WorldWideScience

Sample records for burn sheep small

  1. Global Burned Area and Biomass Burning Emissions from Small Fires

    Science.gov (United States)

    Randerson, J. T.; Chen, Y.; vanderWerf, G. R.; Rogers, B. M.; Morton, D. C.

    2012-01-01

    In several biomes, including croplands, wooded savannas, and tropical forests, many small fires occur each year that are well below the detection limit of the current generation of global burned area products derived from moderate resolution surface reflectance imagery. Although these fires often generate thermal anomalies that can be detected by satellites, their contributions to burned area and carbon fluxes have not been systematically quantified across different regions and continents. Here we developed a preliminary method for combining 1-km thermal anomalies (active fires) and 500 m burned area observations from the Moderate Resolution Imaging Spectroradiometer (MODIS) to estimate the influence of these fires. In our approach, we calculated the number of active fires inside and outside of 500 m burn scars derived from reflectance data. We estimated small fire burned area by computing the difference normalized burn ratio (dNBR) for these two sets of active fires and then combining these observations with other information. In a final step, we used the Global Fire Emissions Database version 3 (GFED3) biogeochemical model to estimate the impact of these fires on biomass burning emissions. We found that the spatial distribution of active fires and 500 m burned areas were in close agreement in ecosystems that experience large fires, including savannas across southern Africa and Australia and boreal forests in North America and Eurasia. In other areas, however, we observed many active fires outside of burned area perimeters. Fire radiative power was lower for this class of active fires. Small fires substantially increased burned area in several continental-scale regions, including Equatorial Asia (157%), Central America (143%), and Southeast Asia (90%) during 2001-2010. Globally, accounting for small fires increased total burned area by approximately by 35%, from 345 Mha/yr to 464 Mha/yr. A formal quantification of uncertainties was not possible, but sensitivity

  2. Global burned area and biomass burning emissions from small fires

    Science.gov (United States)

    Randerson, J. T.; Chen, Y.; van der Werf, G. R.; Rogers, B. M.; Morton, D. C.

    2012-12-01

    In several biomes, including croplands, wooded savannas, and tropical forests, many small fires occur each year that are well below the detection limit of the current generation of global burned area products derived from moderate resolution surface reflectance imagery. Although these fires often generate thermal anomalies that can be detected by satellites, their contributions to burned area and carbon fluxes have not been systematically quantified across different regions and continents. Here we developed a preliminary method for combining 1-km thermal anomalies (active fires) and 500 m burned area observations from the Moderate Resolution Imaging Spectroradiometer (MODIS) to estimate the influence of these fires. In our approach, we calculated the number of active fires inside and outside of 500 m burn scars derived from reflectance data. We estimated small fire burned area by computing the difference normalized burn ratio (dNBR) for these two sets of active fires and then combining these observations with other information. In a final step, we used the Global Fire Emissions Database version 3 (GFED3) biogeochemical model to estimate the impact of these fires on biomass burning emissions. We found that the spatial distribution of active fires and 500 m burned areas were in close agreement in ecosystems that experience large fires, including savannas across southern Africa and Australia and boreal forests in North America and Eurasia. In other areas, however, we observed many active fires outside of burned area perimeters. Fire radiative power was lower for this class of active fires. Small fires substantially increased burned area in several continental-scale regions, including Equatorial Asia (157%), Central America (143%), and Southeast Asia (90%) during 2001-2010. Globally, accounting for small fires increased total burned area by approximately by 35%, from 345 Mha/yr to 464 Mha/yr. A formal quantification of uncertainties was not possible, but sensitivity

  3. Combined anticoagulants ameliorate acute lung injury in sheep after burn and smoke inhalation.

    Science.gov (United States)

    Enkhbaatar, Perenlei; Esechie, Aimalohi; Wang, Jianpu; Cox, Robert A; Nakano, Yoshimitsu; Hamahata, Atsumori; Lange, Matthias; Traber, Lillian D; Prough, Donald S; Herndon, David N; Traber, Daniel L

    2008-02-01

    Burn and smoke inhalation-related multiple organ dysfunction is associated with a severe fall in the plasma concentration of antithrombin. Therefore the aim of the present study was to test the hypothesis that intravenous administration of recombinant human antithrombin in combination with aerosolized heparin will ameliorate acute lung injury in sheep exposed to cutaneous burn and smoke inhalation. Sheep were prepared operatively for study and, 7 days post-surgery, sheep were given a cutaneous burn (40% of total body surface area, third-degree burn) and insufflated with cotton smoke (48 breaths, injury, sheep were placed on a ventilator and resuscitated with Ringer's lactate solution. The animals were divided into three groups: sham group (non-injured and non-treated; n=6), saline group (injured and received saline; n=6) and rhAT.iv.+Hep group [injured and treated with rhAT (recombinant human antithrombin) and heparin; n=6]. In the rhAT.iv.+Hep group, rhAT was infused continuously for 48 h starting 1 h post-injury with a dose of 0.34 mg.h(-1).kg(-1) of body weight and heparin (10000 units) was aerosolized every 4 h starting at 1 h post-injury. The experiment lasted 48 h. Haemodynamics were stable in sham group, whereas the saline-treated sheep developed multiple signs of acute lung injury, including decreased pulmonary gas exchange, increased inspiratory pressures, extensive airway obstruction and increased pulmonary oedema. These pathological changes were associated with a severe fall in plasma antithrombin concentration, lung tissue accumulation of leucocytes and excessive production of NO. Treatment of injured sheep with anticoagulants attenuated all of the pulmonary pathophysiology observed. In conclusion, the results provide definitive evidence that anticoagulant therapy may be a novel and effective treatment tool in the management of burn patients with concomitant smoke inhalation injury.

  4. Aerosolized anticoagulants ameliorate acute lung injury in sheep after exposure to burn and smoke inhalation.

    Science.gov (United States)

    Enkhbaatar, Perenlei; Cox, Robert A; Traber, Lillian D; Westphal, Martin; Aimalohi, Esechie; Morita, Naoki; Prough, Donald S; Herndon, David N; Traber, Daniel L

    2007-12-01

    Acute lung injury is a detrimental complication for victims of burn accidents. Airway obstruction plays an important role in pulmonary dysfunction in these patients. In this study, we tested the hypothesis that aerosolized anticoagulants will reduce the degree of airway obstruction and improve pulmonary function in sheep with severe combined burn and smoke inhalation injury by preventing the formation of airway fibrin clots. Prospective, randomized, controlled, experimental animal study. Investigational intensive care unit at a university hospital. Adult female sheep. After 7 days of surgical recovery, sheep were given a cutaneous burn (40% of total body surface, third degree) and insufflated with cotton smoke (48 breaths, injury, sheep were placed on ventilators and resuscitated with lactated Ringer's solution. Sheep were randomly divided into five groups: sham, noninjured and nontreated (n = 6); control, injured and aerosolized with saline (n = 6); recombinant human antithrombin (rhAT) + heparin, injured and aerosolized with rhAT (290 units for each) and heparin (10,000 units for each) (n = 6); rhAT, injured and aerosolized with rhAT alone (290 units for each; n = 5); and heparin, injured and aerosolized with heparin alone (10,000 units for each; n = 5). rhAT and heparin were aerosolized every 4 hrs, starting at 2 hrs postinjury. Cardiopulmonary hemodynamics were monitored during a 48-hr experimental time period. Control sheep developed multiple signs of acute lung injury. This pathophysiology included decreased pulmonary gas exchange and lung compliance, increased pulmonary edema, and extensive airway obstruction. These variables were stable in sham animals. The aerosolization of rhAT or heparin alone did not significantly improve deteriorated pulmonary gas exchange. However, aerosolization of these anticoagulants in combination significantly attenuated all the observed pulmonary pathophysiology. The results provide definitive evidence that aerosolized rhAT and

  5. The Industrial Fluorosis Caused by a Coal-Burning Power Station and its Effects on Sheep

    OpenAIRE

    FİDANCI, Ulvi Reha; SEL, Tevhide

    2001-01-01

    The aim of this investigation was to examine the industrial fluorosis caused by the coal burning power station in Muğla-Yatağan. Blood and urine samples of sheep, and water, plant and soil samples from around the power station were collected four times throughout the year to cover all four seasons. Fluoride ion concentrations in the water, urine, plant and soil samples were detected potentiometrically using an ion selective electrode. Serum Alkaline phosphatase (ALP-EC 3.1.3.1), Alanine amino...

  6. Catalytic combustion in small wood burning appliances

    Energy Technology Data Exchange (ETDEWEB)

    Oravainen, H. [VTT Energy, Jyvaeskylae (Finland)

    1996-12-31

    There is over a million hand fired small heating appliances in Finland where about 5,4 million cubic meters of wood fuel is used. Combustion in such heating appliances is a batch-type process. In early stages of combustion when volatiles are burned, the formation of carbon monoxide (CO) and other combustible gases are difficult to avoid when using fuels that have high volatile matter content. Harmful emissions are formed mostly after each fuel adding but also during char burnout period. When the CO-content in flue gases is, say over 0.5 %, also other harmful emissions will be formed. Methane (CH{sub 4}) and other hydrocarbons are released and the amount of polycyclic aromatic hydrocarbons (PAH)-compounds can be remarkable. Some PAH-compounds are very carcinogenic. It has been estimated that in Finland even more than 90 % of hydrocarbon and PAH emissions are due to small scale wood combustion. Emissions from transportation is excluded from these figures. That is why wood combustion has a net effect on greenhouse gas phenomena. For example carbon monoxide emissions from small scale wood combustion are two fold compared to that of energy production in power plants. Methane emission is of the same order as emission from transportation and seven fold compared with those of energy production. Emissions from small heating appliances can be reduced by developing the combustion techniques, but also by using other means, for example catalytic converters. In certain stages of the batch combustion, temperature is not high enough, gas mixing is not good enough and residence time is too short for complete combustion. When placed to a suitable place inside a heating appliance, a catalytic converter can oxidize unburned gases in the flue gas into compounds that are not harmful to the environment. (3 refs.)

  7. Up-regulation of the parathyroid calcium-sensing receptor after burn injury in sheep: a potential contributory factor to postburn hypocalcemia.

    Science.gov (United States)

    Murphey, E D; Chattopadhyay, N; Bai, M; Kifor, O; Harper, D; Traber, D L; Hawkins, H K; Brown, E M; Klein, G L

    2000-12-01

    To test the hypothesis that the hypocalcemia and hypoparathyroidism that follow severe burn injury are related to up-regulation of the parathyroid gland calcium-sensing receptor (CaR), which may reduce the set-point for suppression of circulating parathyroid hormone by blood calcium. A controlled but unblinded study. An investigational intensive care unit. Female range ewes. Sheep were subjected to a 40% total body surface area burn under anesthesia (n = 9) or sham burn receiving anesthesia and fluid resuscitation only (n = 8) and were killed 48 hrs postburn. Blood ionized calcium, magnesium, and creatinine, and urinary calcium, magnesium, and creatinine were monitored for 48 hrs. After the sheep were killed, parathyroids (burn group, n = 3; sham group, n = 4) and kidneys (n = 4, each group) were harvested, snap frozen in liquid nitrogen, and analyzed for CaR messenger ribonucleic acid (mRNA) by Northern blot, and were analyzed for CaR cell-surface staining by immunocytochemistry with a polyclonal CaR-specific antiserum (parathyroids only). Bumed sheep were hypocalcemic and hypomagnesemic compared with sham-burned control sheep. CaR mRNA was increased by 50% (p sheep. These findings are consistent with up-regulation of the parathyroid CaR and a related decrease in set-point for calcium suppression of parathyroid hormone secretion that may contribute to the previously reported postburn hypoparathyroidism and hypocalcemia.

  8. Costs-Returns Analysis of Small Ruminant (Sheep) Production in ...

    African Journals Online (AJOL)

    Data collected were analyzed using descriptive statistics and costs-returns analysis. Results from the analysis revealed that a net returns of N1,942,400.00 was realized with N 33.72 made on every naira invested. Sheep production is a profitable farming business, with attractive net return on investment. This study also ...

  9. Molecular characterization and phylogenetic analysis of small ruminant lentiviruses isolated from Canadian sheep and goats

    Directory of Open Access Journals (Sweden)

    Bertoni Giuseppe

    2011-06-01

    Full Text Available Abstract Background Small Ruminant Lentiviruses (SRLV are widespread in Canadian sheep and goats and represent an important health issue in these animals. There is however no data about the genetic diversity of Caprine Arthritis Encephalitis Virus (CAEV or Maedi Visna Virus (MVV in this country. Findings We performed a molecular and phylogenetic analysis of sheep and goat lentiviruses from a small geographic area in Canada using long sequences from the gag region of 30 infected sheep and 36 infected goats originating from 14 different flocks. Pairwise DNA distance and phylogenetic analyses revealed that all SRLV sequences obtained from sheep clustered tightly with prototypical Maedi visna sequences from America. Similarly, all SRLV strains obtained from goats clustered tightly with prototypical US CAEV-Cork strain. Conclusions The data reported in this study suggests that Canadian and US SRLV strains share common origins. In addition, the molecular data failed to bring to light any evidence of past cross species transmission between sheep and goats, which is consistent with the type of farming practiced in this part of the country where single species flocks predominate and where opportunities of cross species transmissions are proportionately low.

  10. Burns

    Science.gov (United States)

    ... doing so puts you in danger as well. Chemical and Electrical Burns For chemical and electrical burns, call 911 or ... the power source has been turned off. For chemical burns: Dry chemicals should be brushed off the skin ...

  11. Clonal diversity of Staphylococcus aureus originating from the small ruminants goats and sheep.

    Science.gov (United States)

    Porrero, M Concepción; Hasman, Henrik; Vela, Ana I; Fernández-Garayzábal, Jose F; Domínguez, Lucas; Aarestrup, Frank M

    2012-04-23

    Staphylococcus aureus is an important pathogen in humans and many animal species. The prevalence of different clonal types in animal species remains largely unknown. We analyzed 267 S. aureus from intramammary infections in goats (47) and sheep (220) by spa typing, multi-locus sequence typing (MLST) and antimicrobial susceptibility. The most frequent spa types in goats were t337 (N=9), t759 (N=6) and t1534 (N=5). Sheep isolates mainly belonged to spa types t1534 (N=72), t2678 (N=29) and t3576 (N=20). Eighteen novel spa-types were observed; two from goat strains, 13 from sheep and three in both species. The majority of the goat strains grouped in MLST CC133 (N=10) and ST522 (N=10), followed by CC9 (N=9), while the majority of the sheep strains were of ST522 (N=108) followed by CC133 (N=86) and CC130 (N=11). Nine new MLST types were detected; three in goat and sheep isolates (ST1739, ST1758 and ST1780), two identified in goats only (ST1740 and ST2061) and four in sheep only (ST1742, ST1743, ST1781 and ST2011). Strains showed resistance below 20% against penicillin and tetracycline; a strong association between CC-types and penicillin resistance was observed. No resistance was detected to cefoxitin, quinupristin-dalfopristin, rifampicin and vancomycin. This study suggests that ST522 is the most common S. aureus clone associated with small ruminants followed by CC133. Copyright © 2011 Elsevier B.V. All rights reserved.

  12. Identification and Classification of New Transcripts in Dorper and Small-Tailed Han Sheep Skeletal Muscle Transcriptomes.

    Science.gov (United States)

    Chao, Tianle; Wang, Guizhi; Wang, Jianmin; Liu, Zhaohua; Ji, Zhibin; Hou, Lei; Zhang, Chunlan

    2016-01-01

    High-throughput mRNA sequencing enables the discovery of new transcripts and additional parts of incompletely annotated transcripts. Compared with the human and cow genomes, the reference annotation level of the sheep genome is still low. An investigation of new transcripts in sheep skeletal muscle will improve our understanding of muscle development. Therefore, applying high-throughput sequencing, two cDNA libraries from the biceps brachii of small-tailed Han sheep and Dorper sheep were constructed, and whole-transcriptome analysis was performed to determine the unknown transcript catalogue of this tissue. In this study, 40,129 transcripts were finally mapped to the sheep genome. Among them, 3,467 transcripts were determined to be unannotated in the current reference sheep genome and were defined as new transcripts. Based on protein-coding capacity prediction and comparative analysis of sequence similarity, 246 transcripts were classified as portions of unannotated genes or incompletely annotated genes. Another 1,520 transcripts were predicted with high confidence to be long non-coding RNAs. Our analysis also revealed 334 new transcripts that displayed specific expression in ruminants and uncovered a number of new transcripts without intergenus homology but with specific expression in sheep skeletal muscle. The results confirmed a complex transcript pattern of coding and non-coding RNA in sheep skeletal muscle. This study provided important information concerning the sheep genome and transcriptome annotation, which could provide a basis for further study.

  13. The Dynamic Distribution of Small-Tail Han Sheep Microbiota across Different Intestinal Segments

    Directory of Open Access Journals (Sweden)

    Hao Zhang

    2018-01-01

    Full Text Available The sheep intestinal tract is characterized by a diverse microbial ecosystem that is vital for the host to digest diet material. The importance of gut microbiota (GM of animals has also been widely acknowledged because of its pivotal roles in the health and well-being of animals. However, there are no relevant studies on GM of small-tail Han sheep, a superior mutton variety domestic in China. In this study, the structure and distribution of gut microflora were studied by high-throughput sequencing technology. Results showed a significant difference between jejunum and cecum, jejunum, and rectum. Meanwhile, the cecum and rectum not only display higher species richness but also exhibit higher similarity of the bacterial diversity than that of the jejunum based on the results of abundance-based coverage estimator (ACE, Chao1, and Shannon indexes. Firmicutes and Bacteroidetes were the predominant phyla in cecum and rectum, while higher relative abundances of Firmicutes and Cyanobacteria were observed in jejunum. At the genus level, Bacteroidetes, Ruminococcus, Lactobacillus, Flavonifractor, and Clostridium were the dominant genera in the cecum and rectum. An obvious dynamic distribution of Lactobacillus is continuously decreasing from the jejunum to the cecum, then to the rectum, whereas the result of Bacteroides is completely inverse. In addition, this study also found many kinds of bacteria associated with the production of volatile fatty acids (VFA colonized in the large intestine. This study is the first to investigate the distribution of intestinal flora in small-tail Han sheep. The findings provide an important indication for diagnosis and treatment of intestinal diseases in small-tail Han sheep, as well as offer a direction for the development of intestinal microecological preparations.

  14. Genome-wide transcriptome analysis between small-tail Han sheep and the Surabaya fur sheep using high-throughput RNA sequencing.

    Science.gov (United States)

    Miao, Xiangyang; Luo, Qingmiao

    2013-06-01

    The small-tail Han sheep and the Surabaya fur sheep are two local breeds in north China, which are characterized by high-fecundity and low-prolificacy breed respectively. Significant genetic differences between these two breeds have provided increasing interests in the identification and utilization of major prolificacy genes in these sheep. High prolificacy is a complex trait, and it is difficult to comprehensively identify the candidate genes related to this trait using the single molecular biology technique. To understand the molecular mechanisms of fecundity and provide more information about high prolificacy candidate genes in high- and low-fecundity sheep, we explored the utility of next-generation sequencing technology in this work. A total of 1.8 Gb sequencing reads were obtained and resulted in more than 20 000 contigs that averaged ∼300 bp in length. Ten differentially expressed genes were further verified by quantitative real-time RT-PCR to confirm the reliability of RNA-seq results. Our work will provide a basis for the future research of the sheep reproduction.

  15. Phenoxy and picolinic acid herbicides and small-intestinal adenocarcinoma in sheep.

    Science.gov (United States)

    Newell, K W; Ross, A D; Renner, R M

    1984-12-08

    A study of age and sex matched groups of adult female sheep from 88 flat, hill, and high-country farms was conducted in the South Island of New Zealand to investigate the influence of breed and certain environmental factors on the prevalence rate of small-intestinal adenocarcinoma (SIA). 20 678 female sheep aged 5.5-7.5 years were examined at slaughter, 125 cases of SIA were found (6 per thousand) in animals from 61 farms (69%) and the prevalence rate for individual farm groups varied from 0 to 38 per thousand. Differences in tumour rate between breed groups were significant but differences between farm type were not. Exposure to phenoxy (Ph), picolinic acid (Pi) herbicides, or both (PhPi) was associated with significant increases in tumour rate. The increase in rate was significant for exposure to each of the 3 herbicide groups. Exposure to recently sprayed feed stuffs was associated with a significantly larger increase in tumour rate than exposure to less recently sprayed food. There was no difference between tumour rates of sheep exposed to Ph herbicides with or without 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Rates rose significantly with the total number of Ph, Pi, PhPi sprays used on the farm. The variation in rates associated with herbicides is sufficient to explain the breed differences recorded.

  16. Recovery of small pile burn scars in conifer forests of the Colorado Front Range

    Science.gov (United States)

    Charles C. Rhoades; Paula J. Fornwalt; Mark W. Paschke; Amber Shanklin; Jayne L. Jonas

    2015-01-01

    The ecological consequences of slash pile burning are a concern for land managers charged with maintaining forest soil productivity and native plant diversity. Fuel reduction and forest health management projects have created nearly 150,000 slash piles scheduled for burning on US Forest Service land in northern Colorado. The vast majority of these are small piles (

  17. Characterization and comparative analyses of muscle transcriptomes in Dorper and small-tailed Han sheep using RNA-Seq technique.

    Directory of Open Access Journals (Sweden)

    Chunlan Zhang

    Full Text Available The sheep is an important domestic animal and model for many types of medically relevant research. An investigation of gene expression in ovine muscle would significantly advance our understanding of muscle growth. RNA-seq is a recently developed analytical approach for transcriptome profiling via high-throughput sequencing. Although RNA-seq has been recently applied to a wide variety of organisms, few RNA-seq studies have been conducted in livestock, particularly in sheep. In this study, two cDNA libraries were constructed from the biceps brachii of one Small-tailed Han sheep (SH and one Dorper sheep (DP. The Illumina high-throughput sequencing technique and bioinformatics were used to determine transcript abundances and characteristics. For the SH and DP libraries, we obtained a total of 50,264,608 and 52,794,216 high quality reads, respectively. Approximately two-thirds of the reads could be mapped to the sheep genome. In addition, 40,481 and 38,851 potential coding single nucleotide polymorphisms (cSNPs were observed, respectively, of which a total of 59,139 cSNP coordinates were different between the two samples. Up to 5,116 and 5,265 respective reference genes had undergone 13,827 and 15,684 alternative splicing events. A total of 6,989 reference genes were extended at the 5', 3' or both ends, and 123,678 novel transcript units were found. A total of 1,300 significantly differentially expressed genes were identified between the two libraries. These results suggest that there are many differences in the muscle transcriptomes between these two animals. This study addresses a preliminary analysis and offers a foundation for future genomic research in the sheep.

  18. Clonal diversity of Staphylococcus aureus originating from the small ruminants goats and sheep

    DEFF Research Database (Denmark)

    Concepción Porrero, M.; Hasman, Henrik; Vela, Ana I.

    2012-01-01

    Staphylococcus aureus is an important pathogen in humans and many animal species. The prevalence of different clonal types in animal species remains largely unknown. We analyzed 267 S. aureus from intramammary infections in goats (47) and sheep (220) by spa typing, multi-locus sequence typing (MLST......) and antimicrobial susceptibility. The most frequent spa types in goats were t337 (N = 9), t759 (N = 6) and t1534 (N = 5). Sheep isolates mainly belonged to spa types t1534 (N = 72), t2678 (N = 29) and t3576 (N = 20). Eighteen novel spa-types were observed; two from goat strains, 13 from sheep and three in both...

  19. Economic evaluation of genomic selection in small ruminants: a sheep meat breeding program.

    Science.gov (United States)

    Shumbusho, F; Raoul, J; Astruc, J M; Palhiere, I; Lemarié, S; Fugeray-Scarbel, A; Elsen, J M

    2016-06-01

    Recent genomic evaluation studies using real data and predicting genetic gain by modeling breeding programs have reported moderate expected benefits from the replacement of classic selection schemes by genomic selection (GS) in small ruminants. The objectives of this study were to compare the cost, monetary genetic gain and economic efficiency of classic selection and GS schemes in the meat sheep industry. Deterministic methods were used to model selection based on multi-trait indices from a sheep meat breeding program. Decisional variables related to male selection candidates and progeny testing were optimized to maximize the annual monetary genetic gain (AMGG), that is, a weighted sum of meat and maternal traits annual genetic gains. For GS, a reference population of 2000 individuals was assumed and genomic information was available for evaluation of male candidates only. In the classic selection scheme, males breeding values were estimated from own and offspring phenotypes. In GS, different scenarios were considered, differing by the information used to select males (genomic only, genomic+own performance, genomic+offspring phenotypes). The results showed that all GS scenarios were associated with higher total variable costs than classic selection (if the cost of genotyping was 123 euros/animal). In terms of AMGG and economic returns, GS scenarios were found to be superior to classic selection only if genomic information was combined with their own meat phenotypes (GS-Pheno) or with their progeny test information. The predicted economic efficiency, defined as returns (proportional to number of expressions of AMGG in the nucleus and commercial flocks) minus total variable costs, showed that the best GS scenario (GS-Pheno) was up to 15% more efficient than classic selection. For all selection scenarios, optimization increased the overall AMGG, returns and economic efficiency. As a conclusion, our study shows that some forms of GS strategies are more advantageous

  20. Prevalence of small ruminant lentivirus and Mycobacterium avium subsp. paratuberculosis co-infection in Ontario dairy sheep and dairy goats.

    Science.gov (United States)

    Stonos, Nancy; Bauman, Cathy; Menzies, Paula; Wootton, Sarah K; Karrow, Niel A

    2017-04-01

    Infection with small ruminant lentiviruses (SRLV) causes a variety of chronic inflammatory conditions that limit production. Mycobacterium avium subsp. paratuberculosis (MAP) is also a major production-limiting disease of sheep and goats, which causes severe inflammation of the small intestine. Previous studies have indicated that both SRLV and MAP are widespread in small ruminants in Ontario. This study estimated the prevalence of SRLV and MAP co-infection. Serum samples that were previously tested for MAP infection were re-tested for SRLV. The apparent prevalence of co-infection was low, with 3.4% [95% confidence interval (CI): 1.9 to 5.9] and 14.3% (95% CI: 11.6 to 17.5) of sheep and goats respectively, positive for both infections. However, co-infection is widespread with 36.8% (95% CI: 19.1 to 59.1) and 71.4% (95% CI: 52.8 to 84.9) of sheep and goat farms with 1 or more co-infected animals. A significant association was found between SRLV seropositivity and MAP fecal culture (P = 0.021), suggesting that co-infected goats may be more likely to shed MAP in their feces.

  1. Evaluation of production and reproduction of sheep, goat and alpaca genotypes in the Small Ruminant Collaborative Research Support Program.

    Science.gov (United States)

    Bradford, G E; Burfening, P J; Cartwright, T C

    1989-11-01

    Research has been conducted as part of the Small Ruminant Collaborative Research Support Program (SR-CRSP) on evaluation of genetic resources and methods of effecting genetic improvement of small ruminants in the participating countries. In Kenya, the focus has been on development of a dual-purpose goat for milk and meat production in farming areas, utilizing two locally adapted breeds, Galla and East African, and two imported dairy breeds, Anglo-Nubian and Toggenburg, into a single stock. That research now has reached the stage of field testing. In Morocco, the performance of a highly prolific breed of sheep, the D'Man, and of a less prolific but larger breed, commonly raised under extensive management, the Sardi, and of their F1, F2 and backcross progeny has been evaluated for several reproduction and growth traits. Prolificacy of the D'Man was transmitted additively, but there was favorable heterosis for age at puberty, fertility and growth rate, resulting in substantial heterosis in total performance. In Indonesia, a high degree of variability in prolificacy in sheep appears to be due to segregation of a gene with large effect on ovulation rate, similar in some respects to the Booroola gene. In Peru, work has involved evaluation of effectiveness of current selection programs and estimation of phenotypic and genetic parameters, in unimproved and improved types of sheep, with a limited amount of work also on alpacas. Fiber production is the principal economic trait in alpacas. There also has been work on evaluation of hair sheep in Brazil, Kenya and Indonesia.

  2. Risk assessment of sheep welfare at small-scale slaughter in Nordic countries, comparing with large-scale slaughter.

    Science.gov (United States)

    Hultgren, Jan; Algers, Bo; Atkinson, Sophie; Ellingsen, Kristian; Eriksson, Sofia; Hreinsson, Kjartan; Nordensten, Lotta; Valtari, Heidi; Mejdell, Cecilie Marie

    2016-06-01

    During the pre-slaughter period, animals experience novel environment and procedures which may cause reduced welfare and suffering. Over the last decades, the slaughter industry has restructured into fewer and larger abattoirs, implying potential risks of transport stress, injuries, and impaired animal welfare. Since recently, however, there is growing interest in small-scale slaughter to supply locally or regionally produced meat. Risk managers at all levels thus need to assess animal welfare risks also at small-scale operations. This study aimed to assess risks of poor animal welfare at small-scale lamb slaughter (≤5000 sheep/year and ≤70 sheep/day) in Norway, Iceland, Sweden and Finland, and to compare these risks to large-scale industrial slaughter. Assessment was done applying an individual expert opinion approach during a 2-day workshop. Nine experts in lamb slaughter procedures, behaviour, physiology, health, scoring schemes and/or risk assessment provided estimates of exposure, likelihood of negative consequences following exposure, and intensity and duration of negative consequences for 71 hazards. The methods applied mainly adhered to the risk assessment guidelines of the European Food Safety Authority. The list of hazards was modified from an earlier study and distributed to the experts before the assessment. No other literature was reviewed specifically for the purpose of the assessment. The highest risks to animal welfare identified in both small- and large-scale slaughter were related to inadequate conditions during overnight lairage at the slaughter plant. For most hazards, risk estimates were lower in small-scale slaughter. The reverse was true for splitting of groups and separation of one sheep from the group. Small-scale slaughter has a potential for improved sheep welfare in comparison with large-scale industrial slaughter. Keeping the animals overnight at the slaughterhouse and prolonged fasting before slaughter should be avoided. Solutions

  3. The Effect of Comic Book’s Story Character and Color on Farmers’ Knowledge Gain About Small Sheep Farm Management in Kulur, District of Majalengka, West Java, Indonesia

    Directory of Open Access Journals (Sweden)

    S. R. Satmoko

    2009-12-01

    Full Text Available What kind of comic book’s character was best suited to small sheep farmers, what was their preferred color, and what were the combined effects of such characters and color on the farmers’ knowledge about small sheep farm management? These questions directed researchers to design a 2x2 factorial quasi experimental study. Four farmer groups were involved in the study. The results indicated that the comic book characters’ effect on the farmers’ knowledge gains was highly significant; the comic book’s color effect on the farmers’ knowledge gains was also significant, and the combined effect of the comic book’s character and colors was not significant. Further tests demonstrated that the farmer group exposed to the colored comic book with human character performed much better than the other three groups in the posttests. So, the conclusion was that farmers preferred the colored comic book with human character to learn the small sheep farm management.

  4. Phylogenetic analysis of small ruminant lentiviruses in mixed flocks: multiple evidence of dual infection and natural transmission of types A2 and B1 between sheep and goats.

    Science.gov (United States)

    Fras, Marion; Leboeuf, Anne; Labrie, François-Mikaël; Laurin, Marc-André; Singh Sohal, Jagdip; L'Homme, Yvan

    2013-10-01

    Previous molecular analyses of small ruminant lentivirus (SRLV) populations in single species herds in Quebec, Canada, have revealed a relatively simple structure where goats and sheep appeared exclusively infected with B1 and A2 subtypes respectively. The present work aimed at extending these earlier findings with the analysis of SRLVs in mixed flocks. Molecular analyses revealed a more complex picture of SRLV population structure in mixed herds compared to single species herds. Notably, phylogenetic analyses of long gag sequences strongly support transmission of A2 subtype from sheep to goats as well as transmission of B1 subtype from goats to sheep. Hence, this work uncovered for the first time natural transmission between sheep and goats of North American subtype A2. In addition, multiple evidences of mixed infection of sheep and goats with A2 and B1 subtypes were found. The data reported in this study reinforces the concept of a genetic continuum of SRLVs where strains are exchanged between sheep and goats under favourable conditions and in the absence of specific species barriers. Most interestingly, this study suggests that dual infection, which is a hallmark of the lentivirus paradigm HIV, may not be such rare events in small ruminants but may simply be understudied and underreported. Overall, the present data shows that sheep and goats in Canada can be infected with both SRLV A and B types, sometimes simultaneously, and that mixed flocks may represent a breeding ground for their evolution. Crown Copyright © 2013. Published by Elsevier B.V. All rights reserved.

  5. X-ray crystal structure and small-angle X-ray scattering of sheep liver sorbitol dehydrogenase

    DEFF Research Database (Denmark)

    Yennawar, Hemant; Møller, Magda; Gillilan, Richard

    2011-01-01

    The X-ray crystal structure of sheep liver sorbitol dehydrogenase (slSDH) has been determined using the crystal structure of human sorbitol dehydrogenase (hSDH) as a molecular-replacement model. slSDH crystallized in space group I222 with one monomer in the asymmetric unit. A conserved tetramer...... that superposes well with that seen in hSDH (despite belonging to a different space group) and obeying the 222 crystal symmetry is seen in slSDH. An acetate molecule is bound in the active site, coordinating to the active-site zinc through a water molecule. Glycerol, a substrate of slSDH, also occupies...... the substrate-binding pocket together with the acetate designed by nature to fit large polyol substrates. The substrate-binding pocket is seen to be in close proximity to the tetramer interface, which explains the need for the structural integrity of the tetramer for enzyme activity. Small-angle X...

  6. Small-Ion and Nano-Aerosol Production During Candle Burning: Size Distribution and Concentration Profile with Time

    National Research Council Canada - National Science Library

    Wright, Matthew D; Fews, A. Peter; Keitch, Paul A; Henshaw, Denis L

    2007-01-01

    The characteristics of small-ions and aerosols in the diameter range 0.4 nm to 1.1 μm, produced during burning of paraffin wax tea-light candles, were investigated using a custom-built aspiration condenser ion mobility spectrometer...

  7. Complete genome sequences of two genotype A2 small ruminant lentiviruses isolated from infected U.S. sheep

    Science.gov (United States)

    Two distinct subgroups of genotype A2 SRLVs have been identified in the U.S. that infect sheep in association with their transmembrane protein 154 (TMEM154) diplotypes. Here, we report the first two complete genome sequences for SRLV strains infecting U.S. sheep belonging to genotype A2, subgroups 1...

  8. A decade of using small-to-medium throughput allele discrimination assay to determine prion protein gene ( Prnp) genotypes in sheep in Slovenia.

    Science.gov (United States)

    Zabavnik, Jelka; Cotman, Marko; Juntes, Polona; Ambrozic, Ivan

    2017-09-01

    Sheep with valine (V) at codon 136 and glutamine (Q) at codon 171 of the prion protein gene ( Prnp) are highly susceptible to classical scrapie, whereas phenylalanine (F) at codon 141 and histidine (H) at codon 154 play a major role in the susceptibility to atypical scrapie. A TaqMan real-time PCR assay was developed to determine Prnp alleles at codons 136, 141, 154, and 171 and used in classical scrapie eradication and breeding programs adopted in Slovenia. The frequency of the most resistant genotypes ARR/ARR and ARR/ARQ increased significantly in tested animals ( n = 35,138) from 6.7 and 27.1% of the tested sheep in 2006 to 12.1 and 32.4%, respectively, in 2015. Frequencies of more susceptible genotypes ARQ/ARQ and ARQ/VRQ decreased significantly from 36.4 and 3.5% in 2006 to 31.1 and 1.8%, respectively, in 2015. The most susceptible genotype VRQ/VRQ was detected in <0.5% of tested sheep. Frequencies of alleles AFRQ and AHQ affecting the susceptibility to atypical scrapie did not change significantly. The developed assay was suitable for genotyping on a small-to-medium throughput scale and was successfully used in classical scrapie eradication, as well as for the selection of classical scrapie-resistant sheep within breeding programs in Slovenia.

  9. teristics of ten white-woolled sheep breeds

    African Journals Online (AJOL)

    BURNS, Marca, 1954b. The development of the fleece and follicle population in Herdwick sheep. J. Agric. Sci. 44, 443. CARTER, H.B., 1943. Studies in the biology of the skin and fleece of sheep. Bull. Coun. Sci. Industr. Res. Aust. No. 164. CARTER, H.B., 1955. Hair follicle groups in sheep. Anim. Breed. Abstr. 23, vol 2, 101 ...

  10. FETAL METABOLIC PROGRAMMING OF THE SMALL INTESTINE IN A COPENHAGEN SHEEP MODEL

    DEFF Research Database (Denmark)

    Axel, Anne Marie Dixen; Khanal, Prabhat; Kongsted, Anna Hauntoft

    effects on gene-expression, however the results vary between genes. These observations suggest that small intestine function has been programmed by the late-gestation Low or High diet at gene expression level, whereas the physiological metabolic functions has mainly been affected by the HCHF diet......Fetal metabolic programming states that early life nutrition is implicated with the risk of later disease development and both under- and overnutrition during gestation might predispose individuals to develop obesity or diabetes later in life. Obesity operations called “gastric bypass” operations...... for diabetes development. Twin-pregnant ewes where fed a Normal, a Low or a High diet during the last 6 weeks of gestation and the twin lambs where fed either a Conventional or a High fat, High carbohydrate (HCHF) diet during the first 6 months of life. Feeding challenge tests were performed on all lambs...

  11. Analyzing small data sets using Bayesian estimation: the case of posttraumatic stress symptoms following mechanical ventilation in burn survivors

    Directory of Open Access Journals (Sweden)

    Rens van de Schoot

    2015-03-01

    Full Text Available Background: The analysis of small data sets in longitudinal studies can lead to power issues and often suffers from biased parameter values. These issues can be solved by using Bayesian estimation in conjunction with informative prior distributions. By means of a simulation study and an empirical example concerning posttraumatic stress symptoms (PTSS following mechanical ventilation in burn survivors, we demonstrate the advantages and potential pitfalls of using Bayesian estimation. Methods: First, we show how to specify prior distributions and by means of a sensitivity analysis we demonstrate how to check the exact influence of the prior (mis- specification. Thereafter, we show by means of a simulation the situations in which the Bayesian approach outperforms the default, maximum likelihood and approach. Finally, we re-analyze empirical data on burn survivors which provided preliminary evidence of an aversive influence of a period of mechanical ventilation on the course of PTSS following burns. Results: Not suprisingly, maximum likelihood estimation showed insufficient coverage as well as power with very small samples. Only when Bayesian analysis, in conjunction with informative priors, was used power increased to acceptable levels. As expected, we showed that the smaller the sample size the more the results rely on the prior specification. Conclusion: We show that two issues often encountered during analysis of small samples, power and biased parameters, can be solved by including prior information into Bayesian analysis. We argue that the use of informative priors should always be reported together with a sensitivity analysis.

  12. Possible indicators for bio-mass burning in a small Swedish city as studied by energy dispersive fluorescence (EDXRF) spectrometry

    DEFF Research Database (Denmark)

    Selin Lindgren, Eva; Henriksson, Dag; Lundin, Magnus

    2006-01-01

    to investigate the contribution of biomass incineration to air quality, energy-dispersive x-ray fluorescence (EDXRF) analysis was performed on aerosol particles sampled in the centre of the small city of Växjö. PM2.5 and PM2.5-10 fractions were sampled with the special aim of determining the contribution...... of biomass burning to particulate air pollution. In order to identify typical indicators for biomass burning, principle component analysis was performed on data on elemental contents and black carbon. Analysis suggests that the K/Zn ratio will be useful as an indicator for biomass incineration.......Biomass is increasingly used in energy plants of different size and sophistication in Sweden. Biomass is also available in Sweden owing to its large forest-covered areas. Incineration of biomass in an environmentally friendly manner is one of the key issues in Swedish policy for sustainable...

  13. West Nile Virus Infection in Sheep.

    Science.gov (United States)

    Rimoldi, G; Mete, A; Adaska, J M; Anderson, M L; Symmes, K P; Diab, S

    2017-01-01

    West Nile virus (WNV) infection has been detected in many species of birds and mammals, but scant information is available about the disease in small ruminants. West Nile virus was diagnosed in 6 sheep with neurological signs and encephalitis, in California between 2002 and 2014. All sheep had severe lymphoplasmacytic meningoencephalitis. Lymphoplasmacytic myelitis was also detected in 2 sheep where the spinal cord was examined. Brain tissue was positive for WNV detected by polymerase chain reaction in 6 of 6 sheep and by immunohistochemistry (IHC) in 5 of 6 sheep. Viral antigen was not detected by IHC in extraneural tissues in the 3 sheep examined. West Nile virus RNA was sequenced from 2 of 6 sheep, and each one clusters closely with WNV isolated from mosquito pools from nearby locations at similar times. West Nile virus was the most common cause of viral encephalitis in sheep diagnosed at this laboratory between 2002 and 2014, accounting for 6 of 9 sheep.

  14. Efficacy of a small cell-binding peptide coated hydroxyapatite substitute on bone formation and implant fixation in sheep

    DEFF Research Database (Denmark)

    Ding, Ming; Andreasen, Christina Møller; Dencker, Mads L.

    2015-01-01

    formation in concentric gap, and its enhancements on bone formation and implant fixation were at least as good as allograft. It is suggested that ABM/P-15 might be a good alternative biomaterial for bone implant fixation in this well-validated critical-size defect gap model in sheep. Nevertheless, future...

  15. Discovery of a novel, monocationic, small-molecule inhibitor of scrapie prion accumulation in cultured sheep microglia and Rov cells.

    Science.gov (United States)

    Stanton, James B; Schneider, David A; Dinkel, Kelcey D; Balmer, Bethany F; Baszler, Timothy V; Mathison, Bruce A; Boykin, David W; Kumar, Arvind

    2012-01-01

    Prion diseases, including sheep scrapie, are neurodegenerative diseases with the fundamental pathogenesis involving conversion of normal cellular prion protein (PrP(C)) to disease-associated prion protein (PrP(Sc)). Chemical inhibition of prion accumulation is widely investigated, often using rodent-adapted prion cell culture models. Using a PrP(Sc)-specific ELISA we discovered a monocationic phenyl-furan-benzimidazole (DB772), which has previously demonstrated anti-pestiviral activity and represents a chemical category previously untested for anti-prion activity, that inhibited PrP(Sc) accumulation and prion infectivity in primary sheep microglial cell cultures (PRNP 136VV/154RR/171QQ) and Rov9 cultures (VRQ-ovinized RK13 cells). We investigated potential mechanisms of this anti-prion activity by evaluating PrP(C) expression with quantitative RT-PCR and PrP ELISA, comparing the concentration-dependent anti-prion and anti-pestiviral effects of DB772, and determining the selectivity index. Results demonstrate at least an approximate two-log inhibition of PrP(Sc) accumulation in the two cell systems and confirmed that the inhibition of PrP(Sc) accumulation correlates with inhibition of prion infectivity. PRNP transcripts and total PrP protein concentrations within cell lysates were not decreased; thus, decreased PrP(C) expression is not the mechanism of PrP(Sc) inhibition. PrP(Sc) accumulation was multiple logs more resistant than pestivirus to DB772, suggesting that the anti-PrP(Sc) activity was independent of anti-pestivirus activity. The anti-PrP(Sc) selectivity index in cell culture was approximately 4.6 in microglia and 5.5 in Rov9 cells. The results describe a new chemical category that inhibits ovine PrP(Sc) accumulation in primary sheep microglia and Rov9 cells, and can be used for future studies into the treatment and mechanism of prion diseases.

  16. Hole burning study of cyanobacterial Photosystem II complexes differing in the content of small putative chlorophyll-binding proteins

    Energy Technology Data Exchange (ETDEWEB)

    Dedic, R. E-mail: roman@kchf-43.karlov.mff.cuni.cz; Promnares, K.; Psencik, J.; Svoboda, A.; Korinek, M.; Tichy, M.; Komenda, J.; Funk, C.; Hala, J

    2004-05-01

    This contribution presents low-temperature absorption, both broad-band and site-selective excited fluorescence, and persistent hole burning spectra of Photosystem II complexes from the Photosystem I-lacking strains of the cyanobacterium Synechocystis sp. PCC 6803 differing in the content of small putative chlorophyll-binding proteins (Scps). These proteins are homologous to light-harvesting complex of higher plants and may bind pigments. The excited state lifetimes of the complexes were determined from zero-phonon hole widths extrapolated to zero-burning dose. The area and spectral position of a phonon side-band with respect to the zero-phonon hole provided additional information concerning chlorophyll-protein coupling and the Stokes shift. Decrease of three absorption subbands at (670.0, 672.9, and 675.7 nm) in the Photosystem II isolated from the strain lacking ScpC and ScpD is in agreement with a hypothesis about the role of Scps in the chlorophyll binding. In addition, narrowing of the zero-phonon hole in Photosystem II without both Scps indicates slowering of the excitation energy transfer which may be explained by the absence of a protective excitation energy quenching related to the presence of Scps.

  17. Discovery of a novel, monocationic, small-molecule inhibitor of scrapie prion accumulation in cultured sheep microglia and Rov cells.

    Directory of Open Access Journals (Sweden)

    James B Stanton

    Full Text Available Prion diseases, including sheep scrapie, are neurodegenerative diseases with the fundamental pathogenesis involving conversion of normal cellular prion protein (PrP(C to disease-associated prion protein (PrP(Sc. Chemical inhibition of prion accumulation is widely investigated, often using rodent-adapted prion cell culture models. Using a PrP(Sc-specific ELISA we discovered a monocationic phenyl-furan-benzimidazole (DB772, which has previously demonstrated anti-pestiviral activity and represents a chemical category previously untested for anti-prion activity, that inhibited PrP(Sc accumulation and prion infectivity in primary sheep microglial cell cultures (PRNP 136VV/154RR/171QQ and Rov9 cultures (VRQ-ovinized RK13 cells. We investigated potential mechanisms of this anti-prion activity by evaluating PrP(C expression with quantitative RT-PCR and PrP ELISA, comparing the concentration-dependent anti-prion and anti-pestiviral effects of DB772, and determining the selectivity index. Results demonstrate at least an approximate two-log inhibition of PrP(Sc accumulation in the two cell systems and confirmed that the inhibition of PrP(Sc accumulation correlates with inhibition of prion infectivity. PRNP transcripts and total PrP protein concentrations within cell lysates were not decreased; thus, decreased PrP(C expression is not the mechanism of PrP(Sc inhibition. PrP(Sc accumulation was multiple logs more resistant than pestivirus to DB772, suggesting that the anti-PrP(Sc activity was independent of anti-pestivirus activity. The anti-PrP(Sc selectivity index in cell culture was approximately 4.6 in microglia and 5.5 in Rov9 cells. The results describe a new chemical category that inhibits ovine PrP(Sc accumulation in primary sheep microglia and Rov9 cells, and can be used for future studies into the treatment and mechanism of prion diseases.

  18. Tissue-Engineered Small Diameter Arterial Vascular Grafts from Cell-Free Nanofiber PCL/Chitosan Scaffolds in a Sheep Model.

    Directory of Open Access Journals (Sweden)

    Takuma Fukunishi

    Full Text Available Tissue engineered vascular grafts (TEVGs have the potential to overcome the issues faced by existing small diameter prosthetic grafts by providing a biodegradable scaffold where the patient's own cells can engraft and form functional neotissue. However, applying classical approaches to create arterial TEVGs using slow degrading materials with supraphysiological mechanical properties, typically results in limited host cell infiltration, poor remodeling, stenosis, and calcification. The purpose of this study is to evaluate the feasibility of novel small diameter arterial TEVGs created using fast degrading material. A 1.0mm and 5.0mm diameter TEVGs were fabricated with electrospun polycaprolactone (PCL and chitosan (CS blend nanofibers. The 1.0mm TEVGs were implanted in mice (n = 3 as an unseeded infrarenal abdominal aorta interposition conduit., The 5.0mm TEVGs were implanted in sheep (n = 6 as an unseeded carotid artery (CA interposition conduit. Mice were followed with ultrasound and sacrificed at 6 months. All 1.0mm TEVGs remained patent without evidence of thrombosis or aneurysm formation. Based on small animal outcomes, sheep were followed with ultrasound and sacrificed at 6 months for histological and mechanical analysis. There was no aneurysm formation or calcification in the TEVGs. 4 out of 6 grafts (67% were patent. After 6 months in vivo, 9.1 ± 5.4% remained of the original scaffold. Histological analysis of patent grafts demonstrated deposition of extracellular matrix constituents including elastin and collagen production, as well as endothelialization and organized contractile smooth muscle cells, similar to that of native CA. The mechanical properties of TEVGs were comparable to native CA. There was a significant positive correlation between TEVG wall thickness and CD68+ macrophage infiltration into the scaffold (R2 = 0.95, p = 0.001. The fast degradation of CS in our novel TEVG promoted excellent cellular infiltration and neotissue

  19. Effects of prescribed burning on small mammal, reptile, and tick populations on the Talladega National Forest, Alabama

    Science.gov (United States)

    Jonathan Adams; Chris Edmondson; Damien Willis; Robert Carter

    2013-01-01

    A study of the relationship between prescribed burning and tick populations was conducted in the Talladega National Forest, AL. The study area for mammal and tick sampling consisted of 12 plots ranging from the unburned control site to sites burned within the previous 5 years. The study area for reptile sampling consisted of four plots ranging from the unburned control...

  20. In situ measurements and modeling of reactive trace gases in a small biomass burning plume

    Directory of Open Access Journals (Sweden)

    M. Müller

    2016-03-01

    Full Text Available An instrumented NASA P-3B aircraft was used for airborne sampling of trace gases in a plume that had emanated from a small forest understory fire in Georgia, USA. The plume was sampled at its origin to derive emission factors and followed  ∼ 13.6 km downwind to observe chemical changes during the first hour of atmospheric aging. The P-3B payload included a proton-transfer-reaction time-of-flight mass spectrometer (PTR-ToF-MS, which measured non-methane organic gases (NMOGs at unprecedented spatiotemporal resolution (10 m spatial/0.1 s temporal. Quantitative emission data are reported for CO2, CO, NO, NO2, HONO, NH3, and 16 NMOGs (formaldehyde, methanol, acetonitrile, propene, acetaldehyde, formic acid, acetone plus its isomer propanal, acetic acid plus its isomer glycolaldehyde, furan, isoprene plus isomeric pentadienes and cyclopentene, methyl vinyl ketone plus its isomers crotonaldehyde and methacrolein, methylglyoxal, hydroxy acetone plus its isomers methyl acetate and propionic acid, benzene, 2,3-butanedione, and 2-furfural with molar emission ratios relative to CO larger than 1 ppbV ppmV−1. Formaldehyde, acetaldehyde, 2-furfural, and methanol dominated NMOG emissions. No NMOGs with more than 10 carbon atoms were observed at mixing ratios larger than 50 pptV ppmV−1 CO. Downwind plume chemistry was investigated using the observations and a 0-D photochemical box model simulation. The model was run on a nearly explicit chemical mechanism (MCM v3.3 and initialized with measured emission data. Ozone formation during the first hour of atmospheric aging was well captured by the model, with carbonyls (formaldehyde, acetaldehyde, 2,3-butanedione, methylglyoxal, 2-furfural in addition to CO and CH4 being the main drivers of peroxy radical chemistry. The model also accurately reproduced the sequestration of NOx into peroxyacetyl nitrate (PAN and the OH-initiated degradation of furan and 2-furfural at an average OH concentration of 7.45 ± 1

  1. Short- and long-term outcomes of small auto- and cryopreserved allograft skin grafting in those with >60%TBSA deep burn wounds.

    Science.gov (United States)

    Shizhao, Ji; Yongjun, Zheng; Lisen, Zhang; Pengfei, Luo; Xiaopeng, Zheng; Guangyi, Wang; Shihui, Zhu; Xiaoyan, Hu; Shichu, Xiao; Zhaofan, Xia

    2017-02-01

    The shortage of autologous skin sources not only adds difficulty to the repair of extremely large-area deep burn wounds but affects the healing quality. The aim of the present study is to explore an ideal method for repairing large-areas burn wounds with low scar formation. Between 2002 and 2014, we used grafting of small auto- and cryopreserved allo-skin to repair large-area residual burn wounds in wounds after 21 days 21 patients, and after early excision in 17 patients. The wound healing rate and quality were observed. The skin expansion rate was 1:9-1:16, and the mean area of wounds repaired after three weeks was 64.8±7.3%TBSA, the wound healing rate was 91.8±3.7%. The mean area of the early excision group was 65.9±9.8 TBSA, where the healing rate was 94.5±5.6%. After small auto- and cryopreserved allograft skin grafting, the epidermis of the auto-skin gradually replaced the allo-epidermis, and the allo-dermis persisted for a prolonged period. The dermal collagen fibers at the allo-skin grafting sites were well arranged. At 1-2-year follow-up, observation showed that the Vancouver Scar Scale total score was 4·304±2·363, and we did not discern significant contracture and dysfunction in the large joints of the four extremities. Small auto- and cryopreserved allograft skin grafting of small auto- and allo-skin not only raised the graft expansion rate but offers a stable wound healing rate. This new technique may provide an option for repair of large-area deep burn wounds. Copyright © 2016 Elsevier Ltd and ISBI. All rights reserved.

  2. Risk assessment of sheep welfare at small-scale slaughter in Nordic countries, comparing with large-scale slaughter

    OpenAIRE

    Hultgren, Jan; Algers, Bo; Atkinson, Sophie; Ellingsen, Kristian; Eriksson, Sofia; Hreinsson, Kjartan; Nordensten, Lotta; Valtari, Heidi; Mejdell, Cecilie Marie

    2016-01-01

    Background During the pre-slaughter period, animals experience novel environment and procedures which may cause reduced welfare and suffering. Over the last decades, the slaughter industry has restructured into fewer and larger abattoirs, implying potential risks of transport stress, injuries, and impaired animal welfare. Since recently, however, there is growing interest in small-scale slaughter to supply locally or regionally produced meat. Risk managers at all levels thus need to assess an...

  3. Prevention and management of outpatient pediatric burns.

    Science.gov (United States)

    O'Brien, Shannon P; Billmire, David A

    2008-07-01

    Burns are common injuries in the pediatric population, with an estimated 250,000 pediatric burn patients seeking medical care annually. A relative few require inpatient management. This article discusses suggestions for burn prevention, as well as acute burn care and long-term management of small burns.

  4. Burning Feet

    Science.gov (United States)

    Symptoms Burning feet By Mayo Clinic Staff Burning feet — the sensation that your feet are painfully hot — can be mild or severe. In some cases, your burning feet may be so painful that the pain interferes ...

  5. Pneumonia in bighorn sheep: Risk and resilience

    Science.gov (United States)

    Cassirer, E. Frances; Manlove, Kezia R.; Almberg, Emily S.; Kamath, Pauline; Cox, Mike; Wolff, Peregrine L.; Roug, Annette; Shannon, Justin M.; Robinson, Rusty; Harris, Richard B.; Gonzales, Ben J.; Plowright, Raina K.; Hudson, Peter J.; Cross, Paul C.; Dobson, Andrew; Besser, Thomas E.

    2018-01-01

    Infectious disease was an important driver of historic declines and extirpations of bighorn sheep (Ovis canadensis) in North America and continues to impede population restoration and management. Domestic sheep have long been linked to pneumonia outbreaks in bighorn sheep and this association has now been confirmed in 13 captive commingling experiments. However, ecological and etiological complexities still hinder our understanding and control of the disease. We provide an overview of the current state of knowledge about the biology and management of respiratory disease in bighorn sheep and propose strategies for moving forward. Epizootic pneumonia in bighorn sheep is polymicrobial. Mycoplasma ovipneumoniae, a bacterium host-specific to Caprinae and commonly carried by healthy domestic sheep and goats appears to be a necessary primary agent. All-age epizootics following introduction of M. ovipneumoniae along with other pathogens into bighorn sheep populations are usually severe (median mortality 47%) but fatality rates vary widely, from 15 – 100%. Disease severity may be influenced by the strain of M. ovipneumoniae, by secondary bacterial and viral pathogens, and by factors affecting transmission and host immunity. Once introduced, M. ovipneumoniae can persist in bighorn sheep populations for decades. Carrier dams transmit the pathogen to their susceptible lambs, triggering fatal pneumonia outbreaks in nursery groups, which limits recruitment and slows or prevents population recovery. The result is that demographic costs of pathogen persistence often outweigh the impacts of the initial invasion and die-off. There is currently no effective vaccine or antibiotic for domestic or wild sheep and to date, no management actions have been successful in reducing morbidity, mortality, or disease spread once pathogen invasion has occurred. Molecular-based strain typing suggests that spillover of M. ovipneumoniae into bighorn sheep populations from domestic small ruminants

  6. [The stabilizing effect of enterosgel on the structural bases of membrane digestion and absorption in the small intestine in severe thermal skin burns].

    Science.gov (United States)

    Pasechka, N V

    1996-01-01

    Enterosgel effect on morphofunctional indices of the small intestine has been ascertained in experiments on animals, histochemical, electron-microscopic and morphometric methods being used. Enterosorbent in the dose of 0.3 g/kg body weight was injected orally to the guinea-pigs for 14 days. The results of the investigations prove the severe burn traumas to result in sufficient structural changes in the small intestine wall which causes impairment of membranous digestion processes and absorption of nutrients. It is to be noted that the developing burn disease results in the increase of changes severity and reaches the highest values at the stage of septicotoxemia. The enterosorbent assessed positively affects morphofunctional values of the small intestine. The enterosorbent does not enhance conventional development of the pathologic process but considerably decreases its manifestation. The enterosgel promotes the improvement of membranous digestion and absorption in the small intestine, increasing alkaline phosphatase action and rising the number of endocellular vesicles in epitheliocytes having brush margins.

  7. [Influences of high-voltage electrical burns on microcirculation perfusion on serosal surface of small intestine of rats and the interventional effects of pentoxifylline].

    Science.gov (United States)

    Zhang, Q F; Xu, S J; Liang, L M; Feng, J K; Xu, Y F; Tu, L L

    2017-03-20

    Objective: To investigate influences of high-voltage electrical burns on microcirculation perfusion on serosal surface of small intestine of rats and the interventional effects of pentoxifylline (PTX). Methods: Totally 180 SD rats were divided into sham injury group, simple electrical burn group, and treatment group according to the random number table, with 60 rats in each group. The electrical current was applied to the outside proximal part of left forelimb of rats and exited from the outside proximal part of right hind limb of rats. Rats in simple electrical burn group and treatment group were inflicted with high-voltage electrical burn wounds of 1cm×1cm at current entrances and exits, with the voltage regulator and experimental transformer. Rats in sham injury group were sham injured through connecting the same equipments without electricity. At 2 min post injury, rats in sham injury group and simple electrical burn group were intraperitoneally injected with 2 mL normal saline, and rats in treatment group were injected with 2 mL PTX injection (50 mg/mL). At 15 min before injury and 5 min, 1 h, 2 h, 4 h, and 8 h post injury, 10 rats in each group were selected to collect blood of heart respectively. Serum were separated from the blood to determine the level of soluble vascular cell adhesion molecule-1(sVCAM-1) with enzyme-linked immunosorbent assay method. The number of adhesional leukocyte in mesenteric venule of rats was determined with Bradford variable projection microscope system. The microcirculation perfusion on serosal surface of small intestine of rats was detected with laser Doppler perfusion imager. Data were processed with analysis of variance of factorial design and LSD test. Results: (1) At 5 min, 1 h, 2 h, 4 h, 8 h post injury, the serum content of sVCAM-1 in rats of simple electrical burn group were (8 502±1 158), (11 793±3 310), (9 960±2 146), (9 708±1 429), (7 292±1 386) ng/mL respectively, higher than that in sham injury group and

  8. Discovery of a novel, monocationic, small-molecule inhibitor of scrapie prion accumulation in cultured sheep microglia and rov cells PLoS one

    Science.gov (United States)

    Prion diseases, including sheep scrapie are neurodegenerative diseases with the fundamental pathogenesis involving conversion of normal cellular prion protein (PrPC) to disease-associated prion protein (PrPSc). An aromatic monocationic furamidine analogue (DB772), which has previously demonstrated a...

  9. Burns dressings.

    Science.gov (United States)

    Douglas, Helen E; Wood, Fiona

    2017-03-01

    Burn injuries are common and costly; each year, there are more than 200,000 cases, costing the Australian community $150 million. Management of smaller burn injuries in the community can be improved by appropriate first aid, good burn dressings and wound management. This can reduce the risk of the burn becoming deeper or infected, and can potentially reduce the requirement for specialist review or surgery. The objective of this article is to provide healthcare professionals with information about the pathophysiology of burn wound progression. This information includes the aims of burn wound dressings and indications for different types of dressings in different burn depths, advantages of blister debridement, and the reasoning behind advice given to patients after healing of the burn wound. This article provides a framework used by the State Burn Service of Western Australia, by which clinicians can understand the needs of a specific burn wound and apply these principles when choosing an appropriate burn dressing for their patient. Every intervention in the journey of a patient with a burn injury affects their eventual outcome. By managing all burn injuries effectively at every single step, we can reduce burn injury morbidity as a community.

  10. Evaluating channel morphology in small watersheds of oak savannas Southeastern New Mexico, USA: Do seasonal prescribed burn treatments have a significant impact on sediment processes?

    Science.gov (United States)

    Koestner, Karen; Neary, Daniel; Gottfried, Gerald; Tecle, Aregai

    2010-05-01

    Oak-savannas comprise over 80,000 km2 of the southwestern United States and northern Mexico. However, there is a paucity of data to assist in the management of this vast ecotype. Fire, which was once the most important natural disturbance in this system, has been excluded due to over-grazing and fire suppression practices. This has resulted in ecosystem changes and fuel accumulations. Prescribed fire is one management technique to restore natural processes within southwestern oak-savannas by reducing woody species density, increasing herbaceous plant production, and creating vegetative mosaics on the landscape. However, questions concerning the seasonality of burn treatments and the overall effects of these treatments on physical and ecological processes need to be addressed prior to broad management application. The Cascabel Watershed Study is a collaborative effort between multiple government agencies, universities, local land managers, and environmental interest groups to evaluate the impacts of warm and cool season burn treatments on an array of ecosystem processes. Established in 2000, the Cascabel Watershed study takes an "ecosystem approach" to watershed research by examining an array of physical and biological components, including geomorphologic, climatologic, hydrologic, and biologic (flora and fauna) data to determine ecosystem response to prescribed fire. The 182.6 ha study area is located in the eastern Peloncillo Mountains, New Mexico at about the 1,640 m elevation. It consists of 12 small watersheds dominated by an oak (Quercus spp.) overstory and bunch-grass (Bouteloua spp.), savanna component. The parent material is fine-grained Tertiary rhyolite that is part of an extensive lava field that was formed about 25 to 27 M ybp. A US Forest Service soil survey in the area classified 45% of the soils as Typic Haplustolls, coarse-loamy, mixed, mesic, 25% as Typic Haplustalfs, and 15% rock outcrops. Here, we evaluate within-channel processes to establish

  11. Becoming with sheep

    DEFF Research Database (Denmark)

    Grum, Charlotte

    2017-01-01

    The art project Becoming Sheep (2015), in which Charlotte Grum connected herself to a live sheep for 5 weeks, intended to explore the apparatuses producing human and non-human animals and to evoke the embodied and embedded mattering processes and practices, producing these very phenomena. Becoming...... Sheep turned into a diffractional aparatus cutting some things together and other things apart....

  12. [Chickenpox, burns and grafts].

