WorldWideScience

Sample records for bursera graveolens triana

  1. Triterpenos aislados de corteza de Bursera graveolens (Burseraceae y su actividad biologica

    Directory of Open Access Journals (Sweden)

    Jorge Robles

    2005-12-01

    Full Text Available Bursera graveolens (Burseraceae, known in Colombia as "sasafrás", is useful for its medicinal properties and is rich in secondary metabolites. In our research, we carried out antimicrobial tests of several fractions and ethanolic extracts from aerial parts against Bacillus subtilis and Staphylococcus aureus, that showed growth inhibitory activity when applied at 250 mg/mL for extracts and 150 mg/mL for fractions. We carried out an antiinflamatory assay also, that showed 71% of inhibition by extracts (81% of Indomethacin and 70% of inhibition by fractions (78% of Indomethacin. Phytochemical investigation of the bark of Bursera graveolens (Burseraceae yielded three tetracyclic triterpene acids that have oxygenation in C-3, carboxylic acid in C-21 and unsaturation in C-24 and have been identified as 3-oxotirucalla-8,24-dien-21-oic acid (b-elemonic acid, 3a-hydroxytirucalla-8,24-dien-21-oic acid (a-elemolic acid and 3a-hydroxytirucalla-7,24-dien-21-oic acid. The isolated compounds were identified using spectroscopic methods including one and two-dimensional Nuclear Magnetic Resonance (COSY, HMQC, HMBC, NOESY experiments and comparison with published data. This is the first report of the isolated compounds in Bursera graveolens and they have a very important chemotaxonomic significance within the Burseraceae family and related families from the order Rutales.

  2. Efectos citotoxicos in vitro de extractos y fracciones de Bursera tomentosa (Jacq. Triana & Planch., Burseraceae, frente a lineas celulares tumorales humanos Efeitos citotóxicos in vitro de extratos e frações de Bursera tomentosa (Jacq. Triana & Planch., Burseraceae, frente a linhagens celulares tumorais humanos In vitro cytotoxicity of extracts and fractions of Bursera tomentosa (Jacq. Triana & Planch., Burseraceae, against human tumor cell

    Directory of Open Access Journals (Sweden)

    Jorge E. Robles Camargo

    2010-09-01

    Full Text Available A los extractos, fracciones y subfracciones obtenidos de hojas, flores y corteza de Bursera tomentosa (Jacq. Triana & Planch., Burseraceae, se les evalúo su actividad citotóxica preliminar frente a las líneas celulares CSC-1595 y Colo 205, siguiendo el método de fraccionamiento guiado por bioensayo de citotoxicidad MTT. Los resultados obtenidos de esta prueba muestran a la subfracción en diclorometano-metanol (9.5:0.5 obtenida de la fracción acetato de etilo del extracto en éter de petróleo de hojas, como la que presentó las sustancias bioactivas con una marcada actividad citotóxica, con porcentajes de viabilidad del 3% y 15.3% a la concentración 30 µg/mL en las líneas tumorales humanas Colo 205 y CSC-1595 respectivamente.A atividade citotóxica de extratos frações e subfrações obtidas das folhas e cascas de Bursera tomentosa (Jacq. Triana & Planch., Burseraceae, foram preliminarmente avaliados pelo método MTT frente a linhagens celulares tumorais CSC-1595 e Colo 205. Os resultados mostraram que a subfração diclorometano-metanol (9.5:0.5, obtidos a partir da fração acetato de etila do extrato em éter de petróleo das folhas, como sendo a que apresenta substâncias bioativas com forte atividade citotóxica, taxa de viabilidade de 3% e de 15,3% na concentração de 30 µg/mL em linhagens de células tumorais humanas Colo 205 e CSC-1595, respectivamente.To the extracts, fractions and subfractions obtained from leaves, flowers and bark of Bursera tomentosa (Jacq. Triana & Planch., Burseraceae, its preliminary cytotoxic activity against to the cellular lines CSC-1595 and Colo 205 were evaluated, following the MTT method. The results showed that dichloromethane-methanol (9.5:0.5 subfraction obtained of ethyl acetate part from petroleum extract of leaves, like to display the bioactives substances with a strong cytotoxic activity, showing viability percentage of 3% and 15,3% to the concentration 30 µg/mL in human tumor cellular

  3. El puente de Triana y su tiempo

    Directory of Open Access Journals (Sweden)

    Ávila Jalvo, José Miguel

    2001-04-01

    Full Text Available Before the XIX century, nobody dare to construct a bridge on Guadalquivir river, from Córdoba to Sanlucar. It was, really, a great venture. In Sevilla, one of the most flourishing towns by the time in Spain, this problem was solved with a boat's bridge. That means that the technicians did not trust in the river bed. But, thanks to the fact of Sevilla’s prosperity and of the new technologies and new materials, they decided, finally, to undertake the work. The industrial use of the iron concerning communications and the success of the first suspension bridges -with span alike or higher to those herewith stated-, encouraged the technicians to jump over the one hundred and fifty meters between Sevilla and Triana . The choice of the suspension bridge was taken because it was useful to introduce other options, like this of the masonry, with Silvestre Pérez not used from the XV century, and this of iron (arcs or beams. But, no one of them solved the bed problems.La labor de construir un puente sobre el Guadalquivir no debía de ser empresa fácil si consideramos que desde Córdoba a Sanlúcar nadie se atreviera a emprenderla hasta mediado el siglo XIX. Que en la Sevilla de la Casa de Contratación, una de las ciudades más prósperas de la época moderna, este salto estuviera resuelto con un puente de barcas, explica, sin necesidad de otra justificación, lo insensato que le debía parecer a los expertos de la zona el fiarse del lecho del río. Esa misma prosperidad hizo que, gracias a nuevas técnicas y nuevos materiales, se retomara la intención de emprender la obra. El uso industrial del hierro, su aplicación a las comunicaciones y el éxito de los primeros puentes suspendidos -con luces iguales y superiores a la que aquí se plantea-, anima a resolver el salto de ciento cincuenta metros que, hablando en términos de distancia, separan a Sevilla de Triana. La opción de un puente colgante prospera porque salva limpiamente los problemas

  4. Rutin from Ruta graveolens L

    OpenAIRE

    Dj. Afshar; Delazar, A.

    1994-01-01

    Quantitative determination of rutin in Ruta Graveolens, L. which is easily cultivated in Iran, is necessary for its economic importance, diversity of specialities and their pharmacological activity in blood vessels disorders. For this purpose, the plant was cultivated in botanical garden of Tabriz University of Medical Sciences and rutin was determinated at different stages of plant growth. The extraction was done from the crude plants by ethanol, boiling water and hydroalcoholic solvents. Ru...

  5. Chemical Composition and Biological Activities of Fragrant Mexican Copal (Bursera spp.

    Directory of Open Access Journals (Sweden)

    Giulia Gigliarelli

    2015-12-01

    Full Text Available Copal is the Spanish word used to describe aromatic resins from several genera of plants. Mexican copal derives from several Bursera spp., Protium copal, some Pinus spp. (e.g., P. pseudostrobus and a few Fabaceae spp. It has been used for centuries as incense for religious ceremonies, as a food preservative, and as a treatment for several illnesses. The aim of this review is to analyze the chemical composition and biological activity of commercial Mexican Bursera copal.

  6. Chemical Composition and Biological Activities of Fragrant Mexican Copal (Bursera spp.)

    OpenAIRE

    Giulia Gigliarelli; Becerra, Judith X.; Massimo Curini; Maria Carla Marcotullio

    2015-01-01

    Copal is the Spanish word used to describe aromatic resins from several genera of plants. Mexican copal derives from several Bursera spp., Protium copal, some Pinus spp. (e.g., P. pseudostrobus) and a few Fabaceae spp. It has been used for centuries as incense for religious ceremonies, as a food preservative, and as a treatment for several illnesses. The aim of this review is to analyze the chemical composition and biological activity of commercial Mexican Bursera copal.

  7. Acremonium camtosporum isolated as an endophyte of Bursera simaruba from Yucatan Peninsula, Mexico

    Science.gov (United States)

    Bursera simaruba (Burseraceae) is a frequent and co-dominant tree of tropical sub-caducifolious forest in the Yucatan Peninsula. This species is important ecologically because it can grow in poor, clay or sandy, saline soils. The Mayan communities use this plant medicinally for its analgesic, antimy...

  8. Acremonium camptosporum isolated as an endophyte of Bursera simaruba from Yucatan Peninsula, Mexico

    Science.gov (United States)

    This paper draws on morphological and molecular analyses to determinate the systematic position of an interesting endophytic fungus isolated from the leaves of Bursera simaruba, a tree of semideciduous dry tropical forest at El Eden Ecological Reserve. The cultured strain develops the characteristic...

  9. Efecto de Bursera grandiflora sobre el peso corporal y lipemia en ratones obesos

    OpenAIRE

    Lucía AGUILAR SANTAMARÍA; Ofelia ROMERO CERECERO; Manasés GONZÁLEZ CORTAZAR; Tortoriello, Jaime

    2012-01-01

    El sobrepeso y la obesidad están claramente vinculados con la ingesta calórica que lleva a la instalación crónica de inflamación sistémica de bajo grado. La terapia farmacológica es altamente recomendable para este padecimiento. Dentro de la familia Burseraceae existen especies utilizadas para el tratamiento de la obesidad, de las cuales, Bursera grandiflora es referida también por su efecto anti-inflamatorio. Evaluar el efecto de B. grandiflora en un modelo de obesidad, su potencial toxicoló...

  10. Nota sobre Bursera Cinerea Engl. (Burseraceae) en el estado de Veracruz

    OpenAIRE

    Jerzy Rzedowski; Graciela Calder\\u00F3n de Rzedowski

    1996-01-01

    Bursera cinerea, especie descrita hace más de una centuria, quedó practicamente ignorada por los botánicos del siglo XX. Exploraciones recientes realizadas en la porción central de Veracruz (México) indican que este árbol debe haber sido uno de los componentes importantes del bosque tropical caducifolio que en otros tiempos cubría amplias extensiones y todavía hoy forma parte de los vestigios del mismo. B. cinerea es muy similar a B. simaruba (L.) Sarg., de la que difiere primordialmente e...

  11. TRIANA. A control strategy for Smart Grids. Forecasting, planning and real-time control

    International Nuclear Information System (INIS)

    Increasing demand, extra fluctuation and a large share of distributed electricity generation will put more stress on the electricity supply chain. Therefore, changes are required in the supply chain to maintain a properly functioning, stable and affordable grid. Currently the supply chain is completely driven by demand by constantly adapting the production to the demand. The exploitation of flexibility on the demand side of the supply chain allows for a more efficient and sustainable electricity production. Techniques like controllable distributed generation, distributed storage, and smart appliances can introduce this required flexibility. To exploit the new flexibility, the grid has to become more intelligent, i.e. become a Smart Grid. In this thesis TRIANA, a three step control strategy for the Smart Grid is presented. In the first step of TRIANA, the forecasting step, the scheduling freedom (flexibility) of a device is determined for each individual device by a local controller. In the second step, a (central) planner tries to exploit the freedom of the devices determined in the first step for his objective. The last step of TRIANA is the real-time control step performed by the local controller achieving the planning in the best possible way. In order to analyze the impact of control methodologies for Smart Grid, a simulator based on an energy model has been built. The basic elements of the model are individual devices and between devices energy streams are defined. The energy streams are connected via so called pools, which represent the physical connections between the devices. To study the effectiveness of the control methodology and study the most economic use of the flexibility of devices, multiple scenarios have been simulated. Simulations show that TRIANA can optimize the energy flows and can control the operation of the domestic devices in an economic manner without discomfort for the residents. TRIANA is a methodology capable of adjusting the energy

  12. Nota sobre Bursera Cinerea Engl. (Burseraceae en el estado de Veracruz

    Directory of Open Access Journals (Sweden)

    Jerzy Rzedowski

    1996-01-01

    Full Text Available Bursera cinerea, especie descrita hace más de una centuria, quedó practicamente ignorada por los botánicos del siglo XX. Exploraciones recientes realizadas en la porción central de Veracruz (México indican que este árbol debe haber sido uno de los componentes importantes del bosque tropical caducifolio que en otros tiempos cubría amplias extensiones y todavía hoy forma parte de los vestigios del mismo. B. cinerea es muy similar a B. simaruba (L. Sarg., de la que difiere primordialmente en las hojas con menor número de foliolos y en los frutos más pequeños.

  13. Diagnóstico del potencial empresarial: análisis de la zona comercial Triana 

    OpenAIRE

    Batista Canino, Rosa María

    1999-01-01

    [ES] El objeto de este trabajo es articular el proceso a seguir y determinar los factores que permiten medir el potencial empresarial de un individuo, una organización o un entorno concreto. La aplicación de la metodología propuesta se desarrolla en la Zona Comercial Triana.

  14. Antiprotozoal activity of the constituents of Teloxys graveolens.

    Science.gov (United States)

    Calzada, Fernando; Velázquez, Claudia; Cedillo-Rivera, Roberto; Esquivel, Baldomero

    2003-08-01

    Antiprotozoal activity-guided fractionation of a methanol extract of the aerial parts of Teloxys graveolens led to the isolation of one coumarinic acid derivative, melilotoside, and five flavonoids, pinocembrine, pinostrobin, chrysin, narcissin and rutin. Among them, melilotoside exhibited the most potent activity toward Entamoeba histolytica and Giardia lamblia (IC(50) 12.5 and 16.8 micro g/mL, respectively). Narcissin showed selectivity against E. histolytlica (IC(50) 17.2 micro g/mL). The results support data for the traditional use of T. graveolens in some gastrointestinal diseases. PMID:12916068

  15. Anethum graveolens L. 1753 - kopr vonný

    Czech Academy of Sciences Publication Activity Database

    Sádlo, Jiří

    Praha: ČSOP, 2006 - (Mlíkovský, J.; Stýblo, P.), s. 47-47 ISBN 80-86770-17-6 Grant ostatní: GA MŽP(CZ) SM/6/37/04 Institutional research plan: CEZ:AV0Z60050516 Keywords : Anethum graveolens * aliens * invasibility Subject RIV: EF - Botanics

  16. Myiarchus flycatchers are the primary seed dispersers of Bursera longipes in a Mexican dry forest

    Science.gov (United States)

    Almazán-Núñez, R. Carlos; Eguiarte, Luis E.; Arizmendi, María del Coro

    2016-01-01

    We evaluated the seed dispersal of Bursera longipes by birds along a successional gradient of tropical dry forest (TDF) in southwestern Mexico. B. longipes is an endemic tree to the TDF in the Balsas basin. The relative abundance of frugivorous birds, their frequency of visits to B. longipes and the number of removed fruits were recorded at three study sites with different stages of forest succession (early, intermediate and mature) characterized by distinct floristic and structural elements. Flycatchers of the Myiarchus and Tyrannus genera removed the majority of fruits at each site. Overall, visits to B. longipes were less frequent at the early successional site. Birds that function as legitimate dispersers by consuming whole seeds and regurgitating or defecating intact seeds in the process also remove the pseudoaril from seeds, thereby facilitating the germination process. The highest germination percentages were recorded for seeds that passed through the digestive system of two migratory flycatchers: M. cinerascens and M. nutingii. Perch plants, mainly composed of legumes (e.g., Eysenhardtia polystachya, Acacia cochliacantha, Calliandra eryophylla, Mimosa polyantha), serve also as nurse plants since the number of young individuals recruited from B. longipes was higher under these than expected by chance. This study shows that Myiarchus flycatchers are the most efficient seed dispersers of B. longipes across all successional stages. This suggests a close mutualistic relationship derived from adaptive processes and local specializations throughout the distribution of both taxa, as supported by the geographic mosaic theory of coevolution. PMID:27326382

  17. Myiarchus flycatchers are the primary seed dispersers of Bursera longipes in a Mexican dry forest.

    Science.gov (United States)

    Almazán-Núñez, R Carlos; Eguiarte, Luis E; Arizmendi, María Del Coro; Corcuera, Pablo

    2016-01-01

    We evaluated the seed dispersal of Bursera longipes by birds along a successional gradient of tropical dry forest (TDF) in southwestern Mexico. B. longipes is an endemic tree to the TDF in the Balsas basin. The relative abundance of frugivorous birds, their frequency of visits to B. longipes and the number of removed fruits were recorded at three study sites with different stages of forest succession (early, intermediate and mature) characterized by distinct floristic and structural elements. Flycatchers of the Myiarchus and Tyrannus genera removed the majority of fruits at each site. Overall, visits to B. longipes were less frequent at the early successional site. Birds that function as legitimate dispersers by consuming whole seeds and regurgitating or defecating intact seeds in the process also remove the pseudoaril from seeds, thereby facilitating the germination process. The highest germination percentages were recorded for seeds that passed through the digestive system of two migratory flycatchers: M. cinerascens and M. nutingii. Perch plants, mainly composed of legumes (e.g., Eysenhardtia polystachya, Acacia cochliacantha, Calliandra eryophylla, Mimosa polyantha), serve also as nurse plants since the number of young individuals recruited from B. longipes was higher under these than expected by chance. This study shows that Myiarchus flycatchers are the most efficient seed dispersers of B. longipes across all successional stages. This suggests a close mutualistic relationship derived from adaptive processes and local specializations throughout the distribution of both taxa, as supported by the geographic mosaic theory of coevolution. PMID:27326382

  18. Evaluación preliminar de la calidad de biofertilizante para Bursera bipinnata

    OpenAIRE

    Diego-Sánchez, T.; Corlay-Chee, L.; Hernández-Tapia, A.

    2015-01-01

    La Bursera bipinnata se reproduce difícilmente en su medio natural, el constante ramoneo, pisoteo y cambios en su hábitat impiden que las plantas logren madurar para que puedan aprovecharse. Por esta situación, es necesario buscar alternativas que favorezcan la supervivencia del copal, una de ellas es mediante establecimiento de simbiosis con Hongos Micorrizógenos Arbusculares (HMA). Por lo anterior, el objetivo de este trabajo fue preparar un biofertilizante de HMA, con la finalidad evaluar ...

  19. Segunda restauración de bursera ovalifolia y nombre nuevo para otro componente del complejo de b. simaruba (burseraceae)

    OpenAIRE

    Jerzy Rzedowski; Rosalinda Medina Lemos; Graciela Calderón de Rzedowski

    2007-01-01

    Uno de los grupos taxonómicamente más difíciles del género Bursera es el que comprende los elementos ubicados alrededor de B. simaruba, pues varias de tales especies son morfológicamente tan parecidas que no siempre resultan fáciles de distinguir de esta última entidad, a la vez muy variable, ni tampoco muchas veces entre sí. En 1936 Bullock redujo a varios componentes de este conjunto a la sinonimia de uno solo, para el que usó el nombre de B. ovalifolia (Schltdl.) Engl., pues juzgó que la p...

  20. Supercritical Fluid Extraction of Botanical Pesticides from Pelargonium graveolens

    OpenAIRE

    Machalová, Z. (Zdeňka); Sajfrtová, M. (Marie); Karban, J. (Jindřich); Pavela, R.

    2013-01-01

    Supercritical fluid extraction was used for isolation of volatiles from P. graveolens to reach maximal biological aktivity of extracts. The extraction yields increased with increasing density of CO2 and the extract with high concentration of volatiles was achieved at SFE conditions 9 MPa, 50°C. The acute and chronic toxicity of isolates were tested on model organism Spodoptera littoralis. The isolate from hydrodistillation was more effective in terms of acute toxicity than other extracts due ...

  1. Supercritical Fluid Extraction of Botanical Pesticides from Pelargonium graveolens

    Czech Academy of Sciences Publication Activity Database

    Machalová, Zdeňka; Sajfrtová, Marie; Karban, Jindřich; Pavela, R.

    Salerno : Centro Stampa di Ateneo, 2013 - (Reverchon, E.; De Marco, I.), s. 133-138 ISBN 88-7897-061-1. [Conference on Supercritical Fluids and Their Applications /10./. Napoli (IT), 29.05.2013-06.05.2013] R&D Projects: GA TA ČR TA01010578 Institutional support: RVO:67985858 Keywords : supercritical fluid extraction * Pelargonium graveolens * chemical composition Subject RIV: CI - Industrial Chemistry, Chemical Engineering

  2. Anethum graveolens and hyperlipidemia: A randomized clinical trial

    OpenAIRE

    Mahmoud Mirhosseini; Azar Baradaran; Mahmoud Rafieian-Kopaei

    2014-01-01

    Background: It has been established that hyperlipidemia increases the incidence and mortality associated with coronary heart disease. In this study, the effects of Dill (Anethum graveolens) were evaluated on lipid profile of hypercholesterolemic patients. Materials and Methods: In this clinical study, 91 hyperlipidemic patients were randomly designated into two groups. One group received gemfibrozil (900 mg daily) and the other group received Dill tablet (six tablets daily) for 2 months. The ...

  3. Supercritical Fluid Extraction of Botanical Pesticides from Pelargonium graveolens

    Czech Academy of Sciences Publication Activity Database

    Machalová, Zdeňka; Sajfrtová, Marie; Karban, Jindřich; Pavela, R.

    Salerno: Centro Stampa di Ateneo, 2013 - (Reverchon, E.; De Marco, I.), s. 133-138 ISBN 88-7897-061-1. [Conference on Supercritical Fluids and Their Applications /10./. Napoli (IT), 29.05.2013-06.05.2013] R&D Projects: GA TA ČR TA01010578 Institutional support: RVO:67985858 Keywords : supercritical fluid extraction * Pelargonium graveolens * chemical composition Subject RIV: CI - Industrial Chemistry, Chemical Engineering

  4. Antioxidant and antiangiogenic activity of Astronium graveolens Jacq. leaves.

    Science.gov (United States)

    Hernández, Vanessa; Malafronte, Nicola; Mora, Flor; Pesca, Maria S; Aquino, Rita P; Mencherini, Teresa

    2014-01-01

    Angiogenesis is involved in many physiological and pathological conditions. Natural compounds with antioxidant activity have also been reported to possess potent antiangiogenic properties by regulating angiogenesis modulators such as vascular endothelial growth factor (VEGF). Based on this, we screened the antioxidant and antiangiogenic activities of Astronium graveolens leaf extracts by a DPPH test and a competitive enzyme-linked immunosorbent assay, respectively. MeOH extract expressed a significant free radical-scavenging activity (EC₅₀ = 37.65 μg/mL) and it was able to inhibit the interaction between placental growth factor (PlGF) (placental growth factor), a VEGF family member, and its receptor Flt-1 by more than 50% at 1 mg/mL. 1,2,3,4,6-Penta-O-galloyl-d-glucopyranose, 6 is the most active compound of the extract. It exhibited a high potency in scavenging DPPH (EC₅₀ = 2.16 μg/mL) and reduced by 58% the PlGF/Flt-1 interaction at a concentration of 50 μM. Moreover, the known compounds (1-6) have been isolated for the first time in A. graveolens. PMID:24588321

  5. Orbit Determination (OD) Error Analysis Results for the Triana Sun-Earth L1 Libration Point Mission and for the Fourier Kelvin Stellar Interferometer (FKSI) Sun-Earth L2 Libration Point Mission Concept

    Science.gov (United States)

    Marr, Greg C.

    2003-01-01

    The Triana spacecraft was designed to be launched by the Space Shuttle. The nominal Triana mission orbit will be a Sun-Earth L1 libration point orbit. Using the NASA Goddard Space Flight Center's Orbit Determination Error Analysis System (ODEAS), orbit determination (OD) error analysis results are presented for all phases of the Triana mission from the first correction maneuver through approximately launch plus 6 months. Results are also presented for the science data collection phase of the Fourier Kelvin Stellar Interferometer Sun-Earth L2 libration point mission concept with momentum unloading thrust perturbations during the tracking arc. The Triana analysis includes extensive analysis of an initial short arc orbit determination solution and results using both Deep Space Network (DSN) and commercial Universal Space Network (USN) statistics. These results could be utilized in support of future Sun-Earth libration point missions.

  6. Antigiardial effect of Anethum graveolens aqueous extract in children

    Directory of Open Access Journals (Sweden)

    Ahmed Salih Sahib

    2014-06-01

    Full Text Available Background: Giardia lamblia is the most common intestinal parasite of humans identified worldwide. In spite of metronidazole is the most commonly used drug for the treatment of giardiasis in humans, low patient compliance and side effects especially in children encourage efforts to look for new and safe agent; many plants used in folk medicine thought to have antigiardial effect,Anethum graveolens(Dill is an annual herb cultivated in Iraq used both as medicinal agent and as food spice. The aim of this study was to investigate the effect of aqueous extract of Anethum graveolens leave in the treatment of giardiasis, compared with that of standard drug metronidazole. Patients and Methods:A prospective randomized clinical trial was carried out on 28 pediatric patients of both sexes with age of less than one year ranging from 3-11 months, who attend to outpatient private clinic in Baghdad for a period of six months from June 2013-December 2013, Patients participate in this study were allocated into two groups: Group A composed of 14 patients treated with Metronidazole 15 mg/kg three times a day for 5 days. Group B composed of 14 patients treated with Anethum graveolensaqueous extract 1ml three times a day for 5 days. Stool samples were collected at zero time before administration of treatment, after five days and after 14 days from starting the treatments to checkthe efficacy of treatment. Results:Administration of Anethum graveolensaqueous extract results in significant decrease in incidence of Giardia lamblia after five days of treatment indicating the efficacy of Anethum graveolensaqueous extract in the treatment of giardiasis a result that is comparable to that of metronidazole. Conclusion:This study showed that pediatric patients with giardiasis may benefit from five days treatment with Anethum graveolensaqueous extract administered as 1 ml three times daily, the improvement in the symptom with this herbal agent was comparable to the standard

  7. Fototoxicidad tras exposición a ruta graveolens

    Directory of Open Access Journals (Sweden)

    P. Zayas-Pinedo

    2014-12-01

    Full Text Available La fototoxicidad es un tipo de reacción cutánea inflamatoria que se produce como consecuencia de la exposición a una sustancia química en combinación con la exposición a radiaciones lumínicas. Ruta graveolens, comúnmente llamada ruda, ha sido descrita en numerosas publicaciones como sustancia causante de reacciones de fototoxicidad. Presentamos el caso de una pareja que sufrió una reacción de fototoxicidad que requirió ingreso en la Unidad de Quemados como consecuencia del contacto con una infusión de ruda y posterior exposición solar. Consideramos que todo profesional que se ocupa del tratamiento de quemaduras debe incluir las fitofotodermatitis dentro del diagnóstico diferencial de las pérdidas cutáneas de espesor parcial.

  8. Potential allelochemicals from the essential oil of Ruta graveolens.

    Science.gov (United States)

    De Feo, Vincenzo; De Simone, Francesco; Senatore, Felice

    2002-11-01

    The essential oil of aerial parts of Ruta graveolens was obtained by hydrodistillation with a 0.74% yield on a dry weight basis. Thirty-eight components were identified by GC and GC-MS analyses. 2-Ketones predominated in the essential oil, with undecan-2-one (46.8%) and nonan-2-one (18.8%) as the main constituents. The essential oil and some of its constituents were tested for their allelopathic activity in vitro on radish germination and radicle growth in light and darkness. The essential oil and some of its minor constituents were effective and dose-dependent inhibitors of both the germination and radicle growth; 2-ketones are not active. The possible allelopathic activity of rue essential oil and some its isolated constituents is reported. PMID:12409025

  9. Variaciones de la comunidad de visitadores florales de Bursera copallifera (Burseraceae) a lo largo de un gradiente de perturbación antropogénica

    OpenAIRE

    Sombra Patricia Rivas-Arancibia; Eribel Bello-Cervantes; Hortensia Carrillo-Ruiz; Agustina Rosa Andrés-Hernández; Dulce María Figueroa-Castro; Silvia Guzmán-Jiménez

    2015-01-01

    El cambio en las condiciones ambientales y el grado de perturbación antropogénica afectan las comunidades de visitadores florale s. Así, se identificó y caracterizó la comunidad de visitadores florales de Bursera copallifera , en Jolalpan, Puebla, México, considerando cambios en variables ambientales (temperatura, humedad y altitud) y factores asociados con un gradiente de perturbación. Se usó un índice multimétrico cuantitativo para medir la perturbación en 13 zonas de la localidad. Se s...

  10. Infraspecific morphological variations in Acinos graveolens (M.B. Link

    Directory of Open Access Journals (Sweden)

    Seyed M. Talebi

    2015-05-01

    Full Text Available This study compares the effect of ecological factors on phenotype plasticity in the natural populations of Acinos graveolens in Iran. In total, twenty six quantitative and qualitative morphological traits were examined in the sixteen populations at two sections: inter- and intrapopulation. In the interpopulation section, averages amounts of morphological characteristics of populations were examined, while in the intrapopulation, morphological features of the seventy six plant samples of the populations were investigated. The obtained data showed that these characteristics differed between and within the populations and the analysis of variance test and one-sample test have shown significant differences of all quantitative characteristics. The biplot Principal Correspondence Analysis (PCA-biplot of traits showed some populations had indicator morphological characteristic(s which were useful in detecting of these populations. Significant correlations were found between some quantitative characteristics with ecological factors. The studied populations were separated from each other in the PCA and Principal Coordinate Analysis (PCO plots and the Unweighted Paired Group using Average method (UPGMA tree. The PCA plot of morphological features showed that some characteristics separated from others and the rest ones were together and had overlapping. The individuals of the studied populations were separated from others in the PCA and PCO plots and the UPGMA tree of the morphological characteristics. Individuals of some populations arranged separately and placed far from others, but this condition was reverse in the rest populations and most of individuals placed near each other. The obtained data confirmed high variations within some populations.

  11. Anethum graveolens and hyperlipidemia: A randomized clinical trial

    Directory of Open Access Journals (Sweden)

    Mahmoud Mirhosseini

    2014-01-01

    Full Text Available Background: It has been established that hyperlipidemia increases the incidence and mortality associated with coronary heart disease. In this study, the effects of Dill (Anethum graveolens were evaluated on lipid profile of hypercholesterolemic patients. Materials and Methods: In this clinical study, 91 hyperlipidemic patients were randomly designated into two groups. One group received gemfibrozil (900 mg daily and the other group received Dill tablet (six tablets daily for 2 months. The blood lipids including total cholesterol, triglyceride and high density lipoprotein (HDL-cholesterol from each group were assessed at the beginning and end of the trial. Results: Use of gemfibrozil brought about increased HDL-cholesterol by 3.91% (P < 0.05 and reduced triglyceride and total cholesterol by 32.7% (P < 0.05 and 9.41% (P < 0.05, respectively. Applying Dill tablet for 2 months resulted in reduction of total cholesterol up to 18% (P < 0.05 and triglyceride by 7.38% (P < 0.05. However, circulating HDL-cholesterol was not affected by this treatment. In this study, gemfibrozil decreased triglyceride and increased HDL-cholesterol more than anethum (P < 0.05. Anethum decreased total cholesterol more than gemfibrozil (P < 0.05. Patients treated with anethum did not report any side effects. Conclusion: The results of this trial indicate that Dill might be beneficial for hypercholesterolemic and hypertriglycemic patients.

  12. Hypolipidemic Effects of Seed Extract of Celery (Apium graveolens in Rats

    Directory of Open Access Journals (Sweden)

    Kamal Mansi

    2009-01-01

    Full Text Available The hypolipidemic effects of ethanol extract of A. graveolens L. (Apiaceae were investigated. Forty adult male albino rats weighing about 260 g each, were divided into four groups (n = 10. Experimental animals were gavaged at doses of 213 and 425 mg/kg body wt. for sixty consecutive days. Extract showed a significant decrease (p< 0.05 of serum total cholesterol, triglycerides, low-density lipoprotein cholesterol (LDL-c, and significant increase (p< 0.05 in high-density lipoprotein cholesterol (HDL-c in the treated groups. The oral administration of ethanol extract of A. graveolens revealed good hypolipideamic effects in adult male albino rats. The results have given a considerable agreement to the traditional use of A. graveolens in the treatment of hyperlipidemia; it could possibly lead to appropriate changes in blood lipid profiles.

  13. Extraction, characterization and evaluation of antibacterial activity of essential oil of Senecio graveolens Wedd (Wiskataya)

    OpenAIRE

    Kiev Ochoa Pumaylle; Luis Ricardo Paredes Quiroz; Dagnith Liz Bejarano Luján; Reynaldo Justino Silva Paz

    2012-01-01

    The aim of this work was extract, characterize and evaluate the antibacterial activity of the essential oil of Senecio graveolens Wedd (Wiskataya) against Escherichia coli and Staphylococcus aureus ATCC 29923. The leaves and stems of S. graveolens were collected in the district of Puquio 3800 m.s.n.m., Lucanas province, and department of Ayacucho. The essential oil was obtained by steam water destilation dried leaves and stems with yield 1.26% (w/w) to which physical testing were performed. T...

  14. Extraction, characterization and evaluation of antibacterial activity of essential oil of Senecio graveolens Wedd (Wiskataya

    Directory of Open Access Journals (Sweden)

    Kiev Ochoa Pumaylle

    2012-12-01

    Full Text Available The aim of this work was extract, characterize and evaluate the antibacterial activity of the essential oil of Senecio graveolens Wedd (Wiskataya against Escherichia coli and Staphylococcus aureus ATCC 29923. The leaves and stems of S. graveolens were collected in the district of Puquio 3800 m.s.n.m., Lucanas province, and department of Ayacucho. The essential oil was obtained by steam water destilation dried leaves and stems with yield 1.26% (w/w to which physical testing were performed. The chemical composition was evaluated by gas chromatography with mass detector (GC-MS. Antibacterial activity of S. graveolens oil was tested by agar diffusion method in wells against Gram positive strains such as S. aureus ATCC 29923 and Gram negative as E. coli. The density a 20 ºC was 0.8755 g/ml; the index refraction was 1.4726 and the rate rotation was 102° 85' and the solubility miscible in ethanol. The GC-MS showed the main components sabinene (52.39 %, (+-4-carene (8.20 %, τ-terpinen (7.11 %, β-myrcene (6.74 %, 4-terpinenol (3.78 % and pulegone (3.67 %. The results showing activity strong antibacterial activity and moderate, respectively, for the strains tested, observing formation of inhibition halos for essential oil concentrations at 80, 90 and 100 % in both strains. The essential oil of S. graveolens presented with promising antibacterial activity.

  15. Suppressive impact of anethum graveolens consumption on biochemical risk factors of atherosclerosis in hypercholesterolemic rabbits

    Directory of Open Access Journals (Sweden)

    Mahbubeh Setorki

    2013-01-01

    Conclusions: A. graveolens might have some protective values against atherosclerosis and that it significantly affects some biochemical risk factors of this disease. Our findings also confirm the potential harmful effects of oxidized fats and the importance of dietary polyphenols in the meal.

  16. Apium graveolens accentuates urinary Ca +2 excretions in experimental model of nephrocalcinosis

    Directory of Open Access Journals (Sweden)

    Faruk H Al Jawad

    2011-01-01

    Full Text Available Nephrocalcinosis (NC is a state characterised by deposition of calcium phosphate or oxalate in the renal parenchyma due to different clinical conditions. Apium graveolens (Celery is a popular vegetable added to salads and many cooked dishes, used in Chinese medicine to reduce high blood pressure and in Arabic medicine to relieve renal pains. To evaluate the effect of A. graveolens in reducing calcium deposits from renal parenchyma in rabbit models with induced NC by a large dose of oxalic acid. A. graveolens produced a significant reduction of blood urea nitrogen (5.7±0.05 vs 7.3±0.2 mmol/l, serum creatinine (87.2±0.63 vs 97.3±0.5 mmol/l and serum Na + levels (136.8±0.2 vs 142.16±0.7 mmol/l with non-significant reduction in serum K + (3.3±0.8 vs 3.8±0.03. There is a significant reduction in calcium deposition in renal parenchyma in comparison to the control group after ten days of treatment. A. graveolens showed a significant diuretic effect that accentuates the excretion of urinary calcium.

  17. DETERMINACIÓN DE LAS PROPIEDADES TÉRMICAS Y COMPOSICIONALES DE LA HARINA Y ALMIDÓN DE CHACHAFRUTO (Erytina Edulis Triana Ex Micheli)

    OpenAIRE

    Erika N. Álzate Carvajal; Víctor Dumar Quintero Castaño; Juan Carlos Lucas Aguirre

    2013-01-01

    Este trabajo presenta un estudio sobre las propiedades químicas, térmicas y estructurales de las harinas y almidones de chachafruto. Se realizó un análisis proximal tanto a la harina como al almidón de chachafruto (Erytrina Edulis Triana Ex Micheli) en las cuales se evaluaron parámetros como humedad, minerales, proteína, grasas, fibra y porcentaje de almidón. Las propiedades térmicas se determinaron con las técnicas de Calorimetría Diferencial de Barrido, Análisis Termogravimétrico y Análisis...

  18. Effect of Ruta graveolens and Cannabis sativa alcoholic extract on spermatogenesis in the adult wistar male rats

    OpenAIRE

    Sailani, M. R.; Moeini, H.

    2007-01-01

    Objective: The present study was undertaken to evaluate the effects of alcohol extracts of Ruta graveolens and Cannabis sativa that were used traditionally in medieval Persian medicine as male contraceptive drugs, on spermatogenesis in the adult male rats. Materials and Methods: Ethanol extracts of these plants were obtained by the maceration method. The male rats were injected intraperitionaly with C. sativa and R. graveolens 5% ethanol extracts at dose of 20 mg/day for 20 consecutive days, ...

  19. Chemical composition of the essential oil from Microlicia graveolens growing wild in Minas Gerais

    OpenAIRE

    Anja B. Toudahl; Sidney A. V. Filho; Gustavo H. B. Souza; Luisa D. Morais; Orlando D. H. dos Santos; Anna K. Jäger

    2012-01-01

    The chemical composition of the essential oil of the aerial parts of Microlicia graveolens DC., Melastomataceae, growing wild in the mountains of Minas Gerais, Brazil, was investigated for the first time. A pale orange to colourless oil was obtained in a yield of 4.8%. The oil was analyzed by GC-MS. The main components were (+)-trans-pinocarvyl acetate (78.9%), (-)-trans-pinocarvyl acetate (5.5%) and β-pinene (3.8%).

  20. Preliminar toxicological assesement of Ruta graveolens, Origanum vulgare and Persea americana on the preimplantational mouse embryos

    OpenAIRE

    Benavides, V; Trujillo, G; G. D'Arrigo; U. Paredes; J. Pino

    2014-01-01

    The growing interest in natural medicine makes it necessary to study plant properties as well as their possible secondary effects. In recent years the toxic effects of many medicinal plants on the preimplantational mouse embryo development have been studied. Many of them produce malformations and alterations in the embryonic development. Ruta graveolens "ruda", Origanum vulgare "oregano" and Persea americana "palta" are used in rural areas to menstrual colic and to provoke abortion (estrella,...

  1. Lippia graveolens and Carya illinoensis Organic Extracts and there in vitro Effect Against Rhizoctonia Solani Kuhn

    Directory of Open Access Journals (Sweden)

    Francisco D. Hernandez-Castillo

    2010-01-01

    Full Text Available Problem statement: Plant extracts with polyphenolic compounds obtained with different solvents have been evaluated against plant pathogens. However, most of these extract have been obtained using solvents no allowed under an organic production context. Approach: In the present research was to evaluate the inhibitory effect of polyphenolic extracts from L. graveolens and C. illinoensis, obtained with alternative organic solvents (lanolin and cocoa butter, water and ethanol against R. solani in order to determine the Inhibitory Concentration (IC50 of each extract. Results: The results showed that extracts of both L. graveolens and C. illinoensis obtained with lanolin and ethanol (200 and 3000 ppm of total tannins, respectively inhibited at 100% growth of R. solani. The IC50 for each extract was highly variable, low IC50 values were obtained with L. graveolens (4.50×101 and C. illinoensis (4.33×102 extract using lanolin and ethanol respectively. Tannins extraction was strongly dependent on plant species and in the solvent used. Conclusion: The alternative organic solvents lanolin and cocoa butter allowed the recovery of polyphenols compounds with antifungal activity against R. solani.

  2. Vasorelaxant activity of extracts obtained from Apium graveolens:Possible source for vasorelaxant molecules isolation with potential antihypertensive effect

    Institute of Scientific and Technical Information of China (English)

    Vergara-Galicia Jorge; Jimenez-Ramirez Luis ngel; Tun-Suarez Adrin; Aguirre-Crespo Francisco; Salazar-Gmez Anuar; Estrada-Soto Samuel; Sierra-Ovando ngel; Hernandez-Nuez Emmanuel

    2013-01-01

    Objective:To investigate the vasorelaxant effect of organic extracts from Apium graveolens (A. graveolens) which is a part of a group of plants subjected to pharmacological and phytochemical study with the purpose of offering it as an ideal source for obtaining lead compounds for designing new therapeutic agents with potential vasorelaxant and antihypertensive effects. Methods:An ex vivo method was employed to assess the vasorelaxant activity. This consisted of using rat aortic rings with and without endothelium precontracted with norepinephrine. Results:All extracts caused concentration-dependent relaxation in precontracted aortic rings with and without endothelium;the most active extracts were Dichloromethane and Ethyl Acetate extracts from A. graveolens. These results suggested that secondary metabolites responsible for the vasorelaxant activity belong to a group of compounds of medium polarity. Also, our evidence showed that effect induced by dichloromethane and ethyl acetate extracts from A. graveolens is mediated probably by calcium antagonism. Conclusions: A. graveolens represents an ideal source for obtaining lead compounds for designing new therapeutic agents with potential vasorelaxant and antihypertensive effects.

  3. Phytochemical research of leaves and flowers of Smallanthus pyramidalis (Triana) H. Rob. (Arboloco) and its use in the recovery of wetlands in Bogota

    International Nuclear Information System (INIS)

    This research focused on the phytochemical characterization of the species Smallanthus pyramidalis (Triana) H. Rob. in order to identify the secondary metabolites of flowers and leaves. This is due to the importance these trees on the sustainable development of the wetlands in the Sabana de Bogota, and its possible application as a promising species in the use and conservation of these ecosystems. We performed preliminary chemical tests, fractionation using conventional techniques, identification of physical and chemical properties, and structural analysis using spectroscopic and spectrometric techniques, such as UV, 1H-RMN, 13C-RMN and GC-MS. We identified alkane-type compounds, steroids, terpenoids and flavonoids mainly, and their role in the plant and the ecosystem.

  4. Insecticide effects of Ruta graveolens, Copaifera langsdorffii and Chenopodium ambrosioides against pests and natural enemies in commercial tomato plantation = Ação inseticida de Ruta graveolens, Copaifera langsdorffii e Chenopodium ambrosioides sobre pragas de tomate

    Directory of Open Access Journals (Sweden)

    Flávia Silva Barbosa

    2011-01-01

    Full Text Available The aim of this study was to evaluate the insecticide effect of watery leaf extracts of Ruta graveolens (Rutaceae, alcoholic leaf extracts of Copaifera langsdorffii (Caesalpinaceae and Chenopodium ambrosioides (Chenopodiaceae in the concentration of 5% under field conditions. The experiment design was randomized blocks with six replications. The parcels treated with plant extracts showed reduction in the population of pests when compared with the controlparcels. The extract elaborated with C. langsdorffii presented greater insecticidal effect under Bemisia tabaci (Hemiptera: Aleyrodidae and sum of pests. It was verified that after 24 hours ofspraying, the parcels treated with the extract of C. ambrosioides presented minor numbers of adults of Tuta absoluta (Lepidoptera: Gelechiidae, followed by the parcels treated with extract of R.graveolens. There were smaller numbers of parasitoid eggs of epidopterans Trichogramma sp. (Hymenoptera: Trichogrammatidae and sum of natural enemies (predators + parasitoids in the parcels that had received spraying with extracts from the plants of C. langsdorffii and C. ambrosioides, followed by R. graveolens, compared to the control. There were a smaller number of parasitoids from the family Eulophidae (Hymenoptera attacking caterpillars of T. absoluta in plants treated with R. graveolens, followed by C. langsdorffii and C. ambrosioides than in the control.O objetivo deste trabalho foi avaliar o efeito inseticida dos extratos aquosos de folhas de Ruta graveolens (Rutaceae e alcoólicos de folhas de Copaifera langsdorffii (Caesalpinaceae e de folhas de Chenopodium ambrosioides (Chenopodiaceae a 5%. O experimento foi em blocos casualizados com seis repetições. As parcelas tratadas tiveram redução na população de pragas, quando comparadas às parcelas sem nenhum tratamento. O extrato elaborado com C. langsdorffii apresentou maior efeito inseticida em Bemisia tabaci (Hemiptera: Aleyrodidae e soma das pragas

  5. Authentication of ruta graveolens and its adulterant using internal transcribed spacer (its) sequences of nuclear ribosomal DNA

    International Nuclear Information System (INIS)

    Ruta graveolens L. (Rutaceae) is commonly known as 'Sudab' which is well known for hippocratic medicine and is commonly used in indigenous health-care system in India. Euphorbia dracunculoides Lam. (Euphorbiaceae) in raw drug trading has almost similar morphology to R. graveolens in dried state, is being sold locally or used clinically as an adulterant of R. graveolens (genuine) at a relatively low price under the same name 'Sudab' which has ultimately reduced the efficacy and quality of this herb. The internal transcribed spacer (ITS) sequence of nuclear ribosomal DNA gene of genuine and adulterant were sequenced and analyzed to assess species admixture in raw drug trading of genuine herbal drug. The BLAST search results of ITS sequence of genuine sample of 'Sudab' i.e., R. graveolens showed 99% similarity to the sequence of R. graveolens, however, E. dracunculoides showed 100% similarity to the species of Euphorbia and did not show any similarity with R. graveolens. The sequence alignment of both species was entirely different to each other. Phylogenetic analysis based on ITS sequence of adulterant sample i.e., E. dracunculoides together with sequences of Euphorbia species available in the GenBank has also clearly showed its nesting within the Euphorbia tree. The generated ITS sequences of both samples in the present study may be referred hereafter as species-specific DNA barcode signature, which can be used in authenticating and validating the exact species identities to discriminate the genuine sample of 'Sudab' from its adulterants if any available to guarantee the quality and purity of this drug in the herbal drug market. (author)

  6. Micropropagação e aclimatização de gerânio (Pelargonium graveolens L.) Micropropagation and acclimatization of geranium (Pelargonium graveolens L.)

    OpenAIRE

    M.F Arrigoni-Blank; S.A. Almeida; A.C.L Oliveira; A.F Blank

    2011-01-01

    O gerânio (Pelargonium graveolens L.) é uma planta medicinal e aromática nativa do sul da África, cujo óleo essencial é amplamente empregado nas indústrias de perfumaria e cosmético, além de ser usado como terapêutico. Avaliou-se o efeito da luminosidade e dos reguladores de crescimento BAP e ANA na multiplicação in vitro e o uso de diferentes substratos na aclimatização de mudas micropropagadas. Foram avaliadas as concentrações 0; 0,5; 1,0 e 2,0 mg L-1 de BAP, 0; 0,1 e 0,5 mg L-1 de ANA e du...

  7. Hypolipidemic Effects of Seed Extract of Celery (Apium graveolens ) in Rats

    OpenAIRE

    Kamal Mansi; Adel M Abushoffa; Ahmad Disi; Talal Aburjai

    2009-01-01

    The hypolipidemic effects of ethanol extract of A. graveolens L. (Apiaceae) were investigated. Forty adult male albino rats weighing about 260 g each, were divided into four groups (n = 10). Experimental animals were gavaged at doses of 213 and 425 mg/kg body wt. for sixty consecutive days. Extract showed a significant decrease (p< 0.05) of serum total cholesterol, triglycerides, low-density lipoprotein cholesterol (LDL-c), and significant increase (p< 0.05) in high-density lipoprotein choles...

  8. Effects of aqueous extract of celery (Apium graveolens L. leaves on spermatogenesis in healthy male rats

    Directory of Open Access Journals (Sweden)

    Ameneh Hardani

    2015-02-01

    Full Text Available Objectives: Nowadays, a lot of attention has been paid to the therapeutic properties of herbs, including evaluation of the effects of these plants on fertility in laboratory animals. Apium graveolens L. (celery has been widely used in traditional medicine for treatment of various disorders including impotency. Therefore, this study was designed to investigate the effects of aqueous extract of A. graveolens on testicular tissue and spermatogenesis in healthy male rats. Materials and Methods: In this research, 24 apparently healthy male rats were divided into three groups, including eight rats in each. The first group as control received only distilled water 1 ml/animal/day. The second and third groups orally received 100 and 200 mg/kg b.w. of the extract, respectively, for 30 days. The day after the last administration of the extract, the rats were sacrificed, the testes were removed entirely, and the morphometric studies were carried out. Epididymal sperm count and histological studies of testicular tissue were conducted. Results: The comparison between the treated and control groups revealed a remarkable increase in the seminiferous tubules diameter, testes volume (p≤0.001, and the number of spermatogonia, primary spermatocytes and spermatozoa. Furthermore, the increase in the number of spermatids and epididymal weight were only significant at high doses of the extract (p≤ 0.05. Conclusions: The results from this study indicated that administration of celery leaf extract may improve spermatogenesis process and also be useful for some sperm fertility parameters.

  9. Cysticidal activity of extracts and isolated compounds from Teloxys graveolens: In vitro and in vivo studies.

    Science.gov (United States)

    Palomares-Alonso, Francisca; Rojas-Tomé, Irma Susana; Juárez Rocha, Victorino; Palencia Hernández, Guadalupe; González-Maciel, Angélica; Ramos-Morales, Andrea; Santiago-Reyes, Rosalba; González-Hernández, Iliana Elvira; Jung-Cook, Helgi

    2015-09-01

    In the search of new alternatives for neurocysticercosis treatment, the cysticidal activity of organic extracts of Teloxys graveolens was evaluated. The in vitro activity of hexane, ethyl acetate and methanol extracts against Taenia crassiceps cysts was tested and the selectivity index relative to human fibroblasts was determined. Subsequently, the in vivo efficacy of the methanolic extract at doses of 200 and 500 mg/kg in the murine cysticercosis model was evaluated. The ultrastructural effects in vitro and in vivo of the methanolic extract were also investigated using scanning electron microscopy. Additionally, a bioassay-guided fractionation for the isolation of the cysticidal components was performed. Our in vitro findings revealed that all extracts exhibited good cysticidal activity with EC50 values from 44.8 to 67.1 µg/mL. Although the ethyl acetate and methanolic extracts displayed low cytotoxicity, the methanolic extract was the most selective. The methanolic extract also showed in vivo efficacy which was similar to that obtained with ABZ. Significant alterations were found on the germinal layer of the cysts, with a high accumulation of granules of glycogen and vacuoles. The bioguided fractionation of methanolic extract led to the isolation of three flavonoids: chrysin, pinocembrin and pinostrobin; among them, pinocembrin was the compound that displayed cysticidal activity. This is the first study which reveals that T. graveolens could be a potential source for cysticidal and non-toxic compounds. PMID:26072200

  10. Efecto de la predación por larvas de mosca sobre la fructificación de Puya trianae (Bromeliaceae en el Parque Nacional Natural Chingaza, Colombia

    Directory of Open Access Journals (Sweden)

    Bonilla María Argenis

    2006-06-01

    Full Text Available Los páramos se caracterizan por su importancia biológica y por presentar una gran importancia paisajística, así mismo, son significativos productores de agua lo cual los hace objetivo para planes de conservación. Por lo tanto es necesario el conocimiento de la historia natural de las especies más frecuentes del páramo. Un elemento importante dentro de esta historia son los factores que pueden afectar la distribución y demografía de las especies. En el presente trabajo se caracterizó el efecto de la predación por larvas de moscas sobre la fructificación en una población de rosetas de Puya trianae (Baker presentes en el Parque Nacional Natural Chingaza, Colombia. Para esta caracterización se cuantificó la presencia de predación por larvas de moscas en las inflorescencias, se describió y cuantificó el efecto de la predación sobre la reproducción de las rosetas individuales de P. trianae, y se evalúó la relación entre el tamaño corporal de las rosetas individuales y la presencia de predación en la población de éstas. Se encontraron un total de 1.021 plantas, de éstas el 78,52% en estado vegetativo, el 15,9% en estado reproductivo y el 5,58% presentaron predación. Se presentaron menores tamaños (longitud de la hoja más larga, de eje y de escapo y menor número de frutos y semillas en las plantas predadas. La variable que se afectó más fue el número frutos y por consiguiente el número de semillas que pudieran llegar a los bancos afectando posiblemente la dinámica poblacional.

  11. Micropropagação e aclimatização de gerânio (Pelargonium graveolens L. Micropropagation and acclimatization of geranium (Pelargonium graveolens L.

    Directory of Open Access Journals (Sweden)

    M.F Arrigoni-Blank

    2011-01-01

    Full Text Available O gerânio (Pelargonium graveolens L. é uma planta medicinal e aromática nativa do sul da África, cujo óleo essencial é amplamente empregado nas indústrias de perfumaria e cosmético, além de ser usado como terapêutico. Avaliou-se o efeito da luminosidade e dos reguladores de crescimento BAP e ANA na multiplicação in vitro e o uso de diferentes substratos na aclimatização de mudas micropropagadas. Foram avaliadas as concentrações 0; 0,5; 1,0 e 2,0 mg L-1 de BAP, 0; 0,1 e 0,5 mg L-1 de ANA e duas condições de luminosidade (ausência e presença de luz, em esquema fatorial 4x3x2; para a aclimatização foram utilizados quatro substratos, pó de coco + Biosafra® (3-12-6 (12 g L-1 + calcário (1 g L-1 (PCBC; pó de coco + Biosafra® (3-12-6 (12 g L-1 + calcário (1 g L-1 + vermiculita (1:1 (PCBCV 1:1; pó de coco + Biosafra® (3-12-6 (12 g L­-1 + calcário (1 g L-1 + vermiculita (PCBCV 2:1 e vermiculita e adição semanal de sais MS (VS. Para a micropropagação de P. graveolens a utilização de 1,3 mg L-1 de BAP e 0,5 mg L-1 de ANA é eficiente na regeneração direta de plantas de gerânio, sendo a condição de escuro a mais indicada por proporcionar o maior número de brotos por explante. Para a aclimatização das mudas de gerânio, os melhores resultados foram obtidos em mudas aclimatizadas no substrato vermiculita com adição semanal de sais de MS seguido do substrato PCBCV 1:1.Geranium (Pelargonium graveolens L. is a medicinal and aromatic plant native to the south of Africa and whose essential oil is widely used by perfume and cosmetic industries, as well as in therapeutics. The effect of luminosity and growth regulators BAP and NAA on in vitro multiplication was evaluated, together with the use of different substrates on the acclimatization of micropropagated seedlings. The evaluated concentrations were 0, 0.5, 1.0 and 2.0 mg L-1 BAP; 0, 0.1 and 0.5 mg L-1 NAA; and two luminosity conditions (absence and presence of

  12. The effect of celery (Apium graveolens L. on reproductive parameters in male wistar rat

    Directory of Open Access Journals (Sweden)

    Wesam Kooti

    2016-04-01

    Full Text Available Dear editor In recent years, the number of scientific research papers of Iranian scientists has substantially grown in national and international journals that indicates particular attitude of Iranian scientific community to the development of knowledge in different fields. Moreover, improvement of quality of scientific papers is necessary. For this purpose, criticism of published studies is a way to increase the quality of articles and make them clear. In Avicenna Journal of Phytomedicine, volume (5, issue (2, year 2015, an article entitled “Effects of aqueous extract of celery (Apium graveolens L. leaves on spermatogenesis in healthy male rats” was published and the papers like this should be appreciated. However, the paper has some drawbacks which if not resolve, could be misleading for researchers who tend to use it or do research in its direction. So, with all due respect to the research team, we decided to evaluate the paper ambiguities in order to improve the quality of future articles.

  13. Aqueous Extract of Anethum Graveolens L. has Potential Antioxidant and Antiglycation Effects.

    Science.gov (United States)

    Oshaghi, Ebrahim Abbasi; Khodadadi, Iraj; Tavilani, Heidar; Goodarzi, Mohammad Taghi

    2016-07-01

    The aim of this study was to assess the antiglycation and antioxidant properties of aqueous extract of Anethum graveolens (dill). In the in vivo and in vitro experiments, antioxidant properties, blood glucose, and AGEs formation were determined. Dill extract was given orally to healthy and diabetic rats. Our results illustrated that different concentrations of dill extract (0.125, 0.25, 0.5, and 1 mg/ml) have potential antiradical and antioxidant activity. Aqueous extract of dill significantly reduced AGEs formation and fructosamine levels, protein carbonyl and also thiol group's oxidation, amyloid cross-β and fragmentation. After 2 months, blood glucose levels (P=0.006) and AGEs formation (P=0.003) significantly reduced in dill treated group compared with untreated diabetic animals. In conclusion, dill can be recommended as herbal medicine for the control and prevention of diabetic complications. PMID:27365555

  14. Aqueous Extract of Anethum Graveolens L. has Potential Antioxidant and Antiglycation Effects

    Directory of Open Access Journals (Sweden)

    Ebrahim Abbasi Oshaghi

    2016-07-01

    Full Text Available The aim of this study was to assess the antiglycation and antioxidant properties of aqueous extract of Anethum graveolens (dill. In the in vivo and in vitro experiments, antioxidant properties, blood glucose, and AGEs formation were determined. Dill extract was given orally to healthy and diabetic rats. Our results illustrated that different concentrations of dill extract (0.125, 0.25, 0.5, and 1 mg/ml have potential antiradical and antioxidant activity. Aqueous extract of dill significantly reduced AGEs formation and fructosamine levels, protein carbonyl and also thiol group’s oxidation, amyloid cross-β and fragmentation. After 2 months, blood glucose levels (P=0.006 and AGEs formation (P=0.003 significantly reduced in dill treated group compared with untreated diabetic animals. In conclusion, dill can be recommended as herbal medicine for the control and prevention of diabetic complications.

  15. Hoya thuathienhuensis and Hoya graveolens (Apocynaceae, Asclepiadoideae), a new species and a new record for the Flora of Vietnam

    OpenAIRE

    Rodda, M.; Trân, Thê Bách; Simonsson Juhonewe, N.; Sâm, Lý Ngọc

    2012-01-01

    A new species from the Annamite mountain range of central Vietnam, Hoya thuathienhuensis, is here described and illustrated. Its flowers bear similarity with Hoya lockii, a taxon recently described from the same area with which it shares the reflexed corolla and the thin coriaceous laves. Hoya lockii is an epiphytic shrub, whereas H. thuathienhuensis is a strong climbing liana. We also report the noteworthy extension into southern Vietnam of Hoya graveolens, a taxon previously considered to b...

  16. Ferrous Ion Chelating, Superoxide Anion Radical Scavenging and Tyrosinase Inhibitory Properties of Pure and Commercial Essential Oils of Anetrhum Graveolens

    Directory of Open Access Journals (Sweden)

    Sh Darvish Alipour Astaneh

    2013-04-01

    Full Text Available Introduction: Despite slight toxicities of essential oils, they are not under strict control in many countries. Anethum graveolens is widely consumed and its essential oils are at public reach. This study was designed to study essential oils of Anethum graveolens. Methods: The biological properties of pure and commercial essential oils of Anethum graveolens were investigated. In fact, Ferrous ion chelating activity, superoxide anion radical scavenging property, tyrosinase inhibition and total flavonoids of the oils were determined. Results: Chelating activity of 7.8 µg of EDTA was equivalent to 2 µg of the pure oil. The oils had superoxide anion radical scavenging activities which may be related to their total phenol and flavonoid contents. IC50 of ferrous ion chelating, antityrosiase and superoxide anion radical scavenging activities of pure and commercial oils were 1.3, 1.4, 1 and (171.6, 589, 132 µg respectively. Antityrosiase activity of 6.4 µg pure oil was equal to 1000 µg of the commercial oil. Conclusion: Anethum possesses antioxidative and free radical scavenging properties. This oil chelates ferrous ions and superoxide radicals. It is effective in formation of reactive toxic products. Anethum has good potentials regarding its applications in food and drug industries.

  17. Maturação e morfometria dos frutos de miconia Albicans (Swartz triana (melastomataceae em um remanescente de floresta estacional semidecídua montana em Lavras, MG Maturation and morphometrics of the fruits of Miconia albicans (Swartz triana (melastomataceae in a remnant of montane seasonal semideciduous forest in Lavras, MG

    Directory of Open Access Journals (Sweden)

    Fábio de Almeida Vieira

    2009-12-01

    Full Text Available Os objetivos deste trabalho foram analisar a dinâmica da maturação dos frutos e avaliar quantitativamente algumas características físicas dos frutos de Miconia albicans (Swartz Triana em um remanescente de Floresta Estacional Semidecídua Montana. A atividade, intensidade e sincronia de 20 indivíduos foram analisadas em relação aos eventos de frutificação, correlacionando-os com as variáveis climáticas. Analisou-se a morfometria (comprimento, largura e massa de 130 frutos de 10 indivíduos. A intensidade da fenofase de frutos maduros nas plantas correlacionou-se significativamente com a precipitação média do período (rS = 0,611; P The aim of this study was to examine the dynamics of fruit maturation and quantitatively assess some physical characteristics of the fruits of Miconia albicans (Swartz Triana in a remnant of Montane Seasonal Semideciduous Forest. The activity and synchrony of 20 individuals were analyzed in regard to the proportion of fruiting events, and to help to determine their correlation to abiotic factors. Morphometric traits (fruit length, diameter and mass of 130 fruits from ten individuals were analyzed. The number of fruits maturing showed a significant correlation with the mean precipitation (rS = 0.611; P < 0.05. M. albicans presented a high number of small seeds per fruit ( = 28.05 ± 1.45 s.d.. The fresh mass of the fruit was approximately equal to the pulp mass (rS = 0.988; P < 0.05. Thepulp contributed with 94% of the total mass, demonstrating the potential importance of this species for frugivores. The results indicate the period of high intrapopulation synchrony of the studied phenophases, which can be a useful guide in the collection of seeds for germoplasm banks and recovery of degraded areas.

  18. The effect of radiation of LED modules on the growth of dill (Anethum graveolens L.

    Directory of Open Access Journals (Sweden)

    Frąszczak Barbara

    2016-04-01

    Full Text Available Light quality is thought to affect the growth and development of plants. We examined how light influences the growth and content of some chemical compounds in dill (Anethum graveolens L.. The plants were grown under different light quality. The share of orange and green light in the spectrum was constant and amounted to 10% for either colour. In the first combination (A, 70/10, there was 70% of red light and 10% of blue light. Other combinations had the following proportions: B 60/20, C 50/30, D 40/40 and E 30/50 of red and blue light. The PPFD was about 155 μmol m-2 s-1. Blue light inhibited the elongation growth as well as leaf area. It had positive influence on the accumulation of dry mass, glucose and fructose in the herb. In the combinations with higher percentage of red light the plants were characterised by higher content of essential oils, macronutrients and zinc. To sum up, we can say that the proportion of red and blue light has significant influence on the morphological qualities, chemical composition and dynamics of photosynthesis in these plants. On the other hand, the selection of spectral composition of LEDs will depend on the result we want to achieve.

  19. Genetic variation for silvicultural traits in open-pollinated progenies of Astronium graveolens Jacq. (Anacardiaceae

    Directory of Open Access Journals (Sweden)

    Daniela Araújo

    2014-03-01

    Full Text Available This study has investigated the genetic variation for silvicultural traits in an open-pollinated progeny test of Astronium graveolens Jacq., established at Luiz Antônio Experimental Station (State of São Paulo, Brazil. The trial was planted in a random block experimental design, containing 23 families, six replications and five plants per plot. The traits measured were diameter at breast height (DBH, total height and stem form. The assessments were taken at the age of 19 years. Significant differences were not detected by the analysis of variance, suggesting that the genetic variation was low, as well as the probability to raising genetic gains through selection among progenies. The coefficient of genetic variation was moderate for the traits height (8.2% and DBH (21.2% and low to stem form (4.0%. However, the average coefficient of heritability among progenies was low for all studied traits (ranging from 0.02 to 0.15, confirming the low probability of genetic improvement of this population by selection among progenies.

  20. Triterpenoid Saponins from Clematis graveolens and Evaluation of their Insecticidal Activities.

    Science.gov (United States)

    Rattan, Rajeev; Reddy, S G Eswara; Dolma, Shudh Kirti; Fozdar, Bharat Inder; Gautam, Veena; Sharma, Ritika; Sharma, Upendra

    2015-09-01

    A new hederagenin based triterpenoid saponin, clematograveolenoside A (1), along with three known saponins, tomentoside A (2), huzhangoside D (3) and clematoside S (4), were isolated from the roots and rhizomes of Clematis graveolens. The structure of new compound was elucidated on the basis of detailed analysis of chemical and spectroscopic data including 1D- and 2D NMR spectra. Compound 2 was found the most effective against aphid (Aphis craccivora) with an LC50 of 1.2 and 0.5 mg/mL after treatment for 72 and 96 h, respectively and was followed by compound 4 (LC50 = 2.3 and 1.9 mg/mL) and 1 (LC50 = 3.2 and 2.6 mg/mL). In case of termite (Coptotermis homii), compound 1 was found more toxic with an LC50 of 0.1 mg/L after 24 h of treatment followed by compound 2, 3 and 4 (LC50 = 0.1, 0.2 and 0.2 mg/mL, respectively). PMID:26594749

  1. Biogenic synthesis of zinc oxide nanoparticles using Ruta graveolens (L.) and their antibacterial and antioxidant activities

    Science.gov (United States)

    Lingaraju, K.; Raja Naika, H.; Manjunath, K.; Basavaraj, R. B.; Nagabhushana, H.; Nagaraju, G.; Suresh, D.

    2015-08-01

    In the present investigation, green synthesis of zinc oxide nanoparticles were successfully synthesized by biological method using aqueous stem extract of Ruta graveolens act as reducing agent. Formation of ZnO nanoparticles were characterized by powder X-ray diffraction (PXRD), UV-visible spectroscopy, scanning electron microscopy (SEM) and transmission electron microscopy (TEM) techniques. Zinc oxide nanoparticles were subjected to biological properties such as antibacterial and antioxidant studies. The PXRD pattern reveals that ZnO sample belongs to hexagonal phase with Wurtzite structure. The UV-vis absorption spectrum shows an absorption band at 355 nm due to ZnO nanoparticles. SEM images show that the particles have spherical like structure with large surface area and the average crystallite sizes were found to be in the range ~28 nm. These observations were confirmed by TEM analysis. The ZnO nanoparticles are found to inhibit the antioxidant activity of 1,1-diphenyl-2-picrylhydrazyl free radicals effectively. ZnO Nps exhibit significant bactericidal activity against Gram -ve bacterial strains such as Klebsiella aerogenes, Pseudomonas aeruginosa, Escherichia coli and Gram +ve Staphylococcus aureus by agar well diffusion method.

  2. IMPROVED PLANT REGENERATION AND IN VITRO SOMATIC EMBRYOGENESIS IN Ruta graveolens

    Directory of Open Access Journals (Sweden)

    Zuraida AR

    2014-07-01

    Full Text Available In vitro callus cultures initiated from stem segments of Ruta graveolen which later on differentiated into somatic embryoids and subsequently regenerated whole plants. Callus formation was observed in culture medium containing low concentrations of the plant growth regulators, 2,4-dichlorophenoxyacetic acid (2,4-D and/or α-naphthalene acetic acid (NAA. At 0.2 mg/L NAA was showing the highest rate (85% of callus induction. The callus appeared watery, but showed no sign of browning after a month of culture. Sub-culturing the callus on to medium with 0.2 mg/L 2,4-D showed enhanced the callus proliferation rate up to 95%. Somatic embryogenesis from callus was most successful on MS medium containing either 6 g/L agar and supplemented with 0.5 mg/L benzylaminopurine (BAP, or with 9 g/L agar, supplemented with 0.5 mg/L kinetin (KIN. The former medium was more successful in plantlet regeneration when the embryoids were subsequently transferred to regeneration medium with 3 g/L agar and 0.5 mg/L BAP.

  3. Biogenic synthesis of zinc oxide nanoparticles using Ruta graveolens (L.) and their antibacterial and antioxidant activities

    Science.gov (United States)

    Lingaraju, K.; Raja Naika, H.; Manjunath, K.; Basavaraj, R. B.; Nagabhushana, H.; Nagaraju, G.; Suresh, D.

    2016-06-01

    In the present investigation, green synthesis of zinc oxide nanoparticles were successfully synthesized by biological method using aqueous stem extract of Ruta graveolens act as reducing agent. Formation of ZnO nanoparticles were characterized by powder X-ray diffraction (PXRD), UV-visible spectroscopy, scanning electron microscopy (SEM) and transmission electron microscopy (TEM) techniques. Zinc oxide nanoparticles were subjected to biological properties such as antibacterial and antioxidant studies. The PXRD pattern reveals that ZnO sample belongs to hexagonal phase with Wurtzite structure. The UV-vis absorption spectrum shows an absorption band at 355 nm due to ZnO nanoparticles. SEM images show that the particles have spherical like structure with large surface area and the average crystallite sizes were found to be in the range ~28 nm. These observations were confirmed by TEM analysis. The ZnO nanoparticles are found to inhibit the antioxidant activity of 1,1-diphenyl-2-picrylhydrazyl free radicals effectively. ZnO Nps exhibit significant bactericidal activity against Gram -ve bacterial strains such as Klebsiella aerogenes, Pseudomonas aeruginosa, Escherichia coli and Gram +ve Staphylococcus aureus by agar well diffusion method.

  4. The toxicological effect of Ruta graveolens extract in Siamese fighting fish: a behavioral and histopathological approach.

    Science.gov (United States)

    Forsatkar, Mohammad Navid; Nematollahi, Mohammad Ali; Brown, Culum

    2016-05-01

    The effects of pharmacological waste on aquatic ecosystems are increasingly highlighted in ecotoxicology research. Many of these products are designed for human physiology but owing to the conservative nature of vertebrate evolution they also tend to have effects on aquatic organisms and fishes in particular when they find their way into aquatic systems via wastewater effluent. One area of research has focused on reproductive control and the associated hormone treatments. Many of these hormones affect the reproductive physiology of fishes and may cause feminization of male reproductive traits. Alternative medicines have also been widely used particularly in traditional cultures but few of these alternative treatments have been assessed with respect to their potential impact on aquatic ecosystems. Rue (Ruta graveolens) has been used as a male contraceptive in traditional medicines but its effects on fish behavior and reproductive anatomy have yet to be established. Here we show that treating Siamese fighting fish, Betta splendens, with extract of rue has a significant effect on key aggressive/reproductive behaviors and the propensity to explore novel objects (boldness). In all cases the respective behaviors were reduced relative to controls and sham injected fish. Histological analysis of the testes revealed that rue exposure reduced the number of spermatozoa but increased the number of spermatocytes relative to controls. PMID:26924199

  5. Caracterização morfológica da semente e da plântula de bacurizinho (Rheedia acuminata (Ruiz et Pav. Plachon et Triana - Clusiaceae

    Directory of Open Access Journals (Sweden)

    NASCIMENTO WALNICE MARIA OLIVEIRA DO

    2002-01-01

    Full Text Available O bacurizinho é uma espécie frutífera do gênero Rheedia, nativa da Amazônia, e raramente cultivada, pois seus frutos, embora comestíveis, apresentam polpa escassa. Os estudos com o bacurizinho visam a sua utilização como porta-enxerto, redutor de porte para outras espécies do gênero Rheedia e Garcinia que apresentam altura elevada, como o bacuripari (Rheedia macrophylla Planchon et Triana- Clusiaceae e o mangostão (Garcinia mangostana L.. Este trabalho teve como objetivo caracterizar, morfologicamente, a semente e a plântula dessa espécie. A semente é exalbuminosa, bitegumentada, com a testa de coloração marrom, apresentando vários feixes vasculares bem visíveis, distinguindo-se por sua coloração um pouco mais clara. O hilo é arredondado, de coloração escura, com pequena região mais clara ao centro, correspondendo no ponto de entrada de feixe vascular. A micrópila situa-se próxima ao hilo, sobre uma pequena protuberância triangular. O embrião é anômalo, hipocotilar e é representado unicamente por um longo eixo hipocótilo-radícula, sendo os cotilédones diminutos, aparecendo apenas na extremidade superior no lado oposto da micrópila. Durante a germinação, ocorre primeiramente a emergência de delgada raiz primária, no pólo oposto onde será originado o epicótilo. Essa raiz cresce aproximadamente 5-7cm e cessa, fenecendo posteriormente. Por ocasião da emergência do epicótilo, ocorre ao mesmo tempo a formação de uma raiz adventícia, na base do epicótilo, bem mais robusta que a anterior e que se constituirá no sistema radicular da planta. Precedendo a abertura do primeiro par de metáfilos, desenvolvem-se no epicótilo três pares de catafilos opostos e de coloração esverdeada. A germinação é hipógea e a plântula do tipo criptocotiledonar.

