WorldWideScience

Sample records for budding yeast ssd1-v

  1. Experimental evolution in budding yeast

    Science.gov (United States)

    Murray, Andrew

    2012-02-01

    I will discuss our progress in analyzing evolution in the budding yeast, Saccharomyces cerevisiae. We take two basic approaches. The first is to try and examine quantitative aspects of evolution, for example by determining how the rate of evolution depends on the mutation rate and the population size or asking whether the rate of mutation is uniform throughout the genome. The second is to try to evolve qualitatively novel, cell biologically interesting phenotypes and track the mutations that are responsible for the phenotype. Our efforts include trying to alter cell morphology, evolve multicellularity, and produce a biological oscillator.

  2. Measuring mitotic spindle dynamics in budding yeast

    Science.gov (United States)

    Plumb, Kemp

    In order to carry out its life cycle and produce viable progeny through cell division, a cell must successfully coordinate and execute a number of complex processes with high fidelity, in an environment dominated by thermal noise. One important example of such a process is the assembly and positioning of the mitotic spindle prior to chromosome segregation. The mitotic spindle is a modular structure composed of two spindle pole bodies, separated in space and spanned by filamentous proteins called microtubules, along which the genetic material of the cell is held. The spindle is responsible for alignment and subsequent segregation of chromosomes into two equal parts; proper spindle positioning and timing ensure that genetic material is appropriately divided amongst mother and daughter cells. In this thesis, I describe fluorescence confocal microscopy and automated image analysis algorithms, which I have used to observe and analyze the real space dynamics of the mitotic spindle in budding yeast. The software can locate structures in three spatial dimensions and track their movement in time. By selecting fluorescent proteins which specifically label the spindle poles and cell periphery, mitotic spindle dynamics have been measured in a coordinate system relevant to the cell division. I describe how I have characterised the accuracy and precision of the algorithms by simulating fluorescence data for both spindle poles and the budding yeast cell surface. In this thesis I also describe the construction of a microfluidic apparatus that allows for the measurement of long time-scale dynamics of individual cells and the development of a cell population. The tools developed in this thesis work will facilitate in-depth quantitative analysis of the non-equilibrium processes in living cells.

  3. Tolerance of budding yeast Saccharomyces cerevisiae to ultra high pressure

    Science.gov (United States)

    Shibata, M.; Torigoe, M.; Matsumoto, Y.; Yamamoto, M.; Takizawa, N.; Hada, Y.; Mori, Y.; Takarabe, K.; Ono, F.

    2014-05-01

    Our studies on the tolerance of plants and animals against very high pressure of several GPa have been extended to a smaller sized fungus, the budding yeast Saccharomyces cerevisiae. Several pieces of budding yeast (dry yeast) were sealed in a small teflon capsule with a liquid pressure medium fluorinate, and exposed to 7.5 GPa by using a cubic anvil press. The pressure was kept constant for various duration of time from 2 to 24 h. After the pressure was released, the specimens were brought out from the teflon capsule, and they were cultivated on a potato dextrose agar. It was found that the budding yeast exposed to 7.5 GPa for up to 6 h showed multiplication. However, those exposed to 7.5 GPa for longer than 12 h were found dead. The high pressure tolerance of budding yeast is a little weaker than that of tardigrades.

  4. Dielectric modelling of cell division for budding and fission yeast

    International Nuclear Information System (INIS)

    Asami, Koji; Sekine, Katsuhisa

    2007-01-01

    The frequency dependence of complex permittivity or the dielectric spectrum of a system including a cell in cell division has been simulated by a numerical technique based on the three-dimensional finite difference method. Two different types of cell division characteristic of budding and fission yeast were examined. The yeast cells are both regarded as a body of rotation, and thus have anisotropic polarization, i.e. the effective permittivity of the cell depends on the orientation of the cell to the direction of an applied electric field. In the perpendicular orientation, where the rotational axis of the cell is perpendicular to the electric field direction, the dielectric spectra for both yeast cells included one dielectric relaxation and its intensity depended on the cell volume. In the parallel orientation, on the other hand, two dielectric relaxations appeared with bud growth for budding yeast and with septum formation for fission yeast. The low-frequency relaxation was shifted to a lower frequency region by narrowing the neck between the bud and the mother cell for budding yeast and by increasing the degree of septum formation for fission yeast. After cell separation, the low-frequency relaxation disappeared. The simulations well interpreted the oscillation of the relative permittivity of culture broth found for synchronous cell growth of budding yeast

  5. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.

    Science.gov (United States)

    Duina, Andrea A; Miller, Mary E; Keeney, Jill B

    2014-05-01

    The budding yeast Saccharomyces cerevisiae is a powerful model organism for studying fundamental aspects of eukaryotic cell biology. This Primer article presents a brief historical perspective on the emergence of this organism as a premier experimental system over the course of the past century. An overview of the central features of the S. cerevisiae genome, including the nature of its genetic elements and general organization, is also provided. Some of the most common experimental tools and resources available to yeast geneticists are presented in a way designed to engage and challenge undergraduate and graduate students eager to learn more about the experimental amenability of budding yeast. Finally, a discussion of several major discoveries derived from yeast studies highlights the far-reaching impact that the yeast system has had and will continue to have on our understanding of a variety of cellular processes relevant to all eukaryotes, including humans.

  6. Apoptosis at inflection point in liquid culture of budding yeasts.

    Directory of Open Access Journals (Sweden)

    Toshiyuki Hagiwara

    Full Text Available Budding yeasts are highly suitable for aging studies, because the number of bud scars (stage proportionally correlates with age. Its maximum stages are known to reach at 20-30 stages on an isolated agar medium. However, their stage dynamics in a liquid culture is virtually unknown. We investigate the population dynamics by counting scars in each cell. Here one cell division produces one new cell and one bud scar. This simple rule leads to a conservation law: "The total number of bud scars is equal to the total number of cells." We find a large discrepancy: extremely fewer cells with over 5 scars than expected. Almost all cells with 6 or more scars disappear within a short period of time in the late log phase (corresponds to the inflection point. This discrepancy is confirmed directly by the microscopic observations of broken cells. This finding implies apoptosis in older cells (6 scars or more.

  7. Actin and Endocytosis in Budding Yeast

    Science.gov (United States)

    Goode, Bruce L.; Eskin, Julian A.; Wendland, Beverly

    2015-01-01

    Endocytosis, the process whereby the plasma membrane invaginates to form vesicles, is essential for bringing many substances into the cell and for membrane turnover. The mechanism driving clathrin-mediated endocytosis (CME) involves > 50 different protein components assembling at a single location on the plasma membrane in a temporally ordered and hierarchal pathway. These proteins perform precisely choreographed steps that promote receptor recognition and clustering, membrane remodeling, and force-generating actin-filament assembly and turnover to drive membrane invagination and vesicle scission. Many critical aspects of the CME mechanism are conserved from yeast to mammals and were first elucidated in yeast, demonstrating that it is a powerful system for studying endocytosis. In this review, we describe our current mechanistic understanding of each step in the process of yeast CME, and the essential roles played by actin polymerization at these sites, while providing a historical perspective of how the landscape has changed since the preceding version of the YeastBook was published 17 years ago (1997). Finally, we discuss the key unresolved issues and where future studies might be headed. PMID:25657349

  8. Regulation of homologous recombination at telomeres in budding yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael

    2010-01-01

    Homologous recombination is suppressed at normal length telomere sequences. In contrast, telomere recombination is allowed when telomeres erode in the absence of telomerase activity or as a consequence of nucleolytic degradation or incomplete replication. Here, we review the mechanisms that contr...... that contribute to regulating mitotic homologous recombination at telomeres and the role of these mechanisms in signalling short telomeres in the budding yeast Saccharomyces cerevisiae....

  9. Sporulation in the Budding Yeast Saccharomyces cerevisiae

    Science.gov (United States)

    Neiman, Aaron M.

    2011-01-01

    In response to nitrogen starvation in the presence of a poor carbon source, diploid cells of the yeast Saccharomyces cerevisiae undergo meiosis and package the haploid nuclei produced in meiosis into spores. The formation of spores requires an unusual cell division event in which daughter cells are formed within the cytoplasm of the mother cell. This process involves the de novo generation of two different cellular structures: novel membrane compartments within the cell cytoplasm that give rise to the spore plasma membrane and an extensive spore wall that protects the spore from environmental insults. This article summarizes what is known about the molecular mechanisms controlling spore assembly with particular attention to how constitutive cellular functions are modified to create novel behaviors during this developmental process. Key regulatory points on the sporulation pathway are also discussed as well as the possible role of sporulation in the natural ecology of S. cerevisiae. PMID:22084423

  10. Synchronization of Budding Yeast by Centrifugal Elutriation.

    Science.gov (United States)

    Rosebrock, Adam P

    2017-01-03

    In yeast, cell size is normally tightly linked to cell cycle progression. Centrifugal elutriation is a method that fractionates cells based on the physical properties of cell size-fluid drag and buoyant density. Using a specially modified centrifuge and rotor system, cells can be physically separated into one or more cohorts of similar size and therefore cell cycle position. Small G 1 daughters are collected first, followed by successively larger cells. Elutriated populations can be analyzed immediately or can be returned to medium and permitted to synchronously progress through the cell cycle. This protocol describes two different elutriation methods. In the first, one or more fractions of synchronized cells are obtained from an asynchronous starting population, reincubated, and followed prospectively across a time series. In the second, an asynchronous starting population is separated into multiple fractions of similarly sized cells, and each cohort of similarly sized cells can be analyzed separately without further growth. © 2017 Cold Spring Harbor Laboratory Press.

  11. Naumovozyma castellii: an alternative model for budding yeast molecular biology.

    Science.gov (United States)

    Karademir Andersson, Ahu; Cohn, Marita

    2017-03-01

    Naumovozyma castellii (Saccharomyces castellii) is a member of the budding yeast family Saccharomycetaceae. It has been extensively used as a model organism for telomere biology research and has gained increasing interest as a budding yeast model for functional analyses owing to its amenability to genetic modifications. Owing to the suitable phylogenetic distance to S. cerevisiae, the whole genome sequence of N. castellii has provided unique data for comparative genomic studies, and it played a key role in the establishment of the timing of the whole genome duplication and the evolutionary events that took place in the subsequent genomic evolution of the Saccharomyces lineage. Here we summarize the historical background of its establishment as a laboratory yeast species, and the development of genetic and molecular tools and strains. We review the research performed on N. castellii, focusing on areas where it has significantly contributed to the discovery of new features of molecular biology and to the advancement of our understanding of molecular evolution. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  12. Identification of SUMO conjugation sites in the budding yeast proteome

    Directory of Open Access Journals (Sweden)

    Miguel Esteras

    2017-10-01

    Full Text Available Post-translational modification by the small ubiquitin-like modifier (SUMO is an important mechanism regulating protein function. Identification of SUMO conjugation sites on substrates is a challenging task. Here we employed a proteomic method to map SUMO acceptor lysines in budding yeast proteins. We report the identification of 257 lysine residues where SUMO is potentially attached. Amongst the hits, we identified already known SUMO substrates and sites, confirming the success of the approach. In addition, we tested several of the novel substrates using SUMO immunoprecipitation analysis and confirmed that the SUMO acceptor lysines identified in these proteins are indeed bona fide SUMOylation sites. We believe that the collection of SUMO sites presented here is an important resource for future functional studies of SUMOylation in yeast.

  13. The cellular robustness by genetic redundancy in budding yeast.

    Directory of Open Access Journals (Sweden)

    Jingjing Li

    2010-11-01

    Full Text Available The frequent dispensability of duplicated genes in budding yeast is heralded as a hallmark of genetic robustness contributed by genetic redundancy. However, theoretical predictions suggest such backup by redundancy is evolutionarily unstable, and the extent of genetic robustness contributed from redundancy remains controversial. It is anticipated that, to achieve mutual buffering, the duplicated paralogs must at least share some functional overlap. However, counter-intuitively, several recent studies reported little functional redundancy between these buffering duplicates. The large yeast genetic interactions released recently allowed us to address these issues on a genome-wide scale. We herein characterized the synthetic genetic interactions for ∼500 pairs of yeast duplicated genes originated from either whole-genome duplication (WGD or small-scale duplication (SSD events. We established that functional redundancy between duplicates is a pre-requisite and thus is highly predictive of their backup capacity. This observation was particularly pronounced with the use of a newly introduced metric in scoring functional overlap between paralogs on the basis of gene ontology annotations. Even though mutual buffering was observed to be prevalent among duplicated genes, we showed that the observed backup capacity is largely an evolutionarily transient state. The loss of backup capacity generally follows a neutral mode, with the buffering strength decreasing in proportion to divergence time, and the vast majority of the paralogs have already lost their backup capacity. These observations validated previous theoretic predictions about instability of genetic redundancy. However, departing from the general neutral mode, intriguingly, our analysis revealed the presence of natural selection in stabilizing functional overlap between SSD pairs. These selected pairs, both WGD and SSD, tend to have decelerated functional evolution, have higher propensities of co

  14. Characterization of dependencies between growth and division in budding yeast.

    Science.gov (United States)

    Mayhew, Michael B; Iversen, Edwin S; Hartemink, Alexander J

    2017-02-01

    Cell growth and division are processes vital to the proliferation and development of life. Coordination between these two processes has been recognized for decades in a variety of organisms. In the budding yeast Saccharomyces cerevisiae , this coordination or 'size control' appears as an inverse correlation between cell size and the rate of cell-cycle progression, routinely observed in G 1 prior to cell division commitment. Beyond this point, cells are presumed to complete S/G 2 /M at similar rates and in a size-independent manner. As such, studies of dependence between growth and division have focused on G 1 Moreover, in unicellular organisms, coordination between growth and division has commonly been analysed within the cycle of a single cell without accounting for correlations in growth and division characteristics between cycles of related cells. In a comprehensive analysis of three published time-lapse microscopy datasets, we analyse both intra- and inter-cycle dependencies between growth and division, revisiting assumptions about the coordination between these two processes. Interestingly, we find evidence (i) that S/G 2 /M durations are systematically longer in daughters than in mothers, (ii) of dependencies between S/G 2 /M and size at budding that echo the classical G 1 dependencies, and (iii) in contrast with recent bacterial studies, of negative dependencies between size at birth and size accumulated during the cell cycle. In addition, we develop a novel hierarchical model to uncover inter-cycle dependencies, and we find evidence for such dependencies in cells growing in sugar-poor environments. Our analysis highlights the need for experimentalists and modellers to account for new sources of cell-to-cell variation in growth and division, and our model provides a formal statistical framework for the continued study of dependencies between biological processes. © 2017 The Author(s).

  15. Analysis of the Budding Yeast Cell Cycle by Flow Cytometry.

    Science.gov (United States)

    Rosebrock, Adam P

    2017-01-03

    DNA synthesis is one of the landmark events in the cell cycle: G 1 cells have one copy of the genome, S phase cells are actively engaged in DNA synthesis, and G 2 cells have twice as much nuclear DNA as G 1 cells. Cellular DNA content can be measured by staining with a fluorescent dye followed by a flow-cytometric readout. This method provides a quantitative measurement of cell cycle position on a cell-by-cell basis at high speed. Using flow cytometry, tens of thousands of single-cell measurements can be generated in a few seconds. This protocol details staining of cells of the budding yeast Saccharomyces cerevisiae for flow cytometry using Sytox Green dye in a method that can be scaled widely-from one sample to many thousands and operating on inputs ranging from 1 million to more than 100 million cells. Flow cytometry is preferred over light microscopy or Coulter analyses for the analysis of the cell cycle as DNA content and cell cycle position are being directly measured. © 2017 Cold Spring Harbor Laboratory Press.

  16. Timing robustness in the budding and fission yeast cell cycles.

    KAUST Repository

    Mangla, Karan

    2010-02-01

    Robustness of biological models has emerged as an important principle in systems biology. Many past analyses of Boolean models update all pending changes in signals simultaneously (i.e., synchronously), making it impossible to consider robustness to variations in timing that result from noise and different environmental conditions. We checked previously published mathematical models of the cell cycles of budding and fission yeast for robustness to timing variations by constructing Boolean models and analyzing them using model-checking software for the property of speed independence. Surprisingly, the models are nearly, but not totally, speed-independent. In some cases, examination of timing problems discovered in the analysis exposes apparent inaccuracies in the model. Biologically justified revisions to the model eliminate the timing problems. Furthermore, in silico random mutations in the regulatory interactions of a speed-independent Boolean model are shown to be unlikely to preserve speed independence, even in models that are otherwise functional, providing evidence for selection pressure to maintain timing robustness. Multiple cell cycle models exhibit strong robustness to timing variation, apparently due to evolutionary pressure. Thus, timing robustness can be a basis for generating testable hypotheses and can focus attention on aspects of a model that may need refinement.

  17. The Genetic Requirements for Pentose Fermentation in Budding Yeast

    Directory of Open Access Journals (Sweden)

    Karin Mittelman

    2017-06-01

    Full Text Available Cells grow on a wide range of carbon sources by regulating substrate flow through the metabolic network. Incoming sugar, for example, can be fermented or respired, depending on the carbon identity, cell type, or growth conditions. Despite this genetically-encoded flexibility of carbon metabolism, attempts to exogenously manipulate central carbon flux by rational design have proven difficult, suggesting a robust network structure. To examine this robustness, we characterized the ethanol yield of 411 regulatory and metabolic mutants in budding yeast. The mutants showed little variation in ethanol productivity when grown on glucose or galactose, yet diversity was revealed during growth on xylulose, a rare pentose not widely available in nature. While producing ethanol at high yield, cells grown on xylulose produced ethanol at high yields, yet induced expression of respiratory genes, and were dependent on them. Analysis of mutants that affected ethanol productivity suggested that xylulose fermentation results from metabolic overflow, whereby the flux through glycolysis is higher than the maximal flux that can enter respiration. We suggest that this overflow results from a suboptimal regulatory adjustment of the cells to this unfamiliar carbon source.

  18. Implication of Ca2+ in the Regulation of Replicative Life Span of Budding Yeast*

    OpenAIRE

    Tsubakiyama, Ryohei; Mizunuma, Masaki; Gengyo, Anri; Yamamoto, Josuke; Kume, Kazunori; Miyakawa, Tokichi; Hirata, Dai

    2011-01-01

    In eukaryotic cells, Ca2+-triggered signaling pathways are used to regulate a wide variety of cellular processes. Calcineurin, a highly conserved Ca2+/calmodulin-dependent protein phosphatase, plays key roles in the regulation of diverse biological processes in organisms ranging from yeast to humans. We isolated a mutant of the SIR3 gene, implicated in the regulation of life span, as a suppressor of the Ca2+ sensitivity of zds1Δ cells in the budding yeast Saccharomyces cerevisiae. Therefore, ...

  19. Continuous High-resolution Microscopic Observation of Replicative Aging in Budding Yeast

    OpenAIRE

    Huberts, Daphne H. E. W.; Janssens, Georges E.; Lee, Sung Sik; Vizcarra, Ima Avalos; Heinemann, Matthias

    2013-01-01

    We demonstrate the use of a simple microfluidic setup, in which single budding yeast cells can be tracked throughout their entire lifespan. The microfluidic chip exploits the size difference between mother and daughter cells using an array of micropads. Upon loading, cells are trapped underneath these micropads, because the distance between the micropad and cover glass is similar to the diameter of a yeast cell (3-4 μm). After the loading procedure, culture medium is continuously flushed thro...

  20. Study of budding yeast colony formation and its characterizations by using circular granular cell

    Science.gov (United States)

    Aprianti, D.; Haryanto, F.; Purqon, A.; Khotimah, S. N.; Viridi, S.

    2016-03-01

    Budding yeast can exhibit colony formation in solid substrate. The colony of pathogenic budding yeast can colonize various surfaces of the human body and medical devices. Furthermore, it can form biofilm that resists drug effective therapy. The formation of the colony is affected by the interaction between cells and with its growth media. The cell budding pattern holds an important role in colony expansion. To study this colony growth, the molecular dynamic method was chosen to simulate the interaction between budding yeast cells. Every cell was modelled by circular granular cells, which can grow and produce buds. Cohesion force, contact force, and Stokes force govern this model to mimic the interaction between cells and with the growth substrate. Characterization was determined by the maximum (L max) and minimum (L min) distances between two cells within the colony and whether two lines that connect the two cells in the maximum and minimum distances intersect each other. Therefore, it can be recognized the colony shape in circular, oval, and irregular shapes. Simulation resulted that colony formation are mostly in oval shape with little branch. It also shows that greater cohesion strength obtains more compact colony formation.

  1. Continuous High-resolution Microscopic Observation of Replicative Aging in Budding Yeast

    NARCIS (Netherlands)

    Huberts, Daphne H. E. W.; Janssens, Georges E.; Lee, Sung Sik; Vizcarra, Ima Avalos; Heinemann, Matthias

    We demonstrate the use of a simple microfluidic setup, in which single budding yeast cells can be tracked throughout their entire lifespan. The microfluidic chip exploits the size difference between mother and daughter cells using an array of micropads. Upon loading, cells are trapped underneath

  2. Whole lifespan microscopic observation of budding yeast aging through a microfluidic dissection platform

    NARCIS (Netherlands)

    Lee, Sung Sik; Avalos Vizcarra, Ima; Huberts, Daphne H E W; Lee, Luke P; Heinemann, Matthias

    2012-01-01

    Important insights into aging have been generated with the genetically tractable and short-lived budding yeast. However, it is still impossible today to continuously track cells by high-resolution microscopic imaging (e.g., fluorescent imaging) throughout their entire lifespan. Instead, the field

  3. 5'-end sequences of budding yeast full-length cDNA clones and quality scores - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available east_seq_qual.zip File URL: ftp://ftp.biosciencedbc.jp/archive/yeast_cdna/LATEST/...yeast_seq_qual.zip File size: 59.9MB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/budding_yeast_cdna

  4. Downsides and benefits of unicellularity in budding yeast

    Science.gov (United States)

    Balazsi, Gabor; Chen, Lin; Kuzdzal-Fick, Jennie

    Yeast cells that do not separate after cell division form clumps. Clumping was shown to aid utilization of certain sugars, but its effects in stressful conditions are unknown. Generally speaking, what are the costs and benefits of unicellularity versus clumping multicellularity in normal and stressful conditions? To address this question, we evolved clumping yeast towards unicellularity by continuously propagating only those cells that remain suspended in liquid culture after settling. Whole-genome sequencing indicated that mutations in the AMN1 (antagonist of mitotic exit network) gene underlie the changes from clumping to unicellular phenotypes in these evolved yeast cells. Simple models predict that clumping should hinder growth in normal conditions while being protective in stress. Accordingly, we find experimentally that yeast clumps are more resistant to freeze/thaw, hydrogen peroxide, and ethanol stressors than their unicellular counterparts. On the other hand, unicellularity seems to be advantageous in normal conditions. Overall, these results reveal the downsides and benefits of unicellularity in different environmental conditions and uncover its genetic bases in yeast. This research was supported by the NIH Director's New Innovator Award Program (1DP2 OD006481-01), by NSF/IOS 1021675 and the Laufer Center for Physical & Quantitative Biology.

  5. The duration of mitosis and daughter cell size are modulated by nutrients in budding yeast.

    Science.gov (United States)

    Leitao, Ricardo M; Kellogg, Douglas R

    2017-11-06

    The size of nearly all cells is modulated by nutrients. Thus, cells growing in poor nutrients can be nearly half the size of cells in rich nutrients. In budding yeast, cell size is thought to be controlled almost entirely by a mechanism that delays cell cycle entry until sufficient growth has occurred in G1 phase. Here, we show that most growth of a new daughter cell occurs in mitosis. When the rate of growth is slowed by poor nutrients, the duration of mitosis is increased, which suggests that cells compensate for slow growth in mitosis by increasing the duration of growth. The amount of growth required to complete mitosis is reduced in poor nutrients, leading to a large reduction in cell size. Together, these observations suggest that mechanisms that control the extent of growth in mitosis play a major role in cell size control in budding yeast. © 2017 Leitao and Kellogg.

  6. Considerations for creating and annotating the budding yeast Genome Map at SGD: a progress report.

    Science.gov (United States)

    Chan, Esther T; Cherry, J Michael

    2012-01-01

    The Saccharomyces Genome Database (SGD) is compiling and annotating a comprehensive catalogue of functional sequence elements identified in the budding yeast genome. Recent advances in deep sequencing technologies have enabled for example, global analyses of transcription profiling and assembly of maps of transcription factor occupancy and higher order chromatin organization, at nucleotide level resolution. With this growing influx of published genome-scale data, come new challenges for their storage, display, analysis and integration. Here, we describe SGD's progress in the creation of a consolidated resource for genome sequence elements in the budding yeast, the considerations taken in its design and the lessons learned thus far. The data within this collection can be accessed at http://browse.yeastgenome.org and downloaded from http://downloads.yeastgenome.org. DATABASE URL: http://www.yeastgenome.org.

  7. Evolution of multinucleated Ashbya gossypii hyphae from a budding yeast-like ancestor.

    Science.gov (United States)

    Schmitz, Hans-Peter; Philippsen, Peter

    2011-06-01

    In the filamentous ascomycete Ashbya gossypii polarity establishment at sites of germ tube and lateral branch emergence depends on homologues of Saccharomyces cerevisiae factors controlling bud site selection and bud emergence. Maintenance of polar growth involves homologues of well-known polarity factors of budding yeast. To achieve the much higher rates of sustained polar surface expansion of hyphae compared to mainly non-polarly growing yeast buds five important alterations had to evolve. Permanent presence of the polarity machinery at a confined area in the rapidly expanding hyphal tip, increased cytoplasmic space with a much enlarged ER surface for generating secretory vesicles, efficient directed transport of secretory vesicles to and accumulation at the tip, increased capacity of the exocytosis system to process these vesicles, and an efficient endocytosis system for membrane and polarity factor recycling adjacent to the zone of exocytosis. Morphological, cell biological, and molecular aspects of this evolution are discussed based on experiments performed within the past 10 y. Copyright © 2011 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  8. Implication of Ca2+ in the regulation of replicative life span of budding yeast.

    Science.gov (United States)

    Tsubakiyama, Ryohei; Mizunuma, Masaki; Gengyo, Anri; Yamamoto, Josuke; Kume, Kazunori; Miyakawa, Tokichi; Hirata, Dai

    2011-08-19

    In eukaryotic cells, Ca(2+)-triggered signaling pathways are used to regulate a wide variety of cellular processes. Calcineurin, a highly conserved Ca(2+)/calmodulin-dependent protein phosphatase, plays key roles in the regulation of diverse biological processes in organisms ranging from yeast to humans. We isolated a mutant of the SIR3 gene, implicated in the regulation of life span, as a suppressor of the Ca(2+) sensitivity of zds1Δ cells in the budding yeast Saccharomyces cerevisiae. Therefore, we investigated a relationship between Ca(2+) signaling and life span in yeast. Here we show that Ca(2+) affected the replicative life span (RLS) of yeast. Increased external and intracellular Ca(2+) levels caused a reduction in their RLS. Consistently, the increase in calcineurin activity by either the zds1 deletion or the constitutively activated calcineurin reduced RLS. Indeed, the shortened RLS of zds1Δ cells was suppressed by the calcineurin deletion. Further, the calcineurin deletion per se promoted aging without impairing the gene silencing typically observed in short-lived sir mutants, indicating that calcineurin plays an important role in a regulation of RLS even under normal growth condition. Thus, our results indicate that Ca(2+) homeostasis/Ca(2+) signaling are required to regulate longevity in budding yeast.

  9. A nutrient dependant switch explains mutually exclusive existence of meiosis and mitosis initiation in budding yeast.

    Science.gov (United States)

    Wannige, C T; Kulasiri, D; Samarasinghe, S

    2014-01-21

    Nutrients from living environment are vital for the survival and growth of any organism. Budding yeast diploid cells decide to grow by mitosis type cell division or decide to create unique, stress resistant spores by meiosis type cell division depending on the available nutrient conditions. To gain a molecular systems level understanding of the nutrient dependant switching between meiosis and mitosis initiation in diploid cells of budding yeast, we develop a theoretical model based on ordinary differential equations (ODEs) including the mitosis initiator and its relations to budding yeast meiosis initiation network. Our model accurately and qualitatively predicts the experimentally revealed temporal variations of related proteins under different nutrient conditions as well as the diverse mutant studies related to meiosis and mitosis initiation. Using this model, we show how the meiosis and mitosis initiators form an all-or-none type bistable switch in response to available nutrient level (mainly nitrogen). The transitions to and from meiosis or mitosis initiation states occur via saddle node bifurcation. This bidirectional switch helps the optimal usage of available nutrients and explains the mutually exclusive existence of meiosis and mitosis pathways. © 2013 Elsevier Ltd. All rights reserved.

  10. The Malleable Nature of the Budding Yeast Nuclear Envelope: Flares, Fusion, and Fenestrations.

    Science.gov (United States)

    Meseroll, Rebecca A; Cohen-Fix, Orna

    2016-11-01

    In eukaryotes, the nuclear envelope (NE) physically separates nuclear components and activities from rest of the cell. The NE also provides rigidity to the nucleus and contributes to chromosome organization. At the same time, the NE is highly dynamic; it must change shape and rearrange its components during development and throughout the cell cycle, and its morphology can be altered in response to mutation and disease. Here we focus on the NE of budding yeast, Saccharomyces cerevisiae, which has several unique features: it remains intact throughout the cell cycle, expands symmetrically during interphase, elongates during mitosis and, expands asymmetrically during mitotic delay. Moreover, its NE is safely breached during mating and when large structures, such as nuclear pore complexes and the spindle pole body, are embedded into its double membrane. The budding yeast NE lacks lamins and yet the nucleus is capable of maintaining a spherical shape throughout interphase. Despite these eccentricities, studies of the budding yeast NE have uncovered interesting, and likely conserved, processes that contribute to NE dynamics. In particular, we discuss the processes that drive and enable NE expansion and the dramatic changes in the NE that lead to extensions and fenestrations. J. Cell. Physiol. 231: 2353-2360, 2016. Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

  11. Relationship between sensitivity to ultraviolet light and budding in yeast cells of different culture ages

    International Nuclear Information System (INIS)

    Atsuta, J.; Okajima, S.

    1976-01-01

    Subpopulations of yeast cells, consisting of cells of different sizes and different percentages of budding cells, were prepared by centrifugation through sucrose solutions with linear density gradients of cultures at different phases of the growth cycle. Ultraviolet survival of these cells was determined by colony counting, and the survival rate was compared with the cells' respiratory rates. Individual budding cells and interdivisional cells, and also mother cells and daughter cells derived from irradiated budding cells, were isolated by the micromanipulation technique. The number of divisions in each cell was measured during a 21-hr incubation period immediately after irradiation. In the population in the logarithmic phase consisting of homogeneous cells of middle size, no difference in uv sensitivity was observed between mother cells and daughter cells, irrespective of mutual adhesion. Budding cell resistance was observed in the population in the transitional phase; this was due to the lesser uv sensitivity of daughter cells in the fresh medium. In the stationary phase, daughter cells were rather more sensitive than mother cells or interdivisional cells, so there was little difference in uv sensitivity between budding cells and interdivisional cells

  12. Genetic variation in adaptability and pleiotropy in budding yeast.

    Science.gov (United States)

    Jerison, Elizabeth R; Kryazhimskiy, Sergey; Mitchell, James Kameron; Bloom, Joshua S; Kruglyak, Leonid; Desai, Michael M

    2017-08-17

    Evolution can favor organisms that are more adaptable, provided that genetic variation in adaptability exists. Here, we quantify this variation among 230 offspring of a cross between diverged yeast strains. We measure the adaptability of each offspring genotype, defined as its average rate of adaptation in a specific environmental condition, and analyze the heritability, predictability, and genetic basis of this trait. We find that initial genotype strongly affects adaptability and can alter the genetic basis of future evolution. Initial genotype also affects the pleiotropic consequences of adaptation for fitness in a different environment. This genetic variation in adaptability and pleiotropy is largely determined by initial fitness, according to a rule of declining adaptability with increasing initial fitness, but several individual QTLs also have a significant idiosyncratic role. Our results demonstrate that both adaptability and pleiotropy are complex traits, with extensive heritable differences arising from naturally occurring variation.

  13. Focal accumulation of preribosomes outside the nucleolus during metaphase-anaphase in budding yeast.

    Science.gov (United States)

    Moriggi, Giulia; Gaspar, Sonia G; Nieto, Blanca; Bustelo, Xosé R; Dosil, Mercedes

    2017-09-01

    Saccharomyces cerevisiae contains one nucleolus that remains intact in the mother-cell side of the nucleus throughout most of mitosis. Based on this, it is assumed that the bulk of ribosome production during cell division occurs in the mother cell. Here, we show that the ribosome synthesis machinery localizes not only in the nucleolus but also at a center that is present in the bud side of the nucleus after the initiation of mitosis. This center can be visualized by live microscopy as a punctate body located in close proximity to the nuclear envelope and opposite to the nucleolus. It contains ribosomal DNA (rDNA) and precursors of both 40S and 60S ribosomal subunits. Proteins that actively participate in ribosome synthesis, but not functionally defective variants, accumulate in that site. The formation of this body occurs in the metaphase-to-anaphase transition when discrete regions of rDNA occasionally exit the nucleolus and move into the bud. Collectively, our data unveil the existence of a previously unknown mechanism for preribosome accumulation at the nuclear periphery in budding yeast. We propose that this might be a strategy to expedite the delivery of ribosomes to the growing bud. © 2017 Moriggi et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  14. Focal accumulation of preribosomes outside the nucleolus during metaphase–anaphase in budding yeast

    Science.gov (United States)

    Moriggi, Giulia; Gaspar, Sonia G.; Nieto, Blanca; Bustelo, Xosé R.

    2017-01-01

    Saccharomyces cerevisiae contains one nucleolus that remains intact in the mother-cell side of the nucleus throughout most of mitosis. Based on this, it is assumed that the bulk of ribosome production during cell division occurs in the mother cell. Here, we show that the ribosome synthesis machinery localizes not only in the nucleolus but also at a center that is present in the bud side of the nucleus after the initiation of mitosis. This center can be visualized by live microscopy as a punctate body located in close proximity to the nuclear envelope and opposite to the nucleolus. It contains ribosomal DNA (rDNA) and precursors of both 40S and 60S ribosomal subunits. Proteins that actively participate in ribosome synthesis, but not functionally defective variants, accumulate in that site. The formation of this body occurs in the metaphase-to-anaphase transition when discrete regions of rDNA occasionally exit the nucleolus and move into the bud. Collectively, our data unveil the existence of a previously unknown mechanism for preribosome accumulation at the nuclear periphery in budding yeast. We propose that this might be a strategy to expedite the delivery of ribosomes to the growing bud. PMID:28588079

  15. Screening the budding yeast genome reveals unique factors affecting K2 toxin susceptibility.

    Science.gov (United States)

    Servienė, Elena; Lukša, Juliana; Orentaitė, Irma; Lafontaine, Denis L J; Urbonavičius, Jaunius

    2012-01-01

    Understanding how biotoxins kill cells is of prime importance in biomedicine and the food industry. The budding yeast (S. cerevisiae) killers serve as a convenient model to study the activity of biotoxins consistently supplying with significant insights into the basic mechanisms of virus-host cell interactions and toxin entry into eukaryotic target cells. K1 and K2 toxins are active at the cell wall, leading to the disruption of the plasma membrane and subsequent cell death by ion leakage. K28 toxin is active in the cell nucleus, blocking DNA synthesis and cell cycle progression, thereby triggering apoptosis. Genome-wide screens in the budding yeast S. cerevisiae identified several hundred effectors of K1 and K28 toxins. Surprisingly, no such screen had been performed for K2 toxin, the most frequent killer toxin among industrial budding yeasts. We conducted several concurrent genome-wide screens in S. cerevisiae and identified 332 novel K2 toxin effectors. The effectors involved in K2 resistance and hypersensitivity largely map in distinct cellular pathways, including cell wall and plasma membrane structure/biogenesis and mitochondrial function for K2 resistance, and cell wall stress signaling and ion/pH homeostasis for K2 hypersensitivity. 70% of K2 effectors are different from those involved in K1 or K28 susceptibility. Our work demonstrates that despite the fact that K1 and K2 toxins share some aspects of their killing strategies, they largely rely on different sets of effectors. Since the vast majority of the host factors identified here is exclusively active towards K2, we conclude that cells have acquired a specific K2 toxin effectors set. Our work thus indicates that K1 and K2 have elaborated different biological pathways and provides a first step towards the detailed characterization of K2 mode of action.

  16. License - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project License to Use This Database Last updated : 2010/02/15 You may use this databas...ional License described below. The Standard License specifies the license terms regarding the use of this database... and the requirements you must follow in using this database. The Additiona...n the Standard License. Standard License The Standard License for this database is the license specified in ...the Creative Commons Attribution-Share Alike 2.1 Japan . If you use data from this database

  17. Global study of holistic morphological effectors in the budding yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Suzuki, Godai; Wang, Yang; Kubo, Karen; Hirata, Eri; Ohnuki, Shinsuke; Ohya, Yoshikazu

    2018-02-20

    The size of the phenotypic effect of a gene has been thoroughly investigated in terms of fitness and specific morphological traits in the budding yeast Saccharomyces cerevisiae, but little is known about gross morphological abnormalities. We identified 1126 holistic morphological effectors that cause severe gross morphological abnormality when deleted, and 2241 specific morphological effectors with weak holistic effects but distinctive effects on yeast morphology. Holistic effectors fell into many gene function categories and acted as network hubs, affecting a large number of morphological traits, interacting with a large number of genes, and facilitating high protein expression. Holistic morphological abnormality was useful for estimating the importance of a gene to morphology. The contribution of gene importance to fitness and morphology could be used to efficiently classify genes into functional groups. Holistic morphological abnormality can be used as a reproducible and reliable gene feature for high-dimensional morphological phenotyping. It can be used in many functional genomic applications.

  18. Synchronization and Arrest of the Budding Yeast Cell Cycle Using Chemical and Genetic Methods.

    Science.gov (United States)

    Rosebrock, Adam P

    2017-01-03

    The cell cycle of budding yeast can be arrested at specific positions by different genetic and chemical methods. These arrests enable study of cell cycle phase-specific phenotypes that would be missed during examination of asynchronous cultures. Some methods for arrest are reversible, with kinetics that enable release of cells back into a synchronous cycling state. Benefits of chemical and genetic methods include scalability across a large range of culture sizes from a few milliliters to many liters, ease of execution, the absence of specific equipment requirements, and synchronization and release of the entire culture. Of note, cell growth and division are decoupled during arrest and block-release experiments. Cells will continue transcription, translation, and accumulation of protein while arrested. If allowed to reenter the cell cycle, cells will do so as a population of mixed, larger-than-normal cells. Despite this important caveat, many aspects of budding yeast physiology are accessible using these simple chemical and genetic tools. Described here are methods for the block and release of cells in G 1 phase and at the M/G 1 transition using α-factor mating pheromone and the temperature-sensitive cdc15-2 allele, respectively, in addition to methods for arresting the cell cycle in early S phase and at G 2 /M by using hydroxyurea and nocodazole, respectively. © 2017 Cold Spring Harbor Laboratory Press.

  19. An insight into the complex prion-prion interaction network in the budding yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Du, Zhiqiang; Valtierra, Stephanie; Li, Liming

    2014-01-01

    The budding yeast Saccharomyces cerevisiae is a valuable model system for studying prion-prion interactions as it contains multiple prion proteins. A recent study from our laboratory showed that the existence of Swi1 prion ([SWI(+)]) and overproduction of Swi1 can have strong impacts on the formation of 2 other extensively studied yeast prions, [PSI(+)] and [PIN(+)] ([RNQ(+)]) (Genetics, Vol. 197, 685-700). We showed that a single yeast cell is capable of harboring at least 3 heterologous prion elements and these prions can influence each other's appearance positively and/or negatively. We also showed that during the de novo [PSI(+)] formation process upon Sup35 overproduction, the aggregation patterns of a preexisting inducer ([RNQ(+)] or [SWI(+)]) can undergo significant remodeling from stably transmitted dot-shaped aggregates to aggregates that co-localize with the newly formed Sup35 aggregates that are ring/ribbon/rod- shaped. Such co-localization disappears once the newly formed [PSI(+)] prion stabilizes. Our finding provides strong evidence supporting the "cross-seeding" model for prion-prion interactions and confirms earlier reports that the interactions among different prions and their prion proteins mostly occur at the initiation stages of prionogenesis. Our results also highlight a complex prion interaction network in yeast. We believe that elucidating the mechanism underlying the yeast prion-prion interaction network will not only provide insight into the process of prion de novo generation and propagation in yeast but also shed light on the mechanisms that govern protein misfolding, aggregation, and amyloidogenesis in higher eukaryotes.

  20. Live cell imaging of mitochondrial movement along actin cables in budding yeast.

    Science.gov (United States)

    Fehrenbacher, Kammy L; Yang, Hyeong-Cheol; Gay, Anna Card; Huckaba, Thomas M; Pon, Liza A

    2004-11-23

    Mitochondrial inheritance is essential for cell division. In budding yeast, mitochondrial movement from mother to daughter requires (1) actin cables, F-actin bundles that undergo retrograde movement during elongation from buds into mother cells; (2) the mitochore, a mitochondrial protein complex implicated in linking mitochondria to actin cables; and (3) Arp2/3 complex-mediated force generation on mitochondria. We observed three new classes of mitochondrial motility: anterograde movement at velocities of 0.2-0.33 microm/s, retrograde movement at velocities of 0.26-0.51 microm/s, and no net anterograde or retrograde movement. In all cases, motile mitochondria were associated with actin cables undergoing retrograde flow at velocities of 0.18-0.62 microm/s. Destabilization of actin cables or mutations of the mitochore blocked all mitochondrial movements. In contrast, mutations in the Arp2/3 complex affected anterograde but not retrograde mitochondrial movements. Actin cables are required for movement of mitochondria, secretory vesicles, mRNA, and spindle alignment elements in yeast. We provide the first direct evidence that one of the proposed cargos use actin cables as tracks. In the case of mitochondrial inheritance, anterograde movement drives transfer of the organelle from mothers to buds, while retrograde movement contributes to retention of the organelle in mother cells. Interaction of mitochondria with actin cables is required for anterograde and retrograde movement. In contrast, force generation on mitochondria is required only for anterograde movement. Finally, we propose a novel mechanism in which actin cables serve as "conveyor belts" that drive retrograde organelle movement.

  1. The phytopathogenic virulent effector protein RipI induces apoptosis in budding yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Deng, Meng-Ying; Sun, Yun-Hao; Li, Pai; Fu, Bei; Shen, Dong; Lu, Yong-Jun

    2016-10-01

    Virulent protein toxins secreted by the bacterial pathogens can cause cytotoxicity by various molecular mechanisms to combat host cell defense. On the other hand, these proteins can also be used as probes to investigate the defense pathway of host innate immunity. Ralstonia solanacearum, one of the most virulent bacterial phytopathogens, translocates more than 70 effector proteins via type III secretion system during infection. Here, we characterized the cytotoxicity of effector RipI in budding yeast Saccharomyce scerevisiae, an alternative host model. We found that over-expression of RipI resulted in severe growth defect and arginine (R) 117 within the predicted integrase motif was required for inhibition of yeast growth. The phenotype of death manifested the hallmarks of apoptosis. Our data also revealed that RipI-induced apoptosis was independent of Yca1 and mitochondria-mediated apoptotic pathways because Δyca1 and Δaif1 were both sensitive to RipI as compared with the wild type. We further demonstrated that RipI was localized in the yeast nucleus and the N-terminal 1-174aa was required for the localization. High-throughput RNA sequencing analysis showed that upon RipI over-expression, 101 unigenes of yeast ribosome presented lower expression level, and 42 GO classes related to the nucleus or recombination were enriched with differential expression levels. Taken together, our data showed that a nuclear-targeting effector RipI triggers yeast apoptosis, potentially dependent on its integrase function. Our results also provided an alternative strategy to dissect the signaling pathway of cytotoxicity induced by the protein toxins. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. Methods for Synchronization and Analysis of the Budding Yeast Cell Cycle.

    Science.gov (United States)

    Rosebrock, Adam P

    2017-01-03

    Like other eukaryotes, budding yeast temporally separate cell growth and division. DNA synthesis is distinct from chromosome segregation. Storage carbohydrates are accumulated slowly and then rapidly liquidated once per cycle. Cyclin-dependent kinase associates with multiple different transcriptionally and posttranslationally regulated cyclins to drive the cell cycle. These and other crucial events of cellular growth and division are limited to narrow windows of the cell cycle. Many experiments in the yeast laboratory treat a culture of cells as a homogeneous mixture. Measurements of asynchronous cultures are, however, confounded by the presence of cells in various cell cycle stages; measuring a population average in unsynchronized cells provides at best a decreased signal and at worst an artifactual result. A number of experimentally tractable methods have been developed to generate populations of yeast cells that are synchronized with respect to cell cycle phase. Robust methods for determining cell cycle position have also been developed. These methods are introduced here. © 2017 Cold Spring Harbor Laboratory Press.

  3. Specificity of mutations induced by carbon ions in budding yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Matuo, Youichirou; Nishijima, Shigehiro; Hase, Yoshihiro; Sakamoto, Ayako; Tanaka, Atsushi; Shimizu, Kikuo

    2006-01-01

    To investigate the nature of mutations induced by accelerated ions in eukaryotic cells, the effects of carbon-ion irradiation were compared with those of γ-ray irradiation in the budding yeast Saccharomyces cerevisiae. The mutational effect and specificity of carbon-ion beams were studied in the URA3 gene of the yeast. Our experiments showed that the carbon ions generated more than 10 times the number of mutations induced by γ-rays, and that the types of base changes induced by carbon ions include transversions (68.7%), transitions (13.7%) and deletions/insertions (17.6%). The transversions were mainly G:C → T:A, and all the transitions were G:C → A:T. In comparison with the surrounding sequence context of mutational base sites, the C residues in the 5'-AC(A/T)-3' sequence were found to be easily changed. Large deletions and duplications were not observed, whereas ion-induced mutations in Arabidopsis thaliana were mainly short deletions and rearrangements. The remarkable feature of yeast mutations induced by carbon ions was that the mutation sites were localized near the linker regions of nucleosomes, whereas mutations induced by γ-ray irradiation were located uniformly throughout the gene

  4. Specificity of mutations induced by carbon ions in budding yeast Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Matuo, Youichirou [Graduate School of Engineering, Osaka University, Yamada-oka 2-1, Suita, Osaka 565-0871 (Japan); Nishijima, Shigehiro [Graduate School of Engineering, Osaka University, Yamada-oka 2-1, Suita, Osaka 565-0871 (Japan); Hase, Yoshihiro [Radiation-Applied Biology Division, Quantum Beam Science Directorate, Japan Atomic Energy Agency (JAEA), Watanuki-machi 1233, Takasaki, Gunma 370-1292 (Japan); Sakamoto, Ayako [Radiation-Applied Biology Division, Quantum Beam Science Directorate, Japan Atomic Energy Agency (JAEA), Watanuki-machi 1233, Takasaki, Gunma 370-1292 (Japan); Tanaka, Atsushi [Radiation-Applied Biology Division, Quantum Beam Science Directorate, Japan Atomic Energy Agency (JAEA), Watanuki-machi 1233, Takasaki, Gunma 370-1292 (Japan); Shimizu, Kikuo [Radioisotope Research Center, Osaka University, Yamada-oka 2-4, Suita, Osaka 565-0871 (Japan)]. E-mail: shimizu@rirc.osaka-u.ac.jp

    2006-12-01

    To investigate the nature of mutations induced by accelerated ions in eukaryotic cells, the effects of carbon-ion irradiation were compared with those of {gamma}-ray irradiation in the budding yeast Saccharomyces cerevisiae. The mutational effect and specificity of carbon-ion beams were studied in the URA3 gene of the yeast. Our experiments showed that the carbon ions generated more than 10 times the number of mutations induced by {gamma}-rays, and that the types of base changes induced by carbon ions include transversions (68.7%), transitions (13.7%) and deletions/insertions (17.6%). The transversions were mainly G:C {sup {yields}} T:A, and all the transitions were G:C {sup {yields}} A:T. In comparison with the surrounding sequence context of mutational base sites, the C residues in the 5'-AC(A/T)-3' sequence were found to be easily changed. Large deletions and duplications were not observed, whereas ion-induced mutations in Arabidopsis thaliana were mainly short deletions and rearrangements. The remarkable feature of yeast mutations induced by carbon ions was that the mutation sites were localized near the linker regions of nucleosomes, whereas mutations induced by {gamma}-ray irradiation were located uniformly throughout the gene.

  5. A microfluidic system for studying ageing and dynamic single-cell responses in budding yeast.

    Directory of Open Access Journals (Sweden)

    Matthew M Crane

    Full Text Available Recognition of the importance of cell-to-cell variability in cellular decision-making and a growing interest in stochastic modeling of cellular processes has led to an increased demand for high density, reproducible, single-cell measurements in time-varying surroundings. We present ALCATRAS (A Long-term Culturing And TRApping System, a microfluidic device that can quantitatively monitor up to 1000 cells of budding yeast in a well-defined and controlled environment. Daughter cells are removed by fluid flow to avoid crowding allowing experiments to run for over 60 hours, and the extracellular media may be changed repeatedly and in seconds. We illustrate use of the device by measuring ageing through replicative life span curves, following the dynamics of the cell cycle, and examining history-dependent behaviour in the general stress response.

  6. Daughter-specific transcription factors regulate cell size control in budding yeast.

    Science.gov (United States)

    Di Talia, Stefano; Wang, Hongyin; Skotheim, Jan M; Rosebrock, Adam P; Futcher, Bruce; Cross, Frederick R

    2009-10-01

    In budding yeast, asymmetric cell division yields a larger mother and a smaller daughter cell, which transcribe different genes due to the daughter-specific transcription factors Ace2 and Ash1. Cell size control at the Start checkpoint has long been considered to be a main regulator of the length of the G1 phase of the cell cycle, resulting in longer G1 in the smaller daughter cells. Our recent data confirmed this concept using quantitative time-lapse microscopy. However, it has been proposed that daughter-specific, Ace2-dependent repression of expression of the G1 cyclin CLN3 had a dominant role in delaying daughters in G1. We wanted to reconcile these two divergent perspectives on the origin of long daughter G1 times. We quantified size control using single-cell time-lapse imaging of fluorescently labeled budding yeast, in the presence or absence of the daughter-specific transcriptional regulators Ace2 and Ash1. Ace2 and Ash1 are not required for efficient size control, but they shift the domain of efficient size control to larger cell size, thus increasing cell size requirement for Start in daughters. Microarray and chromatin immunoprecipitation experiments show that Ace2 and Ash1 are direct transcriptional regulators of the G1 cyclin gene CLN3. Quantification of cell size control in cells expressing titrated levels of Cln3 from ectopic promoters, and from cells with mutated Ace2 and Ash1 sites in the CLN3 promoter, showed that regulation of CLN3 expression by Ace2 and Ash1 can account for the differential regulation of Start in response to cell size in mothers and daughters. We show how daughter-specific transcriptional programs can interact with intrinsic cell size control to differentially regulate Start in mother and daughter cells. This work demonstrates mechanistically how asymmetric localization of cell fate determinants results in cell-type-specific regulation of the cell cycle.

  7. Mek1/Mre4 is a master regulator of meiotic recombination in budding yeast

    Directory of Open Access Journals (Sweden)

    Nancy M. Hollingsworth

    2016-02-01

    Full Text Available Sexually reproducing organisms create gametes with half the somatic cell chromosome number so that fusion of gametes at fertilization does not change the ploidy of the cell. This reduction in chromosome number occurs by the specialized cell division of meiosis in which two rounds of chromosome segregation follow a single round of chromosome duplication. Meiotic crossovers formed between the non-sister chromatids of homologous chromosomes, combined with sister chromatid cohesion, physically connect homologs, thereby allowing proper segregation at the first meiotic division. Meiotic recombination is initiated by programmed double strand breaks (DSBs whose repair is highly regulated such that (1 there is a bias for recombination with homologs rather than sister chromatids, (2 crossovers are distributed throughout the genome by a process called interference, (3 crossover homeostasis regulates the balance between crossover and non-crossover repair to maintain a critical number of crossovers and (4 each pair of homologs receives at least one crossover. It was previously known that the imposition of interhomolog bias in budding yeast requires meiosis-specific modifications to the DNA damage response and the local activation of the meiosis-specific Mek1/Mre4 (hereafter Mek1 kinase at DSBs. However, because inactivation of Mek1 results in intersister, rather than interhomolog DSB repair, whether Mek1 had a role in interhomolog pathway choice was unknown. A recent study by Chen et al. (2015 reveals that Mek1 indirectly regulates the crossover/non-crossover decision between homologs as well as genetic interference. It does this by enabling phosphorylation of Zip1, the meiosis-specific transverse filament protein of the synaptonemal complex (SC, by the conserved cell cycle kinase, Cdc7-Dbf4 (DDK. These results suggest that Mek1 is a “master regulator” of meiotic recombination in budding yeast.

  8. Daughter-Specific Transcription Factors Regulate Cell Size Control in Budding Yeast

    Science.gov (United States)

    Di Talia, Stefano; Wang, Hongyin; Skotheim, Jan M.; Rosebrock, Adam P.; Futcher, Bruce; Cross, Frederick R.

    2009-01-01

    In budding yeast, asymmetric cell division yields a larger mother and a smaller daughter cell, which transcribe different genes due to the daughter-specific transcription factors Ace2 and Ash1. Cell size control at the Start checkpoint has long been considered to be a main regulator of the length of the G1 phase of the cell cycle, resulting in longer G1 in the smaller daughter cells. Our recent data confirmed this concept using quantitative time-lapse microscopy. However, it has been proposed that daughter-specific, Ace2-dependent repression of expression of the G1 cyclin CLN3 had a dominant role in delaying daughters in G1. We wanted to reconcile these two divergent perspectives on the origin of long daughter G1 times. We quantified size control using single-cell time-lapse imaging of fluorescently labeled budding yeast, in the presence or absence of the daughter-specific transcriptional regulators Ace2 and Ash1. Ace2 and Ash1 are not required for efficient size control, but they shift the domain of efficient size control to larger cell size, thus increasing cell size requirement for Start in daughters. Microarray and chromatin immunoprecipitation experiments show that Ace2 and Ash1 are direct transcriptional regulators of the G1 cyclin gene CLN3. Quantification of cell size control in cells expressing titrated levels of Cln3 from ectopic promoters, and from cells with mutated Ace2 and Ash1 sites in the CLN3 promoter, showed that regulation of CLN3 expression by Ace2 and Ash1 can account for the differential regulation of Start in response to cell size in mothers and daughters. We show how daughter-specific transcriptional programs can interact with intrinsic cell size control to differentially regulate Start in mother and daughter cells. This work demonstrates mechanistically how asymmetric localization of cell fate determinants results in cell-type-specific regulation of the cell cycle. PMID:19841732

  9. Daughter-specific transcription factors regulate cell size control in budding yeast.

    Directory of Open Access Journals (Sweden)

    Stefano Di Talia

    2009-10-01

    Full Text Available In budding yeast, asymmetric cell division yields a larger mother and a smaller daughter cell, which transcribe different genes due to the daughter-specific transcription factors Ace2 and Ash1. Cell size control at the Start checkpoint has long been considered to be a main regulator of the length of the G1 phase of the cell cycle, resulting in longer G1 in the smaller daughter cells. Our recent data confirmed this concept using quantitative time-lapse microscopy. However, it has been proposed that daughter-specific, Ace2-dependent repression of expression of the G1 cyclin CLN3 had a dominant role in delaying daughters in G1. We wanted to reconcile these two divergent perspectives on the origin of long daughter G1 times. We quantified size control using single-cell time-lapse imaging of fluorescently labeled budding yeast, in the presence or absence of the daughter-specific transcriptional regulators Ace2 and Ash1. Ace2 and Ash1 are not required for efficient size control, but they shift the domain of efficient size control to larger cell size, thus increasing cell size requirement for Start in daughters. Microarray and chromatin immunoprecipitation experiments show that Ace2 and Ash1 are direct transcriptional regulators of the G1 cyclin gene CLN3. Quantification of cell size control in cells expressing titrated levels of Cln3 from ectopic promoters, and from cells with mutated Ace2 and Ash1 sites in the CLN3 promoter, showed that regulation of CLN3 expression by Ace2 and Ash1 can account for the differential regulation of Start in response to cell size in mothers and daughters. We show how daughter-specific transcriptional programs can interact with intrinsic cell size control to differentially regulate Start in mother and daughter cells. This work demonstrates mechanistically how asymmetric localization of cell fate determinants results in cell-type-specific regulation of the cell cycle.

  10. Maintenance of cellular ATP level by caloric restriction correlates chronological survival of budding yeast

    International Nuclear Information System (INIS)

    Choi, Joon-Seok; Lee, Cheol-Koo

    2013-01-01

    Highlights: •CR decreases total ROS and mitochondrial superoxide during the chronological aging. •CR does not affect the levels of oxidative damage on protein and DNA. •CR contributes extension of chronological lifespan by maintenance of ATP level -- Abstract: The free radical theory of aging emphasizes cumulative oxidative damage in the genome and intracellular proteins due to reactive oxygen species (ROS), which is a major cause for aging. Caloric restriction (CR) has been known as a representative treatment that prevents aging; however, its mechanism of action remains elusive. Here, we show that CR extends the chronological lifespan (CLS) of budding yeast by maintaining cellular energy levels. CR reduced the generation of total ROS and mitochondrial superoxide; however, CR did not reduce the oxidative damage in proteins and DNA. Subsequently, calorie-restricted yeast had higher mitochondrial membrane potential (MMP), and it sustained consistent ATP levels during the process of chronological aging. Our results suggest that CR extends the survival of the chronologically aged cells by improving the efficiency of energy metabolism for the maintenance of the ATP level rather than reducing the global oxidative damage of proteins and DNA

  11. Maintenance of cellular ATP level by caloric restriction correlates chronological survival of budding yeast

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Joon-Seok; Lee, Cheol-Koo, E-mail: cklee2005@korea.ac.kr

    2013-09-13

    Highlights: •CR decreases total ROS and mitochondrial superoxide during the chronological aging. •CR does not affect the levels of oxidative damage on protein and DNA. •CR contributes extension of chronological lifespan by maintenance of ATP level -- Abstract: The free radical theory of aging emphasizes cumulative oxidative damage in the genome and intracellular proteins due to reactive oxygen species (ROS), which is a major cause for aging. Caloric restriction (CR) has been known as a representative treatment that prevents aging; however, its mechanism of action remains elusive. Here, we show that CR extends the chronological lifespan (CLS) of budding yeast by maintaining cellular energy levels. CR reduced the generation of total ROS and mitochondrial superoxide; however, CR did not reduce the oxidative damage in proteins and DNA. Subsequently, calorie-restricted yeast had higher mitochondrial membrane potential (MMP), and it sustained consistent ATP levels during the process of chronological aging. Our results suggest that CR extends the survival of the chronologically aged cells by improving the efficiency of energy metabolism for the maintenance of the ATP level rather than reducing the global oxidative damage of proteins and DNA.

  12. Experimental testing of a new integrated model of the budding yeast Start transition.

    Science.gov (United States)

    Adames, Neil R; Schuck, P Logan; Chen, Katherine C; Murali, T M; Tyson, John J; Peccoud, Jean

    2015-11-05

    The cell cycle is composed of bistable molecular switches that govern the transitions between gap phases (G1 and G2) and the phases in which DNA is replicated (S) and partitioned between daughter cells (M). Many molecular details of the budding yeast G1-S transition (Start) have been elucidated in recent years, especially with regard to its switch-like behavior due to positive feedback mechanisms. These results led us to reevaluate and expand a previous mathematical model of the yeast cell cycle. The new model incorporates Whi3 inhibition of Cln3 activity, Whi5 inhibition of SBF and MBF transcription factors, and feedback inhibition of Whi5 by G1-S cyclins. We tested the accuracy of the model by simulating various mutants not described in the literature. We then constructed these novel mutant strains and compared their observed phenotypes to the model's simulations. The experimental results reported here led to further changes of the model, which will be fully described in a later article. Our study demonstrates the advantages of combining model design, simulation, and testing in a coordinated effort to better understand a complex biological network. © 2015 Adames et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  13. Measurement of the volume growth rate of single budding yeast with the MOSFET-based microfluidic Coulter counter.

    Science.gov (United States)

    Sun, Jiashu; Stowers, Chris C; Boczko, Erik M; Li, Deyu

    2010-11-07

    We report on measurements of the volume growth rate of ten individual budding yeast cells using a recently developed MOSFET-based microfluidic Coulter counter. The MOSFET-based microfluidic Coulter counter is very sensitive, provides signals that are immune from the baseline drift, and can work with cell culture media of complex composition. These desirable features allow us to directly measure the volume growth rate of single cells of Saccharomyces cerevisiae LYH3865 strain budding yeast in YNB culture media over a whole cell cycle. Results indicate that all budding yeast follow a sigmoid volume growth profile with reduced growth rates at the initial stage before the bud emerges and the final stage after the daughter gets mature. Analysis of the data indicates that even though all piecewise linear, Gomperitz, and Hill's function models can fit the global growth profile equally well, the data strongly support local exponential growth phenomenon. Accurate volume growth measurements are important for applications in systems biology where quantitative parameters are required for modeling and simulation.

  14. Effects of intense magnetic fields on sedimentation pattern and gene expression profile in budding yeast

    Science.gov (United States)

    Ikehata, Masateru; Iwasaka, Masakazu; Miyakoshi, Junji; Ueno, Shoogo; Koana, Takao

    2003-05-01

    Effects of magnetic fields (MFs) on biological systems are usually investigated using biological indices such as gene expression profiles. However, to precisely evaluate the biological effects of MF, the effects of intense MFs on systematic material transport processes including experimental environment must be seriously taken into consideration. In this study, a culture of the budding yeast, Saccharomyces cerevisiae, was used as a model for an in vitro biological test system. After exposure to 5 T static vertical MF, we found a difference in the sedimentation pattern of cells depending on the location of the dish in the magnet bore. Sedimented cells were localized in the center of the dish when they were placed in the lower part of the magnet bore while the sedimentation of the cells was uniform in dishes placed in the upper part of the bore because of the diamagnetic force. Genome wide gene expression profile of the yeast cells after exposure to 5 T static MF for 2 h suggested that the MF did not affect the expression level of any gene in yeast cells although the sedimentation pattern was altered. In addition, exposure to 10 T for 1 h and 5 T for 24 h also did not affect the gene expression. On the other hand, a slight change in expressions of several genes which are related to respiration was observed by exposure to a 14 T static MF for 24 h. The necessity of estimating the indirect effects of MFs on a study of its biological effect of MF in vitro will be discussed.

  15. Single-Cell Analysis of Growth in Budding Yeast and Bacteria Reveals a Common Size Regulation Strategy.

    Science.gov (United States)

    Soifer, Ilya; Robert, Lydia; Amir, Ariel

    2016-02-08

    To maintain a constant cell size, dividing cells have to coordinate cell-cycle events with cell growth. This coordination has long been supposed to rely on the existence of size thresholds determining cell-cycle progression [1]. In budding yeast, size is controlled at the G1/S transition [2]. In agreement with this hypothesis, the size at birth influences the time spent in G1: smaller cells have a longer G1 period [3]. Nevertheless, even though cells born smaller have a longer G1, the compensation is imperfect and they still bud at smaller cell sizes. In bacteria, several recent studies have shown that the incremental model of size control, in which size is controlled by addition of a constant volume (in contrast to a size threshold), is able to quantitatively explain the experimental data on four different bacterial species [4-7]. Here, we report on experimental results for the budding yeast Saccharomyces cerevisiae, finding, surprisingly, that cell size control in this organism is very well described by the incremental model, suggesting a common strategy for cell size control with bacteria. Additionally, we argue that for S. cerevisiae the "volume increment" is not added from birth to division, but rather between two budding events. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Cdc7-Dbf4 Regulates NDT80 Transcription as Well as Reductional Segregation during Budding Yeast Meiosis

    OpenAIRE

    Lo, Hsiao-Chi; Wan, Lihong; Rosebrock, Adam; Futcher, Bruce; Hollingsworth, Nancy M.

    2008-01-01

    In budding yeast, as in other eukaryotes, the Cdc7 protein kinase is important for initiation of DNA synthesis in vegetative cells. In addition, Cdc7 has crucial meiotic functions: it facilitates premeiotic DNA replication, and it is essential for the initiation of recombination. This work uses a chemical genetic approach to demonstrate that Cdc7 kinase has additional roles in meiosis. First, Cdc7 allows expression of NDT80, a meiosis-specific transcriptional activator required for the induct...

  17. cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project cDNA sequence quality data Data detail Data name cDNA sequence quality... data DOI 10.18908/lsdba.nbdc00838-003 Description of data contents Phred's quality score. P...tion Download License Update History of This Database Site Policy | Contact Us cDNA sequence quality

  18. A role for the budding yeast separase, Esp1, in Ty1 element retrotransposition.

    Directory of Open Access Journals (Sweden)

    Krystina L Ho

    2015-03-01

    Full Text Available Separase/Esp1 is a protease required at the onset of anaphase to cleave cohesin and thereby enable sister chromatid separation. Esp1 also promotes release of the Cdc14 phosphatase from the nucleolus to enable mitotic exit. To uncover other potential roles for separase, we performed two complementary genome-wide genetic interaction screens with a strain carrying the budding yeast esp1-1 separase mutation. We identified 161 genes that when mutated aggravate esp1-1 growth and 44 genes that upon increased dosage are detrimental to esp1-1 viability. In addition to the expected cell cycle and sister chromatid segregation genes that were identified, 24% of the genes identified in the esp1-1 genetic screens have a role in Ty1 element retrotransposition. Retrotransposons, like retroviruses, replicate through reverse transcription of an mRNA intermediate and the resultant cDNA product is integrated into the genome by a conserved transposon or retrovirus encoded integrase protein. We purified Esp1 from yeast and identified an interaction between Esp1 and Ty1 integrase using mass spectrometry that was subsequently confirmed by co-immunoprecipitation analysis. Ty1 transposon mobility and insertion upstream of the SUF16 tRNA gene are both reduced in an esp1-1 strain but increased in cohesin mutant strains. Securin/Pds1, which is required for efficient localization of Esp1 to the nucleus, is also required for efficient Ty1 transposition. We propose that Esp1 serves two roles to mediate Ty1 transposition - one to remove cohesin and the second to target Ty1-IN to chromatin.

  19. Anethole potentiates dodecanol's fungicidal activity by reducing PDR5 expression in budding yeast.

    Science.gov (United States)

    Fujita, Ken-Ichi; Ishikura, Takayuki; Jono, Yui; Yamaguchi, Yoshihiro; Ogita, Akira; Kubo, Isao; Tanaka, Toshio

    2017-02-01

    trans-Anethole (anethole), a major component of anise oil, has a broad antimicrobial spectrum and a weaker antimicrobial potency than other available antibiotics. When combined with polygodial, nagilactone E, and n-dodecanol, anethole has been shown to exhibit synergistic antifungal activity against a budding yeast, Saccharomyces cerevisiae, and a human opportunistic pathogenic yeast, Candida albicans. However, the mechanism underlying this synergistic effect of anethole has not been characterized. We studied this mechanism using dodecanol-treated S. cerevisiae cells and focusing on genes related to multidrug efflux. Although dodecanol transiently reduced the number of colony forming units, this recovered to levels similar to those of untreated cells with continued incubation beyond 24h. Reverse transcription polymerase chain reaction analysis revealed overexpression of an ATP-binding cassette (ABC) transporter gene, PDR5, in addition to a slight increase in PDR11, PDR12, and PDR15 transcriptions in dodecanol-treated cells. In the presence of anethole, these effects were attenuated and the fungicidal activity of dodecanol was extended. Dodecanol showed longer lasting fungicidal activity against a Δpdr5. In addition, Δpdr3 and Δlge1, lack transcription factors of PDR5 and PDR3, were partly and completely susceptible to dodecanol, respectively. Furthermore, combination of anethole with fluconazole was also found to exhibit synergy on C. albicans. These results indicated that although anethole reduced the transcription of several transporters, PDR5 expression was particularly relevant to dodecanol efflux. Anethole is expected to be a promising candidate drug for the inhibition of efflux by reducing the transcription of several ABC transporters. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Characterization of the minimum domain required for targeting budding yeast myosin II to the site of cell division

    Directory of Open Access Journals (Sweden)

    Tolliday Nicola J

    2006-06-01

    Full Text Available Abstract Background All eukaryotes with the exception of plants use an actomyosin ring to generate a constriction force at the site of cell division (cleavage furrow during mitosis and meiosis. The structure and filament forming abilities located in the C-terminal or tail region of one of the main components, myosin II, are important for localising the molecule to the contractile ring (CR during cytokinesis. However, it remains poorly understood how myosin II is recruited to the site of cell division and how this recruitment relates to myosin filament assembly. Significant conservation between species of the components involved in cytokinesis, including those of the CR, allows the use of easily genetically manipulated organisms, such as budding yeast (Saccharomyces cerevisiae, in the study of cytokinesis. Budding yeast has a single myosin II protein, named Myo1. Unlike most other class II myosins, the tail of Myo1 has an irregular coiled coil. In this report we use molecular genetics, biochemistry and live cell imaging to characterize the minimum localisation domain (MLD of budding yeast Myo1. Results We show that the MLD is a small region in the centre of the tail of Myo1 and that it is both necessary and sufficient for localisation of Myo1 to the yeast bud neck, the pre-determined site of cell division. Hydrodynamic measurements of the MLD, purified from bacteria or yeast, show that it is likely to exist as a trimer. We also examine the importance of a small region of low coiled coil forming probability within the MLD, which we call the hinge region. Removal of the hinge region prevents contraction of the CR. Using fluorescence recovery after photobleaching (FRAP, we show that GFP-tagged MLD is slightly more dynamic than the GFP-tagged full length molecule but less dynamic than the GFP-tagged Myo1 construct lacking the hinge region. Conclusion Our results define the intrinsic determinant for the localization of budding yeast myosin II and show

  1. Biology of the Heat Shock Response and Protein Chaperones: Budding Yeast (Saccharomyces cerevisiae) as a Model System

    Science.gov (United States)

    Verghese, Jacob; Abrams, Jennifer; Wang, Yanyu

    2012-01-01

    Summary: The eukaryotic heat shock response is an ancient and highly conserved transcriptional program that results in the immediate synthesis of a battery of cytoprotective genes in the presence of thermal and other environmental stresses. Many of these genes encode molecular chaperones, powerful protein remodelers with the capacity to shield, fold, or unfold substrates in a context-dependent manner. The budding yeast Saccharomyces cerevisiae continues to be an invaluable model for driving the discovery of regulatory features of this fundamental stress response. In addition, budding yeast has been an outstanding model system to elucidate the cell biology of protein chaperones and their organization into functional networks. In this review, we evaluate our understanding of the multifaceted response to heat shock. In addition, the chaperone complement of the cytosol is compared to those of mitochondria and the endoplasmic reticulum, organelles with their own unique protein homeostasis milieus. Finally, we examine recent advances in the understanding of the roles of protein chaperones and the heat shock response in pathogenic fungi, which is being accelerated by the wealth of information gained for budding yeast. PMID:22688810

  2. Visual screening for localized RNAs in yeast revealed novel RNAs at the bud-tip

    International Nuclear Information System (INIS)

    Andoh, Tomoko; Oshiro, Yukiko; Hayashi, Sachiko; Takeo, Hideki; Tani, Tokio

    2006-01-01

    Several RNAs, including rRNAs, snRNAs, snoRNAs, and some mRNAs, are known to be localized at specific sites in a cell. Although methods have been established to visualize RNAs in a living cell, no large-scale visual screening of localized RNAs has been performed. In this study, we constructed a genomic library in which random genomic fragments were inserted downstream of U1A-tag sequences under a GAL1 promoter. In a living yeast cell, transcribed U1A-tagged RNAs were visualized by U1A-GFP that binds the RNA sequence of the U1A-tag. In this screening, many RNAs showed nuclear signals. Since the nuclear signals of some RNAs were not seen when the U1A-tag was connected to the 3' ends of the RNAs, it is suggested that their nuclear signals correspond to nascent transcripts on GAL1 promoter plasmids. Using this screening method, we successfully identified two novel localized mRNAs, CSR2 and DAL81, which showed bud-tip localization

  3. Regulation of ER-Golgi Transport Dynamics by GTPases in Budding Yeast

    Directory of Open Access Journals (Sweden)

    Yasuyuki Suda

    2018-01-01

    Full Text Available A large number of proteins are synthesized de novo in the endoplasmic reticulum (ER. They are transported through the Golgi apparatus and then delivered to their proper destinations. The ER and the Golgi play a central role in protein processing and sorting and show dynamic features in their forms. Ras super family small GTPases mediate the protein transport through and between these organelles. The ER-localized GTPase, Sar1, facilitates the formation of COPII transport carriers at the ER exit sites (ERES on the ER for the transport of cargo proteins from the ER to the Golgi. The Golgi-localized GTPase, Arf1, controls intra-Golgi, and Golgi-to-ER transport of cargo proteins by the formation of COPI carriers. Rab GTPases localized at the Golgi, which are responsible for fusion of membranes, are thought to establish the identities of compartments. Recent evidence suggests that these small GTPases regulate not only discrete sites for generation/fusion of transport carriers, but also membrane dynamics of the organelles where they locate to ensure the integrity of transport. Here we summarize the current understandings about the membrane traffic between these organelles and highlight the cutting-edge advances from super-resolution live imaging of budding yeast, Saccharomyces cerevisiae.