    Science.gov (United States)

    Rojas Zegers, J; Fidel Avendaño, L

    1979-01-01

    An outbreak of chickenpox that occurred at the Burns Repair Surgery Unit, Department of Children's Surgery, Hospital R. del Río, between June and November, 1975, is reported. 27 cases of burned children were studied, including analysis of correlations of the stages and outcome of the disease (varicela), the trauma (burns) and the graft (repair surgery). As a result, the authors emphasize the following findings: 1. Burns and their repair are not aggravating factors for varicella. In a small number of cases the exanthema looked more confluent in the graft surgical areas and in the first degree burns healing spontaneously. 2. Usually there was an uneventful outcome of graft repair surgery on a varicella patient, either during the incubation period, the acme or the convalescence. 3. The fact that the outmost intensity of secondary viremia of varicella occurs before the onset of exanthemia, that is, during the late incubation period, is confirmed.

  13. Iatrogenic Burns

    Directory of Open Access Journals (Sweden)

    Burak Kaya

    2016-03-01

    Full Text Available Iatrogenic burns are rare complications that can occur after using medical devices and chemicals in hospitals. Usually, these burns are deep and cause additional morbidity to patients. In this article, 6 iatrogenic burn patients referred to our department are presented, and predisposing factors and preventive measures are discussed.

  14. Management of burn wounds.

    Science.gov (United States)

    Schiestl, Clemens; Meuli, Martin; Trop, Marija; Neuhaus, Kathrin

    2013-10-01

    Small and moderate scalds in toddlers are still the most frequent thermal injuries the pediatric surgeons have to face today. Over the last years, surgical treatment of these patients has changed in many aspects. Due to new dressing materials and new surgical treatment strategies that are particularly suitable for children, today, far better functional and aesthetic long-term results are possible. While small and moderate thermal injuries can be treated in most European pediatric surgical departments, the severely burned child must be transferred to a specialized, ideally pediatric, burn center, where a well-trained multidisciplinary team under the leadership of a (ideally pediatric) burn surgeon cares for these highly demanding patients. In future, tissue engineered full thickness skin analogues will most likely play an important role, in pediatric burn as well as postburn reconstructive surgery. Georg Thieme Verlag KG Stuttgart · New York.

  15. Burns and military clothing.

    Science.gov (United States)

    McLean, A D

    2001-02-01

    Burn injury is a ubiquitous threat in the military environment. The risks during combat are well recognised, but the handling of fuel, oil, munitions and other hot or flammable materials during peacetime deployment and training also imposes an inherent risk of accidental burn injury. Over the last hundred years, the burn threat in combat has ranged from nuclear weapons to small shoulder-launched missiles. Materials such as napalm and white phosphorus plainly present a risk of burn, but the threat extends to encompass personnel in vehicles attacked by anti-armour weapons, large missiles, fuel-air explosives and detonations/conflagrations on weapons platforms such as ships. Large numbers of burn casualties were caused at Pearl Harbor, in Hiroshima and Nagasaki, Vietnam, during the Arab/Israeli Wars and in the Falkland Islands conflict. The threat from burns is unlikely to diminish, indeed new developments in weapons seek to exploit the vulnerability of the serviceman and servicewoman to burns. Clothing can be a barrier to some types of burn--both inherently in the properties of the material, but also by trapping air between clothing layers. Conversely, ignition of the clothing may exacerbate a burn. There is hearsay that burnt clothing products within a wound may complicate the clinical management, or that materials that melt (thermoplastic materials) should not be worn if there is a burn threat. This paper explores the incidence of burn injury, the mechanisms of heat transfer to bare skin and skin covered by materials, and the published evidence for the complication of wound management by materials. Even light-weight combat clothing can offer significant protection to skin from short duration flash burns; the most vulnerable areas are the parts of the body not covered--face and hands. Multilayered combat clothing can offer significant protection for short periods from engulfment by flames; lightweight tropical wear with few layers offers little protection. Under

  16. Sheep feed and scrapie, France.

    Science.gov (United States)

    Philippe, Sandrine; Ducrot, Christian; Roy, Pascal; Remontet, Laurent; Jarrige, Nathalie; Calavas, Didier

    2005-08-01

    Scrapie is a small ruminant, transmissible spongiform encephalopathy (TSE). Although in the past scrapie has not been considered a zoonosis, the emergence of bovine spongiform encephalopathy, transmissible to humans and experimentally to sheep, indicates that risk exists for small ruminant TSEs in humans. To identify the risk factors for introducing scrapie into sheep flocks, a case-control study was conducted in France from 1999 to 2000. Ninety-four case and 350 control flocks were matched by location and main breed. Three main hypotheses were tested: direct contact between flocks, indirect environmental contact, and foodborne risk. Statistical analysis was performed by using adjusted generalized linear models with the complementary log-log link function, considering flock size as an offset. A notable effect of using proprietary concentrates and milk replacers was observed. The risk was heterogeneous among feed factories. Contacts between flocks were not shown to be a risk factor.

  17. Streptococcus zooepidemicus infection in sheep.

    Science.gov (United States)

    Stevenson, R G

    1974-07-01

    Fibrinous pericarditis, fibrinous pleuritis and pneumonia associated with Streptococcus zooepidemicus were observed in two lambs in a small flock of sheep. These lesions were reproduced in lambs inoculated intratracheally with Streptococcus zooepidemicus. Clinical signs included pyrexia, serous to mucopurulent nasal discharge, dyspnea and depression followed by death in six to seven days. Histologically the tissue changes were characterized by an acute inflammatory response involving bronchioles and alveoli, fibrinous pleuritis and fibrinous pericarditis.

  18. Burn Rehabilitation

    Directory of Open Access Journals (Sweden)

    Koray Aydemir

    2011-07-01

    Full Text Available Burn injuries are important in terms of causing serious disability and threatening life. With the establishment of modern burn treatment units and advances in acute care management contributed to a reduced mortality rate over the last decades. As a result of improved outcome, more attention has to be given to a comprehensive burn rehabilitation program. Burn rehabilitation is a process that starts from day of admission and continues for months or sometimes years after the initial event. The term ‘burn rehabilitation’ incorporates the physical, physiological and social aspects of care. Burns can leave a patient with severely debilitating and deforming contractures, which can lead to significant disability when left untreated. Burn rehabilitation aims to prevent the possible complications, minimalize joint contractures and deformities, increase range of motion, control hypertrophic scarring, achieve the best possible functional capacity and to regain the patients vocational and recreational activities. (Journal of the Turkish Society Intensive Care 2011; 9 Suppl: 70-7

  19. Risk assessment of the risk of introduction and distribution of Sheep and goat pox in Bulgaria

    OpenAIRE

    Grigorova, Krasimira

    2014-01-01

    Sheep pox and Goat pox (Variola ovina; Variola caprina; Sheep pox, Goat pox) is a contagious viral disease of small ruminants. The disease can take place with moderate clinical presentations of local breeds, but for animals that have met for the first time the virus ends with death. Caused by a virus of Sheep pox and a virus of Goat pox, genus Capripoxvirus, family Poxviridae. Economic losses come from reduced milk production, lowering the quality of the leather, wool and more. Sheep...

  20. The Role of Hydrogen Bonding on Laminar Burning Velocity of Hydrous and Anhydrous Ethanol Fuel with Small Addition of n-Heptane

    OpenAIRE

    I Made Suarta; Wardana, I. N. G.; Nurkholis Hamidi; Widya Wijayanti

    2016-01-01

    The molecular structure of mixed hydrous and anhydrous ethanol with up to 10% v n-heptane had been studied. The burning velocity was examined in a cylindrical explosion combustion chamber. The result showed that the burning velocity of hydrous ethanol is higher than anhydrous ethanol and n-heptane at stoichiometric, rich, and very rich mixtures. The burning velocity of hydrous ethanol with n-heptane drops drastically compared to the burning velocity of anhydrous ethanol with n-heptane. It is ...

  1. Immune checkpoint inhibitors in non-small cell lung cancer (NSCLC): Approaches on special subgroups and unresolved burning questions.

    Science.gov (United States)

    Remon, J; Vilariño, N; Reguart, N

    2018-02-08

    Immune checkpoint inhibitors (ICIs) have been incorporated in the treatment strategy of advanced non-small cell lung cancer (NSCLC). Beyond the already approved indications in first- and second-line setting of advanced NSCLC, new data has recently emerged demonstrating its efficacy in locally advanced disease as maintenance after chemo-radiotherapy and currently several trials are also exploring its efficacy in earlier stages of the disease to evaluate whether these results could be extrapolated to the adjuvant setting. With the advent of all these new therapies, their potential in other thoracic malignancies such as mesothelioma and small-cell lung cancer are also being evaluated with encouraging preliminary data that endorses their short-term incorporation as new therapeutic options in these thoracic malignancies. However, despite all these new evidence, there are still several open questions that remain to be solved like the use of immune agents in special subpopulations such as elderly or fragile patients or the case of patients with brain metastases or autoimmune disorders. In addition some other open questions remain with regards ICIs activity in patients receiving corticosteroid or antibiotics, the potential use in oncogenic addicted tumours, as well as the safety of retreatment after the onset of immune-related adverse events (ir-AE) or the optimal dose schedule or time on treatment for ICIs administration. Herein, we propose to address all these questions, reviewing most recent evidence available in order to give readers some practical advises and guidance on how to deal with these challenges when treating NSCLC patients with immunotherapy. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Karakul sheep industry

    African Journals Online (AJOL)

    ing is possible. Commercial or freehold land is fenced thus controlled breeding is possible. Eight- four per cent of the sheep in Botswana are pure Tswana and its crosses, while the remaining 16% are Karakul and its crosses (Madimabe & Nsoso, 1998). There are also other sheep breeds, which are only important as ram ...

  3. Parturition difficulties in sheep

    NARCIS (Netherlands)

    Grommers, F. J.; Elving, L.; Eldik, P. van

    1985-01-01

    The incidence of difficult parturition was recorded in Texel Sheep lambs (224), Milk Sheep lambs (273) and various crossbreeds (1043) in ten spring lambing seasons. at lambing time the ewes were under 24-hour observation. Difficult parturition is defined as necessity for obstetrical assistance as

  4. Opportunities for change in small ruminant systems in Central Java-Indonesia

    NARCIS (Netherlands)

    Budisatria, I.G.S.; Udo, H.M.J.; Viets, T.C.; Zijpp, van der A.J.

    2012-01-01

    This study evaluated sheep fattening and goat breeding innovation scenarios for small ruminant systems in Central Java. In sheep fattening scenario 1, farmers were proposed to fatten 5 male sheep two times a year, in sheep fattening scenario 2, farmers were proposed to fatten sheep in one round of 9

  5. [Ocular burns].

    Science.gov (United States)

    Merle, H; Gérard, M; Schrage, N

    2008-09-01

    Ocular or thermal burns account for 7.7%-18% of ocular trauma. The majority of victims are young. The burns occur in the setting of accidents at work or in the home, or during a physical attack. Chemical burns by strong acids or bases are responsible for the most serious injuries. Associated with the destruction of limbal stem cells, they present as recurrent epithelial ulcerations, chronic stromal ulcers, deep stromal revascularization, conjunctival overlap, or even corneal perforation. The initial clinical exam is sometimes difficult to perform in the presence of burning symptoms. Nevertheless, it enables the physician to classify the injury, establish a prognosis, and most importantly, guide the therapeutic management. The Roper-Hall modification of the Hughes classification system is the most widely utilized, broken down into stages based on the size of the stromal opacity and the extent of possible limbal ischemia. This classification is now favorably supplemented by those proposed by Dua and Wagoner, which are based on the extent of the limbal stem cell deficiency. The prognosis of the more serious forms of ocular burns has markedly improved over the last decade because of a better understanding of the physiology of the corneal epithelium. Surgical techniques aimed at restoring the destroyed limbal stem cells have altered the prognosis of severe corneal burns. In order to decrease the incidence of burns, prevention, particularly in industry, is essential.

  6. Assessment of the burning behavior of protected and unprotected cables and cable trays in nuclear installations using small- and large-scale experiments

    Energy Technology Data Exchange (ETDEWEB)

    Siemon, Matthias; Riese, Olaf; Zehfuss, Jochen [Technische Univ. Braunschweig (Germany). Inst. fuer Baustoffe, Massivbau und Brandschutz (iBMB)

    2015-12-15

    Electric installations and cables are a main fire risk source in industrial buildings and power plants. In general, cables and cable systems are associated with flash-over phenomena due to pyrolysis of fuel gases induced by the heat of an adjacent fire, fire spread along cable trays affecting additional areas besides the fire origin, being an ignition source due to malfunction. If burning, cables can emit large amounts of smoke and toxic products affecting occupants as well as the long-term functionality of structure and installations. Paying attention to these risks has led to the development of fire retardant non-corrosive (non-halogenated) cables which are qualified to reduce the individual or all of the risks mentioned. For existing installations in industrial buildings and power plants with halogenated cables, different protection measures are available and widely applied retroactively. Important protective measures are intumescent or ablative coatings, cable casings and bindings. For qualification of the effects of the protection measures, small-scale tests investigating a single cable specimen as well as large-scale cable tray test setups have been developed and carried out in the last 20 years at iBMB. In this paper, these test results are analysed regarding their effects on the heat release, ignition time and fire spread over cable trays. Furthermore, national and international research projects have investigated the burning behaviour of different cable types, tray installations, tray loading and spacing and ventilation conditions. As a conclusion, the main outcomes of past researches are summarized. Influence factors (e.g. pre-heating due to high power utilization, influence of cable aging) which have not been accounted for in detail are emphasized. The modelling of unprotected cables has been internationally studied in recent years. For future applications, the question of applicability of recently developed sub-models on the fire behaviour of protected

  7. Coxiella burnetii infections in sheep or goats

    NARCIS (Netherlands)

    Brom, Van den R.; Engelen, van E.; Roest, H.I.J.; Hoek, van der W.; Vellema, P.

    2015-01-01

    Q fever is an almost ubiquitous zoonosis caused by Coxiella burnetii, which is able to infect several animal species, as well as humans. Cattle, sheep and goats are the primary animal reservoirs. In small ruminants, infections are mostly without clinical symptoms, however, abortions and

  8. Development of a long-term ovine model of cutaneous burn and smoke inhalation injury and the effects of early excision and skin autografting.

    Science.gov (United States)

    Yamamoto, Yusuke; Enkhbaatar, Perenlei; Sakurai, Hiroyuki; Rehberg, Sebastian; Asmussen, Sven; Ito, Hiroshi; Sousse, Linda E; Cox, Robert A; Deyo, Donald J; Traber, Lillian D; Traber, Maret G; Herndon, David N; Traber, Daniel L

    2012-09-01

    Smoke inhalation injury frequently increases the risk of pneumonia and mortality in burn patients. The pathophysiology of acute lung injury secondary to burn and smoke inhalation is well studied, but long-term pulmonary function, especially the process of lung tissue healing following burn and smoke inhalation, has not been fully investigated. By contrast, early burn excision has become the standard of care in the management of major burn injury. While many clinical studies and small-animal experiments support the concept of early burn wound excision, and show improved survival and infectious outcomes, we have developed a new chronic ovine model of burn and smoke inhalation injury with early excision and skin grafting that can be used to investigate lung pathophysiology over a period of 3 weeks. Eighteen female sheep were surgically prepared for this study under isoflurane anesthesia. The animals were divided into three groups: an Early Excision group (20% TBSA, third-degree cutaneous burn and 36 breaths of cotton smoke followed by early excision and skin autografting at 24h after injury, n=6), a Control group (20% TBSA, third-degree cutaneous burn and 36 breaths of cotton smoke without early excision, n=6) and a Sham group (no injury, no early excision, n=6). After induced injury, all sheep were placed on a ventilator and fluid-resuscitated with Lactated Ringers solution (4 mL/% TBS/kg). At 24h post-injury, early excision was carried out to fascia, and skin grafting with meshed autografts (20/1000 in., 1:4 ratio) was performed under isoflurane anesthesia. At 48 h post-injury, weaning from ventilator was begun if PaO(2)/FiO(2) was above 250 and sheep were monitored for 3 weeks. At 96 h post-injury, all animals were weaned from ventilator. There are no significant differences in PaO(2)/FiO(2) between Early Excision and Control groups at any points. All animals were survived for 3 weeks without infectious complication in Early Excision and Sham groups, whereas two

  9. The Role of Hydrogen Bonding on Laminar Burning Velocity of Hydrous and Anhydrous Ethanol Fuel with Small Addition of n-Heptane

    Directory of Open Access Journals (Sweden)

    I Made Suarta

    2016-01-01

    Full Text Available The molecular structure of mixed hydrous and anhydrous ethanol with up to 10% v n-heptane had been studied. The burning velocity was examined in a cylindrical explosion combustion chamber. The result showed that the burning velocity of hydrous ethanol is higher than anhydrous ethanol and n-heptane at stoichiometric, rich, and very rich mixtures. The burning velocity of hydrous ethanol with n-heptane drops drastically compared to the burning velocity of anhydrous ethanol with n-heptane. It is caused by two reasons. Firstly, there was a composition change of azeotropic hydrous ethanol molecules within the mixture of fuel. Secondly, at the same volume the number of ethanol molecules in hydrous ethanol was less than in anhydrous ethanol at the same composition of the n-heptane in the mixture. At the mixture of anhydrous ethanol with n-heptane, the burning velocity decreases proportionally to the addition of the n-heptane composition. The burning velocity is between the velocities of anhydrous ethanol and n-heptane. It shows that the burning velocity of anhydrous ethanol mixed with n-heptane is only influenced by the mixture composition.

  10. Burning Issue: Handling Household Burns

    Science.gov (United States)

    ... to injury. , as your immune system shifts into gear. “The immune system response is intended to limit ... maintain blood pressure. Grafting—placing healthy skin on top of the burn wound—might help promote new ...

  11. Hand chemical burns.

    Science.gov (United States)

    Robinson, Elliot P; Chhabra, A Bobby

    2015-03-01

    There is a vast and ever-expanding variety of potentially harmful chemicals in the military, industrial, and domestic landscape. Chemical burns make up a small proportion of all skin burns, yet they can cause substantial morbidity and mortality. Additionally, the hand and upper extremity are the most frequently involved parts of the body in chemical burns, and therefore these injuries may lead to severe temporary or permanent loss of function. Despite this fact, discussion of the care of these injuries is sparse in the hand surgery literature. Although most chemical burns require only first response and wound care, some require the attention of a specialist for surgical debridement and, occasionally, skin coverage and reconstruction. Exposure to certain chemicals carries the risk of substantial systemic toxicity and even mortality. Understanding the difference between thermal and chemical burns, as well as special considerations for specific compounds, will improve patient treatment outcomes. Copyright © 2015 American Society for Surgery of the Hand. Published by Elsevier Inc. All rights reserved.

  12. Outcomes of outpatient management of pediatric burns.

    Science.gov (United States)

    Brown, Matthew; Coffee, Tammy; Adenuga, Paul; Yowler, Charles J

    2014-01-01

    The literature surrounding pediatric burns has focused on inpatient management. The goal of this study is to characterize the population of burned children treated as outpatients and assess outcomes validating this method of burn care. A retrospective review of 953 patients treated the burn clinic and burn unit of a tertiary care center. Patient age, burn etiology, burn characteristics, burn mechanism, and referral pattern were recorded. The type of wound care and incidence of outcomes including subsequent hospital admission, infection, scarring, and surgery served as the primary outcome data. Eight hundred and thirty children were treated as outpatients with a mean time of 1.8 days for the evaluation of burn injury in our clinic. Scalds accounted for 53% of the burn mechanism, with burns to the hand/wrist being the most frequent area involved. The mean percentage of TBSA was 1.4% for the outpatient cohort and 8% for the inpatient cohort. Burns in the outpatient cohort healed with a mean time of 13.4 days. In the outpatient cohort, nine (1%) patients had subsequent admissions and three (0.4%) patients had concern for infection. Eight patients from the outpatient cohort were treated with excision and grafting. The vast majority of pediatric burns are small, although they may often involve more critical areas such as the face and hand. Outpatient wound care is an effective treatment strategy which results in low rates of complications and should become the standard of care for children with appropriate burn size and home support.

  13. Characterization of introduced breed of sheep and pattenl of conservation of Sumatera thin tail (STT sheep in North Sumatera

    Directory of Open Access Journals (Sweden)

    Priyanto D

    2000-03-01

    Full Text Available Sumatera thin tail (STT sheep are highly adapted to the local environment, no seasonal reproductive activity, and highresistance to internal parasite, but they have small body size and low mature body weight. "On Fann research" to identify morphological characteristics of intoduced breed and STT sheep, as well as an altemative conservation pattem were conducted in two location, i.e. Pulahan village, Air Batu District, Asahan Regency as the potensial area for STT sheep and Pulo Gambar village, Galang District, Deli Serdang Regency as the development area of introduced breed of sheep. The approach of Agroecosystem analysis, quantitative and qualitative characteristics of STT and introduced breed of sheep as well as interview to the farmer that raised STT in order to get recommendation of conservation pattern were aplied. The study show that STT sheep were isolated from the other area, and the populations tend to decrease from year to year. Qualitative characteristics of STT indicated smaller linear body measurements than those of introducted breed of sheep at the same age. Qualitative characteristics indicated that STT possess dominance body color of light brown and white (50.93% vs 41.28%. The STT mostly have one body color pattern (61.75%. The dominance spotted pattem were 1-10% of the body (60.29%, while the dominance of the head color was light brown (48.40%. Conservation pattern of STT are through natural process, in which the farmers are directly conserved, therefore the farmers do not have opportunity to develop their sheep farming. Therefore the conservation pattern recomnendation for STT sheep are by defending the location as "in situ conservation" or "on farm conservation" and giving "compensation program" to fanner because STT sheep farming less benefit than those of introduced breed of sheep.

  14. Fat-tailed sheep in Indonesia; an essential resource for smallholders.

    Science.gov (United States)

    Udo, Henk Mathijs Johannes; Budisatria, I Gede Suparta

    2011-10-01

    This paper discusses the historical development of fat-tailed sheep in Indonesia, the dynamics of production systems, production and reproduction performances under farmers' conditions, and roles of sheep in livelihoods. In the eighteenth and nineteenth century, fat-tailed sheep from southwest Asia and Africander sheep from South Africa were introduced. Crossing of fat-tailed sheep with the local thin-tailed sheep produced the Javanese fat-tailed sheep. Main motives for the gradual change-over to fat-tailed sheep have been their potential larger body size and the preference of consumers for their meat. Management systems are changing in response to the intensification of land use. The reproductive performances of fat-tailed sheep are good. Households keep four to six animals, housed close to the family quarters. This results in very high levels of faecal bacteria contamination of drinking water sources. Sheep provide a small income, manure, security and help to accumulate capital. Sheep also play a key role in religious festivities. Farmers hardly profit from the increased demand for the feast of sacrifice; animals are sold mainly when the owners have urgent cash needs. Systematic sheep fattening can contribute to higher economic results, if sufficient family labour and crop residues are available.

  15. Burns: dressings

    Science.gov (United States)

    2015-01-01

    Introduction Burns are classified according to depth. This overview concerns the treatments for partial-thickness burns, which can be expected or have the potential to heal spontaneously (superficial partial-thickness and mid-dermal partial-thickness burns). Injuries that involve the deeper part of the dermis and require surgical treatments to achieve healing are not the focus of this overview. Methods and outcomes We conducted a systematic overview and aimed to answer the following clinical question: What are the effects of treatments for partial-thickness burns? We searched: Medline, Embase, The Cochrane Library, and other important databases up to January 2014 (BMJ Clinical Evidence overviews are updated periodically; please check our website for the most up-to-date version of this review). Results At this update, searching of electronic databases retrieved 322 studies. After deduplication and removal of conference abstracts, 193 records were screened for inclusion in the overview. Appraisal of titles and abstracts led to the exclusion of 160 studies and the further review of 33 full publications. Of the 33 full articles evaluated, two systematic reviews and two RCTs were added at this update. We performed a GRADE evaluation for 30 PICO combinations. Conclusions In this systematic overview, we categorised the efficacy for 10 interventions, based on information relating to the effectiveness and safety of alginate dressing, biosynthetic dressing, chlorhexidine-impregnated paraffin gauze dressing, hydrocolloid dressing, hydrogel dressing, paraffin gauze dressing, polyurethane film, silicone-coated nylon dressing, silver-impregnated dressing, and silver sulfadiazine cream. PMID:26173045

  16. Impact of sheep and goats ectoparasites on the tanning industry in ...

    African Journals Online (AJOL)

    Impact of sheep and goats ectoparasites on the tanning industry in Tigray. Region, Ethiopia. 1Hagos ... The small ruminant population of Tigray Region is estimated to be 1,022,779 sheep and 1,588,779 goats. ..... Sheba tannery belong to small, medium, large and extra large sizes, respectively. Considering the proportion ...

  17. Bovine spongiform encephalopathy in sheep?

    NARCIS (Netherlands)

    Schreuder, B.E.C.; Somerville, R.A.

    2003-01-01

    Bovine spongiform encephalopathy (BSE) in sheep has not been identified under natural conditions at the time of writing and remains a hypothetical issue. However, rumours about the possible finding of a BSE-like isolate in sheep have led to great unrest within the sheep industry, among the general

  18. Acetone metabolism in sheep

    Science.gov (United States)

    Lindsay, D. B.; Brown, R. E.

    1966-01-01

    1. Entry rates of acetone were estimated in normal and ketonaemic sheep by using a constant-infusion technique with [14C]acetone. Entry rates were less than 1mg./min. in normal and 2–6mg./min. in ketonaemic sheep. 2. Only 1–2% of plasma glucose is derived from acetone. 3. Labelling in lactate is consistent with the conversion of acetone into glucose through lactate. 4. There is significant labelling of blood but not rumen volatile fatty acids. PMID:5969275

  19. Localization and migration of benzimidazole resistant and susceptible adult Cooperia curticei in the small intestine of sheep after treatment with thiabendazole.

    Science.gov (United States)

    Kerboeuf, D; Hubert, J; Alvinerie, M

    2000-11-01

    Four groups of three lambs per group were experimentally infected with Cooperia curticei susceptible (two groups) or resistant (two groups) to benzimidazoles, and distributions of adult worms in the small intestine were studied. For each Cooperia isolate, one group was treated with thiabendazole (TBZ) (5 or 50mg/kg bodyweight) 28 days after infection. In the two untreated groups, the population of C. curticei were present from the second to the tenth meter of intestine from the pylorus with a maximum in the sixth meter for both isolates. After treatment with TBZ, the size of the resistant worm population did not significantly decrease but a large number of worms were found towards the proximal sections of the intestine. In contrast, the susceptible population was reduced by about 40% but the surviving worms remained at this same site of predilection after treatment. Measurements of the concentration of TBZ and 5OH-thiabendazole (5OH-TBZ) in the intestinal segments do not indicate a clear relationship between the localization of worms and TBZ or 5OH-TBZ concentrations at least 12h after the anthelmintic treatment. The hypothesis of an enhanced expression of the mechanisms of resistance in the first few meters of small intestine is suggested.

  20. Environmental implications of dairy sheep supply chain and evaluation of climate change mitigation actions for Sardinian sheep farming systems

    OpenAIRE

    Vagnoni, Enrico

    2017-01-01

    The contribution of small ruminant sector to overall livestock GHG emissions is quite significant and the optimization of environmental performances by the way of eco-innovation is considered a valid strategy to improve the competitiveness of Mediterranean dairy sheep systems. Despite their significant role in environmental and socio-economic terms, little research has been conducted on the environmental implications of dairy sheep production systems. In this context, the main aim of this ...

  1. NERVOUS FORM OF LISTERIOSIS IN SHEEP IN BOSNIA AND HERZEGOVINA

    Directory of Open Access Journals (Sweden)

    Hajrudin Beširović

    2013-09-01

    Full Text Available This paper describes the occurence of listeriosis in silage fed domestic sheep of the Pramenka type. The aim was to investigate causes of death of animals with previously manifested nervous signs. According to the Law on Veterinary Medicine in Bosnia and Herzegovina, the brain of sheep showing nervous signs of illness must be examined with suspicion on Listeria monocytogenes infection. The disesase occured in  the region of Eastern Bosnia in February, 2009. The sheep affected were adult, gravid females. All sheep affected by disease shared similar clinical signs: dyspnea, increased heart rate, circling, staggering, torticollis and inappetence. No abortions of gravid sheep were noted. All simptoms were lasting for 3 to 4 days with lethal outcome and mortality of 5%. The administration of procaine benzylpenicillin showed no results. The necropsy of death sheep revealed encephalitis.Histopathologically, multifocal microabscesses containing mainly degenerated and viable neutrophils, perivascular accummulation of lymphocytes and plasma cells with some macrophages and neutrophils, and multifocal fibrinous microthrombi in the lumina of the blood vessels were observed in the brain tissue. Also, neuronal degeneration and small microglial accummulation were noted. Microbiologically, Listeria monocytogenes was isolated from the brain tissue.Key words: Listeria monocytogenes, encephalitis, microabscess, sheep, silage

  2. Phylogeny of sheep and goat Theileria and Babesia parasites.

    Science.gov (United States)

    Schnittger, Leonhard; Yin, Hong; Gubbels, Marc J; Beyer, Doreen; Niemann, Stefan; Jongejan, Frans; Ahmed, Jabbar S

    2003-11-01

    The phylogenetic relationship of Theileria and Babesia species infecting sheep and goats on the basis of their 18S RNA gene structure was addressed in the present study. For this purpose, the complete sequences of the small ribosomal RNA genes of a panel of sheep and goat piroplasm isolates, including T. lestoquardi, T. ovis, T. separata, B. ovis, B. motasi, B. crassa and several novel species, were sequenced and compared. The classification based on the established phylogenetic tree corresponded with traditional systematics and revealed that sheep/goat piroplasm species are of polyphyletic origin. The independent evolution of almost all sheep/goat piroplasms suggests that speciation may have occurred after transfer of the piroplasm-transmitting tick from a primal wild ruminant host to domestic sheep and goats. In accordance with recent reports, our study confirms the existence of at least two additional sheep/goat piroplasm species, designated Theileria sp. 1 (China) and Theileria sp. 2 (China). The recently reported pathogenic sheep/goat Theileria sp. 1 (China) seems to be identical with a Theileria sp. isolated from Japanese serow. Furthermore, our results suggest that T. ovis represents a single species.

  3. Agriculture. Sheep Livestock.

    Science.gov (United States)

    Michigan State Univ., East Lansing. Coll. of Agriculture and Natural Resources Education Inst.

    This task-based curriculum guide for agricultural production, specifically for sheep, is intended to help the teacher develop a classroom management system where students learn by doing. Introductory materials include a Dictionary of Occupational Titles job code and title sheet, a task sheet for developing leadership skills, and a task list. Each…

  4. Toxicokinetics of cotyledoside following intravenous administration to sheep

    Directory of Open Access Journals (Sweden)

    C.J. Botha

    2003-06-01

    Full Text Available Cotyledoside, a bufadienolide cardiac glycoside, was administered intravenously to sheep in 2 studies. In experiment 1, sheep (n = 4 received 0.0135 mg / kg daily on 5 consecutive days and in the 2nd experiment, sheep (n = 4 received 0.027 mg / kg as a single dose. Jugular blood was collected at different time intervals and kinetic parameters were determined. The data fitted a 1-compartmental model. In both experiments a short half-life (t1/2 and mean residence time (MRT, a relative small volume of distribution (Vdss and rapid clearance were calculated. In the 1st experiment, t1/2 and MRT increased significantly (P < 0.007 from Day (D 0 to D 4. It is suggested that the rapid decline in plasma cotyledoside concentrations in sheep denotes rapid distribution of cotyledoside to the tissues or extracellular spaces and possible accumulation at the biophase.

  5. Reactive burn models and ignition & growth concept

    Science.gov (United States)

    Menikoff, R.; Shaw, M. S.

    Plastic-bonded explosives are heterogeneous materials. Experimentally, shock initiation is sensitive to small amounts of porosity, due to the formation of hot spots (small localized regions of high temperature). This leads to the Ignition & Growth concept, introduced by LeeTarver in 1980, as the basis for reactive burn models. A homo- genized burn rate needs to account for three meso-scale physical effects: (i) the density of active hot spots or burn centers; (ii) the growth of the burn fronts triggered by the burn centers; (iii) a geometric factor that accounts for the overlap of deflagration wavelets from adjacent burn centers. These effects can be combined and the burn model defined by specifying the reaction progress variable λ = g(s) as a function of a dimensionless reaction length s(t) = rbc/ℓbc, rather than by specifying an explicit burn rate. The length scale ℓbc(Ps) = [Nbc(Ps)]-1/3 is the average distance between burn centers, where Nbc is the number density of burn centers activated by the lead shock. The reaction length rbc(t) = ∫t0 D(P(t'))dt' is the distance the burn front propagates from a single burn center, where D(P) is the deflagration speed as a function of the local pressure and t is the time since the shock arrival. A key implementation issue is how to determine the lead shock strength in conjunction with a shock capturing scheme. We have developed a robust algorithm for this purpose based on the Hugoniot jump condition for the energy. The algorithm utilizes the time dependence of density, pressure and energy within each cell. The method is independent of the numerical dissipation used for shock capturing. It is local and can be used in one or more space dimensions. The burn model has a small number of parameters which can be calibrated to fit velocity gauge data from shock initiation experiments.

  6. Chemical burns in children: Aetiology and prevention.

    Science.gov (United States)

    D'Cruz, Rachel; Pang, Tony C Y; Harvey, John G; Holland, Andrew J A

    2015-06-01

    Chemical burns account for a small proportion of total burns in children, but may require specific first aid and different modes of prevention. A retrospective study between 2006 and 2012 of children ≤16 years treated with chemical burns at a specialist paediatric burn centre. Data were extracted from a prospectively maintained database. 56 episodes of chemical burns occurred during the study period. The majority (54%) occurred in boys. There were 39 (72%) patients chemical burns occurred in the domestic setting, especially in the chemicals by an unattended child accounted for half of all (n=22, 49%) chemical burns burns in patients ≥10 years resulted from self-harm. The most common aetiological agents were household cleaners and aerosols in the younger and older age groups respectively. Chemical burns remain infrequent but potentially preventable. These burns mainly occur in the domestic setting due to non-intentional exposure of household chemicals in children burns in children <10. Crown Copyright © 2014. Published by Elsevier Ltd. All rights reserved.

  7. Detection and control of lentiviral infections in sheep and goats

    NARCIS (Netherlands)

    Brinkhof, J.M.A.

    2009-01-01

    Infections caused by the small ruminant lentiviruses (SRLV) of sheep (maedi visna virus) and goats (caprine arthritis encephalitis virus) are a serious economical threat to small ruminant farming particularly in the more intensive settings like dairy farms. Revenue is ultimately negatively

  8. Experimental Transmission of Bighorn Sheep Sinus Tumors to Bighorn Sheep (Ovis canadensis canadensis) and Domestic Sheep.

    Science.gov (United States)

    Fox, K A; Wootton, S; Marolf, A; Rouse, N; LeVan, I; Spraker, T; Miller, M; Quackenbush, S

    2016-11-01

    Bighorn sheep sinus tumors are a recently described disease affecting the paranasal sinuses of Rocky Mountain bighorn sheep (Ovis canadensis canadensis). Several features of this disease suggest an infectious cause, although a specific etiologic agent has not been identified. To test the hypothesis that bighorn sheep sinus tumors are caused by an infectious agent, we inoculated 4 bighorn sheep lambs and 4 domestic sheep lambs intranasally with a cell-free filtrate derived from a naturally occurring bighorn sheep sinus tumor; we held 1 individual of each species as a control. Within 18 months after inoculation, all 4 inoculated domestic sheep (100%) and 1 of the 4 inoculated bighorn sheep (25%) developed tumors within the ethmoid sinuses or nasal conchae, with features similar to naturally occurring bighorn sheep sinus tumors. Neither of the uninoculated sheep developed tumors. Histologically, the experimentally transmitted tumors were composed of stellate to spindle cells embedded within a myxoid matrix, with marked bone production. Tumor cells stained positively with vimentin, S100, alpha smooth muscle actin, and osteocalcin, suggesting origin from a multipotent mesenchymal cell. A periosteal origin for these tumors is suspected. Immunohistochemical staining for the envelope protein of JSRV (with cross-reactivity to ENTV) was equivocal, and PCR assays specific for these agents were negative. © The Author(s) 2016.

  9. Prevalence of antibodies to Dermatophilus congolensis in sheep and goats in Nigeria.

    Science.gov (United States)

    Oyejide, A; Makinde, A A; Ezeh, A O

    1984-01-01

    A serological survey on dermatophilosis was carried out amongst sheep and goats in Kaduna State of Nigeria. Sera were obtained from slaughter animals and from sheep kept on an isolated ranch. The percentage of seropositive animals was 28.0 in slaughter sheep, 0.0 in sheep kept on the ranch, and 23.2 in slaughter goats. The high prevalence of D. congolensis antibodies among small ruminants compares well with the level of prevalence reported of cattle of cattle and calls for a concerted government effort for the control of the disease.

  10. Scrapie resistance in ARQ sheep.

    Science.gov (United States)

    Laegreid, W W; Clawson, M L; Heaton, M P; Green, B T; O'Rourke, K I; Knowles, D P

    2008-10-01

    Variation in the ovine prion protein amino acid sequence influences scrapie progression, with sheep homozygous for A(136)R(154)Q(171) considered susceptible. This study examined the association of survival time of scrapie-exposed ARQ sheep with variation elsewhere in the ovine prion gene. Four single nucleotide polymorphism alleles were associated with prolonged survival. One nonsynonymous allele (T112) was associated with an additional 687 days of survival for scrapie-exposed sheep compared to M112 sheep (odds ratio, 42.5; P = 0.00014). The only two sheep homozygous for T112 (TARQ) did not develop scrapie, suggesting that the allelic effect may be additive. These results provide evidence that TARQ sheep are genetically resistant to development of classical scrapie.

  11. Salmonella in Sheep in Iceland

    Directory of Open Access Journals (Sweden)

    Gunnarsson E

    2002-03-01

    Full Text Available In 1995 several outbreaks of food poisoning in humans occurred in Iceland, that were traced to salmonella contamination of singed sheep heads. This prompted us to study the prevalence of salmonella infection in sheep and to trace where and how infection might have occurred. Faecal, intestinal contents and tonsillar samples were collected in the spring and autumn from sheep on 50 farms in the southwestern part of the country, where salmonellosis had been detected and from 5 farms in the northwestern part of the country. All faecal samples from the southwest were negative, whereas samples from 3 farms obtained in the autumn in the northwest were positive. Tonsillae taken in the autumn were positive in sheep from 3 farms in the southwest and 2 in the northwest. Our results show that salmonella infection is rare in Icelandic sheep but healthy carriers may harbour the bacteria in tonsillae. Salmonella was not detected in drainage from slaughterhouses nor in singed sheep heads.

  12. Chemical burn or reaction

    Science.gov (United States)

    ... this page: //medlineplus.gov/ency/article/000059.htm Chemical burn or reaction To use the sharing features on ... the burned area from pressure and friction. Minor chemical burns will generally heal without further treatment. However, if ...

  13. Paratuberculosis in sheep and goats.

    Science.gov (United States)

    Windsor, P A

    2015-12-14

    Paratuberculosis is a chronic insidious, often serious, disease of the global small ruminant industries, mainly causing losses from mortalities and reduced productivity on-farm, interference in trading and, in Australia, profound socio-economic impacts that have periodically compromised harmony of rural communities. The pathogenesis, diagnosis, impacts and disease management options for ovine and caprine paratuberculosis are reviewed, comparing current controls in the extensive management system for sheep in wool flocks in Australia with the semi-intensive system of dairy flocks/herds in Greece. Improved understanding of the immune and cellular profiles of sheep with varying paratuberculosis outcomes and the recognition of the need for prolonged vaccination and biosecurity is considered of relevance to future control strategies. Paratuberculosis in goats is also of global distribution although the prevalence, economic impact and strategic control options are less well recognized, possibly due to the relatively meagre resources available for goat industry research. Although there have been some recent advances, more work is required on developing control strategies for goats, particularly in dairy situations where there is an important need for validation of improved diagnostic assays and the recognition of the potential impacts for vaccination. For all species, a research priority remains the identification of tests that can detect latent and subclinical infections to enhance removal of future sources of infectious material from flocks/herds and the food chain, plus predict the likely outcomes of animals exposed to the organism at an early age. Improving national paratuberculosis control programs should also be a priority to manage disease risk from trade. The importance of strong leadership and communication, building trust within rural communities confused by the difficulties in managing this insidious disease, reflects the importance of change management

  14. Exposure of bighorn sheep to domestic goats colonized with Mycoplasma ovipneumoniae induces sub-lethal pneumonia.

    Science.gov (United States)

    Besser, Thomas E; Cassirer, E Frances; Potter, Kathleen A; Foreyt, William J

    2017-01-01

    Bronchopneumonia is a population limiting disease of bighorn sheep (Ovis canadensis) that has been associated with contact with domestic Caprinae. The disease is polymicrobial but is initiated by Mycoplasma ovipneumoniae, which is commonly carried by both domestic sheep (O. aries) and goats (Capra aegagrus hircus). However, while previous bighorn sheep comingling studies with domestic sheep have resulted in nearly 100% pneumonia mortality, only sporadic occurrence of fatal pneumonia was reported from previous comingling studies with domestic goats. Here, we evaluated the ability of domestic goats of defined M. ovipneumoniae carriage status to induce pneumonia in comingled bighorn sheep. In experiment 1, three bighorn sheep naïve to M. ovipneumoniae developed non-fatal respiratory disease (coughing, nasal discharge) following comingling with three naturally M. ovipneumoniae-colonized domestic goats. Gross and histological lesions of pneumonia, limited to small areas on the ventral and lateral edges of the anterior and middle lung lobes, were observed at necropsies conducted at the end of the experiment. A control group of three bighorn sheep from the same source housed in isolation during experiment 1 remained free of observed respiratory disease. In experiment 2, three bighorn sheep remained free of observed respiratory disease while comingled with three M. ovipneumoniae-free domestic goats. In experiment 3, introduction of a domestic goat-origin strain of M. ovipneumoniae to the same comingled goats and bighorn sheep used in experiment 2 resulted in clinical signs of respiratory disease (coughing, nasal discharge) in both host species. At the end of experiment 3, gross and histological evidence of pneumonia similar to that observed in experiment 1 bighorn sheep was observed in both affected bighorn sheep and domestic goats. M. ovipneumoniae strains carried by domestic goats were transmitted to comingled bighorn sheep, triggering development of pneumonia. However

  15. Benefit from the association of small amounts of tannin-rich shrub foliage (Acacia cyanophylla Lindl.) with soya bean meal given as supplements to Barbarine sheep fed on oaten hay

    Energy Technology Data Exchange (ETDEWEB)

    Ben Salem, H. [Institut National de la Recherche Agronomique de Tunisie, Laboratoire des Productions Animales et Fourrageres, Ariana (Tunisia)]. E-mail: bensalem.hichem@iresa.agrinet.tn; Makkar, H.P.S. [Animal Production and Health Section, Joint FAO/IAEA Division, International Atomic Energy Agency, Vienna (Austria); Nefzaoui, A.; Abidi, S. [Institut National de la Recherche Agronomique de Tunisie, Laboratoire des Productions Animales et Fourrageres, Ariana (Tunisia); Hassayoun, L. [Institut National de la Recherche Agronomique de Tunisie, Laboratoire des Productions Animales et Fourrageres, Ariana (Tunisia); Ecole Superieure d' Agriculture de Mateur, Mateur (Tunisia)

    2005-08-19

    Two trials were conducted to test the hypotheses that (i) feeding small amount of a tanniniferous shrub foliage (Acacia cyanophylla Lindl., acacia) increases the proportion of rumen undegradable protein, and consequently benefits growth performance in Barbarine lamb; and (ii) such positive effect depends on the timing of feeding tannin source (i.e. acacia) relative to protein source (soya bean meal, SBM). Total (TT) and condensed tannin (CT) concentrations in air-dried acacia leaves used in this study averaged 29 g tannic acid and 48 g leucocyanidin equivalents per kg dry matter (DM), respectively. In trial 1, rumen fistulated ewes received oaten hay (hay) ad libitum and 200 g SBM (D1), D1 and 100 g acacia fed with the SBM (D2, mixed strategy) or as D2, but the SBM fed 1 h later than acacia when acacia was consumed completely (D3, sequential strategy). Hay intake, diet digestibility, rumen fermentation parameters (pH, ammonia nitrogen (NH{sub 3}-N) and total volatile fatty acids) and in situ degradation of SBM nitrogen were similar between D1 and D2 (P > 0.05). However, the sequential strategy (D3) resulted in efficient use of N as reflected by the decrease of crude protein digestibility (CPD), plasma urea, NH{sub 3}-N concentration and in situ degradation of SBM nitrogen. In trial 2, four groups each of six Barbarine lambs (initial LW 35.3 {+-} 3.7 kg) received for 90 days: hay ad libitum and 200 g SBM (D1), D1 and 20 g polyethylene glycol (PEG, MW 4000) mixed with SBM (D2), D1 and 100 g acacia with the SBM fed 1 h later when acacia was completely consumed (sequential strategy) (D3) or D3 and 20 g PEG fed with the SBM (D4). Polyethylene glycol was here used to deactivate tannins. Hay intake and DM, organic matter and neutral detergent fibre digestibility were similar among dietary treatment (P > 0.05). However, supplementing lambs with SBM and acacia without PEG (D3) resulted in a significant decrease (P < 0.001) of CPD (0.664 versus 0.597, respectively for D1 and

  16. Breeding Practices in Sheep Farming

    Directory of Open Access Journals (Sweden)

    M.A. Shejal

    2009-02-01

    Full Text Available The sheep is an important economic livestock species, contributing greatly to the Indian economy, especially in arid, semi arid and mountain areas. The current population in world is 1110.78 millions, around 44.85 millions (1987 sheeps in India (ICAR., 2002. Sheeps are mostly reared for meat and wool. The average annual wool production per sheep is between 3.5 to 5.5 kg of fine quality wool in Australia, New Zealand and U.S.S.R., where as in India except Magra sheep which annually yield more than 2 kg wool having staple length 5.8 cm, the average of rest of the wool produced is less than 1.0 kg per sheep of inferior quality (Banerjee G.C., 1998. Therefore many farmers in southern India adapted sheep rearing for meat production than for wool production. For yielding more production from sheep farming one should have sound knowledge of general information related to the reproduction and different breeding practices. [Vet. World 2009; 2(1.000: 43-44

  17. First Aid: Burns

    Science.gov (United States)

    ... to the Gynecologist? Blood Test: Thyroid Peroxidase Antibodies First Aid: Burns KidsHealth > For Parents > First Aid: Burns Print A A A Scald burns from ... THIS TOPIC Kitchen: Household Safety Checklist Fireworks Safety First Aid: Sunburn Firesetting Fire Safety Burns Household Safety: Preventing ...

  18. Minor burns - aftercare

    Science.gov (United States)

    ... If this is not possible, put a cool, clean wet cloth on the burn, or soak the burn in a cool water bath for 5 minutes. ... After the burn is cooled, make sure it is a minor burn. If it is deeper, ... You may put a thin layer of ointment, such as petroleum ...

  19. Complete Mitochondrial Genome Sequences of Chinese Indigenous Sheep with Different Tail Types and an Analysis of Phylogenetic Evolution in Domestic Sheep.

    Science.gov (United States)

    Fan, Hongying; Zhao, Fuping; Zhu, Caiye; Li, Fadi; Liu, Jidong; Zhang, Li; Wei, Caihong; Du, Lixin

    2016-05-01

    China has a long history of sheep (Ovis aries [O. aries]) breeding and an abundance of sheep genetic resources. Knowledge of the complete O. aries mitogenome should facilitate the study of the evolutionary history of the species. Therefore, the complete mitogenome of O. aries was sequenced and annotated. In order to characterize the mitogenomes of 3 Chinese sheep breeds (Altay sheep [AL], Shandong large-tailed sheep [SD], and small-tailed Hulun Buir sheep [sHL]), 19 sets of primers were employed to amplify contiguous, overlapping segments of the complete mitochondrial DNA (mtDNA) sequence of each breed. The sizes of the complete mitochondrial genomes of the sHL, AL, and SD breeds were 16,617 bp, 16,613 bp, and 16,613 bp, respectively. The mitochondrial genomes were deposited in the GenBank database with accession numbers KP702285 (AL sheep), KP981378 (SD sheep), and KP981380 (sHL sheep) respectively. The organization of the 3 analyzed sheep mitochondrial genomes was similar, with each consisting of 22 tRNA genes, 2 rRNA genes (12S rRNA and 16S rRNA), 13 protein-coding genes, and 1 control region (D-loop). The NADH dehydrogenase subunit 6 (ND6) and 8 tRNA genes were encoded on the light strand, whereas the rest of the mitochondrial genes were encoded on the heavy strand. The nucleotide skewness of the coding strands of the 3 analyzed mitogenomes was biased toward A and T. We constructed a phylogenetic tree using the complete mitogenomes of each type of sheep to allow us to understand the genetic relationships between Chinese breeds of O. aries and those developed and utilized in other countries. Our findings provide important information regarding the O. aries mitogenome and the evolutionary history of O. aries inside and outside China. In addition, our results provide a foundation for further exploration of the taxonomic status of O. aries.

  20. Self-inflicted burns: a case series.

    Science.gov (United States)

    Henderson, Antony; Wijewardena, Aruna; Streimer, Jeff; Vandervord, John

    2013-03-01

    Self-inflicted burns are regularly admitted to burns units worldwide. Most of these patients are referred to psychiatric services and are successfully treated however some return to hospital with recurrent self-inflicted burns. The aim of this study is to explore the characteristics of the recurrent self-inflicted burn patients admitted to the Royal North Shore Hospital during 2004-2011. Burn patients were drawn from a computerized database and recurrent self-inflicted burn patients were identified. Of the total of 1442 burn patients, 40 (2.8%) were identified as self-inflicted burns. Of these patients, 5 (0.4%) were identified to have sustained previous self-inflicted burns and were interviewed by a psychiatrist. Each patient had been diagnosed with a borderline personality disorder and had suffered other forms of deliberate self-harm. Self-inflicted burns were utilized to relieve or help regulate psychological distress, rather than to commit suicide. Most patients had a history of emotional neglect, physical and/or sexual abuse during their early life experience. Following discharge from hospital, the patients described varying levels of psychiatric follow-up, from a post-discharge review at a local community mental health centre to twice-weekly psychotherapy. The patients who engaged in regular psychotherapy described feeling more in control of their emotions and reported having a longer period of abstinence from self-inflicted burn. Although these patients represent a small proportion of all burns, the repeat nature of their injuries led to a significant use of clinical resources. A coordinated and consistent treatment pathway involving surgical and psychiatric services for recurrent self-inflicted burns may assist in the management of these challenging patients. Copyright © 2012 Elsevier Ltd and ISBI. All rights reserved.

  1. Coxiella burnetii infections in sheep or goats: an opinionated review.

    Science.gov (United States)

    Van den Brom, R; van Engelen, E; Roest, H I J; van der Hoek, W; Vellema, P

    2015-12-14

    Q fever is an almost ubiquitous zoonosis caused by Coxiella burnetii, which is able to infect several animal species, as well as humans. Cattle, sheep and goats are the primary animal reservoirs. In small ruminants, infections are mostly without clinical symptoms, however, abortions and stillbirths can occur, mainly during late pregnancy. Shedding of C. burnetii occurs in feces, milk and, mostly, in placental membranes and birth fluids. During parturition of infected small ruminants, bacteria from birth products become aerosolized. Transmission to humans mainly happens through inhalation of contaminated aerosols. In the last decade, there have been several, sometimes large, human Q fever outbreaks related to sheep and goats. In this review, we describe C. burnetii infections in sheep and goats, including both advantages and disadvantages of available laboratory techniques, as pathology, different serological tests, PCR and culture to detect C. burnetii. Moreover, worldwide prevalences of C. burnetii in small ruminants are described, as well as possibilities for treatment and prevention. Prevention of shedding and subsequent environmental contamination by vaccination of sheep and goats with a phase I vaccine are possible. In addition, compulsory surveillance of C. burnetii in small ruminant farms raises awareness and hygiene measures in farms help to decrease exposure of people to the organism. Finally, this review challenges how to contain an infection of C. burnetii in small ruminants, bearing in mind possible consequences for the human population and probable interference of veterinary strategies, human risk perception and political considerations. Copyright © 2015 Elsevier B.V. All rights reserved.

  2. Expression of inflammatory cytokine and inducible nitric oxide synthase genes in the small intestine and mesenteric lymph node tissues of pauci- and multibacillary sheep naturally infected with Mycobacterium avium ssp. paratuberculosis

    Directory of Open Access Journals (Sweden)

    Ganesh G Sonawane

    2016-01-01

    Conclusion: The present study indicated that IFN-γ and iNOS were found to play important role in the induction of Th1 type immune response in PB sheep. MB sheep had significant reduction in expression of IFN-γ and iNOS and elevation of IL-10 and TGF-β, which was typical of Th2 cytokine pattern. Elevated expression of IL-10 and TGF-β in PB cases possibly suggests the role of T-regulatory cells and may follow an independent mechanism not typical of Th1 pattern. In view of significantly reduced expression in both forms of the disease, IL-1α may not be an important cytokine in ovine paratuberculosis.

  3. ANTIPARASITICAL PROTECTION IN SHEEP FARMS

    Directory of Open Access Journals (Sweden)

    DOINA ARDELEANU

    2008-10-01

    Full Text Available Through our researches were carried out at ICDCOC- Palas, Constantza, we proposed ourselves to establish the poly-parasitism structure on sheep, as well as elaborating efficientical methods for anti-parasitical prophylaxis and fighting in sheep populations and pasture sourfaces, in order to ensuring anti-parasitical protection in sheep exploitations The copro-parasitological examinations was carried ovoscopicaly (flotation - by Willis and Mc. Master methods; sediment – by polyvalent method and larvoscopicaly – by Baermann method. The parasitological examination of coprological smears which were harvested on sheep showed the presence of polyparasitism phenomenon with protozoans (coccidiae: Eimeria spp. and helmints (cestodae: Moniesia expansa; gastro-intestinal nemathodes: Trichostrongylus spp., Nematodirus spp., Strongyloides papillosus and pulmonary nemathodes: Müellerius capillaris, Protostrongylus rufescens, Dictyocaulus filaria. Also, we proposed ourselves to study the paresites and their intermediary stages on pastures which were exploited with sheep, comparatively with mowed pastures. In the ansamble of research activities a special place is occupied by testing differents methods, in order to prevention and fighting of parasitical infestations on sheep and pasture in sheep farms.

  4. Optimization of burn referrals

    DEFF Research Database (Denmark)

    Reiband, Hanna K; Lundin, Kira; Alsbjørn, Bjarne

    2014-01-01

    INTRODUCTION: Correct estimation of the severity of burns is important to obtain the right treatment of the patient and to avoid over- and undertriage. In this study we aimed to assess how often the guidelines for referral of burn injured patients are met at the national burn centre (NBC), Denmark....... METHODS: We included burn patients referred to the NBC in a three-months period. Patient records were systematically analyzed and compared with the national guidelines for referral of burn injured patients. RESULTS: A total of 97 burn injured patients were transferred for treatment at the NBC and the most...... common reason for referral was partial thickness burn exceeding 3% estimated area of burn (55% of the patients) while facial burns (32%) and inhalational injury (25%) were other common reasons. We found that 29 (30%) of the referrals were considered potentially unnecessary according to the guidelines...

  5. Microsatellite-based estimation of inbreeding level in sheep ...

    African Journals Online (AJOL)

    In sheep populations with small effective population sizes (Ne), inbreeding is a major concern because genetic variation has to be maintained. A panel of 28 microsatellite markers was used to measure the inbreeding level in three separate Merino flocks bred for superfine wool (CR), low parasite resistance (LR) or high ...

  6. Assessment of Quality Characteristics of Cellulose, Sheep and Goat ...

    African Journals Online (AJOL)

    Small intestines of 12 West African Dwarf (WAD) sheep and those of 12 Red Sokoto goats obtained from an abattoir were converted into casings. The imported cellulose casing used for the study was obtained from a sausage manufacturing company. Cellulose casing had the widest diameter of 35.00mm followed by ...

  7. some reproductive disorders of the indigenous sheep and coats in

    African Journals Online (AJOL)

    The short supply ol'animal protein has become a matter of concern in Nigeria because of the teeming human population with an ... systems of/small ruminants should be controlled. This study was ... female reprOductive disorders of the indigenous female sheep and goats (over a ten year period) that were presented to the ...

  8. Inbreeding in the Danish populations of five Nordic sheep breeds

    DEFF Research Database (Denmark)

    Sørensen, Anders Christian; Norberg, Elise

    2008-01-01

    In Denmark there are small populations of five Nordic sheep breeds, two of which are Danish in origin. The purpose of this study was to estimate trends in inbreeding for these breeds. All five breeds have been recording pedigrees for decades, so pedigree completeness is adequate. The rate...

  9. Characterization of the microbial communities along the gastrointestinal tract of sheep by 454 pyrosequencing analysis

    Directory of Open Access Journals (Sweden)

    Jin Wang

    2017-01-01

    Full Text Available Objective The gastrointestinal tract of sheep contain complex microbial communities that influence numerous aspects of the sheep’s health and development. The objective of this study was to analyze the composition and diversity of the microbiota in the gastrointestinal tract sections (rumen, reticulum, omasum, abomasum, duodenum, jejunum, ileum, cecum, colon, and rectum of sheep. Methods This analysis was performed by 454 pyrosequencing using the V3-V6 region of the 16S rRNA genes. Samples were collected from five healthy, small tailed Han sheep aged 10 months, obtained at market. The bacterial composition of sheep gastrointestinal microbiota was investigated at the phylum, class, order, family, genus, and species levels. Results The dominant bacterial phyla in the entire gastrointestinal sections were Firmicutes, Bacteroidetes, and Proteobacteria. In the stomach, the three most dominant genera in the sheep were Prevotella, unclassified Lachnospiraceae, and Butyrivibrio. In the small intestine, the three most dominant genera in the sheep were Escherichia, unclassified Lachnospiraceae, and Ruminococcus. In the large intestine, the three most dominant genera in the sheep were Ruminococcus, unclassified Ruminococcaceae, and Prevotella. R. flavefaciens, B. fibrisolvens, and S. ruminantium were three most dominant species in the sheep gastrointestinal tract. Principal Coordinates Analysis showed that the microbial communities from each gastrointestinal section could be separated into three groups according to similarity of community composition: stomach (rumen, reticulum, omasum, and abomasum, small intestine (duodenum, jejunum, and ileum, and large intestine (cecum, colon, and rectum. Conclusion This is the first study to characterize the entire gastrointestinal microbiota in sheep by use of 16S rRNA gene amplicon pyrosequencing, expanding our knowledge of the gastrointestinal bacterial community of sheep.

  10. Involving burn survivors in agenda setting on burn research: an added value?

    NARCIS (Netherlands)

    Broerse, J.E.W.; Zweekhorst, M.B.M.; Van Rensen, A.J.M.L.; De Haan, M.J.M.

    2010-01-01

    Background and aim: The role of burn survivors in burn research is usually restricted to being objects of study and beneficiaries of research results, while decision-making on research is traditionally the domain of a small group of experts, mainly scientists. In this article we compare the research

  11. Rituals Cows or just another flock of Sheep?

    DEFF Research Database (Denmark)

    Bangsgaard, Pernille

    or body-parts and any special treatment of the bones, such as cutting, skinning and painting. In order to contextualise the faunal deposits I have also included information concerning the cemeteries, the graves, the small finds and the gender and age of the deceased. In the SJE assemblages three types...... of deposits could be identified, these include complete sheep deposited next to the dead, cut cattle skulls as well as large deposits of decorated sheep and goat skulls, the two latter located on or near the original surface of the cemetery. In the following fifth chapter information regarding from a number...

  12. Becoming Sheep, Becoming Animal..

    DEFF Research Database (Denmark)

    Grum, Charlotte; Svabo, Connie

    As a part of a 2015 group exhibition exploring the history and local myths of a woman living in a Danish heath landscape 150 years ago, artist Charlotte Grum connected herself to a live sheep for 4 hours a day, 5 days a week, for 5 weeks, turning the two into a hybrid relational assemblage, intra......-acting and becoming with the heath habitat, the other by-passing human and non-human animals, the changing weather and their fluctuating biological needs. She wanted to explore the discursive and material effects of a site specific human-nonhuman animal intra-action, to challenge the gendered and anthropocentric...... reading of a particular historical subject and to explore the messy constituents of the very categories of women and animals. In general she is occupied with how to animate and perform the intra-active entanglement of subjectivity and materiality.The “Becoming Sheep” project produced a variety of visual...

  13. Implications of Genotype by Environment Interactions in Dairy Sheep Welfare

    Directory of Open Access Journals (Sweden)

    Dinu Gavojdian

    2014-05-01

    Full Text Available Small ruminants are the most extensively farmed livestock species in Europe, as a result being extremely exposed to natural hazards which leads to strong interactions between genotype and environment. Aim of the current review was to outline and discuss the main welfare issues and economic implications with regards to the genotype by environment interactions in dairy sheep. Researches concerning the additive genetic effect on milk yield, shown that this accounts only for 10%, while the milk production is 90% influenced by environmental factors, highlighting the major role that management and nutrition play in the dairy production of sheep. Nowadays, dairy sheep breeds (e.g. Eastern Friesian and Lacaune, are being introduced and reared in various countries under an extremely wide range of rearing conditions, without adequate knowledge on their acclimatization to the new specific conditions. It was concluded that a welfare assessment protocol for dairy sheep does not exist up today, moreover, there is a serious lack of data concerning the genetic and environmental factors affecting the welfare status of dairy sheep at farm level under different production systems.

  14. Crude oil burning mechanisms

    DEFF Research Database (Denmark)

    van Gelderen, Laurens; Malmquist, Linus Mattias Valdemar; Jomaas, Grunde

    2015-01-01

    In order to improve predictions for the burning efficiency and the residue composition of in-situ burning of crude oil, the burning mechanism of crude oil was studied in relation to the composition of its hydrocarbon mixture, before, during and after the burning. The surface temperature, flame...... to the predictions of four conceptual models that describe the burning mechanism of multicomponent fuels. Based on the comparisons, hydrocarbon liquids were found to be best described by the Equilibrium Flash Vaporization model, showing a constant gas composition and gasification rate. The multicomponent fuels...... followed the diffusion-limited gasification model, showing a change in the hydrocarbon composition of the fuel and its evaporating gases, as well as a decreasing gasification rate, as the burning progressed. This burning mechanism implies that the residue composition and burning efficiency mainly depend...

  15. Burns - Multiple Languages

    Science.gov (United States)

    ... Supplements Videos & Tools You Are Here: Home → Multiple Languages → All Health Topics → Burns URL of this page: https://medlineplus.gov/languages/burns.html Other topics A-Z Expand Section ...

  16. Study on the polymorphism of POU1F1 gene in sheep

    Directory of Open Access Journals (Sweden)

    Jun Yan Bai

    Full Text Available ABSTRACT In this study, POU1F1 gene polymorphism was detected in five sheep populations (large-tailed Han, small-tailed Han, Yuxi fat-tailed, Lanzhou large-tailed, and Mongolian sheep, using DNA pooling and sequencing, to provide theoretical basis for the breeding of excellent sheep varieties. Three single-nucleotide polymorphism (SNP loci of POU1F1 gene were detected in five sheep populations, namely C355T (C/T, C71G (C/G, and C330G (C/G. C and T frequencies of C355T were 0.67/0.33, 0.81/0.19, 0.67/0.33, 1.00/0.00, and 0.93/0.07, respectively, in large-tailed Han, small-tailed Han, Yuxi fat-tailed, Mongolian, and Lanzhou large-tailed sheep. C of C355T locus was the dominant allele in five sheep populations. C and G allele frequencies of C330G locus were detected in Yuxi fat-tailed sheep; their frequencies were 0.75 and 0.25, respectively. C and G allele of C71G locus were only detected in Yuxi fat-tailed and large-tailed Han sheep; their frequencies were 0.87/0.13 and 0.87/0.13, respectively. The cluster analysis based on POU1F1 gene sequence showed that bactrian camel, dromedary, and wild camel clustered first, and dolphin and killer whales clustered according to taxonomy. Although the four species Tibetan antelope, buffalo, goat, and sheep were alone, they got close and the relative genetic relationship was intimate according to the dendrogram. The mutation site analysis of the POU1F1 gene in five sheep populations in this study would be favorable for uncovering the function of POU1F1 gene deeply.