  6. Antifungal Activity of the Essential Oils of Two Verbenaceae: Lantana achyranthifolia and Lippia graveolens of Zapotitlán de las Salinas, Puebla (México)

    OpenAIRE

    Tzasna Hernández; Margarita Canales; Ana Maria García; Ángel Duran; Samuel Meráz; Patricia Dávila; J. Guillermo Ávila

    2008-01-01

    Se documenta la actividad antifúngica de los aceites esenciales de Lantana achyranthifolia y Lippia graveolens. Los aceites esenciales de la parte aérea de L. achyranthifolia y L. graveolens fueron obtenidos mediante arrastre de vapor y examinados por GC y GC-MS. La actividad antifúngica fue evaluada frente a cinco cepas de hongos con el método de difusión en agar. La concentración inhibitoria media (IC50) se determinó mediante el método de inhibición del crecimiento radial. Los acei...

  7. Actividad antioxidante de flavonoides del tallo de orégano mexicano (Lippia graveolens HBK var. berlandieri Schauer)

    OpenAIRE

    Martha Celina González Güereca; Marcos Soto Hernández; Geoffrey Kite; Mariano Martínez Vázquez

    2007-01-01

    México es el principal exportador a nivel mundial de orégano mexicano (Lippia graveolens), con 35 – 40 % del mercado internacional; su alta demanda se debe al contenido de aceite esencial de calidad en la hoja. Su recolección es complementaria a la agricultura de temporal o secano en zonas áridas y semiáridas. El desaprovechamiento del tallo y los escasos estudios fitoquímicos y farmacológicos reportados, indujeron esta investigación en la que determinó el tipo de flavonoides y se evaluó la...

  8. [The production of furocumarin in Apium graveolens L. and Pastinaca sativa L. after infection with Sclerotinia slcerotiorum].

    Science.gov (United States)

    Uecker, S; Jira, T; Beyrich, T

    1991-08-01

    Roots of celery (Apium graveolens) and parsnip (Pastinaca sativa) were inoculated with Sclerotinia sclerotiorum. At the beginning of the infection it is recognized that the level of furocoumarins rises but decreasing in the further time. Trimethylpsoralene was detected neither dc nor hplc. Sclerotinia grows poorly in parsnip. In this the high level of furocoumarins prevents the growth of the fungus because the furocoumarins are fungistatic. Obvious Sclerotinia is able to stimulate the origin of furocumarins in genetic predestinated plants first at time which can explained as reaction against the infection. The infection cannot avail to arise the technical useful yield. PMID:1798717

  9. Antiviral activity of the Lippia graveolens (Mexican oregano) essential oil and its main compound carvacrol against human and animal viruses

    OpenAIRE

    Pilau, Marciele Ribas; Alves, Sydney Hartz; Weiblen, Rudi; Arenhart, Sandra; Cueto, Ana Paula; Lovato, Luciane Teresinha

    2011-01-01

    Mexican oregano (Lippia graveolens) is a plant found in Mexico and Central America that is traditionally used as a medicinal herb. In the present study, we investigated the antiviral activity of the essential oil of Mexican oregano and its major component, carvacrol, against different human and animal viruses. The MTT test (3–4,5-dimethythiazol-2yl)-2,5-diphenyl tetrazolium bromide) was conducted to determine the selectivity index (SI) of the essential oil, which was equal to 13.1, 7.4, 10.8,...

  10. Antiviral activity of the Lippia graveolens (Mexican oregano) essential oil and its main compound carvacrol against human and animal viruses

    OpenAIRE

    Marciele Ribas Pilau; Sydney Hartz Alves; Rudi Weiblen; Sandra Arenhart; Ana Paula Cueto; Luciane Teresinha Lovato

    2011-01-01

    Mexican oregano (Lippia graveolens) is a plant found in Mexico and Central America that is traditionally used as a medicinal herb. In the present study, we investigated the antiviral activity of the essential oil of Mexican oregano and its major component, carvacrol, against different human and animal viruses. The MTT test (3-4,5-dimethythiazol-2yl)-2,5-diphenyl tetrazolium bromide) was conducted to determine the selectivity index (SI) of the essential oil, which was equal to 13.1, 7.4, 10.8,...

  11. The selective cytotoxicity elicited by phytochemical extract from Senecio graveolens (Asteraceae) on breast cancer cells is enhanced by hypoxia.

    Science.gov (United States)

    Echiburú-Chau, Carlos; Alfaro-Lira, Susana; Brown, Nelson; Salas, Cristian O; Cuellar, Mauricio; Santander, Javier; Ogalde, Juan Pablo; Rothhammer, Francisco

    2014-04-01

    Breast cancer is the second cause of cancer‑related deaths in woman and the incidence of the disease has increased worldwide, in part due to improvements in early detection. Several drugs with anticancer effects have been extracted from plants in the last 20 years, many of which are particularly effective against breast cancer cells. In particular, we have become interested in the ethanolic extract from Senecio graveolens (synonym of S. nutans), a plant commonly called Chachacoma, in an effort to isolate compounds that could demonstrate cytotoxic effects on breast cancer cells. Senecio (Asteraceae) is the largest gender in Chile comprising approximatly 200 species. These herbs inhabit areas over 3,500 meters above the sea level in the Andes Mountains. S. graveolens is commonly used by local communities for its medicinal properties, particularly its capacity to ameliorate high-altitude-associated sickness. The cytotoxic effect of the alcoholic extract from S. graveolens, as well as its most abundant compound 4-hydroxy-3-(3-methyl-2-butenyl)acetophenone, were tested in the breast cancer cell lines ZR-75-1, MCF-7 and MDA-MB‑231, and non-tumorigenic MCF-10F cells. We show that the phytochemical extract was able to induce cytotoxicity in cancer cells but not in MCF-10F. Importantly, this effect was enhanced under hypoxic conditions. However, 4-hydroxy-3-(3-methyl-2-butenyl)acetophenone, the main compound, did not by itself show an effective anticarcinogenic activity in comparison to the whole extract. Interestingly, the cytotoxic effect of the phytochemical extract was dependent on the basal MnSOD protein expression. Thus, cytotoxicity was increased when MnSOD levels were low, but resistance was evident when protein levels were high. Additionally, the crude extract seems to trigger cell death by a variety of processes, including autophagy, apoptosis and necrosis, in MCF-7 cells. In summary, S. graveolens extract possess anticancer activity displaying a specific

  12. Antibacterial and phytochemical screening of Anethum graveolens, Foeniculum vulgare and Trachyspermum ammi

    Directory of Open Access Journals (Sweden)

    Arora Daljit S

    2009-08-01

    Full Text Available Abstract Background Anethum graveolens Linn., Foeniculum vulgare Mill. and Trachyspermum ammi L. are widely used traditional medicinal plants to treat various ailments. To provide a scientific basis to traditional uses of these plants, their aqueous and organic seed extracts, as well as isolated phytoconstituents were evaluated for their antibacterial potential. Methods Antibacterial activity of aqueous and organic seed extracts was assessed using agar diffusion assay, minimum inhibitory concentration and viable cell count studies; and their antibacterial effect was compared with some standard antibiotics. The presence of major phytoconstituents was detected qualitatively and quantitatively. The isolated phytoconstituents were subjected to disc diffusion assay to ascertain their antibacterial effect. Results Hot water and acetone seed extracts showed considerably good antibacterial activity against all the bacteria except Klebsiella pneumoniae and one strain of Pseudomonas aeruginosa. Minimum inhibitory concentration for aqueous and acetone seed extracts ranged from 20–80 mg/ml and 5–15 mg/ml respectively. Viable cell count studies revealed the bactericidal nature of the seed extracts. Statistical analysis proved the better/equal efficacy of some of these seed extracts as compared to standard antibiotics. Phytochemical analysis showed the presence of 2.80 – 4.23% alkaloids, 8.58 – 15.06% flavonoids, 19.71 – 27.77% tannins, 0.55–0.70% saponins and cardiac glycosides. Conclusion Antibacterial efficacy shown by these plants provides a scientific basis and thus, validates their traditional uses as homemade remedies. Isolation and purification of different phytochemicals may further yield significant antibacterial agents.

  13. Interference of quorum sensing in urinary pathogen Serratia marcescens by Anethum graveolens.

    Science.gov (United States)

    Salini, Ramesh; Pandian, Shunmugiah Karutha

    2015-08-01

    Serratia marcescens is an opportunistic turned obligate pathogen frequently associated with urinary tract infections (UTI) and are multidrug resistant at most instances. Quorum sensing (QS) system, a population-dependent global regulatory system, controls the pathogenesis machinery of S. marcescens as it does in other pathogens. In the present study, methanol extract of a common herb and spice, Anethum graveolens (AGME) was assessed for its anti-QS potential against the clinical isolate of S. marcescens. AGME notably reduced the biofilm formation and QS-dependent virulence factors production in a concentration-dependent manner (64-1024 μg mL(-1)). The light and confocal microscopic images clearly evidenced the antibiofilm activity of AGME (256 μg mL(-1)) at its minimal biofilm inhibitory concentration. Besides, in support of biochemical assays, the expression analysis of QS-regulated genes fimC, bsmA and flhD which are crucial for initial adhesion and motility confirmed their downregulation upon exposure to AGME. LC-MS analysis of AGME revealed 3-O-methyl ellagic acid (3-O-ME) as one of its active principles having nearly similar antibiofilm activity and a reduced inhibition of prodigiosin (27%) and protease (15%) compared to AGME [prodigiosin (47%) and protease (50%)]. UFLC analysis revealed that 0.355 mg g(-1) of 3-O-ME was present in the AGME. AGME and the 3-O-ME significantly interfered the QS system of a QS model strain S. marcescens MG1 and its mutant S. marcescens MG44 which in turn corroborates the anti-QS mechanism of AGME. PMID:26013821

  14. Antibacterial Activity and Composition of Essential Oils from Pelargonium Graveolens L’Her and Vitex Agnus-Castus L

    Directory of Open Access Journals (Sweden)

    Alireza Ghannadi

    2012-12-01

    Full Text Available Background and Objectives: Essential oils are volatile compounds that have been used since Middle Ages as antimicrobial, anti-inflammatory, sedative, local anesthetic and food flavoring agents. In the current study, essential oils of Pelargonium graveolens L’Her and Vitex agnus-castus L. were analyzed for their antibacterial activities.Materials and Methods: The chemical compositions of essential oils were characterized by GC-MS. Disc diffusion method was used to study antimicrobial activity.Results and Conclusion: Inhibition zones showed that the essential oils of the two plants were active against all of the studied bacteria (except Listeria monocytogenes. The susceptibility of the strains changed with the dilution of essential oils in DMSO. The pure essential oils showed the most extensive inhibition zones and they were very effective antimicrobial compounds compared to chloramphenicol and amoxicillin. The most susceptible strain against these two essential oils was Staphylococcus aureus. It seems that β-citronellol is a prominent part of P. graveolens volatile oil and caryophyllene oxide is a famous and important part of V. agnus-castus volatile oil and their probable synergistic effect with other constituents are responsible for the antibacterial effects of these oils. However further studies must be performed to confirm the safety of these oils for use as antimicrobial agents and natural preservatives in different products.

  15. Effects of Apium graveolens Extract on the Oxidative Stress in the Liver of Adjuvant-Induced Arthritic Rats.

    Science.gov (United States)

    Sukketsiri, Wanida; Chonpathompikunlert, Pennapa; Tanasawet, Supita; Choosri, Nutjanat; Wongtawatchai, Tulaporn

    2016-06-01

    Apium graveolens Linn. (Apiaceae) is an indigenous plant of the North and South Americas, Southern Europe, and Asia and has been widely used as a food or a traditional medicine for treatment of inflammation and arthritis. The purpose of this study was to investigate the antioxidant effects of a methanolic extract of A. graveolens (AGE) against liver oxidative stress in an adjuvant-induced arthritic rat model. The AGE (250, 500, and 1,000 mg/kg) was given orally for 24 consecutive days after induction by injecting complete Freund's adjuvant. Liver and spleen weights were recorded. The superoxide anion level, total peroxide (TP), glutathione peroxidase (GPx) activity, superoxide dismutase (SOD) activity, total antioxidant status, and oxidative stress index (OSI) were also measured. AGE treatment significantly decreased the levels of the superoxide anion, TP, and OSI whereas the GPx and SOD activities significantly increased in the liver of the arthritic rats. These results indicated that AGE showed an ameliorative effect against liver oxidative stress in adjuvant-induced arthritic rats by reducing the generation of liver free radicals and increasing the liver antioxidant enzyme activity. PMID:27390722

  16. Effects of Apium graveolens Extract on the Oxidative Stress in the Liver of Adjuvant-Induced Arthritic Rats

    Science.gov (United States)

    Sukketsiri, Wanida; Chonpathompikunlert, Pennapa; Tanasawet, Supita; Choosri, Nutjanat; Wongtawatchai, Tulaporn

    2016-01-01

    Apium graveolens Linn. (Apiaceae) is an indigenous plant of the North and South Americas, Southern Europe, and Asia and has been widely used as a food or a traditional medicine for treatment of inflammation and arthritis. The purpose of this study was to investigate the antioxidant effects of a methanolic extract of A. graveolens (AGE) against liver oxidative stress in an adjuvant-induced arthritic rat model. The AGE (250, 500, and 1,000 mg/kg) was given orally for 24 consecutive days after induction by injecting complete Freund’s adjuvant. Liver and spleen weights were recorded. The superoxide anion level, total peroxide (TP), glutathione peroxidase (GPx) activity, superoxide dismutase (SOD) activity, total antioxidant status, and oxidative stress index (OSI) were also measured. AGE treatment significantly decreased the levels of the superoxide anion, TP, and OSI whereas the GPx and SOD activities significantly increased in the liver of the arthritic rats. These results indicated that AGE showed an ameliorative effect against liver oxidative stress in adjuvant-induced arthritic rats by reducing the generation of liver free radicals and increasing the liver antioxidant enzyme activity. PMID:27390722

  17. First report of a 16SrI-C phytoplasma infecting celery (|Apium graveolens) with stunting, bushy top and phyllody in the Czech Republic

    Czech Academy of Sciences Publication Activity Database

    Fránová, Jana; Špak, Josef

    2013-01-01

    Roč. 161, č. 9 (2013), s. 666-670. ISSN 0931-1785 R&D Projects: GA MŠk LD12074 Institutional support: RVO:60077344 Keywords : Apium graveolens * PCR/RFLP * sequencing Subject RIV: EE - Microbiology, Virology Impact factor: 0.921, year: 2013

  18. Phytochemicals from Ruta graveolens Activate TAS2R Bitter Taste Receptors and TRP Channels Involved in Gustation and Nociception.

    Science.gov (United States)

    Mancuso, Giuseppe; Borgonovo, Gigliola; Scaglioni, Leonardo; Bassoli, Angela

    2015-01-01

    Ruta graveolens (rue) is a spontaneous plant in the Mediterranean area with a strong aroma and a very intense bitter taste, used in gastronomy and in folk medicine. From the leaves, stems and fruits of rue, we isolated rutin, rutamarin, three furanocoumarins, two quinolinic alkaloids, a dicoumarin and two long chain ketones. Bitter taste and chemesthetic properties have been evaluated by in vitro assays with twenty receptors of the TAS2R family and four TRP ion channels involved in gustation and nociception. Among the alkaloids, skimmianine was active as a specific agonist of T2R14, whereas kokusaginin did not activate any of the tested receptors. The furanocoumarins activates TAS2R10, 14, and 49 with different degrees of selectivity, as well as the TRPA1 somatosensory ion channel. Rutamarin is an agonist of TRPM5 and TRPV1 and a strong antagonist of TRPM8 ion channels. PMID:26501253

  19. Phytochemicals from Ruta graveolens Activate TAS2R Bitter Taste Receptors and TRP Channels Involved in Gustation and Nociception

    Directory of Open Access Journals (Sweden)

    Giuseppe Mancuso

    2015-10-01

    Full Text Available Ruta graveolens (rue is a spontaneous plant in the Mediterranean area with a strong aroma and a very intense bitter taste, used in gastronomy and in folk medicine. From the leaves, stems and fruits of rue, we isolated rutin, rutamarin, three furanocoumarins, two quinolinic alkaloids, a dicoumarin and two long chain ketones. Bitter taste and chemesthetic properties have been evaluated by in vitro assays with twenty receptors of the TAS2R family and four TRP ion channels involved in gustation and nociception. Among the alkaloids, skimmianine was active as a specific agonist of T2R14, whereas kokusaginin did not activate any of the tested receptors. The furanocoumarins activates TAS2R10, 14, and 49 with different degrees of selectivity, as well as the TRPA1 somatosensory ion channel. Rutamarin is an agonist of TRPM5 and TRPV1 and a strong antagonist of TRPM8 ion channels.

  20. The effects of chrysin and pinostrobin, two flavonoids isolated from Teloxys graveolens leaves, on isolated guinea-pig ileum.

    Science.gov (United States)

    Meckes, M; Paz, D; Acosta, J; Mata, R

    1998-12-01

    The pharmacological effects of pinostrobin and chrysin obtained from the aerial parts of Teloxys graveolens (Chenopodiaceae) were evaluated using isolated in vitro guinea-pig ileal smooth muscle. Both flavonoids inhibited the contractions evoked by high concentrations of potassium. The potency of the relaxant effect was determined by measuring the capacity of each product in reducing the phasic and the slower sustained tonic contractile responses induced by depolarization with 60 mM K(+). Concentrations up to 5 × 10(-7) M of pinostrobin and 1 × 10(-7) M of chrysin induced a non-competitive depression of responses to Ca(2+) in ileum preparations bathed in a Ca(2+)-free, high K(+) medium. Both compounds produced a rightward displacement of the concentration-response curves to Ca(2+) with a concentration-dependant increase of EC(50) and a decrease of the maximal response. Examination of the inhibitory effect produced by these flavonoids on the phasic component of contractile response evoked with K(+) and on the contraction induced with caffeine, led to propose a different intracellular mechanism of action used by these compounds. The results obtained led us to conclude that the previously detected relaxant effect of Teloxys graveolens crude extract is due in part, to the presence of chrysin and pinostrobin, which inhibit intestinal smooth muscle contractions by means of a calcium-mediated mechanism. Since the modulation of calcium fluxes in the mucosal epithelium may play a role in antidiarrheal drug action, the observed effects in vitro could in the same way explain the popular use of the plant for the treatment of diarrhea. PMID:23196029

  1. Lippia graveolens and Carya illinoensis Organic Extracts and there in vitro Effect Against Rhizoctonia Solani Kuhn

    OpenAIRE

    Francisco D. Hernandez-Castillo; Francisco Castillo-Reyes; Gabriel Gallegos-Morales; Raul Rodriguez-Herrera; AGUILAR-GONZALEZ, CRISTOBAL N.

    2010-01-01

    Problem statement: Plant extracts with polyphenolic compounds obtained with different solvents have been evaluated against plant pathogens. However, most of these extract have been obtained using solvents no allowed under an organic production context. Approach: In the present research was to evaluate the inhibitory effect of polyphenolic extracts from L. graveolens and C. illinoensis, obtained with alternative organic solvents (lanolin and cocoa butter), water and ethanol against R. solani i...

  2. Antibacterial and phytochemical screening of Anethum graveolens, Foeniculum vulgare and Trachyspermum ammi

    OpenAIRE

    Arora Daljit S; Kaur Gurinder J

    2009-01-01

    Abstract Background Anethum graveolens Linn., Foeniculum vulgare Mill. and Trachyspermum ammi L. are widely used traditional medicinal plants to treat various ailments. To provide a scientific basis to traditional uses of these plants, their aqueous and organic seed extracts, as well as isolated phytoconstituents were evaluated for their antibacterial potential. Methods Antibacterial activity of aqueous and organic seed extracts was assessed using agar diffusion assay, minimum inhibitory conc...

  3. UJI IRITASI DAN AKTIVITAS PERTUMBUHAN RAMBUT TIKUS PUTIH: EFEK SEDIAAN GEL APIGENIN DAN PERASAN HERBA SELEDRI (Apium graveolens L.

    Directory of Open Access Journals (Sweden)

    Emma Sri Kuncari

    2015-05-01

    Full Text Available AbstrakPerasan seledri (Apium graveolens L. biasa dipergunakan untuk memacu pertumbuhan rambut. Salah satu senyawa utama yang terkandung di dalam seledri adalah apigenin. Penelitian ini membahas tentang pengaruh pemakaian gel yang mengandung apigenin dan perasan herba seledri sebagai penumbuh rambut, meliputi uji iritasi dan aktivitas pertumbuhan rambut pada tikus putih jantan galur Spraque-Dawley. Uji iritasi menggunakan metode Kamkaen dan Rao, sedangkan uji aktivitas penumbuh rambut menggunakan metode Hattori-Ogawa dan Suzuki-Hamada. Berdasarkan indeks iritasi primer, semua formulasi gel tidak potensial menyebabkan iritasi pada kulit tikus putih (p>0,05. Gel yang mengandung apigenin dan perasan herba seledri menunjukkan aktivitas lebih baik dalam memacu pertumbuhan rambut (p<0,05 dibandingkan kontrol tanpa perlakuan. Apigenin menunjukkan aktivitas lebih baik (p<0,05 dalam meningkatkan ketebalan rambut dibandingkan kontrol tanpa perlakuan.Namun perlakuan perasan herba seledri tidak nyata (p>0,05 meningkatkan ketebalan rambut. Dapat disimpulkan bahwa gel yang mengandung apigenin dan perasan herba seledri dapat meningkatkan pertumbuhan rambut pada tikus putih dibandingkan kontrol tanpa perlakuan.Kata kunci : seledri, apigenin, gel, iritasi kulit, penumbuh rambutAbstractCelery (Apium graveolens L. juice is widely used for promoting hair growth. One of the main compounds in celery is apigenin. This research discusses about the effect of gel containing apigenin and celery juice application as hair growth in term of skin irritation and its hair growth activity on Spraque-Dawley male mice. The irritation test was Kamkaen and Rao methods, while hair growth activity was HattoriOgawa and Suzuki-Hamada methods. Based on primary index irritation, all of the gel formulations did not signifiantly potential in resulting skin irritation on the mice (p>0,05. Gel containing apigenin andcelery juice showed better activity in promoting hair growth (p<0,05 than

  4. In Vitro and In Vivo Activities of Essential Oil from the Seed of Anethum graveolens L. against Candida spp.

    Directory of Open Access Journals (Sweden)

    Hong Zeng

    2011-01-01

    Full Text Available The essential oil produced from the seed of Anethum graveolens L. (Umbelliferae was tested in vitro and in vivo anti-Candida activity. The microbroth dilution method was used in the minimal inhibitory concentration (MIC, according to M27-A3 of the guidelines of the Clinical and Laboratory Standard Institute (CLSI. And then, efficacy evaluation of essential oil in the prophylaxis and treatment of experimental vaginal candidiasis was performed in immunosuppressed mice. The anti-Candida activity was analyzed by microbiological and histological techniques and was compared with that of fluconazole (FCZ. The results showed essential oil was active in vitro against all tested strains, with MICs ranging from 0.312 μL/mL (for C. tropicalis, C. parapsilosis, and C. krusei to 0.625 μL/mL (for 6 isolated C. albicans strains. Essential oil (2% v/v was highly efficacious in accelerating C. albicans 09-1555 clearance from experimentally infected mice vagina by prophylaxis and therapeutic treatments. In both therapeutic efficacy and prophylaxis studies, the histological findings confirmed the microbiological results. The experimental results revealed that the tested essential oil is effective against vulvovaginal candidiasis in immunosuppressed mice.

  5. Relation between growth stages and synthesis of flavonoids and essential oils affected by irradiation in Ruta graveolens seeds

    International Nuclear Information System (INIS)

    Ruta graveolens plants are radio-adaptive up to 8 Krad gamma radiation. Flavonoids and essential oils were remarkably increased as function of irradiation doses from 2 up to 8 Krad. Doses of 4 and 8 Krad were the most effective ones. Concerning flavonoids, 4 and 8 Krad treatments exerted the following percent increase over control plants: 76, 77% (leaves), 137, 100% (stems), 153, 80% (flowers) and 77, 61% (fruits). The distribution pattern of flavonoids was in the following order: Leaves > flowers > fruits > stems. Treated plants with 4 or 8 Krad resulted in an increase in essential oil yield by 65-67% over control plants. Chemical constitution of oil: ketones and esters did not seem to be affected by seed irradiation (0-8 Krad). Similarly, physical properties ''refractive index, solubility and specific gravity'' did not materially affect. However, chemical properties ''acid value, ester value and saponification value'' were increased by 24% over control treatment as a function of 4 Krad. Yet higher doses had the capacity of increasing the acid value but not of both ester or saponification value

  6. Ozone stomatal flux and O3 concentration-based metrics for Astronium graveolens Jacq., a Brazilian native forest tree species.

    Science.gov (United States)

    Cassimiro, Jéssica C; Moura, Bárbara B; Alonso, Rocio; Meirelles, Sérgio T; Moraes, Regina M

    2016-06-01

    The current levels of surface ozone (O3) are high enough to negatively affect trees in large regions of São Paulo State, southeastern Brazil, where standards for the protection of vegetation against the adverse effects of O3 do not exist. We evaluated three O3 metrics - phytotoxic ozone dose (POD), accumulated ozone exposure over the threshold of 40 ppb h (AOT40), and the sum of all hourly average concentrations (SUM00) - for the Brazilian native tropical tree species Astronium graveolens Jacq. We used the DO3SE (Deposition of Ozone for Stomatal Exchange) model and calculated PODY for different thresholds (from 0 to 6 mmol O3 m(-2) PLA s(-1)), evaluating the model's performance through the relationship between measured and modelled conductance. The response parameters were: visible foliar injury, considered as incidence (% injured plants), severity (% injured leaves in relation to the number of leaves on injured plants), and leaf abscission. The model performance was suitable and significant (R(2) = 0.58; p < 0.001). POD0 was better correlated to incidence and leaf abscission, and SUM00 was better correlated to severity. The highest values of O3 concentration-based metrics (AOT40 and SUM00) did not coincide with those of POD0. Further investigation may improve the model and contribute to the proposition of a national standard for the protection of native species. PMID:26805742

  7. Antiviral activity of the Lippia graveolens (Mexican oregano) essential oil and its main compound carvacrol against human and animal viruses.

    Science.gov (United States)

    Pilau, Marciele Ribas; Alves, Sydney Hartz; Weiblen, Rudi; Arenhart, Sandra; Cueto, Ana Paula; Lovato, Luciane Teresinha

    2011-10-01

    Mexican oregano (Lippia graveolens) is a plant found in Mexico and Central America that is traditionally used as a medicinal herb. In the present study, we investigated the antiviral activity of the essential oil of Mexican oregano and its major component, carvacrol, against different human and animal viruses. The MTT test (3-4,5-dimethythiazol-2yl)-2,5-diphenyl tetrazolium bromide) was conducted to determine the selectivity index (SI) of the essential oil, which was equal to 13.1, 7.4, 10.8, 9.7, and 7.2 for acyclovir-resistant herpes simplex virus type 1 (ACVR-HHV-1), acyclovir-sensitive HHV-1, human respiratory syncytial virus (HRSV), bovine herpesvirus type 2 (BoHV-2), and bovine viral diarrhoea virus (BVDV), respectively. The human rotavirus (RV) and BoHV-1 and 5 were not inhibited by the essential oil. Carvacrol alone exhibited high antiviral activity against RV with a SI of 33, but it was less efficient than the oil for the other viruses. Thus, Mexican oregano oil and its main component, carvacrol, are able to inhibit different human and animal viruses in vitro. Specifically, the antiviral effects of Mexican oregano oil on ACVR-HHV-1 and HRSV and of carvacrol on RV justify more detailed studies. PMID:24031796

  8. Antiviral activity of the Lippia graveolens (Mexican oregano essential oil and its main compound carvacrol against human and animal viruses

    Directory of Open Access Journals (Sweden)

    Marciele Ribas Pilau

    2011-12-01

    Full Text Available Mexican oregano (Lippia graveolens is a plant found in Mexico and Central America that is traditionally used as a medicinal herb. In the present study, we investigated the antiviral activity of the essential oil of Mexican oregano and its major component, carvacrol, against different human and animal viruses. The MTT test (3-4,5-dimethythiazol-2yl-2,5-diphenyl tetrazolium bromide was conducted to determine the selectivity index (SI of the essential oil, which was equal to 13.1, 7.4, 10.8, 9.7, and 7.2 for acyclovir-resistant herpes simplex virus type 1 (ACVR-HHV-1, acyclovir-sensitive HHV-1, human respiratory syncytial virus (HRSV, bovine herpesvirus type 2 (BoHV-2, and bovine viral diarrhoea virus (BVDV, respectively. The human rotavirus (RV and BoHV-1 and 5 were not inhibited by the essential oil. Carvacrol alone exhibited high antiviral activity against RV with a SI of 33, but it was less efficient than the oil for the other viruses. Thus, Mexican oregano oil and its main component, carvacrol, are able to inhibit different human and animal viruses in vitro. Specifically, the antiviral effects of Mexican oregano oil on ACVR-HHV-1 and HRSV and of carvacrol on RV justify more detailed studies.

  9. Improvement Seedling Growth Of Celery (Apium graveolens L.) Using Humic Acid, Potassium Silicate And Low Gamma Irradiation Doses

    International Nuclear Information System (INIS)

    The effects of different priming treatments either at room temperature or at 5 degree C in an incubator for 16 hours were studied. An experiment of pots was planted using hydro priming celery ( Apium graveolens L.) seeds for comparison with those primed in different solutions. Seeds were soaked in Petri dishes containing: tap water, different concentrations of potassium silicate (2, 4, 8, 16 mM Si) and humic acid concentrations (5, 20,100, 200 mM ) at room temperature and 5 degree C in an incubator before planting for 16 hours. Also, some dry seeds we re exposed to gamma rays at different low doses (20, 40, 60 Gy) before priming in tap water. This work aimed to improve the tolerance of celery seeds subjected to chilling stress by priming seeds in different concentrations of humic acid and potassium silicate in addition to use low doses of ionizing radiation to accelerate plants proliferation, growth, and leaves yield. Humic acid and potassium silicate were effective as priming solutions for alleviating the chilling stress, stimulating celery growth, and proliferation. In addition, using of low doses of ionizing radiation had a stimulant effect on plants after 120 days from planting

  10. Performance of rose scented geranium (Pelargonium graveolens) in heavy metal polluted soil vis-à-vis phytoaccumulation of metals.

    Science.gov (United States)

    Chand, Sukhmal; Singh, Geetu; Patra, D D

    2016-08-01

    An investigation was carried out to evaluate the effect of heavy metal toxicity on growth, herb, oil yield and quality and metal accumulation in rose scented geranium (Pelargonium graveolens) grown in heavy metal enriched soils. Four heavy metals (Cd, Ni, Cr, and Pb) each at two levels (10 and 20 mg kg-1 soil) were tested on geranium. Results indicated that Cr concentration in soil at 20 mg kg-1 reduced leaves, stem and root yield by 70, 83, and 45%, respectively, over control. Root growth was significantly affected in Cr stressed soil. Nickel, Cr, and Cd concentration and accumulation in plant increased with higher application of these metals. Chromium, nickel and cadmium uptake was observed to be higher in leaves than in stem and roots. Essential oil constituents were generally not significantly affected by heavy metals except Pb at 10 and 20 ppm, which significantly increased the content of citronellol and Ni at 20 ppm increased the content of geraniol. Looking in to the higher accumulation of toxic metals by geranium and the minimal impact of heavy metals on quality of essential oil, geranium can be commercially cultivated in heavy metal polluted soil for production of high value essential oil. PMID:26696243

  11. Anethum graveolens Linn. (dill) extract enhances the mounting frequency and level of testicular tyrosine protein phosphorylation in rats

    Institute of Scientific and Technical Information of China (English)

    Sitthichai IAMSAARD; Thawatchai PRABSATTROO; Wannisa SUKHORUM; Supaporn MUCHIMAPURA; Panee SRISAARD; Nongnut UABUNDIT; Wipawee THUKHAMMEE

    2013-01-01

    Objective:To investigate the effect of Anethum graveolens (AG) extracts on the mounting frequency,histology of testis and epididymis,and sperm physiology.Methods:Male rats induced by cold immobilization before treating with vehicle or AG extracts [50,150,and 450 mg/kg body weight (BW)] via gastric tube for consecutive 1,7,and 14 d were examined for mounting frequency,testicular phosphorylation level by immunoblotting,sperm concentration,sperm acrosome reaction,and histological structures of testis and epididymis,respectively.Results:AG (50 mg/kg BW) significantly increased the mounting frequency on Days 1 and 7 compared to the control group.Additionally,rat testis treated with 50 mg/kg BW AG showed high levels of phosphorylated proteins as compared with the control group.In histological analyses,AG extract did not affect the sperm concentration,acrosome reaction,and histological structures of testis and epididymis.Conclusions:AG extract enhances the aphrodisiac activity and is not harmful to sperm and male reproductive organs.

  12. Anti-Giardia activity of phenolic-rich essential oils: effects of Thymbra capitata, Origanum virens, Thymus zygis subsp. sylvestris, and Lippia graveolens on trophozoites growth, viability, adherence, and ultrastructure.

    Science.gov (United States)

    Machado, Marisa; Dinis, Augusto M; Salgueiro, Ligia; Cavaleiro, Carlos; Custódio, José B A; Sousa, Maria do Céu

    2010-04-01

    The present work evaluates the anti-Giardia activity of phenolic-rich essential oils obtained from Thymbra capitata, Origanum virens, Thymus zygis subsp. sylvestris chemotype thymol, and Lippia graveolens aromatic plants. The effects were evaluated on parasite growth, cell viability adherence, and morphology. The tested essential oils inhibited the growth of Giardia lamblia. T. capitata essential oil is the most active followed by O. virens, T. zygis subsp. sylvestris, and L. graveolens oils. The tested essential oils at IC50 (71-257) microg/ml inhibited parasite adherence (p capitata, O. virens, T. zygis subsp. sylvestris chemotype thymol, and L. graveolens essential oils have antigiardial activity in vitro and seem to have potential for the treatment of the parasitic disease caused by the protozoan G. lamblia. PMID:20217133

  13. Evaluation of Safety and Protective Effect of Combined Extract of Cissampelos pareira and Anethum graveolens (PM52) against Age-Related Cognitive Impairment

    OpenAIRE

    Wipawee Thukham-mee; Jintanaporn Wattanathorn

    2012-01-01

    The present study aimed to determine acute toxicity, the protective effect, and underlying mechanism of PM52, a combined extract of Cissampelos pareira and Anethum graveolens, against age-related cognitive impairment in animal model of age-related cognitive impairment. PM52 was determined as acute toxicity according to OECD guideline. Male Wistar rats, weighing 180–220 g, were orally given PM52 at doses of 2, 10, and 50 mg/kg at a period of 14 days before and 7 days after the bilateral admini...

  14. Estimación de la capacidad germinativa y el vigor de las semillas de diomate (astronium graveolens jacq.) sometidas a diferentes tratamientos y condiciones de almacenamiento.

    OpenAIRE

    Gómez Restrepo, Martha Ligia

    2011-01-01

    Se llevaron a cabo dos estudios con semillas de diomate (Astronium graveolens Jacq). El primero se hizo con el fin de determinar el efecto que sobre la germinación tienen el sustrato y la condición lumínica. El segundo, para evaluar la respuesta germinativa de semillas almacenadas durante varios períodos y bajo diferentes condiciones de temperatura y empaque. Las semillas de diomate sembradas a plena exposición y en las cuales se utilizó tierra como sustrato obtuvieron la mayor potencia germi...

  15. Evaluation of antioxidant activity of Ruta graveolens L. extract on inhibition of lipid peroxidation and DPPH radicals and the effects of some external factors on plant extract's potency.

    Directory of Open Access Journals (Sweden)

    S. Mohammadi- Motamed

    2014-01-01

    Full Text Available The antioxidant properties of Ruta graveolens L. were evaluated by two different methods; free radical scavenging using DPPH and inhibition of lipid peroxidation by the ferric thiocyanate method. The IC50 value of the methanol extract in DPPH inhibition was 200.5 μg/mL which was acceptable in comparison with BHT (41.8 μg/mL. In thiocyanate method, the plant extract demonstrated activity as much as BHT in prevention of lipid peroxidation. Increasing the temperature during extraction, significantly decreased the extract power in inhibition of DPPH radicals. The storage time and temperature had no effect on lipid peroxidation inhibition.

  16. Evaluation of antioxidant activity of Ruta graveolens L. extract on inhibition of lipid peroxidation and DPPH radicals and the effects of some external factors on plant extract's potency.

    OpenAIRE

    S. Mohammadi- Motamed; S. Shahidi-Motlagh; H. Bagherzadeh; S. Azad Forouz; H. Tafazoli

    2014-01-01

    The antioxidant properties of Ruta graveolens L. were evaluated by two different methods; free radical scavenging using DPPH and inhibition of lipid peroxidation by the ferric thiocyanate method. The IC50 value of the methanol extract in DPPH inhibition was 200.5 μg/mL which was acceptable in comparison with BHT (41.8 μg/mL). In thiocyanate method, the plant extract demonstrated activity as much as BHT in prevention of lipid peroxidation. Increasing the temperature during extraction, signific...

  17. The effect of chronic administration of Apium graveolens aqueous extract on learning and memory in normal and diabetic rats

    Directory of Open Access Journals (Sweden)

    Mehdad Roghani

    2009-01-01

    Full Text Available   Abstract   Introduction: Diabetes mellitus accompanies with disturbances in learning, memory, and cognitive skills in the human society and experimental animals. Considering the beneficial antidiabetic potential of Apium graveolens (AG , this research study was conducted to evaluate the effect of chronic i.p. administration of AG on learning and memory in diabetic rats using passive avoidance and Y-maze tests.   Methods: Female Wistar rats were randomly divided into control, AG-treated control, diabetic, and AG-treated diabetic groups. AG treatment continued for 4 weeks. For induction of diabetes, streptozotocin was injected i.p. at a single dose of 60 mg/kg. For evaluation of learning and memory, initial latency (IL and step-through latency (STL were determined at the end of study using passive avoidance test. Meanwhile, alternation behavior percentage was determined using Y maze. Results: There was a significant increase (p<0.05 in IL in diabetic and AG-treated diabetic groups after 4 weeks as compared to control group. In this respect, there was no significant difference between diabetic and AG-treated diabetic groups. On the other hand, STL significantly decreased (p<0.05 in diabetic group and significantly increased (p<0.05 in AG-treated diabetic group as compared to control group at the end of study. In addition, STL did not significantly change in AG-treated control group in comparison with control group. In addition, results of Y-maze test showed that there is no significant difference between diabetic and Ag-treated diabetic groups and between control and Ag-treated control group regarding alternation behavior. Discussion: In summary, chronic oral administration of AG could enhance the consolidation and recall capability of stored information only in diabetic animals and did not affect spatial memory of diabetic animals.  

  18. ESTIMACIÓN DE LA CAPACIDAD GERMINATIVA Y EL VIGOR DE LAS SEMILLAS DE diomate (Astronium graveolens Jacq.) SOMETIDAS A DIFERENTES TRATAMIENTOS Y CONDICIONES DE ALMACENAMIENTO ESTIMATE OF THE GERMINATIVE CAPACITY AND THE VIGOR OF DIOMATE SEEDS (Astronium graveolens Jacq.) SUBJECTED TO DIFFERENT TREATMENTS AND STORAGE CONDITIONS

    OpenAIRE

    Martha Ligia Gómez Restrepo

    2004-01-01

    Se llevaron a cabo dos estudios con semillas de diomate (Astronium graveolens Jacq). El primero se hizo con el fin de determinar el efecto que sobre la germinación tienen el sustrato y la condición lumínica. El segundo, para evaluar la respuesta germinativa de semillas almacenadas durante varios períodos y bajo diferentes condiciones de temperatura y empaque. Las semillas de diomate sembradas a plena exposición y en las cuales se utilizó tierra como sustrato obtuvieron la mayor potencia germi...

  19. Efectos inducidos por Ruta graveolens L., Cnidoscolus chayamansa McVaugh y Citrus aurantium L. sobre los niveles de glucosa, colesterol y triacilglicéridos en un modelo de rata diabética Efeitos induzidos por Ruta graveolens L., Rutaceae, Cnidoscolus chayamansa McVaugh, Euphorbiaceae, e Citrus aurantium L., Rutaceae, nos níveis de glucose, colesterol e triacilglicerídeos num modelo do rato diabético Induced effects by Ruta graveolens L., Rutaceae, Cnidoscolus chayamansa McVaugh, Euphorbiaceae, and Citrus aurantium L., Rutaceae, on glucose, cholesterol and triacylglycerides levels in a diabetic rat model

    Directory of Open Access Journals (Sweden)

    Lauro Figueroa-Valverde

    2009-12-01

    Full Text Available Varias plantas con propiedades hipoglucemicas se han utilizado en medicina popular y sistemas curativos tradicionales en todo el mundo. El propósito de este trabajo fue evaluar los efectos inducidos por Ruta graveolens L., Rutaceae, Cnidoscolus chayamansa McVaugh, Euphorbiaceae, y Citrus aurantium L., Rutaceae, en un modelo de rata diabética, a la que se le cuantificaron los niveles de glucosa cada 24 horas por un mes después de la administración gástrica del extracto de las plantas. Además, el colesterol y los triglicéridos fueron evaluados usando técnicas enzimáticas. Los resultados mostraron que la administración de Cnidoscolus chayamansa a dosis de 0.5 a 1.5 g/kg induce un aumento hipoglucemico ( 200 mg/dL. Otros resultados, mostraron que Citrus aurantium ejerce cambios en la concentración de triacilglicéridos (158-172 mg/dL y colesterol (120-128 mg/dL. Finalmente, la administración de Ruta graveolens a dosis de 0.5 g/kg induce un efecto hipoglucemico (Diversas plantas com propriedades hipoglicêmicas foram usadas na medicina popular e em sistemas tradicionais de curas em torno do mundo. A finalidade deste trabalho foi avaliar os efeitos induzidos por Ruta graveolens L, Rutaceae, Cnidoscolus chayamansa McVaugh, Euphorbiaceae, e Citrus aurantium L., Rutaceae, em modelo do rato diabético onde níveis da glucose foram determinados a cada 24 h em um mês antes da administração gástrica do extrato das plantas. Colesterol e triacilglicerídeos foram avaliados usando técnicas enzimáticas. Os resultados mostraram que a administração de Cnidoscolus chayamansa a dose de 0,5 a 1,5 g/kg induz um aumento hipoglicêmico ( 200 mg/dL. Outros resultados, mostraram que Citrus aurantium exerce mudanças na concentração de triacilglicerídeos (158-172 mg/dL e colesterol (120-128 mg/dL. Finalmente, a administração de Ruta graveolens na dose de 0.5 g/kg induziu um efeito hipoglicêmico (Several plants with hypoglycemic properties have

  20. Atividade in vitro de plantas condimentares (Rosmarinus officinalis L., Lippia graveolens HBK e Thymus vulgaris L.) contra o calicivírus felino

    OpenAIRE

    Thaís Felli Kubiça; Sydney Hartz Alves; Rudi Weiblen; Andréia Henzel; Mathias Martins; Luciane Terezinha Lovato

    2015-01-01

    O calicivírus felino (FCV) é um importante patógeno de gatos que causa lesões ulcerativas orais e infecções respiratórias. O vírus tem sido utilizado como modelo experimental para avaliação de agente antivirais contra norovírus (NoVs). Nesse estudo, investigou-se a ação dos óleos essenciais de alecrim (Rosmarinus officinalis L.), orégano mexicano (Lippia graveolens HBK.) e tomilho (Thymus vulgaris L.) frente ao FCV, in vitro. A toxicidade celular foi testada pelo método de MTT e os ensaios an...

  1. CYP98A22, a phenolic ester 3’-hydroxylase specialized in the synthesis of chlorogenic acid, as a new tool for enhancing the furanocoumarin concentration in Ruta graveolens

    Directory of Open Access Journals (Sweden)

    Karamat Fazeelat

    2012-08-01

    Full Text Available Abstract Background Furanocoumarins are molecules with proven therapeutic properties and are produced in only a small number of medicinal plant species such as Ruta graveolens. In vivo, these molecules play a protective role against phytophageous insect attack. Furanocoumarins are members of the phenylpropanoids family, and their biosynthetic pathway is initiated from p-coumaroyl coA. The enzymes belonging to the CYP98A cytochrome P450 family have been widely described as being aromatic meta-hydroxylases of various substrates, such as p-coumaroyl ester derivatives, and are involved in the synthesis of coumarins such as scopoletin. In furanocoumarin-producing plants, these enzymes catalyze the step directly downstream of the junction with the furanocoumarin biosynthetic pathway and might indirectly impact their synthesis. Results In this work, we describe the cloning and functional characterization of the first CYP98A encoding gene isolated from R. graveolens. Using Nicotiana benthamiana as a heterologous expression system, we have demonstrated that this enzyme adds a 3-OH to p-coumaroyl ester derivatives but is more efficient to convert p-coumaroyl quinate into chlorogenic acid than to metabolize p-coumaroyl shikimate. Plants exposed to UV-B stress showed an enhanced expression level of the corresponding gene. The R. graveolens cyp98a22 open reading frame and the orthologous Arabidopsis thaliana cyp98a3 open reading frame were overexpressed in stable transgenic Ruta plants. Both plant series were analyzed for their production of scopoletin and furanocoumarin. A detailed analysis indicates that both genes enhance the production of furanocoumarins but that CYP98A22, unlike CYP98A3, doesn’t affect the synthesis of scopoletin. Conclusions The overexpression of CYP98A22 positively impacts the concentration of furanocoumarins in R. graveolens. This gene is therefore a valuable tool to engineer plants with improved therapeutical values that might

  2. A densidade básica e característica anatômicas variam radialmente na madeira de Astronium graveolens Jacq. (Anacardiaceae. Basic density and anatomical features vary in the radial direction in the wood of Astronium graveolens Jacq. (Anacardiaceae.

    Directory of Open Access Journals (Sweden)

    Camila Moura SANTOS

    2011-12-01

    Full Text Available Estudos sobre variações nas dimensões celulares de espécies arbóreas de clima tropical são escassos. Sendo assim, o objetivo deste trabalho foi caracterizar a variação da densidade básica e da anatomia no sentido radial da madeira de Astronium graveolens Jacq. Coletaram-se cinco indivíduos da espécie, provenientes da Estação Experimental Luiz Antônio (SP. Os métodos empregados nas análises foram os usualmente utilizados em pesquisas de densidade e anatomia de madeira. De acordo com os resultados foram constatadas altas correlações entre densidade básica, comprimento de fibra, espessura da parede da fibra, diâmetro de vaso e frequência de vaso com a distância da medula. A densidade básica da madeira é altamente dependente do comprimento das fibras, espessura da parede das fibras e diâmetro dos vasos, ocorrendo aumento no sentido da medula para a casca.Studies on variations in cell sizes of tree species in tropical climate are scarce. Thus, the aim was characterize the radial variation of basic density and wood anatomy of Astronium graveolens Jacq. Five specimens were collected at the Luiz Antônio Experimental Station,(SP. Sstandard methods for studying the density and wood anatomy were employed. According to the results we observed high correlation among basic density,fiber length, fiber wall thickness, vessel diameter and vessel frequency with distance fromthe pith. The wood density is highly dependent on fiber length, fiber wall thicknessand vessel diameter, there was an increase towards the pith to bark.

  3. Genotype variations in accumulation of cadmium and lead in celery (Apium graveolens L.) and screening for low Cd and Pb accumulative cultivars

    Institute of Scientific and Technical Information of China (English)

    Kun ZHANG; Jianbing WANG; Zhongyi YANG; Guorong XIN; Jiangang YUAN; Junliang XIN; Charlie HUANG

    2013-01-01

    To help reduce risks of heavy metal pollution, two pot experiments were conducted to investigate the variations, transfer potential, and stability of Cadmium (Cd) and Lead (Pb) accumulations in celery (Apium graveolens L.) and to screen for low Cd and Pb accumulative cultivars. The maximum differences in shoot Cd concentration were 4.7-fold under low-Cd exposure and 3.3-fold under high-Cd exposure. These genotype variations in Cd accumulation are sufficiently large to help reduce Cd contamination risk in soil by using the Low-Cd-Accumulative genotypes. Cd accumulation of the Low-Cd-Accumulative genotypes is significantly positive correlated with Pb accumulation. Evidence obtained proves that Cd and Pb accumulations in celery are stable and genotype-dependent at the cultivar level. The presence of high-Pb contamination in soil promoted Cd accumulation in shoots of celery. Celery is considered a species with high risks in Cd pollution and low risks in Pb pollution. Among the tested cultivars, cv. Shuanggang- kangbing (SGKB) had the lowest shoot Cd and Pb accumulating abilities, and thus is the most important material for breeding of pollution-safe cultivars (PSCs) to minimize Cd and Pb accumulations in celery.

  4. Observation on Meiosis of Pollen Mother Cells in Apium graveolens%芹菜花粉母细胞减数分裂观察

    Institute of Scientific and Technical Information of China (English)

    赵冬; 张蜀宁; 张宇; 李俊星; 刘惠吉

    2011-01-01

    The flower buds of celery (Apium graveolens ) were used to study the mitosis in pollen mother cells with enzyme - dye -squash technique.The results showed that the pollen mother cells carried on their meiosis and cytokinesis simultaneously and their tetrads were tetrahedral or decussate type; at metaphases Ⅰ and Ⅱ there showed a small number of chromosomes scattered outside their equatorial plate; at anaphases Ⅰ and Ⅱ there appeared chromosome bridges and lagged chromosomes in some pollen mother cells.%以中国芹品种铁杆芹花蕾为材料,采用改良卡宝染色压片法对芹菜花粉母细胞减数分裂进行了细胞学研究.结果表明:花粉母细胞减数分裂为胞质同时型,四分体为正四面体型或十字交叉型,中期Ⅰ和中期Ⅱ细胞可见赤道板外染色体,后期Ⅰ和后期Ⅱ部分细胞出现染色体桥及落后染色体.

  5. Antiprotozoal Activity against Entamoeba histolytica of Plants Used in Northeast Mexican Traditional Medicine. Bioactive Compounds from Lippia graveolens and Ruta chalepensis

    Directory of Open Access Journals (Sweden)

    Ramiro Quintanilla-Licea

    2014-12-01

    Full Text Available Amoebiasis caused by Entamoeba histolytica is associated with high morbidity and mortality is becoming a major public health problem worldwide, especially in developing countries. Because of the side-effects and the resistance that pathogenic protozoa build against the standard antiparasitic drugs, e.g., metronidazole, much recent attention has been paid to plants used in traditional medicine around the world in order to find new antiprotozoal agents. We collected 32 plants used in Northeast Mexican traditional medicine and the methanolic extracts of these species were screened for antiprotozoal activity against E. histolytica trophozoites using in vitro tests. Only 18 extracts showed a significant inhibiting activity and among them six plant extracts showed more than 80% growth inhibition against E. histolytica at a concentration of 150 µg/mL and the IC50 values of these extracts were determined. Lippia graveolens Kunth and Ruta chalepensis Pers. showed the more significant antiprotozoal activity (91.54% and 90.50% growth inhibition at a concentration of 150 µg/mL with IC50 values of 59.14 and 60.07 µg/mL, respectively. Bioassay-guided fractionation of the methanolic extracts from these two plants afforded carvacrol (1 and chalepensin (2, respectively, as bioactive compounds with antiprotozoal activity.

  6. Effect of Vermicompost on Chemical and Biological Properties of an Alkaline Soil with High Lime Content during Celery (Apium graveolens L. var. dulce Mill. Production

    Directory of Open Access Journals (Sweden)

    Ilker UZ

    2016-06-01

    Full Text Available The aim of this study was to investigate impact of vermicompost on chemical and biological properties of an alkaline soil with high lime content in the presence of plant under the open field conditions in semiarid Mediterranean region of Turkey. The study also included farmyard manure and chemical fertilizers for comparison and was conducted in two consecutive growth seasons in the same plots to observe any cumulative effect. Plots were amended with fertilizers in different rates and celery (Apium graveolens L. var. dulce Mill. was grown as the test plant. In general, vermicompost appeared to be more effective to increase organic matter, N, P, and Ca compared to farmyard manure. Soil alkaline phosphatase and β-glucosidase activities, especially in the second growth season, were significantly elevated by the vermicompost application. Urease activity, however, appeared not to be influenced by the type of organic fertilizer. A slight but statistically significant difference was detected between organic amendments in terms of number of aerobic mesophilic bacteria with vermicompost giving the lower values. Results showed that, in general, vermicompost significantly alters chemical and biological properties of the alkaline soil with high lime content during celery production under field conditions compared to farmyard manure and that it has a high potential to be used as an alternative to conventional organic fertilizers in agricultural production in the Mediterranean region of Turkey.

  7. An appropriate method for extracting the insect repellent citronellol from an indigenous plant (Pelargonium graveolens L'Her for potential use by resource-limited animal owners

    Directory of Open Access Journals (Sweden)

    B.M. Botha

    2000-07-01

    Full Text Available Veterinary needs appraisals in rural, peri-urban and urban areas have indicated a need for affordable and accessible veterinary health care. It was also found that farmers and animal owners used indigenous plants for treating animals. In Africa, insects such as Culex, Culicoides and Stomoxys may transmit diseases, cause irritation to animals or prevent wound healing. Insect repellents used topically are generally safer and cheaper than insecticides. Using readily available commercial sources of ethanol 43 %v/v (brandy and cane spirits, it was shown that citronellol could be extracted from uncrushed leaves of the indigenous shrub Pelargonium graveolens L'Hér. Efficacy of extraction was compared to that using reagent grade absolute ethanol. The peak concentration of citronellol was achieved within 7 days of extraction and thereafter remained constant for 4 months. Extraction methods using tap water and cooking oil were not successful. The extraction was also less successful when the leaves were crushed or macerated before being placed into ethanol. Gas chromatography was used to monitor the concentration of citronellol in the different extracts.

  8. Microencapsulation, chemical characterization, and antimicrobial activity of Mexican (Lippia graveolens H.B.K.) and European (Origanum vulgare L.) oregano essential oils.

    Science.gov (United States)

    Hernández-Hernández, Elvia; Regalado-González, Carlos; Vázquez-Landaverde, Pedro; Guerrero-Legarreta, Isabel; García-Almendárez, Blanca E

    2014-01-01

    The effect of solvent polarity (methanol and pentane) on the chemical composition of hydrodistilled essential oils (EO's) of Lippia graveolens H.B.K. (MXO) and Origanum vulgare L. (EUO) was studied by GC-MS. Composition of modified starch microencapsulated EO's was conducted by headspace-solid-phase microextraction (HS-SPME). The antimicrobial activity of free and microencapsulated EO's was evaluated. They were tested against Salmonella sp., Brochothrix thermosphacta, Pseudomonas fragi, Lactobacillus plantarum, and Micrococcus luteus. Thymol and carvacrol were among the main components of EO's and their free and microencapsulated inhibitory activity was tested against M. luteus, showing an additive combined effect. Chemical composition of EO's varied according to the solvent used for GC analysis and to volatile fraction as evaluated by HS-SPME. Thymol (both solvents) was the main component in essential oil of MXO, while carvacrol was the main component of the volatile fraction. EUO showed α-pinene (methanol) and γ-terpinene (pentane) as major constituents, the latter being the main component of the volatile fraction. EO's showed good stability after 3 months storage at 4°C, where antimicrobial activity of microencapsulated EO's remained the same, while free EO's decreased 41% (MXO) and 67% (EUO) from initial activity. Microencapsulation retains most antimicrobial activity and improves stability of EO's from oregano. PMID:25177730

  9. Análise e discriminação de quimiotipos de Lippia graveolens H.B.K. da Guatemala por microextração em fase sólida, CG-EM e análise multivariada

    Directory of Open Access Journals (Sweden)

    Juan Francisco Pérez Sabino

    2012-01-01

    Full Text Available SPME-GC-MS, PCA and HCA multivariate techniques were used in order to evaluate their applicability to discriminate the three chemotypes (thymol, carvacrol and mixed described for L. graveolens of Guatemala. The leaves of L. graveolens are used for treatment of colds, bronchitis, and as seasoning for food preparations, yielding essential oil up to 4.34 %. Leaves of 35 individuals from eight populations, and eight composite samples were analyzed using a DVB/Carboxen/PDMS fiber and GC-MS. PCA and HCA were carried out using eight markers (p-cymene, cis-sabinene hydrate, linalool, terpinen-4-ol, thymol, carvacrol, (E-caryophyllene and caryophyllene oxide. The three chemotypes of L. graveolens were satisfactorily discriminated.

  10. Ethnopharmacology, Antibacterial and Antioxidant Activity of Dittrichia graveolens (L. W. Greuter. Which Has Been Used as Remedies Antirheumatic, Anti-inflammation and Antiinfection against Leishmaniasis in the Traditional Medicine of Gorgan, Iran

    Directory of Open Access Journals (Sweden)

    Mazandarani Masoumeh

    2014-10-01

    Full Text Available Objective: This study was survey to investigate of ethnopharmacology, antibacterial and antioxidant capacity of Dittrichia graveolens (L. W. Greuter extract in in vitro from waste ground region of Gorgan, Iran, which has been used in traditional as a strong anti-inflammation, antirheumatism, antitumor, antipathogene, and antiinfection. Materials and Methods: Ethnopharmacological data were obtained among well-known indigenous herbal practitioner (70 ages in Gorgan, Iran. Aerial parts of plant in blooming were collected from Gorgan waste ground (80 m in October 2013. Methanol and acetone extracts were obtained by maceration, antioxidant activity were evaluated spectrophotometrically by 1,1-diphenyl-2-picryl hydrazyl (DPPH, total antioxidant capacity and reducing power to compare of butylated hydroxytoluene and butylated hydroxyanisole antioxidant standard and antibacterial activity were determined by disc diffusion and minimal inhibitory concentrations (MICs method against tree Gram-positive and negative pathogenic bacteria. Results: D. graveolens (L. W. Greuteris is usually wild grow in Golestan Province and has been used in traditional medicine as a strong anti-inflammation, antirheumatism, antitumor, antipathogene and antiinfection specially in treat of leishmaniosis metanolic extract of plant has strong antioxidant activity against free radical scavenging specially in DPPH methode than aceton extract with IC50 (6.2 ± 0.13 μg/ml and Staphylococcus aureus, Staphylococcus epidermidis, Enterococcus faecalis and Bacillus cereus with inhibition zone 35, 30, 26, 21 mm were the most sensitive bacteria, with MIC ranging from 12.6 to 112 μg/ml, respectively. Escherichia coli and Salmonella typhimurium have moderate sensitivity and other bacteria were resistant to the plant extract. Conclusion: Results demonstrate that the methanolic extract of D. graveolens can become good potential antioxidant and antibacterial activity for controlling certain Gram

  11. Estudio comparativo de la composición química y actividad antibacteriana del aceite esencial de Ruta graveolens L. recolectada en los estados Mérida y Miranda, Venezuela.

    Directory of Open Access Journals (Sweden)

    Janne Rojas

    2011-12-01

    Full Text Available Essential oil from two R. graveolens samples collected from Mérida and Miranda states, Venezuela, were analyzed by GC/MS identifying as major components: 2-undecanone, 2-nonanonae and pregeijerene. On the other hand, the antibacterial activity assays showed the wide range of activity of the oils that inhibited the bacterial strains grow not only for the Gram positive (S. aureus and E. faecalis but the Gram negative (E. coli and K. pneumonie as well, displaying MIC values between 100 μg/mL and 200 μg/mL.

  12. Morfoanatomía y efecto del secado en la germinación de semillas de caléndula y eneldo Morphology, anatomy and influence of drying on germination of seeds of Calendula officinalis and Anethum graveolens

    OpenAIRE

    Jorge A Victoria T; Carmen R Bonilla C; Manuel S. Sánchez O

    2007-01-01

    En semillas de caléndula Calendula officinalis y de eneldo Anethum graveolens , se realizaron la descripción morfológica y anatómica y mediciones del contenido de humedad en equilibrio (CHE). La descripción morfológica y anatómica permitió precisar e ilustrar detalladamente los órganos y tejidos internos de la semilla, además, clarificar aspectos en la definición de semilla pura de caléndula. Se elaboraron curvas de secado y se midió el CHE en diferentes ambientes de secamiento artificial, ob...

  13. Atividade in vitro de plantas condimentares (Rosmarinus officinalis L., Lippia graveolens HBK e Thymus vulgaris L. contra o calicivírus felino

    Directory of Open Access Journals (Sweden)

    Thaís Felli Kubiça

    2015-09-01

    Full Text Available O calicivírus felino (FCV é um importante patógeno de gatos que causa lesões ulcerativas orais e infecções respiratórias. O vírus tem sido utilizado como modelo experimental para avaliação de agente antivirais contra norovírus (NoVs. Nesse estudo, investigou-se a ação dos óleos essenciais de alecrim (Rosmarinus officinalis L., orégano mexicano (Lippia graveolens HBK. e tomilho (Thymus vulgaris L. frente ao FCV, in vitro. A toxicidade celular foi testada pelo método de MTT e os ensaios antivirais pelo teste de redução de placas. Três protocolos foram aplicados: a diferentes concentrações não tóxicas dos óleos essenciais (CNTOE foram incubadas com o vírus por 1 hora antes da inoculação (ensaio virucida; b CNTOE foram adicionadas às células CRFK e incubadas por 1 hora antes da adsorção viral (ensaio de pré-tratamento; c CNTOE foram adicionadas às células após a inoculação do FCV e mantidas por 18 horas (ensaio de pós-tratamento. A CC50 para os óleos de alecrim, orégano mexicano e tomilho foram: 1300,21 μg mL-1; 435,92 μg mL-1 e 675,34 μg mL-1; respectivamente. O óleo essencial de tomilho apresentou índice de seletividade [IS=CC50/CI50] de 8,57 para o ensaio de pré-tratamento e 6,2 no ensaio virucida. O óleo de alecrim mostrou atividade antiviral no ensaio virucida (IS=6,54 e de pós-tratamento (IS=6,86. O orégano mexicano apresentou IS de 5,75 no ensaio virucida e 5,59 no de pós-tratamento. Conclui-se que os óleos essenciais de tomilho e alecrim apresentaram atividade frente ao FCV em diferentes momentos da infecção viral.Palavras-chave: Norovírus. FCV. óleos essenciais. Citotoxicidade. MTT. ensaio de placa. ABSTRACTIn vitro activity of plants used as condiments (Rosmarinus officinalis L., Lippia graveolens HBK e Thymus vulgaris L. against the feline calicivirusThe feline calicivirus (FCV is an important pathogen of feline causing oral ulcerative lesions and respiratory disease. This virus

  14. ESTIMACIÓN DE LA CAPACIDAD GERMINATIVA Y EL VIGOR DE LAS SEMILLAS DE diomate (Astronium graveolens Jacq. SOMETIDAS A DIFERENTES TRATAMIENTOS Y CONDICIONES DE ALMACENAMIENTO ESTIMATE OF THE GERMINATIVE CAPACITY AND THE VIGOR OF DIOMATE SEEDS (Astronium graveolens Jacq. SUBJECTED TO DIFFERENT TREATMENTS AND STORAGE CONDITIONS

    Directory of Open Access Journals (Sweden)

    Martha Ligia Gómez Restrepo

    2004-06-01

    Full Text Available Se llevaron a cabo dos estudios con semillas de diomate (Astronium graveolens Jacq. El primero se hizo con el fin de determinar el efecto que sobre la germinación tienen el sustrato y la condición lumínica. El segundo, para evaluar la respuesta germinativa de semillas almacenadas durante varios períodos y bajo diferentes condiciones de temperatura y empaque. Las semillas de diomate sembradas a plena exposición y en las cuales se utilizó tierra como sustrato obtuvieron la mayor potencia germinativa, los menores tiempos de germinación y el vigor más alto. La pérdida total de vigor en las semillas varió según el tiempo y la temperatura de almacenamiento así: al cabo de un mes de almacenamiento a temperaturas entre 7 y 10ºC, al sexto mes de almacenamiento a temperaturas entre 20 y 33ºC y al undécimo mes cuando fueron almacenadas a temperatura ambiente entre 12 y 18ºC. El tipo de empaque no influyó significativamente en los resultados finales.Two studies of diomate seeds (Astronium graveolens Jacq were conducted. The first was conducted to determine the effect that substrate and light condition has on germination. The second was to evaluate the germinative response of seeds stored over differing time periods and under temperature and packaging conditions. The diomate seeds sowed in full exposure in soil substrate had the greatest germinative potential, the fastest germination times and the highest vigor. The total loss of vigor in the seeds varied according to time and temperature of storage, as follows: after a month of storage at temperatures between 7 and 10ºC, after six months of storage at temperatures between 20 and 33ºC and after eleven months of storage at ambient temperatures between 12 and 18ºC. The type of packing did not significantly influence the final results.

  15. Larvicidal, Repellent and Irritant Potential of the Seed-derived Essential oil of Apium graveolens against Dengue Vector, Aedes aegypti L. (Diptera: Culicidae

    Directory of Open Access Journals (Sweden)

    Sarita eKumar

    2014-09-01

    Full Text Available Aedes aegypti L., the primary carrier for viruses causing dengue, chikungunya and yellow fever is widespread over large areas of the tropics and subtropics. Keeping in view the adverse effects of chemical insecticides-based intervention measures; the eco-friendly, bio-degradable essential oil extracted from the seeds of celery, Apium graveolens; was investigated for anti-mosquito potential against Ae. aegypti. Evaluation of larvicidal potential of celery seed oil against early fourth instars of Ae. aegypti resulted in LC50 and LC90 values of 16.10 ppm and 29.08 ppm, respectively, after an exposure to 24 h; the toxic effect of the oil increasing by 1.2 fold with an LC50 value of 13.22 ppm after an exposure to 48h. Interestingly, the seed oil did not cause rapid mortality, suggesting a delayed type of larval killing effect. The remarkable finding of the present study was effective repellency of the essential oil leading to 100% protection till 165 min as compared to control that did not show any repellency against mosquitoes. Only 1 bite was recorded in the 165th minute after which only 2 bites were scored until 180 min of exposure of the oil to the adult mosquitoes. An exciting observation was the knocked-down of mosquitoes caused by the exposure to 10% oil-impregnated papers. The exposure to 1% oil resulted in first flight only after 4 sec and a total of 63.66 average flights during 15 min exposure revealing the relative irritability of 26.97.The qualitative phytochemical study of the oil showed the presence of terpenoids, lactones and flavonoids as the major constituents suggesting their possible role in the toxicity. Present investigations proved celery seed essential oil to be an efficient larvicide and repellent against dengue vector. Further studies are needed to identify the active principles involved, their mode of action, formulated preparations for enhancing potency and stability, toxicity and effects on non-target organisms and the

  16. Evaluation of the Antitoxic Effect of Phthalides from Apium graveolens in Acrylamide Intoxication I. Evolution of the Hepatic Cytolysis and Proteosynthetic Parameters in Acrylamide Intoxication on the Background of Phthalide Protection

    Directory of Open Access Journals (Sweden)

    Cornelia PRISACARU

    2009-11-01

    Full Text Available Acrylamide is a toxic compound formed during thermical processing of foods that contain amino acids, mainly asparagine, and reducing sugars. The toxicodynamics of acrylamide, exerted mainly by its major metabolite glycidamide, is expressed by mutagenic, carcinogenic and imunosupressive effects. Due to its toxicity and its high prevalence in aliments, the present paper approaches a possible way of reducing the toxic effects of acrylamide by using phytotherapeutical means. In this direction, the antitoxic potential of some phytopreparates obtained from Apium graveolens (Apii aetheroleum, extractive solutions from A. radix, A. folium and A. semen were monitorized on the background of acrylamide intoxication. The antitoxic potential of phthalides has been evaluated by determining biochemical parameters: hepatic cytolysis parameters (aspartate aminotransferase, alanil aminotransferase, lactate dehydrogenase and protesosynthesis parameters (colinesterase, total poteins, albumins. The biochemical investigation confirmed the antitoxic potential fo phthalides from celery, the highest protection being obtained for the phytopreparate from Apii semen.

  17. 芹菜黄酮合成酶Ⅰ基因的克隆与序列分析%Cloning and sequence analysis of flavone synthase I gene in Apium graveo-lens

    Institute of Scientific and Technical Information of China (English)

    陈逸云; 王枫; 徐志胜; 谭国飞; 李梦瑶; 熊爱生

    2014-01-01

    The flavone synthase I gene (AgFS I), the key gene for flavonoids synthesis, was cloned from Apium graveolens cultivars Liuhehuangxinqin, Jinnanshiqin and Meiguoxiqin, respectively. The length of AgFS I gene was 1 616 bp, containing 359-bp intronⅠ and 190-bp intronⅡ. The AgFS I gene encodes 355 amino acids, belonging to the 20G-FeII Oxy superfamily. There were differences in 5 nucleotide sites and 5 amino acid sites among the three cultivars of Api-um graveolens. Multiple sequence alignment of AgFS Is with FSIs from other plants showed that FSⅠs were highly conser-vative. Phylogenetic tree revealed the AgFS Is had the closest relationship to Daucus carota and Cuminum cyminum, which belong to the Apiaceae. Amino acid sequence analyses indicate that AgFS I belong to the hydrophobic protein. The AgFS Is from three cultivars of Apium graveolens are similar in three dimentional structure.%选用3个芹菜材料六合黄心芹、津南实芹和美国西芹,分别从中克隆了合成黄酮类化合物的关键酶基因---芹菜黄酮合成酶I基因( AgFS I)。该基因全长均为1616 bp,含有359 bp的内含子I和190 bp的内含子II。芹菜AgFS I基因编码355个氨基酸,属于20G-FeII Oxy超级家族。序列分析结果显示,3种芹菜中AgFS I基因在核苷酸水平上有5个碱基的差异,编码的氨基酸有5个位点的差异。芹菜黄酮合成酶I( AgFS I)与其他来源植物的FSI氨基酸多重序列比对分析结果表明,该酶具有高度保守性。对AgFS I进行进化树分析,氨基酸序列的疏水性/亲水性分析,三级结构预测与分析,结果显示AgFS I与同属于伞形科的胡萝卜和孜然芹的FSI进化关系最近, AgFS I属于疏水性蛋白质,3种芹菜AgFS I的空间结构相似。

  18. Effects of aqueous extract of Ruta graveolens and its ingredients on cytochrome P450, uridine diphosphate (UDP-glucuronosyltransferase, and reduced nicotinamide adenine dinucleotide (phosphate (NAD(PH-quinone oxidoreductase in mice

    Directory of Open Access Journals (Sweden)

    Yune-Fang Ueng

    2015-09-01

    Full Text Available Ruta graveolens (the common rue has been used for various therapeutic purposes, including relief of rheumatism and treatment of circulatory disorder. To elucidate the effects of rue on main drug-metabolizing enzymes, effects of an aqueous extract of the aerial part of rue and its ingredients on cytochrome P450 (P450/CYP, uridine diphosphate (UDP-glucuronosyltransferase, and reduced nicotinamide adenine dinucleotide (phosphate (NAD(PH:quinone oxidoreductase were studied in C57BL/6JNarl mice. Oral administration of rue extract to males increased hepatic Cyp1a and Cyp2b activities in a dose-dependent manner. Under a 7-day treatment regimen, rue extract (0.5 g/kg induced hepatic Cyp1a and Cyp2b activities and protein levels in males and females. This treatment increased hepatic UDP-glucuronosyltransferase activity only in males. However, NAD(PH:quinone oxidoreductase activity remained unchanged. Based on the contents of rutin and furanocoumarins of mouse dose of rue extract, rutin increased hepatic Cyp1a activity and the mixture of furanocoumarins (Fmix increased Cyp2b activities in males. The mixture of rutin and Fmix increased Cyp1a and Cyp2b activities. These results revealed that rutin and Fmix contributed at least in part to the P450 induction by rue.