  4. The step-wise pathway of septin hetero-octamer assembly in budding yeast.

    Science.gov (United States)

    Weems, Andrew; McMurray, Michael

    2017-05-25

    Septin proteins bind guanine nucleotides and form rod-shaped hetero-oligomers. Cells choose from a variety of available septins to assemble distinct hetero-oligomers, but the underlying mechanism was unknown. Using a new in vivo assay, we find that a stepwise assembly pathway produces the two species of budding yeast septin hetero-octamers: Cdc11/Shs1-Cdc12-Cdc3-Cdc10-Cdc10-Cdc3-Cdc12-Cdc11/Shs1. Rapid GTP hydrolysis by monomeric Cdc10 drives assembly of the core Cdc10 homodimer. The extended Cdc3 N terminus autoinhibits Cdc3 association with Cdc10 homodimers until prior Cdc3-Cdc12 interaction. Slow hydrolysis by monomeric Cdc12 and specific affinity of Cdc11 for transient Cdc12•GTP drive assembly of distinct trimers, Cdc11-Cdc12-Cdc3 or Shs1-Cdc12-Cdc3. Decreasing the cytosolic GTP:GDP ratio increases the incorporation of Shs1 vs Cdc11, which alters the curvature of filamentous septin rings. Our findings explain how GTP hydrolysis controls septin assembly, and uncover mechanisms by which cells construct defined septin complexes.

  5. HRR25, a putative protein kinase from budding yeast: Association with repair of damaged DNA

    International Nuclear Information System (INIS)

    Hoekstra, M.F.; Ou, A.C.; DeMaggio, A.J.; Burbee, D.G.; Liskay, R.M.; Heffron, F.

    1991-01-01

    In simple eukaryotes, protein kinases regulate mitotic and meiotic cell cycles, the response to polypeptide pheromones, and the initiation of nuclear DNA synthesis. The protein HRR25 from the budding yeast Saccharomyces cerevisiae was defined by the mutation hrr25-1. This mutation resulted in sensitivity to continuous expression of the HO double-strand endonuclease, to methyl methanesulfonate, and to x-irradiation. Homozygotes of hrr25-1 were unable to sporulate and disruption and deletion of HRR25 interfered with mitotic and meiotic cell division. Sequence analysis revealed two distinctive regions in the protein. The NH 2 -terminus of HRR25 contains the hallmark features of protein kinases, whereas the COOH-terminus is rich in proline and glutamine. Mutations in HRR25 at conserved residues found in all protein kinases inactivated the gene, and these mutants exhibited the hrr25 null phenotypes. Taken together, the hrr25 mutant phenotypes and the features of the gene product indicate that HRR25 is a distinctive member of the protein kinase superfamily

  6. A conserved signaling network monitors delivery of sphingolipids to the plasma membrane in budding yeast.

    Science.gov (United States)

    Clarke, Jesse; Dephoure, Noah; Horecka, Ira; Gygi, Steven; Kellogg, Douglas

    2017-10-01

    In budding yeast, cell cycle progression and ribosome biogenesis are dependent on plasma membrane growth, which ensures that events of cell growth are coordinated with each other and with the cell cycle. However, the signals that link the cell cycle and ribosome biogenesis to membrane growth are poorly understood. Here we used proteome-wide mass spectrometry to systematically discover signals associated with membrane growth. The results suggest that membrane trafficking events required for membrane growth generate sphingolipid-dependent signals. A conserved signaling network appears to play an essential role in signaling by responding to delivery of sphingolipids to the plasma membrane. In addition, sphingolipid-dependent signals control phosphorylation of protein kinase C (Pkc1), which plays an essential role in the pathways that link the cell cycle and ribosome biogenesis to membrane growth. Together these discoveries provide new clues as to how growth--dependent signals control cell growth and the cell cycle. © 2017 Clarke et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  7. Proteomics analysis for asymmetric inheritance of preexisting proteins between mother and daughter cells in budding yeast.

    Science.gov (United States)

    Okada, Mitsuhiro; Kusunoki, Shunta; Ishibashi, Yuko; Kito, Keiji

    2017-06-01

    In budding yeast, a mother cell can produce a finite number of daughter cells over its life. The accumulation of a variety of types of damaged components has an impact on the aging process. Asymmetrical inheritance during cell division causes these aberrant intracellular constituents to be retained in mother cells and prevents them from segregating to daughter cells. However, the understanding of asymmetrical inheritance of individual proteins that are damaged or old age, and their relevance to the aging process, has been limited. The aim of this study is to propose a proteomics strategy for asymmetrical inheritance of preexisting proteins between mother and daughter cells. During synchronous culture for one generation, newly synthesized proteins were labeled with stable isotope amino acids to discriminate preexisting proteins originally expressed in mother cells, followed by separation of mother and daughter cells using a conventional method based on biotin labeling. Isotope incorporation ratios for individual proteins were quantified using mass spectrometry. We successfully identified 21 proteins whose preexisting versions were asymmetrically inherited in mother cells, including plasma membrane transporter involved in the aging process and organelle-anchoring proteins related to the stress response to misfolded proteins. Thus, our approach would be useful for making catalog of asymmetrically inherited proteins. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  8. SAGA complex and Gcn5 are necessary for respiration in budding yeast.

    Science.gov (United States)

    Canzonetta, Claudia; Leo, Manuela; Guarino, Salvatore Rocco; Montanari, Arianna; Francisci, Silvia; Filetici, Patrizia

    2016-12-01

    In budding yeast, growth through fermentation and/or respiration is dependent on the type of carbon source present in the medium. SAGA complex is the main acetylation complex and is required, together with Rtg factors, for nucleus-mitochondria communication and transcriptional activation of specific nuclear genes. Even though acetylation is necessary for mitochondria activity and respiratory pathways the direct role of histone acetyltransferases and SAGA complex has never been investigated directly. In this study we demonstrate, for the first time, that Gcn5 and SAGA are needed for respiratory metabolism and oxygen consumption. According to a central role for acetylation in respiration we find that the Gcn5 inhibitor CPTH2 had higher efficacy on cells grown in glycerol containing media. We also demonstrated that the opposing activities of Gcn5 and Hda1 modify selectively H3-AcK18 and are essential for respiration. Taken together our results suggest a novel paradigm coupling acetyltransferase activity to respiratory metabolism. Correspondingly we propose the selective utilization of KAT inhibitor CPTH2, combined to the modulation of the respiratory metabolism of the cell, as a promising novel tool of intervention in cancer cells. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Role for cER and Mmr1p in anchorage of mitochondria at sites of polarized surface growth in budding yeast.

    Science.gov (United States)

    Swayne, Theresa C; Zhou, Chun; Boldogh, Istvan R; Charalel, Joseph K; McFaline-Figueroa, José Ricardo; Thoms, Sven; Yang, Christine; Leung, Galen; McInnes, Joseph; Erdmann, Ralf; Pon, Liza A

    2011-12-06

    Mitochondria accumulate at neuronal and immunological synapses and yeast bud tips and associate with the ER during phospholipid biosynthesis, calcium homeostasis, and mitochondrial fission. Here we show that mitochondria are associated with cortical ER (cER) sheets underlying the plasma membrane in the bud tip and confirm that a deletion in YPT11, which inhibits cER accumulation in the bud tip, also inhibits bud tip anchorage of mitochondria. Time-lapse imaging reveals that mitochondria are anchored at specific sites in the bud tip. Mmr1p, a member of the DSL1 family of tethering proteins, localizes to punctate structures on opposing surfaces of mitochondria and cER sheets underlying the bud tip and is recovered with isolated mitochondria and ER. Deletion of MMR1 impairs bud tip anchorage of mitochondria without affecting mitochondrial velocity or cER distribution. Deletion of the phosphatase PTC1 results in increased Mmr1p phosphorylation, mislocalization of Mmr1p, defects in association of Mmr1p with mitochondria and ER, and defects in bud tip anchorage of mitochondria. These findings indicate that Mmr1p contributes to mitochondrial inheritance as a mediator of anchorage of mitochondria to cER sheets in the yeast bud tip and that Ptc1p regulates Mmr1p phosphorylation, localization, and function. Copyright © 2011 Elsevier Ltd. All rights reserved.

  10. Phosphorylation and cellular function of the human Rpa2 N-terminus in the budding yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Ghospurkar, Padmaja L; Wilson, Timothy M; Liu, Shengqin; Herauf, Anna; Steffes, Jenna; Mueller, Erica N; Oakley, Gregory G; Haring, Stuart J

    2015-02-01

    Maintenance of genome integrity is critical for proper cell growth. This occurs through accurate DNA replication and repair of DNA lesions. A key factor involved in both DNA replication and the DNA damage response is the heterotrimeric single-stranded DNA (ssDNA) binding complex Replication Protein A (RPA). Although the RPA complex appears to be structurally conserved throughout eukaryotes, the primary amino acid sequence of each subunit can vary considerably. Examination of sequence differences along with the functional interchangeability of orthologous RPA subunits or regions could provide insight into important regions and their functions. This might also allow for study in simpler systems. We determined that substitution of yeast Replication Factor A (RFA) with human RPA does not support yeast cell viability. Exchange of a single yeast RFA subunit with the corresponding human RPA subunit does not function due to lack of inter-species subunit interactions. Substitution of yeast Rfa2 with domains/regions of human Rpa2 important for Rpa2 function (i.e., the N-terminus and the loop 3-4 region) supports viability in yeast cells, and hybrid proteins containing human Rpa2 N-terminal phospho-mutations result in similar DNA damage phenotypes to analogous yeast Rfa2 N-terminal phospho-mutants. Finally, the human Rpa2 N-terminus (NT) fused to yeast Rfa2 is phosphorylated in a manner similar to human Rpa2 in human cells, indicating that conserved kinases recognize the human domain in yeast. The implication is that budding yeast represents a potential model system for studying not only human Rpa2 N-terminal phosphorylation, but also phosphorylation of Rpa2 N-termini from other eukaryotic organisms. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  11. Novel E3 ubiquitin ligases that regulate histone protein levels in the budding yeast Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Rakesh Kumar Singh

    Full Text Available Core histone proteins are essential for packaging the genomic DNA into chromatin in all eukaryotes. Since multiple genes encode these histone proteins, there is potential for generating more histones than what is required for chromatin assembly. The positively charged histones have a very high affinity for negatively charged molecules such as DNA, and any excess of histone proteins results in deleterious effects on genomic stability and cell viability. Hence, histone levels are known to be tightly regulated via transcriptional, posttranscriptional and posttranslational mechanisms. We have previously elucidated the posttranslational regulation of histone protein levels by the ubiquitin-proteasome pathway involving the E2 ubiquitin conjugating enzymes Ubc4/5 and the HECT (Homologous to E6-AP C-Terminus domain containing E3 ligase Tom1 in the budding yeast. Here we report the identification of four additional E3 ligases containing the RING (Really Interesting New Gene finger domains that are involved in the ubiquitylation and subsequent degradation of excess histones in yeast. These E3 ligases are Pep5, Snt2 as well as two previously uncharacterized Open Reading Frames (ORFs YKR017C and YDR266C that we have named Hel1 and Hel2 (for Histone E3 Ligases respectively. Mutants lacking these E3 ligases are sensitive to histone overexpression as they fail to degrade excess histones and accumulate high levels of endogenous histones on histone chaperones. Co-immunoprecipitation assays showed that these E3 ligases interact with the major E2 enzyme Ubc4 that is involved in the degradation related ubiquitylation of histones. Using mutagenesis we further demonstrate that the RING domains of Hel1, Hel2 and Snt2 are required for histone regulation. Lastly, mutants corresponding to Hel1, Hel2 and Pep5 are sensitive to replication inhibitors. Overall, our results highlight the importance of posttranslational histone regulatory mechanisms that employ multiple E3

  12. Systematic Analysis of the DNA Damage Response Network in Telomere Defective Budding Yeast

    Directory of Open Access Journals (Sweden)

    Eva-Maria Holstein

    2017-07-01

    Full Text Available Functional telomeres are critically important to eukaryotic genetic stability. Scores of proteins and pathways are known to affect telomere function. Here, we report a series of related genome-wide genetic interaction screens performed on budding yeast cells with acute or chronic telomere defects. Genetic interactions were examined in cells defective in Cdc13 and Stn1, affecting two components of CST, a single stranded DNA (ssDNA binding complex that binds telomeric DNA. For comparison, genetic interactions were also examined in cells with defects in Rfa3, affecting the major ssDNA binding protein, RPA, which has overlapping functions with CST at telomeres. In more complex experiments, genetic interactions were measured in cells lacking EXO1 or RAD9, affecting different aspects of the DNA damage response, and containing a cdc13-1 induced telomere defect. Comparing fitness profiles across these data sets helps build a picture of the specific responses to different types of dysfunctional telomeres. The experiments show that each context reveals different genetic interactions, consistent with the idea that each genetic defect causes distinct molecular defects. To help others engage with the large volumes of data, the data are made available via two interactive web-based tools: Profilyzer and DIXY. One particularly striking genetic interaction observed was that the chk1∆ mutation improved fitness of cdc13-1 exo1∆ cells more than other checkpoint mutations (ddc1∆, rad9∆, rad17∆, and rad24∆, whereas, in cdc13-1 cells, the effects of all checkpoint mutations were similar. We show that this can be explained by Chk1 stimulating resection—a new function for Chk1 in the eukaryotic DNA damage response network.

  13. Positive Feedback of NDT80 Expression Ensures Irreversible Meiotic Commitment in Budding Yeast

    Science.gov (United States)

    Tsuchiya, Dai; Yang, Yang; Lacefield, Soni

    2014-01-01

    In budding yeast, meiotic commitment is the irreversible continuation of the developmental path of meiosis. After reaching meiotic commitment, cells finish meiosis and gametogenesis, even in the absence of the meiosis-inducing signal. In contrast, if the meiosis-inducing signal is removed and the mitosis-inducing signal is provided prior to reaching meiotic commitment, cells exit meiosis and return to mitosis. Previous work has shown that cells commit to meiosis after prophase I but before entering the meiotic divisions. Since the Ndt80 transcription factor induces expression of middle meiosis genes necessary for the meiotic divisions, we examined the role of the NDT80 transcriptional network in meiotic commitment. Using a microfluidic approach to analyze single cells, we found that cells commit to meiosis in prometaphase I, after the induction of the Ndt80-dependent genes. Our results showed that high-level expression of NDT80 is important for the timing and irreversibility of meiotic commitment. A modest reduction in NDT80 levels delayed meiotic commitment based on meiotic stages, although the timing of each meiotic stage was similar to that of wildtype cells. A further reduction of NDT80 resulted in the surprising finding of inappropriately uncommitted cells: withdrawal of the meiosis-inducing signal and addition of the mitosis-inducing signal to cells at stages beyond metaphase I caused return to mitosis, leading to multi-nucleate cells. Since Ndt80 enhances its own transcription through positive feedback, we tested whether positive feedback ensured the irreversibility of meiotic commitment. Ablating positive feedback in NDT80 expression resulted in a complete loss of meiotic commitment. These findings suggest that irreversibility of meiotic commitment is a consequence of the NDT80 transcriptional positive feedback loop, which provides the high-level of Ndt80 required for the developmental switch of meiotic commitment. These results also illustrate the

  14. Altered sterol metabolism in budding yeast affects mitochondrial iron-sulfur (Fe-S) cluster synthesis.

    Science.gov (United States)

    Ward, Diane M; Chen, Opal S; Li, Liangtao; Kaplan, Jerry; Bhuiyan, Shah Alam; Natarajan, Selvamuthu K; Bard, Martin; Cox, James E

    2018-05-17

    Ergosterol synthesis is essential for cellular growth and viability of the budding yeast Saccharomyces cerevisiae, and intracellular sterol distribution and homeostasis are therefore highly regulated in this species. Erg25 is an iron-containing C4-methyl sterol oxidase that contributes to the conversion of 4,4-dimethylzymosterol to zymosterol, a precursor of ergosterol. The ERG29 gene encodes an endoplasmic reticulum (ER)-associated protein, and here we identified a role for Erg29 in the methyl sterol oxidase step of ergosterol synthesis. ERG29 deletion resulted in lethality in respiring cells, but respiration-incompetent (Rho- or Rho0) cells survived, suggesting that Erg29 loss leads to accumulation of oxidized sterol metabolites that affect cell viability. Down-regulation of ERG29 expression in Δerg29 cells indeed led to accumulation of methyl sterol metabolites, resulting in increased mitochondrial oxidants and a decreased ability of mitochondria to synthesize iron-sulfur (Fe-S) clusters due to reduced levels of Yfh1, the mammalian frataxin homolog, which is involved in mitochondrial Fe metabolism. Using a high-copy genomic library, we identified suppressor genes that permitted growth of Δerg29 cells on respiratory substrates, and these included genes encoding the mitochondrial proteins Yfh1, Mmt1, Mmt2, and Pet20, which reversed all phenotypes associated with loss of ERG29. Of note, loss of Erg25 also resulted in accumulation of methyl sterol metabolites and also increased mitochondrial oxidants and degradation of Yfh1. We propose that accumulation of toxic intermediates of the methyl sterol oxidase reaction increase mitochondrial oxidants, which affect Yfh1 protein stability. These results indicate an interaction between sterols generated by ER proteins and mitochondrial iron metabolism. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Regulation of Budding Yeast CENP-A levels Prevents Misincorporation at Promoter Nucleosomes and Transcriptional Defects.

    Directory of Open Access Journals (Sweden)

    Erica M Hildebrand

    2016-03-01

    Full Text Available The exclusive localization of the histone H3 variant CENP-A to centromeres is essential for accurate chromosome segregation. Ubiquitin-mediated proteolysis helps to ensure that CENP-A does not mislocalize to euchromatin, which can lead to genomic instability. Consistent with this, overexpression of the budding yeast CENP-A(Cse4 is lethal in cells lacking Psh1, the E3 ubiquitin ligase that targets CENP-A(Cse4 for degradation. To identify additional mechanisms that prevent CENP-A(Cse4 misincorporation and lethality, we analyzed the genome-wide mislocalization pattern of overexpressed CENP-A(Cse4 in the presence and absence of Psh1 by chromatin immunoprecipitation followed by high throughput sequencing. We found that ectopic CENP-A(Cse4 is enriched at promoters that contain histone H2A.Z(Htz1 nucleosomes, but that H2A.Z(Htz1 is not required for CENP-A(Cse4 mislocalization. Instead, the INO80 complex, which removes H2A.Z(Htz1 from nucleosomes, promotes the ectopic deposition of CENP-A(Cse4. Transcriptional profiling revealed gene expression changes in the psh1Δ cells overexpressing CENP-A(Cse4. The down-regulated genes are enriched for CENP-A(Cse4 mislocalization to promoters, while the up-regulated genes correlate with those that are also transcriptionally up-regulated in an htz1Δ strain. Together, these data show that regulating centromeric nucleosome localization is not only critical for maintaining centromere function, but also for ensuring accurate promoter function and transcriptional regulation.

  16. The Budding Yeast “Saccharomyces cerevisiae” as a Drug Discovery Tool to Identify Plant-Derived Natural Products with Anti-Proliferative Properties

    Directory of Open Access Journals (Sweden)

    Bouchra Qaddouri

    2011-01-01

    Full Text Available The budding yeast Saccharomyces cerevisiae is a valuable system to study cell-cycle regulation, which is defective in cancer cells. Due to the highly conserved nature of the cell-cycle machinery between yeast and humans, yeast studies are directly relevant to anticancer-drug discovery. The budding yeast is also an excellent model system for identifying and studying antifungal compounds because of the functional conservation of fungal genes. Moreover, yeast studies have also contributed greatly to our understanding of the biological targets and modes of action of bioactive compounds. Understanding the mechanism of action of clinically relevant compounds is essential for the design of improved second-generation molecules. Here we describe our methodology for screening a library of plant-derived natural products in yeast in order to identify and characterize new compounds with anti-proliferative properties.

  17. Genetic control of x-ray resistance in budding yeast cells

    International Nuclear Information System (INIS)

    Benathen, I.A.; Beam, C.A.

    1977-01-01

    Five x-ray-sensitive mutants were selected from 10,000 colonies arising from survivors of ultraviolet light. These were named XS5, XS6, XS7, XS8, and XS9. Mutant XS1 was donated by Nakai. These mutations affect the resistant budding cell survival component of the survival curve and, in diploids, the low-dose interdivisional cell shoulder. They are of two types: Class I, in which budding cells lack resistance; and Class II, in which budding cells show reduced resistance. When crossed with one another, they show a complex complementation pattern. Gene dosage effects are seen in XS1 heterozygotes, while budding but not between divisions. No direct correlation between radiation sensitivity, meiosis, and sporulation is observed; genes which influence radiation sensitivity do not affect meiotic recombination. A single mutation (XS1 or XS5) suppresses the shoulders of the survival curves of both budding haploid cells and diploid nonbudding cells

  18. Molecular Genetic Characterization of Mutagenesis Using a Highly Sensitive Single-Stranded DNA Reporter System in Budding Yeast.

    Science.gov (United States)

    Chan, Kin

    2018-01-01

    Mutations are permanent alterations to the coding content of DNA. They are starting material for the Darwinian evolution of species by natural selection, which has yielded an amazing diversity of life on Earth. Mutations can also be the fundamental basis of serious human maladies, most notably cancers. In this chapter, I describe a highly sensitive reporter system for the molecular genetic analysis of mutagenesis, featuring controlled generation of long stretches of single-stranded DNA in budding yeast cells. This system is ~100- to ~1000-fold more susceptible to mutation than conventional double-stranded DNA reporters, and is well suited for generating large mutational datasets to investigate the properties of mutagens.

  19. Construction and use of a microfluidic dissection platform for long-term imaging of cellular processes in budding yeast.

    Science.gov (United States)

    Huberts, Daphne H E W; Sik Lee, Sung; Gonzáles, Javier; Janssens, Georges E; Vizcarra, Ima Avalos; Heinemann, Matthias

    2013-06-01

    This protocol describes the production and operation of a microfluidic dissection platform for long-term, high-resolution imaging of budding yeast cells. At the core of this platform is an array of micropads that trap yeast cells in a single focal plane. Newly formed daughter cells are subsequently washed away by a continuous flow of fresh culture medium. In a typical experiment, 50-100 cells can be tracked during their entire replicative lifespan. Apart from aging-related research, the microfluidic platform can also be a valuable tool for other studies requiring the monitoring of single cells over time. Here we provide step-by-step instructions on how to fabricate the silicon wafer mold, how to produce and operate the microfluidic device and how to analyze the obtained data. Production of the microfluidic dissection platform and setting up an aging experiment takes ~7 h.

  20. Separable Crossover-Promoting and Crossover-Constraining Aspects of Zip1 Activity during Budding Yeast Meiosis.

    Directory of Open Access Journals (Sweden)

    Karen Voelkel-Meiman

    2015-06-01

    Full Text Available Accurate chromosome segregation during meiosis relies on the presence of crossover events distributed among all chromosomes. MutSγ and MutLγ homologs (Msh4/5 and Mlh1/3 facilitate the formation of a prominent group of meiotic crossovers that mature within the context of an elaborate chromosomal structure called the synaptonemal complex (SC. SC proteins are required for intermediate steps in the formation of MutSγ-MutLγ crossovers, but whether the assembled SC structure per se is required for MutSγ-MutLγ-dependent crossover recombination events is unknown. Here we describe an interspecies complementation experiment that reveals that the mature SC is dispensable for the formation of Mlh3-dependent crossovers in budding yeast. Zip1 forms a major structural component of the budding yeast SC, and is also required for MutSγ and MutLγ-dependent crossover formation. Kluyveromyces lactis ZIP1 expressed in place of Saccharomyces cerevisiae ZIP1 in S. cerevisiae cells fails to support SC assembly (synapsis but promotes wild-type crossover levels in those nuclei that progress to form spores. While stable, full-length SC does not assemble in S. cerevisiae cells expressing K. lactis ZIP1, aggregates of K. lactis Zip1 displayed by S. cerevisiae meiotic nuclei are decorated with SC-associated proteins, and K. lactis Zip1 promotes the SUMOylation of the SC central element protein Ecm11, suggesting that K. lactis Zip1 functionally interfaces with components of the S. cerevisiae synapsis machinery. Moreover, K. lactis Zip1-mediated crossovers rely on S. cerevisiae synapsis initiation proteins Zip3, Zip4, Spo16, as well as the Mlh3 protein, as do the crossovers mediated by S. cerevisiae Zip1. Surprisingly, however, K. lactis Zip1-mediated crossovers are largely Msh4/Msh5 (MutSγ-independent. This separation-of-function version of Zip1 thus reveals that neither assembled SC nor MutSγ is required for Mlh3-dependent crossover formation per se in budding yeast

  1. Cdc7-Dbf4 regulates NDT80 transcription as well as reductional segregation during budding yeast meiosis.

    Science.gov (United States)

    Lo, Hsiao-Chi; Wan, Lihong; Rosebrock, Adam; Futcher, Bruce; Hollingsworth, Nancy M

    2008-11-01

    In budding yeast, as in other eukaryotes, the Cdc7 protein kinase is important for initiation of DNA synthesis in vegetative cells. In addition, Cdc7 has crucial meiotic functions: it facilitates premeiotic DNA replication, and it is essential for the initiation of recombination. This work uses a chemical genetic approach to demonstrate that Cdc7 kinase has additional roles in meiosis. First, Cdc7 allows expression of NDT80, a meiosis-specific transcriptional activator required for the induction of genes involved in exit from pachytene, meiotic progression, and spore formation. Second, Cdc7 is necessary for recruitment of monopolin to sister kinetochores, and it is necessary for the reductional segregation occurring at meiosis I. The use of the same kinase to regulate several distinct meiosis-specific processes may be important for the coordination of these processes during meiosis.

  2. Shaping meiotic chromosomes with SUMO: a feedback loop controls the assembly of the synaptonemal complex in budding yeast

    Directory of Open Access Journals (Sweden)

    Hideo Tsubouchi

    2016-02-01

    Full Text Available The synaptonemal complex (SC is a meiosis-specific chromosomal structure in which homologous chromosomes are intimately linked through arrays of specialized proteins called transverse filaments (TF. Widely conserved in eukaryote meiosis, the SC forms during prophase I and is essential for accurate segregation of homologous chromosomes at meiosis I. However, the basic mechanism overlooking formation and regulation of the SC has been poorly understood. By using the budding yeast Saccharomyces cerevisiae, we recently showed that SC formation is controlled through the attachment of multiple molecules of small ubiquitin-like modifier (SUMO to a regulator of TF assembly. Intriguingly, this SUMOylation is activated by TF, implicating the involvement of a positive feedback loop in the control of SC assembly. We discuss the implication of this finding and possible involvement of a similar mechanism in regulating other processes.

  3. Cdc7-Dbf4 Regulates NDT80 Transcription as Well as Reductional Segregation during Budding Yeast Meiosis

    Science.gov (United States)

    Lo, Hsiao-Chi; Wan, Lihong; Rosebrock, Adam; Futcher, Bruce

    2008-01-01

    In budding yeast, as in other eukaryotes, the Cdc7 protein kinase is important for initiation of DNA synthesis in vegetative cells. In addition, Cdc7 has crucial meiotic functions: it facilitates premeiotic DNA replication, and it is essential for the initiation of recombination. This work uses a chemical genetic approach to demonstrate that Cdc7 kinase has additional roles in meiosis. First, Cdc7 allows expression of NDT80, a meiosis-specific transcriptional activator required for the induction of genes involved in exit from pachytene, meiotic progression, and spore formation. Second, Cdc7 is necessary for recruitment of monopolin to sister kinetochores, and it is necessary for the reductional segregation occurring at meiosis I. The use of the same kinase to regulate several distinct meiosis-specific processes may be important for the coordination of these processes during meiosis. PMID:18768747

  4. The protein expression landscape of mitosis and meiosis in diploid budding yeast.

    Science.gov (United States)

    Becker, Emmanuelle; Com, Emmanuelle; Lavigne, Régis; Guilleux, Marie-Hélène; Evrard, Bertrand; Pineau, Charles; Primig, Michael

    2017-03-06

    Saccharomyces cerevisiae is an established model organism for the molecular analysis of fundamental biological processes. The genomes of numerous strains have been sequenced, and the transcriptome and proteome ofmajor phases during the haploid and diploid yeast life cycle have been determined. However, much less is known about dynamic changes of the proteome when cells switch from mitotic growth to meiotic development. We report a quantitative protein profiling analysis of yeast cell division and differentiation based on mass spectrometry. Information about protein levels was integrated with strand-specific tiling array expression data. We identified a total of 2366 proteins in at least one condition, including 175 proteins showing a statistically significant>5-fold change across the sample set, and 136 proteins detectable in sporulating but not respiring cells. We correlate protein expression patterns with biological processes and molecular function by Gene Ontology term enrichment, chemoprofiling, transcription interference and the formation of double stranded RNAs by overlapping sense/antisense transcripts. Our work provides initial quantitative insight into protein expression in diploid respiring and differentiating yeast cells. Critically, it associates developmentally regulated induction of antisense long noncoding RNAs and double stranded RNAs with fluctuating protein concentrations during growth and development. This integrated genomics analysis helps better understand how the transcriptome and the proteome correlate in diploid yeast cells undergoing mitotic growth in the presence of acetate (respiration) versus meiotic differentiation (Meiosis I and II). The study (i) provides quantitative expression data for 2366 proteins and their cognate mRNAs in at least one sample, (ii) shows strongly fluctuating protein levels during growth and differentiation for 175 cases, and (iii) identifies 136 proteins absent in mitotic but present in meiotic yeast cells. We

  5. Frequent and efficient use of the sister chromatid for DNA double-strand break repair during budding yeast meiosis.

    Directory of Open Access Journals (Sweden)

    Tamara Goldfarb

    2010-10-01

    Full Text Available Recombination between homologous chromosomes of different parental origin (homologs is necessary for their accurate segregation during meiosis. It has been suggested that meiotic inter-homolog recombination is promoted by a barrier to inter-sister-chromatid recombination, imposed by meiosis-specific components of the chromosome axis. Consistent with this, measures of Holliday junction-containing recombination intermediates (joint molecules [JMs] show a strong bias towards inter-homolog and against inter-sister JMs. However, recombination between sister chromatids also has an important role in meiosis. The genomes of diploid organisms in natural populations are highly polymorphic for insertions and deletions, and meiotic double-strand breaks (DSBs that form within such polymorphic regions must be repaired by inter-sister recombination. Efforts to study inter-sister recombination during meiosis, in particular to determine recombination frequencies and mechanisms, have been constrained by the inability to monitor the products of inter-sister recombination. We present here molecular-level studies of inter-sister recombination during budding yeast meiosis. We examined events initiated by DSBs in regions that lack corresponding sequences on the homolog, and show that these DSBs are efficiently repaired by inter-sister recombination. This occurs with the same timing as inter-homolog recombination, but with reduced (2- to 3-fold yields of JMs. Loss of the meiotic-chromosome-axis-associated kinase Mek1 accelerates inter-sister DSB repair and markedly increases inter-sister JM frequencies. Furthermore, inter-sister JMs formed in mek1Δ mutants are preferentially lost, while inter-homolog JMs are maintained. These findings indicate that inter-sister recombination occurs frequently during budding yeast meiosis, with the possibility that up to one-third of all recombination events occur between sister chromatids. We suggest that a Mek1-dependent reduction in

  6. The Adder Phenomenon Emerges from Independent Control of Pre- and Post-Start Phases of the Budding Yeast Cell Cycle.

    Science.gov (United States)

    Chandler-Brown, Devon; Schmoller, Kurt M; Winetraub, Yonatan; Skotheim, Jan M

    2017-09-25

    Although it has long been clear that cells actively regulate their size, the molecular mechanisms underlying this regulation have remained poorly understood. In budding yeast, cell size primarily modulates the duration of the cell-division cycle by controlling the G1/S transition known as Start. We have recently shown that the rate of progression through Start increases with cell size, because cell growth dilutes the cell-cycle inhibitor Whi5 in G1. Recent phenomenological studies in yeast and bacteria have shown that these cells add an approximately constant volume during each complete cell cycle, independent of their size at birth. These results seem to be in conflict, as the phenomenological studies suggest that cells measure the amount they grow, rather than their size, and that size control acts over the whole cell cycle, rather than specifically in G1. Here, we propose an integrated model that unifies the adder phenomenology with the molecular mechanism of G1/S cell-size control. We use single-cell microscopy to parameterize a full cell-cycle model based on independent control of pre- and post-Start cell-cycle periods. We find that our model predicts the size-independent amount of cell growth during the full cell cycle. This suggests that the adder phenomenon is an emergent property of the independent regulation of pre- and post-Start cell-cycle periods rather than the consequence of an underlying molecular mechanism measuring a fixed amount of growth. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Ndj1, a telomere-associated protein, regulates centrosome separation in budding yeast meiosis

    Science.gov (United States)

    Li, Ping; Shao, Yize; Jin, Hui

    2015-01-01

    Yeast centrosomes (called spindle pole bodies [SPBs]) remain cohesive for hours during meiotic G2 when recombination takes place. In contrast, SPBs separate within minutes after duplication in vegetative cells. We report here that Ndj1, a previously known meiosis-specific telomere-associated protein, is required for protecting SPB cohesion. Ndj1 localizes to the SPB but dissociates from it ∼16 min before SPB separation. Without Ndj1, meiotic SPBs lost cohesion prematurely, whereas overproduction of Ndj1 delayed SPB separation. When produced ectopically in vegetative cells, Ndj1 caused SPB separation defects and cell lethality. Localization of Ndj1 to the SPB depended on the SUN domain protein Mps3, and removal of the N terminus of Mps3 allowed SPB separation and suppressed the lethality of NDJ1-expressing vegetative cells. Finally, we show that Ndj1 forms oligomeric complexes with Mps3, and that the Polo-like kinase Cdc5 regulates Ndj1 protein stability and SPB separation. These findings reveal the underlying mechanism that coordinates yeast centrosome dynamics with meiotic telomere movement and cell cycle progression. PMID:25897084

  8. Transcription factor genes essential for cell proliferation and replicative lifespan in budding yeast

    Energy Technology Data Exchange (ETDEWEB)

    Kamei, Yuka; Tai, Akiko; Dakeyama, Shota; Yamamoto, Kaori; Inoue, Yamato; Kishimoto, Yoshifumi; Ohara, Hiroya; Mukai, Yukio, E-mail: y_mukai@nagahama-i-bio.ac.jp

    2015-07-31

    Many of the lifespan-related genes have been identified in eukaryotes ranging from the yeast to human. However, there is limited information available on the longevity genes that are essential for cell proliferation. Here, we investigated whether the essential genes encoding DNA-binding transcription factors modulated the replicative lifespan of Saccharomyces cerevisiae. Heterozygous diploid knockout strains for FHL1, RAP1, REB1, and MCM1 genes showed significantly short lifespan. {sup 1}H-nuclear magnetic resonance analysis indicated a characteristic metabolic profile in the Δfhl1/FHL1 mutant. These results strongly suggest that FHL1 regulates the transcription of lifespan related metabolic genes. Thus, heterozygous knockout strains could be the potential materials for discovering further novel lifespan genes. - Highlights: • Involvement of yeast TF genes essential for cell growth in lifespan was evaluated. • The essential TF genes, FHL1, RAP1, REB1, and MCM1, regulate replicative lifespan. • Heterozygous deletion of FHL1 changes cellular metabolism related to lifespan.

  9. Energy landscape reveals that the budding yeast cell cycle is a robust and adaptive multi-stage process.

    Directory of Open Access Journals (Sweden)

    Cheng Lv

    2015-03-01

    Full Text Available Quantitatively understanding the robustness, adaptivity and efficiency of cell cycle dynamics under the influence of noise is a fundamental but difficult question to answer for most eukaryotic organisms. Using a simplified budding yeast cell cycle model perturbed by intrinsic noise, we systematically explore these issues from an energy landscape point of view by constructing an energy landscape for the considered system based on large deviation theory. Analysis shows that the cell cycle trajectory is sharply confined by the ambient energy barrier, and the landscape along this trajectory exhibits a generally flat shape. We explain the evolution of the system on this flat path by incorporating its non-gradient nature. Furthermore, we illustrate how this global landscape changes in response to external signals, observing a nice transformation of the landscapes as the excitable system approaches a limit cycle system when nutrients are sufficient, as well as the formation of additional energy wells when the DNA replication checkpoint is activated. By taking into account the finite volume effect, we find additional pits along the flat cycle path in the landscape associated with the checkpoint mechanism of the cell cycle. The difference between the landscapes induced by intrinsic and extrinsic noise is also discussed. In our opinion, this meticulous structure of the energy landscape for our simplified model is of general interest to other cell cycle dynamics, and the proposed methods can be applied to study similar biological systems.

  10. FLO1 is a variable green beard gene that drives biofilm-like cooperation in budding yeast

    Science.gov (United States)

    Smukalla, Scott; Caldara, Marina; Pochet, Nathalie; Beauvais, Anne; Guadagnini, Stephanie; Yan, Chen; Vinces, Marcelo D.; Jansen, An; Prevost, Marie Christine; Latgé, Jean-Paul; Fink, Gerald R.; Foster, Kevin R.; Verstrepen, Kevin J.

    2008-01-01

    Summary The budding yeast, Saccharomyces cerevisiae, has emerged as an archetype of eukaryotic cell biology. Here we show that S. cerevisiae is also a model for the evolution of cooperative behavior by revisiting flocculation, a self-adherence phenotype lacking in most laboratory strains. Expression of the gene FLO1 in the laboratory strain S288C restores flocculation, an altered physiological state, reminiscent of bacterial biofilms. Flocculation protects the FLO1-expressing cells from multiple stresses, including antimicrobials and ethanol. Furthermore, FLO1+ cells avoid exploitation by non-expressing flo1 cells by self/non-self recognition: FLO1+ cells preferentially stick to one another, regardless of genetic relatedness across the rest of the genome. Flocculation, therefore, is driven by one of a few known “green beard genes”, which direct cooperation towards other carriers of the same gene. Moreover, FLO1 is highly variable among strains both in expression and in sequence, suggesting that flocculation in S. cerevisiae is a dynamic, rapidly-evolving social trait. PMID:19013280

  11. Decoding the principles underlying the frequency of association with nucleoli for RNA polymerase III–transcribed genes in budding yeast

    Science.gov (United States)

    Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier

    2016-01-01

    The association of RNA polymerase III (Pol III)–transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III–transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements—centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III–transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III–transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III–dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III–transcribed genes required active transcription. We conclude that the association of Pol III–transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. PMID:27559135

  12. Rif1 acts through Protein Phosphatase 1 but independent of replication timing to suppress telomere extension in budding yeast.

    Science.gov (United States)

    Kedziora, Sylwia; Gali, Vamsi K; Wilson, Rosemary H C; Clark, Kate R M; Nieduszynski, Conrad A; Hiraga, Shin-Ichiro; Donaldson, Anne D

    2018-05-04

    The Rif1 protein negatively regulates telomeric TG repeat length in the budding yeast Saccharomyces cerevisiae, but how it prevents telomere over-extension is unknown. Rif1 was recently shown to control DNA replication by acting as a Protein Phosphatase 1 (PP1)-targeting subunit. Therefore, we investigated whether Rif1 controls telomere length by targeting PP1 activity. We find that a Rif1 mutant defective for PP1 interaction causes a long-telomere phenotype, similar to that of rif1Δ cells. Tethering PP1 at a specific telomere partially substitutes for Rif1 in limiting TG repeat length, confirming the importance of PP1 in telomere length control. Ablating Rif1-PP1 interaction is known to cause precocious activation of telomere-proximal replication origins and aberrantly early telomere replication. However, we find that Rif1 still limits telomere length even if late replication is forced through deletion of nearby replication origins, indicating that Rif1 can control telomere length independent of replication timing. Moreover we find that, even at a de novo telomere created after DNA synthesis during a mitotic block, Rif1-PP1 interaction is required to suppress telomere lengthening and prevent inappropriate recruitment of Tel1 kinase. Overall, our results show that Rif1 controls telomere length by recruiting PP1 to directly suppress telomerase-mediated TG repeat lengthening.

  13. Functional conservation of RNA polymerase II in fission and budding yeasts.

    Science.gov (United States)

    Shpakovski, G V; Gadal, O; Labarre-Mariotte, S; Lebedenko, E N; Miklos, I; Sakurai, H; Proshkin, S A; Van Mullem, V; Ishihama, A; Thuriaux, P

    2000-02-04

    The complementary DNAs of the 12 subunits of fission yeast (Schizosaccharomyces pombe) RNA polymerase II were expressed from strong promoters in Saccharomyces cerevisiae and tested for heterospecific complementation by monitoring their ability to replace in vivo the null mutants of the corresponding host genes. Rpb1 and Rpb2, the two largest subunits and Rpb8, a small subunit shared by all three polymerases, failed to support growth in S. cerevisiae. The remaining nine subunits were all proficient for heterospecific complementation and led in most cases to a wild-type level of growth. The two alpha-like subunits (Rpb3 and Rpb11), however, did not support growth at high (37 degrees C) or low (25 degrees C) temperatures. In the case of Rpb3, growth was restored by increasing the gene dosage of the host Rpb11 or Rpb10 subunits, confirming previous evidence of a close genetic interaction between these three subunits. Copyright 2000 Academic Press.

  14. Spatial organization of the budding yeast genome in the cell nucleus and identification of specific chromatin interactions from multi-chromosome constrained chromatin model.

    Science.gov (United States)

    Gürsoy, Gamze; Xu, Yun; Liang, Jie

    2017-07-01

    Nuclear landmarks and biochemical factors play important roles in the organization of the yeast genome. The interaction pattern of budding yeast as measured from genome-wide 3C studies are largely recapitulated by model polymer genomes subject to landmark constraints. However, the origin of inter-chromosomal interactions, specific roles of individual landmarks, and the roles of biochemical factors in yeast genome organization remain unclear. Here we describe a multi-chromosome constrained self-avoiding chromatin model (mC-SAC) to gain understanding of the budding yeast genome organization. With significantly improved sampling of genome structures, both intra- and inter-chromosomal interaction patterns from genome-wide 3C studies are accurately captured in our model at higher resolution than previous studies. We show that nuclear confinement is a key determinant of the intra-chromosomal interactions, and centromere tethering is responsible for the inter-chromosomal interactions. In addition, important genomic elements such as fragile sites and tRNA genes are found to be clustered spatially, largely due to centromere tethering. We uncovered previously unknown interactions that were not captured by genome-wide 3C studies, which are found to be enriched with tRNA genes, RNAPIII and TFIIS binding. Moreover, we identified specific high-frequency genome-wide 3C interactions that are unaccounted for by polymer effects under landmark constraints. These interactions are enriched with important genes and likely play biological roles.

  15. Temporal Expression of a Master Regulator Drives Synchronous Sporulation in Budding Yeast

    Directory of Open Access Journals (Sweden)

    Minghao Chia

    2016-11-01

    Full Text Available Yeast cells enter and undergo gametogenesis relatively asynchronously, making it technically challenging to perform stage-specific genomic and biochemical analyses. Cell-to-cell variation in the expression of the master regulator of entry into sporulation, IME1, has been implicated to be the underlying cause of asynchronous sporulation. Here, we find that timing of IME1 expression is of critical importance for inducing cells to undergo sporulation synchronously. When we force expression of IME1 from an inducible promoter in cells incubated in sporulation medium for 2 hr, the vast majority of cells exhibit synchrony during premeiotic DNA replication and meiotic divisions. Inducing IME1 expression too early or too late affects the synchrony of sporulation. Surprisingly, our approach for synchronous sporulation does not require growth in acetate-containing medium, but can be achieved in cells grown in rich medium until saturation. Our system requires solely IME1, because the expression of the N6-methyladenosine methyltransferase IME4, another key regulator of early sporulation, is controlled by IME1 itself. The approach described here can be combined easily with other stage-specific synchronization methods, and thereby applied to study specific stages of sporulation, or the complete sporulation program.

  16. Temporal Expression of a Master Regulator Drives Synchronous Sporulation in Budding Yeast.

    Science.gov (United States)

    Chia, Minghao; van Werven, Folkert J

    2016-09-07

    Yeast cells enter and undergo gametogenesis relatively asynchronously, making it technically challenging to perform stage-specific genomic and biochemical analyses. Cell-to-cell variation in the expression of the master regulator of entry into sporulation IME1, has been implicated to be the underlying cause of asynchronous sporulation. Here we find that timing of IME1 expression is of critical importance for inducing cells to undergo sporulation synchronously. When we force expression of IME1 from an inducible promoter in cells incubated in sporulation medium for two hours, the vast majority of cells exhibit synchrony during pre-meiotic DNA replication and meiotic divisions. Inducing IME1 expression too early or too late affects the synchrony of sporulation. Surprisingly, our approach for synchronous sporulation does not require growth in acetate containing medium, but can be achieved in cells grown in rich medium until saturation. Our system solely requires IME1 because the expression of the N6-methyladenosine methyltransferase IME4, another key regulator of early sporulation, is controlled by IME1 itself. The approach described here can be easily combined with other stage specific synchronization methods, and thereby applied to study specific stages of sporulation or the complete sporulation program. Copyright © 2016 Author et al.

  17. RPA facilitates telomerase activity at chromosome ends in budding and fission yeasts.

    Science.gov (United States)

    Luciano, Pierre; Coulon, Stéphane; Faure, Virginie; Corda, Yves; Bos, Julia; Brill, Steven J; Gilson, Eric; Simon, Marie-Noelle; Géli, Vincent

    2012-04-18

    In Saccharomyces cerevisiae, the telomerase complex binds to chromosome ends and is activated in late S-phase through a process coupled to the progression of the replication fork. Here, we show that the single-stranded DNA-binding protein RPA (replication protein A) binds to the two daughter telomeres during telomere replication but only its binding to the leading-strand telomere depends on the Mre11/Rad50/Xrs2 (MRX) complex. We further demonstrate that RPA specifically co-precipitates with yKu, Cdc13 and telomerase. The interaction of RPA with telomerase appears to be mediated by both yKu and the telomerase subunit Est1. Moreover, a mutation in Rfa1 that affects both the interaction with yKu and telomerase reduces the dramatic increase in telomere length of a rif1Δ, rif2Δ double mutant. Finally, we show that the RPA/telomerase association and function are conserved in Schizosaccharomyces pombe. Our results indicate that in both yeasts, RPA directly facilitates telomerase activity at chromosome ends.

  18. Effect of nagilactone E on cell morphology and glucan biosynthesis in budding yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Hayashi, Kengo; Yamaguchi, Yoshihiro; Ogita, Akira; Tanaka, Toshio; Kubo, Isao; Fujita, Ken-Ichi

    2018-05-14

    Nagilactones are norditerpene dilactones isolated from the root bark of Podocarpus nagi. Although nagilactone E has been reported to show antifungal activities, its activity is weaker than that of antifungals on the market. Nagilactone E enhances the antifungal activity of phenylpropanoids such as anethole and isosafrole against nonpathogenic Saccharomyces cerevisiae and pathogenic Candida albicans. However, the detailed mechanisms underlying the antifungal activity of nagilactone E itself have not yet been elucidated. Therefore, we investigated the antifungal mechanisms of nagilactone E using S. cerevisiae. Although nagilactone E induced lethality in vegetatively growing cells, it did not affect cell viability in non-growing cells. Nagilactone E-induced morphological changes in the cells, such as inhomogeneous thickness of the glucan layer and leakage of cytoplasm. Furthermore, a dose-dependent decrease in the amount of newly synthesized (1, 3)-β-glucan was detected in the membrane fractions of the yeast incubated with nagilactone E. These results suggest that nagilactone E exhibits an antifungal activity against S. cerevisiae by depending on cell wall fragility via the inhibition of (1, 3)-β-glucan biosynthesis. Additionally, we confirmed nagilactone E-induced morphological changes of a human pathogenic fungus Aspergillus fumigatus. Therefore, nagilactone E is a potential antifungal drug candidate with fewer adverse effects. Copyright © 2018 Elsevier B.V. All rights reserved.

  19. Identification of She3 as an SCF(Grr1 substrate in budding yeast.

    Directory of Open Access Journals (Sweden)

    Ruiwen Wang

    Full Text Available The highly orchestrated progression of the cell cycle depends on the degradation of many regulatory proteins at different cell cycle stages. One of the key cell cycle ubiquitin ligases is the Skp1-cullin-F-box (SCF complex. Acting in concert with the substrate-binding F-box protein Grr1, SCF(Grr1 promotes the degradation of cell cycle regulators as well as various metabolic enzymes. Using a yeast two-hybrid assay with a Grr1 derivative as the bait, we identified She3, which is an adaptor protein in the asymmetric mRNA transport system, as a novel Grr1 substrate. We generated stabilized She3 mutants, which no longer bound to Grr1, and found that the degradation of She3 is not required for regulating asymmetric mRNA transport. However, She3 stabilization leads to slower growth compared to wild-type cells in a co-culture assay, demonstrating that the degradation of She3 by Grr1 is required for optimal cell growth.

  20. Cell cycle commitment in budding yeast emerges from the cooperation of multiple bistable switches

    Science.gov (United States)

    Zhang, Tongli; Schmierer, Bernhard; Novák, Béla

    2011-01-01

    The start-transition (START) in the G1 phase marks the point in the cell cycle at which a yeast cell initiates a new round of cell division. Once made, this decision is irreversible and the cell is committed to progressing through the entire cell cycle, irrespective of arrest signals such as pheromone. How commitment emerges from the underlying molecular interaction network is poorly understood. Here, we perform a dynamical systems analysis of an established cell cycle model, which has never been analysed from a commitment perspective. We show that the irreversibility of the START transition and subsequent commitment can be consistently explained in terms of the interplay of multiple bistable molecular switches. By applying an existing mathematical model to a novel problem and by expanding the model in a self-consistent manner, we achieve several goals: we bring together a large number of experimental findings into a coherent theoretical framework; we increase the scope and the applicability of the original model; we give a systems level explanation of how the START transition and the cell cycle commitment arise from the dynamical features of the underlying molecular interaction network; and we make clear, experimentally testable predictions. PMID:22645649

  1. Caloric Restriction-Induced Extension of Chronological Lifespan Requires Intact Respiration in Budding Yeast.

    Science.gov (United States)

    Kwon, Young-Yon; Lee, Sung-Keun; Lee, Cheol-Koo

    2017-04-01

    Caloric restriction (CR) has been shown to extend lifespan and prevent cellular senescence in various species ranging from yeast to humans. Many effects of CR may contribute to extend lifespan. Specifically, CR prevents oxidative damage from reactive oxygen species (ROS) by enhancing mitochondrial function. In this study, we characterized 33 single electron transport chain (ETC) gene-deletion strains to identify CR-induced chronological lifespan (CLS) extension mechanisms. Interestingly, defects in 17 of these 33 ETC gene-deleted strains showed loss of both respiratory function and CR-induced CLS extension. On the contrary, the other 16 respiration-capable mutants showed increased CLS upon CR along with increased mitochondrial membrane potential (MMP) and intracellular adenosine triphosphate (ATP) levels, with decreased mitochondrial superoxide generation. We measured the same parameters in the 17 non-respiratory mutants upon CR. CR simultaneously increased MMP and mitochondrial superoxide generation without altering intracellular ATP levels. In conclusion, respiration is essential for CLS extension by CR and is important for balancing MMP, ROS, and ATP levels.

  2. Four linked genes participate in controlling sporulation efficiency in budding yeast.

    Directory of Open Access Journals (Sweden)

    Giora Ben-Ari

    2006-11-01

    Full Text Available Quantitative traits are conditioned by several genetic determinants. Since such genes influence many important complex traits in various organisms, the identification of quantitative trait loci (QTLs is of major interest, but still encounters serious difficulties. We detected four linked genes within one QTL, which participate in controlling sporulation efficiency in Saccharomyces cerevisiae. Following the identification of single nucleotide polymorphisms by comparing the sequences of 145 genes between the parental strains SK1 and S288c, we analyzed the segregating progeny of the cross between them. Through reciprocal hemizygosity analysis, four genes, RAS2, PMS1, SWS2, and FKH2, located in a region of 60 kilobases on Chromosome 14, were found to be associated with sporulation efficiency. Three of the four "high" sporulation alleles are derived from the "low" sporulating strain. Two of these sporulation-related genes were verified through allele replacements. For RAS2, the causative variation was suggested to be a single nucleotide difference in the upstream region of the gene. This quantitative trait nucleotide accounts for sporulation variability among a set of ten closely related winery yeast strains. Our results provide a detailed view of genetic complexity in one "QTL region" that controls a quantitative trait and reports a single nucleotide polymorphism-trait association in wild strains. Moreover, these findings have implications on QTL identification in higher eukaryotes.

  3. Cytosolic chaperones mediate quality control of higher-order septin assembly in budding yeast.

    Science.gov (United States)

    Johnson, Courtney R; Weems, Andrew D; Brewer, Jennifer M; Thorner, Jeremy; McMurray, Michael A

    2015-04-01

    Septin hetero-oligomers polymerize into cytoskeletal filaments with essential functions in many eukaryotic cell types. Mutations within the oligomerization interface that encompasses the GTP-binding pocket of a septin (its "G interface") cause thermoinstability of yeast septin hetero-oligomer assembly, and human disease. When coexpressed with its wild-type counterpart, a G interface mutant is excluded from septin filaments, even at moderate temperatures. We show that this quality control mechanism is specific to G interface mutants, operates during de novo septin hetero-oligomer assembly, and requires specific cytosolic chaperones. Chaperone overexpression lowers the temperature permissive for proliferation of cells expressing a G interface mutant as the sole source of a given septin. Mutations that perturb the septin G interface retard release from these chaperones, imposing a kinetic delay on the availability of nascent septin molecules for higher-order assembly. Un-expectedly, the disaggregase Hsp104 contributes to this delay in a manner that does not require its "unfoldase" activity, indicating a latent "holdase" activity toward mutant septins. These findings provide new roles for chaperone-mediated kinetic partitioning of non-native proteins and may help explain the etiology of septin-linked human diseases. © 2015 Johnson et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  4. Cleavage of the SUN-domain protein Mps3 at its N-terminus regulates centrosome disjunction in budding yeast meiosis.

    Directory of Open Access Journals (Sweden)

    Ping Li

    2017-06-01

    Full Text Available Centrosomes organize microtubules and are essential for spindle formation and chromosome segregation during cell division. Duplicated centrosomes are physically linked, but how this linkage is dissolved remains unclear. Yeast centrosomes are tethered by a nuclear-envelope-attached structure called the half-bridge, whose components have mammalian homologues. We report here that cleavage of the half-bridge protein Mps3 promotes accurate centrosome disjunction in budding yeast. Mps3 is a single-pass SUN-domain protein anchored at the inner nuclear membrane and concentrated at the nuclear side of the half-bridge. Using the unique feature in yeast meiosis that centrosomes are linked for hours before their separation, we have revealed that Mps3 is cleaved at its nucleus-localized N-terminal domain, the process of which is regulated by its phosphorylation at serine 70. Cleavage of Mps3 takes place at the yeast centrosome and requires proteasome activity. We show that noncleavable Mps3 (Mps3-nc inhibits centrosome separation during yeast meiosis. In addition, overexpression of mps3-nc in vegetative yeast cells also inhibits centrosome separation and is lethal. Our findings provide a genetic mechanism for the regulation of SUN-domain protein-mediated activities, including centrosome separation, by irreversible protein cleavage at the nuclear periphery.

  5. Cleavage of the SUN-domain protein Mps3 at its N-terminus regulates centrosome disjunction in budding yeast meiosis

    Science.gov (United States)

    Koch, Bailey A.; Han, Xuemei

    2017-01-01

    Centrosomes organize microtubules and are essential for spindle formation and chromosome segregation during cell division. Duplicated centrosomes are physically linked, but how this linkage is dissolved remains unclear. Yeast centrosomes are tethered by a nuclear-envelope-attached structure called the half-bridge, whose components have mammalian homologues. We report here that cleavage of the half-bridge protein Mps3 promotes accurate centrosome disjunction in budding yeast. Mps3 is a single-pass SUN-domain protein anchored at the inner nuclear membrane and concentrated at the nuclear side of the half-bridge. Using the unique feature in yeast meiosis that centrosomes are linked for hours before their separation, we have revealed that Mps3 is cleaved at its nucleus-localized N-terminal domain, the process of which is regulated by its phosphorylation at serine 70. Cleavage of Mps3 takes place at the yeast centrosome and requires proteasome activity. We show that noncleavable Mps3 (Mps3-nc) inhibits centrosome separation during yeast meiosis. In addition, overexpression of mps3-nc in vegetative yeast cells also inhibits centrosome separation and is lethal. Our findings provide a genetic mechanism for the regulation of SUN-domain protein-mediated activities, including centrosome separation, by irreversible protein cleavage at the nuclear periphery. PMID:28609436

  6. CRISPR/Cas9 cleavages in budding yeast reveal templated insertions and strand-specific insertion/deletion profiles.

    Science.gov (United States)

    Lemos, Brenda R; Kaplan, Adam C; Bae, Ji Eun; Ferrazzoli, Alexander E; Kuo, James; Anand, Ranjith P; Waterman, David P; Haber, James E

    2018-02-27

    Harnessing CRISPR-Cas9 technology provides an unprecedented ability to modify genomic loci via DNA double-strand break (DSB) induction and repair. We analyzed nonhomologous end-joining (NHEJ) repair induced by Cas9 in budding yeast and found that the orientation of binding of Cas9 and its guide RNA (gRNA) profoundly influences the pattern of insertion/deletions (indels) at the site of cleavage. A common indel created by Cas9 is a 1-bp (+1) insertion that appears to result from Cas9 creating a 1-nt 5' overhang that is filled in by a DNA polymerase and ligated. The origin of +1 insertions was investigated by using two gRNAs with PAM sequences located on opposite DNA strands but designed to cleave the same sequence. These templated +1 insertions are dependent on the X-family DNA polymerase, Pol4. Deleting Pol4 also eliminated +2 and +3 insertions, which are biased toward homonucleotide insertions. Using inverted PAM sequences, we also found significant differences in overall NHEJ efficiency and repair profiles, suggesting that the binding of the Cas9:gRNA complex influences subsequent NHEJ processing. As with events induced by the site-specific HO endonuclease, CRISPR-Cas9-mediated NHEJ repair depends on the Ku heterodimer and DNA ligase 4. Cas9 events are highly dependent on the Mre11-Rad50-Xrs2 complex, independent of Mre11's nuclease activity. Inspection of the outcomes of a large number of Cas9 cleavage events in mammalian cells reveals a similar templated origin of +1 insertions in human cells, but also a significant frequency of similarly templated +2 insertions.

  7. Decoding the principles underlying the frequency of association with nucleoli for RNA polymerase III-transcribed genes in budding yeast.

    Science.gov (United States)

    Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier

    2016-10-15

    The association of RNA polymerase III (Pol III)-transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III-transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements-centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III-transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III-transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III-dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III-transcribed genes required active transcription. We conclude that the association of Pol III-transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. © 2016 Belagal et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  8. Direct and indirect control of the initiation of meiotic recombination by DNA damage checkpoint mechanisms in budding yeast.

    Directory of Open Access Journals (Sweden)

    Bilge Argunhan

    Full Text Available Meiotic recombination plays an essential role in the proper segregation of chromosomes at meiosis I in many sexually reproducing organisms. Meiotic recombination is initiated by the scheduled formation of genome-wide DNA double-strand breaks (DSBs. The timing of DSB formation is strictly controlled because unscheduled DSB formation is detrimental to genome integrity. Here, we investigated the role of DNA damage checkpoint mechanisms in the control of meiotic DSB formation using budding yeast. By using recombination defective mutants in which meiotic DSBs are not repaired, the effect of DNA damage checkpoint mutations on DSB formation was evaluated. The Tel1 (ATM pathway mainly responds to unresected DSB ends, thus the sae2 mutant background in which DSB ends remain intact was employed. On the other hand, the Mec1 (ATR pathway is primarily used when DSB ends are resected, thus the rad51 dmc1 double mutant background was employed in which highly resected DSBs accumulate. In order to separate the effect caused by unscheduled cell cycle progression, which is often associated with DNA damage checkpoint defects, we also employed the ndt80 mutation which permanently arrests the meiotic cell cycle at prophase I. In the absence of Tel1, DSB formation was reduced in larger chromosomes (IV, VII, II and XI whereas no significant reduction was found in smaller chromosomes (III and VI. On the other hand, the absence of Rad17 (a critical component of the ATR pathway lead to an increase in DSB formation (chromosomes VII and II were tested. We propose that, within prophase I, the Tel1 pathway facilitates DSB formation, especially in bigger chromosomes, while the Mec1 pathway negatively regulates DSB formation. We also identified prophase I exit, which is under the control of the DNA damage checkpoint machinery, to be a critical event associated with down-regulating meiotic DSB formation.

  9. Timely activation of budding yeast APCCdh1 involves degradation of its inhibitor, Acm1, by an unconventional proteolytic mechanism.

    Directory of Open Access Journals (Sweden)

    Michael Melesse

    Full Text Available Regulated proteolysis mediated by the ubiquitin proteasome system is a fundamental and essential feature of the eukaryotic cell division cycle. Most proteins with cell cycle-regulated stability are targeted for degradation by one of two related ubiquitin ligases, the Skp1-cullin-F box protein (SCF complex or the anaphase-promoting complex (APC. Here we describe an unconventional cell cycle-regulated proteolytic mechanism that acts on the Acm1 protein, an inhibitor of the APC activator Cdh1 in budding yeast. Although Acm1 can be recognized as a substrate by the Cdc20-activated APC (APCCdc20 in anaphase, APCCdc20 is neither necessary nor sufficient for complete Acm1 degradation at the end of mitosis. An APC-independent, but 26S proteasome-dependent, mechanism is sufficient for complete Acm1 clearance from late mitotic and G1 cells. Surprisingly, this mechanism appears distinct from the canonical ubiquitin targeting pathway, exhibiting several features of ubiquitin-independent proteasomal degradation. For example, Acm1 degradation in G1 requires neither lysine residues in Acm1 nor assembly of polyubiquitin chains. Acm1 was stabilized though by conditional inactivation of the ubiquitin activating enzyme Uba1, implying some requirement for the ubiquitin pathway, either direct or indirect. We identified an amino terminal predicted disordered region in Acm1 that contributes to its proteolysis in G1. Although ubiquitin-independent proteasome substrates have been described, Acm1 appears unique in that its sensitivity to this mechanism is strictly cell cycle-regulated via cyclin-dependent kinase (Cdk phosphorylation. As a result, Acm1 expression is limited to the cell cycle window in which Cdk is active. We provide evidence that failure to eliminate Acm1 impairs activation of APCCdh1 at mitotic exit, justifying its strict regulation by cell cycle-dependent transcription and proteolytic mechanisms. Importantly, our results reveal that strict cell

  10. Timely Activation of Budding Yeast APCCdh1 Involves Degradation of Its Inhibitor, Acm1, by an Unconventional Proteolytic Mechanism

    Science.gov (United States)

    Melesse, Michael; Choi, Eunyoung; Hall, Hana; Walsh, Michael J.; Geer, M. Ariel; Hall, Mark C.

    2014-01-01

    Regulated proteolysis mediated by the ubiquitin proteasome system is a fundamental and essential feature of the eukaryotic cell division cycle. Most proteins with cell cycle-regulated stability are targeted for degradation by one of two related ubiquitin ligases, the Skp1-cullin-F box protein (SCF) complex or the anaphase-promoting complex (APC). Here we describe an unconventional cell cycle-regulated proteolytic mechanism that acts on the Acm1 protein, an inhibitor of the APC activator Cdh1 in budding yeast. Although Acm1 can be recognized as a substrate by the Cdc20-activated APC (APCCdc20) in anaphase, APCCdc20 is neither necessary nor sufficient for complete Acm1 degradation at the end of mitosis. An APC-independent, but 26S proteasome-dependent, mechanism is sufficient for complete Acm1 clearance from late mitotic and G1 cells. Surprisingly, this mechanism appears distinct from the canonical ubiquitin targeting pathway, exhibiting several features of ubiquitin-independent proteasomal degradation. For example, Acm1 degradation in G1 requires neither lysine residues in Acm1 nor assembly of polyubiquitin chains. Acm1 was stabilized though by conditional inactivation of the ubiquitin activating enzyme Uba1, implying some requirement for the ubiquitin pathway, either direct or indirect. We identified an amino terminal predicted disordered region in Acm1 that contributes to its proteolysis in G1. Although ubiquitin-independent proteasome substrates have been described, Acm1 appears unique in that its sensitivity to this mechanism is strictly cell cycle-regulated via cyclin-dependent kinase (Cdk) phosphorylation. As a result, Acm1 expression is limited to the cell cycle window in which Cdk is active. We provide evidence that failure to eliminate Acm1 impairs activation of APCCdh1 at mitotic exit, justifying its strict regulation by cell cycle-dependent transcription and proteolytic mechanisms. Importantly, our results reveal that strict cell-cycle expression profiles

  11. A switch from a gradient to a threshold mode in the regulation of a transcriptional cascade promotes robust execution of meiosis in budding yeast.

    Directory of Open Access Journals (Sweden)

    Vyacheslav Gurevich

    Full Text Available Tight regulation of developmental pathways is of critical importance to all organisms, and is achieved by a transcriptional cascade ensuring the coordinated expression of sets of genes. We aimed to explore whether a strong signal is required to enter and complete a developmental pathway, by using meiosis in budding yeast as a model. We demonstrate that meiosis in budding yeast is insensitive to drastic changes in the levels of its consecutive positive regulators (Ime1, Ime2, and Ndt80. Entry into DNA replication is not correlated with the time of transcription of the early genes that regulate this event. Entry into nuclear division is directly regulated by the time of transcription of the middle genes, as premature transcription of their activator NDT80, leads to a premature entry into the first meiotic division, and loss of coordination between DNA replication and nuclear division. We demonstrate that Cdk1/Cln3 functions as a negative regulator of Ime2, and that ectopic expression of Cln3 delays entry into nuclear division as well as NDT80 transcription. Because Ime2 functions as a positive regulator for premeiotic DNA replication and NDT80 transcription, as well as a negative regulator of Cdk/Cln, we suggest that a double negative feedback loop between Ime2 and Cdk1/Cln3 promotes a bistable switch from the cell cycle to meiosis. Moreover, our results suggest a regulatory mode switch that ensures robust meiosis as the transcription of the early meiosis-specific genes responds in a graded mode to Ime1 levels, whereas that of the middle and late genes as well as initiation of DNA replication, are regulated in a threshold mode.

  12. The proline metabolism intermediate Δ1-pyrroline-5-carboxylate directly inhibits the mitochondrial respiration in budding yeast.