  17. Economics of pediatric burns.

    Science.gov (United States)

    Bass, Michael J; Phillips, Linda G

    2008-07-01

    Sustaining a burn injury sets in motion a cycle of pain, disfigurement, and a search for survival. In pediatric burns, the injury extends to the parents where fear, ignorance, and helplessness forever change their lives. Pediatric burn injuries are caused by fire, hot liquids, clothing irons, hair curlers, caustic substances like drain cleaner, the grounding of an electrical source, and exposure to radiation. Efficiency in the delivery of pediatric burn care is critical. Maximizing resource utilization means continual self-evaluation and economic analysis of therapeutic modalities. Griffiths et al found that most childhood burns are due to scalds, which can be treated for $1061 per percent burn. Paddock et al reduced the cost of treating superficial pediatric burns and reduced the length of stay in hospital using silver-impregnated gauze over traditional methods. Barrett et al found improved cosmesis of skin grafts using cultured epithelial autografts but at a substantially increased cost. Corpron et al showed that pediatric burn units that treat burns >10% total body surface area and operative treatment of pediatric burns regardless of size generate positive revenue. There is a paucity of evidentiary pediatric burn economic data. More research is needed to address areas of pediatric burn care inefficiency. Improving knowledge of cost in all health care endeavors will create competition and drive down expenditures.

  18. Epidemiology of burns

    NARCIS (Netherlands)

    Dokter, Jan

    2016-01-01

    The aim of this thesis is to understand the epidemiology, treatment and outcomes of specialized burn care in The Netherlands. This thesis is mainly based on historical data of the burn centre in Rotterdam from 1986, combined with historical data from the burn centres in Groningen and Beverwijk from

  19. Prevalence and risk factors for Cysticercus tenuicollis in goats and sheep in Paraíba, northeastern Brazil

    Directory of Open Access Journals (Sweden)

    Dayana Firmino de Morais

    Full Text Available Abstract This study aimed to determine the prevalence and risk factors for C. tenuicollis among goats and sheep in slaughterhouses in Paraíba. 390 animals (195 goats and 195 sheep in the municipalities of Patos and Esperança, Paraíba, Brazil, were inspected between February and May 2014. The prevalence of C. tenuicollis was 39% (76/195 in goats and 17.4% (34/195 in sheep. In both species, most of the cysticerci vesicles were located at the omentum and mesentery. The only risk factor found was extensive sheep farming. It can be concluded that C. tenuicollis is highly prevalent in small ruminants in Paraíba, being more prevalent in goats than in sheep. Extensively-reared sheep were twice as likely to develop infection by this parasite.

  20. Changes in the risk management of Salmonella enterica subspecies diarizonae serovar 61:(k):1, 5, (7) in Swedish sheep herds and sheep meat due to the results of a prevalence study 2012.

    Science.gov (United States)

    Sörén, Kaisa; Lindblad, Mats; Jernberg, Cecilia; Eriksson, Erik; Melin, Lennart; Wahlström, Helene; Lundh, Maria

    2015-02-03

    The prevalence of Salmonella in food producing animals is very low in Sweden due to rigorous control programmes. However, no active surveillance is in place in sheep. The authorities decided to perform a prevalence study in sheep herds because findings at slaughter indicated that sheep associated S. diarizonae (S. enterica subspecies diarizonae serovar 61:(k):1, 5, (7)) might be common in sheep. Sampling was stratified by herd size in two groups, small herds with ≤ 30 animals and large herds with > 30 animals. In each stratum, 237 herds were selected at random. Faecal samples received from 244 out of the 474 randomly selected herds were analysed. A total of 40 of 100 (40%) of large herds and 17 of 144 (12%) of small herds were positive. The overall adjusted prevalence was 17.6% (95% CI, 12.9-22.2). Sheep associated S. diarizonae was detected in all counties (n = 21). Scientific opinions and an evaluation of on-farm control measures performed concluded that the impact of sheep associated S. diarizonae on human health is very low, and that risk management measures applied in response to findings of sheep associated S. diarizonae in sheep or sheep meat can be expected to have very little impact on reducing risks to human health. As a result, Swedish authorities decided to make an exemption for sheep associated Salmonella diarizonae in sheep and sheep meat in the current Salmonella control measures. Sheep associated S. diarizonae is endemic in Swedish sheep herds. It is more common in large herds and not limited to certain parts of the country. The responsible authorities concluded that current risk management actions regarding sheep associated S. diarizonae in sheep and sheep meat are not proportional to the risk. This is the first time in the history of the Swedish Salmonella control programme that an exemption from the legislation has been made for a specific serovar. If there is any future indication of an increasing risk, due to e.g. change in the pathogenicity

  1. Reactive burn models and ignition & growth concept

    Directory of Open Access Journals (Sweden)

    Shaw M.S.

    2011-01-01

    Full Text Available Plastic-bonded explosives are heterogeneous materials. Experimentally, shock initiation is sensitive to small amounts of porosity, due to the formation of hot spots (small localized regions of high temperature. This leads to the Ignition & Growth concept, introduced by LeeTarver in 1980, as the basis for reactive burn models. A homo- genized burn rate needs to account for three meso-scale physical effects: (i the density of active hot spots or burn centers; (ii the growth of the burn fronts triggered by the burn centers; (iii a geometric factor that accounts for the overlap of deflagration wavelets from adjacent burn centers. These effects can be combined and the burn model defined by specifying the reaction progress variable λ = g(s as a function of a dimensionless reaction length s(t = rbc/ℓbc, rather than by specifying an explicit burn rate. The length scale ℓbc(Ps = [Nbc(Ps]−1/3 is the average distance between burn centers, where Nbc is the number density of burn centers activated by the lead shock. The reaction length rbc(t = ∫t0 D(P(t′dt′ is the distance the burn front propagates from a single burn center, where D(P is the deflagration speed as a function of the local pressure and t is the time since the shock arrival. A key implementation issue is how to determine the lead shock strength in conjunction with a shock capturing scheme. We have developed a robust algorithm for this purpose based on the Hugoniot jump condition for the energy. The algorithm utilizes the time dependence of density, pressure and energy within each cell. The method is independent of the numerical dissipation used for shock capturing. It is local and can be used in one or more space dimensions. The burn model has a small number of parameters which can be calibrated to fit velocity gauge data from shock initiation experiments.

  2. Thalidomide pharmacokinetics in sheep.

    Science.gov (United States)

    Smith, S L; Singh, P; Harding, D; Lun, D; Chambers, J P

    2016-07-01

    To determine the half life (T1/2), time taken to reach maximum plasma concentration (Tmax) and maximum plasma concentration (Cmax) of thalidomide in sheep following I/V, oral and topical treatment with a single dose of thalidomide. Three groups of 4-6-month-old ram lambs were treated with thalidomide dissolved in dimethylsulphoxide (DMSO). The first group (n=10) was treated I/V with 100 mg thalidomide in 2 mL DMSO; the second group (n=8) received 400 mg thalidomide in 2 mL DMSO orally, and the third group (n=8) had 400 mg thalidomide in 4 mL DMSO applied topically. Plasma samples were collected up to 36 hours after treatment, snap-frozen at -80°C and analysed for concentrations of thalidomide using high performance liquid chromatography. Following I/V administration, T1/2 was 5.0 (SEM 0.4) hours, volume of distribution was 3,372.0 (SEM 244.3) mL/kg and clearance was 487.1 (SEM 46.1) mL/hour.kg. Topical application of 400 mg thalidomide did not increase plasma concentrations. Following oral administration, thalidomide bioavailability was 89%, with T1/2, Tmax, and Cmax being 7.2 (SEM 0.8) hours, 3.0 (SEM 0.4) hours and 1,767.3 (SEM 178.1) ng/mL, respectively. Topical administration using DMSO as a solvent did not increase concentrations of thalidomide in plasma. The mean pharmacokinetic parameters determined following oral treatment with 400 mg of thalidomide were similar to those reported in humans receiving a single 400 mg oral dose (T1/2 7.3 hours; Tmax 4.3 hours and Cmax 2,820 ng/mL). There is potential for thalidomide to be used as a model for the treatment of chronic inflammatory conditions in sheep, such as Johne's disease, where tumour necrosis factor alpha plays a pathogenic role.

  3. External and internal modulators of sheep reproduction.

    Science.gov (United States)

    Blache, Dominique; Bickell, Samantha L

    2011-12-01

    Several factors such as season, genetics, social interaction and metabolic status control or modulate the reproductive capacity of sheep. In addition to these well-studied factors in sheep, the influence of emotional reactivity on the reproductive success of sheep has started to be investigated over the last two decades. In this paper, after briefly reviewing the impact of classical factors affecting reproduction in sheep, we define emotional reactivity and the expression of its inter-individual variability, named temperament. Then, following a description of the protocol to measure temperament in sheep and discussion on the heritability of temperament traits, we illustrate how this selection affects the reproductive biology of sheep. We will be mainly using results obtained from a unique flock of sheep selected for low or high emotional reactivity. In conclusion, we propose that energy partitioning could be one of the mechanisms by which selection for temperament in sheep affects the different steps of the reproductive cycle.

  4. Effects of mulberry leaf flavonoid and resveratrol on methane emission and nutrient digestion in sheep

    OpenAIRE

    Dandan Chen; Xiaolin Chen; Yan Tu; Bo Wang; Can Lou; Tao Ma; Qiyu Diao

    2015-01-01

    As a new type of methane control agent, natural plant extract has been widely studied in recent years, but in vivo studies are few. This study was to investigate the effects of the dietary supplementation of 2 different polyphenols on the methane (CH4) emission and digestion metabolism in sheep. Ten healthy crossbred sheep (Dorper ♂ × small-tailed Han ♀; BW 60.0 ± 1.73 kg) were used in a change-over design. The sheep were fed the following 3 diets in the present study: the basal diet (CON) wi...

  5. Burn mortality in Iraq.

    Science.gov (United States)

    Qader, Ari Raheem

    2012-08-01

    Mortality rates are important outcome parameters after burn, and can serve as objective end points for quality control. Causes of death after severe burn have changed over time. In a prospective study, eight hundred and eighty-four burn patients were admitted to the Burns and Plastic surgery Hospital in Sulaimani-Kurdistan region of Iraq in 2009. Age, gender, nationality, cause of burn, extent of injury, cause of death and mortality rate were tabulated and analyzed, 338 (38.2%) were male and 546 (61.8%) were female. The highest number of cases occurred in January, with the highest short period incidence occurring in April. Out of 884 cases, 260 persons died. Burn injuries were more frequent and larger with higher mortality in females than in males. Flame was the major cause of burns. Self-inflicted burns were noted mainly in young women. A large number of burns which affect children and females, occur in the domestic setting and could have been prevented. Therefore, it is necessary to implement programs for health education relating to prevention of burn injuries focusing on the domestic setting. Copyright © 2012 Elsevier Ltd and ISBI. All rights reserved.

  6. Nutritional Therapy in Burns

    Directory of Open Access Journals (Sweden)

    Muzaffer Durmuş

    2016-12-01

    Full Text Available A burn is characterized by the damage to one’s body tissues caused by heat, chemicals, electricity, or radiation. The incidence of burn injuries has recently been decreasing. However, it is a fact that burns constitute a significant problem all over the world, with a few million people being affected by burns each year. A burn is an extensive trauma that affects the whole organism and determines the prognosis through its physiopathology. The case of the burn patient is also characterized by the acute phase response. Since burn patients have a non-functional skin barrier, they experience loss of liquids, minerals, proteins and electrolytes. They can also develop protein, energy and micro-nutrition deficiencies due to intense catabolic processes, infections and increased bodily needs in case of wound healing. Therefore, nutritional therapy is one of the major steps that need to be monitored from the initial moments of the burn injury through to the end of the burn treatment. This study focuses on the significance of nutritional therapy for burn patients in the light of current literature.

  7. [The pain from burns].

    Science.gov (United States)

    Latarjet, J

    2002-03-01

    The painful events associated with the treatment of a severe burn can, because of their long-lasting and repetitive characteristics, be one of the most excruciating experiences in clinical practice. Moreover, burn pain has been shown to be detrimental to burn patients. Although nociception and peripheral hyperalgesia are considered the major causes of burn pain, the study of more hypothetical mechanisms like central hyperalgesia and neuropathic pain may lead to a better understanding of burn pain symptoms and to new therapeutic approaches. Continuous pain and intermittent pain due to therapeutic procedures are two distinct components of burn pain. They have to be evaluated and managed separately. Although continuous pain is by far less severe than intermittent pain, the treatment is, in both cases, essentially pharmacological relying basically on opioids. Because of wide intra- and inter-individual variations, protocols will have to leave large possibilities of adaptation for each case, systematic pain evaluation being mandatory to achieve the best risk/benefit ratio. Surprisingly, the dose of medication decreases only slowly with time, a burn often remaining painful for long periods after healing. Non pharmacological treatments are often useful and sometimes indispensable adjuncts; but their rationale and their feasibility depends entirely on previous optimal pharmacological control of burn pain. Several recent studies show that burn pain management is inadequate in most burn centres.

  8. Sheep Production Occupations. Skills and Competencies.

    Science.gov (United States)

    Sabol, Joe

    This report summarizes the findings of a national study to determine what skills and competencies are needed by beginning employees on sheep ranches and farms, lamb feedlots, and in the sheep shearing industry. The research procedure, which involved determining from the sheep industry the competencies needed by beginning employees in the thirteen…

  9. Ural-Tweed Bighorn Sheep Wildlife Mitigation Project, 1986 Annual Report.

    Energy Technology Data Exchange (ETDEWEB)

    Yde, Chris A. (Montana Department of Fish, Wildlife and Parks, Helena, MT); Summerfield, Bob; Young, Lewis (Kootenai National Forest, Libby, MT)

    1987-02-01

    This report summarizes the results of the project activities from September 1, 1984 to December 31, 1986. To date, habitat treatments have been initiated on eight areas. The treatments include selective slash and burn, prescribed fire and fertilization. Inclement weather precluded the completion of the prescribed burns scheduled during fall 1985 and fall 1986. The lower Stonehill prescribed fire was rescheduled from fall 1985 to spring 1986 with the burn accomplished, producing varied results. Extensive pretreatment vegetative information has been collected from all units scheduled for habitat manipulations. Additionally, future projects have been delineated for other areas frequented by bighorn sheep. Ten adult bighorn sheep (5 ewes and 5 rams) have been fitted with radio transmitters. Systematic aerial and ground surveys were utilized to monitor the movements and seasonal habitat preferences of the instrumented sheep. Age and sex information was gathered whenever possible to aid in the development of a population model, Monthly pallet group collections were initiated in May 1985 to provide samples for 2.6 diaminopimetic acid (DAPA), food habits and lungworm larvae analysis. The majority of the data analysis is ongoing and will be presented in later reports.

  10. Cross-linking of dermal sheep collagen with tannic acid.

    Science.gov (United States)

    Heijmen, F H; du Pont, J S; Middelkoop, E; Kreis, R W; Hoekstra, M J

    1997-05-01

    The purpose of this study was to investigate cross-linking of (damaged) collagen by tannic acid, with a view to reconsider its use as a possible therapeutical agent in the treatment of burn wounds. Because of contradictory reports in the literature, and increased purity of tannic acid, this method has again become valuable for re-evaluation. A laboratory study using dermal sheep collagen was conducted to analyse the influence of several metal ions on collagen cross-linking with tannic acid. The tannic acid concentration vs degree of cross-linking, tannic acid uptake and release, influence of the addition of metal ions, and the rate of degradation of treated collagen were established. We have shown that tannic acid mediated collagen cross-linking in a concentration-dependent manner. Cross-linking was influenced by the presence of metal ions: Fe3+ and Ag+ were shown to exert a stimulatory effect on the degree of cross-linking by a 2% tannic acid solution, whereas Zn2+ had an inhibitory effect Ce3+ Ca2+ and Na+ did not influence the degree of cross-linking. The degree of cross-linking was proportional to the uptake of tannic acid, which variod between 6 and 35 wt%. Reversibility of cross-linking was established. Tannic acid-treated dermal sheep collagen showed a slow degradation rate relative to differently cross-linked collagen materials when subjected to collagenase or pancreatic proteolytic enzymes. The results of this study suggest that tannic acid could have a function in vivo in burn treatment by binding burn toxins and inhibiting degradation of the (remaining) dermal matrix, and allows combination with metal ions as antimicrobials. Optimal cross-linking was obtained using a 2 wt% tannic acid solution; combination with Ce3+ as a potential antimicrobial agent is possible without diminishing cross-linking.

  11. Burns and epilepsy.

    Science.gov (United States)

    Berrocal, M

    1997-01-01

    This is a report of the first descriptive analytic study of a group of 183 burn patients, treated in the Burn Unit at the University Hospital of Cartagena, Colombia during the period since January 1985 until December 1990. There is presented experience with the selected group of 24 patients in whom the diagnosis of burn was associated with epilepsy. There is also analysed and described the gravity of the scars sequels, neurological disorders, the complication of the burn and an impact of this problem on the patient, his (her) family and the community. It is very important to report that there was found Neurocisticercosis in 66.6% of the group of burn patients with epilepsy, and it is probably the first risk factor of burn in this group.

  12. The Parameters Controlling the Burning Efficiency of In-Situ Burning of Crude Oil on Water

    DEFF Research Database (Denmark)

    van Gelderen, Laurens; Jomaas, Grunde

    2017-01-01

    Parameters that control the burning efficiency of in-situ burning of crude oil on water were identified by studying the influence of the initial slick thickness, vaporization order, oil slick diameter, weathering state of the oil, heat losses to the water layer and heat flux to the fuel surface...... on the burning efficiency for light and heavy crude oils. These parameters were studied in several small scale and intermediate scale experimental setups. The results showed that the heat losses to the water layer increase with increasing burning time because the components in a crude oil evaporate from volatile...... oil. It can be concluded that the pool fire diameter is the key parameter that determines the burning efficiency of crude oil fires on water, which was partially attributed to the increasing heat flux (in kW/m2) to the fuel surface with increasing diameter. Increasing the heat flux to the fuel surface...

  13. Management of Hand Burns

    Directory of Open Access Journals (Sweden)

    Fatih Irmak

    2017-09-01

    Full Text Available Objective: The hand is one of the most frequently affected body parts by burn injuries with a rate of 80% among all burn wounds. Early and effective treatment ensures the best chance of survival as well as a good functional prognosis. The aim of this study was to determine the epidemiology, variation, relationship between etiology and hospital stay, clinical features, and management of hand burns. Material and Methods: This retrospective study was conducted the University of Health Sciences; Şişli Hamidiye Etfal Application and Research Center, Departmant of Plastic, Reconstructive and Aesthetic Surgery and the Intensive Burn Care Unit between April 2009 and April 2014. Burns were assessed based on etiology, anatomical location, percentage of total body surface area affected, and depth of injury. Treatment was categorized as conservative, elective operative, or urgent operative. Results: In the study period, 788 patients were admitted to our Burn Unit. Of these, 240 were females (30.5% and 548 were males (69.5%. The most common type of burn injury in this study was thermal injury (695 cases; 88.2%, followed by electrical injury (67 cases; 8.5%, and chemical, frictional or unknown injuries (26 cases; 3.3%. Majority (more than 85% of the patients had second-degree burns, and some had third-degree burns. Conclusions: Burns commonly affect the hands, and many functional problems may develop if appropriate basic treatments are neglected. The best treatment for burns is prevention. Appropriate indoor arrangement and simple but effective measures that can be taken at home can significantly reduce burn trauma exposure.

  14. Pediatric facial burns.

    Science.gov (United States)

    Kung, Theodore A; Gosain, Arun K

    2008-07-01

    Despite major advances in the area of burn management, burn injury continues to be a leading cause of pediatric mortality and morbidity. Facial burns in particular are devastating to the affected child and result in numerous physical and psychosocial sequelae. Although many of the principles of adult burn management can be applied to a pediatric patient with facial burns, the surgeon must be cognizant of several important differences. Facial burns and subsequent scar formation can drastically affect the growth potential of a child's face. Structures such as the nose and teeth may become deformed due to abnormal external forces caused by contractures. Serious complications such as occlusion amblyopia and microstomia must be anticipated and urgently addressed to avert permanent consequences, whereas other reconstructive procedures can be delayed until scar maturation occurs. Furthermore, because young children are actively developing the concept of self, severe facial burns can alter a child's sense of identity and place the child at high risk for future emotional and psychologic disturbances. Surgical reconstruction of burn wounds should proceed only after thorough planning and may involve a variety of skin graft, flap, and tissue expansion techniques. The most favorable outcome is achieved when facial resurfacing is performed with respect to the aesthetic units of the face. Children with facial burns remain a considerable challenge to their caregivers, and these patients require long-term care by a multidisciplinary team of physicians and therapists to optimize functional, cosmetic, and psychosocial outcomes.

  15. A spatial risk assessment of bighorn sheep extirpation by grazing domestic sheep on public lands.

    Science.gov (United States)

    Carpenter, Tim E; Coggins, Victor L; McCarthy, Clinton; O'Brien, Chans S; O'Brien, Joshua M; Schommer, Timothy J

    2014-04-01

    Bighorn sheep currently occupy just 30% of their historic distribution, and persist in populations less than 5% as abundant overall as their early 19th century counterparts. Present-day recovery of bighorn sheep populations is in large part limited by periodic outbreaks of respiratory disease, which can be transmitted to bighorn sheep via contact with domestic sheep grazing in their vicinity. In order to assess the viability of bighorn sheep populations on the Payette National Forest (PNF) under several alternative proposals for domestic sheep grazing, we developed a series of interlinked models. Using telemetry and habitat data, we characterized herd home ranges and foray movements of bighorn sheep from their home ranges. Combining foray model movement estimates with known domestic sheep grazing areas (allotments), a Risk of Contact Model estimated bighorn sheep contact rates with domestic sheep allotments. Finally, we used demographic and epidemiologic data to construct population and disease transmission models (Disease Model), which we used to estimate bighorn sheep persistence under each alternative grazing scenario. Depending on the probability of disease transmission following interspecies contact, extirpation probabilities for the seven bighorn sheep herds examined here ranged from 20% to 100%. The Disease Model allowed us to assess the probabilities that varied domestic sheep management scenarios would support persistent populations of free-ranging bighorn sheep. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Ivermectin pharmacokinetics in lactating sheep

    NARCIS (Netherlands)

    Cerkvenik, V.; Grabnar, V.; Skubic, V.; Doganoc, D.Z.; Beek, W.M.J.; Keukens, H.J.; Kosorok, M.D.; Pogacnik, M.

    2002-01-01

    Ivermectin (IVM) concentrations in plasma and milk were studied in six Istrian Pramenka dairy sheep after a single subcutaneous dose of 0.2 mg/kg b.w. of IVM in the early lactation period to describe IVM disposition in milk and to evaluate the transfer of IVM residues via milk to suckling lambs.

  17. truncatula pasture bY sheeP

    African Journals Online (AJOL)

    Hacker). commonwealth Agricultural Bureaux: Farnham Royal. p the rate of wool growth was equivalent to about 10,2; 8,9. 245. and 16,8 e/100 g absorbed amino acids. LINDSAY, J.R., HOGAN, J.P. & DONNELLY, J.B., 1980. ThC digestion of protein from forage diets in the small intestine of the sheep. Aust. J. Agric. Res.

  18. Burns and Fire Safety

    Science.gov (United States)

    ... Cairns BA, et al. Etiology and outcome of pediatric burns. J Pediatr Surg. 1996; 31(3): 329-33. ... RT, Feldman JA, McMillon M. Tap water scald burns in children. Pediatrics. 1978; 62(1): 1-7. 10 Baptiste MS, ...

  19. Are burns photographs useful?

    Science.gov (United States)

    Nelson, L; Boyle, M; Taggart, I; Watson, S

    2006-11-01

    Routine photography of all patients admitted to the West of Scotland Regional Burns Unit was introduced in 2003. To date, there are few burns units to evaluate the usefulness of photographs taken. To assess the usefulness of photographs of patients admitted to the burns unit to various members of the multidisciplinary team. A questionnaire was completed by hospital staff involved in the management of burns patients over a 3-month period. A total of 43 questionnaires were completed. The majority of questionnaires were completed by nursing staff (55%) followed by medical staff (23%); physiotherapy (5%); anaesthetists (7%); theatre staff (5%); students (2%); dietician (2%). About 98% of respondents agreed that photographs were useful overall, particularly for teaching purposes. About 9% disagreed that photographs were useful for assessment due to difficulty in assessing depth of burn. About 72% agreed that the photographs were useful for patient management and improve patient care. About 88% agreed that all patients should have photographs available in future. Advantages of photographs include; moving and handling of patients; patient positioning in theatre; reviewing wound healing and complications. They are useful for assessing site, size and type of burn. Disadvantages include difficulty in assessing depth of burn, technical factors, and unavailability out of hours. Photographs of burns patients are useful overall to all members of the multidisciplinary team.

  20. Treating and Preventing Burns

    Science.gov (United States)

    ... Listen Español Text Size Email Print Share Burn Treatment & Prevention Tips for Families Page Content ​There are many different causes of serious burns in children, including sunburn , hot water or other hot liquids, and those due to ...

  1. Pain in burn patients.

    Science.gov (United States)

    Latarjet, J; Choinère, M

    1995-08-01

    While severe pain is a constant component of the burn injury, inadequate pain management has been shown to be detrimental to burn patients. Pain-generating mechanisms in burns include nociception, primary and secondary hyperalgesia and neuropathy. The clinical studies of burn pain characteristics reveal very clear-cut differences between continuous pain and pain due to therapeutic procedures which have to be treated separately. Some of the main features of burn pain are: (1) its long-lasting course, often exceeding healing time, (2) the repetition of highly nociceptive procedures which can lead to severe psychological disturbances if pain control is inappropriate. Pharmaco-therapy with opioids is the mainstay for analgesia in burned patients, but non-pharmacological techniques may be useful adjuncts. Routine pain evaluation is mandatory for efficient and safe analgesia. Special attention must be given to pain in burned children which remains too often underestimated and undertreated. More educational efforts from physicians and nursing staff are necessary to improve pain management in burned patients.

  2. Methane emission from free-ranging sheep: a comparison of two measurement methods

    Science.gov (United States)

    Leuning, R.; Baker, S. K.; Jamie, I. M.; Hsu, C. H.; Klein, L.; Denmead, O. T.; Griffith, D. W. T.

    Methane emissions from a flock of 14, 1-year old sheep grazing on a grass and legume pasture were measured using a micrometeorological mass-balance method and a sulphur hexaflouride (SF 6) tracer technique. The former measured the mean emission, over 45 min intervals, from all the sheep within a fenced 24 m×24 m enclosure, from the enrichment of methane (CH 4) in air as it passed over the sheep. The tracer technique measured emissions from a subset of 7 individual animals over 24 h periods from measurements of CH 4 and SF 6 concentrations in air exhaled by the sheep, and from the known rate of release of SF 6 from small permeation tubes placed in the animals' rumens. Both methods gave highly similar results for 4 out of 5 days. When the species composition of dietary intake was steady during the last two days of measurement, the mean emission rate from the mass-balance method was 11.9±1.5 (SEM) g CH 4 sheep -1 d -1, while the rate from the tracer technique was 11.7±0.4 (SEM) g CH 4 sheep -1 d -1. These rates are for sheep with mean live mass of 27 kg, with a measured dry matter intake of 508 g sheep -1 d -1 and pasture dry matter digestibility of 69.5%. There was close agreement between these measurements and estimates from algorithms used to predict methane emissions from sheep for the Australian National Greenhouse Gas Inventory.

  3. Burning mouth syndrome

    Directory of Open Access Journals (Sweden)

    K A Kamala

    2016-01-01

    Full Text Available Burning mouth syndrome (BMS is multifactorial in origin which is typically characterized by burning and painful sensation in an oral cavity demonstrating clinically normal mucosa. Although the cause of BMS is not known, a complex association of biological and psychological factors has been identified, suggesting the existence of a multifactorial etiology. As the symptom of oral burning is seen in various pathological conditions, it is essential for a clinician to be aware of how to differentiate between symptom of oral burning and BMS. An interdisciplinary and systematic approach is required for better patient management. The purpose of this study was to provide the practitioner with an understanding of the local, systemic, and psychosocial factors which may be responsible for oral burning associated with BMS, and review of treatment modalities, therefore providing a foundation for diagnosis and treatment of BMS.

  4. Polymorphisms of KiSS-1 and GPR54 genes and their relationships with litter size in sheep.

    Science.gov (United States)

    Chu, Mingxing; Xiao, Chaoting; Feng, Tao; Fu, Yan; Cao, Guiling; Fang, Li; Di, Ran; Tang, Qianqian; Huang, Dongwei; Ma, Yuehui; Li, Kui; Li, Ning

    2012-03-01

    The KiSS-1 and GPR54 genes were studied as candidate genes for the prolificacy in sheep. Four pairs of primers were designed to detect single nucleotide polymorphisms of exon 1 of KiSS-1 gene and exon 1, exon 2 and partial exon 5 of GPR54 gene in high fecundity breeds (Small Tail Han and Hu sheep) and low fecundity breeds (Dorset, Texel and Corriedale sheep) by PCR-SSCP. Polymorphisms in exon 1 of KiSS-1 gene were detected in prolific Small Tail Han sheep (AA, AB and BB genotypes) and Hu sheep (AA and CC genotypes), no polymorphism was found in low fecundity sheep breeds (only AA genotype). Polymorphisms in exon 2 of GPR54 gene were detected in prolific Hu sheep (DD and EE genotypes) and no polymorphism was found in prolific Small Tail Han sheep and low fecundity sheep breeds (only DD genotype). No polymorphism was detected in exon 1 and partial exon 5 of GPR54 gene in five sheep breeds. The polymorphic genotypes were sequenced. While compared the BB genotype with the AA genotype, one nucleotide mutation (G1035A) was detected, which resulted in amino acid change, Val25Met. Five nucleotide mutations were detected from AA to CC genotype (C981T, C996T, T997C, C1034G, C1039T), and among them four caused amino acid changes, that is, Arg7Trp, Phe12Leu, Asn24Lys, Ala26Val. While compared the EE genotype with the DD genotype, two nucleotide mutations (T2360C, A2411C) were detected, which gave rise to amino acid changes, Met90Thr and Asp107Ala, respectively. Genotype frequencies of AA, BB and AB were 0.62, 0.05 and 0.33 in Small Tail Han sheep, respectively. The Small Tail Han sheep ewes with genotype BB or AB had 0.88 (P 0.05) lambs more than those with genotype AB. These results preliminarily indicated that the KiSS-1 gene may have some association with prolificacy in sheep.

  5. The sheep as a large osteoporotic model for orthopaedic research in humans

    DEFF Research Database (Denmark)

    Cheng, L.; Ding, Ming; Li, Z.

    2008-01-01

    Although small animals as rodents are very popular animals for osteoporosis models , large animals models are necessary for research of human osteoporotic diseases. Sheep osteoporosis models are becoming more important because of its unique advantages for osteoporosis reseach. Sheep are docile...... fracture. However , to be used as the most ideal animal for osteoporosis model , some researches need to be done for sheep. Here , we review the use of sheep as an animal model for human orthopaedic diseases. Udgivelsesdato: June...... in nature and large in size , which facilitates obtaining blood samples , urine samples and bone tissue samples for different biochemical tests and histological tests , and surgical manipulation and instrument examinations. Their physiology is similar to humans. To induce osteoporosis , OVX and calcium...

  6. Seroprevalence of Sheep and Goat Pox, Peste Des Petits Ruminants and Rift Valley Fever in Saudi Arabia.

    Directory of Open Access Journals (Sweden)

    Hani Boshra

    Full Text Available Sheep and goat pox, peste des petits ruminants and Rift Valley fever are important diseases of small ruminant livestock. Sheep and goat pox, along with peste des petits ruminants, are endemic throughout most of Africa, Asia and the Middle East. Whereas Rift Valley fever is endemic in Africa, outbreaks in the Middle East have been reported over the past decade, including the Arabian Peninsula. Saudi Arabia is a major importer of livestock, and understanding the prevalence of these viral infections would be useful for disease control. In this study, sera from sheep and goats were collected from 3 regions in Saudi Arabia. They were evaluated for antibodies specific to sheep and goat pox, peste des petits ruminants and Rift Valley fever by virus neutralization assays. To the best of our knowledge, this is the first study to evaluate the seroprevalence of these viruses in sheep and goats.

  7. Seroprevalence of Sheep and Goat Pox, Peste Des Petits Ruminants and Rift Valley Fever in Saudi Arabia.

    Science.gov (United States)

    Boshra, Hani; Truong, Thang; Babiuk, Shawn; Hemida, Maged Gomaa

    2015-01-01

    Sheep and goat pox, peste des petits ruminants and Rift Valley fever are important diseases of small ruminant livestock. Sheep and goat pox, along with peste des petits ruminants, are endemic throughout most of Africa, Asia and the Middle East. Whereas Rift Valley fever is endemic in Africa, outbreaks in the Middle East have been reported over the past decade, including the Arabian Peninsula. Saudi Arabia is a major importer of livestock, and understanding the prevalence of these viral infections would be useful for disease control. In this study, sera from sheep and goats were collected from 3 regions in Saudi Arabia. They were evaluated for antibodies specific to sheep and goat pox, peste des petits ruminants and Rift Valley fever by virus neutralization assays. To the best of our knowledge, this is the first study to evaluate the seroprevalence of these viruses in sheep and goats.

  8. Emerging parasitic diseases of sheep.

    Science.gov (United States)

    Taylor, M A

    2012-09-30

    There have been changes in the emergence and inability to control of a number of sheep parasitic infections over the last decade. This review focuses on the more globally important sheep parasites, whose reported changes in epidemiology, occurrence or failure to control are becoming increasingly evident. One of the main perceived driving forces is climate change, which can have profound effects on parasite epidemiology, especially for those parasitic diseases where weather has a direct effect on the development of free-living stages. The emergence of anthelmintic-resistant strains of parasitic nematodes and the increasing reliance placed on anthelmintics for their control, can exert profound changes on the epidemiology of those nematodes causing parasitic gastroenteritis. As a consequence, the effectiveness of existing control strategies presents a major threat to sheep production in many areas around the world. The incidence of the liver fluke, Fasciola hepatica, is inextricably linked to high rainfall and is particularly prevalent in high rainfall years. Over the last few decades, there have also been increasing reports of other fluke associated diseases, such as dicroceliosis and paramphistomosis, in a number of western European countries, possibly introduced through animal movements, and able to establish with changing climates. External parasite infections, such as myiasis, can cause significant economic loss and presents as a major welfare problem. The range of elevated temperatures predicted by current climate change scenarios, result in an elongated blowfly season with earlier spring emergence and a higher cumulative incidence of fly strike. Additionally, legislative decisions leading to enforced changes in pesticide usage and choices have resulted in increased reports and spread of ectoparasitic infections, particularly mite, lice and tick infestations in sheep. Factors, such as dip disposal and associated environmental concerns, and, perhaps more

  9. Burning mouth and saliva.

    Science.gov (United States)

    Chimenos-Kustner, Eduardo; Marques-Soares, Maria Sueli

    2002-01-01

    Stomatodynia is the complaint of burning, tickling or itching of the oral cavity, and can be associated with other oral and non-oral signs and symptoms. However, the oral mucosa often appears normal, with no apparent underlying organic cause to account for the symptomatology. The etiology is unknown, though evidence points to the participation of numerous local, systemic and psychological factors. Among the local factors, saliva may play an important role in the symptoms of burning mouth. Saliva possesses specific rheological properties as a result of its chemical, physical and biological characteristics - these properties being essential for maintaining balanced conditions within the oral cavity. Patients with burning mouth present evidence of changes in salivary composition and flow, as well as a probable alteration in the oral mucosal sensory perception related particularly to dry mouth and taste alterations. On the other hand, alterations in salivary composition appear to reflect on its viscosity and symptomatology of burning mouth. Saliva is a field open to much research related to burning mouth, and knowledge of its properties (e.g., viscosity) merits special attention in view of its apparent relationship to the symptoms of burning mouth. The present study describes our clinical experience with burning mouth, and discusses some of the aspects pointing to salivary alterations as one of the most important factors underlying stomatodynia.

  10. Demography of Dall's sheep in northwestern Alaska

    Science.gov (United States)

    Kleckner, Christopher; Udevitz, Mark S.; Adams, Layne G.; Shults, Brad S.

    2003-01-01

    Dall’s sheep in northwestern Alaska declined in the early 1990s following the severe 1989-90 and 1990-91 winters. In the Baird Mountains of Noatak National Preserve, estimates of adult sheep declined by 50% from 800 in 1989 to under 400 in 1991. Population counts remained low throughout 1991 to 1996, reaching a minimum of 244 adult sheep in 1996. Few lambs were observed during annual midsummer aerial surveys in 1991 to 1994. We suspect that these declines resulted from a combination of poorer nutritional condition and increased vulnerability of sheep to predation resulting from severe winter conditions.As a result of these declines, both subsistence and sport hunting seasons were closed by emergency order in 1991, resulting in substantial management controversy. The affected publics, although willing to accept the closures, questioned the validity of the sheep survey data and strongly emphasized their interest in restoring harvests as soon as populations increased sufficiently. In 1995 the Northwest Arctic Regional Advisory Council, the local advisory committee for the Federal Subsistence Board, passed a motion supporting efforts to initiate research on sheep populations in the region to better understand the factors limiting sheep populations and to evaluate sheep survey methodologies.Currently estimates of Dall’s sheep population size and composition in the western Brooks Range are based on intensive fixed-wing aerial surveys conducted annually since 1986 in areas including the Baird Mountains. The annual variation in recent Baird Mountains aerial counts cannot be explained with reasonable assumptions about reproduction and survival, suggesting that there is some variability in the proportion of the population observed each year or that a substantial number of sheep move during the survey. Prior to our research, no attempt had been made to estimate visibility bias or precision for these surveys.Our understanding of Dall’s sheep population biology comes

  11. Improving burn care and preventing burns by establishing a burn database in Ukraine.

    Science.gov (United States)

    Fuzaylov, Gennadiy; Murthy, Sushila; Dunaev, Alexander; Savchyn, Vasyl; Knittel, Justin; Zabolotina, Olga; Dylewski, Maggie L; Driscoll, Daniel N

    2014-08-01

    Burns are a challenge for trauma care and a contribution to the surgical burden. The former Soviet republic of Ukraine has a foundation for burn care; however data concerning burns in Ukraine has historically been scant. The objective of this paper was to compare a new burn database to identify problems and implement improvements in burn care and prevention in this country. Retrospective analyses of demographic and clinical data of burn patients including Tukey's post hoc test, analysis of variance, and chi square analyses, and Fisher's exact test were used. Data were compared to the American Burn Association (ABA) burn repository. This study included 1752 thermally injured patients treated in 20 hospitals including Specialized Burn Unit in Municipal Hospital #8 Lviv, Lviv province in Ukraine. Scald burns were the primary etiology of burns injuries (70%) and burns were more common among children less than five years of age (34%). Length of stay, mechanical ventilation use, infection rates, and morbidity increased with greater burn size. Mortality was significantly related to burn size, inhalation injury, age, and length of stay. Wound infections were associated with burn size and older age. Compared to ABA data, Ukrainian patients had double the length of stay and a higher rate of wound infections (16% vs. 2.4%). We created one of the first burn databases from a region of the former Soviet Union in an effort to bring attention to burn injury and improve burn care. Copyright © 2013 Elsevier Ltd and ISBI. All rights reserved.

  12. Making of a burn unit: SOA burn center

    Directory of Open Access Journals (Sweden)

    Jayant Kumar Dash

    2016-01-01

    Full Text Available Each year in India, burn injuries account for more than 6 million hospital emergency department visits; of which many require hospitalization and are referred to specialized burn centers. There are few burn surgeons and very few burn centers in India. In our state, Odisha, there are only two burn centers to cater to more than 5000 burn victims per year. This article is an attempt to share the knowledge that I acquired while setting up a new burn unit in a private medical college of Odisha.

  13. Amino acids in sheep production.

    Science.gov (United States)

    McCoard, Susan A; Sales, Francisco A; Sciascia, Quentin L

    2016-01-01

    Increasing production efficiency with a high standard of animal welfare and respect for the environment is a goal of sheep farming systems. Substantial gains in productivity have been achieved through improved genetics, nutrition and management changes; however the survival and growth performance of multiple-born lambs still remains a problem. This is a significant production efficiency and animal well-being issue. There is a growing body of evidence that some amino acids have a role in regulating growth, reproduction and immunity through modulation of metabolic and cell signaling pathways. The purpose of this review is to provide an overview of what is currently known about the role of amino acids in sheep production and the potential for supplementation strategies to influence on-farm survival and growth of lambs.

  14. Megaesophagus in sheep and goats

    Directory of Open Access Journals (Sweden)

    Eduardo Melo Nascimento

    2016-01-01

    Full Text Available ABSTRACT: Megaesophagus is a rare disease in ruminants characterized by regurgitation of rumen contents. In this paper it was described cases of megaesophagus in two sheep and two goats on a farm in the state of Paraíba, Northeastern Brazil. All animals showed regurgitation of rumen contents and weight loss, with a clinical course of several months. At necropsy all animals presented megaesophagus. Histological examination showed segmental muscle necrosis in the esophagus and skeletal muscles. Serum samples from one sheep and one goat were negative for the presence of blue tongue antibodies by ELISA, and whole blood and muscle samples from one goat were negative for this virus by RT PCR. Epidemiological data and pathology suggested that the disease could have been caused by some toxic plant, but known plants causing segmental muscle necrosis were not observed in the areas where the disease occurred.

  15. The International Sheep and Wool Handbook

    Directory of Open Access Journals (Sweden)

    Antonello Cannas

    2011-02-01

    Full Text Available This revised book is an expanded and updated version of the Australian Sheep and Wool Handbook published in 1991 and focuses on the sheep wool and meat industry. The book is divided in 5 sections, each including several chapters written by well-known and qualified researchers and industry representatives from many countries. The first section on Major sheep and wool industries, in my opinion, is particularly interesting because it explores the sheep and wool industries of leading countries (e.g. Australia, South Africa and New Zealand and continents (Europe and South America, and those of emerging countries (e.g. China.....

  16. Wool proteins of New Zealand Romney sheep.

    Science.gov (United States)

    Woods, J L; Orwin, D F

    1987-01-01

    Proteins extracted from the wool of 65 Romney ewes were analysed qualitatively by one- and two-dimensional polyacrylamide gel electrophoresis. Romney wool proteins could be classified into the low-sulfur, high-sulfur, and high-tyrosine protein groups described for wool from other breeds. The wool protein pattern of an individual sheep remained constant despite changes in season, age or nutritional status of the sheep, and did not vary between different body positions. There were between-sheep differences in protein pattern, most variation occurring in the high-sulfur protein group. These differences were presumed to reflect genetic differences between the sheep.

  17. Burning Mouth Syndrome

    Science.gov (United States)

    ... NIDCR Home Oral Health Diseases and Conditions Gum Disease TMJ Disorders Oral Cancer Dry Mouth Burning Mouth Tooth Decay See All Oral Complications of Systemic Diseases Cancer Treatment Developmental Disabilities Diabetes Heart Disease HIV/ ...

  18. Crude oil burning mechanisms

    DEFF Research Database (Denmark)

    van Gelderen, Laurens; Malmquist, L.M.V.; Jomaas, Grunde

    2015-01-01

    In order to improve predictions for the burning efficiency and the residue composition of in-situ burning of crude oil, the burning mechanism of crude oil was studied in relation to the composition of its hydrocarbon mixture, before, during and after the burning. The surface temperature, flame...... height, mass loss rate and residues of three hydrocarbon liquids (n-octane, dodecane and hexadecane), two crude oils (DUC and REBCO) and one hydrocarbon liquid mixture of the aforementioned hydrocarbon liquids were studied using the Crude Oil Flammability Apparatus. The experimental results were compared...... on the highest achievable oil slick temperature. Based on this mechanism, predictions can then be made depending on the hydrocarbon composition of the fuel and the measured surface temperature....

  19. American Burn Association

    Science.gov (United States)

    ... is the premier educational event for the entire burn care team. Submit an abstract or session idea, exhibit or sponsor the meeting, or plan to attend. Find out more about the 50th Annual Meeting in Chicago, ...

  20. Burns (For Parents)

    Science.gov (United States)

    ... oven. The liquid may heat unevenly, resulting in pockets of breast milk or formula that can scald a baby's mouth. Screen fireplaces and wood-burning stoves. Radiators and electric baseboard heaters may ...

  1. Burn Wise Awareness Kit

    Science.gov (United States)

    Health and safety outreach materials in the form of an awareness kit. Designed specifically for state, local, and tribal air agencies working to reduce wood smoke pollution, it includes best burn tips, social media m

  2. Smartphone applications in burns.

    Science.gov (United States)

    Wurzer, Paul; Parvizi, Daryousch; Lumenta, David B; Giretzlehner, Michael; Branski, Ludwik K; Finnerty, Celeste C; Herndon, David N; Tuca, Alexandru; Rappl, Thomas; Smolle, Christian; Kamolz, Lars P

    2015-08-01

    Since the introduction of applications (apps) for smartphones, the popularity of medical apps has been rising. The aim of this review was to demonstrate the current availability of apps related to burns on Google's Android and Apple's iOS store as well as to include a review of their developers, features, and costs. A systematic online review of Google Play Store and Apple's App Store was performed by using the following search terms: "burn," "burns," "thermal," and the German word "Verbrennung." All apps that were programmed for use as medical apps for burns were included. The review was performed from 25 February until 1 March 2014. A closer look at the free and paid calculation apps including a standardized patient was performed. Four types of apps were identified: calculators, information apps, book/journal apps, and games. In Google Play Store, 31 apps were related to burns, of which 20 were calculation apps (eight for estimating the total body surface area (TBSA) and nine for total fluid requirement (TFR)). In Apple's App Store, under the category of medicine, 39 apps were related to burns, of which 21 were calculation apps (19 for estimating the TBSA and 17 for calculating the TFR). In 19 out of 32 available calculation apps, our study showed a correlation of the calculated TFR compared to our standardized patient. The review demonstrated that many apps for medical burns are available in both common app stores. Even free available calculation apps may provide a more objective and reproducible procedure compared to manual/subjective estimations, although there is still a lack of data security especially in personal data entered in calculation apps. Further clinical studies including smartphone apps for burns should be performed. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  3. Ball lightning burn.

    Science.gov (United States)

    Selvaggi, Gennaro; Monstrey, Stan; von Heimburg, Dennis; Hamdi, Mustapha; Van Landuyt, Koen; Blondeel, Phillip

    2003-05-01

    Ball lightning is a rare physical phenomenon, which is not yet completely explained. It is similar to lightning but with different, peculiar characteristics. It can be considered a mix of fire and electricity, concentrated in a fireball with a diameter of 20-cm that most commonly appears suddenly, even in indoor conditions, during a thunderstorm. It moves quickly for several meters, can change direction, and ultimately disappears. During a great storm, a 28-year-old man and his 5-year-old daughter sustained burn wounds after ball lightning came from the outdoors through a chimney. These two patients demonstrated signs of fire and electrical injuries. The father, who lost consciousness, sustained superficial second-degree burn wounds bilaterally on the zygomatic area and deep second-degree burn wounds on his right hand (total body surface area, 4%). His daughter demonstrated superficial second-degree burn wounds on the left part of the face and deep second-degree and third-degree burn wounds (total body surface area, 30%) on the left neck, both upper arms, and the back. In this article, the authors report the first two cases of burn injuries resulting from ball lightning contact indoors. The literature on this rare phenomenon is reviewed to elucidate the nature of ball lightning. Emphasis is placed on the nature of injuries after ball lightning contact, the therapy used, and the long-term complications.

  4. Burn mouse models

    DEFF Research Database (Denmark)

    Calum, Henrik; Høiby, Niels; Moser, Claus

    2014-01-01

    Severe thermal injury induces immunosuppression, involving all parts of the immune system, especially when large fractions of the total body surface area are affected. An animal model was established to characterize the burn-induced immunosuppression. In our novel mouse model a 6 % third-degree b......Severe thermal injury induces immunosuppression, involving all parts of the immune system, especially when large fractions of the total body surface area are affected. An animal model was established to characterize the burn-induced immunosuppression. In our novel mouse model a 6 % third......-degree burn injury was induced with a hot-air blower. The third-degree burn was confirmed histologically. At 48 h, a decline in the concentration of peripheral blood leucocytes was observed in the group of mice with burn wound. The reduction was ascribed to the decline in concentration of polymorphonuclear...... neutrophil leucocytes and monocytes. When infecting the skin with Pseudomonas aeruginosa, a dissemination of bacteria was observed only in the burn wound group. Histological characterization of the skin showed an increased polymorphonuclear neutrophil granulocytes dominated inflammation in the group of mice...

  5. Chemical burns: Diphoterine untangled.

    Science.gov (United States)

    Alexander, K Skaria; Wasiak, Jason; Cleland, Heather

    2017-10-10

    Diphoterine is a hypertonic, amphoteric, polyvalent and chelating decontamination solution used in the treatment of cutaneous and ocular chemical burns. Due to infrequent use by emergency physicians along with the small number of available studies, its debate in the literature as to its efficacy and safety remains inconclusive. A structured literature search was performed in MEDLINE, EMBASE BIOLOGICAL ABSTRACTS and TOXNET to June 2016 for original English-language studies reporting on the safety and effectiveness of Diphoterine. Methodological and reporting quality of pre-clinical animal studies was assessed using the Systematic Review Centre for Laboratory Animal Experimentation (SYRCLE) risk of bias tool and Animal Research: Reporting of In Vivo Experiments (ARRIVE) guidelines. Clinical studies were assessed using Chambers' criteria. 13 studies (seven in the pre-clinical, five in the clinical setting and one mixed) met the study inclusion criteria. Pre-clinical studies showed a faster resolution of pH and reduced tissue necrosis with Diphoterine. Clinical studies showed reduced tissue necrosis/severity of symptoms, faster pH resolution and a reduction in pain when using Diphoterine. No adverse events were attributable to Diphoterine. Reporting and methodology of the studies was poor or showed a high risk of bias. Diphoterine appears to be safe to use and is probably superior to other rinsing solutions. However, immediate decontamination is imperative and if Diphoterine is not available a different rinsing solution should be used. The methodology of the published literature for Diphoterine is generally poor and future publications should use the frameworks given as templates. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

  6. Management of pediatric hand burns.

    Science.gov (United States)

    Liodaki, Eirini; Kisch, Tobias; Mauss, Karl L; Senyaman, Oezge; Kraemer, Robert; Mailänder, Peter; Wünsch, Lutz; Stang, Felix

    2015-04-01

    Hand burns are common in the pediatric population. Optimal hand function is a crucial component of a high-quality survival after burn injury. This can only be achieved with a coordinated approach to the injuries. The aim of this study was to review the management algorithm and outcomes of pediatric hand burns at our institution. In total, 70 children fulfilling our study criteria were treated for a burn hand injury in our Burn Care Center between January 2008 and May 2013. 14 of the 70 pediatric patients underwent surgery because of the depth of the hand burns. The management algorithm depending on the depth of the burn is described. Two patients underwent correction surgery due to burn contractures later. For a successful outcome of the burned hand, the interdisciplinary involvement and cooperation of the plastic and pediatric surgeon, hand therapist, burn team, patient and their parents are crucial.

  7. COEXISTENCE OF POLYMORPHISM IN FECUNDITY GENES BMPR 1B AND GDF 9 OF INDIAN KENDRAPADA SHEEP

    Directory of Open Access Journals (Sweden)

    Satyabrata Dash

    2017-06-01

    Full Text Available Present study was carried out to find out the status of mutations in three fecundity genes i.e. growth differentiation factor 9 (GDF9/FecG, bone morphogenetic protein 15 (BMP15/FecX and bone morphogenetic protein receptor (BMPR1B/FecB in Kendrapada sheep, the second most prolific sheep breed of India after Garole. Kendrapada ewes (n=85 were genotyped by Tetra-primer amplification refractory mutation system-PCR and a total of eleven SNP points over these three candidate fecundity genes (one point on FecB and five points each on BMP15 and GDF9 were assessed. Out of eleven, two SNP points, viz. FecB and G4 of GDF9 were found to be polymorphic in this breed. In this sheep breed average litter size of the ewes with non-carriers, heterozygous carrier and homozygous carrier of FecB locus mutation were 1.61, 1.80 and 2.06 respectively. G4 point of the GDF9 gene was also polymorphic with average litter size of noncarriers, heterozygous carrier and homozygous carrier ewes were 1.63, 2.00 and 1.91 respectively. This study establishes Kendrapada sheep as the sixth sheep breed after Belclare/Cambridge, Lacaune, Small-tailed Han, Garole and Bayanbulak sheep, where coexisting polymorphism has been found in two different fecundity genes (BMPRIB and GDF9 genes.

  8. Detection of Theileria ovis in naturally infected sheep by nested PCR.

    Science.gov (United States)

    Altay, Kursat; Dumanli, Nazir; Holman, Patricia J; Aktas, Munir

    2005-01-20

    A nested polymerase chain reaction (PCR) for the detection of Theileria ovis in sheep using oligonucleotide primers designed from the small subunit ribosomal RNA (SSU rRNA) gene sequence of T. ovis from sheep in eastern Turkey is described. A 398-bp DNA fragment was specifically amplified from blood samples from sheep, naturally infected with T. ovis. No PCR products resulted from T. lestoquardi, T. annulata, T. parva, T. buffeli and Babesia spp. DNA using these specific primers. The sensitivity of the nested PCR for T. ovis, which was assessed showed that one infected cell in 10(7) sheep erythrocytes, equivalent to a blood parasitemia of 0.00001%, could be detected. This is more sensitive than examining 200 fields under light microscopy. In addition, of the 124 field samples obtained from sheep in eastern Turkey tested, 19.35% (24/124) were positive for the presence of Theileria spp. by microscopic examination compared to 54.03% (67/124) positive for T. ovis by nested PCR. The primer pairs described in this study will be useful for epidemiological studies on ovine theileriosis and for discrimination between T. lestoquardi and T. ovis infections in sheep.

  9. Burn Patient Expectations from Nurses

    OpenAIRE

    Sibel Yilmaz sahin; Umran Dal; Gulsen Vural

    2014-01-01

    AIM: Burn is a kind of painful trauma that requires a long period of treatment and also changes patients body image. For this reason, nursing care of burn patients is very important. In this study in order to provide qualified care to the burned patients, patient and #8217;s expectations from nurses were aimed to be established. METHODS: Patients and #8217; expectations were evaluated on 101 patients with burn in Ministry of Health Ankara Numune Education and Research Hospital Burn Servic...

  10. Quality control of the sheep bacterial artificial chromosome library, CHORI-243

    Directory of Open Access Journals (Sweden)

    Kirkness Ewen F

    2010-12-01

    Full Text Available Abstract Background The sheep CHORI-243 bacterial artificial chromosome (BAC library is being used in the construction of the virtual sheep genome, the sequencing and construction of the actual sheep genome assembly and as a source of DNA for regions of the genome of biological interest. The objective of our study is to assess the integrity of the clones and plates which make up the CHORI-243 library using the virtual sheep genome. Findings A series of analyses were undertaken based on the mapping the sheep BAC-end sequences (BESs to the virtual sheep genome. Overall, very few plate specific biases were identified, with only three of the 528 plates in the library significantly affected. The analysis of the number of tail-to-tail (concordant BACs on the plates identified a number of plates with lower than average numbers of such BACs. For plates 198 and 213 a partial swap of the BESs determined with one of the two primers appear to have occurred. A third plate, 341, also with a significant deficit in tail-to-tail BACs, appeared to contain a substantial number of sequences determined from contaminating eubacterial 16 S rRNA DNA. Additionally a small number of eubacterial 16 S rRNA DNA sequences were present on two other plates, 111 and 338, in the library. Conclusions The comparative genomic approach can be used to assess BAC library integrity in the absence of fingerprinting. The sequences of the sheep CHORI-243 library BACs have high integrity, especially with the corrections detailed above. The library represents a high quality resource for use by the sheep genomics community.

  11. An ecologic study comparing distribution of Pasteurella trehalosi and Mannheimia haemolytica between Sierra Nevada bighorn sheep, White Mountain bighorn sheep, and domestic sheep.

    Science.gov (United States)

    Tomassini, Letizia; Gonzales, Ben; Weiser, Glen C; Sischo, William

    2009-10-01

    The prevalence and phenotypic variability of Pasteurella and Mannheimia isolates from Sierra Nevada bighorn sheep (Ovis canadensis sierrae), White Mountain bighorn sheep (Ovis canadensis nelsoni), and domestic sheep (Ovis aries) from California, USA, were compared. The White Mountain bighorn sheep population had a recent history of pneumonia-associated mortality, whereas the Sierra Nevada bighorn sheep population had no recent history of pneumonia-associated mortality. The domestic sheep flocks were pastured in areas geographically near both populations but were not known to have direct contact with either bighorn sheep population. Oropharyngeal swab samples were collected from healthy domestic and bighorn sheep and cultured to characterize bacterial species, hemolysis, biogroups, and biovariants. Pasteurella trehalosi and Mannheimia haemolytica were detected in all of the study populations, but the relative proportion of each bacterial species differed among sheep populations. Pasteurella trehalosi was more common than M. haemolytica in the bighorn sheep populations, whereas the opposite was true in domestic sheep. Mannheimia haemolytica was separated into 11 biogroups, and P. trehalosi was characterized into two biogroups. Biogroup distributions for M. haemolytica and P. trehalosi differed among the three populations; however, no difference was detected for the distribution of P. trehalosi biogroups between the Sierra Nevada bighorn sheep and domestic sheep. The prevalence odds ratios (pOR) for the distribution of M. haemolytica biogroups suggested little difference between White Mountain bighorn sheep and domestic sheep compared with Sierra Nevada bighorn sheep and domestic sheep, although these comparisons had relatively large confidence intervals for the point estimates. Hemolytic activity of the isolates was not different among the sheep populations for M. haemolytica but was different for P. trehalosi. No clear evidence of association was found in the

  12. The Effects of Prescribed Burning and Thinning on Herpetofauna and Small Mammals in the Upper Piedmont of South Carolina: Preliminary Results of the National Fire and Fire Surrogate Study

    Science.gov (United States)

    Eran S. Kilpatrick; Dean B. Kubacz; David C. Guynn; J. Drew Lanham; Thomas A. Waldrop

    2004-01-01

    Due to heavy fuel loads resulting from years of fire suppression, upland pine and mixed pine hardwood forests in the Upper Piedmont of South Carolina are at risk of severe wildfire. The National Fire and Fire Surrogate Study (NFFS) was conducted on the Clemson Experimental Forest to study the effects of prescribed burning and thinning on a multitude of factors,...

  13. The sheep industry in Botswana: promoting the

    African Journals Online (AJOL)

    Technical Notes. The sheep industry in Botswana: promoting the. Karakul sheep industry. S.J. Nsoso' and M.J. Madimabe. Botswana College of Agriculture, Private Bag 0027, Gaborone, Botswana. Received revised 25 October 1999; accepted 25 October I999. *To whom correspondence should be addressed at: Tel: 00267 ...

  14. 9 CFR 91.8 - Sheep.

    Science.gov (United States)

    2010-01-01

    ..., parent, or sibling of any scrapie-positive animal. (1) Sheep exported for immediate slaughter need not... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Sheep. 91.8 Section 91.8 Animals and Animal Products ANIMAL AND PLANT HEALTH INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE EXPORTATION AND...

  15. Preferences for sheep or goats in Indonesia

    NARCIS (Netherlands)

    Budisatria, I.G.S.; Udo, H.M.J.; Eilers, C.H.A.M.; Baliarti, E.; Zijpp, van der A.J.

    2010-01-01

    This paper aims to explore farmers’ preferences for sheep or goats based on feeding practices, animal and flock performances and economic benefits of sheep and goats in different agro-ecological zones in Central Java, Indonesia. In total, 150 smallholder farmers were selected from three

  16. Epidemiology of Burns in Rural Bangladesh: An Update.

    Science.gov (United States)

    He, Siran; Alonge, Olakunle; Agrawal, Priyanka; Sharmin, Shumona; Islam, Irteja; Mashreky, Saidur Rahman; Arifeen, Shams El

    2017-04-05

    Each year, approximately 265,000 deaths occur due to burns on a global scale. In Bangladesh, around 173,000 children under 18 sustain a burn injury. Since most epidemiological studies on burn injuries in low and middle-income countries are based on small-scale surveys or hospital records, this study aims to derive burn mortality and morbidity measures and risk factors at a population level in Bangladesh. A household survey was conducted in seven rural sub-districts of Bangladesh in 2013 to assess injury outcomes. Burn injuries were one of the external causes of injury. Epidemiological characteristics and risk factors were described using descriptive as well as univariate and multivariate logistic regression analyses. The overall mortality and morbidity rates were 2 deaths and 528 injuries per 100,000 populations. Females had a higher burn rate. More than 50% of injuries were seen in adults 25 to 64 years of age. Most injuries occurred in the kitchen while preparing food. 88% of all burns occurred due to flame. Children 1 to 4 years of age were four times more likely to sustain burn injuries as compared to infants. Age-targeted interventions, awareness of first aid protocols, and improvement of acute care management would be potential leads to curb death and disability due to burn injuries.

  17. Impact of prescribed burning on a heathland inhabiting spider community

    Directory of Open Access Journals (Sweden)

    Krause, Rolf Harald

    2016-04-01

    Full Text Available Heathlands can provide refuge for many stenotopic and endangered arthropods, if habitat management practices are applied. A management measure that is rarely being used today, but which has the potential to support diversity of arthropod communities, is prescribed burning. In this study we investigated the effects of prescribed burning on spider assemblages on a burned site with Calluna vulgaris in the nature reserve Lueneburg Heath, northwest Germany. We used pitfall trapping with a sampling design of 39 traps over a period of one year and 17 sampling intervals on a burned and a control site. We compared overall species richness, activity abundance patterns and community composition of the two sites, with a particular focus on stenotopic and endangered species. We collected 5116 adult spiders and 99 species altogether in a relatively small sampling area. This number of species represents nearly one third of the regional species pool of heathland spider species. Twelve species occurred exclusively on the burned site in contrast to 28 species exclusively found on the unburned site. Although we found more than twice as many spider individuals and higher mean species richness on the control site than on the burned site, the species richness of red-listed spiders was higher on the burned site. Especially the fact that we found 24 endangered species on the burned site and only 20 on the control site indicates that the applied measure of prescribed burning can foster certain endangered spider species and contribute to preserving the overall biodiversity of heathland ecosystems.

  18. Burning mouth disorder

    Directory of Open Access Journals (Sweden)

    Anand Bala

    2012-01-01

    Full Text Available Burning mouth disorder (BMD is a burning or stinging sensation affecting the oral mucosa, lips and/or tongue, in the absence of clinically visible mucosal lesions. There is a strong female predilection, with the age of onset being approximately 50 years. Affected patients often present with multiple oral complaints, including burning, dryness and taste alterations. The causes of BMD are multifactorial and remain poorly understood. Recently, there has been a resurgence of interest in this disorder with the discovery that the pain of burning mouth syndrome (BMS may be neuropathic in origin and originate both centrally and peripherally. The most common sites of burning are the anterior tongue, anterior hard palate and lower lip, but the distribution of oral sites affected does not appear to affect the natural history of the disorder or the response to treatment BMS may persist for many years. This article provides updated information on BMS and presents a new model, based on taste dysfunction, for its pathogenesis.