  19. Beslenme ve Halk Sağlığı Yönünden Önemli Bazı Sebzeler I: Sarımsak (Allium sativum L.), Enginar (Cynara scolymus L.), Kereviz (Apium graveolens L.) ve Lahana (Brassica oleraceae)

    OpenAIRE

    Altıniğne, Nejat; Gönül, Meral

    1988-01-01

    Karbonhidrat, mineral madde ve vitamin gibi önemli bazı besin ögelerini çok miktarda içeren sebzeler, beslenme amacıyla kullanıldıkları gibi, içerdikleri bazı ilaç etken maddeleri nedeniyle halk sağlığında tedavi amacıylada kullanılmaktadırlar. Bu makalede genel özellikleri, besin içerikleri ve halk sağlığında kullanılma amaçları yönünden sarımsak (A. sativum), enginar (C. scolymus), kereviz (A. graveolens) ve lahana (B. oleraceae) sebzeleri ele alınarak incelenmiştir.   ...

  20. Produção de voláteis por culturas de raízes transgénicas de Anethum graveolens:influência da regeneração e da capacidade de biotransformação

    OpenAIRE

    Faria, Jorge Miguel Silva, 1983-

    2008-01-01

    Foram usadas culturas de raízes transgénicas (r.t.) de Anthum graveolens para testar a possibilidade de regeneração e para avaliar a influência da capacidade de biotransformação dos álcoois monoterpénicos, mentol e geraniol, no crescimento e produção de voláteis. A regeneração foi ensaiada em fotoperíodo, de 24h luz em jiffy pellets e de 16h luz em caixas de Petri com 20 ml de meio MS/2. Parte destas foi suplementada com higromicina B (2 mg.l-1, 5 mg.l-1 e 7 mg.l-1) ou ácido salicílico (0,3; ...

  1. Fruit ontogeny of Garcinia gardneriana (Planch. & Triana) Zappi (Clusiaceae) Ontogênese do fruto de Garcinia gardneriana (Planch. & Triana) Zappi (Clusiaceae)

    OpenAIRE

    Marta Eglaé Camargo Asinelli; Maria Conceição de Souza; Káthia Socorro Mathias Mourão

    2011-01-01

    Garcinia gardneriana (Clusiaceae) is a small to medium-sized tree that usually occurs on the floodplains of the Paraná River and it is an important food source for the local inhabitants. The fruit itself is consumed in natura, and juices and sweets are made from it. The purpose of this study was to describe morphological and structural aspects of fruits and seeds of this species in order to classify the fruit type and the pulpy layer which involves the seeds. The material analyzed consisted o...

  2. Fruit ontogeny of Garcinia gardneriana (Planch. & Triana Zappi (Clusiaceae Ontogênese do fruto de Garcinia gardneriana (Planch. & Triana Zappi (Clusiaceae

    Directory of Open Access Journals (Sweden)

    Marta Eglaé Camargo Asinelli

    2011-03-01

    Full Text Available Garcinia gardneriana (Clusiaceae is a small to medium-sized tree that usually occurs on the floodplains of the Paraná River and it is an important food source for the local inhabitants. The fruit itself is consumed in natura, and juices and sweets are made from it. The purpose of this study was to describe morphological and structural aspects of fruits and seeds of this species in order to classify the fruit type and the pulpy layer which involves the seeds. The material analyzed consisted of ovary and fruits in different stages of development, collected from five plants from Aurélio Island, Baía River (MS, BR and the description was done according to standard procedures in anatomy. The fruit is a yellowish-orange spherical berry ("bacóide" type. The smooth, coriaceous skin consists of the lignified exocarp. The endocarp cell layers are derived from the activity of an adaxial meristem that undergoes radial elongation. The edible sweet white pulp is formed by the endocarp, as well as the spongy mesocarp, in which the secretory ducts lose their function. The unitegmic anatropous ovules develop into anatropous exalbuminous seeds with a collapsed and undifferentiated testa. The embryo is hypocotylar. The features here described generally occur in Clusioideae-Garcinieae and Symphonieae.Garcinia gardneriana (Clusiaceae é árvore de pequeno a médio porte frequente na Planície de Inundação do Alto Rio Paraná e de importância na alimentação das populações ribeirinhas, sendo consumida in natura e na forma de sucos e doces. O objetivo do presente estudo foi descrever aspectos morfológicos e estruturais dos frutos e sementes dessa espécie como contribuição à classificação do tipo de fruto e da porção carnosa e comestível que envolve as sementes. Ovários e frutos, em diferentes estádios de desenvolvimento foram coletados de cinco espécimes de uma população localizada na ilha do Aurélio, rio Baía (MS, BR e processados segundo técnicas usuais em anatomia vegetal. O fruto é bacóide, esférico, de coloração amarelo-alaranjado. A casca é lisa e coriácea, constituída pelo exocarpo lignificado. O endocarpo é derivado da atividade de um meristema adaxial, cujas células alongam-se radialmente. A polpa tem coloração branca, comestível, de sabor doce, de origem principalmente endocárpica, mas é constituída também por parte do mesocarpo esponjoso, cujos ductos perdem a funcionalidade. Os óvulos anátropos e unitegumentados originam sementes também anátropas, exalbuminosas, com testa colapsada. O embrião é hipocotilar. Os caracteres aqui descritos de maneira geral são comuns a Clusioideae-Garcinieae e Symphonieae.

  3. Determination of the contents of monosaccharide components in non-starch polysaccharides of aerial part of Apium graveolens L. By pre-column derivatization GC%柱前衍生化GC法测定旱芹非淀粉多糖中各单糖组分含量

    Institute of Scientific and Technical Information of China (English)

    谭亮; 杨洋; 张琦; 霍鑫; 毕开顺; 贾英

    2011-01-01

    Objective To establish pre-column derivatization GC method for determination of monosaccharide component of non-starch polysaccharides of the aerial part of Apium graveolens L. Methods The derivatives were determined by GC and DB-17 column(30 m ×0. 25 mm,0. 25 μm)was used. The inlet temperature was maintained for 270 ℃. The column oven was begun at 180 ℃ ,then programmed from 180 ℃ to 225℃ at 3 ℃- min -1, hold for 2 min, then programmed from 225 ℃ to 260 ℃ at 6 ℃· min -1, and finally, hold for 7 min. Manner of sample injection was splitless. Detector temperature was maintained at 270 ℃. Sample amount was I. 0 μL. Results Seven monosaccharides L-( + )-rhamnose,L-( + )-arabinose,D-( + )-fucose, D-( + )-xylose,D-( + )-mannose,D-( + )-glucose and D-( + )-galactose were determined in INSP. Except D-( + )-fucose,other six monosaccharides were the same as from INSP in SNSP. Conclusions The method is accurate and reproducible,which is suitable for the determination of monosaccharide component in soluble and insoluble non-starch polysaccharides in Apium graveolens L.%目的 建立测定旱芹非淀粉多糖中各单糖组分含量的柱前衍生化GC法.方法 非淀粉多糖经衍生化生成糖腈乙酯,采用GC法进行分析.色谱柱:DB-17柱(30 m×0.25 mm,0.25 μm);柱温:程序升温;载气:N2;进样温度:270℃;进样方式:不分流;检测器温度:270℃;进样量:1.0μL.结果 水不溶性非淀粉多糖(insoluble non-starch polysaccharides,INSP)水解后得到7种单糖,分别是:L-(+)-鼠李糖、L-(+)-阿拉伯糖、D-(+)-岩藻糖、D-(+)-木糖、D-(+)-甘露糖、D-(+)-葡萄糖和D-(+)-半乳糖;水溶性非淀粉多糖(soluble non-starch polysaccharides,SNSP)水解后得到6种单糖,除无D-(+)-岩藻糖外,其余均同INSP水解后单糖.结论 本方法准确度高,重现性好,可用于测定旱芹水溶性和水不溶性非淀粉多糖中各单糖组分的含量.

  4. Antidiarrhoea and toxicological evaluation of the leaf extract of Dissotis rotundifolia triana (Melastomataceae

    Directory of Open Access Journals (Sweden)

    Okoto Pius E

    2010-11-01

    Full Text Available Abstract Background The leaves of Dissotis rotundifolia are used ethnomedically across Africa without scientific basis or safety concerns. Determination of its phytochemical constituents, antimicrobial activity, effects on the gastrointestinal tract (GIT as well as toxicological profile will provide supportive scientific evidence in favour of its continous usage. Method Chemical and chromatographic tests were employed in phytochemical investigations. Inhibitory activity against clinical strains of Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus and Salmonella typhi were compared with Gentamycin. Our report includes minimum inhibitory concentration (MIC against the tested organisms. The effect of the ethanol extract on the motility of the GIT in mice using the charcoal plug method and castor oil induced diarrhoea in rats was evaluated. Toxicological evaluation was determined by administering 250 mg/kg and 500 mg/kg of extracts on male Wistar rats for 14 days with normal saline as control. The tissues of the kidneys, liver, heart and testes were examined. Results Phytochemical studies revealed the presence of alkaloids, saponin and cardiac glycosides. The crude ethanol extract and fractions inhibited the growth of E. coli, P. aeruginosa, S. aureus and S. typhi to varying extents. The degree of transition exhibited by the charcoal meal was dose-dependent. In the castor oil induced diarrhoea test, all the doses showed anti-spasmodic effects. The LD50 in mice was above 500 mg/kg body weight. Toxicological evaluation at 500 mg/kg showed increased cytoplasmic eosinophilia and densely stained nuclei of the liver, tubular necrosis of the kidney, presence of ill-defined testes with indistinct cell outlines and no remarkable changes in the heart. Conclusion Ethanol extracts of Dissotis rotundifolia have demonstrated antimicrobial activity against clinical strains of selected microorganisms. The plant showed potential for application in the treatment of diarrhoea, thereby justifying its usage across Africa. It also demonstrated toxicity in certain organs at the dose of 500 mg/kg, and it will be necessary to fully establish its safety profile.

  5. Garcinia gardneriana (Planchon & Triana) Zappi. (Clusiaceae) as a topical anti-inflammatory alternative for cutaneous inflammation.

    Science.gov (United States)

    Otuki, Michel F; Bernardi, Camila A; Prudente, Arthur S; Laskoski, Kerly; Gomig, Franciane; Horinouchi, Cintia D S; Guimarães, Claudio L; Ferreira, Juliano; Delle-Monache, Franco; Cechinel-Filho, Valdir; Cabrini, Daniela A

    2011-07-01

    Garcinia gardneriana is popularly used in skin disorders; therefore, this article investigated the effect of G. gardneriana extracts from leaves, bark and seeds and two isolated compounds in ear oedema and leucocytes migration caused by croton oil. The topical application of the extract of G. gardneriana leaves was able to reduce (70 ± 3%, and ID(50) 0.33 mg/ear) ear oedema, while the seeds (51 ± 5%) and the wood (60 ± 12%) extracts were less effective. In a time-course evaluation, the leaf extract (1 mg/ear) was effective when applied 2 hr before and until 3 hr after the stimulation, presenting a higher effectiveness when applied right after croton oil (83 ± 7% inhibition). In addition, the leaf extract was able to diminish the myeloperoxidase (MPO) activity in 64 ± 13%, which suggests the inhibition of leucocyte infiltration that was confirmed by histological analysis. Also, both biflavonoids isolated from the leaves of G. gardneriana, fukugetin (or morelloflavone) and 13-naringenin-II 8-eriodictyol (GB-2a), were able to reduce ear oedema, with ID(50) values of 0.18 (0.10-0.28) and 0.22 (0.15-0.31) mg/ear, respectively, besides the inhibition of MPO activity of 52 ± 6% and 64 ± 5%, respectively. Using the fluorescent probe 2',7'-dichlorodihydrofluorescein diacetate, the leaf extract, fukugetin and GB-2a topically applied to the ear treated with croton oil reduced 52 ± 15%, 63 ± 17% and 83 ± 4%, respectively, the production of reactive oxygen species of the skin. Thus, these results reveal the anti-inflammatory effect of G. gardneriana leaves for topical usage, and both biflavonoids are responsible for this effect. PMID:21362142

  6. BOMBACACEAE NEOTROPICAE NOVAE VEL MINUS COGNITAE VII. REDESCUBRIMIENTO DE PACHIRA PULCHRA PLANCH. & LIND. EX TRIANA & PLANCH

    Directory of Open Access Journals (Sweden)

    FERNÁNDEZ-ALONSO JOSÉ LUIS

    2003-06-01

    Full Text Available Se aclara la identidad de Pachira pulchra, especie poco conocida descrita del nortede la Cordillera Oriental de Colombia y se complementa su descripción al darse aconocer sus frutos y semillas. Se incluye una clave para el grupo de especiesandinas del género Pachira, relacionadas con la que se comenta en este trabajo.

  7. Bombacaceae neotropicae novae vel minus cognitae vii. redescubrimiento de pachira pulchra planch. & lind. ex triana & planch

    OpenAIRE

    Fernández-Alonso, José Luis; Sánchez Montaño, Luis Roberto; GALINDO-T., ROBINSON

    2013-01-01

    Se aclara la identidad de Pachira pulchra, especie poco conocida descrita del nortede la Cordillera Oriental de Colombia y se complementa su descripción al darse aconocer sus frutos y semillas. Se incluye una clave para el grupo de especiesandinas del género Pachira, relacionadas con la que se comenta en este trabajo.

  8. BOMBACACEAE NEOTROPICAE NOVAE VEL MINUS COGNITAE VII. REDESCUBRIMIENTO DE PACHIRA PULCHRA PLANCH. & LIND. EX TRIANA & PLANCH

    OpenAIRE

    FERNÁNDEZ-ALONSO JOSÉ LUIS; SÁNCHEZ MONTAÑO LUIS ROBERTO; GALINDO-T. ROBINSON

    2003-01-01

    Se aclara la identidad de Pachira pulchra, especie poco conocida descrita del nortede la Cordillera Oriental de Colombia y se complementa su descripción al darse aconocer sus frutos y semillas. Se incluye una clave para el grupo de especiesandinas del género Pachira, relacionadas con la que se comenta en este trabajo.

  9. Wet season precipitation during the past century reconstructed from tree-rings of a tropical dry forest in Southern Ecuador

    Science.gov (United States)

    Pucha-Cofrep, Darwin; Peters, Thorsten; Bräuning, Achim

    2015-10-01

    This study investigates the dendroclimatic potential of tree species in a tropical dry forest in southern Ecuador. From 10 selected tree species, Bursera graveolens and Maclura tinctoria exhibited distinct annual and cross-datable tree-rings. It was possible to synchronize individual tree-ring series and to establish two tree-ring chronologies of 203 and 87 years length, respectively. The characteristic ENSO frequency band is reflected in wavelet power spectra of both chronologies. Both species show a strong correlation between ring width and precipitation of the wet season (January-May). Strong El Niño events (1972, 1983 and 1998) lead to strong growth responses in the tree-ring chronologies, whereas 'normal' ENSO events do not trigger long-lasting growth responses. The first ring-width based wet-season precipitation reconstruction for the past 103 years was developed. Statistical and spatial correlation analysis verified the skills of the reconstructed precipitation which captures a great part of the Rainfall Index over the land area of Ecuador and the equatorial Pacific. Furthermore, teleconnections with central Pacific precipitation and SST patterns were found.

  10. Mannitol utilisation by celery (Apium graveolens) plants grown under different conditions in vitro

    Czech Academy of Sciences Publication Activity Database

    Vítová, Lenka; Stodůlková, E.; Bartoníčková, A.; Lipavská, H.

    2002-01-01

    Roč. 163, - (2002), s. 907-916. ISSN 0168-9452 R&D Projects: GA MŠk LN00A081 Institutional research plan: CEZ:AV0Z5038910; CEZ:MSM 113100003 Keywords : Carbohydrates * Osmotic stress * Sugar alcohol Subject RIV: EF - Botanics Impact factor: 1.556, year: 2002

  11. Extraction of Botanical Pesticides from Pelargonium graveolens using Supercritical Carbon Dioxide

    Czech Academy of Sciences Publication Activity Database

    Machalová, Zdeňka; Sajfrtová, Marie; Pavela, R.; Topiař, Martin

    2015-01-01

    Roč. 67, MAY (2015), s. 310-317. ISSN 0926-6690 R&D Projects: GA TA ČR TA01010578 Institutional support: RVO:67985858 Keywords : botanical pesticides * geranium oil * supercritical fluid extraction Subject RIV: CI - Industrial Chemistry, Chemical Engineering Impact factor: 2.837, year: 2014

  12. The effect of celery (Apium graveolens L.) on reproductive parameters in male wistar rat

    OpenAIRE

    Wesam Kooti; Najmeh Kafash-Farkhad; Ali Ghorbani-Ranjbari; Naim Sharafi-Ahvazi

    2016-01-01

    Dear editor In recent years, the number of scientific research papers of Iranian scientists has substantially grown in national and international journals that indicates particular attitude of Iranian scientific community to the development of knowledge in different fields. Moreover, improvement of quality of scientific papers is necessary. For this purpose, criticism of published studies is a way to increase the quality of articles and make them clear. In Avicenna Journal of Phytomedicine, v...

  13. Chemistry, technology, and nutraceutical functions of celery (Apium graveolens L.): an overview.

    Science.gov (United States)

    Sowbhagya, H B

    2014-01-01

    Celery is a commercially important seed spice belonging to the family Umbelliferrae. Celery is used in various forms such as fresh herb, stalk, seeds, oil, and oleoresin for flavoring of foods and for medicinal purposes. Celery seed contains 2% volatile oil that finds application for flavoring of foods and also in perfumery industry. Limonene and selinene form about 60% and 20% of the oil, respectively. However, the important flavor constituents of the oil responsible for the typical aroma are 3-n-butyl-4-5-dihydrophthalide (sedanenolide), 3-n-butyl phthalide, sedanolide, and sedanonic anhydride present in very low levels (1-3%). Celery contains 15% fatty oil with the fatty acids: petroselenic (64.3%), oleic (8.1%), linoleic (18%), linolenic (0.6%), and palmitic acids. Phthalides especially sedanenaloide possess many health benefits. Celery extracts are reported to possess many nutraceutical properties, viz., antioxidant, hypolipidemic, hypoglycemic, and anti-platelet aggregation. In the present review, the chemistry, processing, and biological activities of celery and the components responsible are discussed. PMID:24188309

  14. Estudo in vitro da atividade do extrato etanólico de sementes de bacupari (Rheedia gardneriana Planch. & Triana e das frações no crescimento de Streptococcus mutans In vitro study of the activity of ethanol extract from "bacupari" (Rheedia gardneriana Planch. & Triana seeds and its fractions on Streptococcus mutans growth

    Directory of Open Access Journals (Sweden)

    S.S Samarão

    2010-06-01

    Full Text Available Streptococcus mutans, principal microrganismo da cavidade oral, desempenha papel preponderante na formação de placas dentárias, sendo considerado o agente etiológico primário da cárie. Rheedia gardneriana, conhecida popularmente como bacupari, é uma planta utilizada com fins medicinais para o tratamento de diversas patologias, e por apresentar atividade antimicrobiana de compostos das folhas contra bactérias Gram-positivas e Gram-negativas. O objetivo do presente trabalho foi avaliar o efeito de extrato de semente de R. gardneriana sobre a cepa S. mutans UA159. Os testes foram conduzidos com o extrato etanólico bruto e as frações obtidas com os solventes diclorometano, etanol-água, metanol e hexano, em ensaios de inibição in vitro. O extrato bruto (100% apresentou halos de inibição com diâmetro similar ao obtido com solução de digluconato de clorexidina 0,12%, usada como controle. Os ensaios com a fração diclorometano exibiram atividade inibitória 35% menor comparado com o controle, enquanto nenhum efeito antimicrobiano foi observado com a fração etanol-água. Contrariamente, os resultados obtidos com as frações hexânica e metanólica demonstraram claramente a atividade antimicrobiana por inibição do crescimento bacteriano. Na fração metanólica a formação de halos de inibição foi similar ao do controle. Estes dados apresentam atividade antimicrobiana de R. gardneriana contra S. mutans.Streptococcus mutans, which is the main microorganism of the oral cavity, plays a preponderant role in dental plaque formation and is considered the primary etiologic agent regarding caries. Commonly known as "bacupari", Rheedia gardneriana is a plant used for medicinal purposes in the treatment of several pathologies; besides, its leaves have compounds that present antimicrobial activity against Gram-positive and Gram-negative bacteria. The aim of this work was to evaluate the effect of R. gardneriana seed extract on S. mutans strain UA159. The tests were carried out with crude ethanol extract and the fractions obtained with the solvents dichloromethane, ethanol-water, methanol, and hexane in in vitro inhibition assays. The crude extract (100% presented inhibition halos with diameter similar to that obtained by using 0.12% chlorhexidine digluconate solution as control. Assays with the fraction dichloromethane showed an inhibitory activity 35% lower than that of the control, whereas no antimicrobial effect was observed with the ethanol-water fraction. Conversely, the results obtained with the fractions hexane and methanol clearly demonstrated antimicrobial activity by inhibiting the bacterial growth. In the methanol fraction, the formation of inhibition halos was similar to that in the control. These data present antimicrobial activity of R. gardneriana against S. mutans.

  15. Estudo in vitro da atividade do extrato etanólico de sementes de bacupari (Rheedia gardneriana Planch. & Triana) e das frações no crescimento de Streptococcus mutans In vitro study of the activity of ethanol extract from "bacupari" (Rheedia gardneriana Planch. & Triana) seeds and its fractions on Streptococcus mutans growth

    OpenAIRE

    S.S Samarão; L.A.S Corrêa; A.S.N Moreira; FREIRE, M.G.M.; M.L.R Macedo

    2010-01-01

    Streptococcus mutans, principal microrganismo da cavidade oral, desempenha papel preponderante na formação de placas dentárias, sendo considerado o agente etiológico primário da cárie. Rheedia gardneriana, conhecida popularmente como bacupari, é uma planta utilizada com fins medicinais para o tratamento de diversas patologias, e por apresentar atividade antimicrobiana de compostos das folhas contra bactérias Gram-positivas e Gram-negativas. O objetivo do presente trabalho foi avaliar o efeito...

  16. Yo quiero ser Marifé de Triana. Experiencia para el desarrollo de la Inteligencia Emocional a través de la Musicoterapia / I want to be Marifé de Triana. An experience for the development of Emotional Intelligence through Music Therapy

    Directory of Open Access Journals (Sweden)

    Sara Prieto Hernández

    2012-01-01

    Full Text Available Resumen: Presentamos el desarrollo de un programa denominado “¡Escúchame!” basado en la experiencia “Mami Sounds” llevada a cabo en Argentina por Federico (2007, teniendo como hilo conductor la Musicoterapia. Nuestro propósito es desarrollar la inteligencia emocional de personas con Síndrome de Down, mediante la estimulación sensorial a través de la música, que genera y despierta toda clase de sentimientos y emociones. Para la evaluación del programa, se han elaborado instrumentos de carácter cualitativo y cuantitativo que nos indican una mejora en las conductas sociales y afectivas de la muestra participante tras la implementación del programa.Abstract: We show the results of a study called “Listen to me”, based on the experience developed in Argentina by Federico (2007, where the leitmotiv is the Music therapy in a sample of people with disabilities, specifically Down syndrome. We implement a programme which mainly works emotional intelligence by using music of different styles. Our aim is to develop the emotional intelligence of people with Down syndrome, by the sensory stimulation through music, which generates and raises all types of feelings and emotions. Results show there is an improvement in social and affective attitudes and behaviors of the people participating in this experience after the implementation of the programme.

  17. Diverse patterns of stored water use among saplings in seasonally dry tropical forests.

    Science.gov (United States)

    Wolfe, Brett T; Kursar, Thomas A

    2015-12-01

    Tree species in seasonally dry tropical forests likely vary in their drought-survival mechanisms. Drought-deciduousness, which reduces water loss, and low wood density, which may permit dependence on stored water, are considered key traits. For saplings of six species at two distinct sites, we studied these and two associated traits: the seasonal amount of water released per stem volume ("water released") and the hydraulic capacitance of the stem (C). Two deciduous species with low stem density, Cavanillesia platanifolia and Bursera simaruba, had high C and high dry-season stem water potential (Ψ(stem)), but differed in dry-season water released. C. platanifolia did not use stored water during the dry season whereas B. simaruba, in a drier forest, released stored water. In both, water released was highest while flushing leaves, suggesting that stored water supports leaf flushing. In contrast, two deciduous species with intermediate stem density, Annona hayesii and Genipa americana, had intermediate C, low dry-season Ψ(stem), and high seasonal change in water released. Meanwhile, two evergreen species with intermediate stem density, Cojoba rufescens and Astronium graveolens, had relatively low C, low dry-season Ψ(stem), and intermediate seasonal change in water released. Thus, at least three, distinct stored-water-use strategies were observed. Additionally, bark relative water content (RWC) decreased along with Ψ(stem) during the dry season while xylem RWC did not change, suggesting that bark-stored water buffers Ψ(stem) seasonally. Together these results suggest that seasonal use of stored water and change in Ψ(stem) are associated with functional groups that are characterized by combinations of deciduousness and stem density. PMID:26025573

  18. Comparative structure of the osmophores in the flowers of Stanhopea graveolens Lindley and Cycnoches chlorochilon Klotzsch (Orchidaceae

    Directory of Open Access Journals (Sweden)

    Mirosława Chwil

    2012-12-01

    Full Text Available The genus Tradescantia comprises about 70 species. In Poland Tradescantia x andersoniana is basically grown as an ornamental plant that is recommended for borders and to be planted around garden ponds. The present study investigated flowering as well as the micromorphological and anatomical features of some floral elements of Tradescantia x andersoniana W. Ludw. Rohweder 'Karin'. The macro- and micromorphology of the flowers was examined using stereoscopic, light, and scanning electron microscopy (SEM. Spiderwort produces flowers with a diameter of 4.6-5 cm, which open early in the morning and close at noon. Non-glandular and glandular hairs grow on the abaxial surface of the calyx and on the apical part of the ovary. The glandular hairs develop a several-celled stalk and a unicellular spherical or elongated head. The staminal filaments produce chain-shaped trichomes. Striate cuticular ornamentation is found on their surface and on the epidermis covering the perianth. The striae on the cells of the stamen hairs run to the two poles of the cell. The pistil develops a wet stigma with unfused unicellular papillae. The cuticle on their surface is smooth, whereas on the style near the stigma it forms dense folds.

  19. De novo assembly, gene annotation and marker development using Illumina paired-end transcriptome sequences in celery (Apium graveolens L..

    Directory of Open Access Journals (Sweden)

    Nan Fu

    Full Text Available BACKGROUND: Celery is an increasing popular vegetable species, but limited transcriptome and genomic data hinder the research to it. In addition, a lack of celery molecular markers limits the process of molecular genetic breeding. High-throughput transcriptome sequencing is an efficient method to generate a large transcriptome sequence dataset for gene discovery, molecular marker development and marker-assisted selection breeding. PRINCIPAL FINDINGS: Celery transcriptomes from four tissues were sequenced using Illumina paired-end sequencing technology. De novo assembling was performed to generate a collection of 42,280 unigenes (average length of 502.6 bp that represent the first transcriptome of the species. 78.43% and 48.93% of the unigenes had significant similarity with proteins in the National Center for Biotechnology Information (NCBI non-redundant protein database (Nr and Swiss-Prot database respectively, and 10,473 (24.77% unigenes were assigned to Clusters of Orthologous Groups (COG. 21,126 (49.97% unigenes harboring Interpro domains were annotated, in which 15,409 (36.45% were assigned to Gene Ontology(GO categories. Additionally, 7,478 unigenes were mapped onto 228 pathways using the Kyoto Encyclopedia of Genes and Genomes Pathway database (KEGG. Large numbers of simple sequence repeats (SSRs were indentified, and then the rate of successful amplication and polymorphism were investigated among 31 celery accessions. CONCLUSIONS: This study demonstrates the feasibility of generating a large scale of sequence information by Illumina paired-end sequencing and efficient assembling. Our results provide a valuable resource for celery research. The developed molecular markers are the foundation of further genetic linkage analysis and gene localization, and they will be essential to accelerate the process of breeding.

  20. EVALUASI, UJI STABILITAS FISIK DAN SINERESIS SEDIAAN GEL YANG MENGANDUNG MINOKSIDIL, APIGENIN DAN PERASAN HERBA SELEDRI (Apium graveolens L.

    Directory of Open Access Journals (Sweden)

    Emma Sri Kuncari

    2015-01-01

    Full Text Available AbstractMinoxidil, apigenin and celery are believed to have the same bioactivity as a vasodilator that can widen blood vessels. This study discusses about the gel formulation in the scope of evaluation of gel preparation, using carbomer as a gelling agent each containing minoxidil, apigenin and celery juice. The method used in gel evaluation were organoleptic observation, homogeneity, pH, consistency and viscosity; physical stability at 40±2 °C, 28±2 °C, 4±2 °C and syneresis. Based on the result, all gel formulations showed their consistency and viscosity were higher after 8 weeks of storage at room temperature. The rheogram of three gel formulations in term of flow properties remain unchanged after 8 weeks of storage. It was indicated that the flow properties of gel formulation was pseudoplastis tixotropic. The gel containing minoxidil, apigenin and celery juice showed good physical stability at 28±2 °C and 40±2 °C, but less stable at 4±2 °C after 14 weeks of storage. The highest number of syneresis was found in a gel containing celery juice.Keywords : Celery, Apigenin, Gel, StabilityAbstrakMinoksidil, apigenin dan seledri memiliki aktivitas biologi yang sama sebagai vasodilator yang dapat memperlebar pembuluh darah. Penelitian ini sebagai evaluasi sediaan gel, menggunakan karbomer sebagai gelling agentyang mengandung masing-masing minoksidil, apigenin dan perasan herba seledri. Metode yang digunakan dalam evaluasi gel adalah pengamatan organoleptis, homogenitas, pH, konsistensi dan viskositas; stabilitas fisik pada suhu 40±2 °C, 28±2 °C, 4±2 °C dan sineresis. Berdasarkan hasil penelitian, ketiga formula gel menunjukkan konsistensi dan viskositas yang lebih tinggi setelah 8  minggu  penyimpanan  pada  temperatur  ruang.  Hasil  rheogram  dari  ketiga  formula gel  menunjukkan  sifat  alir  yang  tetap  tidak  berubah  setelah  8  minggu  penyimpanan, yaitu pseudoplastis tiksotropik. Gel yang mengandung minoxidil, apigenin dan perasan herba seledri menunjukkan stabil fisik pada penyimpanan suhu 28±2 °C dan 40±2 °C, tetapi kurang stabil pada suhu 4±2 °C setelah 14 minggu penyimpanan. Angka sineresis tertinggi terdapat pada gel yang mengandung perasan herba seledri.Kata kunci : Seledri, Apigenin, Gel, Stabilitas

  1. Dinámica de impregnación al vacío en apio (Apium graveolens L. y pepino (Cucumis sativus L.

    Directory of Open Access Journals (Sweden)

    Yisell Martelo C.

    2011-05-01

    Full Text Available Objetivo. Evaluar la respuesta a la impregnación al vacio (IV en apio y pepino, con soluciones isotónicas de NaCl. Materiales y métodos. Se determinaron variables de impregnación en troncos de apio y rodajas de pepino (3 posiciones diferentes a lo largo de su estructura, considerando, fracción y deformación volumétrica en la etapa de vacío (X1 y g1 y atmosférica (X y g, y la porosidad disponible (Ee al proceso IV. Resultados. El apio y pepino no presentaron diferencias estadísticas por efecto de la posición. En las etapas de proceso se obtuvieron para el apio y el pepino valores de X1 (-14.32 ± 2.75 y -5.51±1.76%, g1 (-0.587±0.69 y -0.079±0.99%, X(13.49±2.32 y 6.72±2.72%, g (-1.40±1.042% y -2.33±1.26% y Ee (15.73±2.31 y 9.35±2.57%, respectivamente. Estos resultados indicaron una salida de líquido nativo (X1<0 y una ligera contracción volumétrica de las estructuras (g y g1<0, lo cual se evidenció microestructuralmente. Conclusiones. La respuesta a la IV en apio y pepino, permite identificar estas matrices alimentarias, como aptas para la incorporación de componentes que le proporcionen un valor agregado a estos productos.

  2. Effect of Dill (Anethum graveolens on the severity of primary dysmenorrhea in compared with mefenamic acid: A randomized, double-blind trial

    Directory of Open Access Journals (Sweden)

    Reza Heidarifar

    2014-01-01

    Full Text Available Background: Dysmenorrhea has negative effects on women′s life. Due to side-effects of chemical drugs, there is growing trend toward herbal medicine. The aim of this study was to assess the effect of Dill compared to mefenamic acid on primary dysmenorrhea. Materials and Methods: This double-blind, randomized, clinical trial study was conducted on 75 single female students between 18 and 28 years old educating in Nursing and Midwifery School and Paramedical Faculty of Qom University of Medical Sciences of Iran in 2011. They were allocated randomly into one of the three groups: In Dill group, they took 1000 mg of Dill powder q12h for 5 days from 2 days before the beginning of menstruation for two cycles. Other groups received 250 mg mefenamic acid or 500 mg starch capsule as placebo, respectively. Dysmenorrhea severity was determined by a verbal multidimensional scoring system and a visual analog scale (VAS. Students with mild dysmenorrhea were excluded. Data were analyzed by SPSS using the descriptive statistic, paired-samples t-test, Wilcoxon signed-rank test, Mann-Whitney test, and Kruskal-Wallis test. Results: There were no significant differences between three groups for demographic or descriptive variables. Comprising the VAS showed that the participants of Dill and mefenamic acid groups had lower significant pain in the 1 st and the 2 nd months after treatment, whereas in the placebo group this was only significant in the 2 nd month (P < 0.05. Conclusion: Dill was as effective as mefenamic acid in reducing the pain severity in primary dysmenorrhea. Further studies regarding side-effects of Dill and its interactivity are recommended.

  3. An appropriate method for extracting the insect repellent citronellol from an indigenous plant (Pelargonium graveolens L'Her) for potential use by resource-limited animal owners

    OpenAIRE

    Botha, B. M.; C.M.E. McCrindle

    2000-01-01

    Veterinary needs appraisals in rural, peri-urban and urban areas have indicated a need for affordable and accessible veterinary health care. It was also found that farmers and animal owners used indigenous plants for treating animals. In Africa, insects such as Culex, Culicoides and Stomoxys may transmit diseases, cause irritation to animals or prevent wound healing. Insect repellents used topically are generally safer and cheaper than insecticides. Using readily available commercial sources ...

  4. Antioxidant properties of Pelargonium graveolens L’Her essential oil on the reproductive damage induced by deltamethrin in mice as compared to alpha-tocopherol

    Science.gov (United States)

    2013-01-01

    Background Exposure to the pyrethroid pesticide deltamethrin has been demonstrated to exert a wide range of effects on non-targeted organisms. The beneficial effects of geranuim essential oil (EO) as an antioxidant has been assessed in deltamethrin (DL) orally administered mice by studying whether the reprotoxicity caused by deltamethrin can be effectively combated with the geranium oil and the effects were compared to vitamin E, as the standard reference drug. Result Sixty male albino mice were divided into six equal groups: a control group, a group of mice was given deltamethrin (5 mg/kg b.w.), two groups were administered deltamethrin after having given geranium essential oil (67 mg/kg b.w.) or vitamin E (Vit E) (100 mg/kg b.w.), and two groups received only EO of geranium or Vit E. When compared to control, a dose of deltamethrin 5 mg/kg/day causes a decrease in the epididymal sperm count motility and viability and an increase in the number of abnormal morphology in spermatozoa. DL-exposed mice showed a significant increase of lipid peroxidation (LPP) in the testis compared to control animals. Conclusion Essential oil of geranium prevented testicular oxidative damage explored by reduced LPP and improved total sperm motility, viability and morphology in mice spermatozoa. Our study showed a positive influence of geranium essential oil in the animal male reproductive system similar than that of Vit E. PMID:23496944

  5. Parameters of Cs 137 and Sr 90 transition from soil into salad crops

    International Nuclear Information System (INIS)

    Transition coefficients of Cs 137 and Sr 90 from soil into plants for potherb of bulb onion (Allium cepa), parsley (Petroselinum crispum), dill (Anethum graveolens), celery (Apium graveolens) and coriander (Coriandrum sativum) have been defined. (authors)

  6. Timing the origin and expansion of the Mexican tropical dry forest

    OpenAIRE

    Becerra, Judith X.

    2005-01-01

    Macroevolution examines the temporal patterns of biological diversity in deep time. When combined with biogeography, it can provide unique information about the historical changes in the distribution of communities and biomes. Here I document temporal and spatial changes of diversity in the genus Bursera and relate them to the origin and expansion of the tropical dry forests of Mexico. Bursera is very old, highly adapted to warm dry conditions, and a dominant member of the Mexican tropical dr...

  7. The role of the white-eyed vireo in the dispersal of bersera fruit on the Yucatan Peninsula

    Science.gov (United States)

    Greenberg, R.; Foster, M.S.; Marquez-Valdelamar, L.

    1995-01-01

    White-eyed vireos (Vireo griseus) winter in the forests and secondary growth of the Yucatan Peninsula where Bursera simaruba (Burseraceae) is an abundant tree Twenty-five per cent of all white-eyed vireos observed foraging visited Bursera trees In addition, presence and abundance of territorial white-eyed vireos in small forest patches were correlated with the size of the Bursera crop Vireos were the most reliable dispersers of Bursera seeds These birds visited 32 of 35 trees observed for at least three hours. They accounted for approximately half of all bird visits, and two-thirds of the seeds dispersed. Most of the other species rarely visited (Yucatan Peninsula, may result from the prolonged fruit ripening period (October-March), the relatively depauperate frugivore community and the relatively high density of small Bursera trees in the hurricane-disturbed dry forests. Small trees at all times, and all trees from October to February, depend upon territorial vireos for continuous, highly efficient local dispersal of a small number of fruits In March and April residual fruits ripen rapidly and synchronously, attracting a greater variety of visitors for broad spectrum dispersal during a period of food scarcity. Thus, Bursera has an unusual two-phase phenological pattern, perhaps alternately to take advantage of both specialized and opportunistic dispersers.

  8. Efecto de la aplicación de aceite esencial de orégano mexicano (Lippia graveolens y tomillo (Thymus vulgaris en factores de calidad de rodajas de manzana (Malus domestica

    Directory of Open Access Journals (Sweden)

    Carlos Enrique Ochoa Velasco

    2012-12-01

    Full Text Available El objetivo de este estudio fue evaluar algunos factores de calidad de rodajas de manzana sumergidas en soluciones de aceite esencial (AE de orégano y tomillo. Rodajas de manzana fueron sumergidas en diferentes soluciones de AE: 100 ppm de AE de orégano (T1, 100 ppm de AE de tomillo (T2, 75:25 ppm de AE de orégano:tomillo (T3, 50:50 ppm de AE de orégano:tomillo (T4, 25:75 ppm de AE de orégano:tomillo (T5; 100 ppm de ácido ascórbico (T6 y agua destilada estéril (T7 que se utilizó como control. Las rodajas de manzana fueron empacadas y almacenadas a 5 ºC. Se evaluó el pH, sólidos solubles totales, acidez titulable, color, actividad de la polifenoloxidasa, compuestos fenólicos, actividad antioxidante, bacterias aerobias mesófilas, mohos y levaduras durante 9 días y atributos sensoriales. Después de 9 días de almacenamiento las rodajas de manzana sumergidas en los tratamientos T1 y T3 presentaron menor valor de pH y menos oscurecimiento. T1 y T5 mostraron el menor cambio neto de color, esto se vio reflejado en una baja actividad de la polifenoloxidasa. La aplicación de AE incrementó significativamente (p < 0,05 los compuestos fenólicos y la actividad antioxidante en los tratamientos T2, T3, T4, T5 y T6. Sin embargo, este incremento se redujo drásticamente después de 9 días de almacenamiento, obteniéndose una actividad antioxidante del 32,1 y 35,2 % (respecto al inicio en los tratamientos T6 y T4, respectivamente. Las bacterias aerobias mesófilas se inhibieron durante 3 días en las rodajas de manzana sumergidas en solución T1, mientras que después de 9 días las que presentaron la menor carga de bacterias fueron las rodajas de manzana sumergidas en T2 y T5. Los mohos y levaduras se inhibieron en los tratamientos T1, T2 y T5. Las rodajas de manzana con mayor aceptación sensorial por parte de los jueces fueron las de los tratamientos T4, T6 y T7 al inicio del almacenamiento y de los tratamientos T4, T5 y T6 después de 6 días.

  9. Raadiosse jõudsid eesti laulud Lätist

    Index Scriptorium Estoniae

    2008-01-01

    Eesti Raadiosse jõudsid Eurovisiooni eelvõistlusel Lätis teise koha võitnud Läti ansambli Triana Park eestikeelsed laulud "Kesköine tramm" (muusika Aivars Rakovskis) ja "Reeda mind" (muusika Agnese Rakovska), mille tekstid on kirjutanud Lääne-Virumal Lehtses suvitav raadioajakirjanik Ivan Makarov

  10. Towards the Use of New Methods for Formative e-Assessment of 21st Century Skills in Schools

    NARCIS (Netherlands)

    Rusman, Ellen; Boon, Jo; Martínez-Monés, Alejandra; Rodríguez-Triana, María-Jesús; Retalis, Simeos

    2013-01-01

    Rusman, E., Boon, J., Martínez-Monés, A., Rodríguez-Triana, M. J., & Retalis, S. (2013, 17-21 September). Towards the Use of New Methods for Formative e-Assessment of 21st Century Skills in Schools. Presentation at the Technology Enhanced Formative Assessment (TEFA) workshop (http://www.kbs.uni-hann

  11. Humus forms in two secondary semi-evergreen tropical forests

    OpenAIRE

    Loranger, Gladys; PONGE, Jean-François; Lavelle, Patrick

    2003-01-01

    International audience The dynamics and function of humus forms in tropical forests are still poorly understood. Humus profiles in two secondary semi-evergreen woodlands in Guadeloupe (French West Indies) were analysed micromorphologically. The humus forms are described under the canopy of five dominant tree species at two sites: under Pisonia subcordata and Bursera simaruba in a secondary forest on a Leptosol (Rendzina), and under Swietenia macrophylla, Tabebuia heterophylla and B. simaru...

  12. Diversity and Genetic Structure of the Mexican Endemic Epiphyte Tillandsia achyrostachys E. Morr. ex Baker var. achyrostachys (Bromeliaceae)

    OpenAIRE

    GONZÁLEZ-ASTORGA, JORGE; CRUZ-ANGÓN, ANDREA; Flores-Palacios, Alejandro; Andrew P. Vovides

    2004-01-01

    • Background and Aims The monoecious, bird-pollinated epiphytic Tillandsia achyrostachys E. Morr. ex Baker var. achyrostachys is an endemic bromeliad of the tropical dry forests of Mexico with clonal growth. In the Sierra de Huautla Natural Reserve this species shows a host preference for Bursera copallifera (Sessé & Moc ex. DC) Bullock. As a result of deforestation in the study area, B. copallifera has become a rare tree species in the remaining forest patches. This human-induced disturbance...

  13. [Plant extracts with cytostatic properties growing in Cuba. II].

    Science.gov (United States)

    Lopez Abraham, A M; Rojas Hernandez, N M; Jimenez Misas, C A

    1979-01-01

    The study of the cytostatic activity of aqueous, alcoholic and ketonic extracts from 18 parts of 9 species of superior plants of the families Araceae, Borraginacease, Burseraceae, Cesalpinaceae, Meliaceae, Compositae, Rebiaceae, Cruciferaceae and Verbenaceae using the microbiologic method of described by Kubas in 1972 is pursued. The best results were obtained from Hamelia patens. Lippia alba, Lepidium virginicum, Cassia ligustrina, Bursera simaruba and Heliotropium campechianum extracts. PMID:161406

  14. STUDY OF DRUG LIKENESS ACTIVITY OF PHYTOCHEMICALS IN MEDICINAL PLANTS

    OpenAIRE

    V. Sathya; Gopalakrishnan, V. K.

    2012-01-01

    Phytochemicals in medicinal plants can deliver potential therapeutic drugs such as anticancer, antiviral, antioxidant etc. The plant kingdom is a treasure house of potential drugs and each phytochemical cannot be tested in the wetlab preparations. Hence the main aim of the study is the drug likeness activity of phytochemicals in medicinal plants such as Anethum graveolens, Apium graveolens against hepatocellular carcinoma. These plants have anticancer, antilivercancer, hepatoprotective, antiv...

  15. Impact of plant growth promoting Pseudomonas monteilii PsF84 and Pseudomonas plecoglossicida PsF610 on metal uptake and production of secondary metabolite (monoterpenes) by rose-scented geranium (Pelargonium graveolens cv. bourbon) grown on tannery sludge amended soil.

    Science.gov (United States)

    Dharni, Seema; Srivastava, Atul Kumar; Samad, Abdul; Patra, Dharani Dhar

    2014-12-01

    Bacterial strains PsF84 and PsF610 were isolated from tannery sludge polluted soil, Jajmau, Kanpur, India. 16S rRNA gene sequence and phylogenetic analysis confirmed the taxonomic affiliation of PsF84 as Pseudomonas monteilii and PsF610 as Pseudomonas plecoglossicida. A greenhouse study was carried out with rose-scented geranium (Pelargonium graveolenscv. bourbon) grown in soil treated with tannery sludge in different proportions viz. soil: sludge ratio of 100:0, 25:75, 50:50, 75:25 and 0:100 to evaluate the effects of bacterial inoculation on the heavy metal uptake. The isolates solubilized inorganic phosphorus and were capable of producing indole acetic acid (IAA) and siderophore. The isolate PsF84 increased the dry biomass of shoot by 44%, root by 48%, essential oil yield 43% and chlorophyll by 31% respectively over uninoculated control. The corresponding increase with the isolate PsF610 were 38%, 40%, 39% and 28%, respectively. Scanning electron microscopic (SEM) studies reveal that the Cr(VI) accumulation resulted in breakdown of vascular bundles and sequesters Cr(VI) in roots. The glandular trichomes (GT) were investigated using SEM studies as these glands are probably the main site of essential oil synthesis. Owing to its wide action spectrum, these isolates could serve as an effective metal sequestering and bioinoculants due to the production of IAA, siderophore and solubilization of phosphate for geranium in metal-stressed soil. The present study has provided a new insight into the phytoremediation of metal-contaminated soil. PMID:25194330

  16. НОВЫЕ ВИДЫ ПЛАСТОВОГО МАРМЕЛАДА С ИСПОЛЬЗОВАНИЕМ СЕЛЬДЕРЕЯ (APIUM GRAVEOLENS)

    OpenAIRE

    ИВАНОВА Г.В.; АНИКИН И.С.; КОЛЬМАН О.Я.

    2015-01-01

    В статье с помощью пакета программ Microsoft Office Excel 2007 проведен регрессионный анализ экспериментальных данных. На основании полученных результатов разработана рецептура и технологическая схема производства пластового сельдерейно-лимонного мармелада.

  17. Review of the world species of Exoryza (Hymenoptera, Braconidae, Microgastrinae), with description of five new species

    OpenAIRE

    Fernandez-Triana, Jose L.; Whitfield, James B.; Smith, M. Alex; Dapkey, Tanya; Hallwachs, Winnie; Janzen, Daniel H

    2016-01-01

    The world species of the genus Exoryza (Hymenoptera, Braconidae, Microgastrinae) are revised. Ten species are recognized, including five new, authored by Fernandez-Triana: mariabustosae, richardashleyi, ritaashleyae, rosamatarritae and yeimycedenoae. The species Dolichogenidea oryzae Walker, 1994 is considered as related to Exoryza – although is not formally transferred to that genus. A dichotomous key to all species, descriptions and illustrations are provided. The only region where the genu...

  18. The role of tree size in the leafing phenology of a seasonally dry tropical forest in Belize, Central America

    OpenAIRE

    Sayer, E. J.; Newbery, David McClintock

    2003-01-01

    Leafing phenology of two dry-forest sites on soils of different depth (S = shallow, D = deep) at Shipstern Reserve, Belize, were compared at the start of the rainy season (April-June 2000). Trees greater than or equal to 2.5 cm dbh were recorded weekly for 8 wk in three 0.04-ha plots per site. Ten species were analysed individually for their phenological patterns, of which the three most common were Bursera simaruba, Metopium brownei and Jatropha gaumeri. Trees were divided into those in the ...

  19. Thirteen new records of ferns from Brazil

    Directory of Open Access Journals (Sweden)

    Thais Almeida

    2015-02-01

    Full Text Available Thirteen fern species are reported for the first time for Brazil. Among the new records, eight are from Acre state (Cyathea subincisa, Cyclodium trianae, Elaphoglossum stenophyllum, Hypoderris brauniana, Pleopeltis stolzei, Thelypteris arcana, Thelypteris comosa, Thelypteris valdepilosa, two are from Pará state (Polypodium flagellare, Tectaria heracleifolia, one from Minas Gerais state (Alsophila salvinii, one from Ceará state (Campyloneurum costatum and one from Bahia state (Thelypteris rolandii. Part of the species shows a disjunct occurrence or illustrates floristic relations between Brazilian and Andean Mountains or Central American Mountains.

  20. Contributions to the study of the Holarctic fauna of Microgastrinae (Hymenoptera, Braconidae. I. Introduction and first results of transatlantic comparisons

    Directory of Open Access Journals (Sweden)

    Jose Fernandez-Triana

    2014-03-01

    Full Text Available Specimens of Microgastrinae (Hymenoptera: Braconidae from both sides of the Holarctic region (Nearctic and Palaearctic were sampled for DNA barcoding and examined morphologically. Two species are recorded for the first time for the Nearctic: Apanteles brunnistigma Abdinbekova, and Microgaster raschkiellae Shaw. Another European species, Apanteles xanthostigma (Haliday, previously introduced as a biological control agent, is confirmed to be present in North America. For another 13 species significant range extension is documented, including new records for France, Canada, United States, and Sweden. New host data are also provided for several species. The species name Apanteles masmithi Fernández-Triana is considered a syn. n. of Dolichogenidea britannica (Wilkinson.

  1. Metallic nano-particles in lustre glazed ceramics from the 15th century in Seville studied by PIXE and RBS

    Energy Technology Data Exchange (ETDEWEB)

    Polvorinos del Rio, A. [Departamento de Cristallografia, Mineralogia y Quimica Agricola, Universidad de Sevilla, avenida Reina Mercedes s/n (Spain); Castaing, J. [Laboratoire du centre de recherche et de restauration des musees de France C2RMF CNRS UMR 171, Plais du Louvre, 14 quai Francois Mitterrand, 75001 Paris (France)]. E-mail: jacques.castaing@culture.fr; Aucouturier, M. [Laboratoire du centre de recherche et de restauration des musees de France C2RMF CNRS UMR 171, Plais du Louvre, 14 quai Francois Mitterrand, 75001 Paris (France)

    2006-08-15

    Lustre ceramics, found in a workshop located in Triana (Sevilla), have been analysed to determine the composition of glazes including the metallic particle layers giving rise to the lustre effect. PIXE and RBS were used for the elemental composition and the sub-surface concentration profiles, respectively. Copper and silver at the origin of the lustre are detected by PIXE. RBS gives access to the detailed distribution of the elements in the surface layers. The simulation of RBS spectra confirms the occurrence of thin layers (less than 300 nm) containing metallic silver and/or copper. The results are compared with those obtained on other types of lustre ceramics.

  2. Metallic nano-particles in lustre glazed ceramics from the 15th century in Seville studied by PIXE and RBS

    International Nuclear Information System (INIS)

    Lustre ceramics, found in a workshop located in Triana (Sevilla), have been analysed to determine the composition of glazes including the metallic particle layers giving rise to the lustre effect. PIXE and RBS were used for the elemental composition and the sub-surface concentration profiles, respectively. Copper and silver at the origin of the lustre are detected by PIXE. RBS gives access to the detailed distribution of the elements in the surface layers. The simulation of RBS spectra confirms the occurrence of thin layers (less than 300 nm) containing metallic silver and/or copper. The results are compared with those obtained on other types of lustre ceramics

  3. Notas de la dirección

    OpenAIRE

    Revista, Caldasia

    2012-01-01

    Homenaje a antiguos profesores del ICN-MHN / José Celestino Mutis 1732-1982 / Cambio de directivas / 200 años de La Real Expedición Botánica del Nuevo Reyno de Granada 1782 – 1982 (Acuerdo numero 144 de 1982 del Consejo Superior Universitario: por el cual se celebra el segundo centenario de la creación de La Real Expedición Botánica de! Nuevo Reyno de Granada) / Programa Flora de Colombia / Biblioteca José Jerónimo Triana / Título de Profesor Honorario / Acuerdo número 20, con fecha 16 de mar...

  4. Fast solar wind measurements from the Bright Monitor of the Solar Wind instrument on Spektr-R

    Science.gov (United States)

    Zerbo, J. L.; Safrankova, J.; Nemecek, Z.; Zastenker, G. N.; Kasper, J. C.; Stevens, M. L.; Richardson, J. D.

    2014-12-01

    Fast solar wind measurements from the Bright Monitor of the Solar Wind instrumentonboard the Spektr-R spacecraft are presented. This instrument measures plasmaparameters with time resolution as high as 30 ms. These measurements provide a preview of what the fast Faraday cup detectors on Triana and Solar Probe Plus will observe. We will compare solar wind structures observed at Spektr-R at high time-resolution with lower cadence observations from Wind. We will describe the small-scale plasma parameters in these solar wind structures.

  5. Keylimepie peckorum gen. n. and sp. n., (Hymenoptera, Braconidae) from southern Florida, U.S., the first known brachypterous member of the subfamily Microgastrinae

    OpenAIRE

    Fernandez-Triana, Jose; Boudreault, Caroline

    2016-01-01

    Keylimepie peckorum Fernandez-Triana, gen. n. and sp. n., are described from southern Florida, U.S. Females have the shortest wings (0.6–0.7 × body length) of any known microgastrine wasp. The genus can also be recognized on features of the head, propodeum and first three metasomal tergites. All specimens were collected in hammock forests of the Florida Keys and Everglades National Park, but their host caterpillar is unknown. Because its morphology is unique and it is the first new microgastr...

  6. Keylimepie peckorum gen. n. and sp. n., ( Hymenoptera , Braconidae ) from southern Florida, U.S., the first known brachypterous member of the subfamily Microgastrinae

    OpenAIRE

    Fernandez-Triana, Jose; Boudreault, Caroline

    2016-01-01

    Abstract Keylimepie peckorum Fernandez-Triana, gen. n. and sp. n., are described from southern Florida, U.S. Females have the shortest wings (0.6–0.7 × body length) of any known microgastrine wasp. The genus can also be recognized on features of the head, propodeum and first three metasomal tergites. All specimens were collected in hammock forests of the Florida Keys and Everglades National Park, but their host caterpillar is unknown. Because its morphology is unique and it is the first new m...

  7. Frugivoria e potencial dispersão de sementes pelo marsupial Gracilinanus agilis (Didelphidae: Didelphimorphia) em áreas de Cerrado no Brasil central Frugivory and potential seed dispersal by the marsupial Gracilinanus agilis (Didelphidae: Didelphimorphia) in areas of Cerrado in central Brazil

    OpenAIRE

    Nícholas Ferreira de Camargo; Ramatis Machado Scarponi Cruz; Juliana Fernandes Ribeiro; Emerson Monteiro Vieira

    2011-01-01

    No presente estudo, investigamos o consumo de frutos e viabilidade de sementes consumidas pelo marsupial Gracilinanus agilis (Burmeister, 1854) em quatro áreas de cerradão do Brasil central. Análises fecais indicaram que este mamífero se alimenta de plantas pioneiras da família Melastomataceae (Miconia albicans (Sw.) Triana, M. cuspidata Naudin, M. ferruginata DC., M. pepericarpa DC., M. pohliana Cogn. e Ossaea congestiflora (Naudin) Cogn.), Solanaceae (uma espécie não identificada) e Viscace...

  8. Antimicrobial Effect of Escherichia Coli on Essential Oils Derived from Romanian Aromatic Plants

    OpenAIRE

    Şandru Daniela Maria

    2015-01-01

    This paper investigates the antimicrobial action of Escherichia coli ATCCR CRM-8739TM on the following essential oils: Teucrium marum, Pinus sylwestris, Thymus vulgaris, Salviae aethedaroleum, Cinnamomum aromaticum, Hippophae rhamnoides, Lavandula angustifolia, Abies alba, Zingiber officinale, Anethum graveolens, Coriandrum sativum, Origanum vulgare, extracted industrialy from romanian plants, using the diffusion disc method. The most intense activity was observed at the essential oil of Cinn...

  9. Antimicrobial Susceptibility of Escherichia coli Strains Isolated from Alouatta spp. Feces to Essential Oils

    OpenAIRE

    Valéria Maria Lara; Adriano Bonfim Carregaro; Deise Flores Santurio; Mariangela Facco de Sá; Janio Moraes Santurio; Sydney Hartz Alves

    2016-01-01

    This study evaluated the in vitro antibacterial activity of essential oils from Lippia graveolens (Mexican oregano), Origanum vulgaris (oregano), Thymus vulgaris (thyme), Rosmarinus officinalis (rosemary), Cymbopogon nardus (citronella), Cymbopogon citratus (lemongrass), and Eucalyptus citriodora (eucalyptus) against Escherichia coli (n = 22) strains isolated from Alouatta spp. feces. Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) were determined for each ...

  10. First Report of Apium Virus Y on Cilantro, Celery, and Parsley in California.

    Science.gov (United States)

    Recently Apium virus Y (ApVY) was detected in field grown cilantro (Coriandrum sativum), celery (Apium graveolens), and parsley (Petroselinum crispum) in California. Previously, in 2003, cilantro plants from 3 different fields in California showed symptoms of mosaic, vein clearing and stunting. Whe...

  11. Alternativní způsoby ochrany zeleniny proti houbovým patogenům

    OpenAIRE

    Zusková, Eva

    2014-01-01

    This thesis is focused on assessment of the effectiveness of 12 selected essential oils originaly from the following plants Thymus vulgaris, Mentha spicata, Rosmarinus officinalis, Pelargonium graveolens, Citrus sinensis, Eucalypthus citriodora, Litsea cubeba, Pelargonium odoratissimum, Cymbopogon citratus, Pimpinella anisum, Foeniculum vulgare, Artemisia dracunculus, against selected pathogens Botrytis cinerea, Alternaria solani and Alternaria brassicae. The first chapter of literature re...

  12. Effect of Gamma Irradiation And Some Plant Oils on Mating Competitiveness of Phthorimaea operculella (Zeller)(Lepidoptera: Gelechiidae)

    International Nuclear Information System (INIS)

    This study was carried out to investigate the effect of gamma radiation and plant oils on mating competitiveness of Phthorimaea operculella. When full grown pupae were irradiated with two sub-sterilizing doses and sterilizing dose (650 Gy) separately or combined with LC50 of 2% conc. Menth pepirita or Pelargonium graveolens. The fecundity and fertility were decreased by increasing the radiation dose. When males of Ph. operculella (Zeller) were sub-sterilized with gamma irradiation (150 or 200 Gy) or sterilized by 650 Gy and caged with non-irradiated pairs of adults at ratios of 1:1:1 and 5:1:1 (I male : U male : U female), the calculated degree of competitiveness showed that males irradiated with the lowest dose (150 Gy and 150 Gy + 2% conc. of M. pepirita or P. graveolens) were more competitive than males irradiated with the highest dose (650Gy). However, increasing the ratio of irradiated males with 650 Gy + 2% conc. M. pepirita to 10 increased the competitiveness value (CV), and the irradiated males were full competitive. The CV was more high among the irradiated males with 200 Gy while males were full competitive when irradiated and treated with 200 Gy + 2% conc. P. graveolens. The irradiated males with 150 Gy separately or combined with plant oil could be used in an effective sterile male release program at the ratio 1:1 (I male:N male) after suppression the field population with LC50 2% of plant oils M. pepirita or P. graveolens

  13. EST data: 8680 [RED

    Lifescience Database Archive (English)

    Full Text Available ST3645 D41273 AU174297 DPlate 090 H05 AAAAGCCCCCATTATTGTTC AGGAGGAGAGATTGCAGGAG >AGU83687_1(U836 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  14. EST data: 8002 [RED

    Lifescience Database Archive (English)

    Full Text Available SS4252 D48175 AU032804 S14252 4 G DPlate 083 B05 CGCAAATACACGAAATATAG TGCTTGATGAATTATGAGTC >AGU8 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  15. EST data: 8329 [RED

    Lifescience Database Archive (English)

    Full Text Available ST0625 AU163183 AU163184 S00625 4 G DPlate 086 A10 ACTTGGCAGGCTGGTTGGTG GAGTGGTTTGGGTCCGTTTC >AG ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  16. Probe data: 5652 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED D41273 AU174297 ST3645 >AGU83687_1(U83687|pid:g1835701) Apium graveolens NADP ... H-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  17. fRNAdb Summary: FR183814 [

    Lifescience Database Archive (English)

    Full Text Available FR183814 AF110534,AF110535,AF110536,AF110537,AF110539,AF110540,AF110542,AF110543,AF110545,AF1105 ... ium graveolens,Conium maculatum,Pseudorlaya pumila,Laser pitium siler,Scandix pecten-veneris,Crithmum mariti ... lica sylvestris,Bifora radians,Cymopterus globosus,Laser pitium hispidum,Lomatium californicum,Thaspium trif ...

  18. Major Cytogenetic Landmarks and Karyotype analysis in Carrot and Other Apiaceace

    Science.gov (United States)

    Chromosome localization of the rDNA gene clusters was determined for the first time in several Apiaceae using double-color fluorescence in situ hybridization (FISH). Twenty-one Apioideae species including taxa of economic importance (e.g. Apium graveolens, Coriandrum sativum, Cumin cyminum, Daucus c...

  19. Distributing Workflows over a Ubiquitous P2P Network

    Directory of Open Access Journals (Sweden)

    Eddie Al-Shakarchi

    2007-01-01

    Full Text Available This paper discusses issues in the distribution of bundled workflows across ubiquitous peer-to-peer networks for the application of music information retrieval. The underlying motivation for this work is provided by the DART project, which aims to develop a novel music recommendation system by gathering statistical data using collaborative filtering techniques and the analysis of the audio itsel, in order to create a reliable and comprehensive database of the music that people own and which they listen to. To achieve this, the DART scientists creating the algorithms need the ability to distribute the Triana workflows they create, representing the analysis to be performed, across the network on a regular basis (perhaps even daily in order to update the network as a whole with new workflows to be executed for the analysis. DART uses a similar approach to BOINC but differs in that the workers receive input data in the form of a bundled Triana workflow, which is executed in order to process any MP3 files that they own on their machine. Once analysed, the results are returned to DART's distributed database that collects and aggregates the resulting information. DART employs the use of package repositories to decentralise the distribution of such workflow bundles and this approach is validated in this paper through simulations that show that suitable scalability is maintained through the system as the number of participants increases. The results clearly illustrate the effectiveness of the approach.

  20. Antifungal activity of 10 Guadeloupean plants.

    Science.gov (United States)

    Biabiany, Murielle; Roumy, Vincent; Hennebelle, Thierry; François, Nadine; Sendid, Boualem; Pottier, Muriel; Aliouat, El Moukhtar; Rouaud, Isabelle; Lohézic-Le Dévéhat, Françoise; Joseph, Henry; Bourgeois, Paul; Sahpaz, Sevser; Bailleul, François

    2013-11-01

    Screening of the antifungal activities of ten Guadeloupean plants was undertaken to find new extracts and formulations against superficial mycoses such as onychomycosis, athlete's foot, Pityriasis versicolor, as well as the deep fungal infection Pneumocystis pneumonia. For the first time, the CMI of these plant extracts [cyclohexane, ethanol and ethanol/water (1:1, v/v)] was determined against five dermatophytes, five Candida species, Scytalidium dimidiatum, a Malassezia sp. strain and Pneumocystis carinii. Cytotoxicity tests of the most active extracts were also performed on an HaCat keratinocyte cell line. Results suggest that the extracts of Bursera simaruba, Cedrela odorata, Enterolobium cyclocarpum and Pluchea carolinensis have interesting activities and could be good candidates for developing antifungal formulations. PMID:23280633

  1. Screening of the topical anti-inflammatory activity of some Central American plants.

    Science.gov (United States)

    Sosa, S; Balick, M J; Arvigo, R; Esposito, R G; Pizza, C; Altinier, G; Tubaro, Aurelia

    2002-07-01

    Hexane, chloroform and methanol extracts of seven herbal drugs used in the folk medicine of Central America against skin disorders (Aristolochia trilobata leaves and bark, Bursera simaruba bark, Hamelia patens leaves, Piper amalago leaves, and Syngonium podophyllum leaves and bark) were evaluated for their topical anti-inflammatory activity against the Croton oil-induced ear oedema in mice. Most of the extracts induced a dose-dependent oedema reduction. The chloroform extract of almost all the drugs exhibited interesting activities with ID(50) values ranging between 108 and 498 micro g/cm(2), comparable to that of indomethacin (93 micro g/cm(2)). Therefore, the tested plants are promising sources of principles with high anti-inflammatory activity. PMID:12065153

  2. Screening of anti-bacterial activity of medicinal plants from Belize (Central America).

    Science.gov (United States)

    Camporese, A; Balick, M J; Arvigo, R; Esposito, R G; Morsellino, N; De Simone, F; Tubaro, A

    2003-07-01

    Twenty-one extracts from seven herbal drugs, Aristolochia trilobata (Aristolochiaceae) leaves and bark, Bursera simaruba (Burseraceae) bark, Guazuma ulmifolia (Sterculiaceae) bark, Hamelia patens (Rubiaceae) leaves and Syngonium podophyllum (Araceae) leaves and bark, used in traditional medicine of Belize (Central America) as deep and superficial wound healers, were evaluated for their anti-bacterial properties. Activity was tested against standard strains of Escherichia coli ATCC 25922, Pseudomonas aeruginosa ATCC 27853, Staphylococcus aureus ATCC 25923 and Enterococcus faecalis ATCC 29212. Almost all the extracts were able to inhibit the growth of one or more of the bacterial strains, except that of Enterococcus faecalis. For the first time an anti-microbial activity is reported for Aristolochia trilobata as well as for Syngonium podophyllum. The hexane extracts of Aristolochia trilobata leaves and bark were the most active extracts against Staphylococcus aureus (MIC=0.31 and 0.625mg/ml, respectively). PMID:12787962

  3. Potential of the Combined use of Inherited Sterility and Four Botanical Extracts for the Control of Sitotroga cerealella (Olivier)

    International Nuclear Information System (INIS)

    Newly hatched larvae of the Angoumois grain moth, Sitotroga cerealella (Lepidoptera: Gelechiidae) were used to evaluate the effect of four aqueous plant extracts on the percentages of penetration, pupation, emergence, sex ratio, developmental period and reproduction of resulting adults from maize kernel. Nerium oleander and Azadirachta indica, were completely reduced infestation of larvae and induce high sterility for resulting adults at concentration 50%. The other extracts, Anethum graveolens and Lantana camara succeeded to minimize the damage and viability of larvae. The persistence of the toxicity of aqueous plant extracts of N. oleander and A. graveolens was better within three weeks but L. camara and A. indica was lost rapidly up to two week. The combined effect of four plant extracts and F1 progeny of S. cerealella, descending from irradiated male pupae with gamma radiation at 175 Gy it could increase the efficacy of F-1 sterility technique

  4. Responses of a tropical tree species to ozone: visible leaf injury, growth, and lipid peroxidation.

    Science.gov (United States)

    Cassimiro, Jéssica C; Moraes, Regina M

    2016-04-01

    The Brazilian native tree species Astronium graveolens was indicated as sensitive to ozone in a fumigation experiment. Thus, the objective of this study was to evaluate how sensitive A. graveolens is to ozone under realistic conditions in the field. Eighteen saplings were exposed to ozone in a contaminated area and in a greenhouse with filtered air during two exposure periods of approximately 63 days each (March-May 2012 and September-October 2012). Leaf injury was analyzed by means of its incidence and severity, the leaf injury index (LII) and the progression of leaf abscission. These variables were monitored weekly, whereas growth and lipid peroxidation were monitored monthly. Plants exposed to ozone showed significant growth decrease and visible leaf injury increase, but lipid peroxidation and leaf abscission remained unchanged. These results indicated that plants subjected to ozone possibly diverted energy from growth to the production of antioxidants necessary to cope with ozone-induced oxidative stress. PMID:26780049

  5. ANTIMICROBIAL POTENTIAL OF VOLATILE OIL ISOLATED FROM SOME TRADITIONAL INDIAN SPICES

    Directory of Open Access Journals (Sweden)

    Bhuyan Anupam

    2012-04-01

    Full Text Available In the present study the antimicrobial activity of Volatile Oils isolated from Traditional Indian Spices, Anethum Graveolens (Umbelliferae, Foeniculum Vulgare (Umbelliferae and Coriandrum Sativum (Umbelliferae were studied. The isolated Volatile Oils in varying concentrations were studied against Staphylococcus Coagulase, E.Coli, Streptococcus fecaelis and Staphylococcus aureus, by paper disc diffusion method, using Amoxicillin as standard drug.The results indicated that all the Volatile Oil samples from Anethum Graveolens (Dill, Foeniculum Vulgare (Fennel and Coriandrum Sativum (Coriender has antimicrobial potential and were active against almost all the microorganisms but in a dose dependent manner. Foeniculum Vulgare by far was the most potent volatile oil showing the highest activity against Staphylococcus Coagulase.

  6. Repellent activity of plant-derived compounds against Amblyomma cajennense (Acari: Ixodidae) nymphs.

    Science.gov (United States)

    Soares, Sara Fernandes; Borges, Lígia Miranda Ferreira; de Sousa Braga, Raquel; Ferreira, Lorena Lopes; Louly, Carla Cristina Braz; Tresvenzol, Leonice Manrique Faustino; de Paula, José Realino; Ferri, Pedro Henrique

    2010-01-20

    Repellence responses of Amblyomma cajennense nymphs to callicarpenal, intermedeol, Hyptis suaveolens essential oil, extract of Melia azedarach, Cymbopogon nardus, Spiranthera odoratissima, Chenopodium ambrosioides, Ageratum conyzoides, Mentha pulegium, Ruta graveolens, and Memora nodosa were studied. Among these the extract of C. nardus stood out because of the long-lasting repellence, maintaining, in the highest concentration, 35h of protection against 90% of the nymphs. The essential oil of H. suaveolens and the extracts of C. ambrosioides and A. conyzoides showed good repellence index (66%) when applied in high concentrations. However, greater protection could be obtained at higher concentrations but with a shorter repellence time. Callicarpenal, intermedeol, extract of M. Pulegium, and M. nodosa leaves showed moderate repellence in high concentrations. Extracts from M. azedarach, R. graveolens, S. odoratissima, and M. nodosa roots showed little or no repellent effect. These results show that some plant extracts may represent a promising alternative in the control of infestations by A. cajennense. PMID:19897309

  7. Antimicrobial Effect of Escherichia Coli on Essential Oils Derived from Romanian Aromatic Plants

    Directory of Open Access Journals (Sweden)

    Şandru Daniela Maria

    2015-07-01

    Full Text Available This paper investigates the antimicrobial action of Escherichia coli ATCCR CRM-8739TM on the following essential oils: Teucrium marum, Pinus sylwestris, Thymus vulgaris, Salviae aethedaroleum, Cinnamomum aromaticum, Hippophae rhamnoides, Lavandula angustifolia, Abies alba, Zingiber officinale, Anethum graveolens, Coriandrum sativum, Origanum vulgare, extracted industrialy from romanian plants, using the diffusion disc method. The most intense activity was observed at the essential oil of Cinnamomum aromaticum (cinnamon and the mildest activity was observed at Zingiber officinale (ginger. Many of the essential oils tested exhibited moderate antimicrobial activity, as Teucrium marum, Thymus vulgaris, Hippophae rhamnoides, Lavandula angustifolia,Coriandrum sativum. The lowest antibacterial activity was exhibited on Pinus sylwestris, Salviae aethedaroleum, Zingiber officinale and Anethum graveolens.