    Science.gov (United States)

    Nishimura, Akira; Nasuno, Ryo; Takagi, Hiroshi

    2012-07-30

    The proline metabolism intermediate Δ(1)-pyrroline-5-carboxylate (P5C) induces cell death in animals, plants and yeasts. To elucidate how P5C triggers cell death, we analyzed P5C metabolism, mitochondrial respiration and superoxide anion generation in the yeast Saccharomyces cerevisiae. Gene disruption analysis revealed that P5C-mediated cell death was not due to P5C metabolism. Interestingly, deficiency in mitochondrial respiration suppressed the sensitivity of yeast cells to P5C. In addition, we found that P5C inhibits the mitochondrial respiration and induces a burst of superoxide anions from the mitochondria. We propose that P5C regulates cell death via the inhibition of mitochondrial respiration. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  13. Integrated RNA- and protein profiling of fermentation and respiration in diploid budding yeast provides insight into nutrient control of cell growth and development.

    Science.gov (United States)

    Becker, Emmanuelle; Liu, Yuchen; Lardenois, Aurélie; Walther, Thomas; Horecka, Joe; Stuparevic, Igor; Law, Michael J; Lavigne, Régis; Evrard, Bertrand; Demougin, Philippe; Riffle, Michael; Strich, Randy; Davis, Ronald W; Pineau, Charles; Primig, Michael

    2015-04-24

    Diploid budding yeast undergoes rapid mitosis when it ferments glucose, and in the presence of a non-fermentable carbon source and the absence of a nitrogen source it triggers sporulation. Rich medium with acetate is a commonly used pre-sporulation medium, but our understanding of the molecular events underlying the acetate-driven transition from mitosis to meiosis is still incomplete. We identified 263 proteins for which mRNA and protein synthesis are linked or uncoupled in fermenting and respiring cells. Using motif predictions, interaction data and RNA profiling we find among them 28 likely targets for Ume6, a subunit of the conserved Rpd3/Sin3 histone deacetylase-complex regulating genes involved in metabolism, stress response and meiosis. Finally, we identify 14 genes for which both RNA and proteins are detected exclusively in respiring cells but not in fermenting cells in our sample set, including CSM4, SPR1, SPS4 and RIM4, which were thought to be meiosis-specific. Our work reveals intertwined transcriptional and post-transcriptional control mechanisms acting when a MATa/α strain responds to nutritional signals, and provides molecular clues how the carbon source primes yeast cells for entering meiosis. Our integrated genomics study provides insight into the interplay between the transcriptome and the proteome in diploid yeast cells undergoing vegetative growth in the presence of glucose (fermentation) or acetate (respiration). Furthermore, it reveals novel target genes involved in these processes for Ume6, the DNA binding subunit of the conserved histone deacetylase Rpd3 and the co-repressor Sin3. We have combined data from an RNA profiling experiment using tiling arrays that cover the entire yeast genome, and a large-scale protein detection analysis based on mass spectrometry in diploid MATa/α cells. This distinguishes our study from most others in the field-which investigate haploid yeast strains-because only diploid cells can undergo meiotic development

  14. Delineating functional principles of the bow tie structure of a kinase-phosphatase network in the budding yeast.

    Science.gov (United States)

    Abd-Rabbo, Diala; Michnick, Stephen W

    2017-03-16

    Kinases and phosphatases (KP) form complex self-regulating networks essential for cellular signal processing. In spite of having a wealth of data about interactions among KPs and their substrates, we have very limited models of the structures of the directed networks they form and consequently our ability to formulate hypotheses about how their structure determines the flow of information in these networks is restricted. We assembled and studied the largest bona fide kinase-phosphatase network (KP-Net) known to date for the yeast Saccharomyces cerevisiae. Application of the vertex sort (VS) algorithm on the KP-Net allowed us to elucidate its hierarchical structure in which nodes are sorted into top, core and bottom layers, forming a bow tie structure with a strongly connected core layer. Surprisingly, phosphatases tend to sort into the top layer, implying they are less regulated by phosphorylation than kinases. Superposition of the widest range of KP biological properties over the KP-Net hierarchy shows that core layer KPs: (i), receive the largest number of inputs; (ii), form bottlenecks implicated in multiple pathways and in decision-making; (iii), and are among the most regulated KPs both temporally and spatially. Moreover, top layer KPs are more abundant and less noisy than those in the bottom layer. Finally, we showed that the VS algorithm depends on node degrees without biasing the biological results of the sorted network. The VS algorithm is available as an R package ( https://cran.r-project.org/web/packages/VertexSort/index.html ). The KP-Net model we propose possesses a bow tie hierarchical structure in which the top layer appears to ensure highest fidelity and the core layer appears to mediate signal integration and cell state-dependent signal interpretation. Our model of the yeast KP-Net provides both functional insight into its organization as we understand today and a framework for future investigation of information processing in yeast and eukaryotes

  15. High-yield expression in Escherichia coli, purification and application of budding yeast K2 killer protein.

    Science.gov (United States)

    Podoliankaitė, Monika; Lukša, Juliana; Vyšniauskis, Gintautas; Sereikaitė, Jolanta; Melvydas, Vytautas; Serva, Saulius; Servienė, Elena

    2014-07-01

    Saccharomyces cerevisiae K2 toxin is a highly active extracellular protein, important as a biocontrol agent for biotechnological applications in the wine industry. This protein is produced at negligible levels in yeast, making difficult to isolate it in amounts sufficient for investigation and generation of analysis tools. In this work, we demonstrate the use of a bacterial system for expression of the recombinant K2 protein, suitable for generation of antibodies specific for toxin of the yeast origin. Synthesis of the full-length S. cerevisiae K2 preprotoxin in Escherichia coli was found to be toxic to the host cell, resulting in diminished growth. Such effect was abolished by the introduction of the C-terminal truncation into K2 protein, directing it into non-toxic inclusion body fraction. The obtained protein is of limited solubility thus, facilitating the purification by simple and efficient chromatography-free procedure. The protein aggregates were successfully refolded into a soluble form yielding sufficient amounts of a tag-less truncated K2 protein suitable for polyclonal antibody production. Antibodies were raised in rabbit and found to be specific for detection of both antigen and native S. cerevisiae K2 toxin.

  16. Long-term tracking of budding yeast cells in brightfield microscopy: CellStar and the Evaluation Platform.

    Science.gov (United States)

    Versari, Cristian; Stoma, Szymon; Batmanov, Kirill; Llamosi, Artémis; Mroz, Filip; Kaczmarek, Adam; Deyell, Matt; Lhoussaine, Cédric; Hersen, Pascal; Batt, Gregory

    2017-02-01

    With the continuous expansion of single cell biology, the observation of the behaviour of individual cells over extended durations and with high accuracy has become a problem of central importance. Surprisingly, even for yeast cells that have relatively regular shapes, no solution has been proposed that reaches the high quality required for long-term experiments for segmentation and tracking (S&T) based on brightfield images. Here, we present CellStar , a tool chain designed to achieve good performance in long-term experiments. The key features are the use of a new variant of parametrized active rays for segmentation, a neighbourhood-preserving criterion for tracking, and the use of an iterative approach that incrementally improves S&T quality. A graphical user interface enables manual corrections of S&T errors and their use for the automated correction of other, related errors and for parameter learning. We created a benchmark dataset with manually analysed images and compared CellStar with six other tools, showing its high performance, notably in long-term tracking. As a community effort, we set up a website, the Yeast Image Toolkit, with the benchmark and the Evaluation Platform to gather this and additional information provided by others. © 2017 The Authors.

  17. Condensin suppresses recombination and regulates double-strand break processing at the repetitive ribosomal DNA array to ensure proper chromosome segregation during meiosis in budding yeast

    Science.gov (United States)

    Li, Ping; Jin, Hui; Yu, Hong-Guo

    2014-01-01

    During meiosis, homologues are linked by crossover, which is required for bipolar chromosome orientation before chromosome segregation at anaphase I. The repetitive ribosomal DNA (rDNA) array, however, undergoes little or no meiotic recombination. Hyperrecombination can cause chromosome missegregation and rDNA copy number instability. We report here that condensin, a conserved protein complex required for chromosome organization, regulates double-strand break (DSB) formation and repair at the rDNA gene cluster during meiosis in budding yeast. Condensin is highly enriched at the rDNA region during prophase I, released at the prophase I/metaphase I transition, and reassociates with rDNA before anaphase I onset. We show that condensin plays a dual role in maintaining rDNA stability: it suppresses the formation of Spo11-mediated rDNA breaks, and it promotes DSB processing to ensure proper chromosome segregation. Condensin is unnecessary for the export of rDNA breaks outside the nucleolus but required for timely repair of meiotic DSBs. Our work reveals that condensin coordinates meiotic recombination with chromosome segregation at the repetitive rDNA sequence, thereby maintaining genome integrity. PMID:25103240

  18. Exposure of ELF-EMF and RF-EMF Increase the Rate of Glucose Transport and TCA Cycle in Budding Yeast.

    Science.gov (United States)

    Lin, Kang-Wei; Yang, Chuan-Jun; Lian, Hui-Yong; Cai, Peng

    2016-01-01

    In this study, we investigated the transcriptional response to 50 Hz extremely low frequency electromagnetic field (ELF-EMF) and 2.0 GHz radio frequency electromagnetic field (RF-EMF) exposure by Illumina sequencing technology using budding yeast as the model organism. The transcription levels of 28 genes were upregulated and those of four genes were downregulated under ELF-EMF exposure, while the transcription levels of 29 genes were upregulated and those of 24 genes were downregulated under RF-EMF exposure. After validation by reverse transcription quantitative polymerase chain reaction (RT-qPCR), a concordant direction of change both in differential gene expression (DGE) and RT-qPCR was demonstrated for nine genes under ELF-EMF exposure and for 10 genes under RF-EMF exposure. The RT-qPCR results revealed that ELF-EMF and RF-EMF exposure can upregulate the expression of genes involved in glucose transportation and the tricarboxylic acid (TCA) cycle, but not the glycolysis pathway. Energy metabolism is closely related with the cell response to environmental stress including EMF exposure. Our findings may throw light on the mechanism underlying the biological effects of EMF.

  19. H2B ubiquitylation is part of chromatin architecture that marks exon-intron structure in budding yeast

    Directory of Open Access Journals (Sweden)

    Shieh Grace S

    2011-12-01

    Full Text Available Abstract Background The packaging of DNA into chromatin regulates transcription from initiation through 3' end processing. One aspect of transcription in which chromatin plays a poorly understood role is the co-transcriptional splicing of pre-mRNA. Results Here we provide evidence that H2B monoubiquitylation (H2BK123ub1 marks introns in Saccharomyces cerevisiae. A genome-wide map of H2BK123ub1 in this organism reveals that this modification is enriched in coding regions and that its levels peak at the transcribed regions of two characteristic subgroups of genes. First, long genes are more likely to have higher levels of H2BK123ub1, correlating with the postulated role of this modification in preventing cryptic transcription initiation in ORFs. Second, genes that are highly transcribed also have high levels of H2BK123ub1, including the ribosomal protein genes, which comprise the majority of intron-containing genes in yeast. H2BK123ub1 is also a feature of introns in the yeast genome, and the disruption of this modification alters the intragenic distribution of H3 trimethylation on lysine 36 (H3K36me3, which functionally correlates with alternative RNA splicing in humans. In addition, the deletion of genes encoding the U2 snRNP subunits, Lea1 or Msl1, in combination with an htb-K123R mutation, leads to synthetic lethality. Conclusion These data suggest that H2BK123ub1 facilitates cross talk between chromatin and pre-mRNA splicing by modulating the distribution of intronic and exonic histone modifications.

  20. H2B ubiquitylation is part of chromatin architecture that marks exon-intron structure in budding yeast

    LENUS (Irish Health Repository)

    Shieh, Grace S.

    2011-12-22

    Abstract Background The packaging of DNA into chromatin regulates transcription from initiation through 3\\' end processing. One aspect of transcription in which chromatin plays a poorly understood role is the co-transcriptional splicing of pre-mRNA. Results Here we provide evidence that H2B monoubiquitylation (H2BK123ub1) marks introns in Saccharomyces cerevisiae. A genome-wide map of H2BK123ub1 in this organism reveals that this modification is enriched in coding regions and that its levels peak at the transcribed regions of two characteristic subgroups of genes. First, long genes are more likely to have higher levels of H2BK123ub1, correlating with the postulated role of this modification in preventing cryptic transcription initiation in ORFs. Second, genes that are highly transcribed also have high levels of H2BK123ub1, including the ribosomal protein genes, which comprise the majority of intron-containing genes in yeast. H2BK123ub1 is also a feature of introns in the yeast genome, and the disruption of this modification alters the intragenic distribution of H3 trimethylation on lysine 36 (H3K36me3), which functionally correlates with alternative RNA splicing in humans. In addition, the deletion of genes encoding the U2 snRNP subunits, Lea1 or Msl1, in combination with an htb-K123R mutation, leads to synthetic lethality. Conclusion These data suggest that H2BK123ub1 facilitates cross talk between chromatin and pre-mRNA splicing by modulating the distribution of intronic and exonic histone modifications.

  1. Divergent Evolution of the Transcriptional Network Controlled by Snf1-Interacting Protein Sip4 in Budding Yeasts.

    Directory of Open Access Journals (Sweden)

    Constance Mehlgarten

    Full Text Available Cellular responses to starvation are of ancient origin since nutrient limitation has always been a common challenge to the stability of living systems. Hence, signaling molecules involved in sensing or transducing information about limiting metabolites are highly conserved, whereas transcription factors and the genes they regulate have diverged. In eukaryotes the AMP-activated protein kinase (AMPK functions as a central regulator of cellular energy homeostasis. The yeast AMPK ortholog SNF1 controls the transcriptional network that counteracts carbon starvation conditions by regulating a set of transcription factors. Among those Cat8 and Sip4 have overlapping DNA-binding specificity for so-called carbon source responsive elements and induce target genes upon SNF1 activation. To analyze the evolution of the Cat8-Sip4 controlled transcriptional network we have compared the response to carbon limitation of Saccharomyces cerevisiae to that of Kluyveromyces lactis. In high glucose, S. cerevisiae displays tumor cell-like aerobic fermentation and repression of respiration (Crabtree-positive while K. lactis has a respiratory-fermentative life-style, respiration being regulated by oxygen availability (Crabtree-negative, which is typical for many yeasts and for differentiated higher cells. We demonstrate divergent evolution of the Cat8-Sip4 network and present evidence that a role of Sip4 in controlling anabolic metabolism has been lost in the Saccharomyces lineage. We find that in K. lactis, but not in S. cerevisiae, the Sip4 protein plays an essential role in C2 carbon assimilation including induction of the glyoxylate cycle and the carnitine shuttle genes. Induction of KlSIP4 gene expression by KlCat8 is essential under these growth conditions and a primary function of KlCat8. Both KlCat8 and KlSip4 are involved in the regulation of lactose metabolism in K. lactis. In chromatin-immunoprecipitation experiments we demonstrate binding of both, KlSip4 and

  2. DNA is structured as a linear "jigsaw puzzle" in the genomes of Arabidopsis, rice, and budding yeast.

    Science.gov (United States)

    Liu, Yun-Hua; Zhang, Meiping; Wu, Chengcang; Huang, James J; Zhang, Hong-Bin

    2014-01-01

    Knowledge of how a genome is structured and organized from its constituent elements is crucial to understanding its biology and evolution. Here, we report the genome structuring and organization pattern as revealed by systems analysis of the sequences of three model species, Arabidopsis, rice and yeast, at the whole-genome and chromosome levels. We found that all fundamental function elements (FFE) constituting the genomes, including genes (GEN), DNA transposable elements (DTE), retrotransposable elements (RTE), simple sequence repeats (SSR), and (or) low complexity repeats (LCR), are structured in a nonrandom and correlative manner, thus leading to a hypothesis that the DNA of the species is structured as a linear "jigsaw puzzle". Furthermore, we showed that different FFE differ in their importance in the formation and evolution of the DNA jigsaw puzzle structure between species. DTE and RTE play more important roles than GEN, LCR, and SSR in Arabidopsis, whereas GEN and RTE play more important roles than LCR, SSR, and DTE in rice. The genes having multiple recognized functions play more important roles than those having single functions. These results provide useful knowledge necessary for better understanding genome biology and evolution of the species and for effective molecular breeding of rice.

  3. A mechanism for the coordination of proliferation and differentiation by spatial regulation of Fus2p in budding yeast

    Science.gov (United States)

    Kim, Junwon; Rose, Mark D.

    2012-01-01

    Yeast cells induce the genes required for mating prior to the completion of mitosis. To ensure proper cell cycle progression prior to mating differentiation, a key cytoplasmic regulator of cell fusion, Fus2p, is sequestered in the nucleus by cyclin-dependent kinase (Cdk). In response to pheromone signaling, the mitogen-activated protein kinase Fus3p phosphorylates Ser 84 in Fus2p to drive nuclear export. We found that Fus3p becomes active and phosphorylates S84 as early as S phase, raising the question of how Cdk prevents inappropriate activation of Fus2p. Countering Fus3p, Cdk and a p21-activated kinase, Cla4p, maintain Fus2p's nuclear localization by phosphorylating Ser 67, which drives nuclear import and inhibits nuclear export. When Cdk and Cla4p activities drop after cell division, Fus3p promotes Fus2p export both via S84 phosphorylation and by down-regulating S67 phosphorylation. Thus, potential premature activation of Fus2p in mitosis is prevented by cell cycle-dependent phosphorylation that overrides the mating pheromone-induced phosphorylation that drives nuclear export. PMID:22588722

  4. Cdc14 phosphatase directs centrosome re-duplication at the meiosis I to meiosis II transition in budding yeast [version 2; referees: 3 approved, 1 approved with reservations

    Directory of Open Access Journals (Sweden)

    Colette Fox

    2017-02-01

    Full Text Available Background Gametes are generated through a specialized cell division called meiosis, in which ploidy is reduced by half because two consecutive rounds of chromosome segregation, meiosis I and meiosis II, occur without intervening DNA replication. This contrasts with the mitotic cell cycle where DNA replication and chromosome segregation alternate to maintain the same ploidy. At the end of mitosis, cyclin-dependent kinases (CDKs are inactivated. This low CDK state in late mitosis/G1 allows for critical preparatory events for DNA replication and centrosome/spindle pole body (SPB duplication. However, their execution is inhibited until S phase, where further preparatory events are also prevented. This “licensing” ensures that both the chromosomes and the centrosomes/SPBs replicate exactly once per cell cycle, thereby maintaining constant ploidy. Crucially, between meiosis I and meiosis II, centrosomes/SPBs must be re-licensed, but DNA re-replication must be avoided. In budding yeast, the Cdc14 protein phosphatase triggers CDK down regulation to promote exit from mitosis. Cdc14 also regulates the meiosis I to meiosis II transition, though its mode of action has remained unclear. Methods Fluorescence and electron microscopy was combined with proteomics to probe SPB duplication in cells with inactive or hyperactive Cdc14. Results We demonstrate that Cdc14 ensures two successive nuclear divisions by re-licensing SPBs at the meiosis I to meiosis II transition. We show that Cdc14 is asymmetrically enriched on a single SPB during anaphase I and provide evidence that this enrichment promotes SPB re-duplication. Cells with impaired Cdc14 activity fail to promote extension of the SPB half-bridge, the initial step in morphogenesis of a new SPB. Conversely, cells with hyper-active Cdc14 duplicate SPBs, but fail to induce their separation. Conclusion Our findings implicate reversal of key CDK-dependent phosphorylations in the differential licensing of

  5. Budding yeast ATM/ATR control meiotic double-strand break (DSB levels by down-regulating Rec114, an essential component of the DSB-machinery.

    Directory of Open Access Journals (Sweden)

    Jesús A Carballo

    2013-06-01

    Full Text Available An essential feature of meiosis is Spo11 catalysis of programmed DNA double strand breaks (DSBs. Evidence suggests that the number of DSBs generated per meiosis is genetically determined and that this ability to maintain a pre-determined DSB level, or "DSB homeostasis", might be a property of the meiotic program. Here, we present direct evidence that Rec114, an evolutionarily conserved essential component of the meiotic DSB-machinery, interacts with DSB hotspot DNA, and that Tel1 and Mec1, the budding yeast ATM and ATR, respectively, down-regulate Rec114 upon meiotic DSB formation through phosphorylation. Mimicking constitutive phosphorylation reduces the interaction between Rec114 and DSB hotspot DNA, resulting in a reduction and/or delay in DSB formation. Conversely, a non-phosphorylatable rec114 allele confers a genome-wide increase in both DSB levels and in the interaction between Rec114 and the DSB hotspot DNA. These observations strongly suggest that Tel1 and/or Mec1 phosphorylation of Rec114 following Spo11 catalysis down-regulates DSB formation by limiting the interaction between Rec114 and DSB hotspots. We also present evidence that Ndt80, a meiosis specific transcription factor, contributes to Rec114 degradation, consistent with its requirement for complete cessation of DSB formation. Loss of Rec114 foci from chromatin is associated with homolog synapsis but independent of Ndt80 or Tel1/Mec1 phosphorylation. Taken together, we present evidence for three independent ways of regulating Rec114 activity, which likely contribute to meiotic DSBs-homeostasis in maintaining genetically determined levels of breaks.

  6. Budding Yeast ATM/ATR Control Meiotic Double-Strand Break (DSB) Levels by Down-Regulating Rec114, an Essential Component of the DSB-machinery

    Science.gov (United States)

    Carballo, Jesús A.; Panizza, Silvia; Serrentino, Maria Elisabetta; Johnson, Anthony L.; Geymonat, Marco; Borde, Valérie; Klein, Franz; Cha, Rita S.

    2013-01-01

    An essential feature of meiosis is Spo11 catalysis of programmed DNA double strand breaks (DSBs). Evidence suggests that the number of DSBs generated per meiosis is genetically determined and that this ability to maintain a pre-determined DSB level, or “DSB homeostasis”, might be a property of the meiotic program. Here, we present direct evidence that Rec114, an evolutionarily conserved essential component of the meiotic DSB-machinery, interacts with DSB hotspot DNA, and that Tel1 and Mec1, the budding yeast ATM and ATR, respectively, down-regulate Rec114 upon meiotic DSB formation through phosphorylation. Mimicking constitutive phosphorylation reduces the interaction between Rec114 and DSB hotspot DNA, resulting in a reduction and/or delay in DSB formation. Conversely, a non-phosphorylatable rec114 allele confers a genome-wide increase in both DSB levels and in the interaction between Rec114 and the DSB hotspot DNA. These observations strongly suggest that Tel1 and/or Mec1 phosphorylation of Rec114 following Spo11 catalysis down-regulates DSB formation by limiting the interaction between Rec114 and DSB hotspots. We also present evidence that Ndt80, a meiosis specific transcription factor, contributes to Rec114 degradation, consistent with its requirement for complete cessation of DSB formation. Loss of Rec114 foci from chromatin is associated with homolog synapsis but independent of Ndt80 or Tel1/Mec1 phosphorylation. Taken together, we present evidence for three independent ways of regulating Rec114 activity, which likely contribute to meiotic DSBs-homeostasis in maintaining genetically determined levels of breaks. PMID:23825959

  7. Sociobiology of the budding yeast

    Indian Academy of Sciences (India)

    2014-03-15

    Mar 15, 2014 ... The organisms taking part in social behaviours can be divided into actors ... behaviour that have been classified as social. .... tory strains on solid agar media. ..... scenario, PCD is beneficial for the young cells where effective.

  8. Arenavirus Budding

    Directory of Open Access Journals (Sweden)

    Shuzo Urata

    2011-01-01

    Full Text Available Several arenaviruses cause hemorrhagic fever disease in humans and pose a significant public health concern in their endemic regions. On the other hand, the prototypic arenavirus LCMV is a superb workhorse for the investigation of virus-host interactions and associated disease. The arenavirus small RING finger protein called Z has been shown to be the main driving force of virus budding. The budding activity of Z is mediated by late (L domain motifs, PT/SAP, and PPXY, located at the C-terminus of Z. This paper will present the current knowledge on arenavirus budding including the diversity of L domain motifs used by different arenaviruses. We will also discuss how improved knowledge of arenavirus budding may facilitate the development of novel antiviral strategies to combat human pathogenic arenaviruses.

  9. Arenavirus Budding

    OpenAIRE

    Urata, Shuzo; de la Torre, Juan Carlos

    2011-01-01

    Several arenaviruses cause hemorrhagic fever disease in humans and pose a significant public health concern in their endemic regions. On the other hand, the prototypic arenavirus LCMV is a superb workhorse for the investigation of virus-host interactions and associated disease. The arenavirus small RING finger protein called Z has been shown to be the main driving force of virus budding. The budding activity of Z is mediated by late (L) domain motifs, PT/SAP, and PPXY, located at the C-termin...

  10. SLC1 and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3-phosphate O-acyltransferases of budding yeast

    DEFF Research Database (Denmark)

    Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath

    2007-01-01

    Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...

  11. Detection of Multiple Budding Yeast Cells and a Partial Sequence of 43-kDa Glycoprotein Coding Gene of Paracoccidioides brasiliensis from a Case of Lacaziosis in a Female Pacific White-Sided Dolphin (Lagenorhynchus obliquidens).

    Science.gov (United States)

    Minakawa, Tomoko; Ueda, Keiichi; Tanaka, Miyuu; Tanaka, Natsuki; Kuwamura, Mitsuru; Izawa, Takeshi; Konno, Toshihiro; Yamate, Jyoji; Itano, Eiko Nakagawa; Sano, Ayako; Wada, Shinpei

    2016-08-01

    Lacaziosis, formerly called as lobomycosis, is a zoonotic mycosis, caused by Lacazia loboi, found in humans and dolphins, and is endemic in the countries on the Atlantic Ocean, Indian Ocean and Pacific Ocean of Japanese coast. Susceptible Cetacean species include the bottlenose dolphin (Tursiops truncatus), the Indian Ocean bottlenose dolphin (T. aduncus), and the estuarine dolphin (Sotalia guianensis); however, no cases have been recorded in other Cetacean species. We diagnosed a case of Lacaziosis in a Pacific white-sided dolphin (Lagenorhynchus obliquidens) nursing in an aquarium in Japan. The dolphin was a female estimated to be more than 14 years old at the end of June 2015 and was captured in a coast of Japan Sea in 2001. Multiple, lobose, and solid granulomatous lesions with or without ulcers appeared on her jaw, back, flipper and fluke skin, in July 2014. The granulomatous skin lesions from the present case were similar to those of our previous cases. Multiple budding and chains of round yeast cells were detected in the biopsied samples. The partial sequence of 43-kDa glycoprotein coding gene confirmed by a nested PCR and sequencing, which revealed a different genotype from both Amazonian and Japanese lacaziosis in bottlenose dolphins, and was 99 % identical to those derived from Paracoccidioides brasiliensis; a sister fungal species to L. loboi. This is the first case of lacaziosis in Pacific white-sided dolphin.

  12. Phosphorylation of the Budding Yeast 9-1-1 Complex Is Required for Dpb11 Function in the Full Activation of the UV-Induced DNA Damage Checkpoint▿ †

    Science.gov (United States)

    Puddu, Fabio; Granata, Magda; Di Nola, Lisa; Balestrini, Alessia; Piergiovanni, Gabriele; Lazzaro, Federico; Giannattasio, Michele; Plevani, Paolo; Muzi-Falconi, Marco

    2008-01-01

    Following genotoxic insults, eukaryotic cells trigger a signal transduction cascade known as the DNA damage checkpoint response, which involves the loading onto DNA of an apical kinase and several downstream factors. Chromatin modifications play an important role in recruiting checkpoint proteins. In budding yeast, methylated H3-K79 is bound by the checkpoint factor Rad9. Loss of Dot1 prevents H3-K79 methylation, leading to a checkpoint defect in the G1 phase of the cell cycle and to a reduction of checkpoint activation in mitosis, suggesting that another pathway contributes to Rad9 recruitment in M phase. We found that the replication factor Dpb11 is the keystone of this second pathway. dot1Δ dpb11-1 mutant cells are sensitive to UV or Zeocin treatment and cannot activate Rad53 if irradiated in M phase. Our data suggest that Dpb11 is held in proximity to damaged DNA through an interaction with the phosphorylated 9-1-1 complex, leading to Mec1-dependent phosphorylation of Rad9. Dpb11 is also phosphorylated after DNA damage, and this modification is lost in a nonphosphorylatable ddc1-T602A mutant. Finally, we show that, in vivo, Dpb11 cooperates with Dot1 in promoting Rad9 phosphorylation but also contributes to the full activation of Mec1 kinase. PMID:18541674

  13. The Gcn2 Regulator Yih1 Interacts with the Cyclin Dependent Kinase Cdc28 and Promotes Cell Cycle Progression through G2/M in Budding Yeast.

    Directory of Open Access Journals (Sweden)

    Richard C Silva

    Full Text Available The Saccharomyces cerevisiae protein Yih1, when overexpressed, inhibits the eIF2 alpha kinase Gcn2 by competing for Gcn1 binding. However, deletion of YIH1 has no detectable effect on Gcn2 activity, suggesting that Yih1 is not a general inhibitor of Gcn2, and has no phenotypic defect identified so far. Thus, its physiological role is largely unknown. Here, we show that Yih1 is involved in the cell cycle. Yeast lacking Yih1 displays morphological patterns and DNA content indicative of a delay in the G2/M phases of the cell cycle, and this phenotype is independent of Gcn1 and Gcn2. Accordingly, the levels of phosphorylated eIF2α, which show a cell cycle-dependent fluctuation, are not altered in cells devoid of Yih1. We present several lines of evidence indicating that Yih1 is in a complex with Cdc28. Yih1 pulls down endogenous Cdc28 in vivo and this interaction is enhanced when Cdc28 is active, suggesting that Yih1 modulates the function of Cdc28 in specific stages of the cell cycle. We also demonstrate, by Bimolecular Fluorescence Complementation, that endogenous Yih1 and Cdc28 interact with each other, confirming Yih1 as a bona fide Cdc28 binding partner. Amino acid substitutions within helix H2 of the RWD domain of Yih1 enhance Yih1-Cdc28 association. Overexpression of this mutant, but not of wild type Yih1, leads to a phenotype similar to that of YIH1 deletion, supporting the view that Yih1 is involved through Cdc28 in the regulation of the cell cycle. We further show that IMPACT, the mammalian homologue of Yih1, interacts with CDK1, the mammalian counterpart of Cdc28, indicating that the involvement with the cell cycle is conserved. Together, these data provide insights into the cellular function of Yih1/IMPACT, and provide the basis for future studies on the role of this protein in the cell cycle.

  14. New phenotypes generated by the G57R mutation of BUD23 in Saccharomyces cerevisiae.

    Science.gov (United States)

    Lin, Jyun-Liang; Yu, Hui-Chia; Chao, Ju-Lan; Wang, Chung; Cheng, Ming-Yuan

    2012-12-01

    BUD23 in Saccharomyces cerevisiae encodes for a class I methyltransferase, and deletion of the gene results in slow growth and random budding phenotypes. Herein, two BUD23 mutants defective in methyltransferase activity were generated to investigate whether the phenotypes of the null mutant might be correlated with a loss in enzymatic activity. Expression at the physiological level of both D77A and G57R mutants was able to rescue the phenotypes of the bud23-null mutant. The result implied that the methyltransferase activity of the protein was not necessary for supporting normal growth and bud site selection of the cells. High-level expression of Bud23 (G57R), but not Bud23 or Bud23 (D77A), in BUD23 deletion cells failed to complement these phenotypes. However, just like Bud23, Bud23 (G57R) was localized in a DAPI-poor region in the nucleus. Distinct behaviour in Bud23 (G57R) could not be originated from a mislocalization of the protein. Over-expression of Bud23 (G57R) in null cells also produced changes in actin organization and additional septin mutant-like phenotypes. Therefore, the absence of Bud23, Bud23 (G57R) at a high level might affect the cell division of yeast cells through an as yet unidentified mechanism. Copyright © 2012 John Wiley & Sons, Ltd.

  15. Sexual differentiation in fission yeast

    DEFF Research Database (Denmark)

    Egel, R; Nielsen, O; Weilguny, D

    1990-01-01

    The regulation of sexual reproduction in yeast constitutes the highest level of differentiation observed in these unicellular organisms. The various ramifications of this system involve DNA rearrangement, transcriptional control, post-translational modification (such as protein phosphorylation) a......) and receptor/signal processing. A few basic similarities are common to both fission and budding yeasts. The wiring of the regulatory circuitry, however, varies considerably between these divergent yeast groups....

  16. Yeast for virus research

    Science.gov (United States)

    Zhao, Richard Yuqi

    2017-01-01

    Budding yeast (Saccharomyces cerevisiae) and fission yeast (Schizosaccharomyces pombe) are two popular model organisms for virus research. They are natural hosts for viruses as they carry their own indigenous viruses. Both yeasts have been used for studies of plant, animal and human viruses. Many positive sense (+) RNA viruses and some DNA viruses replicate with various levels in yeasts, thus allowing study of those viral activities during viral life cycle. Yeasts are single cell eukaryotic organisms. Hence, many of the fundamental cellular functions such as cell cycle regulation or programed cell death are highly conserved from yeasts to higher eukaryotes. Therefore, they are particularly suited to study the impact of those viral activities on related cellular activities during virus-host interactions. Yeasts present many unique advantages in virus research over high eukaryotes. Yeast cells are easy to maintain in the laboratory with relative short doubling time. They are non-biohazardous, genetically amendable with small genomes that permit genome-wide analysis of virologic and cellular functions. In this review, similarities and differences of these two yeasts are described. Studies of virologic activities such as viral translation, viral replication and genome-wide study of virus-cell interactions in yeasts are highlighted. Impacts of viral proteins on basic cellular functions such as cell cycle regulation and programed cell death are discussed. Potential applications of using yeasts as hosts to carry out functional analysis of small viral genome and to develop high throughput drug screening platform for the discovery of antiviral drugs are presented. PMID:29082230

  17. A Comparative Study of the Cell Wall Structure of Basidiomycetous and Related Yeasts

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    The wall of basidiomycetous and related yeasts showed a lamellar structure in sections of both budding cells and hyphae fixed with potassium permanganate. The yeasts also had a typical way of bud formation and septation. These features differ from those recorded for ascomycetous yeasts. In the

  18. Propagation of Mammalian Prions in Yeast

    National Research Council Canada - National Science Library

    Harris, David A

    2006-01-01

    ...: the budding yeast Saccharomyces cerevisiae. This unicellular organism offers a number of potential advantages for the study of prion biology, including rapid generation time, ease of culturing, and facile genetics...

  19. What Are Taste Buds?

    Science.gov (United States)

    ... Sexual Health Food & Fitness Diseases & Conditions Infections Drugs & Alcohol School & Jobs Sports Expert Answers (Q&A) Staying Safe Videos for Educators Search English Español What Are Taste Buds? KidsHealth / For Kids / What Are Taste Buds? ...

  20. Yeast replicative aging: a paradigm for defining conserved longevity interventions

    OpenAIRE

    Wasko, Brian M.; Kaeberlein, Matt

    2013-01-01

    The finite replicative life span of budding yeast mother cells was demonstrated as early as 1959, but the idea that budding yeast could be used to model aging of multicellular eukaryotes did not enter the scientific mainstream until relatively recently. Despite continued skepticism by some, there are now abundant data that several interventions capable of extending yeast replicative life span have a similar effect in multicellular eukaryotes including nematode worms, fruit flies, and rodents....

  1. Axillary bud development in chrysanthemum

    NARCIS (Netherlands)

    Ruiter, de H.A.

    1996-01-01


    Each chrysanthemum cutting originates from an axillary bud. For an improvement of the cultivation of cuttings or more specific their quality, it is necessary that the development of an axillary bud can be controlled as good as possible. Axillary bud development can be distinguished into

  2. The final cut: cell polarity meets cytokinesis at the bud neck in S. cerevisiae.

    Science.gov (United States)

    Juanes, Maria Angeles; Piatti, Simonetta

    2016-08-01

    Cell division is a fundamental but complex process that gives rise to two daughter cells. It includes an ordered set of events, altogether called "the cell cycle", that culminate with cytokinesis, the final stage of mitosis leading to the physical separation of the two daughter cells. Symmetric cell division equally partitions cellular components between the two daughter cells, which are therefore identical to one another and often share the same fate. In many cases, however, cell division is asymmetrical and generates two daughter cells that differ in specific protein inheritance, cell size, or developmental potential. The budding yeast Saccharomyces cerevisiae has proven to be an excellent system to investigate the molecular mechanisms governing asymmetric cell division and cytokinesis. Budding yeast is highly polarized during the cell cycle and divides asymmetrically, producing two cells with distinct sizes and fates. Many components of the machinery establishing cell polarization during budding are relocalized to the division site (i.e., the bud neck) for cytokinesis. In this review we recapitulate how budding yeast cells undergo polarized processes at the bud neck for cell division.

  3. Axillary bud development in rose

    NARCIS (Netherlands)

    Marcelis - van Acker, C.A.M.

    1994-01-01

    Axillary buds form the basis of flower production of a rose crop. Within a rose crop there exists an undesired large variation in shoot number and size, which affects flower yield. Part of this variation may be traced back to early variation in axillary buds. The aim of the research

  4. Fission yeast mating-type switching: programmed damage and repair

    DEFF Research Database (Denmark)

    Egel, Richard

    2005-01-01

    Mating-type switching in fission yeast follows similar rules as in budding yeast, but the underlying mechanisms are entirely different. Whilst the initiating double-strand cut in Saccharomyces cerevisiae requires recombinational repair for survival, the initial damage in Schizosaccharomyces pombe...

  5. Transcriptional Waves in the Yeast Cell Cycle

    OpenAIRE

    Oliva, Anna; Rosebrock, Adam; Ferrezuelo, Francisco; Pyne, Saumyadipta; Chen, Haiying; Skiena, Steve; Futcher, Bruce; Leatherwood, Janet

    2005-01-01

    Many genes are regulated as an innate part of the eukaryotic cell cycle, and a complex transcriptional network helps enable the cyclic behavior of dividing cells. This transcriptional network has been studied in Saccharomyces cerevisiae (budding yeast) and elsewhere. To provide more perspective on these regulatory mechanisms, we have used microarrays to measure gene expression through the cell cycle of Schizosaccharomyces pombe (fission yeast). The 750 genes with the most significant oscillat...

  6. Simultaneous production of buds on mother and daughter cells of Saccharomyces cerevisiae in the presence of hydroxyurea

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, K; Michio, I

    1979-12-01

    Individual budding yeast cells, Saccharomyces cerevisiae, enclosed in small culture chambers were observed through two budding cycles to examine their behavior during growth and division. In the nutrient medium (YHG medium), the duration of the budding cycles was 77 minutes for mother cells and 90 minutes for daughter cells. Continuous exposure of cells to 16 or 32 mm hydroxyurea extended the duration of the cycles and increased the volume of cells, resulting in the formation of abnormally large and equal-sized mother-daughter pairs. Each cell of these pairs subsequently produced buds simultaneously. Stained cell nuclei showed simultaneous nuclear division. This synchronous budding on mother-daughter pairs was repeated in the next budding cycle. The coordination of growth with division is discussed in relation to these results.

  7. New vectors in fission yeast: application for cloning the his2 gene

    DEFF Research Database (Denmark)

    Weilguny, D; Praetorius, M; Carr, Alan

    1991-01-01

    of transforming Sc. pombe ura4 strains, as well as ura 3 strains of the distantly related budding yeast Saccharomyces cerevisiae. We have used pON163 for the construction of two fission yeast genomic libraries. From these gene banks clones were isolated that were able to complement fission yeast his2 mutants...

  8. ESCRT-independent budding of HIV-1 gag virus-like particles from Saccharomyces cerevisiae spheroplasts.

    Directory of Open Access Journals (Sweden)

    Andrew P Norgan

    Full Text Available Heterologous expression of HIV-1 Gag in a variety of host cells results in its packaging into virus-like particles (VLPs that are subsequently released into the extracellular milieu. This phenomenon represents a useful tool for probing cellular factors required for viral budding and has contributed to the discovery of roles for ubiquitin ligases and the endosomal sorting complexes required for transport (ESCRTs in viral budding. These factors are highly conserved throughout eukaryotes and have been studied extensively in the yeast Saccharomyces cerevisiae, a model eukaryote previously utilized as a host for the production of VLPs. We used heterologous expression of HIV Gag in yeast spheroplasts to examine the role of ESCRTs and associated factors (Rsp5, a HECT ubiquitin ligase of the Nedd4 family; Bro1, a homolog of Alix; and Vps4, the AAA-ATPase required for ESCRT function in all contexts/organisms investigated in the generation of VLPs. Our data reveal: 1 characterized Gag-ESCRT interaction motifs (late domains are not required for VLP budding, 2 loss of function alleles of the essential HECT ubiquitin ligase Rsp5 do not display defects in VLP formation, and 3 ESCRT function is not required for VLP formation from spheroplasts. These results suggest that the egress of HIV Gag from yeast cells is distinct from the most commonly described mode of exit from mammalian cells, instead mimicking ESCRT-independent VLP formation observed in a subset of mammalian cells. As such, budding of Gag from yeast cells appears to represent ESCRT-independent budding relevant to viral replication in at least some situations. Thus the myriad of genetic and biochemical tools available in the yeast system may be of utility in the study of this aspect of viral budding.

  9. Taste bud cells and nerves

    OpenAIRE

    武田,正子/内田,暢彦/鈴木,裕子; タケダ,マサコ/ウチダ,ノブヒコ/スズキ,ユウコ; TAKEDA,Masako/UCHIDA,Nobuhiko/SUZUKI,Yuko

    2002-01-01

    Sectioning of glossopharyngeal nerves which innervate the taste buds in the circumvallate papillae caused apoptosis of taste buds, the numbers decreasing and the taste buds disappearing after 11 days. This indicates that gustatory nerves may release a trophic substance that induces and maintains taste buds. Taste bud cells contain neurotrophins, NCAM, NSE, PGP9.5, and NeuroD which are specific markers of neurons. The BDNF and GDNF of neurotrophins, and Trk B and GFRαl of their receptors were ...

  10. The yeast replicative aging model.

    Science.gov (United States)

    He, Chong; Zhou, Chuankai; Kennedy, Brian K

    2018-03-08

    It has been nearly three decades since the budding yeast Saccharomyces cerevisiae became a significant model organism for aging research and it has emerged as both simple and powerful. The replicative aging assay, which interrogates the number of times a "mother" cell can divide and produce "daughters", has been a stalwart in these studies, and genetic approaches have led to the identification of hundreds of genes impacting lifespan. More recently, cell biological and biochemical approaches have been developed to determine how cellular processes become altered with age. Together, the tools are in place to develop a holistic view of aging in this single-celled organism. Here, we summarize the current state of understanding of yeast replicative aging with a focus on the recent studies that shed new light on how aging pathways interact to modulate lifespan in yeast. Copyright © 2018. Published by Elsevier B.V.

  11. Biotechnological Applications of Dimorphic Yeasts

    Science.gov (United States)

    Doiphode, N.; Joshi, C.; Ghormade, V.; Deshpande, M. V.

    The dimorphic yeasts have the equilibrium between spherical growth (budding) and polarized (hyphal or pseudohyphal tip elongation) which can be triggered by change in the environmental conditions. The reversible growth phenomenon has made dimorphic yeasts as an useful model to understand fungal evolution and fungal differentiation, in general. In nature dimorphism is clearly evident in plant and animal fungal pathogens, which survive and most importantly proliferate in the respective hosts. However, number of organisms with no known pathogenic behaviour also show such a transition, which can be exploited for the technological applications due to their different biochemical make up under different morphologies. For instance, chitin and chitosan production using dimorphic Saccharomyces, Mucor, Rhizopus and Benjaminiella, oil degradation and biotransformation with yeast-form of Yarrowia species, bioremediation of organic pollutants, exopolysac-charide production by yeast-phase of Aureobasidium pullulans, to name a few. Myrothecium verrucaria can be used for seed dressing in its yeast form and it produces a mycolytic enzyme complex in its hyphal-form for the biocontrol of fungal pathogens, while Beauveria bassiana and other entomopathogens kill the insect pest by producing yeast- like cells in the insect body. The form-specific expression of protease, chitinase, lipase, ornithine decarboxylase, glutamate dehydrogenases, etc. make Benjaminiella poitrasii, Basidiobolus sp., and Mucor rouxii strains important in bioremediation, nanobiotechnology, fungal evolution and other areas.

  12. Tapping into yeast diversity.

    Science.gov (United States)

    Fay, Justin C

    2012-11-01

    Domesticated organisms demonstrate our capacity to influence wild species but also provide us with the opportunity to understand rapid evolution in the context of substantially altered environments and novel selective pressures. Recent advances in genetics and genomics have brought unprecedented insights into the domestication of many organisms and have opened new avenues for further improvements to be made. Yet, our ability to engineer biological systems is not without limits; genetic manipulation is often quite difficult. The budding yeast, Saccharomyces cerevisiae, is not only one of the most powerful model organisms, but is also the premier producer of fermented foods and beverages around the globe. As a model system, it entertains a hefty workforce dedicated to deciphering its genome and the function it encodes at a rich mechanistic level. As a producer, it is used to make leavened bread, and dozens of different alcoholic beverages, such as beer and wine. Yet, applying the awesome power of yeast genetics to understanding its origins and evolution requires some knowledge of its wild ancestors and the environments from which they were derived. A number of surprisingly diverse lineages of S. cerevisiae from both primeval and secondary forests in China have been discovered by Wang and his colleagues. These lineages substantially expand our knowledge of wild yeast diversity and will be a boon to elucidating the ecology, evolution and domestication of this academic and industrial workhorse.

  13. History of genome editing in yeast.

    Science.gov (United States)

    Fraczek, Marcin G; Naseeb, Samina; Delneri, Daniela

    2018-05-01

    For thousands of years humans have used the budding yeast Saccharomyces cerevisiae for the production of bread and alcohol; however, in the last 30-40 years our understanding of the yeast biology has dramatically increased, enabling us to modify its genome. Although S. cerevisiae has been the main focus of many research groups, other non-conventional yeasts have also been studied and exploited for biotechnological purposes. Our experiments and knowledge have evolved from recombination to high-throughput PCR-based transformations to highly accurate CRISPR methods in order to alter yeast traits for either research or industrial purposes. Since the release of the genome sequence of S. cerevisiae in 1996, the precise and targeted genome editing has increased significantly. In this 'Budding topic' we discuss the significant developments of genome editing in yeast, mainly focusing on Cre-loxP mediated recombination, delitto perfetto and CRISPR/Cas. © 2018 The Authors. Yeast published by John Wiley & Sons, Ltd.

  14. Imaging of DNA Ultrafine Bridges in Budding Yeast

    DEFF Research Database (Denmark)

    Quevedo Rodriguez, Oliver; Lisby, Michael

    2018-01-01

    DNA ultrafine bridges (UFBs) are a type of chromatin-free DNA bridges that connect sister chromatids in anaphase and pose a threat to genome stability. However, little is known about the origin of these structures, and how they are sensed and resolved by the cell. In this chapter, we review tools...... and methods for studying UFBs by fluorescence microscopy including chemical and genetic approaches to induce UFBs in the model organism Saccharomyces cerevisiae....

  15. Imaging of DNA Ultrafine Bridges in Budding Yeast.

    Science.gov (United States)

    Quevedo, Oliver; Lisby, Michael

    2018-01-01

    DNA ultrafine bridges (UFBs) are a type of chromatin-free DNA bridges that connect sister chromatids in anaphase and pose a threat to genome stability. However, little is known about the origin of these structures, and how they are sensed and resolved by the cell. In this chapter, we review tools and methods for studying UFBs by fluorescence microscopy including chemical and genetic approaches to induce UFBs in the model organism Saccharomyces cerevisiae.

  16. Timing robustness in the budding and fission yeast cell cycles.

    KAUST Repository

    Mangla, Karan; Dill, David L; Horowitz, Mark A

    2010-01-01

    Robustness of biological models has emerged as an important principle in systems biology. Many past analyses of Boolean models update all pending changes in signals simultaneously (i.e., synchronously), making it impossible to consider robustness

  17. Development and growth potential of axillary buds in roses as affected by bud age.

    NARCIS (Netherlands)

    Marcelis-van Acker, C.A.M.

    1994-01-01

    The effect of axillary bud age on the development and potential for growth of the bud into a shoot was studied in roses. Age of the buds occupying a similar position on the plant varied from 'subtending leaf just unfolded' up to 1 year later. With increasing age of the axillary bud its dry mass,

  18. Budded baculovirus particle structure revisited

    NARCIS (Netherlands)

    Wang, Qiushi; Bosch, Berend-Jan; Vlak, Just M; van Oers, Monique M; Rottier, Peter J; van Lent, Jan W M

    2015-01-01

    Baculoviruses are a group of enveloped, double-stranded DNA insect viruses with budded (BV) and occlusion-derived (ODV) virions produced during their infection cycle. BVs are commonly described as rod shaped particles with a high apical density of protein extensions (spikes) on the lipid envelope

  19. Budded baculovirus particle structure revisited

    NARCIS (Netherlands)

    Wang, Qiushi; Bosch, Berend Jan; Vlak, J.M.; Oers, van M.M.; Rottier, P.J.; Lent, van J.W.M.

    2016-01-01

    Baculoviruses are a group of enveloped, double-stranded DNA insect viruses with budded (BV) and occlusion-derived (ODV) virions produced during their infection cycle. BVs are commonly described as rod shaped particles with a high apical density of protein extensions (spikes) on the lipid envelope

  20. Budding yeast cDNA sequencing project: S03036-05_I15 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available EST - Link to UCSC Genome Browser - Sequence >S03036-05_I15.phd NNNTNNTNNNNCNCTCACATANAAGACGGANNAGNNNGCTGGGC...CAATGCGTTCCATATGCG AAAATTCTTGGNCAATGTATTCTCTAGCAATCTNTNCTTTTGTACANTCGGAGGNTTNTC ATGNTCCTTTCATANATTATANAAANNG

  1. Budding yeast cDNA sequencing project: S03052-78_H01 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available GGTTCAGTC ACCCCAGCTTTAAACNATTGTTAATACAGAAGTGAATGCTTCCGTTTTCCAATTTTTCGC TTCCCTCCGCCGCNCCNNACCGNTTCTTCCGANCATTTAGATATNNATTCATANA...TGCTT ATTTNNGGGTCATANAGGAAANAATTTTCGATTGNAANGACTGAATATANATTGTTNTAT ANTTANATTGAANANGNTANNAN

  2. Budding yeast cDNA sequencing project: S03036-21_O21 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available NANAAGAGNATATGATATANNNNCATANATAN AGATAAATANANNAACAANCACNCACATANATNTAGACAANNANGANGNTNACTATANAN TTTATTCTATTAAA...CTTTTNNNNAAGAATANA AAAAANAAAAACCACCCCCCNTCCCCCTATGAGAGAGGAGGAGGAGANNNNNACNNTNTT TTTATTTANTANATANGNAAANGANAGC

  3. Budding yeast cDNA sequencing project: S03052-01_K20 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available GTCTTTGCTTCTAAA GCTTAACCATANAGTCACGGACTTAAGACTGTACGACCTGAAGGGCGCAAAAGGTGTATG CG Quality >S03052-01_K20.phd 4...C ATATACAATGTTGTCANGAGTAGCTAAACGTGCGTTTTCCTCTACANTTGCCAACCCTTA TAAAGTGACTGTCTTGGGTGCAGGCGGTGGTATTGGACAACCATT

  4. Influence of the bud neck on nuclear envelope fission in Saccharomyces cerevisiae.

    Science.gov (United States)

    Melloy, Patricia G; Rose, Mark D

    2017-09-15

    Studies have shown that nuclear envelope fission (karyokinesis) in budding yeast depends on cytokinesis, but not distinguished whether this was a direct requirement, indirect, because of cell cycle arrest, or due to bud neck-localized proteins impacting both processes. To determine the requirements for karyokinesis, we examined mutants conditionally defective for bud emergence and/or nuclear migration. The common mutant phenotype was completion of the nuclear division cycle within the mother cell, but karyokinesis did not occur. In the cdc24 swe1 mutant, at the non-permissive temperature, multiple nuclei accumulated within the unbudded cell, with connected nuclear envelopes. Upon return to the permissive temperature, the cdc24 swe1 mutant initiated bud emergence, but only the nucleus spanning the neck underwent fission suggesting that the bud neck region is important for fission initiation. The neck may be critical for either mechanical reasons, as the contractile ring might facilitate fission, or for regulatory reasons, as the site of a protein network regulating nuclear envelope fission, mitotic exit, and cytokinesis. We also found that 77-85% of pairs of septin mutant nuclei completed nuclear envelope fission. In addition, 27% of myo1Δ mutant nuclei completed karyokinesis. These data suggested that fission is not dependent on mechanical contraction at the bud neck, but was instead controlled by regulatory proteins there. Copyright © 2017 Elsevier Inc. All rights reserved.

  5. Increased genome instability is not accompanied by sensitivity to DNA damaging agents in aged yeast cells

    NARCIS (Netherlands)

    Novarina, Daniele; Mavrova, Sara N.; Janssens, Georges E.; Rempel, Irina L.; Veenhoff, Liesbeth M.; Chang, Michael

    The budding yeast Saccharomyces cerevisiae divides asymmetrically, producing a new daughter cell from the original mother cell. While daughter cells are born with a full lifespan, a mother cell ages with each cell division and can only generate on average 25 daughter cells before dying. Aged yeast

  6. Yeast cells contain a heterogeneous population of peroxisomes that segregate asymmetrically during cell division

    NARCIS (Netherlands)

    Kumar, Sanjeev; de Boer, Rinse; van der Klei, Ida J

    2018-01-01

    Here we used fluorescence microscopy and a peroxisome-targeted tandem fluorescent protein timer to determine the relative age of peroxisomes in yeast. Our data indicate that yeast cells contain a heterogeneous population of relatively old and younger peroxisomes. During budding the peroxisome

  7. Mutant allele of rna14 in fission yeast affects pre-mRNA splicing

    Indian Academy of Sciences (India)

    transcript. Rna14 protein in budding yeast has been implicated in cleavage and ... Subsequently, genetic interaction of Rna14 with prp1 and physical .... molecular yeast techniques as described by Moreno et al. ..... To elucidate the role of Rna14 in splicing, RT-PCR analysis ..... design principles of a dynamic RNP machine.

  8. Checkpoint independence of most DNA replication origins in fission yeast

    OpenAIRE

    Mickle, Katie L; Ramanathan, Sunita; Rosebrock, Adam; Oliva, Anna; Chaudari, Amna; Yompakdee, Chulee; Scott, Donna; Leatherwood, Janet; Huberman, Joel A

    2007-01-01

    Abstract Background In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU), which limits the pool of deoxyribonucleo...

  9. Quantitative analysis of taste bud cell numbers in fungiform and soft palate taste buds of mice.

    Science.gov (United States)

    Ohtubo, Yoshitaka; Yoshii, Kiyonori

    2011-01-07

    Mammalian taste bud cells (TBCs) consist of several cell types equipped with different taste receptor molecules, and hence the ratio of cell types in a taste bud constitutes the taste responses of the taste bud. Here we show that the population of immunohistochemically identified cell types per taste bud is proportional to the number of total TBCs in the taste bud or the area of the taste bud in fungiform papillae, and that the proportions differ among cell types. This result is applicable to soft palate taste buds. However, the density of almost all cell types, the population of cell types divided by the area of the respective taste buds, is significantly higher in soft palates. These results suggest that the turnover of TBCs is regulated to keep the ratio of each cell type constant, and that taste responsiveness is different between fungiform and soft palate taste buds. Copyright © 2010 Elsevier B.V. All rights reserved.

  10. Coevolutionary patterning of teeth and taste buds

    Science.gov (United States)

    Bloomquist, Ryan F.; Parnell, Nicholas F.; Phillips, Kristine A.; Fowler, Teresa E.; Yu, Tian Y.; Sharpe, Paul T.; Streelman, J. Todd

    2015-01-01

    Teeth and taste buds are iteratively patterned structures that line the oro-pharynx of vertebrates. Biologists do not fully understand how teeth and taste buds develop from undifferentiated epithelium or how variation in organ density is regulated. These organs are typically studied independently because of their separate anatomical location in mammals: teeth on the jaw margin and taste buds on the tongue. However, in many aquatic animals like bony fishes, teeth and taste buds are colocalized one next to the other. Using genetic mapping in cichlid fishes, we identified shared loci controlling a positive correlation between tooth and taste bud densities. Genome intervals contained candidate genes expressed in tooth and taste bud fields. sfrp5 and bmper, notable for roles in Wingless (Wnt) and bone morphogenetic protein (BMP) signaling, were differentially expressed across cichlid species with divergent tooth and taste bud density, and were expressed in the development of both organs in mice. Synexpression analysis and chemical manipulation of Wnt, BMP, and Hedgehog (Hh) pathways suggest that a common cichlid oral lamina is competent to form teeth or taste buds. Wnt signaling couples tooth and taste bud density and BMP and Hh mediate distinct organ identity. Synthesizing data from fish and mouse, we suggest that the Wnt-BMP-Hh regulatory hierarchy that configures teeth and taste buds on mammalian jaws and tongues may be an evolutionary remnant inherited from ancestors wherein these organs were copatterned from common epithelium. PMID:26483492

  11. Coevolutionary patterning of teeth and taste buds.

    Science.gov (United States)

    Bloomquist, Ryan F; Parnell, Nicholas F; Phillips, Kristine A; Fowler, Teresa E; Yu, Tian Y; Sharpe, Paul T; Streelman, J Todd

    2015-11-03

    Teeth and taste buds are iteratively patterned structures that line the oro-pharynx of vertebrates. Biologists do not fully understand how teeth and taste buds develop from undifferentiated epithelium or how variation in organ density is regulated. These organs are typically studied independently because of their separate anatomical location in mammals: teeth on the jaw margin and taste buds on the tongue. However, in many aquatic animals like bony fishes, teeth and taste buds are colocalized one next to the other. Using genetic mapping in cichlid fishes, we identified shared loci controlling a positive correlation between tooth and taste bud densities. Genome intervals contained candidate genes expressed in tooth and taste bud fields. sfrp5 and bmper, notable for roles in Wingless (Wnt) and bone morphogenetic protein (BMP) signaling, were differentially expressed across cichlid species with divergent tooth and taste bud density, and were expressed in the development of both organs in mice. Synexpression analysis and chemical manipulation of Wnt, BMP, and Hedgehog (Hh) pathways suggest that a common cichlid oral lamina is competent to form teeth or taste buds. Wnt signaling couples tooth and taste bud density and BMP and Hh mediate distinct organ identity. Synthesizing data from fish and mouse, we suggest that the Wnt-BMP-Hh regulatory hierarchy that configures teeth and taste buds on mammalian jaws and tongues may be an evolutionary remnant inherited from ancestors wherein these organs were copatterned from common epithelium.

  12. GC-rich DNA elements enable replication origin activity in the methylotrophic yeast Pichia pastoris.

    Science.gov (United States)

    Liachko, Ivan; Youngblood, Rachel A; Tsui, Kyle; Bubb, Kerry L; Queitsch, Christine; Raghuraman, M K; Nislow, Corey; Brewer, Bonita J; Dunham, Maitreya J

    2014-03-01

    The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins--a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation.

  13. GC-rich DNA elements enable replication origin activity in the methylotrophic yeast Pichia pastoris.

    Directory of Open Access Journals (Sweden)

    Ivan Liachko

    2014-03-01

    Full Text Available The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins--a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation.

  14. [Impact of TDZ and NAA on adventitious bud induction and cluster bud multiplication in Tulipa edulis].

    Science.gov (United States)

    Zhu, Li-Fang; Xu, Chao; Zhu, Zai-Biao; Yang, He-Tong; Guo, Qiao-Sheng; Xu, Hong-jian; Ma, Hong-Jian; Zhao, Gui-Hua

    2014-08-01

    To explore the method of explants directly induced bud and establish the tissue culture system of mutiple shoot by means of direct organogenesis, core bud and daughter bulbs (the top of bud stem expanded to form daughter bulb) of T. edulis were used as explants and treated with thidiazuron (TDZ) and 1-naphthlcetic acid (NAA). The results showed that the optimal medium for bud inducted form core bud and daughter bulb were MS + TDZ 2.0 mg x L(-1) + NAA 4.0 mg x L(-1) and MS +TDZ 2.0 mg x L(-1) + NAA 2.0 mg x L(-1) respectively, both of them had a bud induction rate of 72.92%, 79.22%. The optimal medium for cluster buds multiplication was MS + TDZ 0.2 mg x L(-1) + NAA 0.2 mg x L(-1), and proliferation coefficient was 2.23. After proliferation, cluster buds rooting occurred on MS medium with IBA 1.0 mg x L(-1) and the rooting rate was 52.6%, three to five seedlings in each plant. Using core bud and daughter bulb of T. edulis, the optimum medium for adventitious bud directly inducted from daughter bulb, core bud and cluster bud multiplication were screened out and the tissue culture system of multiple shoot by means of direct organogenesis was established.

  15. Repellence of the red bud borer (Resseliella oculiperda) to grafted apple trees by impregnation of budding tape with essential oils

    NARCIS (Netherlands)

    Tol, van R.W.H.M.; Linden, van der A.; Swarts, H.J.; Visser, J.H.

    2007-01-01

    The red bud borer Resseliella oculiperda (Rübs.) is a pest insect of apple trees when rootstocks are grafted with scion buds by shield budding. The female midges are attracted to the wounds of the grafted buds where they lay their eggs. The larvae feed on the cambium and destroy the buds completely

  16. Apoptosis-like yeast cell death in response to DNA damage and replication defects

    Energy Technology Data Exchange (ETDEWEB)

    Burhans, William C.; Weinberger, Martin; Marchetti, Maria A.; Ramachandran, Lakshmi; D' Urso, Gennaro; Huberman, Joel A

    2003-11-27

    In budding (Saccharomyces cerevisiae) and fission (Schizosaccharomyces pombe) yeast and other unicellular organisms, DNA damage and other stimuli can induce cell death resembling apoptosis in metazoans, including the activation of a recently discovered caspase-like molecule in budding yeast. Induction of apoptotic-like cell death in yeasts requires homologues of cell cycle checkpoint proteins that are often required for apoptosis in metazoan cells. Here, we summarize these findings and our unpublished results which show that an important component of metazoan apoptosis recently detected in budding yeast - reactive oxygen species (ROS) - can also be detected in fission yeast undergoing an apoptotic-like cell death. ROS were detected in fission and budding yeast cells bearing conditional mutations in genes encoding DNA replication initiation proteins and in fission yeast cells with mutations that deregulate cyclin-dependent kinases (CDKs). These mutations may cause DNA damage by permitting entry of cells into S phase with a reduced number of replication forks and/or passage through mitosis with incompletely replicated chromosomes. This may be relevant to the frequent requirement for elevated CDK activity in mammalian apoptosis, and to the recent discovery that the initiation protein Cdc6 is destroyed during apoptosis in mammals and in budding yeast cells exposed to lethal levels of DNA damage. Our data indicate that connections between apoptosis-like cell death and DNA replication or CDK activity are complex. Some apoptosis-like pathways require checkpoint proteins, others are inhibited by them, and others are independent of them. This complexity resembles that of apoptotic pathways in mammalian cells, which are frequently deregulated in cancer. The greater genetic tractability of yeasts should help to delineate these complex pathways and their relationships to cancer and to the effects of apoptosis-inducing drugs that inhibit DNA replication.

  17. Apoptosis-like yeast cell death in response to DNA damage and replication defects

    International Nuclear Information System (INIS)

    Burhans, William C.; Weinberger, Martin; Marchetti, Maria A.; Ramachandran, Lakshmi; D'Urso, Gennaro; Huberman, Joel A.

    2003-01-01

    In budding (Saccharomyces cerevisiae) and fission (Schizosaccharomyces pombe) yeast and other unicellular organisms, DNA damage and other stimuli can induce cell death resembling apoptosis in metazoans, including the activation of a recently discovered caspase-like molecule in budding yeast. Induction of apoptotic-like cell death in yeasts requires homologues of cell cycle checkpoint proteins that are often required for apoptosis in metazoan cells. Here, we summarize these findings and our unpublished results which show that an important component of metazoan apoptosis recently detected in budding yeast - reactive oxygen species (ROS) - can also be detected in fission yeast undergoing an apoptotic-like cell death. ROS were detected in fission and budding yeast cells bearing conditional mutations in genes encoding DNA replication initiation proteins and in fission yeast cells with mutations that deregulate cyclin-dependent kinases (CDKs). These mutations may cause DNA damage by permitting entry of cells into S phase with a reduced number of replication forks and/or passage through mitosis with incompletely replicated chromosomes. This may be relevant to the frequent requirement for elevated CDK activity in mammalian apoptosis, and to the recent discovery that the initiation protein Cdc6 is destroyed during apoptosis in mammals and in budding yeast cells exposed to lethal levels of DNA damage. Our data indicate that connections between apoptosis-like cell death and DNA replication or CDK activity are complex. Some apoptosis-like pathways require checkpoint proteins, others are inhibited by them, and others are independent of them. This complexity resembles that of apoptotic pathways in mammalian cells, which are frequently deregulated in cancer. The greater genetic tractability of yeasts should help to delineate these complex pathways and their relationships to cancer and to the effects of apoptosis-inducing drugs that inhibit DNA replication

  18. In vitro PROLIFERATION ABILITY OF AXILLARY BUDS IN Musa spp

    African Journals Online (AJOL)

    AISA

    The proliferation rate of Axillary and apical buds and other growth parameters ... types of buds after four to five sub cultures in all the varieties except for CRBP 39 where the axillary bud exhibits ..... propagation, conservation and exchange.

  19. Identification of differentially expressed sequences in bud ...

    African Journals Online (AJOL)

    The developmental process of lily flower bud differentiation has been studied in morphology thoroughly, but the mechanism in molecular biology is still ambiguous and few studies on genetic expression have been carried out. Little is known about the physiological responses of flower bud differentiation in Oriental hybrid lily ...

  20. Fingerprinting taste buds: intermediate filaments and their implication for taste bud formation.

    OpenAIRE

    Witt, M; Reutter, K; Ganchrow, D; Ganchrow, J R

    2000-01-01

    Intermediate filaments in taste organs of terrestrial (human and chick) as well as aquatic (Xenopus laevis) species were detected using immunohistochemistry and electron microscopy. During development, the potential importance of the interface between the taste bud primordium and non-gustatory adjacent tissues is evidenced by the distinct immunoreactivity of a subpopulation of taste bud cells for cytokeratins and vimentin. In human foetuses, the selective molecular marker for taste bud primor...

  1. Shrinkage of ipsilateral taste buds and hyperplasia of contralateral taste buds following chorda tympani nerve transection

    OpenAIRE

    Li, Yi-ke; Yang, Juan-mei; Huang, Yi-bo; Ren, Dong-dong; Chi, Fang-lu

    2015-01-01

    The morphological changes that occur in the taste buds after denervation are not well understood in rats, especially in the contralateral tongue epithelium. In this study, we investigated the time course of morphological changes in the taste buds following unilateral nerve transection. The role of the trigeminal component of the lingual nerve in maintaining the structural integrity of the taste buds was also examined. Twenty-four Sprague-Dawley rats were randomly divided into three groups: co...

  2. Un-“ESCRT”-ed Budding

    Directory of Open Access Journals (Sweden)

    Mark Yondola

    2011-01-01

    Full Text Available In their recent publication, Rossman et al. [1] describe how the inherent budding capability of its M2 protein allows influenza A virus to bypass recruitment of the cellular ESCRT machinery enlisted by several other enveloped RNA and DNA viruses, including HIV, Ebola, rabies, herpes simplex type 1 and hepatitis B. Studies from the same laboratory [2] and other laboratories [3–6] indicate that budding of plasmid-derived virus-like particles can be mediated by the influenza virus hemagglutinin and neuraminidase proteins in the absence of M2. These events are also independent of canonical ESCRT components [2,7]. Understanding how intrinsic properties of these influenza virus proteins permit ESCRT-independent budding expands our understanding of the budding process itself.

  3. Taste buds: cells, signals and synapses.

    Science.gov (United States)

    Roper, Stephen D; Chaudhari, Nirupa

    2017-08-01

    The past decade has witnessed a consolidation and refinement of the extraordinary progress made in taste research. This Review describes recent advances in our understanding of taste receptors, taste buds, and the connections between taste buds and sensory afferent fibres. The article discusses new findings regarding the cellular mechanisms for detecting tastes, new data on the transmitters involved in taste processing and new studies that address longstanding arguments about taste coding.

  4. Single-particle tracking of quantum dot-conjugated prion proteins inside yeast cells

    Energy Technology Data Exchange (ETDEWEB)

    Tsuji, Toshikazu; Kawai-Noma, Shigeko [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan); Pack, Chan-Gi [Cellular Informatics Laboratory, RIKEN Advanced Science Institute, Wako-shi, Saitama 351-0198 (Japan); Terajima, Hideki [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan); Yajima, Junichiro; Nishizaka, Takayuki [Department of Physics, Gakushuin University, 1-5-1 Mejiro, Toshima-ku, Tokyo 171-8588 (Japan); Kinjo, Masataka [Laboratory of Molecular Cell Dynamics, Graduate School of Life Sciences, Hokkaido University, Sapporo 001-0021 (Japan); Taguchi, Hideki, E-mail: taguchi@bio.titech.ac.jp [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan)

    2011-02-25

    Research highlights: {yields} We develop a method to track a quantum dot-conjugated protein in yeast cells. {yields} We incorporate the conjugated quantum dot proteins into yeast spheroplasts. {yields} We track the motions by conventional or 3D tracking microscopy. -- Abstract: Yeast is a model eukaryote with a variety of biological resources. Here we developed a method to track a quantum dot (QD)-conjugated protein in the budding yeast Saccharomyces cerevisiae. We chemically conjugated QDs with the yeast prion Sup35, incorporated them into yeast spheroplasts, and tracked the motions by conventional two-dimensional or three-dimensional tracking microscopy. The method paves the way toward the individual tracking of proteins of interest inside living yeast cells.

