction. The illustrations of nonstoichiometry and x-ray diffraction spectra rationalize the experimental observation of nominal composition WB4 as defective tungsten borides (W1-xB3 (x0.25. The results provide new insight into the real structural and mechanical properties of tungsten borides.

  10. Influence of CeO₂ content on complex optical parameters of phosphovanadate glass system. (United States)

    Barde, R V


    In the present work, glass system of the compositions of 60V2O5-5P2O5-(35-x)B2O3-xCeO2 is prepared by modified melt-quenching method. The conformation of amorphous phase in sample was done through X-ray diffraction analysis. Optical studies were carried out at room temperature and direct and indirect band gap energy, refractive index, Urbach energy, molar refractivity and polarizability have been determined. The values of indirect band gap are lower than the corresponding values of direct band gap. Urbach energy is observed between 0.58 and 0.48 eV. The samples show gradual increase in absorption around the 225 nm, which results in increase of refractive index and optical conductivity. The real and imaginary dielectric constants show good agreement with each other. Copyright © 2015. Published by Elsevier B.V.

  11. Typing of Salmonella enterica serovar Infantis isolates from 51 outbreaks in Germany between 1974 and 2009 by a novel phage-typing scheme. (United States)

    Miller, T; Braun, P G; Fehlhaber, K; Prager, R; Pfeifer, Y; Rabsch, W


    We developed a new phage-typing method and evaluated its application in combination with XbaI macrorestriction analysis by pulsed-field gel electrophoresis (PFGE) as a useful tool for the long-term epidemiology of Salmonella enterica serovar Infantis. In this study, we investigated 1008 S. Infantis isolates recovered from humans, various animal species and food products from 1973 to 2009. The typing scheme is based on 17 typing phages, defining 61 different patterns within the strain collection. The experiments showed that phage typing is a reliable method for differentiation of outbreaks and sporadic clinical cases as well as for elucidation of chains of transmission. The combined analysis of phage typing and PFGE revealed the existence of epidemic clones with a high stability over time like PT29/XB27 which was identified in nosocomial salmonellosis, community outbreaks as well as in broiler chickens from 2002 to 2009.

  12. Technology Insertion-Engineering Services Process Characterization. Task Order No. 1. Book 1 of 3. Database Documentation Book. OO-ALC MANPGP (Overview Layouts) (United States)


    MECHANIC. XA. Ordnance Device Repairer XB. Weapons Repairer XC. Munition Mechanics XE. Gun Mechanic Y. AIRCRAFT ACCESSORIES MECHANIC. YA. Aircraft...34Z// 7 AX L 6! 1A’FA’I RA#L~ e’LL’~PTcHCLILLAP SAFTEY S7-,’P F/7T/A16 u ATRrxch’ Ar- AYLLU. T 07- S*/DE-i ZE hA’fd A 6 //ifY/’f 72Y .4 2 (- 6g/&f//f...specialty codes at the end of F-f S5 and the total medical leave, organizational duties, education axd number of losses expenerr darrng that year. The

  13. Performance of local correlation methods for halogen bonding: The case of Br{sub 2}–(H{sub 2}O){sub n},n = 4,5 clusters and Br{sub 2}@5{sup 12}6{sup 2} clathrate cage

    Energy Technology Data Exchange (ETDEWEB)

    Batista-Romero, Fidel A.; Bernal-Uruchurtu, Margarita I.; Hernández-Lamoneda, Ramón, E-mail: [Centro de Investigaciones Químicas, Universidad Autónoma del Estado de Morelos, Av. Universidad 1001, Cuernavaca, Morelos 62209 (Mexico); Pajón-Suárez, Pedro [Instituto Superior de Tecnologías y Ciencias Aplicadas (InSTEC), Habana 6163 (Cuba)


    The performance of local correlation methods is examined for the interactions present in clusters of bromine with water where the combined effect of hydrogen bonding (HB), halogen bonding (XB), and hydrogen-halogen (HX) interactions lead to many interesting properties. Local methods reproduce all the subtleties involved such as many-body effects and dispersion contributions provided that specific methodological steps are followed. Additionally, they predict optimized geometries that are nearly free of basis set superposition error that lead to improved estimates of spectroscopic properties. Taking advantage of the local correlation energy partitioning scheme, we compare the different interaction environments present in small clusters and those inside the 5{sup 12}6{sup 2} clathrate cage. This analysis allows a clear identification of the reasons supporting the use of local methods for large systems where non-covalent interactions play a key role.

  14. Evaluate More General Integrals Involving Universal Associated Legendre Polynomials via Taylor’s Theorem (United States)

    Yañez-Navarro, G.; Sun, Guo-Hua; Sun, Dong-Sheng; Chen, Chang-Yuan; Dong, Shi-Hai


    A few important integrals involving the product of two universal associated Legendre polynomials {P}{l\\prime}{m\\prime}(x), {P}{k\\prime}{n\\prime}(x) and x2a(1 - x2)-p-1, xb(1 ± x)-p-1 and xc(1 -x2)-p-1 (1 ± x) are evaluated using the operator form of Taylor’s theorem and an integral over a single universal associated Legendre polynomial. These integrals are more general since the quantum numbers are unequal, i.e. l‧ ≠ k‧ and m‧ ≠ n‧. Their selection rules are also given. We also verify the correctness of those integral formulas numerically. Supported by 20170938-SIP-IPN, Mexico

  15. Ginga observations of dipping low mass X ray binaries (United States)

    Smale, Alan P.; Mukai, Koji; Williams, O. Rees; Jones, Mark H.; Parmar, Arvind N.; Corbet, Robin H. D.


    Ginga observations of several low mass X ray binaries displaying pronounced dips of variable depth and duration in their X ray light curves are analyzed. The periodic occultation of the central X ray source by azimuthal accretion disk structure is considered. A series of spectra selected by intensity from the dip data from XB1916-053, are presented. The effects of a rapidly changing column density upon the spectral fitting results are modeled. EXO0748-676 was observed in March 1989 for three days. The source was found to be in a bright state with a 1 to 20 keV flux of 8.8 x 10 (exp -10) erg/sqcms. The data include two eclipses, observed with high time resolution.

  16. Deeply Virtual Compton Scattering Beam-Spin Asymmetries

    Energy Technology Data Exchange (ETDEWEB)

    F.X. Girod; R.A. Niyazov


    The beam spin asymmetries in the hard exclusive electroproduction of photons on the proton (ep -> epg) were measured over a wide kinematic range and with high statistical accuracy. These asymmetries result from the interference of the Bethe-Heitler process and of deeply virtual Compton scattering. Over the whole kinematic range (x_B from 0.11 to 0.58, Q^2 from 1 to 4.8 GeV^2, -t from 0.09 to 1.8 GeV^2), the azimuthal dependence of the asymmetries is compatible with expectations from leading-twist dominance, A = a*sin(phi)/[1+c*cos(phi)]. This extensive set of data can thus be used to constrain significantly the generalized parton distributions of the nucleon in the valence quark sector.

  17. A Zero Extraction and Separation Technique for Surface Acoustic Wave and Digital Signal Processing FIR (Finite Impulse Response) Filter Implementation. (United States)


    4.16) = b ctb_2 5b_ I ab-2 (.7= b 1z + b_2 + ab 1 + 2 " + (4.17)- + - + z Equating like coefficients: R1 =b_ Ro = b2 + (xb_ 1 (4.18) = ao -b- 1...KVKV*S+K (I) no COTINUE TO.D0 IF (DABS(KV) .QT.DABS(K(10 ) *10. *EM) T--W/KV S-S+lT GO TO 10 DID S BIN CRLCS (TYPE) C THIS 11IOUINE (CLATES SCALA ...REAL L’Th ARE, ME INT~ME N, MI DOUBLE HUMECISICt~ A5,B1, B2 ,C2,C2,C3, I C4, TEMP, tKJ, W INTE TYPE C USE PMMAS APHMRI’E TO SM7Il1 TYPE. WF(TYP.1.3) GO

  18. Identification and inspection of the vacancy site in Li doped BPO 4 ceramic electrolyte by NMR (United States)

    Dodd, A. J.; van Eck, E. R. H.


    A study of the properties of the high temperature ceramic electrolyte Li xB 1- x/3 PO 4 (lithium boron phosphate) is reported. XRD and NMR are used to investigate changes of the material as a function of heat treatment. It was found that after synthesis at 450 °C the material contains a phase of Li 4P 2O 7 in addition to the BPO 4 phase. This second phase is removed by heat treatment at temperatures higher than 600 °C. Boron vacancies are present, REDOR and CPMAS techniques are used to investigate this defect site and show that for the heat treated material Li ions are present at the vacancy site.

  19. Nanostructuring of an AlGaInP light emitting diode for surface plasmon enhanced emission of light output

    Energy Technology Data Exchange (ETDEWEB)

    Perks, R.M. [Cardiff University School of Engineering (United Kingdom); Kettle, J.; Lalev, G.M.; Dimov, S. [Manufacturing Engineering Centre, (United Kingdom)


    This work describes a successful post fabrication method of applying a plasmonic grating to the surface of a mounted AlGaInP LED device. A Carl Zeiss 1540 XB focused ion beam system was used to mill holes in a thin gold layer with a periodicity of around 540 nm. Measurements of the total light output of the device compared with a standard un-textured device show that the plasmonic grating was found to significantly affect the light output characteristics such that the overall light output was reduced. This is attributed to the fact that only p-polarised light can interact with the hole array. Furthermore, the onset of saturation in the textured device was not evident as compared with the un-textured device. This is attributed to improved current spreading in the device due to the top gold layer. (copyright 2008 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  20. On the low lying singlet states of BeO (United States)

    Bauschlicher, C. W., Jr.; Lengsfield, B. H.; Yarkony, D. R.


    Calculations of the ground and low-lying singlet states of BeO are performed in order to gain an understanding of the techniques needed to treat the excited states of other, more complex, ionic molecules. The MCSCF and CI calculations are based on a Gaussian basis set of slightly better than double zeta plus polarization quality for single configuration descriptions of the states. The calculated X-A and X-B state separations are found to be in agreement with experimental measurements. The 1 Sigma - and 1 Delta states are predicted to lie approximately 40,000 kaysers above the ground state and are identified as the C and D states.The 2 1 Pi state is found to be approximately 15,000 kaysers and the 3 1 Sigma + state is found to be approximately 65,000 kaysers above the ground state.

  1. Incorporação de dióxido de titânio em zeólitas para emprego em fotocatálise heterogênea Titanium oxide incorporation on zeolites for heterogeneous photocatalisis

    Directory of Open Access Journals (Sweden)

    Jean C. Merg


    Full Text Available This work proposes the study of heterogeneous photocatalysis using TiO2 impregnated in zeolites beta, ZSM-5, mordenite, NaXb, NaXp and NaY for the decomposition of methylene blue. The catalysts were characterized by XRD, IR, textural analyses by N2 adsorption, SEM, DRS and the reaction of decomposition was monitored by UV visible. The results indicated that didn't have structural changes in the catalysts after Ti impregnations, only in the case of NaY and NaX zeolites. The better photocatalyst to metylene blue decomposition was beta/Ti zeolite due had one structure more accessible (with bigger porous helping in TiO2 dispersion and catalytic active.

  2. New horizons for aerobic fitness normalization in children: Breaking the paradigm

    Directory of Open Access Journals (Sweden)

    Giovani dos Santos Cunha


    Full Text Available Traditional methods to normalize aerobic fitness (VO2max have been considered inadequate for not properly adjusting the effects of body size in children, adolescents and adults. Allometric scaling (Y=aXb has emerged as an efficient method to compare individuals of different body dimensions. Studies aimed to compare VO2max in individuals with different body sizes should use methodology that properly accounts for the body size effect, thereby avoiding misinterpretation and reaching the potentially wrong conclusion. The use of allometric scaling for studies aimed to compare aerobic fitness in children and adolescents who dramatically vary in body size is strongly recommended.

  3. Performance of local correlation methods for halogen bonding: The case of Br2-(H2O)n,n = 4,5 clusters and Br2@51262 clathrate cage (United States)

    Batista-Romero, Fidel A.; Pajón-Suárez, Pedro; Bernal-Uruchurtu, Margarita I.; Hernández-Lamoneda, Ramón


    The performance of local correlation methods is examined for the interactions present in clusters of bromine with water where the combined effect of hydrogen bonding (HB), halogen bonding (XB), and hydrogen-halogen (HX) interactions lead to many interesting properties. Local methods reproduce all the subtleties involved such as many-body effects and dispersion contributions provided that specific methodological steps are followed. Additionally, they predict optimized geometries that are nearly free of basis set superposition error that lead to improved estimates of spectroscopic properties. Taking advantage of the local correlation energy partitioning scheme, we compare the different interaction environments present in small clusters and those inside the 51262 clathrate cage. This analysis allows a clear identification of the reasons supporting the use of local methods for large systems where non-covalent interactions play a key role.

  4. AcEST: BP914684 [AcEST

    Lifescience Database Archive (English)

    Full Text Available LY48|Q1LY48_DANRE Novel protein similar to vertebrate Wolf-... 84 3e-15 tr|Q06ZW5|Q06ZW5_DANRE Wolf-Hirschho... 84 3e-15 tr|B7ZVT1|B7ZVT1_DANRE Wolf-Hirschhorn syndrome candidate 1 OS=D... 84 ...SET isof... 84 3e-15 tr|A2A2T3|A2A2T3_HUMAN Wolf-Hirschhorn syndrome candidate 1 ...OS=H... 84 3e-15 tr|A2A2T2|A2A2T2_HUMAN Wolf-Hirschhorn syndrome candidate 1 OS=H... 84 3e-15 tr|A5XBQ0|A5XB

  5. SU-F-SPS-11: The Dosimetric Comparison of Truebeam 2.0 and Cyberknife M6 Treatment Plans for Brain SRS Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Mabhouti, H; Sanli, E; Cebe, M; Codel, G; Pacaci, P; Serin, E; Kucuk, N; Kucukmorkoc, E; Doyuran, M; Canoglu, D; Altinok, A; Acar, H; Caglar Ozkok, H [Medipol University, Istanbul, Istanbul (Turkey)


    Purpose: Brain stereotactic radiosurgery involves the use of precisely directed, single session radiation to create a desired radiobiologic response within the brain target with acceptable minimal effects on surrounding structures or tissues. In this study, the dosimetric comparison of Truebeam 2.0 and Cyberknife M6 treatment plans were made. Methods: For Truebeam 2.0 machine, treatment planning were done using 2 full arc VMAT technique with 6 FFF beam on the CT scan of Randophantom simulating the treatment of sterotactic treatments for one brain metastasis. The dose distribution were calculated using Eclipse treatment planning system with Acuros XB algorithm. The treatment planning of the same target were also done for Cyberknife M6 machine with Multiplan treatment planning system using Monte Carlo algorithm. Using the same film batch, the net OD to dose calibration curve was obtained using both machine by delivering 0- 800 cGy. Films were scanned 48 hours after irradiation using an Epson 1000XL flatbed scanner. Dose distribution were measured using EBT3 film dosimeter. The measured and calculated doses were compared. Results: The dose distribution in the target and 2 cm beyond the target edge were calculated on TPSs and measured using EBT3 film. For cyberknife plans, the gamma analysis passing rates between measured and calculated dose distributions were 99.2% and 96.7% for target and peripheral region of target respectively. For Truebeam plans, the gamma analysis passing rates were 99.1% and 95.5% for target and peripheral region of target respectively. Conclusion: Although, target dose distribution calculated accurately by Acuros XB and Monte Carlo algorithms, Monte carlo calculation algorithm predicts dose distribution around the peripheral region of target more accurately than Acuros algorithm.

  6. Physcomitrella patens has kinase-LRR R gene homologs and interacting proteins.

    Directory of Open Access Journals (Sweden)

    Yusuke Tanigaki

    Full Text Available Plant disease resistance gene (R gene-like sequences were screened from the Physcomitrella patens genome. We found 603 kinase-like, 475 Nucleotide Binding Site (NBS-like and 8594 Leucine Rich Repeat (LRR-like sequences by homology searching using the respective domains of PpC24 (Accession No. BAD38895, which is a candidate kinase-NBS-LRR (kinase-NL type R-like gene, as a reference. The positions of these domains in the genome were compared and 17 kinase-NLs were predicted. We also found four TIR-NBS-LRR (TIR-NL sequences with homology to Arabidopsis TIR-NL (NM_001125847, but three out of the four TIR-NLs had tetratricopeptide repeats or a zinc finger domain in their predicted C-terminus. We also searched for kinase-LRR (KLR type sequences by homology with rice OsXa21 and Arabidopsis thaliana FLS2. As a result, 16 KLRs with similarity to OsXa21 were found. In phylogenetic analysis of these 16 KLRs, PpKLR36, PpKLR39, PpKLR40, and PpKLR43 formed a cluster with OsXa21. These four PpKLRs had deduced transmembrane domain sequences and expression of all four was confirmed. We also found 14 homologs of rice OsXB3, which is known to interact with OsXa21 and is involved in signal transduction. Protein-protein interaction was observed between the four PpKLRs and at least two of the XB3 homologs in Y2H analysis.

  7. Comparação do peso dos quelípodos e crescimento em duas espécies de "sirís" do gênero Callinectes (Brachyura, Portunidae

    Directory of Open Access Journals (Sweden)

    Cecilia Margarita Guerrero-Ocampo


    Full Text Available Neste trabalho, as espécies C. danae e C. ornatus foram comparadas quanto ao peso dos quelípodos. Os siris foram coletados com 2 redes de arrasto do tipo "otter trawl" na Enseada de Ubatuba (23° 26' S e 45° 02' W. As constantes alométricas obtidas foram analisadas por meio da função potência (Y = aXb . As espécies apresentaram diferentes graus alométricos para cada sexo. A relação PQ X PC apresentou alometria positiva em ambas espécies, porém os machos apresentam maior alometria positiva do que as fêmeas. C. danae apresenta maior alometria positiva para os quelípodos do que C. ornatus. O fato de C. danae atingir maior porte e possuir quelípodos maiores indica que esta espécie tem potencial para o cultivo.A comparison of the cheliped's weight in two species of the genus Callinectes was accomplished. The species C. danae e C. ornatus were collected by two otter trawl in Ubatuba bay (23º 26' S and 45º 02' W. The allometric constants obtained from the regression adjusted to a power function (Y = aXb were analyzed. These species presented different allometry degrees for each sex considered. The relation PQ x PC presented positive allometry for sex of both species, but male presented higher positive allometry than female. C. danae presented higher positive allometry for chelipeds than C. ornatus. We suggest here that C. danae could be indicated to be submitted to grow out in ponds since it reaches higher size and bigger chelipeds.

  8. 3XMM J181923.7-170616: An X-Ray Binary with a 408 s Pulsar (United States)

    Qiu, Hao; Zhou, Ping; Yu, Wenfei; Li, Xiangdong; Xu, Xiaojie


    We carry out a dedicated study of 3XMM J181923.7-170616 with an approximate pulsation period of 400 s using the XMM-Newton and Swift observations spanning across nine years. We have refined the period of the source to 407.904(7) s (at epoch MJD 57142) and constrained the 1σ upper limit on the period derivative \\dot{P}≤slant 1.1× {10}-8 {{s}} {{{s}}}-1. The source radiates hard, persistent X-ray emission during the observation epochs, which is best described by an absorbed power-law model (Γ ˜ 0.2-0.8) plus faint Fe lines at 6.4 and 6.7 keV. The X-ray flux revealed a variation within a factor of 2, along with a spectral hardening as the flux increased. The pulse shape is sinusoid-like and the spectral properties of different phases do not present significant variation. The absorption {N}{{H}} (˜ 1.3× {10}22 {{cm}}-2) is similar to the total Galactic hydrogen column density along the direction, indicating that it is a distant source. A search for the counterpart in optical and near-infrared surveys reveals a low-mass K-type giant, while the existence of a Galactic OB supergiant is excluded. A symbiotic X-ray binary (SyXB) is the favored nature of 3XMM J181923.7-170616 and can essentially explain the low luminosity of 2.78× {10}34{d}102 {erg} {{{s}}}-1, slow pulsation, hard X-ray spectrum, and possible K3 III companion. An alternative explanation of the source is a persistent Be X-ray binary (BeXB) with a companion star no earlier than B3-type.

  9. The Effects of Different Types of Antioxidants (Se, Vitamin E and Carotenoids in Broiler Diets on the Growth Performance, Skin Pigmentation and Liver and Plasma Antioxidant Concentrations

    Directory of Open Access Journals (Sweden)

    F Karadas


    Full Text Available Abstract This study investigated the effects of the addition of different antioxidants to broiler diets on their live performance, liver antioxidant composition and concentrations, immune response, and meat and skin color. A total of 945 three-day-old Ross 308 broiler chicks of both genders were randomly allocated to one of nine dietary treatments (n=105, with three replicates 35 chicks per pen, as follows: T1: control (commercially available corn-and soybean-based broiler diet; T2: selenium (control+0.5 mg/kg Sel-PlexTMSe yeast; T3: vitamin E (control+200 mg/kg Kavimix-E-50 a-tocopherol acetate; T4: lutein (control+100 mg/kg 5% Lutein Beads XB; T5: lycopene (control+100 mg/kg 5% Lyco Beads XB;T6: canthaxanthin (control+25 mg/kg 10% Carophyll(rRed;T7: apo-ester (control+25 mg/kg 10% Carophyll(rYellow; T8: lutein+zeaxanthin (control+25 mg/kg Xamacol(r; and T9: b-carotene (control+100 mg/kg 10% Rovimix(r. Feed (starter, grower, developer and finisher phases and water were provided ad libitum for 42 days. Body weights, feed intake, feed conversion values and plasma carotene concentrations were recorded weekly, and liver antioxidant concentrations were recorded at the end of the experiment. Newcastle disease (LaSota vaccination was performed on day 22. HI titers were measured on days 14, 21, 35 and 42 to determine the effects of the antioxidants on the immune system. The addition of selenium, vitamin E, and carotenoid supplements to the commercial broiler diet significantly increased antioxidant accumulation in the liver and the plasma. All antioxidants assessed significantly improved the immune response. Selenium and vitamin E supplementation also significantly improved total carotenoid concentrations in the plasma. The carotenoids enhanced skin and meat color. None of the supplements tested influenced growth (p>0.05.

  10. Spectral and Timing Nature of the Symbiotic X-Ray Binary 4U 1954+319: The Slowest Rotating Neutron Star in AN X-Ray Binary System (United States)

    Enoto, Teruaki; Sasano, Makoto; Yamada, Shin'Ya; Tamagawa, Toru; Makishima, Kazuo; Pottschmidt, Katja; Marcu, Diana; Corbet, Robin H. D.; Fuerst, Felix; Wilms, Jorn


    The symbiotic X-ray binary (SyXB) 4U 1954+319 is a rare system hosting a peculiar neutron star (NS) and an M-type optical companion. Its approx. 5.4 hr NS spin period is the longest among all known accretion-powered pulsars and exhibited large (is approx. 7%) fluctuations over 8 yr. A spin trend transition was detected with Swift/BAT around an X-ray brightening in 2012. The source was in quiescent and bright states before and after this outburst based on 60 ks Suzaku observations in 2011 and 2012. The observed continuum is well described by a Comptonized model with the addition of a narrow 6.4 keV Fe-K alpha line during the outburst. Spectral similarities to slowly rotating pulsars in high-mass X-ray binaries, its high pulsed fraction (approx. 60%-80%), and the location in the Corbet diagram favor high B-field (approx. greater than 10(exp12) G) over a weak field as in low-mass X-ray binaries. The observed low X-ray luminosity (10(exp33)-10(exp35) erg s(exp-1)), probable wide orbit, and a slow stellar wind of this SyXB make quasi-spherical accretion in the subsonic settling regime a plausible model. Assuming a approx. 10(exp13) G NS, this scheme can explain the approx. 5.4 hr equilibrium rotation without employing the magnetar-like field (approx. 10(exp16) G) required in the disk accretion case. The timescales of multiple irregular flares (approx. 50 s) can also be attributed to the free-fall time from the Alfv´en shell for a approx. 10(exp13) G field. A physical interpretation of SyXBs beyond the canonical binary classifications is discussed.


    Energy Technology Data Exchange (ETDEWEB)

    Lowes, Ted


    During this two-year Solid-State Lighting (SSL) Manufacturing R&D project Cree developed novel light emitting diode (LED) technologies contributing to a cost-optimized, efficient LED troffer luminaire platform emitting at ~3500K correlated color temperature (CCT) at a color rendering index (CRI) of >90. To successfully achieve program goals, Cree used a comprehensive approach to address cost reduction of the various optical, thermal and electrical subsystems in the luminaire without impacting performance. These developments built on Cree’s high- brightness, low-cost LED platforms to design a novel LED component architecture that will enable low-cost troffer luminaire designs with high total system efficacy. The project scope included cost reductions to nearly all major troffer subsystems as well as assembly costs. For example, no thermal management components were included in the troffer, owing to the optimized distribution of compact low- to mid-power LEDs. It is estimated that a significant manufacturing cost savings will result relative to Cree’s conventional troffers at the start of the project. A chief project accomplishment was the successful development of a new compact, high-efficacy LED component geometry with a broad far-field intensity distribution and even color point vs. emission angle. After further optimization and testing for production, the Cree XQ series of LEDs resulted. XQ LEDs are currently utilized in Cree’s AR series troffers, and they are being considered for use in other platforms. The XQ lens geometry influenced the independent development of Cree’s XB-E and XB-G high-voltage LEDs, which also have a broad intensity distribution at high efficacy, and are finding wide implementation in Cree’s omnidirectional A-lamps.

  12. Does conduit artery diameter vary according to the anthropometric characteristics of children or men? (United States)

    Hopkins, N D; Green, D J; Tinken, T M; Sutton, L; McWhannell, N; Thijssen, D H J; Cable, N T; Stratton, G; George, K


    Arterial measurements are commonly undertaken to assess acute and chronic adaptations to exercise. Despite the widespread adoption of scaling practices in cardiac research, the relevance of scaling for body size and/or composition has not been addressed for arterial measures. We therefore investigated the relationships between brachial artery diameter and body composition in 129 children aged 9 to 10 yr (75 girls and 54 boys), and 50 men aged 16-49 yr. Body composition variables (total, lean, and fat mass in the whole body, arm, and forearm) were assessed by dual-energy X-ray absorptiometry, and brachial artery diameter was measured using high-resolution ultrasound. Bivariate correlations were performed, and arterial diameter was then scaled using simple ratios (y/x) and allometric approaches after log-log least squares linear regression and production of allometric exponents (b) and construction of power function ratios (y/xb). Size independence was checked via bivariate correlations (x:y/x; x:y/xb). As a result, significant correlations existed between brachial artery diameter and measures of body mass and lean mass in both cohorts (r=0.21-0.48, P0.05). In conclusion, when between- or within-group comparisons are performed under circumstances where it is important to control for differences in body size or composition, allometric scaling of artery diameter should be adopted rather than ratio scaling. Our data also suggest that scaling for lean or total mass may be more appropriate than scaling for indexes of fat mass.

  13. INTEGRAL observation of renewed activity from 4U 1608-522

    DEFF Research Database (Denmark)

    Ishibashi, W.; Ferrigno, C.; Sánchez-Fernández, C.


    On 3 March 2010 SuperAGILE detected an X-ray burst from the LMXB 4U 1608-522 (Atel #2461). Confirmation of the renewed activity of this transient source was reported by MAXI/GSC (Atel #2462). 4U1608-522 was in the IBIS/ISGRI and JEMX field of view during several observations between 2010-Feb-23 06......:20 and 2010-March-03 01:04 UTC, when INTEGRAL was monitoring the inner Galactic Disk. The source was detected by JEMX since March 2, with a flux of 17+/-2 mCrab in the 3-20 keV band. Before that time the source was not detectable by JEMX. We derive an upper limit of about 10 mCrab in the 3-20 keV band between...... Feb. 23 and March, 2. We suggest the onset of the outburst to happen at March 1. This in agreement with the results derived by MAXI/GSC (Atel #2462). No X-ray bursts were detected within the INTEGRAL observations. The JEMX spectrum, accumulated between 2010-Mar-02 19:12 and 2010-Mar-03 0:57 UTC...

