WorldWideScience

Sample records for budding yeast ssd1-v

  1. Sociobiology of the budding yeast

    Indian Academy of Sciences (India)

    Dominika M Wloch-Salamon

    2014-04-01

    Social theory has provided a useful framework for research with microorganisms. Here I describe the advantages and possible risks of using a well-known model organism, the unicellular yeast Saccharomyces cerevisiae, for sociobiological research. I discuss the problems connected with clear classification of yeast behaviour based on the fitness-based Hamilton paradigm. Relevant traits include different types of communities, production of flocculins, invertase and toxins, and the presence of apoptosis.

  2. Bipolar budding in yeasts - an electron microscope study

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    Bud formation in yeasts with bipolar budding was studied by electron microscopy of thin sections. Budding in yeasts of the species Saccharomycodes ludwigii, Hanseniaspora valbyensis and Wickerhamia fluorescens resulted in concentric rings of scar ridges on the wall of the mother cell. The wall betwe

  3. 5'-end sequences of budding yeast full-length cDNA clones - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Budding yeast cDNA sequencing project 5'-end sequences of budding yeast full-length cDNA clones Data detail Data name 5'-end sequence...s of budding yeast full-length cDNA clones Description of data contents cDNA sequence...e Update History of This Database Site Policy | Contact Us 5'-end sequences of budding yeast full-length cDNA clones - Budding yeast cDNA sequencing project | LSDB Archive ...

  4. Calling Card Analysis in Budding Yeast.

    Science.gov (United States)

    Mayhew, David; Mitra, Robi D

    2016-02-01

    Calling card analysis is a high-throughput method for identifying the genomic binding sites of multiple transcription factors in a single experiment in budding yeast. By tagging a DNA-binding protein with a targeting domain that directs the insertion of the Ty5 retrotransposon, the genomic binding sites for that transcription factor are marked. The transposition locations are then identified en masse by Illumina sequencing. The calling card protocol allows for simultaneous analysis of multiple transcription factors. By cloning barcodes into the Ty5 transposon, it is possible to pair a unique barcode with every transcription factor in the experiment. The method presented here uses expression of transcription factors from their native loci; however, it can also be altered to measure binding sites of transcription factors overexpressed from a plasmid. PMID:26832687

  5. Measuring mitotic spindle dynamics in budding yeast

    Science.gov (United States)

    Plumb, Kemp

    In order to carry out its life cycle and produce viable progeny through cell division, a cell must successfully coordinate and execute a number of complex processes with high fidelity, in an environment dominated by thermal noise. One important example of such a process is the assembly and positioning of the mitotic spindle prior to chromosome segregation. The mitotic spindle is a modular structure composed of two spindle pole bodies, separated in space and spanned by filamentous proteins called microtubules, along which the genetic material of the cell is held. The spindle is responsible for alignment and subsequent segregation of chromosomes into two equal parts; proper spindle positioning and timing ensure that genetic material is appropriately divided amongst mother and daughter cells. In this thesis, I describe fluorescence confocal microscopy and automated image analysis algorithms, which I have used to observe and analyze the real space dynamics of the mitotic spindle in budding yeast. The software can locate structures in three spatial dimensions and track their movement in time. By selecting fluorescent proteins which specifically label the spindle poles and cell periphery, mitotic spindle dynamics have been measured in a coordinate system relevant to the cell division. I describe how I have characterised the accuracy and precision of the algorithms by simulating fluorescence data for both spindle poles and the budding yeast cell surface. In this thesis I also describe the construction of a microfluidic apparatus that allows for the measurement of long time-scale dynamics of individual cells and the development of a cell population. The tools developed in this thesis work will facilitate in-depth quantitative analysis of the non-equilibrium processes in living cells.

  6. Tolerance of budding yeast Saccharomyces cerevisiae to ultra high pressure

    Science.gov (United States)

    Shibata, M.; Torigoe, M.; Matsumoto, Y.; Yamamoto, M.; Takizawa, N.; Hada, Y.; Mori, Y.; Takarabe, K.; Ono, F.

    2014-05-01

    Our studies on the tolerance of plants and animals against very high pressure of several GPa have been extended to a smaller sized fungus, the budding yeast Saccharomyces cerevisiae. Several pieces of budding yeast (dry yeast) were sealed in a small teflon capsule with a liquid pressure medium fluorinate, and exposed to 7.5 GPa by using a cubic anvil press. The pressure was kept constant for various duration of time from 2 to 24 h. After the pressure was released, the specimens were brought out from the teflon capsule, and they were cultivated on a potato dextrose agar. It was found that the budding yeast exposed to 7.5 GPa for up to 6 h showed multiplication. However, those exposed to 7.5 GPa for longer than 12 h were found dead. The high pressure tolerance of budding yeast is a little weaker than that of tardigrades.

  7. Dielectric modelling of cell division for budding and fission yeast

    International Nuclear Information System (INIS)

    The frequency dependence of complex permittivity or the dielectric spectrum of a system including a cell in cell division has been simulated by a numerical technique based on the three-dimensional finite difference method. Two different types of cell division characteristic of budding and fission yeast were examined. The yeast cells are both regarded as a body of rotation, and thus have anisotropic polarization, i.e. the effective permittivity of the cell depends on the orientation of the cell to the direction of an applied electric field. In the perpendicular orientation, where the rotational axis of the cell is perpendicular to the electric field direction, the dielectric spectra for both yeast cells included one dielectric relaxation and its intensity depended on the cell volume. In the parallel orientation, on the other hand, two dielectric relaxations appeared with bud growth for budding yeast and with septum formation for fission yeast. The low-frequency relaxation was shifted to a lower frequency region by narrowing the neck between the bud and the mother cell for budding yeast and by increasing the degree of septum formation for fission yeast. After cell separation, the low-frequency relaxation disappeared. The simulations well interpreted the oscillation of the relative permittivity of culture broth found for synchronous cell growth of budding yeast

  8. Dielectric modelling of cell division for budding and fission yeast

    Science.gov (United States)

    Asami, Koji; Sekine, Katsuhisa

    2007-02-01

    The frequency dependence of complex permittivity or the dielectric spectrum of a system including a cell in cell division has been simulated by a numerical technique based on the three-dimensional finite difference method. Two different types of cell division characteristic of budding and fission yeast were examined. The yeast cells are both regarded as a body of rotation, and thus have anisotropic polarization, i.e. the effective permittivity of the cell depends on the orientation of the cell to the direction of an applied electric field. In the perpendicular orientation, where the rotational axis of the cell is perpendicular to the electric field direction, the dielectric spectra for both yeast cells included one dielectric relaxation and its intensity depended on the cell volume. In the parallel orientation, on the other hand, two dielectric relaxations appeared with bud growth for budding yeast and with septum formation for fission yeast. The low-frequency relaxation was shifted to a lower frequency region by narrowing the neck between the bud and the mother cell for budding yeast and by increasing the degree of septum formation for fission yeast. After cell separation, the low-frequency relaxation disappeared. The simulations well interpreted the oscillation of the relative permittivity of culture broth found for synchronous cell growth of budding yeast.

  9. A Monitor for Bud Emergence in the Yeast Morphogenesis Checkpoint

    OpenAIRE

    Theesfeld, Chandra L.; Zyla, Trevin R.; Bardes, Elaine G.S.; Lew, Daniel J.

    2003-01-01

    Cell cycle transitions are subject to regulation by both external signals and internal checkpoints that monitor satisfactory progression of key cell cycle events. In budding yeast, the morphogenesis checkpoint arrests the cell cycle in response to perturbations that affect the actin cytoskeleton and bud formation. Herein, we identify a step in this checkpoint pathway that seems to be directly responsive to bud emergence. Activation of the kinase Hsl1p is dependent upon...

  10. Newly identified prions in budding yeast, and their possible functions

    OpenAIRE

    Crow, Emily T.; Li, Liming

    2011-01-01

    Yeast prions are atypical genetic elements that are transmitted as heritable protein conformations. [PSI+], [URE3], and [PIN+] are three well-studied prions in the budding yeast, Saccharomyces cerevisiae. In the last three years, several additional prions have been reported in yeast, including [SWI+], [OCT+], [MCA], [GAR+], [MOT3+], [ISP+], and [NSI+]. The growing number of yeast prions suggests that protein-based inheritance might be a widespread biological phenomenon. In this review, we sum...

  11. Mechanical feedback stabilizes budding yeast morphogenesis

    Science.gov (United States)

    Banavar, Samhita; Trogdon, Michael; Petzold, Linda; Campas, Otger

    Walled cells have the ability to remodel their shape while sustaining an internal turgor pressure that can reach values up to 10 atmospheres. This requires a tight and simultaneous regulation of cell wall assembly and mechanochemistry, but the underlying mechanisms by which this is achieved remain unclear. Using the growth of mating projections in budding yeast (S. cerevisiae) as a motivating example, we have developed a theoretical description that couples the mechanics of cell wall expansion and assembly via a mechanical feedback. In the absence of a mechanical feedback, cell morphogenesis is inherently unstable. The presence of a mechanical feedback stabilizes changes in cell shape and growth, and provides a mechanism to prevent cell lysis in a wide range of conditions. We solve for the dynamics of the system and obtain the different dynamical regimes. In particular, we show that several parameters affect the stability of growth, including the strength of mechanical feedback in the system. Finally, we compare our results to existing experimental data.

  12. Measuring Replicative Life Span in the Budding Yeast

    OpenAIRE

    Steffen, Kristan K.; Kennedy, Brian K.; Kaeberlein, Matt

    2009-01-01

    Aging is a degenerative process characterized by a progressive deterioration of cellular components and organelles resulting in mortality. The budding yeast Saccharomyces cerevisiae has been used extensively to study the biology of aging, and several determinants of yeast longevity have been shown to be conserved in multicellular eukaryotes, including worms, flies, and mice 1. Due to the lack of easily quantified age-associated phenotypes, aging in yeast has been assayed almost exclusively by...

  13. A Monitor for Bud Emergence in the Yeast Morphogenesis Checkpoint

    Science.gov (United States)

    Theesfeld, Chandra L.; Zyla, Trevin R.; Bardes, Elaine G.S.; Lew, Daniel J.

    2003-01-01

    Cell cycle transitions are subject to regulation by both external signals and internal checkpoints that monitor satisfactory progression of key cell cycle events. In budding yeast, the morphogenesis checkpoint arrests the cell cycle in response to perturbations that affect the actin cytoskeleton and bud formation. Herein, we identify a step in this checkpoint pathway that seems to be directly responsive to bud emergence. Activation of the kinase Hsl1p is dependent upon its recruitment to a cortical domain organized by the septins, a family of conserved filament-forming proteins. Under conditions that delayed or blocked bud emergence, Hsl1p recruitment to the septin cortex still took place, but hyperphosphorylation of Hsl1p and recruitment of the Hsl1p-binding protein Hsl7p to the septin cortex only occurred after bud emergence. At this time, the septin cortex spread to form a collar between mother and bud, and Hsl1p and Hsl7p were restricted to the bud side of the septin collar. We discuss models for translating cellular geometry (in this case, the emergence of a bud) into biochemical signals regulating cell proliferation. PMID:12925763

  14. Evaluation and Properties of the Budding Yeast Phosphoproteome

    OpenAIRE

    Amoutzias, G. D.; He, Y.; Lilley, K. S.; Van de Peer, Y.; Oliver, S G

    2012-01-01

    We have assembled a reliable phosphoproteomic data set for budding yeast Saccharomyces cerevisiae and have investigated its properties. Twelve publicly available phosphoproteome data sets were triaged to obtain a subset of high-confidence phosphorylation sites (p-sites), free of "noisy" phosphorylations. Analysis of this combined data set suggests that the inventory of phosphoproteins in yeast is close to completion, but that these proteins may have many undiscovered p-sites. Proteins involve...

  15. Apoptosis at inflection point in liquid culture of budding yeasts.

    Directory of Open Access Journals (Sweden)

    Toshiyuki Hagiwara

    Full Text Available Budding yeasts are highly suitable for aging studies, because the number of bud scars (stage proportionally correlates with age. Its maximum stages are known to reach at 20-30 stages on an isolated agar medium. However, their stage dynamics in a liquid culture is virtually unknown. We investigate the population dynamics by counting scars in each cell. Here one cell division produces one new cell and one bud scar. This simple rule leads to a conservation law: "The total number of bud scars is equal to the total number of cells." We find a large discrepancy: extremely fewer cells with over 5 scars than expected. Almost all cells with 6 or more scars disappear within a short period of time in the late log phase (corresponds to the inflection point. This discrepancy is confirmed directly by the microscopic observations of broken cells. This finding implies apoptosis in older cells (6 scars or more.

  16. Reconstitution of hemisomes on budding yeast centromeric DNA

    OpenAIRE

    Furuyama, Takehito; Codomo, Christine A.; Henikoff, Steven

    2013-01-01

    The structure of nucleosomes that contain the cenH3 histone variant has been controversial. In budding yeast, a single right-handed cenH3/H4/H2A/H2B tetramer wraps the ∼80-bp Centromere DNA Element II (CDE II) sequence of each centromere into a ‘hemisome’. However, attempts to reconstitute cenH3 particles in vitro have yielded exclusively ‘octasomes’, which are observed in vivo on chromosome arms only when Cse4 (yeast cenH3) is overproduced. Here, we show that Cse4 octamers remain intact unde...

  17. Dynamical Analysis of Protein Regulatory Network in Budding Yeast Nucleus

    Institute of Scientific and Technical Information of China (English)

    LI Fang-Ting; JIA Xun

    2006-01-01

    @@ Recent progresses in the protein regulatory network of budding yeast Saccharomyces cerevisiae have provided a global picture of its protein network for further dynamical research. We simplify and modularize the protein regulatory networks in yeast nucleus, and study the dynamical properties of the core 37-node network by a Boolean network model, especially the evolution steps and final fixed points. Our simulation results show that the number of fixed points N(k) for a given size of the attraction basin k obeys a power-law distribution N(k)∝k-2.024. The yeast network is more similar to a scale-free network than a random network in the above dynamical properties.

  18. Tripartite organization of centromeric chromatin in budding yeast

    OpenAIRE

    Krassovsky, Kristina; Henikoff, Jorja G.; Henikoff, Steven

    2011-01-01

    The centromere is the genetic locus that organizes the proteinaceous kinetochore and is responsible for attachment of the chromosome to the spindle at mitosis and meiosis. In most eukaryotes, the centromere consists of highly repetitive DNA sequences that are occupied by nucleosomes containing the CenH3 histone variant, whereas in budding yeast, a ∼120-bp centromere DNA element (CDE) that is sufficient for centromere function is occupied by a single right-handed histone variant CenH3 (Cse4) n...

  19. Vector sequences - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Budding yeast cDNA sequencing project Vector sequences Data detail Data name Vector sequences Description of data contents Vector seq...wnload License Update History of This Database Site Policy | Contact Us Vector sequences - Budding yeast cDNA sequencing project | LSDB Archive ... ...uences used for sequencing. Multi FASTA format. 7 entries. Data file File name: vec

  20. Post-transcriptional regulation in budding yeast meiosis.

    Science.gov (United States)

    Jin, Liang; Neiman, Aaron M

    2016-05-01

    The precise regulation of gene expression is essential for developmental processes in eukaryotic organisms. As an important post-transcriptional regulatory point, translational control is complementary to transcriptional regulation. Sporulation in the budding yeast Saccharomyces cerevisiae is a developmental process controlled by a well-studied transcriptional cascade that drives the cell through the events of DNA replication, meiotic chromosome segregation, and spore assembly. Recent studies have revealed that as cells begin the meiotic divisions, translational regulation of gene expression fine tunes this transcriptional cascade. The significance and mechanisms of this translational regulation are beginning to emerge. These studies may also provide insights into translational regulation in germ cell development of multicellular organisms. PMID:26613728

  1. Systems Level Modeling of the Cell Cycle Using Budding Yeast

    Directory of Open Access Journals (Sweden)

    D.R. Kim

    2007-01-01

    Full Text Available Proteins involved in the regulation of the cell cycle are highly conserved across all eukaryotes, and so a relatively simple eukaryote such as yeast can provide insight into a variety of cell cycle perturbations including those that occur in human cancer. To date, the budding yeast Saccharomyces cerevisiae has provided the largest amount of experimental and modeling data on the progression of the cell cycle, making it a logical choice for in-depth studies of this process. Moreover, the advent of methods for collection of high-throughput genome, transcriptome, and proteome data has provided a means to collect and precisely quantify simultaneous cell cycle gene transcript and protein levels, permitting modeling of the cell cycle on the systems level. With the appropriate mathematical framework and suffi cient and accurate data on cell cycle components, it should be possible to create a model of the cell cycle that not only effectively describes its operation, but can also predict responses to perturbations such as variation in protein levels and responses to external stimuli including targeted inhibition by drugs. In this review, we summarize existing data on the yeast cell cycle, proteomics technologies for quantifying cell cycle proteins, and the mathematical frameworks that can integrate this data into representative and effective models. Systems level modeling of the cell cycle will require the integration of high-quality data with the appropriate mathematical framework, which can currently be attained through the combination of dynamic modeling based on proteomics data and using yeast as a model organism.

  2. Dissecting ribosome assembly and transport in budding yeast.

    Science.gov (United States)

    Altvater, Martin; Schütz, Sabina; Chang, Yiming; Panse, Vikram Govind

    2014-01-01

    Construction of the eukaryotic ribosome begins in the nucleolus and requires >300 evolutionarily conserved nonribosomal trans-acting factors, which transiently associate with preribosomal subunits at distinct assembly stages. A subset of trans-acting and transport factors passage assembled preribosomal subunits in a functionally inactive state through the nuclear pore complexes (NPC) into the cytoplasm, where they undergo final maturation before initiating translation. Here, we summarize the repertoire of tools developed in the model organism budding yeast that are spearheading the functional analyses of trans-acting factors involved in the assembly and intracellular transport of preribosomal subunits. We elaborate on different GFP-tagged ribosomal protein reporters and a pre-rRNA reporter that reliably monitors the movement of preribosomal particles from the nucleolus to cytoplasm. We discuss the powerful yeast heterokaryon assay, which can be employed to uncover shuttling trans-acting factors that need to accompany preribosomal subunits to the cytoplasm to be released prior to initiating translation. Moreover, we present two biochemical approaches, namely sucrose gradient analyses and tandem affinity purification, that are rapidly facilitating the uncovering of regulatory processes that control the compositional dynamics of trans-acting factors on maturing preribosomal particles. Altogether, these approaches when combined with traditional analytical biochemistry, targeted proteomics and structural methodologies, will contribute to the dissection of the assembly and intracellular transport of preribosomal subunits, as well as other macromolecular assemblies that influence diverse biological pathways. PMID:24857742

  3. The cellular robustness by genetic redundancy in budding yeast.

    Directory of Open Access Journals (Sweden)

    Jingjing Li

    2010-11-01

    Full Text Available The frequent dispensability of duplicated genes in budding yeast is heralded as a hallmark of genetic robustness contributed by genetic redundancy. However, theoretical predictions suggest such backup by redundancy is evolutionarily unstable, and the extent of genetic robustness contributed from redundancy remains controversial. It is anticipated that, to achieve mutual buffering, the duplicated paralogs must at least share some functional overlap. However, counter-intuitively, several recent studies reported little functional redundancy between these buffering duplicates. The large yeast genetic interactions released recently allowed us to address these issues on a genome-wide scale. We herein characterized the synthetic genetic interactions for ∼500 pairs of yeast duplicated genes originated from either whole-genome duplication (WGD or small-scale duplication (SSD events. We established that functional redundancy between duplicates is a pre-requisite and thus is highly predictive of their backup capacity. This observation was particularly pronounced with the use of a newly introduced metric in scoring functional overlap between paralogs on the basis of gene ontology annotations. Even though mutual buffering was observed to be prevalent among duplicated genes, we showed that the observed backup capacity is largely an evolutionarily transient state. The loss of backup capacity generally follows a neutral mode, with the buffering strength decreasing in proportion to divergence time, and the vast majority of the paralogs have already lost their backup capacity. These observations validated previous theoretic predictions about instability of genetic redundancy. However, departing from the general neutral mode, intriguingly, our analysis revealed the presence of natural selection in stabilizing functional overlap between SSD pairs. These selected pairs, both WGD and SSD, tend to have decelerated functional evolution, have higher propensities of co

  4. Integrative analysis of cell cycle control in budding yeast.

    Science.gov (United States)

    Chen, Katherine C; Calzone, Laurence; Csikasz-Nagy, Attila; Cross, Frederick R; Novak, Bela; Tyson, John J

    2004-08-01

    The adaptive responses of a living cell to internal and external signals are controlled by networks of proteins whose interactions are so complex that the functional integration of the network cannot be comprehended by intuitive reasoning alone. Mathematical modeling, based on biochemical rate equations, provides a rigorous and reliable tool for unraveling the complexities of molecular regulatory networks. The budding yeast cell cycle is a challenging test case for this approach, because the control system is known in exquisite detail and its function is constrained by the phenotypic properties of >100 genetically engineered strains. We show that a mathematical model built on a consensus picture of this control system is largely successful in explaining the phenotypes of mutants described so far. A few inconsistencies between the model and experiments indicate aspects of the mechanism that require revision. In addition, the model allows one to frame and critique hypotheses about how the division cycle is regulated in wild-type and mutant cells, to predict the phenotypes of new mutant combinations, and to estimate the effective values of biochemical rate constants that are difficult to measure directly in vivo. PMID:15169868

  5. Timing robustness in the budding and fission yeast cell cycles.

    KAUST Repository

    Mangla, Karan

    2010-02-01

    Robustness of biological models has emerged as an important principle in systems biology. Many past analyses of Boolean models update all pending changes in signals simultaneously (i.e., synchronously), making it impossible to consider robustness to variations in timing that result from noise and different environmental conditions. We checked previously published mathematical models of the cell cycles of budding and fission yeast for robustness to timing variations by constructing Boolean models and analyzing them using model-checking software for the property of speed independence. Surprisingly, the models are nearly, but not totally, speed-independent. In some cases, examination of timing problems discovered in the analysis exposes apparent inaccuracies in the model. Biologically justified revisions to the model eliminate the timing problems. Furthermore, in silico random mutations in the regulatory interactions of a speed-independent Boolean model are shown to be unlikely to preserve speed independence, even in models that are otherwise functional, providing evidence for selection pressure to maintain timing robustness. Multiple cell cycle models exhibit strong robustness to timing variation, apparently due to evolutionary pressure. Thus, timing robustness can be a basis for generating testable hypotheses and can focus attention on aspects of a model that may need refinement.

  6. 5'-end sequences of budding yeast full-length cDNA clones and quality scores - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Budding yeast cDNA sequencing project 5'-end sequences of budding yeast full-length cDNA clones and quality ...scores Data detail Data name 5'-end sequences of budding yeast full-length cDNA clones and quality scores De...from the budding yeast full-length cDNA library by the vector-capping method, the sequence quality score gen...s accession only. Sequence 5'-end sequence data of budding yeast full-length cDNA clones. FASTA format. Quality Phred's quality... Update History of This Database Site Policy | Contact Us 5'-end sequences of budding yeast full-length cDNA clones and quality

  7. Specific residues of the GDP/GTP exchange factor Bud5p are involved in establishment of the cell type-specific budding pattern in yeast.

    Science.gov (United States)

    Kang, Pil Jung; Lee, Bongyong; Park, Hay-Oak

    2004-07-01

    Cells of the budding yeast undergo oriented cell division by choosing a specific site for growth depending on their cell type. Haploid a and alpha cells bud in an axial pattern whereas diploid a/alpha cells bud in a bipolar pattern. The Ras-like GTPase Rsr1p/Bud1p, its GDP-GTP exchange factor Bud5p, and its GTPase-activating protein Bud2p are essential for selecting the proper site for polarized growth in all cell types. Here we showed that specific residues at the N terminus and the C terminus of Bud5p were important for bipolar budding, while some residues were involved in both axial and bipolar budding. These bipolar-specific mutations of BUD5 disrupted proper localization of Bud5p in diploid a/alpha cells without affecting Bud5p localization in haploid alpha cells. In contrast, Bud5p expressed in the bud5 mutants defective in both budding patterns failed to localize in all cell types. Thus, these results identify specific residues of Bud5p that are likely to be involved in direct interaction with spatial landmarks, which recruit Bud5p to the proper bud site. Finally, we found a new start codon of BUD5, which extends the open reading frame to 210 bp upstream of the previously estimated start site, thus encoding a polypeptide of 608 amino acid residues. Bud5p with these additional N-terminal residues interacted with Bud8p, a potential bipolar landmark, suggesting that the N-terminal region is necessary for recognition of the spatial cues. PMID:15136576

  8. Chemical Genetics: Budding Yeast as a Platform for Drug Discovery and Mapping of Genetic Pathways

    Directory of Open Access Journals (Sweden)

    Jorrit M. Enserink

    2012-08-01

    Full Text Available The budding yeast Saccharomyces cerevisiae is a widely used model organism, and yeast genetic methods are powerful tools for discovery of novel functions of genes. Recent advancements in chemical-genetics and chemical-genomics have opened new avenues for development of clinically relevant drug treatments. Systematic mapping of genetic networks by high-throughput chemical-genetic screens have given extensive insight in connections between genetic pathways. Here, I review some of the recent developments in chemical-genetic techniques in budding yeast.

  9. Whole lifespan microscopic observation of budding yeast aging through a microfluidic dissection platform

    OpenAIRE

    Lee, Sung Sik; Avalos Vizcarra, Ima; Huberts, Daphne H. E. W.; Lee, Luke P; Heinemann, Matthias

    2012-01-01

    Important insights into aging have been generated with the genetically tractable and short-lived budding yeast. However, it is still impossible today to continuously track cells by high-resolution microscopic imaging (e.g., fluorescent imaging) throughout their entire lifespan. Instead, the field still needs to rely on a 50-y-old laborious and time-consuming method to assess the lifespan of yeast cells and to isolate differentially aged cells for microscopic snapshots via manual dissection of...

  10. CENP-A exceeds microtubule attachment sites in centromere clusters of both budding and fission yeast

    OpenAIRE

    Coffman, Valerie C.; Wu, Pengcheng; Parthun, Mark R.; Wu, Jian-Qiu

    2011-01-01

    The stoichiometries of kinetochores and their constituent proteins in yeast and vertebrate cells were determined using the histone H3 variant CENP-A, known as Cse4 in budding yeast, as a counting standard. One Cse4-containing nucleosome exists in the centromere (CEN) of each chromosome, so it has been assumed that each anaphase CEN/kinetochore cluster contains 32 Cse4 molecules. We report that anaphase CEN clusters instead contained approximately fourfold more Cse4 in Saccharomyces cerevisiae...

  11. Study of budding yeast colony formation and its characterizations by using circular granular cell

    Science.gov (United States)

    Aprianti, D.; Haryanto, F.; Purqon, A.; Khotimah, S. N.; Viridi, S.

    2016-03-01

    Budding yeast can exhibit colony formation in solid substrate. The colony of pathogenic budding yeast can colonize various surfaces of the human body and medical devices. Furthermore, it can form biofilm that resists drug effective therapy. The formation of the colony is affected by the interaction between cells and with its growth media. The cell budding pattern holds an important role in colony expansion. To study this colony growth, the molecular dynamic method was chosen to simulate the interaction between budding yeast cells. Every cell was modelled by circular granular cells, which can grow and produce buds. Cohesion force, contact force, and Stokes force govern this model to mimic the interaction between cells and with the growth substrate. Characterization was determined by the maximum (L max) and minimum (L min) distances between two cells within the colony and whether two lines that connect the two cells in the maximum and minimum distances intersect each other. Therefore, it can be recognized the colony shape in circular, oval, and irregular shapes. Simulation resulted that colony formation are mostly in oval shape with little branch. It also shows that greater cohesion strength obtains more compact colony formation.

  12. Whole lifespan microscopic observation of budding yeast aging through a microfluidic dissection platform

    NARCIS (Netherlands)

    Lee, Sung Sik; Avalos Vizcarra, Ima; Huberts, Daphne H E W; Lee, Luke P; Heinemann, Matthias

    2012-01-01

    Important insights into aging have been generated with the genetically tractable and short-lived budding yeast. However, it is still impossible today to continuously track cells by high-resolution microscopic imaging (e.g., fluorescent imaging) throughout their entire lifespan. Instead, the field st

  13. Continuous High-resolution Microscopic Observation of Replicative Aging in Budding Yeast

    NARCIS (Netherlands)

    Huberts, Daphne H. E. W.; Janssens, Georges E.; Lee, Sung Sik; Vizcarra, Ima Avalos; Heinemann, Matthias

    2013-01-01

    We demonstrate the use of a simple microfluidic setup, in which single budding yeast cells can be tracked throughout their entire lifespan. The microfluidic chip exploits the size difference between mother and daughter cells using an array of micropads. Upon loading, cells are trapped underneath the

  14. Budding yeast PAK kinases regulate mitotic exit by two different mechanisms

    OpenAIRE

    Chiroli, Elena; Fraschini, Roberta; Beretta, Alessia; Tonelli, Mariagrazia; Lucchini, Giovanna; Piatti, Simonetta

    2003-01-01

    We report the characterization of the dominant-negative CLA4t allele of the budding yeast CLA4 gene, encoding a member of the p21-activated kinase (PAK) family of protein kinases, which, together with its homologue STE20, plays an essential role in promoting budding and cytokinesis. Overproduction of the Cla4t protein likely inhibits both endogenous Cla4 and Ste20 and causes a delay in the onset of anaphase that correlates with inactivation of Cdc20/anaphase-promoting complex (APC)–dependent ...

  15. Proliferation enhancement of budding yeast and mammalian cells with periodic oxygen radical treatment

    Science.gov (United States)

    Mori, Yosuke; Kobayashi, Jun; Murata, Tomiyasu; Hahizume, Hiroshi; Hori, Masaru; Ito, Masafumi

    2015-09-01

    Recently, nonequilibrium atmospheric-pressure plasmas have been intensively studied for biological applications. However, the each effect of species in plasmas to biological tissue has not been clarified yet because various factors exist in the plasmas. Accordingly, we have studied effects of atomic oxygen dose on cell growth such as budding yeast and mouse NIH3T3 fibroblasts of mammalian cells. Both of cells were suspended with PBS, and treated using oxygen radical source. In order to prevent the radicals from reacting with the ambient air, the treatment region was surrounded by a plastic cover and purged with Ar. The proliferative effect of 15 % was observed at the O3Pj dose of around 1 . 0 ×1017 cm-3 in NIH3T3 cells as well as in yeast cells. Moreover, periodic oxygen treatment enhanced the effect in budding yeast cells. The best interval of periodic oxygen radical treatment was around 2 hours, which is almost the same period as that of their cell cycle. With the optimum interval time, we have investigated the effect of the number of the treatments. As the number of treatments increases, the growth rate of budding yeast cells was gradually enhanced and saturated at thrice treatments. This work was partly supported by JSPS KAKENHI Grant Numbers 26286072 and project for promoting Research Center in Meijo University.

  16. Force Generation by Endocytic Actin Patches in Budding Yeast

    OpenAIRE

    Carlsson, Anders E.; Bayly, Philip V.

    2014-01-01

    Membrane deformation during endocytosis in yeast is driven by local, templated assembly of a sequence of proteins including polymerized actin and curvature-generating coat proteins such as clathrin. Actin polymerization is required for successful endocytosis, but it is not known by what mechanisms actin polymerization generates the required pulling forces. To address this issue, we develop a simulation method in which the actin network at the protein patch is modeled as an active gel. The def...

  17. Clathrin-mediated endocytosis in budding yeast at a glance.

    Science.gov (United States)

    Lu, Rebecca; Drubin, David G; Sun, Yidi

    2016-04-15

    Clathrin-mediated endocytosis is an essential cellular process that involves the concerted assembly and disassembly of many different proteins at the plasma membrane. In yeast, live-cell imaging has shown that the spatiotemporal dynamics of these proteins is highly stereotypical. Recent work has focused on determining how the timing and functions of endocytic proteins are regulated. In this Cell Science at a Glance article and accompanying poster, we review our current knowledge of the timeline of endocytic site maturation and discuss recent works focusing on how phosphorylation, ubiquitylation and lipids regulate various aspects of the process. PMID:27084361

  18. The conserved protein kinase Ipl1 regulates microtubule binding to kinetochores in budding yeast

    OpenAIRE

    Biggins, Sue; Fedor F. Severin; Bhalla, Needhi; Sassoon, Ingrid; Hyman, Anthony A.; Murray, Andrew W.

    1999-01-01

    Chromosome segregation depends on kinetochores, the structures that mediate chromosome attachment to the mitotic spindle. We isolated mutants in IPL1, which encodes a protein kinase, in a screen for budding yeast mutants that have defects in sister chromatid separation and segregation. Cytological tests show that ipl1 mutants can separate sister chromatids but are defective in chromosome segregation. Kinetochores assembled in extracts from ipl1 mutants show altered binding to microtubules. Ip...

  19. The budding yeast Ipl1/Aurora protein kinase regulates mitotic spindle disassembly

    OpenAIRE

    Buvelot, Stéphanie; Tatsutani, Sean Y.; Vermaak, Danielle; Biggins, Sue

    2003-01-01

    Ipl1p is the budding yeast member of the Aurora family of protein kinases, critical regulators of genomic stability that are required for chromosome segregation, the spindle checkpoint, and cytokinesis. Using time-lapse microscopy, we found that Ipl1p also has a function in mitotic spindle disassembly that is separable from its previously identified roles. Ipl1–GFP localizes to kinetochores from G1 to metaphase, transfers to the spindle after metaphase, and accumulates at the spindle midzone ...

  20. Biophysical Characterization of the Centromere-specific Nucleosome from Budding Yeast*

    OpenAIRE

    Kingston, Isabel J.; Yung, Jasmine S. Y.; Singleton, Martin R

    2010-01-01

    The centromeric DNA of all eukaryotes is assembled upon a specialized nucleosome containing a histone H3 variant known as CenH3. Despite the importance and conserved nature of this protein, the characteristics of the centromeric nucleosome are still poorly understood. In particular, the stoichiometry and DNA-binding properties of the CenH3 nucleosome have been the subject of some debate. We have characterized the budding yeast centromeric nucleosome by biochemical and biophysical methods and ...

  1. Cse4 is Part of an Octameric Nucleosome in Budding Yeast

    OpenAIRE

    Camahort, Raymond; Shivaraju, Manjunatha; Mattingly, Mark; Li, Bing; Nakanishi, Shima; Zhu, Dongxiao; Shilatifard, Ali; Workman, Jerry L.; Gerton, Jennifer L.

    2009-01-01

    The budding yeast CenH3 histone variant Cse4 localizes to centromeric nucleosomes and is required for kinetochore assembly and chromosome segregation. The exact composition of centromeric Cse4–containing nucleosomes is a subject of debate. ChIP-chip experiments and high resolution quantitative PCR confirm that there is a single Cse4 nucleosome at each centromere, and additional regions of the genome contain Cse4 nucleosomes at low levels. Using unbiased biochemical, cell biological, and genet...

  2. Screening the Budding Yeast Genome Reveals Unique Factors Affecting K2 Toxin Susceptibility

    OpenAIRE

    Elena Servienė; Juliana Lukša; Irma Orentaitė; Lafontaine, Denis L. J.; Jaunius Urbonavičius

    2012-01-01

    BACKGROUND: Understanding how biotoxins kill cells is of prime importance in biomedicine and the food industry. The budding yeast (S. cerevisiae) killers serve as a convenient model to study the activity of biotoxins consistently supplying with significant insights into the basic mechanisms of virus-host cell interactions and toxin entry into eukaryotic target cells. K1 and K2 toxins are active at the cell wall, leading to the disruption of the plasma membrane and subsequent cell death by ion...

  3. cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Budding yeast cDNA sequencing project cDNA sequence quality data Data detail Data name cDNA sequence quality... data Description of data contents Phred's quality score. PHD format, one file to a single cDNA data, and co...ription Download License Update History of This Database Site Policy | Contact Us cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive ...

  4. The Malleable Nature of the Budding Yeast Nuclear Envelope: Flares, Fusion, and Fenestrations.

    Science.gov (United States)

    Meseroll, Rebecca A; Cohen-Fix, Orna

    2016-11-01

    In eukaryotes, the nuclear envelope (NE) physically separates nuclear components and activities from rest of the cell. The NE also provides rigidity to the nucleus and contributes to chromosome organization. At the same time, the NE is highly dynamic; it must change shape and rearrange its components during development and throughout the cell cycle, and its morphology can be altered in response to mutation and disease. Here we focus on the NE of budding yeast, Saccharomyces cerevisiae, which has several unique features: it remains intact throughout the cell cycle, expands symmetrically during interphase, elongates during mitosis and, expands asymmetrically during mitotic delay. Moreover, its NE is safely breached during mating and when large structures, such as nuclear pore complexes and the spindle pole body, are embedded into its double membrane. The budding yeast NE lacks lamins and yet the nucleus is capable of maintaining a spherical shape throughout interphase. Despite these eccentricities, studies of the budding yeast NE have uncovered interesting, and likely conserved, processes that contribute to NE dynamics. In particular, we discuss the processes that drive and enable NE expansion and the dramatic changes in the NE that lead to extensions and fenestrations. J. Cell. Physiol. 231: 2353-2360, 2016. Published 2016. This article is a U.S. Government work and is in the public domain in the USA. PMID:26909870

  5. Relationship between sensitivity to ultraviolet light and budding in yeast cells of different culture ages

    International Nuclear Information System (INIS)

    Subpopulations of yeast cells, consisting of cells of different sizes and different percentages of budding cells, were prepared by centrifugation through sucrose solutions with linear density gradients of cultures at different phases of the growth cycle. Ultraviolet survival of these cells was determined by colony counting, and the survival rate was compared with the cells' respiratory rates. Individual budding cells and interdivisional cells, and also mother cells and daughter cells derived from irradiated budding cells, were isolated by the micromanipulation technique. The number of divisions in each cell was measured during a 21-hr incubation period immediately after irradiation. In the population in the logarithmic phase consisting of homogeneous cells of middle size, no difference in uv sensitivity was observed between mother cells and daughter cells, irrespective of mutual adhesion. Budding cell resistance was observed in the population in the transitional phase; this was due to the lesser uv sensitivity of daughter cells in the fresh medium. In the stationary phase, daughter cells were rather more sensitive than mother cells or interdivisional cells, so there was little difference in uv sensitivity between budding cells and interdivisional cells

  6. Screening the budding yeast genome reveals unique factors affecting K2 toxin susceptibility.

    Directory of Open Access Journals (Sweden)

    Elena Servienė

    Full Text Available BACKGROUND: Understanding how biotoxins kill cells is of prime importance in biomedicine and the food industry. The budding yeast (S. cerevisiae killers serve as a convenient model to study the activity of biotoxins consistently supplying with significant insights into the basic mechanisms of virus-host cell interactions and toxin entry into eukaryotic target cells. K1 and K2 toxins are active at the cell wall, leading to the disruption of the plasma membrane and subsequent cell death by ion leakage. K28 toxin is active in the cell nucleus, blocking DNA synthesis and cell cycle progression, thereby triggering apoptosis. Genome-wide screens in the budding yeast S. cerevisiae identified several hundred effectors of K1 and K28 toxins. Surprisingly, no such screen had been performed for K2 toxin, the most frequent killer toxin among industrial budding yeasts. PRINCIPAL FINDINGS: We conducted several concurrent genome-wide screens in S. cerevisiae and identified 332 novel K2 toxin effectors. The effectors involved in K2 resistance and hypersensitivity largely map in distinct cellular pathways, including cell wall and plasma membrane structure/biogenesis and mitochondrial function for K2 resistance, and cell wall stress signaling and ion/pH homeostasis for K2 hypersensitivity. 70% of K2 effectors are different from those involved in K1 or K28 susceptibility. SIGNIFICANCE: Our work demonstrates that despite the fact that K1 and K2 toxins share some aspects of their killing strategies, they largely rely on different sets of effectors. Since the vast majority of the host factors identified here is exclusively active towards K2, we conclude that cells have acquired a specific K2 toxin effectors set. Our work thus indicates that K1 and K2 have elaborated different biological pathways and provides a first step towards the detailed characterization of K2 mode of action.

  7. The centromeric nucleosome of budding yeast is perfectly positioned and covers the entire centromere

    OpenAIRE

    Cole, Hope A.; Howard, Bruce H.; David J Clark

    2011-01-01

    The centromeres of budding yeast are ∼120 bp in size and contain three functional elements: an AT-rich region flanked by binding sites for Cbf1 and CBF3. A specialized nucleosome containing the H3 variant Cse4 (CenH3) is formed at the centromere. Our genome-wide paired-end sequencing of nucleosomal DNA reveals that the centromeric nucleosome contains a micrococcal nuclease-resistant kernel of 123–135 bp, depending on the centromere, and is therefore significantly shorter than the canonical nu...

  8. CENP-A exceeds microtubule attachment sites in centromere clusters of both budding and fission yeast.

    Science.gov (United States)

    Coffman, Valerie C; Wu, Pengcheng; Parthun, Mark R; Wu, Jian-Qiu

    2011-11-14

    The stoichiometries of kinetochores and their constituent proteins in yeast and vertebrate cells were determined using the histone H3 variant CENP-A, known as Cse4 in budding yeast, as a counting standard. One Cse4-containing nucleosome exists in the centromere (CEN) of each chromosome, so it has been assumed that each anaphase CEN/kinetochore cluster contains 32 Cse4 molecules. We report that anaphase CEN clusters instead contained approximately fourfold more Cse4 in Saccharomyces cerevisiae and ~40-fold more CENP-A (Cnp1) in Schizosaccharomyces pombe than predicted. These results suggest that the number of CENP-A molecules exceeds the number of kinetochore-microtubule (MT) attachment sites on each chromosome and that CENP-A is not the sole determinant of kinetochore assembly sites in either yeast. In addition, we show that fission yeast has enough Dam1-DASH complex for ring formation around attached MTs. The results of this study suggest the need for significant revision of existing CEN/kinetochore architectural models. PMID:22084306

  9. Astral microtubule pivoting promotes their search for cortical anchor sites during mitosis in budding yeast.

    Directory of Open Access Journals (Sweden)

    Stephan Baumgärtner

    Full Text Available Positioning of the mitotic spindle is crucial for proper cell division. In the budding yeast Saccharomyces cerevisiae, two mechanisms contribute to spindle positioning. In the Kar9 pathway, astral microtubules emanating from the daughter-bound spindle pole body interact via the linker protein Kar9 with the myosin Myo2, which moves the microtubule along the actin cables towards the neck. In the dynein pathway, astral microtubules off-load dynein onto the cortical anchor protein Num1, which is followed by dynein pulling on the spindle. Yet, the mechanism by which microtubules target cortical anchor sites is unknown. Here we quantify the pivoting motion of astral microtubules around the spindle pole bodies, which occurs during spindle translocation towards the neck and through the neck. We show that this pivoting is largely driven by the Kar9 pathway. The microtubules emanating from the daughter-bound spindle pole body pivot faster than those at the mother-bound spindle pole body. The Kar9 pathway reduces the time needed for an astral microtubule inside the daughter cell to start pulling on the spindle. Thus, we propose a new role for microtubule pivoting: By pivoting around the spindle pole body, microtubules explore the space laterally, which helps them search for cortical anchor sites in the context of spindle positioning in budding yeast.

  10. Divergence of a conserved elongation factor and transcription regulation in budding and fission yeast.

    Science.gov (United States)

    Booth, Gregory T; Wang, Isabel X; Cheung, Vivian G; Lis, John T

    2016-06-01

    Complex regulation of gene expression in mammals has evolved from simpler eukaryotic systems, yet the mechanistic features of this evolution remain elusive. Here, we compared the transcriptional landscapes of the distantly related budding and fission yeast. We adapted the Precision Run-On sequencing (PRO-seq) approach to map the positions of RNA polymerase active sites genome-wide in Schizosaccharomyces pombe and Saccharomyces cerevisiae. Additionally, we mapped preferred sites of transcription initiation in each organism using PRO-cap. Unexpectedly, we identify a pause in early elongation, specific to S. pombe, that requires the conserved elongation factor subunit Spt4 and resembles promoter-proximal pausing in metazoans. PRO-seq profiles in strains lacking Spt4 reveal globally elevated levels of transcribing RNA Polymerase II (Pol II) within genes in both species. Messenger RNA abundance, however, does not reflect the increases in Pol II density, indicating a global reduction in elongation rate. Together, our results provide the first base-pair resolution map of transcription elongation in S. pombe and identify divergent roles for Spt4 in controlling elongation in budding and fission yeast. PMID:27197211

  11. Ingression Progression Complexes Control Extracellular Matrix Remodelling during Cytokinesis in Budding Yeast

    Science.gov (United States)

    Foltman, Magdalena; Molist, Iago; Arcones, Irene; Sacristan, Carlos; Filali-Mouncef, Yasmina; Roncero, Cesar; Sanchez-Diaz, Alberto

    2016-01-01

    Eukaryotic cells must coordinate contraction of the actomyosin ring at the division site together with ingression of the plasma membrane and remodelling of the extracellular matrix (ECM) to support cytokinesis, but the underlying mechanisms are still poorly understood. In eukaryotes, glycosyltransferases that synthesise ECM polysaccharides are emerging as key factors during cytokinesis. The budding yeast chitin synthase Chs2 makes the primary septum, a special layer of the ECM, which is an essential process during cell division. Here we isolated a group of actomyosin ring components that form complexes together with Chs2 at the cleavage site at the end of the cell cycle, which we named ‘ingression progression complexes’ (IPCs). In addition to type II myosin, the IQGAP protein Iqg1 and Chs2, IPCs contain the F-BAR protein Hof1, and the cytokinesis regulators Inn1 and Cyk3. We describe the molecular mechanism by which chitin synthase is activated by direct association of the C2 domain of Inn1, and the transglutaminase-like domain of Cyk3, with the catalytic domain of Chs2. We used an experimental system to find a previously unanticipated role for the C-terminus of Inn1 in preventing the untimely activation of Chs2 at the cleavage site until Cyk3 releases the block on Chs2 activity during late mitosis. These findings support a model for the co-ordinated regulation of cell division in budding yeast, in which IPCs play a central role. PMID:26891268

  12. Requirements for Recruitment of a G Protein-coupled Receptor to Clathrin-coated Pits in Budding Yeast

    OpenAIRE

    Toshima, Junko Y.; Nakanishi, Jun-ichi; Mizuno, Kensaku; Toshima, Jiro; Drubin, David G.

    2009-01-01

    Endocytic internalization of G protein-coupled receptors (GPCRs) plays a critical role in down-regulation of GPCR signaling. The yeast mating pheromone receptor Ste2p has been used as a model to investigate mechanisms of signal transduction, modification, and endocytic internalization of GPCRs. We previously used a fluorescently labeled mating pheromone derivative to reveal unappreciated molecular and spatiotemporal features of GPCR endocytosis in budding yeast. Here, we identify recruitment ...

  13. Mitochondrial quality control during inheritance is associated with lifespan and mother-daughter age asymmetry in budding yeast

    OpenAIRE

    McFaline-Figueroa, José Ricardo; Vevea, Jason; Swayne, Theresa C.; Zhou, Chun; Liu, Christopher; Leung, Galen; Boldogh, Istvan R.; Pon, Liza A.

    2011-01-01

    Fluorescence loss in photobleaching experiments and analysis of mitochondrial function using superoxide and redox potential biosensors revealed that mitochondria within individual yeast cells are physically and functionally distinct. Mitochondria that are retained in mother cells during yeast cell division have significantly lower redox potential and higher superoxide levels compared to mitochondria in buds. Retention of mitochondria with lower redox potential in mother cells occurs to the sa...

  14. Update History of This Database - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ...Budding yeast cDNA sequencing project Update History of This Database Date Update contents 2010/03/29 Buddin...tio About This Database Database Description Download License Update History of This Database Site Policy | Contact Us Update History

  15. Development of automatic image analysis algorithms for protein localization studies in budding yeast

    Science.gov (United States)

    Logg, Katarina; Kvarnström, Mats; Diez, Alfredo; Bodvard, Kristofer; Käll, Mikael

    2007-02-01

    Microscopy of fluorescently labeled proteins has become a standard technique for live cell imaging. However, it is still a challenge to systematically extract quantitative data from large sets of images in an unbiased fashion, which is particularly important in high-throughput or time-lapse studies. Here we describe the development of a software package aimed at automatic quantification of abundance and spatio-temporal dynamics of fluorescently tagged proteins in vivo in the budding yeast Saccharomyces cerevisiae, one of the most important model organisms in proteomics. The image analysis methodology is based on first identifying cell contours from bright field images, and then use this information to measure and statistically analyse protein abundance in specific cellular domains from the corresponding fluorescence images. The applicability of the procedure is exemplified for two nuclear localized GFP-tagged proteins, Mcm4p and Nrm1p.

  16. Daughter-specific transcription factors regulate cell size control in budding yeast.

    Directory of Open Access Journals (Sweden)

    Stefano Di Talia

    2009-10-01

    Full Text Available In budding yeast, asymmetric cell division yields a larger mother and a smaller daughter cell, which transcribe different genes due to the daughter-specific transcription factors Ace2 and Ash1. Cell size control at the Start checkpoint has long been considered to be a main regulator of the length of the G1 phase of the cell cycle, resulting in longer G1 in the smaller daughter cells. Our recent data confirmed this concept using quantitative time-lapse microscopy. However, it has been proposed that daughter-specific, Ace2-dependent repression of expression of the G1 cyclin CLN3 had a dominant role in delaying daughters in G1. We wanted to reconcile these two divergent perspectives on the origin of long daughter G1 times. We quantified size control using single-cell time-lapse imaging of fluorescently labeled budding yeast, in the presence or absence of the daughter-specific transcriptional regulators Ace2 and Ash1. Ace2 and Ash1 are not required for efficient size control, but they shift the domain of efficient size control to larger cell size, thus increasing cell size requirement for Start in daughters. Microarray and chromatin immunoprecipitation experiments show that Ace2 and Ash1 are direct transcriptional regulators of the G1 cyclin gene CLN3. Quantification of cell size control in cells expressing titrated levels of Cln3 from ectopic promoters, and from cells with mutated Ace2 and Ash1 sites in the CLN3 promoter, showed that regulation of CLN3 expression by Ace2 and Ash1 can account for the differential regulation of Start in response to cell size in mothers and daughters. We show how daughter-specific transcriptional programs can interact with intrinsic cell size control to differentially regulate Start in mother and daughter cells. This work demonstrates mechanistically how asymmetric localization of cell fate determinants results in cell-type-specific regulation of the cell cycle.

  17. Ndc10 is a platform for inner kinetochore assembly in budding yeast

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Uhn-Soo; Harrison, Stephen C. (Harvard-Med)

    2012-01-10

    Kinetochores link centromeric DNA to spindle microtubules and ensure faithful chromosome segregation during mitosis. In point-centromere yeasts, the CBF3 complex Skp1-Ctf13-(Cep3){sub 2}-(Ndc10){sub 2} recognizes a conserved centromeric DNA element through contacts made by Cep3 and Ndc10. We describe here the five-domain organization of Kluyveromyces lactis Ndc10 and the structure at 2.8 {angstrom} resolution of domains I-II (residues 1-402) bound to DNA. The structure resembles tyrosine DNA recombinases, although it lacks both endonuclease and ligase activities. Structural and biochemical data demonstrate that each subunit of the Ndc10 dimer binds a separate fragment of DNA, suggesting that Ndc10 stabilizes a DNA loop at the centromere. We describe in vitro association experiments showing that specific domains of Ndc10 interact with each of the known inner-kinetochore proteins or protein complexes in budding yeast. We propose that Ndc10 provides a central platform for inner-kinetochore assembly.

  18. Maintenance of cellular ATP level by caloric restriction correlates chronological survival of budding yeast

    International Nuclear Information System (INIS)

    Highlights: •CR decreases total ROS and mitochondrial superoxide during the chronological aging. •CR does not affect the levels of oxidative damage on protein and DNA. •CR contributes extension of chronological lifespan by maintenance of ATP level -- Abstract: The free radical theory of aging emphasizes cumulative oxidative damage in the genome and intracellular proteins due to reactive oxygen species (ROS), which is a major cause for aging. Caloric restriction (CR) has been known as a representative treatment that prevents aging; however, its mechanism of action remains elusive. Here, we show that CR extends the chronological lifespan (CLS) of budding yeast by maintaining cellular energy levels. CR reduced the generation of total ROS and mitochondrial superoxide; however, CR did not reduce the oxidative damage in proteins and DNA. Subsequently, calorie-restricted yeast had higher mitochondrial membrane potential (MMP), and it sustained consistent ATP levels during the process of chronological aging. Our results suggest that CR extends the survival of the chronologically aged cells by improving the efficiency of energy metabolism for the maintenance of the ATP level rather than reducing the global oxidative damage of proteins and DNA

  19. Maintenance of cellular ATP level by caloric restriction correlates chronological survival of budding yeast

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Joon-Seok; Lee, Cheol-Koo, E-mail: cklee2005@korea.ac.kr

    2013-09-13

    Highlights: •CR decreases total ROS and mitochondrial superoxide during the chronological aging. •CR does not affect the levels of oxidative damage on protein and DNA. •CR contributes extension of chronological lifespan by maintenance of ATP level -- Abstract: The free radical theory of aging emphasizes cumulative oxidative damage in the genome and intracellular proteins due to reactive oxygen species (ROS), which is a major cause for aging. Caloric restriction (CR) has been known as a representative treatment that prevents aging; however, its mechanism of action remains elusive. Here, we show that CR extends the chronological lifespan (CLS) of budding yeast by maintaining cellular energy levels. CR reduced the generation of total ROS and mitochondrial superoxide; however, CR did not reduce the oxidative damage in proteins and DNA. Subsequently, calorie-restricted yeast had higher mitochondrial membrane potential (MMP), and it sustained consistent ATP levels during the process of chronological aging. Our results suggest that CR extends the survival of the chronologically aged cells by improving the efficiency of energy metabolism for the maintenance of the ATP level rather than reducing the global oxidative damage of proteins and DNA.