  5. Single-particle tracking of quantum dot-conjugated prion proteins inside yeast cells

    International Nuclear Information System (INIS)

    Tsuji, Toshikazu; Kawai-Noma, Shigeko; Pack, Chan-Gi; Terajima, Hideki; Yajima, Junichiro; Nishizaka, Takayuki; Kinjo, Masataka; Taguchi, Hideki

    2011-01-01

    Research highlights: → We develop a method to track a quantum dot-conjugated protein in yeast cells. → We incorporate the conjugated quantum dot proteins into yeast spheroplasts. → We track the motions by conventional or 3D tracking microscopy. -- Abstract: Yeast is a model eukaryote with a variety of biological resources. Here we developed a method to track a quantum dot (QD)-conjugated protein in the budding yeast Saccharomyces cerevisiae. We chemically conjugated QDs with the yeast prion Sup35, incorporated them into yeast spheroplasts, and tracked the motions by conventional two-dimensional or three-dimensional tracking microscopy. The method paves the way toward the individual tracking of proteins of interest inside living yeast cells.

  6. Comparative live-cell imaging analyses of SPA-2, BUD-6 and BNI-1 in Neurospora crassa reveal novel features of the filamentous fungal polarisome.

    Directory of Open Access Journals (Sweden)

    Alexander Lichius

    Full Text Available A key multiprotein complex involved in regulating the actin cytoskeleton and secretory machinery required for polarized growth in fungi, is the polarisome. Recognized core constituents in budding yeast are the proteins Spa2, Pea2, Aip3/Bud6, and the key effector Bni1. Multicellular fungi display a more complex polarized morphogenesis than yeasts, suggesting that the filamentous fungal polarisome might fulfill additional functions. In this study, we compared the subcellular organization and dynamics of the putative polarisome components BUD-6 and BNI-1 with those of the bona fide polarisome marker SPA-2 at various developmental stages of Neurospora crassa. All three proteins exhibited a yeast-like polarisome configuration during polarized germ tube growth, cell fusion, septal pore plugging and tip repolarization. However, the localization patterns of all three proteins showed spatiotemporally distinct characteristics during the establishment of new polar axes, septum formation and cytokinesis, and maintained hyphal tip growth. Most notably, in vegetative hyphal tips BUD-6 accumulated as a subapical cloud excluded from the Spitzenkörper (Spk, whereas BNI-1 and SPA-2 partially colocalized with the Spk and the tip apex. Novel roles during septal plugging and cytokinesis, connected to the reinitiation of tip growth upon physical injury and conidial maturation, were identified for BUD-6 and BNI-1, respectively. Phenotypic analyses of gene deletion mutants revealed additional functions for BUD-6 and BNI-1 in cell fusion regulation, and the maintenance of Spk integrity. Considered together, our findings reveal novel polarisome-independent functions of BUD-6 and BNI-1 in Neurospora, but also suggest that all three proteins cooperate at plugged septal pores, and their complex arrangement within the apical dome of mature hypha might represent a novel aspect of filamentous fungal polarisome architecture.

  7. Checkpoint independence of most DNA replication origins in fission yeast.

    Science.gov (United States)

    Mickle, Katie L; Ramanathan, Sunita; Rosebrock, Adam; Oliva, Anna; Chaudari, Amna; Yompakdee, Chulee; Scott, Donna; Leatherwood, Janet; Huberman, Joel A

    2007-12-19

    In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU), which limits the pool of deoxyribonucleoside triphosphates (dNTPs) and activates the replication checkpoint. The checkpoint-mutant cells carried deletions either of rad3 (which encodes the fission yeast homologue of ATR) or cds1 (which encodes the fission yeast homologue of Chk2). Our microarray results proved to be largely consistent with those independently obtained and recently published by three other laboratories. However, we were able to reconcile differences between the previous studies regarding the extent to which fission yeast replication origins are affected by the replication checkpoint. We found (consistent with the three previous studies after appropriate interpretation) that, in surprising contrast to budding yeast, most fission yeast origins, including both early- and late-firing origins, are not significantly affected by checkpoint mutations during replication in the presence of HU. A few origins (approximately 3%) behaved like those in budding yeast: they replicated earlier in the checkpoint mutants than in wild type. These were located primarily in the heterochromatic subtelomeric regions of chromosomes 1 and 2. Indeed, the subtelomeric regions defined by the strongest checkpoint restraint correspond precisely to previously mapped subtelomeric heterochromatin. This observation implies that subtelomeric heterochromatin in fission yeast differs from heterochromatin at centromeres, in the mating type region, and in ribosomal DNA, since these regions replicated at least as efficiently in wild-type cells as in checkpoint

  8. Checkpoint independence of most DNA replication origins in fission yeast

    Science.gov (United States)

    Mickle, Katie L; Ramanathan, Sunita; Rosebrock, Adam; Oliva, Anna; Chaudari, Amna; Yompakdee, Chulee; Scott, Donna; Leatherwood, Janet; Huberman, Joel A

    2007-01-01

    Background In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU), which limits the pool of deoxyribonucleoside triphosphates (dNTPs) and activates the replication checkpoint. The checkpoint-mutant cells carried deletions either of rad3 (which encodes the fission yeast homologue of ATR) or cds1 (which encodes the fission yeast homologue of Chk2). Results Our microarray results proved to be largely consistent with those independently obtained and recently published by three other laboratories. However, we were able to reconcile differences between the previous studies regarding the extent to which fission yeast replication origins are affected by the replication checkpoint. We found (consistent with the three previous studies after appropriate interpretation) that, in surprising contrast to budding yeast, most fission yeast origins, including both early- and late-firing origins, are not significantly affected by checkpoint mutations during replication in the presence of HU. A few origins (~3%) behaved like those in budding yeast: they replicated earlier in the checkpoint mutants than in wild type. These were located primarily in the heterochromatic subtelomeric regions of chromosomes 1 and 2. Indeed, the subtelomeric regions defined by the strongest checkpoint restraint correspond precisely to previously mapped subtelomeric heterochromatin. This observation implies that subtelomeric heterochromatin in fission yeast differs from heterochromatin at centromeres, in the mating type region, and in ribosomal DNA, since these regions replicated at least as efficiently in wild-type cells as in

  9. Checkpoint independence of most DNA replication origins in fission yeast

    Directory of Open Access Journals (Sweden)

    Scott Donna

    2007-12-01

    Full Text Available Abstract Background In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU, which limits the pool of deoxyribonucleoside triphosphates (dNTPs and activates the replication checkpoint. The checkpoint-mutant cells carried deletions either of rad3 (which encodes the fission yeast homologue of ATR or cds1 (which encodes the fission yeast homologue of Chk2. Results Our microarray results proved to be largely consistent with those independently obtained and recently published by three other laboratories. However, we were able to reconcile differences between the previous studies regarding the extent to which fission yeast replication origins are affected by the replication checkpoint. We found (consistent with the three previous studies after appropriate interpretation that, in surprising contrast to budding yeast, most fission yeast origins, including both early- and late-firing origins, are not significantly affected by checkpoint mutations during replication in the presence of HU. A few origins (~3% behaved like those in budding yeast: they replicated earlier in the checkpoint mutants than in wild type. These were located primarily in the heterochromatic subtelomeric regions of chromosomes 1 and 2. Indeed, the subtelomeric regions defined by the strongest checkpoint restraint correspond precisely to previously mapped subtelomeric heterochromatin. This observation implies that subtelomeric heterochromatin in fission yeast differs from heterochromatin at centromeres, in the mating type region, and in ribosomal DNA, since these regions replicated at least as efficiently in wild

  10. Replication dynamics of the yeast genome.

    Science.gov (United States)

    Raghuraman, M K; Winzeler, E A; Collingwood, D; Hunt, S; Wodicka, L; Conway, A; Lockhart, D J; Davis, R W; Brewer, B J; Fangman, W L

    2001-10-05

    Oligonucleotide microarrays were used to map the detailed topography of chromosome replication in the budding yeast Saccharomyces cerevisiae. The times of replication of thousands of sites across the genome were determined by hybridizing replicated and unreplicated DNAs, isolated at different times in S phase, to the microarrays. Origin activations take place continuously throughout S phase but with most firings near mid-S phase. Rates of replication fork movement vary greatly from region to region in the genome. The two ends of each of the 16 chromosomes are highly correlated in their times of replication. This microarray approach is readily applicable to other organisms, including humans.

  11. Complex bud architecture and cell-specific chemical patterns enable supercooling of Picea abies bud primordial

    Science.gov (United States)

    Bud primordia of Picea abies, despite a frozen shoot, stay ice free down to -50 °C by a mechanism termed supercooling whose biophysical and biochemical requirements are poorly understood. Bud architecture was assessed by 3D-reconstruction, supercooling and freezing patterns by infrared video thermog...

  12. Shrinkage of ipsilateral taste buds and hyperplasia of contralateral taste buds following chorda tympani nerve transection.

    Science.gov (United States)

    Li, Yi-Ke; Yang, Juan-Mei; Huang, Yi-Bo; Ren, Dong-Dong; Chi, Fang-Lu

    2015-06-01

    The morphological changes that occur in the taste buds after denervation are not well understood in rats, especially in the contralateral tongue epithelium. In this study, we investigated the time course of morphological changes in the taste buds following unilateral nerve transection. The role of the trigeminal component of the lingual nerve in maintaining the structural integrity of the taste buds was also examined. Twenty-four Sprague-Dawley rats were randomly divided into three groups: control, unilateral chorda tympani nerve transection and unilateral chorda tympani nerve transection + lingual nerve transection. Rats were allowed up to 42 days of recovery before being euthanized. The taste buds were visualized using a cytokeratin 8 antibody. Taste bud counts, volumes and taste receptor cell numbers were quantified and compared among groups. No significant difference was detected between the chorda tympani nerve transection and chorda tympani nerve transection + lingual nerve transection groups. Taste bud counts, volumes and taste receptor cell numbers on the ipsilateral side all decreased significantly compared with control. On the contralateral side, the number of taste buds remained unchanged over time, but they were larger, and taste receptor cells were more numerous postoperatively. There was no evidence for a role of the trigeminal branch of the lingual nerve in maintaining the structural integrity of the anterior taste buds.

  13. Shrinkage of ipsilateral taste buds and hyperplasia of contralateral taste buds following chorda tympani nerve transection

    Directory of Open Access Journals (Sweden)

    Yi-ke Li

    2015-01-01

    Full Text Available The morphological changes that occur in the taste buds after denervation are not well understood in rats, especially in the contralateral tongue epithelium. In this study, we investigated the time course of morphological changes in the taste buds following unilateral nerve transection. The role of the trigeminal component of the lingual nerve in maintaining the structural integrity of the taste buds was also examined. Twenty-four Sprague-Dawley rats were randomly divided into three groups: control, unilateral chorda tympani nerve transection and unilateral chorda tympani nerve transection + lingual nerve transection. Rats were allowed up to 42 days of recovery before being euthanized. The taste buds were visualized using a cytokeratin 8 antibody. Taste bud counts, volumes and taste receptor cell numbers were quantified and compared among groups. No significant difference was detected between the chorda tympani nerve transection and chorda tympani nerve transection + lingual nerve transection groups. Taste bud counts, volumes and taste receptor cell numbers on the ipsilateral side all decreased significantly compared with control. On the contralateral side, the number of taste buds remained unchanged over time, but they were larger, and taste receptor cells were more numerous postoperatively. There was no evidence for a role of the trigeminal branch of the lingual nerve in maintaining the structural integrity of the anterior taste buds.

  14. A Review of Fluorescent Proteins for Use in Yeast.

    Science.gov (United States)

    Bialecka-Fornal, Maja; Makushok, Tatyana; Rafelski, Susanne M

    2016-01-01

    The field of fluorescent proteins (FPs) is constantly developing. The use of FPs changed the field of life sciences completely, starting a new era of direct observation and quantification of cellular processes. The broad spectrum of FPs (see Fig. 1) with a wide range of characteristics allows their use in many different experiments. This review discusses the use of FPs for imaging in budding yeast (Saccharomyces cerevisiae) and fission yeast Schizosaccharomyces pombe). The information included in this review is relevant for both species unless stated otherwise.

  15. Oxytocin signaling in mouse taste buds.

    Directory of Open Access Journals (Sweden)

    Michael S Sinclair

    2010-08-01

    Full Text Available The neuropeptide, oxytocin (OXT, acts on brain circuits to inhibit food intake. Mutant mice lacking OXT (OXT knockout overconsume salty and sweet (i.e. sucrose, saccharin solutions. We asked if OXT might also act on taste buds via its receptor, OXTR.Using RT-PCR, we detected the expression of OXTR in taste buds throughout the oral cavity, but not in adjacent non-taste lingual epithelium. By immunostaining tissues from OXTR-YFP knock-in mice, we found that OXTR is expressed in a subset of Glial-like (Type I taste cells, and also in cells on the periphery of taste buds. Single-cell RT-PCR confirmed this cell-type assignment. Using Ca2+ imaging, we observed that physiologically appropriate concentrations of OXT evoked [Ca2+]i mobilization in a subset of taste cells (EC50 approximately 33 nM. OXT-evoked responses were significantly inhibited by the OXTR antagonist, L-371,257. Isolated OXT-responsive taste cells were neither Receptor (Type II nor Presynaptic (Type III cells, consistent with our immunofluorescence observations. We also investigated the source of OXT peptide that may act on taste cells. Both RT-PCR and immunostaining suggest that the OXT peptide is not produced in taste buds or in their associated nerves. Finally, we also examined the morphology of taste buds from mice that lack OXTR. Taste buds and their constituent cell types appeared very similar in mice with two, one or no copies of the OXTR gene.We conclude that OXT elicits Ca2+ signals via OXTR in murine taste buds. OXT-responsive cells are most likely a subset of Glial-like (Type I taste cells. OXT itself is not produced locally in taste tissue and is likely delivered through the circulation. Loss of OXTR does not grossly alter the morphology of any of the cell types contained in taste buds. Instead, we speculate that OXT-responsive Glial-like (Type I taste bud cells modulate taste signaling and afferent sensory output. Such modulation would complement central pathways of

  16. Oxytocin signaling in mouse taste buds.

    Science.gov (United States)

    Sinclair, Michael S; Perea-Martinez, Isabel; Dvoryanchikov, Gennady; Yoshida, Masahide; Nishimori, Katsuhiko; Roper, Stephen D; Chaudhari, Nirupa

    2010-08-05

    The neuropeptide, oxytocin (OXT), acts on brain circuits to inhibit food intake. Mutant mice lacking OXT (OXT knockout) overconsume salty and sweet (i.e. sucrose, saccharin) solutions. We asked if OXT might also act on taste buds via its receptor, OXTR. Using RT-PCR, we detected the expression of OXTR in taste buds throughout the oral cavity, but not in adjacent non-taste lingual epithelium. By immunostaining tissues from OXTR-YFP knock-in mice, we found that OXTR is expressed in a subset of Glial-like (Type I) taste cells, and also in cells on the periphery of taste buds. Single-cell RT-PCR confirmed this cell-type assignment. Using Ca2+ imaging, we observed that physiologically appropriate concentrations of OXT evoked [Ca2+]i mobilization in a subset of taste cells (EC50 approximately 33 nM). OXT-evoked responses were significantly inhibited by the OXTR antagonist, L-371,257. Isolated OXT-responsive taste cells were neither Receptor (Type II) nor Presynaptic (Type III) cells, consistent with our immunofluorescence observations. We also investigated the source of OXT peptide that may act on taste cells. Both RT-PCR and immunostaining suggest that the OXT peptide is not produced in taste buds or in their associated nerves. Finally, we also examined the morphology of taste buds from mice that lack OXTR. Taste buds and their constituent cell types appeared very similar in mice with two, one or no copies of the OXTR gene. We conclude that OXT elicits Ca2+ signals via OXTR in murine taste buds. OXT-responsive cells are most likely a subset of Glial-like (Type I) taste cells. OXT itself is not produced locally in taste tissue and is likely delivered through the circulation. Loss of OXTR does not grossly alter the morphology of any of the cell types contained in taste buds. Instead, we speculate that OXT-responsive Glial-like (Type I) taste bud cells modulate taste signaling and afferent sensory output. Such modulation would complement central pathways of appetite

  17. Taste buds as peripheral chemosensory processors.

    Science.gov (United States)

    Roper, Stephen D

    2013-01-01

    Taste buds are peripheral chemosensory organs situated in the oral cavity. Each taste bud consists of a community of 50-100 cells that interact synaptically during gustatory stimulation. At least three distinct cell types are found in mammalian taste buds - Type I cells, Receptor (Type II) cells, and Presynaptic (Type III) cells. Type I cells appear to be glial-like cells. Receptor cells express G protein-coupled taste receptors for sweet, bitter, or umami compounds. Presynaptic cells transduce acid stimuli (sour taste). Cells that sense salt (NaCl) taste have not yet been confidently identified in terms of these cell types. During gustatory stimulation, taste bud cells secrete synaptic, autocrine, and paracrine transmitters. These transmitters include ATP, acetylcholine (ACh), serotonin (5-HT), norepinephrine (NE), and GABA. Glutamate is an efferent transmitter that stimulates Presynaptic cells to release 5-HT. This chapter discusses these transmitters, which cells release them, the postsynaptic targets for the transmitters, and how cell-cell communication shapes taste bud signaling via these transmitters. Copyright © 2012 Elsevier Ltd. All rights reserved.

  18. Engineering prokaryotic transcriptional activators as metabolite biosensors in yeast

    DEFF Research Database (Denmark)

    Skjødt, Mette Louise; Snoek, Tim; Kildegaard, Kanchana Rueksomtawin

    2016-01-01

    ,cis-muconic acid at different levels, and found that reporter gene output correlated with production. The transplantation of prokaryotic transcriptional activators into the eukaryotic chassis illustrates the potential of a hitherto untapped biosensor resource useful for biotechnological applications....... real-time monitoring of production has attracted attention. Here we applied systematic engineering of multiple parameters to search for a general biosensor design in the budding yeast Saccharomyces cerevisiae based on small-molecule binding transcriptional activators from the prokaryote superfamily...

  19. Evolution of cyclin-dependent kinases (CDKs) and CDK-activating kinases (CAKs): differential conservation of CAKs in yeast and metazoa.

    Science.gov (United States)

    Liu, J; Kipreos, E T

    2000-07-01

    Cyclin-dependent kinases (CDKs) function as central regulators of both the cell cycle and transcription. CDK activation depends on phosphorylation by a CDK-activating kinase (CAK). Different CAKs have been identified in budding yeast, fission yeast, and metazoans. All known CAKs belong to the extended CDK family. The sole budding yeast CAK, CAK1, and one of the two CAKs in fission yeast, csk1, have diverged considerably from other CDKs. Cell cycle regulatory components have been largely conserved in eukaryotes; however, orthologs of neither CAK1 nor csk1 have been identified in other species to date. To determine the evolutionary relationships of yeast and metazoan CAKs, we performed a phylogenetic analysis of the extended CDK family in budding yeast, fission yeast, humans, the fruit fly Drosophila melanogaster, and the nematode Caenorhabditis elegans. We observed that there were 10 clades for CDK-related genes, of which seven appeared ancestral, containing both yeast and metazoan genes. The four clades that contain CDKs that regulate transcription by phosphorylating the carboxyl-terminal domain (CTD) of RNA Polymerase II generally have only a single orthologous gene in each species of yeast and metazoans. In contrast, the ancestral cell cycle CDK (analogous to budding yeast CDC28) gave rise to a number of genes in metazoans, as did the ancestor of budding yeast PHO85. One ancestral clade is unique in that there are fission yeast and metazoan members, but there is no budding yeast ortholog, suggesting that it was lost subsequent to evolutionary divergence. Interestingly, CAK1 and csk1 branch together with high bootstrap support values. We used both the relative apparent synapomorphy analysis (RASA) method in combination with the S-F method of sampling reduced character sets and gamma-corrected distance methods to confirm that the CAK1/csk1 association was not an artifact of long-branch attraction. This result suggests that CAK1 and csk1 are orthologs and that a

  20. Identification and Quality Assessment of Chrysanthemum Buds by CE Fingerprinting

    Directory of Open Access Journals (Sweden)

    Xiaoping Xing

    2015-01-01

    Full Text Available A simple and efficient fingerprinting method for chrysanthemum buds was developed with the aim of establishing a quality control protocol based on biochemical makeup. Chrysanthemum bud samples were successively extracted by water and alcohol. The fingerprints of the chrysanthemum buds samples were obtained using capillary electrophoresis and electrochemical detection (CE-ED employing copper and carbon working electrodes to capture all of the chemical information. 10 batches of chrysanthemum buds were collected from different regions and various factories to establish the baseline fingerprint. The experimental data of 10 batches electropherogram buds by CE were analyzed by correlation coefficient and the included angle cosine methods. A standard chrysanthemum bud fingerprint including 24 common peaks was established, 12 from each electrode, which was successfully applied to identify and distinguish between chrysanthemum buds from 2 other chrysanthemum species. These results demonstrate that fingerprint analysis can be used as an important criterion for chrysanthemum buds quality control.

  1. Quantitative analysis of developing epiglottal taste buds in sheep.

    OpenAIRE

    Bradley, R M; Cheal, M L; Kim, Y H

    1980-01-01

    Epiglottal taste buds of the sheep increase in number during development, and continue to increase until the epiglottis has reached its adult size. However, since the increase in taste bud numbers is paralleled by increase in the surface area of the epiglottis, the density of taste buds decreases progressively in the fetus and newborn. After birth the density remains relatively constant. From examination of the morphological stages of epiglottal taste bud development, we conclude that taste b...

  2. Prions in yeast

    OpenAIRE

    Bezdíčka, Martin

    2013-01-01

    The thesis describes yeast prions and their biological effects on yeast in general. It defines the basic characteristics of yeast prions, that distinguish prions from other proteins. The thesis introduces various possibilities of prion formation, and propagation as well as specific types of yeast prions, including various functions of most studied types of prions. The thesis also focuses on chaperones that affect the state of yeast prions in cells. Lastly, the thesis indicates similarities be...

  3. Overhead irrigation increased winter chilling and floral bud ...

    African Journals Online (AJOL)

    Eucalyptus nitens requires a sufficiently cold winter to produce flower buds. In areas in South Africa where E. nitens commercial plantations as well as breeding and production seed orchards are located, winter chilling is often insufficient for floral bud initiation. Hence, under such conditions, E. nitens floral bud and seed ...

  4. Taste buds in the palatal mucosa of snakes | Berkhoudt | African ...

    African Journals Online (AJOL)

    An examination of the oral mucosa of Crotalus and several Scolecophidia revealed the presence of taste buds. The taste buds in these two divergent groups of snakes are similar in appearance, and correspond to previous descriptions of gustatory organs in other reptiles. Few taste buds were present in any specimen, and ...

  5. Sprouting of dormant buds on border trees

    Science.gov (United States)

    G.R., Jr. Trimble; H. Clay Smith; H. Clay Smith

    1970-01-01

    As part of an evaluation of silvicultura1 systems used in managing Appalachian hardwoods, we are studying degrade of border trees surrounding harvest-cut openings made in the patch cutting and group selection systems. One facet of this research dealt with determining what portion of visually evident dormant buds on border tree boles sprouted when the openings were cut...

  6. thidiazuron improves adventitious bud and shoot regeneration

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    Induction of adventitious buds and shoots from intact leaves and stem internode segments of two recalcitrant. Ugandan sweetpotato (Ipomoea batatas L.) cultivars was investigated in vitro on Murashige and Skoog (MS) medium, supplemented with 3 different levels (0.5, 2.0 and 4.0 µM) of Thidiazuron (TDZ). Shoots were.

  7. Immunohistochemical Analysis of Human Vallate Taste Buds.

    Science.gov (United States)

    Tizzano, Marco; Grigereit, Laura; Shultz, Nicole; Clary, Matthew S; Finger, Thomas E

    2015-11-01

    The morphology of the vallate papillae from postmortem human samples was investigated with immunohistochemistry. Microscopically, taste buds were present along the inner wall of the papilla, and in some cases in the outer wall as well. The typical taste cell markers PLCβ2, GNAT3 (gustducin) and the T1R3 receptor stain elongated cells in human taste buds consistent with the Type II cells in rodents. In the human tissue, taste bud cells that stain with Type II cell markers, PLCβ2 and GNAT3, also stain with villin antibody. Two typical immunochemical markers for Type III taste cells in rodents, PGP9.5 and SNAP25, fail to stain any taste bud cells in the human postmortem tissue, although these antibodies do stain numerous nerve fibers throughout the specimen. Car4, another Type III cell marker, reacted with only a few taste cells in our samples. Finally, human vallate papillae have a general network of innervation similar to rodents and antibodies directed against SNAP25, PGP9.5, acetylated tubulin and P2X3 all stain free perigemmal nerve endings as well as intragemmal taste fibers. We conclude that with the exception of certain molecular features of Type III cells, human vallate papillae share the structural, morphological, and molecular features observed in rodents. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Radiation effects on bovine taste bud membranes

    International Nuclear Information System (INIS)

    Shatzman, A.R.; Mossman, K.L.

    1982-01-01

    In order to investigate the mechanisms of radiation-induced taste loss, the effects of radiation on preparations of enriched bovine taste bud membranes were studied. Taste buds containing circumvallate papilae, and surrounding control epithelial tissues devoid of taste buds, were obtained from steers and given radiation doses of 0-7000 cGy (rad). Tissue fractions were isolated into membrane-enriched and heterogeneous components using differential and sucrose gradient centrifugation of tissue homogenates. The yield of membranes, as measured by protein content in the buoyant membrane-enriched fractions, was reduced in quantity with increasing radiation dose. The relation between radiation dose and membrane quantity in membrane-enriched fractions could be fit by a simple exponential model with taste bud-derived membranes twice as radiosensitive as membranes from control epithelial tissue. Binding of sucrose, sodium, and acetate and fluoride stimulation of adenylate cyclase were nearly identical in both irradiated and nonirradiated intact membranes. Radiation had no effect on fractions of heterogeneous components. While it is not clear what changes are occurring in enriched taste cell membranes, damage to membranes may play an important role in the taste loss observed in patients following radiotherapy

  9. Effect of temperature on development and growth potential of axillary buds in roses

    NARCIS (Netherlands)

    Marcelis-van Acker, C.A.M.

    1995-01-01

    The effect of temperature during axillary bud formation on axillary bud development and subsequent shoot growth was investigated. Growth potential of the axillary buds was studied either in situ, by pruning the parent shoot above the bud, or in isolation, by grafting the bud or by culturing the bud

  10. Ontogeny of axillary buds and shoots in roses: Leaf initiation and pith development.

    NARCIS (Netherlands)

    Marcelis-van Acker, C.A.M.

    1994-01-01

    The ontogeny of an axillary bud (in the middle region of a shoot) from initiation up to flowering of the subsequent shoot was studied. The first secondary buds appeared in the axillary bud (primary bud) when the leaf subtending the primary bud unfolded. By that time, the primary bud contained seven

  11. Characterisation of the nascent polypeptide-associated complex in fission yeast

    DEFF Research Database (Denmark)

    Andersen, Katrine M; Semple, Colin A; Hartmann-Petersen, Rasmus

    2007-01-01

    with other cell proteins, but has also been found to associate with DNA junctions, and to be involved in other processes including transcription regulation and mitochondrial protein import.Here, we characterize NAC in fission yeast. We find that NAC is associated with ribosomes, while a significant fraction...... defects in protein degradation. Accordingly, we find that the NAC UBA domain belongs to an ancient and distinct subgroup of the UBA family. In contrast to the situation with budding yeast, fission yeast cells devoid of NAC were not temperature sensitive. However, they displayed resistance to the amino...

  12. Lipid raft involvement in yeast cell growth and death

    Energy Technology Data Exchange (ETDEWEB)

    Mollinedo, Faustino, E-mail: fmollin@usal.es [Instituto de Biología Molecular y Celular del Cáncer, Centro de Investigación del Cáncer, Consejo Superior de Investigaciones Científicas - Universidad de Salamanca, Salamanca (Spain)

    2012-10-10

    The notion that cellular membranes contain distinct microdomains, acting as scaffolds for signal transduction processes, has gained considerable momentum. In particular, a class of such domains that is rich in sphingolipids and cholesterol, termed as lipid rafts, is thought to compartmentalize the plasma membrane, and to have important roles in survival and cell death signaling in mammalian cells. Likewise, yeast lipid rafts are membrane domains enriched in sphingolipids and ergosterol, the yeast counterpart of mammalian cholesterol. Sterol-rich membrane domains have been identified in several fungal species, including the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe as well as the pathogens Candida albicans and Cryptococcus neoformans. Yeast rafts have been mainly involved in membrane trafficking, but increasing evidence implicates rafts in a wide range of additional cellular processes. Yeast lipid rafts house biologically important proteins involved in the proper function of yeast, such as proteins that control Na{sup +}, K{sup +}, and pH homeostasis, which influence many cellular processes, including cell growth and death. Membrane raft constituents affect drug susceptibility, and drugs interacting with sterols alter raft composition and membrane integrity, leading to yeast cell death. Because of the genetic tractability of yeast, analysis of yeast rafts could be an excellent model to approach unanswered questions of mammalian raft biology, and to understand the role of lipid rafts in the regulation of cell death and survival in human cells. A better insight in raft biology might lead to envisage new raft-mediated approaches to the treatment of human diseases where regulation of cell death and survival is critical, such as cancer and neurodegenerative diseases.

  13. Lipid raft involvement in yeast cell growth and death

    International Nuclear Information System (INIS)

    Mollinedo, Faustino

    2012-01-01

    The notion that cellular membranes contain distinct microdomains, acting as scaffolds for signal transduction processes, has gained considerable momentum. In particular, a class of such domains that is rich in sphingolipids and cholesterol, termed as lipid rafts, is thought to compartmentalize the plasma membrane, and to have important roles in survival and cell death signaling in mammalian cells. Likewise, yeast lipid rafts are membrane domains enriched in sphingolipids and ergosterol, the yeast counterpart of mammalian cholesterol. Sterol-rich membrane domains have been identified in several fungal species, including the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe as well as the pathogens Candida albicans and Cryptococcus neoformans. Yeast rafts have been mainly involved in membrane trafficking, but increasing evidence implicates rafts in a wide range of additional cellular processes. Yeast lipid rafts house biologically important proteins involved in the proper function of yeast, such as proteins that control Na + , K + , and pH homeostasis, which influence many cellular processes, including cell growth and death. Membrane raft constituents affect drug susceptibility, and drugs interacting with sterols alter raft composition and membrane integrity, leading to yeast cell death. Because of the genetic tractability of yeast, analysis of yeast rafts could be an excellent model to approach unanswered questions of mammalian raft biology, and to understand the role of lipid rafts in the regulation of cell death and survival in human cells. A better insight in raft biology might lead to envisage new raft-mediated approaches to the treatment of human diseases where regulation of cell death and survival is critical, such as cancer and neurodegenerative diseases.

  14. Taste Bud-Derived BDNF Is Required to Maintain Normal Amounts of Innervation to Adult Taste Buds123

    Science.gov (United States)

    Meng, Lingbin; Ohman-Gault, Lisa; Ma, Liqun

    2015-01-01

    Abstract Gustatory neurons transmit chemical information from taste receptor cells, which reside in taste buds in the oral cavity, to the brain. As adult taste receptor cells are renewed at a constant rate, nerve fibers must reconnect with new taste receptor cells as they arise. Therefore, the maintenance of gustatory innervation to the taste bud is an active process. Understanding how this process is regulated is a fundamental concern of gustatory system biology. We speculated that because brain-derived neurotrophic factor (BDNF) is required for taste bud innervation during development, it might function to maintain innervation during adulthood. If so, taste buds should lose innervation when Bdnf is deleted in adult mice. To test this idea, we first removed Bdnf from all cells in adulthood using transgenic mice with inducible CreERT2 under the control of the Ubiquitin promoter. When Bdnf was removed, approximately one-half of the innervation to taste buds was lost, and taste buds became smaller because of the loss of taste bud cells. Individual taste buds varied in the amount of innervation each lost, and those that lost the most innervation also lost the most taste bud cells. We then tested the idea that that the taste bud was the source of this BDNF by reducing Bdnf levels specifically in the lingual epithelium and taste buds. Taste buds were confirmed as the source of BDNF regulating innervation. We conclude that BDNF expressed in taste receptor cells is required to maintain normal levels of innervation in adulthood. PMID:26730405

  15. Taste Bud-Derived BDNF Is Required to Maintain Normal Amounts of Innervation to Adult Taste Buds.

    Science.gov (United States)

    Meng, Lingbin; Ohman-Gault, Lisa; Ma, Liqun; Krimm, Robin F

    2015-01-01

    Gustatory neurons transmit chemical information from taste receptor cells, which reside in taste buds in the oral cavity, to the brain. As adult taste receptor cells are renewed at a constant rate, nerve fibers must reconnect with new taste receptor cells as they arise. Therefore, the maintenance of gustatory innervation to the taste bud is an active process. Understanding how this process is regulated is a fundamental concern of gustatory system biology. We speculated that because brain-derived neurotrophic factor (BDNF) is required for taste bud innervation during development, it might function to maintain innervation during adulthood. If so, taste buds should lose innervation when Bdnf is deleted in adult mice. To test this idea, we first removed Bdnf from all cells in adulthood using transgenic mice with inducible CreERT2 under the control of the Ubiquitin promoter. When Bdnf was removed, approximately one-half of the innervation to taste buds was lost, and taste buds became smaller because of the loss of taste bud cells. Individual taste buds varied in the amount of innervation each lost, and those that lost the most innervation also lost the most taste bud cells. We then tested the idea that that the taste bud was the source of this BDNF by reducing Bdnf levels specifically in the lingual epithelium and taste buds. Taste buds were confirmed as the source of BDNF regulating innervation. We conclude that BDNF expressed in taste receptor cells is required to maintain normal levels of innervation in adulthood.

  16. Discrete innervation of murine taste buds by peripheral taste neurons.

    Science.gov (United States)

    Zaidi, Faisal N; Whitehead, Mark C

    2006-08-09

    The peripheral taste system likely maintains a specific relationship between ganglion cells that signal a particular taste quality and taste bud cells responsive to that quality. We have explored a measure of the receptoneural relationship in the mouse. By injecting single fungiform taste buds with lipophilic retrograde neuroanatomical markers, the number of labeled geniculate ganglion cells innervating single buds on the tongue were identified. We found that three to five ganglion cells innervate a single bud. Injecting neighboring buds with different color markers showed that the buds are primarily innervated by separate populations of geniculate cells (i.e., multiply labeled ganglion cells are rare). In other words, each taste bud is innervated by a population of neurons that only connects with that bud. Palate bud injections revealed a similar, relatively exclusive receptoneural relationship. Injecting buds in different regions of the tongue did not reveal a topographic representation of buds in the geniculate ganglion, despite a stereotyped patterned arrangement of fungiform buds as rows and columns on the tongue. However, ganglion cells innervating the tongue and palate were differentially concentrated in lateral and rostral regions of the ganglion, respectively. The principal finding that small groups of ganglion cells send sensory fibers that converge selectively on a single bud is a new-found measure of specific matching between the two principal cellular elements of the mouse peripheral taste system. Repetition of the experiments in the hamster showed a more divergent innervation of buds in this species. The results indicate that whatever taste quality is signaled by a murine geniculate ganglion neuron, that signal reflects the activity of cells in a single taste bud.

  17. Processing umami and other tastes in mammalian taste buds.

    Science.gov (United States)

    Roper, Stephen D; Chaudhari, Nirupa

    2009-07-01

    Neuroscientists are now coming to appreciate that a significant degree of information processing occurs in the peripheral sensory organs of taste prior to signals propagating to the brain. Gustatory stimulation causes taste bud cells to secrete neurotransmitters that act on adjacent taste bud cells (paracrine transmitters) as well as on primary sensory afferent fibers (neurocrine transmitters). Paracrine transmission, representing cell-cell communication within the taste bud, has the potential to shape the final signal output that taste buds transmit to the brain. The following paragraphs summarize current thinking about how taste signals generally, and umami taste in particular, are processed in taste buds.

  18. Genome scale models of yeast: towards standardized evaluation and consistent omic integration

    DEFF Research Database (Denmark)

    Sanchez, Benjamin J.; Nielsen, Jens

    2015-01-01

    Genome scale models (GEMs) have enabled remarkable advances in systems biology, acting as functional databases of metabolism, and as scaffolds for the contextualization of high-throughput data. In the case of Saccharomyces cerevisiae (budding yeast), several GEMs have been published and are curre......Genome scale models (GEMs) have enabled remarkable advances in systems biology, acting as functional databases of metabolism, and as scaffolds for the contextualization of high-throughput data. In the case of Saccharomyces cerevisiae (budding yeast), several GEMs have been published...... in which all levels of omics data (from gene expression to flux) have been integrated in yeast GEMs. Relevant conclusions and current challenges for both GEM evaluation and omic integration are highlighted....

  19. Volumetry of human taste buds using laser scanning microscopy.

    Science.gov (United States)

    Just, T; Srur, E; Stachs, O; Pau, H W

    2009-10-01

    In vivo laser scanning confocal microscopy is a relatively new, non-invasive method for assessment of oral cavity epithelia. The penetration depth of approximately 200-400 microm allows visualisation of fungiform papillae and their taste buds. This paper describes the technique of in vivo volumetry of human taste buds. Confocal laser scanning microscopy used a diode laser at 670 nm for illumination. Digital laser scanning confocal microscopy equipment consisted of the Heidelberg Retina Tomograph HRTII and the Rostock Cornea Module. Volume scans of fungiform papillae were used for three-dimensional reconstruction of the taste bud. This technique supplied information on taste bud structure and enabled measurement and calculation of taste bud volume. Volumetric data from a 23-year-old man over a nine-day period showed only a small deviation in values. After three to four weeks, phenomenological changes in taste bud structures were found (i.e. a significant increase in volume, followed by disappearance of the taste bud and appearance of a new taste bud). The data obtained indicate the potential application of this non-invasive imaging modality: to evaluate variation of taste bud volume in human fungiform papillae with ageing; to study the effects of chorda tympani nerve transection on taste bud volume; and to demonstrate recovery of taste buds in patients with a severed chorda tympani nerve who show recovery of gustatory sensibility after surgery.

  20. Vaginal yeast infection

    Science.gov (United States)

    Yeast infection - vagina; Vaginal candidiasis; Monilial vaginitis ... Most women have a vaginal yeast infection at some time. Candida albicans is a common type of fungus. It is often found in small amounts ...

  1. Yeast signaling pathways in the oxidative stress response

    Energy Technology Data Exchange (ETDEWEB)

    Ikner, Aminah [Section of Microbiology, Division of Biological Sciences, University of California, Davis, CA 95616 (United States); Shiozaki, Kazuhiro [Section of Microbiology, Division of Biological Sciences, University of California, Davis, CA 95616 (United States)]. E-mail: kshiozaki@ucdavis.edu

    2005-01-06

    Oxidative stress that generates the reactive oxygen species (ROS) is one of the major causes of DNA damage and mutations. The 'DNA damage checkpoint' that arrests cell cycle and repairs damaged DNA has been a focus of recent studies, and the genetically amenable model systems provided by yeasts have been playing a leading role in the eukaryotic checkpoint research. However, means to eliminate ROS are likely to be as important as the DNA repair mechanisms in order to suppress mutations in the chromosomal DNA, and yeasts also serve as excellent models to understand how eukaryotes combat oxidative stress. In this article, we present an overview of the signaling pathways that sense oxidative stress and induce expression of various anti-oxidant genes in the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe and the pathogenic yeast Candida albicans. Three conserved signaling modules have been identified in the oxidative stress response of these diverse yeast species: the stress-responsive MAP kinase cascade, the multistep phosphorelay and the AP-1-like transcription factor. The structure and function of these signaling modules are discussed.

  2. Yeast signaling pathways in the oxidative stress response

    International Nuclear Information System (INIS)

    Ikner, Aminah; Shiozaki, Kazuhiro

    2005-01-01

    Oxidative stress that generates the reactive oxygen species (ROS) is one of the major causes of DNA damage and mutations. The 'DNA damage checkpoint' that arrests cell cycle and repairs damaged DNA has been a focus of recent studies, and the genetically amenable model systems provided by yeasts have been playing a leading role in the eukaryotic checkpoint research. However, means to eliminate ROS are likely to be as important as the DNA repair mechanisms in order to suppress mutations in the chromosomal DNA, and yeasts also serve as excellent models to understand how eukaryotes combat oxidative stress. In this article, we present an overview of the signaling pathways that sense oxidative stress and induce expression of various anti-oxidant genes in the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe and the pathogenic yeast Candida albicans. Three conserved signaling modules have been identified in the oxidative stress response of these diverse yeast species: the stress-responsive MAP kinase cascade, the multistep phosphorelay and the AP-1-like transcription factor. The structure and function of these signaling modules are discussed

  3. A sphingolipid-dependent diffusion barrier confines ER stress to the yeast mother cell

    Science.gov (United States)

    Clay, Lori; Caudron, Fabrice; Denoth-Lippuner, Annina; Boettcher, Barbara; Buvelot Frei, Stéphanie; Snapp, Erik Lee; Barral, Yves

    2014-01-01

    In many cell types, lateral diffusion barriers compartmentalize the plasma membrane and, at least in budding yeast, the endoplasmic reticulum (ER). However, the molecular nature of these barriers, their mode of action and their cellular functions are unclear. Here, we show that misfolded proteins of the ER remain confined into the mother compartment of budding yeast cells. Confinement required the formation of a lateral diffusion barrier in the form of a distinct domain of the ER-membrane at the bud neck, in a septin-, Bud1 GTPase- and sphingolipid-dependent manner. The sphingolipids, but not Bud1, also contributed to barrier formation in the outer membrane of the dividing nucleus. Barrier-dependent confinement of ER stress into the mother cell promoted aging. Together, our data clarify the physical nature of lateral diffusion barriers in the ER and establish the role of such barriers in the asymmetric segregation of proteotoxic misfolded proteins during cell division and aging. DOI: http://dx.doi.org/10.7554/eLife.01883.001 PMID:24843009

  4. 5'-end sequences of budding yeast full-length cDNA clones - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available search(/contents-en/) != -1 || url.search(/index-e.html/) != -1 ) { document.getElementById(lang).innerHTML=.../) != -1 ) { url = url.replace(-e.html,.html); document.getElementById(lang).innerHTML=[ Japanese |...en/,/jp/); document.getElementById(lang).innerHTML=[ Japanese | English ]; } else if ( url.search(//contents...//) != -1 ) { url = url.replace(/contents/,/contents-en/); document.getElementById(lang).innerHTML=[ Japanes...e(/contents-en/,/contents/); document.getElementById(lang).innerHTML=[ Japanese | English ]; } else if( url.

  5. Functional conservation between Schizosaccharomyces pombe ste8 and Saccharomyces cerevisiae STE11 protein kinases in yeast signal transduction

    DEFF Research Database (Denmark)

    Styrkársdóttir, U; Egel, R; Nielsen, O

    1992-01-01

    in signal transduction in budding yeast. Expression of the S. cerevisiae STE11 gene in S. pombe ste8 mutants restores the ability to transcribe mat1-Pm in response to pheromone. Also, such cells become capable of conjugation and sporulation. When mat1-Pm is artifically expressed from a heterologous promoter...

  6. Breadth of Tuning and Taste Coding in Mammalian Taste Buds

    OpenAIRE

    Tomchik, Seth M.; Berg, Stephanie; Kim, Joung Woul; Chaudhari, Nirupa; Roper, Stephen D.

    2007-01-01

    A longstanding question in taste research concerns taste coding and, in particular, how broadly are individual taste bud cells tuned to taste qualities (sweet, bitter, umami, salty, and sour). Taste bud cells express G-protein-coupled receptors for sweet, bitter, or umami tastes but not in combination. However, responses to multiple taste qualities have been recorded in individual taste cells. We and others have shown previously there are two classes of taste bud cells directly involved in gu...

  7. Processing Umami and Other Tastes in Mammalian Taste Buds

    OpenAIRE

    Roper, Stephen D.; Chaudhari, Nirupa

    2009-01-01

    Neuroscientists are now coming to appreciate that a significant degree of information processing occurs in the peripheral sensory organs of taste prior to signals propagating to the brain. Gustatory stimulation causes taste bud cells to secrete neurotransmitters that act on adjacent taste bud cells (paracrine transmitters) as well as on primary sensory afferent fibers (neurocrine transmitters). Paracrine transmission, representing cell-cell communication within the taste bud, has the potentia...

  8. Principles of mRNA transport in yeast.

    Science.gov (United States)

    Heym, Roland Gerhard; Niessing, Dierk

    2012-06-01

    mRNA localization and localized translation is a common mechanism by which cellular asymmetry is achieved. In higher eukaryotes the mRNA transport machinery is required for such diverse processes as stem cell division and neuronal plasticity. Because mRNA localization in metazoans is highly complex, studies at the molecular level have proven to be cumbersome. However, active mRNA transport has also been reported in fungi including Saccharomyces cerevisiae, Ustilago maydis and Candida albicans, in which these events are less difficult to study. Amongst them, budding yeast S. cerevisiae has yielded mechanistic insights that exceed our understanding of other mRNA localization events to date. In contrast to most reviews, we refrain here from summarizing mRNA localization events from different organisms. Instead we give an in-depth account of ASH1 mRNA localization in budding yeast. This approach is particularly suited to providing a more holistic view of the interconnection between the individual steps of mRNA localization, from transcriptional events to cytoplasmic mRNA transport and localized translation. Because of our advanced mechanistic understanding of mRNA localization in yeast, the present review may also be informative for scientists working, for example, on mRNA localization in embryogenesis or in neurons.

  9. A Predictive Model for Yeast Cell Polarization in Pheromone Gradients.

    Science.gov (United States)

    Muller, Nicolas; Piel, Matthieu; Calvez, Vincent; Voituriez, Raphaël; Gonçalves-Sá, Joana; Guo, Chin-Lin; Jiang, Xingyu; Murray, Andrew; Meunier, Nicolas

    2016-04-01

    Budding yeast cells exist in two mating types, a and α, which use peptide pheromones to communicate with each other during mating. Mating depends on the ability of cells to polarize up pheromone gradients, but cells also respond to spatially uniform fields of pheromone by polarizing along a single axis. We used quantitative measurements of the response of a cells to α-factor to produce a predictive model of yeast polarization towards a pheromone gradient. We found that cells make a sharp transition between budding cycles and mating induced polarization and that they detect pheromone gradients accurately only over a narrow range of pheromone concentrations corresponding to this transition. We fit all the parameters of the mathematical model by using quantitative data on spontaneous polarization in uniform pheromone concentration. Once these parameters have been computed, and without any further fit, our model quantitatively predicts the yeast cell response to pheromone gradient providing an important step toward understanding how cells communicate with each other.

  10. Recent advances in the genome-wide study of DNA replication origins in yeast

    Science.gov (United States)

    Peng, Chong; Luo, Hao; Zhang, Xi; Gao, Feng

    2015-01-01

    DNA replication, one of the central events in the cell cycle, is the basis of biological inheritance. In order to be duplicated, a DNA double helix must be opened at defined sites, which are called DNA replication origins (ORIs). Unlike in bacteria, where replication initiates from a single replication origin, multiple origins are utilized in the eukaryotic genomes. Among them, the ORIs in budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe have been best characterized. In recent years, advances in DNA microarray and next-generation sequencing technologies have increased the number of yeast species involved in ORIs research dramatically. The ORIs in some non-conventional yeast species such as Kluyveromyces lactis and Pichia pastoris have also been genome-widely identified. Relevant databases of replication origins in yeast were constructed, then the comparative genomic analysis can be carried out. Here, we review several experimental approaches that have been used to map replication origins in yeast and some of the available web resources related to yeast ORIs. We also discuss the sequence characteristics and chromosome structures of ORIs in the four yeast species, which can be utilized to improve yeast replication origins prediction. PMID:25745419

  11. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  12. Mutant induction through adventitious buds of Kohleria

    International Nuclear Information System (INIS)

    Parliman, B.J.; Stushnoff, C.

    1979-01-01

    Freshly cut leaves of Kohleria eriantha and K. x 'Longwood' were exposed in a wide range of gamma irradiation doses and allowed to root and form adventitious buds. K. Eriantha could not be successfully propagated from leaf half cuttings. 'Longwood' produced a small number of adventitious plantlets as compared to other Gesneriads. Colchicine treatments reduced leaf half survival in 'Longwood' by more than 50%. Leaf halves exposed to low and moderate doses of gamma irradiation showed increased overall plantlet production compared to nonirradiated leaf halves. (Auth.)

  13. Epicormic buds in trees: a review of bud establishment, development and dormancy release

    Science.gov (United States)

    Andrew R. ​Meier; Michael R. Saunders; Charles H. Michler

    2012-01-01

    The formation of epicormic sprouts on the boles of trees is a phenomenon that has, until recently, been poorly understood. Renewed interest in the topic in the last two decades has led to significant advances in our knowledge of the subject, especially in regard to bud anatomy, morphology and ontogeny. There exists, however, no comprehensive synthesis of results from...

  14. Mitochondrial localization of fission yeast manganese superoxide dismutase is required for its lysine acetylation and for cellular stress resistance and respiratory growth

    International Nuclear Information System (INIS)

    Takahashi, Hidekazu; Suzuki, Takehiro; Shirai, Atsuko; Matsuyama, Akihisa; Dohmae, Naoshi; Yoshida, Minoru

    2011-01-01

    Research highlights: → Fission yeast manganese superoxide dismutase (MnSOD) is acetylated. → The mitochondrial targeting sequence (MTS) is required for the acetylation of MnSOD. → The MTS is not crucial for MnSOD activity, but is important for respiratory growth. → Posttranslational regulation of MnSOD differs between budding and fission yeast. -- Abstract: Manganese-dependent superoxide dismutase (MnSOD) is localized in the mitochondria and is important for oxidative stress resistance. Although transcriptional regulation of MnSOD has been relatively well studied, much less is known about the protein's posttranslational regulation. In budding yeast, MnSOD is activated after mitochondrial import by manganese ion incorporation. Here we characterize posttranslational modification of MnSOD in the fission yeast Schizosaccharomyces pombe. Fission yeast MnSOD is acetylated at the 25th lysine residue. This acetylation was diminished by deletion of N-terminal mitochondrial targeting sequence, suggesting that MnSOD is acetylated after import into mitochondria. Mitochondrial localization of MnSOD is not essential for the enzyme activity, but is crucial for oxidative stress resistance and growth under respiratory conditions of fission yeast. These results suggest that, unlike the situation in budding yeast, S. pombe MnSOD is already active even before mitochondrial localization; nonetheless, mitochondrial localization is critical to allow the cell to cope with reactive oxygen species generated inside or outside of mitochondria.

  15. Molecular Mechanism of Arenavirus Assembly and Budding

    Directory of Open Access Journals (Sweden)

    Shuzo Urata

    2012-10-01

    Full Text Available Arenaviruses have a bisegmented negative-strand RNA genome, which encodes four viral proteins: GP and NP by the S segment and L and Z by the L segment. These four viral proteins possess multiple functions in infection, replication and release of progeny viruses from infected cells. The small RING finger protein, Z protein is a matrix protein that plays a central role in viral assembly and budding. Although all arenaviruses encode Z protein, amino acid sequence alignment showed a huge variety among the species, especially at the C-terminus where the L-domain is located. Recent publications have demonstrated the interactions between viral protein and viral protein, and viral protein and host cellular protein, which facilitate transportation and assembly of viral components to sites of virus egress. This review presents a summary of current knowledge regarding arenavirus assembly and budding, in comparison with other enveloped viruses. We also refer to the restriction of arenavirus production by the antiviral cellular factor, Tetherin/BST-2.

  16. Whole transcriptome profiling of taste bud cells.

    Science.gov (United States)

    Sukumaran, Sunil K; Lewandowski, Brian C; Qin, Yumei; Kotha, Ramana; Bachmanov, Alexander A; Margolskee, Robert F

    2017-08-08

    Analysis of single-cell RNA-Seq data can provide insights into the specific functions of individual cell types that compose complex tissues. Here, we examined gene expression in two distinct subpopulations of mouse taste cells: Tas1r3-expressing type II cells and physiologically identified type III cells. Our RNA-Seq libraries met high quality control standards and accurately captured differential expression of marker genes for type II (e.g. the Tas1r genes, Plcb2, Trpm5) and type III (e.g. Pkd2l1, Ncam, Snap25) taste cells. Bioinformatics analysis showed that genes regulating responses to stimuli were up-regulated in type II cells, while pathways related to neuronal function were up-regulated in type III cells. We also identified highly expressed genes and pathways associated with chemotaxis and axon guidance, providing new insights into the mechanisms underlying integration of new taste cells into the taste bud. We validated our results by immunohistochemically confirming expression of selected genes encoding synaptic (Cplx2 and Pclo) and semaphorin signalling pathway (Crmp2, PlexinB1, Fes and Sema4a) components. The approach described here could provide a comprehensive map of gene expression for all taste cell subpopulations and will be particularly relevant for cell types in taste buds and other tissues that can be identified only by physiological methods.

  17. Tumor budding in upper gastrointestinal carcinomas

    Directory of Open Access Journals (Sweden)

    Viktor Hendrik Koelzer

    2014-08-01

    Full Text Available The basis of personalized medicine in oncology is the prediction of an individual’s risk of relapse and death from disease. The presence of tumor budding (TB at the tumor-host interface of gastrointestinal cancers has been recognized as a hallmark of unfavorable disease biology. TB is defined as the presence of dedifferentiated cells or small clusters of up to five cells at the tumor invasive front and can be observed in aggressive carcinomas of the esophagus, stomach, pancreas, ampulla, colon and rectum. Presence of TB reproducibly correlates with advanced tumor stage, frequent lymphovascular invasion, nodal and distant metastasis. The UICC has officially recognized TB as additional independent prognostic factor in cancers of the colon and rectum. Recent studies have also characterized TB as a promising prognostic indicator for clinical management of esophageal squamous cell carcinoma, adenocarcinoma of the gastro-esophageal junction and gastric adenocarcinoma. However, several important issues have to be addressed for application in daily diagnostic practice: 1 Validation of prognostic scoring systems for tumor budding in large, multi-center studies 2 Consensus on the optimal assessment method 3 Inter-observer reproducibility. This review provides a comprehensive analysis of TB in cancers of the upper gastrointestinal tract including critical appraisal of perspectives for further study.

  18. Glutamate: Tastant and Neuromodulator in Taste Buds.

    Science.gov (United States)

    Vandenbeuch, Aurelie; Kinnamon, Sue C

    2016-07-01

    In taste buds, glutamate plays a double role as a gustatory stimulus and neuromodulator. The detection of glutamate as a tastant involves several G protein-coupled receptors, including the heterodimer taste receptor type 1, member 1 and 3 as well as metabotropic glutamate receptors (mGluR1 and mGluR4). Both receptor types participate in the detection of glutamate as shown with knockout animals and selective antagonists. At the basal part of taste buds, ionotropic glutamate receptors [N-methyl-d-aspartate (NMDA) and non-NMDA] are expressed and participate in the modulation of the taste signal before its transmission to the brain. Evidence suggests that glutamate has an efferent function on taste cells and modulates the release of other neurotransmitters such as serotonin and ATP. This short article reviews the recent developments in the field with regard to glutamate receptors involved in both functions as well as the influence of glutamate on the taste signal. © 2016 American Society for Nutrition.

  19. Radiosensitivity of continuous cultures: experiments with diploid yeast

    International Nuclear Information System (INIS)

    Kiefer, J.; Wagner, E.

    1975-01-01

    To study the influence of systems parameters on the radiosensitivity of cell populations, stationary chemostat cultures of diploid yeast with different dilution rates were γ-irradiated. Proliferation and budding kinetics were investigated and the doses necessary to eliminate the entire population determined as a function of dilution rate. It was found that this killing dose decreases with dilution rate in a linear manner. The radiosensitivity of the cells was shown to depend on the dilution rate which is presumably due to differing compositions of the population. (U.S.)

  20. Nutrient sensing and TOR signaling in yeast and mammals.

    Science.gov (United States)

    González, Asier; Hall, Michael N

    2017-02-15

    Coordinating cell growth with nutrient availability is critical for cell survival. The evolutionarily conserved TOR (target of rapamycin) controls cell growth in response to nutrients, in particular amino acids. As a central controller of cell growth, mTOR (mammalian TOR) is implicated in several disorders, including cancer, obesity, and diabetes. Here, we review how nutrient availability is sensed and transduced to TOR in budding yeast and mammals. A better understanding of how nutrient availability is transduced to TOR may allow novel strategies in the treatment for mTOR-related diseases. © 2017 The Authors.

  1. Unearthing belowground bud banks in fire-prone ecosystems.

    Science.gov (United States)

    Pausas, Juli G; Lamont, Byron B; Paula, Susana; Appezzato-da-Glória, Beatriz; Fidelis, Alessandra

    2018-03-01

    Despite long-time awareness of the importance of the location of buds in plant biology, research on belowground bud banks has been scant. Terms such as lignotuber, xylopodium and sobole, all referring to belowground bud-bearing structures, are used inconsistently in the literature. Because soil efficiently insulates meristems from the heat of fire, concealing buds below ground provides fitness benefits in fire-prone ecosystems. Thus, in these ecosystems, there is a remarkable diversity of bud-bearing structures. There are at least six locations where belowground buds are stored: roots, root crown, rhizomes, woody burls, fleshy swellings and belowground caudexes. These support many morphologically distinct organs. Given their history and function, these organs may be divided into three groups: those that originated in the early history of plants and that currently are widespread (bud-bearing roots and root crowns); those that also originated early and have spread mainly among ferns and monocots (nonwoody rhizomes and a wide range of fleshy underground swellings); and those that originated later in history and are strictly tied to fire-prone ecosystems (woody rhizomes, lignotubers and xylopodia). Recognizing the diversity of belowground bud banks is the starting point for understanding the many evolutionary pathways available for responding to severe recurrent disturbances. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.

  2. Cell to cell signalling during vertebrate limb bud development

    NARCIS (Netherlands)

    Panman, Lia

    2004-01-01

    Communication between cells is essential during embryonic development. The vertebrate limb bud provides us a model to study signalling interactions between cells during patterning of embryonic tissues and organogenesis. In chapter 1 I give an introduction about limb bud development that is focussed

  3. Bud initiation and optimum harvest date in Brussels sprouts

    NARCIS (Netherlands)

    Everaarts, A.P.; Sukkel, W.

    1999-01-01

    For six cultivars of Brussels sprouts (Brassica oleracea var. gemmifera) with a decreasing degree of earliness, or optimum harvest date, the time of bud initiation was determined during two seasons. Fifty percent of the plants had initiated buds between 60 and 75 days after planting (DAP) in 1994

  4. Bud abortion in tulip bulbs studied by magnetic resonance imaging

    NARCIS (Netherlands)

    Kilsdonk, van M.G.; Nicolaij, K.; Franssen, J.M.; Kollöffel, C.

    2002-01-01

    After storage and subsequent planting of flower bulbs, the flower bud frequently appears to be aborted. This physiological aberration is probably caused by a change in the water status of the bulb and may be initiated during storage. The development of bud abortion in tulip bulbs was studied during

  5. Plantlets from encapsulated shoot buds of Catalpa ovata G. Don

    Directory of Open Access Journals (Sweden)

    Halina Wysokińska

    2014-01-01

    Full Text Available Shoot buds isolated from in vitro shoot cultures of Catalpa ovata G. Don were encapsulated using 3% sodium alginate with sucrose (3% and 50 mM calcium chloride. The morphogenic response of encapsulated buds was affected by such factors, like composition of the media and the presence of growth regulators. The highest frequency of plantlet germination from encapsulated buds (70% within 4 weeks was obtained on Woody Plant medium (WP (Lloyd and McCown 1980 containing indole-3-butyric acid (IBA (1 mg/l. The process was substantially inhibited by cold-storage (4oC of encapsulated buds. In this case, the frequency response ranged from 3% to 22% dependent on storage period (28 or 42 days and the presence of the paraffin coat covering the alginate capsules. The plantlets developed from both unstored and stored encapsulated buds of C. ovata were transplanted to soil and grew in pots to phenotypically normal plants.

  6. Assembly of fission yeast eisosomes in the plasma membrane of budding yeast: Import of foreign membrane microdomains

    Czech Academy of Sciences Publication Activity Database

    Vaškovičová, Katarína; Strádalová, Vendula; Efenberk, Aleš; Opekarová, Miroslava; Malínský, Jan

    2015-01-01

    Roč. 94, č. 1 (2015), s. 1-11 ISSN 0171-9335 R&D Projects: GA ČR(CZ) GAP302/11/0146 Institutional support: RVO:68378041 Keywords : plasma membrane * membrane microdomain * MCC Subject RIV: EA - Cell Biology Impact factor: 4.011, year: 2015

  7. Cytokinins and polar transport of auxin in axillary pea buds

    Directory of Open Access Journals (Sweden)

    Petr Kalousek

    2010-01-01

    Full Text Available The influence of cytokinin on auxin transport during release of axillary buds from apical dominance was studied. Expression of auxin-carrier coding genes PsAUX1 (AUXIN RESISTANT 1 and PsPIN1 (PIN-FORMED 1 was explored in axillary buds of the 2nd node of 7-day pea plants (Pisum sativum L. cv. Vladan after decapitation or after exogenous application of benzyladenine (6-benzylaminopurine onto axillary buds of intact plants. Localization of the PsPIN1 protein, the key factor for polar transport of auxin in axillary buds, was visualised by immunohistochemistry. After exogenous application of cytokinin the expression of PsAUX1 and PsPIN1 rapidly increased with a simultaneous rapid decrease in PsDRM1 and PsAD1 expression – genes related to bud dormancy. The same changes in expression were observed after decapitation, however they were markedly slower. The PsPIN1 auxin efflux carrier in the inhibited axillary buds of intact plants was localised in a non-polar manner. After exogenous application of cytokinin gradual polarisation of the PsPIN1 protein occurred on the basal pole of polar auxin transport competent cells. Despite the fact that direct auxin application to buds of intact plants led to an increase in PsAUX1 and PsPIN1 expression, the buds remained dormant (non-growing what was accompanied by persistent expression of the dormancy markers PsDRM1 and PsAD1. The results indicate a possible effect of cytokinins on biosynthesis, and/or transport of auxin in axillary buds and they highlight the importance of auxin-cytokinin crosstalk in the regulation of bud outgrowth after breaking of apical dominance.

  8. Speciation driven by hybridization and chromosomal plasticity in a wild yeast.

    Science.gov (United States)

    Leducq, Jean-Baptiste; Nielly-Thibault, Lou; Charron, Guillaume; Eberlein, Chris; Verta, Jukka-Pekka; Samani, Pedram; Sylvester, Kayla; Hittinger, Chris Todd; Bell, Graham; Landry, Christian R

    2016-01-11

    Hybridization is recognized as a powerful mechanism of speciation and a driving force in generating biodiversity. However, only few multicellular species, limited to a handful of plants and animals, have been shown to fulfil all the criteria of homoploid hybrid speciation. This lack of evidence could lead to the interpretation that speciation by hybridization has a limited role in eukaryotes, particularly in single-celled organisms. Laboratory experiments have revealed that fungi such as budding yeasts can rapidly develop reproductive isolation and novel phenotypes through hybridization, showing that in principle homoploid speciation could occur in nature. Here, we report a case of homoploid hybrid speciation in natural populations of the budding yeast Saccharomyces paradoxus inhabiting the North American forests. We show that the rapid evolution of chromosome architecture and an ecological context that led to secondary contact between nascent species drove the formation of an incipient hybrid species with a potentially unique ecological niche.

  9. Recent advances in the genome-wide study of DNA replication origins in yeast

    Directory of Open Access Journals (Sweden)

    Chong ePeng

    2015-02-01

    Full Text Available DNA replication, one of the central events in the cell cycle, is the basis of biological inheritance. In order to be duplicated, a DNA double helix must be opened at defined sites, which are called DNA replication origins (ORIs. Unlike in bacteria, where replication initiates from a single replication origin, multiple origins are utilized in the eukaryotic genome. Among them, the ORIs in budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe have been best characterized. In recent years, advances in DNA microarray and next-generation sequencing technologies have increased the number of yeast species involved in ORIs research dramatically. The ORIs in some nonconventional yeast species such as Kluyveromyces lactis and Pichia pastoris have also been genome-widely identified. Relevant databases of replication origins in yeast were constructed, then the comparative genomic analysis can be carried out. Here, we review several experimental approaches that have been used to map replication origins in yeast and some of the available web resources related to yeast ORIs. We also discuss the sequence characteristics and chromosome structures of ORIs in the four yeast species, which can be utilized to improve the replication origins prediction.

  10. Recommendations for reporting tumor budding in colorectal cancer based on the International Tumor Budding Consensus Conference (ITBCC) 2016

    DEFF Research Database (Denmark)

    Lugli, Alessandro; Kirsch, Richard; Ajioka, Yoichi

    2017-01-01

    to determine the strength of recommendations and quality of evidence. The following 10 statements achieved consensus: Tumor budding is defined as a single tumor cell or a cell cluster consisting of four tumor cells or less (22/22, 100%). Tumor budding is an independent predictor of lymph node metastases in pT1......%). Intratumoral budding exists in colorectal cancer and has been shown to be related to lymph node metastasis (22/22, 100%). Tumor budding is assessed in one hotspot (in a field measuring 0.785 mm 2) at the invasive front (22/22, 100%). A three-tier system should be used along with the budding count in order...

  11. Engineering 1-Alkene Biosynthesis and Secretion by Dynamic Regulation in Yeast

    DEFF Research Database (Denmark)

    Zhou, Yongjin J.; Hu, Yating; Zhu, Zhiwei

    2018-01-01

    strategy to control the expression of membrane enzyme and 1-alkene production and cell growth by relieving the possible toxicity of overexpressed membrane proteins. With these efforts, the engineered yeast cell factory produced 35.3 mg/L 1-alkenes with more than 80% being secreted. This represents a 10...... product secretion. Here, we engineered the budding yeast Saccharomyces cerevisiae to produce and secrete 1-alkenes by manipulation of the fatty acid metabolism, enzyme selection, engineering the electron transfer system and expressing a transporter. Furthermore, we implemented a dynamic regulation...

  12. Heterotrimeric G Protein-coupled Receptor Signaling in Yeast Mating Pheromone Response.

    Science.gov (United States)

    Alvaro, Christopher G; Thorner, Jeremy

    2016-04-08

    The DNAs encoding the receptors that respond to the peptide mating pheromones of the budding yeastSaccharomyces cerevisiaewere isolated in 1985, and were the very first genes for agonist-binding heterotrimeric G protein-coupled receptors (GPCRs) to be cloned in any organism. Now, over 30 years later, this yeast and its receptors continue to provide a pathfinding experimental paradigm for investigating GPCR-initiated signaling and its regulation, as described in this retrospective overview. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. An Algorithm to Automate Yeast Segmentation and Tracking

    Science.gov (United States)

    Doncic, Andreas; Eser, Umut; Atay, Oguzhan; Skotheim, Jan M.

    2013-01-01

    Our understanding of dynamic cellular processes has been greatly enhanced by rapid advances in quantitative fluorescence microscopy. Imaging single cells has emphasized the prevalence of phenomena that can be difficult to infer from population measurements, such as all-or-none cellular decisions, cell-to-cell variability, and oscillations. Examination of these phenomena requires segmenting and tracking individual cells over long periods of time. However, accurate segmentation and tracking of cells is difficult and is often the rate-limiting step in an experimental pipeline. Here, we present an algorithm that accomplishes fully automated segmentation and tracking of budding yeast cells within growing colonies. The algorithm incorporates prior information of yeast-specific traits, such as immobility and growth rate, to segment an image using a set of threshold values rather than one specific optimized threshold. Results from the entire set of thresholds are then used to perform a robust final segmentation. PMID:23520484

  14. An algorithm to automate yeast segmentation and tracking.

    Directory of Open Access Journals (Sweden)

    Andreas Doncic

    Full Text Available Our understanding of dynamic cellular processes has been greatly enhanced by rapid advances in quantitative fluorescence microscopy. Imaging single cells has emphasized the prevalence of phenomena that can be difficult to infer from population measurements, such as all-or-none cellular decisions, cell-to-cell variability, and oscillations. Examination of these phenomena requires segmenting and tracking individual cells over long periods of time. However, accurate segmentation and tracking of cells is difficult and is often the rate-limiting step in an experimental pipeline. Here, we present an algorithm that accomplishes fully automated segmentation and tracking of budding yeast cells within growing colonies. The algorithm incorporates prior information of yeast-specific traits, such as immobility and growth rate, to segment an image using a set of threshold values rather than one specific optimized threshold. Results from the entire set of thresholds are then used to perform a robust final segmentation.

  15. Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae

    OpenAIRE

    Lang, Gregory I.; Murray, Andrew W.

    2008-01-01

    Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...

  16. Analysis of the Yeast Kinome Reveals a Network of Regulated Protein Localization during Filamentous Growth

    OpenAIRE

    Bharucha, Nikë; Ma, Jun; Dobry, Craig J.; Lawson, Sarah K.; Yang, Zhifen; Kumar, Anuj

    2008-01-01

    The subcellular distribution of kinases and other signaling proteins is regulated in response to cellular cues; however, the extent of this regulation has not been investigated for any gene set in any organism. Here, we present a systematic analysis of protein kinases in the budding yeast, screening for differential localization during filamentous growth. Filamentous growth is an important stress response involving mitogen-activated protein kinase and cAMP-dependent protein kinase signaling m...

  17. Live longer on MARS: a yeast paradigm of mitochondrial adaptive ROS signaling in aging

    Directory of Open Access Journals (Sweden)

    Gerald S. Shadel

    2014-04-01

    Full Text Available Adaptive responses to stress, including hormesis, have been implicated in longevity, but their mechanisms and out comes are not fully understood. Here, I briefly summarize a longevity mechanism elucidated in the budding yeast chronological lifespan model by which Mitochondrial Adaptive ROS Signaling (MARS promotes beneficial epigenetic and metabolic remodeling. The potential relevance of MARS to the human disease Ataxia-Telangiectasia and as a potential anti-aging target is discussed.

  18. The subcellular localization of yeast glycogen synthase is dependent upon glycogen content

    OpenAIRE

    Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.

    2010-01-01

    The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...

  19. Identification of candidate new cancer susceptibility genes using yeast genomics

    International Nuclear Information System (INIS)

    Brown, M.; Brown, J.A.; Game, J.C.