  14. Where Are the R-modes? Chandra Observations of Millisecond Pulsars (United States)

    Mahmoodifar, Simin; Strohmayer, Tod E.


    We present the results of Chandra observations of two non-accreting millisecond pulsars PSRs J1640+2224 (J1640) and J1709+2313(J1709), with low inferred magnetic fields in order to constrain their surface temperatures, obtain limits on the amplitude of unstable r-modes in them and make comparisons with similar limits obtained for a sample of accreting LMXB neutron stars (NSs). We detect both pulsars in the X-ray band for the first time. We found upper limits on the global surface temperature of these pulsars that are ~ 3.3 - 4.7 × 105 K. These sources are several Gyr old. In all standard cooling models NSs cool to surface temperatures less than 104 K in less than 107 yr. While we derived upper limits on the surface temperatures of these sources, they appear to be consistent with the values measured for PSR J0437-4715 and J2124-3358. Taken together these results suggest that the surface temperatures of at least some MSPs are significantly higher, given their ages, than standard cooling models would suggest. For pulsars that are inside the r-mode instability window, r-mode dissipation can provide a potential source of reheating.

  15. Low mass X-ray binaries in the Inner Galaxy: implications for millisecond pulsars and the GeV excess (United States)

    Haggard, Daryl; Heinke, Craig; Hooper, Dan; Linden, Tim


    If millisecond pulsars (MSPs) are responsible for the excess gamma-ray emission observed from the region surrounding the Galactic Center, the same region should also contain a large population of low-mass X-ray binaries (LMXBs). In this study, we compile and utilize a sizable catalog of LMXBs observed in the the Milky Way's globular cluster system and in the Inner Galaxy, as well as the gamma-ray emission observed from globular clusters, to estimate the flux of gamma rays predicted from MSPs in the Inner Galaxy. From this comparison, we conclude that only up to ~ 4-23% of the observed gamma-ray excess is likely to originate from MSPs. This result is consistent with, and more robust than, previous estimates which utilized smaller samples of both globular clusters and LMXBs. If MSPs had been responsible for the entirety of the observed excess, INTEGRAL should have detected ~ 103 LMXBs from within a 10o radius around the Galactic Center, whereas only 42 LMXBs (and 46 additional LMXB candidates) have been observed.

  16. Jet quenching in the neutron star low-mass X-ray binary 1RXS J180408.9-342058 (United States)

    Gusinskaia, N. V.; Deller, A. T.; Hessels, J. W. T.; Degenaar, N.; Miller-Jones, J. C. A.; Wijnands, R.; Parikh, A. S.; Russell, T. D.; Altamirano, D.


    We present quasi-simultaneous radio (VLA) and X-ray (Swift) observations of the neutron star low-mass X-ray binary (NS-LMXB) 1RXS J180408.9-342058 (J1804) during its 2015 outburst. We found that the radio jet of J1804 was bright (232 ± 4 μJy at 10 GHz) during the initial hard X-ray state, before being quenched by more than an order of magnitude during the soft X-ray state (19 ± 4 μJy). The source then was undetected in radio ( 0.7 (where L_R ∝ L_X^{β }). Few other sources have been studied in this faint regime, but a steep track is inconsistent with the suggested behaviour for the recently identified class of transitional millisecond pulsars. J1804 also shows fainter radio emission at LX millisecond pulsars. This suggests that J1804 is likely not an accreting X-ray or transitional millisecond pulsar.

  17. Gravitational waves from rotating neutron stars and evaluation of fast chirp transform techniques

    CERN Document Server

    Strohmayer, T E


    X-ray observations suggest that neutron stars in low mass x-ray binaries (LMXB) are rotating with frequencies in the range 300-600 Hz. These spin rates are significantly less than the break-up rates for essentially all realistic neutron star equations of state, suggesting that some process may limit the spin frequencies of accreting neutron stars to this range. If the accretion-induced spin up torque is in equilibrium with gravitational radiation losses, these objects could be interesting sources of gravitational waves. I present a brief summary of current measurements of neutron star spins in LMXBs based on the observations of high-Q oscillations during thermonuclear bursts (so-called 'burst oscillations'). Further measurements of neutron star spins will be important in exploring the gravitational radiation hypothesis in more detail. To this end, I also present a study of fast chirp transform (FCT) techniques as described by Jenet and Prince (Prince T A and Jenet F A 2000 Phys. Rev. D 62 122001) in the conte...

  18. Where Are the R-modes? Chandra Observations of Millisecond Pulsars (United States)

    Mahmoodifar, S.; Strohmayer, T.


    We present the results of Chandra observations of two non-accreting millisecond pulsars PSRs J1640+2224 (J1640) and J1709+2313(J1709), with low inferred magnetic fields in order to constrain their surface temperatures, obtain limits on the amplitude of unstable r-modes in them and make comparisons with similar limits obtained for a sample of accreting LMXB neutron stars (NSs). We detect both pulsars in the X-ray band for the first time. We found upper limits on the global surface temperature of these pulsars that are ˜ 3.3 × 10^5 - 4.7 × 10^5K. These sources are several Gyr old. In all standard cooling models NSs cool to surface temperatures less than 10^4K in less than 10^7 yr. While we derived upper limits on the surface temperatures of these sources, they appear to be consistent with the values measured for PSR J0437-4715 and J2124-3358. Taken together these results suggest that the surface temperatures of at least some MSPs are significantly higher, given their ages, than standard cooling models would suggest. For pulsars that are inside the r-mode instability window, r-mode dissipation can provide a potential source of reheating.

  19. Searching for Jet Emission in LMXBs: A Polarimetric View

    Directory of Open Access Journals (Sweden)

    Maria Cristina Baglio


    Full Text Available We present results taken from a study aiming at detecting the emission from relativistic particles jets in neutron star-low mass X-ray binaries using optical polarimetric observations. First, we focus on a polarimetric study performed on the persistent LMXB 4U 0614+091. Once corrected for interstellar effects, we measured an intrinsic linear polarization in the r-band of ~3% at a 3σ confidence level. This is in-line with the observation of an infrared excess in the spectral energy distribution (SED of the source, reported in a previous work, which the authors linked to the optically thin synchrotron emission of a jet. We then present a study performed on the transitional millisecond pulsar PSR J1023+0038 during quiescence. We measured a linear polarization of 1.09 ± 0.27% and 0.90 ± 0.17% in the V and R bands, respectively. The phase-resolved polarimetric curve of the source in the R-band reveals a hint of a sinusoidal modulation at the source orbital period. The NIR -optical SED of the system did not suggest the presence of a jet. We conclude that the optical linear polarization observed for PSR J1023+0038 is possibly due to Thomson scattering with electrons in the disc, as also suggested by the hint of the modulation of the R-band linear polarization at the system orbital period.

  20. A multiwavelength study of the massive GLIMPSE-C01 cluster with the Hubble Space Telescope and Chandra X-ray Observatory (United States)

    Hare, Jeremy; Kargaltsev, Oleg; Rangelov, Blagoy


    GLIMPSE-C01 is a heavily obscured, intermediate-age cluster that has been suggested to be one of the most massive clusters in the Milky Way. We observed GLIMPSE-C01 with both HST WFC3 IR and UVIS to look for NIR/Optical counterparts to the X-ray sources discovered by the Chandra X-ray Observatory. We present the results of the HST observations, analyze the stellar population of the cluster, and classify X-ray sources using multiwavelength information. We identify several X-ray binary candidates including one likely CV and one likely LMXB. The multi-band HST data also constrain the somewhat controversial distance and age of the cluster. The impact of confusion, affecting the WFC3/IR images of the cluster's core, is also evaluated. The presented observations and their analyses demonstrate the limitations of current instruments and the potential of JWST's superior angular resolution and sensitivety in crowded fields. We also discuss the potential of HST and JWST for multiwavelength X-ray source classification.

  1. Low mass X-ray binaries in the Inner Galaxy: implications for millisecond pulsars and the GeV excess

    Energy Technology Data Exchange (ETDEWEB)

    Haggard, Daryl; Heinke, Craig; Hooper, Dan; Linden, Tim


    If millisecond pulsars (MSPs) are responsible for the excess gamma-ray emission observed from the region surrounding the Galactic Center, the same region should also contain a large population of low-mass X-ray binaries (LMXBs). In this study, we compile and utilize a sizable catalog of LMXBs observed in the the Milky Way's globular cluster system and in the Inner Galaxy, as well as the gamma-ray emission observed from globular clusters, to estimate the flux of gamma rays predicted from MSPs in the Inner Galaxy. From this comparison, we conclude that only up to $\\sim$4-23% of the observed gamma-ray excess is likely to originate from MSPs. This result is consistent with, and more robust than, previous estimates which utilized smaller samples of both globular clusters and LMXBs. If MSPs had been responsible for the entirety of the observed excess, INTEGRAL should have detected $\\sim$$10^3$ LMXBs from within a $10^{\\circ}$ radius around the Galactic Center, whereas only 42 LMXBs (and 46 additional LMXB candidates) have been observed.

  2. A possible link between kHz quasi-periodic oscillations and the magnetospheric boundary

    Directory of Open Access Journals (Sweden)

    Hakan Erkut M.


    Full Text Available The quasi-periodic oscillations (QPOs observed with a 200-1300 Hz frequency range in the X-ray power spectra of low mass X-ray binaries (LMXBs might be considered as one of the observational clues to the physics at the innermost regions of accretion disks around neutron stars. In a neutron star LMXB, the magnetospheric boundary is likely to be close to the surface of the neutron star because of its presumably weak magnetic dipole field. The kHz QPOs can therefore be interpreted as the modulation of X-ray emission with smallest timescales associated with the dynamics of accreting disk matter at the magnetospheric boundary. As a result of magnetosphere-disk interaction we expect the rotational dynamics of the disk matter in the boundary region to be characterized by either sub-Keplerian or super-Keplerian flow depending on the fastness of the neutron star. We summarize our current understanding of the kHz QPO frequency correlations in terms of the oscillatory modes amplified in the magnetic boundary region and discuss the future prospects related to the possible link between kHz QPOs and the rotational dynamics at the magnetospheric boundary.

  3. Instability windows and evolution of rapidly rotating neutron stars. (United States)

    Gusakov, Mikhail E; Chugunov, Andrey I; Kantor, Elena M


    We consider an instability of rapidly rotating neutron stars in low-mass x-ray binaries (LMXBs) with respect to excitation of r modes (which are analogous to Earth's Rossby waves controlled by the Coriolis force). We argue that finite temperature effects in the superfluid core of a neutron star lead to a resonance coupling and enhanced damping (and hence stability) of oscillation modes at certain stellar temperatures. Using a simple phenomenological model we demonstrate that neutron stars with high spin frequency may spend a substantial amount of time at these "resonance" temperatures. This finding allows us to explain puzzling observations of hot rapidly rotating neutron stars in LMXBs and to predict a new class of hot, nonaccreting, rapidly rotating neutron stars, some of which may have already been observed and tentatively identified as quiescent LMXB candidates. We also impose a new theoretical limit on the neutron star spin frequency, which can explain the cutoff spin frequency ∼730  Hz, following from the statistical analysis of accreting millisecond x-ray pulsars. In addition to explaining the observations, our model provides a new tool to constrain superdense matter properties by comparing measured and theoretically predicted resonance temperatures.

  4. An XMM-Newton Observation of 4U1755-33 in Quiescence: Evidence for a Fossil X-Ray Jet (United States)

    Angelini, Lorella; White, Nicholas E.


    We report an XMM-Newton observation of the Low mass X-ray Binary (LMXB) and black hole candidate 4U1755-33. This source had been a bright persistent source for at least 25 yrs, but in 1995 entered an extended quiescent phase. 4U1755-33 was not detected with an upper limit to the 2-10 keV luminosity of 5 x 10(exp 31) d(sup 2) (sub 4kpc) ergs per second (where d(sub 4kpc) is the distance in units of 4 kpc) - consistent with the luminosity of other black hole candidates in a quiescent state. An unexpected result is the discovery of a narrow 7 arc min long X-ray jet centered on the position of 4Ul755-33. The spectrum of the jet is similar to that of jets observed from other galactic and extragalactic sources, and may have been ejected from 4Ul755-33 when it was bright. Jets are a feature of accreting black holes, and the detection of a fossil jet provides additional evidence supporting the black hole candidacy of 4U1755-33. The spectral properties of three bright serendipitous sources in the field are reported and it is suggested these are background active galactic nuclei sources.

  5. Absence of Reflection Features in NuSTAR  Spectra of the Luminous Neutron Star X-Ray Binary GX 5–1 (United States)

    Homan, Jeroen; Steiner, James F.; Lin, Dacheng; Fridriksson, Joel K.; Remillard, Ronald A.; Miller, Jon M.; Ludlam, Renee M.


    We present NuSTAR observations of the luminous neutron star low-mass X-ray binary (NS LMXB) and Z source GX 5‑1. During our three observations made with separations of roughly two days, the source traced out an almost complete Z track. We extract spectra from the various branches and fit them with a continuum model that has been successfully applied to other Z sources. Surprisingly, and unlike most of the (luminous) NS-LMXBs observed with NuSTAR, we do not find evidence for reflection features in any of the spectra of GX 5‑1. We discuss several possible explanations for the absence of reflection features. Based on a comparison with other accreting neutron star systems, and given the high luminosity of GX 5‑1 (∼1.6–2.3 times the Eddington luminosity, for a distance of 9 kpc), we consider a highly ionized disk the most likely explanation for the absence of reflection features in GX 5‑1.

  6. Probing the origin of Pulsar wind with a Black widow pulsar 2FGL J2339.6-0532 (United States)

    Yatsu, Yoichi; Shibata, Shinpei; Kawai, Nobuyuki; Kataoka, Jun; Saito, Yoshihiko

    Multi-wavelength observations of a black widow binary system 2FGL2339.6-0532 are presented. Black widow pulsars are believed to be in the intermediate stage between LMXB and isolated millisecond pulsars(MSPs). In a typical black widow system, the recycled MSP is evaporating up its companion star by the powerful pulsar wind. Fermi gamma-ray source 2FGL2339.6-0532 is recently categorized as an black widow pulsar. It possesses a K-star companion orbiting at a period of 4.63 h that corresponds to an orbit radius of about 10(11) cm for a standard NS mass. Our optical observations utilizing OISTER show clear sinusoidal light curves at various wavelength covering Ks B band. Phase resolved SED precisely constrained the size of the companion star and temperature. X-ray spectra taken with Suzaku revealed steady soft X-ray excess below 1 keV energy range that may be originated in blackbody emission from the neutron surface. While In hard X-ray energy band the X-ray light curve shows double peak modulation synchronized with the orbital motion indicating that the hard X-ray may be from the surface of the companion star. To explain the hard X-ray behavior we examined a simple geometry and estimated the physical state of the pulsar wind at immediate vicinity of the light cylinder of the pulsar.


    Energy Technology Data Exchange (ETDEWEB)

    Linares, M.; Chakrabarty, D. [Massachusetts Institute of Technology, Kavli Institute for Astrophysics and Space Research, Cambridge, MA 02139 (United States); Connaughton, V.; Bhat, P. N.; Briggs, M. S.; Preece, R. [CSPAR and Physics Department, University of Alabama in Huntsville, Huntsville, AL 35899 (United States); Jenke, P.; Kouveliotou, C.; Wilson-Hodge, C. A. [Space Science Office, VP62, NASA/Marshall Space Flight Center, Huntsville, AL 35812 (United States); Van der Horst, A. J. [Astronomical Institute ' Anton Pannekoek' , University of Amsterdam, NL-1090-GE Amsterdam (Netherlands); Camero-Arranz, A.; Finger, M.; Paciesas, W. S. [Universities Space Research Association, Huntsville, AL 35805 (United States); Beklen, E. [Physics Department, Suleyman Demirel University, 32260 Isparta (Turkey); Von Kienlin, A. [Max Planck Institute for Extraterrestrial Physics, Giessenbachstrasse, Postfach 1312, D-85748 Garching (Germany)


    Thermonuclear bursts from slowly accreting neutron stars (NSs) have proven difficult to detect, yet they are potential probes of the thermal properties of the NS interior. During the first year of a systematic all-sky search for X-ray bursts using the Gamma-ray Burst Monitor aboard the Fermi Gamma-ray Space Telescope we have detected 15 thermonuclear bursts from the NS low-mass X-ray binary 4U 0614+09 when it was accreting at nearly 1% of the Eddington limit. We measured an average burst recurrence time of 12 {+-} 3 days (68% confidence interval) between 2010 March and 2011 March, classified all bursts as normal duration bursts and placed a lower limit on the recurrence time of long/intermediate bursts of 62 days (95% confidence level). We discuss how observations of thermonuclear bursts in the hard X-ray band compare to pointed soft X-ray observations and quantify such bandpass effects on measurements of burst radiated energy and duration. We put our results for 4U 0614+09 in the context of other bursters and briefly discuss the constraints on ignition models. Interestingly, we find that the burst energies in 4U 0614+09 are on average between those of normal duration bursts and those measured in long/intermediate bursts. Such a continuous distribution in burst energy provides a new observational link between normal and long/intermediate bursts. We suggest that the apparent bimodal distribution that defined normal and long/intermediate duration bursts during the last decade could be due to an observational bias toward detecting only the longest and most energetic bursts from slowly accreting NSs.

  8. A new Arctic seepage site? Preliminary evidence from benthic community (United States)

    Caridi, Francesca; Sabbatini, Anna; Morigi, Caterina; Giulia Lucchi, Renata


    The Kveithola Trough is an abrupt and narrow sedimentary system located in the NW Barents Sea. The hydrographic, bio-geochemical conditions and the possible existence of gas seepage activity of the area have been investigated during the Eurofleets 2- BURSTER cruise, conducted on board the German icebreaker RV Polarstern. The aim of our work is to characterize the benthic biota and more specifically the macrofaunal community structure coupled to the study of benthic foraminiferal meiofauna. Preliminary qualitative results revealed that in the inner Kveithola Trough, the macrofaunal community is composed by abundant black worm tubes (Chaetopteridae worms and Siboglinidae-like taxa) with presence of Thyasiridae bivalve species. The occurrence of these macrofaunal taxa is usually associated to oxygen-reduced environments, hydrothermal vents and cold seeps. The living benthic foraminiferal assemblage in the same stations is characterized by the presence of typically oxygen-depleted environmental taxa including the calcareous species Nonionellina labradorica and Globobulimina spp.. Conversely, in the outer Kveithola trough, both benthic macrofauna and foraminiferal meiofauna assemblages are characterized by less opportunistic taxa with a higher biodiversity suggesting very distinct oceanographic sea bottom conditions. The organic matter richness plays a large role in the Kveithola Trough environmental setting and may bring anoxic conditions that could affect the biota of the area. In fact, the benthic community structure of this area inhabits suboxic, anoxic and organic-enriched sediments and disturbed environments, forming assemblages with low diversity and high abundances of a few tolerant and/or specialized species. This preliminary finding could be consistent with other studies examining benthic community structure around Svalbard and in particular cold seep and vents habitats where faunal characteristics are patchy, suggesting small-scale heterogeneity in the

  9. Explosive fragmentation of liquids in spherical geometry (United States)

    Milne, A.; Longbottom, A.; Frost, D. L.; Loiseau, J.; Goroshin, S.; Petel, O.


    Rapid acceleration of a spherical shell of liquid following central detonation of a high explosive causes the liquid to form fine jets that are similar in appearance to the particle jets that are formed during explosive dispersal of a packed layer of solid particles. Of particular interest is determining the dependence of the scale of the jet-like structures on the physical parameters of the system, including the fluid properties (e.g., density, viscosity, and surface tension) and the ratio of the mass of the liquid to that of the explosive. The present paper presents computational results from a multi-material hydrocode describing the dynamics of the explosive dispersal process. The computations are used to track the overall features of the early stages of dispersal of the liquid layer, including the wave dynamics, and motion of the spall and accretion layers. The results are compared with new experimental results of spherical charges surrounded by a variety of different fluids, including water, glycerol, ethanol, and vegetable oil, which together encompass a significant range of fluid properties. The results show that the number of jet structures is not sensitive to the fluid properties, but primarily dependent on the mass ratio. Above a certain mass ratio of liquid fill-to-explosive burster ( F / B), the number of jets is approximately constant and consistent with an empirical model based on the maximum thickness of the accretion layer. For small values of F / B, the number of liquid jets is reduced, in contrast with explosive powder dispersal, where small F / B yields a larger number of particle jets. A hypothetical explanation of these features based on the nucleation of cavitation is explored numerically.

  10. Reproduction of an animal model of landmine blast injuries

    Directory of Open Access Journals (Sweden)

    Sen ZHANG


    Full Text Available Objective To reproduce an animal model of landmine blast injuries for studying its mechanism and characteristics. Methods Fifteen healthy New Zealand white rabbits (body weight 1.9-2.4 kg were prepared as experimental animals. Punctiform burster was used to simulate the landmine, and it was electrically detonated far away to produce landmine blast injuries on unilateral hind limb of rabbits in upright state. The vital signs before and 5min, 15min, 30min, 45min, 1h, 2h, 3h, 6h, 9h and 12h after injuries were recorded. Autopsy of dead animals was performed immediately and the survivors were sacrificed for pathological examination 6h and 12h after the injury. Macroscopic and microscopic changes in the injured limb and distant organs were observed. Fifteen random adult body weights were generated by random number table, and the explosive energy of M14 landmine (about 29g TNT explosive energy was simulated, to compare the ratio of explosive force equivalent to weight calculated between experimental animals and randomly selected adults. Results No significant change in blood pressure was observed at different time points before and after injuries. A broom-like change was found in the injured limb by the general observation. The subareas and pathological changes of injured limb coincided with the typical limb injuries produced by landmine explosion. Damage in different degrees was found in distant organs, and the wound characteristics and injury of major organs were in accordance with the reports of relevant literature. The ratio of explosive equivalent to weight of experimental animals (0.50±0.04g TNT/kg was similar to that of randomly selected adults (0.51±0.05g TNT/kg. Conclusion The present animal model could simulate the landmine explosive injuries, and may be used in research of landmine explosive injuries. DOI: 10.11855/j.issn.0577-7402.2014.01.14

  11. Hard-X-Ray/Soft-Gamma-Ray Imaging Sensor Assembly for Astronomy (United States)

    Myers, Richard A.


    An improved sensor assembly has been developed for astronomical imaging at photon energies ranging from 1 to 100 keV. The assembly includes a thallium-doped cesium iodide scintillator divided into pixels and coupled to an array of high-gain avalanche photodiodes (APDs). Optionally, the array of APDs can be operated without the scintillator to detect photons at energies below 15 keV. The array of APDs is connected to compact electronic readout circuitry that includes, among other things, 64 independent channels for detection of photons in various energy ranges, up to a maximum energy of 100 keV, at a count rate up to 3 kHz. The readout signals are digitized and processed by imaging software that performs "on-the-fly" analysis. The sensor assembly has been integrated into an imaging spectrometer, along with a pair of coded apertures (Fresnel zone plates) that are used in conjunction with the pixel layout to implement a shadow-masking technique to obtain relatively high spatial resolution without having to use extremely small pixels. Angular resolutions of about 20 arc-seconds have been measured. Thus, for example, the imaging spectrometer can be used to (1) determine both the energy spectrum of a distant x-ray source and the angular deviation of the source from the nominal line of sight of an x-ray telescope in which the spectrometer is mounted or (2) study the spatial and temporal development of solar flares, repeating - ray bursters, and other phenomena that emit transient radiation in the hard-x-ray/soft- -ray region of the electromagnetic spectrum.

  12. The Nature and Evolutionary History of GRO J1744-28 (United States)

    Rappaport, S.


    calculations yield the following values for the GRO J1744-28 system parameters (with 95% confidence limits in parentheses): donor star mass: 0.24 solar mass (0.2-0.7 solar mass); He core mass of the donor star: 0.22 solar mass (0.20-0.25 solar mass); neutron-star mass: 1.7 solar mass (1.39-1.96 solar mass); orbital inclination angle: 18deg (7deg-22deg); semi- major axis: 64 lt-s (60-67 lt-s); radius of the donor star: 6.2 solar radius(6-9 solar radius); luminosity of donor star: 23 solar luminosity (15-49 solar luminosity), and long-term mass transfer rate at the current epoch: 5 x 10(exp -10)solar mass/yr (2 x 10(exp -10) to 5 x 10(exp -9)solar mass/yr). We deduce that the magnetic field of the underlying neutron star lies in the range of approximately 1.8 x 10(exp 11)G to approximately 7 x 10(exp 11)G, with a most probable value of 2.7 x 10(exp 11)G. This is evidently sufficiently strong to funnel the accretion flow onto the magnetic polar caps and suppress the thermonuclear flashes that would otherwise give rise to the type 1 X-ray bursts observed in most X-ray bursters. We present a simple paradigm for magnetic accreting neutron stars where X-ray pulsars, GRO J1744-28, the Rapid Burster, and the type 1 X-ray bursters may form a continuum of possible behaviors among accreting neutron stars, with the strength of the neutron-star magnetic field serving as a crucial parameter that determines the mode of X-ray variability from a given object.

  13. Temporal epidemiology of microfilaraemia among migrant workers entering Kuwait

    Directory of Open Access Journals (Sweden)

    Michael Edwin


    Full Text Available Abstract Background There is paucity of published data on the microfilarial infection among migrants from endemic countries entering Kuwait. The primary objectives of this study were to use routine health surveillance data to i to estimate the prevalence of microfilarial infection in migrant workers to Kuwait and ii to determine the occurrence of any time trends in the proportions of microfilaria positives among these workers over the recent past. Methods Monthly aggregates of microfilaria thick slide test results obtained from routine health examinations of migrant workers conducted at the Ports and Border Health Division of Ministry of Health, Kuwait between January 1, 1992 and December 31, 2006, were available for trend analysis of these time series data. Results During the study period, the prevalence (per 100,000 of microfilaraemia positive migrant workers was 48 (1169/2449360. A third-order polynomial regression model of monthly proportions of microfilaraemic workers revealed a significant initial increase (βˆ1 MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGaciGaaiaabeqaaeqabiWaaaGcbaGafqOSdiMbaKaadaWgaaWcbaGaeGymaedabeaaaaa@2EA2@ = 2.976 (± 0.157; P βˆ2 MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGaciGaaiaabeqaaeqabiWaaaGcbaGafqOSdiMbaKaadaWgaaWcbaGaeGOmaidabeaaaaa@2EA4@ = -0.0358 (± 0.002; P βˆ3 MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGaciGaaiaabeqaaeqabiWaaaGcbaGafqOSdiMbaKaadaWgaaWcbaGaeG4mamdabeaaaaa@2EA6@ = 0.0001 (± P Conclusion This

  14. Estimation of the number of extreme pathways for metabolic networks

    Directory of Open Access Journals (Sweden)

    Thiele Ines


    Full Text Available Abstract Background The set of extreme pathways (ExPa, {pi}, defines the convex basis vectors used for the mathematical characterization of the null space of the stoichiometric matrix for biochemical reaction networks. ExPa analysis has been used for a number of studies to determine properties of metabolic networks as well as to obtain insight into their physiological and functional states in silico. However, the number of ExPas, p = |{pi}|, grows with the size and complexity of the network being studied, and this poses a computational challenge. For this study, we investigated the relationship between the number of extreme pathways and simple network properties. Results We established an estimating function for the number of ExPas using these easily obtainable network measurements. In particular, it was found that log [p] had an exponential relationship with log⁡[∑i=1Rd−id+ici] MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacH8akY=wiFfYdH8Gipec8Eeeu0xXdbba9frFj0=OqFfea0dXdd9vqai=hGuQ8kuc9pgc9s8qqaq=dirpe0xb9q8qiLsFr0=vr0=vr0dc8meaabaqaciaacaGaaeqabaqabeGadaaakeaacyGGSbaBcqGGVbWBcqGGNbWzdaWadaqaamaaqadabaGaemizaq2aaSbaaSqaaiabgkHiTmaaBaaameaacqWGPbqAaeqaaaWcbeaakiabdsgaKnaaBaaaleaacqGHRaWkdaWgaaadbaGaemyAaKgabeaaaSqabaGccqWGJbWydaWgaaWcbaGaemyAaKgabeaaaeaacqWGPbqAcqGH9aqpcqaIXaqmaeaacqWGsbGua0GaeyyeIuoaaOGaay5waiaaw2faaaaa@4414@, where R = |Reff| is the number of active reactions in a network, d−i MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacH8akY=wiFfYdH8Gipec8Eeeu0xXdbba9frFj0=OqFfea0dXdd9vqai=hGuQ8kuc9pgc9s8qqaq=dirpe0xb9q8qiLsFr0=vr0=vr0dc8meaabaqaciaacaGaaeqabaqabeGadaaakeaacqWGKbazdaWgaaWcbaGaeyOeI0YaaSbaaWqaaiabdMgaPbqabaaaleqaaaaa@30A9@ and d+i MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacH8akY=wiFfYdH8Gipec8Eeeu0xXdbba9frFj0=OqFfea0dXdd9vqai=hGuQ8kuc9pgc9s8qqaq=dirpe0xb

  15. Models of low-mass helium white dwarfs including gravitational settling, thermal and chemical diffusion, and rotational mixing (United States)

    Istrate, A. G.; Marchant, P.; Tauris, T. M.; Langer, N.; Stancliffe, R. J.; Grassitelli, L.