  8. Characterization of rue extract and its potential for controlling rice blast

    OpenAIRE

    Karinna Bannach Reis; Marcio Vinicius de Carvalho Barros Côrtes; Frederico Severino Martins; Marta Cristina Corsi de Filippi; José Realino de Paula; Edemilson Cardoso da Conceição

    2015-01-01

    Abstract: The objective of this work was to purify and standardize the rue (Ruta graveolens) extract and evaluate its effect on Magnaporthe oryzae as an alternative to the integrated management of rice blast. The drug was characterized, the liquid extract was obtained, and the methodology for quantifying the standard markers psoralen and bergapten was validated. Rue extract and the markers, solely or in combination, were assayed in vitro, as well as in greenhouse conditions, for their ability...

  9. USE OF BOTANICAL INSECTICIDES AS AN ALTERNATIVE FOR THE MANAGEMENT OF THE MEXICAN BEAN WEEVIL

    Directory of Open Access Journals (Sweden)

    KAREN FERREIRA DA SILVA

    2016-01-01

    Full Text Available This study aimed to evaluate the insecticidal activity of eight botanical species in the behavior and biological development of Zabrotes subfasciatus (Coleoptera: Chrysomelidae: Bruchinae under laboratory conditions. The botanical species were applied on bean grains (Phaseolus vulgaris Linnaeus directly as powder or indirectly within TNT bags. Three laboratory assays were performed. First, a repellent activity test was performed by exposing twenty couples of Z. subfasciatus adults in a choice-test arena. Second, a mortality test was performed for seven days after infestation. Finally, the oviposition and emergency rates of adults (% and the development from egg to adult (in days were evaluated in seven couples (males and females for seven days inside of a vial containing 0.3g of the powder from each botanical species and 10 g of bean grains (3% w.w-1. The study was conducted in a completely randomized design, and the treatments were arranged as a factorial design (2 x 9 with two factors (factor 1= powder and TNT bag application forms and factor 2= eight botanical species and control with eight replications. The powder application form was more efficient in controlling Z. subfasciatus. Azadirachta indica (powder application, Ruta graveolens (powder application, and Piper aduncum (TNT bag reduced the infestation of adults. The species A. inidica, Piper tuberculatum, Trichilia catigua, Pfaffia glomerata, R. graveolens, and Mentha pulegium inhibited the oviposition of the insects regardless of the formulation applied. R. graveolens (powder application caused 100% of mortality. The powder application of R. graveolens and M. pulegium reduced egg viability and insect emergence; therefore, they are very promising alternatives to control Z. subfasciatus in stored grains.

  10. Morphology, anatomy and influence of drying on germination of seeds of Calendula officinalis Morfoanatomía y efecto del secado en la germinación de semillas de caléndula y eneldo

    OpenAIRE

    Victoria T. Jorge A.; Sánchez O Manuel Salvador; Bonilla C Carmen Rosa

    2007-01-01

    Laboratory tests with seed of Calendula officinalis and Anethum graveolens to describe morphology and anatomy components such as humidity content in balance (CHB) in different atmospheres to get appropriate conservation of the germsplasm to determine physiological behavior in short seed storage to evaluate and to stablish an appropriate methodology for germination, were carried out. The morphological and anatomical description allowed to specify and to illustrate the organs and internal struc...

  11. ANALYSIS OF SOME ESSENTIAL ELEMENTS IN MEDICINAL PLANTS USED IN AYURVEDA

    OpenAIRE

    Om Prakash Rout; Rabinarayan Acharya; Rakshapal Gupta; Sagar Kumar Mishra; Rashmibala Sahoo

    2013-01-01

    This study presents a preliminary data of occurrence of elemental concentration in medicinal plants i.e Apium graveolens (seed), Sida cordifolia (root), Solanum surattense (whole plant), Tribulus terrestris(fruit) and Withania somnifera (root) used in Ayurveda, using Atomic absorption spectrometer (AAS) following standard procedures. The elemental concentration i.e. Mn, Na, K, Cl, Ca, Cr, Co, Cu, Fe, Pb, Zn, Ni, Cd and Hg were found in various proportions. The data obtained from the study can...

  12. Slope variation and population structure of tree species from different ecological groups in South Brazil

    OpenAIRE

    Edmilson Bianchini; Garcia, Cristina C.; José A. Pimenta; José M.D. Torezan

    2010-01-01

    Size structure and spatial arrangement of 13 abundant tree species were determined in a riparian forest fragment inParaná State, South Brazil (23"16'S and 51"01'W). The studied species were Aspidosperma polyneuron Müll. Arg., Astronium graveolens Jacq. and Gallesia integrifolia (Spreng) Harms (emergent species); Alseis floribunda Schott, Ruprechtia laxiflora Meisn. and Bougainvillea spectabilis Willd. (shade-intolerant canopy species); Machaerium paraguariense Hassl, Myroxylum peruiferum L. a...

  13. Apuntes sobre la flora gallega, XVII

    OpenAIRE

    Amigo Vázquez, Javier; Pulgar Sañudo, Íñigo

    2005-01-01

    Presentamos un nuevo capítulo dentro de la serie de contribuciones al conocimiento actualizado de la Flora de Galicia, aportando información de interés corológico sobre 11 taxa recolectados: Bidens frondosa L., Crypsis alopecuroides (Piller & Mitterp.) Schrad., Cyperus fuscus L., Cyperus michelianus (L.) Link, Dittrichia graveolens (L.) Desf., Echinochloa crus-galli (L.) P. Beauv. subsp. hispidula (Retz.) Honda, Eragrostis curvula (Schrad.) Nees, Hypericum hirsutum L., Lindernia dubia (L.) Pe...

  14. Antimicrobial and antiviral effects of essential oils from selected Umbelliferae and Labiatae plants and individual essential oil components

    OpenAIRE

    ORHAN, İlkay ERDOĞAN; ÖZÇELİK, Berrin; Kartal, Murat; Kan, Yüksel

    2012-01-01

    The essential oils obtained from Anethum graveolens, Foeniculum vulgare collected at fully-mature and flowering stages, Mentha piperita, Mentha spicata, Lavandula officinalis, Ocimum basilicum (green- and purple-leaf varieties), Origanum onites, O. vulgare, O. munitiflorum, O. majorana, Rosmarinus officinalis, Salvia officinalis, and Satureja cuneifolia, as well as the widely encountered components in essential oils (g-terpinene, 4-allylanisole, (-)-carvone, dihydrocarvone, D-limonene, (-)-ph...

  15. Sviluppo di fertilizzanti azotati con inibitore della nitrificazione di origine vegetale

    OpenAIRE

    Di Cillo, Pardo

    2012-01-01

    Le proprietà di inibizione della nitrificazione di sostanze naturali offrono potenziali benefici per l’agricoltura e l’ambiente. Al fine di valutare le performance di oli estratti da Mentha spicata e Artemisia annua e di Acque di Vegetazione delle Olive come inibitori della nitrificazione per regolare la trasformazione dell’azoto dal Solfato Ammonico. Questi effetti sull’efficienza dell’uso dell’azoto sono stati testati su sedano (Apium graveolens). I risultati di questa ricerca suggeriscono ...

  16. Searching for native tree species and respective potential biomarkers for future assessment of pollution effects on the highly diverse Atlantic Forest in SE-Brazil

    International Nuclear Information System (INIS)

    This study summarizes the first effort to search for bioindicator tree species and respective potential biomarkers for future assessment of potential mixed pollution effects on the highly diverse Atlantic Forest in SE-Brazil. Leaves of the three most abundant species inventoried in a phytosociological survey (Croton floribundus, Piptadenia gonoacantha and Astronium graveolens) were collected in four forest remnants during winter and summer (2012). Their potential bioindicator attributes were highlighted using a screening of morphological, chemical and biochemical markers. The leaf surface structure and/or epicuticular wax composition pointed the accumulator properties of C. floribundus and P. gonoacantha. C. floribundus is a candidate for assessing potential accumulation of Cu, Cd, Mn, Ni, S and Zn. P. gonoacantha is a candidate to monitor polycyclic aromatic hydrocarbons. Increased levels of secondary metabolites and decreased antioxidant capacity in leaves of A. graveolens may support its value as a bioindicator for oxidative pollutants by visible dark stipplings. - Highlights: • We searched for tree species from Atlantic Forest for future air pollution monitoring in Brazil. • Croton floribundus, Astronium graveolens and Piptadenia gonoacantha were possible bioindicators. • P. gonoachanta was a potential bioindicator of polycyclic aromatic hydrocarbons. • C. floribundus was a potential bioindicator of heavy metals and sulfur. • A. graveolens may be used for monitoring oxidative pollutants, due to its biochemical leaf traits. - Inherent characteristics of the most abundant native tree species were potential biomarkers for assessing pollution effects on the highly diverse Atlantic Forest in SE-Brazil

  17. Efecto de la incorporación de plantas antagónicas sobre la actividad parasítica del nematodo del nudo de la raíz meloidogyne hapla en un cultivo de zanahoria bajo condiciones de invernadero

    OpenAIRE

    Alvarez, César G.; Torres, Enrique; de Vis, Raf

    2011-01-01

    En el Centro de Investigaciones y Asesorías Agroindustriales (CIAA) de la Universidad Jorge Tadeo Lozano, localidad de Chía (Cundinamarca), se llevó a cabo un ensayo bajo condiciones de invernadero para evaluar el efecto de la incorporación de material vegetal fresco proveniente de siete especies de plantas (Tagetes zipaquirensis, T. erecta, Brassica cempestris, Bidens pilosa, Ruta graveolens, Taraxacum officinale y Ricinus communis) sobre el rendimiento y calidad comercial de un cultivo de z...

  18. Hepatoprotective activity of two plants belonging to the Apiaceae and the Euphorbiaceae family.

    Science.gov (United States)

    Ahmed, Bahar; Alam, Tanveer; Varshney, Manoj; Khan, Shah Alam

    2002-03-01

    The different extracts of Apium graveolens Linn. (Apiaceae) and Croton oblongifolius Roxb. (Euphorbiaceae) were tested for their hepatoprotective activity against CCl(4) induced hepatotoxicity in albino rats. The degree of protection was measured by using biochemical parameters like serum transaminases (SGOT and SGPT), alkaline phosphatase, total protein and albumin. The methanolic extracts showed the most significant hepatoprotective activity comparable with standard drug silymarin. Other extracts namely petroleum ether and acetone also exhibited a potent activity. PMID:11849834

  19. Total Phenolic, Flavonoids and Antioxidant Capacity of Some Medicinal and Aromatic Plants

    OpenAIRE

    Melinda Nagy; Maria Tofană; Sonia A. Socaci; Ana viorica Pop; Maria Doiniţa Borş; Anca Fărcaş; Ovidiu Moldovan

    2014-01-01

    Abstract: Antioxidants are substances that protect cells from the induced oxidative stress damage caused by unstable molecules known as free radicals that. Antioxidants neutralize free radicals as a natural by-product of normal cell processes. In the present study,were evaluated  the phenolic and flavonoids contents as well as the antioxidant capacity of seeds from  the Lamiaceae and Apiaceae family: fennel  (Foeniculum vulgare), dill (Anethum graveolens) and rosemary (Rosmarinus officin...

  20. Green corrosion inhibitors for carbon steel by green leafy vegetables extracts in 1 M HCl

    OpenAIRE

    Ghadah M. Al-Senani; Sameerah I. Al-Saeedi; Rasmiah Almufarij

    2015-01-01

    The effect of some Green Leafy Vegetables (GLV) extracts namely Lactuca sativa (Lactuca), Eruca Sativa (Arugula), Petroselinum crispum (Parsley), and Anethum Graveolens (Dill) were investigated on inhibition of corrosion carbon steel in 1 M HCl solution using gravimetric (weight loss) method. The inhibition efficiency has increased as concentration of the extract increased. The inhibition efficiency has decreased as the temperature increased. The results obtained showed that GLV extracts inh...

  1. Antidiabetic and Cytotoxicity Screening of Five Medicinal Plants Used by Traditional African Health Practitioners in the Nelson Mandela Metropole, South Africa

    OpenAIRE

    van Huyssteen, Mea; Milne, Pieter J; Campbell, Eileen E; VAN DE VENTER, MARYNA

    2010-01-01

    Diabetes mellitus is a growing problem in South Africa and of concern to traditional African health practitioners in the Nelson Mandela Metropole, because they experience a high incidence of diabetic cases in their practices. A collaborative research project with these practitioners focused on the screening of Bulbine frutescens, Ornithogalum longibracteatum, Ruta graveolens, Tarchonanthus camphoratus and Tulbaghia violacea for antidiabetic and cytotoxic potential. In vitro glucose utilisatio...

  2. The socio-economic importance of the Apiales

    OpenAIRE

    Heywood, Vernon H.

    2015-01-01

    Within the Apiales, the Apiaceae (Umbelliferae) is by far the most important family, both economically and socially. Although it includes the carrot (Daucus carota), one of the world’s leading root crops, and other widely consumed vegetables such as parsnip (Pastinaca sativa), celery and celeriac (Apium graveolens), the family is perhaps best known for its remarkable diversity of culinary herbs, flavourings, condiments and spices, such as parsley, dill, coriander, anise, chervil, caraway, and...

  3. EST data: 731 [RED

    Lifescience Database Archive (English)

    Full Text Available CB2762 C26646 AU108627 C12762 4 G DPlate 008 C08 5' AAC AAT AAT GGG GGC TTT TC 3' 5' TTA TTG ATT ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  4. Massage with aromatherapy: effectiveness on anxiety of users with personality disorders in psychiatric hospitalization

    OpenAIRE

    Thiago da Silva Domingos; Eliana Mara Braga

    2015-01-01

    OBJECTIVE To investigate the effectiveness of aromatherapy massage using the essential oils (0.5%) of Lavandula angustifolia and Pelargonium graveolens for anxiety reduction in patients with personality disorders during psychiatric hospitalization. METHOD Uncontrolled clinical trial with 50 subjects submitted to six massages with aromatherapy, performed on alternate days, on the cervical and the posterior thoracic regions. Vital data (heart and respiratory rate) were collected before and afte...

  5. Stinkwort is rapidly expanding its range in California

    OpenAIRE

    Brownsey, Rachel; Kyser, Guy B; DiTomaso, Joseph M.

    2013-01-01

    Stinkwort (Dittrichia graveolens) is a Mediterranean native that has become a weed in areas of Europe as well as in Australia. This strongly aromatic weed was first reported in California in 1984 in Santa Clara County, and it had spread to 36 of the 58 California counties by 2012. Stinkwort is not palatable to animals, and can be poisonous to livestock and cause contact allergic dermatitis in humans. In California, this weed is found primarily along roadsides. However, the biology of t...

  6. Plant-Derived Chemicals as Tick Repellents

    OpenAIRE

    Sadek Garboui, Samira

    2008-01-01

    Ixodes ricinus is the main vector of Lyme borreliosis and Tick-borne encephalitis in Europe. Repellents provide a practical means of protection against tick bites and can therefore reduce transmission of tick-borne diseases. In laboratory tests, pieces of cloth treated with MyggA Natural® (a commercial insect repellent) or with the essential oils of Corymbia citriodora (30%), Lavandula angustifolia (1 and 30%), Pelargonium graveolens (1 and 30%), Hyptis suaveolens (10%), Salvadora persica, Pi...

  7. Plant compounds insecticide activity against Coleoptera pests of stored products Compostos de plantas com atividade inseticida a coleópteros-praga de produtos armazenados

    OpenAIRE

    Márcio Dionizio Moreira; Marcelo Coutinho Picanço; Luiz Cláudio de Almeida Barbosa; Raul Narciso Carvalho Guedes; Mateus Ribeiro de Campos; Gerson Adriano Silva; Júlio Cláudio Martins

    2007-01-01

    The objective of this work was to screen plants with insecticide activity, in order to isolate, identify and assess the bioactivity of insecticide compounds present in these plants, against Coleoptera pests of stored products: Oryzaephilus surinamensis L. (Silvanidae), Rhyzopertha dominica F. (Bostrichidae) and Sitophilus zeamais Mots. (Curculionidae). The plant species used were: basil (Ocimum selloi Benth.), rue (Ruta graveolens L.), lion's ear (Leonotis nepetifolia (L.) R.Br.), jimson weed...

  8. Response of Brazilian native trees to acute ozone dose.

    Science.gov (United States)

    Moura, Bárbara Baêsso; de Souza, Sílvia Ribeiro; Alves, Edenise Segala

    2014-03-01

    Ozone (O3) is a toxic secondary pollutant able to cause an intense oxidative stress that induces visual symptoms on sensitive plant species. Controlled fumigation experiment was conducted with the aim to verify the O3 sensibility of three tropical species: Piptadenia gonoachanta (Mart.) Macbr. (Fabaceae), Astronium graveolens Jacq. (Anacardiaceae), and Croton floribundus Spreng. (Euphorbiaceae). The microscopical features involved in the oxidative stress were recognized based on specific histochemical analysis. The three species showed visual symptoms, characterized as necrosis and stippling between the veins, mostly visible on the adaxial leaf surface. All the studied species presented hypersensitive-like response (HR-like), and peroxide hydrogen accumulation (H2O2) followed by cell death and proanthocyanidin oxidation in P. gonoachanta and A. graveolens. In P. gonoachanta, a decrease in chlorophyll autofluorescence occurred on symptomatic tissues, and in A. graveolens and C. floribundus, a polyphenol compound accumulation occurred. The responses of Brazilian native species were similar to those described for sensitive species from temperate climate, and microscopical markers may be useful for the detection of ozone symptoms in future studies in the field. PMID:24297466

  9. Launch and Commissioning of the Deep Space Climate Observatory

    Science.gov (United States)

    Frey, Nicholas P.; Davis, Edward P.

    2016-01-01

    The Deep Space Climate Observatory (DSCOVR), formerly known as Triana, successfully launched on February 11th, 2015. To date, each of the five space-craft attitude control system (ACS) modes have been operating as expected and meeting all guidance, navigation, and control (GN&C) requirements, although since launch, several anomalies were encountered. While unplanned, these anomalies have proven to be invaluable in developing a deeper understanding of the ACS, and drove the design of three alterations to the ACS task of the flight software (FSW). An overview of the GN&C subsystem hardware, including re-furbishment, and ACS architecture are introduced, followed by a chronological discussion of key events, flight performance, as well as anomalies encountered by the GN&C team.

  10. Majolica ware in the New Spain: an evaluation through NAA

    International Nuclear Information System (INIS)

    The results of a study about Majolica ceramics recovered from three sites located in Mexico City are here presented. The set of 83 samples includes several local ceramic-types dating from the Colonial Period, the nineteenth century and the present day, plus some foreign specimens and clay samples from the Puebla area. Fourteen chemical elements present in the samples were analyzed and measured by means of neutron activation, and statistically the following groups were established: two groups that were presumably manufactured in Mexico City, two from Puebla, one from outside the Mexican boundaries, most probably Sevilla-Triana pottery, plus three more groups from unidentified origins. It was also found out that botijas were both imported and produced domestically. These results are discussed against the relevant literature on known provenance, chronology and manufacture standards of this kind of pottery. (author)

  11. Verification of thermohydraulic code HYDRA-IBRAE/LM and calculations of fast reactor facility components

    International Nuclear Information System (INIS)

    A short review is given for models using in thermohydraulic code HYDRA-IBRAE/LM and the results of verification of calculational code on the problems of liquid metal coolant flow and heat transfer. It is shown that developed version of code HYDRA-IBRAE/LM simulates one-phase flow of lead, sodium and lead-bismuth coolants with high accuracy and the processes of sodium boiling with good one. The results of applied calculations of once-through steam generators are considered. It is pointed out that code HYDRA-IBRAE/LM represents correctly physics of the processes and phenomena taking place in the steam generator. The results of cross-verification calculations of lead steam generator by codes HYDRA-IBRAE/LM and TRIANA-4 show satisfactory agreement of results on temperatures of coolants and materials of channel walls in Field tube

  12. Atividade antimicrobiana in vitro de produtos vegetais em otite externa aguda In vitro antimicrobial activity of plants in Acute Otitis Externa

    Directory of Open Access Journals (Sweden)

    Janaina Cândida Rodrigues Nogueira

    2008-02-01

    Full Text Available Otite externa aguda é a inflamação do conduto auditivo externo, e plantas medicinais podem ser utilizadas, na cultura popular, para seu tratamento. OBJETIVO: Avaliar atividade antimicrobiana in vitro de Aleolanthus suaveolens, Caryophyllus aromaticus, Cymbopogon citratus, Matricaria chamomila, Pithecellobium avaremotemo, Plectranthus amboinicus e Ruta graveolens sobre agentes etiológicos de otite externa. CASUÍSTICA E MÉTODOS: A concentração inibitória mínima de extratos e óleos destas plantas foi obtida em amostras de otite externa. RESULTADOS: Staphylococcus aureus em 10 culturas, Pseudomonas aeruginosa em 8, Pseudomonas aeruginosa e Staphylococcus aureus, em associação, em 5 culturas e Candida albicans e Candida krusei em 4 culturas. P. aeruginosa foi resistente a todos os extratos e óleos essenciais testados; os extratos de A. suaveolens, P. avaremotemo e de R. graveolens foram inativos, o óleo essencial de C. aromaticus e M. chamomila foram ativos contra 3 cepas de S. aureus e as cepas de Candida; Sete das cepas de S. aureus foram sensíveis ao extrato de P. amboinicus, mas o óleo não mostrou atividade, 4 cepas de S.aureus e as cepas de Candida foram sensíveis ao óleo essencial de R. graveolens. CONCLUSÃO: Algumas plantas apresentaram resultados satisfatórios, dependendo do agente etiológico, porém se faz necessário estudos mais detalhados, para melhorar o aproveitamento destas plantas.Acute Otitis Externa is an inflammation of the outer auditory meatus, and according to popular saying, medicinal plant extracts can be used in its treatment. AIM: to assess the in vitro antimicrobial activity of the following plants: Aleolanthus suaveolens; Caryophyllus aromaticus; Cymbopogon citratus; Matricaria chamomila; Pithecellobium avaremotemo; Plectranthus amboinicus and Ruta graveolens on the germs that cause otitis externa. MATERIALS AND METHODS: the minimum inhibitory concentration of extracts and oils from these plants was

  13. Susceptibility of Microsporum canis arthrospores to a mixture of chemically defined essential oils: a perspective for environmental decontamination.

    Science.gov (United States)

    Nardoni, Simona; Tortorano, Annamaria; Mugnaini, Linda; Profili, Greta; Pistelli, Luisa; Giovanelli, Silvia; Pisseri, Francesca; Papini, Roberto; Mancianti, Francesca

    2015-01-01

    The zoophilic dermatophyte Microsporum canis has cats as natural reservoir, but it is able to infect a wide range of hosts, including humans, where different clinical features of the so-called ringworm dermatophytosis have been described. Human infections are increasingly been reported in Mediterranean countries. A reliable control program against M. canis infection in cats should include an antifungal treatment of both the infected animals and their living environment. In this article, a herbal mixture composed of chemically defined essential oils (EOs) of Litsea cubeba (1%), Illicium verum, Foeniculum vulgare, and Pelargonium graveolens (0.5% each) was formulated and its antifungal activity assessed against M. canis arthrospores which represent the infective environmental stage of M. canis. Single compounds present in higher amounts in the mixture were also separately tested in vitro. Litsea cubeba and P. graveolens EOs were most effective (minimum inhibitory concentration (MIC) 0.5%), followed by EOs of I. verum (MIC 2%) and F. vulgare (MIC 2.5%). Minimum fungicidal concentrations (MFC) values were 0.75% (L. cubeba), 1.5% (P. graveolens), 2.5% (I. verum) and 3% (F. vulgare). MIC and MFC values of the mixture were 0.25% and 0.5%, respectively. The daily spray of the mixture (200 μL) directly onto infected hairs inhibited fungal growth from the fourth day onwards. The compounds present in higher amounts exhibited variable antimycotic activity, with MIC values ranging from >10% (limonene) to 0.1% (geranial and neral). Thus, the mixture showed a good antifungal activity against arthrospores present in infected hairs. These results are promising for a further application of the mixture as an alternative tool or as an adjuvant in the environmental control of feline microsporosis. PMID:25854840

  14. Riqueza y diversidad de especies leñosas del bosque tropical caducifolio El Tarimo, Cuenca del Balsas, Guerrero Richness and diversity of woody species in the tropical dry forest of El Tarimo, Cuenca del Balsas, Guerrero

    Directory of Open Access Journals (Sweden)

    Fernando Pineda-García

    2007-06-01

    Full Text Available Se describe la composición florística, la riqueza y la diversidad de especies de un bosque tropical caducifolio en la provincia florística Cuenca del Balsas, México. Se seleccionaron 4 sitios de 1000 m² cada uno, censándose los árboles, arbustos y lianas con d.a.p. >1 cm. En total se registraron 1456 individuos, pertenecientes a 82 especies, 56 géneros y 24 familias. Independientemente del sitio y de la forma de crecimiento, Leguminosae fue la familia con mayor número de especies y de individuos. Los géneros más diversos fueron Bursera (Burseraceae y Cordia (Boraginaceae con 9 y 4 especies, respectivamente. La riqueza entre los sitios varió de 43 a 55 especies y su similitud fue más alta en el nivel de familia que en el de especie. Los árboles fueron la forma de crecimiento con mayor riqueza de especies. Respectoa otros bosques tropicales caducifolios de México y del mundo, los sitios que se estudiaron en este bosque ocupan una posición baja en cuanto a sus valores de riqueza y estructura.Floristic composition, species richness, and diversity of the seasonally dry tropical forest in the floristic province of the Balsas Depression, México, is described. We sampled four 1,000 m² sites and recorded species and dbh of trees, shrubs and lianas >1 cm dbh. Data from 1,456 individuals were recorded, representing 82 species, 56 genera, and 24 families. Independently of site or growth form, Leguminosae was the family with the highest number of species and individuals. Bursera (Burseraceae and Cordia (Boraginaceae were the most speciose genera, with nine and four species, respectively. Species richness among sites ranged from 43-55 species and their similarity was higher at the family level than the species level. Trees had higher numbers of species than shrubs and lianas. Our results indicate that these forests have low values of species richness and structure attributes in relation with other tropical dry forests of Mexico and the world.

  15. Efeitos de extratos de plantas na biologia de Spodoptera frugiperda (J. E. Smith, 1797 (Lepidoptera: Noctuidae mantida em dieta artificial Effects of plant extracts on the biology of Spodoptera frugiperda (J. E. Smith, 1797 (Lepidoptera: Noctuidae maintained under artificial diet

    Directory of Open Access Journals (Sweden)

    Gilberto Pedreira Santiago

    2008-06-01

    Full Text Available Avaliaram-se os efeitos dos extratos aquosos a 10% de folhas e ramos de arruda (Ruta graveolens L., folhas e ramos de melão-de-são-caetano (Momordica charantia L., folhas do alecrim-pimenta (Lippia sidoides Cham. e fruto verde de mamona (Ricinus communis L., sobre a biologia da lagarta-do-cartucho do milho (Spodoptera frugiperda, mantida em dieta artificial. Os parâmetros avaliados foram duração e viabilidade das fases larval e pupal, peso de pupa, fecundidade, fertilidade e longevidade de adultos. Larvas de S. frugiperda recém-eclodidas foram colocadas em tubos de ensaio com dieta artificial, contendo os extratos de cada material testado. O extrato aquoso do fruto verde de R. communis apresentou bioatividade, nos parâmetros duração larval e pupal e peso de pupa. O extrato aquoso de R. graveolens reduziu o peso de pupa. A dieta contendo extrato de folhas e ramos de M. charantia reduziu a viabilidade larval e o peso de pupa. O extrato aquoso de folhas de L. sidoides não afetou as fases larval e pupal, reduziu a postura e a viabilidade de ovos e aumentou a longevidade de adultos de S. frugiperda. A viabilidade de pupa não foi afetada pelos extratos testados.The effects of aqueous extracts, at 10% concentration of leaves and branches of Ruta graveolens L., leaves and branches of Momordica charantia L., leaves of Lippia sidoides Cham. and green fruits of Ricinus communis L. were evaluated on the biology of fall armyworm (Spodoptera frugiperda maintained under artificial diet. The evaluated parameters were: duration and viability of the larval and pupal phases, pupa weight, fecundity, fertility and longevity of adults. Just-hatched larvae of S. frugiperda was placed in test tube with artificial diet containing extracts of each tested material. The aqueous extract of the green fruits of R. communis presented bioactivity upon duration and weight of larval and pupal phases. The aqueous extract of R. graveolens reduced weight of pupa. The diet

  16. Atividade antimicrobiana de óleos essenciais de condimentos frente a Staphylococcus spp isolados de mastite caprina Antimicrobial activities of essential oils extracted from spices against Staphylococcus spp isolated from goat mastitis

    OpenAIRE

    Marcelo Dal Pozzo; Julio Viégas; Deise Flores Santurio; Luana Rossatto; Isaura Helena Soares; Sydney Hartz Alves; Mateus Matiuzzi da Costa

    2011-01-01

    Avaliou-se a atividade antimicrobiana dos óleos essenciais (OEs) de Origanum vulgare (orégano), Thymus vulgaris (tomilho), Lippia graveolens (lípia), Zingiber officinale (gengibre), Salvia officinalis (sálvia), Rosmarinus officinalis (alecrim) e Ocimum basilicum (manjericão), bem como de frações majoritárias carvacrol, timol, cinamaldeído e cineol frente a 33 isolados de Staphylococcus spp oriundos de rebanhos leiteiros caprinos. A concentração inibitória mínima (CIM) e a concentração bacteri...

  17. ANALYSIS OF SOME ESSENTIAL ELEMENTS IN MEDICINAL PLANTS USED IN AYURVEDA

    Directory of Open Access Journals (Sweden)

    Om Prakash Rout

    2013-02-01

    Full Text Available This study presents a preliminary data of occurrence of elemental concentration in medicinal plants i.e Apium graveolens (seed, Sida cordifolia (root, Solanum surattense (whole plant, Tribulus terrestris(fruit and Withania somnifera (root used in Ayurveda, using Atomic absorption spectrometer (AAS following standard procedures. The elemental concentration i.e. Mn, Na, K, Cl, Ca, Cr, Co, Cu, Fe, Pb, Zn, Ni, Cd and Hg were found in various proportions. The data obtained from the study can be used to evaluate the potentiality of these plants in their used for Ayurvedic drugs

  18. Root development of beetroot, sweet corn and celeriac, and soil N content after incorporation of green manure

    OpenAIRE

    Christiansen, J.S.; Thorup-Kristensen, K.; Kristensen, H.L.

    2006-01-01

    Root development in beetroot (Beta vulgaris L. ssp vulgaris var. conditiva Alef.), sweet corn (Zea mays L. convar. Saccharata Koern.) and celeriac (Apium graveolens L. var. rapaceum Gaud.) was followed during two growing seasons with the aim of describing the root systems and nitrogen (N) utilisation of the three vegetables. The crops were grown after incorporation of green manure either in the preceding Autumn or Spring. Beetroot reached a final root depth of 1.55 – 1.8 m. For sweet corn, th...

  19. Revisión de la producción, composición fitoquímica y propiedades nutracéuticas del orégano mexicano Revision of the production, phytochemical composition, and nutraceutical properties of Mexican oregano

    Directory of Open Access Journals (Sweden)

    Enrique García-Pérez

    2012-04-01

    Full Text Available El orégano es una planta de distribución mundial, el cual está representado principalmente por dos especies: Origanum vulgare (Lamiaceace nativo de Europa, y Lippia graveolens (Verbenaceae, originaria de América. México ocupa el segundo lugar como productor mundial de orégano con la especie L. graveolens H. B. K. Sin embargo, la mayoría de las especies explotadas son silvestres y su cultivo es aún tradicional y limitado. En este trabajo se presenta un análisis de las estrategias de propagación, composición química y propiedades nutracéuticas del orégano. Los fitoquímicos presentes pueden clasificarse en tres categorías: compuestos volátiles, lípidos y fenólicos. Estos componentes presentan diversas propiedades nutracéuticas entre las que destacan la actividad antioxidante, hipoglucémica, hipotensiva, hipolipidémica y anticancerígena. Los avances en el estudio de la composición fitoquímica y su relación con nuevas propiedades nutracéuticas hacen del orégano un producto de alto valor comercial con amplias aplicaciones quimioterapéuticas.The oregano plant is distributed worldwide, and represented mainly by two species: Origanum vulgare (Lamiaceace native of Europa, and Lippia graveolens (Verbenaceae, native of America. Mexico is the second largest producer of oregano in the world, with the species L. graveolens H. B. K. However, most of the species used are wild, and raising them is done in a traditional and limited way. In this study we present an analysis of the dissemination strategies, chemical composition and nutraceutical properties of oregano. Phytochemicals present can be classified into three categories: volatile, lipids and phenolic compounds. These components present diverse neutraceutical properties, the most important of which are antioxidant activities, hypoglycemic, hypotensive, hypolypidemic and anti-carcinogenic. The advances in the study of the phytochemical composition and its relationship with new

  20. Avaliação in vitro da atividade antifúngica de extratos de plantas e óleo de eucalipto sobre Trichophyton mentagrophytes In vitro evaluation of the antifungal activity of plant extracts and eucalyptus oil on Trichophyton mentagrophytes

    OpenAIRE

    D.F.R. Frias; D.I. Kozusny-Andreani

    2009-01-01

    O presente estudo teve como objetivo determinar a ação antifúngica de extratos de plantas medicinais e óleo de eucalipto frente ao dermatófito Trichophyton mentagropytes, visando a utilização da fitoterapia no controle. As plantas utilizadas na obtenção dos extratos foram arruda (Ruta graveolens), citronela (Cymbopogon nardus), cravo de defunto (Tagetes minuta), eucalipto (Eucalyptus spp), graviola (Annona muricata), fruta do conde (Annona spp), manga (Mangifera indica), romã (Punica granatum...

  1. Evaluación de extractos de fique, coquito, sorgo y ruda como posibles bio-herbicidas Evaluation of cuban hemp, nut sedge, johnson grass and herb of grace extracts in weed control

    OpenAIRE

    Liliana Osorio Salazar; Francisco Antonio Valverde; Carmen Rosa Bonilla Correa; Manuel Salvador Sánchez Orozco; Carmen Elena Mier Barona

    2009-01-01

    En experimentos completamente al azar en condiciones de laboratorio y campo, en Palmira, Valle del Cauca, se evaluó el efecto de extractos de Macrophylla furcraea Baker (fique), Cyperus rotundus L (coquito), Sorghum bicolor L (sorgo), y Ruta graveolens L (ruda) sobre la germinación de semillas de las arvenses Bidens pilosa L (papunga) y Amaranthus dubius Mart (bledo) y del cilantro Coriandrum sativum L. Se obtuvieron los extractos por el método Soxhlet, utilizando agua, etanol y cloroformo co...

  2. Effect of plant and fungous metabolites on Meloidogyne exigua Efeito de metabólitos vegetais e fúngicos sobre Meloidogyne exigua

    Directory of Open Access Journals (Sweden)

    Daniel Rufino Amaral

    2009-01-01

    Full Text Available As nematodes cause great damage to Brazilian coffee production, effective methods to control these parasites are necessary. In a previous work Allium cepa L., Cajanus cajan (L. Mill., Crotalaria juncea L., Ficus elastica Roxb., Ruta graveolens L., Stylosanthes guianensis Aubl., Leucaena leucocephala (Lam. Dewit., Brachiaria decumbens Stapf., Catharanthus roseus G. Don, Tagetes minuta L., Ricinus communis L. and Coffea arabica L. produced active substances against Meloidogyne exigua Goeldi, a nematode widely disseminated through Brazilian coffee fields. Thus, aqueous extracts of such plants, collected in a different season from that of the previous work, as well as crude metabolites produced in liquid medium by Fusarium moniliforme Shelden and Cylindrocarpon magnusianum (Sacc. Woll., were submitted to in vitro assays with M. exigua second-stage juveniles (J2. All plants and fungi produced active substances against J2. Therefore, their metabolites were applied to six-month-old coffee plants inoculated with M. exigua. After 90 days in a greenhouse, those samples obtained from A. cepa, L. leucocephala, R. graveolens and F. moniliforme inhibited the production of galls and eggs by M. exigua, demonstrating potential to control such parasite.Os nematóides acarretam grandes perdas aos produtores brasileiros de café, sendo necessário o desenvolvimento de métodos eficientes para o seu controle. Em trabalho anterior, Allium cepa L., Cajanus cajan (L. Mill., Crotalaria juncea L., Ficus elastica Roxb., Ruta graveolens L., Stylosanthes guianensis Aubl., Leucaena leucocephala (Lam. Dewit., Brachiaria decumbens Stapf., Catharanthus roseus G. Don, Tagetes minuta L., Ricinus communis L. e Coffea arabica L. produziram substâncias ativas contra o nematóide Meloidogyne exigua Goeldi, que é amplamente disseminado pelos cafezais brasileiros. Dando continuidade a esse trabalho, extratos aquosos das plantas mencionadas, coletadas em época diferente daquela

  3. Atividade antimicrobiana in vitro de produtos vegetais em otite externa aguda In vitro antimicrobial activity of plants in Acute Otitis Externa

    OpenAIRE

    Janaina Cândida Rodrigues Nogueira; Margareth de Fátima Melo Diniz; Edeltrudes de O. Lima

    2008-01-01

    Otite externa aguda é a inflamação do conduto auditivo externo, e plantas medicinais podem ser utilizadas, na cultura popular, para seu tratamento. OBJETIVO: Avaliar atividade antimicrobiana in vitro de Aleolanthus suaveolens, Caryophyllus aromaticus, Cymbopogon citratus, Matricaria chamomila, Pithecellobium avaremotemo, Plectranthus amboinicus e Ruta graveolens sobre agentes etiológicos de otite externa. CASUÍSTICA E MÉTODOS: A concentração inibitória mínima de extratos e óleos destas planta...

  4. Sensitization Prevalence, Antibody Cross-Reactivity and Immunogenic Peptide Profile of Api g 2, the Non-Specific Lipid Transfer Protein 1 of Celery

    OpenAIRE

    Gadermaier, G.; Hauser, M.; Egger, M.; Ferrara, R; Briza, P.; Santos, K.S.; Zennaro, D.; Girbl, T.; Zuidmeer-Jongejan, L.; Mari, A.; F. Ferreira

    2011-01-01

    Background: Celery (Apium graveolens) represents a relevant allergen source that can elicit severe reactions in the adult population. To investigate the sensitization prevalence and cross-reactivity of Api g 2 from celery stalks in a Mediterranean population and in a mouse model. Methodology: 786 non-randomized subjects from Italy were screened for IgE reactivity to rApi g 2, rArt v 3 (mugwort pollen LTP) and nPru p 3 (peach LTP) using an allergen microarray. Clinical data of 32 selected pati...

  5. Atividade antimicrobiana de óleos essenciais de condimentos frente a amostras de Escherichia coli isoladas de aves e bovinos Antimicrobial activity of spice essential oils against Escherichia coli strains isolated from poultry and cattle

    OpenAIRE

    Deise Flores Santurio; Mateus Matiuzzi da Costa; Grazieli Maboni; Carlos Pasqualin Cavalheiro; Mariangela Facco de Sá; Marcelo Dal Pozzo; Sydney Hartz Alves; Leadir Lucy Martins Fries

    2011-01-01

    A discutida questão da substituição do uso de antibacterianos em rações (promotores de crescimento) requer urgentes alternativas. Face às necessidades de inibidores microbianos nesses alimentos, os óleos essenciais (OES) se constituem em alternativa, sob avaliação. Neste estudo, avaliou-se a atividade antimicrobiana dos OES de Origanum vulgare (orégano), Thymus vulgaris (tomilho), Cinnamomum zeylanicum (canela), Lippia graveolens (orégano mexicano), Zingiber officinale (gengibre), Salvia offi...

  6. Acaricidal and Insecticidal Activities of Essential Oils against a Stored-Food Mite and Stored-Grain Insects.

    Science.gov (United States)

    Song, Ja-Eun; Kim, Jeong-Moon; Lee, Na-Hyun; Yang, Ji-Yeon; Lee, Hoi-Seon

    2016-01-01

    Twenty plant-derived oils were evaluated for their acaricidal and insecticidal activities against Sitotroga cerealella, Sitophilus oryzae, Sitophilus zeamais, and Tyrophagus putrescentiae adults, by using the fumigant and filter paper diffusion methods. Responses varied with bioassay systems, insect or mite species, plant oils, and exposure time. Based on the 50% lethal dose (LD50) values against S. oryzae and S. zeamais in the fumigant bioassay, Anethum graveolens oil (4.12 and 1.12 μg/cm(3), respectively) induced the highest mortality, followed by Achillea millefolium (21.92 and 14.91 μg/cm(3)) and Eucalyptus dives (28.02 and 24.02 μg/cm(3)) oils, respectively. The most toxic oil based on the 50% lethal concentration values against T. putrescentiae was E. dives (3.13 μg/cm(3)), followed by Melaleuca leucadendron (3.93 μg/cm(3)) and Leptospermum pertersonii (4.41 μg/cm(3)). Neroli birgard oil (1.70 μg/cm(3)) was the most toxic based on the LD50 values against S. cerealella, followed by Citrus aurantium (1.80 μg/cm(3)) and Artemisia vulgaris (1.81 μg/cm(3)). The insecticidal and acaricidal activities of the plant oils in the filter paper diffusion bioassay were similar to those in the fumigant bioassay. In comparison, A. millefolium, A. graveolens, and E. dives oils were more effective against S. oryzae and S. zeamais in the fumigant bioassay than in the contact bioassay. These results indicate that the insecticidal activity of the three plant oils against S. oryzae and S. zeamais may be due to their fumigant action. Acaricidal activities of the A. millefolium, A. graveolens, and E. dives oils against T. putrescentiae were 2.62, 1.11, and 122 times higher than that of benzyl benzoate in the contact bioassay. These results indicate that A. millefolium, A. graveolens, and E. dives oils have potential for development as agents to control stored-grain insects and mites. PMID:26735047

  7. Óleos essenciais para aromaterapia

    OpenAIRE

    Coelho, Meirilane Gonçalves

    2009-01-01

    Dissertação de mestrado em Biotecnologia e Bio-empreendedorismo em Plantas Aromáticas e Medicinais O potencial terapêutico de óleos essenciais de Salvia sclarea, Salvia officinalis cv. ‘purpurascens’, Rosmarinus officinalis (Lamiaceae) em doenças neurodegenerativas e de óleos essenciais de Pelargonium graveolens (Geraniaceae) como ansiolítico, muitas vezes utilizados em Aromaterapia sugerem o papel relevante da regulamentação deste sector, designadamente quanto a critérios d...

  8. Viabilidad y germinación de semillas de tres especies arbóreas nativas de la selva tropical, Chiapas, México

    Directory of Open Access Journals (Sweden)

    Carolina Orantes-García

    2015-08-01

    Full Text Available Se determinó la proporción de semillas viables y la pérdida de viabilidad debido al periodo de almacenamiento, así como el efecto de tratamientos pregerminativos que favorecen la germinación en semillas deCordia alliodora, Terminalia amazoniayBursera bipinnata, árboles nativos de la selva tropical, Chiapas, México. Se encontró que las semillas recién colectadas presentaron más del 90% de viabilidad, la cual fue disminuyendo hasta mostrar un 15% enB. bipinnata, 34% enC. alliodoray 18% enT. amazoniadespués de 12 meses de almacenamiento. De acuerdo con la germinación acumulada se encontraron diferencias significativas entre los tratamientos (pB. bipinnata63%,C. alliodora62% yT. amazonia54%. En conclusión, para poder obtener un mayor porcentaje de semillas germinadas en poco tiempo, es necesario dar un tratamiento previo a la siembra para las semillas de estas especies. El almacenamiento de las semillas durante un año provocó una declinación en la capacidad germinativa.

  9. The copal of the Chichen Itza offerings and of the Templo Mayor of Tenochtitlan; El copal de las ofrendas de Chichen Itza y del Templo Mayor de Tenochtitlan

    Energy Technology Data Exchange (ETDEWEB)

    Montufar L, A. [Subdireccion de Laboratorios y Apoyo Academico INAH, Moneda No. 6, Col Centro, 06060 Mexico D.F. (Mexico); Gutierrez W, C.E.; Mendoza A, D. [ININ, Carr. Mexico-Toluca s/n La Marquesa, 52750 Ocoyoacac, Estado de Mexico (Mexico); Torres M, A. [Facultad de Ciencias, UNAM, A.P. 20-364 01000 Mexico D.F. (Mexico)

    2006-07-01

    Literature from the post conquest shows that the Mayans used copal resins in their religious celebrations and ceremonial rites, specially as a sahumerio material. Historical precedents have been fully documented, establishing its use in the calendar ceremonies performed by the Aztecs towards their agricultural practices, mainly for the corn crop; and that according to the registries of sacred figures of their gods, they were made out of copal resin. Abundant fragments of this resin were found in a number of offerings at the digging of the Templo Mayor of Tenochtitlan. These facts indicate the intensive use of the copal as a link with divinities of life, maintenance and fertility, among many other aspects of existence, as stated by the Mexicas cosmos view. In order to determine the possible origin of the different types of copal, small samples were analyzed by infrared spectroscopy, both from Chichen Itza and the pre hispanic from Templo Mayor of Tenochtitlan. Results show a great similarity between each absorption band, the one from Templo Mayor and the modern sample Bursera bipinnata and the one from Chichen Itza and the modem resin of Protium copal. This suggests that the pre hispanic copal form Chichen Itza was obtained from the Protium copal tree. (Author)

  10. The copal of the Chichen Itza offerings and of the Templo Mayor of Tenochtitlan

    International Nuclear Information System (INIS)

    Literature from the post conquest shows that the Mayans used copal resins in their religious celebrations and ceremonial rites, specially as a sahumerio material. Historical precedents have been fully documented, establishing its use in the calendar ceremonies performed by the Aztecs towards their agricultural practices, mainly for the corn crop; and that according to the registries of sacred figures of their gods, they were made out of copal resin. Abundant fragments of this resin were found in a number of offerings at the digging of the Templo Mayor of Tenochtitlan. These facts indicate the intensive use of the copal as a link with divinities of life, maintenance and fertility, among many other aspects of existence, as stated by the Mexicas cosmos view. In order to determine the possible origin of the different types of copal, small samples were analyzed by infrared spectroscopy, both from Chichen Itza and the pre hispanic from Templo Mayor of Tenochtitlan. Results show a great similarity between each absorption band, the one from Templo Mayor and the modern sample Bursera bipinnata and the one from Chichen Itza and the modem resin of Protium copal. This suggests that the pre hispanic copal form Chichen Itza was obtained from the Protium copal tree. (Author)

  11. A Late Holocene Record of Human Impact in the Tropical Lowlands of the Mexican Gulf Coast: Lago Verde.

    Science.gov (United States)

    Socorro, L.; Sosa, S.; Caballero, M.; Rodriguez, A.; Ortega, B.

    2005-05-01

    Lago Verde is a maar lake (18 36 43 N; 95 20 52 W) located on the Gulf Coast of Mexico in "Los Tuxtlas" region. The area was cover by tropical rain forest and is part of the core area of the earliest Mesoamerican cultures. A 6 m sediment core was obtained in order to document vegetation and lake level history of this area. Lago Verde is a shallow, eutrophic lake (max. 4 m), the natural vegetation has been removed and grasslands with some tropical trees such Bursera grows around the lake. According with the radiocarbon chronology the sequence covers the last 2500 yr BP. At the base of the sequence low abundance of tropical trees is record, with intermediate lake levels. A sudden change in the pollen stratigraphy occurs at ca. 2000 yr BP, with important presence of Poaceae, Ambrosia and Cheno.-Am. along with Zea mays indicating human activity in the area. This is associated with a change in limnological conditions, recording turbid, shallow environments. This pollen signals correlates with dry phases in Yucatan, suggesting that this dry climatic signal probably had effect on an ample area of Mexico. However, at 1200 yr BP, no more Zea mays pollen is recovered suggesting the abandonment of the area. Lake levels recover as well as the tropical forest. The last 150 yr BP is characterized by the reduction in the pollen of tropical forest trees, presence of Zea mays, increased erosion rates, turbidity and eutrophication in the lake, all related to deforestation.

  12. Structure and floristic composition of tree stand in tropical forest in the Eastern Ghats of northern Andhra Pradesh, India

    Institute of Scientific and Technical Information of China (English)

    C. Sudhakar Reddy; Shilpa Babar; Giriraj Amamath; Chiranjibi Pattanaik

    2011-01-01

    The changes in species composition,abundance and forest stand structure were analyzed across altitudinal regimes in tropical forests of Eastern Ghats of northern Andhra Pradesh,India.Three 1-ha plots were established with one each in low,medium and high altitudes.A total of 153 species,2129 stems (709 stems ·ha-l) of>10 cm girth were enumerated.Species richness and diversity pattern varied along altitudinal gradient and increased with the altitude.Species richness varied from 52 to 110 species·ha-1 and stand density from 639 to 836 stems·ha-1 with average basal area of 34.39 m2·ha-1.Shannon-Wiener index (H) ranged from 4.55 to 5.17.Low altitude (i.e.,Site 1) is dominated by Xylia xylocarpa (59.22) and Lagerstroemia parviflora (23.90),medium altitude (i.e.,Site 2) by Xylia xylocarpa (45.50) Bursera serrata (17.29),and high altitude (i.e.,Site 3) has Schleichera oleosa (28.25) Pterocarpus marsupium (26.55) as predominant species.Taxonomically,Rubiaceae (12 species),Fabaceae (12),Euphorbiaceae (11),Rutaceae (7) and Lauraceae (7) were dominant families.Density-wise,Fabaceae,Combretaceae,Euphorbiaceae,Anacardiaceae and Myrtaceae were abundant.Thus,conservation assessment based on altitudinal regimes and the information on species structure and function can provide baseline information for monitoring and sustaining the biodiversity.

  13. Coleoptera Associated with Decaying Wood in a Tropical Deciduous Forest.

    Science.gov (United States)

    Muñoz-López, N Z; Andrés-Hernández, A R; Carrillo-Ruiz, H; Rivas-Arancibia, S P

    2016-08-01

    Coleoptera is the largest and diverse group of organisms, but few studies are dedicated to determine the diversity and feeding guilds of saproxylic Coleoptera. We demonstrate the diversity, abundance, feeding guilds, and succession process of Coleoptera associated with decaying wood in a tropical deciduous forest in the Mixteca Poblana, Mexico. Decaying wood was sampled and classified into four stages of decay, and the associated Coleoptera. The wood was identified according to their anatomy. Diversity was estimated using the Simpson index, while abundance was estimated using a Kruskal-Wallis test; the association of Coleoptera with wood species and decay was assessed using canonical correspondence analysis. Decay wood stage I is the most abundant (51%), followed by stage III (21%). We collected 93 Coleoptera belonging to 14 families, 41 genera, and 44 species. The family Cerambycidae was the most abundant, with 29% of individuals, followed by Tenebrionidae with 27% and Carabidae with 13%. We recognized six feeding guilds. The greatest diversity of Coleoptera was recorded in decaying Acacia farnesiana and Bursera linanoe. Kruskal-Wallis analysis indicated that the abundance of Coleoptera varied according to the species and stage of decay of the wood. The canonical analysis showed that the species and stage of decay of wood determined the composition and community structure of Coleoptera. PMID:26911160

  14. Extraction and GC determination of volatile aroma compounds from extracts of three plant species of the Apiaceae family

    Science.gov (United States)

    Stan, M.; Soran, M. L.; Varodi, C.; Lung, I.; Copolovici, L.; MǎruÅ£oiu, C.

    2013-11-01

    Parsley (Petroselinum crispum), dill (Anethum graveolens) and celery (Apium graveolens), three aromatic plants belonging to the Apiaceae (Umbelliferae) botanical family, were selected as sources of essential or volatile oils. Essential oils are composed of a large diversity of volatile aroma compounds. Plant-derived essential oils and extracts have long been used as natural agents in food preservation, pharmaceuticals and medicinal therapies. In the present study, the plant extracts from leaves of parsley, dill and celery, were obtained by maceration, ultrasound-assisted extraction and microwave-assisted extraction. All extractions were performed at 30°C, using different solvents (ethanol, diethyl ether, n-hexane) and solvent mixtures (1:1, v/v). The most effective solvent system for the extraction of volatile aroma compounds was diethyl ether - n-hexane (1:1, v/v). Extraction efficiency and determination of aroma volatiles were performed by GC-FID and GC-MS, respectively. The major volatile compounds present in plant extracts were myristicin, α-phellandrene, β-phellandrene, 1,3,8-p-menthatriene, apiol, dill ether and allyl phenoxyacetate.

  15. Green synthesis of gold nanoparticles using plant extracts as reducing agents

    Directory of Open Access Journals (Sweden)

    Elia P

    2014-08-01

    Full Text Available Paz Elia,1 Raya Zach,1 Sharon Hazan,2 Sofiya Kolusheva,2 Ze’ev Porat,1,3 Yehuda Zeiri1,3 1Department of Biomedical Engineering, 2Ilse Katz Institute of Nanotechnology, Ben-Gurion University of the Negev, 3Division of Chemistry, Negev Nuclear Research Center Beersheba, Israel Abstract: Gold nanoparticles (GNPs were prepared using four different plant extracts as reducing and stabilizing agents. The extracts were obtained from the following plants: Salvia officinalis, Lippia citriodora, Pelargonium graveolens and Punica granatum. The size distributions of the GNPs were measured using three different methods: dynamic light scattering, nanoparticle-tracking analysis and analysis of scanning electron microscopy images. The three methods yielded similar size distributions. Biocompatibility was examined by correlation of L-cell growth in the presence of different amounts of GNPs. All GNPs showed good biocompatibility and good stability for over 3 weeks. Therefore, they can be used for imaging and drug-delivery applications in the human body. High-resolution transmission electron microscopy was used to view the shapes of the larger GNPs, while infrared spectroscopy was employed to characterize the various functional groups in the organic layer that stabilize the particles. Finally, active ingredients in the plant extract that might be involved in the formation of GNPs are proposed, based on experiments with pure antioxidants that are known to exist in that plant. Keywords: gold nanoparticles, Lippia citriodora, Salvia officinalis, Pelargonium graveolens, Punica granatum, antioxidants, size distribution, zeta potential

  16. Slope variation and population structure of tree species from different ecological groups in South Brazil.

    Science.gov (United States)

    Bianchini, Edmilson; Garcia, Cristina C; Pimenta, José A; Torezan, José M D

    2010-09-01

    Size structure and spatial arrangement of 13 abundant tree species were determined in a riparian forest fragment in Paraná State, South Brazil (23°16'S and 51°01'W). The studied species were Aspidosperma polyneuron Müll. Arg., Astronium graveolens Jacq. and Gallesia integrifolia (Spreng) Harms (emergent species); Alseis floribunda Schott, Ruprechtia laxiflora Meisn. and Bougainvillea spectabilis Willd. (shade-intolerant canopy species); Machaerium paraguariense Hassl, Myroxylum peruiferum L. and Chrysophyllum gonocarpum (Mart. & Eichler ex Miq.) Engl. (shade-tolerant canopy species); Sorocea bonplandii (Baill.) Bürger, Trichilia casaretti C. Dc, Trichilia catigua A. Juss. and Actinostemon concolor (Spreng.) Müll. Arg. (understory small trees species). Height and diameter structures and basal area of species were analyzed. Spatial patterns and slope correlation were analyzed by Moran's / spatial autocorrelation coefficient and partial Mantel test, respectively. The emergent and small understory species showed the highest and the lowest variations in height, diameter and basal area. Size distribution differed among emergent species and also among canopy shade-intolerant species. The spatial pattern ranged among species in all groups, except in understory small tree species. The slope was correlated with spatial pattern for A. polyneuron, A. graveolens, A. floribunda, R. laxiflora, M. peruiferum and T. casaretti. The results indicated that most species occurred in specific places, suggesting that niche differentiation can be an important factor in structuring the tree community. PMID:21562693

  17. Total Phenolic, Flavonoids and Antioxidant Capacity of Some Medicinal and Aromatic Plants

    Directory of Open Access Journals (Sweden)

    Melinda Nagy

    2014-11-01

    Full Text Available Abstract: Antioxidants are substances that protect cells from the induced oxidative stress damage caused by unstable molecules known as free radicals that. Antioxidants neutralize free radicals as a natural by-product of normal cell processes. In the present study,were evaluated  the phenolic and flavonoids contents as well as the antioxidant capacity of seeds from  the Lamiaceae and Apiaceae family: fennel  (Foeniculum vulgare, dill (Anethum graveolens and rosemary (Rosmarinus officinalis . (Sreemoyee Ch. et. al., 2012 The main objective of the study was the comparative assessment of the phenolic and flavonoid compounds from dill, rosemary and fennel methanolic extracts correlated with their  antioxidant activity. Both total phenolic content and flavonoids content of the seeds samples were measured spectrophotometrically using the Folin-Ciocalteu assay and a chromogenic system of NaNO2–Al(NO33–NaOH, respectively.. Antioxidant capacity was determined by 2,2-DPPH method. Results strongly showed that Rosmarinus officinalis extract has the most effective antioxidant capacity in scavenging DPPH radicals, while Foeniculum vulgare and Anethum graveolens were less active. The total phenolic content was within 773,14 and 3367,24mg GAE/ 100g while the concentration in flavonoids was between 231,84 and 1325,53 QEg/100g dry seeds.  

  18. Leaf and whole-tree water use relations of Australian rainforest species

    Science.gov (United States)

    Ishida, Yoko; Laurance, Susan; Liddell, Michael; Lloyd, Jonathan

    2015-04-01

    Climate change induces drought events and may therefore cause significant impact on tropical rainforests, where most plants are reliant on high water availability - potentially affecting the distribution, composition and abundance of plant species. Using an experimental approach, we are studying the effects of a simulated drought on lowland rainforest plants at the Daintree Rainforest Observatory (DRO), in tropical northern Australia. Before to build up the rainout infrastructure, we installed sap flow meters (HRM) on 62 rainforest trees. Eight tree species were selected with diverse ecological strategies including wood density values ranging from 0.34 to 0.88 g/cm3 and could be replicated within a 1ha plot: Alstonia scholaris (Apocynaceae), Argyrondendron peralatum (Malvaceae), Elaeocarpus angustifolius (Elaeocarpaceae), Endiandra microneura (Lauraceae), Myristica globosa (Myristicaceae), Syzygium graveolens (Myrtaceae), Normanbya normanbyi (Arecaceae), and Castanospermum australe (Fabaceae). Our preliminary results from sap flow data obtained from October 2013 to December of 2014 showed differences in the amount of water used by our trees varied in response to species, size and climate. For example Syzygium graveolens has used a maximum of 60 litres/day while Argyrondendrum peralatum used 13 litres/day. Other potential causes for differential water-use between species and the implications of our research will be discussed. We will continue to monitor sap flow during the rainfall exclusion (2014 to 2016) to determine the effects of plant physiological traits on water use strategies.

  19. Searching for native tree species and respective potential biomarkers for future assessment of pollution effects on the highly diverse Atlantic Forest in SE-Brazil.

    Science.gov (United States)

    Domingos, Marisa; Bulbovas, Patricia; Camargo, Carla Z S; Aguiar-Silva, Cristiane; Brandão, Solange E; Dafré-Martinelli, Marcelle; Dias, Ana Paula L; Engela, Marcela R G S; Gagliano, Janayne; Moura, Barbara B; Alves, Edenise S; Rinaldi, Mirian C S; Gomes, Eduardo P C; Furlan, Claudia M; Figueiredo, Ana Maria G

    2015-07-01

    This study summarizes the first effort to search for bioindicator tree species and respective potential biomarkers for future assessment of potential mixed pollution effects on the highly diverse Atlantic Forest in SE-Brazil. Leaves of the three most abundant species inventoried in a phytosociological survey (Croton floribundus, Piptadenia gonoacantha and Astronium graveolens) were collected in four forest remnants during winter and summer (2012). Their potential bioindicator attributes were highlighted using a screening of morphological, chemical and biochemical markers. The leaf surface structure and/or epicuticular wax composition pointed the accumulator properties of C. floribundus and P. gonoacantha. C. floribundus is a candidate for assessing potential accumulation of Cu, Cd, Mn, Ni, S and Zn. P. gonoacantha is a candidate to monitor polycyclic aromatic hydrocarbons. Increased levels of secondary metabolites and decreased antioxidant capacity in leaves of A. graveolens may support its value as a bioindicator for oxidative pollutants by visible dark stipplings. PMID:25818087

  20. Antileishmanial activity of medicinal plants used in endemic areas in northeastern Brazil.

    Science.gov (United States)

    De Queiroz, Aline Cavalcanti; Dias, Thays de Lima Matos Freire; Da Matta, Carolina Barbosa Brito; Cavalcante Silva, Luiz Henrique Agra; de Araújo-Júnior, João Xavier; de Araújo, Givanildo Bernardino; Moura, Flávia de Barros Prado; Alexandre-Moreira, Magna Suzana

    2014-01-01

    This study investigates the leishmanicidal activity of five species of plants used in folk medicine in endemic areas of the state of Alagoas, Brazil. Data were collected in the cities of Colonia Leopoldina, Novo Lino, and União dos Palmares, Alagoas state, from patients with cutaneous leishmaniasis (Leishmania amazonensis) who use medicinal plants to treat this disease. Plants extracts were tested at a concentration of 1-100 μg/mL in all experiments, except in an assay to evaluate activity against amastigotes, when 10 μg/mL was used. All plants extracts did not show deleterious activity to the host cell evidenced by LDH assay at 100, 10, and 1 μg/mL after 48 h of incubation. The plants extracts Hyptis pectinata (L.) Poit, Aloe vera L., Ruta graveolens L., Pfaffia glomerata (Spreng.) Pedersen, and Chenopodium ambrosioides L. exhibited direct activity against extracellular forms at 100 μg/mL; these extracts inhibited growth by 81.9%, 82.9%, 74.4%, 88.7%, and 87.4%, respectively, when compared with promastigotes. The plants extracts H. pectinata, A. vera, and R. graveolens also significantly diminished the number of amastigotes at 10 μg/mL, inhibiting growth by 85.0%, 40.4%, 94.2%, and 97.4%, respectively, when compared with control. Based on these data, we conclude that the five plants exhibited considerable leishmanicidal activity. PMID:25126099

  1. Effects of host plants on digestive enzymatic activities and some components involved in intermediary metabolism of Chrysodeixis chalcites (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    M. Mardani-Talaee

    2014-12-01

    Full Text Available Chrysodeixis chalcites (Esper is a serious pest that causes devastating damages in infested areas to many fruits, vegetables, ornamental crops and weeds. In the current study, effects of three host plants including lemon balm (Melissa officinalis L.; corn (Zea mays L. and dill (Anethum graveolens L. were determined on digestive enzyme activities and intermediary metabolism of C. chalcites larvae. The highest activities of α-amylase, glucosidases and specific proteases were observed in the larvae fed on dill. Our results showed that C. chalcites larvae had the highest TAG-lipase activity on corn in comparison with other host plants. Significant differences were found among enzymatic activities of acid (ACP and alkaline phosphatases, aspartate aminotransferases and lactate dehydrogenase (LDH in the haemolymph of C. chalcites larvae reared on lemon balm, corn and dill, respectively, although activity of alanine aminotransferase showed no statistically significant differences among different host plants. The enzymatic activity of ACP significantly decreased on dill in comparison with lemon balm and corn. The activity of LDH significantly increased on dill compared with other host plants. These results revealed that dill (A. graveolens is the most appropriate host plant for larvae of C. chalcites as evidenced by the highest digestive enzyme activities and intermediary metabolism.

  2. Influence of microwave frequency electromagnetic radiation on terpene emission and content in aromatic plants.

    Science.gov (United States)

    Soran, Maria-Loredana; Stan, Manuela; Niinemets, Ülo; Copolovici, Lucian

    2014-09-15

    Influence of environmental stress factors on both crop and wild plants of nutritional value is an important research topic. The past research has focused on rising temperatures, drought, soil salinity and toxicity, but the potential effects of increased environmental contamination by human-generated electromagnetic radiation on plants have little been studied. Here we studied the influence of microwave irradiation at bands corresponding to wireless router (WLAN) and mobile devices (GSM) on leaf anatomy, essential oil content and volatile emissions in Petroselinum crispum, Apium graveolens and Anethum graveolens. Microwave irradiation resulted in thinner cell walls, smaller chloroplasts and mitochondria, and enhanced emissions of volatile compounds, in particular, monoterpenes and green leaf volatiles (GLV). These effects were stronger for WLAN-frequency microwaves. Essential oil content was enhanced by GSM-frequency microwaves, but the effect of WLAN-frequency microwaves was inhibitory. There was a direct relationship between microwave-induced structural and chemical modifications of the three plant species studied. These data collectively demonstrate that human-generated microwave pollution can potentially constitute a stress to the plants. PMID:25050479

  3. Effect of Sri Lankan traditional medicine and Ayurveda on Sandhigata Vata (osteoarthritis of knee joint).

    Science.gov (United States)

    Perera, Pathirage Kamal; Perera, Manaram; Kumarasinghe, Nishantha

    2014-01-01

    Reported case was a 63-year-old female with end-stage osteoarthritis (OA) (Sandhigata Vata) of the left knee joint accompanied by exostoses. Radiology (X-ray) report confirmed it as a Kellgren-Lawrence grade III or less with exostoses. At the beginning, the Knee Society Rating System scores of pain, movement and stability were poor, and function score was fair. Srilankan traditional and Ayurveda medicine treatment was given in three regimens for 70 days. After 70 days, external treatment of oleation and 2 capsules of Shallaki (Boswellia serrata Triana and Planch) and two tablets of Jeewya (comprised of Emblica officinalis Gaertn., Tinospora cordifolia [Willd.] Millers. and Terminalia chebula Retz.), twice daily were continued over 5 months. Visual analogue scale for pain, knee scores in the Knee Society online rating system and a Ayurveda clinical assessment criteria was used to evaluate the effects of treatments in weekly basis. After treatment for 70 days, the Knee Society Rating System scores of pain, movement and stability were also improved up to good level and function score was improved up to excellent level. During the follow-up period, joint symptoms and signs and the knee scores were unchanged. In conclusion, this OA patient's quality of life was improved by the combined treatment of Sri Lankan traditional medicine and Ayurveda. PMID:26195904

  4. A fluid Foucault pendulum: the impossibility of achieving solid-body rotation on Earth

    Science.gov (United States)

    Blum, Robert; Zimmerman, Daniel; Triana, Santiago; Lathrop, Daniel

    2012-11-01

    Rotating fluid dynamics is key to our understanding of the Earth's atmosphere, oceans, and core, along with a plethora of astrophysical objects. Laboratory study of these natural systems often involves spinning experimental devices, which are assumed to tend to rigid rotation when unstirred. We present results showing that even at the tabletop scale, there is a measurable oscillatory flow driven by the precession of the experiment's axis as the earth rotates. We measure this flow in a rotating cylinder with an adjustable aspect ratio. The horizontal flow in the rotating frame is measured using particle tracking. The steady state is well-described by an inertial mode whose amplitude is maximum when the height to diameter ratio is 0.995, which matches theoretical predictions. We also quantify the resonant amplitude of the inertial mode in the cylinder and estimate the amplitude in other devices. We compare our results to similar studies done in spherical devices. [Triana et al., JGR, 117 (2012), B04103][Boisson et al., EPL, 98 (2012), 59002].

  5. Sevilla, una encrucijada de caminos

    Directory of Open Access Journals (Sweden)

    Manuel Martín Martin

    2009-01-01

    Full Text Available El mundo del flamenco, tan acostumbrado a contemplar la historia del género como una sucesión de nombres distinguidos que, por su significación expresiva o por su carácter de maestría incontestable, simbolizan una época, olvida con frecuencia el universo en que esa constelación de estrellas irradia su luminosidad más intensa, esto es, relega a un rol de menor importancia el ámbito en que se desarrollaron unos talentos especiales que, a lapostre, describirían situaciones y formas que el tiempo estimaría de verdadera trascendencia. Sin ánimo de caer en un determinismo localista demasiado forzoso, justo es decir que uno de los más grandes milagros de la música flamenca, se llama Sevilla, su barrio de Triana y muchos pueblos de la provincia. Una unidad demográfica que ofrece en grado sumo el origen de la complacencia en los goces de los sentidos.

  6. Revision of the genera Microplitis and Snellenius (Hymenoptera, Braconidae, Microgastrinae from Area de Conservacion Guanacaste, Costa Rica, with a key to all species previously described from Mesoamerica

    Directory of Open Access Journals (Sweden)

    Jose L. Fernandez-Triana

    2015-07-01

    Full Text Available The genera Microplitis and Snellenius (Hymenoptera: Braconidae, Microgastrinae from Area de Conservacion Guanacaste (ACG, Costa Rica, are revised. A total of 28 new species are described: 23 of Snellenius (the first record for Mesoamerica and five of Microplitis. A key is provided to all new species and five species of Microplitis previously described from Mesoamerica. In ACG, all Microplitis were reared exclusively from Sphingidae, while all Snellenius were reared from Noctuoidea (Noctuidae and Erebidae. All of the wasp species with known host records are unambiguously specialists, parasitizing one or a few related hosts. Biological information (wasp cocoon and caterpillar hosts in the Neotropical region seems to differ from similar data reported in previous works for the Oriental region -but more studies on the world fauna are needed. Although the distinction between these two genera has been controversial, we consider that the available evidence, although not conclusive, suggests that these two genera are best kept as separate (based on the presence of at least a partial epicnemial carina in Snellenius, which is absent in Microplitis. The following 28 species, all authored by Fernández-Triana & Whitfield, are described as species nova: Microplitis adrianguadamuzi, M. alexanderrojasi, M. francopupulini, M. hebertbakeri, M. jorgehernandezi, Snellenius billburgeri, S. bobdressleri, S. donstonei, S. felipechavarriai, S. gerardoherrerai, S. irenebakerae, S. isidrochaconi, S. johnkressi, S. jorgecampabadali, S. jorgegomezlauritoi, S. josesarukhani, S. kerrydresslerae, S. lucindamcdadeae, S. luisdiegogomezi, S. mariakuzminae, S. mariamartachavarriae, S. phildevriesi, S. quiricojimenezi, S. robertoespinozai, S. sandyknappae, S. velvaruddae, S. vickifunkae, S. warrenwagneri.

  7. Zinc and Liming Effects on the Development of Cerrado Forest Species

    Science.gov (United States)

    Casagrande, J. C.; Soares, M. R.; Moraes, M. I. M.

    2012-04-01

    The Brazilian Cerrado is considered priority area for conservation of biodiversity. The biome has covered approximately 33% of the territory of the State of São Paulo, but, currently, there are isolated fragments of Cerrado that correspond to less than 7% of its original area. One of the consequences of the natural vegetation removal and soil degradation is the loss of fertility, reduction the nutrient content. There is limited knowledge of the nutritional requirements of native forest species from Cerrado, especially about micronutrients. The aims of this work are: (i) verify the influence of four levels of Zn in soil and three levels of liming on development of six forest species native to the Cerrado biome; (ii) assess Zn deficiency symptoms in native species of Savannah. The treatments were four levels of Zn (0.0; 2.0; 4.0;-1 6.0 kg ha of Zn) and three levels of base saturation (V% = natural, V% = 50% and V% = 70%), cultivated in green house. The forest species studied have different responses to soil correction and fertilization, and were not observed responses regarding biometric parameters (growth in height and dry matter) with respect to the correction of base saturation and soil fertilization with Zn, for seedlings of Tabebuia aurea, Eugenia dysenterica and Astronium graveolens, showing that these species are highly adapted to the conditions of low fertility and showing efficient physiology for Zn absorption, since there was satisfactory growth in conditions of low base saturation (36%), very low content of Zn in soil (0.3 mg dm-3 ) and ideal supply of other nutrients. The species Andira cuyabensis and Anacardium giganteum responded well to fertilization and soil remediation. The omission of Zn resulted in visual symptoms of nutritional deficiency only for the species Tabebuia aurea, Astronium graveolens and Anacardium giganteum. The content of Zn presented significance interaction between Zn doses and V% for species Hymenaea courbaril, Tabebuia aurea and

  8. Efficient surface functionalization of wound dressings by a phytoactive nanocoating refractory to Candida albicans biofilm development.