  20. Measurement of the volume growth rate of single budding yeast with the MOSFET-based microfluidic Coulter counter.

    Science.gov (United States)

    Sun, Jiashu; Stowers, Chris C; Boczko, Erik M; Li, Deyu

    2010-11-01

    We report on measurements of the volume growth rate of ten individual budding yeast cells using a recently developed MOSFET-based microfluidic Coulter counter. The MOSFET-based microfluidic Coulter counter is very sensitive, provides signals that are immune from the baseline drift, and can work with cell culture media of complex composition. These desirable features allow us to directly measure the volume growth rate of single cells of Saccharomyces cerevisiae LYH3865 strain budding yeast in YNB culture media over a whole cell cycle. Results indicate that all budding yeast follow a sigmoid volume growth profile with reduced growth rates at the initial stage before the bud emerges and the final stage after the daughter gets mature. Analysis of the data indicates that even though all piecewise linear, Gomperitz, and Hill's function models can fit the global growth profile equally well, the data strongly support local exponential growth phenomenon. Accurate volume growth measurements are important for applications in systems biology where quantitative parameters are required for modeling and simulation. PMID:20717618

  1. Ctf3p, the Mis6 budding yeast homolog, interacts with Mcm22p and Mcm16p at the yeast outer kinetochore.

    Science.gov (United States)

    Measday, Vivien; Hailey, Dale W; Pot, Isabelle; Givan, Scott A; Hyland, Katherine M; Cagney, Gerard; Fields, Stan; Davis, Trisha N; Hieter, Philip

    2002-01-01

    The budding yeast kinetochore is composed of an inner and outer protein complex, which binds to centromere (CEN) DNA and attaches to microtubules. We performed a genetic synthetic dosage lethality screen to identify novel kinetochore proteins in a collection of chromosome transmission fidelity mutants. Our screen identified several new kinetochore-related proteins including YLR381Wp/Ctf3p, which is a member of a conserved family of centromere-binding proteins. Ctf3p interacts with Mcm22p, Mcm16p, and the outer kinetochore protein Ctf19p. We used chromatin immunoprecipitation to demonstrate that Ctf3p, Mcm22p, and Mcm16p bind to CEN DNA in a Ctf19p-dependent manner. In addition, Ctf3p, Mcm22p, and Mcm16p have a localization pattern similar to other kinetochore proteins. The fission yeast Ctf3p homolog, Mis6, is required for loading of a CENP-A centromere specific histone, Cnp1, onto centromere DNA. We find however that Ctf3p is not required for loading of the budding yeast CENP-A homolog, Cse4p, onto CEN DNA. In contrast, Ctf3p and Ctf19p fail to bind properly to the centromere in a cse4-1 mutant strain. We conclude that the requirements for CENP-A loading onto centromere DNA differ in fission versus budding yeast. PMID:11782448

  2. The budding yeast protein kinase Ipl1/Aurora allows the absence of tension to activate the spindle checkpoint

    OpenAIRE

    Biggins, Sue; Murray, Andrew W.

    2001-01-01

    The spindle checkpoint prevents cell cycle progression in cells that have mitotic spindle defects. Although several spindle defects activate the spindle checkpoint, the exact nature of the primary signal is unknown. We have found that the budding yeast member of the Aurora protein kinase family, Ipl1p, is required to maintain a subset of spindle checkpoint arrests. Ipl1p is required to maintain the spindle checkpoint that is induced by overexpression of the protein kinase Mps1. Inactivating I...

  3. The budding yeast protein Chl1p is required to preserve genome integrity upon DNA damage in S-phase

    OpenAIRE

    Laha, Suparna; Das, Shankar Prasad; Hajra, Sujata; Sau, Soumitra; Sinha, Pratima

    2006-01-01

    The budding yeast protein, Chl1p, is required for sister-chromatid cohesion, transcriptional silencing, rDNA recombination and aging. In this work, we show that Chl1p is also required for viability when DNA replication is stressed, either due to mutations or if cells are treated with genotoxic agents like methylmethane sulfonate (MMS) and ultraviolet (UV) rays. The chl1 mutation caused synthetic growth defects with mutations in DNA replication genes. At semi-permissive temperatures, the doubl...

  4. FLO1 Is a Variable Green Beard Gene that Drives Biofilm-like Cooperation in Budding Yeast

    OpenAIRE

    Smukalla, Scott; Caldara, Marina; Pochet, Nathalie; Beauvais, Anne; Guadagnini, Stephanie; Yan, Chen; Vinces, Marcelo; Jansen, An; Prevost, Marie Christine; Latge, Jean-Paul; Fink, Gerald R.; Foster, Kevin R.; Verstrepen, Kevin

    2008-01-01

    The budding yeast, Saccharomyces cerevisiae, has emerged as an archetype of eukaryotic cell biology. Here we show that S. cerevisiae is also a model for the evolution of cooperative behavior by revisiting flocculation, a self-adherence phenotype lacking in most laboratory strains. Expression of the gene FLO1 in the laboratory strain S288C restores flocculation, an altered physiological state, reminiscent of bacterial biofilms. Flocculation protects the FLO1 expressing cells from multiple stre...

  5. Characterization of the minimum domain required for targeting budding yeast myosin II to the site of cell division

    Directory of Open Access Journals (Sweden)

    Tolliday Nicola J

    2006-06-01

    Full Text Available Abstract Background All eukaryotes with the exception of plants use an actomyosin ring to generate a constriction force at the site of cell division (cleavage furrow during mitosis and meiosis. The structure and filament forming abilities located in the C-terminal or tail region of one of the main components, myosin II, are important for localising the molecule to the contractile ring (CR during cytokinesis. However, it remains poorly understood how myosin II is recruited to the site of cell division and how this recruitment relates to myosin filament assembly. Significant conservation between species of the components involved in cytokinesis, including those of the CR, allows the use of easily genetically manipulated organisms, such as budding yeast (Saccharomyces cerevisiae, in the study of cytokinesis. Budding yeast has a single myosin II protein, named Myo1. Unlike most other class II myosins, the tail of Myo1 has an irregular coiled coil. In this report we use molecular genetics, biochemistry and live cell imaging to characterize the minimum localisation domain (MLD of budding yeast Myo1. Results We show that the MLD is a small region in the centre of the tail of Myo1 and that it is both necessary and sufficient for localisation of Myo1 to the yeast bud neck, the pre-determined site of cell division. Hydrodynamic measurements of the MLD, purified from bacteria or yeast, show that it is likely to exist as a trimer. We also examine the importance of a small region of low coiled coil forming probability within the MLD, which we call the hinge region. Removal of the hinge region prevents contraction of the CR. Using fluorescence recovery after photobleaching (FRAP, we show that GFP-tagged MLD is slightly more dynamic than the GFP-tagged full length molecule but less dynamic than the GFP-tagged Myo1 construct lacking the hinge region. Conclusion Our results define the intrinsic determinant for the localization of budding yeast myosin II and show

  6. Ctf3p, the Mis6 budding yeast homolog, interacts with Mcm22p and Mcm16p at the yeast outer kinetochore

    OpenAIRE

    Measday, Vivien; Hailey, Dale W.; Pot, Isabelle; Givan, Scott A.; Hyland, Katherine M.; Cagney, Gerard; Fields, Stan; Davis, Trisha N.; Hieter, Philip

    2002-01-01

    The budding yeast kinetochore is composed of an inner and outer protein complex, which binds to centromere (CEN) DNA and attaches to microtubules. We performed a genetic synthetic dosage lethality screen to identify novel kinetochore proteins in a collection of chromosome transmission fidelity mutants. Our screen identified several new kinetochore-related proteins including YLR381Wp/Ctf3p, which is a member of a conserved family of centromere-binding proteins. Ctf3p interacts with Mcm22p, Mcm...

  7. The nuclear exosome is active and important during budding yeast meiosis.

    Directory of Open Access Journals (Sweden)

    Stephen Frenk

    Full Text Available Nuclear RNA degradation pathways are highly conserved across eukaryotes and play important roles in RNA quality control. Key substrates for exosomal degradation include aberrant functional RNAs and cryptic unstable transcripts (CUTs. It has recently been reported that the nuclear exosome is inactivated during meiosis in budding yeast through degradation of the subunit Rrp6, leading to the stabilisation of a subset of meiotic unannotated transcripts (MUTs of unknown function. We have analysed the activity of the nuclear exosome during meiosis by deletion of TRF4, which encodes a key component of the exosome targeting complex TRAMP. We find that TRAMP mutants produce high levels of CUTs during meiosis that are undetectable in wild-type cells, showing that the nuclear exosome remains functional for CUT degradation, and we further report that the meiotic exosome complex contains Rrp6. Indeed Rrp6 over-expression is insufficient to suppress MUT transcripts, showing that the reduced amount of Rrp6 in meiotic cells does not directly cause MUT accumulation. Lack of TRAMP activity stabilises ∼ 1600 CUTs in meiotic cells, which occupy 40% of the binding capacity of the nuclear cap binding complex (CBC. CBC mutants display defects in the formation of meiotic double strand breaks (DSBs, and we see similar defects in TRAMP mutants, suggesting that a key function of the nuclear exosome is to prevent saturation of the CBC complex by CUTs. Together, our results show that the nuclear exosome remains active in meiosis and has an important role in facilitating meiotic recombination.

  8. Visual screening for localized RNAs in yeast revealed novel RNAs at the bud-tip

    International Nuclear Information System (INIS)

    Several RNAs, including rRNAs, snRNAs, snoRNAs, and some mRNAs, are known to be localized at specific sites in a cell. Although methods have been established to visualize RNAs in a living cell, no large-scale visual screening of localized RNAs has been performed. In this study, we constructed a genomic library in which random genomic fragments were inserted downstream of U1A-tag sequences under a GAL1 promoter. In a living yeast cell, transcribed U1A-tagged RNAs were visualized by U1A-GFP that binds the RNA sequence of the U1A-tag. In this screening, many RNAs showed nuclear signals. Since the nuclear signals of some RNAs were not seen when the U1A-tag was connected to the 3' ends of the RNAs, it is suggested that their nuclear signals correspond to nascent transcripts on GAL1 promoter plasmids. Using this screening method, we successfully identified two novel localized mRNAs, CSR2 and DAL81, which showed bud-tip localization

  9. Dynamic behaviour of the 'Raman spectroscopic signature of life' in a starving budding yeast cell

    International Nuclear Information System (INIS)

    Complete text of publication follows. In vivo molecular-level information is essentially important for understanding the structure, dynamics and functions of living cells. We use Raman microspectroscopy to single living budding yeast cells under a starving condition and study the dynamic behaviour of the 'Raman spectroscopic signature of life' (Y. Naito et al., J. Raman. Spectrosc., 36 (2005) 837-839. and Y-S. Huang et al., Biochemistry, 44 (2005) 10009-10019.) in relation to the formation and disappearance of a 'dancing body' in a vacuole. A focus is placed on the cell death process and the recovery from it. Our previous studies have shown that, under a starving condition, a dancing body appears suddenly in a vacuole and that the 'Raman spectroscopic signature of life' disappears concomitantly indicating the loss of the mitochondrial metabolic activity. This event is followed by gradual deterioration of the cell structure leading to death. This cell death process was visualized at the molecular level by time-resolved Raman imaging. In the present study, we show strong correlations not only between the appearance of a dancing body and the loss of the mitochondrial activity but also between the disappearance of the dancing body and the recovery of the activity. Time- and space-resolved Raman spectra of a single living budding yeast cell were recorded on a confocal Raman microspectrometer with 632.8 nm line of a He-Ne laser for excitation. The laser power at the sample was about 5 mW. The lateral and depth resolutions were about 300 nm with a 100 x oil immersion objective lens (N.A.=1.3) and about 2 μm with a 100 μm pinhole for a confocal detection. Raman spectra were recorded in the wavenumber range 300 - 1800 cm-1 with a spectral resolution of 3 cm-1. The exposure time was 150 sec. Saccharomyces cerevisiae/ Saccharomyces Bayanus hybrid, strain AJL3062 from, was grown at 30 deg C under a stationary cultivation condition in wort medium. The cells dispersed in 1 ml

  10. Novel E3 ubiquitin ligases that regulate histone protein levels in the budding yeast Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Rakesh Kumar Singh

    Full Text Available Core histone proteins are essential for packaging the genomic DNA into chromatin in all eukaryotes. Since multiple genes encode these histone proteins, there is potential for generating more histones than what is required for chromatin assembly. The positively charged histones have a very high affinity for negatively charged molecules such as DNA, and any excess of histone proteins results in deleterious effects on genomic stability and cell viability. Hence, histone levels are known to be tightly regulated via transcriptional, posttranscriptional and posttranslational mechanisms. We have previously elucidated the posttranslational regulation of histone protein levels by the ubiquitin-proteasome pathway involving the E2 ubiquitin conjugating enzymes Ubc4/5 and the HECT (Homologous to E6-AP C-Terminus domain containing E3 ligase Tom1 in the budding yeast. Here we report the identification of four additional E3 ligases containing the RING (Really Interesting New Gene finger domains that are involved in the ubiquitylation and subsequent degradation of excess histones in yeast. These E3 ligases are Pep5, Snt2 as well as two previously uncharacterized Open Reading Frames (ORFs YKR017C and YDR266C that we have named Hel1 and Hel2 (for Histone E3 Ligases respectively. Mutants lacking these E3 ligases are sensitive to histone overexpression as they fail to degrade excess histones and accumulate high levels of endogenous histones on histone chaperones. Co-immunoprecipitation assays showed that these E3 ligases interact with the major E2 enzyme Ubc4 that is involved in the degradation related ubiquitylation of histones. Using mutagenesis we further demonstrate that the RING domains of Hel1, Hel2 and Snt2 are required for histone regulation. Lastly, mutants corresponding to Hel1, Hel2 and Pep5 are sensitive to replication inhibitors. Overall, our results highlight the importance of posttranslational histone regulatory mechanisms that employ multiple E3

  11. The Budding Yeast “Saccharomyces cerevisiae” as a Drug Discovery Tool to Identify Plant-Derived Natural Products with Anti-Proliferative Properties

    Directory of Open Access Journals (Sweden)

    Bouchra Qaddouri

    2011-01-01

    Full Text Available The budding yeast Saccharomyces cerevisiae is a valuable system to study cell-cycle regulation, which is defective in cancer cells. Due to the highly conserved nature of the cell-cycle machinery between yeast and humans, yeast studies are directly relevant to anticancer-drug discovery. The budding yeast is also an excellent model system for identifying and studying antifungal compounds because of the functional conservation of fungal genes. Moreover, yeast studies have also contributed greatly to our understanding of the biological targets and modes of action of bioactive compounds. Understanding the mechanism of action of clinically relevant compounds is essential for the design of improved second-generation molecules. Here we describe our methodology for screening a library of plant-derived natural products in yeast in order to identify and characterize new compounds with anti-proliferative properties.

  12. Genetic control of x-ray resistance in budding yeast cells

    International Nuclear Information System (INIS)

    Five x-ray-sensitive mutants were selected from 10,000 colonies arising from survivors of ultraviolet light. These were named XS5, XS6, XS7, XS8, and XS9. Mutant XS1 was donated by Nakai. These mutations affect the resistant budding cell survival component of the survival curve and, in diploids, the low-dose interdivisional cell shoulder. They are of two types: Class I, in which budding cells lack resistance; and Class II, in which budding cells show reduced resistance. When crossed with one another, they show a complex complementation pattern. Gene dosage effects are seen in XS1 heterozygotes, while budding but not between divisions. No direct correlation between radiation sensitivity, meiosis, and sporulation is observed; genes which influence radiation sensitivity do not affect meiotic recombination. A single mutation (XS1 or XS5) suppresses the shoulders of the survival curves of both budding haploid cells and diploid nonbudding cells

  13. The Histone Fold Domain of Cse4 Is Sufficient for CEN Targeting and Propagation of Active Centromeres in Budding Yeast

    OpenAIRE

    Morey, Lisa; Barnes, Kelly; Chen, Yinhuai; Fitzgerald-Hayes, Molly; Baker, Richard E.

    2004-01-01

    Centromere-specific H3-like proteins (CenH3s) are conserved across the eukaryotic kingdom and are required for packaging centromere DNA into a specialized chromatin structure required for kinetochore assembly. Cse4 is the CenH3 protein of the budding yeast Saccharomyces cerevisiae. Like all CenH3 proteins, Cse4 consists of a conserved histone fold domain (HFD) and a divergent N terminus (NT). The Cse4 NT contains an essential domain designated END (for essential N-terminal domain); deletion o...

  14. Fusion of nearby inverted repeats by a replication-based mechanism leads to formation of dicentric and acentric chromosomes that cause genome instability in budding yeast

    OpenAIRE

    Paek, Andrew L.; Kaochar, Salma; Jones, Hope; Elezaby, Aly; Shanks, Lisa; Weinert, Ted

    2009-01-01

    Large-scale changes (gross chromosomal rearrangements [GCRs]) are common in genomes, and are often associated with pathological disorders. We report here that a specific pair of nearby inverted repeats in budding yeast fuse to form a dicentric chromosome intermediate, which then rearranges to form a translocation and other GCRs. We next show that fusion of nearby inverted repeats is general; we found that many nearby inverted repeats that are present in the yeast genome also fuse, as does a p...

  15. Isolation of a cdc28 mutation that abrogates the dependence of S phase on completion of M phase of the budding yeast cell cycle

    Indian Academy of Sciences (India)

    Santanu Kumar Ghosh; Pratima Sinha

    2000-01-01

    We have isolated a mutation in the budding yeast Saccharomyces cerevisisae CDC28 gene that allows cdc13 cells, carrying damaged DNA, to continue with the cell division cycle. While cdc13 mutant cells are arrested as large-budded cells at the nonpermissive temperature 37°C, the cdc13 cdc28 double mutant culture showed cells with one or more buds, most of which showed apical growth. The additional buds emerged without the intervening steps of nuclear division and cell separation. We suggest that the cdc28 mutation abrogates a checkpoint function and allows cells with damaged or incompletely replicated DNA an entry to another round of cell cycle and bypasses the mitotic phase of the cell cycle.

  16. Stable Pseudohyphal Growth in Budding Yeast Induced by Synergism between Septin Defects and Altered MAP-kinase Signaling.

    Science.gov (United States)

    Kim, Junwon; Rose, Mark D

    2015-12-01

    Upon nutrient limitation, budding yeasts like Saccharomyces cerevisiae can be induced to adopt alternate filament-like growth patterns called diploid pseudohyphal or invasive haploid growth. Here, we report a novel constitutive pseudohyphal growth state, sharing some characteristics with classic forms of filamentous growth, but differing in crucial aspects of morphology, growth conditions and genetic regulation. The constitutive pseudohyphal state is observed in fus3 mutants containing various septin assembly defects, which we refer to as sadF growth (septin assembly defect induced filamentation) to distinguish it from classic filamentation pathways. Similar to other filamentous states, sadF cultures comprise aggregated chains of highly elongated cells. Unlike the classic pathways, sadF growth occurs in liquid rich media, requiring neither starvation nor the key pseudohyphal proteins, Flo8p and Flo11p. Moreover sadF growth occurs in haploid strains of S288C genetic background, which normally cannot undergo pseudohyphal growth. The sadF cells undergo highly polarized bud growth during prolonged G2 delays dependent on Swe1p. They contain septin structures distinct from classical pseudo-hyphae and FM4-64 labeling at actively growing tips similar to the Spitzenkörper observed in true hyphal growth. The sadF growth state is induced by synergism between Kss1p-dependent signaling and septin assembly defects; mild disruption of mitotic septins activates Kss1p-dependent gene expression, which exacerbates the septin defects, leading to hyper-activation of Kss1p. Unlike classical pseudo-hyphal growth, sadF signaling requires Ste5, Ste4 and Ste18, the scaffold protein and G-protein β and γ subunits from the pheromone response pathway, respectively. A swe1 mutation largely abolished signaling, breaking the positive feedback that leads to amplification of sadF signaling. Taken together, our findings show that budding yeast can access a stable constitutive pseudohyphal growth

  17. Stable Pseudohyphal Growth in Budding Yeast Induced by Synergism between Septin Defects and Altered MAP-kinase Signaling.

    Directory of Open Access Journals (Sweden)

    Junwon Kim

    2015-12-01

    Full Text Available Upon nutrient limitation, budding yeasts like Saccharomyces cerevisiae can be induced to adopt alternate filament-like growth patterns called diploid pseudohyphal or invasive haploid growth. Here, we report a novel constitutive pseudohyphal growth state, sharing some characteristics with classic forms of filamentous growth, but differing in crucial aspects of morphology, growth conditions and genetic regulation. The constitutive pseudohyphal state is observed in fus3 mutants containing various septin assembly defects, which we refer to as sadF growth (septin assembly defect induced filamentation to distinguish it from classic filamentation pathways. Similar to other filamentous states, sadF cultures comprise aggregated chains of highly elongated cells. Unlike the classic pathways, sadF growth occurs in liquid rich media, requiring neither starvation nor the key pseudohyphal proteins, Flo8p and Flo11p. Moreover sadF growth occurs in haploid strains of S288C genetic background, which normally cannot undergo pseudohyphal growth. The sadF cells undergo highly polarized bud growth during prolonged G2 delays dependent on Swe1p. They contain septin structures distinct from classical pseudo-hyphae and FM4-64 labeling at actively growing tips similar to the Spitzenkörper observed in true hyphal growth. The sadF growth state is induced by synergism between Kss1p-dependent signaling and septin assembly defects; mild disruption of mitotic septins activates Kss1p-dependent gene expression, which exacerbates the septin defects, leading to hyper-activation of Kss1p. Unlike classical pseudo-hyphal growth, sadF signaling requires Ste5, Ste4 and Ste18, the scaffold protein and G-protein β and γ subunits from the pheromone response pathway, respectively. A swe1 mutation largely abolished signaling, breaking the positive feedback that leads to amplification of sadF signaling. Taken together, our findings show that budding yeast can access a stable constitutive

  18. The glyoxylate shunt is essential for desiccation tolerance in C. elegans and budding yeast.

    Science.gov (United States)

    Erkut, Cihan; Gade, Vamshidhar R; Laxman, Sunil; Kurzchalia, Teymuras V

    2016-01-01

    Many organisms, including species from all kingdoms of life, can survive desiccation by entering a state with no detectable metabolism. To survive, C. elegans dauer larvae and stationary phase S. cerevisiae require elevated amounts of the disaccharide trehalose. We found that dauer larvae and stationary phase yeast switched into a gluconeogenic mode in which metabolism was reoriented toward production of sugars from non-carbohydrate sources. This mode depended on full activity of the glyoxylate shunt (GS), which enables synthesis of trehalose from acetate. The GS was especially critical during preparation of worms for harsh desiccation (preconditioning) and during the entry of yeast into stationary phase. Loss of the GS dramatically decreased desiccation tolerance in both organisms. Our results reveal a novel physiological role for the GS and elucidate a conserved metabolic rewiring that confers desiccation tolerance on organisms as diverse as worm and yeast. PMID:27090086

  19. Molecular analysis of heavy ion induced mutations in the budding yeast

    International Nuclear Information System (INIS)

    This study is intended to elucidate the molecular mechanism of the mutagenesis caused by High-linear energy transfer (LET) ion beam. The frequency of DNA double stranded breaks (DSBs) was estimated by agarose gel electrophoresis. Moreover, the mutation sites of ura3 mutants were determined by DNA sequencing. The yeast cells were irradiated with carbon ions (12C5+; 290 MeV) with the dose 50 to 200 Gy. Carbon ion beam was generated from synchrotron in HIMAC. The carbon ion beams at 100 Gy generate mutations 10.3 - fold more than spontaneous mutation. The mutation frequency increased consistently with LET. This result indicates the high LET ion beam is more mutagenic than low LET ion beam. The remarkable feature of yeast mutations induced by carbon ions was that the mutation sites were localized near the linker regions of nucleosomes, whereas mutations induced by gamma-ray irradiation were located uniformly throughout the gene. (author)

  20. Frequent and efficient use of the sister chromatid for DNA double-strand break repair during budding yeast meiosis.

    Directory of Open Access Journals (Sweden)

    Tamara Goldfarb

    Full Text Available Recombination between homologous chromosomes of different parental origin (homologs is necessary for their accurate segregation during meiosis. It has been suggested that meiotic inter-homolog recombination is promoted by a barrier to inter-sister-chromatid recombination, imposed by meiosis-specific components of the chromosome axis. Consistent with this, measures of Holliday junction-containing recombination intermediates (joint molecules [JMs] show a strong bias towards inter-homolog and against inter-sister JMs. However, recombination between sister chromatids also has an important role in meiosis. The genomes of diploid organisms in natural populations are highly polymorphic for insertions and deletions, and meiotic double-strand breaks (DSBs that form within such polymorphic regions must be repaired by inter-sister recombination. Efforts to study inter-sister recombination during meiosis, in particular to determine recombination frequencies and mechanisms, have been constrained by the inability to monitor the products of inter-sister recombination. We present here molecular-level studies of inter-sister recombination during budding yeast meiosis. We examined events initiated by DSBs in regions that lack corresponding sequences on the homolog, and show that these DSBs are efficiently repaired by inter-sister recombination. This occurs with the same timing as inter-homolog recombination, but with reduced (2- to 3-fold yields of JMs. Loss of the meiotic-chromosome-axis-associated kinase Mek1 accelerates inter-sister DSB repair and markedly increases inter-sister JM frequencies. Furthermore, inter-sister JMs formed in mek1Δ mutants are preferentially lost, while inter-homolog JMs are maintained. These findings indicate that inter-sister recombination occurs frequently during budding yeast meiosis, with the possibility that up to one-third of all recombination events occur between sister chromatids. We suggest that a Mek1-dependent reduction in

  1. Molecular analysis of heavy ion induced mutations in the budding yeast

    International Nuclear Information System (INIS)

    The aim of this study is to elucidate the molecular mechanism of mutagenesis caused with heavy ion irradiation. Yeast cells were irradiated with accelerated carbon ion (290 MeV/u, 13-75 keV/mm) and helium ion (150 MeV/u, 2.2 keV/mm). The survival rate of carbon ion beam irradiated cells was reduced with linear energy transfer (LET), and the mutation frequency increased consistently with LET. The survival rate of helium ion beam (0.45 keV/mm) was slightly higher than that of carbon ion beam (LET: 25 keV/ mm) irradiated cells. (author)

  2. High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation.

    Science.gov (United States)

    Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J; Fox, Catherine A

    2016-01-01

    The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid

  3. Whole-cell imaging of the budding yeast Saccharomyces cerevisiae by high-voltage scanning transmission electron tomography

    International Nuclear Information System (INIS)

    Electron tomography using a high-voltage electron microscope (HVEM) provides three-dimensional information about cellular components in sections thicker than 1 μm, although in bright-field mode image degradation caused by multiple inelastic scattering of transmitted electrons limit the attainable resolution. Scanning transmission electron microscopy (STEM) is believed to give enhanced contrast and resolution compared to conventional transmission electron microscopy (CTEM). Samples up to 1 μm in thickness have been analyzed with an intermediate-voltage electron microscope because inelastic scattering is not a critical limitation, and probe broadening can be minimized. Here, we employed STEM at 1 MeV high-voltage to extend the useful specimen thickness for electron tomography, which we demonstrate by a seamless tomographic reconstruction of a whole, budding Saccharomyces cerevisiae yeast cell, which is ∼3 μm in thickness. High-voltage STEM tomography, especially in the bright-field mode, demonstrated sufficiently enhanced contrast and intensity, compared to CTEM tomography, to permit segmentation of major organelles in the whole cell. STEM imaging also reduced specimen shrinkage during tilt-series acquisition. The fidelity of structural preservation was limited by cytoplasmic extraction, and the spatial resolution was limited by the relatively large convergence angle of the scanning probe. However, the new technique has potential to solve longstanding problems of image blurring in biological specimens beyond 1 μm in thickness, and may facilitate new research in cellular structural biology. - Highlights: • High voltage TEM and STEM tomography were compared to visualize whole yeast cells. • 1-MeV STEM-BF tomography had significant improvements in image contrast and SNR. • 1-MeV STEM tomography showed less specimen shrinkage than the TEM tomography. • KMnO4 post-treatment permitted segmenting the major cellular components

  4. Whole-cell imaging of the budding yeast Saccharomyces cerevisiae by high-voltage scanning transmission electron tomography

    Energy Technology Data Exchange (ETDEWEB)

    Murata, Kazuyoshi, E-mail: kazum@nips.ac.jp [National Institute for Physiological Sciences, Okazaki, Aichi 444-8585 (Japan); Esaki, Masatoshi; Ogura, Teru [Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto 860-0811 (Japan); Arai, Shigeo; Yamamoto, Yuta; Tanaka, Nobuo [Ecotopia Science Institute, Nagoya University, Nagoya, Aichi 464-8603 (Japan)

    2014-11-15

    Electron tomography using a high-voltage electron microscope (HVEM) provides three-dimensional information about cellular components in sections thicker than 1 μm, although in bright-field mode image degradation caused by multiple inelastic scattering of transmitted electrons limit the attainable resolution. Scanning transmission electron microscopy (STEM) is believed to give enhanced contrast and resolution compared to conventional transmission electron microscopy (CTEM). Samples up to 1 μm in thickness have been analyzed with an intermediate-voltage electron microscope because inelastic scattering is not a critical limitation, and probe broadening can be minimized. Here, we employed STEM at 1 MeV high-voltage to extend the useful specimen thickness for electron tomography, which we demonstrate by a seamless tomographic reconstruction of a whole, budding Saccharomyces cerevisiae yeast cell, which is ∼3 μm in thickness. High-voltage STEM tomography, especially in the bright-field mode, demonstrated sufficiently enhanced contrast and intensity, compared to CTEM tomography, to permit segmentation of major organelles in the whole cell. STEM imaging also reduced specimen shrinkage during tilt-series acquisition. The fidelity of structural preservation was limited by cytoplasmic extraction, and the spatial resolution was limited by the relatively large convergence angle of the scanning probe. However, the new technique has potential to solve longstanding problems of image blurring in biological specimens beyond 1 μm in thickness, and may facilitate new research in cellular structural biology. - Highlights: • High voltage TEM and STEM tomography were compared to visualize whole yeast cells. • 1-MeV STEM-BF tomography had significant improvements in image contrast and SNR. • 1-MeV STEM tomography showed less specimen shrinkage than the TEM tomography. • KMnO{sub 4} post-treatment permitted segmenting the major cellular components.

  5. Transcription factor genes essential for cell proliferation and replicative lifespan in budding yeast

    Energy Technology Data Exchange (ETDEWEB)

    Kamei, Yuka; Tai, Akiko; Dakeyama, Shota; Yamamoto, Kaori; Inoue, Yamato; Kishimoto, Yoshifumi; Ohara, Hiroya; Mukai, Yukio, E-mail: y_mukai@nagahama-i-bio.ac.jp

    2015-07-31

    Many of the lifespan-related genes have been identified in eukaryotes ranging from the yeast to human. However, there is limited information available on the longevity genes that are essential for cell proliferation. Here, we investigated whether the essential genes encoding DNA-binding transcription factors modulated the replicative lifespan of Saccharomyces cerevisiae. Heterozygous diploid knockout strains for FHL1, RAP1, REB1, and MCM1 genes showed significantly short lifespan. {sup 1}H-nuclear magnetic resonance analysis indicated a characteristic metabolic profile in the Δfhl1/FHL1 mutant. These results strongly suggest that FHL1 regulates the transcription of lifespan related metabolic genes. Thus, heterozygous knockout strains could be the potential materials for discovering further novel lifespan genes. - Highlights: • Involvement of yeast TF genes essential for cell growth in lifespan was evaluated. • The essential TF genes, FHL1, RAP1, REB1, and MCM1, regulate replicative lifespan. • Heterozygous deletion of FHL1 changes cellular metabolism related to lifespan.

  6. Direct TFIIA-TFIID protein contacts drive budding yeast ribosomal protein gene transcription.

    Science.gov (United States)

    Layer, Justin H; Weil, P Anthony

    2013-08-01

    We have previously shown that yeast TFIID provides coactivator function on the promoters of ribosomal protein-encoding genes (RPGs) by making direct contact with the transactivator repressor activator protein 1 (Rap1). Further, our structural studies of assemblies generated with purified Rap1, TFIID, and TFIIA on RPG enhancer-promoter DNA indicate that Rap1-TFIID interaction induces dramatic conformational rearrangements of enhancer-promoter DNA and TFIID-bound TFIIA. These data indicate a previously unknown yet critical role for yeast TFIIA in the integration of activator-TFIID contacts with promoter conformation and downstream preinitiation complex formation and/or function. Here we describe the use of systematic mutagenesis to define how specific TFIIA contacts contribute to these processes. We have verified that TFIIA is required for RPG transcription in vivo and in vitro, consistent with the existence of a critical Rap1-TFIIA-TFIID interaction network. We also identified essential points of contact for TFIIA and Rap1 within the Rap1 binding domain of the Taf4 subunit of TFIID. These data suggest a mechanism for how interactions between TFIID, TFIIA, and Rap1 contribute to the high rate of transcription initiation seen on RPGs in vivo. PMID:23814059

  7. Transcription factor genes essential for cell proliferation and replicative lifespan in budding yeast

    International Nuclear Information System (INIS)

    Many of the lifespan-related genes have been identified in eukaryotes ranging from the yeast to human. However, there is limited information available on the longevity genes that are essential for cell proliferation. Here, we investigated whether the essential genes encoding DNA-binding transcription factors modulated the replicative lifespan of Saccharomyces cerevisiae. Heterozygous diploid knockout strains for FHL1, RAP1, REB1, and MCM1 genes showed significantly short lifespan. 1H-nuclear magnetic resonance analysis indicated a characteristic metabolic profile in the Δfhl1/FHL1 mutant. These results strongly suggest that FHL1 regulates the transcription of lifespan related metabolic genes. Thus, heterozygous knockout strains could be the potential materials for discovering further novel lifespan genes. - Highlights: • Involvement of yeast TF genes essential for cell growth in lifespan was evaluated. • The essential TF genes, FHL1, RAP1, REB1, and MCM1, regulate replicative lifespan. • Heterozygous deletion of FHL1 changes cellular metabolism related to lifespan

  8. Checkpoints Studies Using the Budding Yeast Saccharomyces cerevisiae: Analysis of changes in protein level and subcellular localization during cell cycle progression

    OpenAIRE

    Wu, Xiaorong; Liu, Lili; HUANG, Mingxia

    2011-01-01

    Methods are described here to monitor changes in protein level and subcellular localization during the cell cycle progression in the budding yeast S. cerevisiae. Cell synchronization is achieved by an α-factor mediated block-and-release protocol. Cells are collected at different time points for the first two cell cycles upon release. Cellular DNA contents are analyzed by flow cytometry. Trichloroacetic acid protein precipitates are prepared for monitoring levels of cell cycle regulated protei...

  9. Positive feedback promotes mitotic exit via the APC/C-Cdh1-separase-Cdc14 axis in budding yeast.

    Science.gov (United States)

    Hatano, Yuhki; Naoki, Koike; Suzuki, Asuka; Ushimaru, Takashi

    2016-10-01

    The mitotic inhibitor securin is degraded via the ubiquitin ligase anaphase-promoting complex/cyclosome (APC/C)-Cdc20 after anaphase onset. This triggers activation of the mitotic protease separase and thereby sister chromatid separation. However, only a proportion of securin molecules are degraded at metaphase-anaphase transition and the remaining molecules are still present in anaphase. The roles of securin and separase in late mitosis remain elusive. Here, we show that securin still inhibits separase to repress mitotic exit in anaphase in budding yeast. APC/C-Cdh1-mediated securin degradation at telophase further liberated separase, which promotes Cdc14 release and mitotic exit. Separase executed these events via its proteolytic action and that in the Cdc14 early release (FEAR) network. Cdc14 release further activated APC/C-Cdh1 in the manner of a positive feedback loop. Thus, the positive feedback promotes mitotic exit via the APC/C-Cdh1-separase-Cdc14 axis. This study shows the importance of the two-step degradation mode of securin and the role of separase in mitotic exit. PMID:27418100

  10. Molecular analysis of heavy ion induced mutations in the budding yeast

    International Nuclear Information System (INIS)

    The aim of this study is to elucidate the relation between linear energy transfer (LET) and mutagenesis. Carbon ion beams with varied LET generated by Heavy Ion Medical Accelerator in Chiba (HIMAC) synchrotron were irradiated to several types of yeast cells, and we examined the survival rate and mutation frequencies. The results showed that the survival rates were reduced along with the LET, while the mutation frequencies were enhanced along with the LET, and the mutation frequencies increased consistently with LET. The sequencing analysis of mutations showed that the low LET carbon ion beams induced more deletion and insertion mutations than high LET carbon ion beams did. Furthermore, we also examined the gene expression analysis of RAD50, RAD52 and OGG1 after ion beam radiation to cells. The result indicated that the high-LET carbon-ion beams induced the expression of RAD50 gene. (author)

  11. Multiple stable states and hysteresis in continuous, oscillating cultures of budding yeast.

    Science.gov (United States)

    Zamamiri, A Q; Birol, G; Hjortsø, M A

    2001-11-01

    The conditions that precede the onset of autonomous oscillations in continuous yeast cultures were studied in three different types of experiments. It was found that the final state of the culture depended on the protocol used to start up the reactor. Batch cultures, switched to continuous operation at different stages of the batch growth curve, all exhibited similar dynamics-ethanol depletion followed by autonomous oscillations. Small perturbations of the distribution of states in the reactor, achieved by addition of externally grown cells, were able to quench the oscillatory dynamics. Reaching the desired operating point by slow dilution rate changes gave rise to different final states, two oscillatory states and one steady state, depending on the rate of change in dilution rate. The multiplicity of stable states at a single operating point is not explained by any current distributed model and points toward a segregated mechanism of these oscillations. PMID:11590603

  12. The dynamics of homologous pairing during mating type interconversion in budding yeast.

    Directory of Open Access Journals (Sweden)

    Peter L Houston

    2006-06-01

    Full Text Available Cells repair most double-strand breaks (DSBs that arise during replication or by environmental insults through homologous recombination, a high-fidelity process critical for maintenance of genomic integrity. However, neither the detailed mechanism of homologous recombination nor the specific roles of critical components of the recombination machinery-such as Bloom and Werner syndrome proteins-have been resolved. We have taken a novel approach to examining the mechanism of homologous recombination by tracking both a DSB and the template from which it is repaired during the repair process in individual yeast cells. The two loci were labeled with arrays of DNA binding sites and visualized in live cells expressing green fluorescent protein-DNA binding protein chimeras. Following induction of an endonuclease that introduces a DSB next to one of the marked loci, live cells were imaged repeatedly to determine the relative positions of the DSB and the template locus. We found a significant increase in persistent associations between donor and recipient loci following formation of the DSB, demonstrating DSB-induced pairing between donor and template. However, such associations were transient and occurred repeatedly in every cell, a result not predicted from previous studies on populations of cells. Moreover, these associations were absent in sgs1 or srs2 mutants, yeast homologs of the Bloom and Werner syndrome genes, but were enhanced in a rad54 mutant, whose protein product promotes efficient strand exchange in vitro. Our results indicate that a DSB makes multiple and reversible contacts with a template during the repair process, suggesting that repair could involve interactions with multiple templates, potentially creating novel combinations of sequences at the repair site. Our results further suggest that both Sgs1 and Srs2 are required for efficient completion of recombination and that Rad54 may serve to dissociate such interactions. Finally, these

  13. Identification of She3 as an SCF(Grr1 substrate in budding yeast.

    Directory of Open Access Journals (Sweden)

    Ruiwen Wang

    Full Text Available The highly orchestrated progression of the cell cycle depends on the degradation of many regulatory proteins at different cell cycle stages. One of the key cell cycle ubiquitin ligases is the Skp1-cullin-F-box (SCF complex. Acting in concert with the substrate-binding F-box protein Grr1, SCF(Grr1 promotes the degradation of cell cycle regulators as well as various metabolic enzymes. Using a yeast two-hybrid assay with a Grr1 derivative as the bait, we identified She3, which is an adaptor protein in the asymmetric mRNA transport system, as a novel Grr1 substrate. We generated stabilized She3 mutants, which no longer bound to Grr1, and found that the degradation of She3 is not required for regulating asymmetric mRNA transport. However, She3 stabilization leads to slower growth compared to wild-type cells in a co-culture assay, demonstrating that the degradation of She3 by Grr1 is required for optimal cell growth.

  14. Direct and indirect control of the initiation of meiotic recombination by DNA damage checkpoint mechanisms in budding yeast.

    Directory of Open Access Journals (Sweden)

    Bilge Argunhan

    Full Text Available Meiotic recombination plays an essential role in the proper segregation of chromosomes at meiosis I in many sexually reproducing organisms. Meiotic recombination is initiated by the scheduled formation of genome-wide DNA double-strand breaks (DSBs. The timing of DSB formation is strictly controlled because unscheduled DSB formation is detrimental to genome integrity. Here, we investigated the role of DNA damage checkpoint mechanisms in the control of meiotic DSB formation using budding yeast. By using recombination defective mutants in which meiotic DSBs are not repaired, the effect of DNA damage checkpoint mutations on DSB formation was evaluated. The Tel1 (ATM pathway mainly responds to unresected DSB ends, thus the sae2 mutant background in which DSB ends remain intact was employed. On the other hand, the Mec1 (ATR pathway is primarily used when DSB ends are resected, thus the rad51 dmc1 double mutant background was employed in which highly resected DSBs accumulate. In order to separate the effect caused by unscheduled cell cycle progression, which is often associated with DNA damage checkpoint defects, we also employed the ndt80 mutation which permanently arrests the meiotic cell cycle at prophase I. In the absence of Tel1, DSB formation was reduced in larger chromosomes (IV, VII, II and XI whereas no significant reduction was found in smaller chromosomes (III and VI. On the other hand, the absence of Rad17 (a critical component of the ATR pathway lead to an increase in DSB formation (chromosomes VII and II were tested. We propose that, within prophase I, the Tel1 pathway facilitates DSB formation, especially in bigger chromosomes, while the Mec1 pathway negatively regulates DSB formation. We also identified prophase I exit, which is under the control of the DNA damage checkpoint machinery, to be a critical event associated with down-regulating meiotic DSB formation.

  15. A septin from the filamentous fungus A. nidulans induces atypical pseudohyphae in the budding yeast S. cerevisiae

    Science.gov (United States)

    Septins were first discovered in Saccharomyces cerevisiae where they form a scaffold that organizes the bud site and are a component of the morphogenesis checkpoint that coordinates budding with mitosis. Five of the seven S. cerevisiae septins (Cdc3, Cdc10, Cdc11, Cdc12 and Shs1) colocalize as a rin...

  16. PRIMED: PRIMEr database for deleting and tagging all fission and budding yeast genes developed using the open-source genome retrieval script (GRS.

    Directory of Open Access Journals (Sweden)

    Michael T Cummings

    Full Text Available The fission (Schizosaccharomyces pombe and budding (Saccharomyces cerevisiae yeasts have served as excellent models for many seminal discoveries in eukaryotic biology. In these organisms, genes are deleted or tagged easily by transforming cells with PCR-generated DNA inserts, flanked by short (50-100 bp regions of gene homology. These PCR reactions use especially designed long primers, which, in addition to the priming sites, carry homology for gene targeting. Primer design follows a fixed method but is tedious and time-consuming especially when done for a large number of genes. To automate this process, we developed the Python-based Genome Retrieval Script (GRS, an easily customizable open-source script for genome analysis. Using GRS, we created PRIMED, the complete PRIMEr D atabase for deleting and C-terminal tagging genes in the main S. pombe and five of the most commonly used S. cerevisiae strains. Because of the importance of noncoding RNAs (ncRNAs in many biological processes, we also included the deletion primer set for these features in each genome. PRIMED are accurate and comprehensive and are provided as downloadable Excel files, removing the need for future primer design, especially for large-scale functional analyses. Furthermore, the open-source GRS can be used broadly to retrieve genome information from custom or other annotated genomes, thus providing a suitable platform for building other genomic tools by the yeast or other research communities.

  17. High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation

    OpenAIRE

    Timothy Hoggard; Ivan Liachko; Cassaundra Burt; Troy Meikle; Katherine Jiang; Gheorghe Craciun; Dunham, Maitreya J.; Fox, Catherine A.

    2016-01-01

    The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chrom...

  18. Mps1 and Ipl1/Aurora B Act Sequentially to Correctly Orient Chromosomes on the Meiotic Spindle of Budding Yeast

    OpenAIRE

    Meyer, Régis E; Kim, Seoyoung; Obeso, David; Straight, Paul D.; Winey, Mark; Dawson, Dean S.

    2013-01-01

    The conserved kinases Mps1 and Ipl1/Aurora B are critical for enabling chromosomes to attach to microtubules such that partner chromosomes will be segregated correctly from each other, but the precise roles of these kinases have been unclear. Here, imaging of live yeast cells was performed to elucidate the stages of chromosome-microtubule interactions, and their regulation by Ipl1 and Mps1, through meiosis I. Ipl1 was found to release kinetochore-microtubule (kMT) associations following meiot...

  19. PP2A(Cdc55)'s role in reductional chromosome segregation during achiasmate meiosis in budding yeast is independent of its FEAR function.

    Science.gov (United States)

    Kerr, Gary W; Wong, Jin Huei; Arumugam, Prakash

    2016-01-01

    PP2A(Cdc55) is a highly conserved serine-threonine protein phosphatase that is involved in diverse cellular processes. In budding yeast, meiotic cells lacking PP2A(Cdc55) activity undergo a premature exit from meiosis I which results in a failure to form bipolar spindles and divide nuclei. This defect is largely due to its role in negatively regulating the Cdc Fourteen Early Anaphase Release (FEAR) pathway. PP2A(Cdc55) prevents nucleolar release of the Cdk (Cyclin-dependent kinase)-antagonising phosphatase Cdc14 by counteracting phosphorylation of the nucleolar protein Net1 by Cdk. CDC55 was identified in a genetic screen for monopolins performed by isolating suppressors of spo11Δ spo12Δ lethality suggesting that Cdc55 might have a role in meiotic chromosome segregation. We investigated this possibility by isolating cdc55 alleles that suppress spo11Δ spo12Δ lethality and show that this suppression is independent of PP2A(Cdc55)'s FEAR function. Although the suppressor mutations in cdc55 affect reductional chromosome segregation in the absence of recombination, they have no effect on chromosome segregation during wild type meiosis. We suggest that Cdc55 is required for reductional chromosome segregation during achiasmate meiosis and this is independent of its FEAR function. PMID:27455870

  20. PP2ACdc55’s role in reductional chromosome segregation during achiasmate meiosis in budding yeast is independent of its FEAR function

    Science.gov (United States)

    Kerr, Gary W.; Wong, Jin Huei; Arumugam, Prakash

    2016-01-01

    PP2ACdc55 is a highly conserved serine-threonine protein phosphatase that is involved in diverse cellular processes. In budding yeast, meiotic cells lacking PP2ACdc55 activity undergo a premature exit from meiosis I which results in a failure to form bipolar spindles and divide nuclei. This defect is largely due to its role in negatively regulating the Cdc Fourteen Early Anaphase Release (FEAR) pathway. PP2ACdc55 prevents nucleolar release of the Cdk (Cyclin-dependent kinase)-antagonising phosphatase Cdc14 by counteracting phosphorylation of the nucleolar protein Net1 by Cdk. CDC55 was identified in a genetic screen for monopolins performed by isolating suppressors of spo11Δ spo12Δ lethality suggesting that Cdc55 might have a role in meiotic chromosome segregation. We investigated this possibility by isolating cdc55 alleles that suppress spo11Δ spo12Δ lethality and show that this suppression is independent of PP2ACdc55’s FEAR function. Although the suppressor mutations in cdc55 affect reductional chromosome segregation in the absence of recombination, they have no effect on chromosome segregation during wild type meiosis. We suggest that Cdc55 is required for reductional chromosome segregation during achiasmate meiosis and this is independent of its FEAR function. PMID:27455870

  1. Exposure of ELF-EMF and RF-EMF Increase the Rate of Glucose Transport and TCA Cycle in Budding Yeast

    Science.gov (United States)

    Lin, Kang-Wei; Yang, Chuan-Jun; Lian, Hui-Yong; Cai, Peng

    2016-01-01

    In this study, we investigated the transcriptional response to 50 Hz extremely low frequency electromagnetic field (ELF-EMF) and 2.0 GHz radio frequency electromagnetic field (RF-EMF) exposure by Illumina sequencing technology using budding yeast as the model organism. The transcription levels of 28 genes were upregulated and those of four genes were downregulated under ELF-EMF exposure, while the transcription levels of 29 genes were upregulated and those of 24 genes were downregulated under RF-EMF exposure. After validation by reverse transcription quantitative polymerase chain reaction (RT-qPCR), a concordant direction of change both in differential gene expression (DGE) and RT-qPCR was demonstrated for nine genes under ELF-EMF exposure and for 10 genes under RF-EMF exposure. The RT-qPCR results revealed that ELF-EMF and RF-EMF exposure can upregulate the expression of genes involved in glucose transportation and the tricarboxylic acid (TCA) cycle, but not the glycolysis pathway. Energy metabolism is closely related with the cell response to environmental stress including EMF exposure. Our findings may throw light on the mechanism underlying the biological effects of EMF.

  2. H2B ubiquitylation is part of chromatin architecture that marks exon-intron structure in budding yeast

    LENUS (Irish Health Repository)

    Shieh, Grace S.

    2011-12-22

    Abstract Background The packaging of DNA into chromatin regulates transcription from initiation through 3\\' end processing. One aspect of transcription in which chromatin plays a poorly understood role is the co-transcriptional splicing of pre-mRNA. Results Here we provide evidence that H2B monoubiquitylation (H2BK123ub1) marks introns in Saccharomyces cerevisiae. A genome-wide map of H2BK123ub1 in this organism reveals that this modification is enriched in coding regions and that its levels peak at the transcribed regions of two characteristic subgroups of genes. First, long genes are more likely to have higher levels of H2BK123ub1, correlating with the postulated role of this modification in preventing cryptic transcription initiation in ORFs. Second, genes that are highly transcribed also have high levels of H2BK123ub1, including the ribosomal protein genes, which comprise the majority of intron-containing genes in yeast. H2BK123ub1 is also a feature of introns in the yeast genome, and the disruption of this modification alters the intragenic distribution of H3 trimethylation on lysine 36 (H3K36me3), which functionally correlates with alternative RNA splicing in humans. In addition, the deletion of genes encoding the U2 snRNP subunits, Lea1 or Msl1, in combination with an htb-K123R mutation, leads to synthetic lethality. Conclusion These data suggest that H2BK123ub1 facilitates cross talk between chromatin and pre-mRNA splicing by modulating the distribution of intronic and exonic histone modifications.

  3. Divergent Evolution of the Transcriptional Network Controlled by Snf1-Interacting Protein Sip4 in Budding Yeasts.

    Directory of Open Access Journals (Sweden)

    Constance Mehlgarten

    Full Text Available Cellular responses to starvation are of ancient origin since nutrient limitation has always been a common challenge to the stability of living systems. Hence, signaling molecules involved in sensing or transducing information about limiting metabolites are highly conserved, whereas transcription factors and the genes they regulate have diverged. In eukaryotes the AMP-activated protein kinase (AMPK functions as a central regulator of cellular energy homeostasis. The yeast AMPK ortholog SNF1 controls the transcriptional network that counteracts carbon starvation conditions by regulating a set of transcription factors. Among those Cat8 and Sip4 have overlapping DNA-binding specificity for so-called carbon source responsive elements and induce target genes upon SNF1 activation. To analyze the evolution of the Cat8-Sip4 controlled transcriptional network we have compared the response to carbon limitation of Saccharomyces cerevisiae to that of Kluyveromyces lactis. In high glucose, S. cerevisiae displays tumor cell-like aerobic fermentation and repression of respiration (Crabtree-positive while K. lactis has a respiratory-fermentative life-style, respiration being regulated by oxygen availability (Crabtree-negative, which is typical for many yeasts and for differentiated higher cells. We demonstrate divergent evolution of the Cat8-Sip4 network and present evidence that a role of Sip4 in controlling anabolic metabolism has been lost in the Saccharomyces lineage. We find that in K. lactis, but not in S. cerevisiae, the Sip4 protein plays an essential role in C2 carbon assimilation including induction of the glyoxylate cycle and the carnitine shuttle genes. Induction of KlSIP4 gene expression by KlCat8 is essential under these growth conditions and a primary function of KlCat8. Both KlCat8 and KlSip4 are involved in the regulation of lactose metabolism in K. lactis. In chromatin-immunoprecipitation experiments we demonstrate binding of both, KlSip4 and

  4. Important role of catalase in the cellular response of the budding yeast Saccharomyces cerevisiae exposed to ionizing radiation.

    Science.gov (United States)

    Nishimoto, Takuto; Furuta, Masakazu; Kataoka, Michihiko; Kishida, Masao

    2015-03-01

    Ionizing radiation indirectly causes oxidative stress in cells via reactive oxygen species (ROS), such as hydroxyl radicals (OH(-)) generated by the radiolysis of water. We investigated how the catalase function was affected by ionizing radiation and analyzed the phenotype of mutants with a disrupted catalase gene in Saccharomyces cerevisiae exposed to radiation. The wild-type yeast strain and isogenic mutants with disrupted catalase genes were exposed to various doses of (60)Co gamma-rays. There was no difference between the wild-type strain and the cta1 disruption mutant following exposure to gamma-ray irradiation. In contrast, there was a significant decrease in the ctt1 disruption mutant, suggesting that this strain exhibited decreased survival on gamma-ray exposure compared with other strains. In all three strains, stationary phase cells were more tolerant to the exposure of gamma-rays than exponential phase cells, whereas the catalase activity in the wild-type strain and cta1 disruption mutant was higher in the stationary phase than in the exponential phase. These data suggest a correlation between catalase activity and survival following gamma-ray exposure. However, this correlation was not clear in the ctt1 disruption mutant, suggesting that other factors are involved in the tolerance to ROS induced by irradiation. PMID:25416226

  5. RIM15 antagonistic pleiotropy is responsible for differences in fermentation and stress response kinetics in budding yeast.