    A large number of extremely low-mass helium white dwarfs (ELM WDs) have been discovered in recent years. The majority of them are found in close binary systems suggesting they are formed either through a common-envelope phase or via stable mass transfer in a low-mass X-ray binary (LMXB) or a cataclysmic variable (CV) system. Here, we investigate the formation of these objects through the LMXB channel with emphasis on the proto-WD evolution in environments with different metallicities. We study for the first time the combined effects of rotational mixing and element diffusion (e.g. gravitational settling, thermal and chemical diffusion) on the evolution of proto-WDs and on the cooling properties of the resulting WDs. We present state-of-the-art binary stellar evolution models computed with MESA for metallicities of Z = 0.02, 0.01, 0.001 and 0.0002, producing WDs with masses between 0.16-0.45 M⊙. Our results confirm that element diffusion plays a significant role in the evolution of proto-WDs that experience hydrogen shell flashes. The occurrence of these flashes produces a clear dichotomy in the cooling timescales of ELM WDs, which has important consequences e.g. for the age determination of binary millisecond pulsars. In addition, we confirm that the threshold mass at which this dichotomy occurs depends on metallicity. Rotational mixing is found to counteract the effect of gravitational settling in the surface layers of young, bloated ELM proto-WDs and therefore plays a key role in determining their surface chemical abundances, I.e. the observed presence of metals in their atmospheres. We predict that these proto-WDs have helium-rich envelopes through a significant part of their lifetime. This is of great importance as helium is a crucial ingredient in the driving of the κ-mechanism suggested for the newly observed ELM proto-WD pulsators. However, we find that the number of hydrogen shell flashes and, as a result, the hydrogen envelope mass at the beginning of

  16. Estimation of Genetic Parameters of Kleiber Ratio and Growth Traits in Kurdish Sheep

    Directory of Open Access Journals (Sweden)

    Davoud Ali Saghi


    restricted maximum likelihood (REML method fitting six animal models using WOMBAT (18: y =Xb+Zaa+e Model 1 y=Xb+Zaa+Zpepe+e Model 2 y =Xb+Zaa+Zmm+e\tCov(a,m=0\tModel 3 y =Xb+Zaa+Zmm+e\tCov(a,m=Aσam\tModel 4 y =Xb+Zaa+Zmm+Zpepe+e\tCov(a,m=0\tModel 5 y =Xb+Zaa+Zmm+Zpepe+e\tCov(a,m= Aσam\tModel 6 where y: is a vector of records, b: is a vector of fixed effects, a: is a vector of direct additive genetic effects, m: is a vector of maternal additive genetic effects, pe: is a vector of permanent environmental effects due to ewe, X, Za, Zm and Zpe are corresponding design matrices relating the fixed effects, direct additive genetic effects, maternal additive genetic effects and permanent environmental effects due to ewe to vector of y, respectively, e: is a vector of residual effects, and Cov(a,m: is the covariance between direct additive genetic and maternal additive genetic effects. Akaike’s Information Criterion (AIC was used for selecting the best model among the tested models (3: Where logLi: is the maximized log likelihood of model i at convergence and pi: is the number of the parameters in each model. Model with the lowest AIC was considered as the best model for each trait. Estimation of genetic and phenotypic correlations was accomplished using multi-trait analysis (with model 1. The fixed effects included in the multi-trait animal models were those in single-trait analyses. Results and Discussion The pre-weaning average daily gain in Kurdish lambs was 215.33±0.96 g, while this trait in post-weaning periods had a decreased trend. These values (especially in pre-weaning period indicated that Kurdish lambs have a good potential for growth. Results from the analysis of variance of ADG and KR in different ages showed that birth year and sex of the lambs significantly influenced studied traits (P< 0.01. Type of birth had significant effect (P< 0.01 on ADG0-3, ADG3-6, KR1 and KR2. The effect of ewe age was significant for ADG0-3 and KR1. The significant effects of fixed


    Energy Technology Data Exchange (ETDEWEB)

    Ouyed, Rachid [Department of Physics and Astronomy, University of Calgary, 2500 University Drive NW, Calgary, Alberta T2N 1N4 (Canada); Staff, Jan [Department of Physics and Astronomy, Louisiana State University, 202 Nicholson Hall, Tower Dr., Baton Rouge, LA 70803-4001 (United States); Jaikumar, Prashanth [Department of Physics and Astronomy, California State University Long Beach, 1250 Bellflower Blvd., Long Beach, CA 90840 (United States)


    We propose a simple model explaining two outstanding astrophysical problems related to compact objects: (1) that of stars such as G87-7 (alias EG 50) that constitute a class of relatively low-mass white dwarfs (WDs) which nevertheless fall away from the C/O composition and (2) that of GRB 110328A/Swift J164449.3+57345 which showed spectacularly long-lived strong X-ray flaring, posing a challenge to standard gamma-ray burst models. We argue that both these observations may have an explanation within the unified framework of a quark-nova (QN) occurring in a low-mass X-ray binary (LMXB; neutron star (NS)-WD). For LMXBs, where the binary separation is sufficiently tight, ejecta from the exploding NS triggers nuclear burning in the WD on impact, possibly leading to Fe-rich composition compact WDs with mass 0.43 M{sub Sun} < M{sub WD} < 0.72 M{sub Sun }, reminiscent of G87-7. Our results rely on the assumption, which ultimately needs to be tested by hydrodynamic and nucleosynthesis simulations, that under certain circumstances the WD can avoid the thermonuclear runaway. For heavier WDs (i.e., M{sub WD} > 0.72 M{sub Sun }) experiencing the QN shock, degeneracy will not be lifted when carbon burning begins, and a sub-Chandrasekhar Type Ia supernova may result in our model. Under slightly different conditions and for pure He WDs (i.e., M{sub WD} < 0.43 M{sub Sun }), the WD is ablated and its ashes raining down on the quark star (QS) leads to accretion-driven X-ray luminosity with energetics and duration reminiscent of GRB 110328A. We predict additional flaring activity toward the end of the accretion phase if the QS turns into a black hole.

  18. Discovery of the Neutron Star Spin Frequency in EXO 0748-676 (United States)

    Villarreal, Adam R.; Strohmayer, Tod E.


    We report the results of a search for burst oscillations during thermonuclear X-ray bursts from the low mass X-ray binary (LMXB) EXO 0748-676. With the proportional counter array (PCA) onboard the Rossi X-ray Timing Explorer (RXTE) we have detected a 45 Hz oscillation in the average power spectrum of 38 thermonuclear X-ray bursts from this source. We computed power spectra with 1 Hz frequency resolution for both the rising and decaying portions of 38 X-ray bursts from the public RXTE archive. We averaged the 1 Hz power spectra and detected a significant signal at 45 Hz in the decaying phases of the bursts. The signal is detected at a significance level of 4 x 10 (exp -8) similar signal was detected in the rising intervals. The oscillation peak is unresolved at 1 Hz frequency resolution, indicating an oscillation quality factor, Q = nu (sub 0)/Delta nu (sub fwhm) greater than 45, and the average signal amplitude is approximately equal to 3% (rms) The detection of 45 Hz burst oscillations from EXO 0748-676 provides compelling evidence that this is the neutron star spin frequency in this system. We use the inferred spin frequency to model the widths of absorption lines from the neutron star surface and show that the widths of the absorption lines from EXO 0748-676 recently reported by Cottam et al. are consistent with a 45 Hz spin frequency as long as the neutron star radius is in the range from about 9.5 - 15 km. With a known spin frequency, precise modelling of the line profiles from EXO 0748-676 holds great promise for constraining the dense matter equation of state.

  19. Effect of the Kerr Metric on Photosperic Radius Expansion in X Ray Burst (United States)

    Kalita, S.; Barman, A.


    The main objective of this paper is to study general relativistic effects on the photospheric radius expansion during an X-ray burst. We examine how the Kerr metric causes a shift in the effective temperature and radiation flux with respect to the Schwarzschild values during mass accretion onto a neutron star or a black hole resulting in the X-ray burst. The spin of the compact object is used up to the maximal Kerr limit χ = 0.99 with different latitudes of accretion emission. The amplitude of temperature shift relative to the Schwarzschild case is found to be δ T/ T ≈ - (10-3 - 10-4) for the range χ = 0.1 - 0.99 at latitudes θ = 0o , 30o, 45o and 88o. The ratio of emission flux in the Kerr metric to that in the Schwarzschild metric, F(K)/F(S), is found to be less than unity. It goes up to a maximum of 0.9 for the lowest nonzero value of the spin parameter (i.e., 0.1). For the maximal Kerr limit, χ = 0.99 , it saturates near 0.8. This effect is more prominent towards the pole. This reduction in temperature and flux is found to be consistent with the absence of photospheric radius expansion in the X Ray burst LMXB 4U 1608-52, observed by NuSTAR. Although this is not uniquely ascribed to the metric, it is believed that the spacetime metric effect in the burst phenomena can be used as a probe for testing general relativity. Also, the shift in temperature or the radiation flux might have an observable signature in the element synthesis processes in such environments.


    Energy Technology Data Exchange (ETDEWEB)

    Patruno, Alessandro; Alpar, M. Ali; Van der Klis, Michiel; Van den Heuvel, Ed P. J., E-mail: [Astronomical Institute ' Anton Pannekoek' , University of Amsterdam, Science Park 904, 1098 SJ Amsterdam (Netherlands)


    The low-mass X-ray binary (LMXB) IGR J17480-2446 in the globular cluster Terzan 5 harbors an 11 Hz accreting pulsar. This is the first object discovered in a globular cluster with a pulsar spinning at such low rate. The accreting pulsar is anomalous because its characteristics are very different from the other five known slow accreting pulsars in galactic LMXBs. Many features of the 11 Hz pulsar are instead very similar to those of accreting millisecond pulsars, spinning at frequencies >100 Hz. Understanding this anomaly is valuable because IGR J17480-2446 could be the only accreting pulsar discovered so far which is in the process of becoming an accreting millisecond pulsar. We first verify that the neutron star (NS) in IGR J17480-2446 is indeed spinning up by carefully analyzing X-ray data with coherent timing techniques that account for the presence of timing noise. We then study the present Roche lobe overflow epoch and the two previous spin-down epochs dominated by magneto-dipole radiation and stellar wind accretion. We find that IGR J17480-2446 is very likely a mildly recycled pulsar and suggest that it has started a spin-up phase in an exceptionally recent time, which has lasted less than a few 10{sup 7} yr. We also find that the total age of the binary is surprisingly low ({approx}< 10{sup 8} yr) when considering typical parameters for the newborn NS and propose different scenarios to explain this anomaly.

  1. Milky Way globular cluster metallicity and low-mass X-ray binaries: the red giant influence (United States)

    Vulic, N.; Barmby, P.; Gallagher, S. C.


    Galactic and extragalactic studies have shown that metal-rich globular clusters (GCs) are approximately three times more likely to host bright low-mass X-ray binaries (LMXBs) than metal-poor GCs. There is no satisfactory explanation for this metallicity effect. We tested the hypothesis that the number density of red giant branch (RGB) stars is larger in metal-rich GCs, and thus potentially the cause of the metallicity effect. Using Hubble Space Telescope photometry for 109 unique Milky Way GCs, we investigated whether RGB star density was correlated with GC metallicity. Isochrone fitting was used to calculate the number of RGB stars, which were normalized by the GC mass and fraction of observed GC luminosity, and determined density using the volume at the half-light radius (rh). The RGB star number density was weakly correlated with metallicity [Fe/H], giving Spearman and Kendall Rank test p-values of 0.000 16 and 0.000 21 and coefficients rs = 0.35 and τ = 0.24, respectively. This correlation may be biased by a possible dependence of rh on [Fe/H], although studies have shown that rh is correlated with Galactocentric distance and independent of [Fe/H]. The dynamical origin of the rh-metallicity correlation (tidal stripping) suggests that metal-rich GCs may have had more active dynamical histories, which would promote LMXB formation. No correlation between the RGB star number density and metallicity was found when using only the GCs that hosted quiescent LMXBs. A complete census of quiescent LMXBs in our Galaxy is needed to further probe the metallicity effect, which will be possible with the upcoming launch of eROSITA.

  2. Catching the role of anisotropic electronic distribution and charge transfer in halogen bonded complexes of noble gases. (United States)

    Bartocci, Alessio; Belpassi, Leonardo; Cappelletti, David; Falcinelli, Stefano; Grandinetti, Felice; Tarantelli, Francesco; Pirani, Fernando


    The systems studied in this work are gas-phase weakly bound adducts of the noble-gas (Ng) atoms with CCl4 and CF4. Their investigation was motivated by the widespread current interest for the intermolecular halogen bonding (XB), a structural motif recognized to play a role in fields ranging from elementary processes to biochemistry. The simulation of the static and dynamic behaviors of complex systems featuring XB requires the formulation of reliable and accurate model potentials, whose development relies on the detailed characterization of strength and nature of the interactions occurring in simple exemplary halogenated systems. We thus selected the prototypical Ng-CCl4 and Ng-CF4 and performed high-resolution molecular beam scattering experiments to measure the absolute scale of their intermolecular potentials, with high sensitivity. In general, we expected to probe typical van der Waals interactions, consisting of a combination of size (exchange) repulsion with dispersion/induction attraction. For the He/Ne-CF4, the analysis of the glory quantum interference pattern, observable in the velocity dependence of the integral cross section, confirmed indeed this expectation. On the other hand, for the He/Ne/Ar-CCl4, the scattering data unravelled much deeper potential wells, particularly for certain configurations of the interacting partners. The experimental data can be properly reproduced only including a shifting of the repulsive wall at shorter distances, accompanied by an increased role of the dispersion attraction, and an additional short-range stabilization component. To put these findings on a firmer ground, we performed, for selected geometries of the interacting complexes, accurate theoretical calculations aimed to evaluate the intermolecular interaction and the effects of the complex formation on the electron charge density of the constituting moieties. It was thus ascertained that the adjustments of the potential suggested by the analysis of the

  3. SU-F-T-609: Impact of Dosimetric Variation for Prescription Dose Using Analytical Anisotropic Algorithm (AAA) in Lung SBRT

    Energy Technology Data Exchange (ETDEWEB)

    Kawai, D [Kanagawa Cancer Center, Yokohama, Kanagawa (Japan); Takahashi, R [Cancer Institute Hospital of Japanese Foundation for Cancer Research, Koto, Tokyo (Japan); Kamima, T [Cancer Institute Hospital Japanese Foundation for Cancer Research, Koto, Tokyo (Japan); Baba, H [The National Cancer Center Hospital East, Kshiwa, Chiba (Japan); Yamamoto, T; Kubo, Y [Otemae Hospital, Chuo-ku, Osaka (Japan); Ishibashi, S; Higuchi, Y [Sasebo City General Hospital, Sasebo, Nagasaki (Japan); Tani, K [St Luke’s International Hospital, Tokyo, Tokyo (Japan); Tachibana, H [National Cancer Center, Kashiwa, Chiba (Japan)


    Purpose: Actual irradiated prescription dose to patients cannot be verified. Thus, independent dose verification and second treatment planning system are used as the secondary check. AAA dose calculation engine has contributed to lung SBRT. We conducted a multi-institutional study to assess variation of prescription dose for lung SBRT when using AAA in reference to using Acuros XB and Clarkson algorithm. Methods: Six institutes in Japan participated in this study. All SBRT treatments were planed using AAA in Eclipse and Adaptive Convolve (AC) in Pinnacle3. All of the institutes used a same independent dose verification software program (Simple MU Analysis: SMU, Triangle Product, Ishikawa, Japan), which implemented a Clarkson-based dose calculation algorithm using CT image dataset. A retrospective analysis for lung SBRT plans (73 patients) was performed to compute the confidence limit (CL, Average±2SD) in dose between the AAA and the SMU. In one of the institutes, a additional analysis was conducted to evaluate the variations between the AAA and the Acuros XB (AXB). Results: The CL for SMU shows larger systematic and random errors of 8.7±9.9 % for AAA than the errors of 5.7±4.2 % for AC. The variations of AAA correlated with the mean CT values in the voxels of PTV (a correlation coefficient : −0.7) . The comparison of AXB vs. AAA shows smaller systematic and random errors of −0.7±1.7%. The correlation between dose variations for AXB and the mean CT values in PTV was weak (0.4). However, there were several plans with more than 2% deviation of AAPM TG114 (Maximum: −3.3 %). Conclusion: In comparison for AC, prescription dose calculated by AAA may be more variable in lung SBRT patient. Even AXB comparison shows unexpected variation. Care should be taken for the use of AAA in lung SBRT. This research is partially supported by Japan Agency for Medical Research and Development (AMED)

  4. Relações de tamanho e peso das grandes medusas (Cnidaria do litoral do Paraná, Sul do Brasil Size-weight relationship among macromedusae (Cnidaria of Paraná coast Southern Brazil

    Directory of Open Access Journals (Sweden)

    Miodeli Nogueira Jr


    Full Text Available Relações de tamanho e peso são dados básicos importantes para facilitar estimativas de estoques, de monitoramentos contínuos e de larga escala das espécies, além de permitir a obtenção de valores de biomassa a partir da distribuição de tamanho. Apesar destes dados serem básicos e de reconhecida importância ecológica e sócio-econômica, estudos biométricos das grandes medusas do litoral brasileiro ainda inexistem. Apresenta-se, neste estudo, as relações de tamanho e peso das seis espécies de macromedusas mais comuns no litoral paranaense: Tamoya haplonema Müller, 1859 e Chiropsalmus quadrumanus (Müller, 1859 - Cubozoa; Olindias sambaquiensis Müller, 1861 - Hydrozoa; Chrysaora lactea Eschscholtz, 1829, Lychnorhiza lucerna Haeckel, 1880 e Phyllorhiza punctata von Lendenfeld, 1884 - Scyphozoa. Foram utilizadas equações do tipo Y = aXb onde, Y = peso úmido; X = diâmetro da umbrela (com exceção de T. haplonema, para a qual utilizou-se a medida de altura umbrelar; a e b são os parâmetros estimados para cada população. A maioria das espécies estudadas apresentou alometria negativa, uma vez que b era menor que 3 na maioria dos casos, variando entre 2,415 e 3,028.Size-weight relationships are important for population stock estimates, continuous and large-scale population monitoring, as well as permitting the estimation of population biomass from size-class distribution. While these data are basic and useful for ecological and economical analyses, such estimates for Brazilian jellyfish do not exist. Here we present size-weight relationships for the six most common species of large medusae in the coast of Paraná, southern Brazil: Tamoya haplonema Müller, 1859 and Chiropsalmus quadrumanus (Müller, 1859 - Cubozoa; Olindias sambaquiensis Müller, 1861 - Hydrozoa; Chrysaora lactea Eschscholtz, 1829, Lychnorhiza lucerna Haeckel, 1880 and Phyllorhiza punctata von Lendenfeld, 1884 - Scyphozoa. A regression of the form Y = aXb

  5. Rotational Dynamics of Diazabicyclo[2.2.2]octane in Isomorphous Halogen-Bonded Co-crystals: Entropic and Enthalpic Effects. (United States)

    Catalano, Luca; Perez-Estrada, Salvador; Wang, Hsin-Hua; Ayitou, Anoklase J-L; Khan, Saeed I; Terraneo, Giancarlo; Metrangolo, Pierangelo; Brown, Stuart; Garcia-Garibay, Miguel A


    Based on rotational dynamics measurements carried out with isomorphic co-crystals formed by halogen-bonding (XB) between tritylacetylene halides (TrX) and diazabicyclo[2.2.2]octane (dabco), we were able to distinguish the sources of the enthalpic and entropic components in the rotational free energy barrier. We describe the formation of the 1:1 co-crystals (TrX···N(R)3N) obtained from 1 equiv of dabco and 1 equiv of either TrI or TrBr, respectively, to give 4a and 4b instead of the potential 2:1 complexes. The co-crystals were prepared by solvent evaporation and mechanochemical synthesis. No co-crystal with TrCl was obtained, reflecting the weaker nature of the TrCl···NR3 interaction. Single-crystal X-ray diffraction confirmed structures that resemble a spinning top on a tripod and revealed that the two XB co-crystals are isomorphous, with slightly different C-X···NR3 (X = I, Br) distances and packing interactions. Quadrupolar-echo 2H NMR experiments with 2H-labeled samples showed that fast rotation of dabco in these co-crystals follows a six-fold potential energy surface with three lowest energy minima. Variable-temperature 1H NMR spin-lattice relaxation (VT 1H T1) data revealed rotational dynamics with indistinguishable pre-exponential factors and small but distinguishable activation energies. The activation energy of 4b (Ea = 0.71 kcal mol-1) is the lowest reported in the field of amphidynamic crystals. Using the Eyring equation, we established that their activation entropy for rotation is small but negative (ΔS⧧ = -3.0 cal mol-1 K-1), while there is almost a 2-fold difference in activation enthalpies, with 4a having a higher barrier (ΔH⧧ = 0.95 kcal mol-1) than 4b (ΔH⧧ = 0.54 kcal mol-1). Analysis of the rotator cavity in the two co-crystals revealed subtle differences in steric interactions that account for their different activation energies.

  6. Saccharide-derived microporous spherical biochar prepared from hydrothermal carbonization and different pyrolysis temperatures: synthesis, characterization, and application in water treatment. (United States)

    Tran, Hai Nguyen; Lee, Chung-Kung; Nguyen, Tien Vinh; Chao, Huan-Ping


    Three saccharides (glucose, sucrose, and xylose) were used as pure precursors for synthesizing spherical biochars (GB, SB, and XB), respectively. The two-stage synthesis process comprised: (1) the hydrothermal carbonization of saccharides to produce spherical hydrochar' and (2) pyrolysis of the hydrochar at different temperatures from 300°C to 1200°C. The results demonstrated that the pyrolysis temperatures insignificantly affected the spherical morphology and surface chemistry of biochar. The biochar' isoelectric point ranged from 2.64 to 3.90 (abundant oxygen-containing functionalities). The Brunauer-Emmett-Teller (BET)-specific surface areas (SBET) and total pore volumes (Vtotal) of biochar increased with the increasing pyrolysis temperatures. The highest SBET and Vtotal were obtained at a pyrolysis temperature of 900°C for GB (775 m2/g and 0.392 cm3/g), 500°C for SB (410 m2/g and 0.212 cm3/g), and 600°C for XB (426 m2/g and 0.225 cm3/g), respectively. The spherical biochar was a microporous material with approximately 71-98% micropore volume. X-ray diffraction results indicated that the biochar' structure was predominantly amorphous. The spherical biochar possessed the graphite structure when the pyrolysis temperature was higher than 600°C. The adsorption capacity of GB depended strongly on the pyrolysis temperature. The maximum Langmuir adsorption capacities ([Formula: see text]) of 900GB exhibited the following selective order: phenol (2.332 mmol/g) > Pb2+ (1.052 mmol/g) > Cu2+ (0.825 mmol/g) > methylene green 5 (0.426 mmol/g) > acid red 1 (0.076 mmol/g). This study provides a simple method to prepare spherical biochar - a new and potential adsorbent for adsorbing heavy metals and aromatic contaminants.