    Science.gov (United States)

    Anghel, Ion; Holban, Alina Maria; Andronescu, Ecaterina; Grumezescu, Alexandru Mihai; Chifiriuc, Mariana Carmen

    2013-12-01

    The present study reports the fabrication and characterization of a novel nanostructured phyto-bioactive coated rayon/polyester wound dressing (WD) surface refractory to Candida albicans adhesion, colonization and biofilm formation, based on functionalized magnetite nanoparticles and Anethum graveolens (AG) and Salvia officinalis (SO) essential oils (EOs). TEM, XRD, TGA, FT-IR were used for the characterization of the fabricated nanobiocoated WDs. Using magnetic nanoparticles for the stabilization and controlled release of EOs, the activity of natural volatile compounds is significantly enhanced and their effect is stable during time. For this reason the nanobiocoated surfaces exhibited a longer term anti-biofilm effect, maintained for at least 72 h. Besides their excellent anti- adherence properties, the proposed solutions exhibit the advantage of using vegetal natural compounds, which are less toxic and easily biodegradable in comparison with synthetic antifungal drugs, representing thus promising approaches for the development of successful ways to control and prevent fungal biofilms associated infections. PMID:24706124

  9. Antimicrobial activity of individual and mixed fractions of dill, cilantro, coriander and eucalyptus essential oils.

    Science.gov (United States)

    Delaquis, Pascal J; Stanich, Kareen; Girard, Benoit; Mazza, G

    2002-03-25

    Essential oils from dill (Anethum graveolens L.), coriander (seeds of Coriandrum sativum L.), cilantro (leaves of immature C. sativum L.) and eucalyptus (Eucalyptus dives) were separated into heterogeneous mixtures of components by fractional distillation and were analyzed by gas chromatography-mass spectroscopy. Minimum inhibitory concentrations against gram-positive bacteria, gram-negative bacteria and Saccharomyces cerevisiae were determined for the crude oils and their fractions. Essential oil of cilantro was particularly effective against Listeria monocytogenes, likely due to the presence of long chain (C6-C10) alcohols and aldehydes. The strength and spectrum of inhibition for the fractions often exceeded those determined in the crude oils. Mixing of fractions resulted in additive, synergistic or antagonistic effects against individual test microorganisms. PMID:11929164

  10. [Plasma levels of psoralens after celery ingestion].

    Science.gov (United States)

    Gral, N; Beani, J C; Bonnot, D; Mariotte, A M; Reymond, J L; Amblard, P

    1993-01-01

    Psoralens are photosensitizing substances present in many vegetables, some of which are routinely consumed. These vegetables are responsible for contact phytophotodermatitis, but it was agreed that they did not produce photodermatitis when taken orally. Ljunggren has recently questioned this concept by reporting a case of phototoxic accident which occurred after ingestion of 450 grams of celery roots (Apium graveolens). In a study in healthy volunteers we looked for psoralens in blood and analyzed the cutaneous photosensitivity by the minimal phototoxic doses (MPD) method, after ingestion of celery in large amounts (500 grams and more). Plasma concentrations of psoralens were inexistant in all subjects and at all sampling times, and no phototoxic reaction was detected by MPD. Celery roots, therefore, do not seem to be photosensitizing, even after ingestion in large amounts, but they might increase the risk of phototoxicity in PUVA-therapy. The same applies to fennel and parsnip. PMID:8161113

  11. Spectrophotometric Determination of Cu2+ and Monitoring of Hg2+ and Ni2+ in some Iranian Vegetables Using 6-(2-Naphthyl)-2, 3-Dihydro-as-triazine-3-thione

    Science.gov (United States)

    Shamsa, Fazel; Barazande Tehrani, Malehe; Mehravar, Hamid; Mohammadi, Elaheh

    2013-01-01

    Recently, 6-(2-naphthyl)-2, 3-dihydro-as-triazine-3-thione (NDTT) was synthesized in laboratory and used successfully for the spectrophotometric determination of nanogram levels of Cu2+ in aqueous solution. This reagent forms a specific red complex with Cu2+ ions after the extraction by chloroform at alkaline pH. The absorption of the complex in the UV region (313 nm) is about 8 times as strong as in the visible one (510 nm). Mercury and nickel ions form yellow complexes with NDTT under the same conditions which interfere in the UV region and without effect on Cu (II) absorbance in the visible region. The studied vegetables include Mentha pipereta L., Anethum graveolens L., Beta vulgaris L., Coriandrum sativum, Petroselinum hortense H., Ocimum basilicum L., Spinacia oleracea L., Lactuca sativa L., and Brassica oleracea L. PMID:24250566

  12. The effect of celery and parsley juices on pharmacodynamic activity of drugs involving cytochrome P450 in their metabolism.

    Science.gov (United States)

    Jakovljevic, V; Raskovic, A; Popovic, M; Sabo, J

    2002-01-01

    Celery (Apium graveolens) and parsley (Petroselinum sativum), plants used worldwide in human nutrition, are the natural sources of methoxsalen. In this study we investigated the effect of mice pretreatment with juices of this plants on the hypnotic action of pentobarbital and analgesic action of paracetamol and aminopyrine, the drugs involving cytochrome P450 superfamily in their metabolism. In mice pretreated with celery and parsley juices a prolonged action of pentobarbital with respect to control was observed, statistical significance being attained only with parsley-pretreated animals. Both pretreatments increased and prolonged the analgesic action of aminopyrine and paracetamol, pretreatment with parsley being again more effective. Celery and parsley juices given to animals two hours before their decapitation caused a significant decrease of cytochrome P450 in the liver homogenate as compared to control. PMID:12365194

  13. Spectrophotometric Determination of Cu(2+) and Monitoring of Hg(2+) and Ni(2+) in some Iranian Vegetables Using 6-(2-Naphthyl)-2, 3-Dihydro-as-triazine-3-thione.

    Science.gov (United States)

    Shamsa, Fazel; Barazande Tehrani, Malehe; Mehravar, Hamid; Mohammadi, Elaheh

    2013-01-01

    Recently, 6-(2-naphthyl)-2, 3-dihydro-as-triazine-3-thione (NDTT) was synthesized in laboratory and used successfully for the spectrophotometric determination of nanogram levels of Cu(2+) in aqueous solution. This reagent forms a specific red complex with Cu(2+) ions after the extraction by chloroform at alkaline pH. The absorption of the complex in the UV region (313 nm) is about 8 times as strong as in the visible one (510 nm). Mercury and nickel ions form yellow complexes with NDTT under the same conditions which interfere in the UV region and without effect on Cu (II) absorbance in the visible region. The studied vegetables include Mentha pipereta L., Anethum graveolens L., Beta vulgaris L., Coriandrum sativum, Petroselinum hortense H., Ocimum basilicum L., Spinacia oleracea L., Lactuca sativa L., and Brassica oleracea L. PMID:24250566

  14. Mėsos gaminių su augalų ekstraktais mikrobiologinių rodiklių kitimas laikymo metu ir juslinės savybės

    OpenAIRE

    Šarkinas, A.; Šipailienė, A.; Venskutonis, P. R.; Čypienė, V.; Mieželienė, A.; Alenčikienė, G.

    2005-01-01

    Augalų ekstraktų antimikrobinės savybės išbandytos modelinėje maltos kiaulienos ir jautienos sistemoje, laikant produktą 4–6 C temperatūroje. Įvertintas gelsvės (Levisticum officinale WDJ Koch), petražolių (Petroselinum sativum Hoffm), salierų (Apium graveolens L), rozmarino (Rozmarinus officinalis L), raudonėlio (Origanum vulgare L) 0,2; 0,4; 0,6 % ekstrakto priedo poveikis. Vertinant bendro mikroorganizmų skaičiaus, koliforminių bakterijų, stafilokokų, salmonelių skaičiaus pokyčius nustaty...

  15. Slope variation and population structure of tree species from different ecological groups in South Brazil

    Directory of Open Access Journals (Sweden)

    Edmilson Bianchini

    2010-09-01

    Full Text Available Size structure and spatial arrangement of 13 abundant tree species were determined in a riparian forest fragment inParaná State, South Brazil (23"16'S and 51"01'W. The studied species were Aspidosperma polyneuron Müll. Arg., Astronium graveolens Jacq. and Gallesia integrifolia (Spreng Harms (emergent species; Alseis floribunda Schott, Ruprechtia laxiflora Meisn. and Bougainvillea spectabilis Willd. (shade-intolerant canopy species; Machaerium paraguariense Hassl, Myroxylum peruiferum L. and Chrysophyllum gonocarpum (Mart. & Eichler ex Miq. Engl. (shade-tolerant canopy species; Sorocea bonplandii (Baill. Bürger, Trichilia casaretti C. Dc, Trichilia catigua A. Juss. and Actinostemon concolor (Spreng. Müll. Arg. (understory small trees species. Height and diameter structures and basal area of species were analyzed. Spatial patterns and slope correlation were analyzed by Moran's / spatial autocorrelation coefficient and partial Mantel test, respectively. The emergent and small understory species showed the highest and the lowest variations in height, diameter and basal area. Size distribution differed among emergent species and also among canopy shade-intolerant species. The spatial pattern ranged among species in all groups, except in understory small tree species. The slope was correlated with spatial pattern for A. polyneuron, A. graveolens, A. floribunda, R. laxiflora, M. peruiferum and T. casaretti. The results indicated that most species occurredin specific places, suggesting that niche differentiation can be an important factor in structuring the tree community.Visando contribuir para o conhecimento das estratégias devida de espécies em fragmentos florestais, foram determinadas as estruturas de tamanho e espacial de 13 espécies arbóreas do remanescente de floresta ciliar no Estado do Paraná, no Sul do Brasil (23"16'S e 51"01'W. Foram analisadas as espécies: Aspidosperma polyneuron Müll. Arg., Astronium graveolens Jacq. e Gallesia

  16. Antiinflammatory Effect of Several Umbelliferae Species

    Directory of Open Access Journals (Sweden)

    SUWIJIYO PRAMONO

    2005-03-01

    Full Text Available A screening for antiinflammatory effects was performed on several Indonesian Umbelliferae plants based on the contents of saponins and flavonoids. They were compared with Bupleurum falcatum L. as an introduced antiinflammatory plant. Roots and grains of each plant were collected, dried, and extracted with ethanol. The ethanolic extracts were then analyzed for their saponin and flavonoid contents by gravimetric and UV-vis spectrophotometric method. Antiinflammatory activity test was conducted on carragenin induced rat paw oedema. The results showed that the highest contents of saponin and flavonoid were found in the grains of Apium graveolens L. and showed antiinflammatory effect that was equivalent to that of the root of B. falcatum.

  17. Desarrollo de apio mínimamente procesado fortificado con vitamina e, utilizando la ingeniería de matrices. / Development of minimally processed celery fortified with vitamin E, by matrix engineering.

    OpenAIRE

    MARTELO CASTAÑO, YISELL JOHAN; Cortés Rodríguez, Misael; Suárez Mahecha, Héctor

    2011-01-01

    El objetivo de este trabajo fue desarrollar un producto mínimamente procesado fortificado con vitamina E, a partir de apio (Apium graveolens L. var.dulce), utilizando la ingeniería de matrices como metodología de obtención de alimentos funcionales. Trozos de apio impregnados al vacío con dlαtocoferol acetato emulsificado en una solución isotónica al vegetal de NaCl, 1,2%, fueron evaluados en función del tiempo de almacenamiento y el envasado (con y sin vacío), en términos de la cuantificación...

  18. AcEST: DK951819 [AcEST

    Lifescience Database Archive (English)

    Full Text Available TST38A01NGRL0012_G16 539 Adiantum capillus-veneris mRNA. clone: TST38A01NGRL0012_G16. 5' end seq ... aucus carota PE=... 39 0.016 sp|Q93VR4|ML423_ARATH MLP -like protein 423 OS=Arabidopsis thalia... 38 0.028 ... protein ABR18 OS=Pisum sativu... 32 1.5 sp|Q9SSK7|MLP 34_ARATH MLP -like protein 34 OS=Arabidopsis thalian ... ion protein tnsB O... 31 4.4 sp|Q9C7I7|ML165_ARATH MLP -like protein 165 OS=Arabidopsis thalia... 31 4.4 s ... n Api g 2 OS=Apium graveolens ... 31 4.4 sp|Q9SSK9|MLP 28_ARATH MLP -like protein 28 OS=Arabidopsis thalian ...

  19. Use of Medical Plants in Schools Communities from Sinop, Mato Grosso.

    Directory of Open Access Journals (Sweden)

    A. C. M. Urtado

    2013-03-01

    Full Text Available Abstract: This study was conducted in Sinop, Mato Grosso, on two school communities. It was applied semi-structured questionnaires with questions focused on socioeconomic and the use of medicinal plants. It has as finality proved the effective use of medicinal plants on the everyday and a levy of the most used plant. The general profile of the respondents has shown that the women detain the major part of the knowledge, and that pass this uses to the future generations and friends, and find these plants on specialty stores, backyards, supermarket, root stores, bush and fairs. The plants that were found more frequently was (Ruta graveolens L., Babosa (Aloe vera L., Erva-Cidreira (Lippia alba Mill., Erva-Santa-Maria (Chenopodium ambrosioides L., Boldo (Plectranthus amboinicus Spreng., Hortel(Menta x vilosa Huds. e Terramicina (Alternanthera dentata Moench..Keywords: medical plants, Sinop, school.

  20. Anti-Trypanosoma cruzi activity of 10 medicinal plants used in northeast Mexico.

    Science.gov (United States)

    Molina-Garza, Zinnia Judith; Bazaldúa-Rodríguez, Aldo Fabio; Quintanilla-Licea, Ramiro; Galaviz-Silva, Lucio

    2014-08-01

    The aim of this study was to screen the trypanocidal activity of plants used in traditional Mexican medicine for the treatment of various diseases related to parasitic infections. Cultured Trypanosoma cruzi epimastigotes were incubated for 96h with different concentrations of methanolic extracts obtained from Artemisia mexicana, Castela texana, Cymbopogon citratus, Eryngium heterophyllum, Haematoxylum brasiletto, Lippia graveolens, Marrubium vulgare, Persea americana, Ruta chalepensis and Schinus molle. The inhibitory concentration (IC50) was determined for each extract via a colorimetric method. Among the evaluated species, the methanolic extracts of E. heterophyllum, H. brasiletto, M. vulgare and S. molle exhibited the highest trypanocidal activity, showing percentages of growth inhibition between 88 and 100% at a concentration of 150μg/ml. These medicinal plants may represent a valuable source of new bioactive compounds for the therapeutic treatment of trypanosomiasis. PMID:24742906

  1. Morpho-histological studies in the aromatic species of Chenopodium from Argentina.

    Science.gov (United States)

    Bonzani, N E; Barboza, G E; Bugatti, M A; Ariza Espinar, L

    2003-04-01

    A morpho-histological study of the vegetative organs (stem and leaf) of the aromatic species of Chenopodium L. from Argentina [C. ambrosioides L., C. burkartii (Aellen) Vorosch., C. carinatum R. Br., C. chilense Schrad., C. graveolens Willd. var. bangii (Murr) Aellen, C. haumanii Ulbr., C. multifidum L., C. oblanceolatum (Speg.) Giusti, C. pumilio R. Br., C. retusum (Moq.) Moq., and C. venturii (Aellen) Cabrera] was carried out. Classifications for the glandular and non-glandular trichomes are established and their presence among species is presented. A variant in both the dorsiventral and isobilateral mesophyll is reported; some data are valuable for systematic purposes and for the identification of dried and smashed material used as vegetal drug. PMID:12727484

  2. Plants used as abortifacients and emmenagogues by Spanish New Mexicans.

    Science.gov (United States)

    Conway, G A; Slocumb, J C

    1979-10-01

    Individuals of Spanish and Mexican descent in New Mexico have used a number of plants as emmenagogues and abortifacients. Of the plants used, cotton root bark (Gossypium sp.), inmortal ((Asclepias capricornu Woodson), poleo chino (Hedeoma oblongifolia (Gray) Heller), rue Ruta graveolens L.), wormseed (Chenopodium ambrosioides L.), and three species of Artemesia seem to be used most widely. Of these, the cotton root bark, when used as an abortifacient, seems to exhibit the lowest toxicity. Rue is notable because of its use independently within different cultures, but may exhibit toxic side effects when used as an abortifacient. Seven other plants are outlined on the basis of anecdotal and folkloric reports. Investigations are underway to look at use effectiveness, side effects, impact on fertility, and acceptance among cultures of the Southwestern United States. PMID:232204

  3. Green corrosion inhibitors for carbon steel by green leafy vegetables extracts in 1 M HCl

    Directory of Open Access Journals (Sweden)

    Ghadah M. Al-Senani

    2015-12-01

    Full Text Available The effect of some Green Leafy Vegetables (GLV extracts namely Lactuca sativa (Lactuca, Eruca Sativa (Arugula, Petroselinum crispum (Parsley, and Anethum Graveolens (Dill were investigated on inhibition of corrosion carbon steel in 1 M HCl solution using gravimetric (weight loss method. The inhibition efficiency has increased as concentration of the extract increased. The inhibition efficiency has decreased as the temperature increased. The results obtained showed that GLV extracts inhibited the corrosion process by a physical adsorption mechanism that followed the Langmuir, Freundlich, and Temkin adsorption isotherm models. The adsorption thermodynamic parameters that were calculated include, free energy of adsorption (∆G°ads, activation energy (Ea, enthalpy of adsorption (ΔH°ads, and entropy of adsorption (ΔS°ads are proposed for the corrosion of carbon steel in 1 M HCl in the absence and presence of GLV extract.

  4. Bioactivity against Bursaphelenchus xylophilus: Nematotoxics from essential oils, essential oils fractions and decoction waters.

    Science.gov (United States)

    Faria, Jorge M S; Barbosa, Pedro; Bennett, Richard N; Mota, Manuel; Figueiredo, A Cristina

    2013-10-01

    The Portuguese pine forest has become dangerously threatened by pine wilt disease (PWD), caused by the pinewood nematode (PWN), Bursaphelenchus xylophilus. Synthetic chemicals are the most common pesticides used against phytoparasitic nematodes but its use has negative ecological impacts. Phytochemicals may prove to be environmentally friendly alternatives. Essential oils (EOs) and decoction waters, isolated from 84 plant samples, were tested against B. xylophilus, in direct contact assays. Some successful EOs were fractionated and the fractions containing hydrocarbons or oxygen-containing molecules tested separately. Twenty EOs showed corrected mortalities ⩾96% at 2 μL/mL. These were further tested at lower concentrations. Ruta graveolens, Satureja montana and Thymbra capitata EOs showed lethal concentrations (LC100)capitata EOs are potential environmentally friendly alternatives for B. xylophilus control given their high nematotoxic properties. Nematotoxic activity of an EO should be taken in its entirety, as its different components may contribute, in distinct ways, to the overall EO activity. PMID:23829930

  5. From traditional European medicine to discovery of new drug candidates for the treatment of dementia and Alzheimer's disease: acetylcholinesterase inhibitors.

    Science.gov (United States)

    Russo, P; Frustaci, A; Del Bufalo, A; Fini, M; Cesario, A

    2013-01-01

    The leading Alzheimer's disease (AD) therapeutics to date involves inhibitors of acetylcholinesterase (AChE), which should, in principle, elevate cholinergic signaling and limit inflammation. In spite of the effectiveness in 20%-30% of AD patients, more attention has been paid to find new anti-AChE agents from medicinal plants. Galanthamine, contained in the bulbs and flowers of Galanthus and related genera like Narcissus, represents a good example. The aim of this study is to review the role of possible AChE inhibitors (AChEI) present in plants traditionally used in European medicine for improving memory. Starting from Galanthamine, properties of Melissa species, Salvia officinalis, Arnica chamissonis and Ruta graveolens are discussed to point to the role of these plants as potential sources for the development of therapeutic agents for AD. PMID:23210783

  6. Massage with aromatherapy: effectiveness on anxiety of users with personality disorders in psychiatric hospitalization

    Directory of Open Access Journals (Sweden)

    Thiago da Silva Domingos

    2015-06-01

    Full Text Available OBJECTIVE To investigate the effectiveness of aromatherapy massage using the essential oils (0.5% of Lavandula angustifolia and Pelargonium graveolens for anxiety reduction in patients with personality disorders during psychiatric hospitalization. METHOD Uncontrolled clinical trial with 50 subjects submitted to six massages with aromatherapy, performed on alternate days, on the cervical and the posterior thoracic regions. Vital data (heart and respiratory rate were collected before and after each session and an anxiety scale (Trait Anxiety Inventory-State was applied at the beginning and end of the intervention. The results were statistically analyzed with the chi square test and paired t test. RESULTS There was a statistically significant decrease (p < 0.001 of the heart and respiratory mean rates after each intervention session, as well as in the inventory score. CONCLUSION Aromatherapy has demonstrated effectiveness in anxiety relief, considering the decrease of heart and respiratory rates in patients diagnosed with personality disorders during psychiatric hospitalization.

  7. Chemical Composition of Different Botanical Origin Honeys Produced by Sicilian Black Honeybees (Apis mellifera ssp. sicula).

    Science.gov (United States)

    Mannina, Luisa; Sobolev, Anatoly P; Di Lorenzo, Arianna; Vista, Silvia; Tenore, Gian Carlo; Daglia, Maria

    2015-07-01

    In 2008 a Slow Food Presidium was launched in Sicily (Italy) for an early warning of the risk of extinction of the Sicilian native breed of black honeybee (Apis mellifera L. ssp sicula). Today, the honey produced by these honeybees is the only Sicilian honey produced entirely by the black honeybees. In view of few available data regarding the chemical composition of A. mellifera ssp. sicula honeys, in the present investigation the chemical compositions of sulla honey (Hedysarum coronarium L.) and dill honey (Anethum graveolens L.) were studied with a multimethodological approach, which consists of HPLC-PDA-ESI-MSn and NMR spectroscopy. Moreover, three unifloral honeys (lemon honey (obtained from Citrus limon (L.) Osbeck), orange honey (Citrus arantium L.), and medlar honey (Eriobotrya japonica (Thunb.) Lindl)), with known phenol and polyphenol compositions, were studied with NMR spectroscopy to deepen the knowledge about sugar and amino acid compositions. PMID:25730368

  8. The vegetation and climate of a Neogene petrified wood forest of Mizoram, India

    Science.gov (United States)

    Tiwari, R. P.; Mehrotra, R. C.; Srivastava, Gaurav; Shukla, Anumeha

    2012-11-01

    Eleven fossil woods belonging to seven families are described from a petrified wood forest of Mizoram. This fossil assemblage is derived from sediments belonging to the Tipam Group considered to be Late Miocene-Early Pliocene in age. The modern counterparts of the identified taxa are: Gluta L., Mangifera L. (Anacardiaceae), Bursera Jacq. ex L. (Burseraceae), Terminalia L. (Combretaceae), Shorea Roxb. (Dipterocarpaceae), Cynometra Linn., Dalbergia L. f., Millettia Wight et Arn.-Pongamia Vent, Ormosia Jacks. (Fabaceae), Artocarpus Forst. (Moraceae) and Madhuca Gmelin. (Sapotaceae). The genus Dalbergia is described for the first time from India. The modern environmental tolerances of the above taxa indicate the existence of a tropical warm and humid climate in Mizoram during the depositional period. The reconstructed climate data using Coexistence Approach (CoA) based on palaeoflora database of Mosbrugger and Utescher, along with other published data sets indicates an MAT (mean annual temperature) of 26.1-27.7 °C, a mean temperature of the warmest month (WMT) of 25.4-28.1 °C, a mean temperature of the coldest month (CMT) of 25.6-26 °C, and a mean annual precipitation (MAP) of 3180-3263 mm. These climatic interpretations are congruent with the data obtained from the anatomical features of all the fossil taxa. As all the fossil taxa possess diffuse porous wood, they further indicate a tropical climate with little seasonality. The majority of the taxa in the fossil assemblage generally have large vessels and simple perforation plates which indicate high precipitation. The present study provides vital evidence of floral exchange or migration between India and southeast Asia.

  9. [Vegetation diversity, composition and structure in a cattle agro-landscape of Matiguás, Nicaragua].

    Science.gov (United States)

    Merlos, Dalia Sánchez; Harvey, Celia A; Grijalva, Alfredo; Medina, Arnulfo; Vílchez, Sergio; Hernández, Blas

    2005-01-01

    The diversity, composition and structure of vegetation in a cattle landscape in Matiguás, Nicaragua was characterized, and the floristic and structural differences of six types of habitats (secondary forests, riparian forests, charrales, live fences and pastures with high and low tree cover) were compared. A total of 3 949 trees of 180 species and 52 families were recorded. Forty six percent of the total trees reported for the landscape were represented by Guazuma ulmifolia (18.5%), Bursera simaruha (13.2%), Tabebuia rosea (6.3%), Enterolobium cyclocarpum (4.2%) and Albizia saman (3.4%). Many of the dominant species in the landscape were typical of open and disturbed areas. There were significant differences between the different habitats in the patterns of tree species richness, abundance, diversity, structure and floristic composition. The riparian forests had greater tree richness (p=0.0001) and diversity (p=0.0009) than other habitats. The floristic composition varied across habitats. with pairs of habitats sharing between 18.4 and 51.6% of the same tree species, and with clear differences in composition between the forested (riparian and secondary forests) and agricultural habitats. Of the habitats studied, the riparian forests and secondary forests seem to have greatest value for the conservation of the flora in the agropaisaje because they have the greatest species richness, and maintain small populations of endangered species. On the basis of the study, we recommend including agricultural landscapes in strategies to conserve tree diversity and suggest measures to ensure the maintenance of tree diversity in the Matiguas landscape. PMID:17354450

  10. Ensaios preliminares em laboratório para verificar a ação moluscicida de algumas espécies da flora brasileira Preliminary laboratory tests of the molluscicide activity of some species of Brazilian flora

    Directory of Open Access Journals (Sweden)

    Nelymar Martineli Mendes

    1984-10-01

    Full Text Available Estudou-se em laboratório a atividade moluscicida de 68 extratos de 23 plantas brasileiras. As soluções em água desclorada dos extratos hexânicos e etanólico, nas concentrações de 1, 10 e 100 ppm, foram testadas sobre caramujos adultos e desovas de Biomphalaria glabrata, criados em laboratório. As plantas que demonstraram ação moluscicida na concentração de 100 ppm foram: Arthemisia verlotorum Lamotte, Caesalpinia peltophoroides Benth, Cassia rugosa G.Don., Eclipta alba Hassk, Euphorbia pulcherrima Willd, Euphorbia splendens Bojer, Joannesia princeps Vell, Leonorus sibiricus L.,Macrosiphonia guaranitica Muell,Nerium oleander L., Palicourea nicotianaefolia Cham, e Schlech., Panicum maximum M., Rumex crispus L., Ruta graveolens L., e Stryphnodendron barbatiman M.The molluscicide activity of sixty-eight extracts from twenty-three Brazilian plants was studied in the laboratory. The solutions, in dechlorinated water, of hexanic and ethylic extracts at 1, 10 and 100 ppm concentrations, were tested on adult snails and egg masses of Biomphalaria glabrata, reared in the laboratory. The plants with molluscicide activity on adult snails and/or egg masses at 100 ppm concentration were: Arthemisia verlotorum Lamotte, Caesalpinia peltophoroides Benth, Cassia rugosa G. Don, Eclipta alba Hassk, Euphorbia pulcherrima Willd, Euphorbia splendens Bojer, Joannesia princeps Vell, Leonorus sibiricus L., Macrosiphonia guaranitica Muell, Nerium oleander L., Palicourea nicotianaefolia Cham. and Schlech., Panicum maximum M., Rumex crispus L., Ruta graveolens L. and Stryphnodendron barbatiman M.

  11. Avaliação in vitro da atividade antifúngica de extratos de plantas e óleo de eucalipto sobre Trichophyton mentagrophytes In vitro evaluation of the antifungal activity of plant extracts and eucalyptus oil on Trichophyton mentagrophytes

    Directory of Open Access Journals (Sweden)

    D.F.R. Frias

    2009-01-01

    Full Text Available O presente estudo teve como objetivo determinar a ação antifúngica de extratos de plantas medicinais e óleo de eucalipto frente ao dermatófito Trichophyton mentagropytes, visando a utilização da fitoterapia no controle. As plantas utilizadas na obtenção dos extratos foram arruda (Ruta graveolens, citronela (Cymbopogon nardus, cravo de defunto (Tagetes minuta, eucalipto (Eucalyptus spp, graviola (Annona muricata, fruta do conde (Annona spp, manga (Mangifera indica, romã (Punica granatum, flores e folhas de primavera (Bougainvillea spectabilis. Verificou-se que uso de 0,5% óleo de eucalipto no combate ao T. mentagropytes foi eficaz, já os extratos de citronela (4% eucalipto (5% e romã (8% atuaram como fungistáticos e os restantes não devem ser usados contra este dermatófito porque não causaram nenhum efeito.The aim of this study was to assess the antifungal action of medicinal plant extracts and eucalyptus oil against the dermatophyte Trichophyton mentagrophytes in order to employ phytotherapy for its control. The plants used for extract production were common rue (Ruta graveolens, citronella (Cymbopogon nardus, wild marigold (Tagetes minuta, eucalyptus (Eucalyptus spp, sweetsop (Annona muricata, custard apple (Annona spp, mango (Mangifera indica, pomegranate (Punica granatum, besides flowers and leaves of bougainvillea (Bougainvillea spectabilis. The use of 0.5% eucalyptus oil was effective in controlling Trichophyton mentagrophytes; however, citronella (4%, eucalyptus (5% and pomegranate (8% extracts acted as fungistatic, and the remaining extracts should not be used against this dermatophyte since they did not have any effect.

  12. АЛЛЕЛОПАТИЧЕСКАЯ АКТИВНОСТЬ У СЕМЯН ОВОЩНЫХ СЕЛЬДЕРЕЙНЫХ КУЛЬТУР

    OpenAIRE

    Бухаров, А.; Балеев, Д.

    2014-01-01

    Исследовали стабильность проявления аллелопатической активности у овощных сельдерейных культур. Объектами-донорами служили семена сельдерея корневого ( Apium graveolens ) сорта Купидон, петрушки корневой ( Petroselinum crispum ) сорта Любаша, пастернака ( Pastinaca sativa ) сорта Кулинар и укропа ( Anethum graveolens ) сорта Кентавр; объекты-тестеры семена редиса ( Raphanus sativus ), салата ( Lactuca sativa ), капусты японской ( Brassica chinesis var. japonica ), кресс-салата ( Lepidium sati...

  13. Larvicidal and acetylcholinesterase inhibitory activities of apiaceae plant essential oils and their constituents against aedes albopictus and formulation development.

    Science.gov (United States)

    Seo, Seon-Mi; Jung, Chan-Sik; Kang, Jaesoon; Lee, Hyo-Rim; Kim, Sung-Woong; Hyun, Jinho; Park, Il-Kwon

    2015-11-18

    This study evaluated the larvicidal activity of 12 Apiaceae plant essential oils and their components against the Asian tiger mosquito, Aedes albopictus, and the inhibition of acetylcholine esterase with their components. Of the 12 plant essential oils tested, ajowan (Trachyspermum ammi), caraway seed (Carum carvi), carrot seed (Daucus carota), celery (Apium graveolens), cumin (Cuminum cyminum), dill (Anethum graveolens), and parsley (Petroselinum sativum) resulted in >90% larval mortality when used at 0.1 mg/mL. Of the compounds identified, α-phellandrene, α-terpinene, p-cymene, (-)-limonene, (+)-limonene, γ-terpinene, cuminaldehyde, neral, (S)-+-carvone, trans-anethole, thymol, carvacrol, myristicin, apiol, and carotol resulted in >80% larval mortality when used at 0.1 mg/mL. Two days after treatment, 24.69, 3.64, and 12.43% of the original amounts of the celery, cumin, and parsley oils, respectively, remained in the water. Less than 50% of the original amounts of α-phellandrene, 1,8-cineole, terpinen-4-ol, cuminaldehyde, and trans-antheole were detected in the water at 2 days after treatment. Carvacrol, α-pinene, and β-pinene inhibited the activity of Ae. albopictus acetylcholinesterase with IC50 values of 0.057, 0.062, and 0.190 mg/mL, respectively. A spherical microemulsion of parsley essential oil-loaded poly(vinyl alcohol) (PVA) was prepared, and the larvicidal activity of this formulation was shown to be similar to that of parsley oil. PMID:26500081

  14. Methylhexanamine is not detectable in Pelargonium or Geranium species and their essential oils: A multi-centre investigation.

    Science.gov (United States)

    ElSohly, Mahmoud A; Gul, Waseem; Tolbert, Candice; ElSohly, Kareem M; Murphy, Timothy P; Avula, Bharathi; Chittiboyina, Amar G; Wang, Mei; Khan, Ikhlas A; Yang, Min; Guo, Dean; Zhang, Wei-Dong; Su, Juan

    2015-07-01

    In an earlier study, we developed two sensitive and reliable procedures for gas chromatography-mass spectrometry (GC-MS) and liquid chromatography-tandem mass spectrometry (LC-MS/MS) analysis of methylhexaneamine (MHA) in P. graveolens plant materials and volatile oils. None of the analyzed plant materials or oils showed any detectable levels of MHA which was further substantiated by high resolution liquid chromatography-quantum time of flight-mass spectrometry (LC-QTOF-MS) analysis with a limit of detection of 10 ppb. However, other laboratories (two studies) reported the presence of MHA in some samples of P. graveolens and pelargonium oil acquired by the investigators from China. Because of the controversy of whether Pelargonium species or pelargonium oil contains MHA, it was recommended that splits of multiple samples be analyzed by different laboratories. In this investigation, multiple plant materials and oil samples were collected from around the world. These samples were submitted to four different sites for analysis. All sites adopted a similar extraction method. All the analysis sites used LC-MS/MS or LC-QTOF-MS and detection limit was set close to the 10 ng/mL as previously reported. A total of 18 plant samples belonging to 6 different Pelargonium species and 9 oils from different locations around the world were split among 4 different analytical laboratories for analysis (each lab received the same samples). None of the laboratories detected MHA in any of the samples at or around the 10 ppb detection level of the procedure used. PMID:25346500

  15. Review of scientific evidence of medicinal convoy plants in traditional Persian medicine

    Directory of Open Access Journals (Sweden)

    Seyede Nargess Sadati

    2016-01-01

    Full Text Available One concept used in traditional Persian medicine (TPM for multidrug therapy is that of the convoy drug (Mobadregh. According to TPM texts, convoy drugs are substances (or drugs, which facilitate the access of drugs or foods to the whole body or to specific organs. This study reviewed some convoy drugs presented in TPM, their biological effects, and their probable interactions with main drugs, considering the increased absorption through inhibition of P-glycoprotein (P-gp efflux function, bioavailability-enhancing effects, and decreased metabolism of the main drug using electronic databases including PubMed, Scopus, ScienceDirect, and Google Scholar in November and December, 2013. Recent studies have proven the beneficial effects of Crocus sativus L. (saffron and camphor on the heart and brain, the cerebral therapeutic effects of Asarum europaeum (hazelwort, the hepatoprotective effects of Cichorium intybus (chicory, and Apium graveolens (celery seeds, and the diuretic effects of Cinnamomum zeylanicum (cinnamon, and Cucumis melo (melon seeds. The effects of vinegar in targeting the liver and brain have also been demonstrated. An evaluation of the results demonstrated that the suggested convoy drugs, including Piper nigrum (black pepper, Piper longum (long pepper, red wine, Camellia sinensis (tea, hazelwort, Mentha longifolia (pennyroyal, Anethum graveolens (dill, Foeniculum vulgare (fennel, cinnamon, and Sassafras albidum (sassafras can increase the bioavailability of coadministered drugs by inhibition of P-gp or cytochrome P450s (CYP450s or both of them. This evidence could be a good basis for the use of these agents as convoys in TPM.

  16. Review of Scientific Evidence of Medicinal Convoy Plants in Traditional Persian Medicine.

    Science.gov (United States)

    Sadati, Seyede Nargess; Ardekani, Mohammad Reza Shams; Ebadi, Nastaran; Yakhchali, Maryam; Dana, Azadeh Raees; Masoomi, Fatemeh; Khanavi, Mahnaz; Ramezany, Farid

    2016-01-01

    One concept used in traditional Persian medicine (TPM) for multidrug therapy is that of the convoy drug (Mobadregh). According to TPM texts, convoy drugs are substances (or drugs), which facilitate the access of drugs or foods to the whole body or to specific organs. This study reviewed some convoy drugs presented in TPM, their biological effects, and their probable interactions with main drugs, considering the increased absorption through inhibition of P-glycoprotein (P-gp) efflux function, bioavailability-enhancing effects, and decreased metabolism of the main drug using electronic databases including PubMed, Scopus, ScienceDirect, and Google Scholar in November and December, 2013. Recent studies have proven the beneficial effects of Crocus sativus L. (saffron) and camphor on the heart and brain, the cerebral therapeutic effects of Asarum europaeum (hazelwort), the hepatoprotective effects of Cichorium intybus (chicory), and Apium graveolens (celery) seeds, and the diuretic effects of Cinnamomum zeylanicum (cinnamon), and Cucumis melo (melon) seeds. The effects of vinegar in targeting the liver and brain have also been demonstrated. An evaluation of the results demonstrated that the suggested convoy drugs, including Piper nigrum (black pepper), Piper longum (long pepper), red wine, Camellia sinensis (tea), hazelwort, Mentha longifolia (pennyroyal), Anethum graveolens (dill), Foeniculum vulgare (fennel), cinnamon, and Sassafras albidum (sassafras) can increase the bioavailability of coadministered drugs by inhibition of P-gp or cytochrome P450s (CYP450s) or both of them. This evidence could be a good basis for the use of these agents as convoys in TPM. PMID:27041871

  17. Leaf litter as a possible food source for chironomids (Diptera in Brazilian and Portuguese headwater streams Detritos foliares como possível fonte de alimento para Chironomidae (Diptera em riachos de cabeceira brasileiros e portugueses

    Directory of Open Access Journals (Sweden)

    Marcos Callisto

    2007-06-01

    Full Text Available Our objective was to evaluate the potential use of leaf detritus by chironomid larvae. Field and laboratory experiments were performed using leaves and chironomid species collected in Portugal and Brazil. Laboratory experiments under controlled conditions were done using microbial conditioned senescent leaves of Alnus glutinosa (L. Gaertn, Neriumoleander L., Protium heptaphilum (Aubl. March, Protium brasiliense (Spreng Engl., Myrcia guyanensis(Aubl. DC and Miconia chartacea Triana. Laboratory experiments were performed using specimens collected from leaf litter in local streams. Whenever possible, after the experiments, chironomids were allowed to emerge as adults and identified. In Portugal the following taxa were identified: Micropsectra apposita (Walker, 1856, Polypedilum albicorne (Meigen, 1838,Eukiefferiella claripennis Lundbeck (1898, Rheocricotopus (Psilocricotopus atripes Rempel (1937 and Ablabesmyia Johannsen (1905 (Diptera, Chironomidae. Consumption rates ranged from 0.15 ± 0.10 mg (AFDM of leaf animal-1 day-1 (Micropsectra apposita feeding on Alnus glutinosa up to 0.85 ± 0.33 mg (AFDM of leaf animal-1 day-1 (Polypedilum albicorne feeding on Miconia chartacea. In Brazil, the following taxa were identified from leaves: Phaenopsectra sp., Chironomus spp. and Polypedilum sp. and maximum consumption rates reached 0.47 ± 0.28 (AFDM of leaf mg.animal-1.day-1 (Chironomus Meigen (1803 feeding on Protium heptaphilum. Feeding experiments with laboratory cultured specimens, revealed that some chironomids were unable to feed on decomposing leaves (e.g., C. xanthus Rempel (1939 on P.brasiliensis and M.guyanensis. Our results suggest that some stream chironomids (not typical shredders can use leaf litter of riparian vegetation as a complementary food source.O objetivo foi avaliar o potencial uso de detritos foliares por larvas de Chironomidae. Foram realizados experimentos em campo e em laboratório utilizando folhas e larvas de Chironomidae

  18. Regeneração de espécies nativas lenhosas sob plantio de Eucalyptus em área de Cerrado na Floresta Nacional de Paraopeba, MG, Brasil Regeneration of wood natives species under Eucalyptus stand of Cerrado area in the Floresta Nacional of Paraopeba, Minas Gerais, Brazil

    Directory of Open Access Journals (Sweden)

    Andreza Viana Neri

    2005-06-01

    Full Text Available A regeneração de sub-bosques em plantios homogêneos tem estreita dependência de florestas vizinhas. Outros fatores exercem influência, como a ecologia da dispersão da espécie, os efeitos de borda e clareiras. Diante disto, procurou-se conhecer a florística e a estrutura da vegetação lenhosa de espécies nativas sob plantio de Eucalyptus em área de Cerrado na Floresta Nacional de Paraopeba, MG, e verificar a variação da riqueza, da densidade e de indivíduos zoocóricos e anemocóricos da borda para o interior do talhão. Para tal, foram alocadas cinco parcelas de 5×40 m, subdivididas em parcelas 5×10 m. Foram encontradas 47 espécies e destas as que se destacaram foram Magonia pubescens A. St.-Hil.e Miconia albicans (Sw. Triana, principalmente quanto à alta densidade. Das espécies amostradas 53% possuem dispersão zoocórica e 43% anemocórica. Verificou-se também a diminuição da riqueza, da densidade e da percentagem de indivíduos anemocóricos da borda para interior. Porém a percentagem de indivíduos zoocóricos aumentou no interior do talhão. A maior riqueza e densidade na borda dá-se pela dificuldade da dispersão de diásporos no interior do fragmento. O índice de diversidade (H'= 2,49 encontrado para este estudo foi próximo aos valores observados em estudos em regeneração sob Eucalyptus em áreas de Cerrado.The regeneration of understory in homogeneous stands is closely dependent of neighbour forests. Others factures also have influency such as the species dispersion ecology, the border effects and clearings. Therefore, the objective of this work were to study the floristic and structure of native woody plant species growing under stands of Eucalyptus in the Cerrado area in the Flona (Floresta Nacional - National Forest of Paraopeba, Minas Gerais, Brazil, and to determine the variations in richness, density and the zoochorous and anemochorous individual dispersions from the borders into the stand. To carry out

  19. Evaluación in vivo de la actividad antimalárica de 25 plantas provenientes de una Reserva de Conservación Biológica de Costa Rica In vivo evaluation of the antimalarial activity of 25 plants from a Biological Conservation Reserve of Costa Rica

    Directory of Open Access Journals (Sweden)

    MISAEL CHINCHILLA-CARMONA

    2011-03-01

    Full Text Available Se realizó una evaluación in vivo de la actividad antimalárica de las hojas, flores, frutos, corteza y raíz de 25 plantas de la Reserva Biológica Alberto Manuel Brenes (REBAMB, situada en San Ramón, Alajuela, Costa Rica. Las plantas estudiadas fueron Aphelandra aurantiaca (Scheidw. Lindl., Aphelandra tridentata Hemsl. (Acanthaceae, Xanthosoma undipes (K. Koch & C.D. Bouché K. Koch. (Araceae, Iriartea deltoidea Ruiz & Pav. (Arecaceae, Neurolaena lobata (L. Cass. (Asteraceae, Lonchocarpus pentaphyllus (Poir. Kunth ex DC., Pterocarpus hayesii Hemsl., Senna papillosa (Britton & Rose H.S. Irwin & Barneby., Cinnamomum chavarrianum (Hammel Kosterm. (Fabaceae, Nectandra membranacea (Sw. Griseb., Persea povedae W.C. Burger. (Lauraceae, Hampea appendiculata (Donn. Sm. Standl. (Malvaceae, Guarea glabra Vahl., Ruagea glabra Triana & Planch. (Meliaceae, Psidium guajava L. (Myrtaceae, Bocconia frutescens L. (Papaveraceae, Piper friedrichsthalii C. DC. (Piperaceae, Clematis dioica L. (Ranunculaceae, Prunus annularis Koehne. (Rosaceae, Siparuna thecaphora (Poepp. & Endl. A. DC. (Siparunaceae, Solanum arboreum Dunal., Witheringia solanacea L'Hér. (Solanaceae, Ticodendron incognitum Gómez-Laur. & L.D. Gómez. (Ticodendraceae, Heliocarpus appendiculatus Turcz. (Tiliaceae y Myriocarpa longipes Liebm. (Urticaceae. Los extractos alcohólicos frescos y secos, fueron evaluados por su actividad inhibitoria de la parasitemia causada por Plasmodium berghei en ratones Swiss. Al realizar las prueba de CI50 las plantas en que esa actividad fue muy relevante fueron (en mg kg-1 de peso: 12 para la corteza de B. frutescens, 18 para la raíz de H. appendiculata, 14 para la raíz de I. deltoidea, 4 para el fruto inmaduro de M. longipes, 21 para la raíz de N. membranacea, 19 para las hojas tiernas de P. povedae y 16 para el fruto inmaduro de S. tecaphora. Los extractos frescos presentaron una mayor actividad antimalárica que los sometidos a desecación. Este estudio es

  20. Caracterização morfológica de minas foliares em espécies de Melastomataceae de Mata Atlântica, PE Morphological characterization of leaf mines in species of Melastomataceae in Atlantic Forest, Pernambuco, Brazil

    Directory of Open Access Journals (Sweden)

    Aretuza B Brito-Ramos

    2010-09-01

    Full Text Available Este trabalho descreve a morfologia e a anatomia de folhas íntegras e minadas de cinco espécies de Melastomataceae, ocorrentes em um fragmento de Mata Atlântica, PE. As minas foram visualizadas em uma ou ambas as faces das folhas, possuindo padrão sinuoso ou retilíneo, distribuídas entre as nervuras ou por toda a lâmina, sendo estas características distintas para cada espécie. As folhas apresentam epiderme uniestratificada com estômatos presentes na face abaxial e tricomas dendríticos, multicelulares, estrelados e com mais de cinco ramos, em ambas ou apenas uma das faces. O mesofilo é dorsiventral e o sistema vascular em forma de arco. As larvas minadoras observadas em Miconia minutiflora (Bonpl. DC., M. albicans (Sw. Triana e Clidemia capitellata (Bonpl. D. Don consomem o parênquima paliçádico e esponjoso, enquanto as de M. prasina (Sw. DC. e M. ciliata (Rich. DC. se alimentam do conteúdo e das paredes anticlinais das células epidérmicas, caracterizando-as como do tipo epidérmica. Entretanto, em M. minutiflora, M. albicans e C. capitellata a epiderme permaneceu intacta formando uma proteção para o minador, enquanto que em M. prasina e M. ciliata a proteção é realizada pelas paredes periclinais externas e cutícula da folha. Tecido de cicatrização foi observado ao longo das minas em M. prasina.This study describes the morphology and anatomy of whole and mined leaves of five species of Melastomataceae native to an Atlantic Forest fragment in Pernambuco, Brazil. Mines can be found on one or both sides of the leaves, with a sinuous or rectilinear pattern, and distributed between the veins or throughout the entire leaf blade. These characteristics are distinct for each species. The leaves, in cross section, have a uniseriate epidermis, stomata on the abaxial surface, and unbranched hairs on both or at least one side. The mesophyll is bifacial and the vascular bundle is semi-circular. The leaf-miner larvae observed in

  1. Frugivoria e potencial dispersão de sementes pelo marsupial Gracilinanus agilis (Didelphidae: Didelphimorphia em áreas de Cerrado no Brasil central Frugivory and potential seed dispersal by the marsupial Gracilinanus agilis (Didelphidae: Didelphimorphia in areas of Cerrado in central Brazil

    Directory of Open Access Journals (Sweden)

    Nícholas Ferreira de Camargo

    2011-09-01

    Full Text Available No presente estudo, investigamos o consumo de frutos e viabilidade de sementes consumidas pelo marsupial Gracilinanus agilis (Burmeister, 1854 em quatro áreas de cerradão do Brasil central. Análises fecais indicaram que este mamífero se alimenta de plantas pioneiras da família Melastomataceae (Miconia albicans (Sw. Triana, M. cuspidata Naudin, M. ferruginata DC., M. pepericarpa DC., M. pohliana Cogn. e Ossaea congestiflora (Naudin Cogn., Solanaceae (uma espécie não identificada e Viscaceae (Phoradendron perrottetii (DC. Eichler, erva-de-passarinho. Detectamos o maior índice de consumo de frutos já registrado para o gênero Gracilinanus, com cerca de 45% das fezes contendo sementes e 86% contendo itens derivados de frutos (N=422. Com exceção de O. congestiflora, o restante das sementes das espécies testadas não sofreram efeitos negativos na germinabilidade ao passarem pelo trato digestório deste marsupial. A avaliação da variação intraspecífica no número de sementes encontradas nas fezes indicou que fêmeas de G. agilis defecam maior quantidade de sementes de Miconia (média±EP = 21,7±3,8 em comparação com os machos (14,4±3,0 (F=26,32; PIn the present study, we investigated patterns of fruit consumption and viability of seeds consumed by the marsupial Gracilinanus agilis (Burmeister, 1854 in four cerrado sites in central Brazil. Faecal analysis indicated that this mammal feeds on seeds of pioneer plant species of Melastomataceae (Miconia albicans (Sw. Triana, M. cuspidata Naudin, M. ferruginata DC., M. pepericarpa DC., M. pohliana Cogn. and Ossaea congestiflora (Naudin Cogn., Solanaceae (one unidentified species, and Viscaceae (Phoradendron perrottetii (DC. Eichler, mistletoe. We recorded the highest reported rate of fruit consumption for Gracilinanus, with about 45% of the scats containing seeds and 86% containing items derived from fruits (N = 422. With the exception of O. congestiflora, the remaining seed species

  2. Natural regeneration in abandoned fields following intensive agricultural land use in an Atlantic Forest Island, Brazil

    Directory of Open Access Journals (Sweden)

    Milene Silvestrini

    2012-08-01

    Full Text Available The time required to regrowth a forest in degraded areas depends on how the forest is removed and on the type of land use following removal. Natural regeneration was studied in abandoned old fields after intensive agricultural land use in areas originally covered by Brazilian Atlantic Forests of the Anchieta Island, Brazil in order to understand how plant communities reassemble following human disturbances as well as to determine suitable strategies of forest restoration. The fields were classified into three vegetation types according to the dominant plant species in: 1 Miconia albicans (Sw. Triana (Melastomataceae fields, 2 Dicranopteris flexuosa (Schrader Underw. (Gleicheniaceae thickets, and 3 Gleichenella pectinata (Willd. Ching. (Gleicheniaceae thickets. Both composition and structure of natural regeneration were compared among the three dominant vegetation types by establishing randomly three plots of 1 x 3 m in five sites of the island. A gradient in composition and abundance of species in natural regeneration could be observed along vegetation types from Dicranopteris fern thickets to Miconia fields. The gradient did not accurately follow the pattern of spatial distribution of the three dominant vegetation types in the island regarding their proximity of the remnant forests. A complex association of biotic and abiotic factors seems to be affecting the seedling recruitment and establishment in the study plots. The lowest plant regeneration found in Dicranopteris and Gleichenella thickets suggests that the ferns inhibit the recruitment of woody and herbaceous species. Otherwise, we could not distinguish different patterns of tree regeneration among the three vegetation types. Our results showed that forest recovery following severe anthropogenic disturbances is not direct, predictable or even achievable on its own. Appropriated actions and methods such as fern removal, planting ground covers, and enrichment planting with tree species were

  3. Using Automation to Improve the Flight Software Testing Process

    Science.gov (United States)

    ODonnell, James R., Jr.; Morgenstern, Wendy M.; Bartholomew, Maureen O.

    2001-01-01

    One of the critical phases in the development of a spacecraft attitude control system (ACS) is the testing of its flight software. The testing (and test verification) of ACS flight software requires a mix of skills involving software, knowledge of attitude control, and attitude control hardware, data manipulation, and analysis. The process of analyzing and verifying flight software test results often creates a bottleneck which dictates the speed at which flight software verification can be conducted. In the development of the Microwave Anisotropy Probe (MAP) spacecraft ACS subsystem, an integrated design environment was used that included a MAP high fidelity (HiFi) simulation, a central database of spacecraft parameters, a script language for numeric and string processing, and plotting capability. In this integrated environment, it was possible to automate many of the steps involved in flight software testing, making the entire process more efficient and thorough than on previous missions. In this paper, we will compare the testing process used on MAP to that used on other missions. The software tools that were developed to automate testing and test verification will be discussed, including the ability to import and process test data, synchronize test data and automatically generate HiFi script files used for test verification, and an automated capability for generating comparison plots. A summary of the benefits of applying these test methods on MAP will be given. Finally, the paper will conclude with a discussion of re-use of the tools and techniques presented, and the ongoing effort to apply them to flight software testing of the Triana spacecraft ACS subsystem.

  4. FLORÍSTICA E ESTRUTURA DA REGENERAÇÃO NATURAL ARBÓREA DE UMA FLORESTA DE VÁRZEA NA RESERVA EXTRATIVISTA CHOCOARÉ-MATO GROSSO, PARÁ, BRASIL

    Directory of Open Access Journals (Sweden)

    Fábio de Jesus Batista

    2013-12-01

    Full Text Available Este estudo teve como objetivo conhecer a composição florística e a estrutura da regeneração natural arbórea de uma floresta de várzea na Reserva Extrativista Chocoaré-Mato Grosso, Santarém Novo, Pará. O estudo foi realizado no período de janeiro a junho de 207 com a marcação de 10 parcelas temporárias de 10 x 100 m (1 ha e calculada a riqueza, a frequência relativa e a densidade relativa das espécies distribuídas em cinco classes de tamanho (CT baseada na altura e CAP. Foram registrados 33.738 indivíduos distribuídos em 20 famílias, 48 gêneros e 53 espécies. As famílias com as maiores densidades foram Clusiaceae, Fabaceae e Arecaceae. As espécies com maiores frequência e densidade relativas foram Symphonia globulifera L. f. (26,06%, Rheedia macrophylla (Mart. Planch. & Triana (11,83%, Inga alba (Sw. Willd. (6,34%, Inga edulis Mart. (6,11% e 91,6% indivíduos da regeneração ocorreram na classe de tamanho 1. A riqueza floristica foi inferior quando comparada com outras florestas de várzeas, contudo, os mecanismos de adaptação são estratégias para a dominância e representação quantitativa de algumas espécies na área como Symphonia globulifera. Palavras-chave: riqueza, classes de tamanho, unidade de conservação. DOI: http://dx.doi.org/10.18561/2179-5746/biotaamazonia.v3n3p139-145

  5. Efeito de diferentes temperaturas na germinação de sementes e no crescimento inicial de plântulas de Miconia albicans (Melastomataceae

    Directory of Open Access Journals (Sweden)

    A.K.M. Oliveira

    2014-01-01

    Full Text Available Miconia albicans (Sw. Triana é uma espécie nativa do Brasil utilizada na medicina tradicional em comunidades rurais. O objetivo deste estudo foi investigar a temperatura mais adequada para a germinação de sementes e formação de plântulas de M. albicans. Para avaliar o efeito da temperatura sobre a germinação da espécie foram utilizadas 1200 sementes postas a germinar sob temperaturas constantes de 20, 25, 30 e 35 ºC e nas temperaturas alternadas de 20-30 e 25-35 ºC. Foram avaliados a percentagem de germinação (PG, o índice de velocidade de germinação (IVG, o tempo médio de germinação (TMG, e o comprimento das raízes primárias e do caule das plântulas. Os resultados encontrados indicaram PG acima de 63% paras as sementes sob temperaturas de 20, 25, 30 e 20-30 ºC. Para o IVG, foram observados valores entre 2,17 a 2,93 para as sementes sob temperaturas de 20, 25, 30 e 20-30 ºC, indicando maior vigor; em relação ao TMG, a maioria dos tratamentos alcançou resultado acima de 15 dias, indicando que as sementes germinaram lentamente. Levando-se em consideração todos os parâmetros avaliados, a temperatura de 25 ºC propiciou o melhor desempenho para as sementes da espécie.

  6. Evaluation of irradiated essential oils to control of Sitophilus zeamais Mots. (Coleoptera: Curculionidae) and Blatella germanica (L.) (Dictyopera: Blattellidae); Avaliacao de produtos naturais irradiados para o controle de Sitophilus zeamais Mots. (Coleoptera: Curculionidae) e Blatella germanica (L.) (Dictyopera: Blattellidae)

    Energy Technology Data Exchange (ETDEWEB)

    Potenza, Marcos Roberto

    2004-07-01

    This work aimed to evaluate the effect of irradiated essential oils of Eucalyptus citriodora, Eucalyptus globulus, Pinus sp., Azadirachta indica, Cymbopogon nardus, Cupressus sempervirens, Cymbopogons citratus and Juniperus communis and aqueous, hexanic and ethanolic irradiated extracts of Solanum paniculatum, Dahlia pinnata, Lycopersicon esculentum, Nephrolepis pectinata, Ruta graveolens, Ficus elastica, Lavandula angustifolia, Rhododendron simsii, Agave angustifolia, Ocimum basilicum, Allamanda cathartica, Dieffenbachia brasiliensis, Pennisetum purpureum, Annona squamosa, Coffea arabica and Hibiscus rosa-sinensis, in order to identify new substances to integrated pest management (IPM) and to observe possible effects of gamma radiation about extracts and essential oils efficiency such as increase, reduction, activation and inactivation of the same to the pest control. It evaluated the effect of contact on Sitophilus zeamais and by ingestion in Blattella germanica. To irradiation was used an experimental irradiator of Cobalt-60, type Gammacell 220. The essential oils were submitted increasing doses of gamma radiation: 2.5; 5.0; 7.5 and 10.0 kGy. The bioassay with B. germanica demonstrated efficiency between 22.0 e 30.0% and between 30.0 and 42.0%, respectively, to irradiated essential oils of E. citriodora and E. globulus and they demonstrated too repellency to the nymphs. The gamma radiation used promoted changes in essential oils of E. citriodora e E. globulus that they began to show efficiency on B. germanica nymphs besides a significant reduction of repellency. Essential oils of Pinus sp., A. indica, C. sempervirens and J. communis did not display efficiency. The essential oils of C. nardus, and C. citratus had low efficiency. The gamma radiation increased the efficiency of ethanolic extract of D. Pinnata with dose of 7.5 kGy, showing 48.0% of efficiency on B. germanica nymphs. The gamma radiation showed adverse effect on the aqueous extract of R. Graveolens

  7. Evaluation of irradiated essential oils to control of Sitophilus zeamais Mots. (Coleoptera: Curculionidae) and Blatella germanica (L.) (Dictyopera: Blattellidae)

    International Nuclear Information System (INIS)

    This work aimed to evaluate the effect of irradiated essential oils of Eucalyptus citriodora, Eucalyptus globulus, Pinus sp., Azadirachta indica, Cymbopogon nardus, Cupressus sempervirens, Cymbopogons citratus and Juniperus communis and aqueous, hexanic and ethanolic irradiated extracts of Solanum paniculatum, Dahlia pinnata, Lycopersicon esculentum, Nephrolepis pectinata, Ruta graveolens, Ficus elastica, Lavandula angustifolia, Rhododendron simsii, Agave angustifolia, Ocimum basilicum, Allamanda cathartica, Dieffenbachia brasiliensis, Pennisetum purpureum, Annona squamosa, Coffea arabica and Hibiscus rosa-sinensis, in order to identify new substances to integrated pest management (IPM) and to observe possible effects of gamma radiation about extracts and essential oils efficiency such as increase, reduction, activation and inactivation of the same to the pest control. It evaluated the effect of contact on Sitophilus zeamais and by ingestion in Blattella germanica. To irradiation was used an experimental irradiator of Cobalt-60, type Gammacell 220. The essential oils were submitted increasing doses of gamma radiation: 2.5; 5.0; 7.5 and 10.0 kGy. The bioassay with B. germanica demonstrated efficiency between 22.0 e 30.0% and between 30.0 and 42.0%, respectively, to irradiated essential oils of E. citriodora and E. globulus and they demonstrated too repellency to the nymphs. The gamma radiation used promoted changes in essential oils of E. citriodora e E. globulus that they began to show efficiency on B. germanica nymphs besides a significant reduction of repellency. Essential oils of Pinus sp., A. indica, C. sempervirens and J. communis did not display efficiency. The essential oils of C. nardus, and C. citratus had low efficiency. The gamma radiation increased the efficiency of ethanolic extract of D. Pinnata with dose of 7.5 kGy, showing 48.0% of efficiency on B. germanica nymphs. The gamma radiation showed adverse effect on the aqueous extract of R. Graveolens

  8. Evaluation of vegetable extracts for control of the pathogenic fungi in banana and strawberry in post harvest storage Evaluación de extractos vegetales para manejo de hongos patógenos en banano y fresa almacenados

    Directory of Open Access Journals (Sweden)

    Bonilla Correa Carmen Rosa

    2006-12-01

    Full Text Available

    This study was carried out get knowledge about fungicidal properties of vegetable extracts to the control of the pathogenyc fungi (Colletotrichum musae and Botrytis cinerea in banana (Musa sapientum and strawberry (Fragaria sp during the pos harvest storage, at the National University of Colombia headquarters in Palmira. Ethanolics extracts of the following vegetable species were evaluated: Plantago major L, Ruta graveolens L, Lippia alba (Mill NE BROS, Pteridium aquilinum (Kaulf Maxon. The extracts were obtained by the percolation method starting from the macerated material (100 g and 1000 ml of solvent. The fungi was isolated from the strawberry (Fragaria sp affected by B. cinerea and banana Gross mitchel affected by C. musae. To evaluate the control of the fungi C. musae and B. cinerea sixteen treatments were used (four extracts of plants, two extraction media, two dilutions and three repetitions. Three control treatments were added: absolute (PDA; solvent (PDA + ethanol or water; and chemical (PDA + chemical fungicide. The dilutions were prepared with the solvent used to obtain the extract. The evaluation in vitro was maid with ethanolics extracts diluted at 25%, because these presented the best results in the previous tests. The results indicate that the ethanolic solvent decreased the development of the fungi in 68%. The fruits in which the etanolic extract of ruda and pronto alivio was applied presented bigger incidence and grade of severity.

    Keys words: Vegetable extract; patogenic fungi; Colletotrichum musae; Botrytis cinérea; post harvest

    En la Universidad Nacional de Colombia -Sede Palmira, se obtuvieron extractos etanólicos (1.000 ml, macerados (100 g de llantén (Plantago major L, ruda (Ruta graveolens L, pronto alivio [Lippia alba (Mill NE BROS] y helecho marranero [Pteridium aquilinum (Kaulf Maxon]. Para la evaluación del control

  9. Community ecology and spatial distribution of trees in a tropical wet evergreen forest in Kaptai national park in Chittagong Hill Tracts, Bangladesh

    Institute of Scientific and Technical Information of China (English)

    S.M.Feroz; Md Rabiul Alam; Prokash Das; Abdullah Al Mamun

    2014-01-01

    We investigated the floristic composition, woody species diversity and spatial distribution of trees in a tropical wet evergreen forest in Kaptai national park in Chittagong Hill Tracks, Bangladesh. We recorded 25 families, 37 genera, 40 species and 1771 woody individuals in a 0.09 ha plot. Euphorbiaceae and Moraceae were the most species-rich families, and Castanopsis, Ficus and Terminalia were the most species-rich genera. Bursera serrata Wall. ex Colebr. was the dominant species in terms of highest importance value (13%). Trema orientalis (L.) Bl was typically a light demanding species as it appeared in the top can-opy with only one individual having the seventh highest IV, but had no regeneration. The expected maximum number of species (Smax) was 140, indicating that many species may invade the forest as the Smax is greater than the recorded total number of species. The nature of the disappear-ance and appearance of species in the present forest reflects instability of floristic composition. The values of Shannon’s index H′ and Pielou’s index J′ (evenness) were 3.36 bit and 0.63, respectively. These values show moderately high species diversity as compared to other subtropical forests in the tropics. In addition, a sample area of 200 m2 in this forest would be sufficient for measuring the diversity indices H′ and J′ , whereas the trend of J′may indicate the rate of equality of individuals among the different species decreased with increasing area. The distribu-tion pattern for the total stand was completely random. However, the dominant species showed aggregate distribution for small areas, but random distribution for large areas. The spatial association between species showed that the strongest positive interspecific association oc-curred between Streblus asper Lour. and Castanea indica Roxb. (ω =0.51). As a whole, most species were weakly associated with each other, of which 58%species associations were completely negative. The result of

  10. Estructura, composición y diversidad de la selva baja caducifolia del Cerro Verde, Nizanda (Oaxaca, México

    Directory of Open Access Journals (Sweden)

    José Antonio Gallardo Cruz

    2005-01-01

    Full Text Available En este estudio se describe la estructura, la composición florística y los patrones de diversidad de la selva baja caducifolia del Cerro Verde, localizado en Nizanda (Istmo de Tehuantepec, Oaxaca, México. En 30 parcelas de 100 m2 se censaron las plantas leñosas con DAP ≥ 1 cm (estrato alto, y en cinco subcuadros de 4 m2 dentro de cada una se censaron las plantas con DAP 30 cm (estrato bajo. Se encontraron 194 especies distribuidas en 52 familias. La riqueza de especies fue idéntica en ambos estratos (145 especies, y cada uno aportó de manera exclusiva ca. 25% de la riqueza total registrada. Leguminosae fue la familia más rica en especies (27, seguida por Asteraceae (20 y Euphorbiaceae (18. Las especies más frecuentes fueron Bursera simaruba + B. aff. cinerea (no distinguidas en el campo, Euphorbia schlechtendalii, Pilosocereus collinsii y Capparis verrucosa. La riqueza específica promedio por cuadro fue de 30 especies. Los índices basados en la riqueza y la abundancia de las especies (Berger-Parker = 0.20; Simpson = 0.09; α de Fisher = 9.47; Shannon = 2.78; equitatividad = 0.82 indican una alta diversidad y una consecuente baja dominancia en esta selva. Los valores extrapolados mostraron una densidad total (estratos alto + bajo de 23,950 ind. ha-1 (830 ind. ha-1 con DAP ≥ 10 cm, una cobertura de 446.7%, y un área basal de 53 m2 ha-1. La altura promedio del 10% de los árboles más altos fue 9.1 m. La estructura de la selva baja del Cerro Verde es semejante a la de otras comunidades vegetales del trópico seco de México y denota un buen estado de conservación. Este hecho, aunado a su particular composición florística, enfatiza la pertinencia de su conservación formal.

  11. Análisis de la relación vegetación-lluvia de polen actual de las comunidades vegetales en el noroeste de la península de Yucatán, México

    Directory of Open Access Journals (Sweden)

    Diana del Socorro Escarraga Paredes

    2015-07-01

    Full Text Available La Reserva de la Biosfera Los Petenes (RBLP conforma una unidad ecológica de gran valor, por ello la importancia de generar mayor conocimiento biogeográfico del sitio. El análisis palinológico es una herramienta útil para la interpretación de la dinámica vegetal y el análisis de patrones biológicos de distribución. Con el objetivo de analizar la relación lluvia de polen-vegetación en el gradiente de comunidades vegetales del Noroeste de la Península de Yucatán se establecieron 30 parcelas de vegetación y se examinó el espectro polínico en muestras superfi ciales de sedimento dentro de la RBLP. Para identificar el grado de relación entre la vegetación y la lluvia de polen, los datos fueron analizados con métodos de asociación, ordenación y modelación estadística. De los 50 taxones identificados en la lluvia polínica, 13 muestran algún grado de asociación, de las cuales, las especies con mayor grado de asociación para manglar fueron:Rhizophora mangle,Avicennia germinansyConocarpus erectus. La mayoría de las especies de selva muestran altos valores de sobrerepresentación y subrepresentación,Bursera simaruba, Euphorbiaceae y Fabaceae mostraron asociación. De los 20 taxones utilizados para la correlación,Avicennia germinansyConocarpus erectusmostraron correlación para las diferentes comunidades de manglar, la vegetación de peten de selva no mostró especies correlacionadas. La ordenación indica una agrupación definida por el gradiente hidrológico, factor importante que determinó la estructura de la vegetación y su capacidad de dispersión. El análisis de la relación de la lluvia de polen y la vegetación actual de RBLP, constituye una herramienta fundamental para obtener información sobre la dinámica ecológica actual e integra una fuente de información para los estudios paleoecológicos.

  12. Accurate Mass GC/LC-Quadrupole Time of Flight Mass Spectrometry Analysis of Fatty Acids and Triacylglycerols of Spicy Fruits from the Apiaceae Family

    Directory of Open Access Journals (Sweden)

    Thao Nguyen

    2015-12-01

    Full Text Available The triacylglycerol (TAG structure and the regio-stereospecific distribution of fatty acids (FA of seed oils from most of the Apiaceae family are not well documented. The TAG structure ultimately determines the final physical properties of the oils and the position of FAs in the TAG molecule affects the digestion; absorption and metabolism; and physical and technological properties of TAGs. Fixed oils from the fruits of dill (Anethum graveolens, caraway (Carum carvi, cumin (Cuminum cyminum, coriander (Coriandrum sativum, anise (Pimpinella anisum, carrot (Daucus carota, celery (Apium graveolens, fennel (Foeniculum vulgare, and Khella (Ammi visnaga, all from the Apiaceae family, were extracted at room temperature in chloroform/methanol (2:1 v/v using percolators. Crude lipids were fractionated by solid phase extraction to separate neutral triacylglycerols (TAGs from other lipids components. Neutral TAGs were subjected to transesterification process to convert them to their corresponding fatty acids methyl esters (FAMES using 1% boron trifluoride (BF3 in methanol. FAMES were analyzed by gas chromatography-quadrupole time of flight (GC-QTOF mass spectrometry. Triglycerides were analyzed using high performance liquid chromatography-quadrupole time of flight (LC-QTOF mass spectrometry. Petroselinic acid was the major fatty acid in all samples ranging from 57% of the total fatty acids in caraway up to 82% in fennel. All samples contained palmitic (16:0, palmitoleic (C16:1n-9, stearic (C18:0, petroselinic (C18:1n-12, linoleic (C18:2n-6, linolinic (18:3n-3, and arachidic (C20:0 acids. TAG were analyzed using LC-QTOF for accurate mass identification and mass spectrometry/mass spectrometry (MS/MS techniques for regiospesific elucidation of the identified TAGs. Five major TAGs were detected in all samples but with different relative concentrations in all of the tested samples. Several other TAGs were detected as minor components and were present in some

  13. Accurate Mass GC/LC-Quadrupole Time of Flight Mass Spectrometry Analysis of Fatty Acids and Triacylglycerols of Spicy Fruits from the Apiaceae Family.