  19. Burn injuries and pregnancy.

    Science.gov (United States)

    Kennedy, Betsy B; Baird, Suzanne McMurtry; Troiano, Nan H

    2008-01-01

    Although burn injuries during pregnancy are considered relatively rare, the exact incidence is not known. Multiple factors influence morbidity and mortality resulting from burn injuries during pregnancy. These factors include the depth and size of the burn, the woman's underlying health and age, and the estimated gestational age of the fetus. Associated inhalation injury and development of other significant secondary complications also influence maternal and fetal outcomes. Successful burn care requires a team approach in which almost every healthcare discipline is represented. Initial care is almost always provided by a specially trained emergency medical team in an out-of-hospital setting. During this phase, the ability of the team to communicate with emergency hospital personnel facilitates appropriate clinical management at the scene. In addition, continued communication regarding the woman's status and responses to treatment allows critical care specialists within the hospital to ensure that necessary personnel and resources are available when the patient arrives. From the time the pregnant woman is admitted to a hospital for additional acute and critical care through the extensive process of rehabilitation from burn injuries, providing care often evokes strong emotions and requires specialized skills to achieve the most positive outcomes.

  20. Seroprevalence of Sheep and Goat Pox, Peste Des Petits Ruminants and Rift Valley Fever in Saudi Arabia

    OpenAIRE

    Hani Boshra; Thang Truong; Shawn Babiuk; Maged Gomaa Hemida

    2015-01-01

    Sheep and goat pox, peste des petits ruminants and Rift Valley fever are important diseases of small ruminant livestock. Sheep and goat pox, along with peste des petits ruminants, are endemic throughout most of Africa, Asia and the Middle East. Whereas Rift Valley fever is endemic in Africa, outbreaks in the Middle East have been reported over the past decade, including the Arabian Peninsula. Saudi Arabia is a major importer of livestock, and understanding the prevalence of these viral infect...

  1. Confirmation of resistance to ivermectin by Cooperia curticei in sheep.

    Science.gov (United States)

    Hughes, P L; McKenna, P B

    2005-10-01

    To investigate the occurrence of resistance to a full dose of oral ivermectin by Cooperia curticei in sheep. Twelve lambs on a sheep and cattle property in the North Island of New Zealand were randomly allocated to one of two equal-sized groups. One group was treated orally with a single dose of ivermectin at the manufacturer's recommended dose rate of 0.2 mg/kg, while the other remained as an untreated control. Worm counts were carried out post mortem on the abomasa and small intestines of all animals in both groups 7 days after treatment. While treatment with ivermectin reduced the numbers of all other worm genera to almost zero, those of Ostertagia(= Telodorsagia) circumcincta and C. curticei were reduced by only 37% and 19%, respectively. These results provide clear evidence of resistance to ivermectin by O. circumcincta and C. curticei. They also appear to represent the first record of macrocylic lactone (ML) resistance in C. curticei in sheep in New Zealand or elsewhere.

  2. Biodiversity of Helminths of Sheep Breed in Vojvodina (Northern Serbia

    Directory of Open Access Journals (Sweden)

    Ivan PAVLOVIĆ

    2017-11-01

    Full Text Available Vojvodina is situated in the northern part of Serbia. The region is divided into: Bačka in the northwest, Banat in the east and Srem in the southwest. A small part of the Mačva region is also located in Vojvodina, in the Srem District. Vojvodina is abundant with numerous grasslands suitable for sheep grazing. The present study was conducted in 90 sheep flocks from the territory of Vojvodina in the period of March 2014 to January 2015, using into consideration the biodiversity and sesonal occurance and prevalence of isolated parasites. Fecal samples were examined by using qualitative and quantitative coprological methods. Infection we occurred at 81.22% of sheep. We found eggs of Nematodirus sp. (71.22%, Ostertagia sp. (69.22%, Trichostrongylus sp. (66.55%, Haemonchus sp. (64.44%, Chabertia ovina (60.11%, Dictyocaulus spp. (49.00%, Oesophagostomum sp.(36.77%, Dicrocelium dendriticum (34.66%, Marshallagia sp. (29.66%, Cooperia sp. (27.88%, Moniezia sp. (26.77%, Bunostomum sp. (22.33% and Skrjabinema sp. (13,66%.

  3. Experimental poisoning by Enterolobium contortisiliquum in sheep

    Directory of Open Access Journals (Sweden)

    Flávia Barbieri Bacha

    Full Text Available ABSTRACT: Ingestion of Enterolobium contortisiliquum pods causes digestive disturbances, secondary hepatogenous photosensitization and abortions in ruminants. Pods were administered to sheep via a ruminal cannula to characterize acute poisoning. In Experiment 1, a single dose of 12g/kg of body weight (BW was administered to three sheep in one experiment. One sheep died, and the other two recovered after presenting clinical signs. In Experiment 2, 10g/kg BW were administered daily to 15 sheep until the onset of clinical signs or for three consecutive days. Fourteen sheep showed mild to severe signs after the ingestion of 1-3 doses. Two sheep died, and the others recovered. Clinical signs in both experiments were diarrhea, anorexia, rumen atony, apathy, dehydration and tachypnea. The main macroscopic findings were an orange, frothy ruminal content witch contained pods fragments. The intestinal content was liquid. Detachment of the mucosa from the submucosa and ballooning degeneration of mucosal cells were observed histologically in the forestomachs. Evaluation of ruminal contents revealed acute lactic ruminal acidosis (ALRA. Bromatological analysis of E. contortisiliquum pods revealed 537.8g/kg DM (dry matter of non-fibrous carbohydrates, which is sufficient to cause ALRA. Only one sheep in Experiment 2 had liver failure, characterized by jaundice, elevated serum activity of liver enzymes and histological lesions in liver biopsies. It is concluded that the administration of E. contortisiliquum pods in forage-fed sheep at doses of 10g/kg BW or higher may cause ALRA. The induction of liver failure in one sheep suggests that liver damage may occur in those sheep that do not develop acidosis.

  4. Haemophilus somnus (Histophilus somni) in bighorn sheep

    Science.gov (United States)

    2006-01-01

    Abstract Respiratory disease and poor lamb recruitment have been identified as limiting factors for bighorn-sheep populations. Haemophilus somnus (recently reclassified as Histophilus somni) is associated with respiratory disease in American bison, domestic sheep, and cattle. It is also harbored in their reproductive tracts and has been associated with reproductive failure in domestic sheep and cattle. Therefore, reproductive tract and lung samples from bighorn sheep were evaluated for the presence of this organism. Organisms identified as H. somnus were isolated from 6 of 62 vaginal but none of 12 preputial swab samples. Antigen specific to H. somnus was detected by immunohistochemical study in 4 of 12 formalin-fixed lung tissue samples of bighorn sheep that died with evidence of pneumonia. Notably, H. somnus was found in alveolar debris in areas of inflammation. The 6 vaginal isolates and 2 H. somnus isolates previously cultured from pneumonic lungs of bighorn sheep were compared with 3 representative isolates from domestic sheep and 2 from cattle. The profiles of major outer membrane proteins and antigens for all of the isolates were predominantly similar, although differences that may be associated with the host–parasite relationship and virulence were detected. The DNA restriction fragment length profiles of the bighorn-sheep isolates had similarities not shared with the other isolates, suggesting distinct phylogenetic lines. All of the isolates had similar antimicrobial profiles, but the isolates from the bighorn sheep produced less pigment than those from the domestic livestock, and growth of the former was not enhanced by CO2. Wildlife biologists and diagnosticians should be aware of the potential of these organisms to cause disease in bighorn sheep and of growth characteristics that may hinder laboratory detection. PMID:16548330

  5. Identification of Single Nucleotide Polymorphism (SNP in Mono Amine Oxidase A (MAO-A Gene as a genetic marker for aggressiveness in sheep

    Directory of Open Access Journals (Sweden)

    Eko Handiwirawan

    2012-12-01

    Full Text Available In the population, there are aggressive sheep in a small number which requires special management those specific animal house and routine management. The purpose of this study was to identify the variation of DNA marker SNP (single nucleotide polymorphism as a genetic marker for the aggressive trait in several of sheep breed. The identification of point mutations in exon 8 of MAO-A gene associated with aggressive behavior in sheep may be further useful to become of DNA markers for the aggressive trait in sheep. Five of sheep breed were used, i.e.: Barbados Black belly Cross sheep (BC, Composite Garut (KG, Local Garut (LG, Composite Sumatra (KS and St. Cross Croix (SC. Duration of ten behavior traits, blood serotonin concentrations and DNA sequence of exon 8 of MAO-A gene from the sheep aggressive and nonaggressive were observed. PROC GLM of SAS Ver. 9.0 program was used to analyze variable behavior and blood serotonin concentrations. DNA polymorphism in exon 8 of MAO-A gene was analyzed using the MEGA software Ver. 4.0. The results show that the percentage of the aggressive rams of each breed was less than 10 percent; except for the KS sheep is higher (23%. Based on the duration of behavior, aggressive sheep group was not significantly different with non aggressive sheep group, except duration of care giving and drinking behavior. It is known that concentration of blood serotonin in aggressive and non aggressive rams was not significantly different. The aggressive trait in sheep has a mechanism or a different cause like that occurs in mice and humans. In this study, aggressive behavior in sheep was not associated with a mutation in exon 8 of MAO-A gene.

  6. Psychiatric aspects of burn

    Directory of Open Access Journals (Sweden)

    Dalal P

    2010-10-01

    Full Text Available Burn injuries and their subsequent treatment cause one of the most excruciating forms of pain imaginable. The psychological aspects of burn injury have been researched in different parts of the world, producing different outcomes. Studies have shown that greater levels of acute pain are associated with negative long-term psychological effects such as acute stress disorder, depression, suicidal ideation, and post-traumatic stress disorder for as long as 2 years after the initial burn injury. The concept of allostatic load is presented as a potential explanation for the relationship between acute pain and subsequent psychological outcomes. A biopsychosocial model is also presented as a means of obtaining better inpatient pain management and helping to mediate this relationship.

  7. Study on common phenotypic traits for purchasing sheep and their ...

    African Journals Online (AJOL)

    During sheep marketing, call price to selling price ratio shows that after an intense negotiation, sheep owners accepted 84±7.3% of the call price. In conclusion, sheep market customers' criteria to select sheep of their preference had strong association with the purpose of buying and the price paid after negotiation.

  8. Prevalence of Trypanosomosis in Small Ruminants at Slaughter in ...

    African Journals Online (AJOL)

    The prevalence of Trypanosoma infection in indigenous breeds of small ruminants at slaughter in Jos was studied from 680 blood samples collected from 300 sheep and 380 goats from December 1999 to May 2000. 8(2.67%) sheep and 4(1.05%) goats were positive for trypanosoma infection. Trypanosoma vivax and T.

  9. Burn Safety Awareness on Playgrounds: Thermal Burns from Playground Equipment

    Science.gov (United States)

    ... Safety Awareness on Playgrounds Thermal Burns from Playground Equipment The U.S. Consumer Product Safety Commission CPSC wants ... of the risk of thermal burns from playground equipment. You may remember the metal slides of your ...

  10. Burning mouth syndrome

    Directory of Open Access Journals (Sweden)

    Sudha Jimson

    2015-01-01

    Full Text Available Burning mouth syndrome (BMS is a complex disorder that is characterized by warm or burning sensation in the oral mucosa without changes on physical examination. It occurs more commonly in middle-aged and elderly women and often affects the tip of the tongue, lateral borders, lips, hard and soft palate. This condition is probably of multi-factorial origin, often idiopathic, and its etiopathogensis is unknown. BMS can be classified into two clinical forms namely primary and secondary BMS. As a result, a multidisciplinary approach is required for better control of the symptoms. In addition, psychotherapy and behavioral feedback may also help eliminate the BMS symptoms.

  11. Electrothermal Ring Burn

    Directory of Open Access Journals (Sweden)

    Yakup Çil

    2012-09-01

    Full Text Available Low-voltage fountainheads such as car, tractor or motorcycle batteries are predisposed to produce large currents. Any metal object that comes into contact with these batteries may result in short-circuit. This may result in rapid and excessive heating of metal object and an electrothermal burn. Herein we presented a motorcycle driver who was 28-year-old man with electrothermal ring burn which was caused by metal chain that was used as a ring. (Turk J Dermatol 2012; 6: 106-7

  12. Aspects Regarding the Coprological Pollution Level in Some Sheep Helminthiasis

    OpenAIRE

    Octavian Negrea; Vioara Mireşan; Camelia Raducu; Flore Chirilă; Octavia Negrea; Adriana Criste; Daniel Cocan; Iulia Festila

    2013-01-01

    The investigations on the incidence and intensity of parasitism in some endoparasytes in sheep  performed on 376 animals (260 sheep and 116 young adult sheep) Turcana breed, Gilău area, Cluj County, indicated an increased incidence in trihostrongilidys  of 72.7% in young  sheep and 65.0% in adult sheep. The incidence of monesya had different values ​​depending on age group, 45.5% at young sheep and 10.0% in  adult sheep. The data obtained regarding the prevalence of hepatobiliary trematodsys...

  13. Genome-wide association analysis identifies the genetic basis of fat deposition in the tails of sheep (Ovis aries).

    Science.gov (United States)

    Xu, S-S; Ren, X; Yang, G-L; Xie, X-L; Zhao, Y-X; Zhang, M; Shen, Z-Q; Ren, Y-L; Gao, L; Shen, M; Kantanen, J; Li, M-H

    2017-10-01

    Fat-tailed sheep (Ovis aries) can survive in harsh environments and satisfy human's intake of dietary fat. However, the animals require more feed, which increases the cost of farming. Thus, most farmers currently prefer thin-tailed, short-tailed or docked sheep. To date, the molecular mechanism of the formation of fat tails in sheep has not been completely elucidated. Here, we conducted a genome-wide association study using phenotypes and genotypes (the Ovine Infinium HD SNP BeadChip genotype data) of two breeds of contrasting tail types (78 Small-tailed and 78 Large-tailed Han sheep breeds) to identify functional genes and variants associated with fat deposition. We identified four significantly (rs416433540, rs409848439, rs408118325 and rs402128848) and three approximately associated autosomal SNPs (rs401248376, rs402445895 and rs416201901). Gene annotation indicated that the surrounding genes (CREB1, STEAP4, CTBP1 and RIP140, also known as NRIP1) function in lipid storage or fat cell regulation. Furthermore, through an X-chromosome-wide association analysis, we detected significantly associated SNPs in the OARX: 88-89 Mb region, which could be a strong candidate genomic region for fat deposition in tails of sheep. Our results represent a new genomic resource for sheep genetics and breeding. In addition, the findings provide novel insights into genetic mechanisms of fat deposition in the tail of sheep and other mammals. © 2017 Stichting International Foundation for Animal Genetics.

  14. A retrospective review of burn dressings on a porcine burn model.

    Science.gov (United States)

    Wang, Xue-Qing; Kravchuk, Olena; Kimble, Roy M

    2010-08-01

    This is a study to compare wound healing among three types of dressings on a porcine model with deep-dermal-partial-thickness burns. The burns in this study were from eight animal trials conducted in the past for other purposes and only burns with a uniform pale appearance that had served as controls in original experiments were selected. In total, there were 57 burns in 33 pigs, using one of following three dressings: Acticoat (Silver) (3 trials), Jelonet (Gauze) (3 trials), and Solosite Gel/Jelonet (Gel/Gauze) (2 trials). The wound healing assessments included wound re-epithelialisation during a 6-week period, clinical and histological scar assessments at week 6 after burn. Of all wound healing/scar assessments, only re-epithelialisation showed statistical difference between dressings. Earlier re-epithelialisation was observed in Gel/Gauze dressings compared to Silver and/or Gauze dressings. However, this study revealed huge variation in wound healing outcome between 3 trials within both Silver and/or Gauze dressings, supported by significant differences on re-epithelialisation, clinical and histological scar measurements. In addition, it was found that larger animals healed better than smaller ones, based on weights from 21 pigs. Of all dressings, Silver delivers the best protection for wound colonization/infection. Wound colonization/infection was found to confine wound healing and lead to thinner RND in scars. From this study, we cannot find enough evidence to suggest the beneficial effect of one dressing(s) over others on burn wound healing outcome on a porcine model with small deep-dermal-partial-thickness burns with a relative small sample size.

  15. An assessment of burn care professionals' attitudes to major burn.

    LENUS (Irish Health Repository)

    Murphy, A D

    2008-06-01

    The resuscitation of severe burn remains a controversial area within the burn care profession. There is ongoing debate as to what percentage burn is associated with a sufficient quality of life to support initial resuscitation efforts. We conducted a survey of delegates at the 39th Annual Meeting of the British Burns Association (2005), regarding attitudes towards resuscitation following major burns. Respondents were asked the maximum percentage total body surface area (TBSA) burn beyond which they would not wish to be resuscitated. They were also asked what maximum TBSA they perceived to be commensurate with an acceptable quality of life (QOL). One hundred and forty three of 300 delegates responded to the questionnaire. Thirty three percent of respondents would not wish to be resuscitated with 50-75% TBSA burns or greater. A further 35% would not wish to have life-sustaining intervention with 75-95% TBSA burns or greater. The remaining 32% indicated that they would not want resuscitation with TBSA burns>95%. Regardless of TBSA affected, 16% would not wish resuscitation if they had full thickness facial burns, a further 10% did not want resuscitation if both their hands and faces were affected. Our survey demonstrates the diversity of personal preference amongst burn care professionals. This would suggest that a unifying philosophy regarding the resuscitation of extensive burns will remain elusive.

  16. Disasters; the 2010 Haitian earthquake and the evacuation of burn victims to US burn centers.

    Science.gov (United States)

    Kearns, Randy D; Holmes, James H; Skarote, Mary Beth; Cairns, Charles B; Strickland, Samantha Cooksey; Smith, Howard G; Cairns, Bruce A

    2014-09-01

    Response to the 2010 Haitian earthquake included an array of diverse yet critical actions. This paper will briefly review the evacuation of a small group of patients with burns to burn centers in the southeastern United States (US). This particular evacuation brought together for the first time plans, groups, and organizations that had previously only exercised this process. The response to the Haitian earthquake was a glimpse at what the international community working together can do to help others, and relieve suffering following a catastrophic disaster. The international response was substantial. This paper will trace one evacuation, one day for one unique group of patients with burns to burn centers in the US and review the lessons learned from this process. The patient population with burns being evacuated from Haiti was very small compared to the overall operation. Nevertheless, the outcomes included a better understanding of how a larger event could challenge the limited resources for all involved. This paper includes aspects of the patient movement, the logistics needed, and briefly discusses reimbursement for the care provided. Copyright © 2013 Elsevier Ltd and ISBI. All rights reserved.

  17. Automated mapping of burned areas in Landsat imagery; tracking spatial and temporal patterns of burned areas and greenhouse gas emissions in the Southern Rocky Mountains, USA.

    Science.gov (United States)

    Hawbaker, Todd; Vanderhoof, Melanie; French, Nancy; Billmire, Michael; Beal, Yen-Ju Grace; Takacs, Josh; Bosshart, Robbert; Caldwell, Megan

    2016-04-01

    Accurate estimates of greenhouse gas emissions depend on precise mapping of burned area extent and timing. Consequently, fire disturbance has been identified by the Global Climate Observing System (GCOS) program as one of the 14 Terrestrial Essential Climate Variables (ECVs). Landsat's temporal resolution and sensor characteristics make it more suitable for mapping burned area than existing burned area products from coarse resolution sensors. We have developed an automated algorithm to identify burned areas in temporally rich stacks of Landsat surface reflectance data using boosted regression trees and spatial filters. For this analysis, we quantified trends in burned area and fire emissions using the USGS Burned Area ECV data and the Monitoring Trends in Burn Severity data, the latter of which is known to be incomplete. Both datasets were combined with the LANDFIRE Fuel Characteristic Classification System to assign pre-fire biomass loads, and the CONSUME model was used to estimate biomass consumption and greenhouse gas emissions. Both data sets show a dramatic increase in burned area between 1984-1999 and 2000-2015, but the Burned Area ECV included more small fires and fires in non-forest ecosystems. Emission estimates were similar between the two burned area datasets, but were generally greater for the Burned Area ECV. Our results suggest that national and regional scale emission estimates could be improved by incorporating the more complete Burned Area ECV dataset.

  18. Propagation of Cigarette Static Burn

    Directory of Open Access Journals (Sweden)

    Miura K

    2014-12-01

    Full Text Available A propagation model of cigarette static burn at the cigarette periphery is proposed. Propagation of cigarette static burn is characterized by intermittent burn of the cigarette paper. The burning rate depends on the period of flash burn of the paper and is independent of the burning width. By measuring the local temperature near the front line of the burning propagation, the rate-determining step was identified as the time required to ignite the paper. A mathematical analysis was performed by calculating the heat transfer at the periphery during the paper heating period, and it was revealed that the thermal properties of the cigarette are the dominant factors of cigarette static burn. Modeling results showed good agreement with measured data.

  19. Ultrasonographic findings in two sheep with enzootic calcinosis

    OpenAIRE

    Braun, Ueli; Mitchell, Katharyn J; Schramm, S.; Nogler, S; Hatt, Jean-Michel; Malbon, A

    2016-01-01

    This report describes 2 sheep with enzootic calcinosis characterized by abnormal cardiovascular and respiratory findings and ascites causing abdominal distension. Both sheep were anorexic and listless and had increased heart and respiratory rates. Auscultation of the heart revealed a gallop rhythm in sheep 1 and a loud systolic heart murmur in sheep 2. The activities of liver enzymes were severely increased in both sheep. Abdominal ultrasonography showed severe ascites and congestion of the l...

  20. The impact of diet in early life on adipose tissue growth and development in sheep

    OpenAIRE

    Birtwistle, Mark D.A.

    2016-01-01

    Adipose tissue is found in two main forms: white (WAT), which stores energy; and brown (BAT), which dissipates energy as heat by means of a unique mitochondrial protein, UCP1. In large mammals, BAT is rapidly replaced by WAT after birth, but it has recently been found that functional BAT is present in human adults, which raises the possibility that it could be manipulated to burn off excess fat. The main aim of this thesis was to investigate, using sheep as a model, the effect of early nutrit...

  1. Accumulative eschar after burn

    OpenAIRE

    Ma, Fushun

    2015-01-01

    Key Clinical Message Eschar formation is a potential sequela of burn injuries. Definitive management may include escharectomy and eschar debridement. After eschar removal, the wound can be covered with a skin graft or reepithelialization. For prolonged refractory eschar on the fingertips, topical use of rb?bFGF after debridement can achieve an optimal outcome.

  2. One Burn, One Standard

    Science.gov (United States)

    2014-09-01

    law , no person shall be...Johannes Kepler University Linz Software GmbH Research Department Medical Informatics Hagenberg, Austria Herbert L. Haller, MD Trauma Hospital Linz of...0000000000000004 Address correspondence to M. Giretzlehner, PhD, Johannes Kepler University Linz, RISC Software GmbH, Research Department Medical Informatics, Softwarepark 35, 4232 Hagenberg, Austria. One Burn, One Standard LETTER TO THE EDITOR

  3. Taenia hydatigena cysticercosis in slaughtered pigs, goats, and sheep in Tanzania

    DEFF Research Database (Denmark)

    Braae, Uffe Christian; Kabululu, Mwemezi; Nørmark, Michelle Elisabeth

    2015-01-01

    Few studies have been carried out in Africa toestimate the prevalence of Taeniahydatigena. With theaim to determine theprevalence of T. hydatigena inslaughtered pigs and small ruminants (goats and sheep) in Mbeya, Tanzania, two cross-sectional surveys were carried out investigating pigs in Aprilt...

  4. Comparison of the serum toxicokinetics of larkspur toxins in cattle, sheep and goats

    Science.gov (United States)

    Larkspurs (Delphinium spp.) are a major cause of cattle losses in western North America, whereas sheep are thought to be resistant to larkspur toxicosis. Goats are often used as a small ruminant model to study poisonous plants. In this study, we compared the serum toxicokinetic profile of toxic lark...

  5. Occurrence and fertility rates of hydatid cysts in sheep and goats ...

    African Journals Online (AJOL)

    In Ethiopia very limited studies were conducted in small ruminant hydatidosis compared to cattle. A cross-sectional study was conducted at Modjo Luna Export Slaughter House from December 2009 to February 2010 to determine the prevalence and fertility of hydatid cysts. A total of 325 sheep and 440 goats were examined ...

  6. Prevalence of diseases among sheep and goats in Edo State, Nigeria

    African Journals Online (AJOL)

    Clinical records of small ruminant (Sheep and Goat) diseases treated were collected from the veterinary clinics, Ministry of Agriculture and Natural Resources of three Local Government areas in Edo state, for a period of five years (1997-2002). To identify the disease occurrence and prevalence as it militates against the ...

  7. PHKG2 and IRAK4 from black-boned sheep (Ovis aries)

    African Journals Online (AJOL)

    The tissue transcription profile analyses indicated that the Black-boned sheep PHKG2 and IRAK4 genes are generally but differentially expressed in the detected tissues including spleen, muscle, skin, kidney, lung, liver, heart, fat and small intestine. These data serve as a foundation for further insight into these two genes.

  8. Fatal Burn due to Solarium

    Directory of Open Access Journals (Sweden)

    Celalettin Sever

    2011-01-01

    Full Text Available Radiation burns are uncommon and their etiologies are various. The ultraviolet lights are also a source of radiation burns. We present a case of life-threatening radiation burn caused by long wave ultraviolet lights (UV at the solarium center. Up to now, despite its widespread use, fatal radiation burns caused by the indoor tanning device at the solarium center have not been reported. The circumstances of this injury and preventive measures are discussed.

  9. Reactive burn models and ignition & growth concept

    Energy Technology Data Exchange (ETDEWEB)

    Menikoff, Ralph S [Los Alamos National Laboratory; Shaw, Milton S [Los Alamos National Laboratory

    2010-01-01

    Plastic-bonded explosives are heterogeneous materials. Experimentally, shock initiation is sensitive to small amounts of porosity, due to the formation of hot spots (small localized regions of high temperature). This leads to the Ignition and Growth concept, introduced by Lee and Tarver in 1980, as the basis for reactive burn models. A homogeneized burn rate needs to account for three mesoscale physical effects (i) the density of burnt hot spots, which depends on the lead shock strength; (ii) the growth of the burn fronts triggered by hot spots, which depends on the local deflagration speed; (iii) a geometric factor that accounts for the overlap of deflagration wavelets from adjacent hot spots. These effects can be combined and the burn model defined by specifying the reaction progress variable {lambda}(t) as a function of a dimensionless reaction length {tau}{sub hs}(t)/{ell}{sub hs}, rather than by xpecifying an explicit burn rate. The length scale {ell}{sub hs} is the average distance between hot spots, which is proportional to [N{sub hs}(P{sub s})]{sup -1/3}, where N{sub hs} is the number density of hot spots activated by the lead shock. The reaction length {tau}{sub hs}(t) = {line_integral}{sub 0}{sup t} D(P(t'))dt' is the distance the burn front propagates from a single hot spot, where D is the deflagration speed and t is the time since the shock arrival. A key implementation issue is how to determine the lead shock strength in conjunction with a shock capturing scheme. They have developed a robust algorithm for this purpose based on the Hugoniot jump condition for the energy. The algorithm utilizes the time dependence of density, pressure and energy within each cell. The method is independent of the numerical dissipation used for shock capturing. It is local and can be used in one or more space dimensions. The burn model has a small number of parameters which can be calibrated to fit velocity gauge data from shock initiation experiments.

  10. Peningkatan Produktivitas Domba pada Skala Peternakan Rakyat Melalui Pemberian Hormon Pregnant Mare Serum Gonadotrophin (IMPROVEMENT OF SMALL HOLDER FARMS SHEEP PRODUCTIVITY THROUGH THE APPLICATION OF PREGNANT MARE SERUM GONADOTROPHIN

    Directory of Open Access Journals (Sweden)

    Andriyanto .

    2013-07-01

    Full Text Available The administration of Pregnant Mare Serum Gonadotrophin (PMSG hormone to stimulate superovulation has been proven to improved fetal prenatal growth, birth weight, mammary gland growth anddevelopment, milk production, litter size, as well as pre and post weaning growth. This study was conductedto apply the administration of PMSG hormone technology in small-holder farms. One hundred ewes weredivided into two groups. Group I (control: 50 ewes ewes without administration of PMSG and Group 2(treatment: 50 ewes ewes with administration of PMSG to stimulate super ovulation and improveendogenous secretion of pregnant hormones. The application of PMSG increased the numbers of lamb bornby 26.8% (69 vs. 87 with average litter size of 20.7% (1.38 vs. 1.74. The lamb weight at birth was alsoincreased by 25.7% (2.76 ± 0.33 vs. 3.47 ± 0.35 kg. The milk production of the dam was also increased by29.7% (0.64 ± 0.25 vs. 0.91 ± 0.22 L/ewe/day. Lambs born to ewes administered PMSG had better weaningweight 22.1% (12.32 ± 2.44 vs. 15.04 ± 1.11 kg/ewe. The number of survival lamb to reach weaning age washigher compared to the control group. The weight at weaning age was almost twice (628.4 kg vs. 1202.8 kgcompared to the control group. Using simple economic analysis calculation, the application of this hormonetechnology could increase gross revenue by Rp 294.280- per ewes. It was concluded that the administrationof PMSG is economically feasible to be applied in to the small-holder farms.

  11. 40 CFR 49.10411 - Permits for general open burning, agricultural burning, and forestry and silvicultural burning.

    Science.gov (United States)

    2010-07-01

    ..., agricultural burning, and forestry and silvicultural burning. 49.10411 Section 49.10411 Protection of... for general open burning, agricultural burning, and forestry and silvicultural burning. (a) Beginning... obtain approval of a permit under § 49.134 Rule for forestry and silvicultural burning permits. ...

  12. THE RUMINANT EFFECT OF VEGETAL LECITHIN AT SHEEP AND GOATS

    OpenAIRE

    H. SĂRĂNDAN; ANA PIVODĂ; D. DRÎNCEANU; ANA SAUER; OLGA RADA; LILIANA CĂRPINIŞAN; CLAUDIA SALA; S. VOIA; C. LUCA

    2009-01-01

    In the extraction process of the vegetable soy oils and sun-flower oils results in large quantities a waste that contains approximately 45% fat from which 58% is lecithin. This waste called “dreg” creates problems of environment pollution because we didn’t find a use for it. We tested this waste in the food of small ruminants, at sheep and goat, watching the ruminant effect and the apparent digestibility of the nutritive substances in the food. The tested doses of “dregs” were of 100 g and 20...

  13. Immunisation of sheep against Schistosoma mattheei using either irradiated cercariae or irradiated schistosomula.

    Science.gov (United States)

    Taylor, M G; James, E R; Nelson, G S; Bickle, Q; Dunne, D W; Webbe, G

    1976-03-01

    Irradiated cercariae, irradiated schistosomula, or heterologous infections were used to vaccinate sheep against Schistosoma mattheei infection. In the first experiment four doses of 10(4) S. mattheei cercariae irradiated at 6Kr were administered to sheep by percutaneous infection at 4 week intervals. This induced a 74% reduction in a challenge infection compared to control sheep while only 13% protection was achieved in a third group of sheep immunised with normal cercariae of the heterologous parasite S. mansoni. No significant differences were seen in histopathology of the liver of any of the sheep but the pathological changes were more severe in the large and small intestines of sheep vaccinated with the heterologous parasite. In the second experiment with irradiated cercariae only one or two immunising exposures were used. The degree of protection in the adult worm load (9-11%) was not significant and no significant differences were noticed in the pathology of the vaccinated and control animals. In the third experiment four doses of irradiated organisms were used to vaccinate five groups of sheep: 3Kr or 6Kr cercariae were administered by percutaneous infection; 6Kr skin-transformed schistosomula were administered by intra muscular injection; the same 6Kr skin-transformed schistosomula were given by intravenous injection and 6Kr syringe transformed schistosomula were administered by intramuscular injection. The degree of protection (determined as the reduction in worm burden) achieved by these different procedures was respectively 72%, 61%, 77%, 56% and 78%. These results indicate the possibility of making a live vaccine against ovine schistosomiasis and show that effective immunisation is not dependent on the presence of a mature worm infection or on cercarial penetration of the skin by the immunising infection.

  14. Impact of pediatric burn camps on participants' self esteem and body image: an empirical study.

    Science.gov (United States)

    Bakker, Anne; Van der Heijden, Peter G M; Van Son, Maarten J M; Van de Schoot, Rens; Van Loey, Nancy E E

    2011-12-01

    This study focuses on possible effects of specialized summer camps on young burn survivors' self esteem and body image. Quantitative as well as qualitative measures was used. To study possible effects, a pretest-posttest comparison group design with a follow-up was employed. Self-report questionnaires were used to measure self esteem and body image in a burn camp group (n=83, 8-18 years) and in a comparison group of children with burns who did not attend a burn camp during the course of the study (n=90, 8-18 years). Additionally, burn camp participants and parents completed an evaluation form about benefits derived from burn camp. A small positive short-term effect of burn camp participation was found on the 'satisfaction with appearance' component of body image. Overall, participants and parents showed high appreciation of the burn camps and reported several benefits, particularly concerning meeting other young burn survivors. Albeit statistically modest, this is the first quantitative study to document on a significant short-term impact of burn camp on young burn survivors' body image. Implications of this result for future research and burn camp organization were discussed, including the strengths of residential camps for young burn survivors. Copyright © 2011 Elsevier Ltd and ISBI. All rights reserved.

  15. The use of Eucalyptus staigeriana nanoemulsion for control of sheep haemonchosis

    Directory of Open Access Journals (Sweden)

    Wesley L.C. Ribeiro

    Full Text Available ABSTRACT: Sustainable control of gastrointestinal nematodes (GIN in small ruminants has been based on the use of alternative methods, including targeted selective treatment, such as FAMACHA. Another GIN control alternative is the use of herbal medicines, although in many cases their use is based on empirical knowledge. Biopolymer nanoformulations has been investigated to maximize the essential oil effects against sheep gastrointestinal nematodes. The aim of the present study was to combine a Eucalyptus staigeriana essential oil nanoemulsion (EsNano with FAMACHA as an alternative control for sheep haemonchosis. The study was performed over six months at a commercial sheep farm located in a semiarid region of Northeast Brazil. Initially, a fecal egg count reduction test (FECRT in sheep with levamisole, ivermectin and oxfendazole in sheep was performed used to determine the most effective anthelmintic to use as the positive control. Levamisole has been selected because it showed efficacy superior to 95%. EsNano was obtained and then its physicochemical properties were characterized. The average (±SE size of the particles in the nanoemulsion was 276.8 (±12.3 nm with bimodal distribution and polydispersity. Nine visits were performed, from April to September 2013, with an interval of 17 days. One hundred sixty-two male and female sheep were divided into three groups (n=54 each and were treated when FAMACHA score was 3, 4, or 5: G-EsNano 250mg kg-1 EsNano; G-Lev 7.5mg kg-1 levamisole (positive control, and G-Neg was not treated (negative control. Feces from sheep were collected to quantify the number of eggs per gram of feces (epg and to identify nematode genera. Sheep weight gain was monitored. The epg data for each group and the average sheep weight gains were analyzed by variance analysis and compared with the Tukey’s test (P0.05. The epg variation was similar in the G-EsNano and G-Lev groups on visits (P>0.05, except the second and fifth

  16. Worm control practice against gastro-intestinal parasites in Norwegian sheep and goat flocks

    Directory of Open Access Journals (Sweden)

    Vatn Synnøve

    2011-05-01

    Full Text Available Abstract Background Anthelmintic treatment is the most common way of controlling nematode infections in ruminants. However, several countries have reported anthelmintic resistance (AR, representing a limitation for sustainable small ruminant production. The knowledge regarding worm control management represents a baseline to develop a guideline for preventing AR. The aim of the present study was therefore to improve our knowledge about the worm control practices in small ruminant flocks in Norway. Methods A questionnaire survey regarding worm control practices was performed in small ruminant flocks in Norway. Flocks were selected from the three main areas of small ruminant farming, i.e. the coastal, inland and northern areas. A total of 825 questionnaires, comprising 587 sheep flocks (return rate of 51.3% and 238 goat flocks (52.6% were included. Results The results indicated that visual appraisal of individual weight was the most common means of estimating the anthelmintic dose used in sheep (78.6% and goat (85.1% flocks. The mean yearly drenching rate in lambs and ewes were 2.5 ± 1.7 and 1.9 ± 1.1, respectively, whereas it was 1.0 (once a year in goats. However, these figures were higher in sheep in the coastal area with a rate of 3.4 and 2.2 in lambs and ewes, respectively. Benzimidazoles were the predominant anthelmintic class used in sheep flocks (64.9% in 2007, whereas benzimidazoles and macrocyclic lactones were both equally used in dairy goat flocks. In the period of 2005-2007, 46.3% of the sheep flocks never changed the anthelmintic class. The dose and move strategy was practiced in 33.2% of the sheep flocks. Conclusions The present study showed that inaccurate weight calculation gives a risk of under-dosing in over 90% of the sheep and goat flocks in Norway. Taken together with a high treatment frequency in lambs, a lack of anthelmintic class rotation and the common use of a dose-and-move strategy, a real danger for development of

  17. Instant cup of soup: design flaws increase risk of burns.

    Science.gov (United States)

    Greenhalgh, David G; Bridges, Peggy; Coombs, Elena; Chapyak, Debbie; Doyle, William; O'Mara, Michael S; Palmieri, Tina L

    2006-01-01

    Prepackaged soups are a frequent cause of burn injury. We hypothesize that package design increases the risk for burn injury by affecting container stability. All pediatric scald burns caused by soup, between June 1997 and August 2004, were reviewed for burn and patient characteristics. Instant or "ready-to-eat" soups also were purchased. Safety statements and recommendations as to use of the microwave oven were documented. The height and the areas of the base and top were compared to the angle that a container would tip over on to its side. During the study period, 99 admissions and 80 outpatients were treated for burns caused by soup. Although the burn size was small (mean 5% TBSA) 22 patients required grafting. Of 13 different soups, 11 required the addition of hot water, and 2 were prepackaged for eating out of the container. Twelve containers had round bases and were tall and narrow, with one being shorter and rectangular. The measurements that correlated with the ease of tipping over were the base area, top area, and the ratio of height/base area. The most significant contributor to the ease of tipping over was height. Instant soups are packaged in containers that tend to be tall with a narrow base that predisposes them to being knocked over and spilled. Simple redesigning of instant soup packaging with a wider base and shorter height, along with the requirement for warnings about the risks of burns would reduce the frequency of soup burns.

  18. Micro-negocios asociativos campesinos: análisis económico de un sistema de producción ovina, Región del Maule, Chile Undertaking associative small holding business: economic analysis of the sheep production system, Maule region, Chile

    Directory of Open Access Journals (Sweden)

    Germán Lobos Andrade

    2005-08-01

    Full Text Available El objetivo de esta investigación fue evaluar la rentabilidad económica de un sistema de producción ovina para un grupo de 20 productores agropecuarios, cuyos predios se encuentran localizados en la zona de secano interior de la provincia de Linares, Región del Maule, Chile. El trabajo en terreno se realizó durante el periodo noviembre del 2002 a junio 2003, el cual permitió caracterizar a los productores en cuatro grupos homogéneos entre sí, en función del número de cabezas del rebaño ovino. Para estimar la rentabilidad económica del sistema propuesto, bajo distintos escenarios de precios de venta, se usó el Valor Actual Neto (VAN, la Tasa Interna de Retorno (TIR y el Índice de Valor Actual Neto (IVAN. El valor promedio del rebaño ovino fue estimado entre 0,26 a $ 1,45 millones y el valor promedio de la tierra entre 6,3 y $ 12,8 millones, dependiendo del tamaño del predio agrícola (hectáreas. Para el escenario normal de precios, se obtuvo un VAN (10,8% de $ 4,12 millones, la TIR se estimó en 14,5% y el IVAN en 0,37. La principal conclusión sugiere que el emprendimiento asociativo a micro-escala puede contribuir a mejorar las condiciones de vida de los pequeños productores.The aim of this research was to assess the economic profitability of a associative sheep husbandry business system for 20 agricultural small holdings, located in the inner unirrigated Linares area, in the Maule region, Chile. Data from the period of November 2002 until June 2003 were recollected, for characterizing the producers in four quite homogeneous sub-groups, according to the size of their herd. Profitability for a proposal system, under different price scenarios, was assessed by means of traditional indicators: Net Present Value (VAN, Internal Rate of Return (TIR and Net Present Value Index (IVAN. The average value of the sheep herd was estimated from 0.26 to $ 1.45 millions and the average value of land from 6.3 to $ 12.8 millions, depending on

  19. Air-Freshener Burns: A New Paradigm in Burns Etiology?

    Science.gov (United States)

    Sarwar, Umran; Nicolaou, M.; Khan, M. S.; Tiernan, E.

    2011-01-01

    Objectives: We report a rare case of burns following the use of automated air-fresheners. Methods: We present a case report with a brief overview of the literature relating to burns associated with air-fresheners. The mechanism and treatment of these types of injuries are also described. Results: A 44 year-old female was admitted under the care of the burns team following burns secondary to an exploding air-freshener canister. The patient sustained burns to the face, thorax and arms resulting in a seven-day hospital admission. The burns were treated conservatively. Conclusions: To our knowledge this is one of the few documented cases of burns as a result of air-fresheners. As they become more ubiquitous, we anticipate the incidence of such cases to increase. As such, they pose a potential public health concern on a massive scale. PMID:22174972

  20. Development of a polymerase chain reaction method for diagnosis of Babesia ovis infection in sheep and goats.

    Science.gov (United States)

    Aktaş, M; Altay, K; Dumanli, N

    2005-11-05

    In this study, a pair of oligonucleotide primers were designed according to the nucleotide sequence of the small subunit ribosomal RNA (ssu rRNA) gene of Babesia ovis isolated from sheep in eastern Turkey. The primers were used to detect parasite DNA from blood samples of B. ovis-infected sheep and goats by polymerase chain reaction (PCR). A 549-bp DNA fragment was specifically amplified from blood samples from sheep and goats, naturally infected with B. ovis. No PCR products resulted from Babesia motasi, T. ovis, Theileria sp. OT1, Theileria sp. OT3, T. lestoquardi, B. canis, B. microti,T. annulata or normal sheep leucocytes DNA using these specific primers. B. ovis-infected erythrocytes with 1% parasitemia were subjected to 10-fold serial dilutions (from 10(-1) to 10(-9)) using an uninfected sheep erythrocytes, and DNA was extracted from each diluted sample for testing the sensitivity of the PCR. The PCR was sensitive enough to detect parasite DNA from the dilution of 10(-5) with 0.00001% parasitemia. This is more sensitive than examining 200 fields under light microscopy. In addition, 98 field samples collected from small ruminanats in eastern Turkey were tested for B. ovis infection. Four samples were positive Babesia spp. in blood smears, 21 samples were positive for B. ovis DNA by PCR. These results indicate that the PCR provides a useful diagnostic tool for the detection of B. ovis infection in sheep and goats.

  1. Pumice stones as potential in-situ burning enhancer

    DEFF Research Database (Denmark)

    Rojas Alva, U.; Andersen, Bjørn Skjønning; Jomaas, Grunde

    2018-01-01

    Small-scale and mid-scale experiments were conducted in order to evaluate pumice stones as a potential enhancement for in-situ burning (ISB). Four oil types, several emulsification degrees of one crude oil were studied. In general, it was observed that the pumice stones did not improve the burning...... and after the burn, thus bringing the oil into the water column. Finally, the species production of CO and CO2 was not reduced. Based on the presented results, pumice stones have a negative impact on the efficiency of ISB, and they are ruled out as an ISB enhancer and should not be used in relation to ISB....

  2. Frozen yogurt from sheep milk

    Directory of Open Access Journals (Sweden)

    Elisangela de Abreu

    Full Text Available ABSTRACT The aim of this work was to develop frozen yogurt formulations from powdered yogurt of sheep milk, through an experimental design of 2², with a triplicate at the central point. The variables studied were emulsifier/stabilizer (0.50%, 0.75%, and 1.00% and powder for cream (2.75%, 3.00% and 3.25%. The parameters evaluated were sensory characteristics, texture, and microbiological counts. The results showed that the formulations had counts of S. aureus and fecal coliforms at 45 °C, lactic acid bacteria and Salmonella sp within the limits established by legislation. Instrumental analysis of texture-related parameters (firmness, cohesiveness, adhesiveness, and consistency of the formulations with different concentrations of emulsifier/stabilizer and cream powder showed no significant differences (p > 0.05. In sensory analysis, Formulations 3 and 4 with lower concentrations of emulsifier/stabilizer scored the highest values, thus indicating good acceptability.

  3. Dataset of milk whey proteins of three indigenous Greek sheep breeds

    Directory of Open Access Journals (Sweden)

    Athanasios K. Anagnostopoulos

    2016-09-01

    Full Text Available The importance and unique biological traits, as well as the growing financial value, of milk from small Greek ruminants is continuously attracting interest from both the scientific community and industry. In this regard the construction of a reference dataset of the milk of the Greek sheep breeds is of great interest. In order to obtain such a dataset we employed cutting-edge proteomics methodologies to investigate and characterize, the proteome of milk from the three indigenous Greek sheep breeds Mpoutsko, Karagouniko and Chios. In total, more than 1300 protein groups were identified in milk whey from these breeds, reporting for the first time the most detailed proteome dataset of this precious biological material. The present results are further discussed in the research paper “Milk of Greek sheep and goat breeds; characterization by means of proteomics” (Anagnostopoulos et al. 2016 [1].

  4. Prevalence of paratuberculosis in the dairy goat and dairy sheep industries in Ontario, Canada

    DEFF Research Database (Denmark)

    Bauman, Cathy A.; Jones-Bitton, Andria; Menzies, Paula

    2016-01-01

    A cross-sectional study was undertaken (October 2010 to August 2011) to estimate the prevalence of paratuberculosis in the small ruminant dairy industries in Ontario, Canada. Blood and feces were sampled from 580 goats and 397 sheep (lactating and 2 y of age or older) that were randomly selected...... from 29 randomly selected dairy goat herds and 21 convenience -selected dairy sheep flocks. Fecal samples were analyzed using bacterial culture (BD BACTEC MGIT 960) and polymerase chain reaction (Tetracore); serum samples were tested with the Prionics Parachek enzyme-linked immunosorbent assay (ELISA......). Using 3-test latent class Bayesian models, true farm-level prevalence was estimated to be 83.0% [95% probability interval (PI): 62.6% to 98.1%] for dairy goats and 66.8% (95% PI: 41.6% to 91.4%) for dairy sheep. The within-farm true prevalence for dairy goats was 35.2% (95% PI: 23.0% to 49...

  5. Healing efficacy of sea buckthorn (Hippophae rhamnoides L.) seed oil in an ovine burn wound model.

    Science.gov (United States)

    Ito, Hiroshi; Asmussen, Sven; Traber, Daniel L; Cox, Robert A; Hawkins, Hal K; Connelly, Rhykka; Traber, Lillian D; Walker, Timothy W; Malgerud, Erik; Sakurai, Hiroyuki; Enkhbaatar, Perenlei

    2014-05-01

    To investigate the efficacy of sea buckthorn (SBT) seed oil - a rich source of substances known to have anti-atherogenic and cardioprotective activity, and to promote skin and mucosa epithelization - on burn wound healing, five adult sheep were subjected to 3rd degree flame burns. Two burn sites were made on the dorsum of the sheep and the eschar was excised down to the fascia. Split-thickness skin grafts were harvested, meshed, and fitted to the wounds. The autograft was placed on the fascia and SBT seed oil was topically applied to one recipient and one donor site, respectively, with the remaining sites treated with vehicle. The wound blood flow (LASER Doppler), and epithelization (ultrasound) were determined at 6, 14, and 21 days after injury. 14 days after grafting, the percentage of epithelization in the treated sites was greater (95 ± 2.2% vs. 83 ± 2.9%, p<0.05) than in the untreated sites. Complete epithelization time was shorter in both treated recipient and donor sites (14.20 ± 0.48 vs. 19.60 ± 0.40 days, p<0.05 and 13.40 ± 1.02 vs. 19.60 ± 0.50 days, p<0.05, respectively) than in the untreated sites, confirmed by ultrasound. In conclusion, SBT seed oil has significant wound healing activity in full-thickness burns and split-thickness harvested wounds. Copyright © 2013 Elsevier Ltd and ISBI. All rights reserved.

  6. Peste des Petits Ruminants Virus Tissue Tropism and Pathogenesis in Sheep and Goats following Experimental Infection

    Science.gov (United States)

    Truong, Thang; Boshra, Hani; Embury-Hyatt, Carissa; Nfon, Charles; Gerdts, Volker; Tikoo, Suresh; Babiuk, Lorne A.; Kara, Pravesh; Chetty, Thireshni; Mather, Arshad; Wallace, David B.; Babiuk, Shawn

    2014-01-01

    Peste des petits ruminants (PPR) is a viral disease which primarily affects small ruminants, causing significant economic losses for the livestock industry in developing countries. It is endemic in Saharan and sub-Saharan Africa, the Middle East and the Indian sub-continent. The primary hosts for peste des petits ruminants virus (PPRV) are goats and sheep; however recent models studying the pathology, disease progression and viremia of PPRV have focused primarily on goat models. This study evaluates the tissue tropism and pathogenesis of PPR following experimental infection of sheep and goats using a quantitative time-course study. Upon infection with a virulent strain of PPRV, both sheep and goats developed clinical signs and lesions typical of PPR, although sheep displayed milder clinical disease compared to goats. Tissue tropism of PPRV was evaluated by real-time RT-PCR and immunohistochemistry. Lymph nodes, lymphoid tissue and digestive tract organs were the predominant sites of virus replication. The results presented in this study provide models for the comparative evaluation of PPRV pathogenesis and tissue tropism in both sheep and goats. These models are suitable for the establishment of experimental parameters necessary for the evaluation of vaccines, as well as further studies into PPRV-host interactions. PMID:24498032

  7. Epidural Analgesia in Sheep and Goats: A Review of Recent Literature

    Directory of Open Access Journals (Sweden)

    Zuhair Bani Ismail

    2016-11-01

    Full Text Available This study was carried out to review the current literature concerning recent advances in the techniques, drugs and drug combinations used to induce epidural analgesia in sheep and goats. Data bases such as PubMed, Scopus, Google Scholar were searched using key words such as small ruminant anesthesia, local anesthesia in ruminants, and epidural analgesia in sheep and goats to retrieve recently published articles in this subject. Only articles published between 2007 and 2016 were considered. Relevant references in the bibliographies of included articles were also retrieved for review. A total of 14 research papers (7 in sheep and 7 in goats published in refereed journals between 2007 and 2016 were reviewed. The lumbosacral space was used in 9 and the first intercoccygeal space was used in one article. The most common drugs used to induce epidural analgesia in sheep and goats were 2% lidocaine with and without epinephrine, bupivacaine, ropivacaine, magnesium sulphate, xylazine, ketamine, and tramadol, methadone, and morphine. The results of these studies indicated adequate analgesia for surgical operations of the perineum could be safely concluded in sheep and goats using any of the discussed drugs or their combinations.

  8. Effects of mulberry leaf flavonoid and resveratrol on methane emission and nutrient digestion in sheep

    Directory of Open Access Journals (Sweden)

    Dandan Chen

    2015-12-01

    Full Text Available As a new type of methane control agent, natural plant extract has been widely studied in recent years, but in vivo studies are few. This study was to investigate the effects of the dietary supplementation of 2 different polyphenols on the methane (CH4 emission and digestion metabolism in sheep. Ten healthy crossbred sheep (Dorper ♂ × small-tailed Han ♀; BW 60.0 ± 1.73 kg were used in a change-over design. The sheep were fed the following 3 diets in the present study: the basal diet (CON with no supplementation; the basal diet supplemented with 2 g mulberry leaf flavonoid (MLF per day per sheep; the basal diet supplemented with 0.25 g resveratrol (RES per day per sheep. Both MLF and RES reduced CH4 emission scaled to metabolic weight per kilogram of DMI and CO2 output scaled to metabolic weight, but the effect of RES was significant (P  0.05. In conclusion, MLF and RES can improve the digestibility of nutrients, the utilization of nutrients and energy, and reduce CH4 emission, but they are not conducive to nitrogen retention.

  9. Naturally occurring infections of cattle with Theileria lestoquardi and sheep with Theileria annulata in the Sudan.

    Science.gov (United States)

    Taha, K M; Salih, D A; Ali, A M; Omer, R A; El Hussein, A M

    2013-01-16

    Theileria annulata is endemic in northern Sudan, hindering all efforts at upgrading cattle for milk production. T. lestoquardi clinical cases occur throughout the year and causes annual outbreaks that result in substantial losses in sheep. In the northern Sudan both cattle and small ruminants are frequently raised together and/or share common grazing grounds at river banks. In an attempt to evaluate field cross infectivity of Theileria lestoquardi and T. annulata in cattle and sheep respectively, a PCR analysis was carried out on samples collected from closely reared sheep and cattle using both T. annulata and T. lestoquardi specific primers. A total of 19 sheep out of 51 (37.3%) were positive for T. lestoquardi while four sheep (7.8%) showed T. annulata specific amplicons. A total of 38 out of 52 (73.1%) surveyed cattle were PCR positive for T. annulata and only two (3.8%) showed T. lestoquardi specific bands. These findings indicate complex epidemiology of both infections in areas where both parasites are transmitted by the same vector and call for further investigations of this phenomenon. Copyright © 2012 Elsevier B.V. All rights reserved.

  10. Hyalomma impeltatum (Acari: Ixodidae) as a potential vector of malignant theileriosis in sheep in Saudi Arabia.

    Science.gov (United States)

    El-Azazy, O M; El-Metenawy, T M; Wassef, H Y

    2001-08-31

    Little is known about tick-borne diseases in Saudi Arabia, particularly regarding the prevalence of theileriosis in small ruminants. This survey studied the potential vectors of malignant theileriosis in Saudi Arabian sheep. Blood, lymph node and tick samples were collected from animals being treated or necropsied at the Veterinary Diagnostic Laboratory in Jeddah, Makkah (western region), and Bureida, Al-Qasim (central region). Blood and lymph node smears were prepared and examined for Theileria species. Theileria hirci (=T. lestoquardi) was found in lymph node smears of one out of 36 sheep (2.8%) in Jeddah and six of 25 sheep (24%) in Bureida. The erythrocytic forms were detected in 5-8% of RBCs. Ticks were found in relatively less number of sheep in Bureida and Jeddah, 17/180 and 26/125, respectively. All Theileria-infected sheep were infested with Hyalomma impeltatum except the one that carried Hyalomma anatolicum anatolicum. This suggests that H. impeltatum is a potential vector of malignant theileriosis in Saudi Arabia.

  11. Occurrence of four Anaplasma species with veterinary and public health significance in sheep, northwestern China.

    Science.gov (United States)

    Yang, Jifei; Han, Rong; Niu, Qingli; Liu, Zhijie; Guan, Guiquan; Liu, Guangyuan; Luo, Jianxun; Yin, Hong

    2017-10-12

    The members of the genus Anaplasma are important tick-borne rickettsial bacteria of veterinary and public health significance. Domestic ruminants are important reservoir hosts for several Anaplasma species. In this study, the occurrence of Anaplasma spp. was investigated by PCR in domestic small ruminants from Gansu, northwestern China. The results showed a high prevalence of Anaplasma spp. (46.2%, 201/435) in sheep. The average infection rates were 5.7%, 24.4%, 28.0% and 18.2% for A. ovis, A. bovis, A. phagocytophilum and A. capra, respectively. Coinfection of different Anaplasma species occurred in 96 (22.1%) sheep. The infections of Anaplasma species in sheep were confirmed by sequencing of msp4, 16S rRNA and gltA genes. Sequence analysis revealed a novel A. capra genotype in sheep that was distinct from the isolates identified from patients in northeastern China. This study gives the first insight of presence of four distinct Anaplasma species with veterinary and medical significance in sheep in northwestern China. Copyright © 2017. Published by Elsevier GmbH.

  12. Chemical Debridement of Burns

    Science.gov (United States)

    Levenson, Stanley M.; Kan, Dorinne; Gruber, Charles; Crowley, Leo V.; Lent, Richard; Watford, Alvin; Seifter, Eli

    1974-01-01

    The development of effective, non-toxic (local and systemic) methods for the rapid chemical (enzymatic and non-enzymatic) debridement of third degree burns would dramatically reduce the morbidity and mortality of severely burned patients. Sepsis is still the major cause of death of patients with extensive deep burns. The removal of the devitalized tissue, without damage to unburned skin or skin only partially injured by burning, and in ways which would permit immediate (or very prompt) skin grafting, would lessen substantially the problems of sepsis, speed convalescence and the return of these individuals to society as effective human beings, and would decrease deaths. The usefulness and limitations of surgical excision for patients with extensive third degree burns are discussed. Chemical debridement lends itself to complementary use with surgical excision and has the potential advantage over surgical excision in not requiring anesthesia or a formal surgical operation. The authors' work with the chemical debridement of burns, in particular the use of Bromelain, indicates that this approach will likely achieve clinical usefulness. The experimental studies indicate that rapid controlled debridement, with minimal local and systemic toxicity, is possible, and that effective chemotherapeutic agents may be combined with the Bromelain without either interfering with the actions of the other. The authors believe that rapid (hours) debridement accomplished by the combined use of chemical debriding and chemotherapeutic agents will obviate the possibility of any increase in infection, caused by the use of chemical agents for debridement, as reported for Paraenzyme21 and Travase.39,48 It is possible that the short term use of systemic antibiotics begun just before and continued during, and for a short time after, the rapid chemical debridement may prove useful for the prevention of infection, as appears to be the case for abdominal operations of the clean-contaminated and

  13. Haemoglobinuria caused by propylene glycol in sheep

    Science.gov (United States)

    Potter, B. J.

    1958-01-01

    Haemoglobinuria occurred in sheep anaesthetized by an intravenous injection of pentobarbitone sodium containing propylene glycol: an equivalent dose failed to cause haemoglobinuria in rabbits. Intravenous injection of an aqueous solution of 20% propylene glycol caused haemoglobinaemia and haemoglobinuria in sheep. Neither distilled water nor 20% glycerol in water administered under identical conditions produced these effects. Haemoglobinuria occurred on some occasions when an aqueous 20% solution of propylene glycol was administered to sheep after an injection of saline: it never occurred when a solution of 20% propylene glycol prepared with physiological saline was injected. It is suggested that saline may protect against the haemolytic action of propylene glycol in sheep and that propylene glycol should be avoided as a menstruum for pharmaceutical preparations to be used for injection into the blood stream of these animals. PMID:13618540

  14. Selective breeding for scrapie resistance in sheep

    Directory of Open Access Journals (Sweden)

    Cristina Santos Sotomaior

    2012-11-01

    Full Text Available It is well known that the susceptibility of sheep to scrapie is determined by the host’s prion protein gene (PRNP. PRNP polymorphisms at codons 136 (alanine, A/valine, V, 154 (histidine, H/arginine, R and 171 (glutamine, Q/histidine, H/arginine, R are the main determinants of sheep susceptibility/resistance to classical scrapie. There are four major variants of the wild-type ARQ allele: VRQ, AHQ, ARH and ARR. Breeding programs have been developed in the European Union and the USA to increase the frequency of the resistant ARR allele while decreasing the frequency of the susceptible VRQ allele in sheep populations. In Brazil, little PRNP genotyping data are available for sheep, and thus far, no controlled breeding scheme for scrapie has been implemented. This review will focus on important epidemiological aspects of scrapie and the use of genetic resistance as a tool in breeding programs to control the disease.

  15. Epidermal growth factor causes hypocalcemia in sheep.

    Science.gov (United States)

    Moore, G P; Wilkinson, M; Panaretto, B A; Delbridge, L W; Posen, S

    1986-04-01

    During iv infusions of epidermal growth factor into sheep, serum calcium concentrations fell, whereas serum magnesium and serum immunoreactive PTH levels increased. Urinary calcium and magnesium decreased significantly. The role of epidermal growth factor in calcium homeostasis is discussed.

  16. [Incidence of Mycoplasma ovipneumoniae in sheep].

    Science.gov (United States)

    Stipkovits, L; Schimmel, D

    1977-01-01

    Out a total number of 19 mycoplasma strain from diseased sheeps, 5 strains were used for further investigations. The 5 strains were differentiated as Mycoplasma ovipneumoniae. The relation between mycoplasma findings and the disease is discussed.

  17. Fluid replacement in burned patients.

    Science.gov (United States)

    Bortolani, A; Governa, M; Barisoni, D

    1996-01-01

    Burn injury involves a large amount of water, electrolytes and proteins loss trough the burn wound. For this reason, to avoid shock, a wide infusion of fluid is necessary in the first hours after trauma. Many reanimation formulas were proposed in the past years, with different composition: saline, colloids, plasma. The authors have studied 40 burned patients admitted in Verona Burn Center within 4 hours after burn, with burns over 30% of the body surface area. Twenty of them were treated with Baxter reanimation formula (ringer lactated saline, RLS) while the others with Monafo hypertonic lactated saline (HLS), modified by Milan Burn Center. The two randomized groups were assessed and compared. In RLS group total fluid volume infused was higher while sodium requirements was lower than in HLS patients, with statistically significative difference (p electrolytes balance with lower fluid load, reducing tissue oedema and complication rate. Mortality rate was higher in HLS, may be for an higher Roy index in this group.

  18. Laryngeal Chondritis in Sheep in Iceland.

    Science.gov (United States)

    Sigurðardóttir, Ó G; Jörundsson, E; Friðriksdóttir, V

    2016-11-01

    Laryngeal chondritis is a chronic disease in sheep with low morbidity, high mortality and unresolved pathogenesis. The disease has been recognized recently in Iceland and affects both ewes and rams. Animals of different ages are affected, but lambs and yearlings predominate. The disease is seen in housed animals and most cases occur during the late winter months. We report the gross and microscopical findings in 45 cases of laryngeal chondritis in Icelandic sheep. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Experimental bluetongue virus infection of sheep; effect of vaccination: pathologic, immunofluorescent, and ultrastructural studies.

    Science.gov (United States)

    Mahrt, C R; Osburn, B I

    1986-06-01

    Ten sheep were inoculated with bluetongue virus (BTV) serotype 17. Six of the sheep had been vaccinated before challenge exposure, 4 sheep served as nonvaccinated challenge-exposed controls, and 2 additional sheep served as nonvaccinated, nonchallenge-exposed, contact controls. Biopsy specimens (oral labial mucosa and skin) were obtained periodically after challenge exposure. Sheep were killed 8 to 13 days after challenge exposure, and necropsy was done. Vaccination did not seem to affect the nature or severity of the lesions observed. The changes in the mucosa of the cranial portion of the digestive tract included hyperemia, edema, inflammation, petechiae, erosions, ulcers, and surface encrustations. Lesions of skeletal, cardiac, and smooth muscles included hemorrhage, edema, myofiber degeneration, and necrosis. Lesions in cardiac muscles were sometimes widespread, indicating that cardiac failure may have been the major contributor to pulmonary congestion, edema, and eventual death during acute BTV infection. Damage to esophageal musculature resulted in vomiting. Hemorrhage was observed within the base of the pulmonary artery of all challenge-exposed sheep. Using immunofluorescence, bluetongue viral antigens were detected in small blood vessels of the skin, oral labial mucosa, tongue, esophagus, rumen, reticulum, urinary bladder, and pulmonary artery and in skeletal and cardiac muscles. Viral antigens were present in tissues obtained 3 to 11 days after inoculation. Ultrastructurally, changes in small-caliber blood vessels included congestion, hemorrhage, swollen degenerated endothelial cells, and occasional fibrin-platelet thrombi. Tubular structures and virus-like particles were observed within some of these endothelial cells.(ABSTRACT TRUNCATED AT 250 WORDS)

  20. Sudanese live sheep and mutton exports competitiveness

    Directory of Open Access Journals (Sweden)

    Babiker Idris Babiker

    2011-01-01

    Full Text Available The livestock sector of Sudan provides livelihood for about 17% of the population. Sudanese livestock products meet the domestic demand for meat in addition to a substantial excess for export amounting to about 22% of total country exports. It contributes about 19% of GDP. Sheep marketing in Sudan is characterised by traditional operations and is informally organised, although, recently there are great efforts by the formal livestock authorities to organise some secondary and terminal livestock markets. These markets are deficient in basic infrastructures and systematic marketing research. The system as a whole is faced by various complex obstacles and constraints, which decrease the contribution of livestock in general, and sheep in particular, to the national economy, and suppress the optimum exploitation of this resource. These obstacles are represented in the lack of transportation networks that connect the production and consumption centres to break the seasonality of supply that creates shortages and high prices at the consumption centres. This paper employs the policy analysis matrix (PAM technique to examine the Sudanese live sheep and mutton competitiveness in the international market. The results indicated that the market price was greater than the border price implying a positive incentive as an implicit subsidy to the live sheep exporter. The mutton exporters were found subsidised as well. The international value added (IVA indicted a positive foreign exchange earnings or savings. Exported live sheep and mutton coefficient of competitiveness (CIC implied that sheep and mutton exports are profitable and internationally competitive.