  7. Pengaruh Model Pembelajaran Kooperatif Tipe Time Token Berbantu Puzzle Terhadap Kemampuan Berpikir Kritis Peserta Didik Kelas X Pada Materi Gelombang

    Directory of Open Access Journals (Sweden)

    Sri Latifah


    Full Text Available The purpose in this research is to know the influence of cooperative Learning Models Time Type Token with puzzle toward critical thought abilityof the students grade X on Wave material at MA Al Hikmah Bandar Lampung year2014/2015 This research is quantitative with quasi experiment. Reasearch design that used is Nonequivalent Control Group Design with the population of all the students in grade X semestre even at MA Al Hikmah, Bandar Lampung year 2014/2015. The Sample of this research are used 2 classes; experiment and control class, where as experiment class (XA used cooperative time type token model with puzzle and control class (XB used cooperative learning model with pictures as media. Data colecting is using test (pretest and posttest, observation and documentation. After the data test collected, then it is analyzed by using normality test of statistic analysis, homoginity test and test-t. According to the result, it can be concluded that time type token with puzzle application influence significantly ttoward the ability of critical thinking of the students on Wave material at MA Al Hikmah Bandar Lampung year 2014/2015. Tujuan penelitian ini adalah untuk mengetahui pengaruh model pembelajaran kooperatif tipe time token berbantu puzzle terhadap kemampuan berpikir kritis peserta didik kelas X pada materi Gelombang di MA Al Hikmah Bandar Lampung Tahun Pelajaran 2014/2015 .Penelitian ini termasuk kedalam penelitian kuantitatif dengan jenis penelitian Quasi Eksperimen. Desain penelitian ini menggunakan Nonequivalent Control Group Design dengan populasi yaitu seluruh peserta didik kelas X semester genap di MA Al Hikmah Bandar Lampung T.P 2014/2015. Sampel penelitian ini menggunakan 2 kelas yaitu kelas eksperimen dan kontrol, dimana kelas eksperimen (XA menggunakan model kooperatif tipe time token berbantu puzzle dan kelas kontrol (XB menggunakan model pembelajaran kooperatif media gambar. Teknik pengambilan data menggunakan test (pretest dan

  8. Índice de heterogeneidade, coeficiente de variação e tamanho ótimo de parcela em batata Heterogeneity index, variation coefficient and optimal potato plot size

    Directory of Open Access Journals (Sweden)

    Sérgio José Ribeiro de Oliveira


    Full Text Available O objetivo deste trabalho foi avaliar a relação entre o coeficiente de variação das parcelas de uma cova e o índice de heterogeneidade com o tamanho ótimo de parcela para experimentos com batata. Foram coletados os dados da produção de tubérculos de batata em doze ensaios. Em cada ensaio, de 12 linhas com 24 covas, foram planejados 18 tipos de parcelas com variações no número de linhas e de comprimentos. Foram ajustadas as funções CV(x=A/X B e VU(x=V1/Xb, sendo X o tamanho da parcela em número de unidades básicas, CV(x o coeficiente de variação entre as parcelas com X unidades básicas e VU(x a variância por unidade básica entre as parcelas com X unidades básicas. A estimativa do tamanho ótimo de parcela foi procedida por três métodos e os resultados foram correlacionados com as estimativas dos respectivos parâmetros das duas funções. A aplicação da análise de causa e efeito permitiu concluir que o tamanho ótimo de parcela obtido em ensaios em branco, com a cultura da batata, é mais influenciado pelo valor do coeficiente de variação entre as parcelas de uma unidade básica do que pelo índice de heterogeneidade da produtividade.This research was aimed at evaluating the relationship between one plot coefficient variation and heterogeneity index with the optimal potato plot size. Tuber yield data was gotten from 12 potato homogeneity trials. Each trial had 12 rows and 24 hills, from which 18 plot sizes, differing in row and hill numbers, were designed. The functions CV(x=A/X B and VU(x=V1/Xb were adjusted, where X is the plot size in number of basic units (BU, CV(x is the coefficient of variation between plots with X BU, and VU(x is the BU variation between plots with X BU. Optimal plot size estimated by three different methods and the results were correlated with the parameter estimations of the above two functions. Based upon path analysis, the variation coefficient between plots of the basic unit affects more

  9. Comparative analysis of protein-protein interactions in the defense response of rice and wheat. (United States)

    Cantu, Dario; Yang, Baoju; Ruan, Randy; Li, Kun; Menzo, Virginia; Fu, Daolin; Chern, Mawsheng; Ronald, Pamela C; Dubcovsky, Jorge


    Despite the importance of wheat as a major staple crop and the negative impact of diseases on its production worldwide, the genetic mechanisms and gene interactions involved in the resistance response in wheat are still poorly understood. The complete sequence of the rice genome has provided an extremely useful parallel road map for genetic and genomics studies in wheat. The recent construction of a defense response interactome in rice has the potential to further enhance the translation of advances in rice to wheat and other grasses. The objective of this study was to determine the degree of conservation in the protein-protein interactions in the rice and wheat defense response interactomes. As entry points we selected proteins that serve as key regulators of the rice defense response: the RAR1/SGT1/HSP90 protein complex, NPR1, XA21, and XB12 (XA21 interacting protein 12). Using available wheat sequence databases and phylogenetic analyses we identified and cloned the wheat orthologs of these four rice proteins, including recently duplicated paralogs, and their known direct interactors and tested 86 binary protein interactions using yeast-two-hybrid (Y2H) assays. All interactions between wheat proteins were further tested using in planta bimolecular fluorescence complementation (BiFC). Eighty three percent of the known rice interactions were confirmed when wheat proteins were tested with rice interactors and 76% were confirmed using wheat protein pairs. All interactions in the RAR1/SGT1/ HSP90, NPR1 and XB12 nodes were confirmed for the identified orthologous wheat proteins, whereas only forty four percent of the interactions were confirmed in the interactome node centered on XA21. We hypothesize that this reduction may be associated with a different sub-functionalization history of the multiple duplications that occurred in this gene family after the divergence of the wheat and rice lineages. The observed high conservation of interactions between proteins that

  10. Catching the role of anisotropic electronic distribution and charge transfer in halogen bonded complexes of noble gases

    Energy Technology Data Exchange (ETDEWEB)

    Bartocci, Alessio; Cappelletti, David; Pirani, Fernando [Dipartimento di Chimica, Biologia e Biotecnologie, Università di Perugia, Perugia 06123 (Italy); Belpassi, Leonardo [Istituto di Scienze e Tecnologie Molecolari del CNR, Perugia 06123 (Italy); Falcinelli, Stefano [Dipartimento di Ingegneria Civile ed Ambientale, Università degli Studi di Perugia, 06125 Perugia (Italy); Grandinetti, Felice [Dipartimento per la Innovazione nei sistemi Biologici, Agroalimentari e Forestali (DIBAF), Università della Tuscia, 01100 Viterbo (Italy); Tarantelli, Francesco [Dipartimento di Chimica, Biologia e Biotecnologie, Università di Perugia, Perugia 06123 (Italy); Istituto di Scienze e Tecnologie Molecolari del CNR, Perugia 06123 (Italy)


    The systems studied in this work are gas-phase weakly bound adducts of the noble-gas (Ng) atoms with CCl{sub 4} and CF{sub 4}. Their investigation was motivated by the widespread current interest for the intermolecular halogen bonding (XB), a structural motif recognized to play a role in fields ranging from elementary processes to biochemistry. The simulation of the static and dynamic behaviors of complex systems featuring XB requires the formulation of reliable and accurate model potentials, whose development relies on the detailed characterization of strength and nature of the interactions occurring in simple exemplary halogenated systems. We thus selected the prototypical Ng-CCl{sub 4} and Ng-CF{sub 4} and performed high-resolution molecular beam scattering experiments to measure the absolute scale of their intermolecular potentials, with high sensitivity. In general, we expected to probe typical van der Waals interactions, consisting of a combination of size (exchange) repulsion with dispersion/induction attraction. For the He/Ne-CF{sub 4}, the analysis of the glory quantum interference pattern, observable in the velocity dependence of the integral cross section, confirmed indeed this expectation. On the other hand, for the He/Ne/Ar-CCl{sub 4}, the scattering data unravelled much deeper potential wells, particularly for certain configurations of the interacting partners. The experimental data can be properly reproduced only including a shifting of the repulsive wall at shorter distances, accompanied by an increased role of the dispersion attraction, and an additional short-range stabilization component. To put these findings on a firmer ground, we performed, for selected geometries of the interacting complexes, accurate theoretical calculations aimed to evaluate the intermolecular interaction and the effects of the complex formation on the electron charge density of the constituting moieties. It was thus ascertained that the adjustments of the potential

  11. Analysis of the 12C (e,e'pd) Reaction at High Energy Transfer

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, Neil [Univ. of Glasgow, Scotland (United Kingdom)


    The Jefferson Lab Hall A experiment E01015 measured the differential cross sections of the 12C (e,e'pd) reaction with low yields for kinematics of w = 0.865 GeV , Q2 = 2 (GeV/c)2, xB = 1.2 at three kinematic settings of 12C (e,e'p) missing momentum of 300, 400 and 500 MeV/c. The main objective of the experiment was to measure the 12C (e, e0p) cross section and the cross section ratios of 12C (e,e'pp) and 12C (e,e'pn) to investigate Short Range Correlations. The 12C (e,e'pd) reaction was investigated to find out what its magnitude of cross section. The very low yields and differential cross sections of 12C (e,e'pd) reaction measured at the three different kinematic settings suggests that the contribution of many of the different reaction mechanisms, including three nucleon forces, may be suppressed at the kinematics of this experiment.

  12. Deeply virtual Compton Scattering cross section measured with CLAS

    Energy Technology Data Exchange (ETDEWEB)

    Guegan, Baptistse [Institut de Physique Nucleaire, Orsay


    The Generalized Parton Distributions (GPDs) provide a new description of nucleon structure in terms of its elementary constituents, the quarks and the gluons. Including and extending the information provided by the form factors and the parton distribution functions, they describe the correlation between the transverse position and the longitudinal momentum fraction of the partons in the nucleon. Deeply Virtual Compton Scattering (DVCS), the electroproduction of a real photon on a single quark in the nucleon eN --> e'N'g, is the exclusive process most directly interpretable in terms of GPDs. A dedicated experiment to study DVCS with the CLAS detector at Jefferson Lab has been carried out using a 5.9-GeV polarized electron beam and an unpolarized hydrogen target, allowing us to collect DVCS events in the widest kinematic range ever explored in the valence region : 1.0 < Q2 < 4.6 GeV2, 0.1 < xB < 0.58 and 0.09 < -t < 2.0 GeV2. In this paper, we show preliminary results of unpolarized cross sections and of polarized cross section differences for the DVCS channel.

  13. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes. (United States)

    Castro-Chavez, Fernando


    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  14. Exclusive pi^0 electroproduction at W > 2 GeV with CLAS

    Energy Technology Data Exchange (ETDEWEB)

    Bedlinskiy, I; Kubarovsky, V; Niccolai, S; Stoler, P; Adhikari, K P; Anderson, M D; Pereira, S Anefalos; Avakian, H; Ball, J; Baltzell, N A; Battaglieri, M; Batourine, V; Biselli, A S; Boiarinov, S; Bono, J; Briscoe, W J; Brooks, W K; Burkert, V D; Carman, D S; Celentano, A; Chandavar, S; Colaneri, L; Cole, P L; Contalbrigo, M; Cortes, O; Crede, V; D' Angelo, A; Dashyan, N; De Vita, R; De Sanctis, E; Deur, A; Djalali, C; Doughty, D; Dupre, R; Egiyan, H; El Alaoui, A; El Fassi, L; Elouadrhiri, L; Eugenio, P; Fedotov, G; Fegan, S; Fleming, J A; Forest, T A; Garillon, B; Garcon, M; Gavalian, G; Gevorgyan, N; Ghandilyan, Y; Gilfoyle, G P; Giovanetti, K L; Girod, F X; Golovatch, E; Gothe, R W; Griffioen, K A; Guegan, B; Guo, L; Hafidi, K; Hakobyan, H; Harrison, N; Hattawy, M; Hicks, K; Holtrop, M; Ireland, D G; Ishkhanov, B S; Isupov, E L; Jenkins, D; Jo, H S; Joo, K; Keller, D; Khandaker, M; Kim, A; Kim, W; Klein, A; Klein, F J; Koirala, S; Kuhn, S E; Kuleshov, S V; Lenisa, P; Levine, W I; Livingston, K; Lu, H Y; MacGregor, I J.D.; Markov, N; Mayer, M; McKinnon, B; Mirazita, M; Mokeev, V; Montgomery, R A; Moody, C I; Moutarde, H; Movsisyan, A; Munoz Camacho, C; Nadel-Turonski, P; Niculescu, I; Osipenko, M; Ostrovidov, A I; Pappalardo, L L; Park, K; Park, S; Pasyuk, E; Phelps, E; Phelps, W; Phillips, J J; Pisano, S; Pogorelko, O; Price, J W; Prok, Y; Protopopescu, D; Procureur, S; Puckett, A J.R.; Raue, B A; Ripani, M; Ritchie, B G; Rizzo, A; Rossi, P; Roy, P; Sabatié, F; Salgado, C; Schott, D; Schumacher, R A; Seder, E; Senderovich, I; Sharabian, Y G; Simonyan, A; Smith, G D; Sober, D I; Sokhan, D; Stepanyan, S S; Strauch, S; Sytnik, V; Tang, W; Tian, Ye; Ungaro, M; Vlassov, A V; Voskanyan, H; Voutier, E; Walford, N K; Watts, D; Wei, X; Weinstein, L B; Yurov, M; Zachariou, N; Zana, L; Zhang, J; Zhao, Z W; Zonta, I


    Exclusive neutral-pion electroproduction (ep-->e'p'pi0) was measured at Jefferson Lab with a 5.75-GeV electron beam and the CLAS detector. Differential cross sections d4sigma/dtdQ2dxBdphipi and structure functions sigmaT+epsilonsigmaL,sigmaTT and σLT as functions of t were obtained over a wide range of Q2 and xB. The data are compared with Regge and handbag theoretical calculations. Analyses in both frameworks find that a large dominance of transverse processes is necessary to explain the experimental results. For the Regge analysis it is found that the inclusion of vector meson rescattering processes is necessary to bring the magnitude of the calculated and measured structure functions into rough agreement. In the handbag framework, there are two independent calculations, both of which appear to roughly explain the magnitude of the structure functions in terms of transversity generalized parton distributions.

  15. Determination of fenticonazole in human plasma by HPLC–MS/MS and its application to pharmacokinetic studies

    Directory of Open Access Journals (Sweden)

    Weixing Mao


    Full Text Available Two simple and sensitive high performance liquid chromatography–tandem mass spectrometry (HPLC–MS/MS methods were developed and validated for the determination of fenticonazole in human plasma after percutaneous and intravaginal administration. Mifepristone was used as an internal standard (IS, and simple protein precipitation by acetonitrile containing 2% acetic acid was utilized for extracting the analytes from the plasma samples. Chromatographic separation was performed on a Kinetex XB-C18 column. The quantitation was performed by a mass spectrometer equipped with an electrospray ionization source in multiple reactions monitoring (MRM positive ion mode using precursor-to-product ion transitions of m/z 455.2–199.1 for fenticonazole and m/z 430.2–372.3 for mifepristone. The validated linear ranges were 5–1000 pg/mL and 0.1–20 ng/mL fenticonazole in plasma for the methods A and B, respectively. For the two methods, the accuracy data ranged from 85% to 115%, the intra- and inter-batch precision data were less than 15%, the recovery data were more than 90%, and no matrix interference was observed. The methods A and B were successfully validated and applied to the pharmacokinetic studies of fenticonazole gel in Chinese healthy volunteers after percutaneous and intravaginal administration, respectively.

  16. High-performance liquid chromatography-tandem mass spectrometry for the determination of pidotimod in human plasma and its application to a pharmacokinetic study. (United States)

    Zhang, Yi; Xiong, Zhili; Qin, Feng; Lu, Shan; Liu, Wei; Li, Famei


    A selective, rapid and sensitive high-performance liquid chromatography-tandem mass spectrometry (HPLC-MS/MS) method was developed for the first time to determine pidotimod in human plasma and applied to a pharmacokinetic study. Diphenhydramine was used as the internal standard (I.S.). Sample pretreatment involved in one-step protein precipitation (PPT) with methanol of 0.1 mL plasma. The analysis was carried out on an Ultimate XB-C(8) column with mobile phase of methanol-water containing 0.5% formic acid (65:35, v/v). The detection was performed on a triple quadrupole tandem mass spectrometer by multiple reaction monitoring (MRM) mode via electrospray ionization (ESI) source. Each plasma sample was chromatographed within 4.5 min. The linear calibration curves were obtained in the concentration range of 0.05-20.00 microg/mL (r(2) > or = 0.99) with the lower limit of quantification (LLOQ) of 0.0500 microg/mL. The intra- and inter-day precision (relative standard deviation, R.S.D.) values were below 15% and accuracy (relative error, R.E.) was from -5.1% to 3.9% at all quality control (QC) levels. The method was applicable to clinical pharmacokinetic study of pidotimod in healthy volunteers after oral administration.

  17. Evaluation of different column chemistries for fast urinary metabolic profiling. (United States)

    Kloos, Dick-Paul; Lingeman, Henk; Niessen, Wilfried M A; Deelder, André M; Giera, Martin; Mayboroda, Oleg A


    Fast analytical methodologies are mandatory for large scale metabolic profiling. Here, we present a thorough evaluation of different column chemistries in combination with different mobile phases for fast LC-MS urinary metabolic profiling. Three porous HILIC materials were investigated, next to core-shell C18-, XB-C18- and PFP-RPLC material. The performance of the selected column chemistries was tested in a non-targeted manner with pooled urine samples and in a targeted manner with a set of 54 common urinary metabolites. In order to evaluate the differential behaviour of the tested columns in a targeted manner, we applied a peak scoring algorithm. This algorithm takes into account several quality criteria such as retention time, dead time, peak height and peak shape. In general, HILIC columns generate more retention for polar metabolites. Our results show that the diol-HILIC column outperforms the RPLC columns. However, because of their opposite nature, comprehensive behaviour is observed as well, which was shown by investigating gender differences in a small urinary sample set. All applied column chemistries enabled sufficient peak capacity within a short gradient time. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. Deeply Virtual Compton Scattering (DVCS) Run (E12-06-114) in Hall A of Thomas Jefferson National Accelerator Facility (TJNAF) (United States)

    Karki, Bishnu; DVCS Hall A of JLab Collaboration; JLab Hall A Collaboration


    Generalized Parton Distributions (GPDs) provide a information about transverse position and longitudinal momentum distribution of partons in the nucleon along with the correlation between transverse position and longitudinal momentum of partons. GPDs also provide access to the contribution of orbital momentum of partons to nucleon total spin. The DVCS is one of the favorite reaction to measure the GPDs because it is simplest process that can be described in terms of GPDs. DVCS refers to scattering of virtual photon off the nucleon (γ* N -> γN). The DVCS experiment (E12-06-114) in Hall A will be running again in Fall 2016, to complete proposed DVCS kinematics. We use the polarized electron beam from CEBAF with energy ranging from 8 GeV to 11 GeV and measure high statistics polarized and unpolarized cross section of H(e,e' γ)p and map it to extract GPDs of proton. The wide range of Q2 scan (2.7 = 9 GeV2) for xB ranging from 0.3 to 0.6 are performed. The Q2 dependence of the cross section allows one to quantify the contribution of higher twist terms. In this talk the status of experiment will be presented.

  19. Paraesophageal hernia repair with bifacial mesh (United States)

    Ungureanu, S; Șipitco, N; Gladun, N; Lepadatu, C


    Abstract Background.The paraesophageal hiatus hernias (PHH) are relatively uncommon, but an increased incidence has been reported and they now account for 5–10% of all hiatus hernias. The surgical treatment is recommended for all the patients with this pathology because of high risk of complications: obstruction, incarceration, strangulation or perforation. The use of prostheses is recommended in the process of repairing the giant PHH because the main problem of this operation is the high rate of recurrence. Case presentation.The patient is a 44-year-old male with a large and symptomatic paraesophageal hernia. Diagnosis was confirmed by instrumental examination. An elective laparoscopic repair was carried out by using polypropylene bifacial anti adhesive synthetic mesh (Surgimesh XB Aspide Medical). The postoperative period passed without severe complications. Conclusions.The laparoscopic approach as a therapeutic option can be successfully used in the repair of paraesophageal hernia. A selective use based on clinical experience was recommended, as the technique appeared to be safe, and in case of large hiatus hernia with hiatal defect, greater than 5 cm, the application of synthetic material to minimize the recurrence rate was recommended. PMID:27974917

  20. Rosenbluth Separation of the π^{0} Electroproduction Cross Section Off the Neutron. (United States)

    Mazouz, M; Ahmed, Z; Albataineh, H; Allada, K; Aniol, K A; Bellini, V; Benali, M; Boeglin, W; Bertin, P; Brossard, M; Camsonne, A; Canan, M; Chandavar, S; Chen, C; Chen, J-P; Defurne, M; de Jager, C W; de Leo, R; Desnault, C; Deur, A; El Fassi, L; Ent, R; Flay, D; Friend, M; Fuchey, E; Frullani, S; Garibaldi, F; Gaskell, D; Giusa, A; Glamazdin, O; Golge, S; Gomez, J; Hansen, O; Higinbotham, D; Holmstrom, T; Horn, T; Huang, J; Huang, M; Huber, G M; Hyde, C E; Iqbal, S; Itard, F; Kang, Ho; Kang, Hy; Kelleher, A; Keppel, C; Koirala, S; Korover, I; LeRose, J J; Lindgren, R; Long, E; Magne, M; Mammei, J; Margaziotis, D J; Markowitz, P; Martí Jiménez-Argüello, A; Meddi, F; Meekins, D; Michaels, R; Mihovilovic, M; Muangma, N; Muñoz Camacho, C; Nadel-Turonski, P; Nuruzzaman, N; Paremuzyan, R; Puckett, A; Punjabi, V; Qiang, Y; Rakhman, A; Rashad, M N H; Riordan, S; Roche, J; Russo, G; Sabatié, F; Saenboonruang, K; Saha, A; Sawatzky, B; Selvy, L; Shahinyan, A; Sirca, S; Solvignon, P; Sperduto, M L; Subedi, R; Sulkosky, V; Sutera, C; Tobias, W A; Urciuoli, G M; Wang, D; Wojtsekhowski, B; Yao, H; Ye, Z; Zana, L; Zhan, X; Zhang, J; Zhao, B; Zhao, Z; Zheng, X; Zhu, P


    We report the first longitudinal-transverse separation of the deeply virtual exclusive π^{0} electroproduction cross section off the neutron and coherent deuteron. The corresponding four structure functions dσ_{L}/dt, dσ_{T}/dt, dσ_{LT}/dt, and dσ_{TT}/dt are extracted as a function of the momentum transfer to the recoil system at Q^{2}=1.75  GeV^{2} and x_{B}=0.36. The ed→edπ^{0} cross sections are found compatible with the small values expected from theoretical models. The en→enπ^{0} cross sections show a dominance from the response to transversely polarized photons, and are in good agreement with calculations based on the transversity generalized parton distributions of the nucleon. By combining these results with previous measurements of π^{0} electroproduction off the proton, we present a flavor decomposition of the u and d quark contributions to the cross section.

  1. Probing the repulsive core of the nucleon-nucleon interaction via the (4)He(e,e'pN) triple-coincidence reaction. (United States)

    Korover, I; Muangma, N; Hen, O; Shneor, R; Sulkosky, V; Kelleher, A; Gilad, S; Higinbotham, D W; Piasetzky, E; Watson, J W; Wood, S A; Aguilera, P; Ahmed, Z; Albataineh, H; Allada, K; Anderson, B; Anez, D; Aniol, K; Annand, J; Armstrong, W; Arrington, J; Averett, T; Badman, T; Baghdasaryan, H; Bai, X; Beck, A; Beck, S; Bellini, V; Benmokhtar, F; Bertozzi, W; Bittner, J; Boeglin, W; Camsonne, A; Chen, C; Chen, J-P; Chirapatpimol, K; Cisbani, E; Dalton, M M; Daniel, A; Day, D; de Jager, C W; De Leo, R; Deconinck, W; Defurne, M; Flay, D; Fomin, N; Friend, M; Frullani, S; Fuchey, E; Garibaldi, F; Gaskell, D; Gilman, R; Glamazdin, O; Gu, C; Gueye, P; Hamilton, D; Hanretty, C; Hansen, J-O; Hashemi Shabestari, M; Holmstrom, T; Huang, M; Iqbal, S; Jin, G; Kalantarians, N; Kang, H; Khandaker, M; LeRose, J; Leckey, J; Lindgren, R; Long, E; Mammei, J; Margaziotis, D J; Markowitz, P; Marti Jimenez-Arguello, A; Meekins, D; Meziani, Z; Michaels, R; Mihovilovic, M; Monaghan, P; Munoz Camacho, C; Norum, B; Nuruzzaman; Pan, K; Phillips, S; Pomerantz, I; Posik, M; Punjabi, V; Qian, X; Qiang, Y; Qiu, X; Rakhman, A; Reimer, P E; Riordan, S; Ron, G; Rondon-Aramayo, O; Saha, A; Schulte, E; Selvy, L; Shahinyan, A; Sirca, S; Sjoegren, J; Slifer, K; Solvignon, P; Sparveris, N; Subedi, R; Tireman, W; Wang, D; Weinstein, L B; Wojtsekhowski, B; Yan, W; Yaron, I; Ye, Z; Zhan, X; Zhang, J; Zhang, Y; Zhao, B; Zhao, Z; Zheng, X; Zhu, P; Zielinski, R


    We studied simultaneously the (4)He(e,e'p), (4)He(e,e'pp), and (4)He(e,e'pn) reactions at Q(2)=2(GeV/c)(2) and x(B)>1, for an (e,e'p) missing-momentum range of 400 to 830  MeV/c. The knocked-out proton was detected in coincidence with a proton or neutron recoiling almost back to back to the missing momentum, leaving the residual A=2 system at low excitation energy. These data were used to identify two-nucleon short-range correlated pairs and to deduce their isospin structure as a function of missing momentum, in a region where the nucleon-nucleon (NN) force is expected to change from predominantly tensor to repulsive. The abundance of neutron-proton pairs is reduced as the nucleon momentum increases beyond ∼500  MeV/c. The extracted fraction of proton-proton pairs is small and almost independent of the missing momentum. Our data are compared with calculations of two-nucleon momentum distributions in (4)He and discussed in the context of probing the elusive repulsive component of the NN force.

  2. Rosenbluth separation of the $\\pi^0$ electroproduction cross section

    CERN Document Server

    Defurne, M; Albataineh, H; Allada, K; Aniol, K A; Bellini, V; Benali, M; Boeglin, W; Bertin, P; Brossard, M; Camsonne, A; Canan, M; Chandavar, S; Chen, C; Chen, J -P; de Jager, C W; de Leo, R; Desnault, C; Deur, A; Fassi, L El; Ent, R; Flay, D; Friend, M; Fuchey, E; Frullani, S; Garibaldi, F; Gaskell, D; Giusa, A; Glamazdin, O; Golge, S; Gomez, J; Hansen, O; Higinbotham, D; Holmstrom, T; Horn, T; Huang, J; Huang, M; Hyde, C E; Iqbal, S; Itard, F; Kang, H; Kelleher, A; Keppel, C; Koirala, S; Korover, I; LeRose, J J; Lindgren, R; Long, E; Magne, M; Mammei, J; Margaziotis, D J; Markowitz, P; Jimenez-Arguello, A Marti; Meddi, F; Meekins, D; Michaels, R; Mihovilovic, M; Camacho, C Munoz; Nadel-Turonski, P; Nuruzzaman, N; Paremuzyan, R; Puckett, A; Punjabi, V; Qiang, Y; Rakhman, A; Rashad, M N H; Riordan, S; Roche, J; Russo, G; Sabati, F; Saenboonruang, K; Saha, A; Sawatzky, B; Selvy, L; Shahinyan, A; Sirca, S; Solvignon, P; Sperduto, M L; Subedi, R; Sulkosky, V; Sutera, C; Tobias, W A; Urciuoli, G M; Wang, D; Wojtsekhowski, B; Yao, H; Ye, Z; Zafar, A; Zhan, X; Zhang, J; Zhao, B; Zhao, Z; Zheng, X; Zhu, P


    We present deeply virtual $\\pi^0$ electroproduction cross-section measurements at $x_B$=0.36 and three different $Q^2$--values ranging from 1.5 to 2 GeV$^2$, obtained from experiment E07-007 that ran in the Hall A at Jefferson Lab. The Rosenbluth technique was used to separate the longitudinal and transverse responses. Results demonstrate that the cross section is dominated by its transverse component, and thus is far from the asymptotic limit predicted by perturbative Quantum Chromodynamics. An indication of a non-zero longitudinal contribution is provided by the interference term $\\sigma_{LT}$ also measured. Results are compared with several models based on the leading twist approach of Generalized Parton Distributions (GPDs). In particular, a fair agreement is obtained with models where the scattering amplitude is described by a convolution of chiral-odd (transversity) GPDs of the nucleon with the twist-3 pion distribution amplitude. Therefore, neutral pion electroproduction may offer the exciting possibil...

  3. Rosenbluth Separation of the π^{0} Electroproduction Cross Section. (United States)

    Defurne, M; Mazouz, M; Ahmed, Z; Albataineh, H; Allada, K; Aniol, K A; Bellini, V; Benali, M; Boeglin, W; Bertin, P; Brossard, M; Camsonne, A; Canan, M; Chandavar, S; Chen, C; Chen, J-P; de Jager, C W; de Leo, R; Desnault, C; Deur, A; El Fassi, L; Ent, R; Flay, D; Friend, M; Fuchey, E; Frullani, S; Garibaldi, F; Gaskell, D; Giusa, A; Glamazdin, O; Golge, S; Gomez, J; Hansen, O; Higinbotham, D; Holmstrom, T; Horn, T; Huang, J; Huang, M; Huber, G M; Hyde, C E; Iqbal, S; Itard, F; Kang, Ho; Kang, Hy; Kelleher, A; Keppel, C; Koirala, S; Korover, I; LeRose, J J; Lindgren, R; Long, E; Magne, M; Mammei, J; Margaziotis, D J; Markowitz, P; Martí Jiménez-Argüello, A; Meddi, F; Meekins, D; Michaels, R; Mihovilovic, M; Muangma, N; Muñoz Camacho, C; Nadel-Turonski, P; Nuruzzaman, N; Paremuzyan, R; Puckett, A; Punjabi, V; Qiang, Y; Rakhman, A; Rashad, M N H; Riordan, S; Roche, J; Russo, G; Sabatié, F; Saenboonruang, K; Saha, A; Sawatzky, B; Selvy, L; Shahinyan, A; Sirca, S; Solvignon, P; Sperduto, M L; Subedi, R; Sulkosky, V; Sutera, C; Tobias, W A; Urciuoli, G M; Wang, D; Wojtsekhowski, B; Yao, H; Ye, Z; Zana, L; Zhan, X; Zhang, J; Zhao, B; Zhao, Z; Zheng, X; Zhu, P


    We present deeply virtual π^{0} electroproduction cross-section measurements at x_{B}=0.36 and three different Q^{2} values ranging from 1.5 to 2  GeV^{2}, obtained from Jefferson Lab Hall A experiment E07-007. The Rosenbluth technique is used to separate the longitudinal and transverse responses. Results demonstrate that the cross section is dominated by its transverse component and, thus, is far from the asymptotic limit predicted by perturbative quantum chromodynamics. Nonetheless, an indication of a nonzero longitudinal contribution is provided by the measured interference term σ_{LT}. Results are compared with several models based on the leading-twist approach of generalized parton distributions (GPDs). In particular, a fair agreement is obtained with models in which the scattering amplitude includes convolution terms of chiral-odd (transversity) GPDs of the nucleon with the twist-3 pion distribution amplitude. This experiment, together with previous extensive unseparated measurements, provides strong support to the exciting idea that transversity GPDs can be accessed via neutral pion electroproduction in the high-Q^{2} regime.