    2003-01-01

    A large proportion of cancer susceptibility syndromes are the result of mutations in genes in DNA repair or in cell-cycle checkpoints in response to DNA damage, such as ataxia telangiectasia (AT), Fanconi's anemia (FA), Bloom's syndrome (BS), Nijmegen breakage syndrome (NBS), and xeroderma pigmentosum (XP). Mutations in these genes often cause gross chromosomal instability leading to an increased mutation rate of all genes including those directly responsible for cancer. We have proposed that because the orthologs of these genes in budding yeast, S. cerevisiae, confer protection against killing by DNA damaging agents it should be possible to identify new cancer susceptibility genes by identifying yeast genes whose deletion causes sensitivity to DNA damage. We therefore screened the recently completed collection of individual gene deletion mutants to identify genes that affect sensitivity to DNA-damaging agents. Screening for sensitivity in this obtained up to now with the F98 glioma model othe fact that each deleted gene is replaced by a cassette containing two molecular 'barcodes', or 20-mers, that uniquely identify the strain when DNA from a pool of strains is hybridized to an oligonucleotide array containing the complementary sequences of the barcodes. We performed the screen with UV, IR, H 2 0 2 and other DNA damaging agents. In addition to identifying genes already known to confer resistance to DNA damaging agents we have identified, and individually confirmed, several genes not previously associated with resistance. Several of these are of unknown function. We have also examined the chromosomal stability of selected strains and found that IR sensitive strains often but not always exhibit genomic instability. We are presently constructing a yeast artificial chromosome to globally interrogate all the genes in the deletion pool for their involvement in genomic stability. This work shows that budding yeast is a valuable eukaryotic model organism to identify

  20. Transcriptomic Analysis of Flower Bud Differentiation in Magnolia sinostellata

    Directory of Open Access Journals (Sweden)

    Lijie Fan

    2018-04-01

    Full Text Available Magnolias are widely cultivated for their beautiful flowers, but despite their popularity, the molecular mechanisms regulating flower bud differentiation have not been elucidated. Here, we used paraffin sections and RNA-seq to study the process of flower bud differentiation in Magnolia sinostellata. Flower bud development occurred between 28 April and 30 May 2017 and was divided into five stages: undifferentiated, early flower bud differentiation, petal primordium differentiation, stamen primordium differentiation, and pistil primordium differentiation. A total of 52,441 expressed genes were identified, of which 11,592 were significantly differentially expressed in the five bud development stages. Of these, 82 genes were involved in the flowering. In addition, MADS-box and AP2 family genes play critical roles in the formation of flower organs and 20 differentially expressed genes associated with flower bud differentiation were identified in M. sinostellata. A qRT-PCR analysis verified that the MADS-box and AP2 family genes were expressed at high levels during flower bud differentiation. Consequently, this study provides a theoretical basis for the genetic regulation of flowering in M. sinostellata, which lays a foundation for further research into flowering genes and may facilitate the development of new cultivars.

  1. Taste bud homeostasis in health, disease, and aging.

    Science.gov (United States)

    Feng, Pu; Huang, Liquan; Wang, Hong

    2014-01-01

    The mammalian taste bud is an onion-shaped epithelial structure with 50-100 tightly packed cells, including taste receptor cells, supporting cells, and basal cells. Taste receptor cells detect nutrients and toxins in the oral cavity and transmit the sensory information to gustatory nerve endings in the buds. Supporting cells may play a role in the clearance of excess neurotransmitters after their release from taste receptor cells. Basal cells are precursor cells that differentiate into mature taste cells. Similar to other epithelial cells, taste cells turn over continuously, with an average life span of about 8-12 days. To maintain structural homeostasis in taste buds, new cells are generated to replace dying cells. Several recent studies using genetic lineage tracing methods have identified populations of progenitor/stem cells for taste buds, although contributions of these progenitor/stem cell populations to taste bud homeostasis have yet to be fully determined. Some regulatory factors of taste cell differentiation and degeneration have been identified, but our understanding of these aspects of taste bud homoeostasis remains limited. Many patients with various diseases develop taste disorders, including taste loss and taste distortion. Decline in taste function also occurs during aging. Recent studies suggest that disruption or alteration of taste bud homeostasis may contribute to taste dysfunction associated with disease and aging.

  2. A permeability barrier surrounds taste buds in lingual epithelia

    Science.gov (United States)

    Dando, Robin; Pereira, Elizabeth; Kurian, Mani; Barro-Soria, Rene; Chaudhari, Nirupa

    2014-01-01

    Epithelial tissues are characterized by specialized cell-cell junctions, typically localized to the apical regions of cells. These junctions are formed by interacting membrane proteins and by cytoskeletal and extracellular matrix components. Within the lingual epithelium, tight junctions join the apical tips of the gustatory sensory cells in taste buds. These junctions constitute a selective barrier that limits penetration of chemosensory stimuli into taste buds (Michlig et al. J Comp Neurol 502: 1003–1011, 2007). We tested the ability of chemical compounds to permeate into sensory end organs in the lingual epithelium. Our findings reveal a robust barrier that surrounds the entire body of taste buds, not limited to the apical tight junctions. This barrier prevents penetration of many, but not all, compounds, whether they are applied topically, injected into the parenchyma of the tongue, or circulating in the blood supply, into taste buds. Enzymatic treatments indicate that this barrier likely includes glycosaminoglycans, as it was disrupted by chondroitinase but, less effectively, by proteases. The barrier surrounding taste buds could also be disrupted by brief treatment of lingual tissue samples with DMSO. Brief exposure of lingual slices to DMSO did not affect the ability of taste buds within the slice to respond to chemical stimulation. The existence of a highly impermeable barrier surrounding taste buds and methods to break through this barrier may be relevant to basic research and to clinical treatments of taste. PMID:25209263

  3. A permeability barrier surrounds taste buds in lingual epithelia.

    Science.gov (United States)

    Dando, Robin; Pereira, Elizabeth; Kurian, Mani; Barro-Soria, Rene; Chaudhari, Nirupa; Roper, Stephen D

    2015-01-01

    Epithelial tissues are characterized by specialized cell-cell junctions, typically localized to the apical regions of cells. These junctions are formed by interacting membrane proteins and by cytoskeletal and extracellular matrix components. Within the lingual epithelium, tight junctions join the apical tips of the gustatory sensory cells in taste buds. These junctions constitute a selective barrier that limits penetration of chemosensory stimuli into taste buds (Michlig et al. J Comp Neurol 502: 1003-1011, 2007). We tested the ability of chemical compounds to permeate into sensory end organs in the lingual epithelium. Our findings reveal a robust barrier that surrounds the entire body of taste buds, not limited to the apical tight junctions. This barrier prevents penetration of many, but not all, compounds, whether they are applied topically, injected into the parenchyma of the tongue, or circulating in the blood supply, into taste buds. Enzymatic treatments indicate that this barrier likely includes glycosaminoglycans, as it was disrupted by chondroitinase but, less effectively, by proteases. The barrier surrounding taste buds could also be disrupted by brief treatment of lingual tissue samples with DMSO. Brief exposure of lingual slices to DMSO did not affect the ability of taste buds within the slice to respond to chemical stimulation. The existence of a highly impermeable barrier surrounding taste buds and methods to break through this barrier may be relevant to basic research and to clinical treatments of taste. Copyright © 2015 the American Physiological Society.

  4. Taste Bud Homeostasis in Health, Disease, and Aging

    Science.gov (United States)

    2014-01-01

    The mammalian taste bud is an onion-shaped epithelial structure with 50–100 tightly packed cells, including taste receptor cells, supporting cells, and basal cells. Taste receptor cells detect nutrients and toxins in the oral cavity and transmit the sensory information to gustatory nerve endings in the buds. Supporting cells may play a role in the clearance of excess neurotransmitters after their release from taste receptor cells. Basal cells are precursor cells that differentiate into mature taste cells. Similar to other epithelial cells, taste cells turn over continuously, with an average life span of about 8–12 days. To maintain structural homeostasis in taste buds, new cells are generated to replace dying cells. Several recent studies using genetic lineage tracing methods have identified populations of progenitor/stem cells for taste buds, although contributions of these progenitor/stem cell populations to taste bud homeostasis have yet to be fully determined. Some regulatory factors of taste cell differentiation and degeneration have been identified, but our understanding of these aspects of taste bud homoeostasis remains limited. Many patients with various diseases develop taste disorders, including taste loss and taste distortion. Decline in taste function also occurs during aging. Recent studies suggest that disruption or alteration of taste bud homeostasis may contribute to taste dysfunction associated with disease and aging. PMID:24287552

  5. Inflammation activates the interferon signaling pathways in taste bud cells.

    Science.gov (United States)

    Wang, Hong; Zhou, Minliang; Brand, Joseph; Huang, Liquan

    2007-10-03

    Patients with viral and bacterial infections or other inflammatory illnesses often experience taste dysfunctions. The agents responsible for these taste disorders are thought to be related to infection-induced inflammation, but the mechanisms are not known. As a first step in characterizing the possible role of inflammation in taste disorders, we report here evidence for the presence of interferon (IFN)-mediated signaling pathways in taste bud cells. IFN receptors, particularly the IFN-gamma receptor IFNGR1, are coexpressed with the taste cell-type markers neuronal cell adhesion molecule and alpha-gustducin, suggesting that both the taste receptor cells and synapse-forming cells in the taste bud can be stimulated by IFN. Incubation of taste bud-containing lingual epithelia with recombinant IFN-alpha and IFN-gamma triggered the IFN-mediated signaling cascades, resulting in the phosphorylation of the downstream STAT1 (signal transducer and activator of transcription protein 1) transcription factor. Intraperitoneal injection of lipopolysaccharide or polyinosinic:polycytidylic acid into mice, mimicking bacterial and viral infections, respectively, altered gene expression patterns in taste bud cells. Furthermore, the systemic administration of either IFN-alpha or IFN-gamma significantly increased the number of taste bud cells undergoing programmed cell death. These findings suggest that bacterial and viral infection-induced IFNs can act directly on taste bud cells, affecting their cellular function in taste transduction, and that IFN-induced apoptosis in taste buds may cause abnormal cell turnover and skew the representation of different taste bud cell types, leading to the development of taste disorders. To our knowledge, this is the first study providing direct evidence that inflammation can affect taste buds through cytokine signaling pathways.

  6. Norepinephrine is coreleased with serotonin in mouse taste buds.

    Science.gov (United States)

    Huang, Yijen A; Maruyama, Yutaka; Roper, Stephen D

    2008-12-03

    ATP and serotonin (5-HT) are neurotransmitters secreted from taste bud receptor (type II) and presynaptic (type III) cells, respectively. Norepinephrine (NE) has also been proposed to be a neurotransmitter or paracrine hormone in taste buds. Yet, to date, the specific stimulus for NE release in taste buds is not well understood, and the identity of the taste cells that secrete NE is not known. Chinese hamster ovary cells were transfected with alpha(1A) adrenoceptors and loaded with fura-2 ("biosensors") to detect NE secreted from isolated mouse taste buds and taste cells. Biosensors responded to low concentrations of NE (>or=10 nm) with a reliable fura-2 signal. NE biosensors did not respond to stimulation with KCl or taste compounds. However, we recorded robust responses from NE biosensors when they were positioned against mouse circumvallate taste buds and the taste buds were stimulated with KCl (50 mm) or a mixture of taste compounds (cycloheximide, 10 microm; saccharin, 2 mm; denatonium, 1 mm; SC45647, 100 microm). NE biosensor responses evoked by stimulating taste buds were reversibly blocked by prazosin, an alpha(1A) receptor antagonist. Together, these findings indicate that taste bud cells secrete NE when they are stimulated. We isolated individual taste bud cells to identify the origin of NE release. NE was secreted only from presynaptic (type III) taste cells and not receptor (type II) cells. Stimulus-evoked NE release depended on Ca(2+) in the bathing medium. Using dual biosensors (sensitive to 5-HT and NE), we found all presynaptic cells secrete 5-HT and 33% corelease NE with 5-HT.

  7. Comprehensive Cloning of Prunus mume Dormancy Associated MADS-Box Genes and Their Response in Flower Bud Development and Dormancy

    Directory of Open Access Journals (Sweden)

    Kai Zhao

    2018-02-01

    Full Text Available Dormancy Associated MADS-box genes are SVP/MADs-box members and supposed to play crucial roles in plant dormancy of perennial species. In Prunus mume, PmDAM6 has been previously identified to induce plant dormancy. In the current study, six PmDAMs were cloned in P. mume and functionally analyzed in yeast and tobacco to detect the roles of the genes paralogous to PmDAM6. The expression patterns together with sequence similarities indicate that PmDAMs are divided into two sub-clades within SVP group. Moreover, PmDAMs are verified to take part in the development of different plant organs, specifically the flower buds, in some intricate patterns. Furthermore, the PmDAM proteins are found to have special functions by forming corresponding protein complex during the development of flower bud and induction of dormancy. In particular, when PmDAM1 dominating in flower bud in the warm months, the protein complexes are consisted of PmDAM1 itself or with PmDAM2. With the decrease temperatures in the following months, PmDAM6 was found to be highly expressed and gradually changed the complex structure to PmDAM6-protein complex due to strong binding tendencies with PmDAM1 and PmDAM3. Finally, the homodimers of PmDAM6 prevailed to induce the dormancy. The results obtained in the current study highlight the functions of PmDAMs in the tissue development and dormancy, which provide available suggestions for further explorations of protein-complex functions in association with bud growth and dormancy.

  8. Download - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available search(/contents-en/) != -1 || url.search(/index-e.html/) != -1 ) { document.getElementById(lang).innerHTML=.../) != -1 ) { url = url.replace(-e.html,.html); document.getElementById(lang).innerHTML=[ Japanese |...en/,/jp/); document.getElementById(lang).innerHTML=[ Japanese | English ]; } else if ( url.search(//contents...//) != -1 ) { url = url.replace(/contents/,/contents-en/); document.getElementById(lang).innerHTML=[ Japanes...e(/contents-en/,/contents/); document.getElementById(lang).innerHTML=[ Japanese | English ]; } else if( url.

  9. High-resolution transcription atlas of the mitotic cell cycle in budding yeast

    DEFF Research Database (Denmark)

    Granovskaia, Marina V; Jensen, Lars J; Ritchie, Matthew E

    2010-01-01

    Extensive transcription of non-coding RNAs has been detected in eukaryotic genomes and is thought to constitute an additional layer in the regulation of gene expression. Despite this role, their transcription through the cell cycle has not been studied; genome-wide approaches have only focused on...

  10. Cell mass and cell cycle dynamics of an asynchronous budding yeast population

    DEFF Research Database (Denmark)

    Lencastre Fernandes, Rita; Carlquist, Magnus; Lundin, Luisa

    2013-01-01

    of model predictions for cell property distributions against experimental data is scarce. This study focuses on the experimental and mathematical description of the dynamics of cell size and cell cycle position distributions, of a population of Saccharomyces cerevisiae, in response to the substrate...

  11. Database Description - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Frontier Sciences, The University of Tokyo(when creating) Creator Name: Takashi ...ating) Contact address GSFS - CB-06, Transdisciplinary Sciences, The University of ...Ito* Creator Affiliation: Department of Computational Biology, Graduate School of Frontier Sciences, The University of Tokyo(when cre

  12. Analysis of aging in lager brewing yeast during serial repitching.

    Science.gov (United States)

    Bühligen, Franziska; Lindner, Patrick; Fetzer, Ingo; Stahl, Frank; Scheper, Thomas; Harms, Hauke; Müller, Susann

    2014-10-10

    Serial repitching of brewing yeast inoculates is an important economic factor in the brewing industry, as their propagation is time and resource intensive. Here, we investigated whether replicative aging and/or the population distribution status changed during serial repitching in three different breweries with the same brewing yeast strain but different abiotic backgrounds and repitching regimes with varying numbers of reuses. Next to bud scar numbers the DNA content of the Saccharomyces pastorianus HEBRU cells was analyzed. Gene expression patterns were investigated using low-density microarrays with genes for aging, stress, storage compound metabolism and cell cycle. Two breweries showed a stable rejuvenation rate during serial repitching. In a third brewery the fraction of virgin cells varied, which could be explained with differing wort aeration rates. Furthermore, the number of bud scars per cell and cell size correlated in all 3 breweries throughout all runs. Transcriptome analyses revealed that from the 6th run on, mainly for the cells positive gene expression could be seen, for example up-regulation of trehalose and glycogen metabolism genes. Additionally, the cells' settling in the cone was dependent on cell size, with the lowest and the uppermost cone layers showing the highest amount of dead cells. In general, cells do not progressively age during extended serial repitching. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Yeast identification in floral nectar of Mimulus aurantiacus (Invited)

    Science.gov (United States)

    Kyauk, C.; Belisle, M.; Fukami, T.

    2009-12-01

    Nectar is such a sugar-rich resource that serves as a natural habitat in which microbes thrive. As a result, yeasts arrive to nectar on the bodies of pollinators such as hummingbirds and bees. Yeasts use the sugar in nectar for their own needs when introduced. This research focuses on the identification of different types of yeast that are found in the nectar of Mimulus aurantiacus (commonly known as sticky monkey-flower). Unopened Mimulus aurantiacus flower buds were tagged at Jasper Ridge and bagged three days later. Floral nectar was then extracted and plated on potato dextrose agar. Colonies on the plates were isolated and DNA was extracted from each sample using QIAGEN DNeasy Plant Mini Kit. The DNA was amplified through PCR and ran through gel electrophoresis. The PCR product was used to clone the nectar samples into an E.coli vector. Finally, a phylogenetic tree was created by BLAST searching sequences in GenBank using the Internal Transcribed Space (ITS) locus. It was found that 18 of the 50 identified species were Candida magnifica, 14 was Candida rancensis, 6 were Crytococcus albidus and there were 3 or less of the following: Starmella bombicola, Candida floricola, Aureobasidium pullulans, Pichia kluyvera, Metschnikowa cibodaserisis, Rhodotorua colostri, and Malassezia globosa. The low diversity of the yeast could have been due to several factors: time of collection, demographics of Jasper Ridge, low variety of pollinators, and sugar concentration of the nectar. The results of this study serve as a necessary first step for a recently started research project on ecological interactions between plants, pollinators, and nectar-living yeast. More generally, this research studies the use of the nectar-living yeast community as a natural microcosm for addressing basic questions about the role of dispersal and competitive and facilitative interactions in ecological succession.

  14. Functional cell types in taste buds have distinct longevities.

    Directory of Open Access Journals (Sweden)

    Isabel Perea-Martinez

    Full Text Available Taste buds are clusters of polarized sensory cells embedded in stratified oral epithelium. In adult mammals, taste buds turn over continuously and are replenished through the birth of new cells in the basal layer of the surrounding non-sensory epithelium. The half-life of cells in mammalian taste buds has been estimated as 8-12 days on average. Yet, earlier studies did not address whether the now well-defined functional taste bud cell types all exhibit the same lifetime. We employed a recently developed thymidine analog, 5-ethynil-2'-deoxyuridine (EdU to re-evaluate the incorporation of newly born cells into circumvallate taste buds of adult mice. By combining EdU-labeling with immunostaining for selected markers, we tracked the differentiation and lifespan of the constituent cell types of taste buds. EdU was primarily incorporated into basal extragemmal cells, the principal source for replenishing taste bud cells. Undifferentiated EdU-labeled cells began migrating into circumvallate taste buds within 1 day of their birth. Type II (Receptor taste cells began to differentiate from EdU-labeled precursors beginning 2 days after birth and then were eliminated with a half-life of 8 days. Type III (Presynaptic taste cells began differentiating after a delay of 3 days after EdU-labeling, and they survived much longer, with a half-life of 22 days. We also scored taste bud cells that belong to neither Type II nor Type III, a heterogeneous group that includes mostly Type I cells, and also undifferentiated or immature cells. A non-linear decay fit described these cells as two sub-populations with half-lives of 8 and 24 days respectively. Our data suggest that many post-mitotic cells may remain quiescent within taste buds before differentiating into mature taste cells. A small number of slow-cycling cells may also exist within the perimeter of the taste bud. Based on their incidence, we hypothesize that these may be progenitors for Type III cells.

  15. Functional cell types in taste buds have distinct longevities.

    Science.gov (United States)

    Perea-Martinez, Isabel; Nagai, Takatoshi; Chaudhari, Nirupa

    2013-01-01

    Taste buds are clusters of polarized sensory cells embedded in stratified oral epithelium. In adult mammals, taste buds turn over continuously and are replenished through the birth of new cells in the basal layer of the surrounding non-sensory epithelium. The half-life of cells in mammalian taste buds has been estimated as 8-12 days on average. Yet, earlier studies did not address whether the now well-defined functional taste bud cell types all exhibit the same lifetime. We employed a recently developed thymidine analog, 5-ethynil-2'-deoxyuridine (EdU) to re-evaluate the incorporation of newly born cells into circumvallate taste buds of adult mice. By combining EdU-labeling with immunostaining for selected markers, we tracked the differentiation and lifespan of the constituent cell types of taste buds. EdU was primarily incorporated into basal extragemmal cells, the principal source for replenishing taste bud cells. Undifferentiated EdU-labeled cells began migrating into circumvallate taste buds within 1 day of their birth. Type II (Receptor) taste cells began to differentiate from EdU-labeled precursors beginning 2 days after birth and then were eliminated with a half-life of 8 days. Type III (Presynaptic) taste cells began differentiating after a delay of 3 days after EdU-labeling, and they survived much longer, with a half-life of 22 days. We also scored taste bud cells that belong to neither Type II nor Type III, a heterogeneous group that includes mostly Type I cells, and also undifferentiated or immature cells. A non-linear decay fit described these cells as two sub-populations with half-lives of 8 and 24 days respectively. Our data suggest that many post-mitotic cells may remain quiescent within taste buds before differentiating into mature taste cells. A small number of slow-cycling cells may also exist within the perimeter of the taste bud. Based on their incidence, we hypothesize that these may be progenitors for Type III cells.

  16. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  17. Real Life Science with Dandelions and Project BudBurst

    Directory of Open Access Journals (Sweden)

    Katherine A. Johnson

    2015-12-01

    Full Text Available Project BudBurst is a national citizen-science project that tracks bloom times and other phenological data for plants across the country. Data from Project BudBurst are being used to measure the effects of climate change. Students can participate in this project by watching any of the plants on the list, including the common dandelion, which makes the program easy and accessible to everyone.

  18. Real Life Science with Dandelions and Project BudBurst.

    Science.gov (United States)

    Johnson, Katherine A

    2016-03-01

    Project BudBurst is a national citizen-science project that tracks bloom times and other phenological data for plants across the country. Data from Project BudBurst are being used to measure the effects of climate change. Students can participate in this project by watching any of the plants on the list, including the common dandelion, which makes the program easy and accessible to everyone. Journal of Microbiology & Biology Education.

  19. Taste Bud Homeostasis in Health, Disease, and Aging

    OpenAIRE

    Feng, Pu; Huang, Liquan; Wang, Hong

    2013-01-01

    The mammalian taste bud is an onion-shaped epithelial structure with 50–100 tightly packed cells, including taste receptor cells, supporting cells, and basal cells. Taste receptor cells detect nutrients and toxins in the oral cavity and transmit the sensory information to gustatory nerve endings in the buds. Supporting cells may play a role in the clearance of excess neurotransmitters after their release from taste receptor cells. Basal cells are precursor cells that differentiate into mature...

  20. Longleaf pine bud development: influence of seedling nutrition

    Science.gov (United States)

    J. P. Barnett; D. P. Jackson; R. K. Dumroese

    2010-01-01

    A subset of seedlings from a larger study (Jackson and others 2006, 2007) were selected and evaluated for two growing seasons to relate bud development, and root-collar diameter (RCD), and height growth with three nursery fertilization rates. We chose seedlings in the 0.5 (lowest), 2.0 (mid-range), and 4.0 (highest) mg of nitrogen per seedling treatments. Buds moved...

  1. Nitrile Metabolizing Yeasts

    Science.gov (United States)

    Bhalla, Tek Chand; Sharma, Monica; Sharma, Nitya Nand

    Nitriles and amides are widely distributed in the biotic and abiotic components of our ecosystem. Nitrile form an important group of organic compounds which find their applications in the synthesis of a large number of compounds used as/in pharmaceutical, cosmetics, plastics, dyes, etc>. Nitriles are mainly hydro-lyzed to corresponding amide/acid in organic chemistry. Industrial and agricultural activities have also lead to release of nitriles and amides into the environment and some of them pose threat to human health. Biocatalysis and biotransformations are increasingly replacing chemical routes of synthesis in organic chemistry as a part of ‘green chemistry’. Nitrile metabolizing organisms or enzymes thus has assumed greater significance in all these years to convert nitriles to amides/ acids. The nitrile metabolizing enzymes are widely present in bacteria, fungi and yeasts. Yeasts metabolize nitriles through nitrilase and/or nitrile hydratase and amidase enzymes. Only few yeasts have been reported to possess aldoxime dehydratase. More than sixty nitrile metabolizing yeast strains have been hither to isolated from cyanide treatment bioreactor, fermented foods and soil. Most of the yeasts contain nitrile hydratase-amidase system for metabolizing nitriles. Transformations of nitriles to amides/acids have been carried out with free and immobilized yeast cells. The nitrilases of Torulopsis candida>and Exophiala oligosperma>R1 are enantioselec-tive and regiospecific respectively. Geotrichum>sp. JR1 grows in the presence of 2M acetonitrile and may have potential for application in bioremediation of nitrile contaminated soil/water. The nitrilase of E. oligosperma>R1 being active at low pH (3-6) has shown promise for the hydroxy acids. Immobilized yeast cells hydrolyze some additional nitriles in comparison to free cells. It is expected that more focus in future will be on purification, characterization, cloning, expression and immobilization of nitrile metabolizing

  2. Micropropagation of Helleborus through axillary budding.

    Science.gov (United States)

    Beruto, Margherita; Viglione, Serena; Bisignano, Alessandro

    2013-01-01

    Helleborus genus, belonging to the Ranunculaceae family, has 20 species of herbaceous perennial flowering plants. The commercial exploitation of this plant is dependent on the selection and propagation of appropriate lines. High propagation rate could be accomplished by using a suitable tissue culture method enabling the rapid introduction of valuable selections in the market. However, in vitro cultivation of Helleborus is still very difficult. Thereby the development of reliable in vitro propagation procedures is crucial for future production systems. Axillary buds cultured on agar-solidified Murashige and Skoog medium supplemented with 1 mg/L benzyladenine, 0.1 mg/L β-naphthoxyacetic acid, and 2 mg/L isopentenyl adenine develop shoots after 16 weeks of culture under 16 h light regime, 50-60 μmol/s/m(2), and 19 ± 1°C. The multiplication rate ranges from 1.4 to 2.1. However, the genotype and the number of subcultures affect the efficiency of the micropropagation process. The rooting of shoots is about 80% in solidified MS medium containing 1 mg/L 1-naphthaleneacetic acid and 3 mg/L indole-3-butyric acid. The described protocol provides information which can contribute to the commercial production of Helleborus plants.

  3. Histological and Molecular Characterization of Grape Early Ripening Bud Mutant

    Directory of Open Access Journals (Sweden)

    Da-Long Guo

    2016-01-01

    Full Text Available An early ripening bud mutant was analyzed based on the histological, SSR, and methylation-sensitive amplified polymorphism (MSAP analysis and a layer-specific approach was used to investigate the differentiation between the bud mutant and its parent. The results showed that the thickness of leaf spongy tissue of mutant (MT is larger than that of wild type (WT and the differences are significant. The mean size of cell layer L2 was increased in the mutant and the difference is significant. The genetic background of bud mutant revealed by SSR analysis is highly uniform to its parent; just the variations from VVS2 SSR marker were detected in MT. The total methylation ratio of MT is lower than that of the corresponding WT. The outside methylation ratio in MT is much less than that in WT; the average inner methylation ratio in MT is larger than that in WT. The early ripening bud mutant has certain proportion demethylation in cell layer L2. All the results suggested that cell layer L2 of the early ripening bud mutant has changed from the WT. This study provided the basis for a better understanding of the characteristic features of the early ripening bud mutant in grape.

  4. Change of the human taste bud volume over time.

    Science.gov (United States)

    Srur, Ehab; Stachs, Oliver; Guthoff, Rudolf; Witt, Martin; Pau, Hans Wilhelm; Just, Tino

    2010-08-01

    The specific aim of this study is to measure the taste volume in healthy human subjects over a 2.5-month period and to demonstrate morphological changes of the peripheral taste organs. Eighteen human taste buds in four fungiform papillae (fPap) were examined over a 10-week period. The fungiform papillae investigated were selected based on the form of the papillae or the arrangement of surface taste pores. Measurements were performed over 10 consecutive weeks, with five scans in a day once a week. The following parameters were measured: height and diameter of the taste bud, diameter of the fungiform papilla and diameter of the taste pore. The findings of this exploratory study indicated that (1) taste bud volumes changed over a 10-week period, (2) the interval between two volume maxima within the 10-week period was 3-5 weeks, and (3) the diameter of the fPap did not correlate with the volume of a single taste bud or with the volume of all taste buds in the fPap within the 10-week period. This exploratory in vivo study revealed changes in taste bud volumes in healthy humans with age-related gustatory sensitivity. These findings need to be considered when studying the effect of denervation of fungiform papillae in vivo using confocal microscopy. Crown Copyright 2009. Published by Elsevier Ireland Ltd. All rights reserved.

  5. Expression of sulfonylurea receptors in rat taste buds.

    Science.gov (United States)

    Liu, Dian-Xin; Liu, Xiao-Min; Zhou, Li-Hong; Feng, Xiao-Hong; Zhang, Xiao-Juan

    2011-07-01

    To test the possibility that a fast-onset promoting agent repaglinide may initiate prandial insulin secretion through the mechanism of cephalic-phase insulin release, we explored the expression and distribution character of sulfonylurea receptors in rat taste buds. Twenty male Wistar rats aged 10 weeks old were killed after general anesthesia. The circumvallate papillae, fungiform papillae and pancreas tissues were separately collected. Immunohistochemical staining was used to detect the expression and distribution of sulfonylurea receptor 1 (SUR1) or sulfonylurea receptor 2 (SUR2) in rat taste buds. Reverse transcriptase polymerase chain reaction (RT-PCR) was used to analyze the expression of SUR1 or SUR2 mRNA. The pancreatic tissues from the same rat were used as positive control. This is the first study to report that SUR1 is uniquely expressed in the taste buds of fungiform papillae of each rat tongue, while the expression of SUR1 or SUR2 was not detected in the taste buds of circumvallate papillae. SUR1 is selectively expressed in rat taste buds, and its distribution pattern may be functionally relevant, suggesting that the rapid insulin secretion-promoting effect of repaglinide may be exerted through the cephalic-phase secretion pathway mediated by taste buds. Copyright © 2010 Elsevier GmbH. All rights reserved.

  6. Yeast as a Heterologous Model System to Uncover Type III Effector Function.

    Directory of Open Access Journals (Sweden)

    Crina Popa

    2016-02-01

    Full Text Available Type III effectors (T3E are key virulence proteins that are injected by bacterial pathogens inside the cells of their host to subvert cellular processes and contribute to disease. The budding yeast Saccharomyces cerevisiae represents an important heterologous system for the functional characterisation of T3E proteins in a eukaryotic environment. Importantly, yeast contains eukaryotic processes with low redundancy and are devoid of immunity mechanisms that counteract T3Es and mask their function. Expression in yeast of effectors from both plant and animal pathogens that perturb conserved cellular processes often resulted in robust phenotypes that were exploited to elucidate effector functions, biochemical properties, and host targets. The genetic tractability of yeast and its amenability for high-throughput functional studies contributed to the success of this system that, in recent years, has been used to study over 100 effectors. Here, we provide a critical view on this body of work and describe advantages and limitations inherent to the use of yeast in T3E research. "Favourite" targets of T3Es in yeast are cytoskeleton components and small GTPases of the Rho family. We describe how mitogen-activated protein kinase (MAPK signalling, vesicle trafficking, membrane structures, and programmed cell death are also often altered by T3Es in yeast and how this reflects their function in the natural host. We describe how effector structure-function studies and analysis of candidate targeted processes or pathways can be carried out in yeast. We critically analyse technologies that have been used in yeast to assign biochemical functions to T3Es, including transcriptomics and proteomics, as well as suppressor, gain-of-function, or synthetic lethality screens. We also describe how yeast can be used to select for molecules that block T3E function in search of new antibacterial drugs with medical applications. Finally, we provide our opinion on the limitations

  7. Extraction of the number of peroxisomes in yeast cells by automated image analysis.

    Science.gov (United States)

    Niemistö, Antti; Selinummi, Jyrki; Saleem, Ramsey; Shmulevich, Ilya; Aitchison, John; Yli-Harja, Olli

    2006-01-01

    An automated image analysis method for extracting the number of peroxisomes in yeast cells is presented. Two images of the cell population are required for the method: a bright field microscope image from which the yeast cells are detected and the respective fluorescent image from which the number of peroxisomes in each cell is found. The segmentation of the cells is based on clustering the local mean-variance space. The watershed transformation is thereafter employed to separate cells that are clustered together. The peroxisomes are detected by thresholding the fluorescent image. The method is tested with several images of a budding yeast Saccharomyces cerevisiae population, and the results are compared with manually obtained results.

  8. GABA, its receptors, and GABAergic inhibition in mouse taste buds.

    Science.gov (United States)

    Dvoryanchikov, Gennady; Huang, Yijen A; Barro-Soria, Rene; Chaudhari, Nirupa; Roper, Stephen D

    2011-04-13

    Taste buds consist of at least three principal cell types that have different functions in processing gustatory signals: glial-like (type I) cells, receptor (type II) cells, and presynaptic (type III) cells. Using a combination of Ca2+ imaging, single-cell reverse transcriptase-PCR and immunostaining, we show that GABA is an inhibitory transmitter in mouse taste buds, acting on GABA(A) and GABA(B) receptors to suppress transmitter (ATP) secretion from receptor cells during taste stimulation. Specifically, receptor cells express GABA(A) receptor subunits β2, δ, and π, as well as GABA(B) receptors. In contrast, presynaptic cells express the GABA(A) β3 subunit and only occasionally GABA(B) receptors. In keeping with the distinct expression pattern of GABA receptors in presynaptic cells, we detected no GABAergic suppression of transmitter release from presynaptic cells. We suggest that GABA may serve function(s) in taste buds in addition to synaptic inhibition. Finally, we also defined the source of GABA in taste buds: GABA is synthesized by GAD65 in type I taste cells as well as by GAD67 in presynaptic (type III) taste cells and is stored in both those two cell types. We conclude that GABA is an inhibitory transmitter released during taste stimulation and possibly also during growth and differentiation of taste buds.

  9. Genetics of Yeasts

    Science.gov (United States)

    Querol, Amparo; Fernández-Espinar, M. Teresa; Belloch, Carmela

    The use of yeasts in biotechnology processes dates back to ancient days. Before 7000 BC, beer was produced in Sumeria. Wine was made in Assyria in 3500 BC, and ancient Rome had over 250 bakeries, which were making leavened bread by 100 BC. And milk has been made into Kefyr and Koumiss in Asia for many centuries (Demain, Phaff, & Kurtzman, 1999). However, the importance of yeast in the food and beverage industries was only realized about 1860, when their role in food manufacturing became evident.

  10. Preliminary results on seasonal changes in flower bud cold hardiness of sour cherry

    DEFF Research Database (Denmark)

    Liu, Guangping; Pagter, Majken; Andersen, Lillie

    2012-01-01

    . cerasus ‘Kelleriis 16’ under natural conditions, and investigated seasonal changes in flower bud cold hardiness of ‘Stevnsbaer Birgitte’. In a cold winter with unusual low temperatures in December, the injury rate of buds of ‘Stevnsbaer Birgitte’ was significantly higher than that of ‘Kelleriis 16......’, confirming that buds of the latter cultivar are considerably more cold hardy than buds of ‘Stevnsbaer Birgitte’. The majority of frost injuries in buds of ‘Stevnsbaer Birgitte’ occurred mid-winter, but dehardening appeared fast, indicating that the critical injury times of buds of ‘Stevnsbaer Birgitte...

  11. L-arabinose fermenting yeast

    Science.gov (United States)

    Zhang, Min; Singh, Arjun; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric; Suominen, Pirkko

    2010-12-07

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. Methods of producing ethanol include utilizing these modified yeast strains. ##STR00001##

  12. Differentiating pneumocystis cysts from Candida Sp. yeasts in pulmonary specimens using methenamine silver

    International Nuclear Information System (INIS)

    Chantiziantoniou, N.

    1996-01-01

    Pneumocystis carinii (PC) pneumonia in the immunocompromised patient requires therapeutic intervention; therefore, rapid identification of PC organisms in cytopathologic specimens is essential. Conclusive diagnoses of PC are achievable using Grocott's methenamine silver (GMS), the gold standard stain for PC cyst visualization. However, non-budding Candida sp. yeasts can stimulate PC cysts with GMS and thus pose significant diagnostic challenges. After qualitative and semi-quantitative analysis of 49 cytopulmonary cases, this study aimed to establish morphologic criteria that differentiate these organisms using GMS. The results showed that spherical/demilune PC cysts (4 to 7 microns in diameter) are monomorphic and mainly transparent, with intracyst densities being commonly evident. Demilune cysts typically display wall wrinkling with longitudinal clefts. Relative to cysts, Candida sp. yeasts reveal increased argyrophilia, range 4 to 10 microns in diameter, are mainly oval and budding, polymorphic and exhibit wall deformation with variable internal structure. Differentiating criteria are (a) budding; (b) cyst transparency, demilune shape; (c) longitudinal cyst clefts; (d) paired common-alike intracyst densities; (e) cyst monomprphism; (f) alveolar cast formations; (g) overall cystomorphologic presentation; and (h)relative argyrophilia. (author)

  13. Sharing the cell's bounty - organelle inheritance in yeast.

    Science.gov (United States)

    Knoblach, Barbara; Rachubinski, Richard A

    2015-02-15

    Eukaryotic cells replicate and partition their organelles between the mother cell and the daughter cell at cytokinesis. Polarized cells, notably the budding yeast Saccharomyces cerevisiae, are well suited for the study of organelle inheritance, as they facilitate an experimental dissection of organelle transport and retention processes. Much progress has been made in defining the molecular players involved in organelle partitioning in yeast. Each organelle uses a distinct set of factors - motor, anchor and adaptor proteins - that ensures its inheritance by future generations of cells. We propose that all organelles, regardless of origin or copy number, are partitioned by the same fundamental mechanism involving division and segregation. Thus, the mother cell keeps, and the daughter cell receives, their fair and equitable share of organelles. This mechanism of partitioning moreover facilitates the segregation of organelle fragments that are not functionally equivalent. In this Commentary, we describe how this principle of organelle population control affects peroxisomes and other organelles, and outline its implications for yeast life span and rejuvenation. © 2015. Published by The Company of Biologists Ltd.

  14. Precise estimates of mutation rate and spectrum in yeast

    Science.gov (United States)

    Zhu, Yuan O.; Siegal, Mark L.; Hall, David W.; Petrov, Dmitri A.

    2014-01-01

    Mutation is the ultimate source of genetic variation. The most direct and unbiased method of studying spontaneous mutations is via mutation accumulation (MA) lines. Until recently, MA experiments were limited by the cost of sequencing and thus provided us with small numbers of mutational events and therefore imprecise estimates of rates and patterns of mutation. We used whole-genome sequencing to identify nearly 1,000 spontaneous mutation events accumulated over ∼311,000 generations in 145 diploid MA lines of the budding yeast Saccharomyces cerevisiae. MA experiments are usually assumed to have negligible levels of selection, but even mild selection will remove strongly deleterious events. We take advantage of such patterns of selection and show that mutation classes such as indels and aneuploidies (especially monosomies) are proportionately much more likely to contribute mutations of large effect. We also provide conservative estimates of indel, aneuploidy, environment-dependent dominant lethal, and recessive lethal mutation rates. To our knowledge, for the first time in yeast MA data, we identified a sufficiently large number of single-nucleotide mutations to measure context-dependent mutation rates and were able to (i) confirm strong AT bias of mutation in yeast driven by high rate of mutations from C/G to T/A and (ii) detect a higher rate of mutation at C/G nucleotides in two specific contexts consistent with cytosine methylation in S. cerevisiae. PMID:24847077

  15. Mutant power: using mutant allele collections for yeast functional genomics.

    Science.gov (United States)

    Norman, Kaitlyn L; Kumar, Anuj

    2016-03-01

    The budding yeast has long served as a model eukaryote for the functional genomic analysis of highly conserved signaling pathways, cellular processes and mechanisms underlying human disease. The collection of reagents available for genomics in yeast is extensive, encompassing a growing diversity of mutant collections beyond gene deletion sets in the standard wild-type S288C genetic background. We review here three main types of mutant allele collections: transposon mutagen collections, essential gene collections and overexpression libraries. Each collection provides unique and identifiable alleles that can be utilized in genome-wide, high-throughput studies. These genomic reagents are particularly informative in identifying synthetic phenotypes and functions associated with essential genes, including those modeled most effectively in complex genetic backgrounds. Several examples of genomic studies in filamentous/pseudohyphal backgrounds are provided here to illustrate this point. Additionally, the limitations of each approach are examined. Collectively, these mutant allele collections in Saccharomyces cerevisiae and the related pathogenic yeast Candida albicans promise insights toward an advanced understanding of eukaryotic molecular and cellular biology. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please email: journals.permissions@oup.com.

  16. Reserve carbohydrates metabolism in the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    François, J; Parrou, J L

    2001-01-01

    Glycogen and trehalose are the two glucose stores of yeast cells. The large variations in the cell content of these two compounds in response to different environmental changes indicate that their metabolism is controlled by complex regulatory systems. In this review we present information on the regulation of the activity of the enzymes implicated in the pathways of synthesis and degradation of glycogen and trehalose as well as on the transcriptional control of the genes encoding them. cAMP and the protein kinases Snf1 and Pho85 appear as major actors in this regulation. From a metabolic point of view, glucose-6-phosphate seems the major effector in the net synthesis of glycogen and trehalose. We discuss also the implication of the recently elucidated TOR-dependent nutrient signalling pathway in the control of the yeast glucose stores and its integration in growth and cell division. The unexpected roles of glycogen and trehalose found in the control of glycolytic flux, stress responses and energy stores for the budding process, demonstrate that their presence confers survival and reproductive advantages to the cell. The findings discussed provide for the first time a teleonomic value for the presence of two different glucose stores in the yeast cell.

  17. Structural properties of replication origins in yeast DNA sequences

    International Nuclear Information System (INIS)

    Cao Xiaoqin; Zeng Jia; Yan Hong

    2008-01-01

    Sequence-dependent DNA flexibility is an important structural property originating from the DNA 3D structure. In this paper, we investigate the DNA flexibility of the budding yeast (S. Cerevisiae) replication origins on a genome-wide scale using flexibility parameters from two different models, the trinucleotide and the tetranucleotide models. Based on analyzing average flexibility profiles of 270 replication origins, we find that yeast replication origins are significantly rigid compared with their surrounding genomic regions. To further understand the highly distinctive property of replication origins, we compare the flexibility patterns between yeast replication origins and promoters, and find that they both contain significantly rigid DNAs. Our results suggest that DNA flexibility is an important factor that helps proteins recognize and bind the target sites in order to initiate DNA replication. Inspired by the role of the rigid region in promoters, we speculate that the rigid replication origins may facilitate binding of proteins, including the origin recognition complex (ORC), Cdc6, Cdt1 and the MCM2-7 complex

  18. Adventitious bud regeneration from the stigma of Sinapis alba L.

    Directory of Open Access Journals (Sweden)

    Elżbieta Zenkteler

    2012-12-01

    Full Text Available Stigmas isolated from flower buds of 'Nakielska' variety of Sinapis alba were used to develop a micropropagation method suitable for breeding of new cultivars. The origin of adventitious bud regeneration was studied on MS medium, under stimulation by bezylaminopurine (BAP in combination with 2,4-D - dichlorophenoxyacetic acid (2,4-D. Histological analysis showed the structure of Sinapis stigma (composed from four types of tissue: papillae, transmitting tissue, parenchyma and vascular bundles and revealed that numerous meristematic centers developed from parenchyma cells in close vicinity of vascular bundles. Buds very quickly appeared on the surface of initial explants and later formed multiplantlets that were easily rooted in the soil.

  19. Light Signaling in Bud Outgrowth and Branching in Plants

    Directory of Open Access Journals (Sweden)

    Nathalie Leduc

    2014-04-01

    Full Text Available Branching determines the final shape of plants, which influences adaptation, survival and the visual quality of many species. It is an intricate process that includes bud outgrowth and shoot extension, and these in turn respond to environmental cues and light conditions. Light is a powerful environmental factor that impacts multiple processes throughout plant life. The molecular basis of the perception and transduction of the light signal within buds is poorly understood and undoubtedly requires to be further unravelled. This review is based on current knowledge on bud outgrowth-related mechanisms and light-mediated regulation of many physiological processes. It provides an extensive, though not exhaustive, overview of the findings related to this field. In parallel, it points to issues to be addressed in the near future.

  20. Role of the ectonucleotidase NTPDase2 in taste bud function.

    Science.gov (United States)

    Vandenbeuch, Aurelie; Anderson, Catherine B; Parnes, Jason; Enjyoji, Keiichi; Robson, Simon C; Finger, Thomas E; Kinnamon, Sue C

    2013-09-03

    Taste buds are unusual in requiring ATP as a transmitter to activate sensory nerve fibers. In response to taste stimuli, taste cells release ATP, activating purinergic receptors containing the P2X2 and P2X3 subunits on taste nerves. In turn, the released ATP is hydrolyzed to ADP by a plasma membrane nucleoside triphosphate previously identified as nucleoside triphosphate diphosphohydrolase-2 (NTPDase2). In this paper we investigate the role of this ectonucleotidase in the function of taste buds by examining gene-targeted Entpd2-null mice globally lacking NTPDase2. RT-PCR confirmed the absence of NTPDase2, and ATPase enzyme histochemistry reveals no reaction product in taste buds of knockout mice, suggesting that NTPDase2 is the dominant form in taste buds. RT-PCR and immunocytochemistry demonstrated that in knockout mice all cell types are present in taste buds, even those cells normally expressing NTPDase2. In addition, the overall number and size of taste buds are normal in Entpd2-null mice. Luciferin/luciferase assays of circumvallate tissue of knockout mice detected elevated levels of extracellular ATP. Electrophysiological recordings from two taste nerves, the chorda tympani and glossopharyngeal, revealed depressed responses to all taste stimuli in Entpd2-null mice. Responses were more depressed in the glossopharyngeal nerve than in the chorda tympani nerve and involved all taste qualities; responses in the chorda tympani were more depressed to sweet and umami stimuli than to other qualities. We suggest that the excessive levels of extracellular ATP in the Entpd2-knockout animals desensitize the P2X receptors associated with nerve fibers, thereby depressing taste responses.

  1. Molecular analysis of radiation injury in rat taste buds

    International Nuclear Information System (INIS)

    Nakagawa, K.; Abe, K.

    2003-01-01

    Full text: A critical adverse effect of radiation therapy for head and neck cancer is the resulting decreased sense of taste, which greatly impairs patients' quality of life. Irradiation of the head and neck area decreases the sense of taste within one or two weeks and recovery takes about one month. Although taste bud cells are intimately involved in these manifestations, few basic studies in this area have been reported. Here, we investigate the injury and recovery process of taste bud tissue after irradiation, at the molecular and cellular levels. Rat tongues were selectively irradiated once with 15 Gy of 6 MV X-rays. Immediately thereafter and at periods up to 30 days samples were collected for HE staining, BrdU labelling, p21 and p53 immunohistochemistry, and TUNEL staining. Six days after irradiation, morphologically-identified taste bud cells, as well as the surrounding epithelial tissue, were no longer visible. Immature bud cells reappeared ten days after irradiation, and looked morphologically normal at 13 to 15 days.BrdU labelling revealed DNA synthesis arrest in of epithelial cells 10 days after irradiation. Cells in the basal layer expressed p21 four hours after irradiation. Prior to that, it, p53 accumulation was observed in the nucleus. Expression of p21 was no longer detectable by on the sixth day or later, and DNA synthesis resumed around the eighth day. No apoptosis was detected at any time. The disappearance and reappearance of taste bud cells after a single 15-Gy irradiation dose can be explained by temporary cell cycle arrest in taste bud stem cells, which is regulated by p21

  2. Yeast Infection during Pregnancy

    Science.gov (United States)

    ... disrupt the pH balance of the vagina. Common yeast infection symptoms include vaginal itching and a white, thick discharge that looks ... and Prevention. http://www.cdc.gov/std/tg2015/candidiasis.htm. Accessed Aug. 27, ... Vagina, Cervix, Toxic Shock Syndrome, Endometritis, and Salpingitis. In: ...

  3. Polysome Profile Analysis - Yeast

    Czech Academy of Sciences Publication Activity Database

    Pospíšek, M.; Valášek, Leoš Shivaya

    2013-01-01

    Roč. 530, č. 2013 (2013), s. 173-181 ISSN 0076-6879 Institutional support: RVO:61388971 Keywords : grow yeast cultures * polysome profile analysis * sucrose density gradient centrifugation Subject RIV: CE - Biochemistry Impact factor: 2.194, year: 2013

  4. L-arabinose fermenting yeast

    Science.gov (United States)

    Zhang, Min; Singh, Arjun; Suominen, Pirkko; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric

    2013-02-12

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

  5. RESEARCH OF SOPHORA JAPONICA L. FLOWER BUDS VOLATILE COMPOUNDS WITH GAS-CHROMATOGRAPHY/MASS- SPECTROMETRY METHOD

    Directory of Open Access Journals (Sweden)

    Cholak I.S.

    2013-10-01

    Full Text Available This work represents the results of the research ofessential oil contained in Sophora japonica L. flowerbuds volatile compounds collected during the nextstages of their development: green flower buds, formedflower buds and the beginning of flower buds opening.Essential oil assay content in Sophora japonica L.flower buds was determined with hydrodistillationmethod. Content of essential oil in the raw material isless than 0,1%. Qualitative composition and assaycontent of Sophora japonica L. flower buds essential oilconstituents were determined with chromato-massspectrometry method. In consequence of the research 80constituents were identified in Sophora japonica L.flower buds out of which 61 substances are during thegreen flower buds and beginning of flower budsopening stages, 66 substances are during formed flowerbuds stage. Substances are represented by aliphatic andcyclic terpenoids, their alcohols and ketones. Mostvolatile substances were extracted on the stage offormed buds.

  6. Effect of gamma irradiated parenchyma on the growth of irradiated potato tuber buds

    International Nuclear Information System (INIS)

    Fernandez Gonzalez, J.; Garcia Collantes, M. A.

    1976-01-01

    The development of buds greffed on irradiated potato parenchyma was studied. The irradiated parenchyma does not influence the sprouting capacity of buds, but it affects the way they develop. (Author) 9 refs

  7. Taste bud development and patterning in sighted and blind morphs of Astyanax mexicanus.

    Science.gov (United States)

    Varatharasan, Nirupa; Croll, Roger P; Franz-Odendaal, Tamara

    2009-12-01

    In the blind cave-dwelling morph of A. mexicanus, the eye degenerates while other sensory systems, such as gustation, are expanded compared to their sighted (surface-dwelling) ancestor. This study compares the development of taste buds along the jaws of each morph. To determine whether cavefish have an altered onset or rate of taste bud development, we fluorescently labeled basal and receptor cells within taste buds over a developmental series. Our results show that taste bud number increases during development in both morphs. The rate of development is, however, accelerated in cavefish; a small difference in taste bud number exists at 5 dpf reaching threefold by 22 dpf. The expansion of taste buds in cavefish is, therefore, detectable after the onset of eye degeneration. This study provides important insights into the timing of taste bud expansion in cavefish as well as enhances our understanding of taste bud development in teleosts in general. (c) 2009 Wiley-Liss, Inc.

  8. Yeast ecology of Kombucha fermentation.

    Science.gov (United States)

    Teoh, Ai Leng; Heard, Gillian; Cox, Julian

    2004-09-01

    Kombucha is a traditional fermentation of sweetened tea, involving a symbiosis of yeast species and acetic acid bacteria. Despite reports of different yeast species being associated with the fermentation, little is known of the quantitative ecology of yeasts in Kombucha. Using oxytetracycline-supplemented malt extract agar, yeasts were isolated from four commercially available Kombucha products and identified using conventional biochemical and physiological tests. During the fermentation of each of the four products, yeasts were enumerated from both the cellulosic pellicle and liquor of the Kombucha. The number and diversity of species varied between products, but included Brettanomyces bruxellensis, Candida stellata, Schizosaccharomyces pombe, Torulaspora delbrueckii and Zygosaccharomyces bailii. While these yeast species are known to occur in Kombucha, the enumeration of each species present throughout fermentation of each of the four Kombucha cultures demonstrated for the first time the dynamic nature of the yeast ecology. Kombucha fermentation is, in general, initiated by osmotolerant species, succeeded and ultimately dominated by acid-tolerant species.

  9. Small molecule inhibitors of the Candida albicans budded-to-hyphal transition act through multiple signaling pathways.

    Directory of Open Access Journals (Sweden)

    John Midkiff

    Full Text Available The ability of the pathogenic yeast Candida albicans to interconvert between budded and hyphal growth states, herein termed the budded-to-hyphal transition (BHT, is important for C. albicans development and virulence. The BHT is under the control of multiple cell signaling pathways that respond to external stimuli, including nutrient availability, high temperature, and pH. Previous studies identified 21 small molecules that could inhibit the C. albicans BHT in response to carbon limitation in Spider media. However, the studies herein show that the BHT inhibitors had varying efficacies in other hyphal-inducing media, reflecting their varying abilities to block signaling pathways associated with the different media. Chemical epistasis analyses suggest that most, but not all, of the BHT inhibitors were acting through either the Efg1 or Cph1 signaling pathways. Notably, the BHT inhibitor clozapine, a FDA-approved drug used to treat atypical schizophrenia by inhibiting G-protein-coupled dopamine receptors in the brain, and several of its functional analogs were shown to act at the level of the Gpr1 G-protein-coupled receptor. These studies are the first step in determining the target and mechanism of action of these BHT inhibitors, which may have therapeutic anti-fungal utility in the future.

  10. β-Catenin signaling regulates temporally discrete phases of anterior taste bud development

    OpenAIRE

    Thirumangalathu, Shoba; Barlow, Linda A.

    2015-01-01

    The sense of taste is mediated by multicellular taste buds located within taste papillae on the tongue. In mice, individual taste buds reside in fungiform papillae, which develop at mid-gestation as epithelial placodes in the anterior tongue. Taste placodes comprise taste bud precursor cells, which express the secreted factor sonic hedgehog (Shh) and give rise to taste bud cells that differentiate around birth. We showed previously that epithelial activation of β-catenin is the primary induct...

  11. Qualitative and quantitative differences between taste buds of the rat and mouse

    OpenAIRE

    Ma Huazhi; Yang Ruibiao; Thomas Stacey M; Kinnamon John C

    2007-01-01

    Abstract Background Numerous electrophysiological, ultrastructural, and immunocytochemical studies on rodent taste buds have been carried out on rat taste buds. In recent years, however, the mouse has become the species of choice for molecular and other studies on sensory transduction in taste buds. Do rat and mouse taste buds have the same cell types, sensory transduction markers and synaptic proteins? In the present study we have used antisera directed against PLCβ2, α-gustducin, serotonin ...

  12. Heterogeneity of fish taste bud ultrastructure as demonstrated in the holosteans Amia calva and Lepisosteus oculatus.

    OpenAIRE

    Reutter, K; Boudriot, F; Witt, M

    2000-01-01

    Taste buds are the peripheral sensory organs of the gustatory system. They occur in all taxa of vertebrates and are pear-shaped intra-epithelial organs of about 80 microm height and 50 microm width. Taste buds mainly consist of specialized epithelial cells, which synapse at their bases and therefore are secondary sensory cells. Taste buds have been described based on studies of teleostean species, but it turned out that the ultrastructure of teleostean taste buds may differ between distinct s...

  13. Induction of ectopic taste buds by SHH reveals the competency and plasticity of adult lingual epithelium

    Science.gov (United States)

    Castillo, David; Seidel, Kerstin; Salcedo, Ernesto; Ahn, Christina; de Sauvage, Frederic J.; Klein, Ophir D.; Barlow, Linda A.

    2014-01-01

    Taste buds are assemblies of elongated epithelial cells, which are innervated by gustatory nerves that transmit taste information to the brain stem. Taste cells are continuously renewed throughout life via proliferation of epithelial progenitors, but the molecular regulation of this process remains unknown. During embryogenesis, sonic hedgehog (SHH) negatively regulates taste bud patterning, such that inhibition of SHH causes the formation of more and larger taste bud primordia, including in regions of the tongue normally devoid of taste buds. Here, using a Cre-lox system to drive constitutive expression of SHH, we identify the effects of SHH on the lingual epithelium of adult mice. We show that misexpression of SHH transforms lingual epithelial cell fate, such that daughter cells of lingual epithelial progenitors form cell type-replete, onion-shaped taste buds, rather than non-taste, pseudostratified epithelium. These SHH-induced ectopic taste buds are found in regions of the adult tongue previously thought incapable of generating taste organs. The ectopic buds are composed of all taste cell types, including support cells and detectors of sweet, bitter, umami, salt and sour, and recapitulate the molecular differentiation process of endogenous taste buds. In contrast to the well-established nerve dependence of endogenous taste buds, however, ectopic taste buds form independently of both gustatory and somatosensory innervation. As innervation is required for SHH expression by endogenous taste buds, our data suggest that SHH can replace the need for innervation to drive the entire program of taste bud differentiation. PMID:24993944

  14. The Sprouting Potential of Dormant Buds on the Bole of Pole-Size Sugar Maple

    Science.gov (United States)

    Richard M. Godman; Gilbert A. Mattson

    1970-01-01

    A study of epicormic sprouting in pole-size sugar maples showed that all visible dormant buds on the bole were capable of producing epicormic shoots. The buds were induced to break dormancy by applying four methods of crown removal known to stimulate sprouting. The amount of crown removed determined the year that the buds broke dormancy; this may be accounted for by...

  15. Visible dormant buds as related to tree diameter and log position

    Science.gov (United States)

    H. Clay Smith

    1967-01-01

    Red oaks and yellow-poplars in a stand of second-growth cove hardwoods in West Virginia were studied to determine whether visible dormant buds are related to tree size or log position. No correlation was found between dormant buds and tree size, for either species; but yellow-poplars had a significantly greater number of buds on the upper log.

  16. Effects of bud loading levels and nitrogen doses on yield, physical ...

    African Journals Online (AJOL)

    The aim of this study was to investigate the effects of several bud loading levels in winter pruning and nitrogen doses on yield and physical and chemical properties of fresh vine-leaves of grape cultivar “Narince”. Vines trained with bilateral cordon system was pruned to yield 35000 to 53000 buds/ha (16 or 24 buds/vine) ...

  17. Developmental control of hypoxia during bud burst in grapevine.

    Science.gov (United States)

    Meitha, Karlia; Agudelo-Romero, Patricia; Signorelli, Santiago; Gibbs, Daniel J; Considine, John A; Foyer, Christine H; Considine, Michael J

    2018-05-01

    Dormant or quiescent buds of woody perennials are often dense and in the case of grapevine (Vitis vinifera L.) have a low tissue oxygen status. The precise timing of the decision to resume growth is difficult to predict, but once committed, the increase in tissue oxygen status is rapid and developmentally regulated. Here, we show that more than a third of the grapevine homologues of widely conserved hypoxia-responsive genes and nearly a fifth of all grapevine genes possessing a plant hypoxia-responsive promoter element were differentially regulated during bud burst, in apparent harmony with resumption of meristem identity and cell-cycle gene regulation. We then investigated the molecular and biochemical properties of the grapevine ERF-VII homologues, which in other species are oxygen labile and function in transcriptional regulation of hypoxia-responsive genes. Each of the 3 VvERF-VIIs were substrates for oxygen-dependent proteolysis in vitro, as a function of the N-terminal cysteine. Collectively, these data support an important developmental function of oxygen-dependent signalling in determining the timing and effective coordination bud burst in grapevine. In addition, novel regulators, including GASA-, TCP-, MYB3R-, PLT-, and WUS-like transcription factors, were identified as hallmarks of the orderly and functional resumption of growth following quiescence in buds. © 2018 John Wiley & Sons Ltd.

  18. presence of axillary bud and application of plant growth hormones

    African Journals Online (AJOL)

    D. alata)- were grown in pots in the greenhouse. Half the cuttings bore axillary buds and half had none. The cuttings were sprayed with a factorial combination of indole acetic acid (IAA), benzyladenine (BA) and giberellic acid (GA3). Cuttings ...

  19. Structure and Chromosomal Organization of Yeast Genes Regulated by Topoisomerase II.

    Science.gov (United States)

    Joshi, Ricky S; Nikolaou, Christoforos; Roca, Joaquim

    2018-01-03

    Cellular DNA topoisomerases (topo I and topo II) are highly conserved enzymes that regulate the topology of DNA during normal genome transactions, such as DNA transcription and replication. In budding yeast, topo I is dispensable whereas topo II is essential, suggesting fundamental and exclusive roles for topo II, which might include the functions of the topo IIa and topo IIb isoforms found in mammalian cells. In this review, we discuss major findings of the structure and chromosomal organization of genes regulated by topo II in budding yeast. Experimental data was derived from short (10 min) and long term (120 min) responses to topo II inactivation in top-2 ts mutants. First, we discuss how short term responses reveal a subset of yeast genes that are regulated by topo II depending on their promoter architecture. These short term responses also uncovered topo II regulation of transcription across multi-gene clusters, plausibly by common DNA topology management. Finally, we examine the effects of deactivated topo II on the elongation of RNA transcripts. Each study provides an insight into the particular chromatin structure that interacts with the activity of topo II. These findings are of notable clinical interest as numerous anti-cancer therapies interfere with topo II activity.

  20. A Global Protein Kinase and Phosphatase Interaction Network in Yeast

    Science.gov (United States)

    Breitkreutz, Ashton; Choi, Hyungwon; Sharom, Jeffrey R.; Boucher, Lorrie; Neduva, Victor; Larsen, Brett; Lin, Zhen-Yuan; Breitkreutz, Bobby-Joe; Stark, Chris; Liu, Guomin; Ahn, Jessica; Dewar-Darch, Danielle; Reguly, Teresa; Tang, Xiaojing; Almeida, Ricardo; Qin, Zhaohui Steve; Pawson, Tony; Gingras, Anne-Claude; Nesvizhskii, Alexey I.; Tyers, Mike

    2011-01-01

    The interactions of protein kinases and phosphatases with their regulatory subunits and substrates underpin cellular regulation. We identified a kinase and phosphatase interaction (KPI) network of 1844 interactions in budding yeast by mass spectrometric analysis of protein complexes. The KPI network contained many dense local regions of interactions that suggested new functions. Notably, the cell cycle phosphatase Cdc14 associated with multiple kinases that revealed roles for Cdc14 in mitogen-activated protein kinase signaling, the DNA damage response, and metabolism, whereas interactions of the target of rapamycin complex 1 (TORC1) uncovered new effector kinases in nitrogen and carbon metabolism. An extensive backbone of kinase-kinase interactions cross-connects the proteome and may serve to coordinate diverse cellular responses. PMID:20489023

  1. Construction of the first compendium of chemical-genetic profiles in the fission yeast Schizosaccharomyces pombe and comparative compendium approach

    Energy Technology Data Exchange (ETDEWEB)

    Han, Sangjo [Bioinformatics Lab, Healthcare Group, SK Telecom, 9-1, Sunae-dong, Pundang-gu, Sungnam-si, Kyunggi-do 463-784 (Korea, Republic of); Lee, Minho [Department of Bio and Brain Engineering, Korea Advanced Institute of Science and Technology, 291 Daehak-ro, Yuseong-gu, Daejeon 305-701 (Korea, Republic of); Chang, Hyeshik [Department of Biological Science, Seoul National University, 599 Gwanakro, Gwanak-gu, Seoul 151-747 (Korea, Republic of); Nam, Miyoung [Department of New Drug Discovery and Development, Chungnam National University, 99 Daehak-ro, Yuseong-gu, Daejeon, 305-764 (Korea, Republic of); Park, Han-Oh [Bioneer Corp., 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 306-220 (Korea, Republic of); Kwak, Youn-Sig [Department of Applied Biology, Gyeongsang National University, 501 Jinju-daero, Jinju, Gyeongnam 660-701 (Korea, Republic of); Ha, Hye-jeong [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-Gu, Daejeon 305-806 (Korea, Republic of); Kim, Dongsup [Department of Bio and Brain Engineering, Korea Advanced Institute of Science and Technology, 291 Daehak-ro, Yuseong-gu, Daejeon 305-701 (Korea, Republic of); Hwang, Sung-Ook [Department of Obstetrics and Gynecology, Inha University Hospital, 7-206 Sinheung-dong, Jung-gu, Incheon 400-711 (Korea, Republic of); Hoe, Kwang-Lae [Department of New Drug Discovery and Development, Chungnam National University, 99 Daehak-ro, Yuseong-gu, Daejeon, 305-764 (Korea, Republic of); Kim, Dong-Uk [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-Gu, Daejeon 305-806 (Korea, Republic of)

    2013-07-12

    Highlights: •The first compendium of chemical-genetic profiles form fission yeast was generated. •The first HTS of drug mode-of-action in fission yeast was performed. •The first comparative chemical genetic analysis between two yeasts was conducted. -- Abstract: Genome-wide chemical genetic profiles in Saccharomyces cerevisiae since the budding yeast deletion library construction have been successfully used to reveal unknown mode-of-actions of drugs. Here, we introduce comparative approach to infer drug target proteins more accurately using two compendiums of chemical-genetic profiles from the budding yeast S. cerevisiae and the fission yeast Schizosaccharomyces pombe. For the first time, we established DNA-chip based growth defect measurement of genome-wide deletion strains of S. pombe, and then applied 47 drugs to the pooled heterozygous deletion strains to generate chemical-genetic profiles in S. pombe. In our approach, putative drug targets were inferred from strains hypersensitive to given drugs by analyzing S. pombe and S. cerevisiae compendiums. Notably, many evidences in the literature revealed that the inferred target genes of fungicide and bactericide identified by such comparative approach are in fact the direct targets. Furthermore, by filtering out the genes with no essentiality, the multi-drug sensitivity genes, and the genes with less eukaryotic conservation, we created a set of drug target gene candidates that are expected to be directly affected by a given drug in human cells. Our study demonstrated that it is highly beneficial to construct the multiple compendiums of chemical genetic profiles using many different species. The fission yeast chemical-genetic compendium is available at (http://pombe.kaist.ac.kr/compendium)

  2. Yeast glycolipid biosurfactants.

    Science.gov (United States)

    Jezierska, Sylwia; Claus, Silke; Van Bogaert, Inge

    2017-10-25

    Various yeasts, both conventional and exotic ones, are known to produce compounds useful to mankind. Ethanol is the most known of these compounds, but more complex molecules such as amphiphilic biosurfactants can also be derived from eukaryotic microorganisms at an industrially and commercially relevant scale. Among them, glycolipids are the most promising, due to their attractive properties and high product titers. Many of these compounds can be considered as secondary metabolites with a specific function for the host. Hence, a dedicated biosynthetic process enables regulation and combines pathways delivering the lipidic moiety and the hydrophilic carbohydrate part of the glycolipid. In this Review, we will discuss the biosynthetic and regulatory aspects of the yeast-derived sophorolipids, mannosylerythritol lipids, and cellobiose lipids, with special emphasis on the relation between glycolipid synthesis and the general lipid metabolism. © 2017 Federation of European Biochemical Societies.

  3. Genetically engineered yeast

    DEFF Research Database (Denmark)

    2014-01-01

    A genetically modified Saccharomyces cerevisiae comprising an active fermentation pathway producing 3-HP expresses an exogenous gene expressing the aminotransferase YhxA from Bacillus cereus AH1272 catalysing a transamination reaction between beta-alanine and pyruvate to produce malonate semialde......A genetically modified Saccharomyces cerevisiae comprising an active fermentation pathway producing 3-HP expresses an exogenous gene expressing the aminotransferase YhxA from Bacillus cereus AH1272 catalysing a transamination reaction between beta-alanine and pyruvate to produce malonate...... semialdehyde. The yeast may also express a 3-hydroxyisobutyrate dehydrogenase (HIBADH) and a 3-hydroxypropanoate dehydrogenase (3-HPDH) and aspartate 1-decarboxylase. Additionally the yeast may express pyruvate carboxylase and aspartate aminotransferase....

  4. Influence of temperature on bud break, shoot growth, flower bud atrophy and winter production of glasshouse roses

    NARCIS (Netherlands)

    Berg, van den G.A.

    1987-01-01

    The influence of temperature in the range 15-22 °C on growth, production, quality and flower bud atrophy ('blindness') of the rose cultivars Sweet Promise and Varlon was studied. The roses were grown in Dutch glasshouse soil under natural light conditions and studied from October until May

  5. Evolution of the hemiascomycete yeasts: on life styles and the importance of inbreeding.

    Science.gov (United States)

    Knop, Michael

    2006-07-01

    The term 'breeding system' is used to describe the morphological and behavioural aspects of the sexual life cycle of a species. The yeast breeding system provides three alternatives that enable hapoids to return to the diploid state that is necessary for meiosis: mating of unrelated haploids (amphimixis), mating between spores from the same tetrad (intratetrad mating, automixis) and mother daughter mating upon mating type switching (haplo-selfing). The frequency of specific mating events affects the level of heterozygosity present in individuals and the genetic diversity of populations. This review discusses the reproductive strategies of yeasts, in particular S. cerevisiae (Bakers' or budding yeast). Emphasis is put on intratetrad mating, its implication for diversity, and how the particular genome structure could have evolved to ensure the preservation of a high degree of heterozygosity in conjunction with frequent intratetrad matings. I also discuss how the ability of yeast to control the number of spores that are formed accounts for high intratetrad mating rates and for enhanced transmission of genomic variation. I extend the discussion to natural genetic variation and propose that a high level of plasticity is inherent in the yeast breeding system, which may allow variation of the breeding behaviour in accordance with the needs imposed by the environment. (c) 2006 Wiley Periodicals, Inc.