    Science.gov (United States)

    Nguyen, Thao; Aparicio, Mario; Saleh, Mahmoud A

    2015-01-01

    The triacylglycerol (TAG) structure and the regio-stereospecific distribution of fatty acids (FA) of seed oils from most of the Apiaceae family are not well documented. The TAG structure ultimately determines the final physical properties of the oils and the position of FAs in the TAG molecule affects the digestion; absorption and metabolism; and physical and technological properties of TAGs. Fixed oils from the fruits of dill (Anethum graveolens), caraway (Carum carvi), cumin (Cuminum cyminum), coriander (Coriandrum sativum), anise (Pimpinella anisum), carrot (Daucus carota), celery (Apium graveolens), fennel (Foeniculum vulgare), and Khella (Ammi visnaga), all from the Apiaceae family, were extracted at room temperature in chloroform/methanol (2:1 v/v) using percolators. Crude lipids were fractionated by solid phase extraction to separate neutral triacylglycerols (TAGs) from other lipids components. Neutral TAGs were subjected to transesterification process to convert them to their corresponding fatty acids methyl esters (FAMES) using 1% boron trifluoride (BF₃) in methanol. FAMES were analyzed by gas chromatography-quadrupole time of flight (GC-QTOF) mass spectrometry. Triglycerides were analyzed using high performance liquid chromatography-quadrupole time of flight (LC-QTOF) mass spectrometry. Petroselinic acid was the major fatty acid in all samples ranging from 57% of the total fatty acids in caraway up to 82% in fennel. All samples contained palmitic (16:0), palmitoleic (C16:1n-9), stearic (C18:0), petroselinic (C18:1n-12), linoleic (C18:2n-6), linolinic (18:3n-3), and arachidic (C20:0) acids. TAG were analyzed using LC-QTOF for accurate mass identification and mass spectrometry/mass spectrometry (MS/MS) techniques for regiospesific elucidation of the identified TAGs. Five major TAGs were detected in all samples but with different relative concentrations in all of the tested samples. Several other TAGs were detected as minor components and were present in

  14. Atividade antimicrobiana de óleos essenciais de condimentos frente a Staphylococcus spp isolados de mastite caprina Antimicrobial activities of essential oils extracted from spices against Staphylococcus spp isolated from goat mastitis

    Directory of Open Access Journals (Sweden)

    Marcelo Dal Pozzo

    2011-04-01

    Full Text Available Avaliou-se a atividade antimicrobiana dos óleos essenciais (OEs de Origanum vulgare (orégano, Thymus vulgaris (tomilho, Lippia graveolens (lípia, Zingiber officinale (gengibre, Salvia officinalis (sálvia, Rosmarinus officinalis (alecrim e Ocimum basilicum (manjericão, bem como de frações majoritárias carvacrol, timol, cinamaldeído e cineol frente a 33 isolados de Staphylococcus spp oriundos de rebanhos leiteiros caprinos. A concentração inibitória mínima (CIM e a concentração bactericida mínima (CBM foram determinadas por meio da técnica de microdiluição em caldo. Observou-se atividade antimicrobiana para os OEs de orégano, lípia e tomilho, bem como para as frações majoritárias de carvacrol, timol e cinamaldeído. A ordem decrescente de atividade foi orégano = tomilho > lípia. As frações majoritárias carvacrol, timol e cinamaldeído evidenciaram melhor atividade do que os óleos essenciais e, dentre elas, carvacrol e cinamaldeído foram mais ativas que o timol.The antimicrobial activity of some essencial oils was evaluated as follows: Origanum vulgare (oregano, Thymus vulgaris (thyme, Lippia graveolens (Mexican oregano, Zingiber officinale (ginger, Salvia officinalis (sage, Rosmarinus officinalis (rosemary and Ocimum basilicum (basil, as well as the majority constituents carvacrol, thymol, cinnamaldehyde and cineole against 33 Staphylococcus spp isolates from herds of dairy goats. The minimum inhibitory concentration (MIC and the minimum bactericidal concentration (MBC were determined for each isolate by using broth microdilution method. Antimicrobial activity observed on the essencial oils of oregano, mexican oregano, thymus, well as to majoritary constituents of carvacrol, thymol and cinnamaldehyde. The descending order of antimicrobial activity were oregano = thyme > mexican oregano. The majority constituents carvacrol, thymol, cinnamaldehyde presented themselves more active than the verified by the essencial oils

  15. Ethnomedicines used in Trinidad and Tobago for reproductive problems

    Directory of Open Access Journals (Sweden)

    Lans Cheryl

    2007-03-01

    Full Text Available Abstract Background Throughout history women have tried to control or enhance their fertility using herbal remedies, with various levels of societal support. Caribbean folk medicine has been influenced by European folk medicine, either through the early Spanish and French settlers or through the continuous immigration of Spanish-speaking peoples from Venezuela. Some folk uses are ancient and were documented by Galen and Pliny the Elder. Methods Thirty respondents, ten of whom were male were interviewed from September 1996 to September 2000. The respondents were obtained by snowball sampling, and were found in thirteen different sites, 12 in Trinidad (Paramin, Talparo, Sangre Grande, Mayaro, Carapichaima, Kernahan, Newlands, Todd's Road, Arima, Guayaguayare, Santa Cruz, Port of Spain and Siparia and one in Tobago (Mason Hall. Snowball sampling was used because there was no other means of identifying respondents and to cover the entire islands. The validation of the remedies was conducted with a non-experimental method. Results Plants are used for specific problems of both genders. Clusea rosea, Urena sinuata and Catharanthus roseus are used for unspecified male problems. Richeria grandis and Parinari campestris are used for erectile dysfunction. Ageratum conyzoides, Scoparia dulcis, Cucurbita pepo, Cucurbita maxima, Gomphrena globosa and Justicia pectoralis are used for prostate problems. The following plants are used for childbirth and infertility: Mimosa pudica, Ruta graveolens, Abelmoschus moschatus, Chamaesyce hirta, Cola nitida, Ambrosia cumanenesis, Pilea microphylla, Eryngium foetidum, Aristolochia rugosa, Aristolochia trilobata, Coleus aromaticus, Laportea aestuans and Vetiveria zizanioides. The following plants are used for menstrual pain and unspecified female complaints: Achyranthes indica, Artemisia absinthium, Brownea latifolia, Eleutherine bulbosa, Hibiscus rosa-sinensis, Eupatorium macrophyllum, Justicia secunda, Parthenium

  16. Ethnoveterinary medicines used for ruminants in British Columbia, Canada

    Directory of Open Access Journals (Sweden)

    Brauer Gerhard

    2007-02-01

    Full Text Available Abstract Background The use of medicinal plants is an option for livestock farmers who are not allowed to use allopathic drugs under certified organic programs or cannot afford to use allopathic drugs for minor health problems of livestock. Methods In 2003 we conducted semi-structured interviews with 60 participants obtained using a purposive sample. Medicinal plants are used to treat a range of conditions. A draft manual prepared from the data was then evaluated by participants at a participatory workshop. Results There are 128 plants used for ruminant health and diets, representing several plant families. The following plants are used for abscesses: Berberis aquifolium/Mahonia aquifolium Echinacea purpurea, Symphytum officinale, Bovista pila, Bovista plumbea, Achillea millefolium and Usnea longissima. Curcuma longa L., Salix scouleriana and Salix lucida are used for caprine arthritis and caprine arthritis encephalitis.Euphrasia officinalis and Matricaria chamomilla are used for eye problems. Wounds and injuries are treated with Bovista spp., Usnea longissima, Calendula officinalis, Arnica sp., Malva sp., Prunella vulgaris, Echinacea purpurea, Berberis aquifolium/Mahonia aquifolium, Achillea millefolium, Capsella bursa-pastoris, Hypericum perforatum, Lavandula officinalis, Symphytum officinale and Curcuma longa. Syzygium aromaticum and Pseudotsuga menziesii are used for coccidiosis. The following plants are used for diarrhea and scours: Plantago major, Calendula officinalis, Urtica dioica, Symphytum officinale, Pinus ponderosa, Potentilla pacifica, Althaea officinalis, Anethum graveolens, Salix alba and Ulmus fulva. Mastitis is treated with Achillea millefolium, Arctium lappa, Salix alba, Teucrium scorodonia and Galium aparine. Anethum graveolens and Rubus sp., are given for increased milk production.Taraxacum officinale, Zea mays, and Symphytum officinale are used for udder edema. Ketosis is treated with Gaultheria shallon, Vaccinium sp., and

  17. Estudo fitossociológico de um trecho da floresta estacional semidecidual em Diamante do Norte, Estado do Paraná, Brasil = Phytosociology in semi-deciduous seasonal forest fragment in Diamate do Norte, State of Paraná, Brazil

    Directory of Open Access Journals (Sweden)

    Erci Marcos Del Quiqui

    2007-04-01

    Full Text Available O presente estudo foi realizado em uma Floresta Estacional Semidecidual de 1.426 ha, localizada na Estação Ecológica do Caiuá (54° 49’W e 22° 34’S em Diamante do Norte, Estado do Paraná, Para o levantamento fitossociológico, foram locadas 29 parcelasgeoreferenciadas de 50 m x 30 m, totalizando 4,35 ha. Em cada parcela, foram amostrados todos os indivíduos com diâmetro à altura do peito (DAP > 5,0 cm, e, em subparcelas, os indivíduos com DAP £ 5 cm, totalizando 3.812 indivíduos arbóreos pertencentes a 38 famílias, 85 gêneros e 102 espécies. As famílias Myrtaceae, Rutaceae e do grupo das Leguminosaea destacaram-se pelo elevado número de espécies. Xylosma venosa, Metrodorea nigra, Chrysophyllum gonocarpum, Plinia rivularis, Eugenia uniflora, Aspidosperma polyneuron, Actinostenon concolor, Zygia cauliflora, Caesaria gossypiosperma, Blepharocalyx salicifolius, Astronium graveolens, Campomanesia xanthocarpa e Balfourodendron riedelianum destacaram-se como as espécies de maior valor de importância. O índice de diversidade de Shannon (H’ obtido foi de 3,56 e índice de similaridade de Sorensen (ISS neste trabalho foi de 75,5% entre os estratos avaliados.The aim of this work was to study a Semideciduous Seasonal Forest fragment. It was carried out at the Ecological Station Caiuá (54° 49’W and 22° 34'S, in Diamante do Norte, Paraná State, Brazil. The study covered an area of 1.426 ha. The plots were located by GPS in that fragment. The area was divided in 29 parcels with 50 x 30 m, totalizing 4.35 ha. The individuals belonging to regeneration and the ones with DBH higher than or equal to 5.0 cm were then measured, totalizing 3,812 adult individuals, gathered into 38 families, 85 genera and 102 species. The families with the highest number of species were Myrtaceae, Rutaceae and Leguminosaea groups. Xylosmavenosa, Metrodorea nigra, Chrysophyllum gonocarpum, Plinia rivularis, Eugenia uniflora, Aspidosperma polyneuron

  18. Evaluations of larvicidal activity of medicinal plant extracts to Aedes aegypti (Diptera: Culicidae) and other effects on a non target fish

    Institute of Scientific and Technical Information of China (English)

    SUWANNEE PROMSIRI; AMARA NAKSATHIT; MALEEYA KRUATRACHUE; USAVADEE THAVARA

    2006-01-01

    A preliminary study was conducted to investigate the effects of the extracts of 112 medicinal plant species, collected from the southern part of Thailand, on Aedes aegypti. Studies on larvicidal properties of plant extracts against the fourth instar larvae revealed that extracts of 14 species showed evidence of larvicidal activity. Eight out of the 14 plant species showed 100% mosquito larvae mortality. The LC50 values were less than 100μg/mL (4.1μg/ mL-89.4μg/mL). Six plant species were comparatively more effective against the fourth instar larvae at very low concentrations. These extracts demonstrated no or very low toxicity to guppy fish (Poecilia reticulata), which was selected to represent most common non-target organism found in habitats of Ae. aegypti, at concentrations active to mosquito larvae. Three medicinal plants with promising larvicidal activity, having LC50 and LC90 values being 4.1 and 16.4μg/mL for Mammea siamensis, 20.2 and 34.7μg/mL for Anethum graveolens and 67.4 and 110.3 μg/mL for Annona muricata, respectively, were used to study the impact of the extracts on the life cycle of Ae. aegypti. These plants affected pupal and adult mortality and also affected the reproductive potential of surviving adults by reducing the number of eggs laid and the percentage of egg hatchability. When each larval stage was treated with successive extracts at the LC50 value, the first instar larvae were found to be very susceptible to A. muricata and the second instar larvae were found to be susceptible to A. graveolens, while the third and fourth instar larvae were found to be susceptible to M. siamensis. These extracts delayed larval development and inhibited adult emergence and had no adverse effects on P.reticulata at LC50 and LC90 values, except for the M. siamensis extract at its LC50 value.

  19. Ethnomedicines used in Trinidad and Tobago for urinary problems and diabetes mellitus

    Directory of Open Access Journals (Sweden)

    Lans Cheryl A

    2006-10-01

    Full Text Available Abstract Background This paper is based on ethnobotanical interviews conducted from 1996–2000 in Trinidad and Tobago with thirty male and female respondents. Methods A non-experimental validation was conducted on the plants used for urinary problems and diabetes mellitus: This is a preliminary step to establish that the plants used are safe or effective, to help direct clinical trials, and to inform Caribbean physicians of the plants' known properties to avoid counter-prescribing. Results The following plants are used to treat diabetes: Antigonon leptopus, Bidens alba, Bidens pilosa, Bixa orellana, Bontia daphnoides, Carica papaya, Catharanthus roseus, Cocos nucifera, Gomphrena globosa, Laportea aestuans, Momordica charantia, Morus alba, Phyllanthus urinaria and Spiranthes acaulis. Apium graviolens is used as a heart tonic and for low blood pressure. Bixa orellana, Bontia daphnoides, Cuscuta americana and Gomphrena globosa are used for jaundice. The following plants are used for hypertension: Aloe vera, Annona muricata, Artocarpus altilis, Bixa orellana, Bidens alba, Bidens pilosa, Bonta daphnoides, Carica papaya, Cecropia peltata, Citrus paradisi, Cola nitida, Crescentia cujete, Gomphrena globosa, Hibiscus sabdariffa, Kalanchoe pinnata, Morus alba, Nopalea cochinellifera, Ocimum campechianum, Passiflora quadrangularis, Persea americana and Tamarindus indicus. The plants used for kidney problems are Theobroma cacao, Chamaesyce hirta, Flemingia strobilifera, Peperomia rotundifolia, Petiveria alliacea, Nopalea cochinellifera, Apium graveolens, Cynodon dactylon, Eleusine indica, Gomphrena globosa, Pityrogramma calomelanos and Vetiveria zizanioides. Plants are also used for gall stones and for cooling. Conclusion Chamaesyce hirta, Cissus verticillata, Kalanchoe pinnata, Peperomia spp., Portulaca oleraceae, Scoparia dulcis, and Zea mays have sufficient evidence to support their traditional use for urinary problems, "cooling" and high cholesterol

  20. PHENOLIC PROFILE, ANTIOXIDANT AND ANTIMICROBIAL ACTIVITIES FROM THE Apiaceae FAMILY (DRY SEEDS

    Directory of Open Access Journals (Sweden)

    Valentina Lubomirova Christova-Bagdassarian

    2013-11-01

    Full Text Available Objective: In the present study, a comparative evaluation of the phenolic compounds antioxidant capacity and antibacterial activity to several kinds of seeds from the Apiacea family, to which belong: Foeniculum vulgare (Fennel, Anethum graveolens (Dill, Pimpinella anisum (Anise, Carum carvi (Caraway and Coriandrum sativum (Coriander were carried out. Methods: The total phenolic content of seeds was measured spectrophotometrically by using the Folin-Ciocalteu assay, the total flavonoids was measured spectrophotometrically by using the aluminum chloride colorimetric. Antioxidant capacity was analysed by 2,2-Diphenyl-1-picrylhydrazyl (DPPH radical scavenging effect of the seeds and was determined also spectrophotometrically. Antibacterial activity was analysed by ISO standards. Results: The total phenolic and flavonoid contents of the Foeniculum vulgare (Fennel varied between 115.96 mg GAE/100g and 68.10 mg CE/100g .The Coriandrum sativum (Coriander content is lower (from 17.04 mg GAE/100g to 11.10 mg CE/100g, respecively. The highest radical scavanging effect was observed in the Foeniculum vulgare (Fennel with IC50 of 113.19 ml/L. In our study, the methanol extract of seeds didn’t have any antimicrobial activity. Conclusions: An original data for total phenolic and total flavonoid contents are present in this study. They are a basis for assessment of the role of Apiaceae family dry seeds against free radicals effect and antibacterial activity. The results show that methanolic extract has the highest of total phenolic and total flavonoid contents, high potential of antioxidant activity of dry seeds from Apiaceae family, to which belong: Fennel (Foeniculum vulgare, Dill (Anethum graveolens, Anise (Pimpinella anisum, Caraway (Carum carvi and Coriander (Coriandrum sativum. From all results, the solvent extracts of dry seeds are rich in phytochemical contents, which possessed high antioxidant and antimicrobial activities. Therefore the data found in

  1. Accurate Mass GC/LC-Quadrupole Time of Flight Mass Spectrometry Analysis of Fatty Acids and Triacylglycerols of Spicy Fruits from the Apiaceae Family

    Science.gov (United States)

    Nguyen, Thao; Aparicio, Mario; Saleh, Mahmoud A.

    2016-01-01

    The triacylglycerol (TAG) structure and the regio-stereospecific distribution of fatty acids (FA) of seed oils from most of the Apiaceae family are not well documented. The TAG structure ultimately determines the final physical properties of the oils and the position of FAs in the TAG molecule affects the digestion; absorption and metabolism; and physical and technological properties of TAGs. Fixed oils from the fruits of dill (Anethum graveolens), caraway (Carum carvi), cumin (Cuminum cyminum), coriander (Coriandrum sativum), anise (Pimpinella anisum), carrot (Daucus carota), celery (Apium graveolens), fennel (Foeniculum vulgare), and Khella (Ammi visnaga), all from the Apiaceae family, were extracted at room temperature in chloroform/methanol (2:1 v/v) using percolators. Crude lipids were fractionated by solid phase extraction to separate neutral triacylglycerols (TAGs) from other lipids components. Neutral TAGs were subjected to transesterification process to convert them to their corresponding fatty acids methyl esters (FAMES) using 1% boron trifluoride (BF3) in methanol. FAMES were analyzed by gas chromatography-quadrupole time of flight (GC-QTOF) mass spectrometry. Triglycerides were analyzed using high performance liquid chromatography-quadrupole time of flight (LC-QTOF) mass spectrometry. Petroselinic acid was the major fatty acid in all samples ranging from 57% of the total fatty acids in caraway up to 82% in fennel. All samples contained palmitic (16:0), palmitoleic (C16:1n-9), stearic (C18:0), petroselinic (C18:1n-12), linoleic (C18:2n-6), linolinic (18:3n-3), and arachidic (C20:0) acids. TAG were analyzed using LC-QTOF for accurate mass identification and mass spectrometry/mass spectrometry (MS/MS) techniques for regiospesific elucidation of the identified TAGs. Five major TAGs were detected in all samples but with different relative concentrations in all of the tested samples. Several other TAGs were detected as minor components and were present in

  2. Characterization of rue extract and its potential for controlling rice blast

    Directory of Open Access Journals (Sweden)

    Karinna Bannach Reis

    2015-12-01

    Full Text Available Abstract: The objective of this work was to purify and standardize the rue (Ruta graveolens extract and evaluate its effect on Magnaporthe oryzae as an alternative to the integrated management of rice blast. The drug was characterized, the liquid extract was obtained, and the methodology for quantifying the standard markers psoralen and bergapten was validated. Rue extract and the markers, solely or in combination, were assayed in vitro, as well as in greenhouse conditions, for their ability to suppress leaf blast, by the evaluation of mycelial growth, conidial germination, and appressorium formation. Rue extract inhibited M. oryzae mycelial growth (100%, conidial germination (LD50=0.237 mg, and the appressorium formation (LD50=0.121 mg; besides, the extract reduced leaf blast severity by 80.84%. Fluorescence microscopy showed that rue extract did not damage M. oryzae cell wall and plasma membrane, indicating another mode of action. Rue extract has a great potential for controlling rice leaf blast.

  3. Antifungal activity of plant-derived essential oils on Candida tropicalis planktonic and biofilms cells.

    Science.gov (United States)

    Souza, Caio Marcelo Cury; Pereira Junior, Silvio Alves; Moraes, Thaís da Silva; Damasceno, Jaqueline Lopes; Amorim Mendes, Suzana; Dias, Herbert Júnior; Stefani, Ricardo; Tavares, Denise Crispim; Martins, Carlos Henrique Gomes; Crotti, Antônio Eduardo Miller; Mendes-Giannini, Maria José Soares; Pires, Regina Helena

    2016-07-01

    Dental prosthesis supports Candida species growth and may predispose the oral cavity to lesions. C. tropicalis has emerged as a colonizer of prosthesis and has shown resistance to clinically used antifungal agents, which has increased the search for new antifungals. This work describes the effectiveness of fifteen essential oils (EOs) against C. tropicalis The EOs were obtained by hydrodistillation and were chemically characterized by gas chromatography-mass spectrometry. The antifungal activities of the EOs were evaluated by the microdilution method and showed that Pelargonium graveolens (Geraniaceae) (PG-EO) was the most effective oil. Geraniol and linalool were the major constituents of PG-EO. The 2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide (XTT) assay showed that all the clinical C. tropicalis strains formed viable biofilms. Scanning electron microscopy examination of the biofilms revealed a complex architecture with basal layer of yeast cells and an upper layer of filamentous cells. Treatments with PG-EO, linalool, and geraniol significantly reduced the number of viable biofilm cells and inhibited biofilm formation after exposure for 48 h. PG-EO, geraniol, and linalool were not toxic to normal human lung fibroblasts (GM07492A) at the concentrations they were active against C. tropicalis Together, our results indicated that C. tropicalis is susceptible to treatment with PG-EO, geraniol, and linalool, which could become options to prevent or treat this infection. PMID:26868902

  4. Petroleum contamination of soil and water, and their effects on vegetables by statistically analyzing entire data set.

    Science.gov (United States)

    Zhang, Juan; Fan, Shu-kai; Yang, Jun-cheng; Du, Xiao-ming; Li, Fa-sheng; Hou, Hong

    2014-04-01

    Aliphatic hydrocarbons have been used to assess total oil concentrations, petroleum sources, and petroleum degradation. In this study, surface soil, groundwater, surface water, and vegetables were collected from the outskirts of Xi'an, the largest city in northwestern China, and the samples were analyzed for aliphatic hydrocarbon contents. The concentrations of n-alkanes were 1.06-4.01 μg/g in the soil. The concentrations and the geochemical characteristics of n-alkanes showed that the low carbon number hydrocarbons were mainly from petroleum sources, whereas the high carbon number hydrocarbons received more hydrocarbons from herbaceous plants. The concentrations of n-alkanes were 9.20-93.44 μg/L and 23.74-118.27 μg/L in the groundwater and the surface water, respectively. The water had characteristics of petroleum and submerged/floating macrophytes and was found in concentrations that would cause chronic disruption of sensitive organisms. The concentrations and geochemical characteristics of n-alkanes in Brassica chinensis L. and Apium graveolens were different, but both were contaminated by petroleum hydrocarbons. The results from principal component analysis (PCA) indicated that the sorption of n-alkanes to soil particles could not be described by linear models. The distributions of n-alkanes in vegetables were positively correlated with those in soil, and the correlation coefficient was up to 0.9310 using the constructed vectors. Therefore, the researchers should pay close attention to the effect of soil contamination on vegetables. PMID:24468500

  5. Inibição do crescimento micelial de Cercospora calendulae Sacc. por extratos de plantas medicinais

    Directory of Open Access Journals (Sweden)

    J.M. Nascimento

    2013-01-01

    Full Text Available O uso de extratos e óleos essenciais de plantas medicinais tem sido amplamente estudado no controle de doenças de plantas. O objetivo da realização do presente trabalho foi avaliar o efeito de extratos de Ruta graveolens L., Mentha x villosa, Calendula officinalis L., Momordica charantia L., Symphytum officinale L., Ageratum conyzoides L. e Ricinus comunis L., nas concentrações de 0, 250, 500, 1000, 2000, 5000 e 10000 mg L-1, sobre a inibição do crescimento micelial de Cercospora calendulae Sacc. in vitro. Os extratos foram obtidos por infusão. O experimento foi desenvolvido no Laboratório de Fitopatologia da FCA/UFGD, estado de Mato Grosso do Sul, em delineamento inteiramente casualizado, esquema fatorial 7 extratos x 7 concentrações, com seis repetições. Foi detectado efeito dos extratos e suas concentrações sobre o crescimento do fungo, sendo a interação significativa. Os extratos de calêndula, arruda, hortelã e melão de São Caetano, nas maiores concentrações resultaram em maiores porcentagens de inibição, próximas de 100%, 30%, 35% e 40%, respectivamente, a 10000 mg L-1.

  6. In Vitro Activity of Twenty Commercially Available, Plant-Derived Essential Oils against Selected Dermatophyte Species.

    Science.gov (United States)

    Nardoni, Simona; Giovanelli, Silvia; Pistelli, Luisa; Mugnaini, Linda; Profili, Greta; Pisseri, Francesca; Mancianti, Francesca

    2015-08-01

    The in vitro activity of twenty chemically defined essential oils (EOs) obtained from Boswellia sacra, Citrus bergamia, C. limon, C. medica, Cinnamomum zeylanicum, Eucalyptus globulus, Foeniculum vulgare, Helichrysum italicum, Illicium verum, Litsea cubeba, Mentha spicata, Myrtus communis, Ocimum basilicum, Origanum majorana, O. vulgare, Pelargonium graveolens, Rosmarinus officinalis, Santalum album, Satureja montana, and Thymus serpyllum was assayed against clinical animal isolates of Microsporum canis, Trichophyton mentagrophytes, T. erinacei, T. terrestre and Microsporum gypseum, main causative agents of zoonotic and/or environmental dermatophytoses in humans. Single main components present in high amounts in such EOs were also tested. Different dermatophyte species showed remarkable differences in sensitivity. In general, more effective EOs were T. serpyllum (MIC range 0.025%-0.25%), O. vulgare (MIC range 0.025%-0.5%) and L. cubeba (MIC range 0.025%-1.5%). F. vulgare showed a moderate efficacy against geophilic species such as M gypseum and T terrestre. Among single main components tested, neral was the most active (MIC and MFC values 5 0.25%). The results of the present study seem to be promising for an in vivo use of some assayed EOs. PMID:26434145

  7. In vitro activity of essential oils extracted from condiments against fluconazole-resistant and -sensitive Candida glabrata.

    Science.gov (United States)

    Soares, I H; Loreto, É S; Rossato, L; Mario, D N; Venturini, T P; Baldissera, F; Santurio, J M; Alves, S H

    2015-09-01

    In the present study, the antifungal activity of essential oils obtained from Origanum vulgare (oregano), Cinnamomum zeylanicum (cinnamon), Lippia graveolens (Mexican oregano), Thymus vulgaris (thyme), Salvia officinalis (sage), Rosmarinus officinalis (rosemary), Ocimum basilicum (basil) and Zingiber officinale (ginger) were assessed against Candida glabrata isolates. One group contained 30 fluconazole-susceptible C. glabrata isolates, and the second group contained fluconazole-resistant isolates derived from the first group after the in vitro induction of fluconazole-resistance, for a total of 60 tested isolates. The broth microdilution methodology was used. Concentrations of 50μg/mL, 100μg/mL, 200μg/mL, 400μg/mL, 800μg/mL, 1600μg/mL and 3200μg/mL of the essential oils were used, and the minimum inhibitory concentration (MIC) and minimum fungicidal concentration (MFC) were determined. Thyme, sage, rosemary, basil and ginger essential oils showed no antifungal activity at the tested concentrations. Antimicrobial activity less than or equal to 3200μg/mL was observed for oregano, Mexican oregano and cinnamon essential oils. Both the oregano and Mexican oregano essential oils showed high levels of antifungal activity against the fluconazole-susceptible C. glabrata group, whereas the cinnamon essential oil showed the best antifungal activity against the fluconazole-resistant C. glabrata isolates. PMID:26281965

  8. Repellency of oils of lemon eucalyptus, geranium, and lavender and the mosquito repellent MyggA natural to Ixodes ricinus (Acari: Ixodidae) in the laboratory and field.

    Science.gov (United States)

    Jaenson, Thomas G T; Garboui, Samira; Palsson, Katinka

    2006-07-01

    MyggA Natural (Bioglan, Lund, Sweden) is a commercially available repellent against blood-feeding arthropods. It contains 30% of lemon-scented eucalyptus, Corymbia citriodora (Hook.) K. D. Hill & L. A. S. Johnson (Myrtaceae), oil with a minimum of 50% p-menthane-3,8-diol. MyggA Natural also contains small amounts of the essential oils of lavender, Lavandula angustifolia Mill. (Lamiaceae), and geranium, Pelargonium graveolens L'Her. (Geraniaceae). In laboratory bioassays, MyggA Natural and C. citriodora oil exhibited 100% repellency against host-seeking nymphs of Ixodes ricinus (L.) (Acari: Ixodidae). Lavender oil and geranium oil, when diluted to 1% in 1,2-propanediol, had weak repellent activities on I. ricinus nymphs, but when diluted to 30% in 1,2-propanediol had 100% repellencies. 1,2-Propanediol (100%) had no significant repellent activity in comparison with that of the control. In field tests in tick-infested areas in central Sweden, tick repellency of MyggA Natural and C. citriodora oil was tested by the blanket-dragging technique for 4 d during a 6-d period. The repellencies (74 and 85%, respectively) on day 1 are similar (89%) to that of blankets treated in a similar manner with 19% diethyl-methyl-benzamide, based on previous work. Repellencies declined significantly from day 1 to day 6 (74 to 45% for MyggA Natural; 85 to 42% for C. citriodora oil). PMID:16892632

  9. Antimicrobial Susceptibility of Escherichia coli Strains Isolated from Alouatta spp. Feces to Essential Oils

    Directory of Open Access Journals (Sweden)

    Valéria Maria Lara

    2016-01-01

    Full Text Available This study evaluated the in vitro antibacterial activity of essential oils from Lippia graveolens (Mexican oregano, Origanum vulgaris (oregano, Thymus vulgaris (thyme, Rosmarinus officinalis (rosemary, Cymbopogon nardus (citronella, Cymbopogon citratus (lemongrass, and Eucalyptus citriodora (eucalyptus against Escherichia coli (n=22 strains isolated from Alouatta spp. feces. Minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC were determined for each isolate using the broth microdilution technique. Essential oils of Mexican oregano (MIC mean = 1818 μg mL−1; MBC mean = 2618 μg mL−1, thyme (MIC mean = 2618 μg mL−1; MBC mean = 2909 μg mL−1, and oregano (MIC mean = 3418 μg mL−1; MBC mean = 4800 μg mL−1 showed the best antibacterial activity, while essential oils of eucalyptus, rosemary, citronella, and lemongrass displayed no antibacterial activity at concentrations greater than or equal to 6400 μg mL−1. Our results confirm the antimicrobial potential of some essential oils, which deserve further research.

  10. Antimicrobial Susceptibility of Escherichia coli Strains Isolated from Alouatta spp. Feces to Essential Oils

    Science.gov (United States)

    Carregaro, Adriano Bonfim; Santurio, Deise Flores; de Sá, Mariangela Facco; Santurio, Janio Moraes; Alves, Sydney Hartz

    2016-01-01

    This study evaluated the in vitro antibacterial activity of essential oils from Lippia graveolens (Mexican oregano), Origanum vulgaris (oregano), Thymus vulgaris (thyme), Rosmarinus officinalis (rosemary), Cymbopogon nardus (citronella), Cymbopogon citratus (lemongrass), and Eucalyptus citriodora (eucalyptus) against Escherichia coli (n = 22) strains isolated from Alouatta spp. feces. Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) were determined for each isolate using the broth microdilution technique. Essential oils of Mexican oregano (MIC mean = 1818 μg mL−1; MBC mean = 2618 μg mL−1), thyme (MIC mean = 2618 μg mL−1; MBC mean = 2909 μg mL−1), and oregano (MIC mean = 3418 μg mL−1; MBC mean = 4800 μg mL−1) showed the best antibacterial activity, while essential oils of eucalyptus, rosemary, citronella, and lemongrass displayed no antibacterial activity at concentrations greater than or equal to 6400 μg mL−1. Our results confirm the antimicrobial potential of some essential oils, which deserve further research. PMID:27313638

  11. Ethnobotany and antibacterial activity of some plants used in traditional medicine of Zapotitlán de las Salinas, Puebla (México).

    Science.gov (United States)

    Hernández, T; Canales, M; Avila, J G; Duran, A; Caballero, J; Romo de Vivar, A; Lira, R

    2003-10-01

    The village of Zapotitlán de las Salinas is situated in the Valley of Tehuacán-Cuicatlán, Puebla, Mexico. Plant species used by the local inhabitants to treat gastrointestinal diseases were identified using ethnobotanical, ethnographic and taxonomic methods. Out of 119 interviews, 44 plant species were registered, of which the following are the most frequently used (listed in descending order): Lippia graveolens H.B. et K. (Verbenaceae), Lantana achyranthifolia Desf. (Verbenaceae), Turnera diffusa (Willd.) ex Schult. (Turneraceae), Lippia oaxacana Rob. et Greenm. (Verbenaceae), Gymnolaena oaxacana (Greenm.) Rydb. (Asteraceae), Cordia curassavica (Jacq.) Roem. et Schult. (Boraginaceae), Lantana camara L. (Verbenaceae) and Acalypha hederacea Torrey (Euphorbiaceae). From these plants, hexane, chloroform and ethanol extracts were prepared in order to assess their antibacterial activity against 14 bacterial strains causing the most common gastrointestinal diseases in Mexican population. All hexane extracts showed antibacterial activity against Gram-positive and Gram-negative bacteria. There is a correlation between the frequency of mention (of plant use) and the antibacterial activity. In conclusion, the knowledge of plants most frequently used for gastrointestinal infections in Zapotitlán de las Salinas is supported by scientific rationale. PMID:12963140

  12. Chemical composition of selected Saudi medicinal plants

    Directory of Open Access Journals (Sweden)

    Ihsanullah Daur

    2015-05-01

    Full Text Available Medicinal plants are important in traditional medicine and modern pharmaceutical drugs; therefore, the interest in the analysis of their chemical composition is increasing. In this study, selected medicinal plants including Achillea fragrantissima (Forssk Sch., Amaranthus viridis L., Asteriscus graveolens (Forssk. Less., Chenopodium album L., and Conyza bonariensis (L. Cronquist were collected from the rangeland of western regions (Bahra and Hada areas of Saudi Arabia to study their chemical composition. Eight minerals (Mg, Ca, Cr, Mn, Fe, Co, Cu, and Zn, total phenolic contents, antioxidant activity, and free-radical scavenging ability were examined in order to evaluate the medicinal potential of these plants. All the plants were found to be rich sources of minerals and antioxidants, although there were significant differences (p < 0.05 in their chemical composition, which may provide a rationale for generating custom extracts from specific plants depending on the application. The findings of this study will thus facilitate herbalists in their efforts to incorporate these plants into various formulations based on their chemical composition.

  13. Use of ionizing radiation to ensure the safety of pre-cut fresh vegetables

    International Nuclear Information System (INIS)

    The determination of D10 values for two Escherichia coli strains (an ATTC and a wild type), Listeria innocua, and a non toxigenic strain of Escherichia coli O157:H7 was carried out in different vegetal products. The studied products -celery (Apium graveolens), cabbage (Lactuca sativa var. capitata), iceberg lettuce (Lactuca sativa var. capitata), carrots (Daucus carota L.), spinach (Spinacia oleracea) and two mixed salads (Toscana, containing chopped iceberg lettuce (Lactuca sativa var. capitata), red cabbage (Brassica oleraceae var. rubra) and shredded carrot (Daucus carota L.) and Four Seasons, a mixture of chopped romaine lettuce (Lactuca sativa var. longifolia), iceberg lettuce (Lactuca sativa var. capitata), Butterhead lettuce (Lactuca sativa var. acephala) and spinach (Spinacia oleraceae) - were minimally processed. The effect of irradiation with 5 D10 doses on the natural microflora and on the sensory characteristics, during refrigerated storage, of the non inoculated products, was also studied. After irradiating with 5 D10 doses, a considerable reduction in the initial contamination of the studied vegetables was obtained. No significant variation of the microbiological counts of the irradiated products was observed during the refrigerated storage, while in the non-irradiated samples a progressive increase up to 3.5 logs in some vegetables was observed. In general, no significant changes in the sensory parameters were observed after irradiation and during seven days storage at refrigeration temperature (4 deg. C). (author)

  14. Assessment of the transfer of 137Cs in three types of vegetables consumed in Hong Kong

    International Nuclear Information System (INIS)

    A dynamic food chain model has been built for the modeling of the transfer of 137Cs in three types of vegetables consumed in Hong Kong, namely, white flowering cabbage (Brassica chinensis), head lettuce (Lactuca sativa) and celery (Apium graveolens). Some parameters have been estimated from the experimental data obtained in this work. The experimental data include the transfer factors of 137Cs from soil to the different vegetable species which are determined through high resolution gamma spectrometry, maximum crop biomasses for the vegetable species, the dry-to-fresh ratios for the vegetable species, the bulk density of soil layers and the average concentration of 137Cs in air. The derived parameters include the deposition rate and the root uptake rate, information for tillage, the logistic growth model and radionuclide concentrations in vegetables. The dynamic food chain model is solved by the Birchall-James algorithm to give the 137Cs concentration in subsurface soil, from the 0.1-25 cm soil layer, and the 137Cs concentration in harvested and unwashed vegetables. As validation of the model and parameters, the concentrations obtained experimentally and from the model are compared and are found to be in good agreement

  15. Evaluación de extractos de fique, coquito, sorgo y ruda como posibles bio-herbicidas

    Directory of Open Access Journals (Sweden)

    Liliana Osorio Salazar

    2009-04-01

    Full Text Available En experimentos completamente al azar en condiciones de laboratorio y campo, en Palmira, Valle del Cauca, se evaluó el efecto de extractos de Macrophylla furcraea Baker (fique, Cyperus rotundus L (coquito, Sorghum bicolor L (sorgo, y Ruta graveolens L (ruda sobre la germinación de semillas de las arvenses Bidens pilosa L (papunga y Amaranthus dubius Mart (bledo y del cilantro Coriandrum sativum L. Se obtuvieron los extractos por el método Soxhlet, utilizando agua, etanol y cloroformo como solventes. Los extractos obtenidos se evaluaron en tres diluciones (0, 5 y 10 % en pruebas de germinación de semillas de las arvenses y del cultivo. Se emplearon tres repeticiones de 50 semillas cada una y el testigo se regó con agua destilada. Los extractos etanólicos y clorofórmicos de coquito y fique en las diluciones al 5 y 10 % presentaron el mayor efecto inhibitorio en la germinación a los 21 días. El ensayo de campo demostró el efecto inhibitorio de los extractos etanólicos de fique y coquito en la emergencia de las semillas del cilantro. El análisis de metabolitos secundarios comprobó la presencia de compuestos reportados como altamente tóxicos en fique y en menor cantidad en coquito, aunque los extractos de éste fueron los que más inhibieron la germinación.

  16. Nondestructive Raman analysis of polyacetylenes in apiaceae vegetables.

    Science.gov (United States)

    Roman, Maciej; Baranski, Rafal; Baranska, Malgorzata

    2011-07-27

    Food plants from the Apiaceae family have been found to demonstrate health-promoting properties. Polyacetylenes are bioactive compounds that are considered to contribute substantially to the beneficial properties of Apiaceae plants. This study applied a Raman mapping technique in the investigation of polyacetylene spatial distribution in fresh roots of some Apiaceae species. Fresh root sections were measured directly without any preliminary preparation. For three Apiaceae species, that is, parsnip ( Pastinaca sativa L.), celeriac ( Apium graveolens var. rapaceum L.), and parsley ( Petroselinum crispum ), the presence of polyacetylenes was confirmed due to the detection of strong and well-separated Raman signals of symmetric -C ≡ C-C ≡ C- stretching vibration in the range of 2200-2300 cm(-1). The spectra were used for generation of two-dimensional maps applying the integration and cluster analysis methods. The Raman maps visualized the distribution of total polyacetylenes as well as individual compounds. Heterogeneous and tissue-specific occurrence of polyacetylenes in roots is shown. PMID:21682272

  17. Ethnoveterinary medicines used to treat endoparasites and stomach problems in pigs and pets in British Columbia, Canada.

    Science.gov (United States)

    Lans, Cheryl; Turner, Nancy; Khan, Tonya; Brauer, Gerhard

    2007-09-30

    This paper documents the medicinal plants used to treat endoparasites and stomach problems in dogs, cats and pigs in British Columbia, Canada. Ethnoveterinary data was collected over a 6-month period in 2003. The majority of the information on pets came from 2 naturopaths, 10 herbalists, 5 dog trainers, breeders and pet shop owners, 9 holistic veterinarians and 6 of 27 organic farmers. Two pig farmers joined the study in the final stages. The following plants were used as anthelmintics: Artemisia cina O. Berg and C.F. Schmidt, Artemisia vulgaris L., Artemisia annua, Calendula officinalis L., Echinacea purpurea (L.) Moench (all Asteraceae), Mentha piperita L. and Salvia officinalis L. (Lamiaceae) (Allium sativum L. (Alliaceae), Cucurbita pepo L. (Cucurbitaceae), Eugenia caryophyllata Thunb (Myrtaceae), Gentiana lutea L. (Gentianaceae), Hydrastis canadensis L. (Ranunculaceae), Juglans nigra L. (Juglandaceae), Olea europaea L. (Oleaceae) and Ruta graveolens L. (Rutaceae)). Stomach problems were treated with: Achillea millefolium L. (Asteraceae), Aloe vera (L.) Burm. f. (Asphodelaceae), Elytrigia repens (L.) Desv. ex Nevski (Poaceae), Frangula purshiana (DC.) Cooper (Rhamnaceae), Juniperus communis L. (Cupressaceae), Melissa officinalis L. and M. piperita L. (Lamiaceae), Petroselinum crispum L. (Apiaceae), Plantago major L. and Plantago ovata Forssk. (Plantaginaceae) Rumex crispus L. and Rumex obtusifolius L. (Polygonaceae), Ulmus fulva Michx. (Ulmaceae) and Zingiber officinalis Roscoe (Zingiberaceae). There is insufficient information available to assess the anthelmintic efficacies of C. officinalis, Salvia officinalis, Eugenia caryophyllata and O. europaea; the other plants have mid- to high-level validity for their ethnoveterinary uses. PMID:17628343

  18. Carotenoid content of commonly consumed herbs and assessment of their bioaccessibility using an in vitro digestion model.

    Science.gov (United States)

    Daly, Trevor; Jiwan, Marvin A; O'Brien, Nora M; Aherne, S Aisling

    2010-06-01

    Herbs are a rich source of bioactive phytochemicals such as carotenoids, which are known to exert various positive biological effects. However, there is very limited information in the literature regarding the content and bioavailability of carotenoids from commonly consumed herbs. Therefore, the objectives of the present study were first, to determine the carotenoid content of eight herbs namely basil (Ocimum basilicum), coriander (Coriandrum sativum), dill (Anethum graveolens), mint (Metha L.), parsley (Petroselinum crispum), rosemary (Rosmarinus officinalis), sage (Salvia officinalis), and tarragon (Artemisia dracunculus L.); and second, to assess carotenoid bioaccessibility from these herbs using a simulated human in vitro digestion model. Carotenoid bioaccessibility is defined as the amount of carotenoids transferred to micelles after digestion when compared with the original amount present in the food. The content of individual carotenoids varied significantly among the herbs tested. Carotenoid bioaccessibility varied from 0 to 42.8%. Basil and coriander, and their respective micelles, contained the highest levels of beta-carotene, beta-cryptoxanthin, and lutein + zeaxanthin. Our findings show that herbs are rich sources of carotenoids and that these foods can significantly contribute to the intake of bioaccessible carotenoids. PMID:20443063

  19. Toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis

    Directory of Open Access Journals (Sweden)

    Bruce Veronez

    2012-04-01

    Full Text Available O objetivo deste trabalho foi avaliar a toxicidade de compostos sintéticos e naturais sobre Tetranychus urticae e o predador Phytoseiulus macropilis. A mortalidade e a taxa de crescimento de T. urticae e seu predador foram avaliadas após a aplicação de: abamectina, clofentezina, fenpropatrina, fenpiroximato, propargito, enxofre e espiromesifeno, nas concentrações recomendadas; óleos de nim (Natuneem e Sempre Verde Killer Neem a 1%; e extratos aquosos a 10% de Dieffenbachia brasiliensis, Annona squamosa, Ruta graveolens, Agave angustifolia, Melia azedarach, Sonchus oleraceus, Mentha spicata x M. suaveolens, Allium cepa, Laurus nobilis e Eucalyptus saligna. A toxicidade aguda e a influência dos compostos sobre a taxa de crescimento instantâneo dos ácaros foram avaliadas em laboratório. Extratos de A. cepa, A. angustifolia, produtos à base de óleo de nim, espiromesifeno, propargito, fenpiroximato, abamectina e fenpropatrina causaram mortalidade superior a 83% em T. urticae. Extrato de A. angustifolia, Natuneem e clofentezina não causaram mortalidade significativa em P. macropilis. Agave angustifolia e Natuneem não afetaram significativamente a taxa de crescimento deste predador. Propargito, fenpiroximato, abamectina, fenpropatrina, espiromesifeno e extrato de L. nobilis afetaram severamente a população de P. macropilis.

  20. Ethno-gynecological knowledge of medicinal plants used by Baluch tribes, southeast of Baluchistan, Iran

    Directory of Open Access Journals (Sweden)

    Zahra Sadeghi

    2014-12-01

    Full Text Available The objective of this study was to establish a regional profile of the indigenous knowledge on the treatment of various gynaecological disorders by Baluch Tribes of Iran. The ethical guidelines adopted by the International Society of Ethnobiology were strictly followed during the field survey. Data were collected during 2013-2014 based on interviews, group conversations and close consultation with local informants. Participants were selected using the snowball sampling technique. Secondary methods of data collection were also used for triangulation. A quantitative analysis including the informant consensus factor and use value was performed to evaluate the medicinal plants. A total of 33.3% Baluch women reported high affiliation with herbal remedies for gynaecological problems, while others attribute was also positive for medicinal plants. A total of eighty plant species belonging to 43 botanical families were documented. Levels of Relative frequency of citation decreased as follows: Nigella sativa (0.92, Pistacia atlantica (0.91, Anethum graveolens (0.88, Carum carvi (0.87 and Trigonella foenum-graecum (0.85. Results of the informant consensus factor showed that menstrual problems (0.87 and vaginal infection (0.74 were the most common problems of women in the studied area. The use value and informant consensus factor validated that the relative importance of plant species and shared knowledge of herbal therapies between Baluch womenfolk of this area is still rich.

  1. Case report: pulicosis por Ctenocephalides felis felis en ovinos y caprinos en la sabana de Bogotá, Colombia

    Directory of Open Access Journals (Sweden)

    Efraín Benavides Ortiz

    2010-06-01

    Full Text Available In Colombia the rearing of hair sheep and goats are expanding in various regions for being an alternative for meat and milk production at competitive prices due to their adaptability and easiness to digest rough fodder. Among the ectoparasites that affect small ruminants traditionally are recognized the lice and the sheep keds Melophagus ovinus (Díptera: Hippoboscidae, however fleas are not included. Here the occurrence of the common cat flea Ctenocephalides felis felis (Díptera: Siphonaptera affecting sheep and goats in a farm at the Sabana de Bogotá are described an so there was performed an epidemiological and parasitological evaluation. The barn maintained animals in rotational grazing at an approximated stocking rate of 25 head/ha, receiving additional supplements of hay and silage. The presence of the flea was confirmed in sheep and goats, young and adult, as well as in dogs. Diverse degrees of anemia were evidenced but the association between flea infestation and anemia, or the presence of other anemia producing agents could not be studied. In the farm synthetic parasiticides are not used, extracts of Ruda (Ruta graveolens are administered to mitigate parasitosis, without major efficacy. Sheep and goat breeders in the tropics should consider flea infestation as an agent causing adverse animal welfare situations in their farms. Control should start from the knowledge of the life cycle of the flea, trying to interrupt it.

  2. Effect of normal/dehydrated greens on the rheological, microstructural, nutritional and quality characteristics of paratha-an Indian flat bread.

    Science.gov (United States)

    Sudha, M L; Eipson, Sushma W; Khanum, Hafeeza; Naidu, M Madhava; Venkateswara Rao, G

    2015-02-01

    The leaves of dill (Anethum graveolens) and fenugreek (Trigonella foenum-graecum L. Leguminosae) were dehydrated using low temperature low humidity dryer, packed in polypropylene bags and stored at refrigerated conditions. Dehydration process marginally reduced the chlorophyll, carotenoid and ascorbic acid contents. Replacement of whole wheat flour with dehydrated leaves (dill-DDL, fenugreek leaves DFL) at 0, 5, 7.5 and 10 % increased the water absorption (68.5 to 70.2 %), dough development time (3.5 to 5.9 min) and mixing tolerance index values (78 to 98 BU). Pasting temperature increased (69 to 74.1 °C), whereas the hot paste viscosity (255 to 210 BU) and cold paste viscosity values (355 to 295 BU) decreased with increase in the DDL/DFL content in the blend. Sensory evaluation of parathas prepared with either normal dill/fenugreek leaves (NDL/NFL) at 0, 12.5, 25 and 37.5 % or dehydrated leaves at 0, 5, and 7.5 % showed that parathas with 25 % of normal leaves and 7.5 % of dehydrated leaves were acceptable. Microstructure of the fenugreek leaves had more porous structure on dehydration. Parathas enriched with either of leaves were rich in dietary fiber, chlorophyll and carotenoid content. PMID:25694692

  3. Characterization of gallotannins from Astronium species by flow injection analysis- electrospray ionization-ion trap-tandem mass spectrometry and matrix-assisted laser desorption/ionization time-of- flight mass spectrometry.

    Science.gov (United States)

    da Silva, Viviane Cândida; Napolitano, Assunta; Eletto, Daniela; Rodrigues, Clenilson Martins; Pizza, Cosimo; Vilegas, Wagner

    2011-01-01

    The species Astronium urundeuva (Allemao) Engl. and Astronium graveolens Jacq., which are used in Brazilian folk medicine to treat allergies, inflammation, diarrhea and ulcers, were investigated for their composition. The aim of this study was to define a rapid and reliable analytical approach, based on the flow-injection analysis-electrospray ionization-ion trap-tandem mass spectrometry (FIA-ESI-IT-MS-MS) and matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-ToF-MS), to investigate the full range of hydrolyzable tannins present in the extracts of these Astronium species. The MALDI-ToF-MS analysis allowed us to ascertain the presence of hydrolysable tannins in both Astronium species as a series of gallotannins with degrees of polymerization of 7 to 13 galloyl units. Moreover, the analysis by FIA-ESI-IT-MS-MS, as well as confirming this result and chemically defining gallotannins as galloylglucose compounds, highlighted the presence of further classes of hydrolysable tannins, such as hexahydrodiphenoyl esters of glucose and some gallic acid derivatives, providing information about their structure by a careful study of their fragmentation patterns. Finally, the evaluation of the number of positional isomers of gallotannins occurring in both Astronium species was obtained by high-performance liquid chromatography-electrospray ionization-ion trap mass spectrometry (HPLC/ESI-IT-MS). This is the first mass spectrometric evidence relating to the existence of gallotannins in Astronium genus. PMID:22006629

  4. A novel coumarin derivative, 8-methoxy chromen-2-one alleviates collagen induced arthritis by down regulating nitric oxide, NFκB and proinflammatory cytokines.

    Science.gov (United States)

    Sahu, Debasis; Raghav, Sunil Kumar; Gautam, Hemlata; Das, Hasi R

    2015-12-01

    Ruta graveolens (Rue) is a well-known medicinal plant having anti-inflammatory and other healing properties. This contains many active phytochemicals such as coumarins which possess anti-inflammatory and anti-cancer activities. The present study was carried out to evaluate the therapeutic potential of a newly isolated coumarin derivative from rue plant, 8-methoxy-chromen-2-one (MCO) in the collagen induced arthritic (CIA) rat model. MCO showed inhibition of cytokines and NF-κB in LPS stimulated J774 cells which prompted its possible use in animal. In CIA, arthritic index and arthritic score reduced markedly within 15days of MCO treatment at doses of 2mg and 20mg per kg body weight. Alleviation of joint damage in CIA animals on treatment with MCO was evident from radiographic and histological data. Behavioral studies by open field tests also showed convalescence in the MCO treated CIA rats. Further, escalated plasma levels of pro-inflammatory cytokines TNF-α, IL-1β and IL-6, and also nitric oxide reduced significantly with the treatment. All these results indicate the therapeutic efficacy of MCO and its possible use as an anti-arthritic drug. PMID:26440401

  5. Efficacy of plant derived oils and extracts against white-fly, bemisia tabaci (gennadius) on sesame crop

    International Nuclear Information System (INIS)

    Whitefly, Bemisia tabaci (Genn.) is a polyphagous pest and is reported on more than 600 host plants worldwide. Different methods are being used for its control. The present experiment was conducted to determine the effect of some plant extracts of mint (Mentha spp.) and gera-nium (Pelargonium graveolens) and soybean oil (Glycine max), mustard oil (Brassica spp.) and taramera oil (Eruca sativa) against whitefly, Bemisia tabaci on sesame crop. The data were recorded 24h before and 24h, 48h, 72h and 168h after application of each spray material. The results showed that whitefly population was significantly suppressed by both the botanical oils and extracts as compared to the control treatment but in general botanical oils showed significant results as compared to plant extracts. Soybean oil was quite effective in reducing whitefly population per leaf, while after second spray soybean oil and extract of Mentha spp. was more effective in the reducing whitefly population per leaf. The results indicated that plant derived oils and extracts have the potential to be used in plant protection strategies but still more research has to be incorporated in the pest management programmes. (author)

  6. Antimicrobial Susceptibility of Escherichia coli Strains Isolated from Alouatta spp. Feces to Essential Oils.

    Science.gov (United States)

    Lara, Valéria Maria; Carregaro, Adriano Bonfim; Santurio, Deise Flores; de Sá, Mariangela Facco; Santurio, Janio Moraes; Alves, Sydney Hartz

    2016-01-01

    This study evaluated the in vitro antibacterial activity of essential oils from Lippia graveolens (Mexican oregano), Origanum vulgaris (oregano), Thymus vulgaris (thyme), Rosmarinus officinalis (rosemary), Cymbopogon nardus (citronella), Cymbopogon citratus (lemongrass), and Eucalyptus citriodora (eucalyptus) against Escherichia coli (n = 22) strains isolated from Alouatta spp. feces. Minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) were determined for each isolate using the broth microdilution technique. Essential oils of Mexican oregano (MIC mean = 1818 μg mL(-1); MBC mean = 2618 μg mL(-1)), thyme (MIC mean = 2618 μg mL(-1); MBC mean = 2909 μg mL(-1)), and oregano (MIC mean = 3418 μg mL(-1); MBC mean = 4800 μg mL(-1)) showed the best antibacterial activity, while essential oils of eucalyptus, rosemary, citronella, and lemongrass displayed no antibacterial activity at concentrations greater than or equal to 6400 μg mL(-1). Our results confirm the antimicrobial potential of some essential oils, which deserve further research. PMID:27313638

  7. Anticancer Effects of HESA-A:An Herbal Marine Compound

    Institute of Scientific and Technical Information of China (English)

    Amrollah Ahmadi; Gholamreza Habibi; Mehdi Farrokhnia

    2010-01-01

    @@ HESA-A,a natural biological compound,is a mixture of herbal-marine substances that includes Penaeus latisculatus (king prawn),Carum carvi and Apium graveolens with anticancer properties(1,2).Although the exact mechanism of action of HESA-A on tumor cells is not fully understood,it appears to have multiple pharmacological effects(2). The lack of selectivity for tumor cells,which is associated with conventional cancer chemotherapy,is the main cause of chemotherapy complications and failure of anticancer agents.Many complementary and alternative medicine (CAM) studies are focused on products obtained from plants,animals or other natural sources to find compounds with high therapeutic indices.HESA-A inhibits the growth of cancer cells selectively and in a dose dependent manner.At the highest concentration (5.4 mg/mL),HESA-A completely inhibits the growth of cells and this effect gradually decreases as the dose is reduced.HESA-A is not cytotoxic towards normal cell lines unlike cancer cells.A major concern in this selectivity effect is the possible interaction with the cell DNA.The apoptotic effects of HESA-A may also have a major role in its anticancer properties(3,4).

  8. Impact of UV radiation on activity of linear furanocoumarins and Bacillus thuringiensis var. kurstaki against Spodoptera exigua: Implications for tritrophic interactions

    International Nuclear Information System (INIS)

    Acidic fogs with a pH of 2.0 and duration of 2 hr did not reduce the efficacy of Bacillus thuringiensis var. kurstaki. Therefore, the impact of UV radiation was investigated on the interactions between (1) levels of the antibacterial linear furanocoumarins psoralen, bergapten, and xanthotoxin in Apium graveolens (L.) occurring following a 2.0 pH acidic fog episode, (2) the noctuid Spodoptera exigua, and (3) a sublethal dosage of the microbial pathogen B. thuringiensis var. kurstaki. Mean time to pupation in the absence of UV radiation was significantly extended by the addition of either psoralens or B. thuringiensis. Larvae developing on diets containing B. thuringiensis plus psoralens required nearly 40% longer to pupate than controls, but their effects were additive as the interaction was not significant. Mean time to mortality, a weighted average time of death, was not significantly affected by any of the treatments. In a 2 x 2 x 2 factorial analysis, all main effects reduced survival significantly, as did the three-way interaction. Thus, antagonistic interactions with psoralens that would reduce the effectiveness of B. thuringiensis in the field were not observed. When pairs of main effects were nested within the two levels of the third factor, several two-way interactions were found. Interestingly, the activity of B. thuringiensis and the psoralens, individually or in combination, was enhanced by exposure to UV radiation. Implications of this research are discussed for both natural and agricultural ecosystems

  9. Inhibitory effect of essential oils against Trichosporon ovoides causing Piedra Hair Infection

    Directory of Open Access Journals (Sweden)

    Seema Saxena

    2012-12-01

    Full Text Available Piedra, is an asymptomatic fungal infection of the hair shaft, resulting in the formation of nodules of different hardness on the infected hair. The infection also known as Trichomycosis nodularis is a superficial fungal infection arising from the pathogen being restricted to the stratum corneum with little or no tissue reaction. The nodules are a concretion of hyphae and fruiting bodies of the fungus. Two varieties of Piedra may be seen, Black Piedra and White Piedra. The fungus Trichosporon ovoides is involved in the occurrence of both types of Piedras. The purpose of this study was to examine the effectiveness of selected essential oils for the control of growth of the fungus and to determine whether the antifungal effect was due to the major compounds of the oils. Two screening methods viz. Agar well diffusion assay and Minimum Inhibitory Concentration were adopted for the study. MIC and MFC were determined by tube dilution method. Essential oils from Eucalyptus, Ocimum basilicum, Mentha piperita, Cymbopogon flexuosus, Cymbopogon winterians, Trachyspermum ammi, Zingiber officinalis, Citrus limon, Cinnamomon zeylanicum, Salvia sclarea, Citrus aurantifolia, Melaleuca alternifolia, Citrus aurantium, Citrus bergamia, Pogostemon pathchouli, Cedrus atlantica, Jasminum officinale, Juniperus communis, Abelmoschus moschatus, Cyperus scariosus, Palargonium graveolens, Boswellia carterii, Rosa damascene, Veteveria zizanoides and Commiphora myrrha were evaluated. The essential oils of Cymbopogon winterians, Mentha piperita, Cinnamomum zeylanicum, Melaleuca alternifolia and Eucalyptus globulus were proved to be most effective against the fungus Trichosporon ovoides.

  10. Comparison of the Antioxidant Capacity of an Important Hepatoprotective Plants

    Directory of Open Access Journals (Sweden)

    Vivek Kumar R

    2011-01-01

    Full Text Available Currently there has been an increased interest globally to identify antioxidant compounds that are pharmacologically potent and have low or no side effects for use in preventive medicine and the food industry. As plants produce significant amount of antioxidants to prevent the oxidative stress caused by photons and oxygen, they represent a potential source of new compounds with antioxidant activity. Commonly used medicinal plant extracts with standardized content of polyphenols were investigated for their antioxidant activity (AA. In the present paper ten plants (Picrorrhiza kurroa, Tephrosia purpurea, Terminalia arjuna, Tinospora cordifolia, Glycyrrhiza glabra, Azadirachta indica, Apium graveolens, Swertia chirata, Phyllanthus amarus, and Aloe vera and their possible constituents responsible for its antioxidant property were compared by reducing power, 2, 2-diphenyl-1-picrylhydrazyl (DPPH scavenging activity method. The plants described contain antioxidant principles that can explain and justify their use in traditional medicine (Hepatoprotective in the past as well as the present. These results suggest that AA determination is of interest for a comparative evaluation of in vitro antioxidant potential, but it needs to be combined with in vivo data for adequate assessment of the antioxidant capacity of medicinal plant extracts.

  11. Chemical composition and antimicrobial activity of the essential oils from four Ruta species growing in Algeria.

    Science.gov (United States)

    Haddouchi, Farah; Chaouche, Tarik Mohammed; Zaouali, Yosr; Ksouri, Riadh; Attou, Amina; Benmansour, Abdelhafid

    2013-11-01

    Antimicrobial properties of plants essential oils have been investigated in order to suggest them as potential tools to overcome the microbial drug resistance and the increasing incidence of food borne diseases problems. The aim of this research is to study the antibacterial and antifungal effects of four traditional plants essential oils, Ruta angustifolia, Ruta chalepensis, Ruta graveolens and Ruta tuberculata, against standard bacterial and fungal strains. The chemical compounds of the oils were examined by GC/MS. Results revealed a powerful antifungal activity against filamentous fungi. Aspergillus fumigatus and Cladosporium herbarum are the most sensitive strains to these oils with MIC values less than 3.5 μg ml(-1) for certain oils, reaching 7.8 μg ml(-1) for other. GC/MS essay exhibited ketones as the most abundant constituent of these oils except for R. tuberculata essential oil which has a completely different composition, monoterpenes alcohols being the most abundant. These compositions explain their potential antifungal activity. PMID:23768355

  12. Comparative study of the assay of Artemia salina L. and the estimate of the medium lethal dose (LD50 value) in mice, to determine oral acute toxicity of plant extracts.

    Science.gov (United States)

    Logarto Parra, A; Silva Yhebra, R; Guerra Sardiñas, I; Iglesias Buela, L

    2001-09-01

    Artemia salina L. (Artemiidae), the brine shrimp larva, is an invertebrate used in the alternative test to determine toxicity of chemical and natural products. In this study the Medium Lethal Concentrations (LC50 value) of 20 plant extracts, Aloe vera (L.) Burm. F. (Aloeaceae), Artemisia absinthium L. (Asteraceae); Citrus aurantium L. (Rutaceae); Cymbopogon citratus (DC. Ex Nees) Stapf (Poaceae); Datura stramonium L. (Solanaceae); Justicia pectoralis Jacq. (Acanthaceae); Musa x paradisiaca L. (Musaceae); Ocimum basilicum L.; O. gratissimum L.; O. tenuiflorum L. (Lamiaceae); Pimenta dioica (L.) Merr. (Myrtaceae); Piper auritum Kunth (Piperaceae); Plantago major L. (Plantaginaceae); Plectranthus amboinicus (Lour.) Spreng. (Lamiaceae); Ruta graveolens L. (Rutaceae); Senna alata (L.) Roxb. (Fabaceae); Stachytarpheta jamaicensis (L.) Vahl (Verbenaceae); and Thuja occidentalis L. (Cupressaceae), were determined using Artemia salina L. (Artemiidae), with the objective of relating the results to the LD50 values reported in mice (tested at three concentrations: 10, 100, and 1000 microg/mL, for each extract). We found good correlation between the in vivo and the in vitro tests (r = 0.85 p < 0.05), and this method is a useful tool for predicting oral acute toxicity in plant extracts. PMID:11695884

  13. Cadmium uptake by plants

    Energy Technology Data Exchange (ETDEWEB)

    Haghiri, F.

    1973-01-01

    Absorption of /sup 115m/Cd by soybean (Gylcine max l.) plants via foliar and root systems and translocation into the seed was determined. The uptake of /sup 115m/Cd by soybeans via the root system was more efficient than that of the foliar placement. Growth and Cd concentrations of soybean and wheat (Triticum aestivum l.) tops were influenced by soil-applied Cd. In both crops, the Cd concentration of plant tops increased while yield decreased with increasing levels of applied Cd. Cadmium toxicitiy began to occur in both crops at the lowest level of soil applied Cd (2.5 ppM). With soybean plants, Cd toxicity symptoms resembled fe chlorosis. For wheat plants there were no visual symptoms other than the studied growth. The relative concentration of Cd found in several vegetable crops varied depending on the plant species. The relative Cd concentration in descending order for various vegetables was lettuce (Lactuca sativa l.) > radish top (Raphanus sativus l.) > celery stalk (Apium graveolens l.) > celery leaves greater than or equal to green pepper (Capsicum frutescens l.) > radish roots.

  14. Herbs of interest to the Brazilian Federal Government: female reproductive and developmental toxicity studies

    Directory of Open Access Journals (Sweden)

    Luiz Fernando Verissimo

    2011-12-01

    Full Text Available In 2009 the Brazilian Ministry of Health published a document named RENISUS that lists 71 herbs traditionally used in Brazil that could result in phytomedicines to be dispensed by the governmental health care program. This manuscript reviews female reproductive and/or developmental toxicity information of these herbs. More than half (35 of the herbs lack information regarding female reproductive and/or developmental effects. From the fourteen herbs used traditionally to disturb female reproduction, five present experimental data corroborating their actions as abortifacients (Maytenus ilicifolia, Momordica charantia, Plectranthus barbatus, Ruta graveolens or labour facilitator (Bidens pilosa. For 23 of the herbs evaluated experimentally for any type of female reproductive endpoint, only a single study was retrieved and at least twelve of these studies were conducted with a single dose. This scenario suggests that the scientific power of the published information is very low and that a scientifically-based risk/benefit analysis about the use of these herbs during pregnancy is not possible. Considering the appeal that phytomedicines have for pregnant women, usually aware and afraid of the risks that synthetic drugs may have in their pregnancy and progeny, well designed studies evaluating reproductive and/or developmental toxicity of these herbs urge.

  15. Fertilization and colors of plastic mulch affect biomass and essential oil of sweet-scented geranium.

    Science.gov (United States)

    Silva, Anderson de Carvalho; Blank, Arie Fitzgerald; dos Santos, Wallace Melo; Prata, Paloma Santana; Alves, Péricles Barreto; Arrigoni-Blank, Maria de Fátima

    2014-01-01

    Sweet-scented geranium (Pelargonium graveolens L'Hér), a plant belonging to the Geraniaceae family, has medicinal and aromatic properties and is widely used in the cosmetic, soap, perfume, aromatherapy, and food industries. The aim of this study was to evaluate the influence of fertilization and the use of different colors of plastic mulch on sweet-scented geranium biomass and essential oil. Three colors of plastic mulch (black, white, and silver-colored) and a control without plastic mulch were assessed along with three fertilizers (20,000 L · ha(-1) of cattle manure; 1,000 kg · ha(-1) of NPK 3-12-6; and 20,000 L · ha(-1) of cattle manure + 1,000 kg · ha(-1) of NPK 3-12-6 fertilizer) and a control without fertilizer. The absence of a soil cover negatively influenced the agronomical variables, while coverage with plastic mulch was associated with increased biomass. The use of fertilizer had no effect on the evaluated agronomic variables. When cattle manure and NPK 3-12-6 were used together, combined with white or black plastic mulch, the highest yields of essential oil were obtained. For the silver-colored plastic mulch, higher amounts of essential oil (6,9-guaiadien) were obtained with mineral fertilizer. PMID:24757440

  16. Unusual carbon partitioning during phosphate deficiency in celery, a mannitol-synthesizing species

    International Nuclear Information System (INIS)

    Mannitol and sucrose are the main photosynthetic products and translocated carbon compounds in celery (Apium graveolens L.). Carbon partitioning was studied in greenhouse-grown celery plants supplied with a nutrient solution containing or lacking phosphate (P). P-deficient plants developed new leaves at about the same rate as control plants, but showed greatly reduced growth of leaves and petioles; root growth was apparently unaffected. P-deficient leaves contained less mannitol and more sucrose than control leaves. Starch content increased with P-deficiency only in mature (the most photosynthetically-active) leaves, and then amounted to less than 10 mg/g fresh weight. Similarly, when 14CO2 was supplied to intact plants, P-deficient leaves contained less label in mannitol and more in sucrose than did control leaves; labeling of starch changed little. The P-status of celery leaves apparently affects the partitioning of carbon between mannitol and sucrose more than it affects starch accumulation. This is in marked contrast to the large increase in starch content commonly observed during P-deficiency in species that produce and translocate predominantly sucrose

  17. Arabidopsis POLYOL TRANSPORTER5, a new member of the monosaccharide transporter-like superfamily, mediates H+-Symport of numerous substrates, including myo-inositol, glycerol, and ribose.

    Science.gov (United States)

    Klepek, Yvonne-Simone; Geiger, Dietmar; Stadler, Ruth; Klebl, Franz; Landouar-Arsivaud, Lucie; Lemoine, Rémi; Hedrich, Rainer; Sauer, Norbert

    2005-01-01

    Six genes of the Arabidopsis thaliana monosaccharide transporter-like (MST-like) superfamily share significant homology with polyol transporter genes previously identified in plants translocating polyols (mannitol or sorbitol) in their phloem (celery [Apium graveolens], common plantain [Plantago major], or sour cherry [Prunus cerasus]). The physiological role and the functional properties of this group of proteins were unclear in Arabidopsis, which translocates sucrose and small amounts of raffinose rather than polyols. Here, we describe POLYOL TRANSPORTER5 (AtPLT5), the first member of this subgroup of Arabidopsis MST-like transporters. Transient expression of an AtPLT5-green fluorescent protein fusion in plant cells and functional analyses of the AtPLT5 protein in yeast and Xenopus oocytes demonstrate that AtPLT5 is located in the plasma membrane and characterize this protein as a broad-spectrum H+-symporter for linear polyols, such as sorbitol, xylitol, erythritol, or glycerol. Unexpectedly, however, AtPLT5 catalyzes also the transport of the cyclic polyol myo-inositol and of different hexoses and pentoses, including ribose, a sugar that is not transported by any of the previously characterized plant sugar transporters. RT-PCR analyses and AtPLT5 promoter-reporter gene plants revealed that AtPLT5 is most strongly expressed in Arabidopsis roots, but also in the vascular tissue of leaves and in specific floral organs. The potential physiological role of AtPLT5 is discussed. PMID:15598803

  18. Antifungal Activity of Essential Oils from Some Medicinal Plants of Iran against Alternaria alternate

    Directory of Open Access Journals (Sweden)

    I. Hadizadeh

    2009-01-01

    Full Text Available Problem statement: Increasing public concern over the level of pesticide residues in food especially fresh produce has built up adequate pressure for scientists to look for less hazardous and environmentally safer compounds for controlling post harvest diseases. Essential oils as registered food grade materials have the potential to be applied as alternative anti-fungal treatments for fresh fruits and vegetables. Approach: We present in this study, the identification of the essential oils with antifungal activity from some medicinal plants of Iran (nettle (Urtica dioica L., thyme (Thymus vulgaris L., eucalyptus (Eucalyptus spp., Rue (Ruta graveolens L. and common yarrow (Achillea millefolium L., and their potential application as "generally regarded as safe" antifungal compounds against Alternaria alternate on tomato as a model pathosystem. Results: Both the nettle and the thyme oils exhibited antifungal activity against A. alternata. The thyme oil exhibited a lower degree of inhibition 68.5 and 74.8% at 1500 and 2000 ppm, respectively. Spore germination and germ tube elongation of the pathogens in potato dextrose broth was strongly reduced in the presence of 1500 ppm of the nettle oil. The same concentration of this oil reduced the percentage of decayed tomatoes. The experiments on reducing the development of natural tomato rot gave similar results. Conclusions: Application of essential oils for postharvest disease control of fresh produce, as a novel emerging alternative to hazardous anti-fungal treatments will allow a safer and environmentally more acceptable management of postharvest diseases.

  19. Effects of essential oils on the growth of Giardia lamblia trophozoites.

    Science.gov (United States)

    Machado, Marisa; Sousa, Maria do Céu; Salgueiro, Lígia; Cavaleiro, Carlos

    2010-01-01

    Giardia lamblia is one of the most important worldwide causes of intestinal infections produced by protozoa. Current therapy for giardiasis is unsatisfactory due to high incidence of undesirable side effects and significant failure in clearing parasites from the gastrointestinal tract. In the search for new therapeutic agents, we report on the effect of several essential oils on G. lamblia growth. Among eighteen tested essential oils, those with phenolic compositions were the most active, particularly if containing high contents of carvacrol, such as Thymbra capitata and Origanum virens (IC50 values of 71 and 85 microg x mL(-1), respectively). The oils from Syzygium aromaticum and Thymus zygis subsp. sylvestris (IC50 values from 100 to 200 microg x mL(-1)), as well as, those from Mentha x piperita and Lippia graveolens (IC50 values over 200 microg x mL(-1)) were less active. Results support the concept that several essential oils or some of their constituents may be useful in the clinical management of Giardia infections. PMID:20184039

  20. Use of Monoclonal Antibodies in an ELISA for Detecting an Invasive Pest Insect, Liriomyza trifolii (Diptera: Agromyzidae).