  4. A mathematical formalism for hyperspectral, multipoint plastic scintillation detectors. (United States)

    Archambault, Louis; Therriault-Proulx, François; Beddar, Sam; Beaulieu, Luc


    The aim of this paper is to generalize and extend the mathematical formalism used with plastic scintillation detectors (PSDs). By doing so, we show the feasibility of multi-point PSD. The new formalism is based on the sole hypothesis that a PSD optical signal is a linear superposition of spectra. Two calibration scenarios were developed. Both involve solving a linear equation of the form Y = XB, but the process and input data depend on the information available on the detector system. Simulations were carried out to validate both scenarios and demonstrate the advantages of the new formalism. In this paper, we prove the following results. (1) Multi-point PSDs are feasible. Simulations have shown that six different spectra could be resolved accurately even in the presence of up to 10% Gaussian noise. (2) The new formalism leads to more precise PSD measurements. (3) By using the condition number of the measurement matrix, the ideal sets of calibration measurements can be identified. (4) By using principal component analysis it was possible to identify the best set of wavelength filters. We have shown through numerical simulations that multi-point detectors are feasible. This has potential for applications such as in vivo dose verification. Furthermore, our new formalism can be used to improve the robustness and ease of use of PSDs.

  5. XbaI GLUT1 Gene Polymorphism and the Risk of Type 2 Diabetes with Nephropathy

    Directory of Open Access Journals (Sweden)

    Ioannis Stefanidis


    Full Text Available Altered expression of the facilitated glucose transporter GLUT1 affects pathways implicated in the pathogenesis of diabetic nephropathy. There is indication that variation of GLUT1 gene (SLC2A1 contributes to development of microangiopathy in diabetes mellitus type 2 (DM patients. A genetic association study involving Caucasians was carried out to investigate the role of XbαI polymorphism in the GLUT1 gene in diabetic nephropathy (DN. Study population (n = 240 consisted of 148 unrelated patients with DM (92 cases with diabetic nephropathy (DN, and of 92 matched healthy control subjects. Diabetic nephropathy was defined as persistent albuminuria (> 300 mg/24 h and/or renal failure, in the absence of non-diabetes induced renal disease. The analysis showed that the risk of developing DM and DN in XbaI(− carriers, when healthy individuals were considered as controls, was two-fold: odds ratio (OR 2.08 [95% confidence interval (1.14–3.79]. However, there was no evidence of association between XbaI(− and DN when patients with DM and without DN were considered as controls: OR = 1.12 (0.55–2.26. Thus, the GLUT1 XbaI(− allele is associated with DM, and possibly with a more severe form of the disease that can lead to development of DN.

  6. Dipole factorization for DIS at NLO: Combining the q q ¯ and q q ¯ contributions (United States)

    Beuf, Guillaume


    The next-to-leading order (NLO) corrections to the deep inelastic scattering structure functions F2 and FL (or equivalently the photon-target cross sections σTγ* and σLγ*) at low xB j are obtained, as a generalization of the dipole factorization formula. For the first time, the contributions of both the q q ¯ and the q q ¯g Fock states in the photon are directly calculated, using earlier results [G. Beuf, Phys. Rev. D 94, 054016 (2016), 10.1103/PhysRevD.94.054016] for the q q ¯ light-front wave functions at one loop inside a dressed virtual photon. Both the q q ¯ and q q ¯g contributions have UV divergences, which are shown to cancel each other, using conventional dimensional regularization as UV regulator. Finally, the resummation of high-energy logarithms on top of the NLO results for σTγ* and σLγ* is discussed.

  7. Target and double spin asymmetries of deeply virtual π0 production with a longitudinally polarized proton target and CLAS

    Directory of Open Access Journals (Sweden)

    A. Kim


    Full Text Available The target and double spin asymmetries of the exclusive pseudoscalar channel e→p→→epπ0 were measured for the first time in the deep-inelastic regime using a longitudinally polarized 5.9 GeV electron beam and a longitudinally polarized proton target at Jefferson Lab with the CEBAF Large Acceptance Spectrometer (CLAS. The data were collected over a large kinematic phase space and divided into 110 four-dimensional bins of Q2, xB, −t and ϕ. Large values of asymmetry moments clearly indicate a substantial contribution to the polarized structure functions from transverse virtual photon amplitudes. The interpretation of experimental data in terms of generalized parton distributions (GPDs provides the first insight on the chiral-odd GPDs H˜T and ET, and complement previous measurements of unpolarized structure functions sensitive to the GPDs HT and E¯T. These data provide a crucial input for parametrizations of essentially unknown chiral-odd GPDs and will strongly influence existing theoretical calculations based on the handbag formalism.

  8. Qualitative confirmation of 9 synthetic cannabinoids and 20 metabolites in human urine using LC-MS/MS and library search. (United States)

    Wohlfarth, Ariane; Scheidweiler, Karl B; Chen, Xiaohong; Liu, Hua-fen; Huestis, Marilyn A


    Synthetic cannabinoids are an emerging illicit drug class. The variety of available substances is large and ever-changing, making it difficult for laboratories to remain current. We present a qualitative LC-MS/MS method identifying urinary metabolites of JWH-018, JWH-073, JWH-081, JWH-122, JWH-200, JWH-210, JWH-250, RCS-4, and AM2201 and the parent compounds JWH-018, JWH-073, JWH-081, JWH-122, JWH-210, JWH-250, RCS-4, AM2201, and MAM2201. After enzymatic hydrolysis, urinary proteins were precipitated with acetonitrile. Chromatography utilized a 10 min gradient on a Kinetex XB-C18 column with 0.1% formic acid in water and acetonitrile. Scheduled multiple reaction monitoring "survey scans" were followed by information-dependent acquisition-enhanced product ion scan experiments on an ABSciex 5500 QTRAP mass spectrometer. Analytes were identified by software-assisted library searching against reference spectra. The method was fully validated, including proof of selectivity (no exogenous or endogenous interferences were observed), assessment of matrix effects (95-122%) and recovery (53-95%), determination of limits of detection (0.5-10 ng/mL), carry-over studies (thresholds between 100 and 1000 ng/mL), and determination of autosampler stability (samples were stable for at least 3 days). Hydrolysis efficiency was thoroughly investigated for a wide range of glucuronides and for the reference standard, JWH-018 5-hydroxypentyl glucuronide.

  9. Qualitative Confirmation of 9 Synthetic Cannabinoids and 20 Metabolites in Human Urine Using LC–MS/MS and Library Search (United States)

    Wohlfarth, Ariane; Scheidweiler, Karl B.; Chen, Xiaohong; Liu, Hua-fen; Huestis, Marilyn A.


    Introduction Synthetic cannabinoids are an emerging illicit drug class. The variety of available substances is large and ever-changing, making it difficult for laboratories to remain current. We present a qualitative LC–MS/MS method identifying urinary metabolites of JWH-018, JWH-073, JWH-081, JWH-122, JWH-200, JWH-210, JWH-250, RCS-4, and AM2201 and the parent compounds JWH-018, JWH-073, JWH-081, JWH-122, JWH-210, JWH-250, RCS-4, AM2201, and MAM2201. Methods After enzymatic hydrolysis, urinary proteins were precipitated with acetonitrile. Chromatography utilized a 10 min gradient on a Kinetex XB-C18 column with 0.1% formic acid in water and acetonitrile. Scheduled multiple reaction monitoring “survey scans” were followed by information-dependent acquisition-enhanced product ion scan experiments on an ABSciex 5500 QTRAP mass spectrometer. Analytes were identified by software-assisted library searching against reference spectra. Results The method was fully validated, including proof of selectivity (no exogenous or endogenous interferences were observed), assessment of matrix effects (95–122%) and recovery (53–95%), determination of limits of detection (0.5–10 ng/mL), carry-over studies (thresholds between 100 and 1000 ng/mL), and determination of autosampler stability (samples were stable for at least 3 days). Hydrolysis efficiency was thoroughly investigated for a wide range of glucuronides and for the reference standard, JWH-018 5-hydroxypentyl glucuronide PMID:23458260

  10. Magnetic field annealing for improved creep resistance

    Energy Technology Data Exchange (ETDEWEB)

    Brady, Michael P.; Ludtka, Gail M.; Ludtka, Gerard M.; Muralidharan, Govindarajan; Nicholson, Don M.; Rios, Orlando; Yamamoto, Yukinori


    The method provides heat-resistant chromia- or alumina-forming Fe-, Fe(Ni), Ni(Fe), or Ni-based alloys having improved creep resistance. A precursor is provided containing preselected constituents of a chromia- or alumina-forming Fe-, Fe(Ni), Ni(Fe), or Ni-based alloy, at least one of the constituents for forming a nanoscale precipitate MaXb where M is Cr, Nb, Ti, V, Zr, or Hf, individually and in combination, and X is C, N, O, B, individually and in combination, a=1 to 23 and b=1 to 6. The precursor is annealed at a temperature of C. for 1-48 h in the presence of a magnetic field of at least 5 Tesla to enhance supersaturation of the M.sub.aX.sub.b constituents in the annealed precursor. This forms nanoscale M.sub.aX.sub.b precipitates for improved creep resistance when the alloy is used at service temperatures of C. Alloys having improved creep resistance are also disclosed.

  11. NMR and conductivity studies of the mixed glass former effect in lithium borophosphate glasses. (United States)

    Storek, Michael; Böhmer, Roland; Martin, Steve W; Larink, Dirk; Eckert, Hellmut


    Alkali ion charge transport has been studied in a series of mixed glass former lithium borophosphate glasses of composition 0.33Li(2)O + 0.67[xB(2)O(3) + (1 - x)P(2)O(5)]. The entire concentration range, 0.0 ≤ x ≤ 1.0, from pure glassy Li(2)P(4)O(11) to pure glassy Li(2)B(4)O(7) has been examined while keeping the molar fraction of Li(2)O constant. Electrical conductivity measurements and nuclear magnetic resonance techniques such as spin relaxometry, line shape analysis, and stimulated-echo spectroscopy were used to examine the temperature and frequency dependence of the Li(+) ion motion over wide ranges of time scale and temperature. By accurately determining motional time scales and activation energies over the entire composition range the ion dynamics and the charge transport are found to be fastest if the borate and the phosphate fractions are similar. The nonlinear variation of the charge conduction, the most notable feature of the mixed glass former effect, is discussed in terms of the composition dependence of network former units which determine the local glass structure.

  12. Pb-free Radiation Shielding Glass Using Coal Fly Ash

    Directory of Open Access Journals (Sweden)

    Watcharin Rachniyom


    Full Text Available In this work, Pb-free shielding glass samples were prepared by the melt quenching technique using subbituminous fly ash (SFA composed of xBi2O3 : (60-xB2O3 : 10Na2O : 30SFA (where x = 10, 15, 20, 25, 30 and 35 by wt%. The samples were investigated for their physical and radiation shielding properties. The density and hardness were measured. The results showed that the density increased with the increase of Bi2O3 content. The highest value of hardness was observed for glass sample with 30 wt% of Bi2O3 concentration. The samples were investigated under 662 keV gamma ray and the results were compared with theoretical calculations. The values of the mass attenuation coefficient (μm, the atomic cross section (σe and the effective atomic number (Zeff were found to increase with an increase of the Bi2O3 concentration and were in good agreement with the theoretical calculations. The best results for the half-value layer (HVL were observed in the sample with 35 wt% of Bi2O3 concentration, better than the values of barite concrete. These results demonstrate the viability of using coal fly ash waste for radiation shielding glass without PbO in the glass matrices.

  13. Synthesis and Characterization of Nano-Particles of Niobium Pentoxide with Orthorhombic Symmetry

    Directory of Open Access Journals (Sweden)

    Miryam Rincón Joya


    Full Text Available In this work, a set of nanoparticles of Nb2O5 nanoparticles were grown by both the Pechini and the sol-gel methods. The amorphous materials were calcined at 650 #xB0;C or at 750 °C. X-ray diffraction, scanning electron microscopy, luminescence and Raman spectroscopy were used in order to characterize the materials. From the study, it is possible to state that the method of production of nanoparticles, beyond the temperature of synthesis, has a great influence on whether the phase produced is hexagonal or orthorhombic. Additionally, compared to de Sol-gel method, the Pechini method produced samples with smaller particle sizes. The photoluminescence spectra of niobium pentoxide nanostructure materials show that the emission peaks are positioned between 334 to 809 nm and there is a change of intensity which varies depending on the synthesis route used. High pressure Raman spectra at room temperature were obtained from two samples grown by the sol-gel method. Up to 6 GPa, where it is possible to observe the Raman bands, no modification other than the increase of disorder was observed, and this can be associated with a change of phase.

  14. A gene for late-onset fundus flavimaculatus with macular dystrophy maps to chromosome 1p13

    Energy Technology Data Exchange (ETDEWEB)

    Gerber, S.; Rozet, J.M.; Bonneau, D.; Souied, E.; Camuzat, A.; Munnich, A.; Kaplan, J. [Hopital des Enfants Malades, Paris (France); Dufier, J.L. [Hopital Laeennec, Paris (France); Amalric, P. [Consultation d`Ophtalmologie, Albi (France); Weissenbach, J. [Genethon, Evry (France)


    Fundus flavimaculatus with macular dystrophy is an autosomal recessive disease responsible for a progressive loss of visual acuity in adulthood, with pigmentary changes of the macula, perimacular flecks, and atrophy of the retinal pigmentary epithelium. Since this condition shares several clinical features with Stargardt disease, which has been mapped to chromosome 1p21-p13, we tested the disease for linkage to chromosome 1p. We report the mapping of the disease locus to chromosome 1p13-p21, in the genetic interval defined by loci D1S435 and D1S415, in four multiplex families (maximum lod score 4.79 at recombination fraction 0 for probe AFM217xb2 at locus D1S435). Thus, despite differences in the age at onset, clinical course, and severity, fundus flavimaculatus with macular dystrophy and Stargardt disease are probably allelic disorders. This result supports the view that allelic mutations produce a continuum of macular dystrophies, with onset in early childhood to late adulthood. 16 refs., 3 figs., 1 tab.

  15. A Review on the Use of Grid-Based Boltzmann Equation Solvers for Dose Calculation in External Photon Beam Treatment Planning

    Directory of Open Access Journals (Sweden)

    Monica W. K. Kan


    Full Text Available Deterministic linear Boltzmann transport equation (D-LBTE solvers have recently been developed, and one of the latest available software codes, Acuros XB, has been implemented in a commercial treatment planning system for radiotherapy photon beam dose calculation. One of the major limitations of most commercially available model-based algorithms for photon dose calculation is the ability to account for the effect of electron transport. This induces some errors in patient dose calculations, especially near heterogeneous interfaces between low and high density media such as tissue/lung interfaces. D-LBTE solvers have a high potential of producing accurate dose distributions in and near heterogeneous media in the human body. Extensive previous investigations have proved that D-LBTE solvers were able to produce comparable dose calculation accuracy as Monte Carlo methods with a reasonable speed good enough for clinical use. The current paper reviews the dosimetric evaluations of D-LBTE solvers for external beam photon radiotherapy. This content summarizes and discusses dosimetric validations for D-LBTE solvers in both homogeneous and heterogeneous media under different circumstances and also the clinical impact on various diseases due to the conversion of dose calculation from a conventional convolution/superposition algorithm to a recently released D-LBTE solver.

  16. Structure of superhard tungsten tetraboride: a missing link between MB2 and MB12 higher borides. (United States)

    Lech, Andrew T; Turner, Christopher L; Mohammadi, Reza; Tolbert, Sarah H; Kaner, Richard B


    Superhard metals are of interest as possible replacements with enhanced properties over the metal carbides commonly used in cutting, drilling, and wear-resistant tooling. Of the superhard metals, the highest boride of tungsten--often referred to as WB4 and sometimes as W(1-x)B3--is one of the most promising candidates. The structure of this boride, however, has never been fully resolved, despite the fact that it was discovered in 1961--a fact that severely limits our understanding of its structure-property relationships and has generated increasing controversy in the literature. Here, we present a new crystallographic model of this compound based on refinement against time-of-flight neutron diffraction data. Contrary to previous X-ray-only structural refinements, there is strong evidence for the presence of interstitial arrangements of boron atoms and polyhedral bonding. The formation of these polyhedral--slightly distorted boron cuboctahedra--appears to be dependent upon the defective nature of the tungsten-deficient metal sublattice. This previously unidentified structure type has an intermediary relationship between MB2 and MB12 type boride polymorphs. Manipulation of the fractionally occupied metal and boron sites may provide insight for the rational design of new superhard metals.

  17. Target and double spin asymmetries of deeply virtual π 0 production with a longitudinally polarized proton target and CLAS

    Energy Technology Data Exchange (ETDEWEB)

    Kim, A.; Avakian, H.; Burkert, V.; Joo, K.; Kim, W.; Adhikari, K. P.; Akbar, Z.; Anefalos Pereira, S.; Badui, R. A.; Battaglieri, M.; Batourine, V.; Bedlinskiy, I.; Biselli, A. S.; Boiarinov, S.; Bosted, P.; Briscoe, W. J.; Brooks, W. K.; Bültmann, S.; Cao, T.; Carman, D. S.; Celentano, A.; Chandavar, S.; Charles, G.; Chetry, T.; Colaneri, L.; Cole, P. L.; Compton, N.; Contalbrigo, M.; Cortes, O.; Crede, V.; D' Angelo, A.; Dashyan, N.; De Vita, R.; De Sanctis, E.; Djalali, C.; Egiyan, H.; El Alaoui, A.; El Fassi, L.; Eugenio, P.; Fedotov, G.; Fersch, R.; Filippi, A.; Fleming, J. A.; Fradi, A.; Garc con, M.; Ghandilyan, Y.; Gilfoyle, G. P.; Giovanetti, K. L.; Girod, F. X.; Gohn, W.; Golovatch, E.; Gothe, R. W.; Griffioen, K. A.; Guo, L.; Hafidi, K.; Hanretty, C.; Hattawy, M.; Heddle, D.; Hicks, K.; Holtrop, M.; Ilieva, Y.; Ireland, D. G.; Ishkhanov, B. S.; Jenkins, D.; Jiang, H.; Jo, H. S.; Joosten, S.; Keller, D.; Khachatryan, G.; Khandaker, M.; Klein, A.; Klein, F. J.; Kubarovsky, V.; Kuhn, S. E.; Kuleshov, S. V.; Lanza, L.; Lenisa, P.; Lu, H. Y.; MacGregor, I. J. D.; Markov, N.; Mattione, P.; McCracken, M. E.; McKinnon, B.; Mokeev, V.; Movsisyan, A.; Munevar, E.; Nadel-Turonski, P.; Net, L. A.; Niccolai, S.; Osipenko, M.; Ostrovidov, A. I.; Paolone, M.; Park, K.; Pasyuk, E.; Phelps, W.; Pisano, S.; Pogorelko, O.; Price, J. W.; Prok, Y.; Ripani, M.; Rizzo, A.; Rosner, G.; Rossi, P.; Roy, P.; Salgado, C.; Schumacher, R. A.; Seder, E.; Sharabian, Y. G.; Skorodumina, Iu.; Smith, G. D.; Sokhan, D.; Sparveris, N.; Stepanyan, S.; Stoler, P.; Strakovsky, I. I.; Strauch, S.; Sytnik, V.; Taiuti, M.; Torayev, B.; Ungaro, M.; Voskanyan, H.; Voutier, E.; Watts, D. P.; Wei, X.; Weinstein, L. B.; Zachariou, N.; Zana, L.; Zhang, J.


    The target and double spin asymmetries of the exclusive pseudoscalar channel e→p→→epπ0 were measured for the first time in the deep-inelastic regime using a longitudinally polarized 5.9 GeV electron beam and a longitudinally polarized proton target at Jefferson Lab with the CEBAF Large Acceptance Spectrometer (CLAS). The data were collected over a large kinematic phase space and divided into 110 four-dimensional bins of Q2, xB, -t and Φ. Large values of asymmetry moments clearly indicate a substantial contribution to the polarized structure functions from transverse virtual photon amplitudes. The interpretation of experimental data in terms of generalized parton distributions (GPDs) provides the first insight on the chiral-odd GPDs H˜T and ET, and complement previous measurements of unpolarized structure functions sensitive to the GPDs HT and E¯T. These data provide a crucial input for parametrizations of essentially unknown chiral-odd GPDs and will strongly influence existing theoretical calculations based on the handbag formalism.

  18. Development and validation of a UHPLC-MS/MS assay for colistin methanesulphonate (CMS) and colistin in human plasma and urine using weak-cation exchange solid-phase extraction. (United States)

    Zhao, Miao; Wu, Xiao-Jie; Fan, Ya-Xin; Guo, Bei-Ning; Zhang, Jing


    A rapid ultra high-performance liquid chromatography-tandem mass spectrometry (UHPLC-MS/MS) assay method was developed for determination of CMS and formed colistin in human plasma and urine. After extraction on a 96-well SPE Supra-Clean Weak Cation Exchange (WCX) plate, the eluents were mixed and injected into the UHPLC-MS/MS system directly. A Phonomenex Kinetex XB-C18 analytical column was employed with a mobile phase consisting of solution "A" (acetonitrile:methanol, 1:1, v/v) and solution "B" (0.1% formic acid in water, v/v). The flow rate was 0.4 mL/min with gradient elution over 3.5 min. Ions were detected in ESI positive ion mode and the precursor-product ion pairs were m/z 390.7/101.3 for colistin A, m/z 386.0/101.2 for colistin B, and m/z 402.3/101.2 for polymyxin B1 (IS), respectively. The lower limit of quantification (LLOQ) was 0.0130 and 0.0251 mg/L for colistin A and colistin B in both plasma and urine with accuracy (relative error, %) colistin, which offers a highly efficient tool for the analysis of a large number of clinical samples as well as routine therapeutic drug monitoring. Copyright © 2016 Elsevier B.V. All rights reserved.

  19. Quantitative determination of 15 bioactive triterpenoid saponins in different parts of Acanthopanax henryi by HPLC with charged aerosol detection and confirmation by LC-ESI-TOF-MS. (United States)

    Zhang, Xiao-Dan; Li, Zhi; Liu, Guo-Zhu; Wang, Xiang; Kwon, Ok-Kyoung; Lee, Hyeong-Kyu; Whang, Wan-Kyunn; Liu, Xiang-Qian


    Triterpenoid saponins are difficult to analyze using high-performance liquid chromatography coupled to UV/vis spectrophotometry due to their lack of chromophores. This study describes the first analytical method for the determination of 15 triterpenoid saponins from the leaves, stems, root bark, and fruits of Acanthopanax henryi, using a high-performance liquid chromatography with charged aerosol detection coupled with electrospray ionization mass spectrometry method. The separation was carried out on a Kinetex XB-C18 column with an acetonitrile/water gradient as the mobile phase, followed by charged aerosol detection. The operating conditions of charged aerosol detection were set at 24 kPa for nitrogen pressure and 100 pA for the detection range. Liquid chromatography with electrospray ionization mass spectrometry is described for the identification of compounds in plant samples. The electrospray ionization mass spectrometry method involved the use of the [M + Na](+) and [M + NH4 ](+) ions for compounds 1-15 in the positive ion mode with an extracted ion chromatogram. The developed method was fully validated in terms of linearity, sensitivity, precision, repeatability, and recovery, then subsequently applied to evaluate the quality of A. henryi. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Identification of QTL-s for drought tolerance in maize, II: Yield and yield components

    Directory of Open Access Journals (Sweden)

    Nikolić Ana


    Full Text Available Grain yield is the primary trait of interest in maize breeding programs. Worldwide, drought is the most pervasive limitation to the achievement of yield potential in maize. Drought tolerance of maize has been considerably improved through conventional breeding. Traditional breeding methods have numerous limitations, so development of new molecular genetics techniques could help in elucidation of genetic basis of drought tolerance .In order to map QTLs underlying yield and yield components under drought 116 F3 families of DTP79xB73 cross were evaluated in the field trials. Phenotypic correlations calculated using Pearson’s coefficients were high and significant. QTL detection was performed using composite interval mapping option in WinQTL Cartographer v 2.5. Over all nine traits 45 QTLs were detected: five for grain yield per plant and 40 for eight yield components. These QTLs were distributed on all chromosomes except on chromosome 9. Percent of phenotypic variability determined for the identified QTLs for all the traits was in the range from 27.46 to 95.85%. Different types of gene action were found for the QTLs identified for analyzed traits. [Projekat Ministarstva nauke Republike Srbije, br. TR31068


    Directory of Open Access Journals (Sweden)

    Zulida Arifa


    Full Text Available The objective of the study was to find whether there was a significant difference between the students taught using authentic materials and the students taught using non-authentic materials on the students’ writing score. The quasi-experimental design was applied in this study. The population was all the tenth year students at MAN Model Palangka Raya. The samples were determined using purposive sampling. The samples were XA as the experiment group and XB as the control group. The collected data were obtained from test and documentation. The main data were analyzed using ttest formula and SPSS 17.0. The results showed that the mean of pre-test score in experiment group was 59.76 and the mean of post-test score was 72.9. The value difference of both means was 13.14. The mean of pre-test score in control group was 53.8 and the mean of post-test score was 58. The value difference of both means was 4.2. It means that teaching writing procedural text using authentic materials was more effective than teaching writing procedural text using non-authentic materials because the authentic materials taught was appropriate with the level of students’ ability in this study. Keywords: authentic material, writing ability, procedural text.

  2. Development and validation of an LC-ESI-MS/MS approach to determine a highly hydrophobic drug, norcantharidin palmitate, and apply to a preliminary pharmacokinetic study in rats. (United States)

    Liu, Xiaolin; Tao, Xiaoguang; Zheng, Qi; Xu, Hang; Zhang, Yu; Lei, Tian; Yin, Tian; He, Haibing; Tang, Xing


    In order to investigate the pharmacokinetics of norcantharidin palmitate (NCTD-PAL) in rats, we developed and validated an LC-ESI-MS/MS method. The NCTD-PAL and internal standard (triamcinoloneacetonide palmitate, TAP) were separated on a Phenomenex Kinetex®XB C18 column, and the mobile phase was composed of tetrahydrofuran (THF)-acetonitrile (20/80, v/v) and an aqueous phase containing 0.2% ammonium hydroxide at a flow rate of 0.3 mL/min. The ESI interface operated in positive mode was used to acquire the mass spectrometric data, and the transition ions were m/z 635.50 → 168.95 and 673.65 → 397.13 for NCTD-PAL and IS, respectively. The method had a linear range of 10-2000 ng/mL with a correlation coefficient of >0.99. The accuracy (RE, %) was within ±10.1%, and the intra- and inter-day precisions (RSD, %) were 10.9 and 13.8%, respectively. The extraction recovery of NCTD-PAL at different concentrations ranged from 89.3 to 102.0%. The validated approach was efficaciously applied to a pharmacokinetic study of NCTD-PAL in rats via intravenous injection. Based on these results obtained, this method is practical and suitable for a wide range of applications. Copyright © 2017 John Wiley & Sons, Ltd.

  3. Alloying effect on bright-dark exciton states in ternary monolayer Mo x W1-x Se2 (United States)

    Liu, Yanping; Tom, Kyle; Zhang, Xiaowei; Lou, Shuai; Liu, Yin; Yao, Jie


    Binary transition metal dichalcogenides (TMDCs) in the class MX2 (M = Mo, W; X = S, Se) have been widely investigated for potential applications in optoelectronics and nanoelectronics. Recently, alloy-based monolayers of TMDCs have provided a stable and versatile technique to tune the physical properties and optimize them for potential applications. Here, we present experimental evidence for the existence of an intermediate alloy state between the MoSe2-like and the WSe2-like behavior of the neutral exciton (X 0) using temperature-dependent photoluminescence (PL) of the monolayer Mo x W1-x Se2 alloy. The existence of a maximum PL intensity around 120 K can be explained by the competition between the thermally activated bright states and the non-radiative quenching of the bright states. Moreover, we also measured localized exciton (XB ) PL peak in the alloy and the observed behavior agrees well with a model previously proposed for the 3D case, which indicates the theory also applies to 2D systems. Our results not only shed light on bright-dark states and localized exciton physics of 2D semiconductors, but also offer a new route toward the control of the bright-dark transition and tailoring optical properties of 2D semiconductors through defect engineering.