  6. Fungal spore germination into yeast or mycelium: possible implications of dimorphism in evolution and human pathogenesis

    Science.gov (United States)

    Ghormade, Vandana; Deshpande, M. V.

    The ability of dimorphism in fungi is conventionally regarded as a reversible change between the two vegetative forms, yeast and mycelium, in response to environmental change. A zygomycetous isolate, Benjaminiella poitrasii, exhibited yeast-mycelium transition in response to the change in temperature (37-28 °C) and decrease in glucose concentration. For the first time the presence of dimorphic response during asexual and sexual spore germination is reported under the dimorphism-triggering conditions in B. poitrasii. The zygospores germinated into budding yeast when subjected to yeast-form supporting conditions. The mycelium-form favoring conditions gave rise to true mycelium. Similarly, the asexual spores displayed a dimorphic response during germination. Our observations suggest that dimorphism is an intrinsic ability present in the vegetative, asexual, and sexual forms of the fungus. As dimorphic fungi are intermediate to the unicellular yeast and the filamentous forms, understanding of the dimorphic character could be useful to trace the evolutionary relationships among taxonomically different fungi. Moreover, the implications of spore germination during the onset of pathogenesis and in drug development for human health care are discussed.

  7. Off-target effects of psychoactive drugs revealed by genome-wide assays in yeast.

    Directory of Open Access Journals (Sweden)

    Elke Ericson

    2008-08-01

    Full Text Available To better understand off-target effects of widely prescribed psychoactive drugs, we performed a comprehensive series of chemogenomic screens using the budding yeast Saccharomyces cerevisiae as a model system. Because the known human targets of these drugs do not exist in yeast, we could employ the yeast gene deletion collections and parallel fitness profiling to explore potential off-target effects in a genome-wide manner. Among 214 tested, documented psychoactive drugs, we identified 81 compounds that inhibited wild-type yeast growth and were thus selected for genome-wide fitness profiling. Many of these drugs had a propensity to affect multiple cellular functions. The sensitivity profiles of half of the analyzed drugs were enriched for core cellular processes such as secretion, protein folding, RNA processing, and chromatin structure. Interestingly, fluoxetine (Prozac interfered with establishment of cell polarity, cyproheptadine (Periactin targeted essential genes with chromatin-remodeling roles, while paroxetine (Paxil interfered with essential RNA metabolism genes, suggesting potential secondary drug targets. We also found that the more recently developed atypical antipsychotic clozapine (Clozaril had no fewer off-target effects in yeast than the typical antipsychotics haloperidol (Haldol and pimozide (Orap. Our results suggest that model organism pharmacogenetic studies provide a rational foundation for understanding the off-target effects of clinically important psychoactive agents and suggest a rational means both for devising compound derivatives with fewer side effects and for tailoring drug treatment to individual patient genotypes.

  8. Structural differences between yeast and mammalian microtubules revealed by cryo-EM

    Energy Technology Data Exchange (ETDEWEB)

    Howes, Stuart C. [Univ. of California, Berkeley, CA (United States). Biophysics Graduate Group; Geyer, Elisabeth A. [Univ. of Texas Southwestern Medical Center, Dallas, TX (United States). Dept. of Biophysics; Univ. of Texas Southwestern Medical Center, Dallas, TX (United States). Dept. of Biochemistry; LaFrance, Benjamin [Univ. of California, Berkeley, CA (United States). Molecular and Cell Biology Graduate Program; Zhang, Rui [Univ. of California, Berkeley, CA (United States). Howard Hughes Medical Inst.; Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Molecular Biophysics and Integrated Bioimaging Division; Kellogg, Elizabeth H. [Univ. of California, Berkeley, CA (United States). Howard Hughes Medical Inst.; Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Molecular Biophysics and Integrated Bioimaging Division; Westermann, Stefan [Univ. of Duisburg-Essen, Essen (Germany). Dept. of Molecular Genetics, Center for Medical Biotechnology; Rice, Luke M. [Univ. of Texas Southwestern Medical Center, Dallas, TX (United States). Dept. of Biophysics; Univ. of Texas Southwestern Medical Center, Dallas, TX (United States). Dept. of Biochemistry; Nogales, Eva [Univ. of California, Berkeley, CA (United States). Howard Hughes Medical Inst.; Univ. of California, Berkeley, CA (United States). Dept. of Molecular Biology and California Inst. for Quantitative Biosciences; Lawrence Berkeley National Lab. (LBNL), Berkeley, CA (United States). Molecular Biophysics and Integrated Bioimaging Division

    2017-06-26

    Microtubules are polymers of αβ-tubulin heterodimers essential for all eukaryotes. Despite sequence conservation, there are significant structural differences between microtubules assembled in vitro from mammalian or budding yeast tubulin. Yeast MTs were not observed to undergo compaction at the interdimer interface as seen for mammalian microtubules upon GTP hydrolysis. Lack of compaction might reflect slower GTP hydrolysis or a different degree of allosteric coupling in the lattice. The microtubule plus end–tracking protein Bim1 binds yeast microtubules both between αβ-tubulin heterodimers, as seen for other organisms, and within tubulin dimers, but binds mammalian tubulin only at interdimer contacts. At the concentrations used in cryo-electron microscopy, Bim1 causes the compaction of yeast microtubules and induces their rapid disassembly. In conclusion, our studies demonstrate structural differences between yeast and mammalian microtubules that likely underlie their differing polymerization dynamics. These differences may reflect adaptations to the demands of different cell size or range of physiological growth temperatures.

  9. Regulation of the yeast metabolic cycle by transcription factors with periodic activities

    Directory of Open Access Journals (Sweden)

    Pellegrini Matteo

    2011-10-01

    Full Text Available Abstract Background When growing budding yeast under continuous, nutrient-limited conditions, over half of yeast genes exhibit periodic expression patterns. Periodicity can also be observed in respiration, in the timing of cell division, as well as in various metabolite levels. Knowing the transcription factors involved in the yeast metabolic cycle is helpful for determining the cascade of regulatory events that cause these patterns. Results Transcription factor activities were estimated by linear regression using time series and genome-wide transcription factor binding data. Time-translation matrices were estimated using least squares and were used to model the interactions between the most significant transcription factors. The top transcription factors have functions involving respiration, cell cycle events, amino acid metabolism and glycolysis. Key regulators of transitions between phases of the yeast metabolic cycle appear to be Hap1, Hap4, Gcn4, Msn4, Swi6 and Adr1. Conclusions Analysis of the phases at which transcription factor activities peak supports previous findings suggesting that the various cellular functions occur during specific phases of the yeast metabolic cycle.

  10. Membrane-elasticity model of Coatless vesicle budding induced by ESCRT complexes.

    Directory of Open Access Journals (Sweden)

    Bartosz Różycki

    Full Text Available The formation of vesicles is essential for many biological processes, in particular for the trafficking of membrane proteins within cells. The Endosomal Sorting Complex Required for Transport (ESCRT directs membrane budding away from the cytosol. Unlike other vesicle formation pathways, the ESCRT-mediated budding occurs without a protein coat. Here, we propose a minimal model of ESCRT-induced vesicle budding. Our model is based on recent experimental observations from direct fluorescence microscopy imaging that show ESCRT proteins colocalized only in the neck region of membrane buds. The model, cast in the framework of membrane elasticity theory, reproduces the experimentally observed vesicle morphologies with physically meaningful parameters. In this parameter range, the minimum energy configurations of the membrane are coatless buds with ESCRTs localized in the bud neck, consistent with experiment. The minimum energy configurations agree with those seen in the fluorescence images, with respect to both bud shapes and ESCRT protein localization. On the basis of our model, we identify distinct mechanistic pathways for the ESCRT-mediated budding process. The bud size is determined by membrane material parameters, explaining the narrow yet different bud size distributions in vitro and in vivo. Our membrane elasticity model thus sheds light on the energetics and possible mechanisms of ESCRT-induced membrane budding.

  11. Labeling and analysis of chicken taste buds using molecular markers in oral epithelial sheets.

    Science.gov (United States)

    Rajapaksha, Prasangi; Wang, Zhonghou; Venkatesan, Nandakumar; Tehrani, Kayvan F; Payne, Jason; Swetenburg, Raymond L; Kawabata, Fuminori; Tabata, Shoji; Mortensen, Luke J; Stice, Steven L; Beckstead, Robert; Liu, Hong-Xiang

    2016-11-17

    In chickens, the sensory organs for taste are the taste buds in the oral cavity, of which there are ~240-360 in total number as estimated by scanning electron microscopy (SEM). There is not an easy way to visualize all taste buds in chickens. Here, we report a highly efficient method for labeling chicken taste buds in oral epithelial sheets using the molecular markers Vimentin and α-Gustducin. Immediate tissue fixation following incubation with sub-epithelially injected proteases enabled us to peel off whole epithelial sheets, leaving the shape and integrity of the tissue intact. In the peeled epithelial sheets, taste buds labeled with antibodies against Vimentin and α-Gustducin were easily identified and counted under a light microscope and many more taste buds, patterned in rosette-like clusters, were found than previously reported with SEM. Broiler-type, female-line males have more taste buds than other groups and continue to increase the number of taste buds over stages after hatch. In addition to ovoid-shaped taste buds, big tube-shaped taste buds were observed in the chicken using 2-photon microscopy. Our protocol for labeling taste buds with molecular markers will factilitate future mechanistic studies on the development of chicken taste buds in association with their feeding behaviors.

  12. Entropy analysis in yeast DNA

    International Nuclear Information System (INIS)

    Kim, Jongkwang; Kim, Sowun; Lee, Kunsang; Kwon, Younghun

    2009-01-01

    In this article, we investigate the language structure in yeast 16 chromosomes. In order to find it, we use the entropy analysis for codons (or amino acids) of yeast 16 chromosomes, developed in analysis of natural language by Montemurro et al. From the analysis, we can see that there exists a language structure in codons (or amino acids) of yeast 16 chromosomes. Also we find that the grammar structure of amino acids of yeast 16 chromosomes has a deep relationship with secondary structure of protein.

  13. How a Small Family of Yeast IDPs Control Complicated Processes Related to DNA Replication

    DEFF Research Database (Denmark)

    Marabini, Riccardo

    Ribonucleotide reductase (RNR) and proliferating cell nuclear antigen (PCNA) are two essential proteins involved in DNA replication. RNR catalyzes the last and rate limiting step of the deoxyribonucleotide biosynthetic pathway. The dysregulation of RNR has been related to higher mutation rate...... characterized in budding and fission yeast. Within this protein family Dif1 (from S. cerevisiae) and Spd1 (from S. pombe) were analyzed in this study. These proteins were previously found to interact with and regulate the activity of RNR and Spd1 was also linked to PCNA dependent signaling for degradation...

  14. Tumor budding is a strong and reproducible prognostic marker in T3N0 colorectal cancer.

    LENUS (Irish Health Repository)

    Wang, Lai Mun

    2012-02-01

    BACKGROUND: Tumor budding along the advancing front of colorectal adenocarcinoma is an early event in the metastatic process. A reproducible, prognostic budding scoring system based on outcomes in early stage colorectal cancer has not been established. DESIGN: One hundred twenty-eight T3N0M0 colorectal carcinoma patients with known outcome were identified. Tumor budding was defined as isolated tumor cells or clusters of <5 cells at the invasive tumor front. Tumor bud counts were generated in 5 regions at 200x by 2 pathologists (conventional bud count method). The median bud count per case was used to divide cases into low (median=0) and high budding (median > or =1) groups. Forty cases were reevaluated to assess reproducibility using the conventional and a novel rapid bud count method. RESULTS: Fifty-seven (45%) carcinomas had high and 71 (55%) had low budding scores. High budding was associated with an infiltrative growth pattern (P<0.0001) and lymphovascular invasion (P=0.005). Five-year cancer-specific survival was significantly poorer in high compared with low budding groups: 63% versus 91%, respectively, P<0.0001. Multivariate analysis demonstrated tumor budding to be independently prognostic (hazard ratio=4.76, P<0.001). Interobserver agreement was at least equivalent comparing the conventional to the rapid bud count methods: 87.5% agreement (kappa=0.75) versus 92.5% agreement (kappa=0.85), respectively. CONCLUSIONS: Tumor budding is a strong, reproducible, and independent prognostic marker of outcome that is easily assessed on hematoxylin and eosin slides. This may be useful for identifying the subset of T3N0M0 patients at high risk of recurrence who may benefit from adjuvant therapy.

  15. Distribution of α-Gustducin and Vimentin in premature and mature taste buds in chickens.

    Science.gov (United States)

    Venkatesan, Nandakumar; Rajapaksha, Prasangi; Payne, Jason; Goodfellow, Forrest; Wang, Zhonghou; Kawabata, Fuminori; Tabata, Shoji; Stice, Steven; Beckstead, Robert; Liu, Hong-Xiang

    2016-10-14

    The sensory organs for taste in chickens (Gallus sp.) are taste buds in the oral epithelium of the palate, base of the oral cavity, and posterior tongue. Although there is not a pan-taste cell marker that labels all chicken taste bud cells, α-Gustducin and Vimentin each label a subpopulation of taste bud cells. In the present study, we used both α-Gustducin and Vimentin to further characterize chicken taste buds at the embryonic and post-hatching stages (E17-P5). We found that both α-Gustducin and Vimentin label distinct and overlapping populations of, but not all, taste bud cells. A-Gustducin immunosignals were observed as early as E18 and were consistently distributed in early and mature taste buds in embryos and hatchlings. Vimentin immunoreactivity was initially sparse at the embryonic stages then became apparent in taste buds after hatch. In hatchlings, α-Gustducin and Vimentin immunosignals largely co-localized in taste buds. A small subset of taste bud cells were labeled by either α-Gustducin or Vimentin or were not labeled. Importantly, each of the markers was observed in all of the examined taste buds. Our data suggest that the early onset of α-Gustducin in taste buds might be important for enabling chickens to respond to taste stimuli immediately after hatch and that distinctive population of taste bud cells that are labeled by different molecular markers might represent different cell types or different phases of taste bud cells. Additionally, α-Gustducin and Vimentin can potentially be used as molecular markers of all chicken taste buds in whole mount tissue. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Genomics and the making of yeast biodiversity

    NARCIS (Netherlands)

    Hittinger, Chris Todd; Rokas, Antonis; Bai, Feng-Yan; Boekhout, Teun; Gonçalves, Paula; Jeffries, Thomas W; Kominek, Jacek; Lachance, Marc-André; Libkind, Diego; Rosa, Carlos A; Sampaio, José Paulo; Kurtzman, Cletus P

    2015-01-01

    Yeasts are unicellular fungi that do not form fruiting bodies. Although the yeast lifestyle has evolved multiple times, most known species belong to the subphylum Saccharomycotina (syn. Hemiascomycota, hereafter yeasts). This diverse group includes the premier eukaryotic model system, Saccharomyces

  17. Current awareness on yeast.

    Science.gov (United States)

    2002-02-01

    In order to keep subscribers up-to-date with the latest developments in their field, this current awareness service is provided by John Wiley & Sons and contains newly-published material on yeasts. Each bibliography is divided into 10 sections. 1 Books, Reviews & Symposia; 2 General; 3 Biochemistry; 4 Biotechnology; 5 Cell Biology; 6 Gene Expression; 7 Genetics; 8 Physiology; 9 Medical Mycology; 10 Recombinant DNA Technology. Within each section, articles are listed in alphabetical order with respect to author. If, in the preceding period, no publications are located relevant to any one of these headings, that section will be omitted. (3 weeks journals - search completed 5th. Dec. 2001)

  18. PpHB22, a member of HD-Zip proteins, activates PpDAM1 to regulate bud dormancy transition in 'Suli' pear (Pyrus pyrifolia White Pear Group).

    Science.gov (United States)

    Yang, Qinsong; Niu, Qingfeng; Li, Jianzhao; Zheng, Xiaoyan; Ma, Yunjing; Bai, Songling; Teng, Yuanwen

    2018-06-01

    Homeodomain-leucine zipper (HD-Zip) proteins, which form one of the largest and most diverse families, regulate many biological processes in plants, including differentiation, flowering, vascular development, and stress signaling. Abscisic acid (ABA) has been proved to be one of the key regulators of bud dormancy and to influence several HD-Zip genes expression. However, the role of HD-Zip genes in regulating bud dormancy remains unclear. We identified 47 pear (P. pyrifolia White Pear Group) HD-Zip genes, which were classified into four subfamilies (HD-Zip I-IV). We further revealed that gene expression levels of some HD-Zip members were closely related to ABA concentrations in flower buds during dormancy transition. Exogenous ABA treatment confirmed that PpHB22 and several other HD-Zip genes responded to ABA. Yeast one-hybrid and dual luciferase assay results combining subcellular localization showed that PpHB22 was present in nucleus and directly induced PpDAM1 (dormancy associated MADS-box 1) expression. Thus, PpHB22 is a negative regulator of plant growth associated with the ABA response pathway and functions upstream of PpDAM1. These findings enrich our understanding of the function of HD-Zip genes related to the bud dormancy transition. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  19. Synthetic genome engineering forging new frontiers for wine yeast.

    Science.gov (United States)

    Pretorius, Isak S

    2017-02-01

    Over the past 15 years, the seismic shifts caused by the convergence of biomolecular, chemical, physical, mathematical, and computational sciences alongside cutting-edge developments in information technology and engineering have erupted into a new field of scientific endeavor dubbed Synthetic Biology. Recent rapid advances in high-throughput DNA sequencing and DNA synthesis techniques are enabling the design and construction of new biological parts (genes), devices (gene networks) and modules (biosynthetic pathways), and the redesign of biological systems (cells and organisms) for useful purposes. In 2014, the budding yeast Saccharomyces cerevisiae became the first eukaryotic cell to be equipped with a fully functional synthetic chromosome. This was achieved following the synthesis of the first viral (poliovirus in 2002 and bacteriophage Phi-X174 in 2003) and bacterial (Mycoplasma genitalium in 2008 and Mycoplasma mycoides in 2010) genomes, and less than two decades after revealing the full genome sequence of a laboratory (S288c in 1996) and wine (AWRI1631 in 2008) yeast strain. A large international project - the Synthetic Yeast Genome (Sc2.0) Project - is now underway to synthesize all 16 chromosomes (∼12 Mb carrying ∼6000 genes) of the sequenced S288c laboratory strain by 2018. If successful, S. cerevisiae will become the first eukaryote to cross the horizon of in silico design of complex cells through de novo synthesis, reshuffling, and editing of genomes. In the meantime, yeasts are being used as cell factories for the semi-synthetic production of high-value compounds, such as the potent antimalarial artemisinin, and food ingredients, such as resveratrol, vanillin, stevia, nootkatone, and saffron. As a continuum of previously genetically engineered industrially important yeast strains, precision genome engineering is bound to also impact the study and development of wine yeast strains supercharged with synthetic DNA. The first taste of what the future

  20. Effect of 60Co γ-ray radiation on bud proliferation of oriental lily scales cultured in vitro

    International Nuclear Information System (INIS)

    Wang Dan; Zhang Zhiwei; Zhang Dongxue

    2009-01-01

    The effects of 60 Co γ-ray radiation on the bud proliferation of the oriental lily scales cultured in vitro were studied. The results show that the irradiation significantly inhibits bud proliferation, but the effects of radiation on the number of bud proliferation and the bud proliferation rate are obviously depressed along with the increasing of times of bud proliferation. The effect of radiation on the bud proliferation is repressive during the first time of bud proliferation and the effect is more significant in the higher radiation dosage treatment. The repressive effect of radiation on the bud proliferation disappears during the third time of bud proliferation, but the physiologic status is in the telophase of the damage repair action. The contents of protein and MDA of the bud were influenced differently depending on the radiation dosage and on the types of medium and positions of scales. (authors)

  1. Saponins from the flower buds of Buddleja officinalis.

    Science.gov (United States)

    Guo, Hongzhu; Koike, Kazuo; Li, Wei; Satou, Tadaaki; Guo, Dean; Nikaido, Tamotsu

    2004-01-01

    Five new saponins, mimengosides C-G (1-5), were isolated from the flower buds of Buddleja officinalis along with five known compounds, namely, songaroside A, acteoside, phenylethyl 2-glucoside, echinacoside, and phenylethyl alcohol 8-O-beta-D-glucopyranosyl-(1-->2)-beta-D-glucopyranoside. The structures of 1-5 were elucidated using spectroscopic and chemical methods, and these compounds were evaluated for their inhibitory effects against HL-60 leukemia cells.

  2. Clonal and bud bank traits: patterns across temperate plant communities

    Czech Academy of Sciences Publication Activity Database

    Klimešová, Jitka; Herben, Tomáš

    2015-01-01

    Roč. 26, č. 2 (2015), s. 243-253 ISSN 1100-9233 R&D Projects: GA ČR GB14-36079G; GA ČR GA13-17118S; GA ČR GAP505/12/1007 Institutional support: RVO:67985939 Keywords : clonal and bud bank traits * vegetation * central Europe Subject RIV: EH - Ecology, Behaviour Impact factor: 3.151, year: 2015

  3. Endogenous peripheral neuromodulators of the mammalian taste bud.

    Science.gov (United States)

    Dando, Robin

    2010-10-01

    The sensitivity of the mammalian taste system displays a degree of plasticity based on short-term nutritional requirements. Deficiency in a particular substance may lead to a perceived increase in palatability of this substance, providing an additional drive to redress this nutritional imbalance through modification of intake. This alteration occurs not only in the brain but also, before any higher level processing has occurred, in the taste buds themselves. A brief review of recent advances is offered.

  4. Inflammation Activates the Interferon Signaling Pathways in Taste Bud Cells

    OpenAIRE

    Wang, Hong; Zhou, Minliang; Brand, Joseph; Huang, Liquan

    2007-01-01

    Patients with viral and bacterial infections or other inflammatory illnesses often experience taste dysfunctions. The agents responsible for these taste disorders are thought to be related to infection-induced inflammation, but the mechanisms are not known. As a first step in characterizing the possible role of inflammation in taste disorders, we report here evidence for the presence of interferon (IFN)-mediated signaling pathways in taste bud cells. IFN receptors, particularly the IFN-γ rece...

  5. Taste isn't just for taste buds anymore

    OpenAIRE

    Finger, Thomas E.; Kinnamon, Sue C.

    2011-01-01

    Taste is a discriminative sense involving specialized receptor cells of the oral cavity (taste buds) and at least two distinct families of G protein-coupled receptor molecules that detect nutritionally important substances or potential toxins. Yet the receptor mechanisms that drive taste also are utilized by numerous systems throughout the body. How and why these so-called taste receptors are used to regulate digestion and respiration is now a matter of intense study. In this article we provi...

  6. Leptin's effect on taste bud calcium responses and transmitter secretion.

    Science.gov (United States)

    Meredith, Tricia L; Corcoran, Alan; Roper, Stephen D

    2015-05-01

    Leptin, a peptide hormone released by adipose tissue, acts on the hypothalamus to control cravings and appetite. Leptin also acts to decrease taste responses to sweet substances, though there is little detailed information regarding where leptin acts in the taste transduction cascade. The present study examined the effects of leptin on sweet-evoked responses and neuro transmitter release from isolated taste buds. Our results indicate that leptin moderately decreased sweet-evoked calcium mobilization in isolated mouse taste buds. We also employed Chinese hamster ovary biosensor cells to examine taste transmitter release from isolated taste buds. Leptin reduced ATP and increased serotonin release in response to sweet stimulation. However, leptin has no effect on bitter-evoked transmitter release, further showing that the action of leptin is sweet specific. Our results support those of previous studies, which state that leptin acts on taste tissue via the leptin receptor, most likely on Type II (Receptor) cells, but also possibly on Type III (Presynaptic) cells. © The Author 2014. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  7. Bud dormancy in apple trees after thermal fluctuations

    Directory of Open Access Journals (Sweden)

    Rafael Anzanello

    2014-06-01

    Full Text Available The objective of this work was to evaluate the effect of heat waves on the evolution of bud dormancy, in apple trees with contrasting chilling requirements. Twigs of 'Castel Gala' and 'Royal Gala' were collected in orchards in Papanduva, state of Santa Catarina, Brazil, and were exposed to constant (3°C or alternating (3 and 15°C for 12/12 hours temperature, combined with zero, one or two days a week at 25°C. Two additional treatments were evaluated: constant temperature (3°C, with a heat wave of seven days at 25°C, in the beginning or in the middle of the experimental period. Periodically, part of the twigs was transferred to 25°C for daily budburst evaluation of apical and lateral buds. Endodormancy (dormancy induced by cold was overcome with less than 330 chilling hours (CH of constant cold in 'Castel Gala' and less than 618 CH in 'Royal Gala'. A daily 15°C-temperature cycle did not affect the endodormancy process. Heat waves during endodormancy resulted in an increased CH to achieve bud requirements. The negative effect of high temperature depended on the lasting of this condition. Chilling was partly cancelled during dormancy when the heat wave lasted 36 continuous hours or more. Therefore, budburst prediction models need adjustments, mainly for regions with mild and irregular winters, such as those of Southern Brazil.

  8. Immunocytochemical analysis of syntaxin-1 in rat circumvallate taste buds.

    Science.gov (United States)

    Yang, Ruibiao; Ma, Huazhi; Thomas, Stacey M; Kinnamon, John C

    2007-06-20

    Mammalian buds contain a variety of morphological taste cell types, but the type III taste cell is the only cell type that has synapses onto nerve processes. We hypothesize that taste cell synapses utilize the SNARE protein machinery syntaxin, SNAP-25, and synaptobrevin, as is used by synapses in the central nervous system (CNS) for Ca2+-dependent exocytosis. Previous studies have shown that taste cells with synapses display SNAP-25- and synaptobrevin-2-like immunoreactivity (LIR) (Yang et al. [2000a] J Comp Neurol 424:205-215, [2004] J Comp Neurol 471:59-71). In the present study we investigated the presynaptic membrane protein, syntaxin-1, in circumvallate taste buds of the rat. Our results indicate that diffuse cytoplasmic and punctate syntaxin-1-LIR are present in different subsets of taste cells. Diffuse, cytoplasmic syntaxin-1-LIR is present in type III cells while punctate syntaxin-1-LIR is present in type II cells. The punctate syntaxin-1-LIR is believed to be associated with Golgi bodies. All of the synapses associated with syntaxin-1-LIR taste cells are from type III cells onto nerve processes. These results support the proposition that taste cell synapses use classical SNARE machinery such as syntaxin-1 for neurotransmitter release in rat circumvallate taste buds. (c) 2007 Wiley-Liss, Inc.

  9. Inheritance of the yeast mitochondrial genome

    DEFF Research Database (Denmark)

    Piskur, Jure

    1994-01-01

    Mitochondrion, extrachromosomal genetics, intergenic sequences, genome size, mitochondrial DNA, petite mutation, yeast......Mitochondrion, extrachromosomal genetics, intergenic sequences, genome size, mitochondrial DNA, petite mutation, yeast...

  10. Fungiform Taste Bud Degeneration in C57BL/6J Mice Following Chorda-Lingual Nerve Transection

    OpenAIRE

    Guagliardo, Nick A.; Hill, David L.

    2007-01-01

    Taste buds are dependent on innervation for normal morphology and function. Fungiform taste bud degeneration after chorda tympani nerve injury has been well documented in rats, hamsters, and gerbils. The current study examines fungiform taste bud distribution and structure in adult C57BL/6J mice from both intact taste systems and after unilateral chorda-lingual nerve transection. Fungiform taste buds were visualized and measured with the aid of cytokeratin 8. In control mice, taste buds were ...

  11. Yeasts preservation: alternatives for lyophilisation

    NARCIS (Netherlands)

    Nyanga, L.K.; Nout, M.J.R.; Smid, E.J.; Boekhout, T.; Zwietering, M.H.

    2012-01-01

    The aim of the study was to compare the effect of two low-cost, low technology traditional methods for drying starter cultures with standard lyophilisation. Lyophilised yeast cultures and yeast cultures preserved in dry rice cakes and dry plant fibre strands were examined for viable cell counts

  12. Long-read sequencing data analysis for yeasts.

    Science.gov (United States)

    Yue, Jia-Xing; Liti, Gianni

    2018-06-01

    Long-read sequencing technologies have become increasingly popular due to their strengths in resolving complex genomic regions. As a leading model organism with small genome size and great biotechnological importance, the budding yeast Saccharomyces cerevisiae has many isolates currently being sequenced with long reads. However, analyzing long-read sequencing data to produce high-quality genome assembly and annotation remains challenging. Here, we present a modular computational framework named long-read sequencing data analysis for yeasts (LRSDAY), the first one-stop solution that streamlines this process. Starting from the raw sequencing reads, LRSDAY can produce chromosome-level genome assembly and comprehensive genome annotation in a highly automated manner with minimal manual intervention, which is not possible using any alternative tool available to date. The annotated genomic features include centromeres, protein-coding genes, tRNAs, transposable elements (TEs), and telomere-associated elements. Although tailored for S. cerevisiae, we designed LRSDAY to be highly modular and customizable, making it adaptable to virtually any eukaryotic organism. When applying LRSDAY to an S. cerevisiae strain, it takes ∼41 h to generate a complete and well-annotated genome from ∼100× Pacific Biosciences (PacBio) running the basic workflow with four threads. Basic experience working within the Linux command-line environment is recommended for carrying out the analysis using LRSDAY.

  13. Mechanism of iron uptake by the pathogenic yeast, Candida albicans

    International Nuclear Information System (INIS)

    Ismail, A.

    1986-01-01

    C. albicans requires iron for growth and phenotypic development. When deprived of iron, mycelium and bud formation was suppressed. Survival of the organism was also reduced under iron-limiting conditions. The combination of elevated temperature and iron-deprivation further reduced phenotypic development and survival of the yeast. The combination of elevated temperature and iron starvation resulted in a decrease in both the growth rate and siderophore production. However, with time, the cells were able to show partial recovery in the growth rate which occurred concomitantly with an increase in siderophore production. In order for siderophores to be utilized, ferri-siderophore receptors must be produced. The receptor was shown to be located in the plasma membrane of the yeast. Scatchard analysis of the binding of ferri-siderophores to plasma membrane receptors showed an increase in receptor affinity and number of binding sites in iron-starved cells when compared to control cells. Autoradiograms of the 58 Fe-siderophore-protein complex following SDS-PAGE separation of candidal proteins revealed the presence of a ferri-siderophore receptor of approximately 10,000 daltons. C. albicans strains which lacked the ability to synthesize phenolate siderophore maintained a phenolate receptor and bound candidal phenolate siderophore better than non-candidal phenolate siderophores

  14. A Three-Dimensional Model of the Yeast Genome

    Science.gov (United States)

    Noble, William; Duan, Zhi-Jun; Andronescu, Mirela; Schutz, Kevin; McIlwain, Sean; Kim, Yoo Jung; Lee, Choli; Shendure, Jay; Fields, Stanley; Blau, C. Anthony

    Layered on top of information conveyed by DNA sequence and chromatin are higher order structures that encompass portions of chromosomes, entire chromosomes, and even whole genomes. Interphase chromosomes are not positioned randomly within the nucleus, but instead adopt preferred conformations. Disparate DNA elements co-localize into functionally defined aggregates or factories for transcription and DNA replication. In budding yeast, Drosophila and many other eukaryotes, chromosomes adopt a Rabl configuration, with arms extending from centromeres adjacent to the spindle pole body to telomeres that abut the nuclear envelope. Nonetheless, the topologies and spatial relationships of chromosomes remain poorly understood. Here we developed a method to globally capture intra- and inter-chromosomal interactions, and applied it to generate a map at kilobase resolution of the haploid genome of Saccharomyces cerevisiae. The map recapitulates known features of genome organization, thereby validating the method, and identifies new features. Extensive regional and higher order folding of individual chromosomes is observed. Chromosome XII exhibits a striking conformation that implicates the nucleolus as a formidable barrier to interaction between DNA sequences at either end. Inter-chromosomal contacts are anchored by centromeres and include interactions among transfer RNA genes, among origins of early DNA replication and among sites where chromosomal breakpoints occur. Finally, we constructed a three-dimensional model of the yeast genome. Our findings provide a glimpse of the interface between the form and function of a eukaryotic genome.

  15. Production of Food Grade Yeasts

    Directory of Open Access Journals (Sweden)

    Argyro Bekatorou

    2006-01-01

    Full Text Available Yeasts have been known to humans for thousands of years as they have been used in traditional fermentation processes like wine, beer and bread making. Today, yeasts are also used as alternative sources of high nutritional value proteins, enzymes and vitamins, and have numerous applications in the health food industry as food additives, conditioners and flavouring agents, for the production of microbiology media and extracts, as well as livestock feeds. Modern scientific advances allow the isolation, construction and industrial production of new yeast strains to satisfy the specific demands of the food industry. Types of commercial food grade yeasts, industrial production processes and raw materials are highlighted. Aspects of yeast metabolism, with respect to carbohydrate utilization, nutritional aspects and recent research advances are also discussed.

  16. Evolutionary History of Ascomyceteous Yeasts

    Energy Technology Data Exchange (ETDEWEB)

    Haridas, Sajeet; Riley, Robert; Salamov, Asaf; Goker, Markus; Klenk, Hans-Peter; Kurtzman, Cletus P.; Blackwell, Meredith; Grigoriev, Igor; Jeffries, Thomas W.

    2014-06-06

    Yeasts are important for many industrial and biotechnological processes and show remarkable diversity despite morphological similarities. We have sequenced the genomes of 16 ascomycete yeasts of taxonomic and industrial importance including members of Saccharomycotina and Taphrinomycotina. A comparison of these with several other previously published yeast genomes have added increased confidence to the phylogenetic positions of previously poorly placed species including Saitoella complicata, Babjeviella inositovora and Metschnikowia bicuspidata. Phylogenetic analysis also showed that yeasts with alternative nuclear codon usage where CUG encodes serine instead of leucine are monophyletic within the Saccharomycotina. Most of the yeasts have compact genomes with a large fraction of single exon genes with Lipomyces starkeyi and the previously published Pneumocystis jirovecii being notable exceptions. Intron analysis suggests that early diverging species have more introns. We also observed a large number of unclassified lineage specific non-simple repeats in these genomes.

  17. Ice nucleation activity in various tissues of Rhododendron flower buds: their relevance to extraorgan freezing

    Directory of Open Access Journals (Sweden)

    Masaya eIshikawa

    2015-03-01

    Full Text Available Wintering flower buds of cold hardy Rhododendron japonicum cooled slowly to subfreezing temperatures are known to undergo extraorgan freezing, whose mechanisms remain obscure. We revisited this material to demonstrate why bud scales freeze first in spite of their lower water content, why florets remain deeply supercooled and how seasonal adaptive responses occur in regard to extraorgan freezing in flower buds. We determined ice nucleation activity (INA of various flower bud tissues of using a test tube-based assay. Irrespective of collection sites, outer and inner bud scales that function as ice sinks in extraorgan freezing had high INA levels whilst florets that remain supercooled and act as a water source lacked INA. The INA level of bud scales was not high in late August when flower bud formation was ending, but increased to reach the highest level in late October just before the first autumnal freeze. The results support the following hypothesis: the high INA in bud scales functions as the subfreezing sensor, ensuring the primary freezing in bud scales at warmer subzero temperatures, which likely allows the migration of floret water to the bud scales and accumulation of icicles within the bud scales. The low INA in the florets helps them remain unfrozen by deep supercooling. The INA in the bud scales was resistant to grinding and autoclaving at 121°C for 15 min, implying the intrinsic nature of the INA rather than of microbial origin, whilst the INA in stem bark was autoclaving labile. Anti-nucleation activity (ANA was implicated in the leachate of autoclaved bud scales, which suppresses the INA at millimolar levels of concentration and likely differs from the colligative effects of the solutes. The tissue INA levels likely contribute to the establishment of freezing behaviors by ensuring the order of freezing in the tissues: from the primary freeze to the last tissue remaining unfrozen.

  18. Genome-wide analysis of gene expression in primate taste buds reveals links to diverse processes.

    Directory of Open Access Journals (Sweden)

    Peter Hevezi

    Full Text Available Efforts to unravel the mechanisms underlying taste sensation (gustation have largely focused on rodents. Here we present the first comprehensive characterization of gene expression in primate taste buds. Our findings reveal unique new insights into the biology of taste buds. We generated a taste bud gene expression database using laser capture microdissection (LCM procured fungiform (FG and circumvallate (CV taste buds from primates. We also used LCM to collect the top and bottom portions of CV taste buds. Affymetrix genome wide arrays were used to analyze gene expression in all samples. Known taste receptors are preferentially expressed in the top portion of taste buds. Genes associated with the cell cycle and stem cells are preferentially expressed in the bottom portion of taste buds, suggesting that precursor cells are located there. Several chemokines including CXCL14 and CXCL8 are among the highest expressed genes in taste buds, indicating that immune system related processes are active in taste buds. Several genes expressed specifically in endocrine glands including growth hormone releasing hormone and its receptor are also strongly expressed in taste buds, suggesting a link between metabolism and taste. Cell type-specific expression of transcription factors and signaling molecules involved in cell fate, including KIT, reveals the taste bud as an active site of cell regeneration, differentiation, and development. IKBKAP, a gene mutated in familial dysautonomia, a disease that results in loss of taste buds, is expressed in taste cells that communicate with afferent nerve fibers via synaptic transmission. This database highlights the power of LCM coupled with transcriptional profiling to dissect the molecular composition of normal tissues, represents the most comprehensive molecular analysis of primate taste buds to date, and provides a foundation for further studies in diverse aspects of taste biology.

  19. Measuring strand discontinuity-directed mismatch repair in yeast Saccharomyces cerevisiae by cell-free nuclear extracts.

    Science.gov (United States)

    Yuan, Fenghua; Lai, Fangfang; Gu, Liya; Zhou, Wen; El Hokayem, Jimmy; Zhang, Yanbin

    2009-05-01

    Mismatch repair corrects biosynthetic errors generated during DNA replication, whose deficiency causes a mutator phenotype and directly underlies hereditary non-polyposis colorectal cancer and sporadic cancers. Because of remarkably high conservation of the mismatch repair machinery between the budding yeast (Saccharomyces cerevisiae) and humans, the study of mismatch repair in yeast has provided tremendous insights into the mechanisms of this repair pathway in humans. In addition, yeast cells possess an unbeatable advantage over human cells in terms of the easy genetic manipulation, the availability of whole genome deletion strains, and the relatively low cost for setting up the system. Although many components of eukaryotic mismatch repair have been identified, it remains unclear if additional factors, such as DNA helicase(s) and redundant nuclease(s) besides EXO1, participate in eukaryotic mismatch repair. To facilitate the discovery of novel mismatch repair factors, we developed a straightforward in vitro cell-free repair system. Here, we describe the practical protocols for preparation of yeast cell-free nuclear extracts and DNA mismatch substrates, and the in vitro mismatch repair assay. The validity of the cell-free system was confirmed by the mismatch repair deficient yeast strain (Deltamsh2) and the complementation assay with purified yeast MSH2-MSH6.

  20. Fungiform taste bud degeneration in C57BL/6J mice following chorda-lingual nerve transection.

    Science.gov (United States)

    Guagliardo, Nick A; Hill, David L

    2007-09-10

    Taste buds are dependent on innervation for normal morphology and function. Fungiform taste bud degeneration after chorda tympani nerve injury has been well documented in rats, hamsters, and gerbils. The current study examines fungiform taste bud distribution and structure in adult C57BL/6J mice from both intact taste systems and after unilateral chorda-lingual nerve transection. Fungiform taste buds were visualized and measured with the aid of cytokeratin 8. In control mice, taste buds were smaller and more abundant on the anterior tip (taste buds were smaller and fewer on the side of the tongue ipsilateral to the transection and continued to decrease in both size and number until 15 days posttransection. Degenerating fungiform taste buds were smaller due to a loss of taste bud cells rather than changes in taste bud morphology. While almost all taste buds disappeared in more posterior fungiform papillae by 15 days posttransection, the anterior tip of the tongue retained nearly half of its taste buds compared to intact mice. Surviving taste buds could not be explained by an apparent innervation from the remaining intact nerves. Contralateral effects of nerve transection were also observed; taste buds were larger due to an increase in the number of taste bud cells. These data are the first to characterize adult mouse fungiform taste buds and subsequent degeneration after unilateral nerve transection. They provide the basis for more mechanistic studies in which genetically engineered mice can be used. (c) 2007 Wiley-Liss, Inc.

  1. Effects of light and growth regulators on adventitious bud formation in horseradish (Armoracia rusticana).

    Science.gov (United States)

    Kamada, H; Tachikawa, Y; Saitou, T; Harada, H

    1995-07-01

    To clarify that the presence of Ri T-DNA genes are not prerequisite for the light-induced bud formation in horseradish (Armoracia rusticana) hairy roots, leaf and root segments of nontransformed horseradish plants were used as explants. Bud formation from nontransformed tissues was observed in hormone-free medium under 16 h daylight conditions, but not under continuous darkness. To investigate the effects of growth regulators on bud formation, leaf and root explants were treated with auxin (1-naphthaleneacetic acid; NAA) and / or cytokinin (6-benzyl-aminopurine; BA). The most effective treatment in the dark to stimulate bud formation was BA at 1 mg·1(-1). These results show that adventitious bud formation in horseradish can be induced by light and growth regulators, and especially cytokinin, may be involved in bud formation, irrespective of whether the tissues were transformed with Ri T-DNA.

  2. Bud irradiation to obtain resistence to citrus canker through induction of mutation

    International Nuclear Information System (INIS)

    Menten, J.O.M.; Pompeu Junior, J.; Dragone, P.; Sobrinho, J.T.; Prada, V.A.; Tulmann Neto, A.; Ando, A.

    1989-01-01

    The radiosensitivity to gamma rays of the bud of the orange cultivar Pera is determined through irradiation of buds with several doses; the irradiated buds were grafted onto rootstocks of lemon cu. Cravo. The grafting percentage and the development of the V 1 stem from the irradiated buds are analysed; it is concluded that the best dose for induction of mutation is 4,0 OK. New buds are irradiated and grafted with this dose. The V 1 stems are Separeted into 3 Groups, according to the position of the buds on the stem. The V 2 stems are analysed according to the morphological alteraTions due to irradiation. (M.A.C.) [pt

  3. Fgf16 is essential for pectoral fin bud formation in zebrafish

    International Nuclear Information System (INIS)

    Nomura, Ryohei; Kamei, Eriko; Hotta, Yuuhei; Konishi, Morichika; Miyake, Ayumi; Itoh, Nobuyuki

    2006-01-01

    Zebrafish pectoral fin bud formation is an excellent model for studying morphogenesis. Fibroblast growth factors (Fgfs) and sonic hedgehog (shh) are essential for pectoral fin bud formation. We found that Fgf16 was expressed in the apical ectodermal ridge (AER) of fin buds. A knockdown of Fgf16 function resulted in no fin bud outgrowth. Fgf16 is required for cell proliferation and differentiation in the mesenchyme and the AER of the fin buds, respectively. Fgf16 functions downstream of Fgf10, a mesenchymal factor, signaling to induce the expression of Fgf4 and Fgf8 in the AER. Fgf16 in the AER and shh in the zone of polarizing activity (ZPA) interact to induce and/or maintain each other's expression. These findings have revealed that Fgf16, a newly identified AER factor, plays a crucial role in pectoral fin bud outgrowth by mediating the interactions of AER-mesenchyme and AER-ZPA

  4. Genetic study on yeast

    International Nuclear Information System (INIS)

    Mortimer, R.K.

    1981-01-01

    Research during the past year has moved ahead on several fronts. A major compilation of all the genetic mapping data for the yeast Saccharomyces cerevisiae has been completed. The map describes the location of over 300 genes on 17 chromosomes. A report on this work will appear in Microbiological Reviews in December 1980. Recombinant DNA procedures have been introduced into the experiments and RAD52 (one of the genes involved in recombination and repair damage), has been successfully cloned. This clone will be used to determine the gene product. Diploid cells homozygous for RAD52 have exceptionally high frequencies of mitotic loss of chromosomes. This loss is stimulated by ionizing radiation. This effect is a very significant finding. The effect has also been seen with certain other RAD mutants

  5. Lager Yeast Comes of Age

    Science.gov (United States)

    2014-01-01

    Alcoholic fermentations have accompanied human civilizations throughout our history. Lager yeasts have a several-century-long tradition of providing fresh beer with clean taste. The yeast strains used for lager beer fermentation have long been recognized as hybrids between two Saccharomyces species. We summarize the initial findings on this hybrid nature, the genomics/transcriptomics of lager yeasts, and established targets of strain improvements. Next-generation sequencing has provided fast access to yeast genomes. Its use in population genomics has uncovered many more hybridization events within Saccharomyces species, so that lager yeast hybrids are no longer the exception from the rule. These findings have led us to propose network evolution within Saccharomyces species. This “web of life” recognizes the ability of closely related species to exchange DNA and thus drain from a combined gene pool rather than be limited to a gene pool restricted by speciation. Within the domesticated lager yeasts, two groups, the Saaz and Frohberg groups, can be distinguished based on fermentation characteristics. Recent evidence suggests that these groups share an evolutionary history. We thus propose to refer to the Saaz group as Saccharomyces carlsbergensis and to the Frohberg group as Saccharomyces pastorianus based on their distinct genomes. New insight into the hybrid nature of lager yeast will provide novel directions for future strain improvement. PMID:25084862

  6. Interaction Between Yeasts and Zinc

    Science.gov (United States)

    Nicola, Raffaele De; Walker, Graeme

    Zinc is an essential trace element in biological systems. For example, it acts as a cellular membrane stabiliser, plays a critical role in gene expression and genome modification and activates nearly 300 enzymes, including alcohol dehydrogenase. The present chapter will be focused on the influence of zinc on cell physiology of industrial yeast strains of Saccharomyces cerevisiae, with special regard to the uptake and subsequent utilisation of this metal. Zinc uptake by yeast is metabolism-dependent, with most of the available zinc translocated very quickly into the vacuole. At cell division, zinc is distributed from mother to daughter cells and this effectively lowers the individual cellular zinc concentration, which may become zinc depleted at the onset of the fermentation. Zinc influences yeast fermentative performance and examples will be provided relating to brewing and wine fermentations. Industrial yeasts are subjected to several stresses that may impair fermentation performance. Such stresses may also impact on yeast cell zinc homeostasis. This chapter will discuss the practical implications for the correct management of zinc bioavailability for yeast-based biotechnologies aimed at improving yeast growth, viability, fermentation performance and resistance to environmental stresses

  7. Induction of ectopic taste buds by SHH reveals the competency and plasticity of adult lingual epithelium.

    Science.gov (United States)

    Castillo, David; Seidel, Kerstin; Salcedo, Ernesto; Ahn, Christina; de Sauvage, Frederic J; Klein, Ophir D; Barlow, Linda A

    2014-08-01

    Taste buds are assemblies of elongated epithelial cells, which are innervated by gustatory nerves that transmit taste information to the brain stem. Taste cells are continuously renewed throughout life via proliferation of epithelial progenitors, but the molecular regulation of this process remains unknown. During embryogenesis, sonic hedgehog (SHH) negatively regulates taste bud patterning, such that inhibition of SHH causes the formation of more and larger taste bud primordia, including in regions of the tongue normally devoid of taste buds. Here, using a Cre-lox system to drive constitutive expression of SHH, we identify the effects of SHH on the lingual epithelium of adult mice. We show that misexpression of SHH transforms lingual epithelial cell fate, such that daughter cells of lingual epithelial progenitors form cell type-replete, onion-shaped taste buds, rather than non-taste, pseudostratified epithelium. These SHH-induced ectopic taste buds are found in regions of the adult tongue previously thought incapable of generating taste organs. The ectopic buds are composed of all taste cell types, including support cells and detectors of sweet, bitter, umami, salt and sour, and recapitulate the molecular differentiation process of endogenous taste buds. In contrast to the well-established nerve dependence of endogenous taste buds, however, ectopic taste buds form independently of both gustatory and somatosensory innervation. As innervation is required for SHH expression by endogenous taste buds, our data suggest that SHH can replace the need for innervation to drive the entire program of taste bud differentiation. © 2014. Published by The Company of Biologists Ltd.

  8. Actin Filaments of Taste Buds in the Goldfish and Parrot

    OpenAIRE

    Yuko, SUZUKI

    1996-01-01

    The filaments in the apical region of the taste bud cells of both goldfish and parrot were examined by fluorescence histochemistry and electron microscopy. The apical cytoplasm of goldfish taste buds terminated in long, slender processes and microvilli, and contained thin and straight filaments composed of f-actin, as detected by fluorecein-labeled phalloidin binding. In the parrot, the apical cytoplasm of taste buds terminating in microvilli also showed phalloidin fluorescence. The result su...

  9. Labeling and analysis of chicken taste buds using molecular markers in oral epithelial sheets

    OpenAIRE

    Rajapaksha, Prasangi; Wang, Zhonghou; Venkatesan, Nandakumar; Tehrani, Kayvan F.; Payne, Jason; Swetenburg, Raymond L.; Kawabata, Fuminori; Tabata, Shoji; Mortensen, Luke J.; Stice, Steven L.; Beckstead, Robert; Liu, Hong-Xiang

    2016-01-01

    In chickens, the sensory organs for taste are the taste buds in the oral cavity, of which there are ~240?360 in total number as estimated by scanning electron microscopy (SEM). There is not an easy way to visualize all taste buds in chickens. Here, we report a highly efficient method for labeling chicken taste buds in oral epithelial sheets using the molecular markers Vimentin and ?-Gustducin. Immediate tissue fixation following incubation with sub-epithelially injected proteases enabled us t...

  10. Yeasts preservation: alternatives for lyophilisation

    OpenAIRE

    Nyanga, Loveness K.; Nout, Martinus J. R.; Smid, Eddy J.; Boekhout, Teun; Zwietering, Marcel H.

    2012-01-01

    The aim of the study was to compare the effect of two low-cost, low technology traditional methods for drying starter cultures with standard lyophilisation. Lyophilised yeast cultures and yeast cultures preserved in dry rice cakes and dry plant fibre strands were examined for viable cell counts during 6 months storage at 4 and 25 °C. None of the yeast cultures showed a significant loss in viable cell count during 6 months of storage at 4 °C upon lyophilisation and preservation in dry rice cak...

  11. [Distiller Yeasts Producing Antibacterial Peptides].

    Science.gov (United States)

    Klyachko, E V; Morozkina, E V; Zaitchik, B Ts; Benevolensky, S V

    2015-01-01

    A new method of controlling lactic acid bacteria contamination was developed with the use of recombinant Saccharomyces cerevisiae strains producing antibacterial peptides. Genes encoding the antibacterial peptides pediocin and plantaricin with codons preferable for S. cerevisiae were synthesized, and a system was constructed for their secretory expression. Recombinant S. cerevisiae strains producing antibacterial peptides effectively inhibit the growth of Lactobacillus sakei, Pediacoccus pentasaceus, Pediacoccus acidilactici, etc. The application of distiller yeasts producing antibacterial peptides enhances the ethanol yield in cases of bacterial contamination. Recombinant yeasts producing the antibacterial peptides pediocin and plantaricin can successfully substitute the available industrial yeast strains upon ethanol production.

  12. Designer Yeasts for the Fermentation Industry of the 21st Century

    Directory of Open Access Journals (Sweden)

    Isak S. Pretorius

    2003-01-01

    Full Text Available The budding yeast, Saccharomyces cerevisiae, has enjoyed a long and distinguished history in the fermention industry. Owing to its efficiency in producing alcohol, S. cerevisiae is, without doubt, the most important commercial microorganism with GRAS (Generally Regarded As Safe status. By brewing beer and sparkling wine, mankind’s oldest domesticated organism made possible the world’s first biotechnological processes. With the emergence of modern molecular genetics, S. cerevisiae has again been harnessed to shift the frontiers of mankind’s newest revolution, genetic engineering. S. cerevisiae is at the forefront of many of these developments in modern biotechnology. Consequently, the industrial importance of S. cerevisiae has extended beyond traditional fermentation. Today, the products of yeast biotechnologies impinge on many commercially important sectors, including food, beverages, biofuels, chemicals, industrial enzymes, pharmaceuticals, agriculture and the environment. Nevertheless, since ethyl alcohol produced by yeast fermentation is likely to remain the foremost worldwide biotechnological commodity for the foreseeable future, this review focuses on advances made with respect to the development of tailor- made yeast strains for the fermented beverage and biofuel industries.

  13. Structure, cell wall elasticity and polysaccharide properties of living yeast cells, as probed by AFM

    International Nuclear Information System (INIS)

    Alsteens, David; Dupres, Vincent; Evoy, Kevin Mc; Dufrene, Yves F; Wildling, Linda; Gruber, Hermann J

    2008-01-01

    Although the chemical composition of yeast cell walls is known, the organization, assembly, and interactions of the various macromolecules remain poorly understood. Here, we used in situ atomic force microscopy (AFM) in three different modes to probe the ultrastructure, cell wall elasticity and polymer properties of two brewing yeast strains, i.e. Saccharomyces carlsbergensis and S. cerevisiae. Topographic images of the two strains revealed smooth and homogeneous cell surfaces, and the presence of circular bud scars on dividing cells. Nanomechanical measurements demonstrated that the cell wall elasticity of S. carlsbergensis is homogeneous. By contrast, the bud scar of S. cerevisiae was found to be stiffer than the cell wall, presumably due to the accumulation of chitin. Notably, single molecule force spectroscopy with lectin-modified tips revealed major differences in polysaccharide properties of the two strains. Polysaccharides were clearly more extended on S. cerevisiae, suggesting that not only oligosaccharides, but also polypeptide chains of the mannoproteins were stretched. Consistent with earlier cell surface analyses, these findings may explain the very different aggregation properties of the two organisms. This study demonstrates the power of using multiple complementary AFM modalities for probing the organization and interactions of the various macromolecules of microbial cell walls

  14. Metabolite changes in conifer buds and needles during forced bud break in Norway spruce (Picea abies and European silver fir (Abies alba

    Directory of Open Access Journals (Sweden)

    Priyanka eDhuli

    2014-12-01

    Full Text Available Environmental changes such as early spring and warm spells induce bud burst and photosynthetic processes in cold-acclimated coniferous trees and consequently, cellular metabolism in overwintering needles and buds. The purpose of the study was to examine metabolism in conifers under forced deacclimation (artificially induced spring by exposing shoots of Picea abies (boreal species and Abies alba (temperate species to a greenhouse environment (22°C, 16/8 h D/N cycle over a nine week period. Each week, we scored bud opening and collected samples for GC/MS–based metabolite profiling. We detected a total of 169 assigned metabolites and 80 identified metabolites, comprising compounds such as mono- and disaccharides, Krebs cycle acids, amino acids, polyols, phenolics and phosphorylated structures. Untargeted multivariate statistical analysis based on PCA and cluster analysis segregated samples by species, tissue type, and stage of tissue deacclimations. Similar patterns of metabolic regulation in both species were observed in buds (amino acids, Krebs cycle acids and needles (hexoses, pentoses, and Krebs cycle acids. Based on correlation of bud opening score with compound levels, distinct metabolites could be associated with bud and shoot development, including amino acids, sugars and acids with known osmolyte function, and secondary metabolites. This study has shed light on how elevated temperature affects metabolism in buds and needles of conifer species during the deacclimation phase, and contributes to the discussion about how phenological characters in conifers may respond to future global warming.

  15. Qualitative and quantitative differences between taste buds of the rat and mouse

    Directory of Open Access Journals (Sweden)

    Ma Huazhi

    2007-01-01

    Full Text Available Abstract Background Numerous electrophysiological, ultrastructural, and immunocytochemical studies on rodent taste buds have been carried out on rat taste buds. In recent years, however, the mouse has become the species of choice for molecular and other studies on sensory transduction in taste buds. Do rat and mouse taste buds have the same cell types, sensory transduction markers and synaptic proteins? In the present study we have used antisera directed against PLCβ2, α-gustducin, serotonin (5-HT, PGP 9.5 and synaptobrevin-2 to determine the percentages of taste cells expressing these markers in taste buds in both rodent species. We also determined the numbers of taste cells in the taste buds as well as taste bud volume. Results There are significant differences (p 3 is smaller than a rat taste bud (64,200 μm3. The numerical density of taste cells in mouse circumvallate taste buds (2.1 cells/1000 μm3 is significantly higher than that in the rat (1.2 cells/1000 μm3. Conclusion These results suggest that rats and mice differ significantly in the percentages of taste cells expressing signaling molecules. We speculate that these observed dissimilarities may reflect differences in their gustatory processing.

  16. Distribution of α-Gustducin and Vimentin in premature and mature taste buds in chickens

    OpenAIRE

    Venkatesan, Nandakumar; Rajapaksha, Prasangi; Payne, Jason; Goodfellow, Forrest; Wang, Zhonghou; Kawabata, Fuminori; Tabata, Shoji; Stice, Steven; Beckstead, Robert; Liu, Hong-Xiang

    2016-01-01

    The sensory organs for taste in chickens (Gallus sp.) are taste buds in the oral epithelium of the palate, base of the oral cavity, and posterior tongue. Although there is not a pan-taste cell marker that labels all chicken taste bud cells, α-Gustducin and Vimentin each label a subpopulation of taste bud cells. In the present study, we used both α-Gustducin and Vimentin to further characterize chicken taste buds at the embryonic and post-hatching stages (E17-P5). We found that both α-Gustduci...

  17. β-Catenin signaling regulates temporally discrete phases of anterior taste bud development

    Science.gov (United States)

    Thirumangalathu, Shoba; Barlow, Linda A.

    2015-01-01

    The sense of taste is mediated by multicellular taste buds located within taste papillae on the tongue. In mice, individual taste buds reside in fungiform papillae, which develop at mid-gestation as epithelial placodes in the anterior tongue. Taste placodes comprise taste bud precursor cells, which express the secreted factor sonic hedgehog (Shh) and give rise to taste bud cells that differentiate around birth. We showed previously that epithelial activation of β-catenin is the primary inductive signal for taste placode formation, followed by taste papilla morphogenesis and taste bud differentiation, but the degree to which these later elements were direct or indirect consequences of β-catenin signaling was not explored. Here, we define discrete spatiotemporal functions of β-catenin in fungiform taste bud development. Specifically, we show that early epithelial activation of β-catenin, before taste placodes form, diverts lingual epithelial cells from a taste bud fate. By contrast, β-catenin activation a day later within Shh+ placodes, expands taste bud precursors directly, but enlarges papillae indirectly. Further, placodal activation of β-catenin drives precocious differentiation of Type I glial-like taste cells, but not other taste cell types. Later activation of β-catenin within Shh+ precursors during papilla morphogenesis also expands taste bud precursors and accelerates Type I cell differentiation, but papilla size is no longer enhanced. Finally, although Shh regulates taste placode patterning, we find that it is dispensable for the accelerated Type I cell differentiation induced by β-catenin. PMID:26525674

  18. Spaceflight enhances cell aggregation and random budding in Candida albicans.

    Directory of Open Access Journals (Sweden)

    Aurélie Crabbé

    Full Text Available This study presents the first global transcriptional profiling and phenotypic characterization of the major human opportunistic fungal pathogen, Candida albicans, grown in spaceflight conditions. Microarray analysis revealed that C. albicans subjected to short-term spaceflight culture differentially regulated 452 genes compared to synchronous ground controls, which represented 8.3% of the analyzed ORFs. Spaceflight-cultured C. albicans-induced genes involved in cell aggregation (similar to flocculation, which was validated by microscopic and flow cytometry analysis. We also observed enhanced random budding of spaceflight-cultured cells as opposed to bipolar budding patterns for ground samples, in accordance with the gene expression data. Furthermore, genes involved in antifungal agent and stress resistance were differentially regulated in spaceflight, including induction of ABC transporters and members of the major facilitator family, downregulation of ergosterol-encoding genes, and upregulation of genes involved in oxidative stress resistance. Finally, downregulation of genes involved in actin cytoskeleton was observed. Interestingly, the transcriptional regulator Cap1 and over 30% of the Cap1 regulon was differentially expressed in spaceflight-cultured C. albicans. A potential role for Cap1 in the spaceflight response of C. albicans is suggested, as this regulator is involved in random budding, cell aggregation, and oxidative stress resistance; all related to observed spaceflight-associated changes of C. albicans. While culture of C. albicans in microgravity potentiates a global change in gene expression that could induce a virulence-related phenotype, no increased virulence in a murine intraperitoneal (i.p. infection model was observed under the conditions of this study. Collectively, our data represent an important basis for the assessment of the risk that commensal flora could play during human spaceflight missions. Furthermore, since the

  19. Expression of sall4 in taste buds of zebrafish.

    Science.gov (United States)

    Jackson, Robyn; Braubach, Oliver R; Bilkey, Jessica; Zhang, Jing; Akimenko, Marie-Andrée; Fine, Alan; Croll, Roger P; Jonz, Michael G

    2013-07-01

    We characterized the expression of sall4, a gene encoding a zinc finger transcription factor involved in the maintenance of embryonic stem cells, in taste buds of zebrafish (Danio rerio). Using an enhancer trap line (ET5), we detected enhanced green fluorescent protein (EGFP) in developing and adult transgenic zebrafish in regions containing taste buds: the lips, branchial arches, and the nasal and maxillary barbels. Localization of EGFP to taste cells of the branchial arches and lips was confirmed by co-immunolabeling with antibodies against calretinin and serotonin, and a zebrafish-derived neuronal marker (zn-12). Transgenic insertion of the ET construct into the zebrafish genome was evaluated and mapped to chromosome 23 in proximity (i.e. 23 kb) to the sall4 gene. In situ hybridization and expression analysis between 24 and 96 h post-fertilization (hpf) demonstrated that transgenic egfp expression in ET5 zebrafish was correlated with the spatial and temporal pattern of expression of sall4 in the wild-type. Expression was first observed in the central nervous system and branchial arches at 24 hpf. At 48 hpf, sall4 and egfp expression was observed in taste bud primordia surrounding the mouth and branchial arches. At 72 and 96 hpf, expression was detected in the upper and lower lips and branchial arches. Double fluorescence in situ hybridization at 3 and 10 dpf confirmed colocalization of sall4 and egfp in the lips and branchial arches. These studies reveal sall4 expression in chemosensory cells and implicate this transcription factor in the development and renewal of taste epithelia in zebrafish. Copyright © 2013 Wiley Periodicals, Inc.

  20. Building Better Biosensors for Exploration into Deep-Space, Using Humanized Yeast

    Science.gov (United States)

    Liddell, Lauren; Santa Maria, Sergio; Tieze, Sofia; Bhattacharya, Sharmila

    2017-01-01

    1.BioSentinel is 1 of 13 secondary payloads hitching a ride beyond Low Earth Orbit on Exploration Mission 1 (EM-1), set to launch from NASAs Space Launch System in 2019. EM-1 is our first opportunity to investigate the effects of the deep space environment on a eukaryotic biological system, the budding yeast S. cerevisiae. Though separated by a billion years of evolution we share hundreds of genes important for basic cell function, including responses to DNA damage. Thus, yeast is an ideal biosensor for detecting typesextent of damage induced by deep-space radiation.We will fly desiccated cells, then rehydrate to wake them up when the automated payload is ready to initiate the experiment. Rehydration solution contains SC (Synthetic Complete) media and alamarBlue, an indicator for changes in growth and metabolism. Telemetry of LED readings will then allow us to detect how cells respond throughout the mission. The desiccation-rehydration process can be extremely damaging to cells, and can severely diminish our ability to accurately measure and model cellular responses to deep-space radiation. The aim of this study is to develop a better biosensor: yeast strains that are more resistant to desiccation stress. We will over-express known cellular protectants, including hydrophilin Sip18, the protein disaggregase Hsp104, and thioredoxin Trx2, a responder to oxidative stress, then measure cell viability after desiccation to determine which factors improve stress tolerance. Over-expression of SIP18 in wine yeast starter cultures was previously reported to increase viability following desiccation stress by up to 70. Thus, we expect similar improvements in our space-yeast strains. By designing better yeast biosensors we can better prepare for and mitigate the potential dangers of deep-space radiation for future missions.This work is funded by NASAs AES program.

  1. Study of the plant COPII vesicle coat subunits by functional complementation of yeast Saccharomyces cerevisiae mutants.

    Directory of Open Access Journals (Sweden)

    Johan-Owen De Craene

    Full Text Available The formation and budding of endoplasmic reticulum ER-derived vesicles depends on the COPII coat protein complex that was first identified in yeast Saccharomyces cerevisiae. The ER-associated Sec12 and the Sar1 GTPase initiate the COPII coat formation by recruiting the Sec23-Sec24 heterodimer following the subsequent recruitment of the Sec13-Sec31 heterotetramer. In yeast, there is usually one gene encoding each COPII protein and these proteins are essential for yeast viability, whereas the plant genome encodes multiple isoforms of all COPII subunits. Here, we used a systematic yeast complementation assay to assess the functionality of Arabidopsis thaliana COPII proteins. In this study, the different plant COPII subunits were expressed in their corresponding temperature-sensitive yeast mutant strain to complement their thermosensitivity and secretion phenotypes. Secretion was assessed using two different yeast cargos: the soluble α-factor pheromone and the membranous v-SNARE (vesicle-soluble NSF (N-ethylmaleimide-sensitive factor attachment protein receptor Snc1 involved in the fusion of the secretory vesicles with the plasma membrane. This complementation study allowed the identification of functional A. thaliana COPII proteins for the Sec12, Sar1, Sec24 and Sec13 subunits that could represent an active COPII complex in plant cells. Moreover, we found that AtSec12 and AtSec23 were co-immunoprecipitated with AtSar1 in total cell extract of 15 day-old seedlings of A. thaliana. This demonstrates that AtSar1, AtSec12 and AtSec23 can form a protein complex that might represent an active COPII complex in plant cells.

  2. Mechanical damage in cotton buds caused by the boll weevil

    Directory of Open Access Journals (Sweden)

    Santos Roseane Cavalcanti

    2003-01-01

    Full Text Available The boll weevil (Anthonomus grandis Boheman causes high levels of bud abscission in cotton plants due to feeding or oviposition punctures. It has been reported that abscission is mainly due to enzymes present in the insect's saliva, but mechanical damage could also contribute to square abscission. The objective of this paper was to undertake an analysis of the morphological damages caused by the insect in cotton squares using microscopy. Anthers and ovules are the main target of boll weevil feeding. The process initiates by perforation of young sepal and petal tissues and proceeds with subsequent alimentation on stamen and ovary leading to abscission of floral structures.

  3. Yeast strains and methods of use thereof

    OpenAIRE

    Goddard, Matthew Robert; Gardner, Richard Clague; Anfang, Nicole

    2013-01-01

    The present invention relates to yeast strains and, in particular, to yeast stains for use in fermentation processes. The invention also relates to methods of fermentation using the yeast strains of the invention either alone or in combination with other yeast strains. The invention thither relates to methods for the selection of yeast strains suitable for fermentation cultures by screening for various metabolic products and the use of specific nutrient sources.

  4. Biotechnical Microbiology, yeast and bacteria

    DEFF Research Database (Denmark)

    Villadsen, Ingrid Stampe

    1999-01-01

    This section contains the following single lecture notes: Eukaryotic Cell Biology. Kingdom Fungi. Cell Division. Meiosis and Recombination. Genetics of Yeast. Organisation of the Chromosome. Organization and genetics of the mitochondrial Geneme. Regulatio of Gene Expression. Intracellular Compart...

  5. Structural investigations of yeast mannans

    International Nuclear Information System (INIS)

    Rademacher, K.H.

    1983-01-01

    Cell wall mannans were isolated from 8 different Candida species and separated in oligosaccharides by partial acetolysis. After gel chromatography specific acetolysis patterns were obtained. The 13 C NMR spectra of mannans and oligosaccharides were recorded. Signals at delta = 93.1 - 105.4 were assigned to certain chemical structures. Both the spectral patterns and the acetolysis patterns of the yeast mannans can be used for the discrimination of related yeasts. (author)

  6. Components of a Fanconi-like pathway control Pso2-independent DNA interstrand crosslink repair in yeast.

    Directory of Open Access Journals (Sweden)

    Thomas A Ward

    Full Text Available Fanconi anemia (FA is a devastating genetic disease, associated with genomic instability and defects in DNA interstrand cross-link (ICL repair. The FA repair pathway is not thought to be conserved in budding yeast, and although the yeast Mph1 helicase is a putative homolog of human FANCM, yeast cells disrupted for MPH1 are not sensitive to ICLs. Here, we reveal a key role for Mph1 in ICL repair when the Pso2 exonuclease is inactivated. We find that the yeast FANCM ortholog Mph1 physically and functionally interacts with Mgm101, a protein previously implicated in mitochondrial DNA repair, and the MutSα mismatch repair factor (Msh2-Msh6. Co-disruption of MPH1, MGM101, MSH6, or MSH2 with PSO2 produces a lesion-specific increase in ICL sensitivity, the elevation of ICL-induced chromosomal rearrangements, and persistence of ICL-associated DNA double-strand breaks. We find that Mph1-Mgm101-MutSα directs the ICL-induced recruitment of Exo1 to chromatin, and we propose that Exo1 is an alternative 5'-3' exonuclease utilised for ICL repair in the absence of Pso2. Moreover, ICL-induced Rad51 chromatin loading is delayed when both Pso2 and components of the Mph1-Mgm101-MutSα and Exo1 pathway are inactivated, demonstrating that the homologous recombination stages of ICL repair are inhibited. Finally, the FANCJ- and FANCP-related factors Chl1 and Slx4, respectively, are also components of the genetic pathway controlled by Mph1-Mgm101-MutSα. Together this suggests that a prototypical FA-related ICL repair pathway operates in budding yeast, which acts redundantly with the pathway controlled by Pso2, and is required for the targeting of Exo1 to chromatin to execute ICL repair.