    Science.gov (United States)

    Kessi-Pérez, Eduardo I; Araos, Sebastián; García, Verónica; Salinas, Francisco; Abarca, Valentina; Larrondo, Luis F; Martínez, Claudio; Cubillos, Francisco A

    2016-05-01

    Different natural yeast populations have faced dissimilar selective pressures due to the heterogeneous fermentation substrates available around the world; this increases the genetic and phenotypic diversity in Saccharomyces cerevisiae In this context, we expect prominent differences between isolates when exposed to a particular condition, such as wine or sake musts. To better comprehend the mechanisms underlying niche adaptation between two S. cerevisiae isolates obtained from wine and sake fermentation processes, we evaluated fermentative and fungicide resistance phenotypes and identify the molecular origin of such adaptive variation. Multiple regions were associated with fermentation rate under different nitrogen conditions and fungicide resistance, with a single QTL co-localizing in all traits. Analysis around this region identified RIM15 as the causative locus driving fungicide sensitivity, together with efficient nitrogen utilization and glycerol production in the wine strain. A null RIM15 variant confers a greater fermentation rate through the utilization of available glucose instead of its storage. However, this variant has a detrimental effect on fungicide resistance since complex sugars are not synthesized and transported into the membrane. Together, our results reveal the antagonist pleiotropic nature of a RIM15 null variant, positively affecting a series of fermentation related phenotypes, but apparently detrimental in the wild. PMID:26945894

  6. Live cell imaging of the assembly, disassembly, and actin cable–dependent movement of endosomes and actin patches in the budding yeast, Saccharomyces cerevisiae

    OpenAIRE

    Huckaba, Thomas M.; Gay, Anna Card; Pantalena, Luiz Fernando; Yang, Hyeong-Cheol; Liza A Pon

    2004-01-01

    Using FM4-64 to label endosomes and Abp1p-GFP or Sac6p-GFP to label actin patches, we find that (1) endosomes colocalize with actin patches as they assemble at the bud cortex; (2) endosomes colocalize with actin patches as they undergo linear, retrograde movement from buds toward mother cells; and (3) actin patches interact with and disassemble at FM4-64–labeled internal compartments. We also show that retrograde flow of actin cables mediates retrograde actin patch movement. An Arp2/3 complex...

  7. Puf3p, a Pumilio family RNA binding protein, localizes to mitochondria and regulates mitochondrial biogenesis and motility in budding yeast

    Science.gov (United States)

    García-Rodríguez, Luis J.; Gay, Anna Card; Pon, Liza A.

    2007-01-01

    Puf3p binds preferentially to messenger RNAs (mRNAs) for nuclear-encoded mitochondrial proteins. We find that Puf3p localizes to the cytosolic face of the mitochondrial outer membrane. Overexpression of PUF3 results in reduced mitochondrial respiratory activity and reduced levels of Pet123p, a protein encoded by a Puf3p-binding mRNA. Puf3p levels are reduced during the diauxic shift and growth on a nonfermentable carbon source, conditions that stimulate mitochondrial biogenesis. These findings support a role for Puf3p in mitochondrial biogenesis through effects on mRNA interactions. In addition, Puf3p links the mitochore, a complex required for mitochondrial–cytoskeletal interactions, to the Arp2/3 complex, the force generator for actin-dependent, bud-directed mitochondrial movement. Puf3p, the mitochore, and the Arp2/3 complex coimmunoprecipitate and have two-hybrid interactions. Moreover, deletion of PUF3 results in reduced interaction between the mitochore and the Arp2/3 complex and defects in mitochondrial morphology and motility similar to those observed in Arp2/3 complex mutants. Thus, Puf3p is a mitochondrial protein that contributes to the biogenesis and motility of the organelle. PMID:17210948

  8. Detection of Multiple Budding Yeast Cells and a Partial Sequence of 43-kDa Glycoprotein Coding Gene of Paracoccidioides brasiliensis from a Case of Lacaziosis in a Female Pacific White-Sided Dolphin (Lagenorhynchus obliquidens).

    Science.gov (United States)

    Minakawa, Tomoko; Ueda, Keiichi; Tanaka, Miyuu; Tanaka, Natsuki; Kuwamura, Mitsuru; Izawa, Takeshi; Konno, Toshihiro; Yamate, Jyoji; Itano, Eiko Nakagawa; Sano, Ayako; Wada, Shinpei

    2016-08-01

    Lacaziosis, formerly called as lobomycosis, is a zoonotic mycosis, caused by Lacazia loboi, found in humans and dolphins, and is endemic in the countries on the Atlantic Ocean, Indian Ocean and Pacific Ocean of Japanese coast. Susceptible Cetacean species include the bottlenose dolphin (Tursiops truncatus), the Indian Ocean bottlenose dolphin (T. aduncus), and the estuarine dolphin (Sotalia guianensis); however, no cases have been recorded in other Cetacean species. We diagnosed a case of Lacaziosis in a Pacific white-sided dolphin (Lagenorhynchus obliquidens) nursing in an aquarium in Japan. The dolphin was a female estimated to be more than 14 years old at the end of June 2015 and was captured in a coast of Japan Sea in 2001. Multiple, lobose, and solid granulomatous lesions with or without ulcers appeared on her jaw, back, flipper and fluke skin, in July 2014. The granulomatous skin lesions from the present case were similar to those of our previous cases. Multiple budding and chains of round yeast cells were detected in the biopsied samples. The partial sequence of 43-kDa glycoprotein coding gene confirmed by a nested PCR and sequencing, which revealed a different genotype from both Amazonian and Japanese lacaziosis in bottlenose dolphins, and was 99 % identical to those derived from Paracoccidioides brasiliensis; a sister fungal species to L. loboi. This is the first case of lacaziosis in Pacific white-sided dolphin. PMID:26883513

  9. A novel role for the GTPase-activating protein Bud2 in the spindle position checkpoint.

    Directory of Open Access Journals (Sweden)

    Scott A Nelson

    Full Text Available The spindle position checkpoint (SPC ensures correct mitotic spindle position before allowing mitotic exit in the budding yeast Saccharomyces cerevisiae. In a candidate screen for checkpoint genes, we identified bud2Δ as deficient for the SPC. Bud2 is a GTPase activating protein (GAP, and the only known substrate of Bud2 was Rsr1/Bud1, a Ras-like GTPase and a central component of the bud-site-selection pathway. Mutants lacking Rsr1/Bud1 had no checkpoint defect, as did strains lacking and overexpressing Bud5, a guanine-nucleotide exchange factor (GEF for Rsr1/Bud1. Thus, the checkpoint function of Bud2 is distinct from its role in bud site selection. The catalytic activity of the Bud2 GAP domain was required for the checkpoint, based on the failure of the known catalytic point mutant Bud2(R682A to function in the checkpoint. Based on assays of heterozygous diploids, bud2(R682A, was dominant for loss of checkpoint but recessive for bud-site-selection failure, further indicating a separation of function. Tem1 is a Ras-like protein and is the critical regulator of mitotic exit, sitting atop the mitotic exit network (MEN. Tem1 is a likely target for Bud2, supported by genetic analyses that exclude other Ras-like proteins.

  10. Pexophagy in yeasts.

    Science.gov (United States)

    Oku, Masahide; Sakai, Yasuyoshi

    2016-05-01

    Pexophagy, selective degradation of peroxisomes via autophagy, is the main system for reducing organelle abundance. Elucidation of the molecular machinery of pexophagy has been pioneered in studies of the budding yeast Saccharomyces cerevisiae and the methylotrophic yeasts Pichia pastoris and Hansenula polymorpha. Recent analyses using these yeasts have elucidated the molecular machineries of pexophagy, especially in terms of the interactions and modifications of the so-called adaptor proteins required for guiding autophagic membrane biogenesis on the organelle surface. Based on the recent findings, functional relevance of pexophagy and another autophagic pathway, mitophagy (selective autophagy of mitochondria), is discussed. We also discuss the physiological importance of pexophagy in these yeast systems. PMID:26409485

  11. ERAD substrate recognition in budding yeast.

    Science.gov (United States)

    Xie, Wei; Ng, Davis T W

    2010-07-01

    During protein synthesis, the orderly progression of folding, modification, and assembly is paramount to function and vis-à-vis cellular viability. Accordingly, sophisticated quality control mechanisms have evolved to monitor protein maturation throughout the cell. Proteins failing at any step are segregated and degraded as a preventative measure against potential toxicity. Although protein quality control is generally poorly understood, recent research advances in endoplasmic reticulum-associated degradation (ERAD) pathways have provided the most detailed view so far. The discovery of distinct substrate processing sites established a biochemical basis for genetic profiles of model misfolded proteins. Detailed mechanisms for substrate recognition were recently uncovered. For some proteins, sequential glycan trimming steps set a time window for folding. Proteins still unfolded at the final stage expose a specific degradation signal recognized by the ERAD machinery. Through this mechanism, the system does not in fact know that a molecule is "misfolded". Instead, it goes by the premise that proteins past due have veered off their normal folding pathways and therefore aberrant. PMID:20178855

  12. Bud Dormancy and Growth

    Science.gov (United States)

    Nearly all land plants produce ancillary meristems in the form of axillary or adventitious buds in addition to the shoot apical meristem. Outgrowth of these buds has a significant impact on plant architecture and the ability of plants to compete with neighboring plants, as well as to respond to and ...

  13. Sexual differentiation in fission yeast

    DEFF Research Database (Denmark)

    Egel, R; Nielsen, O; Weilguny, D;

    1990-01-01

    The regulation of sexual reproduction in yeast constitutes the highest level of differentiation observed in these unicellular organisms. The various ramifications of this system involve DNA rearrangement, transcriptional control, post-translational modification (such as protein phosphorylation) a......) and receptor/signal processing. A few basic similarities are common to both fission and budding yeasts. The wiring of the regulatory circuitry, however, varies considerably between these divergent yeast groups....

  14. Robust heat shock induces eIF2α-phosphorylation-independent assembly of stress granules containing eIF3 and 40S ribosomal subunits in budding yeast, Saccharomyces cerevisiae

    Czech Academy of Sciences Publication Activity Database

    Groušl, Tomáš; Ivanov, P.; Frýdlová, Ivana; Vašicová, Pavla; Janda, Filip; Vojtová, Jana; Malínská, Kateřina; Malcová-Janatová, Ivana; Nováková, Lenka; Janošková, Dana; Valášek, Leoš; Hašek, Jiří

    2009-01-01

    Roč. 122, č. 12 (2009), s. 2078-2088. ISSN 0021-9533 R&D Projects: GA ČR GA204/02/1424; GA ČR GA204/05/0838; GA ČR GA204/09/1924; GA MŠk LC545; GA MŠk ME 939 Institutional research plan: CEZ:AV0Z50200510 Keywords : p-bodies * stress granules * yeast Subject RIV: EE - Microbiology, Virology Impact factor: 6.144, year: 2009

  15. The final cut: cell polarity meets cytokinesis at the bud neck in S. cerevisiae.

    Science.gov (United States)

    Juanes, Maria Angeles; Piatti, Simonetta

    2016-08-01

    Cell division is a fundamental but complex process that gives rise to two daughter cells. It includes an ordered set of events, altogether called "the cell cycle", that culminate with cytokinesis, the final stage of mitosis leading to the physical separation of the two daughter cells. Symmetric cell division equally partitions cellular components between the two daughter cells, which are therefore identical to one another and often share the same fate. In many cases, however, cell division is asymmetrical and generates two daughter cells that differ in specific protein inheritance, cell size, or developmental potential. The budding yeast Saccharomyces cerevisiae has proven to be an excellent system to investigate the molecular mechanisms governing asymmetric cell division and cytokinesis. Budding yeast is highly polarized during the cell cycle and divides asymmetrically, producing two cells with distinct sizes and fates. Many components of the machinery establishing cell polarization during budding are relocalized to the division site (i.e., the bud neck) for cytokinesis. In this review we recapitulate how budding yeast cells undergo polarized processes at the bud neck for cell division. PMID:27085703

  16. Tumor Budding in Colorectal Carcinomas

    Directory of Open Access Journals (Sweden)

    Sevda SERT BEKTAŞ

    2012-01-01

    Full Text Available Objective: In colorectal carcinomas, tumor budding has been defined as the presence of isolated single tumor cells or small cell clusters in the stroma at the invasive tumor margin. In this study, the relationship between tumor budding density at the invasive tumor margin and pathological parameters is investigated.Material and Method: Haematoxylin and eosin stained slides of 73 cases with colorectal carcinoma were retrospectively evaluated for the presence and intensity of tumor budding by 2 observers. After the specimens were assessed, the highest density of tumor budding area was counted in a microscopic field of x200. Cases were separated into 2 groups according to tumor budding density as low grade (<10 and high grade (≥10. The relationship of these groups with depth of tumor invasion, histological grade, vascular invasion and lymph node involvement was investigated.Results: Of the 73 colorectal carcinoma cases, 33 (45.2% had low and 40 (54.8% had high grade tumor budding density, respectively. There was a statistically significant relationship between high grade tumor budding density and histological grade (p=0.042, lymph node involvement (p=0.0001 and vascular invasion (p=0.0034.Conclusion: High grade tumor budding density is associated with aggressive phenotypical features in colorectal carcinoma.

  17. Fission yeast mating-type switching: programmed damage and repair

    DEFF Research Database (Denmark)

    Egel, Richard

    2005-01-01

    Mating-type switching in fission yeast follows similar rules as in budding yeast, but the underlying mechanisms are entirely different. Whilst the initiating double-strand cut in Saccharomyces cerevisiae requires recombinational repair for survival, the initial damage in Schizosaccharomyces pombe...

  18. Principles of chromosomal organization: lessons from yeast

    OpenAIRE

    Zimmer, Christophe; Fabre, Emmanuelle

    2011-01-01

    The spatial organization of genes and chromosomes plays an important role in the regulation of several DNA processes. However, the principles and forces underlying this nonrandom organization are mostly unknown. Despite its small dimension, and thanks to new imaging and biochemical techniques, studies of the budding yeast nucleus have led to significant insights into chromosome arrangement and dynamics. The dynamic organization of the yeast genome during interphase argues for both the physica...

  19. Flow cytometry for age assessment of a yeast population and its application in beer fermentations

    OpenAIRE

    Kuřec, Michal; Baszczyňski, Martin; Lehnert, Radek; Mota, André; Teixeira, J.A.; Brányik, Tomáš

    2009-01-01

    An expeditious method of yeast age estimation was developed based on selective bud scar staining (Alexa Fluor 488-labelled wheat-germ agglutinin) and subsequent fluorescence intensity measurement by flow cytometry. The calibration curve resulting from the cytometric determination of average bud scar fluorescence intensities vs. microscopically counted average bud scar numbers of the same cell populations showed a good correlation and allowed routine cell age estimation by...

  20. Regulation of homologous recombination at telomeres in budding yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael

    2010-01-01

    Homologous recombination is suppressed at normal length telomere sequences. In contrast, telomere recombination is allowed when telomeres erode in the absence of telomerase activity or as a consequence of nucleolytic degradation or incomplete replication. Here, we review the mechanisms that...

  1. Septin Filament Formation is Essential in Budding Yeast

    OpenAIRE

    McMurray, Michael A.; Bertin, Aurelie; Garcia, Galo; Lam, Lisa; Nogales, Eva; Thorner, Jeremy

    2011-01-01

    Septins are GTP-binding proteins that form ordered, rod-like multimeric complexes and polymerize into filaments, but how such supramolecular structure is related to septin function was unclear. In Saccharomyces cerevisiae, four septins form an apolar hetero-octamer (Cdc11–Cdc12–Cdc3–Cdc10–Cdc10–Cdc3–Cdc12–Cdc11) that associates end-to-end to form filaments. We show that septin filament assembly displays previously unanticipated plasticity. Cells lacking Cdc10 or Cdc11 are able to divide becau...

  2. Biotechnological Applications of Dimorphic Yeasts

    Science.gov (United States)

    Doiphode, N.; Joshi, C.; Ghormade, V.; Deshpande, M. V.

    The dimorphic yeasts have the equilibrium between spherical growth (budding) and polarized (hyphal or pseudohyphal tip elongation) which can be triggered by change in the environmental conditions. The reversible growth phenomenon has made dimorphic yeasts as an useful model to understand fungal evolution and fungal differentiation, in general. In nature dimorphism is clearly evident in plant and animal fungal pathogens, which survive and most importantly proliferate in the respective hosts. However, number of organisms with no known pathogenic behaviour also show such a transition, which can be exploited for the technological applications due to their different biochemical make up under different morphologies. For instance, chitin and chitosan production using dimorphic Saccharomyces, Mucor, Rhizopus and Benjaminiella, oil degradation and biotransformation with yeast-form of Yarrowia species, bioremediation of organic pollutants, exopolysac-charide production by yeast-phase of Aureobasidium pullulans, to name a few. Myrothecium verrucaria can be used for seed dressing in its yeast form and it produces a mycolytic enzyme complex in its hyphal-form for the biocontrol of fungal pathogens, while Beauveria bassiana and other entomopathogens kill the insect pest by producing yeast- like cells in the insect body. The form-specific expression of protease, chitinase, lipase, ornithine decarboxylase, glutamate dehydrogenases, etc. make Benjaminiella poitrasii, Basidiobolus sp., and Mucor rouxii strains important in bioremediation, nanobiotechnology, fungal evolution and other areas.

  3. Budding yeast cDNA sequencing project: S03052-35_D14 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available S03052-35_D14 S03052-35_D14 - - Show S03052-35_D14 Seqid S03052-35_D14 Link to SGD S03052-35_D14 ... AACTGCGGCNCAAATGAGGATCTATTCTCTCTCTATCAGTAT GAATTTACCAT CTGTCCTATTTGCTGCCAGTTAAAAAAGGACTACTTTGGCCCAATTTTC C ... AACGGTGGATCTGCTTCTTCCACCGATGTAGCTTCCTCCTCNTCCAT CTCCACTTCCTC TGGCTCAGTATTTATCACNNCTTCTGAACCTTCAT AAT ...

  4. Budding yeast cDNA sequencing project: S03036-24_C13 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available S03036-24_C 13 - - - Show S03036-24_C 13 Seqid S03036-24_C 13 Link to SGD - Link to dbEST - Link to ... UC SC ... Genome Browser - Sequenc e >S03036-24_C 13.phd NNN ... NNNNNNNNNNNNNNANNNNNNNNTGNNGGNNNNNTNNNNNN ANTTGNTATC GAC TTNNTTCC NNNNGAGANNNNNNTGGANAANGANGAGNNNNNGNANAC ... TTNNGANAAANANNC NNANGGTGAGAGCC AGATCC NNNNNNGC GGATTGNGAGC AAATC G TTAAG ... TTC AGGTC AAGTAAAAATTGATTTC NAAAAC TAATTTC TC TTATAC NANNNTTT ...

  5. Budding yeast cDNA sequencing project: S03052-35_P07 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available S03052-35_P07 S03052-35_P07 - - Show S03052-35_P07 Seqid S03052-35_P07 Link to SGD S03052-35_P07 ... Browser - Sequence >S03052-35_P07.phd CGGNNNNNNNTTTTNT CAGAATCTNNNNNNTNNATACGACTCACTNT AGGGCGAATTGGC GGCCAA ... TCATANCTGTTT CCTGTGTGAAATTGTTATCCGCTNAAAATTCCACACAATNT ACGATCNNNAANCATAAAG TGTAAAGCCTGGGGGTGCCTAATGGAGTGAG ... TCCCTCCCGCANNCCTGAGGAGGGAGAGGGGATTTATGGATCTTCTAAGA TNT ... Quality >S03052-35_P07.phd 9 8 8 5 4 4 5 4 4 5 8 1 ...

  6. Coevolutionary patterning of teeth and taste buds.

    Science.gov (United States)

    Bloomquist, Ryan F; Parnell, Nicholas F; Phillips, Kristine A; Fowler, Teresa E; Yu, Tian Y; Sharpe, Paul T; Streelman, J Todd

    2015-11-01

    Teeth and taste buds are iteratively patterned structures that line the oro-pharynx of vertebrates. Biologists do not fully understand how teeth and taste buds develop from undifferentiated epithelium or how variation in organ density is regulated. These organs are typically studied independently because of their separate anatomical location in mammals: teeth on the jaw margin and taste buds on the tongue. However, in many aquatic animals like bony fishes, teeth and taste buds are colocalized one next to the other. Using genetic mapping in cichlid fishes, we identified shared loci controlling a positive correlation between tooth and taste bud densities. Genome intervals contained candidate genes expressed in tooth and taste bud fields. sfrp5 and bmper, notable for roles in Wingless (Wnt) and bone morphogenetic protein (BMP) signaling, were differentially expressed across cichlid species with divergent tooth and taste bud density, and were expressed in the development of both organs in mice. Synexpression analysis and chemical manipulation of Wnt, BMP, and Hedgehog (Hh) pathways suggest that a common cichlid oral lamina is competent to form teeth or taste buds. Wnt signaling couples tooth and taste bud density and BMP and Hh mediate distinct organ identity. Synthesizing data from fish and mouse, we suggest that the Wnt-BMP-Hh regulatory hierarchy that configures teeth and taste buds on mammalian jaws and tongues may be an evolutionary remnant inherited from ancestors wherein these organs were copatterned from common epithelium. PMID:26483492

  7. Role of SAGA in the asymmetric segregation of DNA circles during yeast ageing

    OpenAIRE

    Denoth-Lippuner, Annina; Krzyzanowski, Marek Konrad; Stober, Catherine; Barral, Yves

    2014-01-01

    eLife digest Budding yeast is a microorganism that has been widely studied to understand how it and many other organisms, including animals, age over time. This yeast is so named because it proliferates by ‘budding’ daughter cells out of the surface of a mother cell. For each daughter cell that buds, the mother cell loses some fitness and eventually dies after a certain number of budding events. This process is called ‘replicative ageing’, and it also resembles the way that stem cells age. In...

  8. HIV Pol inhibits HIV budding and mediates the severe budding defect of Gag-Pol.

    Directory of Open Access Journals (Sweden)

    Xin Gan

    Full Text Available The prevailing hypothesis of HIV budding posits that the viral Gag protein drives budding, and that the Gag p6 peptide plays an essential role by recruiting host-cell budding factors to sites of HIV assembly. HIV also expresses a second Gag protein, p160 Gag-Pol, which lacks p6 and fails to bud from cells, consistent with the prevailing hypothesis of HIV budding. However, we show here that the severe budding defect of Gag-Pol is not caused by the absence of p6, but rather, by the presence of Pol. Specifically, we show that (i the budding defect of Gag-Pol is unaffected by loss of HIV protease activity and is therefore an intrinsic property of the Gag-Pol polyprotein, (ii the N-terminal 433 amino acids of Gag and Gag-Pol are sufficient to drive virus budding even though they lack p6, (iii the severe budding defect of Gag-Pol is caused by a dominant, cis-acting inhibitor of budding in the HIV Pol domain, and (iv Gag-Pol inhibits Gag and virus budding in trans, even at normal levels of Gag and Gag-Pol expression. These and other data support an alternative hypothesis of HIV budding as a process that is mediated by the normal, non-viral pathway of exosome/microvesicle biogenesis.

  9. Dissection and design of yeast prions.

    OpenAIRE

    Osherovich, Lev Z; Cox, Brian S; Mick F Tuite; Weissman, Jonathan S

    2004-01-01

    Many proteins can misfold into beta-sheet-rich, self-seeding polymers (amyloids). Prions are exceptional among such aggregates in that they are also infectious. In fungi, prions are not pathogenic but rather act as epigenetic regulators of cell physiology, providing a powerful model for studying the mechanism of prion replication. We used prion-forming domains from two budding yeast proteins (Sup35p and New1p) to examine the requirements for prion formation and inheritance. In both proteins, ...

  10. Conflict between noise and plasticity in yeast.

    OpenAIRE

    Lehner, Ben

    2010-01-01

    Gene expression responds to changes in conditions but also stochastically among individuals. In budding yeast, both expression responsiveness across conditions (“plasticity”) and cell-to-cell variation (“noise”) have been quantified for thousands of genes and found to correlate across genes. It has been argued therefore that noise and plasticity may be strongly coupled and mechanistically linked. This is consistent with some theoretical ideas, but a strong coupling between noise and plasticit...

  11. Repellence of the red bud borer (Resseliella oculiperda) to grafted apple trees by impregnation of budding tape with essential oils

    NARCIS (Netherlands)

    Tol, van R.W.H.M.; Linden, van der A.; Swarts, H.J.; Visser, J.H.

    2007-01-01

    The red bud borer Resseliella oculiperda (Rübs.) is a pest insect of apple trees when rootstocks are grafted with scion buds by shield budding. The female midges are attracted to the wounds of the grafted buds where they lay their eggs. The larvae feed on the cambium and destroy the buds completely

  12. Mum, this bud’s for you: where do you want it? Roles for Cdc42 in controlling bud site selection in Saccharomyces cerevisiae

    OpenAIRE

    Nelson, W. James

    2003-01-01

    The generation of asymmetric cell shapes is a recurring theme in biology. In budding yeast, one form of cell asymmetry occurs for division and is generated by anisotropic growth of the mother cell to form a daughter cell bud. Previous genetic studies uncovered key roles for the small GTPase Cdc42 in organizing the actin cytoskeleton and vesicle delivery to the site of bud growth,(1,2) but a recent paper has also raised questions about how control of Cdc42 activity is integrated into a propose...

  13. Multistep Phosphorelay Proteins Transmit Oxidative Stress Signals to the Fission Yeast Stress-activated Protein Kinase

    OpenAIRE

    Nguyen, Aaron Ngocky; Lee, Albert; Place, Warren; Shiozaki, Kazuhiro

    2000-01-01

    In response to oxidative stress, eukaryotic cells induce transcription of genes required for detoxification of oxidants. Here we present evidence that oxidative stress stimuli are transmitted by a multistep phosphorelay system to the Spc1/Sty1 stress-activated protein kinase in the fission yeast Schizosaccharomyces pombe. The fission yeast mpr1+ gene encodes a novel protein with a histidine-containing phosphotransfer domain homologous to the budding yeast Ypd1. Spc1 activation upon oxidative ...

  14. Off-Target Effects of Psychoactive Drugs Revealed by Genome-Wide Assays in Yeast

    OpenAIRE

    Ericson, Elke; Gebbia, Marinella; Heisler, Lawrence E.; Wildenhain, Jan; Tyers, Mike; Giaever, Guri; Nislow, Corey

    2008-01-01

    To better understand off-target effects of widely prescribed psychoactive drugs, we performed a comprehensive series of chemogenomic screens using the budding yeast Saccharomyces cerevisiae as a model system. Because the known human targets of these drugs do not exist in yeast, we could employ the yeast gene deletion collections and parallel fitness profiling to explore potential off-target effects in a genome-wide manner. Among 214 tested, documented psychoactive drugs, we identified 81 comp...

  15. Un-“ESCRT”-ed Budding

    Directory of Open Access Journals (Sweden)

    Mark Yondola

    2011-01-01

    Full Text Available In their recent publication, Rossman et al. [1] describe how the inherent budding capability of its M2 protein allows influenza A virus to bypass recruitment of the cellular ESCRT machinery enlisted by several other enveloped RNA and DNA viruses, including HIV, Ebola, rabies, herpes simplex type 1 and hepatitis B. Studies from the same laboratory [2] and other laboratories [3–6] indicate that budding of plasmid-derived virus-like particles can be mediated by the influenza virus hemagglutinin and neuraminidase proteins in the absence of M2. These events are also independent of canonical ESCRT components [2,7]. Understanding how intrinsic properties of these influenza virus proteins permit ESCRT-independent budding expands our understanding of the budding process itself.

  16. Shrinkage of ipsilateral taste buds and hyperplasia of contralateral taste buds following chorda tympani nerve transection

    Directory of Open Access Journals (Sweden)

    Yi-ke Li

    2015-01-01

    Full Text Available The morphological changes that occur in the taste buds after denervation are not well understood in rats, especially in the contralateral tongue epithelium. In this study, we investigated the time course of morphological changes in the taste buds following unilateral nerve transection. The role of the trigeminal component of the lingual nerve in maintaining the structural integrity of the taste buds was also examined. Twenty-four Sprague-Dawley rats were randomly divided into three groups: control, unilateral chorda tympani nerve transection and unilateral chorda tympani nerve transection + lingual nerve transection. Rats were allowed up to 42 days of recovery before being euthanized. The taste buds were visualized using a cytokeratin 8 antibody. Taste bud counts, volumes and taste receptor cell numbers were quantified and compared among groups. No significant difference was detected between the chorda tympani nerve transection and chorda tympani nerve transection + lingual nerve transection groups. Taste bud counts, volumes and taste receptor cell numbers on the ipsilateral side all decreased significantly compared with control. On the contralateral side, the number of taste buds remained unchanged over time, but they were larger, and taste receptor cells were more numerous postoperatively. There was no evidence for a role of the trigeminal branch of the lingual nerve in maintaining the structural integrity of the anterior taste buds.

  17. Comparative live-cell imaging analyses of SPA-2, BUD-6 and BNI-1 in Neurospora crassa reveal novel features of the filamentous fungal polarisome.

    Directory of Open Access Journals (Sweden)

    Alexander Lichius

    Full Text Available A key multiprotein complex involved in regulating the actin cytoskeleton and secretory machinery required for polarized growth in fungi, is the polarisome. Recognized core constituents in budding yeast are the proteins Spa2, Pea2, Aip3/Bud6, and the key effector Bni1. Multicellular fungi display a more complex polarized morphogenesis than yeasts, suggesting that the filamentous fungal polarisome might fulfill additional functions. In this study, we compared the subcellular organization and dynamics of the putative polarisome components BUD-6 and BNI-1 with those of the bona fide polarisome marker SPA-2 at various developmental stages of Neurospora crassa. All three proteins exhibited a yeast-like polarisome configuration during polarized germ tube growth, cell fusion, septal pore plugging and tip repolarization. However, the localization patterns of all three proteins showed spatiotemporally distinct characteristics during the establishment of new polar axes, septum formation and cytokinesis, and maintained hyphal tip growth. Most notably, in vegetative hyphal tips BUD-6 accumulated as a subapical cloud excluded from the Spitzenkörper (Spk, whereas BNI-1 and SPA-2 partially colocalized with the Spk and the tip apex. Novel roles during septal plugging and cytokinesis, connected to the reinitiation of tip growth upon physical injury and conidial maturation, were identified for BUD-6 and BNI-1, respectively. Phenotypic analyses of gene deletion mutants revealed additional functions for BUD-6 and BNI-1 in cell fusion regulation, and the maintenance of Spk integrity. Considered together, our findings reveal novel polarisome-independent functions of BUD-6 and BNI-1 in Neurospora, but also suggest that all three proteins cooperate at plugged septal pores, and their complex arrangement within the apical dome of mature hypha might represent a novel aspect of filamentous fungal polarisome architecture.

  18. Oxytocin signaling in mouse taste buds.

    Directory of Open Access Journals (Sweden)

    Michael S Sinclair

    Full Text Available BACKGROUND: The neuropeptide, oxytocin (OXT, acts on brain circuits to inhibit food intake. Mutant mice lacking OXT (OXT knockout overconsume salty and sweet (i.e. sucrose, saccharin solutions. We asked if OXT might also act on taste buds via its receptor, OXTR. METHODOLOGY/PRINCIPAL FINDINGS: Using RT-PCR, we detected the expression of OXTR in taste buds throughout the oral cavity, but not in adjacent non-taste lingual epithelium. By immunostaining tissues from OXTR-YFP knock-in mice, we found that OXTR is expressed in a subset of Glial-like (Type I taste cells, and also in cells on the periphery of taste buds. Single-cell RT-PCR confirmed this cell-type assignment. Using Ca2+ imaging, we observed that physiologically appropriate concentrations of OXT evoked [Ca2+]i mobilization in a subset of taste cells (EC50 approximately 33 nM. OXT-evoked responses were significantly inhibited by the OXTR antagonist, L-371,257. Isolated OXT-responsive taste cells were neither Receptor (Type II nor Presynaptic (Type III cells, consistent with our immunofluorescence observations. We also investigated the source of OXT peptide that may act on taste cells. Both RT-PCR and immunostaining suggest that the OXT peptide is not produced in taste buds or in their associated nerves. Finally, we also examined the morphology of taste buds from mice that lack OXTR. Taste buds and their constituent cell types appeared very similar in mice with two, one or no copies of the OXTR gene. CONCLUSIONS/SIGNIFICANCE: We conclude that OXT elicits Ca2+ signals via OXTR in murine taste buds. OXT-responsive cells are most likely a subset of Glial-like (Type I taste cells. OXT itself is not produced locally in taste tissue and is likely delivered through the circulation. Loss of OXTR does not grossly alter the morphology of any of the cell types contained in taste buds. Instead, we speculate that OXT-responsive Glial-like (Type I taste bud cells modulate taste signaling and afferent

  19. Single-particle tracking of quantum dot-conjugated prion proteins inside yeast cells

    International Nuclear Information System (INIS)

    Research highlights: → We develop a method to track a quantum dot-conjugated protein in yeast cells. → We incorporate the conjugated quantum dot proteins into yeast spheroplasts. → We track the motions by conventional or 3D tracking microscopy. -- Abstract: Yeast is a model eukaryote with a variety of biological resources. Here we developed a method to track a quantum dot (QD)-conjugated protein in the budding yeast Saccharomyces cerevisiae. We chemically conjugated QDs with the yeast prion Sup35, incorporated them into yeast spheroplasts, and tracked the motions by conventional two-dimensional or three-dimensional tracking microscopy. The method paves the way toward the individual tracking of proteins of interest inside living yeast cells.

  20. Single-particle tracking of quantum dot-conjugated prion proteins inside yeast cells

    Energy Technology Data Exchange (ETDEWEB)

    Tsuji, Toshikazu; Kawai-Noma, Shigeko [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan); Pack, Chan-Gi [Cellular Informatics Laboratory, RIKEN Advanced Science Institute, Wako-shi, Saitama 351-0198 (Japan); Terajima, Hideki [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan); Yajima, Junichiro; Nishizaka, Takayuki [Department of Physics, Gakushuin University, 1-5-1 Mejiro, Toshima-ku, Tokyo 171-8588 (Japan); Kinjo, Masataka [Laboratory of Molecular Cell Dynamics, Graduate School of Life Sciences, Hokkaido University, Sapporo 001-0021 (Japan); Taguchi, Hideki, E-mail: taguchi@bio.titech.ac.jp [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan)

    2011-02-25

    Research highlights: {yields} We develop a method to track a quantum dot-conjugated protein in yeast cells. {yields} We incorporate the conjugated quantum dot proteins into yeast spheroplasts. {yields} We track the motions by conventional or 3D tracking microscopy. -- Abstract: Yeast is a model eukaryote with a variety of biological resources. Here we developed a method to track a quantum dot (QD)-conjugated protein in the budding yeast Saccharomyces cerevisiae. We chemically conjugated QDs with the yeast prion Sup35, incorporated them into yeast spheroplasts, and tracked the motions by conventional two-dimensional or three-dimensional tracking microscopy. The method paves the way toward the individual tracking of proteins of interest inside living yeast cells.

  1. Competitive canalization of PIN-dependent auxin flow from axillary buds controls pea bud outgrowth.

    Science.gov (United States)

    Balla, Jozef; Kalousek, Petr; Reinöhl, Vilém; Friml, Jiří; Procházka, Stanislav

    2011-02-01

    Shoot branching is one of the major determinants of plant architecture. Polar auxin transport in stems is necessary for the control of bud outgrowth by a dominant apex. Here, we show that following decapitation in pea (Pisum sativum L.), the axillary buds establish directional auxin export by subcellular polarization of PIN auxin transporters. Apical auxin application on the decapitated stem prevents this PIN polarization and canalization of laterally applied auxin. These results support a model in which the apical and lateral auxin sources compete for primary channels of auxin transport in the stem to control the outgrowth of axillary buds. PMID:21219506

  2. Assessment of Yeast Aging by Flow Cytometry

    Czech Academy of Sciences Publication Activity Database

    Baszczyňski, Martin; Kuřec, M.; Novák, Pavel; Brányik, Tomáš; Růžička, Marek; Drahoš, Jiří

    Bratislava : Slovak University of Technology, 2009 - (Markoš, J.), s. 317 ISBN 978-80-227-3072-3. [International Conference of Slovak Society of Chemical Engineering /36./. Tatranské Matliare (SK), 25.05.2009-29.05.2009] R&D Projects: GA ČR GA104/07/1110; GA ČR(CZ) GD104/08/H055; GA ČR GA104/06/1418 Institutional research plan: CEZ:AV0Z40720504 Keywords : yeast * aging * bud scars Subject RIV: CI - Industrial Chemistry, Chemical Engineering

  3. Identification and Quality Assessment of Chrysanthemum Buds by CE Fingerprinting

    Directory of Open Access Journals (Sweden)

    Xiaoping Xing

    2015-01-01

    Full Text Available A simple and efficient fingerprinting method for chrysanthemum buds was developed with the aim of establishing a quality control protocol based on biochemical makeup. Chrysanthemum bud samples were successively extracted by water and alcohol. The fingerprints of the chrysanthemum buds samples were obtained using capillary electrophoresis and electrochemical detection (CE-ED employing copper and carbon working electrodes to capture all of the chemical information. 10 batches of chrysanthemum buds were collected from different regions and various factories to establish the baseline fingerprint. The experimental data of 10 batches electropherogram buds by CE were analyzed by correlation coefficient and the included angle cosine methods. A standard chrysanthemum bud fingerprint including 24 common peaks was established, 12 from each electrode, which was successfully applied to identify and distinguish between chrysanthemum buds from 2 other chrysanthemum species. These results demonstrate that fingerprint analysis can be used as an important criterion for chrysanthemum buds quality control.

  4. Bilingual Buds: The Evolution of a Program

    Science.gov (United States)

    Huang, Sharon

    2009-01-01

    The impetus to begin Bilingual Buds came about six years ago when the author, pregnant with twins and commuting into New York City, was reading about the numerous cognitive benefits for children of acquiring a second language early in their lives. She was surprised to learn that even by the age of six months, children begin to lose the ability to…

  5. Assay for Spore Wall Integrity Using a Yeast Predator.

    Science.gov (United States)

    Okada, Hiroki; Neiman, Aaron M; Ohya, Yoshikazu

    2016-01-01

    During the budding yeast life cycle, a starved diploid cell undergoes meiosis followed by production of four haploid spores, each surrounded by a spore wall. The wall allows the spores to survive in harsh environments until conditions improve. Spores are also more resistant than vegetative cells to treatments such as ether vapor, glucanases, heat shock, high salt concentrations, and exposure to high or low pH, but the relevance of these treatments to natural environmental stresses remains unclear. This protocol describes a method for assaying the yeast spore wall under natural environmental conditions by quantifying the survival of yeast spores that have passed through the digestive system of a yeast predator, the fruit fly. PMID:27480715

  6. Requirement of RNA synthesis for bud morphogenesis in hydra

    International Nuclear Information System (INIS)

    Inhibition of RNA synthesis in hydra resulted in complete suppression of bud morphogenesis. A partial inhibition allowed the bud formation, but affected the development of nematocysts, gland cells and interstitial cells. These results indicate that bud morphogenesis in hydra is associated with new DNA-dependent RNA synthesis. (author)

  7. Concentration-Dependent Effects of Rhodiola Rosea on Long-Term Survival and Stress Resistance of Yeast Saccharomyces Cerevisiae: The Involvement of YAP 1 and MSN2/4 Regulatory Proteins

    OpenAIRE

    Bayliak, Maria M.; Burdyliuk, Nadia I.; Izers’ka, Lilia I.; Lushchak, Volodymyr I.

    2013-01-01

    Concentration-dependent effects of aqueous extract from R. rosea root on long-term survival and stress resistance of budding yeast Saccharomyces cerevisiae were studied. At low concentrations, R. rosea aqueous extract extended yeast chronological lifespan, enhanced oxidative stress resistance of stationary-phase cells and resistance to number stressors in exponentially growing cultures. At high concentrations, R. rosea extract sensitized yeast cells to stresses and shortened yeast lifespan. T...

  8. Testing a Mathematical Model of the Yeast Cell Cycle

    OpenAIRE

    Cross, Frederick R.; Archambault, Vincent; Miller, Mary; Klovstad, Martha

    2002-01-01

    We derived novel, testable predictions from a mathematical model of the budding yeast cell cycle. A key qualitative prediction of bistability was confirmed in a strain simultaneously lacking cdc14 and G1 cyclins. The model correctly predicted quantitative dependence of cell size on gene dosage of the G1 cyclin CLN3, but it incorrectly predicted strong genetic interactions between G1 cyclins and the anaphase- promoting complex specificity factor Cdh1. To provide cons...

  9. Molecular Mechanism of Arenavirus Assembly and Budding

    OpenAIRE

    Shuzo Urata; Jiro Yasuda

    2012-01-01

    Arenaviruses have a bisegmented negative-strand RNA genome, which encodes four viral proteins: GP and NP by the S segment and L and Z by the L segment. These four viral proteins possess multiple functions in infection, replication and release of progeny viruses from infected cells. The small RING finger protein, Z protein is a matrix protein that plays a central role in viral assembly and budding. Although all arenaviruses encode Z protein, amino acid sequence alignment showed a huge variety ...

  10. Use of the BioGRID Database for Analysis of Yeast Protein and Genetic Interactions.

    Science.gov (United States)

    Oughtred, Rose; Chatr-aryamontri, Andrew; Breitkreutz, Bobby-Joe; Chang, Christie S; Rust, Jennifer M; Theesfeld, Chandra L; Heinicke, Sven; Breitkreutz, Ashton; Chen, Daici; Hirschman, Jodi; Kolas, Nadine; Livstone, Michael S; Nixon, Julie; O'Donnell, Lara; Ramage, Lindsay; Winter, Andrew; Reguly, Teresa; Sellam, Adnane; Stark, Chris; Boucher, Lorrie; Dolinski, Kara; Tyers, Mike

    2016-01-01

    The BioGRID database is an extensive repository of curated genetic and protein interactions for the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe, and the yeast Candida albicans SC5314, as well as for several other model organisms and humans. This protocol describes how to use the BioGRID website to query genetic or protein interactions for any gene of interest, how to visualize the associated interactions using an embedded interactive network viewer, and how to download data files for either selected interactions or the entire BioGRID interaction data set. PMID:26729909

  11. Characterisation of the nascent polypeptide-associated complex in fission yeast

    DEFF Research Database (Denmark)

    Andersen, Katrine M; Semple, Colin A; Hartmann-Petersen, Rasmus

    2007-01-01

    with other cell proteins, but has also been found to associate with DNA junctions, and to be involved in other processes including transcription regulation and mitochondrial protein import.Here, we characterize NAC in fission yeast. We find that NAC is associated with ribosomes, while a significant fraction...... defects in protein degradation. Accordingly, we find that the NAC UBA domain belongs to an ancient and distinct subgroup of the UBA family. In contrast to the situation with budding yeast, fission yeast cells devoid of NAC were not temperature sensitive. However, they displayed resistance to the amino...

  12. Fission Yeast Scm3: A CENP-A Receptor Required for Integrity of Subkinetochore Chromatin

    OpenAIRE

    Pidoux, Alison L.; Choi, Eun Shik; Abbott, Johanna K.R.; Liu, Xingkun; Kagansky, Alexander; Castillo, Araceli G.; Hamilton, Georgina L.; Richardson, William; Rappsilber, Juri; He, Xiangwei; Allshire, Robin C.

    2009-01-01

    Summary The mechanisms ensuring specific incorporation of CENP-A at centromeres are poorly understood. Mis16 and Mis18 are required for CENP-A localization at centromeres and form a complex that is conserved from fission yeast to human. Fission yeast sim1 mutants that alleviate kinetochore domain silencing are defective in Scm3Sp, the ortholog of budding yeast Scm3Sc. Scm3Sp depends on Mis16/18 for its centromere localization and like them is recruited to centromeres in late anaphase. Importa...

  13. Rif1 Controls DNA Replication Timing in Yeast through the PP1 Phosphatase Glc7

    OpenAIRE

    Stefano Mattarocci; Maksym Shyian; Laure Lemmens; Pascal Damay; Dogus Murat Altintas; Tianlai Shi; Clinton R. Bartholomew; Thomä, Nicolas H.; Christopher F.J. Hardy; David Shore

    2014-01-01

    The Rif1 protein, originally identified as a telomere-binding factor in yeast, has recently been implicated in DNA replication control from yeast to metazoans. Here, we show that budding yeast Rif1 protein inhibits activation of prereplication complexes (pre-RCs). This inhibitory function requires two N-terminal motifs, RVxF and SILK, associated with recruitment of PP1 phosphatase (Glc7). In G1 phase, we show both that Glc7 interacts with Rif1 in an RVxF/SILK-dependent manner and that two pro...

  14. Yeast Interacting Proteins Database: YMR124W, YLR031W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available in localizes to the cell periphery, cytoplasm, bud, and bud neck; interacts with Crm1p in two-hybrid assay; ... periphery, cytoplasm, bud, and bud neck; interacts with Crm1p in two-hybrid assay

  15. Budding yeast cDNA sequencing project: Y053_E12_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y053_E12_F.ab1 Y053_E12_F.ab1 - - Show Y053_E12_F.ab1 Seqid Y053_E12_F.ab1 Link to SGD Y053_E12_ ... 0 753 ABI TCTTCTGCTCTAAGCTGCTCGAGTGTAAACGACTTACACTACAT AGTTAA TACGACTCACTATTTGGCAT TCCTTAAGATTTGATCGAAATAGA ... TATTAA GAAAAACAAACTGTACAATCAATCAATCAATCAT CACAT AAAATGTTCAG CGAATTAATTAACTTCCAAAATGAAGGTCAT GAG ...

  16. Budding yeast cDNA sequencing project: Y004_M09_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y004_M09_F.ab1 Y004_M09_F.ab1 DB652777 DB652777 Show Y004_M09_F.ab1 Seqid Y004_M09_F.ab1 Link to ... TAGACGATGAGGTGTTTCCCTTATCTTTTGCCAATTA TCAATTTACCGAGCAT GTGTCACTTGGTGAGCAT TATTCACTCAATACTT CGGAAGATGCCAAATA ... ACTGT GTTCTCGTTAGATAACCCTCAAGAAAACAACTACAAACACCAAGCCAT GA ATAACGTCCAGGATTGTCGCAT GGCCGTCGCGGCCAAAACTACCCAGT ...

  17. Budding yeast cDNA sequencing project: Y031_N21_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y031_N21_F.ab1 - - - Show Y031_N21_F.ab1 Seqid Y031_N21_F.ab1 Link to SGD - Link to dbEST - Link ... TGGTACCGCGGCCGCG GATCTCCCTTTAGTGAGGGTTAATTGGATCCAGACAT GATAAGATACAT T GATGAGTTTGGACAAACCACAACTAGAATGCAGTGAA ... AAAAATGCTTTAT TTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCAT TATAAGCTGCA ATAAACAAGTTAACAACAACAATTGCAT TCAT TTTATGT ...

  18. Budding yeast cDNA sequencing project: Y045_B09_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y045_B09_F.ab1 Y045_B09_F.ab1 - - Show Y045_B09_F.ab1 Seqid Y045_B09_F.ab1 Link to SGD Y045_B09_ ... b1 753 0 753 ABI ATTCTGCTTAAGCTGCTCGAGTGTAAACGACGGCCAT TCCCCAT TAAAGA CGACTCACTATAGGGAATTCCTTAAGATTTGGAGCAC ... TCACAACAAATAGCCAAAAATGCCCGTAAAGCAGGGA ATATTTTGAAAACCAT CTCAAACGAGGGCAGATCAGATATTTTATACAAA ATTCACGATGCCCTGA ...

  19. Budding yeast cDNA sequencing project: Y072_P20_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y072_P20_F.ab1 Y072_P20_F.ab1 DB661654 DB661654 Show Y072_P20_F.ab1 Seqid Y072_P20_F.ab1 Link to ... AATGCTGAGAT CGTTATTGCAAAGCGGCCACCGCAGGGTGGTTGCTTCTTCAT GTGCTACC AT GGTGCGTTGCAGTTCCTCGTCGACCTCCGCGTTGGCGTAC ... TCCCTTGCCCACACTAGACACTCCTTCCT GGAATGCCAACAGTGCCGTTTCAT CCATCAT TTACGAAACACCAGCGCCT TCTCGTCAACCAAGAAAACAGCAT ...

  20. Budding yeast cDNA sequencing project: Y073_K23_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y073_K23_F.ab1 - - - Show Y073_K23_F.ab1 Seqid Y073_K23_F.ab1 Link to SGD - Link to dbEST - Link ... TGGTACCGCGGCCGCGG ATCTCCCTTTAGTGAGGGTTAATTGGATCCAGACAT GATAAGATACAT TG ATGAGTTTGGACAAACCACAACTAGAATGCAGTGAA ... AAAAATGCTTTATT TGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCAT TATAAGCTGCAA TAAACAAGTTAACAACAACAATTGCAT TCAT TTTATGT ...

  1. Budding yeast cDNA sequencing project: Y102_E19_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y102_E19_F.ab1 - - - Show Y102_E19_F.ab1 Seqid Y102_E19_F.ab1 Link to SGD - Link to dbEST - Link ... _F.ab1 753 0 753 ABI GCTCTAAGCTGCTCGAGTGTAAACGACGGCCAT TACGTATTTTATACGAC TCACTATAGGGAATTCCTTAAGATTAAATGTGG ... AAACTGGATAAAAACCTTTGAA GAATTTGGAACAACCCCCACCTAAATGGCAT GGAAAAAAAGGCTTTATTT GTAAAATTTGTGAGGCTATTGCTTTATTTGT ...

  2. Budding yeast cDNA sequencing project: Y114_D11_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y114_D11_F.ab1 Y114_D11_F.ab1 DB668015 DB668015 Show Y114_D11_F.ab1 Seqid Y114_D11_F.ab1 Link to ... CGAGTGTNNNAAGAGGNCATCTCTNAAATAGGG GANTNANNATAGGGAATTCC TTAAGATTTGGCGAGCAAATTAACAGACCT AATTGAACTGGAAAACATGT ... AAACCCATTGACAACTACATCACGA ACAGTGTTCGCCTTTTTGAGGTGAATCC ATCTCAAACGCTCTTCTCC ATA TCGTATAAACCACCAACACAGAAGACAG ... ACACCAAAGTGTCC TTTAGAAC TCATAACTCGCATTTATCC TTGAACTATAAATTTACTACTAA ... GATGTTTCAAGATTACTTAGTGCATTAGGCCCACGAGGCGTATCTATA ACTCC AGGTAAAATTGAAAAAATAGCACAGTCGAAGAAGAAAAATAACAA AATAA ...

  3. Budding yeast cDNA sequencing project: Y077_A07_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y077_A07_F.ab1 - - - Show Y077_A07_F.ab1 Seqid Y077_A07_F.ab1 Link to SGD - Link to dbEST - Link ... GGGGGGG GGGGGGGGGGGGGTATTCGTTTTAAAGGAATAAATTCGGGGTTTCC CCTT TCC ... Quality >Y077_A07_F.ab1 203 0 203 ABI 7 7 ...

  4. Budding yeast cDNA sequencing project: Y102_P06_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y102_P06_F.ab1 - - - Show Y102_P06_F.ab1 Seqid Y102_P06_F.ab1 Link to SGD - Link to dbEST - Link ... TTGACTGNNGCGTGTGTT GAGGTGGGGGGGAGGGAAATTATAAAAGAGGATCC GGGGAGAGGGGGGTT TCTCC ANTTNTTNGGNGNNNNNNNNNNNNNNNCNT ... NANNNNNNNTGTTTTAGGGGGGGGGG AGACTTTTTTTTGGGGGGGTTTTTTCC CCCCAAAAAAAAAAATTTTTGTG TGTGGGCCCCCCCCCCACCGGGGGAAA ... AAAAAATTTTTTTTAAAAAAGGG GGGGGTTTTTTTTTTTTCC CCCCGCGGGGAAAAAAAAAAAAAAAAAGCCC TCTTTTTTTTTTTTGGAGG ... TTAAATAAACCCCCCGCCAACCCCCCCCGGGAGGTTTTTGGGCGCCCCTT TCC ... Quality >Y102_P06_F.ab1 653 0 653 ABI 12 12 12 12 ...

  5. Budding yeast cDNA sequencing project: Y086_E03_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y086_E03_F.ab1 Y086_E03_F.ab1 DB663490 DB663490 Show Y086_E03_F.ab1 Seqid Y086_E03_F.ab1 Link to ... CGAGTGTAAAAGTACGGATACAAAAGAGGGGAC GACTCACTATAGTTACTTCC TTAAGATTTGAGCGATGAGAGCAGCTACAT AACACATAGTAAATCACACA ... TCTACGCAACACACACACACACGCATACAC TCACCCTCATGACAGATCC CCACTTGAACACGCCCCAAGTGAGCACGTCA CCCACATTTGAAAGATCAC ... AGGACTTCC TCAACATCGACGAACCGCCCTG TGCACAGGAAACACCTAGTGTTTCTACA ... TTCAACCTCC CGGGTCC AAGCG CTCC CGCTCAAAGCGTAGACAAGCCAGTCC CCATGATT ...

  6. Budding yeast cDNA sequencing project: Y108_J23_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y108_J23_F.ab1 Y108_J23_F.ab1 - - Show Y108_J23_F.ab1 Seqid Y108_J23_F.ab1 Link to SGD Y108_J23_ ... GAGTGTAAACGACGGCCATAACTTATTTAAT ACGACTCACTATAGGGAATTCC TTAAGATTTTAGGGATGCTGTGGAAAAG GCTCTTAAACAGACTAACGGAA ... ATGCAGAATTTGCTGCATCC CTCC TTTT CC AATGAGCAACCACTGATATTGTGATCGGCCTCTACTTATG ... CTGTTAATATATAATATGCA TAGTTGTATTTGTGCCTCAATGTGCGCCATTCC TGTGTTGGACAAAGCCG CAAGGGCCAAGGCAAGATCC CAGTTTGAAAACG ... ACCCCCGGCCGCTAGAT GCTCC CTTTAGTGACGGTAAATTGCATCC GCACTGACAAGATACTTTGAC GAGTT ...