  4. Nanostructuring of Strontium Hexaboride via Lithiation. (United States)

    Ramachandran, Roshini; Salguero, Tina T


    We describe the top-down nanostructuring of a metal boride using SrB6 as an example. To accomplish this transformation, we demonstrate (1) the direct lithiation of a metal boride using n-butyllithium and then (2) the reactive disassembly of Li-SrB6 into nanoparticles using water. The identity of the Li-SrB6 intermediate, a mixture of Li2B6, LixSr1-2xB6, and SrB6 phases, was established by powder X-ray diffraction (PXRD), solid-state 11B and 7Li NMR, transmission electron microscopy, selected-area electron diffraction, and scanning electron microscopy. The necessary 2Li+/Sr2+ substitution is enabled by cation mobility within the hexaboride lattice. The subsequent reaction with water results in Li2B6 decomposition and the release of <100 nm SrB6 nanoparticles, which were characterized by PXRD, solid-state 11B and 7Li NMR, and high-resolution TEM. This chemistry opens new solution-based modification and processing options for metal borides.

  5. Test pilots 1962 - Thompson, McKay, Dana, Armstrong, Peterson, Butchart, Walker (United States)


    A group photo of NASA research pilots at the front door of the Flight Research Center headquarters building. In the front row are (left to right) Milt Thompson, Jack McKay, and Bill Dana. All three flew the X-15, and Thompson and Dana were also involved in the lifting body flights. McKay was injured in a crash landing in X-15 #2. Although he recovered, the injuries eventually forced him to retire from research flying. In the back row (left to right) are Neil Armstrong, Bruce Peterson, Stanley Butchart, and Joe Walker. Armstrong and Walker also both flew the X-15. Soon after this photo was taken, Armstrong was selected as an astronaut, and seven years later became the first man to walk on the Moon. Walker made the highest flight in the X-15, reaching 354,200 feet. He then went on to fly the Lunar Landing Research Vehicle, and was killed on June 8, 1966 when his F-104N collided with the XB-70. Peterson made the first flight in the HL-10 lifting body, and was later badly injured in the crash of the M2-F2 lifting body. Butchart flew a wide range of research missions in the 1950s, and was the B-29 drop plane pilot for a number of rocket flight.

  6. An HPLC-ESI-MS method for analysis of loureirin A and B in dragon's blood and application in pharmacokinetics and tissue distribution in rats. (United States)

    Zhao, Haiyan; Chen, Zilin


    A sensitive HPLC-ESI-MS method for the simultaneous determination of loureirin A (LA) and loureirin B (LB) in rat plasma and tissues was developed, and the pharmacokinetic and tissue distribution characteristics of LA and LB were investigated after gavage administration. The samples were pretreated by protein precipitation with ethyl acetate and then separated on a Welch Ultimate XB-C18 column with water-acetonitrile (42:58, v/v) containing 0.1% glacial acetic acid as the mobile phase. The analytes were detected with no interference in multiple reaction monitoring (MRM) mode on an electrospray ionization ion trap mass spectrometer. The analytes showed good linearity over a wide concentration range and the lowest limit of quantification (LLOQ) was 5 ng/mL for LA and 2ng/mL for LB in matrices. The pharmacokinetic curves of both analytes were best fitted to one-compartment model. It suggested that the analytes absorbed and distributed very quickly in rats. Tissue distribution results showed that the analytes had a wide distribution in tissues and the highest levels for LA and LB were observed in liver followed by kidney, lung, spleen, heart and cerebrum. This work provided the pharmacokinetics and tissue distribution characteristics of LA and LB, which would be instructive for their clinical regiment design. Copyright © 2013 Elsevier B.V. All rights reserved.

  7. Multiyear sea ice floe distribution in the Canadian Arctic Ocean (United States)

    Hudson, Rick D.


    A series of aerial photographic flights, made over the polar pack ice during April 1982, from M'Clure Strait in the south to Ellef Ringnes Island in the north, shows the changes in ice floe type, size, and area as the pack moves southwest under the effect of the Polar Gyre. The area has some of the most heavily ridged and dynamically active ice in the Arctic Ocean. Floe size distributions were found to fit a negative power relationship (y = A xb, where b = -3.7), rather than the expected negative exponential function. A Prony analysis suggests that a single physical parameter controls the distribution: most likely splitting, rather than bending, shear, or crushing. The effect of proximity to the coast was investigated and showed that nearshore floes were about 20% smaller than their offshore counterparts. The ratio of maximum to minimum floe diameter was consistently 1.5-1.6. The mean floe diameter was found to be 700 m; the mean area was 0.38 km 2.Heavily hummocked and ridged floes were found to be a fairly constant fraction (1%) of the multiyear pack.

  8. Structural properties of Bi2O3-B2O3-SiO2-Na2O glasses for gamma ray shielding applications (United States)

    Kaur, Kulwinder; Singh, K. J.; Anand, Vikas


    Glass samples of the xBi2O3-(0.70-x)B2O3-0.15SiO2-0.15Na2O (where x=0 up to 0.5 mol fraction) have been prepared in the laboratory by using melt quenching technique. 137Cs source has been used for experimental measurements of mass attenuation coefficient of γ-rays at 662 keV. Mass attenuation coefficient of our glass samples has been compared with standard nuclear radiation shield "barite concrete". It has been concluded that bismuth containing glass samples can be potential candidates for γ-ray shielding applications. Glasses must have appreciable elastic moduli values for their practical utility as γ-ray shields which are related to coordination number and non-bridging oxygens. Structural properties including coordination number and non-bridging oxygens of the structural units of the glass system have been estimated from the detailed analysis of Optical, Raman and FTIR spectra. Reported investigations can contribute to the development of transparent gamma ray shields.

  9. Effect of Bi2O3 on spectroscopic and structural properties of Er3+ doped cadmium bismuth borate glasses. (United States)

    Sanghi, S; Pal, I; Agarwal, A; Aggarwal, M P


    Glasses with composition 20CdO·xBi(2)O(3)·(79.5-x)B(2)O(3) (15≤x≤35, x in mol%) containing 0.5 mol% of Er(3+) ions were prepared by melt-quench technique (1150°C in air). The amorphous nature of the glasses was confirmed by X-ray diffraction. The spectroscopic properties of the glasses were investigated using optical absorption spectra and fluorescence spectra. The phenomenological Judd-Ofelt intensity parameters Ω(λ) (λ=2, 4, 6) were determined from the spectral intensities of absorption bands in order to calculate the radiative transition probability (A(R)), radiative life time (τ(R)), branching ratios (β(R)) for various excited luminescent states. Using the near infrared emission spectra, full width at half maxima (FWHM), stimulated emission cross-section (σ(e)) and figure of merit (FOM) were evaluated and compared with other hosts. Especially, the numerical values of these parameters indicate that the emission transition (4)I(13/2)→(4)I(15/2) at 1.506 μm in Er(3+)-doped cadmium bismuth borate glasses may be useful in optical communication. Copyright © 2011 Elsevier B.V. All rights reserved.

  10. Novel microwave assisted chemical synthesis of Nd₂Fe₁₄B hard magnetic nanoparticles. (United States)

    Swaminathan, Viswanathan; Deheri, Pratap Kumar; Bhame, Shekhar Dnyaneswar; Ramanujan, Raju Vijayaraghavan


    The high coercivity and excellent energy product of Nd2Fe14B hard magnets have led to a large number of high value added industrial applications. Chemical synthesis of Nd2Fe14B nanoparticles is challenging due to the large reduction potential of Nd(3+) and the high tendency for Nd2Fe14B oxidation. We report the novel synthesis of Nd2Fe14B nanoparticles by a microwave assisted combustion process. The process consisted of Nd-Fe-B mixed oxide preparation by microwave assisted combustion, followed by the reduction of the mixed oxide by CaH2. This combustion process is fast, energy efficient and offers facile elemental substitution. The coercivity of the resulting powders was ∼8.0 kOe and the saturation magnetization was ∼40 emu g(-1). After removal of CaO by washing, saturation magnetization increased and an energy product of 3.57 MGOe was obtained. A range of magnetic properties was obtained by varying the microwave power, reduction temperature and Nd to Fe ratio. A transition from soft to exchange coupled to hard magnetic properties was obtained by varying the composition of NdxFe1-xB8 (x varies from 7% to 40%). This synthesis procedure offers an inexpensive and facile platform to produce exchange coupled hard magnets.

  11. Effect of 3-D magnetic fields on neutral particle fueling and exhaust in MAST (United States)

    Flesch, Kurt; Kremeyer, Thierry; Waters, Ian; Schmitz, Oliver; Kirk, Andrew; Harrison, James


    The application of resonant magnetic perturbations (RMPs) is used to suppress edge localized modes but causes in many cases a density pump-out. At MAST, this particle pump out was found to be connected to an amplifying MHD plasma response. An analysis is presented on past MAST discharges to understand the effect of these RMPs on the neutral household and on changes in neutral fueling and exhaust during the pump out. A global, 0-D particle balance model was used to study the neutral dynamics and plasma confinement during shots with and without RMP application. Using the D α emission measured by filterscopes and a calibrated 1-D CCD camera, as well as S/XB coefficients determined by the edge plasma parameters, globally averaged ion confinement times were calculated. In L-mode, discharges with RMPs that caused an MHD response had a 15-20% decrease in confinement time but an increase in total recycling flux. The application of RMPs in H-mode caused either a decrease or no change in confinement, like those in L-mode, depending on the configuration of the RMPs and plasma response. A spectroscopically assisted Penning gauge is being prepared for the next campaign at MAST-U to extend this particle balance to study impurity exhaust with RMPs. This work was funded in part by the U.S. DoE under Grant DE-SC0012315.


    Directory of Open Access Journals (Sweden)

    S. Fisichella


    Full Text Available Salmonella enterica is a major epidemic cause of gastrointestinal infection worldwide. Although the animal host is believed to be the primary habitat of this specie, Salmonella is frequently isolated from water sources and it has been identified in marine environments. In this study the incidence of serotypes of Salmonella in the coastal water of the Italian region of Marche on the Adriatic Sea was evaluated. A total of 3985 samples of molluscan shellfish were analyzed during routine surveillance activity for a period of five years (2002-2007 and 0,95% of the samples were found contaminated with Salmonella. The most prevalent serotypes were Seftenberg (23.5%, Typhimurium (14,7% and Enteritidis (11.8% respectively. Pulsed-field electrophoresis and phage typing were used to determine possible genetic relationship (relatedness between S. Enteritidis strains isolated from bivalve mollusc and those isolated from human cases, animals and foods in Region of Marche. Three isolates from mollusc shellfish, 7 from sporadic human infection and 4 from poultry farms were confirmed as phagetype PT2 and PFGE profile XB0002. These results suggest a molecular fingerprinting relationship among shellfish, human and animal isolates, which could be considered as preliminary evidence of human infections associated with poultry production industry.

  13. Characterization of Flow and Ohm's Law in the Rotating Wall Machine (United States)

    Hannum, David; Brookhart, M.; Forest, C. B.; Kendrick, R.; Mengin, G.; Paz-Soldan, C.


    The rotating wall machine is a linear screw-pinch built to study the role of different electromagnetic boundary conditions on the Resistive Wall Mode (RWM). Its plasma is created by an array of electrostatic washer guns which can be biased to discharge up to 1 kA of current each. Individual flux ropes from the guns shear, merge, and expand into a 20 cm diameter, ˜1 m long plasma column. Langmuir (singletip) and tri-axial B-dot probes move throughout the column to measure radial and axial profiles of key plasma parameters. As the plasma current increases, more H2 fuel is ionized, raising ne to 5 x10^20 m-3 while Te stays at a constant 3 eV. The electron density expands to the wall while the current density (Jz) stays pinched to the central axis. E xB and diamagnetic drifts create radially and axially sheared plasma rotation. Plasma resistivity follows the Spitzer model in the core while exceeding it at the edge. These measurements improve the model used to predict the RWM growth rate.

  14. Allometric study of functional fitness of children and adolescents in a rural area of Mozambique.DOI:

    Directory of Open Access Journals (Sweden)

    Luciano Basso


    Full Text Available Few studies in Africa have investigated the physical performance of children using the allometric method. This study evaluated the functional fitness of children and adolescents in a rural area of Mozambique using the contrast between theoretical models and empirical allometric coefficients. Height and weight were measured and functional fitness was assessed using the AAHPERD, EUROFIT and Fitnessgram tests. The allometric equation Y=aXb, was used. In addition to descriptive statistics, factorial ANOVA was used to test differences of body size and functional variables between sexes and age groups. An extension of the allometric equation based on ANCOVA was used after proper logarithmic transformation of all variables of interest. Mean height and weight increased with age and were significantly associated with age and sex. Functional fitness increased with age, and mean results were higher for boys. Allometric coefficients were different from those expected according to theory, and girls had higher coefficients in almost all tests. A marked sexual dimorphism was seen in functional fitness results according to age. Empirical coefficients were different from those expected according to theory, which demonstrated the absence of the presumed geometric similarity. Girls had higher coefficients than boys in all fitness tests.

  15. Structure and magnetism in S r1 -xAxTc O3 perovskites: Importance of the A -site cation (United States)

    Reynolds, Emily; Avdeev, Maxim; Thorogood, Gordon J.; Poineau, Frederic; Czerwinski, Kenneth R.; Kimpton, Justin A.; Yu, Michelle; Kayser, Paula; Kennedy, Brendan J.


    The S r1 -xB axTc O3 (x =0 , 0.1, 0.2) oxides were prepared and their solid-state and magnetic structure studied as a function of temperature by x-ray and neutron powder diffraction. The refined Tc moments at room temperature and Néel temperatures for B a0.1S r0.9Tc O3 and B a0.2S r0.8Tc O3 were 2.32 (14 ) μβ and 2.11 (13 ) μβ and 714 ∘C and 702 ∘C , respectively. In contrast to expectations, the Néel temperature in the series S r1 -xAxTc O3 decreases with increasing Ba content. This observation is consistent with previous experimental measurements for the two series A M O3 (M =Ru , Mn; A =Ca , Sr, Ba) where the maximum magnetic ordering temperature was observed for A =Sr . Taken with these previous results the current work demonstrates the critical role of the A -site cation in the broadening of the π* bandwidth and ultimately the magnetic ordering temperature.

  16. Design of an novel antenna for EBW heating in FLIPS

    Energy Technology Data Exchange (ETDEWEB)

    Rudischhauser, Lukas; Rumiantcev, Kirill; Kasparek, Walter [Institut fuer Grenzflaechenverfahrenstechnik und Plasmatechnologie, Universitaet Stuttgart (Germany)


    Electron Bernstein waves (EBW) are electrostatic waves which do not have an O-wave cutoff. This enables them to penetrate into overdense plasmas and be absorbed at multiples of the electron cyclotron resonance frequency. These waves cannot propagate in free space, necessitating generation of EBW within the plasma volume through O-X-B or X-B conversion processes only possible for certain plasma parameters and injection angles. The aim of this work is to design a high directivity antenna which can excite EBW in FLIPS (Flexible Linear Plasma Experiment Stuttgart). We use commercial and scientific software such as CST MS and PROFUSION to produce two designs, a Vlasov-type cut waveguide and a circular slotted waveguide antenna. This second design is to line the inside of the vessel with rotational symmetry, simplifying comparison to numerical results. To find optimal injection angles and polarisations extensive use is made of simulations using a FD3D code and previous work on the plasma configuration in FLIPS. In a first step radiation pattern measurements outside of the plasma will be performed, the antenna will then be installed and generation of EBW indirectly shown by increased heating in the overdense plasma region.

  17. The structure of n-alkane binary mixtures adsorbed on graphite

    Energy Technology Data Exchange (ETDEWEB)

    Espeau, Philippe [Laboratoire de Chimie Physique et Minerale, Faculte de Pharmacie, Universite Rene Descartes-Paris V, F-75006 Paris (France)]. E-mail:; White, John W. [Research School of Chemistry, Australian National University, Canberra, ACT 0200 (Australia); Papoular, Robert J. [Laboratoire Leon Brillouin, CEA-CEN Saclay, F-91191 Gif-sur-Yvette Cedex (France)


    The thermodynamics and structure of the surface adsorbed phase in binary C15-C16 and C15-C17 n-alkane mixtures confined in graphite pores have been studied by differential scanning calorimetry and small-angle X-ray scattering. The previously observed selective adsorption of the longer alkane for chain length differences greater than five carbon atoms is verified but reduced for chain length differences less than or equal to two. With a difference in chain length of one carbon atom, Vegard's law is followed for the melting points of the adsorbed mixture and the (0 2) d-spacing is a continuous function of the mole fraction x. With a two-carbon atom difference, samples aged for 1 week have a lamellar structure for which the entities A{sub 1-x}B {sub x} try to be commensurate with the substrate. The same samples aged for 1 month show a continuous parabolic x-dependence for both the melting points and the d-spacings. An explanation in terms of selective probability of adsorption is proposed based on crystallographic considerations.


    Directory of Open Access Journals (Sweden)

    Anak Agung Oka


    Full Text Available The objective of this research was to know the effect of  alone learning to the critical thinking skill and problem solving ability in SMA Teladan 1 Metro. This research applied quasy experimental with non-equvalent control group design. The population of this research is allow students of class X SMA Teladan 1 Metro on academic year 2009/2010. The samples of this research were class XA as experimental (alone learning and class XB as control (conventional. The instrument of this research namely critical thinking and problem solving test. This research data are quantitative data consisted by score capacity critical thinking and problem solving ability to river ecosystem, collected on 15 january until 12 Juni 2010. Data were analysed by bilinear covariant statistical analysis (Ancova, continued with LSD test. The result of this research indicated that there were an effect of alone learning strategy toward the critical thinking skill and problem solving ability. Student with alone learning strategy having critical thinking higher 80,111% than conventional learning. Beside, student with alone learning strategy having 11,124% higher than convensional learning. Based on this research, the researcher suggest to the teacher that this strategy can implemented in biology learning.   Kata Kunci: Belajar Mandiri, Keterampilan Berpikir Kritis, Kemampuan Memecahkan Masalah.

  19. Interplay between halogen bonds and hydrogen bonds in OH/SH···HOX···HY (X = Cl, Br; Y = F, Cl, Br) complexes. (United States)

    Wu, Wenjie; Zeng, Yanli; Li, Xiaoyan; Zhang, Xueying; Zheng, Shijun; Meng, Lingpeng


    The character of the cooperativity between the HOX···OH/SH halogen bond (XB) and the Y-H···(H)OX hydrogen bond (HB) in OH/SH···HOX···HY (X = Cl, Br; Y = F, Cl, Br) complexes has been investigated by means of second-order Møller-Plesset perturbation theory (MP2) calculations and "quantum theory of atoms in molecules" (QTAIM) studies. The geometries of the complexes have been determined from the most negative electrostatic potentials (V (S,min)) and the most positive electrostatic potentials (V (S,max)) on the electron density contours of the individual species. The greater the V (S,max) values of HY, the larger the interaction energies of halogen-bonded HOX···OH/SH in the termolecular complexes, indicating that the ability of cooperative effect of hydrogen bond on halogen bond are determined by V (S,max) of HY. The interaction energies, binding distances, infrared vibrational frequencies, and electron densities ρ at the BCPs of the hydrogen bonds and halogen bonds prove that there is positive cooperativity between these bonds. The potentiation of hydrogen bonds on halogen bonds is greater than that of halogen bonds on hydrogen bonds. QTAIM studies have shown that the halogen bonds and hydrogen bonds are closed-shell noncovalent interactions, and both have greater electrostatic character in the termolecular species compared with the bimolecular species.

  20. [Preliminary results of an open-label observational study evaluating the efficacy and safety of Prolia used in women with postmenopausal osteoporosis]. (United States)

    Ershova, O B; Lesniak, O M; Belova, K Iu; Nazarova, A V; Manovitskaia, A V; Musaeva, T M; Musraev, R M; Nurlygaianov, R Z; Rozhinskaia, L Ia; Skripnikova, I A; Toroptsova, N V


    To evaluate the efficacy and safety of Denosumab (Prolia), a first-line osteoporosis (OP) medication that is a fully human monoclonal antibody to the receptor activator of nuclear factor xB ligand (RANKL), within an open-label observational study. Patients aged 50 years or older with postmenopausal OP, who were treated with Prolia in clinical practice, were examined. The concentrations of the bone resorption (BR) marker of C-terminal telopeptide and other laboratory indicators (total serum calcium, total alkaline phosphatase, and creatinine) were measured following 3 months. Adverse drug reactions were recorded. Three months after initiation of the investigation, there was a significant decrease in the BR marker C-terminal telopeptide (by 89%; p<0.0001). There were rare adverse reactions: hypocalcemia in 3 (5.9%) patients, arthralgias in 2 (3.9%), and eczema in 1 (1.9%). There were neither serious adverse events nor study withdrawal cases. The preliminary results of the open-label study of Prolia in postmenopausal OP suggest that the significantly lower BR activity determines the efficacy of this drug and its high safety.

  1. Genetic characterization and relatedness of wild and farmed Eurasian perch (Perca fluviatilis: Possible implications for aquaculture practices

    Directory of Open Access Journals (Sweden)

    Sana Ben Khadher


    Full Text Available Aquaculture of the Eurasian perch, Perca fluviatilis, in recirculating systems has emerged over the past decades to become a significant way of diversification for inland areas in Europe. The development of such a production relies partly on the improvement of growth performance (i.e., reducing production costs, which requires suitable genetic management of broodstocks and the development of selective breeding programs. In this context, the present study was undertaken assessing for the first time the genetic diversity of farmed stocks of perch. Twelve microsatellite loci were used to investigate the genetic diversity of nine farmed stocks (547 individuals from two perch farms located in France and their supposedly wild founder population from Lake Geneva (394 individuals. First, the wild population displayed the lowest genetic diversity and differed genetically from all farmed populations except one, XB2. Second, genetic diversity did not decrease between farmed breeders and their potential offspring. However, in the three groups of broodstock-offspring the number of alleles decreased by 10%, 21%, and 15%, respectively. In addition, effective population size decreased in all offspring groups. A family structuring was also observed among broodstocks and their offspring, with an unequal family contribution being suspected. In the absence of parental information, these results attest to the utility of genetic tools to evaluate genetic diversity and the necessity of a monitoring program to maintain genetic variability among farmed perch. Genetic variability among farmed stocks appears to be sufficient for perch production to be sustainable and selective breeding programs to be developed.

  2. Optical properties in the visible luminescence of SiO2:B2O3:CaO:GdF3 glass scintillators containing CeF3 (United States)

    Park, J. M.; Kim, H. J.; Karki, Sujita; Kaewkhao, J.; Damdee, B.; Kothan, S.; Kaewjaeng, S.


    CeF3-doped silicaborate-calcium-gadolinium glass scintillators, with the formula 10SiO2:(55-x)B2O3:10CaO:25GdF3:xCeF3, were fabricated by the melt-quenching technique. The doping concentration of the CeF3 was from 0.00 mol% to 0.20 mol%. The optical properties of the CeF3 doped glass scintillators were studied by using various radiation sources. The transition state of the CeF3-doped glass scintillators studied by using the absorption and photo-luminescence spectrum results. The X-ray, photo, proton and laser-induced luminescence spectra were also studied to understand the luminescence mechanism under various conditions. To understand the temperature dependence, the laser-induced luminescence and the decay component of the CeF3-doped glass scintillator were studied while the temperature was varied from 300 K to 10 K. The emission wavelength spectrum showed from 350 nm to 55 nm under various radiation sources. Also the CeF3-doped glass scintillator have one decay component as 34 ns at room temperature.

  3. Spin-dependent energy distribution of B-hadrons from polarized top decays considering the azimuthal correlation rate

    Directory of Open Access Journals (Sweden)

    S.M. Moosavi Nejad


    Full Text Available Basically, the energy distribution of bottom-flavored hadrons produced through polarized top quark decays t(↑→W++b(→Xb, is governed by the unpolarized rate and the polar and the azimuthal correlation functions which are related to the density matrix elements of the decay t(↑→bW+. Here we present, for the first time, the analytical expressions for the O(αs radiative corrections to the differential azimuthal decay rates of the partonic process t(↑→b+W+ in two helicity systems, which are needed to study the azimuthal distribution of the energy spectrum of the hadrons produced in polarized top decays. These spin-momentum correlations between the top quark spin and its decay product momenta will allow the detailed studies of the top decay mechanism. Our predictions of the hadron energy distributions also enable us to deepen our knowledge of the hadronization process and to test the universality and scaling violations of the bottom-flavored meson fragmentation functions.

  4. Around 200 new X-ray binary IDs from 13 YR of Chandra observations of the M31 center

    Energy Technology Data Exchange (ETDEWEB)

    Barnard, R.; Garcia, M. R.; Primini, F. [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Li, Z. [School of Astronomy and Space Science, Nanjing University, Nanjing 210093 (China); Baganoff, F. K. [Kavli Institute for Astrophysics and Space Research, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Murray, S. S. [Johns Hopkins University, Baltimore, MD (United States)


    We have created 0.3-10 keV, 13 yr, unabsorbed luminosity lightcurves for 528 X-ray sources in the central 20' of M31. We have 174 Chandra observations spaced at ∼1 month intervals due to our transient monitoring program, deeper observations of the M31 nucleus, and some public data from other surveys. We created 0.5-4.5 keV structure functions (SFs) for each source for comparison with the ensemble SF of active galactic nuclei (AGN). We find 220 X-ray sources with luminosities ≳10{sup 35} erg s{sup –1} that have SFs with significantly more variability than the ensemble AGN SF, and which are likely X-ray binaries (XBs). A further 30 X-ray sources were identified as XBs using other methods. We therefore have 250 probable XBs in total, including ∼200 new identifications. This result represents great progress over the ∼50 XBs and ∼40 XB candidates previously identified out of the ∼2000 X-ray sources within the D {sub 25} region of M31; it also demonstrates the power of SF analysis for identifying XBs in external galaxies. We also identify a new transient black hole candidate, associated with the M31 globular cluster B128.

  5. Chemical modeling of mixed occupations and site preferences in anisotropic crystal structures: case of complex intermetallic borides. (United States)

    Deringer, Volker L; Goerens, Christian; Esters, Marco; Dronskowski, Richard; Fokwa, Boniface P T


    Transition-metal borides show not only promising physical properties but also a rich variety of crystal structures. In this context, quantum-chemical tools can shed light on important facets of the chemistry within such intermetallic borides. Using density-functional theory (DFT), we analyze in detail two phases of significant structural-chemical importance: the recently synthesized Ti(1+x)Os(2-x)RuB(2) and the isotypical Ti(1+x)Os(3-x)B(2). Starting from the observation of different Ti/Os occupations in X-ray crystal structure analysis, we assess suitable computational models and rationalize how the interplay of Ti-Ti, Ti-Os, and Os-Os bonds drives the site preferences. Then, we move on to a systematic investigation of the metal-boron bonds which embed the characteristic, trigonal-planar B(4) units within their metallic surroundings. Remarkably, the different Ti-B bonds in Ti(1+x)Os(2-x)RuB(2) (and also in its ternary derivative) are of vastly different strength, and the strength of these bonds does not correlate with their length. The tools presented in this work are based on simple and insightful chemical arguments together with DFT, and may subsequently be transferred to other intermetallic phases--transition-metal borides and beyond.