    Science.gov (United States)

    Zhao, W C; Shang, H W; Guo, W; Xu, D; Huang, T Y; Zhu, L X

    2015-04-01

    A monoclonal antibody was prepared by the hybridoma technology. It reacted only with the protein of Liriomyza trifolii (Burgess) and not with that of Chromatomyia horticola Goureau or Liriomyza sativae Blanchard in indirect enzyme-linked immunosorbent assay. It was effective even after being diluted more than 8.192×10(6)-fold. The detection sensitivity of the antibody was 31.3 µg/ml under controlled conditions. Positive reaction was achieved with all laboratory-reared L. trifolii samples, including larvae, pupae, and adults. An indirect enzyme-linked immunosorbent assay system was successfully established to detect L. trifolii in the field. This antibody was successfully used to determine the L. trifolii collected in different locations, from different host plants, and in different seasons. More than 50% of leafminers collected on Brassica chinensis var chinensis, Apium graveolens (Miller) Persoon, Vigna unguiculata (L.) Walpers, Phaseolus vulgaris L., Lactuca sativa L., and Chrysanthemum coronarium (L.) Cassini ex Spach were L. trifolii, indicating that those six plant species might be the preference host plants of L. trifolii. Population of L. trifolii peaked in September, October, or November in Hangzhou, Zhejiang. These results suggest a great potential of using this McAb for precisely identifying L. trifolii and monitoring the population dynamics of L. trifolii in the field. PMID:26470159

  1. Phytoavailability and fractionation of copper, manganese, and zinc in soil following application of two composts to four crops

    Energy Technology Data Exchange (ETDEWEB)

    Zheljazkov, Valtcho D.; Warman, Phil R

    2004-09-01

    Two experiments were conducted to evaluate the effect of compost addition to soil on fractionation and bioavailability of Cu, Mn, and Zn to four crops. Soils growing Swiss chard (Beta vulgaris var. cicla L.) and basil (Ocimum basilicum L.) were amended (by volume) with 0, 20, 40, and 60% Source-Separated Municipal Solid Waste (SS-MSW) compost, and dill (Anethum graveolens L.) and peppermint (Mentha X piperita L.) were amended with 0, 20, 40, and 60% of high-Cu manure compost (by volume). The SS-MSW compost applications increased the concentration of Cu and Zn in all fractions, increased Mn in acid extractable (ACID), iron and manganese oxides (FeMnOX), and organic matter (OM) fractions, but decreased slightly exchangeable-Mn. Addition of 60% high-Cu manure compost to the soil increased Cu EXCH, ACID, FeMnOX, and OM fractions, but decreased EXCH-Mn, and did not change EXCH-Zn. Addition of both composts to soil reduced bioavailability and transfer factors for Cu and Zn. Our results suggest that mature SS-MSW and manure composts with excess Cu and Zn could be safely used as soil conditioners for agricultural crops.

  2. Potencial toxicológico frente Artemia Salina em plantas condimentares comercializadas no município de Campina Grande-PB

    Directory of Open Access Journals (Sweden)

    Emmanuel Moreira Pereira

    2015-03-01

    Full Text Available O conhecimento do potencial toxicológico das plantas é um fator primordial para estipular o limite consumível. Objetivou-se nesse trabalho avaliar o potencial toxicológico de plantas condimentares frente Artemia salina, expostas às concentrações dos extratos das plantas erva-doce (Pimpinella anisum L., pimenta malagueta (Capsicum frutescens, endro (Anethum graveolens L. e alecrim (Rosmarinus officinalis L.. O trabalho foi desenvolvido no Laboratório de Engenharia de Alimentos - LEA pertencente ao Centro de Tecnologia e Recursos Naturais da Universidade Federal de Campina Grande-PB. A erva doce apresentou uma baixa toxicidade, atingindo uma DL50 de 428ppm do extrato. Já a pimenta malagueta exibiu um comportamento similar, atingindo o seu potencial toxicológico máximo na terceira diluição com DL50 716,1ppm. Para o endro, observou-se uma baixa taxa de mortalidade, consequentemente foi considerada não toxica, apresentando a DL50, com 2.624,5ppm. O alecrim apresentou baixos percentuais de mortalidade em náuplios de Artemia, sendo a DL50 com 3.720,6ppm, sendo considerado não toxico. No entanto necessita-se de estudos mais aprofundados para caracterizar a composição química das plantas estudadas e um teste in vivo para as que apresentaram baixa toxicidade.

  3. Antimicrobial Activity of Essential Oils of some Medicinal Plants from Saudi Arabia

    International Nuclear Information System (INIS)

    Antibacterial and anticandidal activities of essential oils obtained from of dill (Anethum graveolens) and fennel (Feoniculum vulgare) were studied by agar dilution technique. Test organisms were inoculated by radial streaking onto agar plates and incubated for 16-20 hours at 35 degree C. Antibacterial activity of dill and fennel was evaluated against Mycobacterium spp, Staphylococcus aureus, Bacillus subtilis, Escherichia coli, Pseudomonas aeruginosa and Candida albicans. Our results showed that the volatile oils extracted by steam distillation method from roots, stem and leaves of dill and fennel plants did not show antibacterial or anticandidal activities. However, seed extracts from both dill and fennel exhibited varying degrees of growth inhibition of C. albicans, C. tropicalis and C.glabrata. Extracts of dill and fennel seeds prepared by simple solvent extraction method, using acetone, petroleum ether, methanol and chloroform, did not show any antimicrobial activity against common bacterial or fungal pathogens. On the other hand, growth of some Mycobacterium species was inhibited by the seed extracts of both fennel and dill. Our results suggest that the anticandidal and antimycobacterial properties of these two herbs may be further investigated to explore the possibility of using them in the treatment of candidal or mycobacterial infections. (author)

  4. Plantas medicinales. Diez años de evaluaciones toxicogenéticas en el CIDEM

    Directory of Open Access Journals (Sweden)

    Janet PILOTO FERRER

    2009-01-01

    Full Text Available Se compiló toda la información de los resultados obtenidos en los ensayos toxicogenéticos, en el período de 1998 al 2008 realizados a extractos vegetales utilizados por la población cubana llevados a cabo en el laboratorio de Genética toxicológica del CIDEM. Se emplearon dos sistemas de ensayos a corto plazo, la prueba in vitro de reversión bacteriana Salmonella/microsoma y el ensayo in vivo de inducción de micronúcleos en médula ósea de ratón. Se evidencian resultados descriptivos en cuanto al % de familias y de especies evaluadas por ensayos comparados con el total de la flora cubana. Solamente se resaltan aquellos extractos que indujeron una respuesta positiva en los ensayos y de esta forma alertar a las autoridades sanitarias y a nuestra población de tales efectos. Los extractos vegetales con actividad genotóxica fueron: extracto acuoso de Ruta graveolens L., extracto acuoso de Indigophera suffructicosa Mill y extracto hidroalcohólico de Tamarindus indica L.

  5. Fertilization and Colors of Plastic Mulch Affect Biomass and Essential Oil of Sweet-Scented Geranium

    Directory of Open Access Journals (Sweden)

    Anderson de Carvalho Silva

    2014-01-01

    Full Text Available Sweet-scented geranium (Pelargonium graveolens L’Hér, a plant belonging to the Geraniaceae family, has medicinal and aromatic properties and is widely used in the cosmetic, soap, perfume, aromatherapy, and food industries. The aim of this study was to evaluate the influence of fertilization and the use of different colors of plastic mulch on sweet-scented geranium biomass and essential oil. Three colors of plastic mulch (black, white, and silver-colored and a control without plastic mulch were assessed along with three fertilizers (20,000 L·ha−1 of cattle manure; 1,000 kg·ha−1 of NPK 3-12-6; and 20,000 L·ha−1 of cattle manure + 1,000 kg·ha−1 of NPK 3-12-6 fertilizer and a control without fertilizer. The absence of a soil cover negatively influenced the agronomical variables, while coverage with plastic mulch was associated with increased biomass. The use of fertilizer had no effect on the evaluated agronomic variables. When cattle manure and NPK 3-12-6 were used together, combined with white or black plastic mulch, the highest yields of essential oil were obtained. For the silver-colored plastic mulch, higher amounts of essential oil (6,9-guaiadien were obtained with mineral fertilizer.

  6. Aplicación de un modelo experimental de valoración económica del uso y manejo de la flora colombiana. Estudio de caso: Meliaceae y Anacardiaceae

    Directory of Open Access Journals (Sweden)

    Campos Héctor Aníbal

    2006-12-01

    Full Text Available Se proponen un modelo y un indicador de valoración económica como alternativas para valorar el uso y
    manejo de la flora colombiana y se aplican a nueve especies de Meliaceae y Anacardiaceae: Swietenia macrophylla
    King (caoba, Cedrela odorata L. (cedro, Carapa guianensis Aubl. (carapa, andiroba o tangare, Guarea guidonia
    (L. Sleumer (trompillo, Anacardium occidentale L. (marañón, Anacardium giganteum Hancock ex Engler (marañón gigante, Spondias mombin L. (hobo, Camnosperma panamense Standl. (sajo y Astronium graveolens Jacq. (diomate o quiebracha. El modelo y el indicador propuestos integran todos los tópicos que se consideraron partícipes del valor económico de las especies en dos grandes aspectos: el biológico y el biocultural y socioeconómico. El indicador produce un valor aproximado de la especie valorando los aspectos contemplados en el modelo a través de cinco componentes: valor actual de uso, valor actual de importancia cultural, valor actual de los productos y servicios, valor potencial de los productos y servicios y estatus de la información. Con su aplicación en el estudio de caso se determinó a Cedrela odorata como la especie más valiosa.

  7. Activity of essential oils from spices against Staphylococcus spp. isolated from bovine mastitis

    Directory of Open Access Journals (Sweden)

    M Dal Pozzo

    2011-10-01

    Full Text Available Avaliou-se a atividade antimicrobiana dos óleos essenciais (OE de Origanum vulgare (orégano, Thymus vulgaris (tomilho, Lippia graveolens (lipia, Zingiber officinale (gengibre, Salvia officinalis (sálvia, Rosmarinus officinalis (alecrim e Ocimum basilicum (manjericão, e de suas frações majoritárias, carvacrol e timol, frente a 32 isolados de Staphylococcus spp, oriundos de rebanhos leiteiros bovinos. A concentração inibitória mínima (CIM e a concentração bactericida mínima foram determinadas por meio da técnica de microdiluição em caldo. Orégano, tomilho e lípia (Orégano Mexicano apresentaram atividade antimicrobiana similar, médias geométrica de CIM de 1600µg mL-1; 1564µg mL-1; 1562µg mL-1, respectivamente, no entanto menos ativos que carvacrol, 584µg mL-1 e thymol, 427µg mL-1. Isolados com diferentes perfis de susceptibil idade aos antimicrobianos usados no tratamento de mastite bovina, quando subagrupados, foram inibidos por concentrações semelhantes de OE . Estes resultados confirmam a atividade antimicrobiana de OE e algumas frações majoritárias.

  8. Plant compounds insecticide activity against Coleoptera pests of stored products

    Energy Technology Data Exchange (ETDEWEB)

    Moreira, Marcio Dionizio; Picanco, Marcelo Coutinho; Guedes, Raul Narciso Carvalho; Campos, Mateus Ribeiro de; Silva, Gerson Adriano; Martins, Julio Claudio [Universidade Federal de Vicosa (UFV), MG (Brazil). Dept. de Biologia Animal]. E-mail: marcio.dionizio@gmail.com; picanco@ufv.br; guedes@ufv.br; mateusc3@yahoo.com.br; agronomiasilva@yahoo.com.br

    2007-07-15

    The objective of this work was to screen plants with insecticide activity, in order to isolate, identify and assess the bioactivity of insecticide compounds present in these plants, against Coleoptera pests of stored products: Oryzaephilus surinamensis L. (Silvanidae), Rhyzopertha dominica F. (Bostrichidae) and Sitophilus zeamais Mots. (Curculionidae). The plant species used were: basil (Ocimum selloi Benth.), rue (Ruta graveolens L.), lion's ear (Leonotis nepetifolia (L.) R.Br.), jimson weed (Datura stramonium L.), baleeira herb (Cordia verbenacea L.), mint (Mentha piperita L.), wild balsam apple (Mormodica charantia L.), and billy goat weed or mentrasto (Ageratum conyzoides L.). The insecticide activity of hexane and ethanol extracts from those plants on R. dominica was evaluated. Among them, only hexane extract of A. conyzoides showed insecticide activity; the hexane extract of this species was successively fractionated by silica gel column chromatography, for isolation and purification of the active compounds. Compounds 5,6,7,8,3',4',5'-heptamethoxyflavone; 5,6,7,8,3'-pentamethoxy-4',5'-methilenedioxyflavone and coumarin were identified. However, only coumarin showed insecticide activity against three insect pests (LD{sub 50} from 2.72 to 39.71 mg g{sup -1} a.i.). The increasing order of insects susceptibility to coumarin was R. dominica, S. zeamais and O. surinamensis. (author)

  9. Composition, antioxidant and antimicrobial activities of methanol extracts of some Acinos Miller species.

    Science.gov (United States)

    Golubović, Tatjana; Palić, Radosav; Kitić, Dusanka; Stojanović, Gordana; Zlatković, Bojan; Ristić, Mihailo; Pavlović, Dragana

    2014-05-01

    GC and GC/MS analyses of the methanol extracts obtained from the aerial parts of six Acinos Miller species from Serbia and Montenegro were performed. Seventy-four constituents, accounting for 84.9-99.0% of the total composition of the extracts, were identified. The common feature of the A. suaveolens, A. majoranifolius and A. alpinus methanol extracts was the high content of monoterpenes, while the common feature of the A. graveolens, A. arvensis and A. hungaricus methanol extracts was the prevalence of sesquiterpenes. The total flavonoids, polyphenols and tannins content, as well as antioxidant activity (FRAP and DPPH assay) of the methanolic extracts were investigated. The highest antioxidant activity was observed in the extract of A. alpinus which had high levels of all polyphenol classes examined. A disk diffusion method was used for the evaluation of the antimicrobial activities of the extracts against a panel of microorganisms (bacteria: Bacillus subtilis, Clostridium pyogenes, Enterococcus sp., Micrococcus flavus, Sarcina lutea, Staphylococcus aureus, Klebsiella pneumoniae, Proteus vulgaris, Pseudomonas aeruginosa, Salmonella enteritidis and Escherichia coli; fungi: Aspergillus niger, Candida albicans and Saccharomyces cerevisiae). The preliminary bioassay results indicated that the methanol extract of A. alpinus could be a possible source of antioxidant and antimicrobial compounds. PMID:25026735

  10. In vitro activity of essential oils extracted from plants used as spices against fluconazole-resistant and fluconazole-susceptible Candida spp.

    Science.gov (United States)

    Pozzatti, Patrícia; Scheid, Liliane Alves; Spader, Tatiana Borba; Atayde, Margareth Linde; Santurio, Janio Morais; Alves, Sydney Hartz

    2008-11-01

    In the present study, the antifungal activity of selected essential oils obtained from plants used as spices was evaluated against both fluconazole-resistant and fluconazole-susceptible Candida spp. The Candida species studied were Candida albicans, Candida dubliniensis, Candida tropicalis, Candida glabrata, and Candida krusei. For comparison purposes, they were arranged in groups as C. albicans, C. dubliniensis, and Candida non-albicans. The essential oils were obtained from Cinnamomum zeylanicum Breyn, Lippia graveolens HBK, Ocimum basilicum L., Origanum vulgare L., Rosmarinus officinalis L., Salvia officinalis L., Thymus vulgaris L., and Zingiber officinale. The susceptibility tests were based on the M27-A2 methodology. The chemical composition of the essential oils was obtained by gas chromatography-mass spectroscopy and by retention indices. The results showed that cinnamon, Mexican oregano, oregano, thyme, and ginger essential oils have different levels of antifungal activity. Oregano and ginger essential oils were found to be the most and the least efficient, respectively. The main finding was that the susceptibilities of fluconazole-resistant C. albicans, C. dubliniensis, and Candida non-albicans to Mexican oregano, oregano, thyme, and ginger essential oils were higher than those of the fluconazole-susceptible yeasts (Pcinnamon essential oil than their fluconazole-susceptible counterparts (P<0.05). A relationship between the yeasts' susceptibilities and the chemical composition of the essential oils studied was apparent when these 2 parameters were compared. Finally, basil, rosemary, and sage essential oils did not show antifungal activity against Candida isolates at the tested concentrations. PMID:18997851

  11. Effect of homeopathic medicines on transplanted tumors in mice.

    Science.gov (United States)

    Es, Sunila; Kuttan, Girija; Kc, Preethi; Kuttan, Ramadasan

    2007-01-01

    Ultra low doses used in homeopathic medicines are reported to have healing potential for various diseases but their action remains controversial. In this study we have investigated the antitumour and antimetastatic activity of selected homeopathic medicines against transplanted tumours in mice. It was found that Ruta graveolens 200c and Hydrastis canadensis 200c significantly increased the lifespan of Ehrlich Ascites Carcinoma and Dalton's Lymphoma Ascites induced tumour-bearing animals by 49.7%, and 69.4% respectively. Moreover there was 95.6% and 95.8% reduction of solid tumour volume in Ruta 200c and Hydrastis 200c treated animals on the 31st day after tumour inoculation. Hydrastis 1M given orally significantly inhibited the growth of developed solid tumours produced by DLA cells and increased the lifespan of tumour bearing animals. Some 9 out of 15 animals with developed tumors were completely tumour free after treatment with Hydrastis 1M. Significant anti-metastatic activity was also found in B16F-10 melanoma-bearing animals treated with Thuja1M, Hydrastis 1M and Lycopodium1M. This was evident from the inhibition of lung tumour nodule formation, morphological and histopathological analysis of lung and decreased levels of gamma-GT in serum, a cellular marker of proliferation. These findings support that homeopathic preparations of Ruta and Hydrastis have significant antitumour activity. The mechanism of action of these medicines is not known at present. PMID:18159975

  12. DESARROLLO DE APIO MINIMAMENTE PROCESADO FORTIFICADO CON VITAMINA E, UTILIZANDO LA INGENIERIA DE MATRICES

    Directory of Open Access Journals (Sweden)

    YISELL JOHAN MARTELO CASTAÑO

    2011-01-01

    Full Text Available El objetivo de este trabajo fue desarrollar un producto minimamente procesado fortificado con vitamina E, a partir de apio (Apium graveolens L. var.dulce, utilizando la ingenieria de matrices como metodologia de obtencion de alimentos funcionales. Trozos de apio impregnados al vacio con dl¿¿tocoferol acetato emulsificado en una solucion isotonica al vegetal de NaCl, 1,2%, fueron evaluados en funcion del tiempo de almacenamiento y el envasado (con y sin vacio, en terminos de la cuantificacion de sus propiedades fisicoquimicas, color, textura, estabilidad de la vitamina E y caracteristicas sensoriales. Se formulo la emulsion con el objetivo de adicionar teoricamente un 73% del Valor Diario Recomendado (VDR vitamina E/100 g de apio fresco y su cuantificacion se realizo por HPLC. La respuesta a la impregnacion en la matriz fue de 12,10+-1,15%, lo cual permitio alcanzar un 112% VDR vitamina E/100g apio fresco, manteniendose este contenido durante el almacenamiento de 9 dias en ambos tipos de envasado. Los parametros fisicoquimicos del producto fueron afectados por la IV, el tiempo y el envasado, manteniendo su coloracion verdosa y presentando disminucion en la firmeza. La ingenieria de matrices constituye una metodologia efectiva para el desarrollo de apio minimamente procesado adicionado con vitamina E.

  13. Antibacterial activity of extracts from some edible plants commonly consumed in Asia.

    Science.gov (United States)

    Alzoreky, N S; Nakahara, K

    2003-02-15

    Extracts of edible plants (26 species) from China, Japan, Thailand and Yemen were screened for their antibacterial activity against Bacillus cereus, Staphylococcus aureus, Listeria monocytogenes, Escherichia coli and Salmonella infantis. Buffered methanol (80% methanol and 20% PBS) and acetone extracted inhibitory substances against tested bacteria from 16 plants, as revealed by the disc assay. The minimum inhibitory concentrations (MICs) of extracts determined by the agar dilution method ranged from 165 to 2640 mg l(-1). The most sensitive microorganism to extracts from Azadirachta indica, Cinnamomum cassia, Rumex nervosus, Ruta graveolens, Thymus serpyllum and Zingiber officinale was B. cereus, with MIC of 165 to 660 mg l(-1). E. coli and S. infantis were only inhibited by Cinnamomum cassia extracts at the highest MIC (2640 mg l(-1)). L. monocytogenes (Tottori) was more resistant than the ATCC 7644 strain to extracts from Ruta chalepensis, Artemisia absinthium and Cissus spp. EDTA (0.85 mM) reduced the MICs of Cinnamomum cassia and Cissus rotundifolia by at least 50% when tested against E. coli, S. infantis, S. aureus and L. monocytogenes. PMID:12423924

  14. Selecting iodine-enriched vegetables and the residual effect of iodate application to soil.

    Science.gov (United States)

    Dai, Jiu-Lan; Zhu, Yong-Guan; Zhang, Min; Huang, Yi-Zhong

    2004-12-01

    A greenhouse pot experiment was conducted to select vegetables for iodine uptake. The residual effect of iodate fertilization on the growth of and iodine uptake by spinach plants were also investigated. Six vegetables, including leafy vegetables (pakchoi [Brassica chinensis L.], spinach [Spinacia oleracea L.]), tuber vegetables (onion [Allium cepa L.]), shoot vegetables (water spinach [Ipomoea aquatica Forsk.], celery [Apium graveolens L.]), and root vegetables (carrot [Daucus carota var. sativa DC.]) were examined. Results showed that the concentrations of iodate in soil had significant effect on the biomass of edible parts of pakchoi and spinach (p<0.01), whereas the concentrations of iodate in soil had no significant effect on that of carrots, water spinach, celery, and onion. Iodine concentrations in edible parts of vegetables and the transfer factors (TFedible parts) of soil-to-edible parts of vegetables significantly increased with increasing iodine concentrations in soil (p<0.001), and iodine concentrations in edible parts and TFedible parts of spinach were much higher than those of other vegetables at any treatment. Both transfer coefficients for edible parts (TCedible parts) and for aerial parts (TCaerial parts) of vegetables changed differently with increasing iodine concentrations in the soil, and TCedible parts and TCaerial parts of spinach were higher than those of other vegetables. Therefore, spinach was considered as an efficient vegetable for iodine biofortification. Further experiment showed that there is considerable residual effect of soil fertilization with iodate. PMID:15564656

  15. Linalool Affects the Antimicrobial Efficacy of Essential Oils.

    Science.gov (United States)

    Herman, Anna; Tambor, Krzysztof; Herman, Andrzej

    2016-02-01

    The high concentrations of essential oils are generally required to receive microbial purity of the products (cosmetics, medicine). On the other hand, their application due to the high concentration of essential oils may be limited by changes in organoleptic and textural quality of the products, as well as they cause irritation and allergies in users. Addition of linalool to essential oil may significantly enhance its antimicrobial effectiveness and reduce their concentrations in products, taking advantage of their synergistic and additive effects. The aim of the study was to compare antimicrobial activity of essential oil alone and in combination with linalool. The antimicrobial activity of the essential oil of Thymus vulgaris, Juniperus communis, Pelargonium graveolens, Citrus bergamia, Citrus grandis, Lavandula angustifolia, Cinnamomum zeylanicum, Melaleuca alternifolia, Syzygium aromaticum, linalool and their combination was investigated against bacteria and fungi using the disc diffusion method. The addition of linalool to S. aromaticum oil in a synergistic manner enhanced its antimicrobial efficacy against P. aeruginosa and A. brasiliensis. Moreover, the additive interaction between this oil and linalool was observed against S. aureus, E. coli and C. albicans. It was also found that linalool in an additive manner increased the antimicrobial effectiveness of T. vulgaris oil against P. aeruginosa. The antimicrobial properties of mixture of essential oils with their active constituents may be used for creating new strategies to maintain microbiological purity of products. PMID:26553262

  16. Response of Listeria monocytogenes-inoculated leafy salad vegetables following irradiation and refrigerated storage under modified atmosphere. Section 1. Radiation sensitivity and quality of fresh cut vegetables exposed to gamma irradiation

    International Nuclear Information System (INIS)

    This section summarizes research on quality of irradiated vegetables. Thirteen fresh-cut (minimally processed) vegetables (broccoli (Brassica oleracea italica), cilantro (Coriandrum sativum), red cabbage (Brassica oleracea capitata), endive (Cichorium endivia), parsley (Petroselinum crispum), green and red leaf lettuce (L. sativa), Iceberg (Lactuca sativa var. capitata) and Romaine lettuce (Lactuca sativa), spinach (Spinacia oleracea), carrots (Daucus carota), green onions, (Allium cepa) and celery (Apium graveolens dulce) plus alfalfa sprouts (Medicago sativa) were gamma irradiated at doses up to 3 kGy at 0.5 kGy intervals. The samples were then stored in air at 4 deg. C for 14 days. At the beginning and end of 14 days, electrolyte leakage, visual quality, and sogginess were assessed. Results showed that electrolyte leakage of vegetables increased linearly with increasing radiation doses when measured immediately after irradiation. Radiation dose threshold, defined as the dose at which electrolyte leakage was significantly (P<0.05) increased, varied among vegetables, ranging from 2.44 kGy for broccoli to 0.60 kGy for carrots. Irradiation had no effect on visual quality on the day of irradiation. After 14 days of storage, the responses of individual vegetables to ionizing radiation varied greatly. Irradiation, especially at lower doses, improved visual quality, and reduced sogginess and electrolyte leakage of many vegetables. It appears that most tested vegetables can tolerate 0.6 kGy radiation based on appearance and electrolyte leakage measurements. The implication and limitation of the results are discussed. (author)

  17. Aspectos florísticos e ecológicos de grandes lianas em três ambientes florestais de terra firme na Amazônia Central Floristic and ecological aspects of large lianas from three forest environments on terra firme in Central Amazonia

    Directory of Open Access Journals (Sweden)

    Arlem Nascimento de Oliveira

    2008-01-01

    Full Text Available As lianas, ou trepadeiras lenhosas são importantes componentes estruturais de muitos ambientes florestais. O estudo objetivou investigar os aspectos florísticos e ecológicos de grandes lianas em três ambientes florestais de terra firme na Amazônia Central (2º35' S e 60º12' W. Para o levantamento florístico, foram alocadas 20 parcelas de 50 x 10 m em cada um dos ambientes florestais (platô, vertente e baixio, nas quais foram mensurados todos os espécimes lianescentes com diâmetro à altura do peito (DAP > 10 cm. Na floresta de platô foram inventariados 17 indivíduos, pertencentes a nove famílias, dez gêneros e treze espécies. Fabaceae e Combretaceae foram as famílias com maior número de espécies, representando juntas mais de 46% do total amostrado. As espécies com os maiores Índices de Valor de Importância (IVI foram Doliocarpus brevipedicellatus Garcke (IVI = 55,2 e Abuta candollei Triana & Planch. (IVI = 33,3. Um total de doze espécimes, compreendendo quatro famílias, quatro gêneros e oito espécies foram registrados na floresta de vertente. Nesse ambiente florestal, Caesalpiniaceae foi a família mais rica, representando cerca de 38% das espécies identificadas. Abuta rufescens Aubl. (IVI = 68,8 e Bauhinia alata Ducke (IVI = 49,2 foram as espécies com os maiores valores de importância. Na floresta de baixio foram registrados quatro indivíduos, distribuídos em quatro famílias, quatro gêneros e quatro espécies. Nos três ambientes florestais estudados, sete indivíduos atingiram DAP > 20 cm. Quanto às espécies, a similaridade florística entre os ambientes florestais foi muita baixa, com a menor dissimilidaridade anotada entre as florestas de vertente e baixio (Is = 0,17. Nesse estudo, de acordo com os índices de diversidade de Shannon-Wiener, Simpson e alfa de Fisher, a floresta de platô mostrou-se mais diversa em lianas de maior porte que as florestas de vertente, o mesmo ocorrendo quando comparado com os

  18. Effects of aquous and ethanolic extracts of vegetal species on seed germination of Brachiaria decumbens Stapf/ Ação de extratos aquoso e etanólico de espécies vegetais na germinação de sementes de Brachiaria decumbens Stapf

    Directory of Open Access Journals (Sweden)

    Ricardo Augusto Gorne Viani

    2002-05-01

    Full Text Available The objective of this study was to evaluate the effects of aquous and ethanolic extracts of medicinal species on seed germination of B. decumbens. The experimental design was completely randomized with 19 treatments (9 aquous extracts, 9 ethanolic extracts and a check was deionized water with 4 replicates. The species and organs used to obtain the extracts were Baccharis trimera (shoot, Baccharis articulata (shoot, Canna denudata (leaves, Cymbopogom citratus (leaves, Eucalyptus citriodora (leaves, Lippia alba (leaves and branches, Momordica charantia (leaves, branches, flowers, fruits and seeds, Ocimum gratissimum (leaves, branches and flowers e Ruta graveolens (leaves and branches. The extracts were obtained by aquous and ethanolic infusions in 10% and 1% concentration respectively. The seeds were treated with extracts for one hour and after this time sowed in plastic boxes. They were maintained in germination chamber (BOD with 16 hours of dark/20ºC and 8 hours of light/35ºC. The evaluation were made at 7Th and 21st days after seeding (DAS. The extraction methods affected seed germination. The use of aquous extract showed greater germination percentage than the ethanolic one at 7Th and 21st days. The evaluated extracts did not affect the seeds’ germination.O objetivo do experimento foi avaliar o efeito dos extratos aquoso e etanólico de espécies medicinais sobre germinação de sementes de B. decumbens. O delineamento experimental foi inteiramente casualizado com 19 tratamentos (9 extratos aquosos, 9 extratos etanólicos e 1 testemunha com água deionizada com quatro repetições. As espécies e as partes das plantas utilizadas para a obtenção dos extratos foram Baccharis trimera (caule, Baccharis articulata (caule, Canna denudata (folhas, Cymbopogom citratus (folhas, Eucalyptus citriodora (folhas, Lippia alba (folhas e ramos, Momordica charantia (folhas, ramos, flores, frutos e sementes, Ocimum gratissimum (folhas, ramos e flores e

  19. Evaluation of plant aqueous extracts, added into the soil, on Meloidogyne javanica (Treub, 1885 Chitwood, 1949 / Avaliação de extratos aquosos de várias espécies vegetais, aplicados ao solo, sobre Meloidogyne javanica (Treub, 1885 Chitwood, 1949

    Directory of Open Access Journals (Sweden)

    Leandro Grassi de Freitas

    2009-10-01

    Full Text Available The use of plant extracts with nematicidal properties to control plant nematodes can be a useful alternative to small farmers, regarding its low cost and non-toxic effects. The effect of the addition into the soil of aqueous extracts of 20 plant species on Meloidogyne javanica in plants of tomato was studied at greenhouse conditions. These were divided into two groups and evaluated in two separate experiments.The soil in the 2.0 L pots was infested with 5,000 eggs and, in the same day, it was applied 20 mL of aqueous extracts of the 20 plant species (Chrysanthemum parthenium, Arctium lappa, Cymbopogon citratus, Bacharis trimera, Equisetum sp., Melia azedarach, Mentha sp., Ricinus communis, Ocimum basilicum, Momordica charantia, Ruta graveolens, Coleus barbatus, Symphitum officinalis, Polygonum acre, Canavalia ensiformis, Foeniculum vulgare, Petiveria alliacea, Ageratum conyzoides, Mucuna pruriens and Azadirachta indica. Distilled water was used as control. Sixty days later, were evaluated for plant height, the fresh weight of shoot and root and the numbers of galls and eggs per root system. The extracts of Mentha sp., Arctium lappa and Ricinus communis reduced the number of galls of M. javanica in 75.6%; 65.7% and 54.4%; and the number of eggs in 81.7%, 75.9% and 56.6%, respectively.O uso de extratos vegetais com propriedades nematicidas no controle de fitonematóides representa mais uma alternativa para os pequenos produtores, com valor prático e econômico, e sem riscos de contaminação do ambiente. A adição ao solo dos extratos aquosos de 20 espécies de plantas foi avaliada sobre a população de Meloidogyne javanica em plantas de tomateiro, em casa de vegetação. Estas foram divididas em dois grupos e avaliadas em dois experimentos separados. No mesmo dia em que se infestou o solo com 5.000 ovos do nematóide, adicionou-se 20 mL dos extratos aquosos obtidos de folhas de artemísia (Chrysanthemum parthenium, bardana (Arctium lappa

  20. Evaluación de extractos de fique, coquito, sorgo y ruda como posibles bio-herbicidas Evaluation of cuban hemp, nut sedge, johnson grass and herb of grace extracts in weed control

    Directory of Open Access Journals (Sweden)

    Liliana Osorio Salazar

    2009-04-01

    Full Text Available En experimentos completamente al azar en condiciones de laboratorio y campo, en Palmira, Valle del Cauca, se evaluó el efecto de extractos de Macrophylla furcraea Baker (fique, Cyperus rotundus L (coquito, Sorghum bicolor L (sorgo, y Ruta graveolens L (ruda sobre la germinación de semillas de las arvenses Bidens pilosa L (papunga y Amaranthus dubius Mart (bledo y del cilantro Coriandrum sativum L. Se obtuvieron los extractos por el método Soxhlet, utilizando agua, etanol y cloroformo como solventes. Los extractos obtenidos se evaluaron en tres diluciones (0, 5 y 10 % en pruebas de germinación de semillas de las arvenses y del cultivo. Se emplearon tres repeticiones de 50 semillas cada una y el testigo se regó con agua destilada. Los extractos etanólicos y clorofórmicos de coquito y fique en las diluciones al 5 y 10 % presentaron el mayor efecto inhibitorio en la germinación a los 21 días. El ensayo de campo demostró el efecto inhibitorio de los extractos etanólicos de fique y coquito en la emergencia de las semillas del cilantro. El análisis de metabolitos secundarios comprobó la presencia de compuestos reportados como altamente tóxicos en fique y en menor cantidad en coquito, aunque los extractos de éste fueron los que más inhibieron la germinación.The objective of this work was to evaluate the effect of the extracts of the species Macrophylla furcraea Baker (cuban hemp, Cyperus rotundus L (nut sedge, Sorghum bicolor L (johnson grass and Ruta graveolens L (herb of grace on seed germination of two weeds and one crop. The extracts were obtained by the Soxhlet method, using water, ethanol and chloroform as solvents. Each extract was evaluated in three dilutions (0, 5 and 10 % v/v and was applied to Bidens pilosa L (spanish needle, Amaranthus dubius Mart (spleen amaranth and Coriandrum sativum L (coriander seeds. Three replications of 50 seeds each one were used and the control was watered only with destilled water. The results

  1. Atividade antifúngica de extratos de plantas a Colletotrichum gloeosporioides = Antifungal activity of plant extracts to Colletotrichum gloeosporioides

    Directory of Open Access Journals (Sweden)

    Mercia Ikarugi Bomfim Celoto

    2008-01-01

    Full Text Available O presente trabalho teve como objetivo avaliar o efeito fungitóxico de extratos vegetais sobre o crescimento micelial e a germinação de esporos de Colletotrichum gloeosporioides. Os extratos foram obtidos a partir de plantas secas e moídas, utilizando-se água e etanol como meio extrator. Foram utilizadas 22 espécies de plantas para a obtençãodos extratos. Os extratos foram avaliados por meio da incorporação de 20% do extrato em meio BDA, antes ou após a autoclavagem do mesmo. Determinou-se a percentagem de inibição do crescimento micelial (PIC. Utilizando-se extrato na proporção de 50% e suspensão de esporos, determinou-se a percentagem de inibição da germinação de esporos (PIG. Verificou-se que os extratos hidroetanólicos proporcionaram maior PIC de C. gloeosporioides, enquanto maior PIG foi obtido com os extratos aquosos. Extratos não autoclavados foram mais eficientes na redução do crescimento micelial de C. gloeosporioides que os extratos autoclavados. Os extratos aquoso e hidroetanólico de melão-de-são-caetano e extrato hidroetanólico de eucalipto proporcionaram maiores PIC. Os extratos aquosos deLuffa acutangula, Eucalyptus citriodora, Chenopodium ambrosioides e Bauhinia, e os extratos hidroetanólicos de Ruta graveolens, Eucalyptus citriodora, Zingiber officinale e Chenopodiumambrosioides inibiram mais de 90% da germinação de esporos.The present work aimed to evaluate the effect fungitoxic of plant extracts on the mycelial growth and on the spores germination of C. gloeosporioides. The plant extracts were obtained starting from dried ground plants, using water and ethilic alcohol as extractor. Twenty-two plant species were used to obtain the extracts. The extracts were tested by means of the incorporation of 20% (v/v in PDA medium, before or after sterilization. The percentage ofinhibition of the mycelial growth (PIM was determined. Extract in the proportion of 50% was added to a spore suspension used to

  2. Fitossociologia de um trecho da mata ciliar do rio da Prata, Jardim, MS, Brasil Phythossociologic along a riparian forest at rio da Prata, Jardim, Mato Grosso do Sul State, Brazil

    Directory of Open Access Journals (Sweden)

    Joanice Lube Battilani

    2005-09-01

    Full Text Available O presente estudo teve como objetivos descrever a riqueza e a diversidade em espécies e analisar os aspectos fitossociológicos de um trecho da mata ciliar do rio da Prata, localizado na Fazenda Nossa Senhora Aparecida no município de Jardim, MS. Seis transectos de 150 m cada foram distribuídos aleatoriamente perpendiculares à margem do rio e subdivididos em 90 parcelas de 10 m×10 m. Em cada parcela foram amostrados todos os indivíduos com diâmetro à 1,30 m de altura do solo (DAP > 3,18 cm, totalizando 661 indivíduos pertencentes a 33 famílias, 57 gêneros e 66 espécies. As famílias Meliaceae, Mimosaceae, Sapindaceae, Euphorbiaceae, Fabaceae, Myrtaceae e Rutaceae destacaramse pelo elevado número de espécies. Myrcianthes pungens (O. Berg D. Legrand, Adelia membranifolia (Müll. Arg. Chodat & Hassl., Dalbergia sp., Holocalyx balansae Micheli, Unonopsis lindmanii R.E. Fr., Guarea kunthiana A. Juss., Trichilia claussenii C. DC., Guarea guidonea (L. Sleumer, Averrhoidium paraguaiense Radlk.e Astronium graveolens Jacq. foram as espécies de maior valor de importância. O índice de diversidade de Shannon (H' obtido foi 3,413 nats/indivíduo e a eqüabilidade (J' foi 0,815. A densidade e a área basal estimada foi 734,44 indivíduos/ha e 21,32 m²/ha respectivamente. Os resultados obtidos neste trabalho reforçam a necessidade de preservação da mata ciliar do rio da Prata e são de extrema importância para subsidiar projetos de manejo e recomposição nestas formações.The present study describes species richness and diversity, and analyses phythossociologic aspects of a riparian forest at Rio da Prata, Jardim district, Mato Grosso do Sul State, Brazil. The phytosociological study was carried out on six 150 m transects perpendicular to the river subdivided in 90 quadrats (10 m×10 m. All trees and shrubs with a minimum of 3,18 cm diameter at breast height were recorded, totalizing 661 individuals of 33 families, 57 genera and 66

  3. Examining food additives and spices for their anti-oxidant ability to counteract oxidative damage due to chronic exposure to free radicals from environmental pollutants

    Science.gov (United States)

    Martinez, Raul A., III

    The main objective of this work was to examine food additives and spices (from the Apiaceae family) to determine their antioxidant properties to counteract oxidative stress (damage) caused by Environmental pollutants. Environmental pollutants generate Reactive Oxygen species and Reactive Nitrogen species. Star anise essential oil showed lower antioxidant activity than extracts using DPPH scavenging. Dill Seed -- Anethum Graveolens -the monoterpene components of dill showed to activate the enzyme glutathione-S-transferase , which helped attach the antioxidant molecule glutathione to oxidized molecules that would otherwise do damage in the body. The antioxidant activity of extracts of dill was comparable with ascorbic acid, alpha-tocopherol, and quercetin in in-vitro systems. Black Cumin -- Nigella Sativa: was evaluated the method 1,1-diphenyl2-picrylhhydrazyl (DPPH) radical scavenging activity. Positive correlations were found between the total phenolic content in the black cumin extracts and their antioxidant activities. Caraway -- Carum Carvi: The antioxidant activity was evaluated by the scavenging effects of 1,1'-diphenyl-2-picrylhydrazyl (DPPH). Caraway showed strong antioxidant activity. Cumin -- Cuminum Cyminum - the major polyphenolic were extracted and separated by HPTLC. The antioxidant activity of the cumin extract was tested on 1,1'-diphenyl-2- picrylhydrazyl (DPPH) free radical scavenging. Coriander -- Coriandrum Sativum - the antioxidant and free-radical-scavenging property of the seeds was studied and also investigated whether the administration of seeds curtails oxidative stress. Coriander seed powder not only inhibited the process of Peroxidative damage, but also significantly reactivated the antioxidant enzymes and antioxidant levels. The seeds also showed scavenging activity against superoxides and hydroxyl radicals. The total polyphenolic content of the seeds was found to be 12.2 galic acid equivalents (GAE)/g while the total flavonoid content

  4. Repelência e deterrência na oviposição de Bemisia tabaci biótipo B pelo uso de extratos vegetais em Cucurbita pepo L Repellence and deterrence on oviposition of Bemisia tabaci biotype B by the use of vegetal extracts in Cucurbita pepo L

    Directory of Open Access Journals (Sweden)

    J.P.G.F. Silva

    2012-01-01

    Full Text Available Bemisia tabaci biótipo B é um dos principais insetos-praga na cultura da abobrinha (Cucurbita pepo L.. O manejo dessa mosca-branca tornou-se grande desafio aos agricultores, uma vez que esta apresenta rápida capacidade de desenvolver resistência a diferentes classes de inseticidas. Como alternativa vem sendo investigado o uso de extratos vegetais com atividades inseticida e/ou insetistática, os quais têm revelado resultados promissores no combate a inseto. O presente trabalho teve por objetivo avaliar os possíveis efeitos de sete extratos provenientes de cinco espécies vegetais, Ruta graveolens L. (folhas, Azadirachta indica A. Juss. (folhas + ramos, Trichilia pallida Swartz (ramos, T. pallida (folhas, A. indica (amêndoas, Chenopodium ambrosioides L. (inflorescências + ramos+ folhas e Mentha pulegium L. (folhas, sobre Bemisia tabaci biótipo B em abobrinha, por meio de testes de repelência e deterrência para oviposição. Em teste com chance de escolha, avaliou-se a atratividade e determinou-se o índice de repelência após 6, 24 e 48 horas da aplicação dos extratos. A oviposição foi verificada após a terceira contagem do número de adultos. O extrato à base de folhas de M. pulegium mostrou repelência e deterrência à oviposição de B. tabaci biótipo B, podendo ser recomendado como alternativa para o manejo do inseto.Bemisia tabaci biotype B is one of the main pests in squash (Cucurbita pepo L.. The management of this whitefly has become a major challenge to growers, since they have the ability to quickly develop resistance to different classes of insecticides. Alternatively, the use of plant extracts with insecticide and/or insectistatic activities has been investigated, showing promising results for the whitefly control. The present study evaluated the possible effects of seven extracts from five plant species, Ruta graveolens L. (leaves, Azadirachta indica A. Juss. (leaves + branches, Trichilia pallida Swartz (branches

  5. Atividade antimicrobiana de óleos essenciais de condimentos frente a amostras de Escherichia coli isoladas de aves e bovinos Antimicrobial activity of spice essential oils against Escherichia coli strains isolated from poultry and cattle

    Directory of Open Access Journals (Sweden)

    Deise Flores Santurio

    2011-06-01

    Full Text Available A discutida questão da substituição do uso de antibacterianos em rações (promotores de crescimento requer urgentes alternativas. Face às necessidades de inibidores microbianos nesses alimentos, os óleos essenciais (OES se constituem em alternativa, sob avaliação. Neste estudo, avaliou-se a atividade antimicrobiana dos OES de Origanum vulgare (orégano, Thymus vulgaris (tomilho, Cinnamomum zeylanicum (canela, Lippia graveolens (orégano mexicano, Zingiber officinale (gengibre, Salvia officinalis (sálvia, Rosmarinus officinalis (alecrim e Ocimum basilicum (manjericão frente a amostras de Escherichia coli isoladas de fezes de aves (n=43 e de bovinos (n=36. A concentração inibitória mínima (CIM e a concentração bactericida mínima (CBM foram determinadas para cada isolado através da técnica de microdiluição em caldo, a partir da máxima concentração de 6400µg mL-1 de cada OE testado. Observou-se atividade antimicrobiana para os OES de orégano, orégano mexicano, tomilho, canela. Para todas as amostras testadas, independente de sua origem, os OES mais e menos efetivos quanto à atividade antimicrobiana foram o orégano e a canela, respectivamente. Esses resultados confirmaram o potencial antibacteriano de alguns OES, os quais merecem novas investigações abordando sua adição na alimentação de aves e bovinos.The discussed issue about replacing the use of antibiotics in animal feed (growth promoters requires emerging alternatives. To meet the needs of microbial inhibitors in these foods, the essentials oils (EOS constitute potential alternatives under evaluation. In this study it was evaluated the antimicrobial activities of EOs from Oreganum vulgare (oregano, Thymus vulgaris (thyme, Lippia graveolens (Mexican oregano, Cinnamomum zeylanicum (cinnamon, Zingiber officinale (ginger, Salvia officinalis (sage, Rosmarinus officinalis (rosemary and Ocimum basilicum (basil against Escherichia coli strains isolated from poultry (n

  6. Florística e estrutura da comunidade arbórea de um remanescente florestal ripário no município de Guariba, Estado de São Paulo, Brasil. Floristic and structure of the arboreal community of riparian forest remain at Guariba municipality, São Paulo State, Brazil.

    Directory of Open Access Journals (Sweden)

    Nicole Maria Marson DONADIO

    2009-06-01

    Full Text Available O conhecimento sobre a composição eestrutura de comunidades florestais é fundamentalpara embasar ações de conservação e restauração.O objetivo deste trabalho foi realizar olevantamento florístico e descrever a estrutura dacomunidade arbórea de um remanescente florestallocalizado no município de Guariba, Estado de SãoPaulo. Foram alocadas 30 parcelas de 10 x 10 m,para amostrar os indivíduos arbóreos e arbustivoscom diâmetro à altura do peito (DAP ³ 5 cm.Foram encontradas 54 espécies, pertencentes a 47gêneros, distribuídos em 32 famílias botânicas,com índice de diversidade (H’ de 2,67 eequabilidade (J de 0,20. As famílias Meliaceae eFabaceae apresentaram maior riqueza em espécies.Calophyllum brasiliensis, Astronium graveolens,Scheffera morototoni, Xylopia aromatica eProtium widgrenii destacaram-se como as espéciesde maior valor de importância. Foram amostrados420 indivíduos. A presença de espécies do cerradosugere condição de ecótono e a dominância de umaespécie higrófila indica saturação hídrica em parteda área. A distribuição dos indivíduos em classesde tamanho revelou uma comunidade emregeneração com a maioria dos indivíduos com até15,0 cm de DAP e distribuídos entre 7 e 14,9 m,e com estoques de jovens tanto das espéciespioneiras como secundárias podendo garantir ofuturo da comunidade. Em termos sucessionais aárea estudada encontra-se em estádio de médiopara avançado.Knowledge of the composition andstructure of arboreal communities is paramount forconservation and restoration efforts. The mainobjectives of this study were to characterize thearboreal species floristic composition and describethe structure of the arboreal community of aremaining forest located at the municipality ofGuariba, State of São Paulo. Thirty plots of 10 x 10 mwere allocated. In each plot, diameter and heightwere measured for each individual tree withdiameter at breast height (dbh ³ 5 cm. Fifty-fourspecies were

  7. Plant compounds insecticide activity against Coleoptera pests of stored products Compostos de plantas com atividade inseticida a coleópteros-praga de produtos armazenados

    Directory of Open Access Journals (Sweden)

    Márcio Dionizio Moreira

    2007-07-01

    Full Text Available The objective of this work was to screen plants with insecticide activity, in order to isolate, identify and assess the bioactivity of insecticide compounds present in these plants, against Coleoptera pests of stored products: Oryzaephilus surinamensis L. (Silvanidae, Rhyzopertha dominica F. (Bostrichidae and Sitophilus zeamais Mots. (Curculionidae. The plant species used were: basil (Ocimum selloi Benth., rue (Ruta graveolens L., lion's ear (Leonotis nepetifolia (L. R.Br., jimson weed (Datura stramonium L., baleeira herb (Cordia verbenacea L., mint (Mentha piperita L., wild balsam apple (Mormodica charantia L., and billy goat weed or mentrasto (Ageratum conyzoides L.. The insecticide activity of hexane and ethanol extracts from those plants on R. dominica was evaluated. Among them, only hexane extract of A. conyzoides showed insecticide activity; the hexane extract of this species was successively fractionated by silica gel column chromatography, for isolation and purification of the active compounds. Compounds 5,6,7,8,3',4',5'-heptamethoxyflavone; 5,6,7,8,3'-pentamethoxy-4',5'-methilenedioxyflavone and coumarin were identified. However, only coumarin showed insecticide activity against three insect pests (LD50 from 2.72 to 39.71 mg g-1 a.i.. The increasing order of insects susceptibility to coumarin was R. dominica, S. zeamais and O. surinamensis.O objetivo deste trabalho foi selecionar plantas com atividade inseticida, para isolar, identificar e avaliar a bioatividade de compostos inseticidas presentes nessas plantas, contra as seguintes pragas de produtos armazenados da ordem Coleoptera: Sitophilus zeamais Mots. (Curculionidae, Rhyzopertha dominica F. (Bostrichidae e Oryzaephilus surinamensis L. (Silvanidae. As espécies de plantas usadas foram: anis (Ocimum selloi Benth, arruda (Ruta graveolens L., cordão-de-frade (Leonotis nepetifolia L., datura (Datura stramonium L., erva baleeira (Cordia verbenacea L., hortelã (Mentha piperita L., mel

  8. Controle de mosca-branca com extratos vegetais, em tomateiro cultivado em casa-de-vegetação Use of plant extracts on whitefly control in tomato grown in greenhouse

    Directory of Open Access Journals (Sweden)

    Edson LL Baldin

    2007-12-01

    Full Text Available Visando buscar métodos alternativos no controle da mosca-branca Bemisia tabaci (Gennadius biótipo B em tomateiro, foram realizados testes de atratividade e preferência para oviposição em casa-de-vegetação, utilizando-se quatorze extratos aquosos a 3% (peso/volume. Os extratos foram preparados com partes de Azadirachta indica, Trichilia pallida,Chenopodium ambrosioides,Piper nigrum,Melia azedarach,Ruta graveolens,Ricinus communis,Mentha pulegium,Tagetes erecta,Eucalyptus citriodora,Cymbopogon nardus e Coriandrum sativum. Numa segunda etapa, os extratos mais eficientes em casa-de-vegetação foram observados em laboratório, a fim de avaliar o possível efeito sistêmico dos mesmos sobre ninfas da mosca-branca. Constatou-se que as plantas de tomateiro pulverizadas com extratos à base de folhas de M. pulegium e folhas e sementes de A. indica foram menos atrativas aos adultos do inseto. Plantas pulverizadas com extratos de folhas de A. indica e folhas + ramos de R. communis mostraram efeitos deterrentes à oviposição do inseto, reduzindo o número de ovos; em contrapartida, o extrato à base de folhas de C. nardus estimulou a oviposição da mosca-branca sobre as plantas. O uso dos extratos por via sistêmica não afetou o período de desenvolvimento (ovo-adulto da mosca-branca; entretanto, a presença de extratos de sementes e folhas de A. indica e de folhas de M. pulegium provocou aumento significativo na mortalidade de ninfas de B. tabaci biótipo B.Looking for alternative methods of control to silverleaf whitefly Bemisia tabaci (Gennadius biotype B in tomato, attractiveness and oviposition preference tests were accomplished in greenhouse using fourteen aqueous extracts at 3% (weight/volume. The extracts were prepared with parts from Azadirachta indica,Trichilia pallida,Chenopodium ambrosioides,Piper nigrum,Melia azedarach,Ruta graveolens,Ricinus communis,Mentha pulegium,Tagetes erecta,Eucalyptus citriodora, Cymbopogon nardus and

  9. Medicinal plants with hepatoprotective activity in Iranian folk medicine

    Institute of Scientific and Technical Information of China (English)

    Majid; Asadi-Samani; Najme; Kafash-Farkhad; Nafiseh; Azimi; Ali; Fasihi; Ebrahim; Alinia-Ahandani; Mahmoud; Rafieian-Kopaei

    2015-01-01

    There are a number of medicinal combinations in the Iranian traditional medicine which are commonly used as tonic for liver.In this review,we have introduced some medicinal plants that are used mainly for the treatment of liver disorders in Iranian folk medicine,with focus on their hepatoprotective effects particularly against CCI4 agent.In this study,online databases including Web of Science.PubMed.Scopus,and Science Direct were searched for papers published from January 1970 to December 2013.Search terms consisted of medicinal plants,traditional medicine,folk medicine,hepatoprotective.Iran,liver,therapeutic uses,compounds,antioxidant.CCI4.anti-inflammatory,and antihepatotoxic,hepatitis,alone or in combination.Allium hirtifolium Boiss..Apium graveolens L..Cynara scolyinus.Berberis vulgaris L..,Calendula officinalis,Nigella sativa L..Taraxacum officinale.Tragopogon porrifolius.Prangos ferulacea L..Allium sativum,Marribium vulgare,Ammi majus L..Citrullus lanatus Thunb.Agrimonia eupatoria L.and Primus armeniaca L.are some of the medicinal plants that have been used for the treatment of liver disorders in Iranian folk medicine.Out of several leads obtained from plants containing potential hepatoprotective agents,silymarin,P-sitosterol,betalain,neoandrographolide.phyllanthin.andrographolide.curcumin.picroside.hypophyllanlhin.kutkoside,and glycyrrhizin have been demonstrated to have potent hepatoprotective properties.Despite encouraging data on possibility of new discoveries in the near future,the evidence on treating viral hepatitis or other chronic liver diseases by herbal medications is not adequate.

  10. Activity of essential oils and individual components against acetyl- and butyrylcholinesterase.

    Science.gov (United States)

    Orhan, Ilkay; Kartal, Murat; Kan, Yüksel; Sener, Bilge

    2008-01-01

    We have tested acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) inhibitory activities of nineteen essential oils obtained from cultivated plants, namely one from Anethum graveolens L. (organic fertilizer), two from Foeniculum vulgare Mill. collected at fully-mature and flowering stages (organic fertilizer), two from Melissa officinalis L. (cultivated using organic and chemical fertilizers), two from Mentha piperita L. and M. spicata L. (organic fertilizer), two from Lavandula officinalis Chaix ex Villars (cultivated using organic and chemical fertilizers), two from Ocimum basilicum L. (green and purple-leaf varieties cultivated using only organic fertilizer), four from Origanum onites L., O. vulgare L., O. munitiflorum Hausskn., and O. majorana L. (cultivated using organic fertilizer), two from Salvia sclarea L. (organic and chemical fertilizers), one from S. officinalis L. (organic fertilizer), and one from Satureja cuneifolia Ten. (organic fertilizer) by a spectrophotometric method of Ellman using ELISA microplate-reader at 1 mg/ml concentration. In addition, a number of single components widely encountered in most of the essential oils [gamma-terpinene, 4-allyl anisole, (-)-carvone, dihydrocarvone, (-)-phencone, cuminyl alcohol, cumol, 4-isopropyl benzaldehyde, trans-anethole, camphene, iso-borneol, (-)-borneol, L-bornyl acetate, 2-decanol, 2-heptanol, methyl-heptanol, farnesol, nerol, iso-pulegol, 1,8-cineole, citral, citronellal, citronellol, geraniol, linalool, alpha-pinene, beta-pinene, piperitone, iso-menthone, menthofurane, linalyl oxide, linalyl ester, geranyl ester, carvacrol, thymol, menthol, vanilline, and eugenol] was also screened for the same activity in the same manner. Almost all of the essential oils showed a very high inhibitory activity (over 80%) against both enzymes, whereas the single components were not as active as the essential oils. PMID:18810999

  11. Evaluación de extractos de fique, coquito, sorgo y ruda como posibles bio-herbicidas

    Directory of Open Access Journals (Sweden)

    Mier Barona Carmen Elena

    2009-06-01

    Full Text Available En experimentos completamente al azar en condiciones de laboratorio y campo, en Palmira, Valle del Cauca, se evaluó el efecto de extractos de Macrophylla furcraea Baker (fique, Cyperus rotundus L (coquito, Sorghum bicolor L (sorgo, y Ruta graveolens L (ruda sobre la germinación de semillas de las arvenses Bidens pilosa L (papunga y Amaranthus dubius Mart (bledo y del cilantro Coriandrum sativum L. Se obtuvieron los extractos por el método Soxhlet, utilizando agua, etanol y cloroformo como solventes. Los extractos obtenidos se evaluaron en tres diluciones (0, 5 y 10 % en pruebas de germinación de semillas de las arvenses y del cultivo. Se emplearon tres repeticiones de 50 semillas cada una y el testigo se regó con agua destilada. Los extractos etanólicos y clorofórmicos de coquito y fique en las diluciones al 5 y 10 % presentaron el mayor efecto inhibitorio en la germinación a los 21 días. El ensayo de campo demostró el efecto inhibitorio de los extractos etanólicos de fique y coquito en la emergencia de las semillas del cilantro. El análisis de metabolitos secundarios comprobó la presencia de compuestos reportados como altamente tóxicos en fique y en menor cantidad en coquito, aunque los extractos de éste fueron los que más inhibieron la germinación.

  12. Perfil dos consumidores de plantas medicinais e condimentares do município de Pato Branco (PR The profile of consumers medicinal plants and spices of Pato Branco city, Paraná State, Brazil

    Directory of Open Access Journals (Sweden)

    José Abramo Marchese

    2004-06-01

    Full Text Available Diagnosticou-se o perfil dos consumidores de supermercados em Pato Branco (PR, com relação às suas preferências pelas plantas medicinais e condimentares, como subsídio à produção por pequenos produtores rurais. Os consumidores preferem produtos orgânicos, observam a aparência e o preço do produto, e vão ao mercado uma vez por semana, preferencialmente aos sábados. As dez plantas medicinais preferidas, em ordem decrescente, são camomila, anis, boldo, carqueja, guaco, malva, poejo, espinheira-santa, menta e sálvia. As dez plantas condimentares preferidas, em ordem decrescente, são cebola, cravo, canela, orégano, alho, nóz-moscada, pimentão, cebolinha, endro e salsinha.The profile of supermarket users in Pato Branco city, Paraná State, Brazil, was obtained, related to their preference for medicinal and spice plants, as a subsidy to production by small farmers. The consumers prefer organic products observing the appearance and price of the product, and they go once a week to the market, preferably on Saturdays. The ten favorite medicinal plants are Chamomilla recutita, Pimpinella anisum, Vernonia condensata, Baccharis sp., Mikania sp., Malva sp., Cunilla sp., Maytenus sp., Mentha sp. and Salvia officinalis. The ten favorite spices are: Allium cepa, Eugenia caryophyllata, Cinnamomum zeylanicum, Origanum vulgaris, Allium sativum, Myristicia fragans, Capsicum annuum, Allium schoenoprasum, Anethum graveolens and Petroselinum crispum.

  13. Combined HPLC-CUPRAC (cupric ion reducing antioxidant capacity) assay of parsley, celery leaves, and nettle.

    Science.gov (United States)

    Yildiz, Leyla; Başkan, Kevser Sözgen; Tütem, Esma; Apak, Reşat

    2008-10-19

    This study aims to identify the essential antioxidant compounds present in parsley (Petroselinum sativum) and celery (Apium graveolens) leaves belonging to the Umbelliferae (Apiaceae) family, and in stinging nettle (Urtica dioica) belonging to Urticaceae family, to measure the total antioxidant capacity (TAC) of these compounds with CUPRAC (cupric ion reducing antioxidant capacity) and ABTS spectrophotometric methods, and to correlate the TAC with high performance liquid chromatography (HPLC) findings. The CUPRAC spectrophotometric method of TAC assay using copper(II)-neocuproine (2,9-dimethyl-1,10-phenanthroline) as the chromogenic oxidant was developed in our laboratories. The individual antioxidant constituents of plant extracts were identified and quantified by HPLC on a C18 column using a modified mobile phase of gradient elution comprised of MeOH-0.2% o-phosphoric acid and UV detection for polyphenols at 280 nm. The TAC values of HPLC-quantified antioxidant constituents were found, and compared for the first time with those found by CUPRAC. The TAC of HPLC-quantified compounds accounted for a relatively high percentage of the observed CUPRAC capacities of plant extracts, namely 81% of nettle, 60-77% of parsley (in different hydrolyzates of extract and solid sample), and 41-57% of celery leaves (in different hydrolyzates). The CUPRAC total capacities of the 70% MeOH extracts of studied plants (in the units of mmol trolox g(-1)plant) were in the order: celery leaves>nettle>parsley. The TAC calculated with the aid of HPLC-spectrophotometry did not compensate for 100% of the CUPRAC total capacities, because all flavonoid glycosides subjected to hydrolysis were either not detectable with HPLC, or not converted to the corresponding aglycons (i.e., easily detectable and quantifiable with HPLC) during the hydrolysis step. PMID:18804638

  14. Synthesis of L-ascorbic acid in the phloem

    Directory of Open Access Journals (Sweden)

    Haupt Sophie

    2003-11-01

    Full Text Available Abstract Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone. Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs.

  15. The ecological aspect of ethnobotany and ethnopharmacology of population in Bosnia and Herzegovina.

    Science.gov (United States)

    Redzić, Sulejman S

    2007-09-01

    This paper contains first systematical revision of the results on traditional use of wild medicinal and aromatic herbs on the territory of Bosnia and Herzegovina (B&H)--west of Balkan Peninsula; Southeast of Europe. There have been detected 227 plants belonging to 71 different plant families, which are being used with ethno therapeutic purpose. Results were obtained by method of open ethno botanical interview which comprised 150 persons, whose average age was 63. Medicinal plants in ethno therapy are being used either in fresh, raw or dried condition. Different herbal parts, depending on period of vegetation season, sometimes even in winter, are basis for preparation of infusions (59%), decoct (19%), tinctures (4%). Especially original are balms known as Bosnian "mehlems", which are fresh cuted herbal parts mixed with lukewarm resin, raw cow butter or honey. In ethno therapy are mostly being used aerial plant organs. Majority of herbs is being used for treatment of illnesses of respiratory (22%), gastrointestinal (19%) and urinary and genital system (9%), for treatment of skin conditions (11%), as well as for nervous system and heart diseases (16%). The most original plants on the field of ethno pharmacology, comparing with ethno therapy practice of other regions, are as follows: Ballota nigra, Aesculus hippocastanum, Calluna vulgaris, Centaurea cyanus, Euphrasia rostkoviana, Geranium robertianum, Gentiana asclepiadea, Helichrysum italicum, Lycopodium clavatum, Marrubium vulgare, Nepeta cataria, Populus tremula, Ruta graveolens, Tamus communis, Teucrium montanum, T. chamaedrys, and endemic plants Gentiana lutea subsp. symphyandra, Teucrium arduini, Micromeria thymifolia, Satureja montana, S. subspicata, Rhamnus fallax and Viola elegantula. There haven't been noticed significant differences in the frequencies of medicinal plants use among different ethnical groups. But, it has been perceived that longer ethno therapeutic tradition possess inhabitants of sub- and

  16. Estudio de la flora y la vegetaciòn del bosque en la estaciòn de primates Coloso-Sucre

    Directory of Open Access Journals (Sweden)

    Fernández Alonso José Luis

    2003-06-01

    Full Text Available El estudio se realizó en Coloso, Sucre, en la planicie del litoral Caribe, se efectuaron muestreos enla zona del arroyo el “Sereno” de la estación de primates. Se realizaron 14 levantamientos,utilizando el método de parcela y subparcelas, de 50 x 10 m2. Se censaron indivuidos con DAP =10 cm. La vegetación del sector “arroyo Sereno” fitosociológicamente se agrupa en la alianzaPoulsenio armatae- Anacardion excelsi, entre cuyas especies características también figuran: Achrasexcelsi, Brownea ariza, Brosimun guianense, Samanea saman, Pachira acuatica, Erythroxylumamazonicum y Aspidosperma spegazzinii. Comprende las asociaciones Ocoteo glomeratae- Spondietum mombinis entrecuyas especies características figuran: Ficus gigantea, Ocotea glomerata, Platymiscium pinnatumy Xylopiagrandifloray Astronio graveolentis- Guazumetum ulmifoliaecon Pseudobombax septenatum, Trichiliaacuminatay Stemmadenia grandiflora. Las especies con mayores valores de IVI (Índice de valor de im-portancia e IPF (Índice de predominio fisiónomico son Anacardium excelsum, Pulsenia armata,Spondias mombin, Ocotea glomerata, Astronium graveolensy Guazuma ulmifolia.En los censos se encon-traron 38 familias y 80 especies entre las cuales se destacan por número de género y especies Leguminosae, Bombacaceae, Anacardiaceae, Annonaceae, Apocynaceae, Bignoniaceae. Entre los génerosmás diversificados figuran Xylopia(Anonaceae, Aspidosperma (Apocynaceae y Bombax, Cavanillesia,Ciebas, Pseudobombax (Bombacaceae. En general los tipos de vegetación que se encontrarontambién se distribuyen en localidades de la región tropical de los valles del Magdalena y del Caucaconstituyendo una formación vegetal definida por el dominio de especies como Guazuma ulmifolia,Astronium graveolens, Spondias mombin, Anacardium occidentalisy especies de Tabebuia.

  17. Nanostructured lipid system as a strategy to improve the anti-Candida albicans activity of Astronium sp.

    Science.gov (United States)

    Bonifácio, Bruna Vidal; Ramos, Matheus Aparecido dos Santos; da Silva, Patrícia Bento; Negri, Kamila Maria Silveira; de Oliveira Lopes, Érica; de Souza, Leonardo Perez; Vilegas, Wagner; Pavan, Fernando Rogério; Chorilli, Marlus; Bauab, Taís Maria

    2015-01-01

    The genus Astronium (Anacardiaceae) includes species, such as Astronium fraxinifolium, Astronium graveolens, and Astronium urundeuva, which possess anti-inflammatory, anti-ulcerogenic, healing, and antimicrobial properties. Nanostructured lipid systems are able to potentiate the action of plant extracts, reducing the required dose and side effects and improving antimicrobial activity. This work aims to evaluate a nanostructured lipid system that was developed as a strategy to improve the anti-Candida albicans activity of hydroethanolic extracts of stems and leaves from Astronium sp. The antifungal activity against C. albicans (ATCC 18804) was evaluated in vitro by a microdilution technique. In addition to the in vitro assays, the Astronium sp. that showed the best antifungal activity and selectivity index was submitted to an in vivo assay using a model of vulvovaginal candidiasis infection. In these assays, the extracts were either used alone or were incorporated into the nanostructured lipid system (comprising 10% oil phase, 10% surfactant, and 80% aqueous phase). The results indicated a minimal inhibitory concentration of 125.00 µg/mL before incorporation into the nanostructured system; this activity was even more enhanced when this extract presented a minimal inhibitory concentration of 15.62 µg/mL after its incorporation. In vivo assay dates showed that the nanostructure-incorporated extract of A. urundeuva leaves was more effective than both the unincorporated extract and the antifungal positive control (amphotericin B). These results suggest that this nanostructured lipid system can be used in a strategy to improve the in vitro and in vivo anti-C. albicans activity of hydroethanolic extracts of Astronium sp. PMID:26300640

  18. Growth and photosynthetic performance of five tree seedlings species in response to natural light regimes from the Central Pacific of Costa Rica.

    Science.gov (United States)

    Guzmán, J Antonio; Cordero, Roberto A

    2013-09-01

    Environmental heterogeneity mostly dominated by differing light regimes affects the expression of phenotypic plasticity, which is important for plant growth and survival, especially in the forest understory. The knowledge about these responses to this heterogeneity is a key factor for forest restoration initiatives. In this study, we determine several phenotypic responses to contrasting light conditions in five native tree seedling species of La Cangreja National Park, Central Pacific of Costa Rica, four of them with threatened or relict populations. After 14 weeks at a medium gap condition (24% of full sun), seedlings were transferred and acclimated for 11 weeks to three different natural light regimes: large gap (LG), medium gap (MG) and small gap (SG), corresponding to 52%, 24%, 9% of the mean direct and indirect radiation at each site from full sun. Growth, biomass allocation and leaf gas exchange were measured after the acclimation period. Four species strongly reduced relative growth rate (RGR) in the lower light condition. Total biomass (TB) and RGR were different in Hymenaea courbaril and Platymiscium curiense. H. courbaril and Astronium graveolens had significant changes in the maximum assimilation rate, with a mean value in the LG of 11.02 and 7.70 micromolCO2/m2s, respectively. P. curuense showed the same trend and significant changes in RGR and biomass allocation. Aspidosperma myristicifolium and Plinia puriscalensis showed no adjustments to the light regimes in any of the measured variables. This study remarks the importance of determining the growth and physiological performance of these tree native species. It also demonstrates that the most threatened species are those with the less plastic responses to the light regimes, which stresses the difficult situation of their natural populations. This study highlights an urgent definition of the conservation and restoration needs of the degraded forests of the Costa Rican Central Pacific area, where these

  19. Synergism between ozone and light stress: structural responses of polyphenols in a woody Brazilian species.

    Science.gov (United States)

    Fernandes, Francine Faia; Cardoso-Gustavson, Poliana; Alves, Edenise Segala

    2016-07-01

    Microscopic studies on isolated ozone (O3) effects or on those in synergy with light stress commonly report the induction of polyphenols that exhibit different aspects within the vacuole of photosynthesizing cells. It has been assumed that these different aspects are randomly spread in the symptomatic (injured) regions of the leaf blade. Interestingly, secretory ducts that constitutively produce polyphenols also exhibit these same variations in their vacuolar aspect, in a spatial sequence related to the destiny of these cells (e.g., programmed cell death (PCD) in lytic secretion processes). Here, we demonstrate that the deposition pattern of polyphenols prior to the establishment of the hypersensitive-like response, a type of PCD caused by O3, follows the same one observed in the epithelial cells of the constitutive lysigenous secretory ducts. Astronium graveolens, an early secondary Brazilian woody species, was selected based on its susceptibility to high light and presence of secretory ducts. The synergism effects were assessed by exposing plants to the high O3 concentrations at an urban site in São Paulo City. Confocal, widefield and light microscopies were used to examine polyphenols' occurrence and aspects. The spatial pattern of polyphenols distribution along the leaflets of plants submitted to the synergism condition, in which a dense vacuolar aspect is the target of a cell destined to death, was also observed in the constitutive secretory cells prior to lysis. This similar structural pattern may be a case of homology of process involving both the constitutive (secretory ducts) and the induced (photosynthesizing cells) defenses. PMID:27155473

  20. Foliar accumulation of polycyclic aromatic hydrocarbons in native tree species from the Atlantic Forest (SE-Brazil).

    Science.gov (United States)

    Dias, Ana Paula L; Rinaldi, Mirian C S; Domingos, Marisa

    2016-02-15

    Polycyclic aromatic hydrocarbons (PAHs) are toxic to living organisms. They can accumulate on foliar surfaces due to their affinity with apolar organic compounds, which enables the use of native plant species as sentinels of atmospheric PAH deposition in polluted ecosystems. The present study extends the knowledge about this subject in the tropical region by focusing on the PAH accumulation in the foliage of dominant tree species (Astronium graveolens, Croton floribundus, Piptadenia gonoacantha) in four remnants of Semi-deciduous Atlantic Forest surrounded by diversified sources of PAHs and located in the cities of Campinas, Paulínia, Holambra and Cosmópilis (central-eastern part of São Paulo State, SE-Brazil). Leaves of the tree species were collected in the forest remnants during the wet and dry seasons (2011 to 2013). All samples were analyzed by high performance liquid chromatography (HPLC) coupled to a fluorescence detector for identification of 14 PAHs. The native tree species showed distinct capacities to accumulate PAHs. All of them accumulated proportionally more light PAHs than heavy PAHs, mainly during the dry period. P. gonoacantha was the most effective accumulator species. Higher accumulations of most of the PAHs occurred during the dry periods. The predominance of moderately (1 ≤ EF < 5) to highly enriched (EF ≥ 5) leaf samples of P. gonoacantha with regard to BaA and PHE in all of the forest remnants indicated that vehicular sources were widely distributed in the entire region. The predominance of the moderate to high enrichment of ACE in leaf samples from the forest remnants located in Paulínia, Holambra and Cosmópolis indicated that they were also affected by emissions from petrochemical industries. PMID:26657363

  1. Bioactive compounds from culinary herbs inhibit a molecular target for type 2 diabetes management, dipeptidyl peptidase IV.