  1. Burn Wound Infection

    Science.gov (United States)

    1981-09-01

    generalized. Clinically, the like- controlled Pseudomonas burn wound infection in most lihood of septicemia appears to increase as the area of patients (2,4...31 patients, dida, Coccidiodes, Phycomyces, and Rhizopus . In 69 of pneumonia was the primary septic process in 27 (20 of these 75 patients (92%), the...carried out as described above and appropriate systemic anti- to which the invading organisms were sensitive and fungal agents are employed to control

  2. Fungal Burn Wound Infection

    Science.gov (United States)

    1991-01-01

    Aspergillus), Blasto- T he use of effective topical chemotherapeutic agents to myces (Candida), and Zygomycetes (Mucor, Rhizopus ).6 reduce...below the infected burn wound . If the infection was controlled by these measures and the patient’s condition permit- ted, the involved area was...species, 18%; Mucor species and Rhizopus species, acetate in the morning and silver sulfadiazine in the evening. Prophy- 9.1%; and Microspora species and

  3. Scaling of the burning efficiency for multicomponent fuel pool fires

    DEFF Research Database (Denmark)

    van Gelderen, Laurens; Farahani, Hamed Farmahini; Rangwala, Ali S.

    must continuously increase to evaporate the heaviest components. Small scale experiments were deemed to lack a sufficient flame volume and resulting heat feedback to the fuel surface to reach such temperatures, thus explaining the lower burning efficiencies. Small scale experiments featuring...... an external heat source to simulate the larger fire size are currently in process....

  4. Antiseptics for burns.

    Science.gov (United States)

    Norman, Gill; Christie, Janice; Liu, Zhenmi; Westby, Maggie J; Jefferies, Jayne M; Hudson, Thomas; Edwards, Jacky; Mohapatra, Devi Prasad; Hassan, Ibrahim A; Dumville, Jo C

    2017-07-12

    Burn wounds cause high levels of morbidity and mortality worldwide. People with burns are particularly vulnerable to infections; over 75% of all burn deaths (after initial resuscitation) result from infection. Antiseptics are topical agents that act to prevent growth of micro-organisms. A wide range are used with the intention of preventing infection and promoting healing of burn wounds. To assess the effects and safety of antiseptics for the treatment of burns in any care setting. In September 2016 we searched the Cochrane Wounds Specialised Register, the Cochrane Central Register of Controlled Trials (CENTRAL), Ovid MEDLINE, Ovid MEDLINE (In-Process & Other Non-Indexed Citations), Ovid Embase, and EBSCO CINAHL. We also searched three clinical trials registries and references of included studies and relevant systematic reviews. There were no restrictions based on language, date of publication or study setting. We included randomised controlled trials (RCTs) that enrolled people with any burn wound and assessed the use of a topical treatment with antiseptic properties. Two review authors independently performed study selection, risk of bias assessment and data extraction. We included 56 RCTs with 5807 randomised participants. Almost all trials had poorly reported methodology, meaning that it is unclear whether they were at high risk of bias. In many cases the primary review outcomes, wound healing and infection, were not reported, or were reported incompletely.Most trials enrolled people with recent burns, described as second-degree and less than 40% of total body surface area; most participants were adults. Antiseptic agents assessed were: silver-based, honey, Aloe Vera, iodine-based, chlorhexidine or polyhexanide (biguanides), sodium hypochlorite, merbromin, ethacridine lactate, cerium nitrate and Arnebia euchroma. Most studies compared antiseptic with a topical antibiotic, primarily silver sulfadiazine (SSD); others compared antiseptic with a non

  5. Ocular burns in eye traumatology emphatically on chemical burns

    OpenAIRE

    Farský, Lukáš

    2008-01-01

    Burns to the sclera, conjunctiva, cornea, and eyelid are considered ocular burns. Ocular burn injuries are classified by etiologic agents as either chemical injuries (ie, acid, alkali) or radiant energy injuries (ie, thermal, ultraviolet). Chemical injuries to the eye represent one of the true ophthalmic emergencies. While almost any chemical can cause ocular irritation, serious damage generally results from either strongly basic (alkaline) compounds or acidic compounds. Alkali injuries are m...

  6. Burn Burn Burn - er du skræmt? - en analyse af Kræftens Bekæmpelses kampagnefilm Burn Burn Burn

    OpenAIRE

    Knigge Kæstel-Hansen, Camilla; Wittrup Stæger, Cæcilie

    2015-01-01

    This project examines how to organize a health campaign to a specific target audience of 15-25 year olds. This audience very quickly filters out information they find irrelevant, and quickly moves on to new things. Thereby, this audience has high demands regarding health campaigns and their relevance. Conclusions will be based on Danish organization Kræftens Bekæmpelse’s campaign film Burn Burn Burn. The film target audience are youths aged 15- 25, and the film’s message is, that the use of t...

  7. The use of venovenous extracorporeal membrane oxygenation in sheep receiving severe smoke inhalation injury.

    Science.gov (United States)

    Brown, M; Traber, D L; Herndon, D N; Oldham, K T; Traber, L D

    1987-02-01

    Smoke inhalation injury now represents the most frequent cause of death in burn patients, and accounts for 20-80 per cent of overall mortality. We have studied the use of extracorporeal membrane oxygenation (ECMO) to support sheep which have received lethal pulmonary smoke damage. The animals (n = 19) received inhalation injury induced by insufflation with smoke derived from burning cotton delivered with a bee smoker. The treatment group, those placed on ECMO at the time of injury (n=6), were systemically heparinized and placed on a venovenous perfusion circuit consisting of a roller pump, membrane oxygenator and heat exchanger. Blood flow rate in the circuit approximated 20-25 per cent of cardiac output. The animals remained on partial venovenous bypass until the termination of the experiment 96 h after injury. All animals in the treatment group survived. The control sheep (n = 7) received inhalation injury alone and had a 100 per cent mortality (P = 0.0015 ECMO vs. control). Ventilatory management of treatment and control groups followed an identical protocol. We have also studied a third group (n = 6) composed of animals receiving inhalation injury with systemic heparinization but not ECMO. This group had a 66 per cent mortality at 96 h. These studies suggest that partial venovenous ECMO may be a valuable form of adjunctive treatment in severe inhalation injury.

  8. Burns, biofilm and a new appraisal of burn wound sepsis.

    Science.gov (United States)

    Kennedy, Peter; Brammah, Susan; Wills, Edward

    2010-02-01

    Following a burn, the wound may become colonized and septic complications may ensue. Many organisms, commonly isolated from burn wounds produce biofilms, which are defined as a collection of organisms on a surface surrounded by a matrix. Biofilms are associated with development of antibiotic resistant organisms and are refractory to the immune system. The presence of biofilm in the burn wound has not been documented. A study was undertaken using light and electron microscopy to determine the presence of biofilm in the burn wound. Specific stains were used to detect the presence of micro-organisms and associated carbohydrate, a major constituent of the biofilm matrix. A concurrent microbiological study of the burn wound was also carried out. Biofilm was detected in ulcerated areas of the burn wound. Bacterial wound invasion with mixed organisms was also commonly detected. The finding of biofilm in the burn wound has significance in our understanding of burn wound sepsis and supports the evidence for early excision and closure of the burn wound. Due to the recalcitrant nature of biofilm associated sepsis and the difficulty in disrupting biofilm it has implications for the future development of wound care dressings. Copyright (c) 2009 Elsevier Ltd and ISBI. All rights reserved.

  9. Methoxyphenols in smoke from biomass burning

    Energy Technology Data Exchange (ETDEWEB)

    Kjaellstrand, J.

    2000-07-01

    Wood and other forest plant materials were burned in laboratory experiments with the ambition to simulate the natural burning course in a fireplace or a forest fire. Smoke samples were taken and analysed with respect to methoxyphenols, using gas chromatography and mass spectrometry. Different kinds of bio pellets, intended for residential heating were studied in the same way. The aim of a first study was to establish analytical data to facilitate further research. Thirty-six specific methoxyphenols were identified, and gas chromatographic retention and mass spectrometric data were determined for these. In a subsequent study, the methoxyphenol emissions from the burning of wood and other forest plant materials were investigated. Proportions and concentrations of specific methoxyphenols were determined. Methoxyphenols and anhydrosugars, formed from the decomposition of lignin and cellulose respectively, were the most prominent semi-volatile compounds in the biomass smoke. The methoxyphenol compositions reflected the lignin structures of different plant materials. Softwood smoke contained almost only 2-methoxyphenols, while hardwood smoke contained both 2-methoxyphenols and 2,6-dimethoxyphenols. The methoxyphenols in smoke from pellets, made of sawdust, bark and lignin, reflected the source of biomass. Although smoke from incompletely burned wood contains mainly methoxyphenols and anhydrosugars, there is also a smaller amount of well-known hazardous compounds present. The methoxyphenols are antioxidants. They appear mainly condensed on particles and are presumed to be inhaled together with other smoke components. As antioxidants, phenols interrupt free radical chain reactions and possibly counteract the effect of hazardous smoke components. Health hazards of small-scale wood burning should be re-evaluated considering antioxidant effects of the methoxyphenols.

  10. A Study on Genes of Bayanbulak Sheep

    Directory of Open Access Journals (Sweden)

    Beiyao Zuo

    2013-01-01

    Full Text Available The average twin lambing rate of Bayanbulak sheep is 2% to 3%. However, a flock of sheep with a close genetic relationship and an average of 2 to 3 lambs per birth has been found recently. To determine the major genes controlling the prolificacy of the flock in the present study, the flock was designated A while 100 normal Bayanbulak sheep were randomly selected to comprise the control flock B. Ligase detection reaction method was applied to detect and analyze the 10 mutational loci of the 3 candidate prolificacy genes including bone morphogenetic protein type I receptors, bone morphogenetic protein 15, and growth differentiation factor 9. The 10 mutational loci are as follows: FecB locus of the BMPR-IB gene; FecXI, FecXB, FecXL, FecXH, FecXG, and FecXR of the BMP15 gene; and G1, G8, and FecTT of the GDF9 gene. Two mutations including BMPR-IB/FecB and GDF9/G1 were found in Bayanbulak sheep. Independence test results of the two flocks demonstrate that the FecB locus has a significant effect on the lambing number of Bayanbulak sheep. However, the mutation frequency of the G1 locus in GDF9 is very low. Independence test results demonstrate that the GDF9 locus does not have a significant impact on the lambing performance of Bayanbulak sheep. Among the 10 detected loci, BMPR-IB/FecB is the major gene that influences the high lambing rate of Bayanbulak sheep.

  11. Electrical burns in sports fishing: a case report.

    Science.gov (United States)

    Valença-Filipe, R; Egipto, P; Horta, R; Braga, J M; Costa, J; Silva, A

    2014-11-01

    Electrical burns are among the most devastating types of burns, with wide-ranging injuries. They can sometimes occur in the context of fishing, usually involving high voltages. The authors present the case of a 59-year-old-man who suffered a sports accident during a fishing competition, with the formation of an electrical arc due to proximity of the fishing rod and high voltage cables. He presented burns affecting 3% of TBSA, third degree deep burns on trunk and left hand; no signs of cardiac injury. He was admitted to our Burn Unit for monitoring, care dressing and surgical treatment; complete wound healing was achieved after 24 days. Due to its relatively small share among burns, published data on electrical injuries and fishing remain scarce, and differ in patient collectives due to infrastructural or environmental differences. The authors are not aware of published specific reports on electrical burns in sports fishing practice, like the case here presented. The authors want to alert for potential medical, social and economic consequences of this type of sports accidents that could be entirely avoidable with some preventive measures. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  12. [The organization of burn care].

    Science.gov (United States)

    Latarjet, Jacques

    2002-12-15

    In 2002, the organisation of burn care is confronted to a great deficiency in burn epidemiological datas. The main mechanisms of hospitalized burns are somehow wellknown in industrialized countries: about 60% scalds and 30% flame burns; as well as the place of occurrence (60% at home, and 20% at work), and the risk groups (3 times more important for the age group 0-4 years old). The incidence of burns needing medical care (all levels) (250/100,000 inh/yr) or hospitalization (15-20/100,000 inh/yr) is much more uncertain. The statistics of Diagnosis Related Groups (DRG), for hospitalized patients will allow in France very shortly to know more about the most rational ways of dispatching and treating them. They already show that only 30% of hospitalized burned patients are treated in specialized facilities.

  13. [Epidemiological investigation on 2 133 hospitalized patients with electrical burns].

    Science.gov (United States)

    Jiang, M J; Li, Z; Xie, W G

    2017-12-20

    relatively higher, which were 18.3% (391/2 133), 22.1% (471/2 133), and 24.6% (525/2 133), respectively. The first three social category groups in proportions were workers, peasants, and preschool children, which were 57.9% (1 235/2 133), 14.6% (311/2 133), and 6.0% (128/2 133), respectively. Among the electrical burn patients with known seasons of injury, most cases were injured in summer (659 cases, accounting for 34.1%), obviously more than the proportions in autumn (537 cases, accounting for 27.8%), spring (455 cases, accounting for 23.5%), and winter (283 cases, accounting for 14.6%), with χ(2) values from 8.414 to 149.573, P values below 0.01. The group of patients with total burn areas less than 10% total body surface area (TBSA) occupied the highest proportion (1 603 cases, accounting for 75.15%), among whom 229 (10.74%) were with scattered small wounds which were less than 1% TBSA. The percentage of electrical contact burn patients with deep wounds was 79.1% (1 122/1 418), which was obviously higher than 2.5% (18/715) of the electrical arc burn patients (χ(2)=381.741, Paccounted for 78.4% (469/598), which was obviously higher than 8.7% (11/127) of the electrical arc burn patients (χ(2)=227.893, Paccounting for 63.2%), followed by lower limbs (382 cases, accounting for 14.6%), head and neck (292 cases, accounting for 11.2%), trunk (247 cases, accounting for 9.5%), and hip and perineum (40 cases, accounting for 1.5%). The operation rate of electrical burn patients was 32.4% (691/2 133), obviously higher than 19.1% (3 860/20 209)of the thermal burn patients during the same period (χ(2)=210.255, P<0.001). Wounds of 116 electrical contact burn patients were repaired with free flap by vascular anastomosis, of which 9 (7.8%) failed. The length of hospital stay, the operation cost, and the hospitalization cost of electrical burn patients were (28±29) d, (9 534±16 935) and (44 258±93 012) Yuan, respectively, obviously longer or higher than those of the thermal burn

  14. Generation of crystalline silica from sugarcane burning.

    Science.gov (United States)

    Le Blond, Jennifer S; Horwell, Claire J; Williamson, Ben J; Oppenheimer, Clive

    2010-07-08

    Sugarcane leaves contain amorphous silica, which may crystallise to form crystalline silica polymorphs (cristobalite or quartz), during commercial sugarcane harvesting where sugarcane plants are burned. Respirable airborne particulate containing these phases may present an occupational health hazard. Following from an earlier pilot study (J. S. Le Blond, B. J. Williamson, C. J. Horwell, A. K. Monro, C. A. Kirk and C. Oppenheimer, Atmos. Environ., 2008, 42, 5558-5565) in which experimental burning of sugarcane leaves yielded crystalline silica, here we report on actual conditions during sugarcane burning on commercial estates, investigate the physico-chemical properties of the cultivated leaves and ash products, and quantify the presence of crystalline silica. Commercially grown raw sugarcane leaf was found to contain up to 1.8 wt% silica, mostly in the form of amorphous silica bodies (with trace impurities e.g., Al, Na, Mg), with only a small amount of quartz. Thermal images taken during several pre-harvest burns recorded temperatures up to 1056 degrees C, which is sufficient for metastable cristobalite formation. No crystalline silica was detected in airborne particulate from pre-harvest burning, collected using a cascade impactor. The sugarcane trash ash formed after pre-harvest burning contained between 10 and 25 wt% SiO(2), mostly in an amorphous form, but with up to 3.5 wt% quartz. Both quartz and cristobalite were identified in the sugarcane bagasse ash (5-15 wt% and 1-3 wt%, respectively) formed in the processing factory. Electron microprobe analysis showed trace impurities of Mg, Al and Fe in the silica particles in the ash. The absence of crystalline silica in the airborne emissions and lack of cristobalite in trash ash suggest that high temperatures during pre-harvest burning were not sustained long enough for cristobalite to form, which is supported by the presence of low temperature sylvite and calcite in the residual ash. The occurrence of quartz and

  15. Detection of a new 20-bp insertion/deletion (indel) within sheep PRND gene using mathematical expectation (ME) method.

    Science.gov (United States)

    Li, Jie; Zhu, Xichun; Ma, Lin; Xu, Hongwei; Cao, Xin; Luo, Renyun; Chen, Hong; Sun, Xiuzhu; Cai, Yong; Lan, Xianyong

    2017-03-04

    Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.

  16. Haplogroup relationships between domestic and wild sheep resolved using a mitogenome panel

    Science.gov (United States)

    Meadows, J R S; Hiendleder, S; Kijas, J W

    2011-01-01

    Five haplogroups have been identified in domestic sheep through global surveys of mitochondrial (mt) sequence variation, however these group classifications are often based on small fragments of the complete mtDNA sequence; partial control region or the cytochrome B gene. This study presents the complete mitogenome from representatives of each haplogroup identified in domestic sheep, plus a sample of their wild relatives. Comparison of the sequence successfully resolved the relationships between each haplogroup and provided insight into the relationship with wild sheep. The five haplogroups were characterised as branching independently, a radiation that shared a common ancestor 920 000±190 000 years ago based on protein coding sequence. The utility of various mtDNA components to inform the true relationship between sheep was also examined with Bayesian, maximum likelihood and partitioned Bremmer support analyses. The control region was found to be the mtDNA component, which contributed the highest amount of support to the tree generated using the complete data set. This study provides the nucleus of a mtDNA mitogenome panel, which can be used to assess additional mitogenomes and serve as a reference set to evaluate small fragments of the mtDNA. PMID:20940734

  17. The labeling of pulmonary surfactant phosphatidylcholine in newborn and adult sheep

    Energy Technology Data Exchange (ETDEWEB)

    Ikegami, M.; Jobe, A.; Nathanielsz, P.W.

    1981-08-01

    The labeling of the saturated phosphatidylcholine from surfactant with radiolabeled palmitic acid was characterized in seven newborn and seven adult sheep using a repetitive sampling technique. Each animal had a small cannula placed surgically in the trachea. Following the intravenous injection of (3H) palmitic acid, surfactant samples in saline were recovered from the distal airways of each animal with fine plastic catheters over a period of 10 days. The change in specific activity of the saturated phosphatidylcholine (cpm/mumol) was used to define the kinetics of secretion and then disappearance of the labeled saturated phosphatidylcholine. Labeled saturated phosphatidylcholine accumulated in a linear fashion without an apparent initial delay for 27 hr in adult and 44 hr in newborn sheep. The labeled saturated phosphatidylcholine then decayed with mean apparent biological half-life values of 45 hr and 54 hr in adult and newborn sheep, respectively. However, these half-life estimates are compromised by the long secretory phase of the labeling curves. The characteristics of the labeling of surfactant saturated phosphatidylcholine in sheep may be more representative of surfactant metabolism in large mammals than previous studies in small rodents.

  18. Perceived fatigue following pediatric burns.

    Science.gov (United States)

    Akkerman, Moniek; Mouton, Leonora J; Dijkstra, Froukje; Niemeijer, Anuschka S; van Brussel, Marco; van der Woude, Lucas H V; Disseldorp, Laurien M; Nieuwenhuis, Marianne K

    2017-12-01

    Fatigue is a common consequence of numerous pediatric health conditions. In adult burn survivors, fatigue was found to be a major problem. The current cross-sectional study is aimed at determining the levels of perceived fatigue in pediatric burn survivors. Perceived fatigue was assessed in 23 children and adolescents (15 boys and 8 girls, aged 6-18 years, with burns covering 10-46% of the total body surface area, 1-5 years post burn) using both child self- and parent proxy reports of the Pediatric Quality of Life Inventory Multidimensional Fatigue Scale. Outcomes were compared with reference values of non-burned peers. At group level, pediatric burn survivors did not report significantly more symptoms of fatigue than their non-burned peers. Individual assessments showed, however, that four children experienced substantial symptoms of fatigue according to the child self-reports, compared to ten children according to the parent proxy reports. Furthermore, parents reported significantly more symptoms of fatigue than the children themselves. Age, gender, extent of burn, length of hospital stay, and number of surgeries could not predict the level of perceived fatigue post-burn. Our results suggest that fatigue is prevalent in at least part of the pediatric burn population after 1-5 years. However, the fact that parents reported significantly more symptoms of fatigue then the children themselves, hampers evident conclusions. It is essential for clinicians and therapists to consider both perspectives when evaluating pediatric fatigue after burn and to determine who needs special attention, the pediatric burn patient or its parent. Copyright © 2017 Elsevier Ltd and ISBI. All rights reserved.

  19. [Epidemiology of burns in France].

    Science.gov (United States)

    Latarjet, Jacques; Ravat, François

    2012-01-01

    As with most traumas, the epidemiology of the "burn" health-event has long been neglected by public health doctors and rarely considered by burns specialists. There were therefore few verified data and many approximations and preconceived ideas. The gathering of information recently undertaken in France enables the reliability of the data to be improved and the diagnostic and demographic elements relating to hospitalised patients with burns to be established.

  20. Sheep and Fasciola hepatica in Europe: the GLOWORM experience

    Directory of Open Access Journals (Sweden)

    Laura Rinaldi

    2015-03-01

    Full Text Available Fasciola hepatica infection challenges health, welfare and productivity of small ruminants throughout the world. The distribution of F. hepatica in sheep in Europe is usually scattered and studies are generally concerned with a single area making it difficult to compare results from different environments, climates and management regimes. In order to elucidate the current scenario in terms of prevalence and intensity of F. hepatica infection in sheep farms across Europe, a standardized cross-sectional survey was conducted in three pilot areas in Ireland, Switzerland and Italy, all part of the EU funded GLOWORM project. Two consecutive field surveys (in 2012 and 2013 were conducted in the three countries in the same period (August-October in 361 sheep farms in total. Harmonized procedures (from farm to laboratory based on pooled samples and the highly sensitive and accurate, diagnostic FLOTAC technique were used. The georeferenced parasitological results were modelled (at the pilot area level following a Bayesian geostatistical approach with correction for preferential sampling and accounting for climatic and environmental covariates. The observed F. hepatica prevalence rates did not differ between the two study years in any of the three pilot areas, but they did vary between the countries showing high values in Ireland (61.6% compared to Italy (7.9% and Switzerland (4.0%. Spatial patterns of F. hepatica distribution were detected by the Bayesian geostatistical approach in Ireland with a high risk of infection in the south-western part of the pilot area there. The latent factor analysis highlighted the importance of year-to-year variation of mean temperature, rainfall and seasonality within a country, while long-term trends of temperature and rainfall dominated between countries with respect to prevalence of infection.

  1. Anthelmintic activity of Cocos nucifera L. against sheep gastrointestinal nematodes.

    Science.gov (United States)

    Oliveira, L M B; Bevilaqua, C M L; Costa, C T C; Macedo, I T F; Barros, R S; Rodrigues, A C M; Camurça-Vasconcelos, A L F; Morais, S M; Lima, Y C; Vieira, L S; Navarro, A M C

    2009-01-22

    The development of anthelmintic resistance has made the search for alternatives to control gastrointestinal nematodes of small ruminants imperative. Among these alternatives are several medicinal plants traditionally used as anthelmintics. This work evaluated the efficacy of Cocos nucifera fruit on sheep gastrointestinal parasites. The ethyl acetate extract obtained from the liquid of green coconut husk fiber (LGCHF) was submitted to in vitro and in vivo tests. The in vitro assay was based on egg hatching (EHT) and larval development tests (LDT) with Haemonchus contortus. The concentrations tested in the EHT were 0.31, 0.62, 1.25, 2.5 and 5 mg ml(-1), while in the LDT they were 5, 10, 20, 40 and 80 mg ml(-1). The in vivo assay was a controlled test. In this experiment, 18 sheep infected with gastrointestinal nematodes were divided into three groups (n=6), with the following doses administered: G1-400 mg kg(-1) LGCHF ethyl acetate extract, G2-0.2 mg kg(-1) moxidectin (Cydectin) and G3-3% DMSO. The worm burden was analyzed. The results of the in vitro and in vivo tests were submitted to ANOVA and analyzed by the Tukey and Kruskal-Wallis tests, respectively. The extract efficacy in the EHT and LDT, at the highest concentrations tested, was 100% on egg hatching and 99.77% on larval development. The parameters evaluated in the controlled test were not statistically different, showing that despite the significant results of the in vitro tests, the LGCHF ethyl acetate extract showed no activity against sheep gastrointestinal nematodes.

  2. Reliability of quantitative echocardiography in adult sheep and goats

    Directory of Open Access Journals (Sweden)

    Hallowell Gayle D

    2012-09-01

    Full Text Available Abstract Background Echocardiography is a non-invasive method for assessment of the ovine and caprine heart. Complete reference ranges for cardiac dimensions and time indices for both species are not currently available and reliability of these measurements has not been evaluated. The objectives for this study are to report reliability, normal cardiac dimensions and time indices in a large group of adult sheep and goats. Fifty-one adult sheep and forty adult goats were recruited. Full echocardiographic examinations were performed in the standing unsedated animal. All animals underwent echocardiography four times in a 72-hour period. Echocardiography was performed three times by one author and once by another. Images were stored and measured offline. Technique and measurement repeatability and reproducibility and any differences due to animal or day were evaluated. Reference ranges (mean ± 2 standard deviations were calculated for both species. Results Majority of the images obtained were of good to excellent quality. Image acquisition was straightforward with 5.4% of animals demonstrating a small scanning window. Reliability was excellent for majority of dimensions and time indices. There was less variation in repeatability when compared with reproducibility and differences were greater for technique than for measurements. Dimensions that were less reliable included those for right ventricular diameter and left ventricular free wall. There were many differences in cardiac dimensions between sheep and goats. Conclusions This study has demonstrated that specific reference ranges are required for these two species. Repeatability and reproducibility were excellent for the majority of cardiac dimensions and time indices suggesting that this technique is reliable and valuable for examination of clinical cases over time and for longitudinal research studies.

  3. Cerebral astrocytoma in a sheep

    Science.gov (United States)

    Farjanikish, Ghasem; Khodakaram-Tafti, Azizollah; Dezfoulian, Omid

    2017-01-01

    Astrocytoma as one of the most common central nervous system (CNS) tumors is rarely reported in veterinary literature. A 7-year-old Persian Lori-Bakhtiari ewe was presented to the clinic with a two months history of progressive blindness, nystagmus to the right, bilaterally decreased pupillary reflexes, head pressing and paddling. At necropsy, a whitish well-circumscribed mass with dimensions of 3.50×2.50×1.50 cm was observed in the dorsal parietal lobe of the left cerebral hemisphere. Microscopically, the mass was well-circumscribed and highly cellular, consisted of round to elongated cells with scant and vacuolated cytoplasm with few, flaccid processes. The nuclei were round to oval with densely stippled chromatin and indistinct nucleoli. Immunohistochemical analyses showed positive staining for vimentin, S100 and glial fibrillary acidic protein. Definitive diagnosis of cerebral protoplasmic astrocytoma was made on the basis of the histopathological and immunohistochemical findings. This type of neoplasm should be included in the differential diagnosis of CNS lesions in the sheep. PMID:29085617

  4. Kenya cardinal burns condoms.

    Science.gov (United States)

    1996-09-09

    Kenya's top Roman Catholic church official burned condoms and safe sex literature in a ceremony organized by a group opposed to contraception and sex education. About 250 people watched as Cardinal Maurice Otunga and two gynecologists prayed and sang before setting fire to several boxes of condoms and 100 copies of pamphlets promoting safe sex. The pamphlets encouraged condom use to fight the spread of HIV. The World Health Organization has estimated that 1 million of Kenya's 26 million people are infected with HIV or AIDS. full text

  5. Peat Bog Ecosystems: Burning

    OpenAIRE

    Lindsay, Richard; Birnie, Richard; Clough, Jack

    2014-01-01

    Fires occur naturally on bogs through lightning strikes, but for any given location this is a rare occurrence - perhaps once every 200 or 300 years. Current burning practice for grazing or to encourage grouse means that ground is burnt 10x more frequently than this, resulting in loss of natural peat bog biodiversity and peat-forming species. Full recovery may take considerably more than a century.\\ud \\ud This briefing note is part of a series aimed at policy makers, practitioners and academic...

  6. Sheep cervical spine biomechanics: a finite element study

    National Research Council Canada - National Science Library

    DeVries Watson, Nicole A; Gandhi, Anup A; Fredericks, Doug C; Smucker, Joseph D; Grosland, Nicole M

    2014-01-01

    .... The sheep model has emerged as an important model in spine biomechanics. Although there are several experimental biomechanical studies of the sheep cervical spine, only a limited number of computational models have been developed...

  7. Participatory disease surveillance (PDS) of sheep and goats ...

    African Journals Online (AJOL)

    Participatory disease surveillance (PDS) of sheep and goats deseases in selected districts of Afar Regional State: Particular focus on Pestes des petit ruminants (PPR) and sheep and goat pox disease (SGP)

  8. Ice & Fire: the Burning Question

    DEFF Research Database (Denmark)

    van Gelderen, Laurens; Jomaas, Grunde

    2017-01-01

    With the Arctic opening up to new shipping routes and increased oil exploration and production due to climate change, the risk of an Arctic oil spill is increasing. Of the classic oil spill response methods (mechanical recovery, dispersants and in-situ burning), in-situ burning is considered...... to be particularly a suitable response method in the Arctic. In-situ burning aims to remove the oil from the marine environment by burning it from the water surface. A recent Ph.D. thesis from the Technical University of Denmark has provided some new insights with respect to the fire science behind this response...

  9. Nutrition Support in Burn Patients

    Directory of Open Access Journals (Sweden)

    Cem Aydoğan

    2012-08-01

    Full Text Available Severe burn trauma causes serious metabolic derangements. Increased metabolic rate which is apart of a pathophysiologic characteristic of burn trauma results in protein-energy malnutrition. This situation causes impaired wound healing, muscle and fat tissue’s breakdown, growth retardation in children and infections. Nutrition support is vital in the treatment strategies of burn victims to prevent high mortal and disabling complications in this devastating trauma. Our aim in this study is to review management of nutrition in burn victims. (Journal of the Turkish Society Intensive Care 2012; 10: 74-83

  10. Milk composition of Yankasa sheep raised under small-holder ...

    African Journals Online (AJOL)

    There were many significant (P<0.05) and positive correlations among the milk composition parameters. For instance BCS vs season, fat vs CP and pH vs parity, CP vs BCS, BCS vs fat; values being r= 0.31, 0.76, 0.31, 0.27, 0.82 (P<0.05), respectively. This study on milk composition of ewes showed great variability in the ...

  11. Mutations in MC1R Gene Determine Black Coat Color Phenotype in Chinese Sheep

    Directory of Open Access Journals (Sweden)

    Guang-Li Yang

    2013-01-01

    Full Text Available The melanocortin receptor 1 (MC1R plays a central role in regulation of animal coat color formation. In this study, we sequenced the complete coding region and parts of the 5′- and 3′-untranslated regions of the MC1R gene in Chinese sheep with completely white (Large-tailed Han sheep, black (Minxian Black-fur sheep, and brown coat colors (Kazakh Fat-Rumped sheep. The results showed five single nucleotide polymorphisms (SNPs: two non-synonymous mutations previously associated with coat color (c.218 T>A, p.73 Met>Lys. c.361 G>A, p.121 Asp>Asn and three synonymous mutations (c.429 C>T, p.143 Tyr>Tyr; c.600 T>G, p.200 Leu>Leu. c.735 C>T, p.245 Ile>Ile. Meanwhile, all mutations were detected in Minxian Black-fur sheep. However, the two nonsynonymous mutation sites were not in all studied breeds (Large-tailed Han, Small-tailed Han, Gansu Alpine Merino, and China Merino breeds, all of which are in white coat. A single haplotype AATGT (haplotype3 was uniquely associated with black coat color in Minxian Black-fur breed (P=9.72E-72, chi-square test. The first and second A alleles in this haplotype 3 represent location at 218 and 361 positions, respectively. Our results suggest that the mutations of MC1R gene are associated with black coat color phenotype in Chinese sheep.

  12. Proteomic evaluation of sheep serum proteins

    Directory of Open Access Journals (Sweden)

    Chiaradia Elisabetta

    2012-05-01

    Full Text Available Abstract Background The applications of proteomic strategies to ovine medicine remain limited. The definition of serum proteome may be a good tool to identify useful protein biomarkers for recognising sub-clinical conditions and overt disease in sheep. Findings from bovine species are often directly translated for use in ovine medicine. In order to characterize normal protein patterns and improve knowledge of molecular species-specific characteristics, we generated a two-dimensional reference map of sheep serum. The possible application of this approach was tested by analysing serum protein patterns in ewes with mild broncho-pulmonary disease, which is very common in sheep and in the peripartum period which is a stressful time, with a high incidence of infectious and parasitic diseases. Results This study generated the first reference 2-DE maps of sheep serum. Overall, 250 protein spots were analyzed, and 138 identified. Compared with healthy sheep, serum protein profiles of animals with rhino-tracheo-bronchitis showed a significant decrease in protein spots identified as transthyretin, apolipoprotein A1 and a significant increase in spots identified as haptoglobin, endopin 1b and alpha1B glycoprotein. In the peripartum period, haptoglobin, alpha-1-acid glycoprotein, apolipoprotein A1 levels rose, while transthyretin content dropped. Conclusions This study describes applications of proteomics in putative biomarker discovery for early diagnosis as well as for monitoring the physiological and metabolic situations critical for ovine welfare.

  13. Oral Rehydration Therapy in Burn Patients

    Science.gov (United States)

    2014-04-24

    Burn Any Degree Involving 20-29 Percent of Body Surface; Burn Any Degree Involving 30-39 Percent of Body Surface; Burn Any Degree Involving 40-49 Percent of Body Surface; Burn Any Degree Involving 50-59 Percent of Body Surface; Burn Any Degree Involving 60-65 Percent of Body Surface

  14. An individual-based modelling approach to estimate landscape connectivity for bighorn sheep (Ovis canadensis

    Directory of Open Access Journals (Sweden)

    Corrie H. Allen

    2016-05-01

    Full Text Available Background. Preserving connectivity, or the ability of a landscape to support species movement, is among the most commonly recommended strategies to reduce the negative effects of climate change and human land use development on species. Connectivity analyses have traditionally used a corridor-based approach and rely heavily on least cost path modeling and circuit theory to delineate corridors. Individual-based models are gaining popularity as a potentially more ecologically realistic method of estimating landscape connectivity. However, this remains a relatively unexplored approach. We sought to explore the utility of a simple, individual-based model as a land-use management support tool in identifying and implementing landscape connectivity. Methods. We created an individual-based model of bighorn sheep (Ovis canadensis that simulates a bighorn sheep traversing a landscape by following simple movement rules. The model was calibrated for bighorn sheep in the Okanagan Valley, British Columbia, Canada, a region containing isolated herds that are vital to conservation of the species in its northern range. Simulations were run to determine baseline connectivity between subpopulations in the study area. We then applied the model to explore two land management scenarios on simulated connectivity: restoring natural fire regimes and identifying appropriate sites for interventions that would increase road permeability for bighorn sheep. Results. This model suggests there are no continuous areas of good habitat between current subpopulations of sheep in the study area; however, a series of stepping-stones or circuitous routes could facilitate movement between subpopulations and into currently unoccupied, yet suitable, bighorn habitat. Restoring natural fire regimes or mimicking fire with prescribed burns and tree removal could considerably increase bighorn connectivity in this area. Moreover, several key road crossing sites that could benefit from

  15. Milk yield and quality of Cres sheep and their crosses with Awassi and East Friesian sheep

    Directory of Open Access Journals (Sweden)

    Boro Mioč

    2009-09-01

    Full Text Available The objective of this study was to establish the impact of crossing the indigenous Cres sheep with Awassi and, respectively, Awassi and East Friesian sheep on the milk yield and quality. For this purpose, through regular monthly milk yield recordings a total of 824individual milk samples from 139 sheep in the second lactation of the same flock were collected, of which: 46 purebred Cres sheep, CS; 33 crosses with 50 % Cres sheep and 50 % Awassi, CA; 60 crosses with 50 % Cres sheep, 25 % Awassi and 25 % East Friesian, CAEF. The obtained results show a significant (P<0.05; P<0.01 impact of the genotype and the lactation stage on the yield and chemical composition of milk, and the somatic cell count. The most milk was yielded by CAEF crosses (690 mL/ewe/day, i.e., 133.8 L per lactation and the least by CS (340 mL/ewe/day, i.e., 58.48 L per lactation. The content of total solids, fat and protein increased as lactation advanced, whereas the trend of the lactose content was opposite. The highest content of total solids, fat and protein were established in the milk of the indigenous Cres sheep. A positive correlation was established between the amount of yielded milk and the somatic cell count, whereas a negative correlation was established between the amount of milk and the content of solids, fat and proteins.

  16. Survival of bighorn sheep (Ovis canadensis) commingled with domestic sheep (Ovis aries) in the absence of Mycoplasma ovipneumoniae.

    Science.gov (United States)

    Besser, Thomas E; Cassirer, E Frances; Yamada, Catherine; Potter, Kathleen A; Herndon, Caroline; Foreyt, William J; Knowles, Donald P; Srikumaran, Subramaniam

    2012-01-01

    To test the hypothesis that Mycoplasma ovipneumoniae is an important agent of the bighorn sheep (Ovis canadensis) pneumonia that has previously inevitably followed experimental commingling with domestic sheep (Ovis aries), we commingled M. ovipneumoniae-free domestic and bighorn sheep (n=4 each). One bighorn sheep died with acute pneumonia 90 days after commingling, but the other three remained healthy for >100 days. This unprecedented survival rate is significantly different (P=0.002) from that of previous bighorn-domestic sheep contact studies but similar to (P>0.05) bighorn sheep survival following commingling with other ungulates. The absence of epizootic respiratory disease in this experiment supports the hypothesized role of M. ovipneumoniae as a key pathogen of epizootic pneumonia in bighorn sheep commingled with domestic sheep.

  17. Study on common phenotypic traits for purchasing sheep and their ...

    African Journals Online (AJOL)

    A study was conducted in 2008 to assess the relationship between common phenotypic traits most considered for marketing sheep and the body weight and price of sheep at markets of four towns in East Showa zone. Six hundred randomly selected sheep purchased for various purposes were studied. The study methods.

  18. Polymorphism investigation of calpastatin gene in Zel sheep ...

    African Journals Online (AJOL)

    Investigation of population genetic structure of Zel sheep revealed that it was not in Hardy-Weinberg equilibrium (p<0.05). The results indicate that it could be useful to consider genetic diversity at calpastatin locus in Zel sheep. Key words: Calpastatin gene, polymorphism, Zel sheep, meat and polymerase chain ...

  19. Prevalence of major sheep diseases and analysis of mortality in ...

    African Journals Online (AJOL)

    A cross sectional and retrospective case study design were carried out from May 2008 to April 2012 in model sheep villages of Farta and Lay Gaint districts with the objective of identifying major sheep diseases, to assess the magnitude of sheep mortality and recommend disease and mortality control options in the study ...

  20. Breeding strategies to make sheep farms resilient to uncertainty

    NARCIS (Netherlands)

    Rose, I.J.

    2014-01-01

    The sheep industry in Western Australian has had many challenges over the last 20 years which have caused sheep numbers to decline. This decline is because sheep farms are not resilient to uncertain pasture growth and commodity prices. One way to improve resilience and profitability of farming

  1. 75 FR 43031 - National Sheep Industry Improvement Center

    Science.gov (United States)

    2010-07-23

    ... Service 7 CFR Part 63 National Sheep Industry Improvement Center AGENCY: Agricultural Marketing Service... regulations establishing a National Sheep Industry Improvement Center (NSIIC) program, consistent with the... production and marketing of sheep or goat products in the United States; (2) Optimize the use of available...

  2. 9 CFR 93.435 - Sheep and goats.

    Science.gov (United States)

    2010-01-01

    ... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Sheep and goats. 93.435 Section 93.435... CONVEYANCE AND SHIPPING CONTAINERS Ruminants Additional General Provisions § 93.435 Sheep and goats. (a) Except as provided in paragraph (b) of this section, all sheep and goats imported into the United States...

  3. Spontaneous poisoning by Prosopis juliflora (Leguminosae) in sheep

    Science.gov (United States)

    The aim of this paper is to describe the first report of clinical, epidemiological and pathological aspects of spontaneous poisoning by Prosopis juliflora in sheep. Of a total of 500 sheep at risk, two adult male sheep were affected; one died spontaneously and the other animal was examined, euthaniz...

  4. Gastrolobium spp. poisoning in sheep: A case report

    Science.gov (United States)

    This report describes the history and investigation of a suspected plant poisoning event in Western Australia where fifteen sheep died. One of the poisoned sheep was necropsied and gross and microscopic pathology of the poisoned sheep is described. Monofluoroacetate was detected in rumen contents ...

  5. 75 FR 75867 - National Sheep Industry Improvement Center

    Science.gov (United States)

    2010-12-07

    ... Service 7 CFR Part 63 National Sheep Industry Improvement Center AGENCY: Agricultural Marketing Service... National Sheep Industry Improvement Center (NSIIC) program, consistent with the Food, Conservation, and... to strengthen and enhance production and marketing of sheep or goat products in the United States; (2...

  6. Prevalence of major sheep diseases and analysis of mortality in ...

    African Journals Online (AJOL)

    A cross sectional and retrospective case study design were carried out from May. 2008 to April 2012 in model sheep villages of Farta and Lay Gaint districts with the objective of identifying major sheep diseases, to assess the magnitude of sheep mortality and recommend disease and mortality control options in the study ...

  7. Chemical burns--an historical comparison and review of the literature.

    Science.gov (United States)

    Hardwicke, Joseph; Hunter, Thomas; Staruch, Robert; Moiemen, Naiem

    2012-05-01

    Chemical burns represent a small proportion of cutaneous burn with an incidence of up to 10.7%, but have been reported to account for up to 30% of all burn deaths. A review of the literature shows incidences ranging from 2.4% to 10.7%, with a substantial predominance in males. Adult patients with a burn referred to our Regional Burns Centre, over an eight-year period, were identified. 185 chemical burns were recorded (7.9%). The mean age of patient was 40 years (range 16-81 years) and male to female ratio was 6.4:1. Over three-quarters of chemical injuries occurred in the domestic or industrial setting. Acids caused 26% of all chemical burns and alkalis caused 55%. A previous study from the same centre highlights a change in the demographics of chemical burn over the last 25 years. The proportion of chemical burns has risen from 2.7% to 7.9%. Chemical burns occurring in an industrial setting, have dropped, whilst the number of domestic chemical burns has increased by over three times. This change reflects the improved industrial health and safety policy in recent years. The move from the industrial setting to the domestic has implications for future regulations. Copyright © 2011 Elsevier Ltd and ISBI. All rights reserved.

  8. Jaagsiekte Sheep Retrovirus Biology and Oncogenesis

    Science.gov (United States)

    Hofacre, Andrew; Fan, Hung

    2010-01-01

    Jaagsiekte sheep retrovirus (JSRV) is the causative agent of a lung cancer in sheep known as ovine pulmonary adenocarcinoma (OPA). The disease has been identified around the world in several breeds of sheep and goats, and JSRV infection typically has a serious impact on affected flocks. In addition, studies on OPA are an excellent model for human lung carcinogenesis. A unique feature of JSRV is that its envelope (Env) protein functions as an oncogene. The JSRV Env-induced transformation or oncogenesis has been studied in a variety of cell systems and in animal models. Moreover, JSRV studies have provided insights into retroviral genomic RNA export/expression mechanisms. JSRV encodes a trans-acting factor (Rej) within the env gene necessary for the synthesis of Gag protein from unspliced viral RNA. This review summarizes research pertaining to JSRV-induced pathogenesis, Env transformation, and other aspects of JSRV biology. PMID:21994634

  9. THE RUMINANT EFFECT OF VEGETAL LECITHIN AT SHEEP AND GOATS

    Directory of Open Access Journals (Sweden)

    H. SĂRĂNDAN

    2009-05-01

    Full Text Available In the extraction process of the vegetable soy oils and sun-flower oils results in large quantities a waste that contains approximately 45% fat from which 58% is lecithin. This waste called “dreg” creates problems of environment pollution because we didn’t find a use for it. We tested this waste in the food of small ruminants, at sheep and goat, watching the ruminant effect and the apparent digestibility of the nutritive substances in the food. The tested doses of “dregs” were of 100 g and 200 g per day. The food supplementation in sheep and goats with dregs up to 7% fat in the dry substance of the ration has favourable and proportional effects with the dose of fat on the digestibility of the nutritive substances from the food. The growth of ruminant bacteria is favoured at the 100 g dose of dregs but is depressed at the 200 g dose of dregs. On the ruminant protozoa the supplementation with fat from dregs leads to the reducing of the number of protozoa and even at defaunation. It is possible that the fat from the dregs to be a source of YATP and to protect the alimentary proteins of the degrading with proteolytic enzymes and therefore to make the protein ruminant by-pass.

  10. Sheep pox in Tunisia: Current status and perspectives.

    Science.gov (United States)

    Ben Chehida, F; Ayari-Fakhfakh, E; Caufour, P; Amdouni, J; Nasr, J; Messaoudi, L; Haj Ammar, H; Sghaier, S; Bernard, C; Ghram, A; Cêtre-Sossah, C

    2017-06-28

    Sheep pox, a well-known endemic capripox infection, has significant impacts on small ruminant populations in Tunisia. It is responsible for high economic losses throughout North Africa due to its enzootic nature and to the active animal transhumance existing in some governorates in Tunisia. The aim of this review was to analyse data gathered on annual vaccination campaigns designed to control its spread by reducing the level of endemicity and to describe diagnostic and management tools adapted to the Tunisian situation. Seasonal, temporal and spatial distributions of sheep pox outbreaks, as well as related clinical features, were found. It was concluded from this review that establishing strong herd immunization through individual animal immunization, creating adequate infrastructure, increasing awareness among breeders, setting up a field-based surveillance network and improving routine diagnostic methods need to be the major components of a programme to eradicate the disease. It was also felt that cost-benefit analyses of the surveillance and control strategies used would help in controlling its persistence. © 2017 Blackwell Verlag GmbH.

  11. Monitoring the on-farm welfare of sheep and goats

    Directory of Open Access Journals (Sweden)

    Agostino Sevi

    2010-01-01

    Full Text Available Schemes for on-farm welfare assessment in sheep and goats are not yet available. Factors responsible for this lack of availability are discussed in the first part of this review. Requisites for reliable methods of welfare assessment to be used in sheep and goat farms are discussed, taking into account the peculiarities of the small ruminant production systems in terms of flock management and farm location. Some housing parameters related to structures, design and micro-environment are reviewed and could be included in schemes of welfare assessment on farm. Human-animal interaction, health status of the animals in terms of body condition scoring, skin and hair conditions, lameness and injuries, and management practices in relation to cleanliness, animal handling and moving, milking procedures and abnormal behaviours, are proposed as potential animal-based indicators. When available, validity, reliability and feasibility of the proposed parameters are discussed. The voluntary adhesion to welfare standards in Sardinia and the application of a scientifically validated protocol in Basilicata are reported as examples of practical experiences.

  12. Perceived fatigue following pediatric burns

    NARCIS (Netherlands)

    Akkerman, Moniek; Mouton, Leonora J.; Dijkstra, Froukje; Niemeijer, Anuschka S.; van Brussel, Marco; van der Woude, Lucas H. V.; Disseldorp, Laurien M.; Nieuwenhuis, Marianne K.

    2017-01-01

    Purpose: Fatigue is a common consequence of numerous pediatric health conditions. In adult burn survivors, fatigue was found to be a major problem. The current cross-sectional study is aimed at determining the levels of perceived fatigue in pediatric burn survivors. Methods: Perceived fatigue was

  13. Perceived fatigue following pediatric burns

    NARCIS (Netherlands)

    Akkerman, Moniek; Mouton, Leonora J.; Dijkstra, Froukje; Niemeijer, Anuschka S.; van Brussel, Marco|info:eu-repo/dai/nl/30481962X; Van der Woude, Lucas H. V.; Disseldorp, Laurien M.; Nieuwenhuis, Marianne K.

    2017-01-01

    Purpose Fatigue is a common consequence of numerous pediatric health conditions. In adult burn survivors, fatigue was found to be a major problem. The current cross-sectional study is aimed at determining the levels of perceived fatigue in pediatric burn survivors. Methods Perceived fatigue was

  14. The Burning Truth(s)

    African Journals Online (AJOL)

    Burns surgery has traditionally been somewhat of a. “Cinderella” subspecialty, with the burn surgeon regularly being faced with significant physical and emotional demands. In addition, this branch of surgery has neither complicated surgical procedures nor a plethora of technological equipment to pique the interest of ...

  15. Modern management of paediatric burns

    African Journals Online (AJOL)

    2010-03-01

    Mar 1, 2010 ... management of burns within a general hospital setting. Causes. About 90% of childhood burns are preventable. Informal housing, overcrowding and lack of electricity are underlying problems.4. The most frequent ... injury is not important from a wound treatment perspective, NAI has far-reaching social and ...

  16. Pathology of Schistosoma curassoni infection in sheep.

    Science.gov (United States)

    Vercruysse, J; Fransen, J; Southgate, V R; Rollinson, D

    1985-10-01

    The gross- and histopathology of natural and experimental Schistosoma curassoni infections in sheep were studied. The data obtained showed that S. curassoni infection in sheep causes only slight clinico-pathological manifestations with preferential involvement of the liver, the lower intestine and the urinary bladder. A variable spectrum of host reaction to the eggs within an individual animal was observed, reflecting the duration of presence of eggs in the organs. In the liver, egg granulomas were most numerous in the perilobular regions, while in the intestine, lesions were most pronounced in the mucosa of the rectum. The presence of eggs in 10% of the urinary bladders examined indicated some bladder involvement.

  17. Sexual transmission of Toxoplasma gondii in sheep.

    Science.gov (United States)

    Lopes, Welber Daniel Zanetti; Rodriguez, Joana D'Ark; Souza, Fernando A; dos Santos, Thais Rabelo; dos Santos, Ricardo Silva; Rosanese, Walter Matheus; Lopes, Werik Renato Zanetti; Sakamoto, Cláudio Alessandro; da Costa, Alvimar José

    2013-07-01

    Male sheep of reproductive age were distributed into three groups: GI, a sheep inoculated (oral) with 2.0×10(5) oocysts of the P strain of Toxoplasma gondii; GII, a sheep infected (subcutaneous) with 1.0×10(6) tachyzoites of the RH strain of T. gondii; and GIII, a sheep kept as a control (not infected). After the inoculation of the males, 12 breeding ewes, which were not pregnant and which were serologically negative for reproductive diseases (particularly toxoplasmosis), were distributed into three groups, synchronized, and subsequently exposed to natural mating with previously inoculated males. The distribution was as follows: five ewes that underwent natural mating with the GI male, five ewes that were exposed to natural mating with the GII male, and two ewes that were mated with the non-infected male (control). Serum samples of all the ewes were collected on days -30, -14, -7, -1, and 0 (days before natural mating) and on days 1, 3, 5, 7, 11, 14, and weekly until birth; the presence of serum antibodies against T. gondii was assessed by IFAT. Using a bioassay and PCR, T. gondii was isolated from the semen of the infected reproducing sheep before mating. Following natural mating, 5 of the 12 females displayed antibodies specific for T. gondii; of these animals, two of the ewes underwent natural mating with the male inoculated with oocysts (GI) and three with the male infected with tachyzoites (GII). One of the females that displayed antibodies specific to this coccidian and that underwent natural mating with the GII sheep had a macerated fetus on the 70th day following coverage. Using a bioassay after the birth, it was possible to isolate T. gondii from samples of the "pool" of tissues from the five females that seroconverted after natural mating and from their respective lambs. Using PCR, the DNA of T. gondii was isolated from the "pool" of tissues from one and two females exposed to natural mating with the reproductive males infected with the oocysts and

  18. The year in burns 2013.

    Science.gov (United States)

    Wolf, Steven E; Phelan, Herbert A; Arnoldo, Brett D

    2014-12-01

    Approximately 3415 research articles were published with burns in the title, abstract, and/or keyword in 2013. We have continued to see an increase in this number; the following reviews articles selected from these by the Editor of one of the major journals (Burns) and colleagues that in their opinion are most likely to have effects on burn care treatment and understanding. As we have done before, articles were found and divided into the following topic areas: epidemiology of injury and burn prevention, wound and scar characterization, acute care and critical care, inhalation injury, infection, psychological considerations, pain and itching management, rehabilitation and long-term outcomes, and burn reconstruction. The articles are mentioned briefly with notes from the authors; readers are referred to the full papers for details. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  19. Deaths related to chemical burns.

    Science.gov (United States)

    Pavelites, Joseph J; Kemp, Walter L; Barnard, Jeffrey J; Prahlow, Joseph A

    2011-12-01

    The authors present a series of 6 deaths due to the uncommon cause of chemical burns. Of the 6 deaths due to chemical burns, 4 deaths were due to ingestion of a chemical, 1 death was caused by chemical burns of the skin, and 1 death resulted from rectal insufflation of a chemical. Seven additional cases where chemical burns may have been a contributing factor to the death or an incidental finding are also presented. Four cases are related to an incident involving chemical exposure during an industrial explosion. Three cases involve motor fuel burns of the skin. Two cases concern a plane crash incident, and 1 case involved a vehicular collision. Cases are derived from the records of the Dallas County Medical Examiner's Office and those of the authors' consultation practices. Each of the cases is presented, followed by a discussion of the various mechanisms of chemical injury.

  20. Comparison of invasive and oscillometric blood pressure measurement techniques in anesthetized sheep, goats, and cattle.

    Science.gov (United States)

    Aarnes, Turi K; Hubbell, John Ae; Lerche, Phillip; Bednarski, Richard M

    2014-03-01

    To determine the level of agreement between an oscillometric (O-NIBP) and an invasive method (IBP) of monitoring arterial blood pressure (ABP) in anesthetized sheep, goats, and cattle. Prospective clinical study. Twenty sheep and goats, 20 cattle weighing < 150 kg body weight, and 20 cattle weighing 150 kg body weight. Animals were anesthetized and systolic ABP (SABP), mean ABP (MABP), and diastolic ABP (DABP) were measured using IBP and O-NIBP. Differences between IBP and O-NIBP, and 95% limits of agreement (LOA) between SABP, MABP, and DABP values were assessed by the Bland-Altman method. Mean difference ± standard deviation (range) between SABP, DABP, and MABP measurements in sheep and goats was 0 ± 16 (-57 to 38) mmHg, 13 ± 16 (-37 to 70) mmHg, and 8 ± 13 (-34 to 54) mmHg, respectively. Mean difference between SABP, DABP, and MABP measurements in small cattle was 0 ± 19 (-37 to 37) mmHg, 6 ± 18 (-77 to 48) mmHg, and 4 ± 16 (-73 to 48) mmHg, respectively. Mean difference between SABP, DABP, and MABP measurements in large cattle was -18 ± 32 (-107 to 71) mmHg, 7 ± 29 (-112 to 63) mmHg, and -5 ± 28 (-110 to 60) mmHg, respectively. The 95% LOAs for SABP, DABP, and MABP were -31 to +31, -19 to +44, and -19 to +34 mmHg, respectively in sheep and goats; were -37 to +37, -19 to +44, and -19 to +34 mmHg, respectively in small cattle; and were -81 to +45, -50 to +63, and -59 to +50 mmHg, respectively in large cattle. Agreement was poor between O-NIBP and IBP monitoring techniques. Arterial BP should be monitored in anesthetized sheep, goats, and cattle using IBP. © 2013 Association of Veterinary Anaesthetists and the American College of Veterinary Anesthesia and Analgesia.

  1. Why burn patients are referred?

    Science.gov (United States)

    Latifi, Noor-Ahmad; Karimi, Hamid

    2017-05-01

    Many burn patients are needed to be referred to a tertiary burn hospital according to the American Burn Association (ABA) criteria. The purpose of this study was to verify the reasons for referring of the burn patients to the hospital. For 2 years, we prospectively surveyed the burn patients referred to a tertiary teaching burn hospital. Data for the following variables were collected and analyzed with SPSS software V21.0: causes of burn; age; gender; total body surface area (TBSA) measured at the referring center; TBSA measured at the receiving center; concomitant diseases and traumas; the reason for referral; condition of patients before and during the transportation; transportation time; presence of infection; presence of inhalation injury, electrical injury, and chemical injury; child abuse; insurance coverage; and results and outcomes of patients. A total of 578 burn patients (33.6% of the total admissions) were referred in the study period. Among these patients, 70.9% were females. The mean (SD) age of the patients was 35.3 (19.69) years. The mean (SD) of TBSA was 45.2 (26.3). Of the 578 patients, 45% were referred by request of the family or patients; 9% were referred because lack of diagnostic facility, approximately 43% were referred because of the need to be admitted in a tertiary burn center, 0.7% were referred because of a lack of capacity at other hospitals, and 0.5% were referred because of an error in the estimation of TBSA. A total of 45% of the referrals were by request of the family and patients. Tele-medicine may help to establish a direct contact between expert burn physicians and the patients and thus reduce unnecessary transfers. Approximately 9% of the referrals were because of lack of some diagnostic facilities. Copyright © 2016 Elsevier Ltd and ISBI. All rights reserved.

  2. Investigation of burning in type Ia supernovae

    Science.gov (United States)

    Glazyrin, S. I.

    2013-04-01

    Type Ia supernovae are important cosmological objects that have played a major role in determining the composition of the Universe. Despite four decades of studies, there is no complete understanding of the explosion mechanism. One of the main problems consists in describing the burning wave propagation through the presupernova, a white dwarf. It is well known from observations that an initially slow flame accelerates and transforms into detonation as it moves. The acceleration mechanism realized in supernovae is not yet known, but it is believed to occur through various instabilities. The Landau-Darrieus instability of a thin deflagration thermonuclear burning front propagating through the presupernova is investigated. Direct numerical simulations of burning by the level-set method are presented. Small perturbations at the front are shown to merge into one large cusp after some time. As a flame with limited sizes moves, this leads only to a slight increase in the velocity, which does not allow it to accelerate to the speed of sound.

  3. Protection of sheep against Rift Valley fever virus and sheep poxvirus with a recombinant capripoxvirus vaccine.

    Science.gov (United States)

    Soi, Reuben K; Rurangirwa, Fred R; McGuire, Travis C; Rwambo, Paul M; DeMartini, James C; Crawford, Timothy B

    2010-12-01

    Rift Valley fever (RVF) is an epizootic viral disease of sheep that can be transmitted from sheep to humans, particularly by contact with aborted fetuses. A capripoxvirus (CPV) recombinant virus (rKS1/RVFV) was developed, which expressed the Rift Valley fever virus (RVFV) Gn and Gc glycoproteins. These expressed glycoproteins had the correct size and reacted with monoclonal antibodies (MAb) to native glycoproteins. Mice vaccinated with rKS1/RVFV were protected against RVFV challenge. Sheep vaccinated with rKS1/RVFV twice developed neutralizing antibodies and were significantly protected against RVFV and sheep poxvirus challenge. These findings further document the value of CPV recombinants as ruminant vaccine vectors and support the inclusion of RVFV genes encoding glycoproteins in multivalent recombinant vaccines to be used where RVF occurs.

  4. Protection of Sheep against Rift Valley Fever Virus and Sheep Poxvirus with a Recombinant Capripoxvirus Vaccine▿

    Science.gov (United States)

    Soi, Reuben K.; Rurangirwa, Fred R.; McGuire, Travis C.; Rwambo, Paul M.; DeMartini, James C.; Crawford, Timothy B.

    2010-01-01

    Rift Valley fever (RVF) is an epizootic viral disease of sheep that can be transmitted from sheep to humans, particularly by contact with aborted fetuses. A capripoxvirus (CPV) recombinant virus (rKS1/RVFV) was developed, which expressed the Rift Valley fever virus (RVFV) Gn and Gc glycoproteins. These expressed glycoproteins had the correct size and reacted with monoclonal antibodies (MAb) to native glycoproteins. Mice vaccinated with rKS1/RVFV were protected against RVFV challenge. Sheep vaccinated with rKS1/RVFV twice developed neutralizing antibodies and were significantly protected against RVFV and sheep poxvirus challenge. These findings further document the value of CPV recombinants as ruminant vaccine vectors and support the inclusion of RVFV genes encoding glycoproteins in multivalent recombinant vaccines to be used where RVF occurs. PMID:20876822

  5. The isolated burned palm in children : Epidemiology and long-term sequelae

    NARCIS (Netherlands)

    Barret, JP; Desai, MH; Herndon, DN

    The isolated burn of the palm is a typical injury in young children. Positioning and splinting in small hands is difficult, and long-term sequelae of these injuries are not uncommon. The objective of the present study was to assess the outcome of palm burns and to identify the risk factors for

  6. Characterization of Emissions and Residues from Simulations of the Deepwater Horizon Surface Oil Burns

    Science.gov (United States)

    The surface oil burns conducted by the U.S. Coast Guard from April to July 2010 during the Deepwater Horizon disaster in the Gulf of Mexico were simulated by small scale burns to characterize the pollutants, determine emission factors, and gather particulate matter for subsequent...

  7. Large interarcuate spaces in the cervical vertebral column of the tyrolean mountain sheep.

    Science.gov (United States)

    Turkof, E; Jurasch, N; Grassberger, M; Schwendenwein, S; Habib, D; Knolle, E; Losert, U

    2003-02-01

    Large interarcual spaces have been described between the arcus vertebrae C5/C6 and C6/C7 in the cervical vertebral column of Nubian goats. This aperture enables direct access to spinal cord and rootlets without the need to perform a hemilaminectomy. The present study was performed in order to determine whether these large interarcual spaces can also be found in the vertebral column of the Tyrolean mountain sheep, as this small ruminant, which is anatomically very similar to the Nubian goat, is frequently used for experimental purposes at the Surgical University Clinic in Austria. The carcasses of 10 sheep (six females, four males; range of age: 2.5-6 years, range of weight: 52-89 kg) were dissected and the vertebral column was exposed. All 10 sheep showed elliptic openings between the fourth cervical and the first thoracal vertebrae. Three sheep had additional openings between the first and the second thoracal vertebrae. All openings were covered solitarily by the ligamentum flavum and under this ligamentum lay the spinal cord without any further osseous or ligamentous protection. These findings are not mentioned in the common textbooks of veterinary anatomy and deserve attention, as they can be a step forward towards non-traumatic experimental surgery on the spinal cord.