  6. Featured Image: A Slow-Spinning X-Ray Pulsar (United States)

    Kohler, Susanna


    This image (click for a closer look!) reveals the sky location of a new discovery: the slowest spinning X-ray pulsar a spinning, highly magnetized neutron star ever found in an extragalactic globular cluster. The pulsar, XB091D (circled in the bottom left inset), lies in the globular cluster B091D in the Andromeda galaxy. In a recent study led by Ivan Zolotukhin (University of Toulouse, Moscow State University, and Special Astrophysical Observatory of the Russian Academy of Sciences), a team of scientists details the importance of this discovery. This pulsar is gradually spinning faster and faster a process thats known as recycling, thought to occur as a pulsar accretes material from a donor star in a binary system. Zolotukhin and collaborators think that this particular pairing formed relatively recently, when the pulsar captured a passing star into a binary system. Were now seeing it in a unique stage of evolution where the pulsar is just starting to get recycled. For more information, check out the paper below!CitationIvan Yu. Zolotukhin et al 2017 ApJ 839 125. doi:10.3847/1538-4357/aa689d

  7. Progress on major genes for high fecundity in ewes

    Directory of Open Access Journals (Sweden)

    Qiuyue LIU,Zhangyuan PAN,Xiangyu WANG,Wenping HU,Ran DI,Yaxing YAO,Mingxing CHU


    Full Text Available The existence of major genes affecting fecundity in sheep flocks throughout the world has been demonstrated. Three major genes whose mutations can increase ovulation rate have been discovered, and all related to the transforming growth factor β (TGF-β superfamily. The mutant FecB of bone morphogenetic protein receptor 1B (BMPR1B has an additive effect on ovulation rate. Six mutations (FecXI, FecXH, FecXG, FecXB, FecXL, FecXR of bone morphogenetic protein 15 (BMP15 related with fertility have been identified that share the same mechanism. All the mutants can increase ovulation rate in heterozygotes and cause complete sterility in homozygotes. Homozygous ewes with two new mutations (FecXGr, FecXO of BMP15 had increased ovulation rate without causing sterility. There are five mutations in growth differentiation factor 9 (GDF9 associated with sheep prolificacy where FecGE and FecGF have additive an effect on ovulation rate and litter size. The newly identified β-1,4-N-acetylgalactosaminyltransferase 2 (B4GALNT2 gene of FecL is proposed as a new mechanism of ovulation rate regulation in sheep. Woodlands is an X-linked maternally imprinted gene which increases ovulation rate. In addition, several putative major genes need to be verified. This review is focused on the identification of the mutations and mechanisms whereby the major genes affecting ovulation rate.

  8. Exclusive processes at JLab at 6 GeV

    Directory of Open Access Journals (Sweden)

    Kim Andrey


    Full Text Available Deeply virtual exclusive reactions provide a unique opportunity to probe the complex internal structure of the nucleon. They allow to access information about the correlations between parton transverse spatial and longitudinal momentum distributions from experimental observables. Dedicated experiments to study Deeply Virtual Compton Scattering (DVCS and Deeply Virtual Meson Production (DVMP have been carried out at Jefferson Lab using continuous electron beam with energies up to 6 GeV. Unpolarized cross sections, beam, target and double spin asymmetries have been measured for DVCS as well as for π0 exclusive electroproduction. The data from Hall B provide a wide kinematic coverage with Q2=1-4.5 GeV2, xB=0.1-0.5, and −t up to 2 GeV2. Hall A data have limited kinematic range partially overlapping with Hall B kinematics but provide a high accuracy measurements. Scaling tests of the DVCS cross sections provide solid evidence of twist-2 dominance, which makes chiral-even GPDs accessible even at modest Q2. We will discuss the interpretation of these data in terms of Generalized Parton Distributions (GPDs model. Successful description of the recent CLAS π0 exclusive production data within the framework of the GPD-based model provides a unique opportunity to access the chiral-odd GPDs.

  9. Heavy exotic molecules with charm and bottom (United States)

    Liu, Yizhuang; Zahed, Ismail


    We revisit the formation of pion-mediated heavy-light exotic molecules with both charm and bottom and their chiral partners under the general strictures of both heavy-quark and chiral symmetry. The chiral exotic partners with good parity formed using the (0+ ,1+) multiplet are about twice more bound than their primary exotic partners formed using the (0- ,1-) multiplet. The chiral couplings across the multiplets (0± ,1±) cause the chiral exotic partners to unbind, and the primary exotic molecules to be about twice more bound, for J ≤ 1. Our multi-channel coupling results show that only the charm isosinglet exotic molecules with JPC =1++ bind, which we identify as the reported neutral X (3872). Also, the bottom isotriplet exotic with JPC =1+- binds, which we identify as a mixture of the reported charged exotics Zb+ (10610) and Zb+ (10650). The bound isosinglet with JPC =1++ is suggested as a possible neutral Xb (10532) not yet reported.

  10. Beam Spin Asymmetries in DVCS with CLAS at 4 .8 GeV

    CERN Document Server

    Gavalian, G


    We report measurements of the beam spin asymmetry in Deeply Virtual Compton Scattering (DVCS) at an electron beam energy of 4.8 GeV using the CLAS detector at the Thomas Jefferson National Accelerator Facility. The DVCS beam spin asymmetry has been measured in a wide range of kinematics, 1(GeV/c)$^2$ $x_B<0.48$, and 0.1 (GeV/c)$^2$ $<-t<0.8$(GeV/c)$^2$, using the reaction \\pEpX. The number of H$(e,e^{\\prime}\\gamma p)$ and H$(e,e^{\\prime}\\pi^0 p)$ events are separated in each $(Q^2,x_B,t)$ bin by a fit to the line shape of the H$(e,e^{\\prime}p)X$ $M_x^2$ distribution. The validity of the method was studied in detail using experimental and simulated data. It was shown, that with the achieved missing mass squared resolution and the available statistics, the separation of DVCS-BH and $\\pi^0$ events can reliably be done with less than 5% uncertainty. The $Q^2$- and $t$-dependences of the $\\sin\\phi$ moments of the asymmetry are extracted and compared with theoretical ca...

  11. Electronic properties of group III-A nitride sheets by molecular simulation

    Energy Technology Data Exchange (ETDEWEB)

    Anota, Ernesto Chigo; Cocoletzi, Heriberto Hernandez [Facultad de Ingenieria Quimica, BUAP, Avenida San Claudio y 18 sur S/N Edificio 106A CU San Manuel Puebla, 72570 (Mexico); Villanueva, Martin Salazar [Facultad de Ingenieria, BUAP, Puebla (Mexico)


    We have performed first principles total energy calculations to investigate the structural and reactivity parameters of novel N{sub 12}X{sub 12}H{sub 12} (X=B, Al, Ga, In, Tl) nitrides, in their coronene-like (C{sub 24}H{sub 12}) structure to simulate these sheets. The exchange and correlations potential energies are treated in the Generalized Gradient Approximation (GGA), and the Local Density Approximation (LDA) within the parameterization of Perdew-Wang and Perdew-Burke-Ernzerhof (PWC, PBE) and the double Numeric plus polarization (DNP) atomic base. The chemical potential, hardness and electrophilicity index, as well as bond length are reported. The bond length of the structures is similar to the bulk. The gap between the HOMO and LUMO decreases from BN (5.18 eV) to TlN (1.76 eV). At the same time, the polarity increases except for TlN. (copyright 2010 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim) (orig.)

  12. Study of the impact of resonant magnetic perturbation fields on gross tungsten erosion using DiMES samples in DIII-D (United States)

    Hinson, E. T.; Schmitz, O.; Frerichs, H.; Abrams, T.; Briesemeister, A.; Rudakov, D. L.; Unterberg, E. A.; Wampler, W. R.; Watkins, J. G.; Wang, H. Q.


    An experiment was conducted in DIII-D to compare gross tungsten (W) erosion on samples exposed to outer strike point (OSP) sweeps in L-mode plasmas for three conditions. These included two phases of resonant magnetic perturbations (RMPs), and a set with no perturbations. Upon RMP application, lobe structures indicative of strike point splitting of the OSP were evident in divertor camera data and on Langmuir probes. Gross W erosion flux, {{{Γ }}}{{W}}, inferred spectroscopically using the S/XB method applied to the 400.9 nm W-I line, was generally in the range {{{Γ }}}{{W}}/{{{Γ }}}{{D}+,\\perp }=2× {10}-4 referenced to incident deuterium ion flux {{{Γ }}}{{D}+,\\perp }, and was increased in the RMP cases by no more than 30% of the level observed in unperturbed discharges. A large reduction in gross erosion (50%) was observed in the private flux region at the W sample for one specific toroidal phase of the RMP field.

  13. Effect of Heat Treatment Technique on the Low Temperature Impact Toughness of Steel EQ70 for Offshore Structure (United States)

    Tao, Su-Fen; Xia, Yun-Jin; Wang, Fu-Ming; Li, Jie; Fan, Ding-Dong


    Circle quenching and tempering (CQ&T), intercritical quenching and tempering (IQ&T) and regular quenching and tempering (Q&T) were used to study the influence of heat treatment techniques on the low temperature impact toughness of steel EQ70 for offshore structure. The steels with 2.10 wt. % Ni (steel A) and 1.47 wt. % Ni (steel B) were chosen to analyze the effect of Ni content on the low temperature impact toughness of steel EQ70 for offshore structure. The fracture morphologies were examined by using a scanning electron microscope (SEM, JSM-6480LV), and microstructures etched by 4 vol. % nitric acid were observed on a type 9XB-PC optical microscope. The results show that the impact toughness of steel A is higher than that of steel B at the same test temperature and heat treatment technique. For steel B, the energy absorbed is, in descending order, CQ&T, Q&T and IQ&T, while for steel A, that is CQ&T, IQ&T and Q&T. The effects of heat treatment on the low temperature impact toughness are different for steels A and B, the absorbed energy changes more obviously for steel A. The results can be significant references for actual heat treatment techniques in steel plant.

  14. Absence of magnetic long-range order in Y2CrSbO7 : Bond-disorder-induced magnetic frustration in a ferromagnetic pyrochlore (United States)

    Shen, L.; Greaves, C.; Riyat, R.; Hansen, T. C.; Blackburn, E.


    The consequences of random nonmagnetic-ion dilution for the pyrochlore family Y2(M 1 -xN x)2O7 (M = magnetic ion, N = nonmagnetic ion) have been investigated. As a first step, we experimentally examine the magnetic properties of Y2CrSbO7 (x =0.5 ), in which the magnetic sites (Cr3 +) are percolative. Although the effective Cr-Cr spin exchange is ferromagnetic, as evidenced by a positive Curie-Weiss temperature, ΘCW ≃19.5 K , our high-resolution neutron powder diffraction measurements detect no sign of magnetic long-range order down to 2 K. In order to understand our observations, we construct a lattice model to numerically study the bond disorder introduced by the ionic size mismatch between M and N , which reveals that the bond disorder percolates at xb ≃0.23 , explaining the absence of magnetic long-range order. This model could be applied to a series of frustrated magnets with a pyrochlore sublattice, for example, the spinel compound Zn (Cr1 -xGax )2O4 , wherein a Néel to spin glass phase transition occurs between x =0.2 and 0.25 [Lee et al., Phys. Rev. B 77, 014405 (2008), 10.1103/PhysRevB.77.014405]. Our study stresses the non-negligible role of bond disorder on magnetic frustration, even in ferromagnets.

  15. Deeply Virtual Pseudoscalar Meson Production at Jefferson Lab and Transversity GPDs

    CERN Document Server

    Kubarovsky, Valery


    The cross section of the exclusive $\\pi^0$ and $\\eta$ electroproduction reaction $ep\\to e^\\prime p^\\prime \\pi^0/\\eta$ was measured at Jefferson Lab with a 5.75-GeV electron beam and the CLAS detector. Differential cross sections $d^4\\sigma/dtdQ^2dx_Bd\\phi$ and structure functions $\\sigma_T+\\epsilon\\sigma_L, \\sigma_{TT}$ and $\\sigma_{LT}$ as functions of $t$ were obtained over a wide range of $Q^2$ and $x_B$. The data are compared with the GPD based theoretical models. Analyses find that a large dominance of transverse processes is necessary to explain the experimental results. Generalized form factors of the transversity GPDs $H_T^{\\pi,\\eta}$ and $\\bar E_T^{\\pi,\\eta}$ were directly extracted from the experimental observables for the first time. It was found that GPD $\\bar E_T$ dominates in pseudoscalar meson production. The combined $\\pi^0$ and $\\eta$ data opens the way for the flavor decomposition of the transversity GPDs. The first ever evaluation of this decomposition was demonstrated.

  16. Propulsion Flight Research at NASA Dryden From 1967 to 1997 (United States)

    Burcham, Frank W., Jr.; Ray, Ronald J.; Conners, Timothy R.; Walsh, Kevin R.


    From 1967 to 1997, pioneering propulsion flight research activities have been conceived and conducted at the NASA Dryden Flight Research Center. Many of these programs have been flown jointly with the United States Department of Defense, industry, or the Federal Aviation Administration. Propulsion research has been conducted on the XB-70, F-111 A, F-111E, YF-12, JetStar, B-720, MD-11, F-15, F- 104, Highly Maneuverable Aircraft Technology, F-14, F/A-18, SR-71, and the hypersonic X-15 airplanes. Research studies have included inlet dynamics and control, in-flight thrust computation, integrated propulsion controls, inlet and boattail drag, wind tunnel-to-flight comparisons, digital engine controls, advanced engine control optimization algorithms, acoustics, antimisting kerosene, in-flight lift and drag, throttle response criteria, and thrust-vectoring vanes. A computer-controlled thrust system has been developed to land the F-15 and MD-11 airplanes without using any of the normal flight controls. An F-15 airplane has flown tests of axisymmetric thrust-vectoring nozzles. A linear aerospike rocket experiment has been developed and tested on the SR-71 airplane. This paper discusses some of the more unique flight programs, the results, lessons learned, and their impact on current technology.

  17. Eta Carinae in the Context of the Most Massive Stars (United States)

    Gull, Theodore R.; Damineli, Augusto


    Eta Car, with its historical outbursts, visible ejecta and massive, variable winds, continues to challenge both observers and modelers. In just the past five years over 100 papers have been published on this fascinating object. We now know it to be a massive binary system with a 5.54-year period. In January 2009, Car underwent one of its periodic low-states, associated with periastron passage of the two massive stars. This event was monitored by an intensive multi-wavelength campaign ranging from -rays to radio. A large amount of data was collected to test a number of evolving models including 3-D models of the massive interacting winds. August 2009 was an excellent time for observers and theorists to come together and review the accumulated studies, as have occurred in four meetings since 1998 devoted to Eta Car. Indeed, Car behaved both predictably and unpredictably during this most recent periastron, spurring timely discussions. Coincidently, WR140 also passed through periastron in early 2009. It, too, is a intensively studied massive interacting binary. Comparison of its properties, as well as the properties of other massive stars, with those of Eta Car is very instructive. These well-known examples of evolved massive binary systems provide many clues as to the fate of the most massive stars. What are the effects of the interacting winds, of individual stellar rotation, and of the circumstellar material on what we see as hypernovae/supernovae? We hope to learn. Topics discussed in this 1.5 day Joint Discussion were: Car: the 2009.0 event: Monitoring campaigns in X-rays, optical, radio, interferometry WR140 and HD5980: similarities and differences to Car LBVs and Eta Carinae: What is the relationship? Massive binary systems, wind interactions and 3-D modeling Shapes of the Homunculus & Little Homunculus: what do we learn about mass ejection? Massive stars: the connection to supernovae, hypernovae and gamma ray bursters Where do we go from here? (future

  18. The characteristics of mine explosion injury of wading in shoal: A study on an animal model

    Directory of Open Access Journals (Sweden)

    Sen ZHANG


    Full Text Available Objective To study the characteristics and mechanism of mine blast injury that wading in shoal of different depths through an animal model. Methods Ninety-six healthy adult New Zealand white rabbits weighing 2.19±0.12kg were randomly divided into land group (n=16, limb wading group (n=16, the water depth reaching up the middle of the thighs of rabbits, and chest wading group (n=16, the water depth reaching up the thoracic xiphoid, stress test group (n=30, fake injury group (n=18. Punctiform burster was used to simulate landmine. Electric ignited the simulated mine away, causing landmine explosion injury to rabbits' one-sided hind limbs in upright state. High-speed photography was used to observe the movement of water accompanying the simulated mine explosion. Arterial blood serum markers of myocardial injury (CK-MB, cTnI and nerve injury (MBP, NSE were detected before injury, and 3, 6 and 12h after injury, and echocardiography, electrocardiography, CT, DSA and other examinations were implemented at the same time. Survival animals were killed 12h after injury for anatomy to record their injuries to the limbs and distant organs. The histopathological examination was done to define the injury characteristics further. Results Feet and distal tibia were broken, and closed femoral fractures and arterial damage were often found away from the stump in limb wading group. This type of injury was different from the mop-like tearing tissue in the land group. Chest, abdominal organs and the brain, spinal cord injury in wading group were more severe than those in land group. There were higher incidences of chest, abdominal organs and spinal cord injury in chest wading Group. Conclusion The energy transfer of underwater explosion is affected by water depth and limbs or trunk mutually, which is an important mechanism of the complex and serious injuries in the wading group. The wading depth is an important factor affecting severity of the injury. Based on

  19. Alignment monitoring system for ASTRO-H (United States)

    Grandmont, Frédéric; Dupont, Fabien; Moreau, Louis; Larouche, Martin; Bibeau, Louis-Philippe; Laplante, Sylvio


    High Energy Astrophysics (HEA) encompasses a broad range of astrophysical science, with sources that include stars and stellar clusters, compact objects (black holes, neutron stars, and white dwarfs), supernova remnants, the interstellar medium, galaxies and clusters of galaxies, Active Galactic Nuclei (AGN), and gamma ray bursters, as well as a variety of fundamental physical processes. The physics involved includes extremes of gravity, density and magnetic field and is often inaccessible via any other waveband. HEA investigates and answers crucial questions in all fields of contemporary astrophysics. Unlike the focusing of radio and optical light, X-rays are brought to focus through shallow, grazing incident angles. The analogy of skimming a stone across a pond is appropriate in describing how X-rays are focused. The higher the energy of the X-ray photon the shallower the incident angle must be, thereby introducing the requirement of longer focal lengths for focusing high-energy X-rays (E > 10 keV). This technical challenge has hindered scientific advancement in the high-energy regime, while at lower X-ray energies the community has prospered immensely with spectacular data from focusing observatories like XMM-Newton, Chandra, and Suzaku. Now, with ASTRO-H, the community will reap similar rewards from the tremendous improvement in spatial and spectral resolution at high energies. ASTRO-H is a JAXA mission. More information can be found on the ASTRO-H web site [1]. Because of the grazing-angle optics, high-energy X-ray instruments have a long focal length. The Hard X-ray Imager (HXI) of ASTRO-H has its detector housed in a boom that will extend by about 6 m in orbit so that a focal length of 12 m can be achieved for that instrument. This long structure will inevitably oscillate and flex, especially when passing across the orbital day/night boundary. In order to retain the essential imaging resolution, it is important that the boom has a metrology system that

  20. Neutron star cooling and the rp process in thermonuclear X-ray bursts (United States)

    in't Zand, J. J. M.; Visser, M. E. B.; Galloway, D. K.; Chenevez, J.; Keek, L.; Kuulkers, E.; Sánchez-Fernández, C.; Wörpel, H.


    When the upper layer of an accreting neutron star experiences a thermonuclear runaway of helium and hydrogen, it exhibits an X-ray burst of a few keV with a cool-down phase of typically 1 min. When there is a surplus of hydrogen, hydrogen fusion is expected to simmer during that same minute due to the rp process, which consists of rapid proton captures and slow β-decays of proton-rich isotopes. We have analyzed the high-quality light curves of 1254X-ray bursts, obtained with the Proportional Counter Array on the Rossi X-ray Timing Explorer between 1996 and 2012, to systematically study the cooling and rp process. This is a follow-up of a study on a selection of 37 bursts from systems that lack hydrogen and show only cooling during the bursts. We find that the bolometric light curves are well described by the combination of a power law and a one-sided Gaussian. The power-law decay index is between 1.3 and 2.1 and similar to that for the 37-bursts sample. There are individual bursters with a narrower range. The Gaussian is detected in half of all bursts, with a typical standard deviation of 50 s and a fluence ranging up to 60% of the total fluence. The Gaussian appears consistent with being due to the rp process. The Gaussian fluence fraction suggests that the layer where the rp process is active is underabundant in H by a factor of at least five with respect to cosmic abundances. Ninety-four percent of all bursts from ultracompact X-ray binaries lack the Gaussian component, and the remaining 6% are marginal detections. This is consistent with a hydrogen deficiency in these binaries. We find no clear correlation between the power law and Gaussian light-curve components. Full Table C.1 is only available at the CDS via anonymous ftp to ( or via


    Energy Technology Data Exchange (ETDEWEB)

    Rebull, L. M. [Infrared Science Archive (IRSA), Infrared Processing and Analysis Center (IPAC), 1200 E. California Blvd., California Institute of Technology, Pasadena, CA 91125 (United States); Stauffer, J. R.; Cody, A. M. [Spitzer Science Center (SSC), 1200 E. California Blvd., California Institute of Technology, Pasadena, CA 91125 (United States); Günther, H. M.; Poppenhaeger, K.; Wolk, S. J.; Hora, J.; Forbrich, J. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States); Hillenbrand, L. A. [Department of Astronomy, California Institute of Technology, Pasadena, CA 91125 (United States); Hernandez, J. [Centro de Investigaciones de Astronomía, Apdo. Postal 264, Mérida 5101-A (Venezuela, Bolivarian Republic of); Bayo, A. [Max Planck Institut für Astronomie, Königstuhl 17, D-69117, Heidelberg (Germany); Covey, K. [Lowell Observatory, 1400 West Mars Hill Road, Flagstaff, AZ 86001 (United States); Gutermuth, R. [Dept. of Astronomy, University of Massachusetts, Amherst, MA 01003 (United States); Morales-Calderón, M.; Bouy, H. [Depto. Astrofísica, Centro de Astrobiología (INTA-CSIC), ESAC campus, P.O. Box 78, E-28691 Villanueva de la Cañada (Spain); Plavchan, P. [NASA Exoplanet Science Institute (NExScI), Infrared Processing and Analysis Center (IPAC), 1200 E. California Blvd., California Institute of Technology, Pasadena, CA 91125 (United States); Song, I. [Physics and Astronomy Department, University of Georgia, Athens, GA 30602-2451 (United States); Terebey, S., E-mail: [Department of Physics and Astronomy, 5151 State University Drive, California State University at Los Angeles, Los Angeles, CA 90032 (United States); and others


    As part of the Young Stellar Object VARiability (YSOVAR) program, we monitored NGC 1333 for ∼35 days at 3.6 and 4.5 μm using the Spitzer Space Telescope. We report here on the mid-infrared variability of the point sources in the ∼10′ × ∼20′ area centered on 03:29:06, +31:19:30 (J2000). Out of 701 light curves in either channel, we find 78 variables over the YSOVAR campaign. About half of the members are variable. The variable fraction for the most embedded spectral energy distributions (SEDs) (Class I, flat) is higher than that for less embedded SEDs (Class II), which is in turn higher than the star-like SEDs (Class III). A few objects have amplitudes (10–90th percentile brightness) in [3.6] or [4.5] > 0.2 mag; a more typical amplitude is 0.1–0.15 mag. The largest color change is >0.2 mag. There are 24 periodic objects, with 40% of them being flat SED class. This may mean that the periodic signal is primarily from the disk, not the photosphere, in those cases. We find 9 variables likely to be “dippers,” where texture in the disk occults the central star, and 11 likely to be “bursters,” where accretion instabilities create brightness bursts. There are 39 objects that have significant trends in [3.6]–[4.5] color over the campaign, about evenly divided between redder-when-fainter (consistent with extinction variations) and bluer-when-fainter. About a third of the 17 Class 0 and/or jet-driving sources from the literature are variable over the YSOVAR campaign, and a larger fraction (∼half) are variable between the YSOVAR campaign and the cryogenic-era Spitzer observations (6–7 years), perhaps because it takes time for the envelope to respond to changes in the central source. The NGC 1333 brown dwarfs do not stand out from the stellar light curves in any way except there is a much larger fraction of periodic objects (∼60% of variable brown dwarfs are periodic, compared to ∼30% of the variables overall)

  2. NuSTAR observations of the state transition of millisecond pulsar binary PSR J1023+0038

    Energy Technology Data Exchange (ETDEWEB)

    Tendulkar, Shriharsh P.; Bellm, Eric; Harrison, Fiona A. [California Institute of Technology, 1200 E California Blvd, MC 249-17, Pasadena, CA 91125 (United States); Yang, Chengwei; An, Hongjun; Kaspi, Victoria M. [Department of Physics, McGill University, 3600 University St, Montreal, QC H3A 2T8 (Canada); Archibald, Anne M.; Bassa, Cees; Hessels, Jason W. T.; Janssen, Gemma H. [ASTRON, The Netherlands Institute for Radio Astronomy, Postbus 2, 7990 AA, Dwingeloo (Netherlands); Bogdanov, Slavko [Columbia Astrophysics Laboratory, Columbia University, 550 West 120th Street, New York, NY 10027 (United States); Lyne, Andrew G.; Stappers, Benjamin [Jodrell Bank Centre for Astrophysics, School of Physics and Astronomy, The University of Manchester, Manchester M13 9PL (United Kingdom); Patruno, Alessandro [Leiden Observatory, Leiden University, P.O. Box 9513, NL-2300 RA Leiden (Netherlands); Stern, Daniel [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States); Tomsick, John A.; Boggs, Steven E.; Craig, William W. [Space Sciences Laboratory, University of California, Berkeley, CA 94720 (United States); Chakrabarty, Deepto [Kavli Institute for Astrophysics and Space Research, Massachusetts Institute of Technology, 70 Vassar Street, Cambridge, MA 02139 (United States); Christensen, Finn E., E-mail: [DTU Space, National Space Institute, Technical University of Denmark, Elektrovej 327, DK-2800 Lyngby (Denmark); and others


    We report NuSTAR observations of the millisecond pulsar-low-mass X-ray binary (LMXB) transition system PSR J1023+0038 from 2013 June and October, before and after the formation of an accretion disk around the neutron star. Between June 10 and 12, a few days to two weeks before the radio disappearance of the pulsar, the 3-79 keV X-ray spectrum was well fit by a simple power law with a photon index of Γ=1.17{sub −0.07}{sup +0.08} (at 90% confidence) with a 3-79 keV luminosity of 7.4 ± 0.4 × 10{sup 32} erg s{sup –1}. Significant orbital modulation was observed with a modulation fraction of 36% ± 10%. During the October 19-21 observation, the spectrum is described by a softer power law (Γ=1.66{sub −0.05}{sup +0.06}) with an average luminosity of 5.8 ± 0.2 × 10{sup 33} erg s{sup –1} and a peak luminosity of ≈1.2 × 10{sup 34} erg s{sup –1} observed during a flare. No significant orbital modulation was detected. The spectral observations are consistent with previous and current multiwavelength observations and show the hard X-ray power law extending to 79 keV without a spectral break. Sharp-edged, flat-bottomed dips are observed with widths between 30 and 1000 s and ingress and egress timescales of 30-60 s. No change in hardness ratio was observed during the dips. Consecutive dip separations are log-normal in distribution with a typical separation of approximately 400 s. These dips are distinct from dipping activity observed in LMXBs. We compare and contrast these dips to observations of dips and state changes in the similar transition systems PSR J1824–2452I and XSS J1227.0–4859 and discuss possible interpretations based on the transitions in the inner disk.

  3. 100y DASCH Search for historical outbursts of Black Hole Low Mass X-ray Binaries (United States)

    Grindlay, Jonathan E.; Miller, George; Gomez, Sebastian


    Black Hole Low mass X-ray binaries (BH-LMXBs) are all transients, although several (e.g. GRS1915+109 and GX339-4) are quasi-persistent. All of the now 22 dynamically confirmed BH-LMXBs were discovered by their luminous outbursts, reaching Lx ~10^37 ergs/s, with outburst durations of typically ~1-3 months. These systems then (with few exceptions) return to a deep quiescent state, with Lx reduced by factors ~10^5-6 and hard X-ray spectra. The X-ray outbursts are accompanied by optical outbursts (if not absorbed by Galactic extinction) with ~6-9 magnitude increases and similar lightcurve shapes and durations as the X-ray (discovery) outburst. Prior to this work, only 3 BH-LMXBs have had historical (before the X-ray discovery) outbursts found in the archival data: A0620-00, the first BH-LMXB to be so identified, V404 Cyg (discoverd as "Nova Cyg" in 1938 and regarded as a classical nova), and V4641-Sgr which was given its variable star name when first noted in 1975. We report on the historical outbursts now discovered from the DASCH (Digital Access to a Sky Century @ Harvard) data from scanning and digitizing the now ~210,000 glass plates in the northern Galactic Hemisphere. This was one of the primary motivations for the DASCH project: to use the detection (or lack threof) of historic outbursts to measure or constrain the Duty Cycle of the accreting black holes in these systems. This, in turn, allows the total population of BH-LMXBs to be estimated and compared with that for the very similar systems containing neutron stars as the accretor (NS-LMXBs). Whereas the ratio of BHs/NSs from stellar evolution and IMFs is expected to be <<1, the DASCH results on half the sky point to an excess of BH-LMXBs. This must constrain the formation process for these systems, of importance for understanding both BH formation and compact binary evolution.