  7. Budding yeast cDNA sequencing project: Y094_K12_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y094_K12_F.ab1 Y094_K12_F.ab1 DB664754 DB664754 Show Y094_K12_F.ab1 Seqid Y094_K12_F.ab1 Link to ... GAGTGTAAACGACGGCCAGTACGTATTTAATA CGACTCACTATAGGGAATTCC TTAAGATTTGAACCACGTCACATTATACT CATAACCATAGAATTCACAGA ... TATATTACACCTTG GTTTTTGCCATTCTAGTGGTGGAGATTTTCATGTTCTCC ATTCTAGCCCT ACCAATCC CTTCTAGATACCGTAGGCCTCTCACCTTACT ... GTTATTAAAGC CGTTCAAATCCTCC ACAGTGCAAGTTGCGATCAAGTGTGTACTTGGGTTC ATTCTTTTGCT ... GGGCTAGTCATAGAACTTTTAACCATGAAAGACATATACAGAGCATCGC CTCC AGTAGCCTCC AGCGATGTCAAGAAGAACGACTCTGTTACTGCCGAA GCTG ...

  8. Budding yeast cDNA sequencing project: Y091_K02_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y091_K02_F.ab1 - - - Show Y091_K02_F.ab1 Seqid Y091_K02_F.ab1 Link to SGD - Link to dbEST - Link ... GNNATATACAGATATAAAAGAAGATAAATAAAATTTTTGT TTATAACCAATCC ACGAGATAAATTATTATTCATAACTTGGTTAAACTTT AAAGTGGGGGTGT ... TGACTAAGAATATATCTTACTATA ATTTATTAAAAAAAAAATAACTACCTTCC AGTATTAATATATTATTTTGT AATATCTAAAACAATATTTTTACGAAATG ... T TTTCTAAGATAAAACAAAAACTAATAATAAAATTTTTTTTTTCTTTTAAT CC AAAATTGGGAGGGGGGTGGATTTAATATCTCTATAAAAGATTTTCTTC C ... ACATACCGCATAACATAATGATTTAAA AGAGTGAGAGTATTTATAAACAATCC ATATTCC TTATATCATAATATATT TACTATACTTACACCTTAAGCTTATT ...

  9. Budding yeast cDNA sequencing project: Y102_K19_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y102_K19_F.ab1 Y102_K19_F.ab1 - - Show Y102_K19_F.ab1 Seqid Y102_K19_F.ab1 Link to SGD Y102_K19_ ... GAGTGTAAACGACGGCCAGCACGTATTTAATACGA CTCACTATAGGGAATTCC TTAAGATTTATCAAGAACTTGGTTTGATATTT CACCAACACACACAAAAA ... T TGAGATTGGCTTTGCAAAGAAAAGACATTGAGGTTGTTGCTGTCAACGAT CC ATTTATCTCTAACGATTATGCTGCTTACATGGTCAAGTACGATTCTAC T ... CATGGTAGATACAAGGGTACTGTTTCC CATGACGACAAGCACATCATCA TTGATGGTGTCAAGATCGCTACCTACCA ... ACCCAGCTAACTTG CCATGGGGTTCTCTAAAGATCGATGTCGCTGTTGACTCC ACTGGTGTTTT CAAGGAATTGGACACCGCTCAAAAGCACATTGACGCTGG ...

  10. Budding yeast cDNA sequencing project: Y016_M23_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y016_M23_F.ab1 Y016_M23_F.ab1 - - Show Y016_M23_F.ab1 Seqid Y016_M23_F.ab1 Link to SGD Y016_M23_ ... GAGTGTAAACGACGGCCAGTATCTATTTAATA CGACTCACTATAGGGAATTCC TTAAGATTTACTCC TCTCAGCCTCAGTCA TCATCC GCTCAAACCCAGCCG ... TCGTTCC AACCTAAAGAAAACCTTTTCGT ACCACGGGTAAAAATTTTGCATCGTGAT ... TAAAATAATA AGAATTATATATTTTATGATTATATTATTACATAAAGTATTCC CCATTAT AAATTCTGAGTTTCGTAAAAAAAAAAAAAAAAAAAAAAAAAAA ... AAAAAAA AAAAAAAAAAAAAAAAAAGTACCGCGGCCGCGGATCTCC CTTTAGGGAGG GTTAATTGGATCC AAACATGATAAAATACATTGATGAGT ...

  11. Budding yeast cDNA sequencing project: Y074_N01_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y074_N01_F.ab1 - - - Show Y074_N01_F.ab1 Seqid Y074_N01_F.ab1 Link to SGD - Link to dbEST - Link ... to UC SC ... Genome Browser - Sequenc e >Y074_N01_F.ab1 301 0 ... 301 ABI GAACCCC AACCCCC AAAAAAGGC ATC AGGNATTCC GAAAC AC ACCCCC AA CC AC C AAAC AC ACC AAC ACC AAC AAC AAC AC AC AC AAC AAACCC ACCCCC ... AAAAAAAAC ... AC ACCC AC AC AACCCC AAAC AC AAC AAAC AC AAAAAAAC AA AAAAACC AC AA ...

  12. Image processing and classification algorithm for yeast cell morphology in a microfluidic chip

    Science.gov (United States)

    Yang Yu, Bo; Elbuken, Caglar; Ren, Carolyn L.; Huissoon, Jan P.

    2011-06-01

    The study of yeast cell morphology requires consistent identification of cell cycle phases based on cell bud size. A computer-based image processing algorithm is designed to automatically classify microscopic images of yeast cells in a microfluidic channel environment. The images were enhanced to reduce background noise, and a robust segmentation algorithm is developed to extract geometrical features including compactness, axis ratio, and bud size. The features are then used for classification, and the accuracy of various machine-learning classifiers is compared. The linear support vector machine, distance-based classification, and k-nearest-neighbor algorithm were the classifiers used in this experiment. The performance of the system under various illumination and focusing conditions were also tested. The results suggest it is possible to automatically classify yeast cells based on their morphological characteristics with noisy and low-contrast images.

  13. Breadth of Tuning and Taste Coding in Mammalian Taste Buds

    OpenAIRE

    Tomchik, Seth M.; Berg, Stephanie; Kim, Joung Woul; Chaudhari, Nirupa; Roper, Stephen D.

    2007-01-01

    A longstanding question in taste research concerns taste coding and, in particular, how broadly are individual taste bud cells tuned to taste qualities (sweet, bitter, umami, salty, and sour). Taste bud cells express G-protein-coupled receptors for sweet, bitter, or umami tastes but not in combination. However, responses to multiple taste qualities have been recorded in individual taste cells. We and others have shown previously there are two classes of taste bud cells directly involved in gu...

  14. Processing Umami and Other Tastes in Mammalian Taste Buds

    OpenAIRE

    Roper, Stephen D.; Chaudhari, Nirupa

    2009-01-01

    Neuroscientists are now coming to appreciate that a significant degree of information processing occurs in the peripheral sensory organs of taste prior to signals propagating to the brain. Gustatory stimulation causes taste bud cells to secrete neurotransmitters that act on adjacent taste bud cells (paracrine transmitters) as well as on primary sensory afferent fibers (neurocrine transmitters). Paracrine transmission, representing cell-cell communication within the taste bud, has the potentia...

  15. BioGRID: A Resource for Studying Biological Interactions in Yeast.

    Science.gov (United States)

    Oughtred, Rose; Chatr-aryamontri, Andrew; Breitkreutz, Bobby-Joe; Chang, Christie S; Rust, Jennifer M; Theesfeld, Chandra L; Heinicke, Sven; Breitkreutz, Ashton; Chen, Daici; Hirschman, Jodi; Kolas, Nadine; Livstone, Michael S; Nixon, Julie; O'Donnell, Lara; Ramage, Lindsay; Winter, Andrew; Reguly, Teresa; Sellam, Adnane; Stark, Chris; Boucher, Lorrie; Dolinski, Kara; Tyers, Mike

    2016-01-01

    The Biological General Repository for Interaction Datasets (BioGRID) is a freely available public database that provides the biological and biomedical research communities with curated protein and genetic interaction data. Structured experimental evidence codes, an intuitive search interface, and visualization tools enable the discovery of individual gene, protein, or biological network function. BioGRID houses interaction data for the major model organism species--including yeast, nematode, fly, zebrafish, mouse, and human--with particular emphasis on the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe as pioneer eukaryotic models for network biology. BioGRID has achieved comprehensive curation coverage of the entire literature for these two major yeast models, which is actively maintained through monthly curation updates. As of September 2015, BioGRID houses approximately 335,400 biological interactions for budding yeast and approximately 67,800 interactions for fission yeast. BioGRID also supports an integrated posttranslational modification (PTM) viewer that incorporates more than 20,100 yeast phosphorylation sites curated through its sister database, the PhosphoGRID. PMID:26729913

  16. Essential Oil of Betula pendula Roth. Buds

    Directory of Open Access Journals (Sweden)

    Betül Demirci

    2004-01-01

    Full Text Available The essential oil of Betula pendula Roth. buds was obtained using both hydrodistillation and microdistillation techniques and their chemical compositions were analyzed using both gas chromatography (GC and gas chromatography–mass spectrometry (GC-MS. Overall, more than 50 compounds were identified representing 80% and 92% for hydrodistillation and microdistillation, respectively. The main components (by hydrodistillation and microdistillation, respectively found were α-copaene (12% and 10%, germacrene D (11% and 18% and δ-cadinene (11% and 15% in the analyzed essential oils. The microdistillation technique proved to be a useful tool and compliant alternative when compared to hydrodistillation.

  17. Essential Oil of Betula pendula Roth. Buds.

    Science.gov (United States)

    Demirci, Betül; Paper, Dietrich H; Demirci, Fatih; Can Başer, K Hüsnü; Franz, Gerhard

    2004-12-01

    The essential oil of Betula pendula Roth. buds was obtained using both hydrodistillation and microdistillation techniques and their chemical compositions were analyzed using both gas chromatography (GC) and gas chromatography-mass spectrometry (GC-MS). Overall, more than 50 compounds were identified representing 80% and 92% for hydrodistillation and microdistillation, respectively. The main components (by hydrodistillation and microdistillation, respectively) found were alpha-copaene (12% and 10%), germacrene D (11% and 18%) and delta-cadinene (11% and 15%) in the analyzed essential oils. The microdistillation technique proved to be a useful tool and compliant alternative when compared to hydrodistillation. PMID:15841263

  18. Cell surface recycling in yeast: mechanisms and machineries.

    Science.gov (United States)

    MacDonald, Chris; Piper, Robert C

    2016-04-15

    Sorting internalized proteins and lipids back to the cell surface controls the supply of molecules throughout the cell and regulates integral membrane protein activity at the surface. One central process in mammalian cells is the transit of cargo from endosomes back to the plasma membrane (PM) directly, along a route that bypasses retrograde movement to the Golgi. Despite recognition of this pathway for decades we are only beginning to understand the machinery controlling this overall process. The budding yeastSaccharomyces cerevisiae, a stalwart genetic system, has been routinely used to identify fundamental proteins and their modes of action in conserved trafficking pathways. However, the study of cell surface recycling from endosomes in yeast is hampered by difficulties that obscure visualization of the pathway. Here we briefly discuss how recycling is likely a more prevalent process in yeast than is widely appreciated and how tools might be built to better study the pathway. PMID:27068957

  19. Development Correlations of the Buds of Grapevine (Vitis vinifera L.

    Directory of Open Access Journals (Sweden)

    Liliana ROTARU

    2010-06-01

    Full Text Available The development characteristics of different buds of the grapevine are mainly related by stimulation and/or inhibition effects, the action of which is still inexplicable. The present study examines the development dynamics of the buds of a one-year old branch after excision of different buds and the application of ?-naphtyl acetic acid (ANA, as well as the growth capacity of each bud individually. We verified the effects of acrotony cited previously by various researchers. These effects are due to different developmental characteristics of which could to lay the groundwork for the improvement of different productions methods.

  20. Yeast Infection (Candidiasis)

    Science.gov (United States)

    ... rash and rashes clinical tools newsletter | contact Share | Yeast Infection (Candidiasis) Information for adults A A A This is a candida (yeast) infection of the skin folds of the abdomen. Overview ...

  1. Vaginal yeast infection

    Science.gov (United States)

    Yeast infection - vagina; Vaginal candidiasis; Monilial vaginitis ... Most women have a vaginal yeast infection at some time. Candida albicans is a common type of fungus. It is often found in small amounts in the ...

  2. Prions in Yeast

    OpenAIRE

    Liebman, Susan W; Chernoff, Yury O.

    2012-01-01

    The concept of a prion as an infectious self-propagating protein isoform was initially proposed to explain certain mammalian diseases. It is now clear that yeast also has heritable elements transmitted via protein. Indeed, the “protein only” model of prion transmission was first proven using a yeast prion. Typically, known prions are ordered cross-β aggregates (amyloids). Recently, there has been an explosion in the number of recognized prions in yeast. Yeast continues to lead the way in unde...

  3. Kinetics of human immunodeficiency virus budding and assembly

    Science.gov (United States)

    Zhang, Rui; Nguyen, Toan

    2009-03-01

    Human immunodeficiency virus (HIV) belongs to a large family of RNA viruses, retroviruses. Unlike budding of regular enveloped viruses, retroviruses bud concurrently with the assembly of retroviral capsids on the cell membrane. The kinetics of HIV (and other retroviruses) budding and assembly is therefore strongly affected by the elastic energy of the membrane and fundamentally different from regular viruses. The main result of this work shows that the kinetics is tunable from a fast budding process to a slow and effectively trapped partial budding process, by varying the attractive energy of retroviral proteins (call Gags), relative to the membrane elastic energy. When the Gag-Gag attraction is relatively high, the membrane elastic energy provides a kinetic barrier for the two pieces of the partial capsids to merge. This energy barrier determines the slowest step in the kinetics and the budding time. In the opposite limit, the membrane elastic energy provides not only a kinetic energy barrier, but a free energy barrier. The budding and assembly is effectively trapped at local free energy minimum, corresponding to a partially budded state. The time scale to escape from this metastable state is exponentially large. In both cases, our result fit with experimental measurements pretty well.

  4. An elastic model of partial budding of retroviruses

    Science.gov (United States)

    Zhang, Rui; Nguyen, Toan

    2008-03-01

    Retroviruses are characterized by their unique infection strategy of reverse transcription, in which the genetic information flows from RNA back to DNA. The most well known representative is the human immunodeficiency virus (HIV). Unlike budding of traditional enveloped viruses, retrovirus budding happens together with the formation of spherical virus capsids at the cell membrane. Led by this unique budding mechanism, we proposed an elastic model of retrovirus budding in this work. We found that if the lipid molecules of the membrane are supplied fast enough from the cell interior, the budding always proceeds to completion. In the opposite limit, there is an optimal size of partially budded virions. The zenith angle of these partially spherical capsids, α, is given by α˜(2̂/κσ)^1/4, where κ is the bending modulus of the membrane, σ is the surface tension of the membrane, and τ characterizes the strength of capsid protein interaction. If τ is large enough such that α˜π, the budding is complete. Our model explained many features of retrovirus partial budding observed in experiments.

  5. Yeast That Smell

    Directory of Open Access Journals (Sweden)

    Eugenia Y Xu

    2008-08-01

    Full Text Available The fundamental mechanism of olfactory receptor activation has been conserved from yeast to humans. Engineered yeast cells can smell some of the same odorants as humans can, which makes yeast an ideal model system for studying human olfaction. Furthermore, if engineered yeast cells are incorporated into sensory arrays, they can be used as biosensors or artificial noses.Keywords: Yeast, olfactory receptor, G protein-coupled receptor, biosensor, smellReceived: 31 July 2008 / Received in revised form: 6 August 2008, Accepted: 13 August 2008, Published online: 17 August 2008

  6. Development of Crystalline Peroxisomes in Methanol-Grown Cells of the Yeast Hansenula polymorpha and Its Relation to Environmental Conditions

    NARCIS (Netherlands)

    Veenhuis, M.; Dijken, J.P. van; Pilon, S.A.F.; Harder, W.

    1978-01-01

    The development of peroxisomes has been studied in cells of the yeast Hansenula polymorpha during growth on methanol in batch and chemostat cultures. During bud formation, new peroxisomes were generated by the separation of small peroxisomes from mature organelles in the mother cells. The number of

  7. This bud's for you: mechanisms of cellular nucleocytoplasmic trafficking via nuclear envelope budding.

    Science.gov (United States)

    Fradkin, Lee G; Budnik, Vivian

    2016-08-01

    The nuclear envelope (NE) physically separates the cytoplasmic and nuclear compartments. While this barrier provides advantages, it also presents a challenge for the nuclear export of large ribonucleoprotein (RNP) complexes. Decades-old dogma holds that all such border-crossing is via the nuclear pore complex (NPC). However, the diameter of the NPC central channel limits the passage of large cargos. Here, we review evidence that such large RNPs employ an endogenous NE-budding pathway, previously thought to be exclusive to the nuclear egress of Herpes viruses. We discuss this and other models proposed, the likelihood that this pathway is conserved, and the consequences of disrupting NE-budding for synapse development, localized translation of synaptic mRNAs, and laminopathies inducing accelerated aging. PMID:27236823

  8. Budding and Fission of a multiphase vesicle

    CERN Document Server

    Allain, J M; Allain, Jean-Marc; Amar, Martine Ben

    2005-01-01

    We present a model of bi-phasic vesicle in the limit of large surface tension. In this regime, the vesicle is completely stretched and well described by two spherical caps with a fold which concentrates the membrane stress. The conservation laws and geometric constraints restrict the space of possible shapes to a pair of solutions labeled by a parameter $\\tau$ given by {\\it line tension/pressure}. For a given $\\tau$ value, the two solutions differ by the length of the interface between domains. For a critical value $\\tau\\_c$, the two vesicle shapes become identical and no solution exists above this critical value. This model sheds new light on two proposed mechanisms (osmotic shocks and molecule absorption) to explain the budding and the fission in recent experiments.

  9. A Predictive Model for Yeast Cell Polarization in Pheromone Gradients

    Science.gov (United States)

    Calvez, Vincent; Voituriez, Raphaël; Gonçalves-Sá, Joana; Guo, Chin-Lin; Jiang, Xingyu; Murray, Andrew; Meunier, Nicolas

    2016-01-01

    Budding yeast cells exist in two mating types, a and α, which use peptide pheromones to communicate with each other during mating. Mating depends on the ability of cells to polarize up pheromone gradients, but cells also respond to spatially uniform fields of pheromone by polarizing along a single axis. We used quantitative measurements of the response of a cells to α-factor to produce a predictive model of yeast polarization towards a pheromone gradient. We found that cells make a sharp transition between budding cycles and mating induced polarization and that they detect pheromone gradients accurately only over a narrow range of pheromone concentrations corresponding to this transition. We fit all the parameters of the mathematical model by using quantitative data on spontaneous polarization in uniform pheromone concentration. Once these parameters have been computed, and without any further fit, our model quantitatively predicts the yeast cell response to pheromone gradient providing an important step toward understanding how cells communicate with each other. PMID:27077831

  10. A Predictive Model for Yeast Cell Polarization in Pheromone Gradients.

    Science.gov (United States)

    Muller, Nicolas; Piel, Matthieu; Calvez, Vincent; Voituriez, Raphaël; Gonçalves-Sá, Joana; Guo, Chin-Lin; Jiang, Xingyu; Murray, Andrew; Meunier, Nicolas

    2016-04-01

    Budding yeast cells exist in two mating types, a and α, which use peptide pheromones to communicate with each other during mating. Mating depends on the ability of cells to polarize up pheromone gradients, but cells also respond to spatially uniform fields of pheromone by polarizing along a single axis. We used quantitative measurements of the response of a cells to α-factor to produce a predictive model of yeast polarization towards a pheromone gradient. We found that cells make a sharp transition between budding cycles and mating induced polarization and that they detect pheromone gradients accurately only over a narrow range of pheromone concentrations corresponding to this transition. We fit all the parameters of the mathematical model by using quantitative data on spontaneous polarization in uniform pheromone concentration. Once these parameters have been computed, and without any further fit, our model quantitatively predicts the yeast cell response to pheromone gradient providing an important step toward understanding how cells communicate with each other. PMID:27077831

  11. Mitochondrial localization of fission yeast manganese superoxide dismutase is required for its lysine acetylation and for cellular stress resistance and respiratory growth

    International Nuclear Information System (INIS)

    Research highlights: → Fission yeast manganese superoxide dismutase (MnSOD) is acetylated. → The mitochondrial targeting sequence (MTS) is required for the acetylation of MnSOD. → The MTS is not crucial for MnSOD activity, but is important for respiratory growth. → Posttranslational regulation of MnSOD differs between budding and fission yeast. -- Abstract: Manganese-dependent superoxide dismutase (MnSOD) is localized in the mitochondria and is important for oxidative stress resistance. Although transcriptional regulation of MnSOD has been relatively well studied, much less is known about the protein's posttranslational regulation. In budding yeast, MnSOD is activated after mitochondrial import by manganese ion incorporation. Here we characterize posttranslational modification of MnSOD in the fission yeast Schizosaccharomyces pombe. Fission yeast MnSOD is acetylated at the 25th lysine residue. This acetylation was diminished by deletion of N-terminal mitochondrial targeting sequence, suggesting that MnSOD is acetylated after import into mitochondria. Mitochondrial localization of MnSOD is not essential for the enzyme activity, but is crucial for oxidative stress resistance and growth under respiratory conditions of fission yeast. These results suggest that, unlike the situation in budding yeast, S. pombe MnSOD is already active even before mitochondrial localization; nonetheless, mitochondrial localization is critical to allow the cell to cope with reactive oxygen species generated inside or outside of mitochondria.

  12. Assembly of fission yeast eisosomes in the plasma membrane of budding yeast: Import of foreign membrane microdomains

    Czech Academy of Sciences Publication Activity Database

    Vaškovičová, Katarína; Strádalová, Vendula; Efenberk, Aleš; Opekarová, Miroslava; Malínský, Jan

    2015-01-01

    Roč. 94, č. 1 (2015), s. 1-11. ISSN 0171-9335 R&D Projects: GA ČR(CZ) GAP302/11/0146 Institutional support: RVO:68378041 Keywords : plasma membrane * membrane microdomain * MCC Subject RIV: EA - Cell Biology Impact factor: 3.825, year: 2014

  13. Identification of a small molecule yeast TORC1 inhibitor with a flow cytometry-based multiplex screen

    OpenAIRE

    Chen, Jun; Young, Susan M.; Allen, Chris; Seeber, Andrew; Péli-Gulli, Marie-Pierre; Panchaud, Nicolas; Waller, Anna; Ursu, Oleg; Yao, Tuanli; Golden, Jennifer E.; Strouse, J. Jacob; Carter, Mark B.; Kang, Huining; Bologa, Cristian G.; Foutz, Terry D.

    2012-01-01

    TOR (target of rapamycin) is a serine/threonine kinase, evolutionarily conserved from yeast to human, which functions as a fundamental controller of cell growth. The moderate clinical benefit of rapamycin in mTOR-based therapy of many cancers favors the development of new TOR inhibitors. Here we report a high throughput flow cytometry multiplexed screen using five GFP-tagged yeast clones that represent the readouts of four branches of the TORC1 signaling pathway in budding yeast. Each GFP-tag...

  14. Symmetric cell division in pseudohyphae of the yeast Saccharomyces cerevisiae.

    OpenAIRE

    Kron, S J; Styles, C. A.; Fink, G R

    1994-01-01

    Laboratory strains of Saccharomyces cerevisiae are dimorphic; in response to nitrogen starvation they switch from a yeast form (YF) to a filamentous pseudohyphal (PH) form. Time-lapse video microscopy of dividing cells reveals that YF and PH cells differ in their cell cycles and budding polarity. The YF cell cycle is controlled at the G1/S transition by the cell-size checkpoint Start. YF cells divide asymmetrically, producing small daughters from full-sized mothers. As a result, mothers and d...

  15. Cryptococcus friedmannii, a new species of yeast from the Antarctic

    Science.gov (United States)

    Vishniac, H. S.

    1985-01-01

    Cryptococcus friedmannii Vishniac sp. nov. from an Antarctic cryptoendolithic community is a psychrophilic basidioblastomycete characterized by cream-colored colonies of cells with smooth, layered walls, budding monopolarly, producing amylose and extracellular proteinase, utilizing nitrate and D-alanine (inter alia) as nitrogen sources and L-arabinose, arbutin, cellobiose, D-glucuronate, maltose, melezitose, salicin, soluble starch, trehalose, and D-xylose as carbon sources. This species differs from all other basidiomycetous yeasts in possessing the following combination of characters: amylose production (positive), assimilation of cellobiose (positive), D-galactose (negative), myo-inositol (negative), D-mannitol (negative), and sucrose (negative).

  16. Dynamics of Cdc42 network embodies a Turing-type mechanism of yeast cell polarity.

    Science.gov (United States)

    Goryachev, Andrew B; Pokhilko, Alexandra V

    2008-04-30

    Complex biochemical networks can be understood by identifying their principal regulatory motifs and mode of action. We model the early phase of budding yeast cellular polarization and show that the biochemical processes in the presumptive bud site comprise a Turing-type mechanism. The roles of the prototypical activator and substrate are played by GTPase Cdc42 in its active and inactive states, respectively. We demonstrate that the nucleotide cycling of Cdc42 converts cellular energy into a stable cluster of activated Cdc42. This energy drives a continuous membrane-cytoplasmic exchange of the cluster components to counteract diffusive spread of the cluster. This exchange explains why only one bud forms per cell cycle, because the winner-takes-all competition of candidate sites inevitably selects a single site. PMID:18381072

  17. Micropropagation of Helleborus through axillary budding.

    Science.gov (United States)

    Beruto, Margherita; Viglione, Serena; Bisignano, Alessandro

    2013-01-01

    Helleborus genus, belonging to the Ranunculaceae family, has 20 species of herbaceous perennial flowering plants. The commercial exploitation of this plant is dependent on the selection and propagation of appropriate lines. High propagation rate could be accomplished by using a suitable tissue culture method enabling the rapid introduction of valuable selections in the market. However, in vitro cultivation of Helleborus is still very difficult. Thereby the development of reliable in vitro propagation procedures is crucial for future production systems. Axillary buds cultured on agar-solidified Murashige and Skoog medium supplemented with 1 mg/L benzyladenine, 0.1 mg/L β-naphthoxyacetic acid, and 2 mg/L isopentenyl adenine develop shoots after 16 weeks of culture under 16 h light regime, 50-60 μmol/s/m(2), and 19 ± 1°C. The multiplication rate ranges from 1.4 to 2.1. However, the genotype and the number of subcultures affect the efficiency of the micropropagation process. The rooting of shoots is about 80% in solidified MS medium containing 1 mg/L 1-naphthaleneacetic acid and 3 mg/L indole-3-butyric acid. The described protocol provides information which can contribute to the commercial production of Helleborus plants. PMID:23179705

  18. Ubiquitin is part of the retrovirus budding machinery

    Science.gov (United States)

    Patnaik, Akash; Chau, Vincent; Wills, John W.

    2000-11-01

    Retroviruses contain relatively large amounts of ubiquitin, but the significance of this finding has been unknown. Here, we show that drugs that are known to reduce the level of free ubiquitin in the cell dramatically reduced the release of Rous sarcoma virus, an avian retrovirus. This effect was suppressed by overexpressing ubiquitin and also by directly fusing ubiquitin to the C terminus of Gag, the viral protein that directs budding and particle release. The block to budding was found to be at the plasma membrane, and electron microscopy revealed that the reduced level of ubiquitin results in a failure of mature virus particles to separate from each other and from the plasma membrane during budding. These data indicate that ubiquitin is actually part of the budding machinery.

  19. Real Life Science with Dandelions and Project BudBurst

    OpenAIRE

    Johnson, Katherine A.

    2016-01-01

    Project BudBurst is a national citizen-science project that tracks bloom times and other phenological data for plants across the country. Data from Project BudBurst are being used to measure the effects of climate change. Students can participate in this project by watching any of the plants on the list, including the common dandelion, which makes the program easy and accessible to everyone. Journal of Microbiology & Biology Education

  20. Real Life Science with Dandelions and Project BudBurst

    Directory of Open Access Journals (Sweden)

    Katherine A. Johnson

    2015-12-01

    Full Text Available Project BudBurst is a national citizen-science project that tracks bloom times and other phenological data for plants across the country. Data from Project BudBurst are being used to measure the effects of climate change. Students can participate in this project by watching any of the plants on the list, including the common dandelion, which makes the program easy and accessible to everyone.

  1. Real Life Science with Dandelions and Project BudBurst.

    Science.gov (United States)

    Johnson, Katherine A

    2016-03-01

    Project BudBurst is a national citizen-science project that tracks bloom times and other phenological data for plants across the country. Data from Project BudBurst are being used to measure the effects of climate change. Students can participate in this project by watching any of the plants on the list, including the common dandelion, which makes the program easy and accessible to everyone. Journal of Microbiology & Biology Education. PMID:27047605

  2. YALI0E32769g (DGA1) and YALI0E16797g (LRO1) encode major triacylglycerol synthases of the oleaginous yeast Yarrowia lipolytica

    OpenAIRE

    Athenstaedt, Karin

    2011-01-01

    The oleaginous yeast Yarrowia lipolytica has an outstanding capacity to produce and store triacylglycerols resembling adipocytes of higher eukaryotes. Here, the identification of two genes YALI0E32769g (DGA1) and YALI0E16797g (LRO1) encoding major triacylglycerol synthases of Yarrowia lipolytica is reported. Heterologous expression of either DGA1 or LRO1 in a mutant of the budding yeast Saccharomyces cerevisiae defective in triacylglycerol synthesis restores the formation of this neutral lipi...

  3. Download - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ...Downlaod via FTP Joomla SEF URLs by Artio About This Database Database Description Download License Update History

  4. High-resolution transcription atlas of the mitotic cell cycle in budding yeast

    DEFF Research Database (Denmark)

    Granovskaia, Marina V; Jensen, Lars J; Ritchie, Matthew E;

    2010-01-01

    Extensive transcription of non-coding RNAs has been detected in eukaryotic genomes and is thought to constitute an additional layer in the regulation of gene expression. Despite this role, their transcription through the cell cycle has not been studied; genome-wide approaches have only focused on...

  5. Heterologous Expression in Budding Yeast as a Tool for Studying the Plant Cell Morphogenesis Machinery

    Czech Academy of Sciences Publication Activity Database

    Cvrčková, F.; Hála, Michal

    Vol. 1080. New York : Humana Press, 2014 - (Žárský, V.; Cvrčková, F.), s. 267-282 ISBN 978-1-62703-643-6. - (Methods in Molecular Biology) Institutional support: RVO:61389030 Keywords : Saccharomyces cerevisiae * Heterologous gene expression * Inducible expression system Subject RIV: EB - Genetics ; Molecular Biology

  6. Vps Factors Are Required for Efficient Transcription Elongation in Budding Yeast

    Czech Academy of Sciences Publication Activity Database

    Gaur, N. A.; Hašek, Jiří; Brickner, D. G.; Qiu, H.; Zhang, F.; Wong, Ch.; M.; Malcová, Ivana; Vašicová, Pavla; Brickner, J. H.; Hinnebusch, A. G.

    2013-01-01

    Roč. 193, č. 3 (2013), s. 829-851. ISSN 0016-6731 R&D Projects: GA ČR GAP305/12/0480 Institutional support: RVO:61388971 Keywords : RNA-POLYMERASE-II * SACCHAROMYCES - CEREVISIAE GENOME * ELL-ASSOCIATED PROTEINS Subject RIV: EE - Microbiology, Virology Impact factor: 4.389, year: 2012

  7. Database Description - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available e University of Tokyo(when creating) Creator Name: Takashi Ito* Creator Affiliation: Department of Computati...onal Biology, Graduate School of Frontier Sciences, The University of Tokyo(when creating) Contact address G

  8. License - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available ecified in the Creative Commons Attribution-Share Alike 2.1 Japan . If you use data from this database, plea...i Ito(the University of Tokyo) licensed under CC Attribution-Share Alike 2.1 Japa...n . The summary of the Creative Commons Attribution-Share Alike 2.1 Japan is found here . With regard to thi

  9. Centromere identity is specified by a single centromeric nucleosome in budding yeast

    OpenAIRE

    Furuyama, Suzanne; Biggins, Sue

    2007-01-01

    Chromosome segregation ensures that DNA is equally divided between daughter cells during each round of cell division. The centromere (CEN) is the specific locus on each chromosome that directs formation of the kinetochore, the multiprotein complex that interacts with the spindle microtubules to promote proper chromosomal alignment and segregation during mitosis. CENs are organized into a specialized chromatin structure due to the incorporation of an essential CEN-specific histone H3 variant (...

  10. Buffering the pH of the culture medium does not extend yeast replicative lifespan

    OpenAIRE

    Wasko, Brian M.; Carr, Daniel T; Herman Tung; Ha Doan; Nathan Schurman; Neault, Jillian R; Joey Feng; Janet Lee; Ben Zipkin; Jacob Mouser; Edward Oudanonh; Tina Nguyen; Torin Stetina; Anna Shemorry; Mekedes Lemma

    2013-01-01

    During chronological aging of budding yeast cells, the culture medium can become acidified, and this acidification limits cell survival.  As a consequence, buffering the culture medium to pH 6 significantly extends chronological life span under standard conditions in synthetic medium.  In this study, we assessed whether a similar process occurs during replicative aging of yeast cells.  We find no evidence that buffering the pH of the culture medium to pH levels either higher or lower than the...

  11. Genome-wide Fitness Profiles Reveal a Requirement for Autophagy During Yeast Fermentation

    OpenAIRE

    Piggott, Nina; Cook, Michael A.; Tyers, Mike; Measday, Vivien

    2011-01-01

    The ability of cells to respond to environmental changes and adapt their metabolism enables cell survival under stressful conditions. The budding yeast Saccharomyces cerevisiae (S. cerevisiae) is particularly well adapted to the harsh conditions of anaerobic wine fermentation. However, S. cerevisiae gene function has not been previously systematically interrogated under conditions of industrial fermentation. We performed a genome-wide study of essential and nonessential S. cerevisiae gene req...

  12. Cdc7-Dbf4 Is a Gene-Specific Regulator of Meiotic Transcription in Yeast

    OpenAIRE

    Lo, Hsiao-Chi; Kunz, Ryan C.; Chen, Xiangyu; Marullo, Allison; Steven P Gygi; Hollingsworth, Nancy M.

    2012-01-01

    Meiosis divides the chromosome number of the cell in half by having two rounds of chromosome segregation follow a single round of chromosome duplication. The first meiotic division is unique in that homologous pairs of sister chromatids segregate to opposite poles. Recent work in budding and fission yeast has shown that the cell cycle kinase, Cdc7-Dbf4, is required for many meiosis-specific chromosomal functions necessary for proper disjunction at meiosis I. This work reveals another role for...

  13. Canonical Modeling of the Multi-Scale Regulation of the Heat Stress Response in Yeast

    OpenAIRE

    Fonseca, Luis L.; Po-Wei Chen; Voit, Eberhard O.

    2012-01-01

    Heat is one of the most fundamental and ancient environmental stresses, and response mechanisms are found in prokaryotes and shared among most eukaryotes. In the budding yeast Saccharomyces cerevisiae, the heat stress response involves coordinated changes at all biological levels, from gene expression to protein and metabolite abundances, and to temporary adjustments in physiology. Due to its integrative multi-level-multi-scale nature, heat adaptation constitutes a complex dynamic process, wh...

  14. Designer Yeasts for the Fermentation Industry of the 21st Century

    OpenAIRE

    Pretorius, Isak S.; du Toit, Maret; van Rensburg, Pierre

    2003-01-01

    The budding yeast, Saccharomyces cerevisiae, has enjoyed a long and distinguished history in the fermention industry. Owing to its efficiency in producing alcohol, S. cerevisiae is, without doubt, the most important commercial microorganism with GRAS (Generally Regarded As Safe) status. By brewing beer and sparkling wine, mankind’s oldest domesticated organism made possible the world’s first biotechnological processes. With the emergence of modern molecular genetics, S. cerevisiae has again b...

  15. Yeast prt1 mutations alter heat-shock gene expression through transcript fragmentation.

    OpenAIRE

    Barnes, C.A.; Singer, R A; Johnston, G C

    1993-01-01

    The inhibition of translation initiation by modification or mutation of initiation factors can lead to disproportionate effects on gene expression. Here we report disproportionate decreases in gene expression in cells with mutated Prt1 activity. The PRT1 gene product of the budding yeast Saccharomyces cerevisiae is necessary for translation initiation and is thought to be a component of initiation factor 3. At a restrictive temperature the prt1-1 mutation, in addition to decreasing global pro...

  16. Live longer on MARS: a yeast paradigm of mitochondrial adaptive ROS signaling in aging

    Directory of Open Access Journals (Sweden)

    Gerald S. Shadel

    2014-04-01

    Full Text Available Adaptive responses to stress, including hormesis, have been implicated in longevity, but their mechanisms and out comes are not fully understood. Here, I briefly summarize a longevity mechanism elucidated in the budding yeast chronological lifespan model by which Mitochondrial Adaptive ROS Signaling (MARS promotes beneficial epigenetic and metabolic remodeling. The potential relevance of MARS to the human disease Ataxia-Telangiectasia and as a potential anti-aging target is discussed.

  17. ARF Is Required for Maintenance of Yeast Golgi and Endosome Structure and Function

    OpenAIRE

    Gaynor, Erin C.; Chen, Chih-Ying; Emr, Scott D.; Graham, Todd R.

    1998-01-01

    ADP ribosylation factor (ARF) is thought to play a critical role in recruiting coatomer (COPI) to Golgi membranes to drive transport vesicle budding. Yeast strains harboring mutant COPI proteins exhibit defects in retrograde Golgi to endoplasmic reticulum protein transport and striking cargo-selective defects in anterograde endoplasmic reticulum to Golgi protein transport. To determine whether arf mutants exhibit similar phenotypes, the anterograde transport kinetics of multiple cargo protein...

  18. The determination of mother cell-specific mating type of switching in yeast by a specific regulator of HO transcription

    OpenAIRE

    Nasmyth, Kim

    1987-01-01

    In haploid homothallic budding yeast, cell division gives rise to a mother cell which proceeds to switch its mating type and a daughter cell (the bud) which does not. Switching is initiated by a specific double strand cleavage of mating type DNA by an endonuclease encoded by the HO gene. Previous data suggest that the pattern of HO transcription is responsible for the mother cell specificity of switching. HO is transcribed transiently, at START, during the cell cycle of mother cells but not a...

  19. Unidirectional P-body transport during the yeast cell cycle.

    Directory of Open Access Journals (Sweden)

    Cecilia Garmendia-Torres

    Full Text Available P-bodies belong to a large family of RNA granules that are associated with post-transcriptional gene regulation, conserved from yeast to mammals, and influence biological processes ranging from germ cell development to neuronal plasticity. RNA granules can also transport RNAs to specific locations. Germ granules transport maternal RNAs to the embryo, and neuronal granules transport RNAs long distances to the synaptic dendrites. Here we combine microfluidic-based fluorescent microscopy of single cells and automated image analysis to follow p-body dynamics during cell division in yeast. Our results demonstrate that these highly dynamic granules undergo a unidirectional transport from the mother to the daughter cell during mitosis as well as a constrained "hovering" near the bud site half an hour before the bud is observable. Both behaviors are dependent on the Myo4p/She2p RNA transport machinery. Furthermore, single cell analysis of cell size suggests that PBs play an important role in daughter cell growth under nutrient limiting conditions.

  20. Electron tomography reveals the steps in filovirus budding.

    Directory of Open Access Journals (Sweden)

    Sonja Welsch

    2010-04-01

    Full Text Available The filoviruses, Marburg and Ebola, are non-segmented negative-strand RNA viruses causing severe hemorrhagic fever with high mortality rates in humans and nonhuman primates. The sequence of events that leads to release of filovirus particles from cells is poorly understood. Two contrasting mechanisms have been proposed, one proceeding via a "submarine-like" budding with the helical nucleocapsid emerging parallel to the plasma membrane, and the other via perpendicular "rocket-like" protrusion. Here we have infected cells with Marburg virus under BSL-4 containment conditions, and reconstructed the sequence of steps in the budding process in three dimensions using electron tomography of plastic-embedded cells. We find that highly infectious filamentous particles are released at early stages in infection. Budding proceeds via lateral association of intracellular nucleocapsid along its whole length with the plasma membrane, followed by rapid envelopment initiated at one end of the nucleocapsid, leading to a protruding intermediate. Scission results in local membrane instability at the rear of the virus. After prolonged infection, increased vesiculation of the plasma membrane correlates with changes in shape and infectivity of released viruses. Our observations demonstrate a cellular determinant of virus shape. They reconcile the contrasting models of filovirus budding and allow us to describe the sequence of events taking place during budding and release of Marburg virus. We propose that this represents a general sequence of events also followed by other filamentous and rod-shaped viruses.

  1. Yeast identification in floral nectar of Mimulus aurantiacus (Invited)

    Science.gov (United States)

    Kyauk, C.; Belisle, M.; Fukami, T.

    2009-12-01

    Nectar is such a sugar-rich resource that serves as a natural habitat in which microbes thrive. As a result, yeasts arrive to nectar on the bodies of pollinators such as hummingbirds and bees. Yeasts use the sugar in nectar for their own needs when introduced. This research focuses on the identification of different types of yeast that are found in the nectar of Mimulus aurantiacus (commonly known as sticky monkey-flower). Unopened Mimulus aurantiacus flower buds were tagged at Jasper Ridge and bagged three days later. Floral nectar was then extracted and plated on potato dextrose agar. Colonies on the plates were isolated and DNA was extracted from each sample using QIAGEN DNeasy Plant Mini Kit. The DNA was amplified through PCR and ran through gel electrophoresis. The PCR product was used to clone the nectar samples into an E.coli vector. Finally, a phylogenetic tree was created by BLAST searching sequences in GenBank using the Internal Transcribed Space (ITS) locus. It was found that 18 of the 50 identified species were Candida magnifica, 14 was Candida rancensis, 6 were Crytococcus albidus and there were 3 or less of the following: Starmella bombicola, Candida floricola, Aureobasidium pullulans, Pichia kluyvera, Metschnikowa cibodaserisis, Rhodotorua colostri, and Malassezia globosa. The low diversity of the yeast could have been due to several factors: time of collection, demographics of Jasper Ridge, low variety of pollinators, and sugar concentration of the nectar. The results of this study serve as a necessary first step for a recently started research project on ecological interactions between plants, pollinators, and nectar-living yeast. More generally, this research studies the use of the nectar-living yeast community as a natural microcosm for addressing basic questions about the role of dispersal and competitive and facilitative interactions in ecological succession.

  2. Vaginal Yeast Infection

    Science.gov (United States)

    ... Centers for Diseases Control and Prevention. Micrograph showing Candida albicans from a patient with vaginal candidiasis, also known ... caused by an overgrowth of a fungus called Candida albicans in the vagina. Candida is yeast, which is ...

  3. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  4. Optical properties of bud scales and protochlorophyll(ide) forms in leaf primordia of closed and opened buds.

    Science.gov (United States)

    Solymosi, Katalin; Böddi, Béla

    2006-08-01

    The transmission spectra of bud scales of 14 woody species and the 77 K fluorescence emission spectra of the innermost leaf primordia of closed and opened buds of 37 woody species were studied. Pigment concentrations were determined in some species. Bud scales had low transmittance between 400 and 680 nm with a local minimum around 680 nm. Transmittance increased steeply above 680 nm and was > 80% in the 700-800 nm spectral region. Significant protochlorophyllide (Pchlide) accumulation was observed in leaf primordia of tightly packed, closed buds with relatively thick, dark bud scales. In common ash (Fraxinus excelsior L.) and Hungarian ash (Fraxinus angustifolia Vahl.), the innermost leaf primordia of the closed buds contained protochlorophyll (Pchl) and Pchlide (abbreviated as Pchl(ide)), but no chlorophyll. We observed Pchl(ide) forms with emission maxima at 633, 643 and 655 nm in these leaves. Complete transformation of Pchlide(655) (protochlorophyllide form with maximum emission at 655 nm) into Chlide(692) (chlorophyllide form with maximum emission at 692 nm) occurred after irradiation for 10 s. The innermost leaf primordia of the buds of four species (flowering ash (Fraxinus ornus L.), horse chestnut (Aesculus hippocastanum L.), tree of heaven (Ailanthus altissima P. Mill.) and common walnut (Juglans regia L.)) contained Pchl(ide)(633), Pchl(ide)(643) and Pchlide(655) as well as an emission band at 688 nm corresponding to a chlorophyll form. The Pchlide(655) was fully photoactive in these species. The outermost leaf primordia of these four species and the innermost leaf primordia of 28 other species contained all of the above described Pchl(ide) forms in various ratios but in small amounts. In addition, Chl forms were present and the main bands in the fluorescence emission spectra were at 690 or 740 nm, or both. The results indicate that Pchl(ide) accumulation occurs in leaf primordia in near darkness inside the tightly closed buds, where the bud scales and

  5. Respiratory Response of Dormant Nectarine Floral Buds on Chilling Deficiency

    Institute of Scientific and Technical Information of China (English)

    TAN Yue; GAO Dong-sheng; LI Ling; CHEN Xiu-de; XU Ai-hong

    2010-01-01

    Changes in main biochemical respiratory pathways in dormant nectarine floral buds were studied with nectarine trees (Prunus persica.var,nectariana cv.Shuguang) in order to determine the function of respiration in dormancy release.Oxygen-electrode system and respiratory inhibitors were used to measure total respiratory rates and rates of respiratory pathways.Results showed that chilling deficiency blocked the transition of respiratory mode,and made buds stay in a state of high level pentose phosphate pathway (PPP) and low level tricarboxylic acid cycle (TCA).The decline of PPP and activation of TCA occurred synchronously with the release of dormancy.In addition,the inhibition of PPP stimulated a respiration increase related with TCA.It could be concluded that the function of PPP activation in dormancy release might be limited and PPP declination inducing TCA activation might be part of respiration mode transition mechanism during bud sprouting.

  6. Adventitious bud regeneration from the stigma of Sinapis alba L.

    Directory of Open Access Journals (Sweden)

    Elżbieta Zenkteler

    2012-12-01

    Full Text Available Stigmas isolated from flower buds of 'Nakielska' variety of Sinapis alba were used to develop a micropropagation method suitable for breeding of new cultivars. The origin of adventitious bud regeneration was studied on MS medium, under stimulation by bezylaminopurine (BAP in combination with 2,4-D - dichlorophenoxyacetic acid (2,4-D. Histological analysis showed the structure of Sinapis stigma (composed from four types of tissue: papillae, transmitting tissue, parenchyma and vascular bundles and revealed that numerous meristematic centers developed from parenchyma cells in close vicinity of vascular bundles. Buds very quickly appeared on the surface of initial explants and later formed multiplantlets that were easily rooted in the soil.

  7. EARLY BUD-BREAK1 (EBB1) defines a conserved mechanism for control of bud-break in woody perennials

    Science.gov (United States)

    Busov, Victor; Carneros, Elena; Yakovlev, Igor

    2016-01-01

    Bud-break is an environmentally and economically important trait in trees, shrubs and vines from temperate latitudes. Poor synchronization of bud-break timing with local climates can lead to frost injuries, susceptibility to pests and pathogens and poor crop yields in fruit trees and vines. The rapid climate changes outpace the adaptive capacities of plants to respond through natural selection. This is particularly true for trees which have long generation cycle and thus the adaptive changes are significantly delayed. Therefore, to devise appropriate breeding and conservation strategies, it is imperative to understand the molecular underpinnings that govern dormancy mechanisms. We have recently identified and characterized the poplar EARLY BUD-BREAK 1 (EBB1) gene. EBB1 is a positive regulator of bud-break and encodes a transcription factor from the AP2/ERF family. Here, using comparative and functional genomics approaches we show that EBB1 function in regulation of bud-break is likely conserved across wide range of woody perennial species with importance to forestry and agriculture. PMID:26317150

  8. Meiosis in haploid yeast

    OpenAIRE

    Wagstaff, Joseph E.; Klapholz, Sue; Esposito, Rochelle Easton

    1982-01-01

    Haploid yeast cells normally contain either the MATa or MATα mating-type allele and cannot undergo meiosis and spore formation. If both mating-type alleles are present as a consequence of chromosome III disomy (MATa/MATα), haploids initiate meiosis but do not successfully form spores, probably because the haploid chromosome complement is irregularly partitioned during meiotic nuclear division. We have demonstrated that the ochre-suppressible mutation spo13-1 enables haploid yeast cells disomi...

  9. Nitrile Metabolizing Yeasts

    Science.gov (United States)

    Bhalla, Tek Chand; Sharma, Monica; Sharma, Nitya Nand

    Nitriles and amides are widely distributed in the biotic and abiotic components of our ecosystem. Nitrile form an important group of organic compounds which find their applications in the synthesis of a large number of compounds used as/in pharmaceutical, cosmetics, plastics, dyes, etc>. Nitriles are mainly hydro-lyzed to corresponding amide/acid in organic chemistry. Industrial and agricultural activities have also lead to release of nitriles and amides into the environment and some of them pose threat to human health. Biocatalysis and biotransformations are increasingly replacing chemical routes of synthesis in organic chemistry as a part of ‘green chemistry’. Nitrile metabolizing organisms or enzymes thus has assumed greater significance in all these years to convert nitriles to amides/ acids. The nitrile metabolizing enzymes are widely present in bacteria, fungi and yeasts. Yeasts metabolize nitriles through nitrilase and/or nitrile hydratase and amidase enzymes. Only few yeasts have been reported to possess aldoxime dehydratase. More than sixty nitrile metabolizing yeast strains have been hither to isolated from cyanide treatment bioreactor, fermented foods and soil. Most of the yeasts contain nitrile hydratase-amidase system for metabolizing nitriles. Transformations of nitriles to amides/acids have been carried out with free and immobilized yeast cells. The nitrilases of Torulopsis candida>and Exophiala oligosperma>R1 are enantioselec-tive and regiospecific respectively. Geotrichum>sp. JR1 grows in the presence of 2M acetonitrile and may have potential for application in bioremediation of nitrile contaminated soil/water. The nitrilase of E. oligosperma>R1 being active at low pH (3-6) has shown promise for the hydroxy acids. Immobilized yeast cells hydrolyze some additional nitriles in comparison to free cells. It is expected that more focus in future will be on purification, characterization, cloning, expression and immobilization of nitrile metabolizing

  10. GABA, its receptors, and GABAergic inhibition in mouse taste buds

    OpenAIRE

    Dvoryanchikov, Gennady; Huang, Yijen A.; Barro-Soria, Rene; Chaudhari, Nirupa; Roper, Stephen D.

    2011-01-01

    Taste buds consist of at least three principal cell types that have different functions in processing gustatory signals — glial-like Type I cells, Receptor (Type II) cells, and Presynaptic (Type III) cells. Using a combination of Ca2+ imaging, single cell RT-PCR, and immunostaining, we show that γ-amino butyric acid (GABA) is an inhibitory transmitter in mouse taste buds, acting on GABA-A and GABA-B receptors to suppress transmitter (ATP) secretion from Receptor cells during taste stimulation...

  11. Project BudBurst: People, Plants, and Climate Change

    Science.gov (United States)

    Henderson, S.; Ward, D.; Havens, K.; Gardiner, L. S.; Alaback, P.