  8. Coinfection of sheep with Anaplasma, Theileria and Babesia species in the Kurdistan Region, Iraq.

    Science.gov (United States)

    Renneker, S; Abdo, J; Bakheit, M A; Kullmann, B; Beyer, D; Ahmed, J; Seitzer, U

    2013-11-01

    Infections of small ruminants with Anaplasma, Theileria and Babesia species are widely distributed in the old world and are of great economic impact. In Iraq, data on disease occurrence in sheep caused by above-mentioned infectious agents are scarce. This study provides information on various haemoparasitic agents infecting sheep in the Kurdistan Region, Iraq, using molecular diagnostic tools. Altogether, 195 samples originating from three governorates in the Kurdistan Region, namely Duhok, Erbil and Sulaimaniya, were analysed. The following pathogens were identified: Anaplasma ovis (62.6%), Theileria ovis (14.35%), T. lestoquardi (7.7%), T. uilenbergi (5.6%) and Babesia ovis (1.5%). T. uilenbergi is detected for the first time in Iraq. Coinfection of sheep with different pathogens could be observed in this study, and it was found that 45 of 195 (23%) of the samples contained more than one pathogen. Even triple-positive samples were identified in 3% of the investigated animals. In conclusion, we confirm the coinfection of sheep with various haemoparasitic pathogen species in the Kurdistan Region of Iraq. Further investigations are needed to reveal the epidemiology of the diseases, the respective tick vectors, and, in the case of coinfection, pathogens' interaction and possible cross-protection. © 2013 Blackwell Verlag GmbH.

  9. Origin and significance of centric fusions in domestic sheep.

    Science.gov (United States)

    Bruère, A N; Chapman, H M; Jaine, P M; Morris, R M

    1976-01-01

    The karyotypes of 731 sheep of various breeds were studied and considered in association with previous chromosome studies of domestic sheep. A high incidence of the t2 trnslocation was found in two pedigree flocks of New Zealand Romney sheep. One of these flocks was established over 100 years ago and it is suggested that this translocation originated in the Romney Marsh breed of sheep in England. A naturally occurring double translocation heterozygote 52t1t2 was reported for the first time. A further flock of sheep of the Perendale breed was found with a high incidence of dicentric chromosome fusion that was identified as the t3 translocation. The apparently common occurrence of chromosome polymorphism, due to centric fusions, in domestic sheep is discussed in relation to karyotype evolution among both domestic and wild sheep.

  10. Minimum Effective Dose of Cattle and Sheep BSE for Oral Sheep Infection.

    Directory of Open Access Journals (Sweden)

    Gillian McGovern

    Full Text Available The minimum dose required to cause infection of Romney and Suffolk sheep of the ARQ/ARQ or ARQ/ARR prion protein gene genotypes following oral inoculation with Romney or Suffolk a sheep Bovine spongiform encephalopathy (BSE-derived or cattle BSE-derived agent was investigated using doses ranging from 0.0005g to 5g. ARQ/ARQ sheep which were methionine (M / threonine (T heterozygous or T/T homozygous at codon 112 of the Prnp gene, dosed ARQ/ARR sheep and undosed controls did not show any evidence of infection. Within groups of susceptible sheep, the minimum effective oral dose of BSE was found to be 0.05g, with higher attack rates following inoculation with the 5g dose. Surprisingly, this study found no effect of dose on survival time suggesting a possible lack of homogeneity within the inoculum. All clinical BSE cases showed PrPd accumulation in brain; however, following cattle BSE inoculation, LRS involvement within Romney recipients was found to be significantly lower than within the Suffolk sheep inoculated group which is in agreement with previous reports.

  11. Evolutionary dynamics of endogenous Jaagsiekte sheep retroviruses proliferation in the domestic sheep, mouflon and Pyrenean chamois.

    Science.gov (United States)

    Sistiaga-Poveda, M; Jugo, B M

    2014-06-01

    The oncogenic exogenous Jaagsiekte sheep retrovirus (JSRV), responsible for ovine pulmonary adenocarcinoma, has several endogenous counterparts termed enJSRVs. Although many of these elements have been inactivated over time by the accumulation of deleterious mutations or internal recombination leading to solo long terminal repeat (LTR) formation, several members of enJSRVs have been identified as nearly intact and probably represent recent integration events. To determine the level of enJSRV polymorphism in the sheep population and related species, we have undertaken a study by characterizing enJSRVs copies and independent integration sites in six domestic sheep and two wild species of the sheep lineage. enJSRVs copies were detected by amplifying the env-LTR region by PCR, and for the detection of the insertion sites, we used two approaches: (1) an in silico approach based on the recently published Sheep Reference Genome Assembly (OARv3.0) and (2) an experimental approach based on PCR suppression and inverse PCR techniques. In total, 103 enJSRV sequences were generated across 10 individuals and enJSRV integrations were found on 11 of the 28 sheep chromosomes. These findings suggest that there are still uncharacterized enJSRVs, and that some of the integration sites are variable among the different species, breeds of the same species, subspecies and geographic locations.

  12. Genome-wide cross-amplification of domestic sheep microsatellites in bighorn sheep and mountain goats.

    Science.gov (United States)

    Poissant, J; Shafer, A B A; Davis, C S; Mainguy, J; Hogg, J T; Côté, S D; Coltman, D W

    2009-07-01

    We tested for cross-species amplification of microsatellite loci located throughout the domestic sheep (Ovis aries) genome in two north American mountain ungulates (bighorn sheep, Ovis canadensis, and mountain goats, Oreamnos americanus). We identified 247 new polymorphic markers in bighorn sheep (≥ 3 alleles in one of two study populations) and 149 in mountain goats (≥ 2 alleles in a single study population) using 648 and 576 primer pairs, respectively. Our efforts increased the number of available polymorphic microsatellite markers to 327 for bighorn sheep and 180 for mountain goats. The average distance between successive polymorphic bighorn sheep and mountain goat markers inferred from the Australian domestic sheep genome linkage map (mean ± 1 SD) was 11.9 ± 9.2 and 15.8 ± 13.8 centimorgans, respectively. The development of genomic resources in these wildlife species enables future studies of the genetic architecture of trait variation. © 2009 Blackwell Publishing Ltd.

  13. Outpatient management of pediatric burns.

    Science.gov (United States)

    Kassira, Wrood; Namias, Nicholas

    2008-07-01

    The leading etiologies of pediatric burns are scald, thermal, and electrical injuries. The initial management of burns involves assessment of burn depth and total body surface area (TBSA) affected, a history, and physical examination. Calculation of percent of TBSA affected is an important determinant of the necessity for hospitalization versus outpatient management. Only second- and third-degree burns are included in the calculation. The criteria for outpatient management vary based on the center experience and resources. One such set of criteria in an experienced burn center includes burn affecting less than 15% TBSA, therefore not requiring fluid resuscitation; the ability to take in oral fluids, excluding serious perioral burns; no airway involvement or aspiration of hot liquid; no abuse; and dependable family able to transport the patient for clinic appointments. Once the child is ready to reenter school, the physician must discuss with the family and school staff any needs and expectations for the child, including wound care. Social reintegration can be difficult. Educating the teachers and staff of the child's appearance may help prepare the students.

  14. Rehabilitation of the burn patient

    Directory of Open Access Journals (Sweden)

    Procter Fiona

    2010-10-01

    Full Text Available Rehabilitation is an essential and integral part of burn treatment. It is not something which takes place following healing of skin grafts or discharge from hospital; instead it is a process that starts from day one of admission and continues for months and sometimes years after the initial event. Burns rehabilitation is not something which is completed by one or two individuals but should be a team approach, incorporating the patient and when appropriate, their family. The term ′Burns Rehabilitation′ incorporates the physical, psychological and social aspects of care and it is common for burn patients to experience difficulties in one or all of these areas following a burn injury. Burns can leave a patient with severely debilitating and deforming contractures, which can lead to significant disability when left untreated. The aims of burn rehabilitation are to minimise the adverse effects caused by the injury in terms of maintaining range of movement, minimising contracture development and impact of scarring, maximising functional ability, maximising psychological wellbeing, maximising social integration

  15. Sedation and Analgesia in Burn

    Directory of Open Access Journals (Sweden)

    Özkan Akıncı

    2011-07-01

    Full Text Available Burn injury is one of the most serious injuries that mankind may face. In addition to serious inflammation, excessive fluid loss, presence of hemodynamic instability due to intercurrent factors such as debridements, infections and organ failure, very different levels and intensities of pain, psychological problems such as traumatic stress disorder, depression, delirium at different levels that occur in patient with severe burn are the factors which make it difficult to provide the patient comfort. In addition to a mild to moderate level of baseline permanent pain in burn patients, which is due to tissue damage, there is procedural pain as well, which occurs by treatments such as grafting and dressings, that are severe, short-term burst style 'breakthrough' pain. Movement and tactile stimuli are also seen in burn injury as an effect to sensitize the peripheral and central nervous system. Even though many burn centers have established protocols to struggle with the pain, studies show that pain relief still inadequate in burn patients. Therefore, the treatment of burn pain and the prevention of possible emergence of future psychiatric problems suc as post-traumatic stress disorder, the sedative and anxiolytic agents should be used as a recommendation according to the needs and hemodynamic status of individual patient. (Journal of the Turkish Society Intensive Care 2011; 9 Suppl: 26-30

  16. Pathogenesis of bovine spongiform encephalopathy in sheep

    NARCIS (Netherlands)

    Keulen, van L.J.M.; Vromans, M.E.W.; Dolstra, C.H.; Bossers, A.; Zijderveld, van F.G.

    2008-01-01

    The pathogenesis of bovine spongiform encephalopathy (BSE) in sheep was studied by immunohistochemical detection of scrapie-associated prion protein (PrPSc) in the gastrointestinal, lymphoid and neural tissues following oral inoculation with BSE brain homogenate. First accumulation of PrPSc was

  17. Phosphorus supplementation of Karakul sheep grazing natural ...

    African Journals Online (AJOL)

    divided into four groups of 20 ewes each, viz. ewes supplemented with P+ and P- which lambed during May and October. All lambs born were slaughtered. The nutritive value (% CP and DOM) of the natural pasture of P- and P+ groups was similar. The average daily intake of supplement. (g/sheep) by the P- and P+ groups ...

  18. THE SYNCHRONISATION OF OESTRUS IN SHEEP. 4 ...

    African Journals Online (AJOL)

    synchronisation of ovulation, since the degree of synchronisation of oestrus in sheep is much higher following the ... However, considering that ovulation takes place approximately 30 hours after the commencement of oestrus (Van ... inject i on ( Accurttu la t ive ). ^1\\. - Fixed Time A.t.. GROUP I INTRAVAGINAL SPONGES.

  19. SODIUM HYDROXIDE TREATED WHEAT STRAW FOR SHEEP

    African Journals Online (AJOL)

    . Schwab & Satter (1976). Diets were fed twice daily at 08h30 and 15h30 at a level of ad lib + lO%. The untreated wheat straw wfuch ... A comparison of NaOH treated wheat straw iraed and not rinsed and untreated wheat strow fed to sheep.

  20. Analysis of wolves and sheep. Final report

    Energy Technology Data Exchange (ETDEWEB)

    Hogden, J.; Papcun, G.; Zlokarnik, I.; Nix, D.

    1997-08-01

    In evaluating speaker verification systems, asymmetries have been observed in the ease with which people are able to break into other people`s voice locks. People who are good at breaking into voice locks are called wolves, and people whose locks are easy to break into are called sheep. (Goats are people that have a difficult time opening their own voice locks.) Analyses of speaker verification algorithms could be used to understand wolf/sheep asymmetries. Using the notion of a ``speaker space``, it is demonstrated that such asymmetries could arise even though the similarity of voice 1 to voice 2 is the same as the inverse similarity. This explains partially the wolf/sheep asymmetries, although there may be other factors. The speaker space can be computed from interspeaker similarity data using multidimensional scaling, and such speaker space can be used to given a good approximation of the interspeaker similarities. The derived speaker space can be used to predict which of the enrolled speakers are likely to be wolves and which are likely to be sheep. However, a speaker must first enroll in the speaker key system and then be compared to each of the other speakers; a good estimate of a person`s speaker space position could be obtained using only a speech sample.

  1. Thoracic radiographic anatomy in sheep | Makungu | Tanzania ...

    African Journals Online (AJOL)

    The right pulmonary cupula pleura was more radiolucent, wide and extended further cranially than the left pulmonary cupula pleura. Knowledge of the normal thoracic radiographic anatomy of individual species is important for accurate interpretation of thoracic radiographs. Keywords: sheep, thorax, radiography, anatomy ...

  2. SUPPLEMENTTNG SHEEP WITH PROTEIN AND PHOSPHORUS ...

    African Journals Online (AJOL)

    rumen NH3 concentratron. Results in this regard pertain- ing to free grazing sheep are virtually non-existent. Both diet composition and digestibility are important factors in the evaluation ot' the nutritrve value ot' any leed. Tlierefore it was decided to obtain more quantitative information on native pastures in this resard.

  3. Performance of sheep grazing Brachiaria decumbens, Panicum ...

    African Journals Online (AJOL)

    The three grasses and their combinations within the alley plots were replicated three times.The animals weregrazed continuously for 28 days in the sub plots. Sheep grazing the Gliricidia/Panicum plot had a higher (P < 001) growth rate (38 g d-1) than those animals grazing both the Gliricidia/Bracharia (23 g d-1) and ...

  4. Improved reproductive response of sheep in intrauterine ...

    African Journals Online (AJOL)

    Improved reproductive response of sheep in intrauterine insemination program with the use of royal jelly. ... estrus in ewes treated with 100 IU eCG plus 500 mg RJ when compared with the other treatment groups. Keywords: Royal jelly, equine chorionic gonadotropin (eCG), natural progesterone, artificial insemination, ewe ...

  5. Possible mechanisms of host resistance to Haemonchus contortus infection in sheep breeds native to the Canary Islands

    Science.gov (United States)

    The blood feeder parasite Haemonchus contortus appears to be the most economically important helminth species for small ruminant production in many regions of the world. The two sheep breeds native to the Canary Islands display distinctly different resistant phenotypes under both natural and experim...

  6. Genetic and phenotypic parameters of body weight in West African Dwarf goat and Djallonké sheep

    NARCIS (Netherlands)

    Bosso, N.A.; Cissé, M.F.; Waaij, van der E.H.; Fall, A.; Arendonk, van J.A.M.

    2007-01-01

    The International Trypanotolerance Centre's small ruminant breeding programme was initiated in 1995. The aim was to increase the efficiency of meat production and the trypanotolerance of the animals (sheep and goat). To achieve that goal, selection was based on estimated breeding values for daily

  7. Burns treatment in ancient times.

    Science.gov (United States)

    Pećanac, Marija; Janjić, Zlata; Komarcević, Aleksandar; Pajić, Milos; Dobanovacki, Dusanka; Misković, Sanja Skeledzija

    2013-01-01

    Discovery of fire at the dawn of prehistoric time brought not only the benefits to human beings offering the light and heat, but also misfortune due to burns; and that was the beginning of burns treatment. Egyptian doctors made medicines from plants, animal products and minerals, which they combined with magic and religious procedures. The earliest records described burns dressings with milk from mothers of male babies. Goddess Isis was called upon to help. Some remedies and procedures proved so successful that their application continued for centuries. The Edwin Smith papyrus (1500 BC) mentioned the treatment of burns with honey and grease. Ebers Papyrus (1500 BC) contains descriptions of application of mud, excrement, oil and plant extracts. They also used honey, Aloe and tannic acid to heal burns. Ancient Egyptians did not know about microorganisms but they knew that honey, moldy bread and copper salts could prevent infections from dirt in burns healing. Thyme, opium and belladona were used for pain relief. In the 4th century BC, Hippocrates recorded that Greek and Roman doctors used rendered pig fat, resin and bitumen to treat burns. Mixture of honey and bran, or lotion of wine and myrrh were used by Celsus. Honey was also known in Ayurveda (Indian medicine) time. Ayurvedic records Characa and Sushruta included honey in their dressing aids to purify sores and promote the healing. Burn treatment in Chinese medicine was traditional. It was a compilation of philosophy, knowledge and herbal medicine. The successful treatment of burns started in recent time and it has been made possible by better knowledge of the pathophysiology of thermal injuries and their consequences, medical technology advances and improved surgical techniques.

  8. Differential gene expression in ovaries of Qira black sheep and Hetian sheep using RNA-Seq technique.

    Directory of Open Access Journals (Sweden)

    Han Ying Chen

    Full Text Available The Qira black sheep and the Hetian sheep are two local breeds in the Northwest of China, which are characterized by high-fecundity and low-fecundity breed respectively. The elucidation of mRNA expression profiles in the ovaries among different sheep breeds representing fecundity extremes will helpful for identification and utilization of major prolificacy genes in sheep. In the present study, we performed RNA-seq technology to compare the difference in ovarian mRNA expression profiles between Qira black sheep and Hetian sheep. From the Qira black sheep and the Hetian sheep libraries, we obtained a total of 11,747,582 and 11,879,968 sequencing reads, respectively. After aligning to the reference sequences, the two libraries included 16,763 and 16,814 genes respectively. A total of 1,252 genes were significantly differentially expressed at Hetian sheep compared with Qira black sheep. Eight differentially expressed genes were randomly selected for validation by real-time RT-PCR. This study provides a basic data for future research of the sheep reproduction.

  9. Differential Gene Expression in Ovaries of Qira Black Sheep and Hetian Sheep Using RNA-Seq Technique

    Science.gov (United States)

    Jia, Bin; Zhang, Yong Sheng; Wang, Xu Hai; Zeng, Xian Cun

    2015-01-01

    The Qira black sheep and the Hetian sheep are two local breeds in the Northwest of China, which are characterized by high-fecundity and low-fecundity breed respectively. The elucidation of mRNA expression profiles in the ovaries among different sheep breeds representing fecundity extremes will helpful for identification and utilization of major prolificacy genes in sheep. In the present study, we performed RNA-seq technology to compare the difference in ovarian mRNA expression profiles between Qira black sheep and Hetian sheep. From the Qira black sheep and the Hetian sheep libraries, we obtained a total of 11,747,582 and 11,879,968 sequencing reads, respectively. After aligning to the reference sequences, the two libraries included 16,763 and 16,814 genes respectively. A total of 1,252 genes were significantly differentially expressed at Hetian sheep compared with Qira black sheep. Eight differentially expressed genes were randomly selected for validation by real-time RT-PCR. This study provides a basic data for future research of the sheep reproduction. PMID:25790350

  10. Estimation of Genetic Parameters of Kleiber Ratio and Growth Traits in Kurdish Sheep

    OpenAIRE

    Davoud Ali Saghi; Alireza Shahdadi

    2016-01-01

    Introduction Kurdish sheep breed is one of the most important native breeds of Iran. They are fat-tailed, large-sized, well adapted to the mountainous regions in northern Khorasan province and mainly raising for meat production under pastoral production system (28). Feed efficiency is a major component in the profitability of the small ruminant enterprise, because quality of range and pasture is low in poor environmental conditions in Iran. Growth rate and feed efficiency are two traits of gr...

  11. Prevalence and risk factors of caseous lymphadenitis in sheep and goats of Batna area (Algeria)

    OpenAIRE

    Mohamed Nabil Alloui,; Jaroslaw Kaba; Nadir Alloui

    2011-01-01

    An epidemiologic investigation of caseous lymphadenitis of the small ruminants (23 herds) was carried out in the Batna area (Algeria). The disease prevalence at the sheep and the goat was 8.9 and 1.6% respectively. This disease was more frequent in the adults. Clinically, the disease did not affect the animal’s general state. The internal disease form was not observed in 38 carcasses. The risk factors in the appearance of the disease were: bad hygiene, the precar...

  12. Colloids in Acute Burn Resuscitation.

    Science.gov (United States)

    Cartotto, Robert; Greenhalgh, David

    2016-10-01

    Colloids have been used in varying capacities throughout the history of formula-based burn resuscitation. There is sound experimental evidence that demonstrates colloids' ability to improve intravascular colloid osmotic pressure, expand intravascular volume, reduce resuscitation requirements, and limit edema in unburned tissue following a major burn. Fresh frozen plasma appears to be a useful and effective immediate burn resuscitation fluid but its benefits must be weighed against its costs, and risks of viral transmission and acute lung injury. Albumin, in contrast, is less expensive and safer and has demonstrated ability to reduce resuscitation requirements and possibly limit edema-related morbidity. Copyright © 2016 Elsevier Inc. All rights reserved.

  13. Protocolized Resuscitation of Burn Patients.

    Science.gov (United States)

    Cancio, Leopoldo C; Salinas, Jose; Kramer, George C

    2016-10-01

    Fluid resuscitation of burn patients is commonly initiated using modified Brooke or Parkland formula. The fluid infusion rate is titrated up or down hourly to maintain adequate urine output and other endpoints. Over-resuscitation leads to morbid complications. Adherence to paper-based protocols, flow sheets, and clinical practice guidelines is associated with decreased fluid resuscitation volumes and complications. Computerized tools assist providers. Although completely autonomous closed-loop control of resuscitation has been demonstrated in animal models of burn shock, the major advantages of open-loop and decision-support systems are identifying trends, enhancing situational awareness, and encouraging burn team communication. Published by Elsevier Inc.

  14. The anaerobic co-digestion of sheep bedding and ⩾ 50% cattle manure increases biogas production and improves biofertilizer quality.

    Science.gov (United States)

    Cestonaro, Taiana; Costa, Mônica Sarolli Silva de Mendonça; Costa, Luiz Antônio de Mendonça; Rozatti, Marcos Antonio Teofilo; Pereira, Dercio Ceri; Lorin, Higor Eisten Francisconi; Carneiro, Leocir José

    2015-12-01

    Sheep manure pellets are peculiarly shaped as small 'capsules' of limited permeability and thus are difficult to degrade. Fragmentation of manure pellets into a homogeneous mass is important for decomposition by microorganisms, and occurs naturally by physical shearing due to animal trampling, when sheep bedding is used. However, the high lignocellulose content of sheep bedding may limit decomposition of sheep manure. Here, we evaluated if co-digestion of sheep bedding with cattle manure would improve the yield and quality of the useful products of anaerobic digestion of sheep bedding--biogas and biofertilizer--by providing a source of nutrients and readily available carbon. Mixtures of sheep bedding and cattle manure in varying proportions (0%, 25%, 50%, 75%, or 100% cattle manure) were added to 6-L digesters, used in a batch system, and analyzed by uni and multivariate statistical tools. PC1, which explained 64.96% of data variability, can be referred to as 'organic fraction/productivity', because higher rates of organic fraction consumption (COD, cellulose and hemicellulose contents) led to higher digester productivity (biogas production, nutrient concentration, and sample stability changes). Therefore, productivity and organic fraction variables were most influenced by manure mixtures with higher (⩾ 50%) or lower (⩽ 25%) ratios of cattle manure, respectively. Increasing the amount of cattle manure up to 50% enhanced the biogas potential production from 142 L kg(-1)TS (0% of cattle manure) to 165, 171, 160 L biogas kg(-1)TS for the mixtures containing 100%, 75% and 50% of cattle manure, respectively. Our results show that the addition of ⩾ 50% cattle manure to the mixture increases biogas production and improves the quality of the final biofertilizer. Copyright © 2015 Elsevier Ltd. All rights reserved.

  15. Replacing cows' with sheep's dairy fat lowers plasma cholesterol concentration in participants consuming dairy fat-rich diets.

    Science.gov (United States)

    Skeaff, C M; Williscroft, K; Mann, J; Chisholm, A

    2004-02-01

    To determine the effects on plasma cholesterol concentration of replacing cows' dairy fat with sheep's dairy fat. Randomised crossover dietary intervention. General community, Dunedin, New Zealand. Volunteer sample of 41 healthy adults with initial plasma cholesterol concentration between 4.8 and 7.8 mmol/l. Participants were asked to follow a self-selected low-fat background diet throughout the study to which, during each of the 2, 3-week dairy diets, they were asked to add sheep's or cows' dairy products. Energy and nutrient intakes, plasma triacylglycerol fatty acids, and plasma cholesterol. Energy and nutrient intakes on the sheep-dairy and cow-dairy diets were very similar, with total, saturated, monounsaturated and polyunsaturated fat contributing 34, 18-19, 9, and 3% of total energy intake, respectively. Participants consumed approximately 50 g/day of dairy fat on each diet. Replacing cows' with sheep's dairy fat led to a 0.33 (0.11-0.56, 95% CI) mmol/l decrease (6%) in plasma total cholesterol concentration, from 5.53 (0.90, s.d.) to 5.20 (0.90) mmol/l. Plasma low-density lipoprotein (LDL) cholesterol was 0.18 (0.02-0.33) mmol/l lower on the sheep-dairy diet as was the concentration of plasma high-density lipoprotein (HDL) cholesterol, 0.11 (0.02-0.20) mmol/l. The LDL to HDL cholesterol ratio at the end of the sheep-dairy diet, 2.91 (1.10), was not significantly different (P>0.05) from the cow-dairy diet, 2.73 (0.83). Within the context of a diet high in dairy fat (50 g/day), replacing cows' milk fat with sheep's milk fat leads to a small reduction in plasma cholesterol concentration, but no change in the ratio of LDL to HDL cholesterol.

  16. Impact of managed moorland burning on peat nutrient and base cation status

    Science.gov (United States)

    Palmer, Sheila; Gilpin, Martin; Wearing, Catherine; Johnston, Kerrylyn; Holden, Joseph; Brown, Lee

    2013-04-01

    Controlled 'patch' burning of moorland vegetation has been used for decades in the UK to stimulate growth of heather (Calluna vulgaris) for game bird habitat and livestock grazing. Typically small patches (300-900 m2) are burned in rotations of 8-25 years. However, our understanding of the short-to-medium term environmental impacts of the practice on these sensitive upland areas has so far been limited by a lack of scientific data. In particular the effect of burning on concentrations of base cations and acid-base status of these highly organic soils has implications both for ecosystem nutrient status and for buffering of acidic waters. As part of the EMBER project peat chemistry data were collected in ten upland blanket peat catchments in the UK. Five catchments were subject to a history of prescribed rotational patch burning. The other five catchments acted as controls which were not subject to burning, nor confounded by other detrimental activities such as drainage or forestry. Soil solution chemistry was also monitored at two intensively studied sites (one regularly burned and one control). Fifty-centimetre soil cores, sectioned into 5-cm intervals, were collected from triplicate patches of four burn ages at each burned site, and from twelve locations at similar hillslope positions at each control site. At the two intensively monitored sites, soil solution chemistry was monitored at four depths in each patch. Across all sites, burned plots had significantly smaller cation exchange capacities, lower concentrations of exchangeable base cations and increased concentrations of exchangeable H+ and Al3+ in near-surface soil. C/N ratios were also lower in burned compared to unburned surface soils. There was no consistent trend between burn age and peat chemistry across all burned sites, possibly reflecting local controls on post-burn recovery rates or external influences on burn management decisions. At the intensively monitored site, plots burned less than two years

  17. Prevalence of paratuberculosis infection in sheep

    Directory of Open Access Journals (Sweden)

    Vidić Branka

    2014-01-01

    Full Text Available Paratuberculosis is an incurable chronic disease of ruminants, which is manifested with clinical signs of diarrhea and progressive weight loss. Causative agent is Mycobacterium avium subsp. paratuberculosis, and the disiase occurs in cattle, sheep and goats. The outspread of paratuberculosis is huge in the whole world, especially in the countries where animal breeding is a developed branch of economy. Animals get infected with food and water contaminated with feces of infected animals. The infection spreads within infected pastures and also when trading animals with latent infection. Clinical manifestation of the disease can firstly be noticed in young categories of sheep, which is different than in cattle. Primary clinical symptom is chronic weight loss. It is rather hard to determine the level of prevalence of the disease, in a certain region, because the diagnostic procedure is complex and not always reliable enough. Detection of antibodies with ELISA test is considered a method of choice for diagnostic of paratuberculosis, because of fast gaining of the results and relatively low price of the test. By applying the ELISA test, we have analysed 2000 sheep blood samples. Positive results for paratuberculosis were found in 66 ( 3,30% animals in total. In sheep samples from southern Backa region, positive findings were gained from 42 (3,89% samples, and in Srem region, positive finding were found in samples from 24 sheep (2,60%. Control programs are based on the removal of all infected animals, application of general preventive measures and vaccination. Application of vaccination aims for elimination of clinical form of the disease. An effective treatment has not been determined so far.

  18. Electrical flash burns due to switchboard explosions in New South Wales--a 9-year experience.

    Science.gov (United States)

    Aggarwal, Shagun; Maitz, Peter; Kennedy, Peter

    2011-09-01

    To document the incidence and outcome of flash burns due to electrical switchboard explosions presenting to Concord Hospital Burns Unit, from January 2000 to December 2008. The Concord Hospital Burns Unit Database was reviewed for admissions due to electrical burns from January 2000 to December 2008. There were 119 electrical burns admitted during the study period, 20 of which were due to high voltage current. Ninety-nine others were low voltage injuries and included 37 cases of electrical burns due to low voltage electrical switchboard explosions. All of the electrical switchboard burns occurred in male electricians. Twenty-one of the 37 low voltage injuries required admission and 7 of them required skin grafting. The mean LOS was 9.95 days. Twenty cases suffered serious complications including major psychological problems and ocular injuries. Flash burns resulting from switchboard explosions account for a significant proportion of all electrical burns presenting to our institution. These burns may highlight deficits in taking safety precautions and the use of personal protection equipment. Despite the small area of injury the long term psychological sequelae were significant resulting in a delayed return to employment, and there was a high incidence of eye injuries. Additional efforts are therefore required towards the prevention of such injuries. Copyright © 2011 Elsevier Ltd and ISBI. All rights reserved.

  19. Burned area detection based on Landsat time series in savannas of southern Burkina Faso

    Science.gov (United States)

    Liu, Jinxiu; Heiskanen, Janne; Maeda, Eduardo Eiji; Pellikka, Petri K. E.

    2018-02-01

    West African savannas are subject to regular fires, which have impacts on vegetation structure, biodiversity and carbon balance. An efficient and accurate mapping of burned area associated with seasonal fires can greatly benefit decision making in land management. Since coarse resolution burned area products cannot meet the accuracy needed for fire management and climate modelling at local scales, the medium resolution Landsat data is a promising alternative for local scale studies. In this study, we developed an algorithm for continuous monitoring of annual burned areas using Landsat time series. The algorithm is based on burned pixel detection using harmonic model fitting with Landsat time series and breakpoint identification in the time series data. This approach was tested in a savanna area in southern Burkina Faso using 281 images acquired between October 2000 and April 2016. An overall accuracy of 79.2% was obtained with balanced omission and commission errors. This represents a significant improvement in comparison with MODIS burned area product (67.6%), which had more omission errors than commission errors, indicating underestimation of the total burned area. By observing the spatial distribution of burned areas, we found that the Landsat based method misclassified cropland and cloud shadows as burned areas due to the similar spectral response, and MODIS burned area product omitted small and fragmented burned areas. The proposed algorithm is flexible and robust against decreased data availability caused by clouds and Landsat 7 missing lines, therefore having a high potential for being applied in other landscapes in future studies.

  20. 40 CFR 49.11021 - Permits for general open burning, agricultural burning, and forestry and silvicultural burning.

    Science.gov (United States)

    2010-07-01

    ..., agricultural burning, and forestry and silvicultural burning. 49.11021 Section 49.11021 Protection of... Reservation, Oregon § 49.11021 Permits for general open burning, agricultural burning, and forestry and..., 2007, a person must apply for and obtain approval of a permit under § 49.134 Rule for forestry and...

  1. Randomized controlled trial of three burns dressings for partial thickness burns in children.

    Science.gov (United States)

    Gee Kee, E L; Kimble, R M; Cuttle, L; Khan, A; Stockton, K A

    2015-08-01

    This study compared the effects of three silver dressing combinations on small to medium size acute partial thickness burns in children, focusing on re-epithelialization time, pain and distress during dressing changes. Children (0-15 years) with clean, ≤ 10% total body surface area (TBSA) partial thickness burns who met the inclusion criteria were included in the study. Children received either (1) Acticoat™; (2) Acticoat™ with Mepitel™; or (3) Mepilex Ag™ dressings. Measures of burn re-epithelialization, pain, and distress were recorded at dressing changes every 3-5 days until full re-epithelialization occurred. One hundred and three children were recruited with 96 children included for analysis. No infections were detected for the course of the study. When adjusted for burn depth, Acticoat™ significantly increased the expected days to full re-epithelialization by 40% (IRR = 1.40; 95% CI: 1.14-1.73, p dressing removal (p = 0.01) and 37% lower at new dressing application (p = 0.04); and scores in the Acticoat™ with Mepitel™ group were 23% lower at dressing removal (p = 0.04) and 40% lower at new dressing application (p dressing removal (p = 0.04) and 34% lower in the Acticoat™ with Mepitel™ group (p = 0.02) at new dressing application in comparison to the Acticoat™ group. There was no significant difference between the Mepilex Ag™ and the Acticoat™ with Mepitel™ groups at all timepoints and with any pain measure. Mepilex Ag™ is an effective silver dressing, in terms of accelerated wound re-epithelialization time (compared to Acticoat™ and Acticoat™ with Mepitel™) and decreased pain during dressing changes (compared to Acticoat™), for clean, burns in children. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  2. Wood-burning stoves in low-carbon dwellings

    DEFF Research Database (Denmark)

    Luis Teles de Carvalho, Ricardo; Jensen, Ole Michael; Afshari, Alireza

    2013-01-01

    The European climate change strategy intends to encourage the erection of low-carbon buildings and the upgrading of existing buildings to low-carbon level. At the same time, it is an EU vision to maximise the use of renewable energy resources. In this strategy, small-scale wood-burning is an over......The European climate change strategy intends to encourage the erection of low-carbon buildings and the upgrading of existing buildings to low-carbon level. At the same time, it is an EU vision to maximise the use of renewable energy resources. In this strategy, small-scale wood......-burning is an overlooked source for heating. A wood-burning stove is considered low-carbon technology since its fuel is based on local residual biomass. A field study investigating how modern wood-burning stoves operated in modern single-family houses showed that intermittent heat supply occasionally conflicted...... with the primary heating system and that chimney exhaust occasionally conflicted with the ventilation system causing overheating and particles in the indoor environment. Nonetheless, most of the wood-burning stoves contributed considerably to the total heating. On this background, it was concluded that better...

  3. Acticoat dressings and major burns: systemic silver absorption.

    Science.gov (United States)

    Moiemen, Naiem S; Shale, Elizabeth; Drysdale, Kate J; Smith, Gary; Wilson, Yvonne T; Papini, Remo

    2011-02-01

    Despite widespread use of wound dressings containing silver, few studies have investigated patients' serum silver levels. An earlier study of Acticoat use in small burns showed transient elevations of serum silver. The aim of this study was to examine the serum silver profile when Acticoat is used in major burns. A prospective study of 6 patients with burns greater than 20% total body surface area (TBSA). All burn wounds, including grafted and non-grafted areas and skin graft donor sites, were dressed with Acticoat or Acticoat Absorbent. Patients' serum silver levels, biochemistry and haematology were examined before, during and after the application of the silver dressings. The median total wound size (including donor sites) was 46.1% TBSA. The median maximum serum silver level recorded, 200.3 μg/L, reached at a median of 9.5 days following initial silver dressing application. This decreased to a median of 164.8 μg/L at the end of the treatment period and to a median of 8.2 μg/L at the end of follow-up. One adverse event, partial skin graft loss was thought to be dressing related. In this small study, serum silver levels were elevated but remained similar to that reported following the use of silver sulfadiazine. This study confirmed our view that Acticoat is safe to use on patients with burns, even when they are extensive. Copyright © 2010 Elsevier Ltd and ISBI. All rights reserved.

  4. Paediatric burns in a rural South African district hospital

    African Journals Online (AJOL)

    Community-based studies would help to estimate the true incidence of burns and would contribute to an ... be higher because of the greater use of fires and relatively small amount of traffic. It also does not reflect the ... assessed: analgesia Gudged according to the severity of the wound), fluid replacement, antibiotic therapy ...

  5. The effects of fepeated prescribed burning on Pinus ponderosa growth

    Science.gov (United States)

    David L. Peterson; Stephen S. Sackett; Lindsay J. Robinson; Sally M. Haase

    1994-01-01

    The effect of repeated prescribed burning on long term growth of Pinus ponderosa in northern Arizona was examined. Fire treatments for hazard reduction were initiated in 1976,and growthwas evaluated in 1988 for fire rotations of 1, 2, 4, 6, 8, and 10 years. Dendroecological analysis shows that there were only small changes in treegrowth (compared tocontrols) in the...

  6. Estimation of Genetic Parameters for Direct and Maternal Effects in Growth Traits of Sangsari Sheep Using Gibbs Sampling

    Directory of Open Access Journals (Sweden)

    Zohreh Yousefi

    2016-11-01

    Full Text Available Introduction Small ruminants, especially native breed types, play an important role in livelihoods of a considerable part of human population in the tropics from socio-economic aspects. Therefore, integrated attempt in terms of management and genetic improvement to enhance production is of crucial importance. Knowledge of genetic variation and co-variation among traits is required for both the design of effective sheep breeding programs and the accurate prediction of genetic progress from these programs. Body weight and growth traits are one of the economically important traits in sheep production, especially in Iran where lamb sale is the main source of income for sheep breeders while other products are in secondary importance. Although mutton is the most important source of protein in Iran, meat production from the sheep does not cover the increasing consumer demand. On the other hand, increase in sheep number to increase meat production has been limited by low quality and quantity of forage range. Therefore, enhancing meat production should be achieved by selecting the animals that have maximum genetic merit as next generation parents. To design an efficient improvement program and genetic evaluation system for maximization response to selection for economically important traits, accurate estimates of the genetic parameters and the genetic relationships between the traits are necessary. Studies of various sheep breeds have shown that both direct and maternal genetic influences are of importance for lamb growth. When growth traits are included in the breeding goal, both direct and maternal genetic effects should be taken into account in order to achieve optimum genetic progress. The objective of this study was to estimate the variance components and heritability, for growth traits, by fitting six animal models in the Sangsari sheep using Gibbs sampling. Material and Method Sangsari is a fat-tailed and relatively small sized breed of sheep

  7. Bone turnover markers in sheep and goat: A review of the scientific literature

    Directory of Open Access Journals (Sweden)

    JOSÉ A. CAMASSA

    Full Text Available ABSTRACT Bone turnover markers (BTMs are product of bone cell activity and are generally divided in bone formation and bone resorption markers. The purpose of this review was to structure the available information on the use of BTMs in studies on small ruminants, especially for monitoring their variations related to diet, exercise, gestation and metabolic lactation state, circadian and seasonal variations, and also during skeletal growth. Pre-clinical and translational studies using BTMs with sheep and goats as animal models in orthopaedic research studies to help in the evaluation of the fracture healing process and osteoporosis research are also described in this review. The available information from the reviewed studies was systematically organized in order to highlight the most promising BTMs in small ruminant research, as well as provide a wide view of the use of sheep and goat as animal models in orthopaedic research, type of markers and commercial assay kits with cross-reactivity in sheep and goat, method of sample and storage of serum and urine for bone turnover markers determination and the usefulness and limitations of bone turnover markers in the different studies, therefore an effective tool for researchers that seek answers to different questions while using BTMs in small ruminants.

  8. Honey dressing in pediatric burns

    Directory of Open Access Journals (Sweden)

    Bangroo A

    2005-01-01

    Full Text Available The medicinal properties of honey have been recognized since antiquity. Although used as an adjuvant method of accelerating wound healing from ancient times, honey has been sporadically used in the treatment of burns. Honey acts mainly as a hyperosmolar medium and prevents bacterial growth. Because of its high viscosity, it forms a physical barrier, and the presence of enzyme catalase gives honey an antioxidant property. Its high-nutrient content improves substrate supply in local environment promoting epithelialization and angiogenesis. In pediatric burn patients no exclusive study has been conducted using honey as a burn dressing. An attempt is being made to evaluate the effect of honey in the management of burns in pediatric patients.

  9. Phoenix Society for Burn Survivors

    Science.gov (United States)

    ... Harman Award Hickey Award Advocacy Award Edge Servant Leadership Award Contact Information News & Media Phoenix Blog Who We Are Get Involved Ways to Give Our Vision | Uniting the voice of the burn community around the globe to profoundly advance lifelong ...

  10. Prescribed burning: a topical issue

    Directory of Open Access Journals (Sweden)

    Bovio G

    2013-11-01

    Full Text Available Prescribed burning is a promising technique for the prevention of forest fires in Italy. The research deepened several ecological and operative aspects. However, legal issues need to be thoroughly investigated.

  11. Chemistry of Cigarette Burning Processes

    Directory of Open Access Journals (Sweden)

    Chen P

    2014-12-01

    Full Text Available Cigarette-burning and the smoke-formation processes and smoke composition are important topics for understanding cigarette performance. This paper proposes the molecular formulas representing the active components of bright, burley, and Oriental tobaccos and a basic chemistry model of the cigarette burning processes. Previous knowledge of the cigarette burning processes and smoke formation helped to establish parameters in deriving the basic chemistry equations. The proposed chemistry provides a brief view of the mechanisms of the cigarette burning during puffing and interpuff smoldering, and can be used to interpret and predict the smoke composition for cigarettes made from bright, burley, and Oriental tobaccos. Based on the proposed chemistry, the effect of ventilation on smoke component deliveries is discussed and the reaction heat of the puffing process is estimated.

  12. Multivariate analysis of morphostructural characteristics in Nigerian indigenous sheep

    Directory of Open Access Journals (Sweden)

    Abdulmojeed Yakubu

    2011-04-01

    Full Text Available The population variability of three breeds of Nigerian sheep was investigated using multivariate discriminant analyses. The sampled populations comprised mature 331 Yankasa, 296 Uda and 166 Balami sheep kept by traditional farmers in northern Nigerian. A total of ten morphological traits (withers height, rump height, body length, face length, rump length, tail length, chest circumference, head width, shoulder width and rump width were collected on each animal. The body measures of Balami sheep were significantly higher (P<0.05 than the others with the exception of tail length. Uda sheep also had comparative advantage over their Yankasa counterparts in all the morphological traits analysed. The stepwise discriminant analysis revealed that head width chronologically followed by tail length, chest circumference and body length were more discriminating in separating the three populations. The Mahalanobis distance between Yankasa and Balami sheep was highest (4.83 while the least differentiation was observed between Uda and Yankasa sheep (1.79. Nearest neighbour discriminant analysis showed that most Balami sheep (61.45% were classified into their source genetic group. While 41.22% of Uda sheep were misclassified as Yankasa sheep, 35.35% of Yankasa were wrongly assigned as Uda sheep, showing the level of genetic exchange that has taken place between the two breeds overtime. The present information could be complemented with genetic analyses geared towards designing appropriate breeding and selection strategies.

  13. Genetic and environmental variation in methane emissions of sheep at pasture.

    Science.gov (United States)

    Robinson, D L; Goopy, J P; Hegarty, R S; Oddy, V H; Thompson, A N; Toovey, A F; Macleay, C A; Briegal, J R; Woodgate, R T; Donaldson, A J; Vercoe, P E

    2014-10-01

    A total of 2,600 methane (CH4) and 1,847 CO2 measurements of sheep housed for 1 h in portable accumulation chambers (PAC) were recorded at 5 sites from the Australian Sheep CRC Information Nucleus, which was set up to test leading young industry sires for an extensive range of current and novel production traits. The final validated dataset had 2,455 methane records from 2,279 animals, which were the progeny of 187 sires and 1,653 dams with 7,690 animals in the pedigree file. The protocol involved rounding up animals from pasture into a holding paddock before the first measurement on each day and then measuring in groups of up to 16 sheep over the course of the day. Methane emissions declined linearly (with different slopes for each site) with time since the sheep were drafted into the holding area. After log transformation, estimated repeatability (rpt) and heritability (h(2)) of liveweight-adjusted CH4 emissions averaged 25% and 11.7%, respectively, for a single 1-h measurement. Sire × site interactions were small and nonsignificant. Correlations between EBV for methane emissions and Sheep Genetics Australia EBV for production traits were used as approximations to genetic correlations. Apart from small positive correlations with weaning and yearling weights (r = 0.21-0.25, P methane EBV (calculated from a model adjusting for liveweight by fitting separate slopes for each site). To improve accuracy, future protocols should use the mean of 2 (rpt = 39%, h(2) = 18.6%) or 3 (rpt = 48%, h(2) = 23.2%) PAC measurements. Repeat tests under different pasture conditions and time of year should also be considered, as well as protocols measuring animals directly off pasture instead of rounding them up in the morning. Reducing the time in the PAC from 1 h to 40 min would have a relatively small effect on overall accuracy and partly offset the additional time needed for more tests per animal. Field testing in PAC has the potential to provide accurate comparisons of animal and

  14. Integrated parasite management: products for adoption by the Australian sheep industry.

    Science.gov (United States)

    Kahn, L P; Woodgate, R G

    2012-05-04

    The increasing cost of production loss caused by gastrointestinal nematodes (GIN) highlights the importance of good control programs. However, the endemic nature of anthelmintic resistance also reminds of the need for nonchemical options. Both chemical and nonchemical control options need to be integrated into regional parasite management programs (IPM) with the emphasis on component options determined by factors such as major GIN species, regional climate, property size and enterprise structure. The Integrated Parasite Management of Sheep project was established to develop and demonstrate regional parasite control programs, that integrated chemical and nonchemical options, for the main sheep-producing regions of Australia. The project included research about the ecology of the main endo and ecto-parasites of sheep and a national survey of parasite control practices by sheep producers. IPM approaches developed for two contrasting regions of Australia are discussed. Barriers for the adoption of IPM programs include perceived complexity associated with a multi-component approach, time requirements and difficulty. Facilitating the industry adoption of IPM programs is discussed with relevance to the use of small group extension and involvement of the commercial sector. Perceptions of complexity of IPM may be managed by facilitating adoption of components in a step-wise process such that learning outcomes accumulate over time. Extension efforts must address the needs of industry sectors other than sheep producers and explore user pay approaches. The success of these approaches will depend on the relation of the extra profit to producers, through adoption of IPM programs, with remuneration sufficient to attract a commercial service. Crown Copyright © 2011. Published by Elsevier B.V. All rights reserved.

  15. THE EFFECTS OF VEGETABLE LECITHIN ON SOME SANGUINE BIOCHEMICAL PARAMETERS AT LACTATING SHEEP AND GOATS

    Directory of Open Access Journals (Sweden)

    D. DRINCEANU

    2008-05-01

    Full Text Available From a complex experiment of establishing the effects of lecithin supplemented in the diet of small ruminants, in this paper we present the influence of lecithin on some sanguine biochemical parameters at lactating sheep and goat. The researches were made on a experimental group formed by 5 sheep from łurcana breed and 5 goats from Crapatina breed, which were fed in the first experimental period with a base ratio (Br formed by 1.5 kg of hill hay and 0.2 kg concentrate forage mixture, in the second experimental period the Br was supplemented with 100 g lecithin/day/animal. At the end of each experimental period were taken blood samples to establish some biochemical parameters from sanguine serum. The supplementation of base ration with 100 g lecithin/day/animal at lactating sheep and goats did not produced significant changes to values of total proteins (TS, albumin, creatinine, urea and total bilirubins (TB from sanguine serum. Contrary to expectation the cholesterol and triglycerides were higher than normal both in sheep (from 82 mg/dl to 83 mg/dl for cholesterol and from 23 mg/dl to 45 mg/dl for triglycerides but specially in goats (from 59 mg/dl to 68 mg/dl for cholesterol and from 24 mg/dl to 55 mg/dl for triglycerides. Were registered significant increment of activity of alkaline phosphatase and in γ – GT and a decrease of plasmatic activity of pancreatic α-amylase both in sheep and goats.

  16. Enterolobium contortisiliquum is a cause of acute ruminal acidosis in sheep.

    Science.gov (United States)

    Pupin, Rayane C; Leal, Paula V; Lima, Stephanie C; Melo, Gleice Kelli A; Pott, Arnildo; Araújo, Marcelo A; Barros, Claudio S L; Lemos, Ricardo A A

    2017-02-01

    The ingestion of pods of Enterolobium contortisiliquum is associated with digestive disturbances, photosensitivity and abortion in domestic ruminants. This experiment was designed to test the hypothesis that digestive disturbances in this toxicosis are really caused by acute ruminal acidosis. Three sheep fed large doses (10-15 g/kg/body weight [bw]) of E. contortisiliquum pods developed ruminal acidosis and were treated with sodium bicarbonate to try to control this metabolic disturbance, thus providing additional evidence of the involvement of ruminal acidosis in the pathogenesis of toxicosis. Two of the sheep died, and one recovered after treatment. In the two sheep that developed severe signs of ruminal acidosis, the values of blood lactate were 18 mg/dL and 196.88 mg/dL, indicating metabolic acidosis as the cause of death. Additionally, four sheep developed elevated serum levels of aspartate aminotransferase and gamma glutamyl transferase, indicating that the pods had hepatotoxic effects. Necropsy findings included the accentuation of the hepatic lobular pattern and multiple focally extensive red areas in the rumen mucosa and on the surface of the liver. Repeated ingestion of small doses induced tolerance but did not induce cumulative effects. Histopathologically, the epithelial mucosa of the rumen and reticulum exhibited swollen and vacuolated epithelia with intraepithelial pustules. Focal ulceration of the mucosa was also observed. Multifocal vacuolar degeneration of hepatocytes and scattered individual hepatocellular necrosis were evident in the liver. We concluded that the main clinical manifestation of intoxication by E. contortisiliquum pods in sheep was acute ruminal lactic acidosis and metabolic acidosis. Ingestion of repeated sublethal doses could stimulate proliferation of the ruminal fauna that degrades the sugar present in the pods, and thereby prevent the occurrence of ruminal acidosis. The plant is also hepatotoxic, and no abortions were

  17. [Experiences with the FAMACHA-Eye-Colour-Chart for identifying sheep and goats for targeted anthelmintic treatment].

    Science.gov (United States)

    Koopmann, Regine; Holst, Christine; Epe, Christian

    2006-01-01

    The bloodsuckling abomasal parasite Haemonchus contortus is the most pathogenic worm in sheep and goats. High prevalences of anthelmintic-resistant isolates make H. contortus difficult to control. Detecting the most anaemic animals could support a targeted selective treatment approach. Leaving the rest of the flock untreated would generate a refuge for anthelmintic-sensitive parasites. South-African researchers tried the FAMACHA-Eye-Colour-Chart for anaemic sheep and goats with good success. Field studies, carried out in Northern Germany on naturally infected sheep and goats showed, that at a comparatively low prevalence of H. contortus the FAMACHA-test proved not being sufficient in detecting all animals with high fecal egg counts. Under these conditions there was no satisfying reliability to identify small ruminants for selective deworming only based on the FAMACHAEye-Colour-Test. But if not working hours are the limiting factor, the repeated score could support the selection of pale animals in need to be treated.

  18. Infection of Parainfluenza type 3 (PI-3 as one of the causative agent of pneumonia in sheep and goats

    Directory of Open Access Journals (Sweden)

    Indrawati Sendow

    2002-03-01

    Full Text Available Serological survey was conducted to obtain the prevalence of Parainfluenza type 3 (PI-3 reactor as one of the causative agent of pneumonia in sheep and goats in abatoir at Jakarta and some small holder farms in Indonesia. Serological test using serum neutralization from 724 goat sera and 109 sheep sera indicated that only 1% of goats were serologically reactors and none of sheep sera had antibodies against PI-3 virus. Isolation of the virus from 56 bronchus and trachea swab and 345 lungs indicated that only one sampel from lung showed cythopathic effect (CPE in Madin Darby Bovine Kidney (MDBK cell lines identification of the virus using serum neutralization test indicated that the virus neutralized reference PI-3 antisera. The isolate came from one lung (7% of 24 that showed histopathologically pneumonia intertitialis that usually caused by viral infection.

  19. PrP(d) accumulation in organs of ARQ/ARQ sheep experimentally infected with BSE by peripheral routes.

    Science.gov (United States)

    Lezmi, Stéphane; Ronzon, Frédéric; Bencsik, Anna; Bedin, Alexandre; Calavas, Didier; Richard, Yves; Simon, Stéphanie; Grassi, Jacques; Baron, Thierry

    2006-01-01

    To study the pathogenesis of bovine spongiform encephalopathy infection in small ruminants, two Lacaune sheep with the AA136RR154QQ171 and one with the AA136RR154RR171 genotype for the prion protein, were inoculated with a brain homogenate from a French cattle BSE case by peripheral routes. Sheep with the ARQ/ARQ genotype are considered as susceptible to prion diseases contrary to those with the ARR/ARR genotype. The accumulation of disease-associated prion protein (PrP(d)) was analysed by biochemical and immunohistochemical methods. No PrP(d) accumulation was detected in samples from the ARR/ARR sheep 2 years post inoculation. In the two ARQ/ARQ sheep that had scrapie-like clinical symptoms, PrP(d) was found in the central, sympathetic and enteric nervous systems and in lymphoid organs. Remarkably, PrP(d) was also detected in some muscle types as well as in all peripheral nerves that had not been reported previously thus revealing a widespread distribution of BSE-associated PrP(d) in sheep tissues.

  20. Electrothermal Ring Burn - Case Report

    Directory of Open Access Journals (Sweden)

    Yakup Çil

    2012-09-01

    Full Text Available Low-voltage fountainheads such as car, tractor or motorcycle batteries are predisposed to produce large currents. Any metal object that comes into contact with these batteries may result in short-circuit. This may result in rapid and excessive heating of metal object and an electrothermal burn. Herein we presented a motorcycle driver who was 28-year-old man with electrothermal ring burn which was caused by metal chain that was used as a ring.

  1. Chemical burns: pathophysiology and treatment.

    Science.gov (United States)

    Palao, R; Monge, I; Ruiz, M; Barret, J P

    2010-05-01

    Chemical burns continue to pose a variety of dilemmas to the clinician managing such cases. Assessment of burn depth is often difficult and the decision whether to excise the wound early is not always clear-cut. In this updated review, common agents are classified and the basic principles of management and specific recommendations are examined. The complications arising from exposure to these chemicals and the supportive measures needed during treatment are also described. Copyright 2009 Elsevier Ltd and ISBI. All rights reserved.

  2. INNOVATION IN BRAZILIAN SMALL COMPANIES

    National Research Council Canada - National Science Library

    Rodrigues, Tonny Kerley de Alencar; Lira, Átila De Melo; Naas, Irenilza De Alencar

    2015-01-01

    .... And the data confirms that small Brazilian companies generally have difficulties to sell their innovations. Keywords: innovation, small enterprises, patents. 1. INTRODUCTION Companies worldwide are looking to technological innovation as feasible for your market expansion (BURNS; STALKER, 1961; NELSON, 1993) alternative. In Brazil, the change an...

  3. Expression of conditioned preference for low-quality food in sheep is modulated by foraging costs.

    Science.gov (United States)

    Catanese, F; Distel, R A; Villalba, J J

    2015-06-01

    Past positive experiences can increase herbivores' motivation to eat low-quality foods. However, this is not always translated into a higher preference for low-quality foods in choice tests among foods of higher nutritional quality. Foraging behavior is also affected by properties of the feeding context because the quality and abundance of foods in nature change in time and space. We hypothesized that in a choice situation, the expression of a past positive experience with a low-quality food is modulated by the costs associated with selecting a high-quality food option. A total of 24 sheep were randomly assigned into two groups (n=12). During conditioning phase, one group (CS+; i.e., conditioned group) was fed with oat hay (a low-quality food) for 20 min and immediately after a ration of soybean meal (a nutritious food), whereas the other group was also fed with oat hay but the offer of soybean meal was delayed 5 h (CS-; i.e., control group). After conditioning, we assessed sheep motivation to eat the oat hay in an experimental arena in which accessibility to alfalfa hay (a high-quality food) was increasingly restricted. When alfalfa hay was readily accessible, CS+ and CS- sheep almost exclusively selected this food, showing a small and similar preference for oat hay. However, when accessibility to alfalfa hay decreased, intake and selection of oat hay was greater in the CS+ sheep than in the CS- sheep. The latter was a consequence of differential changes in behavior between groups; for example, sheep in CS+ spent more time foraging oat hay and were more likely to switch to oat hay if they had previously been eating alfalfa hay than sheep in CS-. Our results show that behavioral expression of the conditioned preference for a low-quality food depends on parameters of the feeding context (e.g., availability). We suggest that this can be the link between learning models and optimal foraging models of diet selection.

  4. Identification of smallholder farmers and pastoralists' preferences for sheep breeding traits: choice model approach.

    Science.gov (United States)

    Duguma, G; Mirkena, T; Haile, A; Okeyo, A M; Tibbo, M; Rischkowsky, B; Sölkner, J; Wurzinger, M

    2011-12-01

    Identification of breeding objective traits pertinent to specific production environments with the involvement of target beneficiaries is crucial to the success of a breed improvement program. A choice experiment was conducted in four locations representing different production systems and agro-ecologies that are habitat to four indigenous sheep breeds (Afar, Bonga, Horro and Menz) of Ethiopia with the objective of identifying farmers'/pastoralists' preferences for sheep breeding traits. Following a synthesis of secondary information and diagnostic surveys, two communities per location consisting of 60 households each having at least four breeding ewes were identified. Producers' priority attributes used in the choice sets were identified through in-depth production system studies conducted from December 2007 to March 2008. On the basis of prior information, four to seven attributes were used to design choice sets with different profiles in order to capture results that mimic real life of the different communities. The attributes and levels chosen for the sheep profile were as follows: body size (large/small), coat color (brown/white/black), tail type (good/bad) for both rams and ewes; horn (polled/horned) and libido (active/poor) for rams; and lambing interval (three lambings in 2 years/two lambings in 2 years time), mothering ability (good mother/bad mother), twinning rate (twin bearer/single bearer) and milk yield (two cups per milking/one cup per milking) for ewes. A fractional factorial design was implemented to construct the alternatives included in the choice sets. The design resulted in a randomized selection of 48 sheep profiles (24 sets) for both sexes, which were grouped into four blocks with six choice sets each. An individual respondent was presented with one of the four blocks to make his/her choices. Results indicate that producers' trait preferences were heterogeneous except for body size in rams and mothering ability in ewes where nearly

  5. DIFFERENTIATING PERIMORTEM AND POSTMORTEM BURNING

    Directory of Open Access Journals (Sweden)

    Brahmaji Master

    2015-01-01

    Full Text Available One of the most challenging cases in forensic medicine is ascertaining the cause of death of burnt bodies under suspicious circumstances. The key questions that arise at the time of investigation include: 1  Was the person alive or dead prior to fire accident?  Did the victim die because of burn?  If death was not related to burns, could burns play a role in causing death?  Were the burns sustained accidentally, did the person commit suicide or was the person murdered?  Are the circumstances suggesting an attempt to conceal crime?  How was the fire started?  How was the victim identified?  In case of mass fatalities, who died first? Postmortem burning of corpses is supposed to be one of the ways to hide a crime. Differentiating the actual cause of death in burn patients is therefore important. Medical examiners usually focus on the defining the changes that occur in tissues while forensic anthropologists deal with the changes related to the bone with or without any the influence of other tissues. Under the circumstances of fire, differentiating the perimortem trauma from that of postmortem cause of bone fractures is vital in determining the cause and motive of death

  6. Chemical and Common Burns in Children.

    Science.gov (United States)

    Yin, Shan

    2017-05-01

    Burns are a common cause of preventable morbidity and mortality in children. Thermal and chemical burns are the most common types of burns. Their clinical appearance can be similar and the treatment is largely similar. Thermal burns in children occur primarily after exposure to a hot surface or liquid, or contact with fire. Burns are typically classified based on the depth and total body surface area, and the severity and onset of the burn can also depend on the temperature and duration of contact. Chemical burns are caused by chemicals-most commonly acids and alkalis-that can damage the skin on contact. In children, the most common cause of chemical burns is from household products such as toilet bowl cleaners, drain cleaners, detergents, and bleaches. Mild chemical burns generally cause redness and pain and can look similar to other common rashes or skin infections, whereas severe chemical burns are more extreme and may cause redness, blistering, skin peeling, and swelling.

  7. Impact of hand burns on health-related quality of life in children younger than 5 years.

    Science.gov (United States)

    Palmieri, Tina L; Nelson-Mooney, Kate; Kagan, Richard J; Stubbs, Teresa K; Meyer, Walter J; Herndon, David N; Hinson, Michelle I; Lee, Austin F; Li, Nien-Chen; Kazis, Lewis E; Tompkins, Ronald G

    2012-09-01

    The purpose of this multicenter study was to evaluate the impact of hand burn injury in preschool children younger than 5 years on health-related quality of life, including both physical and psychosocial function, in the 5 years after burn injury. This prospective case series assessed children younger than 5 years admitted to four pediatric burn centers. Each child's family completed the American Burn Association/Shriners Hospitals for Children Burn Outcome Questionnaire (BOQ), a validated and reliable assessment tool, which measures the physical and psychosocial functioning of the child with burn injury ages 0 year to 5 years, at baseline, 3, 6, 12, 18, 24, 36, and 48 months after discharge. Multivariate models controlling for sociodemographic and clinical characteristics were developed, and recovery curves were generated for the time since burn using generalized estimating equations with random effects. A cohort of 438 patients was followed up prospectively. Mean (SD) patient age was 2.2 (1.2) years, mean (SD) total body surface area (TBSA) was 28% (22.4%), and 19% had inhalation injury. Children with hand burns had lower scores in most of the areas tested, with the most pronounced and significant differences were in fine motor function, gross motor function, and appearance. These findings applied to both small (burns. The most profound impact of hand burns was noted in fine and gross motor function during the 4 years of follow-up. Children with hand burns have significantly worse outcomes than do children with burns in other areas.

  8. Risk Factors Associated with Brucella Seropositivity in Sheep and Goats in Duhok Province, Iraq

    Directory of Open Access Journals (Sweden)

    Ali. G. Alhamada

    2017-12-01

    Full Text Available Sera from 432 small ruminants (335 sheep and 97 goats from 72 farms in Duhok Province, northern Iraq, were collected to investigate risk factors associated with brucellosis seropositivity. Serum samples were tested using the Rose Bengal test (RBT and an indirect enzyme-linked immunosorbent assay (iELISA. Using parallel interpretation, RBT and iELISA results showed that 31.7% (95% confidence interval (CI: 26.1, 36.3 of sheep and 34.0% (95% CI: 24.7, 44.3 of goats had antibodies against Brucella in the study area. A random-effects multivariable logistic regression model indicated that a higher chance of being seropositive (odds ratio (OR = 1.7; 95% 1.4; 2.2 was associated with an increase in the age of animals. The odds of Brucella seropositivity in flocks where sheep and goats grazed together was 2.0 times higher (95% CI: 1.08; 3.9 compared to flocks where sheep and goats grazed separately. The odds of Brucella seropositivity in small ruminants was 2.2 higher (95% CI: 1.2; 4.3 for animals originating from farms with a history of goat abortion in the preceding 12 months. In contrast, for every 1000 Iraqi Dinars (~0.85 US Dollar spent by the farmers on control of Brucella in their flocks, the odds of Brucella seropositivity decreased significantly (OR = 0.9, p-value = 0.021. The final model also indicated significant differences in Brucella seropositivity between the different districts of Duhok Province. This study provides a contribution to the epidemiology of brucellosis in small ruminants in northern Iraq.