  7. Oral yeast colonization throughout pregnancy.

    Science.gov (United States)

    Rio, R; Simões-Silva, L; Garro, S; Silva, M-J; Azevedo, Á; Sampaio-Maia, B

    2017-03-01

    Recent studies suggest that placenta may harbour a unique microbiome that may have origin in maternal oral microbiome. Although the major physiological and hormonal adjustments observed in pregnant women lead to biochemical and microbiological modifications of the oral environment, very few studies evaluated the changes suffered by the oral microbiota throughout pregnancy. So, the aim of our study was to evaluate oral yeast colonization throughout pregnancy and to compare it with non-pregnant women. The oral yeast colonization was assessed in saliva of 30 pregnant and non-pregnant women longitudinally over a 6-months period. Demographic information was collected, a non-invasive intra-oral examination was performed and saliva flow and pH were determined. Pregnant and non-pregnant groups were similar regarding age and level of education. Saliva flow rate did not differ, but saliva pH was lower in pregnant than in non-pregnant women. Oral yeast prevalence was higher in pregnant than in non-pregnant women, either in the first or in the third trimester, but did not attain statistical significance. In individuals colonized with yeast, the total yeast quantification (Log10CFU/mL) increase from the 1st to the 3rd trimester in pregnant women, but not in non-pregnant women. Pregnancy may favour oral yeast growth that may be associated with an acidic oral environment.

  8. A Novel Family of Cell Wall-Related Proteins Regulated Differently during the Yeast Life Cycle

    Science.gov (United States)

    Rodríguez-Peña, José Manuel; Cid, Víctor J.; Arroyo, Javier; Nombela, César

    2000-01-01

    The Saccharomyces cerevisiae Ygr189c, Yel040w, and Ylr213c gene products show significant homologies among themselves and with various bacterial β-glucanases and eukaryotic endotransglycosidases. Deletion of the corresponding genes, either individually or in combination, did not produce a lethal phenotype. However, the removal of YGR189c and YEL040w, but not YLR213c, caused additive sensitivity to compounds that interfere with cell wall construction, such as Congo red and Calcofluor White, and overexpression of YEL040w led to resistance to these compounds. These genes were renamed CRH1 and CRH2, respectively, for Congo red hypersensitive. By site-directed mutagenesis we found that the putative glycosidase domain of CRH1 was critical for its function in complementing hypersensitivity to the inhibitors. The involvement of CRH1 and CRH2 in the development of cell wall architecture was clearly shown, since the alkali-soluble glucan fraction in the crh1Δ crh2Δ strain was almost twice the level in the wild-type. Interestingly, the three genes were subject to different patterns of transcriptional regulation. CRH1 and YLR213c (renamed CRR1, for CRH related) were found to be cell cycle regulated and also expressed under sporulation conditions, whereas CRH2 expression did not vary during the mitotic cycle. Crh1 and Crh2 are localized at the cell surface, particularly in chitin-rich areas. Consistent with the observed expression patterns, Crh1–green fluorescent protein was found at the incipient bud site, around the septum area in later stages of budding, and in ascospore envelopes. Crh2 was found to localize mainly at the bud neck throughout the whole budding cycle, in mating projections and zygotes, but not in ascospores. These data suggest that the members of this family of putative glycosidases might exert a common role in cell wall organization at different stages of the yeast life cycle. PMID:10757808

  9. Morphological characterization and gene expression profiling during bud development in a tropical perennial, Litchi chinensis Sonn.

    Directory of Open Access Journals (Sweden)

    Huifeng Zhang

    2016-10-01

    Full Text Available Tropical evergreen perennials undergo recurrent flush growth, and their terminal buds alternate between growth and dormancy. In sharp contrast to intensive studies on bud development in temperate deciduous trees, there is little information about bud development regulation in tropical trees. In this study, litchi (Litchi chinensis Sonn. was used as a model tropical perennial for morphological characterization and transcriptomic analysis of bud development. Litchi buds are naked with apical meristem embraced by rudimentary leaves, which are brown at dormant stage (Stage I. They swell and turn greenish as buds break (Stage II, and as growth accelerates, the rudimentary leaves elongate and open exposing the inner leaf primodia. With the outgrowth of the needle-like leaflets, bud growth reaches a maximum (Stage III. When leaflets expand, bud growth cease with the abortion of the rudimentary leaves at upper positions (Stage IV. Then buds turn brown and reenter dormant status. Budbreak occurs again when new leaves become hard green. Buds at four stages (Stage I to IV were collected for respiration measurements and in-depth RNA sequencing. Respiration rate was lowest at Stage I and highest at Stage II, decreasing towards growth cessation. RNA sequencing obtained over 5 Gb data from each of the bud samples and de novo assembly generated a total of 59999 unigenes, 40119 of which were annotated. Pair-wise comparison of gene expression between stages, gene profiling across stages, GO/KEGG enrichment analysis, and the expression patterns of 17 major genes highlighted by principal component (PC analysis displayed significant changes in stress resistance, hormone signal pathways, circadian rhythm, photosynthesis, cell division, carbohydrate metabolism, programmed cell death during bud development, which might be under epigenetic control involving chromatin methylation. The qPCR results of 8 selected unigenes with high PC scores agreed with the RPKM values

  10. BudBurst Buddies: Introducing Young Citizen Scientists to Plants and Environmental Change

    Science.gov (United States)

    Ward, D.; Gardiner, L. S.; Henderson, S.

    2011-12-01

    As part of Project BudBurst, the BudBurst Buddies recently moved to the National Ecological Network (NEON) as part of its Education and Public Engagement efforts. The BudBurst Buddies (www.budburstbuddies.org) were created to engage elementary school age children in the science of observing plants and the timing of phenological (life cycle) events. BudBurst Buddies is a part of the Project BudBurst national citizen science initiative (www.budburst.org), which allows individuals to engage in the scientific process, contributing to a better understanding of climate change while increasing public awareness of phenology and the impacts of climate change on plants. As a first step towards engaging the next generation of citizen scientists, BudBurst Buddies provides the opportunity for children to gain experience with scientific research and increases awareness of how plants change throughout the year. Hundreds of young students have participated in the inaugural year of BudBurst Buddies. Children can participate in BudBurst Buddies on their own, with their families, or in formal or informal education settings. The program was recently highlighted by education staff at the New York Hall of Science and numerous classrooms have been implementing this resource as part of their curriculum. Each child who participates creates a journal about a plant of his or her choosing, makes observations of the plant over the growing season and submits findings online, earning an official BudBurst Buddies certificate. An online storybook for kids tells how two children, Lily and Sage, observed plants in their neighborhood and became BudBurst Buddies. This presentation will provide an overview of the BudBurst Buddies resources including a new implementation guide and will also share feedback from the first year of implementation.

  11. Ontogeny and innervation of taste buds in mouse palatal gustatory epithelium.

    Science.gov (United States)

    Rashwan, Ahmed; Konishi, Hiroyuki; El-Sharaby, Ashraf; Kiyama, Hiroshi

    2016-01-01

    We investigated the relationship between mouse taste bud development and innervation of the soft palate. We employed scanning electron microscopy and immunohistochemistry using antibodies against protein gene product 9.5 and peripherin to detect sensory nerves, and cytokeratin 8 and α-gustducin to stain palatal taste buds. At E14, nerve fibers were observed along the medial border of the palatal shelves that tracked toward the epithelium. At E15.5, primordial stages of taste buds in the basal lamina of the soft palate first appeared. At E16, the taste buds became large spherical masses of columnar cells scattered in the soft palate basal lamina. At E17, the morphology and also the location of taste buds changed. At E18-19, some taste buds acquired a more elongated shape with a short neck, extending a variable distance from the soft palate basal lamina toward the surface epithelium. At E18, mature taste buds with taste pores and perigemmal nerve fibers were observed on the surface epithelium of the soft palate. The expression of α-gustducin was demonstrated at postnatal day 1 and the number of pored taste buds increased with age and they became pear-shaped at 8 weeks. The percent of pored fungiform-like papillae at birth was 58.3% of the whole palate; this increased to 83.8% at postnatal day 8 and reached a maximum of 95.7% at 12 weeks. The innervation of the soft palate was classified into three types of plexuses in relation to taste buds: basal nerve plexus, intragemmal and perigemmal nerve fibers. This study reveals that the nerve fibers preceded the development of taste buds in the palate of mice, and therefore the nerve fibers have roles in the initial induction of taste buds in the soft palate. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. A Fate Map of the Murine Pancreas Buds Reveals a Multipotent Ventral Foregut Organ Progenitor

    Science.gov (United States)

    Angelo, Jesse R.; Guerrero-Zayas, Mara-Isel; Tremblay, Kimberly D.

    2012-01-01

    The definitive endoderm is the embryonic germ layer that gives rise to the budding endodermal organs including the thyroid, lung, liver and pancreas as well as the remainder of the gut tube. DiI fate mapping and whole embryo culture were used to determine the endodermal origin of the 9.5 days post coitum (dpc) dorsal and ventral pancreas buds. Our results demonstrate that the progenitors of each bud occupy distinct endodermal territories. Dorsal bud progenitors are located in the medial endoderm overlying somites 2–4 between the 2 and 11 somite stage (SS). The endoderm forming the ventral pancreas bud is found in 2 distinct regions. One territory originates from the left and right lateral endoderm caudal to the anterior intestinal portal by the 6 SS and the second domain is derived from the ventral midline of the endoderm lip (VMEL). Unlike the laterally located ventral foregut progenitors, the VMEL population harbors a multipotent progenitor that contributes to the thyroid bud, the rostral cap of the liver bud, ventral midline of the liver bud and the midline of the ventral pancreas bud in a temporally restricted manner. This data suggests that the midline of the 9.5 dpc thyroid, liver and ventral pancreas buds originates from the same progenitor population, demonstrating a developmental link between all three ventral foregut buds. Taken together, these data define the location of the dorsal and ventral pancreas progenitors in the prespecified endodermal sheet and should lead to insights into the inductive events required for pancreas specification. PMID:22815796

  13. Yeast ribosomal proteins

    International Nuclear Information System (INIS)

    Otaka, E.; Kobata, K.

    1978-01-01

    The cytoplasmic 80s ribosomal proteins from the cells of yeast Saccharomyces cerevisiae were analyzed by SDS two-dimensional polyacrylamide gel electrophoresis. Seventyfour proteins were identified and consecutively numbered from 1 to 74. Upon oxidation of the 80s proteins with performic acid, ten proteins (no. 15, 20, 35, 40, 44, 46, 49, 51, 54 and 55) were dislocated on the gel without change of the total number of protein spots. Five proteins (no. 8, 14, 16, 36 and 74) were phosphorylated in vivo as seen in 32 P-labelling experiments. The large and small subunits separated in low magnesium medium were analyzed by the above gel electrophoresis. At least forty-five and twenty-eight proteins were assumed to be in the large and small subunits, respectively. All proteins found in the 80s ribosomes, except for no. 3, were detected in either subunit without appearance of new spots. The acidic protein no. 3 seems to be lost during subunit dissociation. (orig.) [de

  14. Metabolic regulation of yeast

    Science.gov (United States)

    Fiechter, A.

    1982-12-01

    Metabolic regulation which is based on endogeneous and exogeneous process variables which may act constantly or time dependently on the living cell is discussed. The observed phenomena of the regulation are the result of physical, chemical, and biological parameters. These parameters are identified. Ethanol is accumulated as an intermediate product and the synthesis of biomass is reduced. This regulatory effect of glucose is used for the aerobic production of ethanol. Very high production rates are thereby obtained. Understanding of the regulation mechanism of the glucose effect has improved. In addition to catabolite repression, several other mechanisms of enzyme regulation have been described, that are mostly governed by exogeneous factors. Glucose also affects the control of respiration in a third class of yeasts which are unable to make use of ethanol as a substrate for growth. This is due to the lack of any anaplerotic activity. As a consequence, diauxic growth behavior is reduced to a one-stage growth with a drastically reduced cell yield. The pulse chemostat technique, a systematic approach for medium design is developed and medium supplements that are essential for metabolic control are identified.

  15. Lung bud anomalies: Radiologic findings in 30 patients

    International Nuclear Information System (INIS)

    Son, Kyung Myung; Yang, Hae Ryoun; Jeon, Jeong Su; Kim, Ok Hwa; Kim, Choon Yul; Bahk, Yong Whee

    1990-01-01

    Bronchogenic cyst, pulmonary sequestration, congenital cystic adenomatoid malformation and congenital lobar emphysema are four major congenital cystic pulmonary diseases that represent a spectrum of closely related anomalies arising at early stage of embryonic lung bud maturation. Most of them present with recurrent pulmonary infections or chest pain since childhood and usually the diagnosis is made at this age. Sometimes the lesions are silent and found at adult age. We retrospectively analyzed the pain chest radiograms of 30 patients with a lung bud anomaly. The diagnosis was established by surgery and biopsy, but bronchography, computed tomography and ultrasonography aided in the diagnosis, seventeen bronchogenic cysts, 8 pulmonary sequestrations, 2 congenital cystic adenomatoid malformations, 2 congenital lobar emphysema and 1 congenital bronchial stenosis are included in this study. Nine out of 13 intrapulmonary bronchogenic cysts involved the lower lobes: thin-walled cysts with or without air-fluid level were the characteristic chest roentgenographic finding. However, mediastinal bronchogenic cysts showed well-marginated mass. The pulmonary sequestration showed similar cysts mass with or without air-fluid levels in five out of eight patients, but the cyst wall was not so sharply defined as in the bronchogenic cyst. In two patients of congenital cystic adenomatoid malformation, a large thin-walled cyst with air fluid level was noted and differentiation from intrapulmonary bronchogenic cyst was difficult both by chest roentgenogram and computed tomography. Two patients of congenital lobar emphysema and one patient of bronchial stenosis showed unilateral hyperlucent lung without discrete cystic mass formation

  16. Micropropagation of Hedychium coronarium J. Koenig through rhizome bud.

    Science.gov (United States)

    Mohanty, Pritam; Behera, Shashikanta; Swain, Swasti S; Barik, Durga P; Naik, Soumendra K

    2013-10-01

    An optimized protocol was developed for in vitro plant regeneration of a medicinally important herb Hedychium coronarium J. Koenig using sprouted buds of rhizomes. The rhizomes with sprouted bud were inoculated on Murashige and Skoog (Physiol Plant 15:473-497, 1962) medium (MS) supplemented with either N(6)-benzyladenine (BA) alone (1.0-4.0 mg L(-1)) or in combination with 0.5 mg L(-1) naphthalene acetic acid (NAA). Of these combinations, MS supplemented with a combination of 2.0 mg L(-1) BA and 0.5 mg L(-1) NAA was most effective. In this medium, best shoots (3.6) and roots (4.0) regeneration was observed simultaneously with an average shoot and root length of 4.7 cm and 4.2 cm respectively. Regeneration of shoots and roots in the same medium at the same time (One step shoot and root regeneration) reduced the time for production of in vitro plantlets and eliminates the media cost of rooting. Cent-percent (100 %) success in plant establishment was observed in both gradual acclimatization process as well as when plants were directly transferred to outdoor in clay pots containing a mixture of garden soil and sand (2:1) without any sequential acclimatization stage.

  17. Receptosecretory nature of type III cells in the taste bud.

    Science.gov (United States)

    Yoshie, Sumio

    2009-01-01

    Type III cells in taste buds form chemical synapses with intragemmal afferent nerve fibers and are characterized by the presence of membrane-bound vesicles in the cytoplasm. Although the vesicles differ in shape and size among species, they are primarily categorized into small clear (40 nm in diameter) and large dense-cored (90-200 nm) types. As such vesicles tend to be closely juxtaposed to the synaptic membrane of the cells, it is reasonable to consider that the vesicles include transmitter(s) towards the gustatory nerve. In the guinea-pig taste bud, stimulation with various taste substances (sucrose, sodium chloride, quinine hydrochloride, or monosodium L-glutamate) causes ultrastructural alterations of the type III cells. At the synapse, the presynaptic plasma membrane often displays invaginations of 90 nm in a mean diameter towards the cytoplasm, which indicates the dense-cored vesicles opening into the synaptic cleft by means of exocytosis. The vesicles are also exocytosed at the non-synaptic region into the intercellular space. These findings strongly suggest that the transmitters presumably contained in the vesicles are released to conduct the excitement of the type III cells to the nerves and also to exert their paracrine effects upon the surroundings, such as the Ebner's salivary gland, acting as local hormones.

  18. Changes in taste bud volume during taste disturbance.

    Science.gov (United States)

    Srur, Ehab; Pau, Hans Wilhelm; Just, Tino

    2011-08-01

    On-line mapping and serial volume measurements of taste buds with confocal laser scanning microscopy provide information on the peripheral gustatory organ over time. We report the volumetric measurements of four selected fungiform papillae over 8 weeks in a 62-year-old man with taste disturbance, which was more apparent on the right than on the left side. In the two papillae on the right side, no taste buds were detected within the fungiform papillae in the sixth and eighth week. During sixth and eighth week, there was no response to the highest presented stimuli in electrogustometry (1 mA) on the right-sided tongue tip nor at the tongue edge. The morphology (shape, diameter) of the fungiform papillae on both sides remained unchanged. Comparison of the time course of the volume changes revealed differences corresponding to gustatory sensitivity. These findings suggest that the time course of volume changes indicated taste disturbance in our patient, rather than morphological changes in the fungiform papillae. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  19. A computational clonal analysis of the developing mouse limb bud.

    Directory of Open Access Journals (Sweden)

    Luciano Marcon

    Full Text Available A comprehensive spatio-temporal description of the tissue movements underlying organogenesis would be an extremely useful resource to developmental biology. Clonal analysis and fate mappings are popular experiments to study tissue movement during morphogenesis. Such experiments allow cell populations to be labeled at an early stage of development and to follow their spatial evolution over time. However, disentangling the cumulative effects of the multiple events responsible for the expansion of the labeled cell population is not always straightforward. To overcome this problem, we develop a novel computational method that combines accurate quantification of 2D limb bud morphologies and growth modeling to analyze mouse clonal data of early limb development. Firstly, we explore various tissue movements that match experimental limb bud shape changes. Secondly, by comparing computational clones with newly generated mouse clonal data we are able to choose and characterize the tissue movement map that better matches experimental data. Our computational analysis produces for the first time a two dimensional model of limb growth based on experimental data that can be used to better characterize limb tissue movement in space and time. The model shows that the distribution and shapes of clones can be described as a combination of anisotropic growth with isotropic cell mixing, without the need for lineage compartmentalization along the AP and PD axis. Lastly, we show that this comprehensive description can be used to reassess spatio-temporal gene regulations taking tissue movement into account and to investigate PD patterning hypothesis.

  20. Bud-bank and tiller dynamics of co-occurring C3 caespitose grasses in mixed-grass prairie.

    Science.gov (United States)

    Ott, Jacqueline P; Hartnett, David C

    2015-09-01

    Tiller recruitment from the belowground bud bank of caespitose grasses influences their ability to monopolize local resources and, hence, their genet fitness. Differences in bud production and outgrowth among tiller types within a genet and among species may explain co-occurrence of caespitose grasses. This study aimed to characterize genet bud-bank and tiller production and dynamics in two co-occurring species and compare their vegetative reproductive strategies. Bud-bank and tiller dynamics of Hesperostipa comata and Nassella viridula, dominant C3 caespitose grasses in the northern mixed-grass prairie of North America, were assessed throughout an annual cycle. The two species showed similar strategies, maintaining polycyclic tillers and thus creating mixed-age genet bud banks comprising multiple bud cohorts produced in different years. Vegetative tillers produced the majority of buds, whereas flowering tillers contributed little to the bud bank. Buds lived for at least 2 yr and were maintained in multiple developmental stages throughout the year. Because bud longevity rarely exceeded tiller longevity, tiller longevity drove turnover within the bud bank. Tiller population dynamics, more than bud production per tiller, determined the differential contribution of tiller types to the bud bank. Nassella viridula had higher bud production per tiller, a consistent annual tiller recruitment density, and greater longevity of buds on senesced and flowering tillers than H. comata. Co-occurring C3 caespitose grasses had similar bud-bank and tiller dynamics contributing to genet persistence but differed in bud characteristics that could affect genet longevity and species coexistence. © 2015 Botanical Society of America.

  1. A Stochastic Model of the Yeast Cell Cycle Reveals Roles for Feedback Regulation in Limiting Cellular Variability.

    Science.gov (United States)

    Barik, Debashis; Ball, David A; Peccoud, Jean; Tyson, John J

    2016-12-01

    The cell division cycle of eukaryotes is governed by a complex network of cyclin-dependent protein kinases (CDKs) and auxiliary proteins that govern CDK activities. The control system must function reliably in the context of molecular noise that is inevitable in tiny yeast cells, because mistakes in sequencing cell cycle events are detrimental or fatal to the cell or its progeny. To assess the effects of noise on cell cycle progression requires not only extensive, quantitative, experimental measurements of cellular heterogeneity but also comprehensive, accurate, mathematical models of stochastic fluctuations in the CDK control system. In this paper we provide a stochastic model of the budding yeast cell cycle that accurately accounts for the variable phenotypes of wild-type cells and more than 20 mutant yeast strains simulated in different growth conditions. We specifically tested the role of feedback regulations mediated by G1- and SG2M-phase cyclins to minimize the noise in cell cycle progression. Details of the model are informed and tested by quantitative measurements (by fluorescence in situ hybridization) of the joint distributions of mRNA populations in yeast cells. We use the model to predict the phenotypes of ~30 mutant yeast strains that have not yet been characterized experimentally.

  2. A Stochastic Model of the Yeast Cell Cycle Reveals Roles for Feedback Regulation in Limiting Cellular Variability.

    Directory of Open Access Journals (Sweden)

    Debashis Barik

    2016-12-01

    Full Text Available The cell division cycle of eukaryotes is governed by a complex network of cyclin-dependent protein kinases (CDKs and auxiliary proteins that govern CDK activities. The control system must function reliably in the context of molecular noise that is inevitable in tiny yeast cells, because mistakes in sequencing cell cycle events are detrimental or fatal to the cell or its progeny. To assess the effects of noise on cell cycle progression requires not only extensive, quantitative, experimental measurements of cellular heterogeneity but also comprehensive, accurate, mathematical models of stochastic fluctuations in the CDK control system. In this paper we provide a stochastic model of the budding yeast cell cycle that accurately accounts for the variable phenotypes of wild-type cells and more than 20 mutant yeast strains simulated in different growth conditions. We specifically tested the role of feedback regulations mediated by G1- and SG2M-phase cyclins to minimize the noise in cell cycle progression. Details of the model are informed and tested by quantitative measurements (by fluorescence in situ hybridization of the joint distributions of mRNA populations in yeast cells. We use the model to predict the phenotypes of ~30 mutant yeast strains that have not yet been characterized experimentally.

  3. Male Seychelles warblers use territory budding to maximize lifetime fitness in a saturated environment

    NARCIS (Netherlands)

    Komdeur, J; Edelaar, P

    2001-01-01

    In cooperatively breeding species, helping at the nest and budding off part of the natal territory have been advanced as strategies to increase fitness in an environment that is saturated with territories. The importance of helping or territory budding as a determinant of lifetime reproductive

  4. Ethylene production, ACC and MACC content of freesia buds and florets.

    NARCIS (Netherlands)

    Spikman, G.

    1988-01-01

    Changes in ethylene production, ACC (1-aminocyclopropane-1-carboxylic acid) and MACC (1-(malonylamino)-cyclopropane-1-carboxylic acid) content of buds and florets of detached inflorescences were studied. Most of the ethylene produced by the inflorescences came from small buds at the apex. This

  5. De groei van jonge Hevea-oculaties = The growth of young Hevea buddings

    NARCIS (Netherlands)

    Ostendorf, F.W.

    1933-01-01

    Results were presented of studies on the initial growth of Hevea buddings, at the Proefstation West-Java, Buitenzorg (now Bogor). The time elapsing between cutting off the stock above the union and sprouting of the implanted bud was a clonal character; so also was the angle between the young sprout

  6. Morphological and physiological aspects of the early phases of flower bud formation of apple

    NARCIS (Netherlands)

    Verheij, F.A.

    1996-01-01


    For consistent yields in apple fruit production, knowledge of the factors affecting flower bud formation is required. The aim of this study was to gain more insight in the role of endogenous factors in flower bud formation of apple. The effects of temperature, applied gibberellin (GA

  7. The YPLGVG sequence of the Nipah virus matrix protein is required for budding

    Directory of Open Access Journals (Sweden)

    Yan Lianying

    2008-11-01

    Full Text Available Abstract Background Nipah virus (NiV is a recently emerged paramyxovirus capable of causing fatal disease in a broad range of mammalian hosts, including humans. Together with Hendra virus (HeV, they comprise the genus Henipavirus in the family Paramyxoviridae. Recombinant expression systems have played a crucial role in studying the cell biology of these Biosafety Level-4 restricted viruses. Henipavirus assembly and budding occurs at the plasma membrane, although the details of this process remain poorly understood. Multivesicular body (MVB proteins have been found to play a role in the budding of several enveloped viruses, including some paramyxoviruses, and the recruitment of MVB proteins by viral proteins possessing late budding domains (L-domains has become an important concept in the viral budding process. Previously we developed a system for producing NiV virus-like particles (VLPs and demonstrated that the matrix (M protein possessed an intrinsic budding ability and played a major role in assembly. Here, we have used this system to further explore the budding process by analyzing elements within the M protein that are critical for particle release. Results Using rationally targeted site-directed mutagenesis we show that a NiV M sequence YPLGVG is required for M budding and that mutation or deletion of the sequence abrogates budding ability. Replacement of the native and overlapping Ebola VP40 L-domains with the NiV sequence failed to rescue VP40 budding; however, it did induce the cellular morphology of extensive filamentous projection consistent with wild-type VP40-expressing cells. Cells expressing wild-type NiV M also displayed this morphology, which was dependent on the YPLGVG sequence, and deletion of the sequence also resulted in nuclear localization of M. Dominant-negative VPS4 proteins had no effect on NiV M budding, suggesting that unlike other viruses such as Ebola, NiV M accomplishes budding independent of MVB cellular proteins

  8. TheCellMap.org: A Web-Accessible Database for Visualizing and Mining the Global Yeast Genetic Interaction Network.

    Science.gov (United States)

    Usaj, Matej; Tan, Yizhao; Wang, Wen; VanderSluis, Benjamin; Zou, Albert; Myers, Chad L; Costanzo, Michael; Andrews, Brenda; Boone, Charles

    2017-05-05

    Providing access to quantitative genomic data is key to ensure large-scale data validation and promote new discoveries. TheCellMap.org serves as a central repository for storing and analyzing quantitative genetic interaction data produced by genome-scale Synthetic Genetic Array (SGA) experiments with the budding yeast Saccharomyces cerevisiae In particular, TheCellMap.org allows users to easily access, visualize, explore, and functionally annotate genetic interactions, or to extract and reorganize subnetworks, using data-driven network layouts in an intuitive and interactive manner. Copyright © 2017 Usaj et al.

  9. The ureteric bud epithelium: morphogenesis and roles in metanephric kidney patterning.

    Science.gov (United States)

    Nagalakshmi, Vidya K; Yu, Jing

    2015-03-01

    The mammalian metanephric kidney is composed of two epithelial components, the collecting duct system and the nephron epithelium, that differentiate from two different tissues -the ureteric bud epithelium and the nephron progenitors, respectively-of intermediate mesoderm origin. The collecting duct system is generated through reiterative ureteric bud branching morphogenesis, whereas the nephron epithelium is formed in a process termed nephrogenesis, which is initiated with the mesenchymal-epithelial transition of the nephron progenitors. Ureteric bud branching morphogenesis is regulated by nephron progenitors, and in return, the ureteric bud epithelium regulates nephrogenesis. The metanephric kidney is physiologically divided along the corticomedullary axis into subcompartments that are enriched with specific segments of these two epithelial structures. Here, we provide an overview of the major molecular and cellular processes underlying the morphogenesis and patterning of the ureteric bud epithelium and its roles in the cortico-medullary patterning of the metanephric kidney. © 2015 Wiley Periodicals, Inc.

  10. Uptake and distribution of /sup 32/P in the budded and self-rooted grape varieties

    Energy Technology Data Exchange (ETDEWEB)

    Srinivasan, C; Chelam, G V; Shanmugam, A [Tamil Nadu Agricultural Univ., Coimbatore (India)

    1974-06-01

    In the self-rooted and budded varieties of grape (Vitis vinifera L.), the total P and /sup 32/P contents were high in 'Anabee-Shahi', but low in in 'Muscat'. The growing shoots contained more P than old stems and roots in all the varieties. In the budded plants, 'Kali Sahebi' scion budded on 'Anab-e-Shani showed the maximum /sup 32/P and total P in the shoots, but 'Muscat' scion budded on 'Anab-e-Shahi' accumulated more P in the roots and very low /sup 32/P in the growing shoots. Auto-radiographs of shoots also showed that 'Kali Sahebi' budded on 'Anab-e-Shani' rootstock accumulated more /sup 32/P in the shoots.

  11. Lgr5 Identifies Progenitor Cells Capable of Taste Bud Regeneration after Injury.

    Directory of Open Access Journals (Sweden)

    Norifumi Takeda

    Full Text Available Taste buds are composed of a variety of taste receptor cell types that develop from tongue epithelium and are regularly replenished under normal homeostatic conditions as well as after injury. The characteristics of cells that give rise to regenerating taste buds are poorly understood. Recent studies have suggested that Lgr5 (leucine-rich repeat-containing G-protein coupled receptor 5 identifies taste bud stem cells that contribute to homeostatic regeneration in adult circumvallate and foliate taste papillae, which are located in the posterior region of the tongue. Taste papillae in the adult anterior region of the tongue do not express Lgr5. Here, we confirm and extend these studies by demonstrating that Lgr5 cells give rise to both anterior and posterior taste buds during development, and are capable of regenerating posterior taste buds after injury induced by glossopharyngeal nerve transection.

  12. Lgr5 Identifies Progenitor Cells Capable of Taste Bud Regeneration after Injury.

    Science.gov (United States)

    Takeda, Norifumi; Jain, Rajan; Li, Deqiang; Li, Li; Lu, Min Min; Epstein, Jonathan A

    2013-01-01

    Taste buds are composed of a variety of taste receptor cell types that develop from tongue epithelium and are regularly replenished under normal homeostatic conditions as well as after injury. The characteristics of cells that give rise to regenerating taste buds are poorly understood. Recent studies have suggested that Lgr5 (leucine-rich repeat-containing G-protein coupled receptor 5) identifies taste bud stem cells that contribute to homeostatic regeneration in adult circumvallate and foliate taste papillae, which are located in the posterior region of the tongue. Taste papillae in the adult anterior region of the tongue do not express Lgr5. Here, we confirm and extend these studies by demonstrating that Lgr5 cells give rise to both anterior and posterior taste buds during development, and are capable of regenerating posterior taste buds after injury induced by glossopharyngeal nerve transection.

  13. Cell kinetic study on the relation between irradiation hypogeusia and taste buds in rats

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, Hideharu; Furumoto, Keiichi [Nippon Dental Univ., Tokyo (Japan)

    1998-12-01

    The present study was designed to elucidate the mechanism of hypogeusia caused by irradiation. X-ray treatment at 10 Gy or 20 Gy was given to the maxillofacial region including the tongue in rats, and the involvement of taste bud for hypogeusia was investigated. In addition, cytological kinetics were immunohistologically studied using bromodeoxyuridine in the taste bud and in the lingual mucosal epithelium. The following results were obtained: In the 10 Gy group, the number of taste bud become less after the exposure, but no hypogeusia was observed during the experimental period. In the 20 Gy group, any labeled taste bud was not observed on the 7th day, and all taste buds disappeared by the 10th day. In the lingual mucosal epithelium, the number of basal cells decreased to the minimum, and the body weight and total water intake decreased coincidently in the 20 Gy group, which were few in the 10 Gy group. (author)

  14. The number of taste buds is related to bitter taste sensitivity in layer and broiler chickens.

    Science.gov (United States)

    Kudo, Ken-ichi; Shiraishi, Jun-ichi; Nishimura, Shotaro; Bungo, Takashi; Tabata, Shoji

    2010-04-01

    The relationship between taste sensitivity and the number of taste buds using a bitter tastant, quinine hydrochloride, was investigated in White Leghorn, Rhode Island Red, and broiler chickens. The White Leghorn and Rhode Island Red strains were able to perceive 2.0 mmol/L quinine hydrochloride, but the taste sensitivity of Rhode Island Red chickens was higher than that of White Leghorn chickens. Broiler chickens perceived 0.5 mmol/L quinine hydrochloride. The number of taste buds in the White Leghorn strain was the lowest, then the Rhode Island Red strain, with the number of taste buds highest in the broiler chickens. The number of taste buds was well correlated with bitter taste sensitivity. Therefore, we suggest that the number of taste buds is a vital factor in the perception of bitter taste and may be useful in selecting appropriate feeds for chickens.

  15. Cell kinetic study on the relation between irradiation hypogeusia and taste buds in rats

    International Nuclear Information System (INIS)

    Kubota, Hideharu; Furumoto, Keiichi

    1998-01-01

    The present study was designed to elucidate the mechanism of hypogeusia caused by irradiation. X-ray treatment at 10 Gy or 20 Gy was given to the maxillofacial region including the tongue in rats, and the involvement of taste bud for hypogeusia was investigated. In addition, cytological kinetics were immunohistologically studied using bromodeoxyuridine in the taste bud and in the lingual mucosal epithelium. The following results were obtained: In the 10 Gy group, the number of taste bud become less after the exposure, but no hypogeusia was observed during the experimental period. In the 20 Gy group, any labeled taste bud was not observed on the 7th day, and all taste buds disappeared by the 10th day. In the lingual mucosal epithelium, the number of basal cells decreased to the minimum, and the body weight and total water intake decreased coincidently in the 20 Gy group, which were few in the 10 Gy group. (author)

  16. Yeast Flocculation—Sedimentation and Flotation

    Directory of Open Access Journals (Sweden)

    Graham G. Stewart

    2018-04-01

    Full Text Available Unlike most fermentation alcohol beverage production processes, brewers recycle their yeast. This is achieved by employing a yeast culture’s: flocculation, adhesion, sedimentation, flotation, and cropping characteristics. As a consequence of yeast recycling, the quality of the cropped yeast culture’s characteristics is critical. However, the other major function of brewer’s yeast is to metabolise wort into ethanol, carbon dioxide, glycerol, and other fermentation products, many of which contribute to beer’s overall flavour characteristics. This review will only focus on brewer’s yeast flocculation characteristics.

  17. The linear interplay of intrinsic and extrinsic noises ensures a high accuracy of cell fate selection in budding yeast

    Science.gov (United States)

    Li, Yongkai; Yi, Ming; Zou, Xiufen

    2014-01-01

    To gain insights into the mechanisms of cell fate decision in a noisy environment, the effects of intrinsic and extrinsic noises on cell fate are explored at the single cell level. Specifically, we theoretically define the impulse of Cln1/2 as an indication of cell fates. The strong dependence between the impulse of Cln1/2 and cell fates is exhibited. Based on the simulation results, we illustrate that increasing intrinsic fluctuations causes the parallel shift of the separation ratio of Whi5P but that increasing extrinsic fluctuations leads to the mixture of different cell fates. Our quantitative study also suggests that the strengths of intrinsic and extrinsic noises around an approximate linear model can ensure a high accuracy of cell fate selection. Furthermore, this study demonstrates that the selection of cell fates is an entropy-decreasing process. In addition, we reveal that cell fates are significantly correlated with the range of entropy decreases. PMID:25042292

  18. Strand-Specific Analysis of DNA Synthesis and Proteins Association with DNA Replication Forks in Budding Yeast.

    Science.gov (United States)

    Yu, Chuanhe; Gan, Haiyun; Zhang, Zhiguo

    2018-01-01

    DNA replication initiates at DNA replication origins after unwinding of double-strand DNA(dsDNA) by replicative helicase to generate single-stranded DNA (ssDNA) templates for the continuous synthesis of leading-strand and the discontinuous synthesis of lagging-strand. Therefore, methods capable of detecting strand-specific information will likely yield insight into the association of proteins at leading and lagging strand of DNA replication forks and the regulation of leading and lagging strand synthesis during DNA replication. The enrichment and Sequencing of Protein-Associated Nascent DNA (eSPAN), which measure the relative amounts of proteins at nascent leading and lagging strands of DNA replication forks, is a step-wise procedure involving the chromatin immunoprecipitation (ChIP) of a protein of interest followed by the enrichment of protein-associated nascent DNA through BrdU immunoprecipitation. The isolated ssDNA is then subjected to strand-specific sequencing. This method can detect whether a protein is enriched at leading or lagging strand of DNA replication forks. In addition to eSPAN, two other strand-specific methods, (ChIP-ssSeq), which detects potential protein-ssDNA binding and BrdU-IP-ssSeq, which can measure synthesis of both leading and lagging strand, were developed along the way. These methods can provide strand-specific and complementary information about the association of the target protein with DNA replication forks as well as synthesis of leading and lagging strands genome wide. Below, we describe the detailed eSPAN, ChIP-ssSeq, and BrdU-IP-ssSeq protocols.

  19. Structure and Function of the Ankyrin Repeats in the Sw14/Sw16 Transcription Complex of Budding Yeast

    National Research Council Canada - National Science Library

    Breeden, Linda

    1998-01-01

    ANK repeats were first found in the Swi6 transcription factor of Saccharomyces cerevisiae and since then were identified in many proteins, including oncogenes and tumor suppressors We have previously...

  20. A Clb/Cdk1-mediated regulation of Fkh2 synchronizes CLB expression in the budding yeast cell cycle

    NARCIS (Netherlands)

    Linke, C.; Chasapi, A.; González-Novo, A.; Al Sawad, I.; Tognetti, S.; Klipp, E.; Loog, M.; Krobitsch, S.; Posas, F.; Xenarios, I.; Barberis, M.

    2017-01-01

    Precise timing of cell division is achieved by coupling waves of cyclin-dependent kinase (Cdk) activity with a transcriptional oscillator throughout cell cycle progression. Although details of transcription of cyclin genes are known, it is unclear which is the transcriptional cascade that modulates

  1. Origin of nuclear buds and micronuclei in normal and folate-deprived human lymphocytes

    International Nuclear Information System (INIS)

    Lindberg, Hanna K.; Wang Xu; Jaerventaus, Hilkka; Falck, Ghita C.-M.; Norppa, Hannu; Fenech, Michael

    2007-01-01

    Micronuclei are formed from chromosomes and chromosomal fragments that lag behind in anaphase and are left outside daughter nuclei in telophase. They may also be derived from broken anaphase bridges. Nuclear buds, micronucleus-like bodies attached to the nucleus by a thin nucleoplasmic connection, have been proposed to be generated similarly to micronuclei during nuclear division or in S-phase as a stage in the extrusion of extra DNA, possibly giving rise to micronuclei. To better understand these phenomena, we have characterized the contents of 894 nuclear buds and 1392 micronuclei in normal and folate-deprived 9-day cultures of human lymphocytes using fluorescence in situ hybridization with pancentromeric and pantelomeric DNA probes. Such information has not earlier been available for human primary cells. Surprisingly, there appears to be no previous data on the occurrence of telomeres in micronuclei (or buds) of normal human cells in general. Our results suggest that nuclear buds and micronuclei have partly different mechanistic origin. Interstitial DNA without centromere or telomere label was clearly more prevalent in nuclear buds (43%) than in micronuclei (13%). DNA with only telomere label or with both centromere and telomere label was more frequent in micronuclei (62% and 22%, respectively) than in nuclear buds (44% and 10%, respectively). Folate deprivation especially increased the frequency of nuclear buds and micronuclei harboring telomeric DNA and nuclear buds harboring interstitial DNA but also buds and micronuclei with both centromeric and telomeric DNA. According to the model we propose, that micronuclei in binucleate lymphocytes primarily derive from lagging chromosomes and terminal acentric fragments during mitosis. Most nuclear buds, however, are suggested to originate from interstitial or terminal acentric fragments, possibly representing nuclear membrane entrapment of DNA that has been left in cytoplasm after nuclear division or excess DNA that

  2. BudBurst Buddies: A New Tool for Engaging the Youngest Citizen Scientists

    Science.gov (United States)

    Gardiner, L. S.; Henderson, S.; Ward, D.

    2010-12-01

    BudBurst Buddies (www.budburstbuddies.org) introduces elementary school age children to the science of observing plants and the timing of phenological (life cycle) events. BudBurst Buddies is a new part of the Project BudBurst national citizen science initiative (www.budburst.org), which allows individuals to engage in the scientific process, contributing to a better understanding of climate change while increasing public awareness of phenology and the impacts of climate change on plants. As a first step towards engaging the next generation of citizen scientists, BudBurst Buddies provides the opportunity for children to gain experience with scientific research and increases awareness of how plants change throughout the year. Children can participate in BudBurst Buddies on their own, with their families, or in formal or informal education settings. Each child who participates creates a journal about a plant of his or her choosing, makes observations of the plant over the growing season and submits findings online, earning an official BudBurst Buddies certificate. An online storybook for kids tells how two children, Lily and Sage, observed plants in their neighborhood and became BudBurst Buddies. This presentation will provide an overview of the BudBurst Buddies newly developed resources. BudBurst Buddies is a part of Project BudBurst, a national citizen science program coordinated by the National Ecological Observatory Network (NEON) and the Chicago Botanic Garden. Funding for this resource was provided by NEON, NSF, NASA, and the National Geographic Education Foundation.

  3. Distribution, Innervation, and Cellular Organization of Taste Buds in the Sea Catfish, Plotosus japonicus.

    Science.gov (United States)

    Nakamura, Tatsufumi; Matsuyama, Naoki; Kirino, Masato; Kasai, Masanori; Kiyohara, Sadao; Ikenaga, Takanori

    2017-01-01

    The gustatory system of the sea catfish Plotosus japonicus, like that of other catfishes, is highly developed. To clarify the details of the morphology of the peripheral gustatory system of Plotosus, we used whole-mount immunohistochemistry to investigate the distribution and innervation of the taste buds within multiple organs including the barbels, oropharyngeal cavity, fins (pectoral, dorsal, and caudal), and trunk. Labeled taste buds could be observed in all the organs examined. The density of the taste buds was higher along the leading edges of the barbels and fins; this likely increases the chance of detecting food. In all the fins, the taste buds were distributed in linear arrays parallel to the fin rays. Labeling of nerve fibers by anti-acetylated tubulin antibody showed that the taste buds within each sensory field are innervated in different ways. In the barbels, large nerve bundles run along the length of the organ, with fascicles branching off to innervate polygonally organized groups of taste buds. In the fins, nerve bundles run along the axis of fin rays to innervate taste buds lying in a line. In each case, small fascicles of fibers branch from large bundles and terminate within the basal portions of the taste buds. Serotonin immunohistochemistry demonstrated that most of the taste buds in all the organs examined contained disk-shaped serotonin-immunopositive cells in their basal region. This indicates a similar organization of the taste buds, in terms of the existence of serotonin-immunopositive basal cells, across the different sensory fields in this species. © 2017 S. Karger AG, Basel.

  4. Taste bud leptin: sweet dampened at initiation site.

    Science.gov (United States)

    Travers, Susan P; Frank, Marion E

    2015-05-01

    The intriguing observation that leptin decreases sweet-evoked peripheral gustatory responses has aroused much interest (Kawai K, Sugimoto K, Nakashima K, Miura H, Ninomiya Y. 2000. Leptin as a modulator of sweet taste sensitivities in mice. Proc Natl Acad Sci U S A. 97(20):11044-11049.) due to its implied importance in controlling appetite. The effects of this anorexic hormone, however, appear more conditional than originally believed. In this issue of Chemical Senses, a careful study by Glendinning and colleagues, find no effects of leptin on sweet-evoked chorda tympani responses, whereas an equally careful study by Meredith and colleagues, find decreased release of ATP and increased release of 5-HT from taste buds in response to sweet stimuli. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  5. [Yeast species in vulvovaginitis candidosa].

    Science.gov (United States)

    Nemes-Nikodém, Éva; Tamási, Béla; Mihalik, Noémi; Ostorházi, Eszter

    2015-01-04

    Vulvovaginal candidiasis is the most common mycosis, however, the available information about antifungal susceptibilities of these yeasts is limited. To compare the gold standard fungal culture with a new molecular identification method and report the incidence of yeast species in vulvovaginitis candidosa. The authors studied 370 yeasts isolated from vulvovaginal candidiasis and identified them by phenotypic and molecular methods. The most common species was Candida albicans (85%), followed by Candida glabrata, and other Candida species. At present there are no recommendations for the evaluation of antifungal susceptibility of pathogenic fungal species occurring in vulvovaginal candidiasis and the natural antifungal resistance of the different species is known only. Matrix Assisted Laser Desorption Ionization Time of Flight identification can be used to differentiate the fluconazole resistant Candida dubliniensis and the sensitive Candida albicans strains.

  6. Voltage-gated sodium channels in taste bud cells.

    Science.gov (United States)

    Gao, Na; Lu, Min; Echeverri, Fernando; Laita, Bianca; Kalabat, Dalia; Williams, Mark E; Hevezi, Peter; Zlotnik, Albert; Moyer, Bryan D

    2009-03-12

    Taste bud cells transmit information regarding the contents of food from taste receptors embedded in apical microvilli to gustatory nerve fibers innervating basolateral membranes. In particular, taste cells depolarize, activate voltage-gated sodium channels, and fire action potentials in response to tastants. Initial cell depolarization is attributable to sodium influx through TRPM5 in sweet, bitter, and umami cells and an undetermined cation influx through an ion channel in sour cells expressing PKD2L1, a candidate sour taste receptor. The molecular identity of the voltage-gated sodium channels that sense depolarizing signals and subsequently initiate action potentials coding taste information to gustatory nerve fibers is unknown. We describe the molecular and histological expression profiles of cation channels involved in electrical signal transmission from apical to basolateral membrane domains. TRPM5 was positioned immediately beneath tight junctions to receive calcium signals originating from sweet, bitter, and umami receptor activation, while PKD2L1 was positioned at the taste pore. Using mouse taste bud and lingual epithelial cells collected by laser capture microdissection, SCN2A, SCN3A, and SCN9A voltage-gated sodium channel transcripts were expressed in taste tissue. SCN2A, SCN3A, and SCN9A were expressed beneath tight junctions in subsets of taste cells. SCN3A and SCN9A were expressed in TRPM5 cells, while SCN2A was expressed in TRPM5 and PKD2L1 cells. HCN4, a gene previously implicated in sour taste, was expressed in PKD2L1 cells and localized to cell processes beneath the taste pore. SCN2A, SCN3A and SCN9A voltage-gated sodium channels are positioned to sense initial depolarizing signals stemming from taste receptor activation and initiate taste cell action potentials. SCN2A, SCN3A and SCN9A gene products likely account for the tetrodotoxin-sensitive sodium currents in taste receptor cells.

  7. Genomic and Phenotypic Characterization of Yeast Biosensor for Deep-space Radiation

    Science.gov (United States)

    Marina, Diana B.; Santa Maria, Sergio; Bhattacharya, Sharmila

    2016-01-01

    The BioSentinel mission was selected to launch as a secondary payload onboard NASA Exploration Mission 1 (EM-1) in 2018. In BioSentinel, the budding yeast Saccharomyces cerevisiae will be used as a biosensor to measure the long-term impact of deep-space radiation to living organisms. In the 4U-payload, desiccated yeast cells from different strains will be stored inside microfluidic cards equipped with 3-color LED optical detection system to monitor cell growth and metabolic activity. At different times throughout the 12-month mission, these cards will be filled with liquid yeast growth media to rehydrate and grow the desiccated cells. The growth and metabolic rates of wild-type and radiation-sensitive strains in deep-space radiation environment will be compared to the rates measured in the ground- and microgravity-control units. These rates will also be correlated with measurements obtained from onboard physical dosimeters. In our preliminary long-term desiccation study, we found that air-drying yeast cells in 10% trehalose is the best method of cell preservation in order to survive the entire 18-month mission duration (6-month pre-launch plus 12-month full-mission periods). However, our study also revealed that desiccated yeast cells have decreasing viability over time when stored in payload-like environment. This suggests that the yeast biosensor will have different population of cells at different time points during the long-term mission. In this study, we are characterizing genomic and phenotypic changes in our yeast biosensor due to long-term storage and desiccation. For each yeast strain that will be part of the biosensor, several clones were reisolated after long-term storage by desiccation. These clones were compared to their respective original isolate in terms of genomic composition, desiccation tolerance and radiation sensitivity. Interestingly, clones from a radiation-sensitive mutant have better desiccation tolerance compared to their original isolate

  8. Design principles of the yeast G1/S switch.

    Directory of Open Access Journals (Sweden)

    Xiaojing Yang

    2013-10-01

    Full Text Available A hallmark of the G1/S transition in budding yeast cell cycle is the proteolytic degradation of the B-type cyclin-Cdk stoichiometric inhibitor Sic1. Deleting SIC1 or altering Sic1 degradation dynamics increases genomic instability. Certain key facts about the parts of the G1/S circuitry are established: phosphorylation of Sic1 on multiple sites is necessary for its destruction, and both the upstream kinase Cln1/2-Cdk1 and the downstream kinase Clb5/6-Cdk1 can phosphorylate Sic1 in vitro with varied specificity, cooperativity, and processivity. However, how the system works as a whole is still controversial due to discrepancies between in vitro, in vivo, and theoretical studies. Here, by monitoring Sic1 destruction in real time in individual cells under various perturbations to the system, we provide a clear picture of how the circuitry functions as a switch in vivo. We show that Cln1/2-Cdk1 sets the proper timing of Sic1 destruction, but does not contribute to its destruction speed; thus, it acts only as a trigger. Sic1's inhibition target Clb5/6-Cdk1 controls the speed of Sic1 destruction through a double-negative feedback loop, ensuring a robust all-or-none transition for Clb5/6-Cdk1 activity. Furthermore, we demonstrate that the degradation of a single-phosphosite mutant of Sic1 is rapid and switch-like, just as the wild-type form. Our mathematical model confirms our understanding of the circuit and demonstrates that the substrate sharing between the two kinases is not a redundancy but a part of the design to overcome the trade-off between the timing and sharpness of Sic1 degradation. Our study provides direct mechanistic insight into the design features underlying the yeast G1/S switch.

  9. Analytical model for macromolecular partitioning during yeast cell division

    International Nuclear Information System (INIS)

    Kinkhabwala, Ali; Khmelinskii, Anton; Knop, Michael

    2014-01-01

    Asymmetric cell division, whereby a parent cell generates two sibling cells with unequal content and thereby distinct fates, is central to cell differentiation, organism development and ageing. Unequal partitioning of the macromolecular content of the parent cell — which includes proteins, DNA, RNA, large proteinaceous assemblies and organelles — can be achieved by both passive (e.g. diffusion, localized retention sites) and active (e.g. motor-driven transport) processes operating in the presence of external polarity cues, internal asymmetries, spontaneous symmetry breaking, or stochastic effects. However, the quantitative contribution of different processes to the partitioning of macromolecular content is difficult to evaluate. Here we developed an analytical model that allows rapid quantitative assessment of partitioning as a function of various parameters in the budding yeast Saccharomyces cerevisiae. This model exposes quantitative degeneracies among the physical parameters that govern macromolecular partitioning, and reveals regions of the solution space where diffusion is sufficient to drive asymmetric partitioning and regions where asymmetric partitioning can only be achieved through additional processes such as motor-driven transport. Application of the model to different macromolecular assemblies suggests that partitioning of protein aggregates and episomes, but not prions, is diffusion-limited in yeast, consistent with previous reports. In contrast to computationally intensive stochastic simulations of particular scenarios, our analytical model provides an efficient and comprehensive overview of partitioning as a function of global and macromolecule-specific parameters. Identification of quantitative degeneracies among these parameters highlights the importance of their careful measurement for a given macromolecular species in order to understand the dominant processes responsible for its observed partitioning

  10. Evaluation of the ability of commercial wine yeasts to form biofilms (mats) and adhere to plastic: implications for the microbiota of the winery environment.

    Science.gov (United States)

    Tek, Ee Lin; Sundstrom, Joanna F; Gardner, Jennifer M; Oliver, Stephen G; Jiranek, Vladimir

    2018-02-01

    Commercially available active dried wine yeasts are regularly used by winemakers worldwide to achieve reliable fermentations and obtain quality wine. This practice has led to increased evidence of traces of commercial wine yeast in the vineyard, winery and uninoculated musts. The mechanism(s) that enables commercial wine yeast to persist in the winery environment and the influence to native microbial communities on this persistence is poorly understood. This study has investigated the ability of commercial wine yeasts to form biofilms and adhere to plastic. The results indicate that the biofilms formed by commercial yeasts consist of cells with a combination of different lifestyles (replicative and non-replicative) and growth modes including invasive growth, bud elongation, sporulation and a mat sectoring-like phenotype. Invasive growth was greatly enhanced on grape pulp regardless of strain, while adhesion on plastic varied between strains. The findings suggest a possible mechanism that allows commercial yeast to colonise and survive in the winery environment, which may have implications for the indigenous microbiota profile as well as the population profile in uninoculated fermentations if their dissemination is not controlled. © FEMS 2018. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  11. Radiation stimulation of yeast crops for increasing output of alcohol and baker yeasts

    International Nuclear Information System (INIS)

    Vlad, E.; Marsheu, P.

    1974-01-01

    The purpose of this study was to stimulate by gamma radiation the existing commercial types of yeast so as to obtain yeasts that would better reflect the substrate and have improved reproductive capacity. The experiments were conducted under ordinary conditions using commercial yeasts received from one factory producing alcohol and bakery yeasts and isolated as pure cultures. Irradiating yeast cultures with small doses (up to 10 krad) was found to stimulate the reproduction and fermenting activity of yeast cells as manifested in increased accumulation of yeast biomass and greater yield of ethyl alcohol. (E.T.)

  12. Sonic hedgehog from both nerves and epithelium is a key trophic factor for taste bud maintenance.

    Science.gov (United States)

    Castillo-Azofeifa, David; Losacco, Justin T; Salcedo, Ernesto; Golden, Erin J; Finger, Thomas E; Barlow, Linda A

    2017-09-01

    The integrity of taste buds is intimately dependent on an intact gustatory innervation, yet the molecular nature of this dependency is unknown. Here, we show that differentiation of new taste bud cells, but not progenitor proliferation, is interrupted in mice treated with a hedgehog (Hh) pathway inhibitor (HPI), and that gustatory nerves are a source of sonic hedgehog (Shh) for taste bud renewal. Additionally, epithelial taste precursor cells express Shh transiently, and provide a local supply of Hh ligand that supports taste cell renewal. Taste buds are minimally affected when Shh is lost from either tissue source. However, when both the epithelial and neural supply of Shh are removed, taste buds largely disappear. We conclude Shh supplied by taste nerves and local taste epithelium act in concert to support continued taste bud differentiation. However, although neurally derived Shh is in part responsible for the dependence of taste cell renewal on gustatory innervation, neurotrophic support of taste buds likely involves a complex set of factors. © 2017. Published by The Company of Biologists Ltd.

  13. Evolutionary origins of taste buds: phylogenetic analysis of purinergic neurotransmission in epithelial chemosensors

    Science.gov (United States)

    Kirino, Masato; Parnes, Jason; Hansen, Anne; Kiyohara, Sadao; Finger, Thomas E.

    2013-01-01

    Taste buds are gustatory endorgans which use an uncommon purinergic signalling system to transmit information to afferent gustatory nerve fibres. In mammals, ATP is a crucial neurotransmitter released by the taste cells to activate the afferent nerve fibres. Taste buds in mammals display a characteristic, highly specific ecto-ATPase (NTPDase2) activity, suggesting a role in inactivation of the neurotransmitter. The purpose of this study was to test whether the presence of markers of purinergic signalling characterize taste buds in anamniote vertebrates and to test whether similar purinergic systems are employed by other exteroceptive chemosensory systems. The species examined include several teleosts, elasmobranchs, lampreys and hagfish, the last of which lacks vertebrate-type taste buds. For comparison, Schreiner organs of hagfish and solitary chemosensory cells (SCCs) of teleosts, both of which are epidermal chemosensory end organs, were also examined because they might be evolutionarily related to taste buds. Ecto-ATPase activity was evident in elongate cells in all fish taste buds, including teleosts, elasmobranchs and lampreys. Neither SCCs nor Schreiner organs show specific ecto-ATPase activity, suggesting that purinergic signalling is not crucial in those systems as it is for taste buds. These findings suggest that the taste system did not originate from SCCs but arose independently in early vertebrates. PMID:23466675

  14. Isolation of chicken taste buds for real-time Ca2+ imaging.

    Science.gov (United States)

    Kudo, Ken-ichi; Kawabata, Fuminori; Nomura, Toumi; Aridome, Ayumi; Nishimura, Shotaro; Tabata, Shoji

    2014-10-01

    We isolated chicken taste buds and used a real-time Ca2+ imaging technique to investigate the functions of the taste cells. With RT-PCR, we found that isolated chicken taste bud-like cell subsets express chicken gustducin messenger RNA. Immunocytochemical techniques revealed that the cell subsets were also immunopositive for chicken gustducin. These results provided strong evidence that the isolated cell subsets contain chicken taste buds. The isolated cell subsets were spindle-shaped and approximately 61-75 μm wide and 88-98 μm long, and these characteristics are similar to those of sectional chicken taste buds. Using Ca2+ imaging, we observed the buds' response to 2 mmol/L quinine hydrochloride (a bitter substance) and their response to a mixture of 25 mmol/L L-glutamic acid monopotassium salt monohydrate and 1 mmol/L inosine 5'-monophosphate disodium salt, umami substances. The present study is the first morphological demonstration of isolated chicken taste buds, and our results indicate that the isolated taste buds were intact and functional approaches for examining the taste senses of the chicken using Ca2+ imaging can be informative. © 2014 Japanese Society of Animal Science.

  15. Evolutionary origins of taste buds: phylogenetic analysis of purinergic neurotransmission in epithelial chemosensors.

    Science.gov (United States)

    Kirino, Masato; Parnes, Jason; Hansen, Anne; Kiyohara, Sadao; Finger, Thomas E

    2013-03-06

    Taste buds are gustatory endorgans which use an uncommon purinergic signalling system to transmit information to afferent gustatory nerve fibres. In mammals, ATP is a crucial neurotransmitter released by the taste cells to activate the afferent nerve fibres. Taste buds in mammals display a characteristic, highly specific ecto-ATPase (NTPDase2) activity, suggesting a role in inactivation of the neurotransmitter. The purpose of this study was to test whether the presence of markers of purinergic signalling characterize taste buds in anamniote vertebrates and to test whether similar purinergic systems are employed by other exteroceptive chemosensory systems. The species examined include several teleosts, elasmobranchs, lampreys and hagfish, the last of which lacks vertebrate-type taste buds. For comparison, Schreiner organs of hagfish and solitary chemosensory cells (SCCs) of teleosts, both of which are epidermal chemosensory end organs, were also examined because they might be evolutionarily related to taste buds. Ecto-ATPase activity was evident in elongate cells in all fish taste buds, including teleosts, elasmobranchs and lampreys. Neither SCCs nor Schreiner organs show specific ecto-ATPase activity, suggesting that purinergic signalling is not crucial in those systems as it is for taste buds. These findings suggest that the taste system did not originate from SCCs but arose independently in early vertebrates.

  16. Cell-autonomous mechanisms of chronological aging in the yeast Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Anthony Arlia-Ciommo

    2014-05-01

    Full Text Available A body of evidence supports the view that the signaling pathways governing cellular aging – as well as mechanisms of their modulation by longevity-extending genetic, dietary and pharmacological interventions - are conserved across species. The scope of this review is to critically analyze recent advances in our understanding of cell-autonomous mechanisms of chronological aging in the budding yeast Saccharomyces cerevisiae. Based on our analysis, we propose a concept of a biomolecular network underlying the chronology of cellular aging in yeast. The concept posits that such network progresses through a series of lifespan checkpoints. At each of these checkpoints, the intracellular concentrations of some key intermediates and products of certain metabolic pathways - as well as the rates of coordinated flow of such metabolites within an intricate network of intercompartmental communications - are monitored by some checkpoint-specific ′′master regulator′′ proteins. The concept envisions that a synergistic action of these master regulator proteins at certain early-life and late-life checkpoints modulates the rates and efficiencies of progression of such processes as cell metabolism, growth, proliferation, stress resistance, macromolecular homeostasis, survival and death. The concept predicts that, by modulating these vital cellular processes throughout lifespan (i.e., prior to an arrest of cell growth and division, and following such arrest, the checkpoint-specific master regulator proteins orchestrate the development and maintenance of a pro- or anti-aging cellular pattern and, thus, define longevity of chronologically aging yeast.

  17. Cell-autonomous mechanisms of chronological aging in the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Arlia-Ciommo, Anthony; Leonov, Anna; Piano, Amanda; Svistkova, Veronika; Titorenko, Vladimir I

    2014-05-27

    A body of evidence supports the view that the signaling pathways governing cellular aging - as well as mechanisms of their modulation by longevity-extending genetic, dietary and pharmacological interventions - are conserved across species. The scope of this review is to critically analyze recent advances in our understanding of cell-autonomous mechanisms of chronological aging in the budding yeast Saccharomyces cerevisiae . Based on our analysis, we propose a concept of a biomolecular network underlying the chronology of cellular aging in yeast. The concept posits that such network progresses through a series of lifespan checkpoints. At each of these checkpoints, the intracellular concentrations of some key intermediates and products of certain metabolic pathways - as well as the rates of coordinated flow of such metabolites within an intricate network of intercompartmental communications - are monitored by some checkpoint-specific "master regulator" proteins. The concept envisions that a synergistic action of these master regulator proteins at certain early-life and late-life checkpoints modulates the rates and efficiencies of progression of such processes as cell metabolism, growth, proliferation, stress resistance, macromolecular homeostasis, survival and death. The concept predicts that, by modulating these vital cellular processes throughout lifespan (i.e., prior to an arrest of cell growth and division, and following such arrest), the checkpoint-specific master regulator proteins orchestrate the development and maintenance of a pro- or anti-aging cellular pattern and, thus, define longevity of chronologically aging yeast.

  18. Bayesian modeling of the yeast SH3 domain interactome predicts spatiotemporal dynamics of endocytosis proteins.

    Directory of Open Access Journals (Sweden)

    Raffi Tonikian

    2009-10-01

    Full Text Available SH3 domains are peptide recognition modules that mediate the assembly of diverse biological complexes. We scanned billions of phage-displayed peptides to map the binding specificities of the SH3 domain family in the budding yeast, Saccharomyces cerevisiae. Although most of the SH3 domains fall into the canonical classes I and II, each domain utilizes distinct features of its cognate ligands to achieve binding selectivity. Furthermore, we uncovered several SH3 domains with specificity profiles that clearly deviate from the two canonical classes. In conjunction with phage display, we used yeast two-hybrid and peptide array screening to independently identify SH3 domain binding partners. The results from the three complementary techniques were integrated using a Bayesian algorithm to generate a high-confidence yeast SH3 domain interaction map. The interaction map was enriched for proteins involved in endocytosis, revealing a set of SH3-mediated interactions that underlie formation of protein complexes essential to this biological pathway. We used the SH3 domain interaction network to predict the dynamic localization of several previously uncharacterized endocytic proteins, and our analysis suggests a novel role for the SH3 domains of Lsb3p and Lsb4p as hubs that recruit and assemble several endocytic complexes.

  19. Building a patchwork - The yeast plasma membrane as model to study lateral domain formation.

    Science.gov (United States)

    Schuberth, Christian; Wedlich-Söldner, Roland

    2015-04-01

    The plasma membrane (PM) has to fulfill a wide range of biological functions including selective uptake of substances, signal transduction and modulation of cell polarity and cell shape. To allow efficient regulation of these processes many resident proteins and lipids of the PM are laterally segregated into different functional domains. A particularly striking example of lateral segregation has been described for the budding yeast PM, where integral membrane proteins as well as lipids exhibit very slow translational mobility and form a patchwork of many overlapping micron-sized domains. Here we discuss the molecular and physical mechanisms contributing to the formation of a multi-domain membrane and review our current understanding of yeast PM organization. Many of the fundamental principles underlying membrane self-assembly and organization identified in yeast are expected to equally hold true in other organisms, even for the more transient and elusive organization of the PM in mammalian cells. This article is part of a Special Issue entitled: Nanoscale membrane organisation and signalling. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Autophagy and leucine promote chronological longevity and respiration proficiency during calorie restriction in yeast.

    Science.gov (United States)

    Aris, John P; Alvers, Ashley L; Ferraiuolo, Roy A; Fishwick, Laura K; Hanvivatpong, Amanda; Hu, Doreen; Kirlew, Christine; Leonard, Michael T; Losin, Kyle J; Marraffini, Michelle; Seo, Arnold Y; Swanberg, Veronica; Westcott, Jennifer L; Wood, Michael S; Leeuwenburgh, Christiaan; Dunn, William A

    2013-10-01

    We have previously shown that autophagy is required for chronological longevity in the budding yeast Saccharomyces cerevisiae. Here we examine the requirements for autophagy during extension of chronological life span (CLS) by calorie restriction (CR). We find that autophagy is upregulated by two CR interventions that extend CLS: water wash CR and low glucose CR. Autophagy is required for full extension of CLS during water wash CR under all growth conditions tested. In contrast, autophagy was not uniformly required for full extension of CLS during low glucose CR, depending on the atg allele and strain genetic background. Leucine status influenced CLS during CR. Eliminating the leucine requirement in yeast strains or adding supplemental leucine to growth media extended CLS during CR. In addition, we observed that both water wash and low glucose CR promote mitochondrial respiration proficiency during aging of autophagy-deficient yeast. In general, the extension of CLS by water wash or low glucose CR was inversely related to respiration deficiency in autophagy-deficient cells. Also, autophagy is required for full extension of CLS under non-CR conditions in buffered media, suggesting that extension of CLS during CR is not solely due to reduced medium acidity. Thus, our findings show that autophagy is: (1) induced by CR, (2) required for full extension of CLS by CR in most cases (depending on atg allele, strain, and leucine availability) and, (3) promotes mitochondrial respiration proficiency during aging under CR conditions. Copyright © 2013 Elsevier Inc. All rights reserved.

  1. Nanoscale domain formation of phosphatidylinositol 4-phosphate in the plasma and vacuolar membranes of living yeast cells.

    Science.gov (United States)

    Tomioku, Kan-Na; Shigekuni, Mikiko; Hayashi, Hiroki; Yoshida, Akane; Futagami, Taiki; Tamaki, Hisanori; Tanabe, Kenji; Fujita, Akikazu

    2018-05-01

    In budding yeast Saccharomyces cerevisiae, PtdIns(4)P serves as an essential signalling molecule in the Golgi complex, endosomal system, and plasma membrane, where it is involved in the control of multiple cellular functions via direct interactions with PtdIns(4)P-binding proteins. To analyse the distribution of PtdIns(4)P in yeast cells at a nanoscale level, we employed an electron microscopy technique that specifically labels PtdIns(4)P on the freeze-fracture replica of the yeast membrane. This method minimizes the possibility of artificial perturbation, because molecules in the membrane are physically immobilised in situ. We observed that PtdIns(4)P is localised on the cytoplasmic leaflet, but not the exoplasmic leaflet, of the plasma membrane, Golgi body, vacuole, and vesicular structure membranes. PtdIns(4)P labelling was not observed in the membrane of the endoplasmic reticulum, and in the outer and inner membranes of the nuclear envelope or mitochondria. PtdIns(4)P forms clusters of plasma membrane and vacuolar membrane according to point pattern analysis of immunogold labelling. There are three kinds of compartments in the cytoplasmic leaflet of the plasma membrane. In the present study, we showed that PtdIns(4)P is specifically localised in the flat undifferentiated plasma membrane compartment. In the vacuolar membrane, PtdIns(4)P was concentrated in intramembrane particle (IMP)-deficient raft-like domains, which are tightly bound to lipid droplets, but not surrounding IMP-rich non-raft domains in geometrical IMP-distributed patterns in the stationary phase. This is the first report showing microdomain formations of PtdIns(4)P in the plasma membrane and vacuolar membrane of budding yeast cells at a nanoscale level, which will illuminate the functionality of PtdIns(4)P in each membrane. Copyright © 2018 Elsevier GmbH. All rights reserved.

  2. Project BudBurst: Continental-scale citizen science for all seasons

    Science.gov (United States)

    Henderson, S.; Newman, S. J.; Ward, D.; Havens-Young, K.; Alaback, P.; Meymaris, K.

    2011-12-01

    Project BudBurst's (budburst.org) recent move to the National Ecological Observatory Network (NEON) has benefitted both programs. NEON has been able to use Project BudBurst as a testbed to learn best practices, network with experts in the field, and prototype potential tools for engaging people in continental-scale ecology as NEON develops its citizen science program. Participation in Project BudBurst has grown significantly since the move to NEON. Project BudBurst is a national citizen science initiative designed to engage the public in observations of phenological (plant life cycle) events that raise awareness of climate change, and create a cadre of informed citizen scientists. Citizen science programs such as Project BudBurst provide the opportunity for students and interested laypersons to actively participate in scientific research. Such programs are important not only from an educational perspective, but because they also enable scientists to broaden the geographic and temporal scale of their observations. The goals of Project BudBurst are to 1) increase awareness of phenology as an area of scientific study; 2) Increase awareness of the impacts of changing climates on plants at a continental-scale; and 3) increase science literacy by engaging participants in the scientific process. From its 2008 launch in February, this on-line educational and data-entry program, engaged participants of all ages and walks of life in recording the timing of the leafing and flowering of wild and cultivated species found across the continent. Thus far, thousands of participants from all 50 states have submitted data. This presentation will provide an overview of Project BudBurst and will report on the results of the 2010 field campaign and discuss plans to expand Project BudBurst in 2012 including the use of mobile phones applications for data collection and reporting from the field. Project BudBurst is co-managed by the National Ecological Observatory Network and the Chicago

  3. Chromatin-associated regulation of sorbitol synthesis in flower buds of peach.

    Science.gov (United States)

    Lloret, Alba; Martínez-Fuentes, Amparo; Agustí, Manuel; Badenes, María Luisa; Ríos, Gabino

    2017-11-01

    PpeS6PDH gene is postulated to mediate sorbitol synthesis in flower buds of peach concomitantly with specific chromatin modifications. Perennial plants have evolved an adaptive mechanism involving protection of meristems within specialized structures named buds in order to survive low temperatures and water deprivation during winter. A seasonal period of dormancy further improves tolerance of buds to environmental stresses through specific mechanisms poorly known at the molecular level. We have shown that peach PpeS6PDH gene is down-regulated in flower buds after dormancy release, concomitantly with changes in the methylation level at specific lysine residues of histone H3 (H3K27 and H3K4) in the chromatin around the translation start site of the gene. PpeS6PDH encodes a NADPH-dependent sorbitol-6-phosphate dehydrogenase, the key enzyme for biosynthesis of sorbitol. Consistently, sorbitol accumulates in dormant buds showing higher PpeS6PDH expression. Moreover, PpeS6PDH gene expression is affected by cold and water deficit stress. Particularly, its expression is up-regulated by low temperature in buds and leaves, whereas desiccation treatment induces PpeS6PDH in buds and represses the gene in leaves. These data reveal the concurrent participation of chromatin modification mechanisms, transcriptional regulation of PpeS6PDH and sorbitol accumulation in flower buds of peach. In addition to its role as a major translocatable photosynthate in Rosaceae species, sorbitol is a widespread compatible solute and cryoprotectant, which suggests its participation in tolerance to environmental stresses in flower buds of peach.