    2010-12-01

    Providing opportunities for individuals to contribute to a better understanding of climate change is the hallmark of Project BudBurst (www.budburst.org). This highly successful, national citizen science program, now in its third year, is bringing climate change education outreach to thousands of individuals. Project BudBurst is a national citizen science initiative designed to engage the public in observations of phenological (plant life cycle) events that raise awareness of climate change, and create a cadre of informed citizen scientists. Citizen science programs such as Project BudBurst provide the opportunity for students and interested laypersons to actively participate in scientific research. Such programs are important not only from an educational perspective, but because they also enable scientists to broaden the geographic and temporal scale of their observations. The goals of Project BudBurst are to 1) increase awareness of phenology as an area of scientific study; 2) Increase awareness of the impacts of changing climates on plants; and 3) increase science literacy by engaging participants in the scientific process. From its 2008 launch in February, this on-line educational and data-entry program, engaged participants of all ages and walks of life in recording the timing of the leafing and flowering of wild and cultivated species found across the continent. Thus far, thousands of participants from all 50 states have submitted data. Project BudBurst has been the subject of almost 200 media outlets including NPR, national and regional television broadcasts, and most of the major national and regional newspapers. This presentation will provide an overview of Project BudBurst and will report on the results of the 2009 field campaign and discuss plans to expand Project BudBurst in 2010 including the use of mobile phones applications for data collection and reporting from the field. Project BudBurst co managed by the National Ecological Observatory Network and

  12. Meiotic chromosome mobility in fission yeast is resistant to environmental stress

    Science.gov (United States)

    Illner, Doris; Lorenz, Alexander; Scherthan, Harry

    2016-01-01

    The formation of healthy gametes requires pairing of homologous chromosomes (homologs) as a prerequisite for their correct segregation during meiosis. Initially, homolog alignment is promoted by meiotic chromosome movements feeding into intimate homolog pairing by homologous recombination and/or synaptonemal complex formation. Meiotic chromosome movements in the fission yeast, Schizosaccharomyces pombe, depend on astral microtubule dynamics that drag the nucleus through the zygote; known as horsetail movement. The response of microtubule-led meiotic chromosome movements to environmental stresses such as ionizing irradiation (IR) and associated reactive oxygen species (ROS) is not known. Here, we show that, in contrast to budding yeast, the horsetail movement is largely radiation-resistant, which is likely mediated by a potent antioxidant defense. IR exposure of sporulating S. pombe cells induced misrepair and irreparable DNA double strand breaks causing chromosome fragmentation, missegregation and gamete death. Comparing radiation outcome in fission and budding yeast, and studying meiosis with poisoned microtubules indicates that the increased gamete death after IR is innate to fission yeast. Inhibition of meiotic chromosome mobility in the face of IR failed to influence the course of DSB repair, indicating that paralysis of meiotic chromosome mobility in a genotoxic environment is not a universal response among species. PMID:27074839

  13. Meiotic chromosome mobility in fission yeast is resistant to environmental stress.

    Science.gov (United States)

    Illner, Doris; Lorenz, Alexander; Scherthan, Harry

    2016-01-01

    The formation of healthy gametes requires pairing of homologous chromosomes (homologs) as a prerequisite for their correct segregation during meiosis. Initially, homolog alignment is promoted by meiotic chromosome movements feeding into intimate homolog pairing by homologous recombination and/or synaptonemal complex formation. Meiotic chromosome movements in the fission yeast, Schizosaccharomyces pombe, depend on astral microtubule dynamics that drag the nucleus through the zygote; known as horsetail movement. The response of microtubule-led meiotic chromosome movements to environmental stresses such as ionizing irradiation (IR) and associated reactive oxygen species (ROS) is not known. Here, we show that, in contrast to budding yeast, the horsetail movement is largely radiation-resistant, which is likely mediated by a potent antioxidant defense. IR exposure of sporulating S. pombe cells induced misrepair and irreparable DNA double strand breaks causing chromosome fragmentation, missegregation and gamete death. Comparing radiation outcome in fission and budding yeast, and studying meiosis with poisoned microtubules indicates that the increased gamete death after IR is innate to fission yeast. Inhibition of meiotic chromosome mobility in the face of IR failed to influence the course of DSB repair, indicating that paralysis of meiotic chromosome mobility in a genotoxic environment is not a universal response among species. PMID:27074839

  14. Fission yeast Scm3: A CENP-A receptor required for integrity of subkinetochore chromatin.

    Science.gov (United States)

    Pidoux, Alison L; Choi, Eun Shik; Abbott, Johanna K R; Liu, Xingkun; Kagansky, Alexander; Castillo, Araceli G; Hamilton, Georgina L; Richardson, William; Rappsilber, Juri; He, Xiangwei; Allshire, Robin C

    2009-02-13

    The mechanisms ensuring specific incorporation of CENP-A at centromeres are poorly understood. Mis16 and Mis18 are required for CENP-A localization at centromeres and form a complex that is conserved from fission yeast to human. Fission yeast sim1 mutants that alleviate kinetochore domain silencing are defective in Scm3(Sp), the ortholog of budding yeast Scm3(Sc). Scm3(Sp) depends on Mis16/18 for its centromere localization and like them is recruited to centromeres in late anaphase. Importantly, Scm3(Sp) coaffinity purifies with CENP-A(Cnp1) and associates with CENP-A(Cnp1) in vitro, yet localizes independently of intact CENP-A(Cnp1) chromatin and is differentially released from chromatin. While Scm3(Sc) has been proposed to form a unique hexameric nucleosome with CENP-A(Cse4) and histone H4 at budding yeast point centromeres, we favor a model in which Scm3(Sp) acts as a CENP-A(Cnp1) receptor/assembly factor, cooperating with Mis16 and Mis18 to receive CENP-A(Cnp1) from the Sim3 escort and mediate assembly of CENP-A(Cnp1) into subkinetochore chromatin. PMID:19217404

  15. Ruffed grouse feeding behavior and its relationship to secondary metabolites of quaking aspen flower buds.

    Science.gov (United States)

    Jakubas, W J; Gullion, G W; Clausen, T P

    1989-06-01

    Quaking aspen (Populus tremuloides Michx.) staminate flower buds and the extended catkins are primary food resources for ruffed grouse (Bonasa umbellus). Winter feeding observations indicate that ruffed grouse select specific trees or clones of quaking aspen to feed in. Flower buds and catkins of quaking aspen were analyzed for secondary compounds (tannins, alkaloids, and phenolics) that might cause ruffed grouse to avoid trees with high levels of these compounds. Coniferyl benzoate, a compound that has not been previously found in quaking aspen, exists in significantly higher concentrations in buds from trees with no feeding history as compared to ruffed grouse feeding trees. Aspen catkins were also significantly lower in coniferyl benzoate than buds from the same tree. Ruffed grouse feeding preference was not related to the tannin or total phenolic levels found in buds or catkins. Buds from feeding trees had higher protein levels than trees with no feeding history; however, catkins did not differ from buds in protein concentration. The high use of extended catkins in the spring by ruffed grouse is probably due to a lower percentage of bud scale material in the catkin as opposed to the dormant bud. Bud scales contain almost all of the nontannin phenolics in catkins and dormant buds. A feeding strategy where bud scales are avoided may exist for other bird species that feed on quaking aspen. Dormant flower buds are significantly lower in protein-precipitable tannins than catkins and differ in secondary metabolite composition from other aspen foliage. PMID:24272191

  16. Yeast Interacting Proteins Database: YLR423C, YMR124W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available phery, cytoplasm, bud, and bud neck; interacts with Crm1p in two-hybrid assay; YMR124W is not an essential g...fusion protein localizes to the cell periphery, cytoplasm, bud, and bud neck; interacts with Crm1p in two-hybrid assay

  17. Yeast Interacting Proteins Database: YGR218W, YMR124W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available ry, cytoplasm, bud, and bud neck; interacts with Crm1p in two-hybrid assay; YMR12...bud, and bud neck; interacts with Crm1p in two-hybrid assay; YMR124W is not an essential gene Rows with this

  18. Dissecting the fission yeast regulatory network reveals phase-specific control elements of its cell cycle

    Directory of Open Access Journals (Sweden)

    Liu Liwen

    2009-09-01

    Full Text Available Abstract Background Fission yeast Schizosaccharomyces pombe and budding yeast Saccharomyces cerevisiae are among the original model organisms in the study of the cell-division cycle. Unlike budding yeast, no large-scale regulatory network has been constructed for fission yeast. It has only been partially characterized. As a result, important regulatory cascades in budding yeast have no known or complete counterpart in fission yeast. Results By integrating genome-wide data from multiple time course cell cycle microarray experiments we reconstructed a gene regulatory network. Based on the network, we discovered in addition to previously known regulatory hubs in M phase, a new putative regulatory hub in the form of the HMG box transcription factor SPBC19G7.04. Further, we inferred periodic activities of several less known transcription factors over the course of the cell cycle, identified over 500 putative regulatory targets and detected many new phase-specific and conserved cis-regulatory motifs. In particular, we show that SPBC19G7.04 has highly significant periodic activity that peaks in early M phase, which is coordinated with the late G2 activity of the forkhead transcription factor fkh2. Finally, using an enhanced Bayesian algorithm to co-cluster the expression data, we obtained 31 clusters of co-regulated genes 1 which constitute regulatory modules from different phases of the cell cycle, 2 whose phase order is coherent across the 10 time course experiments, and 3 which lead to identification of phase-specific control elements at both the transcriptional and post-transcriptional levels in S. pombe. In particular, the ribosome biogenesis clusters expressed in G2 phase reveal new, highly conserved RNA motifs. Conclusion Using a systems-level analysis of the phase-specific nature of the S. pombe cell cycle gene regulation, we have provided new testable evidence for post-transcriptional regulation in the G2 phase of the fission yeast cell cycle

  19. RESEARCH OF SOPHORA JAPONICA L. FLOWER BUDS VOLATILE COMPOUNDS WITH GAS-CHROMATOGRAPHY/MASS- SPECTROMETRY METHOD

    Directory of Open Access Journals (Sweden)

    Cholak I.S.

    2013-10-01

    Full Text Available This work represents the results of the research ofessential oil contained in Sophora japonica L. flowerbuds volatile compounds collected during the nextstages of their development: green flower buds, formedflower buds and the beginning of flower buds opening.Essential oil assay content in Sophora japonica L.flower buds was determined with hydrodistillationmethod. Content of essential oil in the raw material isless than 0,1%. Qualitative composition and assaycontent of Sophora japonica L. flower buds essential oilconstituents were determined with chromato-massspectrometry method. In consequence of the research 80constituents were identified in Sophora japonica L.flower buds out of which 61 substances are during thegreen flower buds and beginning of flower budsopening stages, 66 substances are during formed flowerbuds stage. Substances are represented by aliphatic andcyclic terpenoids, their alcohols and ketones. Mostvolatile substances were extracted on the stage offormed buds.

  20. Effect of gamma irradiated parenchyma on the growth of irradiated potato tuber buds

    International Nuclear Information System (INIS)

    The development of buds greffed on irradiated potato parenchyma was studied. The irradiated parenchyma does not influence the sprouting capacity of buds, but it affects the way they develop. (Author) 9 refs

  1. A comprehensive web resource on RNA helicases from the baker's yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Linder, P; Gasteiger, E; Bairoch, A

    2000-04-01

    Members of the RNA helicase protein family are defined by several motifs that have been widely conserved during evolution. They are found in all organisms-from bacteria to humans-and many viruses. The minimum number of RNA helicases present within a eukaryotic cell can be predicted from the complete sequence of the Saccharomyces cerevisiae genome. Recent progress in the functional analysis of various family members has confirmed the significance of RNA helicases for most cellular RNA metabolic processes. We have assembled a web resource that focuses on RNA helicases from the budding yeast Saccharomyces cerevisiae. It includes descriptions of RNA helicases and their functions, links to sequence- and yeast-specific databases, an extensive list of references, and links to non-yeast helicase web resources. PMID:10790687

  2. Extending the dormant bud cryopreservation method to new tree species

    Science.gov (United States)

    In cryopreservation of germplasm, using dormant winter buds (DB) as source plant material is economically favorable over tissue culture options. Although the DB cryopreservation method has been known for many years, the approach is feasible only for cryopreserving a select number of temperate tree s...

  3. Contribution of the tooth bud mesenchyme to alveolar bone

    Czech Academy of Sciences Publication Activity Database

    Diep, L.; Matalová, Eva; Mitsiadis, T. A.; Tucker, A. S.

    312B, č. 5 (2009), 510-517. ISSN 1552-5007 R&D Projects: GA ČR GC524/08/J032; GA AV ČR KJB500450802 Institutional research plan: CEZ:AV0Z50450515 Keywords : tooth * alveolar bone * bud Subject RIV: FF - HEENT, Dentistry Impact factor: 2.938, year: 2009

  4. Detection of γ-irradiation induced DNA damage and radioprotection of compounds in yeast using comet assay

    International Nuclear Information System (INIS)

    The single cell gel electrophoresis assay (SCGE), a very rapid and sensitive method, has been applied to follow γ-irradiation induced DNA damage in budding yeast, Saccharomyces cerevisiae. Spheroplasting the γ-irradiated yeast cells by enzyme glusulase, before subjecting them to electrophoresis, resulted in a well-defined appearance of comets. Yeast comets look quite different from mammalian comets. A linear relationship was observed between the doses of irradiation and the tail moments of comets. These studies were extended to follow the action of known radio-protectors, i.e., caffeine and disulfiram. The results revealed the usefulness SCGE as applied to yeast in studies of the γ-irradiation-induced DNA breaks and also radio-protection by chemicals at doses that are not feasible with other eukaryotes. (author)

  5. Project BudBurst: Citizen Science for All Seasons

    Science.gov (United States)

    Meymaris, K.; Henderson, S.; Alaback, P.; Havens, K.

    2008-12-01

    Providing opportunities for individuals to contribute to a better understanding of climate change is the hallmark of Project BudBurst (www.budburst.org). This highly successful, national citizen science program, now in its second year, is bringing climate change education outreach to thousands of individuals. Project BudBurst is a national citizen science initiative designed to engage the public in observations of phenological (plant life cycle) events that raise awareness of climate change, and create a cadre of informed citizen scientists. Citizen science programs such as Project BudBurst provide the opportunity for students and interested laypersons to actively participate in scientific research. Such programs are important not only from an educational perspective, but because they also enable scientists to broaden the geographic and temporal scale of their observations. The goals of Project BudBurst are to 1) increase awareness of phenology as an area of scientific study; 2) Increase awareness of the impacts of changing climates on plants; and 3) increase science literacy by engaging participants in the scientific process. From its 2008 launch in February, this on-line educational and data-entry program, engaged participants of all ages and walks of life in recording the timing of the leafing and flowering of wild and cultivated species found across the continent. Thus far, participants from 49 states have submitted data that is being submitted to the USA National Phenology Network (www.usanpn.org) database. Project BudBurst has been the subject of almost 200 media outlets including NPR, national and regional television broadcasts, and most of the major national and regional newspapers. This presentation will provide an overview of Project Budburst and will report on the results of the 2008 field campaign and discuss plans to expand Project BudBurst in 2009. Project BudBurst is a Windows to the Universe Citizen Science program managed by the University

  6. TEP1, the yeast homolog of the human tumor suppressor gene PTEN/MMAC1/TEP1, is linked to the phosphatidylinositol pathway and plays a role in the developmental process of sporulation

    OpenAIRE

    Heymont, Jennifer; Berenfeld, Ludmilla; Collins, Jennifer; Kaganovich, Alexandra; Maynes, Bradford; Moulin, Aaron; Ratskovskaya, Irina; Poon, Pak P.; Johnston, Gerald C.; Kamenetsky, Margarita; DeSilva, John; Sun, Hong; Petsko, Gregory A; Engebrecht, JoAnne

    2000-01-01

    PTEN/MMAC1/TEP1 (PTEN, phosphatase deleted on chromosome ten; MMAC1, mutated in multiple advanced cancers; TEP1, tensin-like phosphatase) is a major human tumor suppressor gene whose suppressive activity operates on the phosphatidylinositol pathway. A single homologue of this gene, TEP1 (YNL128w), exists in the budding yeast Saccharomyces cerevisiae. Yeast strains deleted for TEP1 exhibit essentially no phenotype in haploids; however, diploids exhibit resistance to...

  7. [Fructose transporter in yeasts].

    Science.gov (United States)

    Lazar, Zbigniew; Dobrowolski, Adam; Robak, Małgorzata

    2014-01-01

    Study of hexoses transporter started with discovery of galactose permease in Saccharomyces cerevisiae. Glucose, fructose and mannose assimilation is assumed by numerous proteins encoded by different genes. To date over 20 hexoses transporters, belonging to Sugar Porter family and to Major Facilitator Superfamily, were known. Genome sequence analysis of Candida glabrata, Kluyveromyces lactis, Yarrowia lipolytica, S. cerevisaie and Debaryomyces hansenii reveled potential presence of 17-48 sugar porter proteins. Glucose transporters in S. cerevisiae have been already characterized. In this paper, hexoses transporters, responsible for assimilation of fructose by cells, are presented and compared. Fructose specific transporter are described for yeasts: Zygosaccharomyces rouxii, Zygosaccharomyces bailli, K. lactis, Saccharomyces pastorianus, S. cerevisiae winemaking strain and for fungus Botritys cinerea and human (Glut5p). Among six yeasts transporters, five are fructose specific, acting by facilitated diffusion or proton symport. Yeasts monosaccharides transporter studies allow understanding of sugars uptake and metabolism important aspects, even in higher eukaryotes cells. PMID:25033548

  8. The Yin and Yang of Yeast Transcription: Elements of a Global Feedback System between Metabolism and Chromatin

    OpenAIRE

    Machné, Rainer; Murray, Douglas B.

    2012-01-01

    When grown in continuous culture, budding yeast cells tend to synchronize their respiratory activity to form a stable oscillation that percolates throughout cellular physiology and involves the majority of the protein-coding transcriptome. Oscillations in batch culture and at single cell level support the idea that these dynamics constitute a general growth principle. The precise molecular mechanisms and biological functions of the oscillation remain elusive. Fourier analysis of transcriptome...

  9. Cellular localization of Sun4p and its interaction with proteins in the yeast birth scar.

    Science.gov (United States)

    Kuznetsov, Evgeny; Váchová, Libuše; Palková, Zdena

    2016-07-17

    Yeast harbor several proteins with predicted glucanase activity that are potentially involved in cell wall remodeling during different processes, including mitosis. Here, we showed that 2 of these putative glucanases, Sun4p and Dse2p, co-localize to the yeast birth scar, dependently on presence of the third glucanase, Egt2p. The absence of these glucanases results in inefficient mother-daughter cell separation. The Sun4p, Dse2p and Egt2p localize to the daughter side of the bud neck, possibly forming a complex, and are involved in the separation of the virgin daughter from the mother cell during mitosis. The formation of properly assembled birth scars that delimitate cell wall area restricted in the next budding is dependent on the presence of Aim44p and its transcriptional regulator, Swi5p. AIM44 or SWI5 deletion caused the "budding within the birth scar" phenotype, together with altered localization of the birth scar proteins Sun4p and Dse2p, indicating the impairment of birth scar protein complexes. PMID:27229769

  10. Genetics of Yeasts

    Science.gov (United States)

    Querol, Amparo; Fernández-Espinar, M. Teresa; Belloch, Carmela

    The use of yeasts in biotechnology processes dates back to ancient days. Before 7000 BC, beer was produced in Sumeria. Wine was made in Assyria in 3500 BC, and ancient Rome had over 250 bakeries, which were making leavened bread by 100 BC. And milk has been made into Kefyr and Koumiss in Asia for many centuries (Demain, Phaff, & Kurtzman, 1999). However, the importance of yeast in the food and beverage industries was only realized about 1860, when their role in food manufacturing became evident.

  11. Molecular Genetic Tools and Techniques in Fission Yeast.

    Science.gov (United States)

    Murray, Johanne M; Watson, Adam T; Carr, Antony M

    2016-01-01

    The molecular genetic tools used in fission yeast have generally been adapted from methods and approaches developed for use in the budding yeast, Saccharomyces cerevisiae Initially, the molecular genetics of Schizosaccharomyces pombe was developed to aid gene identification, but it is now applied extensively to the analysis of gene function and the manipulation of noncoding sequences that affect chromosome dynamics. Much current research using fission yeast thus relies on the basic processes of introducing DNA into the organism and the extraction of DNA for subsequent analysis. Targeted integration into specific genomic loci is often used to create site-specific mutants or changes to noncoding regulatory elements for subsequent phenotypic analysis. It is also regularly used to introduce additional sequences that generate tagged proteins or to create strains in which the levels of wild-type protein can be manipulated through transcriptional regulation and/or protein degradation. Here, we draw together a collection of core molecular genetic techniques that underpin much of modern research using S. pombe We summarize the most useful methods that are routinely used and provide guidance, learned from experience, for the successful application of these methods. PMID:27140925

  12. Yeast metabolic state identification using micro-fiber optics spectroscopy

    Science.gov (United States)

    Silva, J. S.; Castro, C. C.; Vicente, A. A.; Tafulo, P.; Jorge, P. A. S.; Martins, R. C.

    2011-05-01

    Saccharomyces cerevisiae morphology is known to be dependent on the cell physiological state and environmental conditions. On their environment, wild yeasts tend to form complex colonies architectures, such as stress response and pseudohyphal filaments morphologies, far away from the ones found inside bioreactors, where the regular cell cycle is observed under controlled conditions (e.g. budding and flocculating colonies). In this work we explore the feasibility of using micro-fiber optics spectroscopy to classify Saccharomyces cerevisiae S288C colony structures in YPD media, under different growth conditions, such as: i) no alcohol; ii) 1 % (v/v) Ethanol; iii) 1 % (v/v) 1-butanol; iv) 1 % (v/v) Isopropanol; v) 1 % (v/v) Tert-Amyl alcohol (2 Methyl-2-butanol); vi) 0,2 % (v/v) 2-Furaldehyde; vii) 5 % (w/v) 5 (Hydroxymethyl)-furfural; and viii) 1 % (w/v) (-)-Adenosine3', 5'cyclic monophosphate. The microscopy system includes a hyperspectral camera apparatus and a micro fiber (sustained by micro manipulator) optics system for spectroscopy. Results show that micro fiber optics system spectroscopy has the potential for yeasts metabolic state identification once the spectral signatures of colonies differs from each others. This technique associated with others physico-chemical information can benefit the creation of an information system capable of providing extremely detailed information about yeast metabolic state that will aid both scientists and engineers to study and develop new biotechnological products.

  13. Quantifying yeast chronological life span by outgrowth of aged cells.

    Science.gov (United States)

    Murakami, Christopher; Kaeberlein, Matt

    2009-01-01

    The budding yeast Saccharomyces cerevisiae has proven to be an important model organism in the field of aging research. The replicative and chronological life spans are two established paradigms used to study aging in yeast. Replicative aging is defined as the number of daughter cells a single yeast mother cell produces before senescence; chronological aging is defined by the length of time cells can survive in a non-dividing, quiescence-like state. We have developed a high-throughput method for quantitative measurement of chronological life span. This method involves aging the cells in a defined medium under agitation and at constant temperature. At each age-point, a sub-population of cells is removed from the aging culture and inoculated into rich growth medium. A high-resolution growth curve is then obtained for this sub-population of aged cells using a Bioscreen C MBR machine. An algorithm is then applied to determine the relative proportion of viable cells in each sub-population based on the growth kinetics at each age-point. This method requires substantially less time and resources compared to other chronological lifespan assays while maintaining reproducibility and precision. The high-throughput nature of this assay should allow for large-scale genetic and chemical screens to identify novel longevity modifiers for further testing in more complex organisms. PMID:19421136

  14. Structural properties of replication origins in yeast DNA sequences

    International Nuclear Information System (INIS)

    Sequence-dependent DNA flexibility is an important structural property originating from the DNA 3D structure. In this paper, we investigate the DNA flexibility of the budding yeast (S. Cerevisiae) replication origins on a genome-wide scale using flexibility parameters from two different models, the trinucleotide and the tetranucleotide models. Based on analyzing average flexibility profiles of 270 replication origins, we find that yeast replication origins are significantly rigid compared with their surrounding genomic regions. To further understand the highly distinctive property of replication origins, we compare the flexibility patterns between yeast replication origins and promoters, and find that they both contain significantly rigid DNAs. Our results suggest that DNA flexibility is an important factor that helps proteins recognize and bind the target sites in order to initiate DNA replication. Inspired by the role of the rigid region in promoters, we speculate that the rigid replication origins may facilitate binding of proteins, including the origin recognition complex (ORC), Cdc6, Cdt1 and the MCM2-7 complex

  15. Kinetics of Formation and Asymmetrical Distribution of Hsp104-Bound Protein Aggregates in Yeast.

    Science.gov (United States)

    Paoletti, Camille; Quintin, Sophie; Matifas, Audrey; Charvin, Gilles

    2016-04-12

    Budding yeast cells have a finite replicative life span; that is, a mother cell produces only a limited number of daughter cells before it slows division and dies. Despite the gradual aging of the mother cell, all daughters are born rejuvenated and enjoy a full replicative lifespan. It has been proposed that entry of mother cells into senescence is driven by the progressive accumulation and retention of damaged material, including protein aggregates. This additionally allows the daughter cells to be born damage free. However, the mechanism underlying such asymmetrical segregation of protein aggregates by mother and daughter cells remains controversial, in part because of the difficulties inherent in tracking the dynamics and fate of protein aggregates in vivo. To overcome such limitations, we have developed single-cell real-time imaging methodology to track the formation of heat-induced protein aggregates in otherwise unperturbed dividing cells. By combining the imaging data with a simple computational model of protein aggregation, we show that the establishment of asymmetrical partitioning of protein aggregates upon division is driven by the large bud-specific dilution rate associated with polarized growth and the absence of significant mother/bud exchange of protein aggregates during the budded phase of the cell cycle. To our knowledge, this study sheds new light on the mechanism of establishment of a segregation bias, which can be accounted for by simple physical arguments. PMID:27074685

  16. Dissection and Design of Yeast Prions

    Directory of Open Access Journals (Sweden)

    Osherovich Lev Z

    2004-01-01

    Full Text Available Many proteins can misfold into beta-sheet-rich, self-seeding polymers (amyloids. Prions are exceptional among such aggregates in that they are also infectious. In fungi, prions are not pathogenic but rather act as epigenetic regulators of cell physiology, providing a powerful model for studying the mechanism of prion replication. We used prion-forming domains from two budding yeast proteins (Sup35p and New1p to examine the requirements for prion formation and inheritance. In both proteins, a glutamine/asparagine-rich (Q/N-rich tract mediates sequence-specific aggregation, while an adjacent motif, the oligopeptide repeat, is required for the replication and stable inheritance of these aggregates. Our findings help to explain why although Q/N-rich proteins are relatively common, few form heritable aggregates: prion inheritance requires both an aggregation sequence responsible for self-seeded growth and an element that permits chaperone-dependent replication of the aggregate. Using this knowledge, we have designed novel artificial prions by fusing the replication element of Sup35p to aggregation-prone sequences from other proteins, including pathogenically expanded polyglutamine.

  17. Yeast fluorescence microscopy

    Czech Academy of Sciences Publication Activity Database

    Hašek, Jiří

    New Jersey : Humana Press, 2005, s. 85-96. ISBN 1-59259-958-3 R&D Projects: GA AV ČR IAA5020102; GA ČR GA204/02/1424 Institutional research plan: CEZ:AV0Z50200510 Keywords : yeast * fluorescence microscopy * immunofluorescence Subject RIV: EE - Microbiology, Virology

  18. Polysome Profile Analysis - Yeast

    Czech Academy of Sciences Publication Activity Database

    Pospíšek, M.; Valášek, Leoš

    2013-01-01

    Roč. 530, č. 2013 (2013), s. 173-181. ISSN 0076-6879 Institutional support: RVO:61388971 Keywords : grow yeast cultures * polysome profile analysis * sucrose density gradient centrifugation Subject RIV: CE - Biochemistry Impact factor: 2.194, year: 2013

  19. Opportunistic Pathogenic Yeasts

    Science.gov (United States)

    Banerjee, Uma

    Advances in medical research, made during the last few decades, have improved the prophylactic, diagnostic and therapeutic capabilities for variety of infections/diseases. However, many of the prophylactic and therapeutic procedures have been seen in many instances to exact a price of host-vulnerability to an expanding group of opportunistic pathogens and yeasts are one of the important members in it. Fortunately amongst the vast majority of yeasts present in nature only few are considered to have the capability to cause infections when certain opportunities predisposes and these are termed as ‘opportunistic pathogenic yeasts.’ However, the term ‘pathogenic’ is quite tricky, as it depends of various factors of the host, the ‘bug’ and the environment to manifest the clinical infection. The borderline is expanding. In the present century with unprecedented increase in number of immune-compromised host in various disciplines of health care settings, where any yeast, which has the capability to grow at 37 ° C (normal body temperature of human), can be pathogenic and cause infection in particular situation

  20. Membrane-elasticity model of Coatless vesicle budding induced by ESCRT complexes.

    Directory of Open Access Journals (Sweden)

    Bartosz Różycki

    Full Text Available The formation of vesicles is essential for many biological processes, in particular for the trafficking of membrane proteins within cells. The Endosomal Sorting Complex Required for Transport (ESCRT directs membrane budding away from the cytosol. Unlike other vesicle formation pathways, the ESCRT-mediated budding occurs without a protein coat. Here, we propose a minimal model of ESCRT-induced vesicle budding. Our model is based on recent experimental observations from direct fluorescence microscopy imaging that show ESCRT proteins colocalized only in the neck region of membrane buds. The model, cast in the framework of membrane elasticity theory, reproduces the experimentally observed vesicle morphologies with physically meaningful parameters. In this parameter range, the minimum energy configurations of the membrane are coatless buds with ESCRTs localized in the bud neck, consistent with experiment. The minimum energy configurations agree with those seen in the fluorescence images, with respect to both bud shapes and ESCRT protein localization. On the basis of our model, we identify distinct mechanistic pathways for the ESCRT-mediated budding process. The bud size is determined by membrane material parameters, explaining the narrow yet different bud size distributions in vitro and in vivo. Our membrane elasticity model thus sheds light on the energetics and possible mechanisms of ESCRT-induced membrane budding.

  1. Influences of polar auxin transport on polarity of adventitious bud formation in hybrid populas

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Myung Won (Yonsei Univ. Kangwondo (Korea)); Hackett, W. (Univ of Minnesota, St. Paul (USA))

    1989-04-01

    The role of auxin and cytokinin distribution of polar regeneration of adventitious bud has been investigated. Explants from leaf midvein were labelled with {sup 14}C-NAA and {sup 14}C-BA and the radioactivity in proximal, mid, and distal portions was counted after 24h and 48h. Explants showing polar regeneration of buds on the proximal end showed a clear polar distribution of {sup 14}CNAA. Auxin transport inhibitors (NPA, TIBA) eliminated polar distribution of auxin and reduced polarity of bud formation and the total number of buds formed, but did not reduce callus formation. Increased concentration of Ca(NO{sub 3}){sub 2} decreased polarity of bud formation and increased the number of buds formed but did not affect the distribution of auxin of cytokinin. Some factor in addition to polar distribution of auxin or cytokinin-auxin ratio appears to influence the polarity of adventitious bud formation.

  2. L-arabinose fermenting yeast

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Min; Singh, Arjun; Suominen, Pirkko; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric

    2014-09-23

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

  3. L-arabinose fermenting yeast

    Science.gov (United States)

    Zhang, Min; Singh, Arjun; Suominen, Pirkko; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric

    2013-02-12

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

  4. Recurrent peripheral odontogenic fibroma associated with basal cell budding

    Directory of Open Access Journals (Sweden)

    C Sreeja

    2014-01-01

    Full Text Available Peripheral odontogenic fibroma (POdF is a rare benign odontogenic neoplasm. It represents the soft tissue counterpart of central odontogenic fibroma. The embryonic source of POdF has been suggested by many as arising from the rest of dental lamina that has persisted in the gingiva following its disintegration. It presents clinically as a firm, slow growing and sessile gingival mass, which is difficult to distinguish with more common inflammatory lesions. Very few cases of recurrence have been documented. It has been stated that histological budding of basal cell layer of the surface squamous epithelium is associated with higher recurrence and the presence of calcification in direct apposition to the epithelial rest is associated with lower recurrence. Hereby, we present a case which histologically exhibited budding of the basal cell layer, which could have been the reason for its recurrence.

  5. Budding Transition of Asymmetric Two-component Lipid Domains

    CERN Document Server

    Wolff, Jean; Andelman, David

    2016-01-01

    We propose a model that accounts for the budding transition of asymmetric two-component lipid domains, where the two monolayers (leaflets) have different average compositions controlled by independent chemical potentials. Assuming a coupling between the local curvature and local lipid composition in each of the leaflets, we discuss the morphology and thermodynamic behavior of asymmetric lipid domains. The membrane free-energy contains three contributions: the bending energy, the line tension, and a Landau free-energy for a lateral phase separation. Within a mean-field treatment, we obtain various phase diagrams containing fully budded, dimpled, and flat states as a function of the two leaflet compositions. The global phase behavior is analyzed, and depending on system parameters, the phase diagrams include one-phase, two-phase and three-phase regions. In particular, we predict various phase coexistence regions between different morphologies of domains, which may be observed in multi-component membranes or ves...

  6. Tumor budding is a strong and reproducible prognostic marker in T3N0 colorectal cancer.

    LENUS (Irish Health Repository)

    Wang, Lai Mun

    2012-02-01

    BACKGROUND: Tumor budding along the advancing front of colorectal adenocarcinoma is an early event in the metastatic process. A reproducible, prognostic budding scoring system based on outcomes in early stage colorectal cancer has not been established. DESIGN: One hundred twenty-eight T3N0M0 colorectal carcinoma patients with known outcome were identified. Tumor budding was defined as isolated tumor cells or clusters of <5 cells at the invasive tumor front. Tumor bud counts were generated in 5 regions at 200x by 2 pathologists (conventional bud count method). The median bud count per case was used to divide cases into low (median=0) and high budding (median > or =1) groups. Forty cases were reevaluated to assess reproducibility using the conventional and a novel rapid bud count method. RESULTS: Fifty-seven (45%) carcinomas had high and 71 (55%) had low budding scores. High budding was associated with an infiltrative growth pattern (P<0.0001) and lymphovascular invasion (P=0.005). Five-year cancer-specific survival was significantly poorer in high compared with low budding groups: 63% versus 91%, respectively, P<0.0001. Multivariate analysis demonstrated tumor budding to be independently prognostic (hazard ratio=4.76, P<0.001). Interobserver agreement was at least equivalent comparing the conventional to the rapid bud count methods: 87.5% agreement (kappa=0.75) versus 92.5% agreement (kappa=0.85), respectively. CONCLUSIONS: Tumor budding is a strong, reproducible, and independent prognostic marker of outcome that is easily assessed on hematoxylin and eosin slides. This may be useful for identifying the subset of T3N0M0 patients at high risk of recurrence who may benefit from adjuvant therapy.

  7. The protein machinery of vesicle budding and fusion.

    OpenAIRE

    Rothman, J E

    1996-01-01

    A general protein machinery that buds and fuses transport vesicles is harnessed to generate the complex web of intracellular transport pathways critical for such diverse processes as cell growth, endocytosis, hormone release, and neurotransmission. With this appreciation, the challenge of understanding the precise molecular mechanisms of these many facets of cell biology has been reduced to a series of problems in protein structure and chemistry.

  8. Signal transduction and information processing in mammalian taste buds

    OpenAIRE

    Roper, Stephen D.

    2007-01-01

    The molecular machinery for chemosensory transduction in taste buds has received considerable attention within the last decade. Consequently, we now know a great deal about sweet, bitter, and umami taste mechanisms and are gaining ground rapidly on salty and sour transduction. Sweet, bitter, and umami tastes are transduced by G-protein-coupled receptors. Salty taste may be transduced by epithelial Na channels similar to those found in renal tissues. Sour transduction appears to be initiated b...

  9. Clonal and bud bank traits: patterns across temperate plant communities

    Czech Academy of Sciences Publication Activity Database

    Klimešová, Jitka; Herben, Tomáš

    2015-01-01

    Roč. 26, č. 2 (2015), s. 243-253. ISSN 1100-9233 R&D Projects: GA ČR GB14-36079G; GA ČR GA13-17118S; GA ČR GAP505/12/1007 Institutional support: RVO:67985939 Keywords : clonal and bud bank traits * vegetation * central Europe Subject RIV: EH - Ecology, Behaviour Impact factor: 3.709, year: 2014

  10. Trichomes control flower bud shape by linking together young petals.

    Science.gov (United States)

    Tan, Jiafu; Walford, Sally-Anne; Dennis, Elizabeth S; Llewellyn, Danny

    2016-01-01

    Trichomes are widespread in plants and develop from surface cells on different tissues(1). They have many forms and functions, from defensive spines to physical barriers that trap layers of air to insulate against desiccation, but there is growing evidence that trichomes can also have developmental roles in regulating flower structure(2,3). We report here that the trichomes on petals of cotton, Gossypium hirsutum L., are essential for correct flower bud shape through a mechanical entanglement of the trichomes on adjacent petals that anchor the edges to counter the opposing force generated by asymmetric expansion of overlapping petals. Silencing a master regulator of petal trichomes, GhMYB-MIXTA-Like10 (GhMYBML10), by RNA interference (RNAi) suppressed petal trichome growth and resulted in flower buds forming into abnormal corkscrew shapes that exposed developing anthers and stigmas to desiccation damage. Artificially gluing petal edges together could partially restore correct bud shape and fertility. Such petal 'Velcro' is present in other Malvaceae and perhaps more broadly in other plant families, although it is not ubiquitous. This mechanism for physical association between separate organs to regulate flower shape and function is different from the usual organ shape control(4) exerted through cell-to-cell communication and differential cell expansion within floral tissues(5,6). PMID:27322517

  11. Ecological conditions favoring budding in colonial organisms under environmental disturbance.

    Directory of Open Access Journals (Sweden)

    Mayuko Nakamaru

    Full Text Available Dispersal is a topic of great interest in ecology. Many organisms adopt one of two distinct dispersal tactics at reproduction: the production of small offspring that can disperse over long distances (such as seeds and spawned eggs, or budding. The latter is observed in some colonial organisms, such as clonal plants, corals and ants, in which (superorganisms split their body into components of relatively large size that disperse to a short distance. Contrary to the common dispersal viewpoint, short-dispersal colonial organisms often flourish even in environments with frequent disturbances. In this paper, we investigate the conditions that favor budding over long-distance dispersal of small offspring, focusing on the life history of the colony growth and the colony division ratio. These conditions are the relatively high mortality of very small colonies, logistic growth, the ability of dispersers to peacefully seek and settle unoccupied spaces, and small spatial scale of environmental disturbance. If these conditions hold, budding is advantageous even when environmental disturbance is frequent. These results suggest that the demography or life history of the colony underlies the behaviors of the colonial organisms.

  12. Bud dormancy in apple trees after thermal fluctuations

    Directory of Open Access Journals (Sweden)

    Rafael Anzanello

    2014-06-01

    Full Text Available The objective of this work was to evaluate the effect of heat waves on the evolution of bud dormancy, in apple trees with contrasting chilling requirements. Twigs of 'Castel Gala' and 'Royal Gala' were collected in orchards in Papanduva, state of Santa Catarina, Brazil, and were exposed to constant (3°C or alternating (3 and 15°C for 12/12 hours temperature, combined with zero, one or two days a week at 25°C. Two additional treatments were evaluated: constant temperature (3°C, with a heat wave of seven days at 25°C, in the beginning or in the middle of the experimental period. Periodically, part of the twigs was transferred to 25°C for daily budburst evaluation of apical and lateral buds. Endodormancy (dormancy induced by cold was overcome with less than 330 chilling hours (CH of constant cold in 'Castel Gala' and less than 618 CH in 'Royal Gala'. A daily 15°C-temperature cycle did not affect the endodormancy process. Heat waves during endodormancy resulted in an increased CH to achieve bud requirements. The negative effect of high temperature depended on the lasting of this condition. Chilling was partly cancelled during dormancy when the heat wave lasted 36 continuous hours or more. Therefore, budburst prediction models need adjustments, mainly for regions with mild and irregular winters, such as those of Southern Brazil.

  13. Removal of deciduous canine tooth buds in Kenyan rural Maasai.

    Science.gov (United States)

    Hassanali, J; Amwayi, P; Muriithi, A

    1995-04-01

    The removal of deciduous canine tooth buds in early childhood is a practice that has been documented in Kenya and in neighboring countries. This paper describes the occurrence, rationale and method of this practice amongst rural Kenyan Maasai. In a group of 95 children aged between six months and two years, who were examined in 1991/92, 87% were found to have undergone the removal of one or more deciduous canine tooth buds. In an older age group (3-7 years of age), 72% of the 111 children examined exhibited missing mandibular or maxillary deciduous canines. It was found that the actual removal of a deciduous tooth bud is often performed by middle-aged Maasai women who enucleate the developing tooth using a pointed pen-knife. There exists a strong belief among the Maasai that diarrhoea, vomiting and other febrile illnesses of early childhood are caused by the gingival swelling over the canine region, and which is thought to contain 'worms' or 'nylon' teeth. The immediate and long-term hazards of this practice include profuse bleeding, infection and damage to the developing permanent canines. A multi-disciplinary approach involving social anthropologists in addition to dental and medical personnel, is recommend in order to discourage this harmful operation that appears to be on the increase. PMID:7621751

  14. Construction of the first compendium of chemical-genetic profiles in the fission yeast Schizosaccharomyces pombe and comparative compendium approach

    Energy Technology Data Exchange (ETDEWEB)

    Han, Sangjo [Bioinformatics Lab, Healthcare Group, SK Telecom, 9-1, Sunae-dong, Pundang-gu, Sungnam-si, Kyunggi-do 463-784 (Korea, Republic of); Lee, Minho [Department of Bio and Brain Engineering, Korea Advanced Institute of Science and Technology, 291 Daehak-ro, Yuseong-gu, Daejeon 305-701 (Korea, Republic of); Chang, Hyeshik [Department of Biological Science, Seoul National University, 599 Gwanakro, Gwanak-gu, Seoul 151-747 (Korea, Republic of); Nam, Miyoung [Department of New Drug Discovery and Development, Chungnam National University, 99 Daehak-ro, Yuseong-gu, Daejeon, 305-764 (Korea, Republic of); Park, Han-Oh [Bioneer Corp., 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 306-220 (Korea, Republic of); Kwak, Youn-Sig [Department of Applied Biology, Gyeongsang National University, 501 Jinju-daero, Jinju, Gyeongnam 660-701 (Korea, Republic of); Ha, Hye-jeong [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-Gu, Daejeon 305-806 (Korea, Republic of); Kim, Dongsup [Department of Bio and Brain Engineering, Korea Advanced Institute of Science and Technology, 291 Daehak-ro, Yuseong-gu, Daejeon 305-701 (Korea, Republic of); Hwang, Sung-Ook [Department of Obstetrics and Gynecology, Inha University Hospital, 7-206 Sinheung-dong, Jung-gu, Incheon 400-711 (Korea, Republic of); Hoe, Kwang-Lae [Department of New Drug Discovery and Development, Chungnam National University, 99 Daehak-ro, Yuseong-gu, Daejeon, 305-764 (Korea, Republic of); Kim, Dong-Uk [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-Gu, Daejeon 305-806 (Korea, Republic of)

    2013-07-12

    Highlights: •The first compendium of chemical-genetic profiles form fission yeast was generated. •The first HTS of drug mode-of-action in fission yeast was performed. •The first comparative chemical genetic analysis between two yeasts was conducted. -- Abstract: Genome-wide chemical genetic profiles in Saccharomyces cerevisiae since the budding yeast deletion library construction have been successfully used to reveal unknown mode-of-actions of drugs. Here, we introduce comparative approach to infer drug target proteins more accurately using two compendiums of chemical-genetic profiles from the budding yeast S. cerevisiae and the fission yeast Schizosaccharomyces pombe. For the first time, we established DNA-chip based growth defect measurement of genome-wide deletion strains of S. pombe, and then applied 47 drugs to the pooled heterozygous deletion strains to generate chemical-genetic profiles in S. pombe. In our approach, putative drug targets were inferred from strains hypersensitive to given drugs by analyzing S. pombe and S. cerevisiae compendiums. Notably, many evidences in the literature revealed that the inferred target genes of fungicide and bactericide identified by such comparative approach are in fact the direct targets. Furthermore, by filtering out the genes with no essentiality, the multi-drug sensitivity genes, and the genes with less eukaryotic conservation, we created a set of drug target gene candidates that are expected to be directly affected by a given drug in human cells. Our study demonstrated that it is highly beneficial to construct the multiple compendiums of chemical genetic profiles using many different species. The fission yeast chemical-genetic compendium is available at (http://pombe.kaist.ac.kr/compendium)

  15. Construction of the first compendium of chemical-genetic profiles in the fission yeast Schizosaccharomyces pombe and comparative compendium approach

    International Nuclear Information System (INIS)

    Highlights: •The first compendium of chemical-genetic profiles form fission yeast was generated. •The first HTS of drug mode-of-action in fission yeast was performed. •The first comparative chemical genetic analysis between two yeasts was conducted. -- Abstract: Genome-wide chemical genetic profiles in Saccharomyces cerevisiae since the budding yeast deletion library construction have been successfully used to reveal unknown mode-of-actions of drugs. Here, we introduce comparative approach to infer drug target proteins more accurately using two compendiums of chemical-genetic profiles from the budding yeast S. cerevisiae and the fission yeast Schizosaccharomyces pombe. For the first time, we established DNA-chip based growth defect measurement of genome-wide deletion strains of S. pombe, and then applied 47 drugs to the pooled heterozygous deletion strains to generate chemical-genetic profiles in S. pombe. In our approach, putative drug targets were inferred from strains hypersensitive to given drugs by analyzing S. pombe and S. cerevisiae compendiums. Notably, many evidences in the literature revealed that the inferred target genes of fungicide and bactericide identified by such comparative approach are in fact the direct targets. Furthermore, by filtering out the genes with no essentiality, the multi-drug sensitivity genes, and the genes with less eukaryotic conservation, we created a set of drug target gene candidates that are expected to be directly affected by a given drug in human cells. Our study demonstrated that it is highly beneficial to construct the multiple compendiums of chemical genetic profiles using many different species. The fission yeast chemical-genetic compendium is available at (http://pombe.kaist.ac.kr/compendium)

  16. Continuous crossbreeding of sake yeasts using growth selection systems for a-type and α-type cells.

    Science.gov (United States)

    Fukuda, Nobuo; Kaishima, Misato; Ishii, Jun; Kondo, Akihiko; Honda, Shinya

    2016-12-01

    Sake yeasts belong to the budding yeast species Saccharomyces cerevisiae and have high fermentation activity and ethanol production. Although the traditional crossbreeding of sake yeasts is a time-consuming and inefficient process due to the low sporulation rates and spore viability of these strains, considerable effort has been devoted to the development of hybrid strains with superior brewing characteristics. In the present work, we describe a growth selection system for a- and α-type cells aimed at the crossbreeding of industrial yeasts, and performed hybridizations with sake yeast strains Kyokai No. 6, No. 7 and No. 9 to examine the feasibility of this approach. We successfully generated both a- and α-type strains from all parental strains, and acquired six types of hybrids by outcrossing. One of these hybrid strains was subjected to continuous crossbreeding, yielding the multi-hybrid strain, which inherited the genetic characteristics of Kyokai No. 6, No. 7 and No. 9. Notably, because all of the genetic modifications of the yeast cells were introduced using plasmids, these traits can be easily removed. The approach described here has the potential to markedly accelerate the crossbreeding of industrial yeast strains with desirable properties. PMID:27392493

  17. Multisite phosphorylation of the guanine nucleotide exchange factor Cdc24 during yeast cell polarization.

    Directory of Open Access Journals (Sweden)

    Stephanie C Wai

    Full Text Available BACKGROUND: Cell polarization is essential for processes such as cell migration and asymmetric cell division. A common regulator of cell polarization in most eukaryotic cells is the conserved Rho GTPase, Cdc42. In budding yeast, Cdc42 is activated by a single guanine nucleotide exchange factor, Cdc24. The mechanistic details of Cdc24 activation at the onset of yeast cell polarization are unclear. Previous studies have suggested an important role for phosphorylation of Cdc24, which may regulate activity or function of the protein, representing a key step in the symmetry breaking process. METHODOLOGY/PRINCIPAL FINDINGS: Here, we directly ask whether multisite phosphorylation of Cdc24 plays a role in its regulation. We identify through mass spectrometry analysis over thirty putative in vivo phosphorylation sites. We first focus on sites matching consensus sequences for cyclin-dependent and p21-activated kinases, two kinase families that have been previously shown to phosphorylate Cdc24. Through site-directed mutagenesis, yeast genetics, and light and fluorescence microscopy, we show that nonphosphorylatable mutations of these consensus sites do not lead to any detectable consequences on growth rate, morphology, kinetics of polarization, or localization of the mutant protein. We do, however, observe a change in the mobility shift of mutant Cdc24 proteins on SDS-PAGE, suggesting that we have indeed perturbed its phosphorylation. Finally, we show that mutation of all identified phosphorylation sites does not cause observable defects in growth rate or morphology. CONCLUSIONS/SIGNIFICANCE: We conclude that lack of phosphorylation on Cdc24 has no overt functional consequences in budding yeast. Yeast cell polarization may be more tightly regulated by inactivation of Cdc42 by GTPase activating proteins or by alternative methods of Cdc24 regulation, such as conformational changes or oligomerization.

  18. Biochemical and Structural Studies of YEast Vps4 Oligomerization

    Energy Technology Data Exchange (ETDEWEB)

    Gonciarz, M.; Whitby, F; Eckert, D; Kieffer, C; Heroux, A; Sundquist, W; Hill, C

    2008-01-01

    The ESCRT (endosomal sorting complexes required for transport) pathway functions in vesicle formation at the multivesicular body, the budding of enveloped RNA viruses such as HIV-1, and the final abscission stage of cytokinesis. As the only known enzyme in the ESCRT pathway, the AAA ATPase (ATPase associated with diverse cellular activities) Vps4 provides the energy required for multiple rounds of vesicle formation. Like other Vps4 proteins, yeast Vps4 cycles through two states: a catalytically inactive disassembled state that we show here is a dimer and a catalytically active higher-order assembly that we have modeled as a dodecamer composed of two stacked hexameric rings. We also report crystal structures of yeast Vps4 proteins in the apo- and ATPS (adenosine 5'-O-(3-thiotriphosphate))-bound states. In both cases, Vps4 subunits assembled into continuous helices with 6-fold screw axes that are analogous to helices seen previously in other Vps4 crystal forms. The helices are stabilized by extensive interactions between the large and small AAA ATPase domains of adjacent Vps4 subunits, suggesting that these contact surfaces may be used to build both the catalytically active dodecamer and catalytically inactive dimer. Consistent with this model, we have identified interface mutants that specifically inhibit Vps4 dimerization, dodecamerization, or both. Thus, the Vps4 dimer and dodecamer likely form distinct but overlapping interfaces. Finally, our structural studies have allowed us to model the conformation of a conserved loop (pore loop 2) that is predicted to form an arginine-rich pore at the center of one of the Vps4 hexameric rings. Our mutational analyses demonstrate that pore loop 2 residues Arg241 and Arg251 are required for efficient HIV-1 budding, thereby supporting a role for this 'arginine collar' in Vps4 function.

  19. Extracellular Polysaccharides Produced by Yeasts and Yeast-Like Fungi

    Science.gov (United States)

    van Bogaert, Inge N. A.; de Maeseneire, Sofie L.; Vandamme, Erick J.

    Several yeasts and yeast-like fungi are known to produce extracellular polysaccharides. Most of these contain D-mannose, either alone or in combination with other sugars or phosphate. A large chemical and structural variability is found between yeast species and even among different strains. The types of polymers that are synthesized can be chemically characterized as mannans, glucans, phosphoman-nans, galactomannans, glucomannans and glucuronoxylomannans. Despite these differences, almost all of the yeast exopolysaccharides display some sort of biological activity. Some of them have already applications in chemistry, pharmacy, cosmetics or as probiotic. Furthermore, some yeast exopolysaccharides, such as pullulan, exhibit specific physico-chemical and rheological properties, making them useful in a wide range of technical applications. A survey is given here of the production, the characteristics and the application potential of currently well studied yeast extracellular polysaccharides.

  20. Differentiation of Apical Bud Cells in a Newly Developed Apical Bud Transplantation Model Using GFP Transgenic Mice as Donor.

    Directory of Open Access Journals (Sweden)

    Naoki Maruo

    Full Text Available Rodent mandibular incisors have a unique anatomical structure that allows teeth to grow throughout the lifetime of the rodent. This report presents a novel transplantation technique for studying the apical bud differentiation of rodent mandibular incisors. Incisal apical end tissue with green fluorescent protein from transgenic mouse was transplanted to wild type mice, and the development of the transplanted cells were immunohistologically observed for 12 weeks after the transplantation. Results indicate that the green fluorescent apical end tissue replaced the original tissue, and cells from the apical bud differentiated and extended toward the incisal edge direction. The immunostaining with podoplanin also showed that the characteristics of the green fluorescent tissue were identical to those of the original. The green fluorescent cells were only found in the labial side of the incisor up to 4 weeks. After 12 weeks, however, they were also found in the lingual side. Here the green fluorescent cementocyte-like cells were only present in the cementum close to the dentin surface. This study suggests that some of the cells that form the cellular cementum come from the apical tissue including the apical bud in rodent incisors.

  1. Differentiation of Apical Bud Cells in a Newly Developed Apical Bud Transplantation Model Using GFP Transgenic Mice as Donor

    Science.gov (United States)

    Sakagami, Ryuji; Yoshinaga, Yasunori; Okamura, Kazuhiko

    2016-01-01

    Rodent mandibular incisors have a unique anatomical structure that allows teeth to grow throughout the lifetime of the rodent. This report presents a novel transplantation technique for studying the apical bud differentiation of rodent mandibular incisors. Incisal apical end tissue with green fluorescent protein from transgenic mouse was transplanted to wild type mice, and the development of the transplanted cells were immunohistologically observed for 12 weeks after the transplantation. Results indicate that the green fluorescent apical end tissue replaced the original tissue, and cells from the apical bud differentiated and extended toward the incisal edge direction. The immunostaining with podoplanin also showed that the characteristics of the green fluorescent tissue were identical to those of the original. The green fluorescent cells were only found in the labial side of the incisor up to 4 weeks. After 12 weeks, however, they were also found in the lingual side. Here the green fluorescent cementocyte-like cells were only present in the cementum close to the dentin surface. This study suggests that some of the cells that form the cellular cementum come from the apical tissue including the apical bud in rodent incisors. PMID:26978064

  2. Iron toxicity in yeast.

    Science.gov (United States)

    Wiśnicka, R; Krzepiłko, A; Wawryn, J; Biliński, T

    1997-01-01

    It has been found that yeast cells are sensitive to iron overload only when grown on glucose as a carbon source. Effective concentration of ferrous iron is much higher than that found in natural environments. Effects of ferrous iron are strictly oxygen dependent, what suggest that the formation of hydroxyl radicals in the Fenton reaction is a cause of the toxicity. Respiratory deficiency and pretreatment of cells with antimycin A prevent toxic effects in the late exponential phase of growth, whereas uncouplers and 2mM magnesium salts completely protect even the most vulnerable exponential cells. Generally, toxic effects correlate with the ability of cells to take up this metal. The results presented suggest that during ferrous iron overload iron is transported through the unspecific divalent cation uptake system which is known in fungi. The data suggest that recently described high and low affinity systems of iron uptake in yeast are the only source of iron in natural environments. PMID:9516981

  3. Strigolactone acts downstream of auxin to regulate bud outgrowth in pea and Arabidopsis.

    Science.gov (United States)

    Brewer, Philip B; Dun, Elizabeth A; Ferguson, Brett J; Rameau, Catherine; Beveridge, Christine A

    2009-05-01

    During the last century, two key hypotheses have been proposed to explain apical dominance in plants: auxin promotes the production of a second messenger that moves up into buds to repress their outgrowth, and auxin saturation in the stem inhibits auxin transport from buds, thereby inhibiting bud outgrowth. The recent discovery of strigolactone as the novel shoot-branching inhibitor allowed us to test its mode of action in relation to these hypotheses. We found that exogenously applied strigolactone inhibited bud outgrowth in pea (Pisum sativum) even when auxin was depleted after decapitation. We also found that strigolactone application reduced branching in Arabidopsis (Arabidopsis thaliana) auxin response mutants, suggesting that auxin may act through strigolactones to facilitate apical dominance. Moreover, strigolactone application to tiny buds of mutant or decapitated pea plants rapidly stopped outgrowth, in contrast to applying N-1-naphthylphthalamic acid (NPA), an auxin transport inhibitor, which significantly slowed growth only after several days. Whereas strigolactone or NPA applied to growing buds reduced bud length, only NPA blocked auxin transport in the bud. Wild-type and strigolactone biosynthesis mutant pea and Arabidopsis shoots were capable of instantly transporting additional amounts of auxin in excess of endogenous levels, contrary to predictions of auxin transport models. These data suggest that strigolactone does not act primarily by affecting auxin transport from buds. Rather, the primary repressor of bud outgrowth appears to be the auxin-dependent production of strigolactones. PMID:19321710

  4. Genome-wide analysis of gene expression in primate taste buds reveals links to diverse processes.

    Directory of Open Access Journals (Sweden)

    Peter Hevezi

    Full Text Available Efforts to unravel the mechanisms underlying taste sensation (gustation have largely focused on rodents. Here we present the first comprehensive characterization of gene expression in primate taste buds. Our findings reveal unique new insights into the biology of taste buds. We generated a taste bud gene expression database using laser capture microdissection (LCM procured fungiform (FG and circumvallate (CV taste buds from primates. We also used LCM to collect the top and bottom portions of CV taste buds. Affymetrix genome wide arrays were used to analyze gene expression in all samples. Known taste receptors are preferentially expressed in the top portion of taste buds. Genes associated with the cell cycle and stem cells are preferentially expressed in the bottom portion of taste buds, suggesting that precursor cells are located there. Several chemokines including CXCL14 and CXCL8 are among the highest expressed genes in taste buds, indicating that immune system related processes are active in taste buds. Several genes expressed specifically in endocrine glands including growth hormone releasing hormone and its receptor are also strongly expressed in taste buds, suggesting a link between metabolism and taste. Cell type-specific expression of transcription factors and signaling molecules involved in cell fate, including KIT, reveals the taste bud as an active site of cell regeneration, differentiation, and development. IKBKAP, a gene mutated in familial dysautonomia, a disease that results in loss of taste buds, is expressed in taste cells that communicate with afferent nerve fibers via synaptic transmission. This database highlights the power of LCM coupled with transcriptional profiling to dissect the molecular composition of normal tissues, represents the most comprehensive molecular analysis of primate taste buds to date, and provides a foundation for further studies in diverse aspects of taste biology.