  9. Pulsed-field gel electrophoresis profile homogeneity of Mycobacterium avium subsp. paratuberculosis isolates from cattle and heterogeneity of those from sheep and goats

    Directory of Open Access Journals (Sweden)

    Geijo Marivi

    2007-03-01

    Full Text Available Abstract Background Mycobacterium avium subsp. paratuberculosis (Map causes paratuberculosis in animals and is suspected of causing Crohn's Disease in humans. Characterization of strains led to classify paratuberculosis isolates in two main types, cattle type strains, found affecting all host species, and sheep type strains, reported affecting mainly sheep. In order to get a better understanding of the epidemiology of paratuberculosis a large set of Map isolates obtained from different species over the last 25 years have been characterized. Five-hundred and twenty isolates from different hosts (cattle, sheep, goats, bison, deer and wild boar and origins had been cultured and typed by IS1311 restriction-endonuclease-analysis. Two-hundred and sixty-nine isolates were further characterized by pulsed-field gel electrophoresis (PFGE using SnaBI and SpeI endonucleases. Differences in strain isolation upon various media conditions were also studied. Results All bovines, 4 and 26% of Spanish sheep and goats, respectively, and the deer and wild boar studied, carried IS1311-Cattle type strains. IS1311-Sheep type encompassed 96% and 74% of Spanish sheep and goats, and all three Portuguese sheep. Thirty-seven distinct multiplex PFGE profiles were found, giving 32 novel profiles. Profiles 2-1 and 1-1 accounted for the 85% of cattle isolates. Ten distinct profiles were detected in Spanish sheep, none of them with an incidence higher than 25%. Profile 16-11 (43% and another three profiles were identified in Spanish caprine cultures. The hierarchical analysis, clustered all profiles found in cattle, "wild" hosts and some small ruminants within the same group. The other group included 11 profiles only found in Spanish sheep and goats, including Spanish pigmented profiles. Differences in growth requirements associated with isolate genotype were observed. Conclusion Cattle in Spain are infected with cattle type strains, while sheep and goats are mainly infected

  10. Heat Emission from a Burning Cigarette

    OpenAIRE

    Miura K; Nagao A; Ueyama K

    2014-01-01

    We investigated the relationship between the smoldering burn rate and the heat transfer from a burning cigarette by measuring the heat emitted by radiation and convection, separately. The net heat generated and the net heat emitted by a burning cigarette did not vary with a change of the cigarette smoldering burn rate. The total heat emitted from a statically burning cigarette was about 50% of the total combustion heat. About 50% of the heat emitted was released as radiation heat. The smolder...

  11. Cytogenetical anchoring of sheep linkage map and syntenic groups using a sheep BAC library

    Directory of Open Access Journals (Sweden)

    Cribiu Edmond-Paul

    2000-07-01

    Full Text Available Abstract In order to simultaneously integrate linkage and syntenic groups to the ovine chromosomal map, a sheep bacterial artificial chromosome (BAC library was screened with previously assigned microsatellites using a sheep-hamster hybrid panel and genetic linkage. Thirty-three BACs were obtained, fluorescently labelled and hybridised on sheep-goat hybrid metaphases (2n = 57. This study allowed us, (i, to anchor all linkage groups on sheep chromosomes, (ii, to give information on the probable position of the centromere on the linkage map for the centromeric chromosomes, (iii, to contradict the previous orientation of the ovine × linkage group by the mapping of BMS1008 on OARXq38. Concerning our somatic cell hybrid panel, this study resulted in the assignment of all the previously unassigned groups to ovine chromosomes and a complete characterisation of the hybrid panel. In addition, since hybridisations were performed on a sheep-goat hybrid, new marker/anchoring points were added to the caprine cytogenetic map.

  12. Mycobacterium avium subsp. paratuberculosis sheep strains isolated from Cyprus sheep and goats.

    Science.gov (United States)

    Liapi, M; Botsaris, G; Slana, I; Moravkova, M; Babak, V; Avraam, M; Di Provvido, A; Georgiadou, S; Pavlik, I

    2015-04-01

    Paratuberculosis, caused by Mycobacterium avium subsp. paratuberculosis (Map), is a chronic incurable infection of intestinal tract of animals. Molecular characterization of Map isolates classifies them into two major groups, 'Cattle' or Type II and 'Sheep' or Type I/III with a different phenotype, epidemiology, virulence and pathogenesis. The aim of this study was to examine 192 Map ELISA-positive sheep and goats from Cyprus using faecal culture and genotype Map isolates using IS1311 PCR and restriction endonuclease analysis (IS1311 PCR-REA) with HinfI restriction enzyme. Map was isolated from only four (4.6%) faecal samples out of 88 sheep and 15 (14.4%) faecal samples out of 104 goats. Genotyping of the isolates using IS1311 PCR-REA revealed that sheep and goat populations on the island are infected primarily by 'Sheep' strains. Only three Map isolates from goats originated from one farm were characterized as 'Cattle' strains. © 2013 Blackwell Verlag GmbH.

  13. Burn plasma transfer induces burn edema in healthy rats.

    Science.gov (United States)

    Kremer, Thomas; Abé, Dorotheé; Weihrauch, Marc; Peters, Christopher; Gebhardt, Martha Maria; Germann, Guenter; Heitmann, Christoph; Walther, Andreas

    2008-10-01

    Thermal injuries greater than 20% body surface area (BSA) result in systemic shock with generalized edema in addition to local tissue destruction. Burn shock is induced by a variety of mediators, mainly immunomodulative cytokines. This experimental study evaluates if burn shock can be induced in healthy rats by transfer of burn plasma (BP) with mediators. Thermal injury was induced by hot water (100 degrees C water, 12 s, 30% BSA) in male syngenic Wistar rats. Donor rats were killed 4 h posttrauma, and BP was harvested. Burn plasma was transferred to healthy animals by continuous intravenous infusion in three types of dilution (100%, 10%, and 1%). Positive controls were directly examined 4 h after thermal injury, and negative control rats had a continuous infusion done with sham burn (SB) plasma (37 degrees C water, 12 s, 30% BSA). Afterwards, intravital fluorescence microscopy was performed in postcapillary mesenteric venules at 0, 60, and 120 min. Edema formation was assessed by relative changes over time in fluorescence intensity of fluorescein isothiocyanate-albumin in the intravascular versus the extravascular space. The interactions of leucocytes and endothelium were evaluated by quantification of leukocyte sticking. Additionally, microhemodynamic (volumetric blood flow, erythrocyte velocity, venular wall shear rate, venular diameters) and macrohemodynamic parameters (blood pressure, heart frequency, temperature) were assessed online (arterial catheter). For statistics, an ANOVA was performed with Bonferroni adjustment procedure. Differences were considered significant when P edema formation remains uncertain and requires further investigation.

  14. Sheep models of polycystic ovary syndrome phenotype

    Science.gov (United States)

    Veiga-Lopez, Almudena

    2012-01-01

    Polycystic ovary syndrome (PCOS) is a fertility disorder affecting 5–7% of reproductive-aged women. Women with PCOS manifest both reproductive and metabolic defects. Several animal models have evolved, which implicate excess steroid exposure during fetal life in the development of the PCOS phenotype. This review addresses the fetal and adult reproductive and metabolic consequences of prenatal steroid excess in sheep and the translational relevance of these findings to PCOS. By comparing findings in various breeds of sheep, the review targets the role of genetic susceptibility to fetal insults. Disruptions induced by prenatal testosterone excess are evident at both the reproductive and metabolic level with each influencing the other thus creating a self-perpetuating vicious cycle. The review highlights the need for identifying a common mediator of the dysfunctions at the reproductive and metabolic levels and developing prevention and treatment interventions targeting all sites of disruption in unison for achieving optimal success. PMID:23084976

  15. Preliminary Evaluation of Slaughter Value and Carcass Composition of Indigenous Sheep and Goats from Traditional Production System in Tanzania

    Directory of Open Access Journals (Sweden)

    Dismas S. Shija

    2013-01-01

    Full Text Available The aim of the pilot study was to evaluate slaughter characteristics and carcass composition of indigenous long fat tailed sheep and Small East African goats purchased from the auction markets slaughtered at 1.5 to 2 yrs of age and 20 kg to 25 kg live weight. The animals were slaughtered according to halal standard procedures. The left half carcasses were jointed into eight wholesale joints, and dissected into muscles, fat and bone, which were weighed separately. Sheep had greater (p<0.05 slaughter BW (22.29 kg vs 20.50 kg and empty BW (20.17 kg vs 18.67 kg than goats (p<0.05. Dressing percentages were lower (p<0.001 in sheep than goats when carcass weight was expressed as percentage of slaughter BW (42.31% and 47.15% and empty BW (46.75% and 51.79%. Sheep carcasses had lower (p<0.001 proportion (66.18% vs 71.64% of muscles and higher (p<0.001 proportion of fat (7.41% vs 3.44% than goat carcasses. Sheep had proportionally lighter (p<0.001 shoulder (18.89% vs 22.68% and heavier (p<0.05 proportion of chump (7.916% vs 6.76% and main rib (8.12% vs 7.07%. Sheep had more (p<0.001 muscles in the leg (28.83% vs 27.08% and main rib (7.62% vs 6.36% than goats. Sheep had less (p<0.001 muscles (20.28% vs 23.56% in shoulder joints when expressed as percentage of total muscle of carcasses. It is concluded that there are differences in sheep and goat both in terms of carcass and joint yields and composition. The present study also implies that there is need to consider setting different meat cuts and prices for these cuts when one takes into account the differences in muscle distribution within joints in sheep and goats.

  16. Adipose tissue cells in cold-acclimatised sheep.

    Science.gov (United States)

    Cox, R W; Leat, W M; Chauca, D; Peacock, M A; Bligh, J

    1978-07-01

    The morphology and lipid content of adipose tissue from sheep subjected to cold acclimatisation were examined. In two sheep the perirenal adipose tissue contained virtually no triglyceride (less than 2 mg/100 mg wet tissue) and the appearance on electron microscopy was typical of that of a depleted white fat cell. The morphological, chemical and physiological evidence indicates that, in the sheep, white adipose tissue does not revert to brown adipose tissue during depletion resulting from cold acclimatisation.

  17. Revealing the history of domesticated sheep using retrovirus integrations

    DEFF Research Database (Denmark)

    Chessa, Bernado; Pereira, Filipe; Arnaud, Frederick

    2009-01-01

    The domestication of livestock represented a crucial step in human history. By using endogenous retroviruses as genetic markers, we found that sheep differentiated on the basis of their "retrotype" and morphological traits dispersed across Eurasia and Africa via separate migratory episodes. Relicts...... production traits, shaped the great majority of present-day breeds. The ability to differentiate genetically primitive sheep from more modern breeds provides valuable insights into the history of sheep domestication...

  18. Encephalitic Sarcocystosis and its Prophylactic Treatment in Sheep

    OpenAIRE

    ÖZMEN, Özlem; ŞAHİNDURAN, Şima; HALIGÜR, Mehmet; YUKARI, Bayram Ali; Dorrestein, Gerry M

    2009-01-01

    The aim of this study was to examine the clinical and pathological findings in sheep naturally infected with severe encephalitic sarcocystosis and to evaluate the prophylactic effect of amprolium on the disease. From a flock of approximately 350 animals, 10 sheep were referred to the Veterinary Faculty Clinic with neurological symptoms that developed during the previous 2 weeks. These 10 sheep were clinically and pathologically examined, and the remaining animals in the flock without neurolog...

  19. LA50 in burn injuries

    Science.gov (United States)

    Seyed-Forootan, K.; Karimi, H.; Motevalian, S.A.; Momeni, M.; Safari, R.; Ghadarjani, M.

    2016-01-01

    Summary Burn injuries put a huge financial burden on patients and healthcare systems. They are the 8th leading cause of mortality and the 13th most common cause of morbidity in our country. We used data from our Burn Registry Program to evaluate risk factors for mortality and lethal area fifty percent (LA50) in all burn patients admitted over two years. We used multiple logistic regressions to identify risk factors for mortality. LA50 is a reliable aggregate index for hospital care quality and a good measure for comparing results, also with those of other countries. 28,690 burn patients sought medical attention in the Emergency Department, and 1721 of them were admitted. Male to female ratio was 1,75:1. 514 patients were under 15 years old. Median age was 25 (range: 3 months – 93 years). Overall, probability of death was 8.4%. LA50 was 62.31% (CI 95%: 56.57-70.02) for patients aged 15 and over and 72.52% (CI 95%: 61.01-100) for those under 15. In the final model, we found that Adjusted OR was significant for age, female sex, TBSA and inhalation injury (P < 0.05). LA50 values showed that children tolerate more extensive burns. Female sex, burn size, age and inhalation injury were the main risk factors for death. Authorities should pay special attention to these variables, especially in prevention programs, to reduce mortality and improve patient outcome. Children have better outcome than adults given equal burn size. Suicide rates are higher for women than men in our country PMID:27857645

  20. Burn Patient Expectations from Nurses

    Directory of Open Access Journals (Sweden)

    Sibel Yilmaz sahin

    2014-02-01

    Full Text Available AIM: Burn is a kind of painful trauma that requires a long period of treatment and also changes patients body image. For this reason, nursing care of burn patients is very important. In this study in order to provide qualified care to the burned patients, patient and #8217;s expectations from nurses were aimed to be established. METHODS: Patients and #8217; expectations were evaluated on 101 patients with burn in Ministry of Health Ankara Numune Education and Research Hospital Burn Service and Gulhane Military Medical Academy Education and Research Hospital Burn Center. A questionnaire which was developed by the researchers was used for collecting data. The questions on the questionnaire were classified into four groups to evaluate the patients and #8217; expectations about communication, information, care and discharge. Data was evaluated by using SPSS 12 package software. RESULTS: In this study, 48.5% of patients were at 18-28 age group, 79.2% were male and 51.5% of patients were employed. Almost all of patients expect nurses to give them confidence (98% and to give them information about latest developments with the disease. Patients prior expectation from nurses about care was to do their treatments regularly (100% and to take the necessary precautions in order to prevent infection (100%. 97% of patient expect nurses to give them information about the drugs, materials and equipment that they are going to use while discharge. CONCLUSION: As a result we found that burn patient expectations from nurses about communication, information, care and discharge were high. [TAF Prev Med Bull 2014; 13(1.000: 37-46

  1. Accuracy of the FAMACHA system for on-farm use by sheep and goat producers in the southeastern United States.

    Science.gov (United States)

    Burke, J M; Kaplan, R M; Miller, J E; Terrill, T H; Getz, W R; Mobini, S; Valencia, E; Williams, M J; Williamson, L H; Vatta, A F

    2007-06-20

    FAMACHA is a practical on-farm system designed to provide small ruminant producers a tool for improving their management of Haemonchus contortus infections. Although this system has become very popular and widely accepted by small ruminant producers in many regions of the southern United States, there is very limited data reported on the effectiveness of the FAMACHA system when performed by farmers. The objective of this study was to evaluate the accuracy of the FAMACHA system for on-farm use by small ruminant producers during the summer season. Small ruminant producers from Georgia, Louisiana, Florida, and Puerto Rico were trained to use the FAMACHA system by veterinarians and scientists experienced with this method. FAMACHA scores were assigned at least every 2 weeks by producers to weaned and mature sheep (n=552) and goats (n=676) of various breeds and ages between April and September 2004. At intervals that varied among farms from 2 to 8 weeks, researchers determined body condition scores (BCS; 1=thin and 5=fat) and collected blood and feces from a group of animals selected randomly to determine packed cell volume (PCV) and fecal egg counts (FEC). Two separate anemia thresholds were evaluated; these were defined by either FAMACHA score (>or=3 versus >or=4) or PCV (FAMACHA scores and PCV or FEC was high for both sheep and goats (PFAMACHA scores of 4 and 5 were considered anemic, but sensitivity was low. Sensitivity for detecting anemic animals was 50% for sheep and 89% for goats when eye score values of >or=3 were considered anemic and PCV cutoff was FAMACHA evaluation) was less than 5% in sheep and less than 1% in goats when FAMACHA scores>or=3 were considered anemic and PCV cutoff was FAMACHA method used by producers is a valuable tool for identifying anemic sheep and goats in the southern United States and Puerto Rico.

  2. Sensitivity and specificity of the FAMACHA(©) system in Suffolk sheep and crossbred Boer goats.

    Science.gov (United States)

    Sotomaior, Cristina Santos; Rosalinski-Moraes, Fernanda; da Costa, Alane Rayana Barbosa; Maia, Dhéri; Monteiro, Alda Lúcia Gomes; van Wyk, Jan A

    2012-11-23

    Sheep and goats are the species of farm animal with the highest growth rate in Paraná State. The main problems facing Paraná State flocks are gastrointestinal parasites and anthelmintic resistance. One of the newest resources used to slow down the development of anthelmintic resistance is the FAMACHA(©) system, a selective method useful for controlling gastrointestinal verminosis in small ruminants. The purpose of the present research was to evaluate the sensitivity and specificity of the FAMACHA(©) system in sheep and goats and to compare the results for both species. The conjunctivae of 83 Suffolk ewes and 60 adult crossbred Boer does were evaluated by the same trained person using the FAMACHA(©) system. The packed cell value (PCV) served as the gold standard for clinical FAMACHA(©) evaluation. To calculate the sensitivity and specificity of the FAMACHA(©) system, different criteria were adopted in turn: animals classified as FAMACHA(©) (F(©)) 4 and 5, or 3, 4 and 5, were considered to be anemic (positive test), and animals classified as F(©)1, 2 and 3, or 1 and 2 were considered to be non-anemic (negative test). Three standard values of PCV, namely ≤19%, ≤18% or ≤15%, were used to confirm anemia. At all cut-off levels, the sensitivity increased if F(©)3 animals were included as being anemic. However, changes in levels of sensitivity were associated with reciprocal changes in specificity. The sensitivity was higher for sheep than for goats, excepting when the criteria included PCV≤18 and F(©)3, F(©)4 and F(©)5 were considered positive. In contrast, the specificity was always lower in sheep for any criteria adopted. Other than in goats, using the ≤15 cut-off level for sheep, it is possible to opt not to drench the animals that were shown to be F(©)3 because the sensitivity is still high, indicating that few animals that should have been drenched were overlooked. In goats, in contrast, the low sensitivity at all cut-off levels made it too

  3. ENTEROTOXIGENIC STAPHYLOCOCCUS AUREUS IN SHEEP RAW MILK

    OpenAIRE

    G. Giacinti; Amatiste, S.; A. Tammaro; D. Sagrafoli; G. Giangolini; R. Rosati

    2011-01-01

    A total of 366 raw milk samples from 30 sheep farms were examined quantitatively for Staphylococcus aureus. Enterotoxin production by strains of Staphylococcus aureus isolated was investigated. S. aureus was detected in 19 farms (63,3%). The ability to synthetise enterotoxins was found in ten strains (52,6%). Production of staphylococcal enterotoxins C (SEC) was recorded in 6 (60%) and production of SEC together with staphylococcal enterotoxin A (SEA) in 4 (40%) staphylococcal isolates. Raw m...

  4. Ocular injury secondary to sheep bile exposure

    Science.gov (United States)

    Okullo, Alfin Taddeo; Low, Tim; Baker, Louise Leslie

    2012-01-01

    A 57-year-old abattoir worker was seen at a general practitioner after sheep bile splashed into his left eye. Flourescein examination revealed extensive ulceration involving at least two-thirds of the corneal surface. Copious irrigation with normal saline, application of chloramphenicol ointment and an eye patch resulted in excellent healing within 2 days with return to normal vision for the patient thereafter. PMID:23208813

  5. First Molecular Identification and Genetic Characterization of Theileria lestoquardi in Sheep of the Maghreb Region.

    Science.gov (United States)

    Rjeibi, M R; Darghouth, M A; Rekik, M; Amor, B; Sassi, L; Gharbi, M

    2016-06-01

    Theileria lestoquardi is the most prominent Theileria species in small ruminants that causes malignant theileriosis of sheep in Africa and Asia. In the present survey, blood samples and ticks were collected in Kebili (southern Tunisia) from 166 Queue Fine de l'Ouest sheep. Giemsa-stained blood smears, immunofluorescent antibody test (IFAT) and PCR were performed. The DNA was extracted from blood and analysed by PCR targeting 18S rRNA gene of Theileria spp. and then sequenced. A total number of 140 ticks were collected from a total number of 166 sheep during the four seasons. The ticks belonged to two genera and 4 species; the most frequent tick was Hyalomma excavatum 84.3% (118/140) and then Rhipicephalus spp. 15.7% (22/140). Only two animals had positive Giemsa-stained blood smears, and they were also positive by IFAT. The amplicons had 99.3 and 99.6% homology with the BLAST published T. lestoquardi amplicons. To our knowledge, this is the first report of T. lestoquardi in small ruminants within the Maghreb region. © 2014 Blackwell Verlag GmbH.

  6. Atypical/Nor98 Scrapie Infectivity in Sheep Peripheral Tissues

    Science.gov (United States)

    Andréoletti, Olivier; Orge, Leonor; Benestad, Sylvie L.; Beringue, Vincent; Litaise, Claire; Simon, Stéphanie; Le Dur, Annick; Laude, Hubert; Simmons, Hugh; Lugan, Séverine; Corbière, Fabien; Costes, Pierrette; Morel, Nathalie; Schelcher, François; Lacroux, Caroline

    2011-01-01

    Atypical/Nor98 scrapie was first identified in 1998 in Norway. It is now considered as a worldwide disease of small ruminants and currently represents a significant part of the detected transmissible spongiform encephalopathies (TSE) cases in Europe. Atypical/Nor98 scrapie cases were reported in ARR/ARR sheep, which are highly resistant to BSE and other small ruminants TSE agents. The biology and pathogenesis of the Atypical/Nor98 scrapie agent in its natural host is still poorly understood. However, based on the absence of detectable abnormal PrP in peripheral tissues of affected individuals, human and animal exposure risk to this specific TSE agent has been considered low. In this study we demonstrate that infectivity can accumulate, even if no abnormal PrP is detectable, in lymphoid tissues, nerves, and muscles from natural and/or experimental Atypical/Nor98 scrapie cases. Evidence is provided that, in comparison to other TSE agents, samples containing Atypical/Nor98 scrapie infectivity could remain PrPSc negative. This feature will impact detection of Atypical/Nor98 scrapie cases in the field, and highlights the need to review current evaluations of the disease prevalence and potential transmissibility. Finally, an estimate is made of the infectivity loads accumulating in peripheral tissues in both Atypical/Nor98 and classical scrapie cases that currently enter the food chain. The results obtained indicate that dietary exposure risk to small ruminants TSE agents may be higher than commonly believed. PMID:21347349

  7. Toxoplasmosis of Goat and Sheep in Java

    Directory of Open Access Journals (Sweden)

    Tolibin Iskandar

    2008-09-01

    Full Text Available Toxoplasmosis is a parasitic disease, caused by Toxoplasma gondii attacking goat, sheep, and wild animals. This disease is zoonosis and widely distributed in many districts of Java and as a zoonotic disease. Cat is the definitive host of T. gondii, while sheep, goats, and humans are the intermediate hosts. The prevalence of toxoplasmosis in Java was between 7 to 84%, with an average of 42.9%. It occurs through out of the year and causes abortions and infertilities of infected animals. All breeds of goat and sheep, male and female are susceptible to T. gondii infections. In cat, T. gondii produces three types of infectious forms, i.e.: tropozoite, cyst, and oocyst, but in intermediate host, it produces tropozoite and cyst forms. The development of T. gondii in definitive host is by sexual and asexual, while in intermediate host only by asexual only. Toxoplasmosis in livestocks is subclinical signs and difficult to diagnose. The confirmation diagnose of T. gondii infection in animals should be conducted by laboratory examinations of the parasite on peritoneal fluid, heart muscles, skelet muscles and brain samples. Serological tests for antibody detection can be done by enzyme linked immunosorbent assays (ELISA. Toxoplasmosis is difficult to be controlled; the use of pyrimethamine drugs only kills tachyzoite form, but does not kill the cyst. Once the animals are infected, they would become carriers and sources of infections.

  8. Performance of sheep fed on annatto byproduct

    Directory of Open Access Journals (Sweden)

    Dorgival M. de Lima Júnior

    2014-08-01

    Full Text Available This study aimed to evaluate intake, digestibility, and performance in sheep fed increasing levels of annatto byproduct (AB. A total of 32 male sheep without defined breed were used. Their initial weight was 23.17±1.45 kg. The animals were housed in individual pens and offered feed twice a day. Nutrient intake was quantified by the difference between the fractions present in the offered feed and the remains. The apparent digestibility was estimated with the aid of the external marker LIPE®. Weight gain was measured by the difference between the initial and final weight of the animals. The intake of dry matter (DM; g/day; g/kg BW; g/kg0.75, organic matter (g/day, crude protein (CP; g/day, and neutral detergent fibre (g/day was not affected (P>0.05 by addition of AB. The intake of ether extract (EE; g/day and non-fibre carbohydrates (g/day was influenced by the inclusion of AB. The apparent digestibility of DM, organic matter, CP, and EE was not affected (P>0.05 by the addition of AB. The AB can be included in the diet at levels up 300 g/kg of total DM without affecting consumption, digestibility, and weight gain in sheep.

  9. Insulin alters the permeability of sheep pleura.

    Science.gov (United States)

    Kouritas, V K; Hatzoglou, C; Ioannou, M; Gourgoulianis, K I; Molyvdas, P A

    2010-05-01

    Insulin promotes ion transportation across epithelia, mainly kidneys, leading to water and electrolyte abnormalities, possibly causing 'insulin oedema syndrome', which rarely presents as pleural effusion. Direct stimulation of sheep pleura by insulin and the possible electrophysiology mechanisms involved were investigated. Sheep visceral and parietal pleural specimens were mounted between Ussing chambers. Insulin solutions (10 (-9) to 10 (-5) M), L-NAME, Nitroprussid sodium, amiloride and ouabain were used. Trans-mesothelial Resistance was determined. Immunohistochemistry for presence of Insulin Receptors was performed. Insulin increased Trans-mesothelial Resistance within 1st minute when added mesothelially of visceral (p=0.008) and parietal pleura (p=0.046) for concentrations higher than 10 (-7) M. L-NAME or Nitroprussid sodium didn't but amiloride and ouabain inhibited insulin's effect. Immunohistochemistry revealed the presence of Insulin Receptors. Insulin changes the permeability of sheep pleura by altering its electrophysiology and may interfere in pleural effusion formation. Involvement of Insulin Receptors may be suggested.

  10. Awassi sheep reproduction and milk production: review.

    Science.gov (United States)

    Talafha, Abdelsalam Q; Ababneh, Mohammed M

    2011-10-01

    Awassi is the local breed of sheep in Jordan and is the most important breed in the semi-arid regions of the near east countries. Awassi ram and ewe lambs reach puberty at around 8 and 9 months of age, respectively. The breeding season of Awassi ewes starts as early as April and lasts through September. After puberty, Awassi rams are sexually active throughout the year. The normal estrous cycle in Awassi ewes is 15-20 days (average 17 days). Estrus ranges from 16-59 h (average 29 h) during the breeding season. The reproductive performance of unimproved Awassi sheep has been low while improved Awassi has the highest fertility and milk production and are the heaviest among all Awassi populations. The gestation length varies from 149 to 155 days (average 152 days). Hormones that are commonly used for induction and synchronization of estrus in Awassi ewes include progestins, gonadotropins and PGF2α. An Awassi ewe produces 40-60 and 70-80 kg of milk per 150-day lactation period under traditional and improved production systems, respectively, in addition to the suckled milk left for lambs until weaning. The improved Awassi has the highest milk production among all Awassi populations and may reach 506 L over 214-day lactation period. The objective of this review is to summarize the reproductive pattern and milk production of Awassi sheep in the Middle East region.

  11. Helicobacter canis colonization in sheep: a Zoonotic link.

    Science.gov (United States)

    Swennes, Alton G; Turk, Michelle L; Trowel, Elise M; Cullin, Cassandra; Shen, Zeli; Pang, Jassia; Petersson, Katherine H; Dewhirst, Floyd E; Fox, James G

    2014-02-01

    Helicobacter canis has been associated with hepatobiliary and gastrointestinal disease in dogs, cats, and humans. Infection has not been documented in other species. Sheep feces subjected to microaerobic culture. Isolates were characterized by genus-specific PCR, restriction fragment length polymorphism, biochemical profiling, and 16S rRNA sequence analysis. Helicobacter canis was isolated from sheep feces and confirmed by the above methods. These isolates are distinct from other sheep-origin enterohepatic Helicobacter species previously isolated. This study identifies sheep as H. canis reservoirs potentially important in zoonotic or foodborne transmission. © 2013 John Wiley & Sons Ltd.

  12. Experimental Infection of Sheep using Infective Larvae (L3 ...

    African Journals Online (AJOL)

    Experimental Infection of Sheep using Infective Larvae (L3) harvested from the Faeces of Naturally Infected Swayne's Hartebeest ( Alcelaphus buselaphus swaynei ) at Senkele Swayne's Hartebeest Sanctuary, Ethiopia.

  13. Resistance to gastrointestinal parasite infection in Djallonké sheep.

    Science.gov (United States)

    Traoré, A; Notter, D R; Soudre, A; Kaboré, A; Álvarez, I; Fernández, I; Sanou, M; Shamshuddin, M; Periasamy, K; Tamboura, H H; Goyache, F

    2017-08-01

    Gastrointestinal parasitism places serious constraints on small ruminant production. The situation has been exacerbated by development of drug resistance in many parasite populations, leading to interest in identification of animals with genetically mediated resistance or tolerance to nematode infections. This study assessed the response to natural infection with gastrointestinal nematodes (GIN) in Djallonké sheep during the rainy season in the Sudan-Guinea Savannah region of Burkina Faso. Haemonchus contortus is the most prevalent GIN at this site and time. Djallonké lambs (n=434) were sampled from 40 households and evaluated at a common location in southern Burkina Faso. Lambs were dewormed with levamisole at 2 to 6 months of age and returned to infected pastures. Fecal egg counts (FEC), packed cell volumes (PCV), and FAffa Malan CHArt (FAMACHA©) scores were determined 28 and 35 days after deworming. Lamb mortality was monitored throughout the experiment. Least-squares means for BW increased from 13.8±0.2 kg at 28 days to 14.0±0.2 kg at 35 days (PFAMACHA scores at 28 and 35 days were all positive (PFAMACHA scores and PCV was negative at 28 (r=-0.14) and 35 days (r=-0.18) (PFAMACHA scores are useful indicators of differences in FEC. Approximately 40% of female and 30% of male lambs did not show detectable levels of infection (i.e. FEC=0) under field conditions. The great variability that was observed in FEC and PCV suggests potential to use Djallonké sheep in breeding programs to enhance resistance to GIN.

  14. Experimental Theileria lestoquardi infection in sheep: Biochemical and hematological changes.

    Science.gov (United States)

    Yaghfoori, Saeed; Mohri, Mehrdad; Razmi, Gholamreza

    2017-09-01

    Malignant theileriosis (Theileria lestoquardi infection) is a hemoparasitic tick-borne disease that affects both wild and domestic small ruminants. The aim of this study was to evaluate biochemical and hematological characteristics of sheep after being experimentally infected by T. lestoquardi. T. lestoquardi infection was induced in seven Baluchi sheep of six-to-eight months old via experimentally-infected Hyalomma anatolicum adult ticks. Biochemical and hematological parameters were measured twice a week during the three weeks' post infection. Twenty-three biochemical analytes and seven hematological ones were measured. After three to four days infection, body temperature rose above 40(°)C. Maximum and minimum parasitaemia were 3.3% and 0.28%, respectively. Piroplasms and schizont were seen on average from days 7.2 and 4 post infection, respectively. The concentrations and activities of Alb, HDL, ALT, T3, T4, Ca, Fe, Mg, iP, WBC, RBC, PCV, Hb, Plt, neutrophil and lymphocytes significantly decreased (P≤0.05) during experimental infection. However, concentrations and activities of BT, GGT, Glu, BUN, Crea, FIB and Cu significantly increased (P≤0.05). There was no significant change in the serum amounts of Chol, LDL, TG, VLDL and Zn. The observed hypoalbuminemia and increase of FIB concentrations referred to pro-inflammatory cytokines production. Moreover, the raising of GGT activity indicates liver damage, cholestatic disorders or schizont infiltration. The disease stress and corticosteroids are suspected to cause the Glu concentration increase. The present study is aimed at improving the knowledge of malignant theileriosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Sheep movement networks and the transmission of infectious diseases.

    Directory of Open Access Journals (Sweden)

    Victoriya V Volkova

    Full Text Available BACKGROUND AND METHODOLOGY: Various approaches have been used to investigate how properties of farm contact networks impact on the transmission of infectious diseases. The potential for transmission of an infection through a contact network can be evaluated in terms of the basic reproduction number, R(0. The magnitude of R(0 is related to the mean contact rate of a host, in this case a farm, and is further influenced by heterogeneities in contact rates of individual hosts. The latter can be evaluated as the second order moments of the contact matrix (variances in contact rates, and co-variance between contacts to and from individual hosts. Here we calculate these quantities for the farms in a country-wide livestock network: >15,000 Scottish sheep farms in each of 4 years from July 2003 to June 2007. The analysis is relevant to endemic and chronic infections with prolonged periods of infectivity of affected animals, and uses different weightings of contacts to address disease scenarios of low, intermediate and high animal-level prevalence. PRINCIPAL FINDINGS AND CONCLUSIONS: Analysis of networks of Scottish farms via sheep movements from July 2003 to June 2007 suggests that heterogeneities in movement patterns (variances and covariances of rates of movement on and off the farms make a substantial contribution to the potential for the transmission of infectious diseases, quantified as R(0, within the farm population. A small percentage of farms (80% and these farms could be efficiently targeted by interventions aimed at reducing spread of diseases via animal movement.

  16. Decreasing incidence of cutaneous chemical burns in a resource limited burn centre: is this a positive effect of modernization?

    Science.gov (United States)

    Nnabuko, R E E; Okoye, C P; Ogbonnaya, I S; Isiwele, Egi

    2017-01-01

    Burns present a devastating injury to patients. Burns caused by chemical agents, present a worse scenario. In a resource limited country like Nigeria, readily available sources of these corrosive agents are mainly from lead-acid battery vendors and to some extent local small scale soap manufacturers who use caustic soda. We hypothesized that with the reduction in small scale soap manufacturing and increasing trend towards modernization in the use of dry cell batteries, chemical burns may be on the decline, and we sought to investigate this. The records of all acute burn patients seen at the Burns and Plastic Department of the National Orthopaedic Hospital Enugu Nigeria between January 2011 and December 2014 were retrospectively reviewed. The results were compared to similar studies carried out at the same centre. A questionnaire was administered to corrosive chemical (sulphuric and caustic soda) vendors to assess the trends in product sales and use in recent times. A total of 624 acute burn cases were treated during the period; among which, 12 cases (1.9%) were chemical burns. When compared with previous studies at the centre, Chemical burn cases were  recorded as the lowest rate. The median age of patients was 24 years. There were eight males and four females. Interpersonal assault was the commonest mechanism of injury with sulphuric acid suspected to be the commonest agent in 83.3% of the cases, while 16.7% of the cases were from accidental use of caustic soda. The head and neck as well as the upper limbs were the most affected (30%). Twenty-six questionnaires to lead-acid vendors were analyzed and revealed that all respondents noticed a marked downward trend in the sale of either sulphuric acid or caustic soda, and they attributed this to the ready availability of imported alternatives to locally manufactured soap or wet lead-acid batteries. Ease of use, durability and convenience of the dry cell batteries were cited as principal reasons. There appears to be

  17. Epidemic pasteurellosis in a bighorn sheep population coinciding with the appearance of a domestic sheep.

    Science.gov (United States)

    George, Janet L; Martin, Daniel J; Lukacs, Paul M; Miller, Michael W

    2008-04-01

    A pneumonia epidemic reduced bighorn sheep (Ovis canadensis) survival and recruitment during 1997-2000 in a population comprised of three interconnected wintering herds (Kenosha Mountains, Sugarloaf Mountain, Twin Eagles) that inhabited the Kenosha and Tarryall Mountain ranges in central Colorado, USA. The onset of this epidemic coincided temporally and spatially with the appearance of a single domestic sheep (Ovis aires) on the Sugarloaf Mountain herd's winter range in December 1997. Although only bighorns in the Sugarloaf Mountain herd were affected in 1997-98, cases also occurred during 1998-99 in the other two wintering herds, likely after the epidemic spread via established seasonal movements of male bighorns. In all, we located 86 bighorn carcasses during 1997-2000. Three species of Pasteurella were isolated in various combinations from affected lung tissues from 20 bighorn carcasses where tissues were available and suitable for diagnostic evaluation; with one exception, beta-hemolytic mannheimia (Pasteurella) haemolytica (primarily reported as biogroup 1(G) or 1(alphaG)) was isolated from lung tissues of cases evaluated during winter 1997-98. The epidemic dramatically lowered adult bighorn monthly survival in all three herds; a model that included an acute epidemic effect, differing between sexes and with vaccination status, that diminished linearly over the next 12 mo best represented field data. In addition to the direct mortality associated with epidemics in these three herds, lamb recruitment in years following the pneumonia epidemic also was depressed as compared to years prior to the epidemic. Based on observations presented here, pasteurellosis epidemics in free-ranging bighorn sheep can arise through incursion of domestic sheep onto native ranges, and thus minimizing contact between domestic and bighorn sheep appears to be a logical principle for bighorn sheep conservation.

  18. Burning mouth syndrome: Current concepts

    Directory of Open Access Journals (Sweden)

    Cibele Nasri-Heir

    2015-01-01

    Full Text Available Burning mouth syndrome (BMS is a chronic pain condition. It has been described by the International Headache Society as "an intra-oral burning or dysesthetic sensation, recurring daily for more than 2 h/day for more than 3 months, without clinically evident causative lesions." BMS is frequently seen in women in the peri-menopausal and menopausal age group in an average female/male ratio of 7:1. The site most commonly affected is the anterior two-thirds of the tongue. The patient may also report taste alterations and oral dryness along with the burning. The etiopathogenesis is complex and is not well-comprehended. The more accepted theories point toward a neuropathic etiology, but the gustatory system has also been implicated in this condition. BMS is frequently mismanaged, partly because it is not well-known among healthcare providers. Diagnosis of BMS is made after other local and systemic causes of burning have been ruled out as then; the oral burning is the disease itself. The management of BMS still remains a challenge. Benzodiazepines have been used in clinical practice as the first-line medication in the pharmacological management of BMS. Nonpharmacological management includes cognitive behavioral therapy and complementary and alternative medicine (CAM. The aim of this review is to familiarize healthcare providers with the diagnosis, pathogenesis, and general characteristics of primary BMS while updating them with the current treatment options to better manage this group of patients.

  19. Lethal triad in severe burns.

    Science.gov (United States)

    Sherren, P B; Hussey, J; Martin, R; Kundishora, T; Parker, M; Emerson, B

    2014-12-01

    Hypothermia, acidaemia and coagulopathy in trauma is associated with significant mortality. This study aimed to identify the incidence of the lethal triad in major burns, and describe demographics and outcomes. Patients admitted during a 71 month period with a total body surface area burn (TBSA)≥30% were identified. A structured review of a prospective database was conducted. The lethal triad was defined as a combination of coagulopathy (International normalised ratio>1.2), hypothermia (temperature≤35.5°C) and acidaemia (pH≤7.25). Fifteen of 117 patients fulfilled the criteria for the lethal triad on admission. Lethal triad patients had a higher median (IQR) abbreviated burn severity index (ABSI) (12 (9-13) vs. 8.5 (6-10), p=0.001), mean (SD) TBSA burn (59.2% (18.7) vs. 47.9% (18.1), p=0.027), mean (SD) age (46 (22.6) vs. 33 (28.3) years, p=0.033), and had a higher incidence of inhalational injury (p0.05). The lethal triad was associated with increased mortality (66.7% vs. 13.7%, plethal triad was not shown to be a predictor of mortality (p>0.05). Burn patients with the lethal triad have a high mortality rate which reflects the severity of the injury sustained. Copyright © 2014 Elsevier Ltd and ISBI. All rights reserved.

  20. Exercise behaviors after burn injury.

    Science.gov (United States)

    Baldwin, Jennifer; Li, Frank

    2013-01-01

    The purpose of this study was to investigate exercise behaviors in adult burn survivors and to identify barriers to exercise in this population. A two-page questionnaire developed by the authors was administered on a single occasion to adults attending the ambulatory burns clinic at a metropolitan hospital. Data from 68 adult burn survivors were analyzed. Within this cohort, 59% of subjects reported exercising several times per week or more and the remaining 41% exercised once per week or less. There was no correlation among exercise frequency and age, TBSA, or hospital length of stay. Walking was the most common type of exercise, and subjects reported lower compliance with stretching and strengthening exercises. Physical condition and motivation were identified as the main barriers to exercise. Although this preliminary study reveals that a higher proportion of burn survivors engage in exercise compared with their healthy counterparts, a substantial number are exercising just once per week or less, below the recommended guidelines to improve physical fitness. Physical and occupational therapists play an important role in providing exercise prescription and education, as well as addressing barriers to exercise in burn survivors. The potential for further research into physical activity across all domains of life using a validated questionnaire is identified.

  1. The changing pattern of pediatric burns.

    Science.gov (United States)

    Abeyasundara, Sandun L; Rajan, Vasant; Lam, Lawrence; Harvey, John G; Holland, Andrew J A

    2011-01-01

    After scalds, flame burns have been considered the next most common mode of burn injury in childhood. Recent experience in the authors' unit suggested that contact burns were becoming more frequent. The authors sought to determine the contemporary frequency of different burn modalities in children presenting to a burns unit. A retrospective review of 3621 children treated in the burns unit, both ambulatory and inpatient, at the authors' institution between January 2003 and December 2007 was performed. Patients were identified using the Burns Unit database. Data collected included age, gender, burn etiology and site, TBSA, and whether operative surgery was required. Of the 3515 patients eligible for inclusion, scalds accounted for 55.9%, contact 30.5%, and flame 7.9% of all burns. Contact burns were shown to be consistently more frequent than flame burns for every year of the study (z = 17.30, P burns, reflecting the variety of mechanisms involved. The data suggest a change in the historical pattern of pediatric burns previously reported in the literature. These findings have implications for public health awareness and burns prevention campaigns.

  2. Chemical Burn Injury in Kumasi: The Trend and Complications following and Their Management.

    Science.gov (United States)

    Agbenorku, Pius; Akpaloo, Joseph; Chirurgie, Facharzt; Aboah, Ken; Klutsey, Ellen; Hoyte-Williams, Paa Ekow; Farhat, Boutros; Turkson, Edmund; Yorke, Joseph; Chirurgie, Facharzt; Ametih, Richard; Hussey, Romeo

    2015-10-01

    A chemical burn refers to irritation and destruction of human tissue caused by exposure to a chemical, usually by direct contact with the chemical or its fumes. The study investigated the trend and complications following chemical burns and their management. The study involved a retrospective review of Burns Registry at the Burns Intensive Care Unit of the Komfo Anokye Teaching Hospital on patients who were admitted for burns from May 1, 2009 to April 30, 2013. Chemical burns admissions accounted for 3.5% (n = 17) out of the total 487 burns cases, consisting of 12 males (70.6%) and 5 females (29.4%). Mean total burns surface area was 21.9%; mean length of stay in Burns Intensive Care Unit was 9.5 days. The etiological agents for the chemical burns included the following: hot caustic soda 1 (5.9%); acid 9 (53.9%)-the most common; hot ethanol 3 (17.6%); and other chemicals such as other bases, oxidizers, solvents, etc. accounted for 4 (23.5%) etiological agents. Outcome included 11 discharges (64.7%), 6 transferred out to other wards (35.3%), and 0 deaths (0.0%). The complications included severe scar contractures in 5 patients (29.4%), loss of vision: partial/total = 2 (11.8%), gross keloidal/hypertrophic scars = 10 (58.8%). Chemical burns are severe and often cause severe debilitating sequelae including partial/total loss of vision. But the current study showed that only a small population (3.5%) were affected by chemical burns and no death was recorded; society has to be continually conscious of chemicals, especially caustic agents, and hence take the necessary precautions so as to prevent these avoidable complications.

  3. Chemical Burn Injury in Kumasi: The Trend and Complications following and Their Management

    Science.gov (United States)

    Akpaloo, Joseph; Chirurgie, Facharzt; Aboah, Ken; Klutsey, Ellen; Hoyte-Williams, Paa Ekow; Farhat, Boutros; Turkson, Edmund; Yorke, Joseph; Chirurgie, Facharzt; Ametih, Richard; Hussey, Romeo

    2015-01-01

    Background: A chemical burn refers to irritation and destruction of human tissue caused by exposure to a chemical, usually by direct contact with the chemical or its fumes. The study investigated the trend and complications following chemical burns and their management. Methods: The study involved a retrospective review of Burns Registry at the Burns Intensive Care Unit of the Komfo Anokye Teaching Hospital on patients who were admitted for burns from May 1, 2009 to April 30, 2013. Results: Chemical burns admissions accounted for 3.5% (n = 17) out of the total 487 burns cases, consisting of 12 males (70.6%) and 5 females (29.4%). Mean total burns surface area was 21.9%; mean length of stay in Burns Intensive Care Unit was 9.5 days. The etiological agents for the chemical burns included the following: hot caustic soda 1 (5.9%); acid 9 (53.9%)—the most common; hot ethanol 3 (17.6%); and other chemicals such as other bases, oxidizers, solvents, etc. accounted for 4 (23.5%) etiological agents. Outcome included 11 discharges (64.7%), 6 transferred out to other wards (35.3%), and 0 deaths (0.0%). The complications included severe scar contractures in 5 patients (29.4%), loss of vision: partial/total = 2 (11.8%), gross keloidal/hypertrophic scars = 10 (58.8%). Conclusions: Chemical burns are severe and often cause severe debilitating sequelae including partial/total loss of vision. But the current study showed that only a small population (3.5%) were affected by chemical burns and no death was recorded; society has to be continually conscious of chemicals, especially caustic agents, and hence take the necessary precautions so as to prevent these avoidable complications. PMID:26579354

  4. Estimation of genetic diversity in Gute sheep: pedigree and microsatellite analyses of an ancient Swedish breed.

    Science.gov (United States)

    Rochus, Christina M; Johansson, Anna M

    2017-01-01

    Breeds with small population size are in danger of an increased inbreeding rate and loss of genetic diversity, which puts them at risk for extinction. In Sweden there are a number of local breeds, native breeds which have adapted to specific areas in Sweden, for which efforts are being made to keep them pure and healthy over time. One example of such a breed is the Swedish Gute sheep. The objective of this study was to estimate inbreeding and genetic diversity of Swedish Gute sheep. Three datasets were analysed: pedigree information of the whole population, pedigree information for 100 animals of the population, and microsatellite genotypes for 94 of the 100 animals. The average inbreeding coefficient for lambs born during a six year time period (2007-2012) did not increase during that time period. The inbreeding calculated from the entire pedigree (0.038) and for a sample of the population (0.018) was very low. Sheep were more heterozygous at the microsatellite markers than expected (average multilocus heterozygosity and Ritland inbreeding estimates 1.01845 and -0.03931) and five of seven microsatellite markers were not in Hardy Weinberg equilibrium due to heterozygosity excess. The total effective population size estimated from the pedigree information was 155.4 and the average harmonic mean effective population size estimated from microsatellites was 88.3. Pedigree and microsatellite genotype estimations of inbreeding were consistent with a breeding program with the purpose of reducing inbreeding. Our results showed that current breeding programs of the Swedish Gute sheep are consistent with efforts of keeping this breed viable and these breeding programs are an example for other small local breeds in conserving breeds for the future.

  5. Isolation of Mycobacterium avium subspecies paratuberculosis from non-ruminant wildlife living in the sheds and on the pastures of Greek sheep and goats.

    Science.gov (United States)

    Florou, M; Leontides, L; Kostoulas, P; Billinis, C; Sofia, M; Kyriazakis, I; Lykotrafitis, F

    2008-05-01

    This study aimed to: (1) investigate whether non-ruminant wildlife interfacing with dairy sheep and goats of four Greek flocks endemically infected with Mycobacterium avium subspecies paratuberculosis (MAP) harboured MAP and (2) genetically compare the strains isolated from the wildlife to those isolated from the small ruminants of these flocks. We cultured and screened, by polymerase chain reaction (PCR), pooled-tissue samples from 327 wild animals of 11 species for the MAP-specific IS900 insertion sequence. We also cultured faecal samples from 100 sheep or goats from each of the four flocks. MAP was detected in samples from 11 sheep, 12 goats, two mice, two rats, a hare and a fox. Only one rat had histopathological findings. Genetic typing categorized 21 isolates as cattle-type strains and two, from a house mouse and a goat respectively, as sheep-type strains; this is the first report of a rodent harbouring a sheep-type strain. The MAP types that were most frequently isolated amongst the sheep and goats of each flock were also the ones isolated from sympatric rodents; those isolated from the fox and hare also belonged to the predominant ruminant strains.

  6. Flue gas wells to minimize dust and acidic components in small-scale burning of field fuel, further development; Roekgasbrunn foer minimering av stoft och sura komponenter vid smaaskalig foerbraenning av aakerbraenslen, vidareutveckling

    Energy Technology Data Exchange (ETDEWEB)

    Yngvesson, Johan; Roennbaeck, Marie; Arkeloev, Olof

    2011-01-15

    Agricultural derived solid fuels are more problematic to combust in small-scale heating plants than conventional wood fuels. Their high content of ash, chlorine and sulphur leads to increased emissions of dust, sulphur dioxide and hydrogen chloride in the flue gases. By transporting the flue gases to a flue gas well where it condenses, and separates dust and sour components, enables a cost effective flue gas purification for small-scale heating plants (50 kW - 10 MW) of agricultural derived solid fuels. This project have studied two heating plants using flue gas wells with the aim to add to the knowledge about how a flue gas wells may look like and to quantify how much emissions of dust, chlorine and sulphur in the flue gases are reduced. The project also aimed to summon regulations and laws regarding the handling of the condensate that develop in the flue gas well. In the project measures were conducted on two different heating plants with mounted flue gas wells: a 60 kW biofuels boiler combusting grains and red canary grass and a 1 MW batch fired boiler combusting wheat straw. Measurements on flue gases were conducted with and without water injection in the flue gases. The flue gas wells reduced dust emissions of up to 80 %. The best reduction was achieved at the 60 kW heating plant when firing red canary grass. Firing grains in the same plant lead to 7 % reduction of the dust emissions. In the 1 MW heating plant firing wheat straw the flue gas well accomplished 40 % reduction of dust emissions. The boiler ability to achieve complete combustion, hence minimize the content of volatile and semi-volatile components in the flue gas, is largely affecting the flue gas well ability to reduce dust emissions. This did not, however, affect the reduction of dust in the flue. Chlorine emissions was reduced by up to 88 % by a flue gas well. Water injection made a big difference on reduction of chlorine emission from grain combustion. Sulphur emissions was reduced by 50

  7. Flight-based chemical characterization of biomass burning aerosols within two prescribed burn smoke plumes

    Directory of Open Access Journals (Sweden)

    K. A. Pratt

    2011-12-01

    Full Text Available Biomass burning represents a major global source of aerosols impacting direct radiative forcing and cloud properties. Thus, the goal of a number of current studies involves developing a better understanding of how the chemical composition and mixing state of biomass burning aerosols evolve during atmospheric aging processes. During the Ice in Clouds Experiment-Layer Clouds (ICE-L in the fall of 2007, smoke plumes from two small Wyoming Bureau of Land Management prescribed burns were measured by on-line aerosol instrumentation aboard a C-130 aircraft, providing a detailed chemical characterization of the particles. After ~2–4 min of aging, submicron smoke particles, produced primarily from sagebrush combustion, consisted predominantly of organics by mass, but were comprised primarily of internal mixtures of organic carbon, elemental carbon, potassium chloride, and potassium sulfate. Significantly, the fresh biomass burning particles contained minor mass fractions of nitrate and sulfate, suggesting that hygroscopic material is incorporated very near or at the point of emission. The mass fractions of ammonium, sulfate, and nitrate increased with aging up to ~81–88 min and resulted in acidic particles. Decreasing black carbon mass concentrations occurred due to dilution of the plume. Increases in the fraction of oxygenated organic carbon and the presence of dicarboxylic acids, in particular, were observed with aging. Cloud condensation nuclei measurements suggested all particles >100 nm were active at 0.5% water supersaturation in the smoke plumes, confirming the relatively high hygroscopicity of the freshly emitted particles. For immersion/condensation freezing, ice nuclei measurements at −32 °C suggested activation of ~0.03–0.07% of the particles with diameters greater than 500 nm.

  8. Heat Emission from a Burning Cigarette

    Directory of Open Access Journals (Sweden)

    Miura K

    2014-12-01

    Full Text Available We investigated the relationship between the smoldering burn rate and the heat transfer from a burning cigarette by measuring the heat emitted by radiation and convection, separately. The net heat generated and the net heat emitted by a burning cigarette did not vary with a change of the cigarette smoldering burn rate. The total heat emitted from a statically burning cigarette was about 50% of the total combustion heat. About 50% of the heat emitted was released as radiation heat. The smoldering burn rate did not affect the total amount of heat emitted nor the ratio of radiated heat to convected heat.

  9. Pox outbreaks in sheep and goats at Makhdoom (Uttar Pradesh), India: evidence of sheeppox virus infection in goats.

    Science.gov (United States)

    Bhanuprakash, V; Venkatesan, G; Balamurugan, V; Hosamani, M; Yogisharadhya, R; Chauhan, R S; Pande, A; Mondal, B; Singh, R K

    2010-10-01

    Sheeppox and goatpox outbreaks occur often in India incurring huge economic loss to the small ruminant industry. This paper describes two sheeppox outbreaks, of which one occurred in an organized sheep breeding farm at Makhdoom (Uttar Pradesh), India, during 2007 and another in goats at the Central Institute of Research on Goats, Makhdoom (Uttar Pradesh), India during 2008. In the first outbreak, a local Muzaffarnagari sheep breed was affected (n=477) with morbidity and mortality rates, respectively, of 100% and 53.9% accompanied by significant productivity losses. In the 2008 outbreaks, a small number of goats were affected without any mortality. The tissue and swabs collected from both the outbreaks were processed and inoculated onto Vero cells, and the causative agent of the outbreaks, capripox virus (CaPV), was isolated. The identity of the virus was confirmed as CaPV based on electron microscopy, experimental pathogenesis in sheep, capripox-specific conventional and real-time PCRs. Sequence analysis of the P32 envelope protein gene revealed that the causative agent of both outbreaks was confirmed as sheeppox virus (SPPV) implying SPPV infection not only in sheep but also goats in India. © 2010 Blackwell Verlag GmbH.

  10. Phylogenetic position of small-ruminant infecting piroplasms.

    Science.gov (United States)

    Ahmed, Jabbar S; Luo, Jianxun; Schnittger, Leonhard; Seitzer, Ulrike; Jongejan, Frans; Yin, Hong

    2006-10-01

    Theileria and Babesia are tick-transmitted protozoa that cause great economical losses in livestock. Recently, interest has risen in sheep-infecting piroplasms and a number of previously unidentified pathogens were described, particularly in China. To address the phylogenetic relationship of Theileria and Babesia species infecting sheep, the complete sequences of the 18 S small subunit ribosomal RNA genes of a panel of piroplasm isolates, including T. lestoquardi, T. ovis, T. separata, B. ovis, B. motasi, B. crassa, and several novel species, were compared. The classification based on the established phylogenetic tree corresponded with traditional systematics and revealed that sheep/goat piroplasm species are of a polyphyletic origin. In addition, these studies revealed the existence of at least two novel sheep/goat piroplasm species, designated Theileria sp. (China 1) and Theileria sp. (China 2).

  11. Models for estimating feed intake in small ruminants

    Directory of Open Access Journals (Sweden)

    Giuseppe Pulina

    2013-09-01

    Full Text Available This review deals with the most relevant limits and developments of the modeling of intake of sheep and goats reared intensively and extensively. Because small ruminants are normally fed ad libitum, voluntary feed intake is crucial in feeding tactics and strategies aimed at optimal animal production. The effects of genetic, neuroendocrine, hormonal, feed and environmental factors on voluntary feed intake were discussed. Then, several mathematical models to estimate dry matter intake (DMI were examined, with emphasis on empirical models for sheep and goats in intensive farm systems or in extensive areas under pasture or rangeland conditions. A sensitivity analysis of four models of prediction of DMI in housed lactating dairy sheep and meat sheep breeds was also presented. This work evidenced a large variability in the approaches used and in the variables considered for housed sheep and goats. Regarding the estimation of feed intake for grazing sheep and browsing goats, the accuracy of estimates based on empirical models developed so far is very low when applied out of the boundaries of the studied system. Feeding experiments indoors and outdoors remain fundamental for a better modeling and understanding of the interactions between feeds and small ruminants. However, there is a need for biological and theoretical frameworks in which these experiments should be carried out, so that appropriate empirical or mechanistic equations to predict DMI could be developed.

  12. Effect of gastro-intestinal nematode infection on sheep performance: a systematic review and meta-analysis.

    Science.gov (United States)

    Mavrot, Fabien; Hertzberg, Hubertus; Torgerson, Paul

    2015-10-24

    Gastrointestinal nematode (GIN) infections are common in domestic sheep and impact directly and indirectly on the health of infected animals as well as on the associated economic production. In this study, we aim at summarizing the current knowledge on the influence of GIN infections on sheep production by conducting a systematic review. A subsequent meta-analysis of relevant studies was performed to provide an estimate of the effect of GIN infections on weight gain, wool production and milk yield. A literature search was performed on the CAB, Pubmed and Web of Science database for the period 1960-2012. Inclusion criteria were: 1) Measurement of at least one production parameter. 2) Comparison between groups of sheep with different nematode burdens. 3) Same conditions regarding all aspects except parasite burden between groups. 4) Quantitative measurements of one or more production traits. Altogether, 88 studies describing 218 trials were included in this review. The majority of studies (86%) reported that GIN infections had a negative effect on production but this was reported to be statistically significant in only 43% of the studies. Meta-analysis indicated that performances of sheep infected with nematodes was 85, 90 and 78% of the performance in uninfected individuals for weight gain, wool production and milk yield respectively. Our results suggest a possible reporting bias or small study effect for the estimation of the impact of GIN infections on weight gain. Finally, a general linear model provided an estimate for the decrease in weight gain in relation to the increase in faecal egg count of nematodes. This study underlines the importance of GIN infections for sheep production and highlights the need to improve parasite management in sheep, in particular in face of challenges such as anthelmintic resistance.

  13. Wood-burning stoves worldwide

    DEFF Research Database (Denmark)

    Luis Teles de Carvalho, Ricardo

    More than any time in our history, the wood-burning stove continues to be the most popular technology used for cooking and heating worldwide. According to the World Health Organization and recent scientific studies, the inefficient use of solid-fuels in traditional stoves constitutes the major...... systems, improved efficient retrofits and advanced stove innovations. In chapter 3, four popular wood-burning practices found in five countries were singled-out to be examined closely in four case studies: “cooking in Brazil”, “cooking and heating in Peru”, “heating in Portugal” and “recreational heat...

  14. [Burn out syndrome in oncology].

    Science.gov (United States)

    Schraub, Simon; Marx, E

    2004-09-01

    SEPS or burnout syndrome was described among health care workers. Oncology care givers--physicians and nurses--can be concerned. Burnout is a chronical stress reaction. Emotional exhaustion and depersonalisation are more prevalent than low personal accomplishment. Burnout is essentially assessed by questionnaires. Oncologists report an higher level of burnout, than AIDS medical or palliative care staff. Causes of burn out are numerous: insufficient personal time, sense of failure,... followed by poorly management and difficulties in staff or institution relationships. Prevention and therapy of burn out can be considered on three levels: personal, (psychotherapy, advices on health way of life), team (improvement in communication) and institution (support meetings and talking groups).

  15. Bacteriological profile of burn patients at Yekatit 12 Hospital Burn ...

    African Journals Online (AJOL)

    Materials and methods: A prospective hospital based study was carried out from December 2010 to February 2011 at Yekatit 12 hospital burn center. Periodic wound swabs and blood samples were collected on 1st, 7th, and 14th days of hospital stay and processed with conventional culture and biochemical tests. Isolates ...

  16. Air-freshener burns: A new paradigm in burns etiology?

    Directory of Open Access Journals (Sweden)

    Umran Sarwar

    2011-01-01

    Conclusions: To our knowledge this is one of the few documented cases of burns as a result of air-fresheners. As they become more ubiquitous, we anticipate the incidence of such cases to increase. As such, they pose a potential public health concern on a massive scale.

  17. Cattle and sheep develop preference for drinking water containing grape seed tannin.

    Science.gov (United States)

    Kronberg, S L; Schauer, C S

    2013-10-01

    Ingestion of small amounts of some types of condensed tannins (CTs) by ruminant livestock can provide nutritional, environmental and economic benefits. However, practical methods are needed to make these tannins more available to ruminant livestock. Results from previous trials with crude quebracho and black wattle tannin indicated that cattle and/or sheep would not preferentially drink water containing these tannins. Therefore, we conducted preference trials to determine if cattle and sheep would learn to prefer water containing purified grape seed tannin (GST) that provided up to 2% of their daily dry matter (DM) intake. After gradual exposure to increasing amounts of this tannin in water during a pre-trial period, five adult ewes and five yearling heifers fed lucerne (Medicago sativa) pellets (19% CP) were offered water and several concentrations of GST solutions for either 15 (sheep trial) or 20 days (cattle trial). We measured intake of all liquids daily. Concentrations of blood urea were also measured for heifers when they drank only tannin solutions or water. Both sheep and cattle developed preferences for water with GST in it over water alone (P tannin solutions (in total) was 0.6 and 6.1 l, respectively. For the cattle, mean daily intake of water and all tannin solutions in total was 21.8 and 20.6 l, respectively, in the first half of the trial and 10.8 and 26.1 l, respectively, in the second half of the trial. Compared with the other tannin solutions, both sheep and cattle drank more of the solution with the highest tannin concentration (2% of daily DM intake as GST) than of water on more trial days (P < 0.05). Ingestion of water with the highest concentration of GST reduced blood plasma urea concentration in the cattle by 9% to 14% (P ≤ 0.10) compared with ingestion of water alone. Results from the trials suggest that providing grape seed and perhaps other CTs via drinking water may be a practical way to introduce CTs into sheep and cattle diets.

  18. Allometric scaling predicts preferences for burned patches in a guild of East African grazers.

    Science.gov (United States)

    Sensenig, Ryan L; Demment, Montague W; Laca, Emilio A

    2010-10-01

    The high herbivore diversity in savanna systems has been attributed to the inherent spatial and temporal heterogeneity related to the quantity and quality of food resources. Allometric scaling predicts that smaller-bodied grazers rely on higher quality forage than larger-bodied grazers. We replicated burns at varying scales in an East African savanna and measured visitation by an entire guild of larger grazers ranging in size from hare to elephant. We found a strong negative relationship between burn preference and body mass with foregut fermenters preferring burns to a greater degree than hindgut fermenters. Burns with higher quality forage were preferred more than burns with lower quality forage by small-bodied grazers, while the opposite was true for large-bodied grazers. Our results represent some of the first experimental evidence demonstrating the importance of body size in predicting how large herbivores respond to fire-induced changes in plant quality and quantity.

  19. Fossil fuel and biomass burning effect on climate - Heating or cooling?

    Science.gov (United States)

    Kaufman, Yoram J.; Fraser, Robert S.; Mahoney, Robert L.

    1991-01-01

    The basic theory of the effect of pollution on cloud microphysics and its global implications is applied to compare the relative effect of a small increase in the consumption rate of oil, coal, or biomass burning on cooling and heating of the atmosphere. The characteristics of and evidence for the SO2 induced cooling effect are reviewed. This perturbation analysis approach permits linearization, therefore simplifying the analysis and reducing the number of uncertain parameters. For biomass burning the analysis is restricted to burning associated with deforestation. Predictions of the effect of an increase in oil or coal burning show that within the present conditions the cooling effect from oil and coal burning may range from 0.4 to 8 times the heating effect.

  20. The Role of Hyperglycemia in Burned Patients: Evidence-Based Studies

    Science.gov (United States)

    Mecott, Gabriel A.; Al-Mousawi, Ahmed M.; Gauglitz, Gerd G.; Herndon, David N.; Jeschke, Marc G.