    Science.gov (United States)

    Bower, Allyson M; Real Hernandez, Luis M; Berhow, Mark A; de Mejia, Elvira Gonzalez

    2014-07-01

    Greek oregano (Origanum vulgare), marjoram (Origanum majorana), rosemary (Rosmarinus officinalis), and Mexican oregano (Lippia graveolens) are concentrated sources of bioactive compounds. The aims were to characterize and examine extracts from greenhouse-grown or commercially purchased herbs for their ability to inhibit dipeptidyl peptidase IV (DPP-IV) and protein tyrosine phosphatase 1B (PTP1B), enzymes that play a role in insulin secretion and insulin signaling, respectively. Greenhouse herbs contained more polyphenols (302.7-430.1 μg of gallic acid equivalents/mg of dry weight of extract (DWE)) and flavonoids (370.1-661.4 μg of rutin equivalents/mg of DWE) compared to the equivalent commercial herbs. Greenhouse rosemary, Mexican oregano, and marjoram extracts were the best inhibitors of DPP-IV (IC₅₀=16, 29, and 59 μM, respectively). Commercial rosemary, Mexican oregano, and marjoram were the best inhibitors of PTP1B (32.4-40.9% at 500 μM). The phytochemicals eriodictyol, naringenin, hispidulin, cirsimaritin, and carnosol were identified by LC-ESI-MS as being present in greenhouse-grown Mexican oregano and rosemary. Computational modeling indicated that hispidulin, carnosol, and eriodictyol would have the best binding affinities for DPP-IV. Biochemically, the best inhibitors of DPP-IV were cirsimaritin (IC₅₀=0.43±0.07 μM), hispidulin (IC₅₀=0.49±0.06 μM), and naringenin (IC₅₀=2.5±0.29 μM). Overall, herbs contain several flavonoids that inhibit DPP-IV and should be investigated further regarding their potential in diabetes management. PMID:24881464

  2. The role of spices and lactic acid bacteria as antimicrobial agent to extend the shelf life of metata ayib (traditional Ethiopian spiced fermented cottage cheese).

    Science.gov (United States)

    Geremew, Tsehayneh; Kebede, Ameha; Andualem, Berhanu

    2015-09-01

    Spices and lactic acid bacteria have natural antimicrobial substances and organic compounds having antagonistic activity against microorganisms. The objective of this study was to investigate the role of spices and lactic acid bacteria as antimicrobial agent to extend the shelf life of metata ayib. Antimicrobial activities of spices and lactic acid bacteria (LAB) filtrates were determined by agar well diffusion method against E. coli, S. aureus, S. flexneri and S. peumoniae. Aantimicrobial activity of garlic was found to be the most effective against all the tested pathogens. Inhibition zones of garlic extract against all pathogens was significantly (P ≤ 0.05) greater than the remaining spice extracts. Inhibition zones (12.50 ± 1.00 to 15.50 ± 1.00 mm) of ginger and R. graveolens ethanol extracts against all tested pathogens were significantly (P ≤ 0.05) greater than the remaining solvent extracts. Inhibition zone of O. basilicum ethanol extract against all pathogenic bacteria was significantly (p ≤ 0.05) greater than hexane and acetone extracts. Lactobacillus isolates were shown the highest antimicrobial activity than the other LAB isolates against all pathogens. The synergistic effect of spices together with LAB might be contributed a lot to preserve and extend shelf life of metata ayib. Their antimicrobial activity can reduce the risk of spoilage and pathogenesis. The possible reason of LAB isolates was may be due to production of lactic acid, acetic acid and secondary metabolites like bacteriocins. Aseptic processing of traditional cottage cheese (ayib) is by far needed to minimize risks associated during consumption of metata ayib. PMID:26344979

  3. [Effects of ruta SSP on the activity of the smooth gastrointestinal muscle isolated of rat].

    Science.gov (United States)

    Grigorjev, Carlota A; Brizuela, Nilda Y

    2010-01-01

    Ruta graveolens L. and Ruta chalepensis L. are plants used in folkloric medicine as antispasmodics, digestive and for intestinal gases. Animals used as experimental model were rats of the Wistar line, adult females, clinically healthy and with a weight average of 250 grams. We used strips of stomach and duodenum. Each one of the segments mounted on two stirrups in a bath of organ isolated with Ringer-lactate solution, at 37° C , pH: 7.3-7.4, and bubbled with 95% O2, 5% CO2. One of the stirrups was connected vertically to the bottom of the bath and the other to a transducer of tension connected to a Beckman polygraph. We applied 500 mgs of basal tension. After the stabilization, the ethanolic extract of Ruta ssp was added in increasing doses. At 50μl/ml the tone lower 23% in small intestine and lower 27% in stomach. However at 100 μl/ml the tone lower 32% and 35% respectively. In the other parameters the amplitude decrease 50% in the stomach at dose of 5 μl/ml while in the small intestine the amplitude lower 60%. With 10 μl/ml the amplitude change in both organs ( 96% in small intestine, and 75% in stomach). The frequency changes in both organs ( 32% in small intestine, and 50% in stomach) at 10 μl/ml Rue showed decreased effects on isolated small intestine and stomach were is dose dependent, maybe we were demonstrated the effects digestive of Ruta. PMID:21450144

  4. Herbal infusions used for induced abortion.

    Science.gov (United States)

    Ciganda, Carmen; Laborde, Amalia

    2003-01-01

    Plants and herbs have been used to induce abortions but there is very little published information describing the commonly used ones. The purpose of this report is to describe the herbal products used to induce abortions, and to enhance awareness and understanding of their toxic effects. A descriptive retrospective survey was conducted on the calls received by the Montevideo Poison Centre between 1986 and 1999 concerning the ingestion of herbal infusions with abortive intent. A total of 86 cases involving 30 different plant species were identified. The species most frequently involved were ruda (Ruta chalepensis/graveolens), cola de quirquincho (Lycopodium saururus), parsley (Petroselinum hortense), and an over-the-counter herbal product named Carachipita. The components of Carachipita are pennyroyal (Mentha pulegium), yerba de la perdiz (Margiricarpus pinnatus), oregano (Origanum vulgare), and guaycuri (Statice brasiliensis). Abortion occurred in 23 cases after the ingestion of parsley, ruda, Carachipita, celery, Cedron, francisco alvarez, floripon, espina colorada. Out of the 23 cases, 15 involved the only the ingestion of plants, 4 cases used injected drugs (presumably hormones), and in 4 cases there was associated self-inflicted instrumental manipulation. Multiple organ system failure occurred in those patients who had ingested ruda (alone or in combination with parsley or fennel), Carachipita, arnica, or bardana. Deaths occurred in one case of Carachipita ingestion and in 4 cases of ruda ingestion (2 cases of ruda alone, 2 cases of ruda with parsley and fennel). Self-inflicted instrumental manipulations were found in 4 of the patients with multiple organ system failure and in one of those who died. The results of this report are not conclusive, but it appears that the ingestion of plants to induce abortion involves the risk of severe morbidity and mortality. PMID:12807304

  5. Assessment of heavy metal pollution in vegetables and relationships with soil heavy metal distribution in Zhejiang province, China.

    Science.gov (United States)

    Ye, Xuezhu; Xiao, Wendan; Zhang, Yongzhi; Zhao, Shouping; Wang, Gangjun; Zhang, Qi; Wang, Qiang

    2015-06-01

    There are increasing concerns on heavy metal contaminant in soils and vegetables. In this study, we investigated heavy metal pollution in vegetables and the corresponding soils in the main vegetable production regions of Zhejiang province, China. A total of 97 vegetable samples and 202 agricultural soil samples were analyzed for the concentrations of Cd, Pb, As, Hg, and Cr. The average levels of Cd, Pb, and Cr in vegetable samples [Chinese cabbage (Brassica campestris spp. Pekinensis), pakchoi (Brassica chinensis L.), celery (Apium graveolens), tomato (Lycopersicon esculentum), cucumber (Colletotrichum lagenarium), cowpea (Vigna unguiculata), pumpkin (Cucurbita pepo L.), and eggplant (Solanum melongena)] were 0.020, 0.048, and 0.043 mg kg(-1), respectively. The Pb and Cr concentrations in all vegetable samples were below the threshold levels of the Food Quality Standard (0.3 and 0.5 mg kg(-1), respectively), except that two eggplant samples exceeded the threshold levels for Cd concentrations (0.05 mg kg(-1)). As and Hg contents in vegetables were below the detection level (0.005 and 0.002 mg kg(-1), respectively). Soil pollution conditions were assessed in accordance with the Chinese Soil Quality Criterion (GB15618-1995, Grade II); 50 and 68 soil samples from the investigated area exceeded the maximum allowable contents for Cd and Hg, respectively. Simple correlation analysis revealed that there were significantly positive correlations between the metal concentrations in vegetables and the corresponding soils, especially for the leafy and stem vegetables such as pakchoi, cabbage, and celery. Bio-concentration factor values for Cd are higher than those for Pb and Cr, which indicates that Cd is more readily absorbed by vegetables than Pb and Cr. Therefore, more attention should be paid to the possible pollution of heavy metals in vegetables, especially Cd. PMID:26013654

  6. Activity of Six Essential Oils Extracted from Tunisian Plants against Legionella pneumophila.

    Science.gov (United States)

    Chaftar, Naouel; Girardot, Marion; Quellard, Nathalie; Labanowski, Jérôme; Ghrairi, Tawfik; Hani, Khaled; Frère, Jacques; Imbert, Christine

    2015-10-01

    The aim of this study was to investigate the composition of six essential oils extracted from Tunisian plants, i.e., Artemisia herba-alba Asso, Citrus sinensis (L.) Osbeck, Juniperus phoenicea L., Rosmarinus officinalis L., Ruta graveolens L., and Thymus vulgaris L., and to evaluate their activity against Legionella pneumophila (microdilution assays). Eight Legionella pneumophila strains were studied, including the two well-known serogroup 1 Lens and Paris strains as controls and six environmental strains isolated from Tunisian spas belonging to serogroups 1, 4, 5, 6, and 8. The essential oils were generally active against L. pneumophila. The activities of the A. herba-alba, C. sinensis, and R. officinalis essential oils were strain-dependent, whereas those of the J. phoenicea and T. vulgaris oils, showing the highest anti-Legionella activities, with minimum inhibitory concentrations (MICs) lower than 0.03 and lower than or equal to 0.07 mg/ml, respectively, were independent of the strains' serogroup. Moreover, the microorganisms treated with T. vulgaris essential oil were shorter, swollen, and less electron-dense compared to the untreated controls. Isoborneol (20.91%), (1S)-α-pinene (18.30%) β-phellandrene (8.08%), α-campholenal (7.91%), and α-phellandrene (7.58%) were the major components isolated from the J. phoenicea oil, while carvacrol (88.50%) was the main compound of the T. vulgaris oil, followed by p-cymene (7.86%). This study highlighted the potential interest of some essential oils extracted from Tunisian plants as biocides to prevent the Legionella risk. PMID:26460561

  7. Bacteriostasis Activity of Flower Extracts Against Three Species of Bacteria%花卉提取物对3种细菌的抑菌性测定

    Institute of Scientific and Technical Information of China (English)

    吕慧; 孟雪; 王志英

    2010-01-01

    利用丙酮超声波提取和减压浓缩技术,获得17种花卉茎、叶的提取物,分析各提取物对3种细菌的抑菌结果.天竺葵(Pelargonium graveolens)对腐生葡萄球菌(Staphylococcus saprophyticus)和藤黄葡萄球菌(Micrococcus luteus)具有抑制作用;杜鹃(Rhododendronsimsii & R. spp.)对腐生葡萄球菌和炭疽杆菌(Bacillus anthracis)具有抑制作用.天竺葵提取物4种供试质量浓度对腐生葡萄球菌的抑菌率均达96%以上,杜鹃提取物对炭疽杆菌的抑菌率在77%~84%之间.但天竺葵、杜鹃提取物分别对炭疽杆菌和藤黄葡萄球菌无抑制效果.2种花卉提取物抑菌率卡方检验结果表明,不同质量浓度的天竺葵提取物对藤黄葡萄球菌抑菌率差异显著;杜鹃提取物不同质量浓度间对腐生葡萄球菌的抑菌率差异显著.

  8. Lethal and Inhibitory Activities of Plant-Derived Essential Oils Against Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae) Biotype B in Tomato.

    Science.gov (United States)

    Fanela, T L M; Baldin, E L L; Pannuti, L E R; Cruz, P L; Crotti, A E M; Takeara, R; Kato, M J

    2016-04-01

    The silverleaf whitefly Bemisia tabaci (Genn.) biotype B (Hemiptera: Aleyrodidae) is one of the most severe tomato pests in the world. The damage caused by this insect may compromise up to 100% of crop production, and management of this pest has relied on spraying of synthetic insecticides. However, due to the environmental issues associated with this practice, alternative methods such as the use of botanical pesticides are now used as a strategy of integrated pest management (IPM). We evaluated the effects of essential oils of five plant species on B. tabaci biotype B in tomato and demonstrate that the essential oils (0.5%) of Piper callosum (PC-EO), Adenocalymma alliaceum (AA-EO), Pelargonium graveolens (PG-EO), and Plectranthus neochilus (PN-EO) inhibit the settlement and oviposition of B. tabaci biotype B adults in tomato plants. In fumigation tests, A. alliaceum (AA-EO) at 0.4 μL/L of air after 72 h and 0.1 μL/L of air after 6 h was the most effective against nymphs and adults of B. tabaci biotype B, respectively. The major chemical constituents of PC-EO were identified as being safrole (29.3%), α-pinene (19.2%), and β-pinene (14.3%), whereas diallyl trisulfide (66.9%) and diallyl disulfide (23.3%) were the major compounds identified in AA-EO. This is the first report on the reduction of oviposition by the use of P. callosum (PC-EO) and A. alliaceum (AA-EO). In addition, the fumigant effect of A. alliaceum (AA-EO) on nymphs and adults has also been reported here for the first time. PMID:26712319

  9. Repelência e atividade inseticida de pós vegetais sobre Zabrotes subfasciatus Boheman em feijão-fava armazenado

    Directory of Open Access Journals (Sweden)

    J.E. Girão Filho

    2014-09-01

    Full Text Available O objetivo desta pesquisa foi avaliar o potencial inseticida de Piper nigrum L. (pimenta do reino, Ruta graveolens L. (arruda, Laurus nobilis L. (louro, Syzygium aromaticum (L. Merr. & L.M.Perry (cravo da índia, Chenopodium ambrosioides L. (mastruz, Piper tuberculatum Jaqc. (pimenta de macaco, Tagetes erecta L. (cravo de defunto, Cymbopogon nardus L. (citronela e Melissa officinalis L. (erva cidreira sobre Z. subfasciatus Boh. através dos testes de confinamento, onde os insetos foram confinados durante cinco dias em um recipiente contendo dez grãos de feijão-fava com 0,3 g do pó da planta a ser testada, e, com chance de escolha por meio de uma arena circular, os insetos tiveram a possibilidade de escolha entre grãos com os pós e a testemunha, grãos sem pó das plantas. Observou-se que houve plantas que atuaram como inseticida, outras que repeliram o inseto e não causaram a morte, e outras, que além de repelir também mataram os insetos quando em contato (cravo da índia e matruz. Concluímos que: P. nigrum, P. tuberculatum, S. aromaticum e C. ambrosioides são tóxicas à Z. subfasciatus causando-lhes a morte, L. nobilis, T. erecta, e C. nardus não apresentaram efeito tóxico sobre Z. subfasciatus, C. ambrosioides, S. aromaticum, e C. nardus são repelentes à Z. subfasciatus; P. nigrum, P. tuberculatum, e T. erecta são neutras, e que M. officinalis não apresentou nenhum efeito sobre Z. subfasciatus em relação aos parâmetros avaliados.

  10. Produtividade do tomateiro em cultivo solteiro e consorciado com espécies aromáticas e medicinais Yield of tomato in monocrop and intercropping with aromatics plants

    Directory of Open Access Journals (Sweden)

    Luciana M de Carvalho

    2009-12-01

    Full Text Available O tomateiro é cultivado, principalmente em monocultivos, com uso intensivo de defensivos químicos, atividade de risco econômico, social e ambiental. O consórcio vem sendo praticado como forma de reduzir os riscos. O objetivo deste trabalho foi avaliar a produção do tomateiro solteiro e em consórcio com as espécies medicinais e aromáticas Foeniculum vulgare, Mentha piperita, Ocimum basilicum e Ruta graveolens. O delineamento experimental foi de blocos ao acaso com quatro repetições e cinco tratamentos. Avaliou-se altura, área do dossel, produção, produtividade e eficiência do uso da terra. Nos consórcios, verificou-se que, na densidade de plantio adotada, o funcho teve maior altura e área de dossel e causou redução significativa na produção total de tomates: de 12,23 kg, no cultivo solteiro, para 7,88 kg, no consórcio com funcho. No entanto, contribuiu com a menor porcentagem de perda de tomates por broqueamento (24%. As maiores perdas por broqueamento ocorreram no monocultivo e no consórcio com hortelã-pimenta. A arruda favoreceu aumento significativo na produção comercial de tomates, em média 26%. A produtividade relativa do tomateiro foi maior no consórcio com arruda (13,6 t ha-1, seguido pelo consórcio com hortelã-pimenta (9,8 t ha-1 e manjericão (9,1 t ha-1, e menor no consórcio com funcho (6,4 t ha-1, o que indicou que o consórcio com arruda foi mais vantajoso para a produção de tomates. Dentre as aromáticas estudadas, o manjericão teve maior produtividade (96,5 t ha-1. Concluindo, os consórcios permitiram maior aproveitamento no uso da terra, com aumento na produtividade dos tomateiros na presença da arruda e redução na presença do funcho. As demais plantas não reduziram significativamente a produção e portanto podem ser empregadas como fonte alternativa de renda.Tomato is mainly cultivated in monocrops, by intensive use of chemical products. It is an activity with economic, social and

  11. Two years monitoring of soil N_{2}O emissions on durum wheat in a Mediterranean area: the effect of tillage intensity and N-fertilizer rate.

    Science.gov (United States)

    Volpi, Iride; Bosco, Simona; Triana, Federico; Di Nasso, Nicoletta Nassi o.; Laville, Patricia; Virgili, Giorgio; Bonari, Enrico

    2016-04-01

    . Differences could be partially attributed to a huge difference in the rainfall amount during the two growing seasons, equal to 810 mm in the 2013-14 growing season and 441 mm in 2014-15. Emission factors for each N rate was calculated through the whole monitoring period and resulted to be in the range of 0.5-0.9% in 2013-14, while between 0.2-0.3% in 2014-15, considerably lower than the IPCC Tier 1 EF (1%). References: Bosco S., Volpi I., Nassi o Di Nasso N., Triana F., Roncucci N., Tozzini C., Villani R., Laville P., Mattei F., Virgili G., Nuvoli S., Fabbrini L., Bonari E., 2015. LIFE+IPNOA mobile prototype for the monitoring of soil N2O emissions from arable crops: first year results on durum wheat. Italian Journal of Agronomy Vol 10:669, pp 124-131. Laville P., Neri S., Continanza D., Ferrante Vero L., Bosco S., Virgili G., 2015. Cross-Validation of a mobile N2O flux prototype (IPNOA) using Micrometeorological and Chamber methods. Journal of Energy and Power Engineering 9 (2015) 375-385. Syakila A, Kroeze C., 2011. The global nitrogen budget revisited. Greenhouse Gas Meas. Manage. 1, 17-26.

  12. SHIWA Services for Workflow Creation and Sharing in Hydrometeorolog

    Science.gov (United States)

    Terstyanszky, Gabor; Kiss, Tamas; Kacsuk, Peter; Sipos, Gergely

    2014-05-01

    pre-deployed workflow engines or submits workflow engines with the workflow to local or remote resources to execute workflows. The SHIWA Proxy Server manages certificates needed to execute the workflows on different DCIs. Currently SSP supports sharing of ASKALON, Galaxy, GWES, Kepler, LONI Pipeline, MOTEUR, Pegasus, P-GRADE, ProActive, Triana, Taverna and WS-PGRADE workflows. Further workflow systems can be added to the simulation platform as required by research communities. The FP7 'Building a European Research Community through Interoperable Workflows and Data' (ER-flow) project disseminates the achievements of the SHIWA project to build workflow user communities across Europe. ER-flow provides application supports to research communities within (Astrophysics, Computational Chemistry, Heliophysics and Life Sciences) and beyond (Hydrometeorology and Seismology) to develop, share and run workflows through the simulation platform. The simulation platform supports four usage scenarios: creating and publishing workflows in the repository, searching and selecting workflows in the repository, executing non-native workflows and creating and running meta-workflows. The presentation will outline the CGI concept, the SHIWA Simulation Platform, the ER-flow usage scenarios and how the Hydrometeorology research community runs simulations on SSP.

  13. Flexible workflow sharing and execution services for e-scientists

    Science.gov (United States)

    Kacsuk, Péter; Terstyanszky, Gábor; Kiss, Tamas; Sipos, Gergely

    2013-04-01

    The sequence of computational and data manipulation steps required to perform a specific scientific analysis is called a workflow. Workflows that orchestrate data and/or compute intensive applications on Distributed Computing Infrastructures (DCIs) recently became standard tools in e-science. At the same time the broad and fragmented landscape of workflows and DCIs slows down the uptake of workflow-based work. The development, sharing, integration and execution of workflows is still a challenge for many scientists. The FP7 "Sharing Interoperable Workflow for Large-Scale Scientific Simulation on Available DCIs" (SHIWA) project significantly improved the situation, with a simulation platform that connects different workflow systems, different workflow languages, different DCIs and workflows into a single, interoperable unit. The SHIWA Simulation Platform is a service package, already used by various scientific communities, and used as a tool by the recently started ER-flow FP7 project to expand the use of workflows among European scientists. The presentation will introduce the SHIWA Simulation Platform and the services that ER-flow provides based on the platform to space and earth science researchers. The SHIWA Simulation Platform includes: 1. SHIWA Repository: A database where workflows and meta-data about workflows can be stored. The database is a central repository to discover and share workflows within and among communities . 2. SHIWA Portal: A web portal that is integrated with the SHIWA Repository and includes a workflow executor engine that can orchestrate various types of workflows on various grid and cloud platforms. 3. SHIWA Desktop: A desktop environment that provides similar access capabilities than the SHIWA Portal, however it runs on the users' desktops/laptops instead of a portal server. 4. Workflow engines: the ASKALON, Galaxy, GWES, Kepler, LONI Pipeline, MOTEUR, Pegasus, P-GRADE, ProActive, Triana, Taverna and WS-PGRADE workflow engines are already

  14. La Botánica Sistemática en Colombia

    Directory of Open Access Journals (Sweden)

    Dugand Armando

    1940-03-01

    Full Text Available En Colombia, salvo algunos ensayos que por lo escasos no son menos meritorios, el estudio profundizado de la Botánica sistemática ha tenido pocos adeptos verdaderamente especializados. Aquellas figuras proceras que iluminaron un siglo de nuestra historia y dieron renombre científico a nuestra patria, buscando en el corazón de nuestras selvas, en la cima de nuestras cordilleras o en los horizontes infinitos de nuestros llanos las rarísimas plantas que ellos mismos estudiaron con esmero y clasificaron para la posteridad: los Mutis, los Caldas, los Trianas, fueron lumbreras que se extinguieron ante la indiferencia de un pueblo necesariamente preocupado ya por las, conmociones desugesta libertadora o por las revueltas de sus luchas políticas internas. Vivieron en época precaria para el desenvolvimiento de sus geniales profesiones y la mayor parte de sus esfuerzos quedó inmaterializada y archivada bajo el polvo de la incomprensión mientras que por todos los ámbitos del territorio patrio cruzaban y se sucedían expediciones extranjeras ávidas de descubrir novedades botánicas, acumulando materiales que fueron a enriquecer los Museos de capitales europeas y a aumentar así, en paísesextraños, el acervo de conocimientos relativos a nuestras riquezas naturales. Todo estudio sistemático importante ha de estar necesariamente basado sobre ejemplares de herbario y, cuando se publican especio géneros nuevos, los ejemplares respectivos se consideran comocomprobantes físicos y se les denomina tipos. Ser aficionado a las plantas y ser botánico sistemático, esto es: genuino y original clasificador de plantas, son cualidades que no se excluyen, pues antes bien armonizan perfectamente, pero sólo pueden complementarse en orden ascendente, porque lo último requiere una idoneidad especial y elementos de trabajo muy completos, El aficionado a las plantas puede quizás ser algo clasificador en el sentido que puede ordenar por familias, g

  15. Comparison Of Cd And Zn Accumulation In Tissues Of Different Vascular Plants: A Radiometric Study

    Directory of Open Access Journals (Sweden)

    Dürešová Zuzana

    2015-12-01

    Full Text Available The aim of the present work was to compare the accumulation and translocation of Cd and Zn in plants of tobacco (Nicotiana tabacum L., celery (Apium graveolens L., maize (Zea mays L., giant reed (Arundo donax L., and alpine pennycress (Noccaea caerulescens L. under conditions of short-term hydroponic experiments using nutrient solutions spiked with radionuclides 109Cd or 65Zn, and direct gamma-spectrometry. It was found that the time-course of metals accumulation in studied plants was not different in terms of target metal, but it was significantly different on the level of plant species. The highest values of Cd accumulation showed plants of giant reed, whereby the accumulation decreased in the order: giant reed > tobacco > alpine pennycress >> maize and celery. On the basis of concentration ratios (CR [Me]shoot / [Me]root calculation for both metals, it was found that Cd and Zn were in prevailing part accumulated in the root tissues and only partially accumulated in the shoots, where the amount of accumulated Cd and Zn increased from the oldest developed leaves to the youngest developed leaves. The CR values corresponding to these facts were calculated in the range 0.06 – 0.27 for Cd and for Zn 0.06 – 0.48. In terms of plant species, the CR values obtained for Cd decreased in the order: maize > celery > tobacco and giant reed > alpine pennycress. The similarity between studied objects – individual plant species on the basis of the obtained variables defining Cd or Zn accumulation at different conditions of the experiments as well as the relationships between obtained variables and conditions of the experiments were subjected to multivariate analysis method – cluster analysis (CA. According to the findings and this analysis, it can be expected that plants of tobacco and giant reed will dispose with similar characteristics as plants of alpine pennycress, which are classified as Zn/Cd hyperaccumulators, in terms of Cd or Zn accumulation

  16. Avaliação fototóxica e screening mutagênico de extratos de propolis, Aloe spp. e Hamamelis virginiana

    Directory of Open Access Journals (Sweden)

    M. F.S. RAMOS

    2009-01-01

    Full Text Available

    A utilização de extratos vegetais em produtos farmacêuticos e cosméticos tem mostrado ser uma tendência mundial e cresceu substancialmente nas duas últimas décadas. No entanto, há ainda poucos relatos na literatura com relação à atividade mutagênica ou fototóxica de extratos vegetais. No presente trabalho foi avaliada a atividade fototóxica e o “screening” mutagênico de extratos fluidos e secos de própolis, Aloe spp. e Hamamelis virginiana. Na investigação de fototoxicidade foram realizados ensaios microbiológicos, utilizando cepas de Candida albicans e Saccharomyces cerevisiae, bem como ensaios biológicos com cobaias albinos. Extratos etanólicos de Ruta graveolens e Citrus spp., além de 8-metoxipsoraleno (fármaco sintético padrão, foram usados como controles positivos em ambos os testes. A atividade mutagênica foi avaliada qualitativamente segundo o “spot test” descrito por Maron & Ames, com cepas de Salmonella typhimurium TA97, TA98, TA100 e TA102, empregando como controle positivo o óxido de 4-nitroquinolina. Não foi observada atividade fototóxica, em ambos os ensaios realizados, para qualquer dos extratos. O ensaio microbiológico demonstrou uma atividade fungistática ou fungicida nos extratos secos de hamamélis. Os resultados obtidos nos ensaios microbiológicos com a levedura S. cerevisiae indicam que este microrganismo apresentou eficiência no procedimento de “screening” de atividade fototóxica comparável à obtida com C. albicans. Os extratos vegetais não apresentaram atividade mutagênica nos ensaios preliminares realizados. Palavras-chave: Aloe spp., Hamamelis virginiana, própolis, fototoxicidade, mutagenicidade.

  17. Natural Plant Oils and Terpenes as Protector for the Potato Tubers against Phthorimaea operculella Infestation by Different Application Methods

    Directory of Open Access Journals (Sweden)

    Aziza Sharaby

    2014-06-01

    Full Text Available For protecting potato tubers from the potato tuber moth (PTM infestation during storage, different concentrations of ten natural plant oils and three commercial monoterpnes were tested, some as fumigants or dusts against adults or dusts against neonate larvae, while others as sprays on the gunny sacks in which potato tubers were stored. Tuber damage indices as well as persistence indices for tested materials were assessed. Vapors of Cymbopogon citratus, Myristica fragrans (nutmag, Mentha citrata and a-Ionone (monoterpene caused a highly significant reductions in the life span of exposed moths as well as in new adult offsprings. Other tested oils as Cinnamonium zeylanicum, Myristica. fragrans (Mace and Pelargonium graveolens caused a insignificant effect. There was no significant effect of the tested vapors on egg hatchability, except in case of oils of C. citratus, M. fragrans (nutmag and M. tragrans(Mace oil which caused high reduction in egg hatchability. According to the values of damage indices, the most effective oil vapors were arranged ascendingly as follows: Myristica (nutmag < Cymbopogon < Mentha < a - Ionone. Dusting potato tubers with 1% conc., (mixed with talcum powder of Myristica, Mentha, Cymbopogons oils and a-Ionone (monoterpene caused high reduction in egg deposition, adult emergence as well as percentage of penetrated larvae of PTM. According to their damage indices, Cymbopogon and ά-Ionone were the most protective oils, followed by Myristica and Mentha. Spraying gunnysacks with 1% conc., of the aforementioned natural oils separately elicited high reduction in PTM progeny; while their combinations did not elicit any significant synergistic effect. According to their tuber damage indices, it was found that Cymbopogon oil alone or mixed with Myristica oil showed the best protective effect, followed by Myristica oil alone and Mentha oil mixed with Cymbopogon oil. Assessment of the persistence index of various tested materials

  18. Nanostructured lipid system as a strategy to improve the anti-Candida albicans activity of Astronium sp.

    Directory of Open Access Journals (Sweden)

    Bonifácio BV

    2015-08-01

    Full Text Available Bruna Vidal Bonifácio,1 Matheus Aparecido dos Santos Ramos,1 Patrícia Bento da Silva,2 Kamila Maria Silveira Negri,1 Érica de Oliveira Lopes,1 Leonardo Perez de Souza,3 Wagner Vilegas,4 Fernando Rogério Pavan,1 Marlus Chorilli,2 Taís Maria Bauab11Department of Biological Sciences, 2Department of Drugs and Medicines, School of Pharmaceutical Sciences, 3Department of Organic Chemistry, Chemistry Institute, UNESP – Univ Estadual Paulista, Araraquara, São Paulo, Brazil; 4Coastal Campus of São Vicente, UNESP – Univ Estadual Paulista, São Vicente, São Paulo, BrazilAbstract: The genus Astronium (Anacardiaceae includes species, such as Astronium fraxinifolium, Astronium graveolens, and Astronium urundeuva, which possess anti-inflammatory, anti-ulcerogenic, healing, and antimicrobial properties. Nanostructured lipid systems are able to potentiate the action of plant extracts, reducing the required dose and side effects and improving antimicrobial activity. This work aims to evaluate a nanostructured lipid system that was developed as a strategy to improve the anti-Candida albicans activity of hydroethanolic extracts of stems and leaves from Astronium sp. The antifungal activity against C. albicans (ATCC 18804 was evaluated in vitro by a microdilution technique. In addition to the in vitro assays, the Astronium sp. that showed the best antifungal activity and selectivity index was submitted to an in vivo assay using a model of vulvovaginal candidiasis infection. In these assays, the extracts were either used alone or were incorporated into the nanostructured lipid system (comprising 10% oil phase, 10% surfactant, and 80% aqueous phase. The results indicated a minimal inhibitory concentration of 125.00 µg/mL before incorporation into the nanostructured system; this activity was even more enhanced when this extract presented a minimal inhibitory concentration of 15.62 µg/mL after its incorporation. In vivo assay dates showed that the

  19. Sensitization prevalence, antibody cross-reactivity and immunogenic peptide profile of Api g 2, the non-specific lipid transfer protein 1 of celery.

    Directory of Open Access Journals (Sweden)

    Gabriele Gadermaier

    Full Text Available BACKGROUND: Celery (Apium graveolens represents a relevant allergen source that can elicit severe reactions in the adult population. To investigate the sensitization prevalence and cross-reactivity of Api g 2 from celery stalks in a Mediterranean population and in a mouse model. METHODOLOGY: 786 non-randomized subjects from Italy were screened for IgE reactivity to rApi g 2, rArt v 3 (mugwort pollen LTP and nPru p 3 (peach LTP using an allergen microarray. Clinical data of 32 selected patients with reactivity to LTP under investigation were evaluated. Specific IgE titers and cross-inhibitions were performed in ELISA and allergen microarray. Balb/c mice were immunized with purified LTPs; IgG titers were determined in ELISA and mediator release was examined using RBL-2H3 cells. Simulated endolysosomal digestion was performed using microsomes obtained from human DCs. RESULTS: IgE testing showed a sensitization prevalence of 25.6% to Api g 2, 18.6% to Art v 3, and 28.6% to Pru p 3 and frequent co-sensitization and correlating IgE-reactivity was observed. 10/32 patients suffering from LTP-related allergy reported symptoms upon consumption of celery stalks which mainly presented as OAS. Considerable IgE cross-reactivity was observed between Api g 2, Art v 3, and Pru p 3 with varying inhibition degrees of individual patients' sera. Simulating LTP mono-sensitization in a mouse model showed development of more congruent antibody specificities between Api g 2 and Art v 3. Notably, biologically relevant murine IgE cross-reactivity was restricted to the latter and diverse from Pru p 3 epitopes. Endolysosomal processing of LTP showed generation of similar clusters, which presumably represent T-cell peptides. CONCLUSIONS: Api g 2 represents a relevant celery stalk allergen in the LTP-sensitized population. The molecule displays common B cell epitopes and endolysosomal peptides that encompass T cell epitopes with pollen and plant-food derived LTP.

  20. The perspective crops for the bioregenerative human life support systems

    Science.gov (United States)

    Polonskiy, Vadim; Polonskaya, Janna

    The perspective crops for the bioregenerative human life support systems V.I. Polonskiy, J.E. Polonskaya aKrasnoyarsk State Agrarian University, 660049, Krasnoyarsk, Russia In the nearest future the space missions will be too long. In this case it is necessary to provide the crew by vitamins, antioxidants, and water-soluble dietary fibers. These compounds will be produced by higher plants. There was not enough attention at present to increasing content of micronutrients in edible parts of crops candidates for CELSS. We suggested to add the new crops to this list. 1. Barley -is the best crop for including to food crops (wheat, rice, soybean). Many of the health effects of barley are connected to dietary fibers beta-glucan of barley grains. Bar-ley is the only seed from cereals including wheat with content of all eight tocopherols (vitamin E, important antioxidant). Barley grains contain much greater amounts of phenolic compounds (potential antioxidant activities) than other cereal grains. Considerable focus is on supplement-ing wheat-based breads with barley to introduce the inherent nutritional advantages of barley flour, currently only 20We have selected and tested during 5 generations two high productive barley lines -1-K-O and 25-K-O. Our investigations (special breeding program for improving grain quality of barley) are in progress. 2. Volatile crops. Young leaves and shoots of these crops are edible and have a piquant taste. A lot of organic volatile compounds, oils, vitamins, antioxidants are in their biomass. These micronutrients are useful for good appetite and health of the crew. We have investigated 11 species: basil (Ocimum basilicum), hyssop (Hyssopus officinalis), marjoram (Origanum majorana), sweet-Mary (Melissa officinalis), common thyme (Thymus vulgaris), creeping thyme (Thymus serpyllum), summer savory (Satureja hortensis), catnip (Nepeta cataria), rue (Ruta graveolens), coriander (Coriandrum Ativum), sulfurwort (Levisticum officinale). These

  1. Patent literature on mosquito repellent inventions which contain plant essential oils--a review.

    Science.gov (United States)

    Pohlit, Adrian Martin; Lopes, Norberto Peporine; Gama, Renata Antonaci; Tadei, Wanderli Pedro; Neto, Valter Ferreira de Andrade

    2011-04-01

    Bites Bites of mosquitoes belonging to the genera Anopheles Meigen, Aedes Meigen, Culex L. and Haemagogus L. are a general nuisance and are responsible for the transmission of important tropical diseases such as malaria, hemorrhagic dengue and yellow fevers and filariasis (elephantiasis). Plants are traditional sources of mosquito repelling essential oils (EOs), glyceridic oils and repellent and synergistic chemicals. A Chemical Abstracts search on mosquito repellent inventions containing plant-derived EOs revealed 144 active patents mostly from Asia. Chinese, Japanese and Korean language patents and those of India (in English) accounted for roughly 3/4 of all patents. Since 1998 patents on EO-containing mosquito repellent inventions have almost doubled about every 4 years. In general, these patents describe repellent compositions for use in topical agents, cosmetic products, incense, fumigants, indoor and outdoor sprays, fibers, textiles among other applications. 67 EOs and 9 glyceridic oils were individually cited in at least 2 patents. Over 1/2 of all patents named just one EO. Citronella [Cymbopogon nardus (L.) Rendle, C.winterianus Jowitt ex Bor] and eucalyptus (Eucalyptus LʼHér. spp.) EOs were each cited in approximately 1/3 of all patents. Camphor [Cinnamomum camphora (L.) J. Presl], cinnamon (Cinnamomum zeylanicum Blume), clove [Syzygium aromaticum (L.) Merr. & L.M. Perry], geranium (Pelargonium graveolens LʼHér.), lavender (Lavandula angustifolia Mill.), lemon [Citrus × limon (L.) Osbeck], lemongrass [Cymbopogon citratus (DC.) Stapf] and peppermint (Mentha × piperita L.) EOs were each cited in > 10% of patents. Repellent chemicals present in EO compositions or added as pure “natural” ingredients such as geraniol, limonene, p-menthane-3,8-diol, nepetalactone and vanillin were described in approximately 40% of all patents. About 25% of EO-containing inventions included or were made to be used with synthetic insect control agents having mosquito

  2. 芹菜素对癌细胞作用机理的研究进展%Research progress in mechanism of apigenin' s anticarcinogenic activity on cancer cells

    Institute of Scientific and Technical Information of China (English)

    陈况况; 章宏慧; 陈健初

    2013-01-01

    Apigenin is an important flavonoid in Apium graveolens.lt has the effect of inhibition and cell apotosis induction on many kinds of cancer cells.But the mechanism of its effect on cancer cells has not yet been explained thoroughly and accurately.ln this paper,apigenin' s anti-cancer effect was summarized and discussed with the reference of relevant literatures of anticarcinogenic activity in recent years. The research of the mechanism was further concentrated on the cellular and molecular levels including the inhibition or activation on gene and protein, regulation of signal factor, intervention of enzyme activity. This research of the mechanism of apigenin' s anticarcinogenic activity v/as an important part of cancer chemoprevention, which provided theory basis for its application as a cancer chemoprevention agent.%芹菜素是芹菜中含有的一种重要的黄酮类物质,对多种癌细胞都有抑制其生长和促使其凋亡的作用,但是它对于癌细胞产生作用的具体机制尚未得到全面准确的阐释.本文参考近年来对芹菜素抗癌作用的研究的相关文献,分别对芹菜素对一些癌细胞的作用机制做了归纳和探讨.芹菜素对癌细胞作用的机理研究已经深入到细胞和分子水平,抑癌机理包括对基因和蛋白的抑制或激活,对信号因子的调节,干预酶发挥作用等.对芹菜素的抗癌作用机理的研究是通过饮食对癌症进行化学预防的一个重要部分,芹菜素作为癌症化学预防制剂具有广阔的应用前景.

  3. Alguns aspectos fisionômicos da vegetação do Brasil

    Directory of Open Access Journals (Sweden)

    Henrique Pimenta Veloso

    1970-01-01

    Full Text Available A - NORTE - A floresta em tôrno de Belém parece já bastante alterada, sendo poucas as árvores de grande porte. O solo é sempre arenoso, com uma camada de húmus muito fina a qual, quando é removida, deixa ver uma areia branca. Em Utinga era de notar o grande número de árvores caídas, justamente as maiores, o que sugere um solo pobre e raso, originando um enraizamento superficial e conseqüente queda das mesmas pelos ventos. Na floresta de àgua Preta é muito maior o número de árvores finas, o que sugere um solo ainda mais pobre. Trata-se de floresta típica da planície (Quartenário antigo, onde o solo foi formado por deposição do arenitos pobres do Centro-oeste capturados pela bacia do Tocatins. B - Nordeste - 1. Caatinga: O tipo de vegetação que predomina no Nordeste é o da caatinga, vegetação de arbustiva a arbórea, espinhosa e decidual. A parte vista, de Terezina até Paulo Afonso, via Ubajara, Fortaleza, Crato e Floresta, apresenta várias nuances fisiográficas de densidade e porte. Essas são devidas, aparentemente ao menos, não só à intervenção humana, como também à grande variação na constituição física do solo. Assim é que observamos: a Caatinga arbórea - dominada pela carnaúba: Copernicia cerifera (A. Cam. Mart. nos lugares encharcados, pela oiticica: Licania rigida Benth. na linha demarcatória das maiores enchentes, e pelo juàzeiro: Zizyphus joazeiro Mart., fora da influência das àguas dos rios. b Caatinga aberta - nos solos pedregosos, com dominância da imburana-de-espinho: Bursera leptophloeos Engl. e do umbu: Spondias tuberosa A. Cam. Ocorre nas enconstas dessecadas dos serrotes de quartzito. c Caatinga arbustiva densa - existente nos largos vales dos maiores rios, provável fruto da intervenção...The authors had the opportunity of visiting all Brazilian national parks and some of the States reserves in order to suggest a revision of the country's policy on that field. During their trip

  4. An update review on Commiphora molmol and related species.

    Science.gov (United States)

    Tonkal, Abdulkader M D; Morsy, Tosson A

    2008-12-01

    calibrations of Commiphora phylogeny proved that it is sister to Vietnamese Bursera tonkinensis and that its crown group radiation corresponds with the onset of the Miocene. Auffray (2007) in France studied the impact of two types of antioxidant on sebum squalene peroxidation by UV irradiation. The first type was free radical scavenger (Butyl hydroxyl toluene and an olive extract rich in hydroxytyrosol). The second type was the essential oil of C. myrrha, a singlet oxygen quencher. These properties were confirmed using the 2,2-diphenyl-1-picrylhydrazyl test for anti-radical capacity and 1,3-diphenylisobenzofuran test for the capacity to quench singlet oxygen. Also, the author extended an ex vivo method to classify the efficacy of cosmetics to protect squalene by collecting sebum in vivo and irradiating it in a controlled way. The squalene monohydroperoxide formation was monitored by high performance liquid chromatography. This method compared the efficiency of 3 antioxidants at 0.6% in a cosmetic formulation to protect squalene from photo oxidation. The data showed that essential oil of C. myrrha gave the best protection against squalene peroxidation, and that squalene peroxidation during solar exposure was mainly because of singlet oxygen and not due to free radical attack, and that sun care cosmetics should make use not only of free radical scavengers but also of singlet oxygen quenchers. This study aimed to review more than 70 out of hundreds papers (Pub-med-indexed for Medline) on the medical importance and safety of Commiphora molmol and other Commiphora species. PMID:19209761

  5. Compatibility of entomopathogenic nematodes and aqueous plant extracts aiming at the control of fruit fly Ceratitis capitata (Wiedemann (Diptera: TephritidaeCompatibilidade de nematóides entomopatogênicos e extratos vegetais aquosos visando o controle da mosca-das-frutas Ceratitis capitata (Wiedemann (Diptera: Tephritidae

    Directory of Open Access Journals (Sweden)

    Cristhiane Rohde

    2013-06-01

    Full Text Available Currently, the fruit fly Ceratitis capitata (Diptera: Tephritidae has been controlled mainly by the chemical method, which is responsible for environmental and public health impacts. It has often been ineffective due to development of resistant insect populations. Thus, it has necessary to research new effective and less impacting control forms. In this sense, the use of entomopathogenic nematodes and plant extracts has been effective for controlling this pest. However, studies are needed to assess the compatibility between these methods, aiming at their use in integrated management programs for this pest. The aim of this study was to evaluate the compatibility of the nematodes Steinernema carpocapsae ALL and Heterorhabditis sp. JPM4 with aqueous extracts prepared from dried plant of cinnamon leaf, twig and fruit (Melia azedarach, rue leaf (Ruta graveolens, ginger (Zingiber officinale and garlic (Allium sativum for the control of C. capitata. The bioassay was carried out in completely randomized design with four replicates per treatment. Each replication consisted of a glass tube containing 1 mL of plant extract 40% w/v and 1 mL suspension of entomopathogenic nematodes with 1800 JI/mL for S. carpocapsae ALL and 600 JI/mL for Heterorhabditis sp. JPM4. The viability and infectivity of this nematode were evaluated on C. capitata larvae after 48 and 120 hours. It was found that all extracts reduced the viability and infectivity of both nematodes and they were incompatible after 120 hours of exposure. The nematode Heterorhabditis sp. JPM4 was more sensitive than the S. carpocapsae ALL as it showed, in the first 48 hours, a reduction in the viability and infectivity of more than 80 and 75%, respectively, when exposed to all the extracts except the ginger.A mosca-das-frutas Ceratitis capitata (Diptera: Tephritidae tem sido controlada, principalmente, pelo método químico, que é o responsável por impactos ambientais e na saúde pública e, muitas

  6. Chlorophyll fluorescence of tropical tree species in a semi-deciduous forest gap Fluorescência da clorofila de espécies arbóreas tropicais em uma clareira de floresta semidecídua

    Directory of Open Access Journals (Sweden)

    Rafael Vasconcelos Ribeiro

    2004-02-01

    Full Text Available The characterization of different ecological groups in a forest formation/succession is unclear. To better define the different successional classes, we have to consider ecophysiological aspects, such as the capacity to use or dissipate the light energy available. The main objective of this work was to assess the chlorophyll fluorescence emission of tropical tree species growing in a gap of a semi-deciduous forest. Three species of different ecological groups were selected: Croton floribundus Spreng. (pioneer, P, Astronium graveolens Jacq. (early secondary, Si, and Esenbeckia febrifuga A. Juss. (late secondary, St. The potential (Fv/Fm and effective (deltaF/Fm' quantum efficiency of photosystem II, apparent electron transport rate (ETR, non-photochemical (qN and photochemical (qP quenching of fluorescence were evaluated, using a modulated fluorometer, between 7:30 and 11:00 h. Values of Fv/Fm remained constant in St, decreasing in P and Si after 9:30 h, indicating the occurrence of photoinhibition. Concerning the measurements taken under light conditions (deltaF/Fm', ETR, qP and qN, P and Si showed better photochemical performance, i.e., values of deltaF/Fm', ETR and qP were higher than St when light intensity was increased. Values of qN indicated that P and Si had an increasing tendency of dissipating the excess of energy absorbed by the leaf, whereas the opposite was found for St. The principal component analysis (PCA, considering all evaluated parameters, showed a clear distinction between St, P and Si, with P and Si being closer. The PCA results suggest that chlorophyll fluorescence may be a potential tool to differentiate tree species from distinct successional groups.A caracterização dos diferentes grupos ecológicos envolvidos nos processos de formação/sucessão florestal é ainda pouco precisa. Para melhor distinção das classes sucessionais deve-se levar em consideração aspectos ecofisiológicos, como a capacidade de

  7. 铁线莲属黄花铁线莲组修订%A revision of Clematis sect. Meclatis (Ranunculaceae)

    Institute of Scientific and Technical Information of China (English)

    王文采

    2006-01-01

    Clematis sect. Meclatis is revised in this paper. Brief taxonomic history and geographical distribution of the section are given, its systematic position and the relationships among the species are discussed, and the evolutionary trends of some characters in the section are evaluated. Clematis akebioides (Maxim.) Veitch and C. tangutica (Maxim.) Korsh. are considered the primitive species in the section, whereas C. caudigera W. T. Wang and C. corniculata W. T. Wang are considered the advanced ones. The western edge of the Qinghai-Xizang (Tibet) plateau with the Pamirs and the adjacent mountains, the highest land mass in the world, where 10 species of the section are concentrated, is regarded as the distribution center, and the eastern edge of the Qinghai-Xizang (Tibet) plateau, where the two primitive species, C. akebioides and C. tangutica, sympatrically occur, may be the center of origin of the section. The inclusion of C. ispahanica Boiss. and C. graveolens Lindl. in sect. Meclatis by some authors is not accepted, with the former being a member of sect. Clematis, and the latter a member of sect. Brachiatae Snoeijer. A new variety, C. intricata Bunge var. intrapuberula W. T. Wang, is described, and two new combinations, C. tangutica var. mongolica (Grey-Wilson) W. T. Wang and C. tibetana Kuntze var. pamiralaica (Grey-Wilson) W. T. Wang, is proposed. As a result, 13 species and 13 varieties are recognized in sect. Meclatis. They are keyed, described, and illustrated.%对毛茛科铁线莲属Clematis的黄花铁线莲组sect. Meclatis进行了全面修订, 确定此属含13种和13变种(包括1新变种和2新变种等级);写出了此组的分类学简史和地理分布, 并对其在铁线莲属中的系统位置和组内诸种的亲缘关系进行了讨论;还写出了此组的分种、分变种检索表, 以及各种植物的形态描述、地理分布、生长环境等, 并附有各种的插图.此组的花构造与对枝铁线莲组sect. Brachiatae

  8. Problemas associados ao uso de plantas medicinais comercializadas no Mercadão de Madureira, município do Rio de Janeiro, Brasil Problems associated with the use of medicinal plants commercialized in "Mercadão de Madureira", Rio de Janeiro City, Brazil

    Directory of Open Access Journals (Sweden)

    R. Bochner

    2012-01-01

    Full Text Available O uso de plantas medicinais pela população brasileira é prática tradicional, sendo muitas vezes o único recurso utilizado na atenção básica de saúde. O uso terapêutico dessas plantas envolve várias etapas da cadeia produtiva, sendo a procedência, coleta, secagem, armazenamento, comércio, modo de preparo pelo usuário e uso. O objetivo desse trabalho documental, de caráter exploratório, foi levantar a produção científica existente sobre os problemas associados a cada uma dessas etapas e discutir as questões relacionadas à carência de estudos para comprovar a eficácia farmacológica e a ausência de riscos toxicológicos, bem como a prática de autodiagnóstico. As vinte plantas mais comercializadas em grande mercado do município do Rio de Janeiro em agosto de 2007 serviram de base para o levantamento documental do presente estudo. Dessas, seis apresentaram propriedades tóxicas comprovadas dependendo do preparo e uso, a arnica (Solidago chilensis Meyen, aroeira (Shinus terebinthifolius Raddi., arruda (Ruta graveolens L., babosa (Aloe vera L., confrei (Symphytum officinale L. e poejo (Mentha pulegium Lam. & DC.. A Agência Nacional de Vigilância Sanitária aponta contra indicações para boldo-do-Chile (Peumus boldus Molina, chapéu-de-couro (Echinodorus macrophyllus Micheli, erva-cidreira (Lippia alba N.E.Br., erva-de-bicho (Polygonum spp., espinheira-santa (Maytenus spp., picão (Bidens pilosa L., poejo (Mentha pulegium Lam. e tanchagem (Plantago major L.. O abajerú, arnica, boldo-do-Chile, confrei, erva-de-bicho e espinheira-santa tiveram relato de problemas de identificação na coleta e comercialização frente a outras morfologicamente semelhantes. Plantas cultivadas e silvestres apresentam variabilidade de princípios ativos influenciados por fatores ambientais e genéticos, como chapéu-de-couro (Echinodorus macrophyllus Micheli, erva-cidreira (Lippia alba N.E.Br. e erva-de-bicho (Polygonum spp.. A contaminação e

  9. Aplicación de Tecnología de Barreras para la Conservación de Mezclas de Vegetales Mínimamente Procesados / Application of Barrier Technology for the Conservation of Minimally Processed Vegetables Mixtures

    Directory of Open Access Journals (Sweden)

    Alejandro Escobar Hernández

    2014-03-01

    Full Text Available Los vegetales son componentes esenciales de la dietahumana y su procesamiento trae como consecuencia el rápido deterioro ocasionado por el aumento de las reacciones metabólicas, esto hace necesario que se utilicen tecnologías emergentes de conservación. En este trabajo se estudió el efecto de la tecnología de barreras (desinfección, tratamiento térmico, recubrimiento comestible, atmósfera modificada y refrigeración sobre la vida útil de una mezcla de vegetales mínimamente procesados compuesta por brócoli (Brassica oleracea var. itálica, coliflor (Brassica oleracea var. botrytis, zucchini (Cucurbita pepo L., chayote (Sechium edule, apio (Apium graveolens y zanahoria (Daucus carota. Las barreras fueron aplicadas a las hortalizas para luego ser envasadas en dos tipos de bandejas (empaque en atmósfera modificada y empaque en bandeja sello plus. Los vegetales se almacenaron durante 12 días en refrigeración (4 °C y 95% HR, se llevaron a cabo análisis microbiológicos, físicoquímicos y sensoriales, y un estudio de vida útil. Los resultados mostraron que el proceso de desinfección con NaClO 100 ppm y el tratamiento térmico de 60 °C durante 2 min, tuvieron efecto en la reducción de la población microbiana para el día cero de evaluación. La calidad general se conservó para los 12 días dealmacenamiento, en la zanahoria, chayote, coliflor y apio. Laevaluación fisicoquímica presentó diferencias estadísticamente significativas de los parámetros evaluados con respecto al tiempo de almacenamiento. El estudio de vida útil arrojó tiempos de 7 y 5 días para la mezcla de vegetales empacada en bandeja sello plus en atmósfera modificada, respectivamente. La combinación debarreras se muestra como alternativa viable en la conservación de mezclas de vegetales mínimamente procesados. /  Vegetables are essential components of the human diet. However, rapid deterioration of vegetables occurs after

  10. 3D characterization of crack propagation in building stones

    Science.gov (United States)

    Fusi, N.; Martinez-Martinez, J.; Crosta, G. B.

    2012-04-01

    Opening of fractures can strongly modify mechanical characteristics of natural stones and thus significantly decrease stability of historical and modern buildings. It is commonly thought that fractures origin from pre-existing structures of the rocks, such as pores, veins, stylolythes (Meng and Pan, 2007; Yang et al., 2008). The aim of this study is to define relationships between crack formation and textural characteristics in massive carbonate lithologies and to follow the evolution of fractures with loading. Four well known Spanish building limestones and dolostones have been analysed: Amarillo Triana (AT): a yellow dolomitic marble, with fissures filled up by calcite and Fe oxides or hydroxides; Blanco Tranco (BT): a homogeneous white calcitic marble with pore clusters orientated parallel to metamorphic foliation; Crema Valencia (CV): a pinkish limestone (mudstone), characterized by abundant stilolythes, filled mainly by quartz (80%) and kaolin (11%); Rojo Cehegin (RC): a red fossiliferous limestone (packstone) with white veins, made up exclusively by calcite in crystals up to 300 micron. All lithotypes are characterized by homogeneous mineralogical composition (calcitic or dolomitic) and low porosity (<10%). Three cores 20 mm in diameter have been obtained for each lithotype. Uniaxial compressive tests have been carried out in order to induce sample fracturing by a series of successive steps with application of a progressive normal stress. Crack propagation has been checked after each stress level application by microCT-RX following Hg impregnation of the sample (in a Hg porosimeter). Combination of both tests (microCT-RX and Hg porosimeter) guarantees a better characterization of small defects and their progressive propagation inside low-porous rocks than by employing solely microCT-RX (Fusi et al., 2009). Due to the reduced dimensions of sample holder (dilatometers) in porosimeter, cores have been cut with a non standard h/d = 1.5. Several cycles of: a) Hg

  11. GAMBARAN PRAKTIK PENGGUNAAN JAMU OLEH DOKTER DI ENAM PROVINSI DI INDONESIA

    Directory of Open Access Journals (Sweden)

    Delima Delima

    2013-02-01

    Full Text Available Abstract Herbal medicine has been widely used. Government supports become more obvious since the declaration of “Saintifikasi Jamu” in Januari 2010 in Kendal, Central Java. To obtain this program, inventory of herbal medicine usage by physicians was conducted. This was a cross sectional descriptive study in 6 provinces of Java and Bali. Doctors registered as member of herbal medicine related association were invited and asked to fill a set of structured questionnaire. A total of 108 physicians using Indonesian herbal medicine participated in this study. They were either general practitioners or specialists with median age of 43 (range 26-70 years old. They (76.9% have used herbal medicine for 1-10 years with median of  2 patients per day (range 0-40. The physicians also practiced other traditional medicines such as acupuncture (47.2 %, massage (7.4 %, acupressure (6.5%. Besides prescribing herbal medicine to their patients, all physicians also consumed herbal medicine for themselves and their family. They used mainly with mono or combined herb in capsule and simplicia. Mostly herbal medicine were given to hypertension, dyslipidemia, diabetes mellitus, acute upper respiratory disease, hepatitis, hyperuricemia, osteoarthritis, diarrhea, cancer, and gastritis. Curcuma xanthorrhiza, Andrographis paniculata, Curcuma domestica (turmeric, Centella asiatica, Orthosiphon aristatus, Apium graveolens (celery, Phylanthus niruri, Guazuma ulmifolia, Zingiber officinale, and Curcuma zedoaria were prescribed. As conclusion, most of the herbal physician in Java and Bali prescribed Indonesian herbal medicine in this 10 years periode combined with foreign herbal medicine and other traditional medicines but still using conventional medicine as the highest standard of theraphy. Key words: herbal medicine, Saintifikasi Jamu, traditional medicine AbstrakPemanfaatan jamu telah berkembang luas. Dukungan pemerintahpun semakin jelas sejak dicanangkannya Saintifikasi

  12. Evaluation of the riparian forest state program in Pitangueiras county, Parana / Avaliação do programa estadual “Mata Ciliar” no município de Pitangueiras, Paraná

    Directory of Open Access Journals (Sweden)

    Cristovon Videira Ripol

    2009-10-01

    ão (Ocimum basilicum, melão-de-São-Caetano (Momordica charantia, arruda (Ruta graveolens, falso-boldo (Coleus barbatus, confrei (Symphitum officinalis, erva-de-bicho (Polygonum acre, feijão-de-porco (Canavalia ensiformis, funcho (Foeniculum vulgare, guiné (Petiveria alliacea, mentrasto (Ageratum conyzoides, mucuna-cinza (Mucuna pruriens e nim (Azadirachta indica. Água destilada foi adicionada ao solo como tratamento testemunha. Após 60 dias, avaliou-se a altura das plantas, o peso fresco da parte aérea e da raiz e os números de galhas e de ovos por sistema radicular. Os extratos de hortelã, bardana e mamona reduziram o número de galhas em 75,6%, 65,7% e 54,4%, e o número de ovos em 81,7%, 75,9% e 56,6%, respectivamente.

  13. Cloning, evolution and expression pattern analysis of M6PR gene in celery%芹菜中6-磷酸甘露糖还原酶基因的克隆、进化和表达分析

    Institute of Scientific and Technical Information of China (English)

    蒋倩; 王枫; 侯喜林; 马静; 李梦瑶; 熊爱生

    2013-01-01

    Full-lengths of cDNA sequences encoding mannose-6-phosphate reductase (M6PR)were cloned from celery (Apium graveolens) cultivars‘Jinnanshiqin' and‘Meiguoxiqin' with reverse transcript PCR (RT-PCR).Sequence analysis showed that the length of the gene was 930 bp,containing a complete open reading frame,which encoded 309 amino acids residues.Its relative molecular mass was 35×103,and pI was 6.38.Three-dimension structure analysis showed that M6PRs from the two celery cultivars were composed by 11 α-helices and 13 β-strands,among which there was a hydrophobic cavity.Catalysis was promoted by a conserved tetrad of active site residues (Tyr,Lys,Asp and His).Amino acid sequence comparison indicated that the M6PRs from ‘Jinnanshiqin' and‘Meiguoxiqin' had high similarity with the AKRs from Selaginella moellendorffii,Physcomitrella patens and Picea sitchensis.Quantitative real-time PCR analysis showed that M6PR gene was tissue-specific and was mainly expressed in the stem.%以2个芹菜品种‘津南实芹’和‘美国西芹’为试材,采用RT-PCR技术分别获得6-磷酸甘露糖还原酶(M6PR)cDNA 序列.序列分析表明:来源于2个芹菜品种的6-磷酸甘露糖还原酶基因核苷酸序列全长均为930 bp,编码309个氨基酸;预测其蛋白质相对分子质量为35×103,pI值为6.38.空间结构分析显示:M6PR蛋白由11个α-螺旋和13条β-延伸主链组成,中间形成1个疏水穴;催化四分体(Asp、Tyr、Lys和His)分布于疏水穴内部,具有催化活性.进化分析显示:芹菜M6PR与卷柏、小立碗藓、云杉等远古物种的醛-酮还原酶(AKR)相似性较高.实时定量PCR表达分析表明:M6PR基因主要在芹菜的茎中表达,具有明显的组织特异性.

  14. 蔬菜作物轮作对嫁接西瓜植株生理代谢与生长的影响%Effects of Rotation with Vegetables on Physiological Metabolism and Growth of Grafted Watermelon

    Institute of Scientific and Technical Information of China (English)

    盛萍萍; 宋尚成; 李敏; 刘润进

    2011-01-01

    With the continuous cropping 20 years soil of watermelon which was collected from the Chanle County, Shandong Province as control, we studied the effect to physiological metabolism and growing of grafting watermelon in the rotation soil of leeks, garlic, and celery. Results showed that rotation could increase root activity and growth of grafting watermelon, and the rotation treatment with celery was the best, of which stem diameter, fresh weight of root, leaf numbers per plant and root activity were increased 10.7% , 20. 3% , 10. 5% , 38. 8% respectively comparing with the control. The leaf chlorophyll content of grafted watermelon grown in rotation soil of leeks, garlic, and celery was significantly higher than that of the control, and grown in rotation soil of celery increased most, Chlorophyll A and Chlorophyll B increased 24.9% and 17.8% respectively comparing with the control. Net photo-synthetic rate of the control was inferior to others. The rotation was proved to increase the activity of SOD, POD, CAT, decreasing the contents of MDA, and it reduce most in the lamina of grafted watermelon in rotation soil of celery, which is 9. 1%. It was concluded that rotation could improve physiological metablism and grwoth of grafted watermelon and reducing replant disease.%以山东昌乐连作20年西瓜(Citrullus lanatus)的土壤为对照,比较轮作大葱(Allium fistulosum)、大蒜(Allium sativum)和芹菜(Apium graveolens)土壤对嫁接西瓜部分生理代谢与生长的影响,结果表明,轮作可以提高嫁接西瓜根系活力和生长量,其中以种植芹菜的处理根系活力最高,生长量最大,其茎粗、地下部鲜重、单株叶片数和根系活力分别比连作西瓜处理(对照)增加10.7%、20.3%、10.5%和38.8%;轮作大葱、大蒜和芹菜处理的西瓜叶片叶绿素含量显著高于对照,其中轮作芹菜增加最多,叶绿素a和叶绿素b含量分别比对照增加了24.9%和17.8%;连作西瓜处理的嫁接

  15. [Nesting habitat characterization for Amazona oratrix (Psittaciformes: Psittacidae) in the Central Pacific, Mexico].

    Science.gov (United States)

    Monterrubio-Rico, Tiberio C; Álvarez-Jara, Margarito; Tellez-Garcia, Loreno; Tena-Morelos, Carlos

    2014-09-01

    The nesting requirements of the Yellow-headed Parrot (Amazona oratrix) are poorly understood, despite their broad historical distribution, high demand for pet trade and current endangered status. Information concerning their nesting requirements is required in order to design specific restoration and conser- vation actions. To assess this, we studied their nesting ecology in the Central Pacific, Michoacan, Mexico during a ten year period. The analyzed variables ranged from local scale nest site characteristics such as nesting tree species, dimensions, geographic positions, diet and nesting forest patches structure, to large scale features such as vegetation use and climatic variables associated to the nesting tree distributions by an ecological niche model using Maxent. We also evaluated the parrot tolerance to land management regimes, and compared the Pacific nest trees with 18 nest trees recorded in an intensively managed private ranch in Tamaulipas, Gulf of Mexico. Parrots nested in tall trees with canopy level cavities in 92 nest-trees recorded from 11 tree species. The 72.8% of nesting occurred in trees of Astronium graveolens, and Enterolobium cyclocarpum which qualified as key- stone trees. The forests where the parrots nested, presented a maximum of 54 tree species, 50% of which were identified as food source; besides, these areas also had a high abundance of trees used as food supply. The lowest number of tree species and trees to forage occurred in an active cattle ranch, whereas the highest species rich- ness was observed in areas with natural recovery. The nesting cavity entrance height from above ground of the Pacific nesting trees resulted higher than those found in the Gulf of Mexico. We hypothesize that the differences may be attributed to Parrot behavioral differences adapting to differential poaching pressure and cavity avail- ability. Nesting trees were found in six vegetation types; however the parrots preferred conserved and riparian semi

  16. Aplicación de tratamiento térmico, recubrimiento comestible y baño químico como tratamientos poscosecha para la conservación de hortalizas mínimamente procesadas

    Directory of Open Access Journals (Sweden)

    Alejandro Escobar Hernández

    2014-01-01

    Full Text Available El consumo creciente ha estimulado el desarrollo de los vegetales cuarta gama o mínimamente procesados. Actualmente, se promueve el uso de tecnologías aplicadas a estos productos que les brinden mayor duración y garanticen la reducción de pérdidas poscosecha. En esta investigación se evaluó el efecto de tres de estas tecnologías poscosecha sobre la intensidad de la respiración y la calidad sensorial general de las hortalizas mínimamente procesadas: brócoli (Brassica oleracea var. Itálica, coliflor (Brassica oleracea var. Botrytis, zucchini (Cucurbita pepo L., apio (Apium graveolens, zanahoria (Daucus carota y chayote (Sechium edule. Para el recubrimiento comestible se utilizó pectina de bajo metoxilo (2%, cera carnauba (1%, glicerol (1.5% y ácido ascórbico (0.05%. El tratamiento térmico se hizo a 60 °C durante 2 min, con adición de ácido ascórbico (0.25%, ácido cítrico (0.5% y cloruro de calcio (0.025%. El baño químico se realizó con una solución de ácido cítrico (0.5%, ácido ascórbico (0.05% y cloruro de calcio (0.05%. La tasa de producción de CO2 se midió por el método estático, monitoreando la composición de los gases del espacio de cabeza durante 24 h a 8 °C y humedad relativa de 90%. La evaluación sensorial de color, aroma, crujencia y sabor objetable fueron las características organolépticas tomadas en cuenta para evaluar la calidad general de cada vegetal, la cual fue realizada con un panel de siete jueces previamente entrenados. Se utilizó un diseño de bloques completos al azar, siendo los bloques cada uno de los vegetales y las variables de respuesta la tasa de respiración y la calidad sensorial general. Se encontró que el tratamiento térmico y el recubrimiento comestible permitieron que los vegetales conservaran la calidad sensorial. El análisis estadístico no mostró diferencias significativas respecto al control (P > 0.05. La celeridad de la respiración disminuyó en el apio, el br

  17. Aspectos del dengue investigados en Santander

    Directory of Open Access Journals (Sweden)

    Ruth Martínez

    2004-03-01

    pt; font-family: Arial">4 Vigilancia del dengue basada en el laboratorio. Evaluamos el ELISA-IgM (7, el aislamiento viral (3,8,9 y la RT-PCR (9, para detectar la infección en la etapa febril de 101 casos con dengue. La IgM se encontró en 32.7% por el MAC-ELISA local y este resultado concordó en 35, 93 y 96.3% con los del UMELISA (SIVIGILA local, ELISA-PanBio y ELISA (IPK. Cuba, respectivamente. El virus se aisló de 29, 16.8 y 13.8% de los sueros dependiendo del procedimiento, siendo mayor por el del IPK (4. La RT-PCR resultó positiva en 23.8% casos y en 8% de negativos por los otros. Usando un único método, la infección se detectó en <33% de casos, pero con los 3 simultáneamente en hasta 57.4% (58/101.

    REFERENCIAS

    1. MINISTERIO DE SALUD. Prevención y Control del dengue. Informe ejecutivo, Sistema Nacional de Vigilancia (SIVIGILA 2000-2003.

    2. SECRETARÍA DE SALUD MUNICIPAL. ALCALDÍA DE BUCARAMANGA. Boletín Epidemiológico 2ª.Ed, 2003; 8-25.

    3. KOURI GP, GUZMÁN MG., BRAVO JR, TRIANA C. Dengue haemorrhagic fever/dengue shock syndrome: lessons from the Cuban epidemic, 1981. Bulletin WHO 1989; 67: 375-380.

    4. RODRÍGUEZ R, ÁLVAREZ M, GUZMÁN M, MORIER L, KOURI G. Comparison of rapid centrifugation assay with conventional tissue culture method for isolation of dengue

    2 virus in C6/36-HT cells. J Clin Microbiol 2000; 38: 3508-10.

    Cloning and expression analysis of gibberellin oxidase geneAgGA2ox from Apium graceolens under abiotic stress treatments%芹菜赤霉素氧化酶基因AgGA2ox的克隆及非生物逆境下表达分析

    Institute of Scientific and Technical Information of China (English)

    冯凯; 王广龙; 黄莹; 徐志胜; 黄蔚; 熊爱生

    2016-01-01

    Gibberellins (GAs) have important impacts on the growth and development of plants.GA2oxgene plays a crucial role in regulating gibberellins synthesis. TheAgGA2oxgene encoding GA oxidase was cloned from two celery cultivars, ‘Luhe Huangxinqin’ and ‘Ventura’, respectively. Sequence analysis revealed thatAg-GA2ox gene contained a full-length open reading frame of 996 bp, which encodes 331 amino acids. There are eight nucleotide sites and two amino acid residues differences in two cultivars. Relative molecular mass of Ag-GA2ox from ‘Luhe Huangxinqin’ and ‘Ventura’ were predicted to be 37 044.6 and 36 984.5, respectively. They showed the same theoretical isoelectric point (8.31). Phylogenetic analysis indicates that the GA2ox showed high evolutionary conservation among celery and other species, and the AgGA2ox was most closed toPanax quinquefolius. Quantitative real-time PCR analysis demonstrats that theAgGA2oxgene was tissue-speciifc in celery, and it mainly expressed in petiole.AgGA2oxgene was response to abiotic stress, such as low and high temperatures, drought, and salt stress. It was upregulated after low temperature treatment and downregulated after high temperature, drought, and salt treatments. Expression level differences ofAgGA2ox between ‘Luhe Huangxinqin’ and ‘Ventura’ may be related to the different abilities to abiotic resistance.%赤霉素(GAs)对植物生长发育有重要影响,赤霉素氧化酶基因(GA2ox)在GAs合成过程中起重要调控作用。本文从不同芹菜(Apium graveolens)品种‘六合黄心芹’和‘文图拉’中分别克隆得到编码赤霉素氧化酶的基因AgGA2ox,序列分析显示两个品种AgGA2ox基因均包含一个全长996 bp的开放阅读框,编码331个氨基酸,在核苷酸水平上有8个碱基位点的差异,氨基酸水平上有2个位点的差异。AgGA2ox蛋白在‘六合黄心芹’和‘文图拉’两个品种中的相对分子质量分别为37044.6和36984.5,理