  5. Ultrastructure of methanotrophic yeasts.

    OpenAIRE

    Wolf, H. J.; Christiansen, M.; Hanson, R. S.

    1980-01-01

    The cellular structure of two yeast strains capable of growth on methane was investigated by electron microscopy. Microbodies were observed in cells of Sporobolomyces roseus strain Y and Rhodotorula glutinis strain CY when grown on methane but rarely when grown on glucose. The size of the microbodies and the number observed per cell in a thin section did not increase with culture age. No crystalline organization was observed within these organelles. Similar microbodies were also observed in c...

  6. Fungal spore germination into yeast or mycelium: possible implications of dimorphism in evolution and human pathogenesis

    Science.gov (United States)

    Ghormade, Vandana; Deshpande, M. V.

    The ability of dimorphism in fungi is conventionally regarded as a reversible change between the two vegetative forms, yeast and mycelium, in response to environmental change. A zygomycetous isolate, Benjaminiella poitrasii, exhibited yeast-mycelium transition in response to the change in temperature (37-28 °C) and decrease in glucose concentration. For the first time the presence of dimorphic response during asexual and sexual spore germination is reported under the dimorphism-triggering conditions in B. poitrasii. The zygospores germinated into budding yeast when subjected to yeast-form supporting conditions. The mycelium-form favoring conditions gave rise to true mycelium. Similarly, the asexual spores displayed a dimorphic response during germination. Our observations suggest that dimorphism is an intrinsic ability present in the vegetative, asexual, and sexual forms of the fungus. As dimorphic fungi are intermediate to the unicellular yeast and the filamentous forms, understanding of the dimorphic character could be useful to trace the evolutionary relationships among taxonomically different fungi. Moreover, the implications of spore germination during the onset of pathogenesis and in drug development for human health care are discussed.

  7. Off-target effects of psychoactive drugs revealed by genome-wide assays in yeast.

    Directory of Open Access Journals (Sweden)

    Elke Ericson

    Full Text Available To better understand off-target effects of widely prescribed psychoactive drugs, we performed a comprehensive series of chemogenomic screens using the budding yeast Saccharomyces cerevisiae as a model system. Because the known human targets of these drugs do not exist in yeast, we could employ the yeast gene deletion collections and parallel fitness profiling to explore potential off-target effects in a genome-wide manner. Among 214 tested, documented psychoactive drugs, we identified 81 compounds that inhibited wild-type yeast growth and were thus selected for genome-wide fitness profiling. Many of these drugs had a propensity to affect multiple cellular functions. The sensitivity profiles of half of the analyzed drugs were enriched for core cellular processes such as secretion, protein folding, RNA processing, and chromatin structure. Interestingly, fluoxetine (Prozac interfered with establishment of cell polarity, cyproheptadine (Periactin targeted essential genes with chromatin-remodeling roles, while paroxetine (Paxil interfered with essential RNA metabolism genes, suggesting potential secondary drug targets. We also found that the more recently developed atypical antipsychotic clozapine (Clozaril had no fewer off-target effects in yeast than the typical antipsychotics haloperidol (Haldol and pimozide (Orap. Our results suggest that model organism pharmacogenetic studies provide a rational foundation for understanding the off-target effects of clinically important psychoactive agents and suggest a rational means both for devising compound derivatives with fewer side effects and for tailoring drug treatment to individual patient genotypes.

  8. Yeast Interacting Proteins Database: YLR319C, YGL015C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available ion and polarized cell growth; isolated as bipolar budding mutant; potential Cdc28p substrate Rows with this...in actin cable nucleation and polarized cell growth; isolated as bipolar budding mutant; potential Cdc28p su

  9. Soft X-Ray Diffraction Microscopy of a Frozen Hydrated Yeast Cell

    OpenAIRE

    Huang, Xiaojing; Nelson, Johanna; Kirz, Janos; Lima, Enju; Marchesini, Stefano; Miao, Huijie; Neiman, Aaron M.; Shapiro, David; Steinbrener, Jan; Stewart, Andrew; Turner, Joshua J.; Jacobsen, Chris

    2009-01-01

    We report the first image of an intact, frozen hydrated eukaryotic cell using x-ray diffraction microscopy, or coherent x-ray diffraction imaging. By plunge freezing the specimen in liquid ethane and maintaining it below −170 °C, artifacts due to dehydration, ice crystallization, and radiation damage are greatly reduced. In this example, coherent diffraction data using 520 eV x rays were recorded and reconstructed to reveal a budding yeast cell at a resolution better than 25 nm. This demonstr...

  10. A sphingolipid-dependent diffusion barrier confines ER stress to the yeast mother cell

    OpenAIRE

    Lori Clay; Fabrice Caudron; Annina Denoth-Lippuner; Barbara Boettcher; St\\xfdphanie Buvelot Frei; Erik Lee Snapp; Yves Barral

    2014-01-01

    eLife digest Cell division isn't always about splitting a cell into two identical parts. The diversity of many of our own cells relies on asymmetric cell divisions. The yeast used to make bread rely on a process called ‘budding’ that involves a small daughter cell emerging from the surface of the mother cell. Mother cells can only produce around 20–50 daughter cells before dying from old age. However, their daughters are always born rejuvenated, and not aged like their mothers. Budding involv...

  11. Association of a centromere specific nucleosome with the yeast plasmid partitioning locus: Implications beyond plasmid partitioning

    OpenAIRE

    Jayaram, Makkuni

    2011-01-01

    The genetically defined point centromeres of budding yeasts and the epigenetically specified regional centromeres of all other eukaryotes harbor a common epigenetic mark in the form of a non-standard nucleosome. Although, the composition of the protein core of the centromere specific nucleosome and the nature of the DNA wrap around it are at present controversial, there is no doubt that this specialized nucleosome harbors a variant of the standard histone H3 (cenH3). The association of cenH3,...

  12. Bimolecular Fluorescence Complementation to Assay the Interactions of Ubiquitylation Enzymes in Living Yeast Cells.

    Science.gov (United States)

    Blaszczak, Ewa; Prigent, Claude; Rabut, Gwenaël

    2016-01-01

    Ubiquitylation is a versatile posttranslational protein modification catalyzed through the concerted action of ubiquitin-conjugating enzymes (E2s) and ubiquitin ligases (E3s). These enzymes form transient complexes with each other and their modification substrates and determine the nature of the ubiquitin signals attached to their substrates. One challenge in the field of protein ubiquitylation is thus to identify the E2-E3 pairs that function in the cell. In this chapter, we describe the use of bimolecular fluorescence complementation to assay E2-E3 interactions in living cells, using budding yeast as a model organism. PMID:27613039

  13. Rif1 supports the function of the CST complex in yeast telomere capping

    OpenAIRE

    S. Anbalagan; Bonetti, D; Lucchini, G; Longhese, MP

    2011-01-01

    Background: Telomere integrity in budding yeast depends on the CST (Cdc13-Stn1-Ten1) and shelterin-like (Rap1-Rif1-Rif2) complexes, which are thought to act independently from each other. Methodology: Here we show that a specific functional interaction indeed exists among components of the two complexes. In particular, unlike RIF2 deletion, the lack of Rif1 is lethal for stn1ΔC cells and causes a dramatic reduction in viability of cdc13-1 and cdc13-5 mutants. This synthetic interaction ...

  14. Membrane tension is a key determinant of bud morphology in clathrin-mediated endocytosis

    CERN Document Server

    Hassinger, Julian E; Drubin, David G; Rangamani, Padmini

    2016-01-01

    In clathrin-mediated endocytosis (CME), clathrin and various adaptor proteins coat a patch of the plasma membrane, which is reshaped to form a budded vesicle. Experimental studies have demonstrated that elevated membrane tension can inhibit bud formation by a clathrin coat. In this study, we investigate the impact of membrane tension on the mechanics of membrane budding by simulating clathrin coats that either grow in area or progressively induce greater curvature. At low membrane tension, progressively increasing the area of a curvature-generating coat causes the membrane to smoothly evolve from a flat to budded morphology, whereas the membrane remains essentially flat at high membrane tensions. Interestingly, at physiologically relevant, intermediate membrane tensions, the shape evolution of the membrane undergoes a snapthrough instability in which increasing coat area causes the membrane to "snap" from an open, U-shaped bud to a closed, $\\Omega$-shaped bud. This instability is accompanied by a large energy...

  15. Flavour-active wine yeasts

    OpenAIRE

    Cordente, Antonio G.; Curtin, Christopher D.; Varela, Cristian; Pretorius, Isak S.

    2012-01-01

    The flavour of fermented beverages such as beer, cider, saké and wine owe much to the primary fermentation yeast used in their production, Saccharomyces cerevisiae. Where once the role of yeast in fermented beverage flavour was thought to be limited to a small number of volatile esters and higher alcohols, the discovery that wine yeast release highly potent sulfur compounds from non-volatile precursors found in grapes has driven researchers to look more closely at how choice of yeast can infl...

  16. Yeast Interacting Proteins Database: YNL078W, YKR048C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YNL078W NIS1 Protein localized in the bud neck at G2/M phase; physically interacts with septins; ... Clb2p; required for the regulation of microtubule dynamics ... during mitosis; controls bud morphogenesis; involv ... Clb2p; required for the regulation of microtubule dynamics ... during mitosis; controls bud morphogenesis; involv ...

  17. Relationship between formation of gametophore buds in the protonema of mosses and increase in ribonuclease activity

    Directory of Open Access Journals (Sweden)

    M. Spychała

    2015-05-01

    Full Text Available Changes in RNase activity similar to those accompanying cytokinin-induced formation of gametophore buds in mosses (a decrease in the early phase of bud formation and later an increase in enzyme activity have also been found during spontaneous formation of gametophores in moss ontogenesis. Using various factors affecting the cytokinin-induced process of bud formation a correlation has been found between this process and the increase in RNase activity.

  18. Model of human immunodeficiency virus budding and self-assembly: Role of the cell membrane

    Science.gov (United States)

    Zhang, Rui; Nguyen, Toan T.

    2008-11-01

    Budding from the plasma membrane of the host cell is an indispensable step in the life cycle of the human immunodeficiency virus (HIV), which belongs to a large family of enveloped RNA viruses, retroviruses. Unlike regular enveloped viruses, retrovirus budding happens concurrently with the self-assembly of the main retrovirus protein subunits (called Gag protein after the name of the genetic material that codes for this protein: Group-specific AntiGen) into spherical virus capsids on the cell membrane. Led by this unique budding and assembly mechanism, we study the free energy profile of retrovirus budding, taking into account the Gag-Gag attraction energy and the membrane elastic energy. We find that if the Gag-Gag attraction is strong, budding always proceeds to completion. During early stage of budding, the zenith angle of partial budded capsids, α , increases with time as α∝t1/2 . However, if the Gag-Gag attraction is weak, a metastable state of partial budding appears. The zenith angle of these partially spherical capsids is given by α0≃(τ2/κσ)1/4 in a linear approximation, where κ and σ are the bending modulus and the surface tension of the membrane, and τ is a line tension of the capsid proportional to the strength of Gag-Gag attraction. Numerically, we find α0<0.3π without any approximations. Using experimental parameters, we show that HIV budding and assembly always proceed to completion in normal biological conditions. On the other hand, by changing Gag-Gag interaction strength or membrane rigidity, it is relatively easy to tune it back and forth between complete budding and partial budding. Our model agrees reasonably well with experiments observing partial budding of retroviruses including HIV.

  19. Breast bud detection: a validation study in the Chilean Growth Obesity Cohort Study

    OpenAIRE

    Pereira, Ana; Garmendia, María Luisa; González, Daniela; Kain, Juliana; Mericq, Verónica; Uauy, Ricardo; Corvalán, Camila

    2014-01-01

    Background Early puberty onset has been related to future chronic disease; however breast bud assessment in large scale population studies is difficult because it requires trained personnel. Thus our aim is to assess the validity of self and maternal breast bud detection, considering girl’s body mass index (BMI) and maternal education. Methods In 2010, 481 girls (mean age = 7.8) from the Growth and Obesity Chilean Cohort Study were evaluated by a nutritionist trained in breast bud detection. ...

  20. Sucrose is an early modulator of the key hormonal mechanisms controlling bud outgrowth in Rosa hybrida.

    Science.gov (United States)

    Barbier, François; Péron, Thomas; Lecerf, Marion; Perez-Garcia, Maria-Dolores; Barrière, Quentin; Rolčík, Jakub; Boutet-Mercey, Stéphanie; Citerne, Sylvie; Lemoine, Remi; Porcheron, Benoît; Roman, Hanaé; Leduc, Nathalie; Le Gourrierec, José; Bertheloot, Jessica; Sakr, Soulaiman

    2015-05-01

    Sugar has only recently been identified as a key player in triggering bud outgrowth, while hormonal control of bud outgrowth is already well established. To get a better understanding of sugar control, the present study investigated how sugar availability modulates the hormonal network during bud outgrowth in Rosa hybrida. Other plant models, for which mutants are available, were used when necessary. Buds were grown in vitro to manipulate available sugars. The temporal patterns of the hormonal regulatory network were assessed in parallel with bud outgrowth dynamics. Sucrose determined bud entrance into sustained growth in a concentration-dependent manner. Sustained growth was accompanied by sustained auxin production in buds, and sustained auxin export in a DR5::GUS-expressing pea line. Several events occurred ahead of sucrose-stimulated bud outgrowth. Sucrose upregulated early auxin synthesis genes (RhTAR1, RhYUC1) and the auxin efflux carrier gene RhPIN1, and promoted PIN1 abundance at the plasma membrane in a pPIN1::PIN1-GFP-expressing tomato line. Sucrose downregulated both RwMAX2, involved in the strigolactone-transduction pathway, and RhBRC1, a repressor of branching, at an early stage. The presence of sucrose also increased stem cytokinin content, but sucrose-promoted bud outgrowth was not related to that pathway. In these processes, several non-metabolizable sucrose analogues induced sustained bud outgrowth in R. hybrida, Pisum sativum, and Arabidopsis thaliana, suggesting that sucrose was involved in a signalling pathway. In conclusion, we identified potential hormonal candidates for bud outgrowth control by sugar. They are central to future investigations aimed at disentangling the processes that underlie regulation of bud outgrowth by sugar. PMID:25873679

  1. Purification, crystallization and preliminary X-ray diffraction analysis of the histone chaperone cia1 from fission yeast

    International Nuclear Information System (INIS)

    The histone chaperone cia1 from fission yeast has been overexpressed in E. coli, purified and crystallized using the vapour-diffusion method. In fission yeast, cia1+ is an essential gene that encodes a histone chaperone, a homologue of human CIA (CCG1-interacting factor A) and budding yeast Asf1p (anti-silencing function-1), which both facilitate nucleosome assembly by interacting with the core histones H3/H4. The conserved domain (residues 1–161) of the cia1+-encoded protein was expressed in Escherichia coli, purified to near-homogeneity and crystallized by the sitting-drop vapour-diffusion method. The protein was crystallized in the monoclinic space group C2, with unit-cell parameters a = 79.16, b = 40.53, c = 69.79 Å, β = 115.93° and one molecule per asymmetric unit. The crystal diffracted to beyond 2.10 Å resolution using synchrotron radiation

  2. Green Synthesis of Novel Jasmine Bud-Shaped Copper Nanoparticles

    OpenAIRE

    Malathi Sampath; Ramya Vijayan; Ezhilarasu Tamilarasu; Abiraman Tamilselvan; Balasubramanian Sengottuvelan

    2014-01-01

    Novel jasmine bud-shaped copper nanoparticles were synthesized by a green chemical reduction method using polyvinylpyrrolidone (PVP) as a capping agent, L-ascorbic acid (AA) as a reducing agent as well as antioxidant agent, isonicotinic acid hydrazide (INH) as a reducing agent, and water as a solvent at 60–70°C (pH-7) in the presence of air. The UV-Vis absorption maximum obtained is 573 nm. The crystal lattice (fcc) structure of Cu Nps was confirmed by X-ray diffraction (XRD). The novel jasm...

  3. Reconstitution of clathrin-coated pit budding from plasma membranes

    OpenAIRE

    1991-01-01

    Receptor-mediated endocytosis begins with the binding of ligand to receptors in clathrin-coated pits followed by the budding of the pits away from the membrane. We have successfully reconstituted this sequence in vitro. Highly purified plasma membranes labeled with gold were obtained by incubating cells in the presence of anti-LDL receptor IgG-gold at 4 degrees C, attaching the labeled cells to a poly-L-lysine- coated substratum at 4 degrees C and then gently sonicating them to remove everyth...

  4. Mechanical damage in cotton buds caused by the boll weevil

    Directory of Open Access Journals (Sweden)

    Santos Roseane Cavalcanti

    2003-01-01

    Full Text Available The boll weevil (Anthonomus grandis Boheman causes high levels of bud abscission in cotton plants due to feeding or oviposition punctures. It has been reported that abscission is mainly due to enzymes present in the insect's saliva, but mechanical damage could also contribute to square abscission. The objective of this paper was to undertake an analysis of the morphological damages caused by the insect in cotton squares using microscopy. Anthers and ovules are the main target of boll weevil feeding. The process initiates by perforation of young sepal and petal tissues and proceeds with subsequent alimentation on stamen and ovary leading to abscission of floral structures.

  5. Genomics and the making of yeast biodiversity

    Science.gov (United States)

    Yeasts are unicellular fungi that do not form fruiting bodies. Although the yeast lifestyle has evolved multiple times, most known species belong to the subphylum Saccharomycotina (syn. Hemiascomycota, hereafter yeasts). This diverse group includes the premier eukaryotic model system, Saccharomyces ...

  6. Qualitative and quantitative differences between taste buds of the rat and mouse

    Directory of Open Access Journals (Sweden)

    Ma Huazhi

    2007-01-01

    Full Text Available Abstract Background Numerous electrophysiological, ultrastructural, and immunocytochemical studies on rodent taste buds have been carried out on rat taste buds. In recent years, however, the mouse has become the species of choice for molecular and other studies on sensory transduction in taste buds. Do rat and mouse taste buds have the same cell types, sensory transduction markers and synaptic proteins? In the present study we have used antisera directed against PLCβ2, α-gustducin, serotonin (5-HT, PGP 9.5 and synaptobrevin-2 to determine the percentages of taste cells expressing these markers in taste buds in both rodent species. We also determined the numbers of taste cells in the taste buds as well as taste bud volume. Results There are significant differences (p 3 is smaller than a rat taste bud (64,200 μm3. The numerical density of taste cells in mouse circumvallate taste buds (2.1 cells/1000 μm3 is significantly higher than that in the rat (1.2 cells/1000 μm3. Conclusion These results suggest that rats and mice differ significantly in the percentages of taste cells expressing signaling molecules. We speculate that these observed dissimilarities may reflect differences in their gustatory processing.

  7. A Fate Map of the Murine Pancreas Buds Reveals a Multipotent Ventral Foregut Organ Progenitor

    OpenAIRE

    Angelo, Jesse R.; Guerrero-Zayas, Mara-Isel; Tremblay, Kimberly D.

    2012-01-01

    The definitive endoderm is the embryonic germ layer that gives rise to the budding endodermal organs including the thyroid, lung, liver and pancreas as well as the remainder of the gut tube. DiI fate mapping and whole embryo culture were used to determine the endodermal origin of the 9.5 days post coitum (dpc) dorsal and ventral pancreas buds. Our results demonstrate that the progenitors of each bud occupy distinct endodermal territories. Dorsal bud progenitors are located in the medial endod...

  8. Analysis of Essential Oils from Flower-buds, Leaves and Stems of Filipendula palmata (Pall.) Maxim.

    Institute of Scientific and Technical Information of China (English)

    WU Yin; MENG Xiang-ying; LIU Xiao-hua; BAO Yong-li; WANG Shu-ping; LI Yu-xin

    2005-01-01

    The essential oils of the flower-buds, leaves and stems of Filipendula palmata (Pall.) Maxim. were analyzed by GC and GC-MS. Thirty-three, forty-seven and forty-seven compounds in the flower-buds, leaves and stems were identified, respectively. Methyl salicylate exists in a great amount which is up to 70. 10% in the flower-buds. Its amount is also high in other two parts. The data obtained show that it may be one of the main natural mosquito-expelling and pain-alleviating components in the three parts. The flower-buds are the main active part with the mosquito-expelling function.

  9. The Race against Protease Activation Defines the Role of ESCRTs in HIV Budding

    Science.gov (United States)

    Bendjennat, Mourad; Saffarian, Saveez

    2016-01-01

    HIV virions assemble on the plasma membrane and bud out of infected cells using interactions with endosomal sorting complexes required for transport (ESCRTs). HIV protease activation is essential for maturation and infectivity of progeny virions, however, the precise timing of protease activation and its relationship to budding has not been well defined. We show that compromised interactions with ESCRTs result in delayed budding of virions from host cells. Specifically, we show that Gag mutants with compromised interactions with ALIX and Tsg101, two early ESCRT factors, have an average budding delay of ~75 minutes and ~10 hours, respectively. Virions with inactive proteases incorporated the full Gag-Pol and had ~60 minutes delay in budding. We demonstrate that during budding delay, activated proteases release critical HIV enzymes back to host cytosol leading to production of non-infectious progeny virions. To explain the molecular mechanism of the observed budding delay, we modulated the Pol size artificially and show that virion release delays are size-dependent and also show size-dependency in requirements for Tsg101 and ALIX. We highlight the sensitivity of HIV to budding “on-time” and suggest that budding delay is a potent mechanism for inhibition of infectious retroviral release. PMID:27280284

  10. Gamma-ray effect on the leaf bud growth in peach

    International Nuclear Information System (INIS)

    The semilethal and lethal gamma-ray doses in irradiating peach leaf buds with regard to the application of experimental mutagenesis in peach tree have been determined. Peach scions have been gamma-irradiated in July, August and September at 1, 2, 3, 4. 5 and 6 kR. It is established that the amount of survived leaf bud grafts linearly declines as the irradiation dose rises. The semilethal dose LD50 for leaf buds varies in different years within the 2.7 to 4 kR range. The lethal dose in irradiated with 60Co gamma-rays peach leaf buds - is about 6 kR. (author)

  11. Post-transcriptional regulation through the HO 3′-UTR by Mpt5, a yeast homolog of Pumilio and FBF

    OpenAIRE

    Tadauchi, Tomofumi; Matsumoto, Kunihiro; Herskowitz, Ira; Irie, Kenji

    2001-01-01

    Drosophila Pumilio (Pum) and Caenorhabditis elegans FBF bind to the 3′-untranslated region (3′-UTR) of their target mRNAs and repress translation. Pum and FBF are members of a large and evolutionarily conserved protein family, the Puf family, found in Drosophila, C.elegans, humans and yeasts. Budding yeast, Saccharomyces cerevisiae, has five proteins with conserved Puf motifs: Mpt5/Uth4, Ygl014w, Yll013c, Jsn1 and Ypr042c. Here we report that Mpt5 negatively regulates expression of the HO gen...

  12. Sequence analysis of three mitochondrial DNA molecules reveals interesting differences among Saccharomyces yeasts

    DEFF Research Database (Denmark)

    Langkjær, Rikke Breinhold; Casaregola, S.; Ussery, David;

    2003-01-01

    The complete sequences of mitochondrial DNA ( mtDNA) from the two budding yeasts Saccharomyces castellii and Saccharomyces servazzii, consisting of 25 753 and 30 782 bp, respectively, were analysed and compared to Saccharomyces cerevisiae mtDNA. While some of the traits are very similar among...... Saccharomyces yeasts, others have highly diverged. The two mtDNAs are much more compact than that of S. cerevisiae and contain fewer introns and intergenic sequences, although they have almost the same coding potential. A few genes contain group I introns, but group II introns, otherwise found in S. cerevisiae...... mtDNA, are not present. Surprisingly, four genes (ATP6, COX2, COX3 and COB) in the mtDNA of S. servazzii contain, in total, five + 1 frameshifts. mtDNAs of S. castellii, S. servazzii and S. cerevisiae contain all genes on the same strand, except for one tRNA gene. On the other hand, the gene order is...

  13. A neurotoxic phospholipase A2 impairs yeast amphiphysin activity and reduces endocytosis.

    Directory of Open Access Journals (Sweden)

    Mojca Mattiazzi

    Full Text Available BACKGROUND: Presynaptically neurotoxic phospholipases A(2 inhibit synaptic vesicle recycling through endocytosis. PRINCIPAL FINDINGS: Here we provide insight into the action of a presynaptically neurotoxic phospholipase A(2 ammodytoxin A (AtxA on clathrin-dependent endocytosis in budding yeast. AtxA caused changes in the dynamics of vesicle formation and scission from the plasma membrane in a phospholipase activity dependent manner. Our data, based on synthetic dosage lethality screen and the analysis of the dynamics of sites of endocytosis, indicate that AtxA impairs the activity of amphiphysin. CONCLUSIONS: We identified amphiphysin and endocytosis as the target of AtxA intracellular activity. We propose that AtxA reduces endocytosis following a mechanism of action which includes both a specific protein-protein interaction and enzymatic activity, and which is applicable to yeast and mammalian cells. Knowing how neurotoxic phospholipases A(2 work can open new ways to regulate endocytosis.

  14. Phenotypic plasticity within yeast colonies: differential partitioning of cell fates.

    Science.gov (United States)

    Piccirillo, Sarah; Kapros, Tamas; Honigberg, Saul M

    2016-05-01

    Across many phyla, a common aspect of multicellularity is the organization of different cell types into spatial patterns. In the budding yeast Saccharomyces cerevisiae, after diploid colonies have completed growth, they differentiate to form alternating layers of sporulating cells and feeder cells. In the current study, we found that as yeast colonies developed, the feeder cell layer was initially separated from the sporulating cell layer. Furthermore, the spatial pattern of sporulation in colonies depended on the colony's nutrient environment; in two environments in which overall colony sporulation efficiency was very similar, the pattern of feeder and sporulating cells within the colony was very different. As noted previously, under moderately suboptimal conditions for sporulation-low acetate concentration or high temperature-the number of feeder cells increases as does the dependence of sporulation on the feeder-cell transcription factor, Rlm1. Here we report that even under a condition that is completely blocked sporulation, the number of feeder cells still increased. These results suggest broader implications to our recently proposed "Differential Partitioning provides Environmental Buffering" or DPEB hypothesis. PMID:26743103

  15. Mechanism of iron uptake by the pathogenic yeast, Candida albicans

    International Nuclear Information System (INIS)

    C. albicans requires iron for growth and phenotypic development. When deprived of iron, mycelium and bud formation was suppressed. Survival of the organism was also reduced under iron-limiting conditions. The combination of elevated temperature and iron-deprivation further reduced phenotypic development and survival of the yeast. The combination of elevated temperature and iron starvation resulted in a decrease in both the growth rate and siderophore production. However, with time, the cells were able to show partial recovery in the growth rate which occurred concomitantly with an increase in siderophore production. In order for siderophores to be utilized, ferri-siderophore receptors must be produced. The receptor was shown to be located in the plasma membrane of the yeast. Scatchard analysis of the binding of ferri-siderophores to plasma membrane receptors showed an increase in receptor affinity and number of binding sites in iron-starved cells when compared to control cells. Autoradiograms of the 58Fe-siderophore-protein complex following SDS-PAGE separation of candidal proteins revealed the presence of a ferri-siderophore receptor of approximately 10,000 daltons. C. albicans strains which lacked the ability to synthesize phenolate siderophore maintained a phenolate receptor and bound candidal phenolate siderophore better than non-candidal phenolate siderophores

  16. A rice Stowaway MITE for gene transfer in yeast.

    Directory of Open Access Journals (Sweden)

    Isam Fattash

    Full Text Available Miniature inverted repeat transposable elements (MITEs lack protein coding capacity and often share very limited sequence similarity with potential autonomous elements. Their capability of efficient transposition and dramatic amplification led to the proposition that MITEs are an untapped rich source of materials for transposable element (TE based genetic tools. To test the concept of using MITE sequence in gene transfer, a rice Stowaway MITE previously shown to excise efficiently in yeast was engineered to carry cargo genes (neo and gfp for delivery into the budding yeast genome. Efficient excision of the cargo gene cassettes was observed even though the excision frequency generally decreases with the increase of the cargo sizes. Excised elements insert into new genomic loci efficiently, with about 65% of the obtained insertion sites located in genes. Elements at the primary insertion sites can be remobilized, frequently resulting in copy number increase of the element. Surprisingly, the orientation of a cargo gene (neo on a construct bearing dual reporter genes (gfp and neo was found to have a dramatic effect on transposition frequency. These results demonstrated the concept that MITE sequences can be useful in engineering genetic tools to deliver cargo genes into eukaryotic genomes.

  17. Inheritance of the yeast mitochondrial genome

    DEFF Research Database (Denmark)

    Piskur, Jure

    1994-01-01

    Mitochondrion, extrachromosomal genetics, intergenic sequences, genome size, mitochondrial DNA, petite mutation, yeast......Mitochondrion, extrachromosomal genetics, intergenic sequences, genome size, mitochondrial DNA, petite mutation, yeast...

  18. Systematic analysis of asymmetric partitioning of yeast proteome between mother and daughter cells reveals “aging factors” and mechanism of lifespan asymmetry

    OpenAIRE

    Yang, Jing; McCormick, Mark A.; Zheng, Jiashun; Xie, Zhengwei; Tsuchiya, Mitsuhiro; Tsuchiyama, Scott; El-Samad, Hana; Ouyang, Qi; Kaeberlein, Matt; Kennedy, Brian K.; Li, Hao

    2015-01-01

    In this work, we took a proteome-centric view to analyze the cell division and lifespan asymmetry between mother and daughter cells in budding yeast. Using a flow cytometry-based, high-throughput approach, we quantified the partitioning of the proteome and identified 74 mother-enriched and 60 daughter-enriched proteins. Functional analysis of these proteins suggests mechanisms of asymmetric partitioning at an organelle/suborganelle level. We found that mother-enriched proteins are much more l...

  19. The Yeast Shu Complex Utilizes Homologous Recombination Machinery for Error-free Lesion Bypass via Physical Interaction with a Rad51 Paralogue

    OpenAIRE

    Xu, Xin; Ball, Lindsay; Chen, Wangyang; Tian, Xuelei; Lambrecht, Amanda; Hanna, Michelle; Xiao, Wei

    2013-01-01

    DNA-damage tolerance (DDT) is defined as a mechanism by which eukaryotic cells resume DNA synthesis to fill the single-stranded DNA gaps left by replication-blocking lesions. Eukaryotic cells employ two different means of DDT, namely translesion DNA synthesis (TLS) and template switching, both of which are coordinately regulated through sequential ubiquitination of PCNA at the K164 residue. In the budding yeast Saccharomyces cerevisiae, the same PCNA-K164 residue can also be sumoylated, which...

  20. A Model for Cell Wall Dissolution in Mating Yeast Cells: Polarized Secretion and Restricted Diffusion of Cell Wall Remodeling Enzymes Induces Local Dissolution

    OpenAIRE

    Huberman, Lori B.; Murray, Andrew W.

    2014-01-01

    Mating of the budding yeast, Saccharomyces cerevisiae, occurs when two haploid cells of opposite mating types signal using reciprocal pheromones and receptors, grow towards each other, and fuse to form a single diploid cell. To fuse, both cells dissolve their cell walls at the point of contact. This event must be carefully controlled because the osmotic pressure differential between the cytoplasm and extracellular environment causes cells with unprotected plasma membranes to lyse. If the cell...

  1. Yeasts preservation: alternatives for lyophilisation

    NARCIS (Netherlands)

    Nyanga, L.K.; Nout, M.J.R.; Smid, E.J.; Boekhout, T.; Zwietering, M.H.

    2012-01-01

    The aim of the study was to compare the effect of two low-cost, low technology traditional methods for drying starter cultures with standard lyophilisation. Lyophilised yeast cultures and yeast cultures preserved in dry rice cakes and dry plant fibre strands were examined for viable cell counts duri

  2. Green Synthesis of Novel Jasmine Bud-Shaped Copper Nanoparticles

    Directory of Open Access Journals (Sweden)

    Malathi Sampath

    2014-01-01

    Full Text Available Novel jasmine bud-shaped copper nanoparticles were synthesized by a green chemical reduction method using polyvinylpyrrolidone (PVP as a capping agent, L-ascorbic acid (AA as a reducing agent as well as antioxidant agent, isonicotinic acid hydrazide (INH as a reducing agent, and water as a solvent at 60–70°C (pH-7 in the presence of air. The UV-Vis absorption maximum obtained is 573 nm. The crystal lattice (fcc structure of Cu Nps was confirmed by X-ray diffraction (XRD. The novel jasmine bud shape was visualized in a transmission electron microscope (TEM. The height of single copper nanobud was 6.41 nm as measured by atomic force microscope (AFM. The average particle size 6.95 nm is obtained by XRD results. Antibacterial activity of the Cu nanobuds was evaluated by testing against Gram-negative (Escherichia coli and Gram-positive (Staphylococcus aureus bacteria.

  3. Eighteen new oleaginous yeast species.

    Science.gov (United States)

    Garay, Luis A; Sitepu, Irnayuli R; Cajka, Tomas; Chandra, Idelia; Shi, Sandy; Lin, Ting; German, J Bruce; Fiehn, Oliver; Boundy-Mills, Kyria L

    2016-07-01

    Of 1600 known species of yeasts, about 70 are known to be oleaginous, defined as being able to accumulate over 20 % intracellular lipids. These yeasts have value for fundamental and applied research. A survey of yeasts from the Phaff Yeast Culture Collection, University of California Davis was performed to identify additional oleaginous species within the Basidiomycota phylum. Fifty-nine strains belonging to 34 species were grown in lipid inducing media, and total cell mass, lipid yield and triacylglycerol profiles were determined. Thirty-two species accumulated at least 20 % lipid and 25 species accumulated over 40 % lipid by dry weight. Eighteen of these species were not previously reported to be oleaginous. Triacylglycerol profiles were suitable for biodiesel production. These results greatly expand the number of known oleaginous yeast species, and reveal the wealth of natural diversity of triacylglycerol profiles within wild-type oleaginous Basidiomycetes. PMID:27072563

  4. BudBurst Buddies: Introducing Young Citizen Scientists to Plants and Environmental Change

    Science.gov (United States)

    Ward, D.; Gardiner, L. S.; Henderson, S.

    2011-12-01

    As part of Project BudBurst, the BudBurst Buddies recently moved to the National Ecological Network (NEON) as part of its Education and Public Engagement efforts. The BudBurst Buddies (www.budburstbuddies.org) were created to engage elementary school age children in the science of observing plants and the timing of phenological (life cycle) events. BudBurst Buddies is a part of the Project BudBurst national citizen science initiative (www.budburst.org), which allows individuals to engage in the scientific process, contributing to a better understanding of climate change while increasing public awareness of phenology and the impacts of climate change on plants. As a first step towards engaging the next generation of citizen scientists, BudBurst Buddies provides the opportunity for children to gain experience with scientific research and increases awareness of how plants change throughout the year. Hundreds of young students have participated in the inaugural year of BudBurst Buddies. Children can participate in BudBurst Buddies on their own, with their families, or in formal or informal education settings. The program was recently highlighted by education staff at the New York Hall of Science and numerous classrooms have been implementing this resource as part of their curriculum. Each child who participates creates a journal about a plant of his or her choosing, makes observations of the plant over the growing season and submits findings online, earning an official BudBurst Buddies certificate. An online storybook for kids tells how two children, Lily and Sage, observed plants in their neighborhood and became BudBurst Buddies. This presentation will provide an overview of the BudBurst Buddies resources including a new implementation guide and will also share feedback from the first year of implementation.

  5. Interaction Between Yeasts and Zinc

    Science.gov (United States)

    Nicola, Raffaele De; Walker, Graeme

    Zinc is an essential trace element in biological systems. For example, it acts as a cellular membrane stabiliser, plays a critical role in gene expression and genome modification and activates nearly 300 enzymes, including alcohol dehydrogenase. The present chapter will be focused on the influence of zinc on cell physiology of industrial yeast strains of Saccharomyces cerevisiae, with special regard to the uptake and subsequent utilisation of this metal. Zinc uptake by yeast is metabolism-dependent, with most of the available zinc translocated very quickly into the vacuole. At cell division, zinc is distributed from mother to daughter cells and this effectively lowers the individual cellular zinc concentration, which may become zinc depleted at the onset of the fermentation. Zinc influences yeast fermentative performance and examples will be provided relating to brewing and wine fermentations. Industrial yeasts are subjected to several stresses that may impair fermentation performance. Such stresses may also impact on yeast cell zinc homeostasis. This chapter will discuss the practical implications for the correct management of zinc bioavailability for yeast-based biotechnologies aimed at improving yeast growth, viability, fermentation performance and resistance to environmental stresses

  6. Yeasts: from genetics to biotechnology.

    Science.gov (United States)

    Russo, S; Berkovitz Siman-Tov, R; Poli, G

    1995-01-01

    Yeasts have been known and used in food and alcoholic fermentations ever since the Neolithic Age. In more recent times, on the basis of their peculiar features and history, yeasts have become very important experimental models in both microbiological and genetic research, as well as the main characters in many fermentative production processes. In the last 40 years, advances in molecular biology and genetic engineering have made possible not only the genetic selection of organisms, but also the genetic modification of some of them, especially the simplest of them, such as bacteria and yeasts. These discoveries have led to the availability of new yeast strains fit to fulfill requests of industrial production and fermentation. Moreover, genetically modified and transformed yeasts have been constructed that are able to produce large amounts of biologically active proteins and enzymes. Thus, recombinant yeasts make it easier to produce drugs, biologically active products, diagnostics, and vaccines, by inexpensive and relatively simple techniques. Yeasts are going to become more and more important in the "biotechnological revolution" by virtue of both their features and their very long and safe use in human nutrition and industry. PMID:9003692

  7. Yeasts: From genetics to biotechnology

    Energy Technology Data Exchange (ETDEWEB)

    Russo, S.; Poli, G. [Univ. of Milan (Italy); Siman-Tov, R.B. [Univ. of Jerusalem, Rehovot (Israel)

    1995-12-31

    Yeasts have been known and used in food and alcoholic fermentations ever since the Neolithic Age. In more recent times, on the basis of their peculiar features and history, yeasts have become very important experimental models in both microbiological and genetic research, as well as the main characters in many fermentative production processes. In the last 40 years, advances in molecular biology and genetic engineering have made possible not only the genetic selection of organisms, but also the genetic modification of some of them, especially the simplest of them, such as bacteria and yeasts. These discoveries have led to the availability of new yeast strains fit to fulfill requests of industrial production and fermentation. Moreover, genetically modified and transformed yeasts have been constructed that are able to produce large amounts of biologically active proteins and enzymes. Thus, recombinant yeasts make it easier to produce drugs, biologically active products, diagnostics, and vaccines, by inexpensive and relatively simple techniques. Yeasts are going to become more and more important in the {open_quotes}biotechnological revolution{close_quotes} by virtue of both their features and their very long and safe use in human nutrition and industry. 175 refs., 4 figs., 6 tabs.

  8. Uptake and distribution of 32P in the budded and self-rooted grape varieties

    International Nuclear Information System (INIS)

    In the self-rooted and budded varieties of grape (Vitis vinifera L.), the total P and 32P contents were high in 'Anabee-Shahi', but low in in 'Muscat'. The growing shoots contained more P than old stems and roots in all the varieties. In the budded plants, 'Kali Sahebi' scion budded on 'Anab-e-Shani showed the maximum 32P and total P in the shoots, but 'Muscat' scion budded on 'Anab-e-Shahi' accumulated more P in the roots and very low 32P in the growing shoots. Auto-radiographs of shoots also showed that 'Kali Sahebi' budded on 'Anab-e-Shani' rootstock accumulated more 32P in the shoots. (author)

  9. Cell kinetic study on the relation between irradiation hypogeusia and taste buds in rats

    Energy Technology Data Exchange (ETDEWEB)

    Kubota, Hideharu; Furumoto, Keiichi [Nippon Dental Univ., Tokyo (Japan)

    1998-12-01

    The present study was designed to elucidate the mechanism of hypogeusia caused by irradiation. X-ray treatment at 10 Gy or 20 Gy was given to the maxillofacial region including the tongue in rats, and the involvement of taste bud for hypogeusia was investigated. In addition, cytological kinetics were immunohistologically studied using bromodeoxyuridine in the taste bud and in the lingual mucosal epithelium. The following results were obtained: In the 10 Gy group, the number of taste bud become less after the exposure, but no hypogeusia was observed during the experimental period. In the 20 Gy group, any labeled taste bud was not observed on the 7th day, and all taste buds disappeared by the 10th day. In the lingual mucosal epithelium, the number of basal cells decreased to the minimum, and the body weight and total water intake decreased coincidently in the 20 Gy group, which were few in the 10 Gy group. (author)

  10. Tannin vacuoles and starch in the development of Scots pine (Pinus sihestris vegetative buds

    Directory of Open Access Journals (Sweden)

    Alina Hejnowicz

    2015-05-01

    Full Text Available Tannin cells occur throughout the bud except the distal and peripheral meristem zones of the apical meristem, and the youngest cataphyll primordia. Starch is absent in winter buds. The earliest structural manifestation of spring awakening in the bud are fragmentation of tannin vacuoles and synthesis of starch in the green cells of the bud. The tannins occurring in the vacuoles are hydrolysable giving a positive reaction for sugars (PAS. During their spring hydrolysis glucose is released. It is probably one of the sources of sugars for the synthesis of starch. During extension growth of the bud there occurs a degradation of tannin cells in the pith, which consist in the precipitation of tannins to a condensed form.

  11. Genetic study on yeast

    International Nuclear Information System (INIS)

    Research during the past year has moved ahead on several fronts. A major compilation of all the genetic mapping data for the yeast Saccharomyces cerevisiae has been completed. The map describes the location of over 300 genes on 17 chromosomes. A report on this work will appear in Microbiological Reviews in December 1980. Recombinant DNA procedures have been introduced into the experiments and RAD52 (one of the genes involved in recombination and repair damage), has been successfully cloned. This clone will be used to determine the gene product. Diploid cells homozygous for RAD52 have exceptionally high frequencies of mitotic loss of chromosomes. This loss is stimulated by ionizing radiation. This effect is a very significant finding. The effect has also been seen with certain other RAD mutants

  12. Identification of Chemical-Genetic Interactions via Parallel Analysis of Barcoded Yeast Strains.

    Science.gov (United States)

    Suresh, Sundari; Schlecht, Ulrich; Xu, Weihong; Miranda, Molly; Davis, Ronald W; Nislow, Corey; Giaever, Guri; St Onge, Robert P

    2016-01-01

    The Yeast Knockout Collection is a complete set of gene deletion strains for the budding yeast, Saccharomyces cerevisiae In each strain, one of approximately 6000 open-reading frames is replaced with a dominant selectable marker flanked by two DNA barcodes. These barcodes, which are unique to each gene, allow the growth of thousands of strains to be individually measured from a single pooled culture. The collection, and other resources that followed, has ushered in a new era in chemical biology, enabling unbiased and systematic identification of chemical-genetic interactions (CGIs) with remarkable ease. CGIs link bioactive compounds to biological processes, and hence can reveal the mechanism of action of growth-inhibitory compounds in vivo, including those of antifungal, antibiotic, and anticancer drugs. The chemogenomic profiling method described here measures the sensitivity induced in yeast heterozygous and homozygous deletion strains in the presence of a chemical inhibitor of growth (termed haploinsufficiency profiling and homozygous profiling, respectively, or HIPHOP). The protocol is both scalable and amenable to automation. After competitive growth of yeast knockout collection cultures, with and without chemical inhibitors, CGIs can be identified and quantified using either array- or sequencing-based approaches as described here. PMID:27587778

  13. A High-Definition View of Functional Genetic Variation from Natural Yeast Genomes

    Science.gov (United States)

    Bergström, Anders; Simpson, Jared T.; Salinas, Francisco; Barré, Benjamin; Parts, Leopold; Zia, Amin; Nguyen Ba, Alex N.; Moses, Alan M.; Louis, Edward J.; Mustonen, Ville; Warringer, Jonas; Durbin, Richard; Liti, Gianni

    2014-01-01

    The question of how genetic variation in a population influences phenotypic variation and evolution is of major importance in modern biology. Yet much is still unknown about the relative functional importance of different forms of genome variation and how they are shaped by evolutionary processes. Here we address these questions by population level sequencing of 42 strains from the budding yeast Saccharomyces cerevisiae and its closest relative S. paradoxus. We find that genome content variation, in the form of presence or absence as well as copy number of genetic material, is higher within S. cerevisiae than within S. paradoxus, despite genetic distances as measured in single-nucleotide polymorphisms being vastly smaller within the former species. This genome content variation, as well as loss-of-function variation in the form of premature stop codons and frameshifting indels, is heavily enriched in the subtelomeres, strongly reinforcing the relevance of these regions to functional evolution. Genes affected by these likely functional forms of variation are enriched for functions mediating interaction with the external environment (sugar transport and metabolism, flocculation, metal transport, and metabolism). Our results and analyses provide a comprehensive view of genomic diversity in budding yeast and expose surprising and pronounced differences between the variation within S. cerevisiae and that within S. paradoxus. We also believe that the sequence data and de novo assemblies will constitute a useful resource for further evolutionary and population genomics studies. PMID:24425782

  14. BudBurst Buddies: A New Tool for Engaging the Youngest Citizen Scientists

    Science.gov (United States)

    Gardiner, L. S.; Henderson, S.; Ward, D.

    2010-12-01

    BudBurst Buddies (www.budburstbuddies.org) introduces elementary school age children to the science of observing plants and the timing of phenological (life cycle) events. BudBurst Buddies is a new part of the Project BudBurst national citizen science initiative (www.budburst.org), which allows individuals to engage in the scientific process, contributing to a better understanding of climate change while increasing public awareness of phenology and the impacts of climate change on plants. As a first step towards engaging the next generation of citizen scientists, BudBurst Buddies provides the opportunity for children to gain experience with scientific research and increases awareness of how plants change throughout the year. Children can participate in BudBurst Buddies on their own, with their families, or in formal or informal education settings. Each child who participates creates a journal about a plant of his or her choosing, makes observations of the plant over the growing season and submits findings online, earning an official BudBurst Buddies certificate. An online storybook for kids tells how two children, Lily and Sage, observed plants in their neighborhood and became BudBurst Buddies. This presentation will provide an overview of the BudBurst Buddies newly developed resources. BudBurst Buddies is a part of Project BudBurst, a national citizen science program coordinated by the National Ecological Observatory Network (NEON) and the Chicago Botanic Garden. Funding for this resource was provided by NEON, NSF, NASA, and the National Geographic Education Foundation.

  15. Novel Features of the Prenatal Horn Bud Development in Cattle (Bos taurus.

    Directory of Open Access Journals (Sweden)

    Dominique Judith Wiener

    Full Text Available Whereas the genetic background of horn growth in cattle has been studied extensively, little is known about the morphological changes in the developing fetal horn bud. In this study we histologically analyzed the development of horn buds of bovine fetuses between ~70 and ~268 days of pregnancy and compared them with biopsies taken from the frontal skin of the same fetuses. In addition we compared the samples from the wild type (horned fetuses with samples taken from the horn bud region of age-matched genetically hornless (polled fetuses. In summary, the horn bud with multiple layers of vacuolated keratinocytes is histologically visible early in fetal life already at around day 70 of gestation and can be easily differentiated from the much thinner epidermis of the frontal skin. However, at the gestation day (gd 212 the epidermis above the horn bud shows a similar morphology to the epidermis of the frontal skin and the outstanding layers of vacuolated keratinocytes have disappeared. Immature hair follicles are seen in the frontal skin at gd 115 whereas hair follicles below the horn bud are not present until gd 155. Interestingly, thick nerve bundles appear in the dermis below the horn bud at gd 115. These nerve fibers grow in size over time and are prominent shortly before birth. Prominent nerve bundles are not present in the frontal skin of wild type or in polled fetuses at any time, indicating that the horn bud is a very sensitive area. The samples from the horn bud region from polled fetuses are histologically equivalent to samples taken from the frontal skin in horned species. This is the first study that presents unique histological data on bovine prenatal horn bud differentiation at different developmental stages which creates knowledge for a better understanding of recent molecular findings.

  16. Origin of nuclear buds and micronuclei in normal and folate-deprived human lymphocytes

    International Nuclear Information System (INIS)

    Micronuclei are formed from chromosomes and chromosomal fragments that lag behind in anaphase and are left outside daughter nuclei in telophase. They may also be derived from broken anaphase bridges. Nuclear buds, micronucleus-like bodies attached to the nucleus by a thin nucleoplasmic connection, have been proposed to be generated similarly to micronuclei during nuclear division or in S-phase as a stage in the extrusion of extra DNA, possibly giving rise to micronuclei. To better understand these phenomena, we have characterized the contents of 894 nuclear buds and 1392 micronuclei in normal and folate-deprived 9-day cultures of human lymphocytes using fluorescence in situ hybridization with pancentromeric and pantelomeric DNA probes. Such information has not earlier been available for human primary cells. Surprisingly, there appears to be no previous data on the occurrence of telomeres in micronuclei (or buds) of normal human cells in general. Our results suggest that nuclear buds and micronuclei have partly different mechanistic origin. Interstitial DNA without centromere or telomere label was clearly more prevalent in nuclear buds (43%) than in micronuclei (13%). DNA with only telomere label or with both centromere and telomere label was more frequent in micronuclei (62% and 22%, respectively) than in nuclear buds (44% and 10%, respectively). Folate deprivation especially increased the frequency of nuclear buds and micronuclei harboring telomeric DNA and nuclear buds harboring interstitial DNA but also buds and micronuclei with both centromeric and telomeric DNA. According to the model we propose, that micronuclei in binucleate lymphocytes primarily derive from lagging chromosomes and terminal acentric fragments during mitosis. Most nuclear buds, however, are suggested to originate from interstitial or terminal acentric fragments, possibly representing nuclear membrane entrapment of DNA that has been left in cytoplasm after nuclear division or excess DNA that

  17. Guillaume Budé, l’humaniste et le prince

    Directory of Open Access Journals (Sweden)

    Sylvie Le Clech-Charton

    2009-09-01

    Full Text Available Grande figure de la Renaissance des lettres et des arts en France, tout à la fois écrivain, traducteur, ambassadeur, créateur du dépôt légal et fondateur du Collège de France, maître de la librairie du roi à Fontainebleau, Guillaume Budé (1468-1540 est essentiellement connu pour le rôle de conseiller politique et culturel qu’il joua auprès de François Ier, dont il fut le secrétaire. Il a été surtout étudié du point de vue de sa production littéraire savante, mais non sous l’angle de son mili...

  18. The physics of lipid droplet nucleation, growth and budding.

    Science.gov (United States)

    Thiam, Abdou Rachid; Forêt, Lionel

    2016-08-01

    Lipid droplets (LDs) are intracellular oil-in-water emulsion droplets, covered by a phospholipid monolayer and mainly present in the cytosol. Despite their important role in cellular metabolism and growing number of newly identified functions, LD formation mechanism from the endoplasmic reticulum remains poorly understood. To form a LD, the oil molecules synthesized in the ER accumulate between the monolayer leaflets and induce deformation of the membrane. This formation process works through three steps: nucleation, growth and budding, exactly as in phase separation and dewetting phenomena. These steps involve sequential biophysical membrane remodeling mechanisms for which we present basic tools of statistical physics, membrane biophysics, and soft matter science underlying them. We aim to highlight relevant factors that could control LD formation size, site and number through this physics description. An emphasis will be given to a currently underestimated contribution of the molecular interactions between lipids to favor an energetically costless mechanism of LD formation. PMID:27131867

  19. Deciphering human heat shock transcription factor 1 regulation via post-translational modification in yeast.

    Directory of Open Access Journals (Sweden)

    Liliana Batista-Nascimento

    Full Text Available Heat shock transcription factor 1 (HSF1 plays an important role in the cellular response to proteotoxic stresses. Under normal growth conditions HSF1 is repressed as an inactive monomer in part through post-translation modifications that include protein acetylation, sumoylation and phosphorylation. Upon exposure to stress HSF1 homotrimerizes, accumulates in nucleus, binds DNA, becomes hyper-phosphorylated and activates the expression of stress response genes. While HSF1 and the mechanisms that regulate its activity have been studied for over two decades, our understanding of HSF1 regulation remains incomplete. As previous studies have shown that HSF1 and the heat shock response promoter element (HSE are generally structurally conserved from yeast to metazoans, we have made use of the genetically tractable budding yeast as a facile assay system to further understand the mechanisms that regulate human HSF1 through phosphorylation of serine 303. We show that when human HSF1 is expressed in yeast its phosphorylation at S303 is promoted by the MAP-kinase Slt2 independent of a priming event at S307 previously believed to be a prerequisite. Furthermore, we show that phosphorylation at S303 in yeast and mammalian cells occurs independent of GSK3, the kinase primarily thought to be responsible for S303 phosphorylation. Lastly, while previous studies have suggested that S303 phosphorylation represses HSF1-dependent transactivation, we now show that S303 phosphorylation also represses HSF1 multimerization in both yeast and mammalian cells. Taken together, these studies suggest that yeast cells will be a powerful experimental tool for deciphering aspects of human HSF1 regulation by post-translational modifications.