  4. Where Are the r-modes? Chandra Observations of Millisecond Pulsars

    Energy Technology Data Exchange (ETDEWEB)

    Mahmoodifar, Simin; Strohmayer, Tod [Astrophysics Science Division and Joint Space-Science Institute, NASA' s Goddard Space Flight Center, Greenbelt, MD 20771 (United States)


    We present the results of Chandra observations of two non-accreting millisecond pulsars, PSRs J1640+2224 (J1640) and J1709+2313 (J1709), with low inferred magnetic fields and spin-down rates in order to constrain their surface temperatures, obtain limits on the amplitude of unstable r -modes in them, and make comparisons with similar limits obtained for a sample of accreting low-mass X-ray binary (LMXB) neutron stars. We detect both pulsars in the X-ray band for the first time. They are faint, with inferred soft X-ray fluxes (0.3–3 keV) of ≈6 × 10{sup −15} and 3 × 10{sup −15} erg cm{sup −2} s{sup −1} for J1640 and J1709, respectively. Spectral analysis assuming hydrogen atmosphere emission gives global effective temperature upper limits (90% confidence) of 3.3–4.3 × 10{sup 5} K for J1640 and 3.6–4.7 × 10{sup 5} K for J1709, where the low end of the range corresponds to canonical neutron stars ( M = 1.4 M {sub ⊙}), and the upper end corresponds to higher-mass stars ( M = 2.21 M {sub ⊙}). Under the assumption that r -mode heating provides the thermal support, we obtain dimensionless r -mode amplitude upper limits of 3.2–4.8 × 10{sup −8} and 1.8–2.8 × 10{sup −7} for J1640 and J1709, respectively, where again the low end of the range corresponds to lower-mass, canonical neutron stars ( M = 1.4 M {sub ⊙}). These limits are about an order of magnitude lower than those we derived previously for a sample of LMXBs, except for the accreting millisecond X-ray pulsar SAX J1808.4–3658, which has a comparable amplitude limit to J1640 and J1709.

  5. Fast index based algorithms and software for matching position specific scoring matrices

    Directory of Open Access Journals (Sweden)

    Homann Robert


    XatLxBI9gBamrtHrhAL1wy0L2yHvtyaeHbnfgDOvwBHrxAJfwnaebbnrfifHhDYfgasaacH8akY=wiFfYdH8Gipec8Eeeu0xXdbba9frFj0=OqFfea0dXdd9vqai=hGuQ8kuc9pgc9s8qqaq=dirpe0xb9q8qiLsFr0=vr0=vr0dc8meaabaqaciaacaGaaeqabaWaaeGaeaaakeaaimaacqWFaeFqaaa@3821@|m + m - 1, where m is the length of the PSSM and A MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBamrtHrhAL1wy0L2yHvtyaeHbnfgDOvwBHrxAJfwnaebbnrfifHhDYfgasaacH8akY=wiFfYdH8Gipec8Eeeu0xXdbba9frFj0=OqFfea0dXdd9vqai=hGuQ8kuc9pgc9s8qqaq=dirpe0xb9q8qiLsFr0=vr0=vr0dc8meaabaqaciaacaGaaeqabaWaaeGaeaaakeaaimaacqWFaeFqaaa@3821@ a finite alphabet. In practice, ESAsearch shows superior performance over the most widely used programs, especially for DNA sequences. The new algorithm for accurate on-the-fly calculations of thresholds has the potential to replace formerly used approximation approaches. Beyond the algorithmic contributions, we provide a robust, well documented, and easy to use software package, implementing the ideas and algorithms presented in this manuscript.

  6. Development of an in-situ diagnostic for the measurement of the hydrogen content of amorphous hydrocarbon layers in fusion devices; Entwicklung einer In-situ-Messmethode zur Bestimmung des Wasserstoffgehalts amorpher Kohlenwasserstoffschichten in Fusionsanlagen

    Energy Technology Data Exchange (ETDEWEB)

    Irrek, F.


    A diagnostic method, the laser-induced thermal desorption spectroscopy (LDS), is developed to measure in situ the hydrogen inventory in the surface of plasma-facing components in fusion experiments. Its capabilities will be demonstrated in TEXTOR. In LDS, during the plasma discharge a laser beam is used to heat a spot on a surface close to the plasma to a temperature of 1400 to 2100 K to a depth of 100 {mu}m. Trapped hydrogen will be released into the plasma where it emits line radiation. The emitted H{sub a}-light is quantitatively measured. The amount of released hydrogen is calculated from the intensity of this emission using conversion factors (S/XB){sub eff}. The laser light (Nd:YAG, 1064 nm) is conducted via light fibres. At TEXTOR, a 5 mm{sup 2} sized homogeneous laser spot is created with a pulse duration of 1.5 ms, and an Energy of 5 J, typically. Below the laser spot a volume of at most 1 mm{sup 3} is desorbed. The generated temperature is calculated numerically and indirectly deduced from surface changings. Depending on the conditions during the layer formation the hydrogen content of the hydrocarbon layer will vary and different fractions of the released molecules (H{sub 2}, CH{sub 4}, C{sub 2}H{sub 4}) are created during the laser heating. The release of atomic hydrogen by laser desorption was not found. The emitted light is measured by means of narrow-band interference filters and a CCD-camera. The fraction of the light emission which lies outside the observation volume is estimated using simulations of the emission by the neutral gas transport Monte Carlo code EIRENE for each molecular fraction. Conversion factors (S/XB){sub eff} were measured in various reference plasmas (T{sub e}=22-30 eV, n{sub e}=1-11 x 10{sup 18} m{sup -3} and T{sub e}=50-74 eV, n{sub e}=1-5 x 10{sup 18} m{sup -3}) by desorbing prepared graphite samples which release a known amount of hydrogen with a known molecular distribution. LDS measurements were carried out in TEXTOR at

  7. Formal representation of complex SNOMED CT expressions

    Directory of Open Access Journals (Sweden)

    Markó Kornél


    Full Text Available Abstract Background Definitory expressions about clinical procedures, findings and diseases constitute a major benefit of a formally founded clinical reference terminology which is ontologically sound and suited for formal reasoning. SNOMED CT claims to support formal reasoning by description-logic based concept definitions. Methods On the basis of formal ontology criteria we analyze complex SNOMED CT concepts, such as "Concussion of Brain with(out Loss of Consciousness", using alternatively full first order logics and the description logic ℰℒ MathType@MTEF@5@5@+=feaagaart1ev2aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGaciGaaiaabeqaaeqabiWaaaGcbaWenfgDOvwBHrxAJfwnHbqeg0uy0HwzTfgDPnwy1aaceaGae8hmHuKae8NeHWeaaa@37B1@. Results Typical complex SNOMED CT concepts, including negations or not, can be expressed in full first-order logics. Negations cannot be properly expressed in the description logic ℰℒ MathType@MTEF@5@5@+=feaagaart1ev2aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGaciGaaiaabeqaaeqabiWaaaGcbaWenfgDOvwBHrxAJfwnHbqeg0uy0HwzTfgDPnwy1aaceaGae8hmHuKae8NeHWeaaa@37B1@ underlying SNOMED CT. All concepts concepts the meaning of which implies a temporal scope may be subject to diverging interpretations, which are often unclear in SNOMED CT as their contextual determinants are not made explicit. Conclusion The description of complex medical occurrents is ambiguous, as the same situations can be described as (i a complex occurrent C that has A and B as temporal parts, (ii a simple occurrent A' defined as a kind of A followed by some B, or (iii a simple occurrent B' defined as a kind of B preceded by some A. As negative statements in SNOMED CT cannot be exactly represented without

  8. Exact p-value calculation for heterotypic clusters of regulatory motifs and its application in computational annotation of cis-regulatory modules

    Directory of Open Access Journals (Sweden)

    Roytberg Mikhail A


    Full Text Available Abstract Background cis-Regulatory modules (CRMs of eukaryotic genes often contain multiple binding sites for transcription factors. The phenomenon that binding sites form clusters in CRMs is exploited in many algorithms to locate CRMs in a genome. This gives rise to the problem of calculating the statistical significance of the event that multiple sites, recognized by different factors, would be found simultaneously in a text of a fixed length. The main difficulty comes from overlapping occurrences of motifs. So far, no tools have been developed allowing the computation of p-values for simultaneous occurrences of different motifs which can overlap. Results We developed and implemented an algorithm computing the p-value that s different motifs occur respectively k1, ..., ks or more times, possibly overlapping, in a random text. Motifs can be represented with a majority of popular motif models, but in all cases, without indels. Zero or first order Markov chains can be adopted as a model for the random text. The computational tool was tested on the set of cis-regulatory modules involved in D. melanogaster early development, for which there exists an annotation of binding sites for transcription factors. Our test allowed us to correctly identify transcription factors cooperatively/competitively binding to DNA. Method The algorithm that precisely computes the probability of simultaneous motif occurrences is inspired by the Aho-Corasick automaton and employs a prefix tree together with a transition function. The algorithm runs with the O(n|Σ|(m|ℋ MathType@MTEF@5@5@+=feaafiart1ev1aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacH8akY=wiFfYdH8Gipec8Eeeu0xXdbba9frFj0=OqFfea0dXdd9vqai=hGuQ8kuc9pgc9s8qqaq=dirpe0xb9q8qiLsFr0=vr0=vr0dc8meaabaqaciaacaGaaeqabaqabeGadaaakeaat0uy0HwzTfgDPnwy1egaryqtHrhAL1wy0L2yHvdaiqaacqWFlecsaaa@3762@| + K|σ|K ∏i ki time complexity, where n is the length of the text, |Σ| is the alphabet size, m is the

  9. Exigências nutricionais de zebuínos: minerais Nutritional requirements of zebu cattle: minerals

    Directory of Open Access Journals (Sweden)

    Pedro Veiga Rodrigues Paulino


    Full Text Available Com o objetivo de determinar as exigências dos macroelementos minerais (Ca, P, Mg, K e Na de zebuínos, foi conduzido um experimento no Departamento de Zootecnia da Universidade Federal de Viçosa, utilizando-se 16 novilhos castrados, com peso vivo médio inicial de 270 kg, mantidos em confinamento. Quatro animais foram abatidos, após o período de adaptação, para servirem como referência, e os doze restantes foram distribuídos em três tratamentos com diferentes níveis de concentrado nas dietas (5, 35 e 65%, na base da matéria seca (MS total, em delineamento inteiramente casualizado, com quatro repetições. As dietas foram formuladas de forma a serem isoprotéicas. O volumoso foi constituído de pré-secado de capim-braquiária (Brachiaria brizantha e de capim-tifton 85 (Cynodon sp.. Os conteúdos de macroelementos minerais retidos no corpo foram estimados por meio de equações de regressão do logaritmo do conteúdo corporal dos macroelementos minerais, em função do logaritmo do peso de corpo vazio (PCVZ. As exigências líquidas dos macroelementos minerais, para ganho de 1 kg de PCVZ, foram obtidas utilizando-se a equação Y' = b.10ª. Xb-1, sendo a e b o intercepto e o coeficiente de regressão, respectivamente, das equações de predição dos conteúdos corporais de cada macroelemento mineral considerado. Verificou-se diminuição nas concentrações de todos os macroelementos minerais estudados, no corpo vazio e no ganho de corpo vazio, com a elevação do peso vivo. As relações obtidas para g Ca/100g de proteína retida e g P/100 g de proteína retida foram, respectivamente, 10,92 e 5,26.With the objective to determine the macrominerals (Ca, P, Mg, Na, K requirements of zebu cattle, a trial involving sixteen zebu steers with initial live weight of 270 kg was conducted. Four steers were slaughtered after the adaptation period of the trial, performing the reference group, and the remaining were uniformly allotted to a

  10. Composição corporal e exigências líquidas e dietéticas de macroelementos minerais de bovinos F1 Limousin x Nelore não-castrados Body composition and net and dietary macrominerals requirements of F1 Limousin x Nellore bulls

    Directory of Open Access Journals (Sweden)

    Cristina Mattos Veloso


    Full Text Available Foram utilizados 50 novilhos F1 Limousin x Nelore inteiros, alocados em dez tratamentos, com cinco níveis de concentrado (25; 37,5; 50; 62,5; e 75% e duas formas de balanceamento protéico da dieta (uma isoprotéica com 12% de proteína bruta [PB] e outra variando proteína com energia. O volumoso utilizado foi feno de capim-Coastcross (Cynodon dactylon. Após o abate, todas as partes do corpo do animal foram pesadas e amostradas. As amostras foram secas, pré-desengorduradas com éter, moídas e foram determinados os teores de macroelementos minerais. O conteúdo corporal de Ca, P, Na, K e Mg foi determinado em função das concentrações destes nas várias partes do corpo. O conteúdo de macroelementos minerais retidos no corpo foi estimado por meio de equações de regressão do logaritmo do conteúdo corporal dos macroelementos minerais em função do logaritmo do peso de corpo vazio (PCVZ. As exigências líquidas dos macroelementos minerais, para ganho de 1 kg de PCVZ, foram obtidas utilizando a equação Y' = b. 10ª. Xb-1, sendo a e b o intercepto e o coeficiente de regressão, respectivamente, das equações de predição dos conteúdos corporais dos macroelementos minerais. Houve diminuição nas concentrações dos cinco macroelementos estudados no corpo vazio e no ganho de corpo vazio, com a elevação do peso vivo. As relações g Ca/100 g de proteína retida e g P/100 g de proteína retida foram iguais a 8,70 e 3,46, respectivamente.Fifty F1 Limousin x Nellore bulls were allotted to ten treatments, with five concentrate levels (25; 37.5; 50; 62.5 e 75% and two diet protein balance methods (one isoprotein and the other changing protein as diet energy changed. The roughage used was Coastcross grass hay (Cynodon dactylon. After the slaughter, all animal body parts were weighted and sampled. The samples were dried, most of the fat was extracted with ether, grinded, and the concentrations of macrominerals were determined. Ca, P, Na, K

  11. Boron: Enabling Exciting Metal-Rich Structures and Magnetic Properties. (United States)

    Scheifers, Jan P; Zhang, Yuemei; Fokwa, Boniface P T


    Boron's unique chemical properties and its reactions with metals have yielded the large class of metal borides with compositions ranging from the most boron-rich YB66 (used as monochromator for synchrotron radiation) up to the most metal-rich Nd2Fe14B (the best permanent magnet to date). The excellent magnetic properties of the latter compound originate from its unique crystal structure to which the presence of boron is essential. In general, knowing the crystal structure of any given extended solid is the prerequisite to understanding its physical properties and eventually predicting new synthetic targets with desirable properties. The ability of boron to form strong chemical bonds with itself and with metallic elements has enabled us to construct new structures with exciting properties. In recent years, we have discovered new boride structures containing some unprecedented boron fragments (trigonal planar B4 units, planar B6 rings) and low-dimensional substructures of magnetically active elements (ladders, scaffolds, chains of triangles). The new boride structures have led to new superconducting materials (e.g., NbRuB) and to new itinerant magnetic materials (e.g., Nb6Fe1-xIr6+xB8). The study of boride compounds containing chains (Fe-chains in antiferromagnetic Sc2FeRu5B2), ladders (Fe-ladders in ferromagnetic Ti9Fe2Rh18B8), and chains of triangles (Cr3 chains in ferrimagnetic and frustrated TiCrIr2B2) of magnetically active elements allowed us to gain a deep understanding of the factors (using density functional theory calculations) that can affect magnetic ordering of such low-dimensional magnetic units. We discovered that the magnetic properties of phases containing these magnetic subunits can be drastically tuned by chemical substitution within the metallic nonmagnetic network. For example, the small hysteresis (measure of magnetic energy storage) of Ti2FeRh5B2 can be successively increased up to 24-times by gradually substituting Ru for Rh, a result that was

  12. Evaluation of the sustainability of road drainage systems (United States)

    García-Diez, Iván; Palencia, Covadonga; Fernández Raga, María


    Water is the most erosive agent that exists on the linear structures, because they are constantly subjected to outdoor condition like irregular infiltration, frosts and different rain intensities. Another variables that highly influence in the entire lifetime of a natural drainage system are the spatial and temporal variability of the rainfall, the soil, the vegetation cover and the design. All this factors are affecting the vulnerability of the clearings and embankments, by wearing away the weakest materials which surround the roads or train rails, producing erosion and very bumpy surfaces. The result is that the original pattern, developped to disminished the lost of soil, is not properly working and it cannot eliminate water, with the consequence destruction of the linear structure after several rainfall periods, and the accumulation of material down slope. The propose of this research focuses on analysing the drainage systems used in spanish roads and railways lines. For this purpose, a revision of the literature has been done, and the main drainage solutions have been recovered, carrying out an evaluation of them from an environmental point of view. This procedure has been requested by several authors in the past (Nwa, E.U. & Twocock, J.G., 1969; Goulter, I.C., 1992), together with the need of designing a more sustainable drainage system. The final objective of this complete revision is to compare objetively the designs to valuate them in order to develop a new drainage patter which minimize the erosion, increasing the durability and effectiveness of the drainage system. For this purpose, it is neccesary to assure that all the systems will be compare under similar parameters of flow rate, vegetation, substrate, lenght, slope and total section. Only the channels pattern and water distribution will change. The analysis has been done following Liu, H. & Zhu, X.B., (2012), who pointed out that the main parameters to take into account to select a road drainage

  13. Genome-assisted prediction of a quantitative trait measured in parents and progeny: application to food conversion rate in chickens

    Directory of Open Access Journals (Sweden)

    Rosa Guilherme JM


    Full Text Available Abstract Accuracy of prediction of yet-to-be observed phenotypes for food conversion rate (FCR in broilers was studied in a genome-assisted selection context. Data consisted of FCR measured on the progeny of 394 sires with SNP information. A Bayesian regression model (Bayes A and a semi-parametric approach (Reproducing kernel Hilbert Spaces regression, RKHS using all available SNPs (p = 3481 were compared with a standard linear model in which future performance was predicted using pedigree indexes in the absence of genomic data. The RKHS regression was also tested on several sets of pre-selected SNPs (p = 400 using alternative measures of the information gain provided by the SNPs. All analyses were performed using 333 genotyped sires as training set, and predictions were made on 61 birds as testing set, which were sons of sires in the training set. Accuracy of prediction was measured as the Spearman correlation (r¯S MathType@MTEF@5@5@+=feaagaart1ev2aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGaciGaaiaabeqaaeqabiWaaaGcbaGafmOCaiNbaebadaWgaaWcbaGaem4uamfabeaaaaa@2EB5@ between observed and predicted phenotype, with its confidence interval assessed through a bootstrap approach. A large improvement of genome-assisted prediction (up to an almost 4-fold increase in accuracy was found relative to pedigree index. Bayes A and RKHS regression were equally accurate (r¯S MathType@MTEF@5@5@+=feaagaart1ev2aaatCvAUfKttLearuWrP9MDH5MBPbIqV92AaeXatLxBI9gBaebbnrfifHhDYfgasaacPC6xNi=xH8viVGI8Gi=hEeeu0xXdbba9frFj0xb9qqpG0dXdb9aspeI8k8fiI+fsY=rqGqVepae9pg0db9vqaiVgFr0xfr=xfr=xc9adbaqaaeGaciGaaiaabeqaaeqabiWaaaGcbaGafmOCaiNbaebadaWgaaWcbaGaem4uamfabeaaaaa@2EB5@ = 0.27 when all 3481 SNPs were included in the model. However, RKHS with 400 pre-selected informative SNPs was more accurate than Bayes A with all SNPs.

  14. A new method for rapid determination of indole-3-carbinol and its condensation products in nutraceuticals using core-shell column chromatography method. (United States)

    Fibigr, Jakub; Šatínský, Dalibor; Havlíková, Lucie; Solich, Petr


    Indole-3-carbinol is a natural glucosinolate known for prevention of human breast, prostate and other types of cancer and it started to be used in commercial preparations, as food supplements. However no analytical method has been proposed for quality control of nutraceuticals with this substance yet. In this paper a new high-performance liquid chromatography (HPLC) method using core-shell column for separation of indole-3-carbinol and its condensation/degradation products was developed and used for the quantitative determination of indole-3-carbinol in nutraceuticals. Separation of indole-3-carbinol, its condensation/degradation products and internal standard ethylparaben was performed on the core-shell column Kinetex 5μ XB-C18 100A (100×4.6mm), particle size 5.0μm, with mobile phase acetonitrile/water according to the gradient program at a flow rate of 1.25mLmin(-1) and at temperature 50°C. The detection wavelength was set at 270nm. Under the optimal chromatographic conditions good linearity of determination was achieved. Available commercial samples of nutraceuticals were extracted with 100% methanol using ultrasound bath. A 5-μL sample volume of the supernatant was directly injected into the HPLC system. The developed method provided rapid and accurate tool for quality control of nutraceuticals based on cruciferous vegetable extracts with indole-3-carbinol content. The presented study showed that the declared content of indole-3-carbinol significantly varied in the different nutraceuticals available on the market. Two analyzed preparations showed the presence of condensation/degradation products of indole-3-carbinol which were not officially declared by the manufacturer. Moreover, further two analyzed nutraceutical preparations showed absolutely no content of declared amount of indole-3-carbinol. Copyright © 2015 Elsevier B.V. All rights reserved.

  15. Pengembangan Perangkat Pembelajaran Fisika Berbasis Pendidikan Karakter dengan Model Problem Based Instruction

    Directory of Open Access Journals (Sweden)

    Rahma Diani


    Full Text Available The unavailable of physics material learning based by the character education which conform with student’s characteristic caused the student’s competency and student’s activity in study process was low. This research aim to develop physics material learning (syllabus, lesson plan, module, worksheet, and assessment based by the character education with validity, practical, and effective problem based instruction model for the temperature and kalor subject. This research was the development research by using 4D models. The phases are define, design, and develop. The researcher did the analysis of curriculum, analysis of concepts, and analysis of students at define phase. On design phase, the researcher designed the physics material learning. Develop phase consist of validation phase, practicality, and effectivity. After designed, the physics material learning was validated by 5 validators. At practicality phase, physics material learning tested by the students of XB MAN 1 Sungai Penuh on even semester 2012/2013. At this activity, student and teacher will be ask for their comments about the practicality of physics material learning. Effectivity of physics material learning investigated at the same time with practicality phase. At this activity, student and teacher will be ask for their comments about the effectivity of physics material learning. Effectivity also seen from the improving of student’s competency and student’s activity in study process. The result showed that physics material learning based character education with model of problem based instruction  are very valid, very practical and very effective. Kata Kunci: model problem based instruction, pendidikan karakter, perangkat pembelajaran fisika

  16. Percentage depth dose calculation accuracy of model based algorithms in high energy photon small fields through heterogeneous media and comparison with plastic scintillator dosimetry. (United States)

    Alagar, Ananda Giri Babu; Mani, Ganesh Kadirampatti; Karunakaran, Kaviarasu


    Small fields smaller than 4 × 4 cm2 are used in stereotactic and conformal treatments where heterogeneity is normally present. Since dose calculation accuracy in both small fields and heterogeneity often involves more discrepancy, algorithms used by treatment planning systems (TPS) should be evaluated for achieving better treatment results. This report aims at evaluating accuracy of four model-based algorithms, X-ray Voxel Monte Carlo (XVMC) from Monaco, Superposition (SP) from CMS-Xio, AcurosXB (AXB) and analytical anisotropic algorithm (AAA) from Eclipse are tested against the measurement. Measurements are done using Exradin W1 plastic scintillator in Solid Water phantom with heterogeneities like air, lung, bone, and aluminum, irradiated with 6 and 15 MV photons of square field size ranging from 1 to 4 cm2. Each heterogeneity is introduced individually at two different depths from depth-of-dose maximum (Dmax), one setup being nearer and another farther from the Dmax. The central axis percentage depth-dose (CADD) curve for each setup is measured separately and compared with the TPS algorithm calculated for the same setup. The percentage normalized root mean squared deviation (%NRMSD) is calculated, which represents the whole CADD curve's deviation against the measured. It is found that for air and lung heterogeneity, for both 6 and 15 MV, all algorithms show maximum deviation for field size 1 × 1 cm2 and gradually reduce when field size increases, except for AAA. For aluminum and bone, all algorithms' deviations are less for 15 MV irrespective of setup. In all heterogeneity setups, 1 × 1 cm2 field showed maximum deviation, except in 6MV bone setup. All algorithms in the study, irrespective of energy and field size, when any heterogeneity is nearer to Dmax, the dose deviation is higher compared to the same heterogeneity far from the Dmax. Also, all algorithms show maximum deviation in lower-density materials compared to high-density materials.

  17. Lasing transition at 1.06 μm emission in Nd(3)(+) -doped borate-based tellurium calcium zinc niobium oxide glasses for high-power solid-state lasers. (United States)

    Ravi, O; Prasad, K; Jain, Rajiv; Venkataswamy, M; Chaurasia, Shivanand; Deva Prasad Raju, B


    The spectroscopic properties of Tellurium Calcium Zinc Niobium oxide Borate (TCZNB) glasses of composition (in mol%) 10TeO2  + 15CaO + 5ZnO + 10 Nb2 O5  + (60 - x)B2 O3  + Nd2 O3 (x = 0.1, 0.5, 1.0 or 1.5 mol%) have been investigated experimentally. The three phenomenological intensity parameters Ω2 , Ω4, Ω6 have been calculated using the Judd-Ofelt theory and in turn radiative properties such as radiative transition probabilities, emission cross-sections, branching ratios and radiative lifetimes have been estimated. The trend found in the JO intensity parameter is Ω2  > Ω6  > Ω4 If Ω6  > Ω4 , the glass system is favourable for the laser emission (4) F3/2  → (4) I11/2 in the infrared (IR) wavelength. The experimental values of branching ratio of (4) F3/2  → (4) I11/2 transition indicate favourable lasing action with low threshold power. The evaluated total radiative transition probabilities (AT ), stimulated emission cross-section (σe ) and gain bandwidth parameters (σe  × Δλp ) were compared with earlier reports. An energy level analysis has been carried out considering the experimental energy positions of the absorption and emission bands. Copyright © 2016 John Wiley & Sons, Ltd.

  18. Remote sensing imagery classification using multi-objective gravitational search algorithm (United States)

    Zhang, Aizhu; Sun, Genyun; Wang, Zhenjie


    Simultaneous optimization of different validity measures can capture different data characteristics of remote sensing imagery (RSI) and thereby achieving high quality classification results. In this paper, two conflicting cluster validity indices, the Xie-Beni (XB) index and the fuzzy C-means (FCM) (Jm) measure, are integrated with a diversity-enhanced and memory-based multi-objective gravitational search algorithm (DMMOGSA) to present a novel multi-objective optimization based RSI classification method. In this method, the Gabor filter method is firstly implemented to extract texture features of RSI. Then, the texture features are syncretized with the spectral features to construct the spatial-spectral feature space/set of the RSI. Afterwards, cluster of the spectral-spatial feature set is carried out on the basis of the proposed method. To be specific, cluster centers are randomly generated initially. After that, the cluster centers are updated and optimized adaptively by employing the DMMOGSA. Accordingly, a set of non-dominated cluster centers are obtained. Therefore, numbers of image classification results of RSI are produced and users can pick up the most promising one according to their problem requirements. To quantitatively and qualitatively validate the effectiveness of the proposed method, the proposed classification method was applied to classifier two aerial high-resolution remote sensing imageries. Th