  4. Limb patterning genes and heterochronic development of the emu wing bud

    Directory of Open Access Journals (Sweden)

    Craig A. Smith

    2016-12-01

    Full Text Available Abstract Background The forelimb of the flightless emu is a vestigial structure, with greatly reduced wing elements and digit loss. To explore the molecular and cellular mechanisms associated with the evolution of vestigial wings and loss of flight in the emu, key limb patterning genes were examined in developing embryos. Methods Limb development was compared in emu versus chicken embryos. Immunostaining for cell proliferation markers was used to analyze growth of the emu forelimb and hindlimb buds. Expression patterns of limb patterning genes were studied, using whole-mount in situ hybridization (for mRNA localization and RNA-seq (for mRNA expression levels. Results The forelimb of the emu embryo showed heterochronic development compared to that in the chicken, with the forelimb bud being retarded in its development. Early outgrowth of the emu forelimb bud is characterized by a lower level of cell proliferation compared the hindlimb bud, as assessed by PH3 immunostaining. In contrast, there were no obvious differences in apoptosis in forelimb versus hindlimb buds (cleaved caspase 3 staining. Most key patterning genes were expressed in emu forelimb buds similarly to that observed in the chicken, but with smaller expression domains. However, expression of Sonic Hedgehog (Shh mRNA, which is central to anterior–posterior axis development, was delayed in the emu forelimb bud relative to other patterning genes. Regulators of Shh expression, Gli3 and HoxD13, also showed altered expression levels in the emu forelimb bud. Conclusions These data reveal heterochronic but otherwise normal expression of most patterning genes in the emu vestigial forelimb. Delayed Shh expression may be related to the small and vestigial structure of the emu forelimb bud. However, the genetic mechanism driving retarded emu wing development is likely to rest within the forelimb field of the lateral plate mesoderm, predating the expression of patterning genes.

  5. Contribution of Underlying Connective Tissue Cells to Taste Buds in Mouse Tongue and Soft Palate

    Science.gov (United States)

    Mederacke, Ingmar; Komatsu, Yoshihiro; Stice, Steve; Schwabe, Robert F.; Mistretta, Charlotte M.; Mishina, Yuji; Liu, Hong-Xiang

    2016-01-01

    Taste buds, the sensory organs for taste, have been described as arising solely from the surrounding epithelium, which is in distinction from other sensory receptors that are known to originate from neural precursors, i.e., neural ectoderm that includes neural crest (NC). Our previous study suggested a potential contribution of NC derived cells to early immature fungiform taste buds in late embryonic (E18.5) and young postnatal (P1-10) mice. In the present study we demonstrated the contribution of the underlying connective tissue (CT) to mature taste buds in mouse tongue and soft palate. Three independent mouse models were used for fate mapping of NC and NC derived connective tissue cells: (1) P0-Cre/R26-tdTomato (RFP) to label NC, NC derived Schwann cells and derivatives; (2) Dermo1-Cre/RFP to label mesenchymal cells and derivatives; and (3) Vimentin-CreER/mGFP to label Vimentin-expressing CT cells and derivatives upon tamoxifen treatment. Both P0-Cre/RFP and Dermo1-Cre/RFP labeled cells were abundant in mature taste buds in lingual taste papillae and soft palate, but not in the surrounding epithelial cells. Concurrently, labeled cells were extensively distributed in the underlying CT. RFP signals were seen in the majority of taste buds and all three types (I, II, III) of differentiated taste bud cells, with the neuronal-like type III cells labeled at a greater proportion. Further, Vimentin-CreER labeled cells were found in the taste buds of 3-month-old mice whereas Vimentin immunoreactivity was only seen in the CT. Taken together, our data demonstrate a previously unrecognized origin of taste bud cells from the underlying CT, a conceptually new finding in our knowledge of taste bud cell derivation, i.e., from both the surrounding epithelium and the underlying CT that is primarily derived from NC. PMID:26741369

  6. Contribution of Underlying Connective Tissue Cells to Taste Buds in Mouse Tongue and Soft Palate.

    Directory of Open Access Journals (Sweden)

    Kristin Boggs

    Full Text Available Taste buds, the sensory organs for taste, have been described as arising solely from the surrounding epithelium, which is in distinction from other sensory receptors that are known to originate from neural precursors, i.e., neural ectoderm that includes neural crest (NC. Our previous study suggested a potential contribution of NC derived cells to early immature fungiform taste buds in late embryonic (E18.5 and young postnatal (P1-10 mice. In the present study we demonstrated the contribution of the underlying connective tissue (CT to mature taste buds in mouse tongue and soft palate. Three independent mouse models were used for fate mapping of NC and NC derived connective tissue cells: (1 P0-Cre/R26-tdTomato (RFP to label NC, NC derived Schwann cells and derivatives; (2 Dermo1-Cre/RFP to label mesenchymal cells and derivatives; and (3 Vimentin-CreER/mGFP to label Vimentin-expressing CT cells and derivatives upon tamoxifen treatment. Both P0-Cre/RFP and Dermo1-Cre/RFP labeled cells were abundant in mature taste buds in lingual taste papillae and soft palate, but not in the surrounding epithelial cells. Concurrently, labeled cells were extensively distributed in the underlying CT. RFP signals were seen in the majority of taste buds and all three types (I, II, III of differentiated taste bud cells, with the neuronal-like type III cells labeled at a greater proportion. Further, Vimentin-CreER labeled cells were found in the taste buds of 3-month-old mice whereas Vimentin immunoreactivity was only seen in the CT. Taken together, our data demonstrate a previously unrecognized origin of taste bud cells from the underlying CT, a conceptually new finding in our knowledge of taste bud cell derivation, i.e., from both the surrounding epithelium and the underlying CT that is primarily derived from NC.

  7. β-Catenin signaling regulates temporally discrete phases of anterior taste bud development.

    Science.gov (United States)

    Thirumangalathu, Shoba; Barlow, Linda A

    2015-12-15

    The sense of taste is mediated by multicellular taste buds located within taste papillae on the tongue. In mice, individual taste buds reside in fungiform papillae, which develop at mid-gestation as epithelial placodes in the anterior tongue. Taste placodes comprise taste bud precursor cells, which express the secreted factor sonic hedgehog (Shh) and give rise to taste bud cells that differentiate around birth. We showed previously that epithelial activation of β-catenin is the primary inductive signal for taste placode formation, followed by taste papilla morphogenesis and taste bud differentiation, but the degree to which these later elements were direct or indirect consequences of β-catenin signaling was not explored. Here, we define discrete spatiotemporal functions of β-catenin in fungiform taste bud development. Specifically, we show that early epithelial activation of β-catenin, before taste placodes form, diverts lingual epithelial cells from a taste bud fate. By contrast, β-catenin activation a day later within Shh(+) placodes, expands taste bud precursors directly, but enlarges papillae indirectly. Further, placodal activation of β-catenin drives precocious differentiation of Type I glial-like taste cells, but not other taste cell types. Later activation of β-catenin within Shh(+) precursors during papilla morphogenesis also expands taste bud precursors and accelerates Type I cell differentiation, but papilla size is no longer enhanced. Finally, although Shh regulates taste placode patterning, we find that it is dispensable for the accelerated Type I cell differentiation induced by β-catenin. © 2015. Published by The Company of Biologists Ltd.

  8. Contribution of Underlying Connective Tissue Cells to Taste Buds in Mouse Tongue and Soft Palate.

    Science.gov (United States)

    Boggs, Kristin; Venkatesan, Nandakumar; Mederacke, Ingmar; Komatsu, Yoshihiro; Stice, Steve; Schwabe, Robert F; Mistretta, Charlotte M; Mishina, Yuji; Liu, Hong-Xiang

    2016-01-01

    Taste buds, the sensory organs for taste, have been described as arising solely from the surrounding epithelium, which is in distinction from other sensory receptors that are known to originate from neural precursors, i.e., neural ectoderm that includes neural crest (NC). Our previous study suggested a potential contribution of NC derived cells to early immature fungiform taste buds in late embryonic (E18.5) and young postnatal (P1-10) mice. In the present study we demonstrated the contribution of the underlying connective tissue (CT) to mature taste buds in mouse tongue and soft palate. Three independent mouse models were used for fate mapping of NC and NC derived connective tissue cells: (1) P0-Cre/R26-tdTomato (RFP) to label NC, NC derived Schwann cells and derivatives; (2) Dermo1-Cre/RFP to label mesenchymal cells and derivatives; and (3) Vimentin-CreER/mGFP to label Vimentin-expressing CT cells and derivatives upon tamoxifen treatment. Both P0-Cre/RFP and Dermo1-Cre/RFP labeled cells were abundant in mature taste buds in lingual taste papillae and soft palate, but not in the surrounding epithelial cells. Concurrently, labeled cells were extensively distributed in the underlying CT. RFP signals were seen in the majority of taste buds and all three types (I, II, III) of differentiated taste bud cells, with the neuronal-like type III cells labeled at a greater proportion. Further, Vimentin-CreER labeled cells were found in the taste buds of 3-month-old mice whereas Vimentin immunoreactivity was only seen in the CT. Taken together, our data demonstrate a previously unrecognized origin of taste bud cells from the underlying CT, a conceptually new finding in our knowledge of taste bud cell derivation, i.e., from both the surrounding epithelium and the underlying CT that is primarily derived from NC.

  9. [Acaricidal activity of clove bud oil against Dermatophagoides farinae (Acari: Pyroglyphidae)].

    Science.gov (United States)

    Li, Jing; Wu, Hai-Qiang; Liu, Zhi-Gang

    2009-12-01

    Volatile oil from the clove bud was extracted by petroleum ether using Soxhlet Extractor. The acaricidal activity was examined using direct contact and vapour phase toxicity bioassays. In a filter paper contact toxicity bio-assay, at 2.5 h after treatment, clove bud oil at a dose of 12.20 microg/cm2 killed all dust mites. As judged by 24-h LD50 values, potent fumigant action was observed with clove bud oil (12.20 microg/cm2), showing an adequate acaricidal activity against indoor Dermatophagoides farinae.

  10. Phenotypic plasticity, QTL mapping and genomic characterization of bud set in black poplar

    Directory of Open Access Journals (Sweden)

    Fabbrini Francesco

    2012-04-01

    Full Text Available Abstract Background The genetic control of important adaptive traits, such as bud set, is still poorly understood in most forest trees species. Poplar is an ideal model tree to study bud set because of its indeterminate shoot growth. Thus, a full-sib family derived from an intraspecific cross of P. nigra with 162 clonally replicated progeny was used to assess the phenotypic plasticity and genetic variation of bud set in two sites of contrasting environmental conditions. Results Six crucial phenological stages of bud set were scored. Night length appeared to be the most important signal triggering the onset of growth cessation. Nevertheless, the effect of other environmental factors, such as temperature, increased during the process. Moreover, a considerable role of genotype × environment (G × E interaction was found in all phenological stages with the lowest temperature appearing to influence the sensitivity of the most plastic genotypes. Descriptors of growth cessation and bud onset explained the largest part of phenotypic variation of the entire process. Quantitative trait loci (QTL for these traits were detected. For the four selected traits (the onset of growth cessation (date2.5, the transition from shoot to bud (date1.5, the duration of bud formation (subproc1 and bud maturation (subproc2 eight and sixteen QTL were mapped on the maternal and paternal map, respectively. The identified QTL, each one characterized by small or modest effect, highlighted the complex nature of traits involved in bud set process. Comparison between map location of QTL and P. trichocarpa genome sequence allowed the identification of 13 gene models, 67 bud set-related expressional and six functional candidate genes (CGs. These CGs are functionally related to relevant biological processes, environmental sensing, signaling, and cell growth and development. Some strong QTL had no obvious CGs, and hold great promise to identify unknown genes that affect bud set

  11. Nerve-independent and ectopically additional induction of taste buds in organ culture of fetal tongues.

    Science.gov (United States)

    Honda, Kotaro; Tomooka, Yasuhiro

    2016-10-01

    An improved organ culture system allowed to observe morphogenesis of mouse lingual papillae and taste buds relatively for longer period, in which fetal tongues were analyzed for 6 d. Taste cells were defined as eosinophobic epithelial cells expressing CK8 and Sox2 within lingual epithelium. Addition of glycogen synthase kinase 3 beta inhibitor CHIR99021 induced many taste cells and buds in non-gustatory and gustatory stratified lingual epithelium. The present study clearly demonstrated induction of taste cells and buds ectopically and without innervation.

  12. Gravity-induced buds formation from protonemata apical cells in the mosses

    Science.gov (United States)

    Kyyak, Natalia; Khorkavtsiv, Yaroslava

    The acceleration of moss protonemata development after the exit it to light from darkness is important gravidependent morphogenetic manifestation of the moss protonemata. The accelerated development of mosses shows in transformation of apical protonemata cells into the gametophores buds (Ripetskyj et al., 1999). In order to establish, that such reaction on gravitation is general property of gravisensity species, or its typical only for single moss species, experiments with the following moss species - Bryum intermedium (Ludw.) Brig., Bryum caespiticium Hedw., Bryum argenteum Hedw., Dicranodontium denudatum (Brid.) Britt. were carried out. All these species in response to influence of gravitation were capable to form rich bunches of gravitropical protonemata in darkness, that testified to their gravisensity. After the transference of Petri dishes with gravitropical protonemata from darkness on light was revealed, that in 3 of the investigated species the gametophores buds were absent. Only B. argenteum has reacted to action of gravitation by buds formation from apical cells of the gravitropical protonemata. With the purpose of strengthening of buds formation process, the experiments with action of exogenous kinetin (in concentration of 10 (-6) M) were carried out. Kinetin essentially stimulated apical buds formation of B. argenteum. The quantity of apical buds has increased almost in three times in comparison with the control. Besides, on separate stolons a few (3-4) buds from one apical cell were formed. Experimentally was established, that the gametophores buds formation in mosses is controlled by phytohormones (Bopp, 1985; Demkiv et al., 1991). In conditions of gravity influence its essentially accelerated. Probably, gravity essentially strengthened acropetal transport of phytohormones and formation of attractive center in the protonemata apical cell. Our investigations have allowed to make the conclusion, that gravi-dependent formation of the apical buds is

  13. Variations of adventitious bud plants initiated from cutting scales of irradiated lily

    International Nuclear Information System (INIS)

    Zhang Kezhong; Zhao Xiangyun; Huang Shanwu; Lu Changxun; Zhang Qixiang

    2003-01-01

    Adventitious bud plants were initiated from cutting scales of irradiated lilies. During adventitious bud plants growth and development, variation was observed on their petals, stamens, pistils and leaves. Stamens gave birth to the highest mutation rate and the most diverse variation, such as no pollen male sterility type, pollen abortion male sterility type, stamen collapse male sterility type and partial male sterility type, etc. Different male sterility types were found among the three lilies. Considering mutation rate of adventitious bud plants, 1-2 Gy was suitable dose for 'Pollyana' and 1-3 Gy was proper to Lilium regale and 'Romano'

  14. Surplus yeast tank failing catastrophically

    DEFF Research Database (Denmark)

    Hedlund, Frank Huess

    2016-01-01

    GOOD REASON FOR CAUTION I A large surplus yeast tank shot into the air leaving the floor plate and the contents behind. Although not designed for overpressure, the tank was kept at “very slight overpressure” to suppress nuisance foaming. The brewery was unaware of the hazards of compressed air...

  15. Nucleotide excision repair in yeast

    NARCIS (Netherlands)

    Eijk, Patrick van

    2012-01-01

    Nucleotide Excision Repair (NER) is a conserved DNA repair pathway capable of removing a broad spectrum of DNA damage. In human cells a defect in NER leads to the disorder Xeroderma pigmentosum (XP). The yeast Saccharomyces cerevisiae is an excellent model organism to study the mechanism of NER. The

  16. Yeast genomics on food flavours

    NARCIS (Netherlands)

    Schoondermark-Stolk, Sung Ah

    2005-01-01

    The appearance and concentration of the fusel alcohol 3-methyl-1-butanol is important for the flavour of fermented foods. 3-Methyl-1-butanol is formed by yeast during the conversion of L-leucine. Identification of the enzymes and genes involved in the formation of 3-methyl-1-butanol is a major

  17. Survival of synchronized diploid yeast after ultraviolet irradiation

    International Nuclear Information System (INIS)

    Nunes, E.; Lorido, L.; Gelos, U.

    1975-01-01

    Synchronized populations of diploid yeast were exposed to uv light and their survival thereafter upon immediate plating (IP) and after liquid holding (LH) treatment in the presence and absence of caffeine was examined. These cells were found to be most resistant to uv light during early budding (G 2 period). The effect of LH is positive throughout the cell cycle and is dependent on the radiosensitivity of the cells upon IP. Caffeine-sensitive and caffeine-insensitive components of dark repair were demonstrated. The uv light responses of logarithmic growing and synchronized populations were compared with x-ray responses of the same strain analyzed under the same conditions in a previous work. The pattern of variation in sensitivity throughout the cell cycle and the ability to recover are qualitatively similar. The caffeine-insensitive component of repair has a similar efficiency in uv and x-irradiated G 1 cells, increasing in uv-irradiated cells after the beginning of the DNA synthetic period and during the G 2 period. The findings observed under IP conditions are consistent with a model already proposed which requires the repair efficiency to oscillate during the cell cycle. The results suggest that repair pathways for lethal uv damage may share some common steps with those for x-ray damage

  18. Voltage-gated sodium channels in taste bud cells

    Directory of Open Access Journals (Sweden)

    Williams Mark E

    2009-03-01

    Full Text Available Abstract Background Taste bud cells transmit information regarding the contents of food from taste receptors embedded in apical microvilli to gustatory nerve fibers innervating basolateral membranes. In particular, taste cells depolarize, activate voltage-gated sodium channels, and fire action potentials in response to tastants. Initial cell depolarization is attributable to sodium influx through TRPM5 in sweet, bitter, and umami cells and an undetermined cation influx through an ion channel in sour cells expressing PKD2L1, a candidate sour taste receptor. The molecular identity of the voltage-gated sodium channels that sense depolarizing signals and subsequently initiate action potentials coding taste information to gustatory nerve fibers is unknown. Results We describe the molecular and histological expression profiles of cation channels involved in electrical signal transmission from apical to basolateral membrane domains. TRPM5 was positioned immediately beneath tight junctions to receive calcium signals originating from sweet, bitter, and umami receptor activation, while PKD2L1 was positioned at the taste pore. Using mouse taste bud and lingual epithelial cells collected by laser capture microdissection, SCN2A, SCN3A, and SCN9A voltage-gated sodium channel transcripts were expressed in taste tissue. SCN2A, SCN3A, and SCN9A were expressed beneath tight junctions in subsets of taste cells. SCN3A and SCN9A were expressed in TRPM5 cells, while SCN2A was expressed in TRPM5 and PKD2L1 cells. HCN4, a gene previously implicated in sour taste, was expressed in PKD2L1 cells and localized to cell processes beneath the taste pore. Conclusion SCN2A, SCN3A and SCN9A voltage-gated sodium channels are positioned to sense initial depolarizing signals stemming from taste receptor activation and initiate taste cell action potentials. SCN2A, SCN3A and SCN9A gene products likely account for the tetrodotoxin-sensitive sodium currents in taste receptor cells.

  19. Endoplasmic reticulum involvement in yeast cell death

    International Nuclear Information System (INIS)

    Nicanor Austriaco, O.

    2012-01-01

    Yeast cells undergo programed cell death (PCD) with characteristic markers associated with apoptosis in mammalian cells including chromatin breakage, nuclear fragmentation, reactive oxygen species generation, and metacaspase activation. Though significant research has focused on mitochondrial involvement in this phenomenon, more recent work with both Saccharomyces cerevisiae and Schizosaccharomyces pombe has also implicated the endoplasmic reticulum (ER) in yeast PCD. This minireview provides an overview of ER stress-associated cell death (ER-SAD) in yeast. It begins with a description of ER structure and function in yeast before moving to a discussion of ER-SAD in both mammalian and yeast cells. Three examples of yeast cell death associated with the ER will be highlighted here including inositol starvation, lipid toxicity, and the inhibition of N-glycosylation. It closes by suggesting ways to further examine the involvement of the ER in yeast cell death.

  20. Brewing characteristics of piezosensitive sake yeasts

    Science.gov (United States)

    Nomura, Kazuki; Hoshino, Hirofumi; Igoshi, Kazuaki; Onozuka, Haruka; Tanaka, Erika; Hayashi, Mayumi; Yamazaki, Harutake; Takaku, Hiroaki; Iguchi, Akinori; Shigematsu, Toru

    2018-04-01

    Application of high hydrostatic pressure (HHP) treatment to food processing is expected as a non-thermal fermentation regulation technology that supresses over fermentation. However, the yeast Saccharomyces cerevisiae used for Japanese rice wine (sake) brewing shows high tolerance to HHP. Therefore, we aimed to generate pressure-sensitive (piezosensitive) sake yeast strains by mating sake with piezosensitive yeast strains to establish an HHP fermentation regulation technology and extend the shelf life of fermented foods. The results of phenotypic analyses showed that the generated yeast strains were piezosensitive and exhibited similar fermentation ability compared with the original sake yeast strain. In addition, primary properties of sake brewed using these strains, such as ethanol concentration, sake meter value and sake flavor compounds, were almost equivalent to those obtained using the sake yeast strain. These results suggest that the piezosensitive strains exhibit brewing characteristics essentially equivalent to those of the sake yeast strain.

  1. Utilizing Biotinylated Proteins Expressed in Yeast to Visualize DNA–Protein Interactions at the Single-Molecule Level

    Directory of Open Access Journals (Sweden)

    Huijun Xue

    2017-10-01

    Full Text Available Much of our knowledge in conventional biochemistry has derived from bulk assays. However, many stochastic processes and transient intermediates are hidden when averaged over the ensemble. The powerful technique of single-molecule fluorescence microscopy has made great contributions to the understanding of life processes that are inaccessible when using traditional approaches. In single-molecule studies, quantum dots (Qdots have several unique advantages over other fluorescent probes, such as high brightness, extremely high photostability, and large Stokes shift, thus allowing long-time observation and improved signal-to-noise ratios. So far, however, there is no convenient way to label proteins purified from budding yeast with Qdots. Based on BirA–Avi and biotin–streptavidin systems, we have established a simple method to acquire a Qdot-labeled protein and visualize its interaction with DNA using total internal reflection fluorescence microscopy. For proof-of-concept, we chose replication protein A (RPA and origin recognition complex (ORC as the proteins of interest. Proteins were purified from budding yeast with high biotinylation efficiency and rapidly labeled with streptavidin-coated Qdots. Interactions between proteins and DNA were observed successfully at the single-molecule level.

  2. A Model of Yeast Cell-Cycle Regulation Based on a Standard Component Modeling Strategy for Protein Regulatory Networks.

    Directory of Open Access Journals (Sweden)

    Teeraphan Laomettachit

    Full Text Available To understand the molecular mechanisms that regulate cell cycle progression in eukaryotes, a variety of mathematical modeling approaches have been employed, ranging from Boolean networks and differential equations to stochastic simulations. Each approach has its own characteristic strengths and weaknesses. In this paper, we propose a "standard component" modeling strategy that combines advantageous features of Boolean networks, differential equations and stochastic simulations in a framework that acknowledges the typical sorts of reactions found in protein regulatory networks. Applying this strategy to a comprehensive mechanism of the budding yeast cell cycle, we illustrate the potential value of standard component modeling. The deterministic version of our model reproduces the phenotypic properties of wild-type cells and of 125 mutant strains. The stochastic version of our model reproduces the cell-to-cell variability of wild-type cells and the partial viability of the CLB2-dbΔ clb5Δ mutant strain. Our simulations show that mathematical modeling with "standard components" can capture in quantitative detail many essential properties of cell cycle control in budding yeast.

  3. [Control levels of Sin3 histone deacetylase for spontaneous and UV-induced mutagenesis in yeasts Saccharomyces cerevisiae].

    Science.gov (United States)

    Lebovka, I Iu; Kozhina, T N; Fedorova, I V; Peshekhonov, V T; Evstiukhina, T A; Chernenkov, A Iu; Korolev, V G

    2014-01-01

    SIN3 gene product operates as a repressor for a huge amount of genes in Saccharomyces cerevisiae. Sin3 protein with a mass of about 175 kDa is a member of the RPD3 protein complex with an assessed mass of greater than 2 million Da. It was previously shownthat RPD3 gene mutations influence recombination and repair processes in S. cerevisiae yeasts. We studied the impacts of the sin3 mutation on UV-light sensitivity and UV-induced mutagenesis in budding yeast cells. The deletion ofthe SIN3 gene causes weak UV-sensitivity of mutant budding cells as compared to the wild-type strain. These results show that the sin3 mutation decreases both spontaneous and UV-induced levels of levels. This fact is hypothetically related to themalfunction of ribonucleotide reductase activity regulation, which leads to a decrease in the dNTP pool and the inaccurate error-prone damage bypass postreplication repair pathway, which in turn provokes a reduction in the incidence of mutations.

  4. Transcriptome analysis of female and male flower buds of Idesia polycarpa Maxim. var. vestita Diels

    Directory of Open Access Journals (Sweden)

    Lanju Mei

    2017-09-01

    Conclusion: This work provides the first detailed transcriptome analysis of female and male flower of I. polycarpa and lays foundations for future studies on the molecular mechanisms underlying flower bud development of I. polycarpa.

  5. Bud Dormancy in Perennial Fruit Tree Species: A Pivotal Role for Oxidative Cues

    Directory of Open Access Journals (Sweden)

    Rémi Beauvieux

    2018-05-01

    Full Text Available For perennial plants, bud dormancy is a crucial step as its progression over winter determines the quality of bud break, flowering, and fruiting. In the past decades, many studies, based on metabolic, physiological, subcellular, genetic, and genomic analyses, have unraveled mechanisms underlying bud dormancy progression. Overall, all the pathways identified are interconnected in a very complex manner. Here, we review early and recent findings on the dormancy processes in buds of temperate fruit trees species including hormonal signaling, the role of plasma membrane, carbohydrate metabolism, mitochondrial respiration and oxidative stress, with an effort to link them together and emphasize the central role of reactive oxygen species accumulation in the control of dormancy progression.

  6. Application of magnetic resonance imaging (MRI) technique on monitoring flower bud differentiation of tulip

    International Nuclear Information System (INIS)

    Han Haojun; Yang Hongguang; Han Hongbin; Sun Xiaomei

    2009-01-01

    Magnetic resonance imaging (MRI) was used for observing morphogenesis process in the living specimen situation of tulip flower buds. Through a comparison of different MRI imaging formation technique (longitudinal relaxation-T1WI, transverse relaxation time weighted imaging-T2WI, proton density weighted imaging-PDWI), seeking for an accurate and practical MRI technique to observe tulip bulb and differentiation period of flower bud. The results showed that in the demonstration of the morphological characters as well as morphogenesis process of flower bud differentiation, the T1WI was completely consistent with the results of rough slice, PDWI and T1WI also had obviously higher map quality than the T2WI (P<0.05). It is indicated that the magnetic resonance imaging technique could monitor the development of flower bud differentiation in vivo. (authors)

  7. effects of bud loading levels and different nitrogen doses on the ...

    African Journals Online (AJOL)

    USER

    2011-09-28

    Sep 28, 2011 ... in 100 g samples, leaf area for physical properties; dry matter, ash, pH and titratable ... Keywords: Brined-grape leaves, nitrogen, bud loading level, narince grape cultivar, Turkey. ..... Agriculture Organization (2010). www.

  8. Innervation of taste buds revealed with Brainbow-labeling in mouse.

    Science.gov (United States)

    Zaidi, Faisal N; Cicchini, Vanessa; Kaufman, Daniel; Ko, Elizabeth; Ko, Abraham; Van Tassel, Heather; Whitehead, Mark C

    2016-12-01

    Nerve fibers that surround and innervate the taste bud were visualized with inherent fluorescence using Brainbow transgenic mice that were generated by mating the founder line L with nestin-cre mice. Multicolor fluorescence revealed perigemmal fibers as branched within the non-taste epithelium and ending in clusters of multiple rounded swellings surrounding the taste pore. Brainbow-labeling also revealed the morphology and branching pattern of single intragemmal fibers. These taste bud fibers frequently innervated both the peripheral bud, where immature gemmal cells are located, and the central bud, where mature, differentiated cells are located. The fibers typically bore preterminal and terminal swellings, growth cones with filopodia, swellings, and rounded retraction bulbs. These results establish an anatomical substrate for taste nerve fibers to contact and remodel among receptor cells at all stages of their differentiation, an interpretation that was supported by staining with GAP-43, a marker for growing fibers and growth cones. © 2016 Anatomical Society.

  9. Network model of chemical-sensing system inspired by mouse taste buds.

    Science.gov (United States)

    Tateno, Katsumi; Igarashi, Jun; Ohtubo, Yoshitaka; Nakada, Kazuki; Miki, Tsutomu; Yoshii, Kiyonori

    2011-07-01

    Taste buds endure extreme changes in temperature, pH, osmolarity, so on. Even though taste bud cells are replaced in a short span, they contribute to consistent taste reception. Each taste bud consists of about 50 cells whose networks are assumed to process taste information, at least preliminarily. In this article, we describe a neural network model inspired by the taste bud cells of mice. It consists of two layers. In the first layer, the chemical stimulus is transduced into an irregular spike train. The synchronization of the output impulses is induced by the irregular spike train at the second layer. These results show that the intensity of the chemical stimulus is encoded as the degree of the synchronization of output impulses. The present algorithms for signal processing result in a robust chemical-sensing system.

  10. In vitro development of buds from tubers of (Solanum tuberosum L.)

    International Nuclear Information System (INIS)

    Fernandez Gonzalez, J.; Garcia Collantes, M. A.

    1976-01-01

    The present work studies the in vitro development of buds from potato tubers subjected to gamma radiation at doses of 3, 6, 9 and 12 Krad. Ths effect of radiation was dependent on the dormant stage of the buds. Intermediate doses (6-9 Krad) did inhibit mitotic division but not cellular elongation. When irradiation is carried out at the end of the resting period, there is an apparent sprouting due to the elongation of previously formed cells. (Author) 17 refs

  11. Evolutionary origins of taste buds: phylogenetic analysis of purinergic neurotransmission in epithelial chemosensors

    OpenAIRE

    Kirino, Masato; Parnes, Jason; Hansen, Anne; Kiyohara, Sadao; Finger, Thomas E.

    2013-01-01

    Taste buds are gustatory endorgans which use an uncommon purinergic signalling system to transmit information to afferent gustatory nerve fibres. In mammals, ATP is a crucial neurotransmitter released by the taste cells to activate the afferent nerve fibres. Taste buds in mammals display a characteristic, highly specific ecto-ATPase (NTPDase2) activity, suggesting a role in inactivation of the neurotransmitter. The purpose of this study was to test whether the presence of markers of purinergi...

  12. Cytokinins Are Initial Targets of Light in the Control of Bud Outgrowth(1[OPEN])

    Czech Academy of Sciences Publication Activity Database

    Roman, H.; Girault, T.; Barbier, F.; Peron, T.; Brouard, N.; Pěnčík, Aleš; Novák, Ondřej; Vian, A.; Sakr, S.; Lothier, J.; Le Gourrierec, J.; Leduc, N.

    2016-01-01

    Roč. 172, č. 1 (2016), s. 489-509 ISSN 0032-0889 R&D Projects: GA MŠk(CZ) LO1204; GA MŠk LK21306 Institutional support: RVO:61389030 Keywords : cell-cycle regulation * pea axillary buds * oryza-sativa l. * apical dominance * rosa sp * arabidopsis-thaliana * lateral buds * meristem activity * plant-responses * acts downstream Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 6.456, year: 2016

  13. A taste for ATP: neurotransmission in taste buds

    Science.gov (United States)

    Kinnamon, Sue C.; Finger, Thomas E.

    2013-01-01

    Not only is ATP a ubiquitous source of energy but it is also used widely as an intercellular signal. For example, keratinocytes release ATP in response to numerous external stimuli including pressure, heat, and chemical insult. The released ATP activates purinergic receptors on nerve fibers to generate nociceptive signals. The importance of an ATP signal in epithelial-to-neuronal signaling is nowhere more evident than in the taste system. The receptor cells of taste buds release ATP in response to appropriate stimulation by tastants and the released ATP then activates P2X2 and P2X3 receptors on the taste nerves. Genetic ablation of the relevant P2X receptors leaves an animal without the ability to taste any primary taste quality. Of interest is that release of ATP by taste receptor cells occurs in a non-vesicular fashion, apparently via gated membrane channels. Further, in keeping with the crucial role of ATP as a neurotransmitter in this system, a subset of taste cells expresses a specific ectoATPase, NTPDase2, necessary to clear extracellular ATP which otherwise will desensitize the P2X receptors on the taste nerves. The unique utilization of ATP as a key neurotransmitter in the taste system may reflect the epithelial rather than neuronal origins of the receptor cells. PMID:24385952

  14. A taste for ATP: neurotransmission in taste buds

    Directory of Open Access Journals (Sweden)

    Thomas E. Finger

    2013-12-01

    Full Text Available Not only is ATP a ubiquitous source of energy but it is also used widely as an intercellular signal. For example, keratinocytes release ATP in response to numerous external stimuli including pressure, heat and chemical insult. The released ATP activates purinergic receptors on nerve fibers to generate nociceptive signals. The importance of an ATP signal in epithelial-to-neuronal signaling is nowhere more evident than in the taste system. The receptor cells of taste buds release ATP in response to appropriate stimulation by tastants and the released ATP then activates P2X2 and P2X3 receptors on the taste nerves. Genetic ablation of the relevant P2X receptors leaves an animal without the ability to taste any primary taste quality. Of interest is that release of ATP by taste receptor cells occurs in a non-vesicular fashion, apparently via gated membrane channels. Further, in keeping with the crucial role of ATP as a neurotransmitter in this system, a subset of taste cells expresses a specific ectoATPase, NTPDase2, necessary to clear extracellular ATP which otherwise will desensitize the P2X receptors on the taste nerves. The unique utilization of ATP as a key neurotransmitter in the taste system may reflect the epithelial rather than neuronal origins of the receptor cells.

  15. Association of Dermatological Conditions of External Ear with the Use of Cotton Buds

    Directory of Open Access Journals (Sweden)

    Salahuddin Ahmed

    2014-09-01

    Full Text Available Background: The habit of cleaning the external auditory canal with cotton buds is a common practice of the masses. It has strong association with neurodermatitis and contact dermatitis of the external ear. It is also associated with acute otitis externa, rupture of tympanic membrane causing bleeding and temporary hearing loss in some cases. In many cases the injury will heal but damage to minuscule bones deep inside the ear can cause permanent deafness. Objective: The objective of this study was to determine the association of dermatological condition of external ear with the use of cotton buds. Materials and Methods: This case control study was done from January to October 2012 in the Ear Nose Throat Department of Pakistan Level III Hospital, Darfur, Sudan. Sixty seven patients with dermatological diseases of external ear were cases and 83 subjects without dermatological diseases of external ear were selected as controls. Results: Among 67 cases, 58 were cotton bud users and among 83 controls only 29 were cotton bud users. Different types of dermatological diseases were neurodermatitis (34.32%, otitis externa (28.36%, contact dermatitis (26.87% and wax impaction (8.95%. Ninety three percent of cotton bud users were ignorant of harmful effects of this bad habit. Conclusion: There is a strong association of dermatological diseases of external ear with the use of cotton bud which should be discouraged by fortifying the warning by manufacturers and health education at various educational levels.

  16. Taste Bud Labeling in Whole Tongue Epithelial Sheet in Adult Mice.

    Science.gov (United States)

    Venkatesan, Nandakumar; Boggs, Kristin; Liu, Hong-Xiang

    2016-04-01

    Molecular labeling in whole-mount tissues provides an efficient way to obtain general information about the formation, maintenance, degeneration, and regeneration of many organs and tissues. However, labeling of lingual taste buds in whole tongue tissues in adult mice has been problematic because of the strong permeability barrier of the tongue epithelium. In this study, we present a simple method for labeling taste buds in the intact tongue epithelial sheet of an adult mouse. Following intralingual protease injection and incubation, immediate fixation of the tongue on mandible in 4% paraformaldehyde enabled the in situ shape of the tongue epithelium to be well maintained after peeling. The peeled epithelium was accessible to taste bud labeling with a pan-taste cell marker, keratin 8, and a type II taste cell marker, α-gustducin, in all three types of taste papillae, that is, fungiform, foliate, and circumvallate. Overnight incubation of tongue epithelial sheets with primary and secondary antibodies was sufficient for intense labeling of taste buds with both fluorescent and DAB visualizations. Labeled individual taste buds were easy to identify and quantify. This protocol provides an efficient way for phenotypic analyses of taste buds, especially regarding distribution pattern and number.

  17. Characterization of stem/progenitor cell cycle using murine circumvallate papilla taste bud organoid.

    Science.gov (United States)

    Aihara, Eitaro; Mahe, Maxime M; Schumacher, Michael A; Matthis, Andrea L; Feng, Rui; Ren, Wenwen; Noah, Taeko K; Matsu-ura, Toru; Moore, Sean R; Hong, Christian I; Zavros, Yana; Herness, Scott; Shroyer, Noah F; Iwatsuki, Ken; Jiang, Peihua; Helmrath, Michael A; Montrose, Marshall H

    2015-11-24

    Leucine-rich repeat-containing G-protein coupled receptor 5-expressing (Lgr5(+)) cells have been identified as stem/progenitor cells in the circumvallate papillae, and single cultured Lgr5(+) cells give rise to taste cells. Here we use circumvallate papilla tissue to establish a three-dimensional culture system (taste bud organoids) that develops phenotypic characteristics similar to native tissue, including a multilayered epithelium containing stem/progenitor in the outer layers and taste cells in the inner layers. Furthermore, characterization of the cell cycle of the taste bud progenitor niche reveals striking dynamics of taste bud development and regeneration. Using this taste bud organoid culture system and FUCCI2 transgenic mice, we identify the stem/progenitor cells have at least 5 distinct cell cycle populations by tracking within 24-hour synchronized oscillations of proliferation. Additionally, we demonstrate that stem/progenitor cells have motility to form taste bud organoids. Taste bud organoids provides a system for elucidating mechanisms of taste signaling, disease modeling, and taste tissue regeneration.

  18. Glutamate may be an efferent transmitter that elicits inhibition in mouse taste buds.

    Directory of Open Access Journals (Sweden)

    Yijen A Huang

    Full Text Available Recent studies suggest that l-glutamate may be an efferent transmitter released from axons innervating taste buds. In this report, we determined the types of ionotropic synaptic glutamate receptors present on taste cells and that underlie this postulated efferent transmission. We also studied what effect glutamate exerts on taste bud function. We isolated mouse taste buds and taste cells, conducted functional imaging using Fura 2, and used cellular biosensors to monitor taste-evoked transmitter release. The findings show that a large fraction of Presynaptic (Type III taste bud cells (∼50% respond to 100 µM glutamate, NMDA, or kainic acid (KA with an increase in intracellular Ca(2+. In contrast, Receptor (Type II taste cells rarely (4% responded to 100 µM glutamate. At this concentration and with these compounds, these agonists activate glutamatergic synaptic receptors, not glutamate taste (umami receptors. Moreover, applying glutamate, NMDA, or KA caused taste buds to secrete 5-HT, a Presynaptic taste cell transmitter, but not ATP, a Receptor cell transmitter. Indeed, glutamate-evoked 5-HT release inhibited taste-evoked ATP secretion. The findings are consistent with a role for glutamate in taste buds as an inhibitory efferent transmitter that acts via ionotropic synaptic glutamate receptors.

  19. Mash1-expressing cells could differentiate to type III cells in adult mouse taste buds.

    Science.gov (United States)

    Takagi, Hiroki; Seta, Yuji; Kataoka, Shinji; Nakatomi, Mitsushiro; Toyono, Takashi; Kawamoto, Tatsuo

    2018-03-10

    The gustatory cells in taste buds have been identified as paraneuronal; they possess characteristics of both neuronal and epithelial cells. Like neurons, they form synapses, store and release transmitters, and are capable of generating an action potential. Like epithelial cells, taste cells have a limited life span and are regularly replaced throughout life. However, little is known about the molecular mechanisms that regulate taste cell genesis and differentiation. In the present study, to begin to understand these mechanisms, we investigated the role of Mash1-positive cells in regulating adult taste bud cell differentiation through the loss of Mash1-positive cells using the Cre-loxP system. We found that the cells expressing type III cell markers-aromatic L-amino acid decarboxylase (AADC), carbonic anhydrase 4 (CA4), glutamate decarboxylase 67 (GAD67), neural cell adhesion molecule (NCAM), and synaptosomal-associated protein 25 (SNAP25)-were significantly reduced in the circumvallate taste buds after the administration of tamoxifen. However, gustducin and phospholipase C beta2 (PLC beta2)-markers of type II taste bud cells-were not significantly changed in the circumvallate taste buds after the administration of tamoxifen. These results suggest that Mash1-positive cells could be differentiated to type III cells, not type II cells in the taste buds.

  20. Acid-sensing ion channels (ASICs) in the taste buds of adult zebrafish.

    Science.gov (United States)

    Viña, E; Parisi, V; Cabo, R; Laurà, R; López-Velasco, S; López-Muñiz, A; García-Suárez, O; Germanà, A; Vega, J A

    2013-03-01

    In detecting chemical properties of food, different molecules and ion channels are involved including members of the acid-sensing ion channels (ASICs) family. Consistently ASICs are present in sensory cells of taste buds of mammals. In the present study the presence of ASICs (ASIC1, ASIC2, ASIC3 and ASIC4) was investigated in the taste buds of adult zebrafish (zASICs) using Western blot and immunohistochemistry. zASIC1 and zASIC3 were regularly absent from taste buds, whereas faint zASIC2 and robust zASIC4 immunoreactivities were detected in sensory cells. Moreover, zASIC2 also immunolabelled nerves supplying taste buds. The present results demonstrate for the first time the presence of zASICs in taste buds of teleosts, with different patterns to that occurring in mammals, probably due to the function of taste buds in aquatic environment and feeding. Nevertheless, the role of zASICs in taste remains to be demonstrated. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  1. Glutamate may be an efferent transmitter that elicits inhibition in mouse taste buds.

    Science.gov (United States)

    Huang, Yijen A; Grant, Jeff; Roper, Stephen

    2012-01-01

    Recent studies suggest that l-glutamate may be an efferent transmitter released from axons innervating taste buds. In this report, we determined the types of ionotropic synaptic glutamate receptors present on taste cells and that underlie this postulated efferent transmission. We also studied what effect glutamate exerts on taste bud function. We isolated mouse taste buds and taste cells, conducted functional imaging using Fura 2, and used cellular biosensors to monitor taste-evoked transmitter release. The findings show that a large fraction of Presynaptic (Type III) taste bud cells (∼50%) respond to 100 µM glutamate, NMDA, or kainic acid (KA) with an increase in intracellular Ca(2+). In contrast, Receptor (Type II) taste cells rarely (4%) responded to 100 µM glutamate. At this concentration and with these compounds, these agonists activate glutamatergic synaptic receptors, not glutamate taste (umami) receptors. Moreover, applying glutamate, NMDA, or KA caused taste buds to secrete 5-HT, a Presynaptic taste cell transmitter, but not ATP, a Receptor cell transmitter. Indeed, glutamate-evoked 5-HT release inhibited taste-evoked ATP secretion. The findings are consistent with a role for glutamate in taste buds as an inhibitory efferent transmitter that acts via ionotropic synaptic glutamate receptors.

  2. Cellular radiation effects and hyperthermia: Cytokinetic investigations with stationary phase yeast cells

    International Nuclear Information System (INIS)

    Fingerhut, R.; Otto, F.; Oldiges, H.; Kiefer, J.

    1980-01-01

    Wild type diploid yeast, Saccharomyces cerevisiae strain 211, was subjected to 250 kV X-rays or 50 0 C heat treatment for 30 min or to a combination of both. X-ray exposure took place either in air or in nitrogen. Cell number, percentage of budding cells and cell cycle progression was followed for up to 12 h post irradiation. The distribution of cell cycle stages was determined by flow cytofluorometry. All treatments cause a retardation of cell division rate. Hyperthermia leads mainly to a lengthening of G 1 , whereas X-rays arrest the cells reversibly in G 2 . The effect of the combined treatment appears to be merely additive. No selective action of hyperthermia on hypoxic cells was found. (orig.) [de

  3. Fundamental mechanisms of telomerase action in yeasts and mammals: understanding telomeres and telomerase in cancer cells.

    Science.gov (United States)

    Armstrong, Christine A; Tomita, Kazunori

    2017-03-01

    Aberrant activation of telomerase occurs in 85-90% of all cancers and underpins the ability of cancer cells to bypass their proliferative limit, rendering them immortal. The activity of telomerase is tightly controlled at multiple levels, from transcriptional regulation of the telomerase components to holoenzyme biogenesis and recruitment to the telomere, and finally activation and processivity. However, studies using cancer cell lines and other model systems have begun to reveal features of telomeres and telomerase that are unique to cancer. This review summarizes our current knowledge on the mechanisms of telomerase recruitment and activation using insights from studies in mammals and budding and fission yeasts. Finally, we discuss the differences in telomere homeostasis between normal cells and cancer cells, which may provide a foundation for telomere/telomerase targeted cancer treatments. © 2017 The Authors.

  4. Yeast Isolation for Bioethanol Production

    Directory of Open Access Journals (Sweden)

    EKA RURIANI

    2012-09-01

    Full Text Available We have isolated 12 yeast isolates from five different rotten fruits by using a yeast glucose chloramphenicol agar (YGCA medium supplemented with tetracycline. From pre-screening assay, four isolates exhibited higher substrate (glucose-xylose consumption efficiency in the reaction tube fermentation compared to Saccharomyces cerevisiae dan Saccharomyces ellipsoids as the reference strains. Based on the fermentation process in gooseneck flasks, we observed that two isolates (K and SB showed high fermentation efficiency both in sole glucose and mixed glucose-xylose substrate. Moreover, isolates K and SB produced relatively identical level of ethanol concentration compared to the reference strains. Isolates H and MP could only produce high levels of ethanol in glucose fermentation, while only half of that amount of ethanol was detected in glucose-xylose fermentation. Isolate K and SB were identified as Pichia kudriavzeevii (100% based on large sub unit (LSU ribosomal DNA D1/D2 region.

  5. Oral yeast colonization throughout pregnancy

    OpenAIRE

    Rio, Rute; Sim?es-Silva, Liliana; Garro, Sofia; Silva, M?rio-Jorge; Azevedo, ?lvaro; Sampaio-Maia, Benedita

    2017-01-01

    Background Recent studies suggest that placenta may harbour a unique microbiome that may have origin in maternal oral microbiome. Although the major physiological and hormonal adjustments observed in pregnant women lead to biochemical and microbiological modifications of the oral environment, very few studies evaluated the changes suffered by the oral microbiota throughout pregnancy. So, the aim of our study was to evaluate oral yeast colonization throughout pregnancy and to compare it with n...

  6. Yeast: A new oil producer?

    Directory of Open Access Journals (Sweden)

    Beopoulos Athanasios

    2012-01-01

    Full Text Available The increasing demand of plant oils or animal fat for biodiesel and specific lipid derivatives for the oleochemical field (such as lubricants, adhesives or plastics have created price imbalance in both the alimentary and energy field. Moreover, the lack of non-edible oil feedstock has given rise to concerns on land-use practices and on oil production strategies. Recently, much attention has been paid to the exploitation of microbial oils. Most of them present lipid profiles similar in type and composition to plants and could therefore have many advantages as are no competitive with food, have short process cycles and their cultivation is independent of climate factors. Among microorganisms, yeasts seem to be very promising as they can be easily genetically enhanced, are suitable for large-scale fermentation and are devoid of endotoxins. This review will focus on the recent understanding of yeasts lipid metabolism, the succeeding genetic engineering of the lipid pathways and the recent developments on fermentation techniques that pointed out yeasts as promising alternative producers for oil or plastic.

  7. Yeast flocculation: New story in fuel ethanol production.

    Science.gov (United States)

    Zhao, X Q; Bai, F W

    2009-01-01

    Yeast flocculation has been used in the brewing industry to facilitate biomass recovery for a long time, and thus its mechanism of yeast flocculation has been intensively studied. However, the application of flocculating yeast in ethanol production garnered attention mainly in the 1980s and 1990s. In this article, updated research progress in the molecular mechanism of yeast flocculation and the impact of environmental conditions on yeast flocculation are reviewed. Construction of flocculating yeast strains by genetic approach and utilization of yeast flocculation for ethanol production from various feedstocks were presented. The concept of self-immobilized yeast cells through their flocculation is revisited through a case study of continuous ethanol fermentation with the flocculating yeast SPSC01, and their technical and economic advantages are highlighted by comparing with yeast cells immobilized with supporting materials and regular free yeast cells as well. Taking the flocculating yeast SPSC01 as an example, the ethanol tolerance of the flocculating yeast was also discussed.

  8. Vascular budding in Symplegma brakenhielmi and the evolution of coloniality in styelid ascidians.

    Science.gov (United States)

    Gutierrez, Stefania; Brown, Federico D

    2017-03-15

    Individuals of colonial animals (e.g. zooids) are in continuous turnover. In ascidians colonial or solitary species have evolved by convergence multiple times. Colonial Botryllus and Botrylloides are well-studied genera that exhibit colony-wide developmental mechanisms that regulate synchronous and orchestrated cycles of budding and turnover of zooids. The origins of modular developmental mechanisms that facilitated the evolution of coloniality in this group remain unclear. To reconstruct ancestral states of coloniality we studied Symplegma brakenhielmi, a sister taxon of the botryllids. S. brakenhielmi zooids are embedded in a common tunic and present a similar vascular system as the botrylloides, however development and turnover of zooids occurs asynchronously and in a more independent manner. We generated a table of common stages of budding in Symplegma and Botryllus for comparative studies of asexual development. We tested dependent processes of budding among individuals of the colony by systemic bud or zooid removals. Although our results showed a higher degree of independence in bud development in S. brakenhielmi, we found a subtle colony-wide regulatory mechanism of modular development, i.e. new buds expedited development after the removal of all buds in the colony. Next, we characterized external morphology, ultrastructure, and abundance of circulatory blood cells in the vascular system of S. brakenhielmi. Macrophage-like cells (MLCs) are involved in zooid resorption and turnover. Proportions of MLCs in the blood of S. brakenhielmi corresponded to the peak of occurrence of this cell type during the budding cycle of B. schlosseri. We found several new blood cell types in S. brakenhielmi, including two cell types that resemble circulatory progenitor stem cells of other botryllid colonial ascidians. These cells showed features of undifferentiated cells and expressed mitotic marker Phospho-histone H3. Comparative studies of S. brakenhielmi and B. schlosseri

  9. Differentiated dynamics of bud dormancy and growth in temperate fruit trees relating to bud phenology adaptation, the case of apple and almond trees

    Science.gov (United States)

    El Yaacoubi, Adnane; Malagi, Gustavo; Oukabli, Ahmed; Citadin, Idemir; Hafidi, Majida; Bonhomme, Marc; Legave, Jean-Michel

    2016-11-01

    Few studies have focused on the characterization of bud dormancy and growth dynamics for temperate fruit species in temperate and mild cropping areas, although this is an appropriate framework to anticipate phenology adaptation facing future warming contexts which would potentially combine chill declines and heat increases. To examine this issue, two experimental approaches and field observations were used for high- and low-chill apple cultivars in temperate climate of southern France and in mild climates of northern Morocco and southern Brazil. Low-chill almond cultivars offered an additional relevant plant material for comparison with apple in northern Morocco. Divergent patterns of dormancy and growth dynamics were clearly found in apple tree between southern France and southern Brazil. Divergences were less pronounced between France and Morocco. A global view outlined main differences in the dormancy chronology and intensity, the transition between endordormancy and ecodormancy and the duration of ecodormancy. A key role of bud rehydration in the transition period was shown. High-chill cultivars would be submitted in mild conditions to heterogeneous rehydration capacities linked to insufficient chill fulfillment and excessive forcing linked to high temperatures. This would favor bud competitions and consequently excessive flowering durations and weak flowering. Low chilling requirements in apple and almond would conversely confer biological capacities to tolerate superficial dormancy and abrupt transition from endordormancy to ecodormancy without important heterogeneous rehydration states within buds. It may also assume that low-chill cultivars can also tolerate high temperatures during ecodormancy as well as extended flowering durations.

  10. Differentiated dynamics of bud dormancy and growth in temperate fruit trees relating to bud phenology adaptation, the case of apple and almond trees.

    Science.gov (United States)

    El Yaacoubi, Adnane; Malagi, Gustavo; Oukabli, Ahmed; Citadin, Idemir; Hafidi, Majida; Bonhomme, Marc; Legave, Jean-Michel

    2016-11-01

    Few studies have focused on the characterization of bud dormancy and growth dynamics for temperate fruit species in temperate and mild cropping areas, although this is an appropriate framework to anticipate phenology adaptation facing future warming contexts which would potentially combine chill declines and heat increases. To examine this issue, two experimental approaches and field observations were used for high- and low-chill apple cultivars in temperate climate of southern France and in mild climates of northern Morocco and southern Brazil. Low-chill almond cultivars offered an additional relevant plant material for comparison with apple in northern Morocco. Divergent patterns of dormancy and growth dynamics were clearly found in apple tree between southern France and southern Brazil. Divergences were less pronounced between France and Morocco. A global view outlined main differences in the dormancy chronology and intensity, the transition between endordormancy and ecodormancy and the duration of ecodormancy. A key role of bud rehydration in the transition period was shown. High-chill cultivars would be submitted in mild conditions to heterogeneous rehydration capacities linked to insufficient chill fulfillment and excessive forcing linked to high temperatures. This would favor bud competitions and consequently excessive flowering durations and weak flowering. Low chilling requirements in apple and almond would conversely confer biological capacities to tolerate superficial dormancy and abrupt transition from endordormancy to ecodormancy without important heterogeneous rehydration states within buds. It may also assume that low-chill cultivars can also tolerate high temperatures during ecodormancy as well as extended flowering durations.

  11. Yeasts Diversity in Fermented Foods and Beverages

    Science.gov (United States)

    Tamang, Jyoti Prakash; Fleet, Graham H.

    People across the world have learnt to culture and use the essential microorganisms for production of fermented foods and alcoholic beverages. A fermented food is produced either spontaneously or by adding mixed/pure starter culture(s). Yeasts are among the essential functional microorganisms encountered in many fermented foods, and are commercially used in production of baker's yeast, breads, wine, beer, cheese, etc. In Asia, moulds are predominant followed by amylolytic and alcohol-producing yeasts in the fermentation processes, whereas in Africa, Europe, Australia and America, fermented products are prepared exclusively using bacteria or bacteria-yeasts mixed cultures. This chapter would focus on the varieties of fermented foods and alcoholic beverages produced by yeasts, their microbiology and role in food fermentation, widely used commercial starters (pilot production, molecular aspects), production technology of some common commercial fermented foods and alcoholic beverages, toxicity and food safety using yeasts cultures and socio-economy

  12. Discrimination of taste qualities among mouse fungiform taste bud cells.

    Science.gov (United States)

    Yoshida, Ryusuke; Miyauchi, Aya; Yasuo, Toshiaki; Jyotaki, Masafumi; Murata, Yoshihiro; Yasumatsu, Keiko; Shigemura, Noriatsu; Yanagawa, Yuchio; Obata, Kunihiko; Ueno, Hiroshi; Margolskee, Robert F; Ninomiya, Yuzo

    2009-09-15

    Multiple lines of evidence from molecular studies indicate that individual taste qualities are encoded by distinct taste receptor cells. In contrast, many physiological studies have found that a significant proportion of taste cells respond to multiple taste qualities. To reconcile this apparent discrepancy and to identify taste cells that underlie each taste quality, we investigated taste responses of individual mouse fungiform taste cells that express gustducin or GAD67, markers for specific types of taste cells. Type II taste cells respond to sweet, bitter or umami tastants, express taste receptors, gustducin and other transduction components. Type III cells possess putative sour taste receptors, and have well elaborated conventional synapses. Consistent with these findings we found that gustducin-expressing Type II taste cells responded best to sweet (25/49), bitter (20/49) or umami (4/49) stimuli, while all GAD67 (Type III) taste cells examined (44/44) responded to sour stimuli and a portion of them showed multiple taste sensitivities, suggesting discrimination of each taste quality among taste bud cells. These results were largely consistent with those previously reported with circumvallate papillae taste cells. Bitter-best taste cells responded to multiple bitter compounds such as quinine, denatonium and cyclohexamide. Three sour compounds, HCl, acetic acid and citric acid, elicited responses in sour-best taste cells. These results suggest that taste cells may be capable of recognizing multiple taste compounds that elicit similar taste sensation. We did not find any NaCl-best cells among the gustducin and GAD67 taste cells, raising the possibility that salt sensitive taste cells comprise a different population.

  13. Binding of DEAD-box helicase Dhh1 to the 5'-untranslated region of ASH1 mRNA represses localized translation of ASH1 in yeast cells.

    Science.gov (United States)

    Zhang, Qianjun; Meng, Xiuhua; Li, Delin; Chen, Shaoyin; Luo, Jianmin; Zhu, Linjie; Singer, Robert H; Gu, Wei

    2017-06-09

    Local translation of specific mRNAs is regulated by dynamic changes in their subcellular localization, and these changes are due to complex mechanisms controlling cytoplasmic mRNA transport. The budding yeast Saccharomyces cerevisiae is well suited to studying these mechanisms because many of its transcripts are transported from the mother cell to the budding daughter cell. Here, we investigated the translational control of ASH1 mRNA after transport and localization. We show that although ASH1 transcripts were translated after they reached the bud tip, some mRNAs were bound by the RNA-binding protein Puf6 and were non-polysomal. We also found that the DEAD-box helicase Dhh1 complexed with the untranslated ASH1 mRNA and Puf6. Loss of Dhh1 affected local translation of ASH1 mRNA and resulted in delocalization of ASH1 transcript in the bud. Forcibly shifting the non-polysomal ASH1 mRNA into polysomes was associated with Dhh1 dissociation. We further demonstrated that Dhh1 is not recruited to ASH1 mRNA co-transcriptionally, suggesting that it could bind to ASH1 mRNA within the cytoplasm. Of note, Dhh1 bound to the 5'-UTR of ASH1 mRNA and inhibited its translation in vitro These results suggest that after localization to the bud tip, a portion of the localized ASH1 mRNA becomes translationally inactive because of binding of Dhh1 and Puf6 to the 5'- and 3'-UTRs of ASH1 mRNA. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  14. Functional interchangeability of late domains, late domain cofactors and ubiquitin in viral budding.

    Directory of Open Access Journals (Sweden)

    Maria Zhadina

    2010-10-01

    Full Text Available The membrane scission event that separates nascent enveloped virions from host cell membranes often requires the ESCRT pathway, which can be engaged through the action of peptide motifs, termed late (L- domains, in viral proteins. Viral PTAP and YPDL-like L-domains bind directly to the ESCRT-I and ALIX components of the ESCRT pathway, while PPxY motifs bind Nedd4-like, HECT-domain containing, ubiquitin ligases (e.g. WWP1. It has been unclear precisely how ubiquitin ligase recruitment ultimately leads to particle release. Here, using a lysine-free viral Gag protein derived from the prototypic foamy virus (PFV, where attachment of ubiquitin to Gag can be controlled, we show that several different HECT domains can replace the WWP1 HECT domain in chimeric ubiquitin ligases and drive budding. Moreover, artificial recruitment of isolated HECT domains to Gag is sufficient to stimulate budding. Conversely, the HECT domain becomes dispensable if the other domains of WWP1 are directly fused to an ESCRT-1 protein. In each case where budding is driven by a HECT domain, its catalytic activity is essential, but Gag ubiquitination is dispensable, suggesting that ubiquitin ligation to trans-acting proteins drives budding. Paradoxically, however, we also demonstrate that direct fusion of a ubiquitin moiety to the C-terminus of PFV Gag can also promote budding, suggesting that ubiquitination of Gag can substitute for ubiquitination of trans-acting proteins. Depletion of Tsg101 and ALIX inhibits budding that is dependent on ubiquitin that is fused to Gag, or ligated to trans-acting proteins through the action of a PPxY motif. These studies underscore the flexibility in the ways that the ESCRT pathway can be engaged, and suggest a model in which the identity of the protein to which ubiquitin is attached is not critical for subsequent recruitment of ubiquitin-binding components of the ESCRT pathway and viral budding to proceed.

  15. Neural crest contribution to lingual mesenchyme, epithelium and developing taste papillae and taste buds.

    Science.gov (United States)

    Liu, Hong-Xiang; Komatsu, Yoshihiro; Mishina, Yuji; Mistretta, Charlotte M

    2012-08-15

    The epithelium of mammalian tongue hosts most of the taste buds that transduce gustatory stimuli into neural signals. In the field of taste biology, taste bud cells have been described as arising from "local epithelium", in distinction from many other receptor organs that are derived from neurogenic ectoderm including neural crest (NC). In fact, contribution of NC to both epithelium and mesenchyme in the developing tongue is not fully understood. In the present study we used two independent, well-characterized mouse lines, Wnt1-Cre and P0-Cre that express Cre recombinase in a NC-specific manner, in combination with two Cre reporter mouse lines, R26R and ZEG, and demonstrate a contribution of NC-derived cells to both tongue mesenchyme and epithelium including taste papillae and taste buds. In tongue mesenchyme, distribution of NC-derived cells is in close association with taste papillae. In tongue epithelium, labeled cells are observed in an initial scattered distribution and progress to a clustered pattern between papillae, and within papillae and early taste buds. This provides evidence for a contribution of NC to lingual epithelium. Together with previous reports for the origin of taste bud cells from local epithelium in postnatal mouse, we propose that NC cells migrate into and reside in the epithelium of the tongue primordium at an early embryonic stage, acquire epithelial cell phenotypes, and undergo cell proliferation and differentiation that is involved in the development of taste papillae and taste buds. Our findings lead to a new concept about derivation of taste bud cells that include a NC origin. Copyright © 2012 Elsevier Inc. All rights reserved.

  16. Drosophila Regulate Yeast Density and Increase Yeast Community Similarity in a Natural Substrate

    OpenAIRE

    Stamps, Judy A.; Yang, Louie H.; Morales, Vanessa M.; Boundy-Mills, Kyria L.

    2012-01-01

    Drosophila melanogaster adults and larvae, but especially larvae, had profound effects on the densities and community structure of yeasts that developed in banana fruits. Pieces of fruit exposed to adult female flies previously fed fly-conditioned bananas developed higher yeast densities than pieces of the same fruits that were not exposed to flies, supporting previous suggestions that adult Drosophila vector yeasts to new substrates. However, larvae alone had dramatic effects on yeast densit...

  17. Digital Image Analysis of Yeast Single Cells Growing in Two Different Oxygen Concentrations to Analyze the Population Growth and to Assist Individual-Based Modeling.

    Science.gov (United States)

    Ginovart, Marta; Carbó, Rosa; Blanco, Mónica; Portell, Xavier

    2017-01-01

    Nowadays control of the growth of Saccharomyces to obtain biomass or cellular wall components is crucial for specific industrial applications. The general aim of this contribution is to deal with experimental data obtained from yeast cells and from yeast cultures to attempt the integration of the two levels of information, individual and population, to progress in the control of yeast biotechnological processes by means of the overall analysis of this set of experimental data, and to assist in the improvement of an individual-based model, namely, INDISIM- Saccha . Populations of S. cerevisiae growing in liquid batch culture, in aerobic and microaerophilic conditions, were studied. A set of digital images was taken during the population growth, and a protocol for the treatment and analyses of the images obtained was established. The piecewise linear model of Buchanan was adjusted to the temporal evolutions of the yeast populations to determine the kinetic parameters and changes of growth phases. In parallel, for all the yeast cells analyzed, values of direct morphological parameters, such as area, perimeter, major diameter, minor diameter, and derived ones, such as circularity and elongation, were obtained. Graphical and numerical methods from descriptive statistics were applied to these data to characterize the growth phases and the budding state of the yeast cells in both experimental conditions, and inferential statistical methods were used to compare the diverse groups of data achieved. Oxidative metabolism of yeast in a medium with oxygen available and low initial sugar concentration can be taken into account in order to obtain a greater number of cells or larger cells. Morphological parameters were analyzed statistically to identify which were the most useful for the discrimination of the different states, according to budding and/or growth phase, in aerobic and microaerophilic conditions. The use of the experimental data for subsequent modeling work was then

  18. During development intense Sox2 expression marks not only Prox1-expressing taste bud cell but also perigemmal cell lineages.

    Science.gov (United States)

    Nakayama, Ayumi; Miura, Hirohito; Ooki, Makoto; Harada, Shuitsu

    2015-03-01

    Sox2 is proposed to regulate the differentiation of bipotential progenitor cells into taste bud cells. However, detailed expression of Sox2 remains unclear. In this report, Sox2 expression during taste bud development in the fungiform (FF), circumvallate (CV) and soft palate (SP) areas is examined together with Prox1. First, we immunohistochemically checked Prox1 expression in adults and found that almost all taste bud cells are Prox1-positive. During FF development, intense Sox2 expression was restricted to taste bud primordia expressing Prox1 at E12.5. However, at E14.5, Sox2 was intensely expressed outside the developing taste buds resolving to perigemmal Sox2 expression in adults. In the SP, at E14.5, taste bud primordia emerged as Prox1-expressing cell clusters. However, intense Sox2 expression was not restricted to taste bud primordia but was detected widely in the epithelium. During development, Sox2 expression outside developing taste buds was generally down-regulated but was retained in the perigemmal region similarly to that in the FF. In the CV, the initial stage of taste bud development remained unclear because of the lack of taste bud primordia comparable to that in the FF and SP. Here, we show that Prox1-expressing cells appear in the apical epithelium at E12.5, in the inner trench wall at E17.5 and in the outer trench wall at E18.5. Sox2 was again not restricted to developing taste bud cells expressing Prox1 during CV development. The expression patterns support that Sox2 does not serve as a cell fate selector between taste bud cells and surrounding keratinocytes but rather may contribute to them both.

  19. The epigenetic memory of temperature during embryogenesis modifies the expression of bud burst-related genes in Norway spruce epitypes.

    Science.gov (United States)

    Carneros, Elena; Yakovlev, Igor; Viejo, Marcos; Olsen, Jorunn E; Fossdal, Carl Gunnar

    2017-09-01

    Epigenetic memory affects the timing of bud burst phenology and the expression of bud burst-related genes in genetically identical Norway spruce epitypes in a manner usually associated with ecotypes. In Norway spruce, a temperature-dependent epigenetic memory established during embryogenesis affects the timing of bud burst and bud set in a reproducible and predictable manner. We hypothesize that the clinal variation in these phenological traits, which is associated with adaptation to growth under frost-free conditions, has an epigenetic component. In Norway spruce, dehydrins (DHNs) have been associated with extreme frost tolerance. DHN transcript levels decrease gradually prior to flushing, a time when trees are highly sensitive to frost. Furthermore, EARLY BUD BREAK 1 genes (EBB1) and the FT-TFL1-LIKE 2-gene (PaFTL2) were previously suggested to be implied in control of bud phenology. Here we report an analysis of transcript levels of 12 DHNs, 3 EBB1 genes and FTL2 in epitypes of the same genotype generated at different epitype-inducing temperatures, before and during spring bud burst. Earlier flushing of epitypes originating from embryos developed at 18 °C as compared to 28 °C, was associated with differential expression of these genes between epitypes and between buds and last year's needles. The majority of these genes showed significantly different expressions between epitypes in at least one time point. The general trend in DHN expression pattern in buds showed the expected reduction in transcript levels when approaching flushing, whereas, surprisingly, transcript levels peaked later in needles, mainly at the moment of bud burst. Collectively, our results demonstrate that the epigenetic memory of temperature during embryogenesis affects bud burst phenology and expression of the bud burst-related DHN, EBB1 and FTL2 genes in genetically identical Norway spruce epitypes.

  20. The glossopharyngeal nerve controls epithelial expression of Sprr2a and Krt13 around taste buds in the circumvallate papilla.

    Science.gov (United States)

    Miura, Hirohito; Kusakabe, Yuko; Hashido, Kento; Hino, Akihiro; Ooki, Makoto; Harada, Shuitsu

    2014-09-19

    Tastants reach the tip of taste bud cells through taste pores which are openings in the epithelium. We found Sprr2a is selectively expressed in the upper layer of the epithelium surrounding taste buds in the circumvallate papilla (CV) where the epithelium is organized into taste pores. Sprr2a is a member of a small proline-rich protein family, which is suggested to be involved in the restitution/migration phase of epithelial wound healing. The expression of Sprr2a was restricted to the upper layer and largely segregated with Ptch1 expression that is restricted to the basal side of the epithelium around the taste buds. Denervation resulted in the gradual loss of Sprr2a-expressing cells over 10 days similarly to that of taste bud cells which is in contrast to the rapid loss of Ptch1 expression. We also found that denervation caused an increase of Keratin (Krt)13 expression around taste buds that corresponded with the disappearance of Sprr2a and Ptch1 expression. Taste buds were surrounded by Krt13-negative cells in the CV in control mice. However, at 6 days post-denervation, taste buds were tightly surrounded by Krt13-positive cells. During taste bud development, taste bud cells emerged together with Krt13-negtive cells, and Sprr2a expression was increased along with the progress of taste bud development. These results demonstrate that regional gene expression surrounding taste buds is associated with taste bud formation and controlled by the innervating taste nerve. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.