  20. ONYCHOMYCOSIS DUE TO YEAST AND YEAST-LIKE FUNGI

    Directory of Open Access Journals (Sweden)

    F. Zaini

    1986-12-01

    Full Text Available Onychomycosis due to the yeast and yeast-like fungi was investigated among the 147 patient who refered to the mycology laboratory of school of public Health during the period of 11 months. The isolated yeasts and yeast-like fungi were examined by API Auxanogram methed. The distribution of isolated microorganisms were C. tropicalis 10(7.4%, C.guillioimondii & (5.9% cases and one case of each of the C.krusei, C.pseudotropicalis, C.rugosa, trichosporon cutaneum, trolopsis maris, Cryptococcus albidus and finaly 3(2.2% cases of candida famata. High incidence of infection was in the patients with 0-15 years of age and most of them were in the groups of 0-4 years. Nail infection among the females were much more frequently than the males and predominant occupation of the women was house duties. The results which obtained from this investigation with the API Auxanogram system is quite satistactory and use of this rapid method for identification of yeasts and yeast-like fungi from the clinical materials of the patients is recommended.

  1. Ipl1/Aurora B kinase coordinates synaptonemal complex disassembly with cell cycle progression and crossover formation in budding yeast meiosis

    OpenAIRE

    Jordan, Philip; Copsey, Alice; Newnham, Louise; Kolar, E; Lichten, M; Hoffmann, Eva

    2009-01-01

    Several protein kinases collaborate to orchestrate and integrate cellular and chromosomal events at the G2/M transition in both mitotic and meiotic cells. During the G2/M transition in meiosis, this includes the completion of crossover recombination, spindle formation, and synaptonemal complex (SC) breakdown. We identified Ipl1/Aurora B kinase as the main regulator of SC disassembly. Mutants lacking Ipl1 or its kinase activity assemble SCs with normal timing, but fail to dissociate the centra...

  2. Towards systematic discovery of signaling networks in budding yeast filamentous growth stress response using interventional phosphorylation data.

    Directory of Open Access Journals (Sweden)

    Yan Zhang

    Full Text Available Reversible phosphorylation is one of the major mechanisms of signal transduction, and signaling networks are critical regulators of cell growth and development. However, few of these networks have been delineated completely. Towards this end, quantitative phosphoproteomics is emerging as a useful tool enabling large-scale determination of relative phosphorylation levels. However, phosphoproteomics differs from classical proteomics by a more extensive sampling limitation due to the limited number of detectable sites per protein. Here, we propose a comprehensive quantitative analysis pipeline customized for phosphoproteome data from interventional experiments for identifying key proteins in specific pathways, discovering the protein-protein interactions and inferring the signaling network. We also made an effort to partially compensate for the missing value problem, a chronic issue for proteomics studies. The dataset used for this study was generated using SILAC (Stable Isotope Labeling with Amino acids in Cell culture technique with interventional experiments (kinase-dead mutations. The major components of the pipeline include phosphopeptide meta-analysis, correlation network analysis and causal relationship discovery. We have successfully applied our pipeline to interventional experiments identifying phosphorylation events underlying the transition to a filamentous growth form in Saccharomyces cerevisiae. We identified 5 high-confidence proteins from meta-analysis, and 19 hub proteins from correlation analysis (Pbi2p and Hsp42p were identified by both analyses. All these proteins are involved in stress responses. Nine of them have direct or indirect evidence of involvement in filamentous growth. In addition, we tested four of our predicted proteins, Nth1p, Pbi2p, Pdr12p and Rcn2p, by interventional phenotypic experiments and all of them present differential invasive growth, providing prospective validation of our approach. This comprehensive pipeline presents a systematic way for discovering signaling networks using interventional phosphoproteome data and can suggest candidate proteins for further investigation. We anticipate the methodology to be applicable as well to other interventional studies via different experimental platforms.

  3. The budding yeast Centromere DNA Element II wraps a stable Cse4 hemisome in either orientation in vivo

    OpenAIRE

    Henikoff, Steven; Ramachandran, Srinivas; Krassovsky, Kristina; Bryson, Terri D; Codomo, Christine A.; Brogaard, Kristin; Widom, Jonathan; Wang, Ji-Ping; Henikoff, Jorja G.

    2014-01-01

    eLife digest DNA is tightly packaged in cells for a variety of reasons—to allow it to fit inside the nucleus, to protect it from damage, and to help control the production of proteins from genes. The basic unit of packaged DNA is called a nucleosome, which consists of DNA wrapped around a structure formed by two pairs of four different proteins. These proteins, which are called histones, have a role that extends beyond providing structural support for DNA. When cells divide, for example, pair...

  4. Evaluation of the lower protein limit in the budding yeast Saccharomyces cerevisiae using TIPI-gTOW

    OpenAIRE

    Sasabe, Masataka; Shintani, Sayumi; Kintaka, Reiko; Kaizu, Kazunari; Makanae, Koji; Moriya, Hisao

    2014-01-01

    Background Identifying permissible limits of intracellular parameters such as protein expression provides important information for examining robustness. In this study, we used the TEV protease-mediated induction of protein instability (TIPI) in combination with the genetic Tug-of-War (gTOW) to develop a method to measure the lower limit of protein level. We first tested the feasibility of this method using ADE2 as a marker and then analyzed some cell cycle regulators to reveal genetic intera...

  5. Palmitoylation controls the dynamics of budding-yeast heterochromatin via the telomere-binding protein Rif1

    OpenAIRE

    Park, Sookhee; Patterson, Erin E.; Cobb, Jenel; Audhya, Anjon; Gartenberg, Marc R.; Fox, Catherine A.

    2011-01-01

    The posttranslational addition of palmitate to cysteines occurs ubiquitously in eukaryotic cells, where it functions in anchoring target proteins to membranes and in vesicular trafficking. Here we show that the Saccharomyces cerevisiae palmitoyltransferase Pfa4 enhanced heterochromatin formation at the cryptic mating-type loci HMR and HML via Rif1, a telomere regulatory protein. Acylated Rif1 was detected in extracts from wild-type but not pfa4Δ mutant cells. In a pfa4Δ mutant, Rif1-GFP dispe...

  6. Changes in well-defined phases of bud dormancy associated with shifts in carbohydrate metabolism may involve beta-amylases

    Science.gov (United States)

    Leafy spurge is a noxious perennial weed that infests range lands in the Northern Great Plains. It is being used as a model to investigate dormancy in underground adventitious buds, i.e., root and crown buds. Underground adventitious buds of leafy spurge (Euphorbia esula) are 1) maintained in a quie...

  7. Biotechnical Microbiology, yeast and bacteria

    DEFF Research Database (Denmark)

    Villadsen, Ingrid Stampe

    1999-01-01

    This section contains the following single lecture notes: Eukaryotic Cell Biology. Kingdom Fungi. Cell Division. Meiosis and Recombination. Genetics of Yeast. Organisation of the Chromosome. Organization and genetics of the mitochondrial Geneme. Regulatio of Gene Expression. Intracellular Compart...

  8. Vaginal Yeast Infections (For Parents)

    Science.gov (United States)

    ... infection caused by a type of fungus called candida albicans . Yeast infections usually happen in warm, moist parts of the ... fungus can grow. Doctors call this candida overgrowth candidiasis (pronounced: can-dih-DYE-uh-sis) Candida can ...

  9. Red Yeast Rice: An Introduction

    Science.gov (United States)

    ... products varies depending on the yeast strains and culture conditions used to manufacture them. The strains and ... supplements should not be used while pregnant or breastfeeding. Lovastatin can interact with a variety of drugs ...

  10. Shuffling Yeast Gene Expression Data

    OpenAIRE

    Bilke, Sven

    2000-01-01

    A new method to sort gene expression patterns into functional groups is presented. The method is based on a sorting algorithm using a non-local similarity score, which takes all other patterns in the dataset into account. The method is therefore very robust with respect to noise. Using the expression data for yeast, we extract information about functional groups. Without prior knowledge of parameters the cell cycle regulated genes in yeast can be identified. Furthermore a second, independent ...

  11. Mucositis Grades and Yeast Species

    OpenAIRE

    Ognjenović, Marina; Milatić, Katja; Parat, Katica; Kovačić, Ivan; Ježina Bušelić, Marina A.; Božić, Joško

    2013-01-01

    Surgically treated patients with oral, head and neck cancer commonly develop mucositis during additional irradiation therapy. Oral mucosa inflammation other than irradiation is mostly caused by Candida albicans, yeast of Candida genus. This study evaluated possible connection between grades of oral mucositis and oral yeast profile in irradiated patients before, during and after irradiation. In 25 examined patients mucosits grades »0« to »2« before irradiation with 20% positive smears and o...

  12. Yeast genomic expression patterns in response to low-shear modeled microgravity

    Directory of Open Access Journals (Sweden)

    Altenburg Sara D

    2007-01-01

    Full Text Available Abstract The low-shear microgravity environment, modeled by rotating suspension culture bioreactors called high aspect ratio vessels (HARVs, allows investigation in ground-based studies of the effects of microgravity on eukaryotic cells and provides insights into the impact of space flight on cellular physiology. We have previously demonstrated that low-shear modeled microgravity (LSMMG causes significant phenotypic changes of a select group of Saccharomyces cerevisiae genes associated with the establishment of cell polarity, bipolar budding, and cell separation. However, the mechanisms cells utilize to sense and respond to microgravity and the fundamental gene expression changes that occur are largely unknown. In this study, we examined the global transcriptional response of yeast cells grown under LSMMG conditions using DNA microarray analysis in order to determine if exposure to LSMMG results in changes in gene expression. Results LSMMG differentially changed the expression of a significant number of genes (1372 when yeast cells were cultured for either five generations or twenty-five generations in HARVs, as compared to cells grown under identical conditions in normal gravity. We identified genes in cell wall integrity signaling pathways containing MAP kinase cascades that may provide clues to novel physiological responses of eukaryotic cells to the external stress of a low-shear modeled microgravity environment. A comparison of the microgravity response to other environmental stress response (ESR genes showed that 26% of the genes that respond significantly to LSMMG are involved in a general environmental stress response, while 74% of the genes may represent a unique transcriptional response to microgravity. In addition, we found changes in genes involved in budding, cell polarity establishment, and cell separation that validate our hypothesis that phenotypic changes observed in cells grown in microgravity are reflected in genome

  13. [Relationships between reactive oxygen metabolism and endodormancy release of peach bud under short-term heating].

    Science.gov (United States)

    Wang, Xiao-di; Wang, Hai-bo; Gao, Dong-sheng; Li, Jiang; Wang, Bao-liang; Liu, Feng-zhi

    2010-11-01

    Taking the 6-year-old peach "Shuguang" as test object, this paper studied the effects of short-term heating at 40 degrees C, 45 degrees C, and 50 degrees C on the bud livability, bud burst, reactive oxygen content, and activities of related enzymes in peach bud, aimed to investigate the regulation effect of short-term heating on the endodormancy release of peach bud. The results indicated that the effects of short-tern heating on the endodormancy release of peach bud were advanced by the postponement of treatment date, the increase of treatment temperature, and the prolonging of treatment time. On November 30, the regulation effect of heating at 40 degrees C was negative. Comparing with those under no-heating (CK), the date of endodormancy release was postponed, the bud burst, the O2-* and * OH production rates, the H2O2 content, and the activities of CAT and POD were lowered, and the SOD activity was improved. It was adverse under heating at 45 degrees C and 50 degrees C. On December 10, heating at 40 degrees C nearly had no obvious effect on the endodormancy release, while heating at 45 degrees C and 50 degrees C had the same effect as that on November 30, with the former being more superior to the latter. Correlation analysis indicated that the rapid increase of reactive oxygen might be the critical reason for the endodormancy release of peach bud. PMID:21360995

  14. Auxin dynamics after decapitation are not correlated with the initial growth of axillary buds.

    Science.gov (United States)

    Morris, Suzanne E; Cox, Marjolein C H; Ross, John J; Krisantini, Santi; Beveridge, Christine A

    2005-07-01

    One of the first and most enduring roles identified for the plant hormone auxin is the mediation of apical dominance. Many reports have claimed that reduced stem indole-3-acetic acid (IAA) levels and/or reduced basipetal IAA transport directly or indirectly initiate bud growth in decapitated plants. We have tested whether auxin inhibits the initial stage of bud release, or subsequent stages, in garden pea (Pisum sativum) by providing a rigorous examination of the dynamics of auxin level, auxin transport, and axillary bud growth. We demonstrate that after decapitation, initial bud growth occurs prior to changes in IAA level or transport in surrounding stem tissue and is not prevented by an acropetal supply of exogenous auxin. We also show that auxin transport inhibitors cause a similar auxin depletion as decapitation, but do not stimulate bud growth within our experimental time-frame. These results indicate that decapitation may trigger initial bud growth via an auxin-independent mechanism. We propose that auxin operates after this initial stage, mediating apical dominance via autoregulation of buds that are already in transition toward sustained growth. PMID:15965021

  15. A homologous cell-free system for studying protein translocation across the endoplasmic reticulum membrane in fission yeast.

    Science.gov (United States)

    Brennwald, P; Wise, J A

    1994-02-01

    We report the development of a homologous in vitro assay system for analysing translocation of proteins across the endoplasmic reticulum (ER) membrane of the fission yeast Schizosaccharomyces pombe. Our protocol for preparing an S. pombe extract capable of translating natural messenger RNAs was modified from a procedure previously used for Saccharomyces cerevisiae, in which cells are lysed in a bead-beater. However, we were unable to prepare fission yeast microsomes active in protein translocation using existing budding yeast protocols. Instead, our most efficient preparations were isolated by fractionating spheroplasts, followed by extensive washing and size exclusion chromatography of the crude membranes. Translocation of two ER-targeted proteins, pre-acid phosphatase from S. pombe and prepro-alpha-factor from S. cerevisiae, was monitored using two distinct assays. First, evidence that a fraction of both proteins was sequestered within membrane-enclosed vesicles was provided by resistance to exogenously added protease. Second, the protected fraction of each protein was converted to a higher molecular weight, glycosylated form; attachment of carbohydrate to the translocated proteins was confirmed by their ability to bind Concanavalin A-Sepharose. Finally, we examined whether proteins could be translocated across fission yeast microsomal membranes after their synthesis was complete. Our results indicate that S. cerevisiae prepro-alpha-factor can be post-translationally imported into the fission yeast ER, while S. pombe pre-acid phosphatase crosses the membrane only by a co-translational mechanism. PMID:8203158

  16. Contribution of Underlying Connective Tissue Cells to Taste Buds in Mouse Tongue and Soft Palate

    Science.gov (United States)

    Mederacke, Ingmar; Komatsu, Yoshihiro; Stice, Steve; Schwabe, Robert F.; Mistretta, Charlotte M.; Mishina, Yuji; Liu, Hong-Xiang

    2016-01-01

    Taste buds, the sensory organs for taste, have been described as arising solely from the surrounding epithelium, which is in distinction from other sensory receptors that are known to originate from neural precursors, i.e., neural ectoderm that includes neural crest (NC). Our previous study suggested a potential contribution of NC derived cells to early immature fungiform taste buds in late embryonic (E18.5) and young postnatal (P1-10) mice. In the present study we demonstrated the contribution of the underlying connective tissue (CT) to mature taste buds in mouse tongue and soft palate. Three independent mouse models were used for fate mapping of NC and NC derived connective tissue cells: (1) P0-Cre/R26-tdTomato (RFP) to label NC, NC derived Schwann cells and derivatives; (2) Dermo1-Cre/RFP to label mesenchymal cells and derivatives; and (3) Vimentin-CreER/mGFP to label Vimentin-expressing CT cells and derivatives upon tamoxifen treatment. Both P0-Cre/RFP and Dermo1-Cre/RFP labeled cells were abundant in mature taste buds in lingual taste papillae and soft palate, but not in the surrounding epithelial cells. Concurrently, labeled cells were extensively distributed in the underlying CT. RFP signals were seen in the majority of taste buds and all three types (I, II, III) of differentiated taste bud cells, with the neuronal-like type III cells labeled at a greater proportion. Further, Vimentin-CreER labeled cells were found in the taste buds of 3-month-old mice whereas Vimentin immunoreactivity was only seen in the CT. Taken together, our data demonstrate a previously unrecognized origin of taste bud cells from the underlying CT, a conceptually new finding in our knowledge of taste bud cell derivation, i.e., from both the surrounding epithelium and the underlying CT that is primarily derived from NC. PMID:26741369

  17. Project BudBurst: Continental-scale citizen science for all seasons

    Science.gov (United States)

    Henderson, S.; Newman, S. J.; Ward, D.; Havens-Young, K.; Alaback, P.; Meymaris, K.

    2011-12-01

    Project BudBurst's (budburst.org) recent move to the National Ecological Observatory Network (NEON) has benefitted both programs. NEON has been able to use Project BudBurst as a testbed to learn best practices, network with experts in the field, and prototype potential tools for engaging people in continental-scale ecology as NEON develops its citizen science program. Participation in Project BudBurst has grown significantly since the move to NEON. Project BudBurst is a national citizen science initiative designed to engage the public in observations of phenological (plant life cycle) events that raise awareness of climate change, and create a cadre of informed citizen scientists. Citizen science programs such as Project BudBurst provide the opportunity for students and interested laypersons to actively participate in scientific research. Such programs are important not only from an educational perspective, but because they also enable scientists to broaden the geographic and temporal scale of their observations. The goals of Project BudBurst are to 1) increase awareness of phenology as an area of scientific study; 2) Increase awareness of the impacts of changing climates on plants at a continental-scale; and 3) increase science literacy by engaging participants in the scientific process. From its 2008 launch in February, this on-line educational and data-entry program, engaged participants of all ages and walks of life in recording the timing of the leafing and flowering of wild and cultivated species found across the continent. Thus far, thousands of participants from all 50 states have submitted data. This presentation will provide an overview of Project BudBurst and will report on the results of the 2010 field campaign and discuss plans to expand Project BudBurst in 2012 including the use of mobile phones applications for data collection and reporting from the field. Project BudBurst is co-managed by the National Ecological Observatory Network and the Chicago

  18. Thyroid bud morphogenesis requires CDC42- and SHROOM3-dependent apical constriction

    Science.gov (United States)

    Loebel, David A. F.; Plageman, Timothy F.; Tang, Theresa L.; Jones, Vanessa J.; Muccioli, Maria; Tam, Patrick P. L.

    2016-01-01

    ABSTRACT Early development of the gut endoderm and its subsequent remodeling for the formation of organ buds are accompanied by changes to epithelial cell shape and polarity. Members of the Rho-related family of small GTPases and their interacting proteins play multiple roles in regulating epithelial morphogenesis. In this study we examined the role of Cdc42 in foregut development and organ bud formation. Ablation of Cdc42 in post-gastrulation mouse embryos resulted in a loss of apical-basal cell polarity and columnar epithelial morphology in the ventral pharyngeal endoderm, in conjunction with a loss of apical localization of the known CDC42 effector protein PARD6B. Cell viability but not proliferation in the foregut endoderm was impaired. Outgrowth of the liver, lung and thyroid buds was severely curtailed in Cdc42-deficient embryos. In particular, the thyroid bud epithelium did not display the apical constriction that normally occurs concurrently with the outgrowth of the bud into the underlying mesenchyme. SHROOM3, a protein that interacts with Rho GTPases and promotes apical constriction, was strongly expressed in the thyroid bud and its sub-cellular localization was disrupted in Cdc42-deficient embryos. In Shroom3 gene trap mutant embryos, the thyroid bud epithelium showed no apical constriction, while the bud continued to grow and protruded into the foregut lumen. Our findings indicate that Cdc42 is required for epithelial polarity and organization in the endoderm and for apical constriction in the thyroid bud. It is possible that the function of CDC42 is partly mediated by SHROOM3. PMID:26772200

  19. Synthetic Yeast Cooperation

    Science.gov (United States)

    Shou, Wenying; Burton, Justin

    2010-03-01

    Cooperation is wide-spread and has been postulated to drive major transitions in evolution. However, Darwinian selection favors ``cheaters'' that consume benefits without paying a fair cost. How did cooperation evolve against the threat of cheaters? To investigate the evolutionary trajectories of cooperation, we created a genetically tractable system that can be observed as it evolves from inception. The system consists of two engineered yeast strains -- a red-fluorescent strain that requires adenine and releases lysine and a yellow-fluorescent strain that requires lysine and releases adenine. Cells that consume but not supply metabolites would be cheaters. From the properties of two cooperating strains, we calculated and experimentally verified the minimal initial cell densities required for the viability of the cooperative system in the absence of exogenously added adenine and lysine. Strikingly, evolved cooperative systems were viable at 100-fold lower initial cell densities than their ancestors. We are investigating the nature and diversity of pro-cooperation changes, the dynamics of cooperator-cheater cocultures, and the effects of spatial environment on cooperation and cheating.

  20. Metabolic regulation of yeast

    Science.gov (United States)

    Fiechter, A.

    1982-12-01

    Metabolic regulation which is based on endogeneous and exogeneous process variables which may act constantly or time dependently on the living cell is discussed. The observed phenomena of the regulation are the result of physical, chemical, and biological parameters. These parameters are identified. Ethanol is accumulated as an intermediate product and the synthesis of biomass is reduced. This regulatory effect of glucose is used for the aerobic production of ethanol. Very high production rates are thereby obtained. Understanding of the regulation mechanism of the glucose effect has improved. In addition to catabolite repression, several other mechanisms of enzyme regulation have been described, that are mostly governed by exogeneous factors. Glucose also affects the control of respiration in a third class of yeasts which are unable to make use of ethanol as a substrate for growth. This is due to the lack of any anaplerotic activity. As a consequence, diauxic growth behavior is reduced to a one-stage growth with a drastically reduced cell yield. The pulse chemostat technique, a systematic approach for medium design is developed and medium supplements that are essential for metabolic control are identified.

  1. Gravity-induced buds formation from protonemata apical cells in the mosses

    Science.gov (United States)

    Kyyak, Natalia; Khorkavtsiv, Yaroslava

    The acceleration of moss protonemata development after the exit it to light from darkness is important gravidependent morphogenetic manifestation of the moss protonemata. The accelerated development of mosses shows in transformation of apical protonemata cells into the gametophores buds (Ripetskyj et al., 1999). In order to establish, that such reaction on gravitation is general property of gravisensity species, or its typical only for single moss species, experiments with the following moss species - Bryum intermedium (Ludw.) Brig., Bryum caespiticium Hedw., Bryum argenteum Hedw., Dicranodontium denudatum (Brid.) Britt. were carried out. All these species in response to influence of gravitation were capable to form rich bunches of gravitropical protonemata in darkness, that testified to their gravisensity. After the transference of Petri dishes with gravitropical protonemata from darkness on light was revealed, that in 3 of the investigated species the gametophores buds were absent. Only B. argenteum has reacted to action of gravitation by buds formation from apical cells of the gravitropical protonemata. With the purpose of strengthening of buds formation process, the experiments with action of exogenous kinetin (in concentration of 10 (-6) M) were carried out. Kinetin essentially stimulated apical buds formation of B. argenteum. The quantity of apical buds has increased almost in three times in comparison with the control. Besides, on separate stolons a few (3-4) buds from one apical cell were formed. Experimentally was established, that the gametophores buds formation in mosses is controlled by phytohormones (Bopp, 1985; Demkiv et al., 1991). In conditions of gravity influence its essentially accelerated. Probably, gravity essentially strengthened acropetal transport of phytohormones and formation of attractive center in the protonemata apical cell. Our investigations have allowed to make the conclusion, that gravi-dependent formation of the apical buds is

  2. Phenotypic plasticity, QTL mapping and genomic characterization of bud set in black poplar

    Directory of Open Access Journals (Sweden)

    Fabbrini Francesco

    2012-04-01

    Full Text Available Abstract Background The genetic control of important adaptive traits, such as bud set, is still poorly understood in most forest trees species. Poplar is an ideal model tree to study bud set because of its indeterminate shoot growth. Thus, a full-sib family derived from an intraspecific cross of P. nigra with 162 clonally replicated progeny was used to assess the phenotypic plasticity and genetic variation of bud set in two sites of contrasting environmental conditions. Results Six crucial phenological stages of bud set were scored. Night length appeared to be the most important signal triggering the onset of growth cessation. Nevertheless, the effect of other environmental factors, such as temperature, increased during the process. Moreover, a considerable role of genotype × environment (G × E interaction was found in all phenological stages with the lowest temperature appearing to influence the sensitivity of the most plastic genotypes. Descriptors of growth cessation and bud onset explained the largest part of phenotypic variation of the entire process. Quantitative trait loci (QTL for these traits were detected. For the four selected traits (the onset of growth cessation (date2.5, the transition from shoot to bud (date1.5, the duration of bud formation (subproc1 and bud maturation (subproc2 eight and sixteen QTL were mapped on the maternal and paternal map, respectively. The identified QTL, each one characterized by small or modest effect, highlighted the complex nature of traits involved in bud set process. Comparison between map location of QTL and P. trichocarpa genome sequence allowed the identification of 13 gene models, 67 bud set-related expressional and six functional candidate genes (CGs. These CGs are functionally related to relevant biological processes, environmental sensing, signaling, and cell growth and development. Some strong QTL had no obvious CGs, and hold great promise to identify unknown genes that affect bud set

  3. Ultraviolet patterns on rear of flowers: basis of disparity of buds and blossoms.

    Science.gov (United States)

    Eisner, T; Eisner, M; Aneshansley, D

    1973-04-01

    Flowers of Jasminium primulinum and Hypericum spp. have ultraviolet patterns on the reverse surface of the corolla. Those areas of the surface that are exposed to the outside in the bud are ultraviolet absorbent, whereas the portions that come into view at maturity in the open blossom are ultraviolet reflectant. Buds and blossoms, as a result, appear different in color to insects sensitive to ultraviolet light. Experimental evidence indicates that the ultraviolet-absorbent quality of the outer surface of the bud is a consequence of exposure itself, attributable possibly to a "sun tanning" effect. PMID:16592074

  4. Type 1 protein phosphatase acts in opposition to IpL1 protein kinase in regulating yeast chromosome segregation.

    OpenAIRE

    Francisco, L; Wang, W.; Chan, C S

    1994-01-01

    The IPL1 gene is required for high-fidelity chromosome segregation in the budding yeast Saccharomyces cerevisiae. Conditional ipl1ts mutants missegregate chromosomes severely at 37 degrees C. Here, we report that IPL1 encodes an essential putative protein kinase whose function is required during the later part of each cell cycle. At 26 degrees C, the permissive growth temperature, ipl1 mutant cells are defective in the recovery from a transient G2/M-phase arrest caused by the antimicrotubule ...

  5. A pathway containing the Ipl1/Aurora protein kinase and the spindle midzone protein Ase1 regulates yeast spindle assembly

    OpenAIRE

    Kotwaliwale, Chitra V.; Frei, Stéphanie Buvelot; Stern, Bodo M.; Biggins, Sue

    2007-01-01

    It is critical to elucidate the pathways that mediate spindle assembly and therefore ensure accurate chromosome segregation during cell division. Our studies of a unique allele of the budding yeast Ipl1/Aurora protein kinase revealed that it is required for centrosome-mediated spindle assembly in the absence of the BimC motor protein Cin8. In addition, we found that the Ase1 spindle midzone-associated protein is required for bipolar spindle assembly. The cin8 ipl1 and cin8 ase1 double mutant ...

  6. Voltage-gated sodium channels in taste bud cells

    Directory of Open Access Journals (Sweden)

    Williams Mark E

    2009-03-01

    Full Text Available Abstract Background Taste bud cells transmit information regarding the contents of food from taste receptors embedded in apical microvilli to gustatory nerve fibers innervating basolateral membranes. In particular, taste cells depolarize, activate voltage-gated sodium channels, and fire action potentials in response to tastants. Initial cell depolarization is attributable to sodium influx through TRPM5 in sweet, bitter, and umami cells and an undetermined cation influx through an ion channel in sour cells expressing PKD2L1, a candidate sour taste receptor. The molecular identity of the voltage-gated sodium channels that sense depolarizing signals and subsequently initiate action potentials coding taste information to gustatory nerve fibers is unknown. Results We describe the molecular and histological expression profiles of cation channels involved in electrical signal transmission from apical to basolateral membrane domains. TRPM5 was positioned immediately beneath tight junctions to receive calcium signals originating from sweet, bitter, and umami receptor activation, while PKD2L1 was positioned at the taste pore. Using mouse taste bud and lingual epithelial cells collected by laser capture microdissection, SCN2A, SCN3A, and SCN9A voltage-gated sodium channel transcripts were expressed in taste tissue. SCN2A, SCN3A, and SCN9A were expressed beneath tight junctions in subsets of taste cells. SCN3A and SCN9A were expressed in TRPM5 cells, while SCN2A was expressed in TRPM5 and PKD2L1 cells. HCN4, a gene previously implicated in sour taste, was expressed in PKD2L1 cells and localized to cell processes beneath the taste pore. Conclusion SCN2A, SCN3A and SCN9A voltage-gated sodium channels are positioned to sense initial depolarizing signals stemming from taste receptor activation and initiate taste cell action potentials. SCN2A, SCN3A and SCN9A gene products likely account for the tetrodotoxin-sensitive sodium currents in taste receptor cells.

  7. Yeast Genetics and Biotechnological Applications

    Science.gov (United States)

    Mishra, Saroj; Baranwal, Richa

    Yeast can be recognized as one of the very important groups of microorganisms on account of its extensive use in the fermentation industry and as a basic eukaryotic model cellular system. The yeast Saccharomyces cerevisiae has been extensively used to elucidate the genetics and regulation of several key functions in the cell such as cell mating, electron transport chain, protein trafficking, cell cycle events and others. Even before the genome sequence of the yeast was out, the structural organization and function of several of its genes was known. With the availability of the origin of replication from the 2 μm plasmid and the development of transformation system, it became the host of choice for expression of a number of important proteins. A large number of episomal and integrative shuttle vectors are available for expression of mammalian proteins. The latest developments in genomics and micro-array technology have allowed investigations of individual gene function by site-specific deletion method. The application of metabolic profiling has also assisted in understanding the cellular network operating in this yeast. This chapter is aimed at reviewing the use of this system as an experimental tool for conducting classical genetics. Various vector systems available, foreign genes expressed and the limitations as a host will be discussed. Finally, the use of various yeast enzymes in biotechnology sector will be reviewed.

  8. Gibberellins and the break of bud dormancy in virus-infected stem cuttings of Euphorbia pulcherrima.

    Science.gov (United States)

    Nath, S; Mandahar, C L; Gulati, A

    1979-10-15

    Break in bud dormancy in virus-infected stem cuttings of Euphorbia pulcherrima occurs because of the higher quantity of gibberellins present in them than in healthy cuttings in the dormant period of the plant. PMID:499409

  9. Field and laboratory investigations of budding in the tetillid sponge Cinachyrella cavernosa

    Digital Repository Service at National Institute of Oceanography (India)

    Singh, A; Thakur, N.L.

    when the average water temperature of intertidal rock pools was 32.4±0.23°C (February–March), followed by a significant decrease in budding frequency at 28.2±0.12°C (April–July), and no budding at

  10. Isolation and Properties of Ferromanganese-Depositing Budding Bacteria from Baltic Sea Ferromanganese Concretions

    OpenAIRE

    Ghiorse, William C.; Hirsch, Peter

    1982-01-01

    Hyphal budding bacteria were observed by electron microscopy in thin sections of surface material from Baltic Sea ferromanganese concretions. Similar bacteria were also observed in and isolated from enrichment cultures prepared from the same concretion material. Three morphologically similar strains of Mn-Fe-depositing budding bacteria were isolated from the enrichment cultures. Strain B-4 possessed extracellular anionic polymers that accumulated Mn oxides. Mn deposition by B-4 was inhibited ...

  11. Electron microscopic observation of hepatitis B virus budding from hepatocytes into bile canaliculi.

    OpenAIRE

    Ymadada, Gotaro; Sakamoto,Yuji; Mizuno, Motowo; Kobayashi, Toshinari; Nagashima,Hideo

    1980-01-01

    In electron microscopic observation of a liver biopsy obtained from a hepatitis B surface antigen-positive patient, noncoated core particles were occasionally seen budding into the hepatocytic cisterni and many Dane particles were found in the pericanalicular vesicles of hepatocytes. Noncoated core particles were also localized in clusters within the bleb of microvilli. There were some core particles being protruded from microvilli into the lumen of bile canaliculi by budding. These findings ...

  12. In vitro development of buds from tubers of (Solanum tuberosum L.)

    International Nuclear Information System (INIS)

    The present work studies the in vitro development of buds from potato tubers subjected to gamma radiation at doses of 3, 6, 9 and 12 Krad. Ths effect of radiation was dependent on the dormant stage of the buds. Intermediate doses (6-9 Krad) did inhibit mitotic division but not cellular elongation. When irradiation is carried out at the end of the resting period, there is an apparent sprouting due to the elongation of previously formed cells. (Author) 17 refs

  13. Marketingová komunikace destinace České Budějovice

    OpenAIRE

    MASARYKOVÁ, Lenka

    2013-01-01

    The thesis deals with an analysis of marketing communication instruments in the destination of České Budějovice. Pursuant of an analysis the current instruments of marketing communication are identified and the efficiency is evaluated. The one part of the thesis is also the suggestion of on optimal communication mix and the measures with contribute to the next development of marketing communication of the destination České Budějovice.

  14. Gustatory stimuli representing different perceptual qualities elicit distinct patterns of neuropeptide secretion from taste buds

    OpenAIRE

    Geraedts, Maartje C. P.; Munger, Steven D.

    2013-01-01

    Taste stimuli that evoke different perceptual qualities (e.g., sweet, umami, bitter, sour, salty) are detected by dedicated subpopulations of taste bud cells that employ distinct combinations of sensory receptors and transduction molecules. Here, we report that taste stimuli also elicit unique patterns of neuropeptide secretion from taste buds that are correlated with those perceptual qualities. We measured tastant-dependent secretion of glucagon-like peptide-1 (GLP-1), glucagon and neuropept...

  15. Identification of genes related to the development of bamboo rhizome bud

    OpenAIRE

    Wang, Kuihong; Peng, Huazheng; Lin, Erpei; Jin, Qunying; Hua, Xiqi; YAO, SHENG; Bian, Hongwu; Han, Ning; Pan, Jianwei; Wang, Junhui; Deng, Mingjuan; Zhu, Muyuan

    2009-01-01

    Bamboo (Phyllostachys praecox) is one of the largest members of the grass family Poaceae, and is one of the most economically important crops in Asia. However, complete knowledge of bamboo development and its molecular mechanisms is still lacking. In the present study, the differences in anatomical structure among rhizome buds, rhizome shoots, and bamboo shoots were compared, and several genes related to the development of the bamboo rhizome bud were identified. The rice cross-species microar...

  16. Partial repair of salinity-induced damage to sprouting sugarcane buds by proline and glycinebetaine pretreatment.

    Science.gov (United States)

    Rasheed, Rizwan; Wahid, Abdul; Hussain, Iqbal; Mahmood, Saqib; Parveen, Abida

    2016-05-01

    Sugarcane shows reduced crop stand under relatively suboptimal conditions; the main reason for this is its sensitivity to ionic stress in the soil solution. This research was performed to explore some physiological and developmental changes in the immature sugarcane buds submitted to salt stress and possible role of glycinebetaine (GB) and proline (Pro) in mitigating the ion toxicity in a time course manner. Salinity stress reduced fresh and dry weight, induced the generation of hydrogen peroxide, increased tissue levels of Na(+) sand Cl(-), reduced K(+) and Ca(2+), and K(+):Na(+) and Ca(2+):Na(+) ratios, while increasing the osmolyte synthesis in expanding sugarcane buds. Salinity stress reduced and delayed the formation of new bud leaves and their expansion, which was mainly because of reduction in the number and area of mesophyll cells and poor development of vascular bundles. The pretreatment of bud chips with 20 mM each of GB and Pro decreased tissue levels of Na(+) and Cl(-), reduced the generation of H2O2, improved K(+) and Ca(2+), K(+):Na(+) and Ca(2+):Na(+) ratios, and further increased the levels of GB, free proline (FP), and soluble sugars in the buds. The pretreatment increased mesophyll cell number and expansion of bud leaves and formation of elaborated vascular tissues, which apparently enabled the sprouting buds to adapt to salinity stress. Of the two osmolytes, GB was a relatively better inducer of salinity tolerance than Pro. In short, salinity-induced oxidative stress was the main cause for altered tissue development, the production of which was offset by pretreatment of bud tissues with Pro and GB. PMID:26043840

  17. Changes of Morphogenic Competence in Mature Pinus sylvestris L. Buds in vitro

    OpenAIRE

    ANDERSONE, UNA; IEVINSH, GEDERTS

    2002-01-01

    The effects of season and cold storage on morphogenic competence in mature Pinus sylvestris buds were investigated. Peroxidase and polyphenol oxidase activity were measured as markers of oxidative metabolism. No growth in vitro was observed on explants detached from the end of January until the beginning of March. Brachioblasts, each with a couple of needles, formed on 11 % of the buds without macrostrobili that were detached in early April and introduced immediately into culture. Of the expl...

  18. Structural Characterization of Ginsenosides from Flower Buds of Panax ginseng by RRLC-Q-TOF MS.

    Science.gov (United States)

    Wu, Wei; Lu, Ziyan; Teng, Yaran; Guo, Yingying; Liu, Shuying

    2016-02-01

    Ginseng flower bud as a part of Panax ginseng has received much attention as a valuable functional food with medicinal potential. A few studies focused on systematic and comprehensive studies on its major ingredients. This study aims to rapidly characterize ginsenosides in ginseng flower buds and provide scientific basis for developing functional food, exploiting pharmaceutical effects and making full use of ginseng resources. A rapid resolution liquid chromatography coupled with quadrupole-time-of-flight mass spectrometry (RRLC-Q-TOF-MS) method was developed for rapid qualitative and quantitative analysis of ginsenosides in ginseng flower buds. The compounds were identified by comparing retention time of the reference standards, accurate mass measurement and the fragment ions obtained from RRLC-Q-TOF-MS/MS analyses. A total of 14 kinds of ginsenosides were identified and 5 kinds of malonyl-ginsenosides were first tentatively identified in ginseng flower buds. Ten kinds of main ginsenosides were quantitatively analyzed. The developed RRLC-Q-TOF-MS method was demonstrated as an effective analytical means for rapid characterization of the ginsenosides in flower buds of P. ginseng. The research result is valuable for quality control, assessment of authenticity and stability evaluation of ginseng flower buds. PMID:26270079

  19. Association of Dermatological Conditions of External Ear with the Use of Cotton Buds

    Directory of Open Access Journals (Sweden)

    Salahuddin Ahmed

    2014-09-01

    Full Text Available Background: The habit of cleaning the external auditory canal with cotton buds is a common practice of the masses. It has strong association with neurodermatitis and contact dermatitis of the external ear. It is also associated with acute otitis externa, rupture of tympanic membrane causing bleeding and temporary hearing loss in some cases. In many cases the injury will heal but damage to minuscule bones deep inside the ear can cause permanent deafness. Objective: The objective of this study was to determine the association of dermatological condition of external ear with the use of cotton buds. Materials and Methods: This case control study was done from January to October 2012 in the Ear Nose Throat Department of Pakistan Level III Hospital, Darfur, Sudan. Sixty seven patients with dermatological diseases of external ear were cases and 83 subjects without dermatological diseases of external ear were selected as controls. Results: Among 67 cases, 58 were cotton bud users and among 83 controls only 29 were cotton bud users. Different types of dermatological diseases were neurodermatitis (34.32%, otitis externa (28.36%, contact dermatitis (26.87% and wax impaction (8.95%. Ninety three percent of cotton bud users were ignorant of harmful effects of this bad habit. Conclusion: There is a strong association of dermatological diseases of external ear with the use of cotton bud which should be discouraged by fortifying the warning by manufacturers and health education at various educational levels.

  20. Taste Bud Labeling in Whole Tongue Epithelial Sheet in Adult Mice.

    Science.gov (United States)

    Venkatesan, Nandakumar; Boggs, Kristin; Liu, Hong-Xiang

    2016-04-01

    Molecular labeling in whole-mount tissues provides an efficient way to obtain general information about the formation, maintenance, degeneration, and regeneration of many organs and tissues. However, labeling of lingual taste buds in whole tongue tissues in adult mice has been problematic because of the strong permeability barrier of the tongue epithelium. In this study, we present a simple method for labeling taste buds in the intact tongue epithelial sheet of an adult mouse. Following intralingual protease injection and incubation, immediate fixation of the tongue on mandible in 4% paraformaldehyde enabled the in situ shape of the tongue epithelium to be well maintained after peeling. The peeled epithelium was accessible to taste bud labeling with a pan-taste cell marker, keratin 8, and a type II taste cell marker, α-gustducin, in all three types of taste papillae, that is, fungiform, foliate, and circumvallate. Overnight incubation of tongue epithelial sheets with primary and secondary antibodies was sufficient for intense labeling of taste buds with both fluorescent and DAB visualizations. Labeled individual taste buds were easy to identify and quantify. This protocol provides an efficient way for phenotypic analyses of taste buds, especially regarding distribution pattern and number. PMID:26701416

  1. Programmed cell death during terminal bud senescence in a sympodial branching tree,Eucommia ulmoides

    Institute of Scientific and Technical Information of China (English)

    XU Wenjie; Kalima-N'Koma MWANGE; CUI Keming

    2004-01-01

    Eucommia ulmoides Oliv. is a typical sympodial branching tree. The apical bud of the branch ages and dies every year, replaced by the nearby axillary bud in the second year. Structural assays and a series of biochemical analyses were performed to analyze the senescence mechanism in the apical bud. It was revealed that most cells of the apical bud underwent the programmed cell death (PCD) during the senescence: the chromosomes were congregated and the nuclear contents were condensed, as shown by 4′,6-diamidino-2-phenylindole (DAPI) fluorescence. DNA fragmentation was detected during senescence using the terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end in situ labeling (TUNEL) method, coincident with the appearance of a DNA ladder. Moreover, a 20 kD DNase related to fragmentation was found. PCD was initiated first in the young leaves, leaf primordia and peripheral zone cells, then in the central mother cells and initial layer cells in the apical meristem. The terminal buds remain in vegetative growth during senescence, in contrast to buds of many annual plants.

  2. Glutamate may be an efferent transmitter that elicits inhibition in mouse taste buds.

    Directory of Open Access Journals (Sweden)

    Yijen A Huang

    Full Text Available Recent studies suggest that l-glutamate may be an efferent transmitter released from axons innervating taste buds. In this report, we determined the types of ionotropic synaptic glutamate receptors present on taste cells and that underlie this postulated efferent transmission. We also studied what effect glutamate exerts on taste bud function. We isolated mouse taste buds and taste cells, conducted functional imaging using Fura 2, and used cellular biosensors to monitor taste-evoked transmitter release. The findings show that a large fraction of Presynaptic (Type III taste bud cells (∼50% respond to 100 µM glutamate, NMDA, or kainic acid (KA with an increase in intracellular Ca(2+. In contrast, Receptor (Type II taste cells rarely (4% responded to 100 µM glutamate. At this concentration and with these compounds, these agonists activate glutamatergic synaptic receptors, not glutamate taste (umami receptors. Moreover, applying glutamate, NMDA, or KA caused taste buds to secrete 5-HT, a Presynaptic taste cell transmitter, but not ATP, a Receptor cell transmitter. Indeed, glutamate-evoked 5-HT release inhibited taste-evoked ATP secretion. The findings are consistent with a role for glutamate in taste buds as an inhibitory efferent transmitter that acts via ionotropic synaptic glutamate receptors.

  3. Trait variation in yeast is defined by population history.

    Directory of Open Access Journals (Sweden)

    Jonas Warringer

    2011-06-01

    Full Text Available A fundamental goal in biology is to achieve a mechanistic understanding of how and to what extent ecological variation imposes selection for distinct traits and favors the fixation of specific genetic variants. Key to such an understanding is the detailed mapping of the natural genomic and phenomic space and a bridging of the gap that separates these worlds. Here we chart a high-resolution map of natural trait variation in one of the most important genetic model organisms, the budding yeast Saccharomyces cerevisiae, and its closest wild relatives and trace the genetic basis and timing of major phenotype changing events in its recent history. We show that natural trait variation in S. cerevisiae exceeds that of its relatives, despite limited genetic variation, and follows the population history rather than the source environment. In particular, the West African population is phenotypically unique, with an extreme abundance of low-performance alleles, notably a premature translational termination signal in GAL3 that cause inability to utilize galactose. Our observations suggest that many S. cerevisiae traits may be the consequence of genetic drift rather than selection, in line with the assumption that natural yeast lineages are remnants of recent population bottlenecks. Disconcertingly, the universal type strain S288C was found to be highly atypical, highlighting the danger of extrapolating gene-trait connections obtained in mosaic, lab-domesticated lineages to the species as a whole. Overall, this study represents a step towards an in-depth understanding of the causal relationship between co-variation in ecology, selection pressure, natural traits, molecular mechanism, and alleles in a key model organism.

  4. Design principles of the yeast G1/S switch.

    Directory of Open Access Journals (Sweden)

    Xiaojing Yang

    2013-10-01

    Full Text Available A hallmark of the G1/S transition in budding yeast cell cycle is the proteolytic degradation of the B-type cyclin-Cdk stoichiometric inhibitor Sic1. Deleting SIC1 or altering Sic1 degradation dynamics increases genomic instability. Certain key facts about the parts of the G1/S circuitry are established: phosphorylation of Sic1 on multiple sites is necessary for its destruction, and both the upstream kinase Cln1/2-Cdk1 and the downstream kinase Clb5/6-Cdk1 can phosphorylate Sic1 in vitro with varied specificity, cooperativity, and processivity. However, how the system works as a whole is still controversial due to discrepancies between in vitro, in vivo, and theoretical studies. Here, by monitoring Sic1 destruction in real time in individual cells under various perturbations to the system, we provide a clear picture of how the circuitry functions as a switch in vivo. We show that Cln1/2-Cdk1 sets the proper timing of Sic1 destruction, but does not contribute to its destruction speed; thus, it acts only as a trigger. Sic1's inhibition target Clb5/6-Cdk1 controls the speed of Sic1 destruction through a double-negative feedback loop, ensuring a robust all-or-none transition for Clb5/6-Cdk1 activity. Furthermore, we demonstrate that the degradation of a single-phosphosite mutant of Sic1 is rapid and switch-like, just as the wild-type form. Our mathematical model confirms our understanding of the circuit and demonstrates that the substrate sharing between the two kinases is not a redundancy but a part of the design to overcome the trade-off between the timing and sharpness of Sic1 degradation. Our study provides direct mechanistic insight into the design features underlying the yeast G1/S switch.

  5. Shuffling Yeast Gene Expression Data

    CERN Document Server

    Bilke, S

    2000-01-01

    A new method to sort gene expression patterns into functional groups is presented. The method is based on a sorting algorithm using a non-local similarity score, which takes all other patterns in the dataset into account. The method is therefore very robust with respect to noise. Using the expression data for yeast, we extract information about functional groups. Without prior knowledge of parameters the cell cycle regulated genes in yeast can be identified. Furthermore a second, independent cell clock is identified. The capability of the algorithm to extract information about signal flow in the regulatory network underlying the expression patterns is demonstrated.

  6. Consequences of Repeated Defoliation on Belowground Bud Banks of Carex brevicuspis (Cyperaceae) in the Dongting Lake Wetlands, China

    Science.gov (United States)

    Chen, Xin-Sheng; Deng, Zheng-Miao; Xie, Yong-Hong; Li, Feng; Hou, Zhi-Yong; Wu, Chao

    2016-01-01

    Despite the predominant role of bud banks in the regeneration of clonal macrophyte populations, few studies have examined the way in which clonal macrophytes adjust the demographic features of bud banks to regulate population dynamics in response to defoliation in wetlands. We investigated the density and composition of bud banks under repeated defoliation in the wetland sedge Carex brevicuspis C. B. Clarke in the Dongting Lake wetlands, China. The density and biomass of rhizome buds and shoots did not decrease significantly in response to repeated defoliation over two consecutive years. The composition of bud banks, which consisted of long and short rhizome buds, also did not change significantly in response to repeated defoliation. Nevertheless, the ramet height and the shoot, root, and rhizome mass of C. brevicuspis declined significantly under repeated defoliation. Our findings suggest that bud banks are a conservative reproductive strategy that enables C. brevicuspis to tolerate a certain amount of defoliation. The maintenance of large bud banks after repeated defoliation may enable C. brevicuspis populations to regenerate and persist in disturbed habitats. However, bud bank density of C. brevicuspis might decline in the long term because the amount of carbon stored in rhizome buds and plants is reduced by frequent defoliation. PMID:27524993

  7. Yeast Interacting Proteins Database: YFL023W, YBR154C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available expression controlled by TOR kinase; diploid mutants show a random budding pattern rather than the wild-type bipolar... gene expression controlled by TOR kinase; diploid mutants show a random budding pattern rather than the wild-type bipolar

  8. Yeast Interacting Proteins Database: YFL023W, YLR200W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available expression controlled by TOR kinase; diploid mutants show a random budding pattern rather than the wild-type bipolar...signaling, and gene expression controlled by TOR kinase; diploid mutants show a random budding pattern rather than the wild-type bipo...lar pattern; plays a role in regulating Ty1 transposition Rows with this bait as ba

  9. Radiation stimulation of yeast crops for increasing output of alcohol and baker yeasts

    International Nuclear Information System (INIS)

    The purpose of this study was to stimulate by gamma radiation the existing commercial types of yeast so as to obtain yeasts that would better reflect the substrate and have improved reproductive capacity. The experiments were conducted under ordinary conditions using commercial yeasts received from one factory producing alcohol and bakery yeasts and isolated as pure cultures. Irradiating yeast cultures with small doses (up to 10 krad) was found to stimulate the reproduction and fermenting activity of yeast cells as manifested in increased accumulation of yeast biomass and greater yield of ethyl alcohol. (E.T.)

  10. Yeast proteinopathy models: a robust tool for deciphering the basis of neurodegeneration

    Directory of Open Access Journals (Sweden)

    Amit Shrestha

    2015-11-01

    Full Text Available Protein quality control or proteostasis is an essential determinant of basic cell health and aging. Eukaryotic cells have evolved a number of proteostatic mechanisms to ensure that proteins retain functional conformation, or are rapidly degraded when proteins misfold or self-aggregate. Disruption of proteostasis is now widely recognized as a key feature of aging related illness, specifically neurodegenerative disease. For example, Alzheimer’s disease, Huntington’s disease, Parkinson’s disease and Amyotrophic Lateral Sclerosis (ALS each target and afflict distinct neuronal cell subtypes, yet this diverse array of human pathologies share the defining feature of aberrant protein aggregation within the affected cell population. Here, we review the use of budding yeast as a robust proxy to study the intersection between proteostasis and neurodegenerative disease. The humanized yeast model has proven to be an amenable platform to identify both, conserved proteostatic mechanisms across eukaryotic phyla and novel disease specific molecular dysfunction. Moreover, we discuss the intriguing concept that yeast specific proteins may be utilized as bona fide therapeutic agents, to correct proteostasis errors across various forms of neurodegeneration.

  11. Evolution of ecological dominance of yeast species in high-sugar environments.

    Science.gov (United States)

    Williams, Kathryn M; Liu, Ping; Fay, Justin C

    2015-08-01

    In budding yeasts, fermentation in the presence of oxygen evolved around the time of a whole genome duplication (WGD) and is thought to confer dominance in high-sugar environments because ethanol is toxic to many species. Although there are many fermentative yeast species, only Saccharomyces cerevisiae consistently dominates wine fermentations. In this study, we use coculture experiments and intrinsic growth rate assays to examine the relative fitness of non-WGD and WGD yeast species across environments to assess when S. cerevisiae's ability to dominate high-sugar environments arose. We show that S. cerevisiae dominates nearly all other non-WGD and WGD species except for its sibling species S. paradoxus in both grape juice and a high-sugar rich medium. Of the species we tested, S. cerevisiae and S. paradoxus have evolved the highest ethanol tolerance and intrinsic growth rate in grape juice. However, the ability of S. cerevisiae and S. paradoxus to dominate certain species depends on the temperature and the type of high-sugar environment. Our results indicate that dominance of high-sugar environments evolved much more recently than the WGD, most likely just prior to or during the differentiation of Saccharomyces species, and that evolution of multiple traits contributes to S. cerevisiae's ability to dominate wine fermentations. PMID:26087012

  12. Mitotic segregation in intergeneric hybrids of yeast to give novel genetic segregants

    International Nuclear Information System (INIS)

    Two strains of yeast, Yarrowia lipolytica and Saccharomycopsis fibuligera, have a filamentous growth form in addition to budding cells. Y. lipolytica produces lipases and is used in the production of citric acid while W. fibuligera produces amylases and is used in the production of rice wine. In the present report, we made a study of the following: (i) karyotypes of the two yeast strains to obtain a better understanding of their genetic relatedness, (ii) genetic crosses between the two strains to produce intergeneric hybrids, and (iii) pattern of genetic segregation of the intergeneric hybrids via the mitotic process. The results of our studies showed that the two yeast strains were genetically related and that putative intergeneric hybrids were obtained by a genetic crossing of the strains. The hybrids were relatively stable in mitosis as compared to their parent strains. However, in prolonged vegetative propagation, the hybrids gave rise to genetic segregants, most of which were of either of the two parent phenotypes. A number of the segregants had phenotypes which combined those of the parental types. Of considerable significance was that yet a few others were novel as they exhibited phenotypes not hitherto seen for both parent strains. (author). 9 refs, 5 tabs

  13. 21 CFR 73.355 - Phaffia yeast.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Phaffia yeast. 73.355 Section 73.355 Food and... ADDITIVES EXEMPT FROM CERTIFICATION Foods § 73.355 Phaffia yeast. (a) Identity. (1) The color additive phaffia yeast consists of the killed, dried cells of a nonpathogenic and nontoxicogenic strain of...