    2013-01-01

    Severely burned patients typically experience a systemic response expressed as increased metabolism, inflammation, alteration of cardiac and immune function, and associated hyperglycemia. Hyperglycemia has been associated with an increased risk of morbidity and mortality in critically ill patients. Until recently and for many years, hyperglycemia has been expectantly managed and considered a normal and desired response of an organism to stress. However, findings reported from recent studies now suggest beneficial effects of intensive insulin treatment for critically-ill patients. The literature on the management of hyperglycemia in severely burned patients is sparse, with most of the available studies involving only small numbers of burned patients. The purpose of this article is to describe the pathophysiology of hyperglycemia following severe burns and review the available literature on the outcome of intensive insulin treatment and other anti-hyperglycemic modalities in burned patients in an evidence-based-medicine approach. PMID:19503020

  1. Toxoplasmosis in sheep-the last 20 years

    Science.gov (United States)

    Sheep are important to the economy of many countries. Sheep are commonly infected with the protozoan parasite, Toxoplasma gondii. This parasite causes early embryonic death and resorption, fetal death and mummification, abortion, stillbirth, and neonatal death, largely dependent on the stage of preg...

  2. Determination of anthelmintic resistance in goats and sheep using ...

    African Journals Online (AJOL)

    Determination of anthelmintic resistance in goats and sheep using faecal egg count reduction test at Luguruni farm, Dar es Salaam, Tanzania. ... The PCV as recorded in Sheep and Goats before and after treatment with anthelmintics drugs shows slight changes in terms of their values so this is convincing that there was less ...

  3. Sexual Dimorphism in Lori Sheep Vomeronasal Organ dimensions ...

    African Journals Online (AJOL)

    This experiment was carried out to study the effect of gender on anatomy of vomeronasal organ (VNO) and their correlations with some external body measurements in Lori sheep. Six external body characteristics ... needs further investigation. Keywords: Vomeronasal organ, Hard palate, External body measures, Lori sheep ...

  4. Efficacy of homologous peste des petits ruminants vaccine on sheep ...

    African Journals Online (AJOL)

    Efficacy of homologous peste des petits ruminants vaccine on sheep and goats at dengi, plateau state, Nigeria. ... Bulletin of Animal Health and Production in Africa ... The effect of homologous peste des petits ruminants vaccine (HPPRV) on flock size, morbidity and mortality in sheep and goats was determined in five ...

  5. The effect of sheep-manure vermicompost on quantitative and ...

    African Journals Online (AJOL)

    The effect of sheep-manure vermicompost on quantitative and qualitative properties of cucumber ( Cucumis sativus L.) grown in the greenhouse. ... This experiment aims to evaluate the effects of vermicompost produced from sheep manure on growth, yield and quality of 2 fruit cucumber (Cucumis sativus L.) varieties (cv.

  6. Serological Evidence of Bluetongue Virus Antibodies in Sheep and ...

    African Journals Online (AJOL)

    To determine the presence and prevalence of bluetongue virus infection in sheep and goats at different geographical regions of North Somalia, a competitive enzyme-linked immune-sorbent assay (cELISA) for the detection of serum antibody against BTV in clinically healthy sheep and goats was carried out in Northern ...

  7. Zoonotic Enterocytozoon bieneusi Genotypes found in Brazilian sheep

    Science.gov (United States)

    The presence of Enterocytozoon bieneusi in sheep has been reported in only three countries worldwide. The present study has found E. bieneusi in Brazilian sheep for the first time; in 24/125 (19.2%) fecal samples by PCR and in 8/10 (80%) farms from three diverse locations. A significantly greater...

  8. Prevalence of Brucella antibodies in sheep and springbok ...

    African Journals Online (AJOL)

    An outbreak of brucellosis in sheep in 2009 on a farm in the adjacent Hardap Region of Namibia and the lack of information on the brucellosis status of springbok prompted a serological investigation of brucellosis in sheep and springbok in the Karas Region, Namibia as these two species are utilized for meat. The main aim ...

  9. Bacteriological investigation of sheep and goats milk for brucellosis ...

    African Journals Online (AJOL)

    Bacteriological investigations of sheep and goats brucellosis were carried out in Northern Nigeria. Seven government or quasi-government farms were investigated. A total of 418 sheep and goats milk samples were examined culturally. Investigation revealed a 34.75 per cent and 15.88 per cent rate of infection in goats and ...

  10. Genotypic frequency of calpastatin gene in lori sheep by polymerase ...

    African Journals Online (AJOL)

    The results show that in the population, genotypes AA, AB and BB, respectively, had frequencies 32.2, 63.2 and 4.6, and that this locus was not at Hardy - Weinberg equilibrium in the lori sheep strain (P<0.05). Keywords: Calpastatin gene, polymorphism, lori sheep, polymerase chain reaction-restriction fragment length ...

  11. Seasonal prevalence of trematode parasites of sheep ( Ovis aries L ...

    African Journals Online (AJOL)

    A longitudinal parasitological examination of 1,325 faecal samples collected from naturally grazing sheep in Kashmir Valley, India, was conducted to assess the prevalence of trematodes. The level of parasitism varied among 28.98% of the sheep that had at least one infection. Fasciola gigantica (23.92%) and Fasciola ...

  12. Feed resources management of smallholder sheep and goat ...

    African Journals Online (AJOL)

    Concentrate and improved pasture were rarely fed to sheep and goats. Crop residue was offered by 7.4% and 9.4% of the sheep and goat farmers respectively. Feed shortages were more prevalent in the dry season. Fodder conservation and agro-forestry were not practiced except for live fencing. About 40.3% and 22.6% ...

  13. Predicting the liveweight of sheep by using linear body measurements

    African Journals Online (AJOL)

    The optimum model for predicting live body weight of sheep involves the sex of the animal and its index of volume (estimated as the product of the square of the heart girth and the body length) as predictor variables. A weight chart based on this model is constructed for determining liveweight of sheep, given an animal's sex, ...

  14. Sheep response to sugar cane tops supplemented with varying ...

    African Journals Online (AJOL)

    This study was conducted to examine the response of West African Dwarf (WAD) sheep to sugarcane (Sacccharum officinarum) tops supplemented with varying levels of Leucaena leucocephala foliage. Twenty WAD sheep averaging 10.14kg were randomly divided into four groups of 5 replicates, and each group was fed ...

  15. Bacteria Associated with Sheep Pneumonia in El - Damazin Area ...

    African Journals Online (AJOL)

    Bacteria Associated with Sheep Pneumonia in El - Damazin Area, the Blue Nile State, the Sudan. ... This study was conducted to isolate and characterize the aerobic bacteria associated with pneumonia in sheep by conventional bacteriological methods. ... The Gram-positive isolates were 45(22.5%) Staphylococcus spp.

  16. Ethnoveterinary practices among sheep rearers in Ona-Ara Local ...

    African Journals Online (AJOL)

    ADEYEYE

    the health and curing diseases of sheep in Ona - Ara Local Government, Oyo State, Nigeria. Information was ... revealed that there is low documentation of ethnoveterinary knowledge among sheep owners in Ona-Ara Local. Government and this has ... sound, as plant products with recognized medicinal properties are far ...

  17. sheep and cattle comparative feed intake and digestibility studies ...

    African Journals Online (AJOL)

    The rcsults also showed tltat cattle digest roughagcs on average better than sheep. I{owcver, the dit'ferences werc signit-icant rn sheep digest various feeds has been considered to ...

  18. (Zulu) Sheep using linear body measurements and some

    African Journals Online (AJOL)

    NKUNENE

    Data on linear body measurements (LBM) of ca. 100 Zulu sheep ... Keywords: Indigenous sheep, body measurements; scrotum circumference, extensive management .... Star grass. * Flock kept at OSCA from May 2002 to November 2002. LW - live weight; HG - heart girth; WH - wither height; SC - scrotal circumference.

  19. Charaterisation of Zulu (Nguni) sheep using linear body ...

    African Journals Online (AJOL)

    WH) and scrotum circumference (SC) of sheep in different age groups as well as the effects of some environmental factors on their LBM. Teeth numbers were used to estimate the age of sheep. The variation in LBM was influenced significantly by ...

  20. Genetic variations between indigenous fat-tailed sheep populations

    African Journals Online (AJOL)

    ONOS

    2010-09-06

    Sep 6, 2010 ... 2Department of Animal Science, faculty of agriculture, University of Arak, Arak, Iran. . Accepted 10 May, 2010. Blood samples were collected from a total 816 sheep of both sexes in three Iranian fat-tailed breeds. (Sangsari, Makoei, indigenous sheep on firoozkouh mountain) serum, plasma and erythrocyte ...

  1. Morphological characterization of breeds of sheep: a discriminant analysis approach.

    Science.gov (United States)

    Asamoah-Boaheng, Michael; Sam, Emmanuel Kofi

    2016-01-01

    In this study the characterisation and separation/discrimination of three sheep breeds (crosses, West African Dwarfs (WAD) and West African Long Legged (WALL)] based on their physical traits (morphological characterisation) was investigated extensively with the application of discriminant analysis. The study's main objective was specifically based on developing a variable selection criterion that can discriminate best among the three sheep breeds and as well as obtain a reliable mathematical function/equation (discriminant functions) for provision of maximum separation among the three known sheep breeds. Data from College of Education, Mampong animal farms on various breeds of sheep (hybrid/crossed breed, Sahell/WALL and Djallonke/WAD) was used. Factor Analysis was employed as a variable selection criterion for selecting six sheep traits that can discriminate best among the sheep breeds. Canonical discriminant function was derived for the eight variable data set and was compared with the derived quadratic discriminant functions (QDFs) using the six extracted sheep traits. The six variable QDF distance classifier provided maximum separation after cross validation than the 8-variable canonical discriminant functions. The derived mathematical functions (QDFs) were able to provide maximum separation among the three known sheep breeds with a correct classification rate of 0.86.

  2. Estimation of genetic diversity between three Saudi sheep breeds ...

    African Journals Online (AJOL)

    The genetic variation of Najdi, Harri and Awassi breeds of Saudi sheep prevailing in Raniah province of Makka district were assessed and compared to Sudanese Desert sheep using random amplified polymorphic DNA polymerase cahin reaction (RAPD-PCR) technique. Five primers successfully amplified distinguishable ...

  3. Genetic diversity of Najdi sheep based on microsatellite analysis

    African Journals Online (AJOL)

    MUNEEB

    2012-10-16

    Oct 16, 2012 ... 2Department of Animal Production, College of Food and Agricultural Sciences, King Saud University, P.O. Box 2460,. Riyadh 11451, Kingdom ... black hair coat with white head, convex head profile and large, pendulous ears .... Egyptian sheep breeds (10.30), (El Nahas et al., 2008),. Spanish sheep breeds ...

  4. Genetic and phenotypic parameters of body weight in Zandi sheep ...

    African Journals Online (AJOL)

    The purposes of this study were to estimate genetic parameters for growth traits and to develop a suitable model for the data set used. Data were collected in the Zandi sheep breed from 1992 to 2007 from the Khojir Sheep Breeding Station, Tehran, Iran. Number of observation were 5711 for birth weight (BW), 4619 for ...

  5. Serological survey for antibodies against pestiviruses in sheep in Wyoming

    Science.gov (United States)

    Pestiviruses including Bovine Viral Diarrhea Virus type 1 (BVDV1), BVDV-2 and Border Disease Virus (BDV) have been reported in sheep populations worldwide. These viruses are not strictly host specific and can also infect cattle, goats, swine and wild ruminants. In sheep, clinical signs are related t...

  6. Genetic variation of Mehraban sheep using two intersimple ...

    African Journals Online (AJOL)

    Genetic diversity within Mehraban sheep populations, as one of the main breeds of Iranian sheep, was studied using (AG)9C and (GA)9C as two inter-simple sequence repeat (ISSR) markers. Blood samples were collected from 210 animals in 6 flocks, 35 heads each, in different parts of Hamedan province.

  7. Prevalence of trypanosomiasis in sheep in the Kachia Grazing ...

    African Journals Online (AJOL)

    , to determine the prevalence of trypanosomiasis among sheep. The reserve has had a history of high prevalence of the disease and farmers in the area are known to ignore the control of trypanosomiasis in sheep and goats and focus more on ...

  8. Poisoning by Poiretia punctata in cattle and sheep

    Science.gov (United States)

    Poiretia punctata (Willd.) Desv. was associated with cattle and sheep poisoning on nine farms in the State of Sergipe, northeastern Brazil. The animals were found dead or died later after showing clinical signs for up to 18 hours. Two sheep that ingested 40g/kg body weight (g/kg) of fresh P punctata...

  9. In vitro maturation of sheep oocytes in different concentrations of ...

    African Journals Online (AJOL)

    The aim of the study was to determine the optimum concentration of the mare serum (MS) for sheep in vitro oocyte maturation. Sheep ovaries were collected from a local abattoir and transported within 1 h to the laboratory in a warm saline solution (30 – 35oC), supplemented with 100 IU penicillin G and 100 g streptomycin ...

  10. Doramectin and albendazole resistance in sheep in the Netherlands

    NARCIS (Netherlands)

    Borgsteede, F.H.M.; Dercksen, D.D.; Huijbers, R.

    2007-01-01

    A faecal egg count reduction test was conducted on a sheep farm with suspected avermectin resistance. Five groups of 10 sheep were formed. Group 1 was the untreated control group. Groups 2¿5 were treated according to weight with the recommended dose of, respectively, levamisole, doramectin,

  11. An inherited cataract in New Zealand Romney sheep.

    Science.gov (United States)

    Brooks, H V; Jolly, R D; West, D M; Bruere, A N

    1982-08-01

    A bilateral cataract was noted to occur in sheep on a New Zealand Romney stud. Extensive breeding trials showed that this defect was inherited as an autosomal dominant. As such this form of cataract is of minimal importance to the sheep industry as control is merely by culling affected individuals.

  12. Performance Of West African Dwarf Sheep Fed Diets Supplemented ...

    African Journals Online (AJOL)

    An experiment to investigate the possible growth promoting effect of rare earth elements (REE) in growing West African dwarf sheep as well as their influence on the haematological and blood serum biochemical changes was conducted for 12 weeks. Forty West African dwarf sheep were allotted to four dietary treatments: a ...

  13. IDENTIFICATION OF SOME PARAMPHISTOMES INFECTING SHEEP IN MAIDUGURI, NIGERIA

    Directory of Open Access Journals (Sweden)

    A. A. Biu and A. Oluwafunmilayo

    2004-10-01

    Full Text Available The prevalence of paramphislome infection in sheep slaughtered at Maiduguri abattoir, Nigeria was studied. Of the 100 slaughtered sheep examined, 28.0% were infected, with an overall worm burden of 203. Of 39 males, 23.1% were infested with a worn burden of 63, while of the 61 females examined, 31.1% were infested with a worm burden of 140. Also of the 91 adult sheep, 28.6% were infested with a worm burden of 189, while out of the 9 young sheep, 22.2% were infested, with a worm burden of 14. Among breeds, 50 Balami were examined with 32.0% infested, and a worm burden of 112, while of the 49 and 1 Udda and Yankassa sheep examined 24.5% and 0.0% were infested, respectively. However, the differences in the prevalence of paramphistomes between sexes, age groups and breeds of sheep were non significant. Identification of the parampluistomes of sheep based on their size and predilection site showed Paramhistome cervi to inhabit the rumen with a mean size of 8.5 x 3.5 mm, while Gastrothylax cruminefer inhabited also the rumen but of the size 13 x 5 mm. The distribution of paramphistome species based on the sex, age and breed of sheep examined showed that more females were infested with P. cervi (52.6% than the males (33.3%, while more males were infested with G. crumenifer (66.7% than the females (47.4%.

  14. Alzheimer's disease markers in the aged sheep (Ovis aries).

    Science.gov (United States)

    Reid, Suzanne J; Mckean, Natasha E; Henty, Kristen; Portelius, Erik; Blennow, Kaj; Rudiger, Skye R; Bawden, C Simon; Handley, Renee R; Verma, Paul J; Faull, Richard L M; Waldvogel, Henry J; Zetterberg, Henrik; Snell, Russell G

    2017-10-01

    This study reports the identification and characterization of markers of Alzheimer's disease (AD) in aged sheep (Ovis aries) as a preliminary step toward making a genetically modified large animal model of AD. Importantly, the sequences of key proteins involved in AD pathogenesis are highly conserved between sheep and human. The processing of the amyloid-β (Aβ) protein is conserved between sheep and human, and sheep Aβ1-42/Aβ1-40 ratios in cerebrospinal fluid (CSF) are also very similar to human. In addition, total tau and neurofilament light levels in CSF are comparable with those found in human. The presence of neurofibrillary tangles in aged sheep brain has previously been established; here, we report for the first time that plaques, the other pathologic hallmark of AD, are also present in the aged sheep brain. In summary, the biological machinery to generate the key neuropathologic features of AD is conserved between the human and sheep, making the sheep a good candidate for future genetic manipulation to accelerate the condition for use in pathophysiological discovery and therapeutic testing. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Occurrence of small ruminant lameness in Maiduguri and its environs

    African Journals Online (AJOL)

    Occurrence of small ruminant lameness in Maiduguri and its environs. MM Aliyu, MM Bukar, AB Zira. Abstract. A study to investigate the occurrence of difference foot conditions in small ruminants in Maiduguri and its environs was undertaken. A total of 611 sheep from 22 flocks and 223 goats from 15 flocks were investigated ...

  16. Protect the Ones You Love: Burns Safety

    Science.gov (United States)

    ... the children you love from burns. Key Prevention Tips To prevent burns from fires and scalding: Be " ... file Microsoft PowerPoint file Microsoft Word file Microsoft Excel file Audio/Video file Apple Quicktime file RealPlayer ...

  17. Methoxyflurane analgesia for burns dressings

    Science.gov (United States)

    Packer, Kathleen J.

    1972-01-01

    The requirements for analgesia for burns dressings are discussed. Methoxyflurane has proved satisfactory in a clinical trial, and can be administered by one of two types of vaporizer. The possibility of nephrotoxicity due to methoxyflurane has not been eliminated. PMID:5024149

  18. Burning effigies with Bakhtinian laughter

    NARCIS (Netherlands)

    Göttke, F.

    2015-01-01

    The hanging or burning of effigies as an expression of dissent is a well-established genre of playful political protest. It is enacted in a variety of ways, accessing the conventions of various traditional rituals and social practices, and can function either as a progressive force demanding change,

  19. Burning mouth syndrome and menopause

    Directory of Open Access Journals (Sweden)

    Parveen Dahiya

    2013-01-01

    Full Text Available Menopause is a physiological process typically occurring in the fifth decade of life. One of the most annoying oral symptoms in this age group is the burning mouth syndrome (BMS, which may be defined as an intraoral burning sensation occurring in the absence of identifiable oral lesion or laboratory findings. Pain in burning mouth syndrome may be described as burning, tender, tingling, hot, scalding, and numb sensation in the oral mucosa. Multiple oral sites may be involved, but the anterior two-third part and the tip of tongue are most commonly affected site. There is no definite etiology for BMS other than the precipitating causative factors, and it is still considered idiopathic. Various treatment options like use of benzodiazepine, anti-depressants, analgesics, capsaicin, alpha lipoic acids, and cognitive behavioral therapy are found to be effective, but definite treatment is still unknown. The present article discusses some of the recent concepts of etiopathogenesis of BMS as well as the role of pharmacotherapeutic management in this disorder.

  20. Minor burn - first aid - slideshow

    Science.gov (United States)

    ... page: //medlineplus.gov/ency/presentations/100213.htm Minor burn - first aid - series—Procedure, part 1 To use the sharing features on this page, please enable JavaScript. Go to slide 1 out of 2 Go to slide 2 out of ...

  1. The Burn-Out Syndrome.

    Science.gov (United States)

    Sullivan, Ruth Christ

    1979-01-01

    An article is presented on the "burn-out" of parents, particularly those of autistic children (i.e., the exhaustion of their psychological and/or physical resources as a result of long and intense caring for their children), along with the comments and responses of five parents and professionals. (DLS)

  2. The Burning Truth(s)

    African Journals Online (AJOL)

    found outside of the burns theatre. Challenges include airway distortion, pulmonary dysfunction, difficult vascular access, rapid blood loss, problematic monitoring and positioning, impaired temperature regulation, altered drug pharmacokinetics and pharmacodynamics, renal dysfunction and sepsis.2 To be able to effectively ...

  3. Clinker Burning Kinetics and Mechanism

    DEFF Research Database (Denmark)

    Telschow, Samira

    dimensions, rotation velocity, temperature, gas composition, heat transfer phenomena, etc. These conditions can only be partly simulated in ordinary lab-scale experiments. Thus, the objectives of this project have been to establish test equipment to simulate the industrial clinker burning process...

  4. Antibiotics and the burn patient.

    Science.gov (United States)

    Ravat, François; Le-Floch, Ronan; Vinsonneau, Christophe; Ainaud, Pierre; Bertin-Maghit, Marc; Carsin, Hervé; Perro, Gérard

    2011-02-01

    Infection is a major problem in burn care and especially when it is due to bacteria with hospital-acquired multi-resistance to antibiotics. Moreover, when these bacteria are Gram-negative organisms, the most effective molecules are 20 years old and there is little hope of any new product available even in the distant future. Therefore, it is obvious that currently available antibiotics should not be misused. With this aim in mind, the following review was conducted by a group of experts from the French Society for Burn Injuries (SFETB). It examined key points addressing the management of antibiotics for burn patients: when to use or not, time of onset, bactericidia, combination, adaptation, de-escalation, treatment duration and regimen based on pharmacokinetic and pharmacodynamic characteristics of these compounds. The authors also considered antibioprophylaxis and some other key points such as: infection diagnosis criteria, bacterial inoculae and local treatment. French guidelines for the use of antibiotics in burn patients have been designed up from this work. Copyright © 2009 Elsevier Ltd and ISBI. All rights reserved.

  5. A standard experimental 'chemical burn'.

    Science.gov (United States)

    Kim, J; Weibel, T J; Carter, E J; Calobrace, M B; Foldi, J F; Zawacki, B E

    1994-06-01

    To establish a standard method for producing experimental cutaneous injuries caused by contact with corrosive liquids, we modified an apparatus and method recommended by Walker and Mason in 1967 to produce experimental thermal burns. The resulting procedure proved to be safe, reproducible, humane and efficient and can be used with a wide variety of corrosive liquids.

  6. Sheep Collisions: the Good, the Bad, and the TBI

    CERN Document Server

    Courtney, Michael

    2007-01-01

    The title page of Chapter 9 in Fundamentals of Physics (Halliday, Resnick, and Walker, 8th Edition, p. 201) shows a dramatic photograph of two Big Horn sheep butting heads and promises to explain how sheep survive such violent clashes without serious injury. However, the answer presented in sample problem 9-4 (p. 213) errs in presuming an interaction time of 0.27 s which results in an unrealistically long stopping distance of 0.62 m. Furthermore, the assertion that the horns provide necessary cushioning of the blow is inconsistent with the absence of concussions in domestic breeds of hornless sheep. Results from traumatic brain injury (TBI) research allow acceleration tolerance of sheep to be estimated as 450 g facilitating an analysis of sheep collisions that is more consistent with available observations (stopping distance less than 1 cm, impact time of roughly 2 ms).

  7. Seroprevalence of Toxoplasma gondii in domestic sheep in Belgium.

    Science.gov (United States)

    Verhelst, D; De Craeye, S; Vanrobaeys, M; Czaplicki, G; Dorny, P; Cox, E

    2014-09-15

    Even though infected sheep are a potential source of Toxoplasma gondii infection in humans, information is lacking concerning the seroprevalence of T. gondii infection in sheep in Belgium. We examined 3170 serum samples for anti-Toxoplasma IgG in sheep by total lysate antigen (TLA) enzyme-linked immunosorbent assay (ELISA). IgG to T. gondii was demonstrated in 87.4% of the tested sheep and in 96.2% of the 209 tested flocks. The seroprevalences in Antwerp (65.2%) and Wallonia (68.6%) are statistically lower than in the other regions in Belgium (96.7-97.8%) (Psheep in Belgium and confirms the high prevalence of Toxoplasma-specific IgG antibodies in the sheep population. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. FOOD SAFETY AND PROCESS HYGIENE CRITERIONS ON SHEEP CARCASSES

    Directory of Open Access Journals (Sweden)

    R. Mazzette

    2011-01-01

    Full Text Available The hygienic status and the presence of some pathogens (Staphylococcus aureus, Listeria monocytogenes e Salmonella spp. at slaughterhouses was evaluated in different matrix of sheep and lambs (carcass surface, faeces, fleeces and mesenteric lymph nodes according to the Com. Reg. (EC No 2073/2005. The 48% of sheep and 68.9% of lamb sampled carcasses resulted allocated into the marginal category for Aerobic colony count, while the 28% and 42.2% respectively were allocated into unacceptable category for Enterobacteriaceae. S.aureus was isolated more frequently in fleeces (11.5%, carcasses (12.6% of lambs than sheep. L. monocytogenes was found in fleeces and carcass of two sheep and in faeces of four lambs, while Salmonella spp. was detected only in sheep carcasses of a single plant.

  9. Management of post burn hand deformities

    OpenAIRE

    Sabapathy S; Bajantri Babu; Bharathi R

    2010-01-01

    The hand is ranked among the three most frequent sites of burns scar contracture deformity. One of the major determinants of the quality of life in burns survivors is the functionality of the hands. Burns deformities, although largely preventable, nevertheless do occur when appropriate treatment is not provided in the acute situation or when they are part of a major burns. Reconstructive procedures can greatly improve the function of the hands. Appropriate choice of procedures and timing of s...

  10. Vitamin E Supplementation in Burn Patients

    Science.gov (United States)

    2015-10-01

    PHHS-BU) in Dallas. 2. Keywords: burn, smoke inhalation, vitamin E, patients, oxidative stress, pulmonary function, ICU days 3. Accomplishments: a...Memorial Hermann Hospital (BICU-MHH) in Houston, and the Parkland Health and Hospital System Burn Unit (PHHS-BU) in Dallas. 15. SUBJECT TERMS 16...Galveston, the Burn Intensive Care Unit at Memorial Hermann Hospital (BICU-MHH) in Houston, and the Parkland Health and Hospital System Burn Unit

  11. Domestic sheep show average Coxiella burnetii seropositivity generations after a sheep-associated human Q fever outbreak and lack detectable shedding by placental, vaginal, and fecal routes.

    Science.gov (United States)

    Oliveira, Ryan D; Mousel, Michelle R; Pabilonia, Kristy L; Highland, Margaret A; Taylor, J Bret; Knowles, Donald P; White, Stephen N

    2017-01-01

    Coxiella burnetii is a globally distributed zoonotic bacterial pathogen that causes abortions in ruminant livestock. In humans, an influenza-like illness results with the potential for hospitalization, chronic infection, abortion, and fatal endocarditis. Ruminant livestock, particularly small ruminants, are hypothesized to be the primary transmission source to humans. A recent Netherlands outbreak from 2007-2010 traced to dairy goats resulted in over 4,100 human cases with estimated costs of more than 300 million euros. Smaller human Q fever outbreaks of small ruminant origin have occurred in the United States, and characterizing shedding is important to understand the risk of future outbreaks. In this study, we assessed bacterial shedding and seroprevalence in 100 sheep from an Idaho location associated with a 1984 human Q fever outbreak. We observed 5% seropositivity, which was not significantly different from the national average of 2.7% for the U.S. (P>0.05). Furthermore, C. burnetii was not detected by quantitative PCR from placentas, vaginal swabs, or fecal samples. Specifically, a three-target quantitative PCR of placenta identified 0.0% shedding (exact 95% confidence interval: 0.0%-2.9%). While presence of seropositive individuals demonstrates some historical C. burnetii exposure, the placental sample confidence interval suggests 2016 shedding events were rare or absent. The location maintained the flock with little or no depopulation in 1984 and without C. burnetii vaccination during or since 1984. It is not clear how a zero-shedding rate was achieved in these sheep beyond natural immunity, and more work is required to discover and assess possible factors that may contribute towards achieving zero-shedding status. We provide the first U.S. sheep placental C. burnetii shedding update in over 60 years and demonstrate potential for C. burnetii shedding to reach undetectable levels after an outbreak event even in the absence of targeted interventions, such as

  12. Domestic sheep show average Coxiella burnetii seropositivity generations after a sheep-associated human Q fever outbreak and lack detectable shedding by placental, vaginal, and fecal routes.

    Directory of Open Access Journals (Sweden)

    Ryan D Oliveira

    Full Text Available Coxiella burnetii is a globally distributed zoonotic bacterial pathogen that causes abortions in ruminant livestock. In humans, an influenza-like illness results with the potential for hospitalization, chronic infection, abortion, and fatal endocarditis. Ruminant livestock, particularly small ruminants, are hypothesized to be the primary transmission source to humans. A recent Netherlands outbreak from 2007-2010 traced to dairy goats resulted in over 4,100 human cases with estimated costs of more than 300 million euros. Smaller human Q fever outbreaks of small ruminant origin have occurred in the United States, and characterizing shedding is important to understand the risk of future outbreaks. In this study, we assessed bacterial shedding and seroprevalence in 100 sheep from an Idaho location associated with a 1984 human Q fever outbreak. We observed 5% seropositivity, which was not significantly different from the national average of 2.7% for the U.S. (P>0.05. Furthermore, C. burnetii was not detected by quantitative PCR from placentas, vaginal swabs, or fecal samples. Specifically, a three-target quantitative PCR of placenta identified 0.0% shedding (exact 95% confidence interval: 0.0%-2.9%. While presence of seropositive individuals demonstrates some historical C. burnetii exposure, the placental sample confidence interval suggests 2016 shedding events were rare or absent. The location maintained the flock with little or no depopulation in 1984 and without C. burnetii vaccination during or since 1984. It is not clear how a zero-shedding rate was achieved in these sheep beyond natural immunity, and more work is required to discover and assess possible factors that may contribute towards achieving zero-shedding status. We provide the first U.S. sheep placental C. burnetii shedding update in over 60 years and demonstrate potential for C. burnetii shedding to reach undetectable levels after an outbreak event even in the absence of targeted

  13. Spironolactone increases permeability of visceral sheep peritoneum.

    Science.gov (United States)

    Karioti, Aggeliki; Hatzoglou, Chrissi; Zarogiannis, Sotirios; Deligiorgi, Triantafyllia; Kourti, Panagiota; Giannopoulou, Myrto; Arampatzis, Spyros; Liakopoulos, Vassilios; Gourgoulianis, Konstantinos; Molyvdas, Paschalis-Adam; Stefanidis, Ioannis

    2009-01-01

    Aldosterone is a key component of the renin-angiotensin-aldosterone system, and spironolactone, an aldosterone receptor blocker, shows beneficial effects in patients with end-stage renal disease and heart failure. The aim of the present study was to investigate by means of Ussing chamber technique the effect of spironolactone on the transmesothelial permeability of visceral sheep peritoneum in vitro. Peritoneal samples from the omentum of adult sheep were collected immediately after slaughter in a cooled and oxygenated Krebs-Ringer bicarbonate (KRB) solution. Isolated intact sheets of peritoneum were mounted in an Ussing-type chamber. Spironolactone (10(-5) mol/L) was added apically and basolaterally to the KRB solution. The transmesothelial resistance (R) was measured before and serially for 30 minutes after the addition of the substances. Data present the mean +/- standard error of 6 experiments in each case. The control R was 19.8 +/- 0.36 omega x cm2. The addition of spironolactone resulted in a reduction in the R, which became significant on both sides of the membrane within 10 minutes and remained significantly different thereafter. The maximum reduction of R (deltaR%) reached 24.8% +/- 2.3% (p < 0.01) apically and 26.3% +/- 3.2% (p < 0.01) basolaterally. Our data clearly show that spironolactone increases the permeability of visceral sheep peritoneum in a lasting manner. Increased peritoneal permeability could result in increased sodium removal, which has acknowledged beneficial effects both in patients undergoing peritoneal dialysis and in patients with heart failure. Further clinical studies investigating the effect of spironolactone on sodium removal in peritoneal dialysis are justified.

  14. Carpal hygroma in one sheep - Case report

    Directory of Open Access Journals (Sweden)

    Geórgia Camargo Góss

    2016-12-01

    Full Text Available ABSTRACT. Góss G.C., Duarte C.A., Leite C.T., Cogo A.B., Pereira E.P., Döwich G. & da Rosa L.R. [Carpal hygroma in one sheep - Case report.] Higroma carpal em ovino - Relato de caso. Revista Brasileira de Medicina Veterinária 38(4:445-448, 2016. Faculdade de Medicina Veterinária, Universidade Federal do Pampa, BR 472, Km 592, Caixa Postal 118, Uruguaiana, RS 97508-000, Brasil. E-mail: georgia_goss@hotmail.com The carpal hygroma is characterized by an abnormal fluid accumulation in a dorsal surface of this region, that is presented with soft consistency, painless and doesn’t lead to lameness. The main cause of hygroma is a constant local trauma. This is a commom disease in horses who live in hard surface sites and, it can also affect ruminants. The diagnosis is achieved by clinical signs and additional tests such as cytological analysis, radiographic and sonographic. The early diagnosis is important because the therapeutic options vary with the degree of evolution of the disease. The treatment may vary from hygroma drainage, with or without application of corticosteroids, followed by compressive bandages to the surgical ablation of this. The objective of this case report is to account the occurrence of a carpal hygroma in sheep. This report is important because the sheeps are being widely created in intensive systems and diseases like hygroma are becoming common, because this is a fundamental supply subsidy to the clinicians, in the literature, to assist in their daily routine.

  15. Techniques for capturing bighorn sheep lambs

    Science.gov (United States)

    Smith, Joshua B.; Walsh, Daniel P.; Goldstein, Elise J.; Parsons, Zachary D.; Karsch, Rebekah C.; Stiver, Julie R.; Cain, James W.; Raedeke, Kenneth J.; Jenks, Jonathan A.

    2014-01-01

    Low lamb recruitment is a major challenge facing managers attempting to mitigate the decline of bighorn sheep (Ovis canadensis), and investigations into the underlying mechanisms are limited because of the inability to readily capture and monitor bighorn sheep lambs. We evaluated 4 capture techniques for bighorn sheep lambs: 1) hand-capture of lambs from radiocollared adult females fitted with vaginal implant transmitters (VITs), 2) hand-capture of lambs of intensively monitored radiocollared adult females, 3) helicopter net-gunning, and 4) hand-capture of lambs from helicopters. During 2010–2012, we successfully captured 90% of lambs from females that retained VITs to ≤1 day of parturition, although we noted differences in capture rates between an area of high road density in the Black Hills (92–100%) of South Dakota, USA, and less accessible areas of New Mexico (71%), USA. Retention of VITs was 78% with pre-partum expulsion the main cause of failure. We were less likely to capture lambs from females that expelled VITs ≥1 day of parturition (range = 80–83%) or females that were collared without VITs (range = 60–78%). We used helicopter net-gunning at several sites in 1999, 2001–2002, and 2011, and it proved a useful technique; however, at one site, attempts to capture lambs led to lamb predation by golden eagles (Aquila chrysaetos). We attempted helicopter hand-captures at one site in 1999, and they also were successful in certain circumstances and avoided risk of physical trauma from net-gunning; however, application was limited. In areas of low accessibility or if personnel lack the ability to monitor females and/or VITs for extended periods, helicopter capture may provide a viable option for lamb capture.

  16. Burn Prevention for Families with Children with Special Needs

    Medline Plus

    Full Text Available ... Burns and Scalds Burn Prevention for Families With Children With Special Needs Watch this video to learn ... know about burn prevention if you have a child with special needs. Read our burn prevention tips | ...

  17. Antimicrobial resistance in Escherichia coli isolated from different parts of the digestive tract of sheep

    Directory of Open Access Journals (Sweden)

    E. Afshari-Safavi

    2017-09-01

    Full Text Available In order to evaluate differences in resistance patterns of Escherichia coli isolated from different parts of sheep digestive tract, the intestinal tracts of 24 sheep were sampled at various locations (duode-num, jejunum, caecum, colon and rectum after slaughter. Samples were cultured on MacConkey agar and obtained colonies were confirmed as E. coli based on the biochemical tests results. Isolates were tested for antimicrobial agent susceptibility to 10 antibiotics (colistin, gentamicin, oxytetracycline, trimethoprim-sulfamethoxazole, amoxicillin-clavulanic acid, enrofloxacin, ampicillin, cephotaxime, neomycin and florfenicol, using disc diffusion method. The tested E. coli resistant to colistin, ampicillin and amoxicillin-clavulanic acid were isolated more frequently from large intestine (rectum than from small intestine (duodenum (P<0.05. In conclusion, antimicrobial resistance pattern of generic E. coli inhabiting the intestinal tract of sheep depends on sampling location, which should be considered in interpreting the results of antimicrobial resistance tests of E. coli isolated from the faecal samples and generalising results to bacteria colonised in other parts of the digestive tract

  18. Relationship between gene polymorphism and milk production traits in Teleorman Black Head sheep breed

    Directory of Open Access Journals (Sweden)

    Gras MA

    2015-12-01

    Full Text Available Objective. This study is a preliminary step of a larger national program aimed to develop a strategy for “in situ” preservation of Teleorman Black Head sheep population. In this paper we estimated the effect of β-lactoglobulin, casein and prolactin on some quantitative and qualitative milk traits in this local sheep population. Material and methods. Genotyping methodology included PCR for CSN3 (A and B alleles and PCR-RFLP for LGB (A and B alleles and PRL (T and C alleles, respectively. Repeated milking and milk composition analysis were used for the polymorphism effect estimation. Results. No association between CSN3 polymorphism and milk traits was found. Effect of LGB on production traits was quite constant. Genotype AA performed better than BB. PRL marker effect showed small differences than LGB. Concerning milk, fat and protein yield, AA genotype for PRL had a smaller positive impact than AA genotype for LGB. Regarding fat and protein content, PRL showed a negative effect for AA and positive for BB genotype, respectively. Conclusions. Positive association between LGB and milk yield and composition recommend this candidate gene like marker for a future MAS program. Although PRL gene is also associated with an increased milk quantity, inverse response over milk composition must be considered in MAS strategy. Our study demonstrated that both LGB and PRL markers could became an advent of MAS utilization in Romanian dairy sheep breeding industry.

  19. Production trials involving use of the FAMACHA© system for haemonchosis in sheep : preliminary results

    Directory of Open Access Journals (Sweden)

    J.A. Van Wyk

    2008-09-01

    Full Text Available In three trials conducted on two separate farms the production of sheep treated for naturally acquired haemonchosis using the FAMACHA© system of targeted selective treatment (TST (i.e. to treat only those animals unable to manage unaided in the face of heavy Haemonchus challenge was compared to that of suppressively drenched sheep in the same flock. As expected by the research team who developed and evaluated the FAMACHA© system, TST did result in some loss in production. However, despite high levels of worm challenge in two of the trials and the fact that the comparison was with suppressive drenching which is not sustainable, the total effect was relatively small in relation to the important advantage of using the TST as regards reduced selection for anthelmintic resistance (AR. Concerning the sustainability of worm control, it is concluded that the development of drug resistance to anthelmintics leaves sheep and goat farmers in South Africa no choice but to use methods of TST such as FAMACHA©. The FAMACHA© system can also be a useful clinical aid for early on-farm detection of AR by farmers; the degree of improvement in the colour of the ocular mucous membrane from pale to red in individually drenched anaemic animals over a period of 7-14 days can give a good indication of the efficacy of the compound(s used.

  20. Production trials involving use of the FAMACHA system for haemonchosis in sheep: preliminary results.

    Science.gov (United States)

    van Wyk, J A

    2008-12-01

    In three trials conducted on two separate farms the production of sheep treated for naturally acquired haemonchosis using the FAMACHA system of targeted selective treatment (TST) (i.e. to treat only those animals unable to manage unaided in the face of heavy Haemonchus challenge) was compared to that of suppressively drenched sheep in the same flock. As expected by the research team who developed and evaluated the FAMACHA system, TST did result in some loss in production. However, despite high levels of worm challenge in two of the trials and the fact that the comparison was with suppressive drenching which is not sustainable, the total effect was relatively small in relation to the important advantage of using the TST as regards reduced selection for anthelmintic resistance (AR). Concerning the sustainability of worm control, it is concluded that the development of drug resistance to anthelmintics leaves sheep and goat farmers in South Africa no choice but to use methods of TST such as FAMACHA. The FAMACHA system can also be a useful clinical aid for early on-farm detection of AR by farmers; the degree of improvement in the colour of the ocular mucous membrane from pale to red in individually drenched anaemic animals over a period of 7-14 days can give a good indication of the efficacy of the compound(s) used.

  1. Serosurvey of Schmallenberg Virus Infections in Sheep and Goat Flocks in Lower Saxony, Germany.

    Science.gov (United States)

    Helmer, C; Eibach, R; Tegtmeyer, P C; Humann-Ziehank, E; Runge, M; Ganter, M

    2015-08-01

    Schmallenberg virus (SBV) infections can cause congenital musculoskeletal and vertebral malformations as well as neurological failures in foetuses of several ruminant species if susceptible mother animals were infected during early gestation. Blood samples gained from 17 goat and 64 sheep flocks in Lower Saxony (LS), Germany (January-May 2012), which is located in the core region of the 2011/2012 epidemic were tested for antibodies against SBV by ELISA to detect past exposure to SBV. A SBV-specific questionnaire was raised in all flocks. The calculated median within-herd prevalence was 43.8% (min-max: 5.6-93.3%) for goats and 58.7% (min-max: 6.5-100%) for sheep, showing that small ruminants in LS, especially goats, are still at risk of novel SBV infections in the following lambing seasons as not all animals have seroconverted yet. Statistical analysis revealed that goats have a significantly lower risk of SBV infections than sheep which might be explained by different host preferences of Culicoides ssp. as main vectors for SBV and different housing conditions. © 2013 Blackwell Verlag GmbH.

  2. INTAKE OF TROPICAL TANNINIFEROUS PLANTS BY GOATS AND SHEEP WHEN OFFERED AS A SOLE FEED

    Directory of Open Access Journals (Sweden)

    Miguel A. Alonso-Díaz

    2009-06-01

    Full Text Available The intake of tropical tanniniferous plants (TTP (Lysiloma latisiliquum, Piscidia piscipula and Acacia pennatula when offered as a single feed to small ruminants could help to design a supplementation strategy looking for an anthelmintic effect. The objectives of the current study were: i to determine the chemical composition of TTP offered to goats and sheep, ii to determine and compare the total intake of TTP when offered as a single feed to goats and sheep. Adult sheep and goats, with experience in the intake of TTP, were allocated to individual pens. Three consecutive experimental period (15 d separated by seven days were used. Each period consisted of 10 d adaptation and 5 days of experiment. During adaptation animals received 40 g of leaves of each TTP plant, fresh grass and concentrate feed on a daily basis. During the experimental period animals were fed ad libitum only with the fodder of a sole TTP. Between each period, animals were fed with fresh grass (ad libitum and concentrate (200 g-1 day. Crude protein (CP, neutral detergent fiber (NDF, acid detergent fiber (ADF and lignin (L were determined from each TTP. Total polyphenols (TP, total tannins (TT and condensed tannins (CT were also determined. During each experimental period, refused fodder and intake were measured every 24 h. A multivariate analysis was used in order to determine the effect of factors (animal species, plant species and individual animal within specie on the dry matter intake. Factors with statistical effect (P

  3. Banded karyotype of the Konya wild sheep (Ovis orientalis anatolica Valenciennes, 1856 from Turkey

    Directory of Open Access Journals (Sweden)

    Jan Zima

    2011-07-01

    Full Text Available The karyotype, C-banding, and nucleoar organizer regions (NORs of eight specimens of Konya wild sheep from Turkey were examined. The complement included six large metacentric autosomes, 46 acrocentric autosomes of decreasing size, a medium-sized acrocentric X chromosome, and a small bi-armed Y chromosome (the diploid chromosome number 2n=54, the number of autosomal arms NFa=58, the number of chromosome arms NF=61. G-banding allowed reliable identification of all the chromosome pairs and the pairing of homologous elements. All the autosomes possessed distinct centromeric or pericentromeric C-positive bands. The X chromosome had a pericentromeric C-positive band, and the Y chromosome was entirely C-heterochromatic. The NORs were located in the terminal regions of the long arms of three metacentric and two acrocentric autosomes. The karyotype of the Konya wild sheep and its banding patterns are quite similar to chromosome complement reported in domestic sheep and European mouflon.

  4. A genome wide survey of SNP variation reveals the genetic structure of sheep breeds.

    Directory of Open Access Journals (Sweden)

    James W Kijas

    Full Text Available The genetic structure of sheep reflects their domestication and subsequent formation into discrete breeds. Understanding genetic structure is essential for achieving genetic improvement through genome-wide association studies, genomic selection and the dissection of quantitative traits. After identifying the first genome-wide set of SNP for sheep, we report on levels of genetic variability both within and between a diverse sample of ovine populations. Then, using cluster analysis and the partitioning of genetic variation, we demonstrate sheep are characterised by weak phylogeographic structure, overlapping genetic similarity and generally low differentiation which is consistent with their short evolutionary history. The degree of population substructure was, however, sufficient to cluster individuals based on geographic origin and known breed history. Specifically, African and Asian populations clustered separately from breeds of European origin sampled from Australia, New Zealand, Europe and North America. Furthermore, we demonstrate the presence of stratification within some, but not all, ovine breeds. The results emphasize that careful documentation of genetic structure will be an essential prerequisite when mapping the genetic basis of complex traits. Furthermore, the identification of a subset of SNP able to assign individuals into broad groupings demonstrates even a small panel of markers may be suitable for applications such as traceability.

  5. A genome wide survey of SNP variation reveals the genetic structure of sheep breeds.

    Science.gov (United States)

    Kijas, James W; Townley, David; Dalrymple, Brian P; Heaton, Michael P; Maddox, Jillian F; McGrath, Annette; Wilson, Peter; Ingersoll, Roxann G; McCulloch, Russell; McWilliam, Sean; Tang, Dave; McEwan, John; Cockett, Noelle; Oddy, V Hutton; Nicholas, Frank W; Raadsma, Herman

    2009-01-01

    The genetic structure of sheep reflects their domestication and subsequent formation into discrete breeds. Understanding genetic structure is essential for achieving genetic improvement through genome-wide association studies, genomic selection and the dissection of quantitative traits. After identifying the first genome-wide set of SNP for sheep, we report on levels of genetic variability both within and between a diverse sample of ovine populations. Then, using cluster analysis and the partitioning of genetic variation, we demonstrate sheep are characterised by weak phylogeographic structure, overlapping genetic similarity and generally low differentiation which is consistent with their short evolutionary history. The degree of population substructure was, however, sufficient to cluster individuals based on geographic origin and known breed history. Specifically, African and Asian populations clustered separately from breeds of European origin sampled from Australia, New Zealand, Europe and North America. Furthermore, we demonstrate the presence of stratification within some, but not all, ovine breeds. The results emphasize that careful documentation of genetic structure will be an essential prerequisite when mapping the genetic basis of complex traits. Furthermore, the identification of a subset of SNP able to assign individuals into broad groupings demonstrates even a small panel of markers may be suitable for applications such as traceability.

  6. Phylogenetic analysis of Croatian orf viruses isolated from sheep and goats

    Directory of Open Access Journals (Sweden)

    Cvetnic Zeljko

    2010-11-01

    Full Text Available Abstract Background The Orf virus (ORFV is the prototype of the parapoxvirus genus and it primarily causes contagious ecthyma in goats, sheep, and other ruminants worldwide. In this paper, we described the sequence and phylogenetic analysis of the B2L gene of ORFV from two natural outbreaks: i in autochthonous Croatian Cres-breed sheep and ii on small family goat farm. Results Sequence and phylogenetic analyses of the ORFV B2L gene showed that the Cro-Cres-12446/09 and Cro-Goat-11727/10 were not clustered together. Cro-Cres-12446/09 shared the highest similarity with ORFV NZ2 from New Zealand, and Ena from Japan; Cro-Goat-11727/10 was closest to the HuB from China and Taiping and Hoping from Taiwan. Conclusion Distinct ORFV strains are circulating in Croatia. Although ORFV infections are found ubiquitously wherever sheep and goats are farmed in Croatia, this is the first information on genetic relatedness of any Croatian ORFV with other isolates around the world.

  7. Effectiveness of Ivermectin and Albendazole against Haemonchus contortus in Sheep in West Java, Indonesia.

    Science.gov (United States)

    Puspitasari, Silvia; Farajallah, Achmad; Sulistiawati, Erni; Muladno

    2016-02-01

    Administering a half dose of an anthelmintic is a simple method for detecting resistance in parasites infesting small ruminants. When a single anthelmintic fails in native sheep from Indonesia, a combination of anthelmintics from different chemical classes with different modes of action are administered as an alternative parasite-control strategy. This study compared the anthelmintic efficacy of ivermectin (IVM) and albendazole (ABZ) given either separately as a single dose or half dose or co-administered to sheep naturally infected with Haemonchus contortus. Twelve sheep from Bogor, West Java, Indonesia were divided into the following six treatment groups: half-dose IVM, full-dose IVM, half-dose ABZ, full-dose ABZ, combined IVM + ABZ, and control. The treatment efficacy was determined using the faecal egg count reduction test (FECRT) at day 0 (pre-treatment) and post-treatment at days 7, 14, 21, 28, 35, and 42. The efficacies of half-dose IVM, full-dose IVM, half-dose ABZ, full-dose ABZ, and the combination treatment ranged from -1900% to 100%, 99% to 100%, -167% to 100%, -467% to 89%, and -200% to 100%, respectively. The FECRT for the half-dose IVM, half-dose ABZ, full-dose ABZ showed that H. contortus is resistant to half-dose IVM and ABZ. Full-dose IVM was effective against H. contortus. The combined treatment was more effective against H. contortus than ABZ alone.

  8. How Much Global Burned Area Can Be Forecast on Seasonal Time Scales Using Sea Surface Temperatures?

    Science.gov (United States)

    Chen, Yang; Morton, Douglas C.; Andela, Niels; Giglio, Louis; Randerson, James T.

    2016-01-01

    Large-scale sea surface temperature (SST) patterns influence the interannual variability of burned area in many regions by means of climate controls on fuel continuity, amount, and moisture content. Some of the variability in burned area is predictable on seasonal timescales because fuel characteristics respond to the cumulative effects of climate prior to the onset of the fire season. Here we systematically evaluated the degree to which annual burned area from the Global Fire Emissions Database version 4 with small fires (GFED4s) can be predicted using SSTs from 14 different ocean regions. We found that about 48 of global burned area can be forecast with a correlation coefficient that is significant at a p < 0.01 level using a single ocean climate index (OCI) 3 or more months prior to the month of peak burning. Continental regions where burned area had a higher degree of predictability included equatorial Asia, where 92% of the burned area exceeded the correlation threshold, and Central America, where 86% of the burned area exceeded this threshold. Pacific Ocean indices describing the El Nino-Southern Oscillation were more important than indices from other ocean basins, accounting for about 1/3 of the total predictable global burned area. A model that combined two indices from different oceans considerably improved model performance, suggesting that fires in many regions respond to forcing from more than one ocean basin. Using OCI-burned area relationships and a clustering algorithm, we identified 12 hotspot regions in which fires had a consistent response to SST patterns. Annual burned area in these regions can be predicted with moderate confidence levels, suggesting operational forecasts may be possible with the aim of improving ecosystem management.

  9. Draft genome of the Marco Polo Sheep (Ovis ammon polii).

    Science.gov (United States)

    Yang, Yongzhi; Wang, Yutao; Zhao, Yue; Zhang, Xiuying; Li, Ran; Chen, Lei; Zhang, Guojie; Jiang, Yu; Qiu, Qiang; Wang, Wen; Wei, Hong-Jiang; Wang, Kun

    2017-12-01

    The Marco Polo Sheep (Ovis ammon polii), a subspecies of argali (Ovis ammon) that is distributed mainly in the Pamir Mountains, provides a mammalian model to study high altitude adaptation mechanisms. Due to over-hunting and subsistence poaching, as well as competition with livestock and habitat loss, O. ammon has been categorized as an endangered species on several lists. It can have fertile offspring with sheep. Hence, a high-quality reference genome of the Marco Polo Sheep will be very helpful in conservation genetics and even in exploiting useful genes in sheep breeding. A total of 1022.43 Gb of raw reads resulting from whole-genome sequencing of a Marco Polo Sheep were generated using an Illumina HiSeq2000 platform. The final genome assembly (2.71 Gb) has an N50 contig size of 30.7 Kb and a scaffold N50 of 5.49 Mb. The repeat sequences identified account for 46.72% of the genome, and 20 336 protein-coding genes were predicted from the masked genome. Phylogenetic analysis indicated a close relationship between Marco Polo Sheep and the domesticated sheep, and the time of their divergence was approximately 2.36 million years ago. We identified 271 expanded gene families and 168 putative positively selected genes in the Marco Polo Sheep lineage. We provide the first genome sequence and gene annotation for the Marco Polo Sheep. The availability of these resources will be of value in the future conservation of this endangered large mammal, for research into high altitude adaptation mechanisms, for reconstructing the evolutionary history of the Caprinae, and for the future conservation of the Marco Polo Sheep.

  10. Genotyping and surveillance for scrapie in Finnish sheep

    Directory of Open Access Journals (Sweden)

    Hautaniemi Maria

    2012-07-01

    Full Text Available Abstract Background The progression of scrapie is known to be influenced by the amino acid polymorphisms of the host prion protein (PrP gene. There is no breeding programme for TSE resistance in sheep in Finland, but a scrapie control programme has been in place since 1995. In this study we have analysed PrP genotypes of total of 928 purebred and crossbred sheep together with the data of scrapie survey carried out in Finland during 2002–2008 in order to gain knowledge of the genotype distribution and scrapie prevalence in Finnish sheep. Results The ARQ/ARQ genotype was the most common genotype in all breeds studied. ARR allele frequency was less than 12% in purebred Finnish sheep and in most genotypes heterozygous for ARR, the second allele was ARQ. The VRQ allele was not detected in the Grey race sheep of Kainuu or in the Aland sheep, and it was present in less than 6% of the Finnish Landrace sheep. Leucine was the most prominent amino acid found in codon 141. In addition, one novel prion dimorphisms of Q220L was detected. During the scrapie survey of over 15 000 sheep in 2002–2008, no classical scrapie cases and only five atypical scrapie cases were detected. Conclusions The results indicate that the Finnish sheep populations have genetically little resistance to classical scrapie, but no classical scrapie was detected during an extensive survey in 2002–2008. However, five atypical scrapie cases emerged; thus, the disease is present in the Finnish sheep population at a low level.

  11. EPIDEMOLOGY OF BURNS IN ENUGU, NIGERIA

    African Journals Online (AJOL)

    JIBURUM

    Fifteen (5.3%) occurred in vehicles following road traffic accidents. Flame constituted the largest source of burn in 147 (49.1%) patients while scald burn from hot fluids( water, soup, hot tea, pap{custard} )constituted the next large group of 108. (37,9%). Twenty patients (7.0%) were due to chemical burns while electrical ...

  12. Costs of burn care: A systematic review

    NARCIS (Netherlands)

    Hop, M.J.; Polinder, S.; van der Vlies, C.H.; Middelkoop, E.; van Baar, M.E.

    2014-01-01

    Burn care is traditionally considered expensive care. However, detailed information about the costs of burn care is scarce despite the increased need for this information and the enhanced focus on healthcare cost control. In this study, economic literature on burn care was systematically reviewed to

  13. Burn Injury Caused by Laptop Computers

    African Journals Online (AJOL)

    phone have been described.[3]. We report on a case of first‑degree burn due to overheating of. Compaq Presario cq50 on the patient's left foot. So far, there have been a few case reports about portable computer causing burns, but until now burning induced in such a quick succession of time (3 days) has not been reported.

  14. Car radiator burns: a prevention issue.

    Science.gov (United States)

    Rabbitts, Angela; Alden, Nicole E; Conlin, Tara; Yurt, Roger W

    2004-01-01

    Scald burns continue to be the major cause of injury to patients admitted to the burn center. Scald burns occurring from car radiator fluid comprise a significant subgroup. Although manufacturer warning labels have been placed on car radiators, these burns continue to occur. This retrospective review looks at all patients admitted to our burn center who suffered scald burns from car radiator fluid to assess the extent of this problem. During the study period, 86 patients were identified as having suffered scald burns as a result of contact with car radiator fluid. Seventy-one percent of the burn injuries occurred in the summer months. The areas most commonly burned were the head and upper extremities. Burn prevention efforts have improved greatly over the years; however, this study demonstrates that scald burns from car radiator fluid continue to cause physical, emotional, and financial devastation. The current radiator warning labels alone are not effective. The National Highway Traffic Safety Administration has proposed a new federal motor vehicle safety standard to aid in decreasing the number of scald burns from car radiators. The results of this study were submitted to the United States Department of Transportation for inclusion in a docket for federal legislation supporting these safety measures.

  15. Titanium tetrachloride burns to the eye.

    OpenAIRE

    Chitkara, D. K.; McNeela, B. J.

    1992-01-01

    We present eight cases of chemical burns of the eyes from titanium tetrachloride, an acidic corrosive liquid. However it causes severe chemical burns which have a protracted course and features more akin to severe alkali burns. Injuries related to titanium tetrachloride should be treated seriously and accordingly appropriate management is suggested.

  16. 21 CFR 133.184 - Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 2 2010-04-01 2010-04-01 false Roquefort cheese, sheep's milk blue-mold, and blue-mold cheese from sheep's milk. 133.184 Section 133.184 Food and Drugs FOOD AND DRUG ADMINISTRATION... PRODUCTS Requirements for Specific Standardized Cheese and Related Products § 133.184 Roquefort cheese...

  17. Intentional burns in Nepal: a comparative study.

    Science.gov (United States)

    Lama, Bir Bahadur; Duke, Janine M; Sharma, Narayan Prasad; Thapa, Buland; Dahal, Peeyush; Bariya, Nara Devi; Marston, Wendy; Wallace, Hilary J

    2015-09-01

    Intentional burns injuries are associated with high mortality rates, and for survivors, high levels of physical and psychological morbidity. This study provides a comprehensive assessment of intentional burn admissions to the adult Burns Unit at Bir Hospital, Kathmandu, Nepal, during the period 2002-2013. A secondary data analysis of de-identified data of patients hospitalized at Bir Hospital, Kathmandu, with a burn during the period of 1 January 2002 to 31 August 2013. Socio-demographic, injury and psychosocial factors of patients with intentional and unintentional burns are described and compared. Chi-square tests, Fisher's exact test and Wilcoxon rank sum tests were used to determine statistical significance. There were a total of 1148 burn admissions of which 329 (29%) were for intentional burn, 293 (26%) were self-inflicted and 36 (3%) were due to assault. Mortality rates for intentional burns were approximately three times those for unintentional burns (60 vs. 22%). When compared to unintentional burns, patients with intentional burns were more likely to be female (79 vs. 48%), married (84 vs. 67%), younger (25 vs. 30 years), have more extensive burns (total body surface area, %: 55 vs. 25) and higher mortality (60 vs. 22%). Intentional burns were more likely to occur at home (95 vs. 67%), be caused by fire (96 vs. 77%), and kerosene was the most common accelerant (91 vs. 31%). A primary psychosocial risk factor was identified in the majority of intentional burn cases, with 60% experiencing adjustment problems/interpersonal conflict and 32% with evidence of a pre-existing psychological condition. A record of alcohol/substance abuse related to the patient or other was associated with a greater proportion of intentional burns when compared with unintentional burns (17 vs. 4%). The majority of intentional burn patients were female. Almost all intentional burns occurred in the home and were caused by fire, with kerosene the most common accelerant used. Underlying

  18. Hospitalized pediatric burns in North China: a 10-year epidemiologic review.

    Science.gov (United States)

    Zhu, Liqiang; Zhang, Yanqi; Liu, Ling; Jiang, Jingcheng; Liu, Yong; Shi, Fusheng; Yi, Dong

    2013-08-01

    Retrospective surveys of all hospitalized pediatric burns under the age of 15 years were conducted in 18 hospitals from 5 provinces and municipal cities of North China between 2001 and 2010. A total of 17,770 patients were included in this study. The epidemiological characteristics of hospitalized pediatric burns and influencing factors of length of hospital stay and hospitalization cost were analyzed. In this study, children accounted for 43.57% of all hospitalized burns, with a gradually increasing trend (P=0.003). Among children hospitalized burns, the percentage of children younger than three years was 69.9%, with an upward trend (Pburns accounted for 89.79% and 71.54% had burns of burned surface area, surgery and treatment outcome. Children under three years of age, boys and children with a small area of mild scald burns should be made the focus of childhood burn prevention. Improving the medical insurance system for children is urgently needed. Copyright © 2013 Elsevier Ltd and ISBI. All rights reserved.

  19. Dermatophilus congolensis infection in sheep and goats in Delta region of Tamil Nadu

    Directory of Open Access Journals (Sweden)

    M. Ananda Chitra

    2017-11-01

    Full Text Available Aim: The study was conducted to isolate and identify Dermatophilus congolensis (DC using conventional and molecular diagnostic techniques in scab materials collected from skin infections of sheep and goats in the Delta region of Tamil Nadu. Materials and Methods: A total of 20 scab samples collected from 18 goats and 2 sheep from Nagapattinam, Thanjavur, and Tiruvarur districts of Tamil Nadu. Smears were made from softened scab materials and stained by either Gram's or Giemsa staining. Isolation was attempted on blood agar plates, and colonies were stained by Gram's staining for morphological identification. Identification was also done by biochemical tests and confirmed by 16S rRNA polymerase chain reaction (PCR, followed by sequencing and phylogenetic analysis of the amplified product. Results: The peculiar laddering arrangement of coccoid forms in stained smears prepared from scab materials revealed the presence of DC. Isolated colonies from scab materials of sheep and goats on bovine blood agar plate were small, hemolytic, rough, adherent, and bright orange-yellow in color, but some colonies were white to cream color. Gram-staining of cultured organisms revealed Gram-positive branching filaments with various disintegration stages of organisms. 16S rRNA PCR yielded 500 bp amplicon specific for DC. Sequence analysis of a sheep DC isolate showed 99-100% sequence homology with other DC isolates available in NCBI database, and phylogenetic tree showed a close cluster with DC isolates of Congo, Nigeria, and Angola of Africa. Genes for virulence factors such as serine protease and alkaline ceramidase could not be detected by PCR in any of the DC strains isolated of this study." Conclusion: The presence of dermatophilosis in Tamil Nadu was established from this study.

  20. The use of epigenetic phenomema for the improvement of sheep and cattle

    Directory of Open Access Journals (Sweden)

    Michael Edward Goddard

    2014-08-01

    Full Text Available This review considers the evidence for inheritance across generations of epigenetic marks and how this phenomenon could be exploited in the cattle and sheep industries. Epigenetic marks are chemical changes in the chromosomes that affect the expression of genes and hence the phenotype of the cell and are passed on during mitosis so that the daughter cells have the same chemical changes or epigenetic marks as the parent cell. Although most epigenetic marks are wiped clean in the process of forming a new zygote, some epigenetic marks (epimutations may be passed on from parent to offspring. The inheritance of epigenetic marks across generations is difficult to prove as there are usually alternative explanations possible. There are few well documented cases, mainly using inbred strains of mice. The epimutations are unstable and revert to wild type after a few generations. Although, there are no known cases in sheep or cattle, it is likely that inherited epimutations occur in these species but it is unlikely that they explain a large part of the inherited or genetic variation. There is limited evidence in mice and rats that an environmental treatment can cause a change in the epigenetic marks of an animal and that this change can be passed on the next generation. If inherited epimutations occur in sheep and cattle, they will already be utilised to some extent by existing genetic improvement programs. It would be possible to modify the statistical models used in the calculation of EBVs to better recognise the variance controlled by epimutations, but it would probably have, at best, a small effect on the rate on genetic (inherited gain achieved. The inheritance of epigenetic marks caused by the environment experienced by the sire offers a new opportunity in sheep and cattle breeding. However, at present we do not know if this occurs or, if it does, what environmental treatment might have a beneficial effect.