  14. Differentiated dynamics of bud dormancy and growth in temperate fruit trees relating to bud phenology adaptation, the case of apple and almond trees

    Science.gov (United States)

    El Yaacoubi, Adnane; Malagi, Gustavo; Oukabli, Ahmed; Citadin, Idemir; Hafidi, Majida; Bonhomme, Marc; Legave, Jean-Michel

    2016-04-01

    Few studies have focused on the characterization of bud dormancy and growth dynamics for temperate fruit species in temperate and mild cropping areas, although this is an appropriate framework to anticipate phenology adaptation facing future warming contexts which would potentially combine chill declines and heat increases. To examine this issue, two experimental approaches and field observations were used for high- and low-chill apple cultivars in temperate climate of southern France and in mild climates of northern Morocco and southern Brazil. Low-chill almond cultivars offered an additional relevant plant material for comparison with apple in northern Morocco. Divergent patterns of dormancy and growth dynamics were clearly found in apple tree between southern France and southern Brazil. Divergences were less pronounced between France and Morocco. A global view outlined main differences in the dormancy chronology and intensity, the transition between endordormancy and ecodormancy and the duration of ecodormancy. A key role of bud rehydration in the transition period was shown. High-chill cultivars would be submitted in mild conditions to heterogeneous rehydration capacities linked to insufficient chill fulfillment and excessive forcing linked to high temperatures. This would favor bud competitions and consequently excessive flowering durations and weak flowering. Low chilling requirements in apple and almond would conversely confer biological capacities to tolerate superficial dormancy and abrupt transition from endordormancy to ecodormancy without important heterogeneous rehydration states within buds. It may also assume that low-chill cultivars can also tolerate high temperatures during ecodormancy as well as extended flowering durations.

  15. Sterol-Rich Membrane Domains Define Fission Yeast Cell Polarity.

    Science.gov (United States)

    Makushok, Tatyana; Alves, Paulo; Huisman, Stephen Michiel; Kijowski, Adam Rafal; Brunner, Damian

    2016-05-19

    Cell polarization is crucial for the functioning of all organisms. The cytoskeleton is central to the process but its role in symmetry breaking is poorly understood. We study cell polarization when fission yeast cells exit starvation. We show that the basis of polarity generation is de novo sterol biosynthesis, cell surface delivery of sterols, and their recruitment to the cell poles. This involves four phases occurring independent of the polarity factor cdc42p. Initially, multiple, randomly distributed sterol-rich membrane (SRM) domains form at the plasma membrane, independent of the cytoskeleton and cell growth. These domains provide platforms on which the growth and polarity machinery assembles. SRM domains are then polarized by the microtubule-dependent polarity factor tea1p, which prepares for monopolar growth initiation and later switching to bipolar growth. SRM polarization requires F-actin but not the F-actin organizing polarity factors for3p and bud6p. We conclude that SRMs are key to cell polarization. PMID:27180904

  16. Single-Molecule Analysis of Replicating Yeast Chromosomes.

    Science.gov (United States)

    Gallo, David; Wang, Gang; Yip, Christopher M; Brown, Grant W

    2016-02-01

    The faithful replication of eukaryotic chromosomal DNA occurs during S phase once per cell cycle. Replication is highly regulated and is initiated at special structures, termed origins, from which replication forks move out bidirectionally. A wide variety of techniques have been developed to study the features and kinetics of replication. Many of these, such as those based on flow cytometry and two-dimensional and pulsed-field gel electrophoresis, give a population-level view of replication. However, an alternative approach, DNA fiber analysis, which was originally developed more than 50 years ago, has the advantage of revealing features of replication at the level of individual DNA fibers. Initially based on autoradiography, this technique has been superseded by immunofluorescence-based detection of incorporated halogenated thymidine analogs. Furthermore, derivations of this technique have been developed to distribute and stretch the labeled DNA fibers uniformly on optically clear surfaces. As described here, one such technique-DNA combing, in which DNA is combed onto silanized coverslips-has been used successfully to monitor replication fork progression and origin usage in budding yeast. PMID:26832692

  17. Black yeasts in cold habitats

    NARCIS (Netherlands)

    L. Selbmann; G.S. de Hoog; L. Zucconi; D. Isola; S. Onofri

    2014-01-01

    Black yeasts have already been known since the end of the nineteenth century, but for a number of reasons, only few workers were familiar with them. That was since recently, until the wealth of biodiversity, stunning ecologies and potential applications have become apparent. Some remote and extreme

  18. High biological variability of plastids, photosynthetic pigments and pigment forms of leaf primordia in buds.

    Science.gov (United States)

    Solymosi, Katalin; Morandi, Dominique; Bóka, Károly; Böddi, Béla; Schoefs, Benoît

    2012-05-01

    To study the formation of the photosynthetic apparatus in nature, the carotenoid and chlorophyllous pigment compositions of differently developed leaf primordia in closed and opening buds of common ash (Fraxinus excelsior L.) and horse chestnut (Aesculus hippocastanum L.) as well as in closed buds of tree of heaven (Ailanthus altissima P. Mill.) were analyzed with HPLC. The native organization of the chlorophyllous pigments was studied using 77 K fluorescence spectroscopy, and plastid ultrastructure was investigated with electron microscopy. Complete etiolation, i.e., accumulation of protochlorophyllide, and absence of chlorophylls occurred in the innermost leaf primordia of common ash buds. The other leaf primordia were partially etiolated in the buds and contained protochlorophyllide (0.5-1 μg g(-1) fresh mass), chlorophyllides (0.2-27 μg g(-1) fresh mass) and chlorophylls (0.9-643 μg g(-1) fresh mass). Etio-chloroplasts with prolamellar bodies and either regular or only low grana were found in leaves having high or low amounts of chlorophyll a and b, respectively. After bud break, etioplast-chloroplast conversion proceeded and the pigment contents increased in the leaves, similarly to the greening processes observed in illuminated etiolated seedlings under laboratory conditions. The pigment contents and the ratio of the different spectral forms had a high biological variability that could be attributed to (i) various light conditions due to light filtering in the buds resulting in differently etiolated leaf primordia, (ii) to differences in the light-exposed and inner regions of the same primordia in opening buds due to various leaf folding, and (iii) to tissue-specific slight variations of plastid ultrastructure. PMID:22160501

  19. Bud development in corydalis (Corydalis bracteata) requires low temperature: a study of developmental and carbohydrate changes

    Science.gov (United States)

    Khodorova, Nadejda V.; Miroslavov, Evgeniy A.; Shavarda, Alexey L.; Laberche, Jean-Claude; Boitel-Conti, Michèle

    2010-01-01

    Background and Aims Spring geophytes require a period of low temperature for proper flower development but the mechanism that underlies the relationship between cold treatment and flowering remains unknown. The present study aims to compare the developmental anatomy and carbohydrate content of the tuberous geophyte Corydalis bracteata growing under natural winter conditions from 10 to −10 °C (field-grown) and under a mild temperature regime of 18 °C (indoor-grown plants). Methods Samples were studied under light and electron microscopy. A histochemical test (periodic acid – Schiff's) was employed to identify starch in sectioned material. Sugars were analysed by capillary gas chromatography. Apoplastic wash fluid was prepared. Key Results Under natural conditions, shoots were elongated, and buds gained in dry mass and developed normally. For indoor-grown plants, these parameters were lower in value and, from December, a progressive necrosis of flower buds was observed. The tuber consisted of the new developing one, which was connected to the bud, and the old tuber with its starch reserve. Due to the absence of plasmodesmata between new and old tuber cells, sugar transport cannot be through the symplast. Thus, a potential apoplastic route is proposed from old tuber phloem parenchyma cells to the adjacent new tuber cells. Sugar content in buds during the autumn months (September–November) was lower for indoor-grown plants than control plants, whereas the sugar content in tubers during the same period was similar for plants from both temperature treatments. However, the amount of apoplastic sugars in tubers of field-grown plants was almost 15-fold higher than in indoor-grown tubers. Conclusions The results suggest that low temperature activates the apoplastic route of sugar transport in C. bracteata tubers and a consequent carbohydrate delivery to the bud. In the absence of cold treatment, the carbohydrate reserve is locked in old tuber cells so the nutrient

  20. Local adaptations and climate change: converging sensitivity of bud break in black spruce provenances

    Science.gov (United States)

    Rossi, Sergio

    2015-07-01

    Species with transcontinental distribution or spread over wide geographical regions develop populations with growth traits genetically adapted to the local climate. The aim of this study was to investigate the ecotypic sensitivity of bud break, a strong adaptive trait, to a changing environment. Six phenological phases of bud break were monitored daily on black spruce [ Picea mariana (Mill.) BSP] seedlings submitted to different temperatures (12, 16 and 20 °C) and photoperiods (14, 18 and 22 h). Six provenances were tested in growth chambers, produced from seeds collected along the whole latitudinal range of the closed boreal forest in Quebec, Canada. Bud break lasted 13.3 days on average and occurred earlier in seedlings from colder sites. The annual temperature of the sites suitably tracked the clinal variation among ecotypes, providing a clear biological explanation for the environmental signal driving the adaptive divergence of populations to the local climate. Increasing temperature induced an earlier bud break according to a non-linear pattern with greater advancements observed between 12 and 16 °C. Photoperiod was significant, but sensitivity analysis indicated that its effect on bud break was marginal with respect to temperature. No interaction of provenance × treatment was observed, demonstrating an ecotypic convergence of the responses to both factors. Changes in the growing conditions could substantially modify the synchronization between bud phenology and climate, thus exposing the developing meristems of black spruce to frost damage. However, similar advancements of bud break could be expected in the different ecotypes subjected to warmer temperatures or longer day lengths.

  1. Yeast GSK-3 kinase regulates astral microtubule function through phosphorylation of the microtubule-stabilizing kinesin Kip2.

    Science.gov (United States)

    Drechsler, Hauke; Tan, Ann Na; Liakopoulos, Dimitris

    2015-11-01

    The S. cerevisiae kinesin Kip2 stabilises astral microtubules (MTs) and facilitates spindle positioning through transport of MT-associated proteins, such as the yeast CLIP-170 homologue Bik1, dynein and the adenomatous-polyposis-coli-related protein Kar9 to the plus ends of astral MTs. Here, we show that Kip2 associates with its processivity factor Bim1, the yeast homologue of the plus-end-tracking protein EB1. This interaction requires an EB1-binding motif in the N-terminal extension of Kip2 and is negatively regulated by phosphorylation through Mck1, the yeast glycogen synthase kinase 3. In addition, Mck1-dependent phosphorylation decreases the intrinsic MT affinity of Kip2. Reduction in Kip2 phosphorylation leads to stabilisation of astral MTs, and accumulation of Kip2, dynein and Kar9 at MT plus ends, whereas loss of Mck1 function leads to defects in spindle positioning. Furthermore, we provide evidence that a subpopulation of Mck1 at the bud-cortex phosphorylates Kip2. We propose that yeast GSK-3 spatially controls astral MT dynamics and the loading of dynein and Kar9 on astral MT plus ends by regulating Kip2 interactions with Bim1 and MTs. PMID:26395399

  2. Regulation of spindle pole body assembly and cytokinesis by the centrin-binding protein Sfi1 in fission yeast.

    Science.gov (United States)

    Lee, I-Ju; Wang, Ning; Hu, Wen; Schott, Kersey; Bähler, Jürg; Giddings, Thomas H; Pringle, John R; Du, Li-Lin; Wu, Jian-Qiu

    2014-09-15

    Centrosomes play critical roles in the cell division cycle and ciliogenesis. Sfi1 is a centrin-binding protein conserved from yeast to humans. Budding yeast Sfi1 is essential for the initiation of spindle pole body (SPB; yeast centrosome) duplication. However, the recruitment and partitioning of Sfi1 to centrosomal structures have never been fully investigated in any organism, and the presumed importance of the conserved tryptophans in the internal repeats of Sfi1 remains untested. Here we report that in fission yeast, instead of doubling abruptly at the initiation of SPB duplication and remaining at a constant level thereafter, Sfi1 is gradually recruited to SPBs throughout the cell cycle. Like an sfi1Δ mutant, a Trp-to-Arg mutant (sfi1-M46) forms monopolar spindles and exhibits mitosis and cytokinesis defects. Sfi1-M46 protein associates preferentially with one of the two daughter SPBs during mitosis, resulting in a failure of new SPB assembly in the SPB receiving insufficient Sfi1. Although all five conserved tryptophans tested are involved in Sfi1 partitioning, the importance of the individual repeats in Sfi1 differs. In summary, our results reveal a link between the conserved tryptophans and Sfi1 partitioning and suggest a revision of the model for SPB assembly. PMID:25031431

  3. A Model of Yeast Cell-Cycle Regulation Based on a Standard Component Modeling Strategy for Protein Regulatory Networks

    Science.gov (United States)

    Laomettachit, Teeraphan; Chen, Katherine C.; Baumann, William T.

    2016-01-01

    To understand the molecular mechanisms that regulate cell cycle progression in eukaryotes, a variety of mathematical modeling approaches have been employed, ranging from Boolean networks and differential equations to stochastic simulations. Each approach has its own characteristic strengths and weaknesses. In this paper, we propose a “standard component” modeling strategy that combines advantageous features of Boolean networks, differential equations and stochastic simulations in a framework that acknowledges the typical sorts of reactions found in protein regulatory networks. Applying this strategy to a comprehensive mechanism of the budding yeast cell cycle, we illustrate the potential value of standard component modeling. The deterministic version of our model reproduces the phenotypic properties of wild-type cells and of 125 mutant strains. The stochastic version of our model reproduces the cell-to-cell variability of wild-type cells and the partial viability of the CLB2-dbΔ clb5Δ mutant strain. Our simulations show that mathematical modeling with “standard components” can capture in quantitative detail many essential properties of cell cycle control in budding yeast. PMID:27187804

  4. A Model of Yeast Cell-Cycle Regulation Based on a Standard Component Modeling Strategy for Protein Regulatory Networks.

    Directory of Open Access Journals (Sweden)

    Teeraphan Laomettachit

    Full Text Available To understand the molecular mechanisms that regulate cell cycle progression in eukaryotes, a variety of mathematical modeling approaches have been employed, ranging from Boolean networks and differential equations to stochastic simulations. Each approach has its own characteristic strengths and weaknesses. In this paper, we propose a "standard component" modeling strategy that combines advantageous features of Boolean networks, differential equations and stochastic simulations in a framework that acknowledges the typical sorts of reactions found in protein regulatory networks. Applying this strategy to a comprehensive mechanism of the budding yeast cell cycle, we illustrate the potential value of standard component modeling. The deterministic version of our model reproduces the phenotypic properties of wild-type cells and of 125 mutant strains. The stochastic version of our model reproduces the cell-to-cell variability of wild-type cells and the partial viability of the CLB2-dbΔ clb5Δ mutant strain. Our simulations show that mathematical modeling with "standard components" can capture in quantitative detail many essential properties of cell cycle control in budding yeast.

  5. A Model of Yeast Cell-Cycle Regulation Based on a Standard Component Modeling Strategy for Protein Regulatory Networks.

    Science.gov (United States)

    Laomettachit, Teeraphan; Chen, Katherine C; Baumann, William T; Tyson, John J

    2016-01-01

    To understand the molecular mechanisms that regulate cell cycle progression in eukaryotes, a variety of mathematical modeling approaches have been employed, ranging from Boolean networks and differential equations to stochastic simulations. Each approach has its own characteristic strengths and weaknesses. In this paper, we propose a "standard component" modeling strategy that combines advantageous features of Boolean networks, differential equations and stochastic simulations in a framework that acknowledges the typical sorts of reactions found in protein regulatory networks. Applying this strategy to a comprehensive mechanism of the budding yeast cell cycle, we illustrate the potential value of standard component modeling. The deterministic version of our model reproduces the phenotypic properties of wild-type cells and of 125 mutant strains. The stochastic version of our model reproduces the cell-to-cell variability of wild-type cells and the partial viability of the CLB2-dbΔ clb5Δ mutant strain. Our simulations show that mathematical modeling with "standard components" can capture in quantitative detail many essential properties of cell cycle control in budding yeast. PMID:27187804

  6. Reactivation from latency displays HIV particle budding at plasma membrane, accompanying CD44 upregulation and recruitment

    Directory of Open Access Journals (Sweden)

    Sano Kouichi

    2009-07-01

    Full Text Available Abstract Background It has been accepted that HIV buds from the cell surface in T lymphocytes, whereas in macrophages it buds into intracellular endosomes. Recent studies, on the other hand, suggest that HIV preferentially buds from the cell surface even in monocytic cells. However, most studies are based on observations in acutely infected cells and little is known about HIV budding concomitant with reactivation from latency. Such studies would provide a better understanding of a reservoir for HIV. Results We observed HIV budding in latently infected T lymphocytic and monocytic cell lines following TNF-α stimulation and examined the upregulation of host factors that may be involved in particle production. Electron microscopy analysis revealed that reactivation of latently infected J1.1 cells (latently infected Jurkat cells with HIV-1 and U1 cells (latently infected U937 cells with HIV-1 displayed HIV particle budding predominantly at the plasma membrane, a morphology that is similar to particle budding in acutely infected Jurkat and U937 cells. When mRNA expression levels were quantified by qRT-PCR, we found that particle production from reactivated J1.1 and U1 cells was accompanied by CD44 upregulation. This upregulation was similarly observed when Jurkat and U937 cells were acutely infected with HIV-1 but not when just stimulated with TNF-α, suggesting that CD44 upregulation was linked with HIV production but not with cell stimulation. The molecules in endocytic pathways such as CD63 and HRS were also upregulated when U1 cells were reactivated and U937 cells were acutely infected with HIV-1. Confocal microscopy revealed that these upregulated host molecules were recruited to and accumulated at the sites where mature particles were formed at the plasma membrane. Conclusion Our study indicates that HIV particles are budded at the plasma membrane upon reactivation from latency, a morphology that is similar to particle budding in acute

  7. Study of disbudding goat kids following injection of clove oil essence in horn bud region.

    Science.gov (United States)

    Molaei, Mohammad Mahdi; Mostafavi, Ali; Kheirandish, Reza; Azari, Omid; Shaddel, Mohsen

    2015-01-01

    This study was performed to evaluate the efficacy of injection of essential oil of Eugenia caryophyllata in the kid horn buds, as a new chemical technique for disbudding. Five-day-old healthy goat kids from both sexes (n = 16) were divided randomly into 4 equal groups. In groups 1, 2 and 3, 0.2 mL of clove essence and in group 4 (control) 0.2 mL of normal saline was injected into the left horn bud of goat kids. Right horn bud in all kids was considered to ensure that they are horned. During the study, the rate of horn growth were evaluated in determined time intervals between groups 1 and 4. Tissue samples were taken from right and left horn bud in groups 2 and 3, at five and ten days after clove essence injection, for microscopic study. The results of the study showed that the clove essence stopped horn growth, whereas there was no significant difference in horn growth rate between left and right horns after injection of normal saline, in group 4. Histopathological study showed that injection of clove essence caused complete necrosis of epidermis and underlying dermis with collagenolysis in horn bud tissues, 5 days after injection and then progress in healing process was observed after 10 days. According to the results of this study, it can be concluded that the injection of clove essence is an effective method to stop horn growth without any undesirable effects on clinical parameters in goat kids. PMID:25992247

  8. Intracellular assembly and budding of the Murine Leukemia Virus in infected cells

    Directory of Open Access Journals (Sweden)

    Briant Laurence

    2006-02-01

    Full Text Available Abstract Background Murine Leukemia Virus (MLV assembly has been long thought to occur exclusively at the plasma membrane. Current models of retroviral particle assembly describe the recruitment of the host vacuolar protein sorting machinery to the cell surface to induce the budding of new particles. Previous fluorescence microscopy study reported the vesicular traffic of the MLV components (Gag, Env and RNA. Here, electron microscopy (EM associated with immunolabeling approaches were used to go deeply into the assembly of the "prototypic" MLV in chronically infected NIH3T3 cells. Results Beside the virus budding events seen at the cell surface of infected cells, we observed that intracellular budding events could also occur inside the intracellular vacuoles in which many VLPs accumulated. EM in situ hybridization and immunolabeling analyses confirmed that these latter were MLV particles. Similar intracellular particles were detected in cells expressing MLV Gag alone. Compartments containing the MLV particles were identified as late endosomes using Lamp1 endosomal/lysosomal marker and BSA-gold pulse-chase experiments. In addition, infectious activity was detected in lysates of infected cells. Conclusion Altogether, our results showed that assembly of MLV could occur in part in intracellular compartments of infected murine cells and participate in the production of infectious viruses. These observations suggested that MLV budding could present similarities with the particular intracellular budding of HIV in infected macrophages.

  9. Making continental-scale environmental programs relevant locally for educators with Project BudBurst

    Science.gov (United States)

    Goehring, L.; Henderson, S.; Wasser, L.; Newman, S. J.; Ward, D.

    2012-12-01

    Project BudBurst is a national citizen science initiative designed to engage non professionals in observations of phenological (plant life cycle) events that raise awareness of climate change, and create a cadre of informed citizen scientists. Citizen science programs such as Project BudBurst provide excellent opportunities for educators and their students to actively participate in scientific research. Such programs are important not only from an educational perspective, but because they also enable scientists to broaden the geographic and temporal scale of their observations. The goals of Project BudBurst are to 1) increase awareness of phenology as an area of scientific study; 2) increase awareness of the impacts of changing climates on plants at a continental-scale; and 3) increase science literacy by engaging participants in the scientific process. From its 2008 launch, this on-line program has engaged participants of all ages and walks of life in recording the timing of the leafing and flowering of wild and cultivated species found across the continent, and in contemplating the meaning of such data in their local environments. Thus far, thousands of participants from all 50 states have submitted data. This presentation will provide an overview of Project BudBurst educational resources and share lessons learned from educators in implementing the program in formal and informal education settings. Lesson plans and tips from educators will be highlighted. Project BudBurst is co-managed by the National Ecological Observatory Network and the Chicago Botanic Garden.

  10. Respiratory Response of Dormant Nectarine Vegetative Buds to High Temperature Stress

    Institute of Scientific and Technical Information of China (English)

    TAN Yue; LI Ling; LENG Chuan-yuan; LI Dong-mei; CHEN Xiu-de; GAO Dong-sheng

    2013-01-01

    High temperature stress (HT) is efficient in breaking endo-dormancy of perennial trees. The effects of HT (50°C) on the respiration of dormant nectarine (Prunus persica var. nectariana cv. Shuguang) vegetative buds were evaluated in the research. We found that bud respiration was transiently inhibited by HT and the pentose phosphate pathway (PPP) and the cytochrome C pathway (CYT) were significantly affected. On the substrate level, PPP was activated in the HT-treated buds compared with the control group. However, the activation did mot occur until hours after HT treatment. The tricarboxylic acid cycle (TCA) in both the HT-treated buds and in the control group proceeded at a low level most of the time compared with total respiration. On the electron transfer level, CYT was transiently inhibited by HT but became significantly active in the later stage. CYT operation in the control group exhibited an attenuation process. The alternative pathway (ALT) fluctuated both in the HT-treated samples and in the control. The results suggest that the temporary CYT inhibition and the following PPP activation may be involved in HT-induced bud dormancy release and budburst mechanisms.

  11. A2BR adenosine receptor modulates sweet taste in circumvallate taste buds.

    Directory of Open Access Journals (Sweden)

    Shinji Kataoka

    Full Text Available In response to taste stimulation, taste buds release ATP, which activates ionotropic ATP receptors (P2X2/P2X3 on taste nerves as well as metabotropic (P2Y purinergic receptors on taste bud cells. The action of the extracellular ATP is terminated by ectonucleotidases, ultimately generating adenosine, which itself can activate one or more G-protein coupled adenosine receptors: A1, A2A, A2B, and A3. Here we investigated the expression of adenosine receptors in mouse taste buds at both the nucleotide and protein expression levels. Of the adenosine receptors, only A2B receptor (A2BR is expressed specifically in taste epithelia. Further, A2BR is expressed abundantly only in a subset of taste bud cells of posterior (circumvallate, foliate, but not anterior (fungiform, palate taste fields in mice. Analysis of double-labeled tissue indicates that A2BR occurs on Type II taste bud cells that also express Gα14, which is present only in sweet-sensitive taste cells of the foliate and circumvallate papillae. Glossopharyngeal nerve recordings from A2BR knockout mice show significantly reduced responses to both sucrose and synthetic sweeteners, but normal responses to tastants representing other qualities. Thus, our study identified a novel regulator of sweet taste, the A2BR, which functions to potentiate sweet responses in posterior lingual taste fields.

  12. High-resolution statistical mapping reveals gene territories in live yeast.

    Science.gov (United States)

    Berger, Axel B; Cabal, Ghislain G; Fabre, Emmanuelle; Duong, Tarn; Buc, Henri; Nehrbass, Ulf; Olivo-Marin, Jean-Christophe; Gadal, Olivier; Zimmer, Christophe

    2008-12-01

    The nonrandom positioning of genes inside eukaryotic cell nuclei is implicated in central nuclear functions. However, the spatial organization of the genome remains largely uncharted, owing to limited resolution of optical microscopy, paucity of nuclear landmarks and moderate cell sampling. We developed a computational imaging approach that creates high-resolution probabilistic maps of subnuclear domains occupied by individual loci in budding yeast through automated analysis of thousands of living cells. After validation, we applied the technique to genes involved in galactose metabolism and ribosome biogenesis. We found that genomic loci are confined to 'gene territories' much smaller than the nucleus, which can be remodeled during transcriptional activation, and that the nucleolus is an important landmark for gene positioning. The technique can be used to visualize and quantify territory positions relative to each other and to nuclear landmarks, and should advance studies of nuclear architecture and function. PMID:18978785

  13. The Genomic Landscape of Position Effects on Protein Expression Level and Noise in Yeast.

    Science.gov (United States)

    Chen, Xiaoshu; Zhang, Jianzhi

    2016-05-25

    Position effect, the influence of the chromosomal location of a gene on its activity, is a fundamental property of the genome. By placing a GFP gene cassette at 482 different locations across all chromosomes in budding yeast, we quantified the position effects on protein expression level and noise at the genomic scale. The position effects are significant, altering the mean protein expression level by up to 15 times and expression noise by up to 20 times. DNA replication timing, 3D chromosomal conformation, and several histone modifications are major covariates of position effects. Essential genes are enriched in genomic regions with inherently low expression noise, supporting the hypothesis that chromosomal clustering of essential genes results from selection against their expressional stochasticity. Position effects exhibit significant interactions with promoters. Together, our results suggest that position effects have shaped the evolution of chromosome organization and should inform future genome engineering efforts. PMID:27185547

  14. The Yeast Cyclin-Dependent Kinase Routes Carbon Fluxes to Fuel Cell Cycle Progression.

    Science.gov (United States)

    Ewald, Jennifer C; Kuehne, Andreas; Zamboni, Nicola; Skotheim, Jan M

    2016-05-19

    Cell division entails a sequence of processes whose specific demands for biosynthetic precursors and energy place dynamic requirements on metabolism. However, little is known about how metabolic fluxes are coordinated with the cell division cycle. Here, we examine budding yeast to show that more than half of all measured metabolites change significantly through the cell division cycle. Cell cycle-dependent changes in central carbon metabolism are controlled by the cyclin-dependent kinase (Cdk1), a major cell cycle regulator, and the metabolic regulator protein kinase A. At the G1/S transition, Cdk1 phosphorylates and activates the enzyme Nth1, which funnels the storage carbohydrate trehalose into central carbon metabolism. Trehalose utilization fuels anabolic processes required to reliably complete cell division. Thus, the cell cycle entrains carbon metabolism to fuel biosynthesis. Because the oscillation of Cdk activity is a conserved feature of the eukaryotic cell cycle, we anticipate its frequent use in dynamically regulating metabolism for efficient proliferation. PMID:27203178

  15. A new design intended to relate high pressure treatment to yeast cell mass transfer.

    Science.gov (United States)

    Perrier-Cornet, J M; Maréchal, P A; Gervais, P

    1995-07-15

    A new optical device has been developed to allow the observation of microorganisms during a high pressure treatment up to 700 MPa. To measure cell volume variation during the high pressure application, an image analysis system was connected with the light microscope. With this device, growth of Saccharomyces cerevisiae was studied at moderate pressure (10 MPa) through the observation of individual cell budding. Cell volume variations were also measured on the yeast Saccharomycopsis fibuligera on fixed cells as well on a population sample and a shrinkage in average cell volume was observed consequently to a pressure increase of 250 MPa. The observed compression rate (25%) under pressure and the partial irreversibility of cell compression (10%) after return to atmospheric pressure lead to the conclusion that a mass transfer between cell and cultivation medium occurred. The causes of this transfer could be explained by a modification of membrane properties, i.e., disruption or increase in permeability. PMID:7640002

  16. A tetraploid intermediate precedes aneuploid formation in yeasts exposed to fluconazole.

    Directory of Open Access Journals (Sweden)

    Benjamin D Harrison

    2014-03-01

    Full Text Available Candida albicans, the most prevalent human fungal pathogen, is generally diploid. However, 50% of isolates that are resistant to fluconazole (FLC, the most widely used antifungal, are aneuploid and some aneuploidies can confer FLC resistance. To ask if FLC exposure causes or only selects for aneuploidy, we analyzed diploid strains during exposure to FLC using flow cytometry and epifluorescence microscopy. FLC exposure caused a consistent deviation from normal cell cycle regulation: nuclear and spindle cycles initiated prior to bud emergence, leading to "trimeras," three connected cells composed of a mother, daughter, and granddaughter bud. Initially binucleate, trimeras underwent coordinated nuclear division yielding four daughter nuclei, two of which underwent mitotic collapse to form a tetraploid cell with extra spindle components. In subsequent cell cycles, the abnormal number of spindles resulted in unequal DNA segregation and viable aneuploid progeny. The process of aneuploid formation in C. albicans is highly reminiscent of early stages in human tumorigenesis in that aneuploidy arises through a tetraploid intermediate and subsequent unequal DNA segregation driven by multiple spindles coupled with a subsequent selective advantage conferred by at least some aneuploidies during growth under stress. Finally, trimera formation was detected in response to other azole antifungals, in related Candida species, and in an in vivo model for Candida infection, suggesting that aneuploids arise due to azole treatment of several pathogenic yeasts and that this can occur during the infection process.

  17. Eavesdropping on the cytoskeleton: progress and controversy in the yeast morphogenesis checkpoint.

    Science.gov (United States)

    Keaton, Mignon A; Lew, Daniel J

    2006-12-01

    The morphogenesis checkpoint provides a link between bud formation and mitosis in yeast. In this pathway, insults affecting the actin or septin cytoskeleton trigger a cell cycle arrest, mediated by the Wee1 homolog Swe1p, which catalyzes the inhibitory phosphorylation of the mitosis-promoting cyclin-dependent kinase (CDK) on a conserved tyrosine residue. Analyses of Swe1p phosphorylation have mapped 61 sites targeted by CDKs and Polo-related kinases, which control both Swe1p activity and Swe1p degradation. Although the sites themselves are not evolutionarily conserved, the control of Swe1p degradation exhibits many conserved features, and is linked to DNA-responsive checkpoints in vertebrate cells. At the 'sensing' end of the checkpoint, recent work has begun to shed light on how septins are organized and how they impact Swe1p regulators. However, the means by which Swe1p responds to actin perturbations once a bud has formed remains controversial. PMID:17055334

  18. Histone H3K36 trimethylation is essential for multiple silencing mechanisms in fission yeast.

    Science.gov (United States)

    Suzuki, Shota; Kato, Hiroaki; Suzuki, Yutaka; Chikashige, Yuji; Hiraoka, Yasushi; Kimura, Hiroshi; Nagao, Koji; Obuse, Chikashi; Takahata, Shinya; Murakami, Yota

    2016-05-19

    In budding yeast, Set2 catalyzes di- and trimethylation of H3K36 (H3K36me2 and H3K36me3) via an interaction between its Set2-Rpb1 interaction (SRI) domain and C-terminal repeats of RNA polymerase II (Pol2) phosphorylated at Ser2 and Ser5 (CTD-S2,5-P). H3K36me2 is sufficient for recruitment of the Rpd3S histone deacetylase complex to repress cryptic transcription from transcribed regions. In fission yeast, Set2 is also responsible for H3K36 methylation, which represses a subset of RNAs including heterochromatic and subtelomeric RNAs, at least in part via recruitment of Clr6 complex II, a homolog of Rpd3S. Here, we show that CTD-S2P-dependent interaction of fission yeast Set2 with Pol2 via the SRI domain is required for formation of H3K36me3, but not H3K36me2. H3K36me3 silenced heterochromatic and subtelomeric transcripts mainly through post-transcriptional and transcriptional mechanisms, respectively, whereas H3K36me2 was not enough for silencing. Clr6 complex II appeared not to be responsible for heterochromatic silencing by H3K36me3. Our results demonstrate that H3K36 methylation has multiple outputs in fission yeast; these findings provide insights into the distinct roles of H3K36 methylation in metazoans, which have different enzymes for synthesis of H3K36me1/2 and H3K36me3. PMID:26792892

  19. Multicopy suppressors of temperature-sensitive mutations of yeast mRNA capping enzyme.

    Science.gov (United States)

    Schwer, B; Shuman, S

    1996-01-01

    We have isolated three Saccharomyces cerevisiae genes-CES1, CES2, and CES3-- that, when present in high copy, suppress the ts growth defect caused by mutations in the CEG1 gene encoding mRNA guanylyltransferase (capping enzyme). Molecular characterization of the capping enzyme suppressor genes reveals the following. CES2 is identical to ESP1, a gene required for proper nuclear division. We show by deletion analysis that the 1573-amino acid ESP1 polypeptide is composed of distinct functional domains. The C-terminal portion of ESP1 is essential for cell growth, but dispensable for CES2 activity. The N-terminal half of ESP1, which is sufficient for CES2 function, displays local sequence similarity to the small subunit of the vaccinia virus RNA capping enzyme. This suggests a basis for suppression by physical or functional interaction between the CES2 domain of ESP1 and the yeast guanylyltransferase. CES1 encodes a novel hydrophilic 915-amino acid protein. The amino acid sequence of CES1 is uninformative, except for its extensive similarity to another yeast gene product of unknown function. The CES1 homologue (designated CES4) is also a multicopy suppressor of capping enzyme ts mutations. Neither CES1 nor CES4 is essential for cell growth, and a double deletion mutant is viable. CES3 corresponds to BUD5, which encodes a putative guanine nucleotide exchange factor. We hypothesize that CES1, CES4, and BUD5 may impact on RNA transactions downstream of cap synthesis that are cap dependent in vivo. PMID:8836740

  20. Mycotoxins - prevention and decontamination by yeasts.

    Science.gov (United States)

    Pfliegler, Walter P; Pusztahelyi, Tünde; Pócsi, István

    2015-07-01

    The application of yeasts has great potential in reducing the economic damage caused by toxigenic fungi in the agriculture. Some yeasts may act as biocontrol agents inhibiting the growth of filamentous fungi. These species may also gain importance in the preservation of agricultural products and in the reduction of their mycotoxin contamination, yet the extent of mycotoxin production in the presence of biocontrol agents is relatively less understood. The application of yeasts in various technological processes may have a direct inhibitory effect on the toxin production of certain molds, which is independent of their growth suppressing effect. Furthermore, several yeast species are capable of accumulating mycotoxins from agricultural products, thereby effectively decontaminating them. Probiotic yeasts or products containing yeast cell wall are also applied to counteract mycotoxicosis in livestock. Several yeast strains are also able to degrade toxins to less-toxic or even non-toxic substances. This intensively researched field would greatly benefit from a deeper knowledge on the genetic and molecular basis of toxin degradation. Moreover, yeasts and their biotechnologically important enzymes may exhibit sensitivity to certain mycotoxins, thereby mounting a considerable problem for the biotechnological industry. It is noted that yeasts are generally regarded as safe; however, there are reports of toxin degrading species that may cause human fungal infections. The aspects of yeast-mycotoxin relations with a brief consideration of strain improvement strategies and genetic modification for improved detoxifying properties and/or mycotoxin resistance are reviewed here. PMID:25682759

  1. Combinatorial pathway assembly in yeast

    Directory of Open Access Journals (Sweden)

    Khalil Essani

    2015-10-01

    Full Text Available With the emergence of synthetic biology and the vast knowledge about individual biocatalytic reactions, the challenge nowadays is to implement whole natural or synthetic pathways into microorganisms. For this purpose balanced enzyme activities throughout the pathway need to be achieved in addition to simple functional gene expression to avoid bottlenecks and to obtain high titers of the desired product. As the optimization of pathways in a specific biological context is often hard to achieve by rational design, combinatorial approaches have been developed to address this issue. Here, current strategies and proof of concepts for combinatorial pathway assembly in yeasts are reviewed. By exploiting its ability to join multiple DNA fragments in a very efficient and easy manner, the yeast Saccharomyces cerevisiae does not only constitute an attractive host for heterologous pathway expression, but also for assembling pathways by recombination in vivo.

  2. Greenhouse irrigation water depths in relation to rose stem and bud qualities

    Directory of Open Access Journals (Sweden)

    Folegatti Marcos Vinícius

    2001-01-01

    Full Text Available The cultivation of roses occupies a special place in the flower production of Brazil, the concern with the quality of the buds being intimately related with the appropriate supply of water and nutrients to the plant. With the objective of evaluating stem and bud quality the rose variety 'Osiana' was cultivated in a greenhouse using different irrigation water depths based on fractions of pan evaporation (0.25, 0.50, 0.75, 1.00 and 1.25. The experimental design consisted of total randomized blocks with five replications and five treatments. There is a linear tendency of increasing the length and diameter of the stems and the length and diameter of the buds with increasing irrigation water depths.

  3. Progress and renewal in gustation: new insights into taste bud development.

    Science.gov (United States)

    Barlow, Linda A

    2015-11-01

    The sense of taste, or gustation, is mediated by taste buds, which are housed in specialized taste papillae found in a stereotyped pattern on the surface of the tongue. Each bud, regardless of its location, is a collection of ∼100 cells that belong to at least five different functional classes, which transduce sweet, bitter, salt, sour and umami (the taste of glutamate) signals. Taste receptor cells harbor functional similarities to neurons but, like epithelial cells, are rapidly and continuously renewed throughout adult life. Here, I review recent advances in our understanding of how the pattern of taste buds is established in embryos and discuss the cellular and molecular mechanisms governing taste cell turnover. I also highlight how these findings aid our understanding of how and why many cancer therapies result in taste dysfunction. PMID:26534983

  4. Nuclear Import of Yeast Proteasomes

    Directory of Open Access Journals (Sweden)

    Julianne Burcoglu

    2015-08-01

    Full Text Available Proteasomes are highly conserved protease complexes responsible for the degradation of aberrant and short-lived proteins. In highly proliferating yeast and mammalian cells, proteasomes are predominantly nuclear. During quiescence and cell cycle arrest, proteasomes accumulate in granules in close proximity to the nuclear envelope/ER. With prolonged quiescence in yeast, these proteasome granules pinch off as membraneless organelles, and migrate as stable entities through the cytoplasm. Upon exit from quiescence, the proteasome granules clear and the proteasomes are rapidly transported into the nucleus, a process reflecting the dynamic nature of these multisubunit complexes. Due to the scarcity of studies on the nuclear transport of mammalian proteasomes, we summarised the current knowledge on the nuclear import of yeast proteasomes. This pathway uses canonical nuclear localisation signals within proteasomal subunits and Srp1/Kap95, and the canonical import receptor, named importin/karyopherin αβ. Blm10, a conserved 240 kDa protein, which is structurally related to Kap95, provides an alternative import pathway. Two models exist upon which either inactive precursor complexes or active holo-enzymes serve as the import cargo. Here, we reconcile both models and suggest that the import of inactive precursor complexes predominates in dividing cells, while the import of mature enzymes mainly occurs upon exit from quiescence.

  5. Yeast: A new oil producer?

    Directory of Open Access Journals (Sweden)

    Beopoulos Athanasios

    2012-01-01

    Full Text Available The increasing demand of plant oils or animal fat for biodiesel and specific lipid derivatives for the oleochemical field (such as lubricants, adhesives or plastics have created price imbalance in both the alimentary and energy field. Moreover, the lack of non-edible oil feedstock has given rise to concerns on land-use practices and on oil production strategies. Recently, much attention has been paid to the exploitation of microbial oils. Most of them present lipid profiles similar in type and composition to plants and could therefore have many advantages as are no competitive with food, have short process cycles and their cultivation is independent of climate factors. Among microorganisms, yeasts seem to be very promising as they can be easily genetically enhanced, are suitable for large-scale fermentation and are devoid of endotoxins. This review will focus on the recent understanding of yeasts lipid metabolism, the succeeding genetic engineering of the lipid pathways and the recent developments on fermentation techniques that pointed out yeasts as promising alternative producers for oil or plastic.

  6. Bud flush phenology and nursery carryover effect of paper birch provenances

    Directory of Open Access Journals (Sweden)

    Dhar A

    2015-12-01

    Full Text Available Paper birch (Betula papyrifera Marsh is an ecologically valuable species with a broad geographic distribution across the North America. Its diversity, versatility and enduring nature make it an ideal candidate for a selective breeding program in this region. However, an understanding of the genecology of this species is fundamental to deploy it successfully. Ten paper birch provenances were collected from British Columbia (BC, Canada and northern Idaho (USA along elevational transects to determine whether observed bud flush phenology was due to genetics and /or environmental variation or their interaction. Seedlings were grown at three different nurseries: University of Idaho (46°44’N, Landing (50°17’N and Little Forestry (54°00’N and planted in a randomized single tree interlocking block design in three common gardens at Sandpoint, ID (48°13’N, Skimikin, BC (50°45’N and Red Rock, BC (53°45’N. Results indicate that variation in the timing of bud flush is a complex interaction among local genetic characteristics and environmental conditions of the growing site. Birch bud flush followed a general geographic trend where provenances at the southern common garden (Sandpoint required less time (Day of Year, DoY and fewer growing degree days (GDD compared to central (Skimikin and northern (Red Rock common gardens. Although there were significant differences in the timing of bud flush among provenances along an elevational gradient, none of the regions showed the expected linear elevational cline, trends were inconsistent. Further, birch bud flush was significantly influenced by nursery displacement effects in the initial year of establishment but disappeared within three years. These results provide an opportunity to characterize bud flush phenology of paper birch and would be useful for improving operational paper birch seed transfer programs in BC.

  7. 6-benzyladenine metabolism during reinvigoration of mature Pinus radiata buds in vitro.

    Science.gov (United States)

    Zhang, Huaibi; Horgan, Kathryn J; Reynolds, Paul H S; Jameson, Paula E

    2010-04-01

    Maturation or phase change is a serious challenge in the deployment of superior trees of Pinus radiata D. Don because of the difficulties associated with propagation of cuttings from mature trees. We used an in vitro system to study 6-benzyladenine (BA)-induced reinvigoration of the fascicle meristems of mature buds during in vitro culture. Anatomical examinations revealed that BA inhibited the development of secondary needle primordia and 'rejuvenated' the fascicle meristems of the mature bud to produce primary needles, which are characteristic of the juvenile phase in P. radiata. Without BA supplement in the culture media, fascicle primordia continued developing secondary needles and quiescent fascicle meristems. BA metabolite analysis showed that the novel cytokinin pathway reported previously in P. radiata (H. Zhang, K.J. Horgan, P.H.S. Reynolds, G.E. Norris and P.E. Jameson. 2001. Novel cytokinins: The predominant forms in mature buds of Pinus radiata. Physiol. Plant. 112: 127-134) was mirrored in vitro, with BA converted into a variety of metabolites including 6-benzylamino-9-glucopyranosylribosyl-purine and its novel phosphorylated form, 6-benzylamino-9-glucopyranosylribosyl-purine. The culture of mature buds in the presence of BA caused a reduction in the level of endogenous cytokinins, suggesting a direct action of BA itself. Similar correlations are noted between levels of certain metabolites and the maturation status of buds from field-grown trees and buds in culture, indicating that this in vitro system may be a good model for studying the processes of maturation and reinvigoration. PMID:20144924

  8. Lamin Mutations Accelerate Aging via Defective Export of Mitochondrial mRNAs through Nuclear Envelope Budding.

    Science.gov (United States)

    Li, Yihang; Hassinger, Linda; Thomson, Travis; Ding, Baojin; Ashley, James; Hassinger, William; Budnik, Vivian

    2016-08-01

    Defective RNA metabolism and transport are implicated in aging and degeneration [1, 2], but the underlying mechanisms remain poorly understood. A prevalent feature of aging is mitochondrial deterioration [3]. Here, we link a novel mechanism for RNA export through nuclear envelope (NE) budding [4, 5] that requires A-type lamin, an inner nuclear membrane-associated protein, to accelerated aging observed in Drosophila LaminC (LamC) mutations. These LamC mutations were modeled after A-lamin (LMNA) mutations causing progeroid syndromes (PSs) in humans. We identified mitochondrial assembly regulatory factor (Marf), a mitochondrial fusion factor (mitofusin), as well as other transcripts required for mitochondrial integrity and function, in a screen for RNAs that exit the nucleus through NE budding. PS-modeled LamC mutations induced premature aging in adult flight muscles, including decreased levels of specific mitochondrial protein transcripts (RNA) and progressive mitochondrial degradation. PS-modeled LamC mutations also induced the accelerated appearance of other phenotypes associated with aging, including a progressive accumulation of polyubiquitin aggregates [6, 7] and myofibril disorganization [8, 9]. Consistent with these observations, the mutants had progressive jumping and flight defects. Downregulating marf alone induced the above aging defects. Nevertheless, restoring marf was insufficient for rescuing the aging phenotypes in PS-modeled LamC mutations, as other mitochondrial RNAs are affected by inhibition of NE budding. Analysis of NE budding in dominant and recessive PS-modeled LamC mutations suggests a mechanism by which abnormal lamina organization prevents the egress of these RNAs via NE budding. These studies connect defects in RNA export through NE budding to progressive loss of mitochondrial integrity and premature aging. PMID:27451905

  9. Pickling process of capers (Capparis spp.) flower buds

    OpenAIRE

    Özcan, Musa; Akgül, Attila

    1999-01-01

    Middle sized (8 < x < 13 mm) buds of Capparis spinosa var. spinosa and C. ovata var. canescens from June in brines containing 5,10,15 and 20% salt and from August in brines of 15% salt, and three different size (x < 8 mm, 8 < x < 13 mm, x > 13 mm) buds of C. . ovata var. canescens from June in brines of 15% salt were pickled for two months fermentation. Some chem...

  10. Chemical composition and content of essential oil from the bud of cultivated Turkish clove

    Directory of Open Access Journals (Sweden)

    Kollmannsberger, H.

    2007-05-01

    Full Text Available In this study, clove bud oil, which was cultivated in the Mediterranean region of Turkey, was provided from a private essential oil company in Turkey. Essential oil from clove (Syzygium aromaticum L. was obtained from steam-distillation method, and its chemical composition was analyzed by GC and GC-MS. The results showed that the essential oils mainly contained about 87.00% eugenol, 8.01% eugenyl acetate and 3.56% β-Caryophyllene. The chemical composition of the Turkish clove bud oil was comparable to those of trees naturally grown in their native regions.

  11. Chemical composition and content of essential oil from the bud of cultivated Turkish clove

    OpenAIRE

    Kollmannsberger, H.; Nitz, S.; Ertaş, M.; Alma, M. H.

    2007-01-01

    In this study, clove bud oil, which was cultivated in the Mediterranean region of Turkey, was provided from a private essential oil company in Turkey. Essential oil from clove (Syzygium aromaticum L.) was obtained from steam-distillation method, and its chemical composition was analyzed by GC and GC-MS. The results showed that the essential oils mainly contained about 87.00% eugenol, 8.01% eugenyl acetate and 3.56% β-Caryophyllene. The chemical composition of the Turkish clove bud oil was com...

  12. Project BudBurst - Meeting the Needs of Climate Change Educators and Scientists

    Science.gov (United States)

    Henderson, S.

    2015-12-01

    It is challenging for many to get a sense of what climate change means as long periods of time are involved - like decades - which can be difficult to grasp. However, there are a number of citizen science based projects, including NEON's Project BudBurst, that provide the opportunity for both learning about climate change and advancing scientific knowledge. In this presentation, we will share lessons learned from Project BudBurst. Project BudBurst is a national citizen science initiative designed to engage the public in observations of phenological (plant life cycle) events and to increase climate literacy. Project BudBurst is important from an educational perspective, but also because it enables scientists to broaden the geographic and temporal scale of their observations. The goals of Project BudBurst are to 1) increase awareness of phenology as an area of scientific study; 2) Increase awareness of the impacts of changing climates on plants at a continental-scale; and 3) increase science literacy by engaging participants in the scientific process. It was important to better understand if and how Project BudBurst is meeting its goals. Specifically, does participation by non-experts advance scientific knowledge? Does participation advance educational goals and outcomes? Is participation an effective approach to advance/enhance science education in both formal and informal settings? Critical examination of Project BudBurst supports advancement of scientific knowledge and realization of educational objectives. Citizen science collected observations and measurements are being used by scientists as evidenced by the increase of such data in scientific publication. In addition, we found that there is a significant increase in educators utilizing citizen science as part of their instruction. Part of this increase is due to the resources and professional development materials available to educators. Working with partners also demonstrated that the needs of both science and

  13. Megasporocyte formation in Pisum sativum L. against the back ground of bud development

    Directory of Open Access Journals (Sweden)

    Wanda Wojciechowska

    2014-02-01

    Full Text Available Megasporocyte formation in Pisum sativum L. takes place at the stages of bud development, when the vexillum surpasses the lower androecium whorl slightly at the beginning, and markedly in further stages. Under the epidermis of an ovule, a multicellular archesporium is formed. Mitotic division of these cells gives rise to a two-layered parietal tissue and to a group of megaspore mother cells (MMCs. The tetrad is formed from one megasporocyte. In the bud development of Pisum sativum the carpel walls accrete to each other relatively early.

  14. Yeasts Diversity in Fermented Foods and Beverages

    Science.gov (United States)

    Tamang, Jyoti Prakash; Fleet, Graham H.

    People across the world have learnt to culture and use the essential microorganisms for production of fermented foods and alcoholic beverages. A fermented food is produced either spontaneously or by adding mixed/pure starter culture(s). Yeasts are among the essential functional microorganisms encountered in many fermented foods, and are commercially used in production of baker's yeast, breads, wine, beer, cheese, etc. In Asia, moulds are predominant followed by amylolytic and alcohol-producing yeasts in the fermentation processes, whereas in Africa, Europe, Australia and America, fermented products are prepared exclusively using bacteria or bacteria-yeasts mixed cultures. This chapter would focus on the varieties of fermented foods and alcoholic beverages produced by yeasts, their microbiology and role in food fermentation, widely used commercial starters (pilot production, molecular aspects), production technology of some common commercial fermented foods and alcoholic beverages, toxicity and food safety using yeasts cultures and socio-economy

  15. Yeast Interacting Proteins Database: YEL005C, YGL079W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available endosome; identified as a transcriptional activator in a high-throughput yeast one-hybrid assay Rows with th...protein localizes to the endosome; identified as a transcriptional activator in a high-throughput yeast one-

  16. Revaluation of Waste Yeast from Beer Production

    OpenAIRE

    Nicoleta Suruceanu; Sonia Socaci; Teodora Coldea; Elena Mudura

    2013-01-01

    Brewing yeast is an important waste product from beer production. The valorification of slurry yeast mainly consists of separation of vitamins and important nitrogen compounds. The hops compounds, one of the most important raw materials in beer technology are removed beforehand valorification. The prenylflavonoids compounds from hops are important bioactive compounds that can be revaluation with proper technology. Revaluation of prenylflavonoids from waste yeast into dietary supplement, ident...

  17. The Application of Enzyme and Yeast

    OpenAIRE

    Zhao, Qing

    2012-01-01

    This bachelor’s thesis concerns the application of enzymes and yeasts for bio-industry. The purpose of this work is to understand the basic knowledge about enzyme and yeast, and meanwhile, to find out their different applications. Through comprehensive study, the knowledge was accumulated which brought a clear understanding for the enzyme structure and yeast microorganism, together with their working principles for the bioprocess. For wood-based industry, the different enzymes used in bi...

  18. Yeast Interacting Proteins Database: YPL114W, YMR133W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available ely overlaps ORF YPL113C; diploid deletion in BY4743 strain background exhibits high budding index Rows with... a functional protein; largely overlaps ORF YPL113C; diploid deletion in BY4743 strain background exhibits h

  19. Culture Media Optimization through Response Surface Methodology for in vitro Shoot Bud Development of Solanum melongena L. for Micropropagation

    Directory of Open Access Journals (Sweden)

    Sila Bhattacharya

    2011-11-01

    Full Text Available Response surface methodology was used for the optimization of shoot bud response and shoot bud induction in leaf explants of Solanum melongena cultivar Arka Shirish. Three independent variables were evaluated for shoot bud response and shoot bud induction. The variables include the concentrations of nitrogen (N2, sucrose and growth regulator thidiazuron (TDZ. The shoot bud response for cultured explant was optimized at 4.34 g/l of total nitrogen, 2.65% of sucrose and 0.67 mg/l of TDZ with 95% response. The optimum medium conditions for shoot bud induction was found to be Murashige and Skoog (MS basal medium supplemented with 4.02 g/l of total nitrogen, 2.36% of sucrose and 1.0 mg/l of TDZ with 10 number of bud per explant. The shoot buds so formed were elongated in 0.5 mg/l 2,3,5-Triiodobenzoic acid (TIBA and 0.1 mg/l Gibberellic acid (GA3. The elongated shoots were rooted in MS with 1 mg/l Indole-3-butyric acid (IBA. The rooted plants were transferred to pots with farmyard manure upon hardening. This study has validation value for optimization of micropropagation protocol and is further useful in genetic transformation studies for Solanum melongena variety Arka Shirish to maximize regenerative response for automation.

  20. Drosophila Regulate Yeast Density and Increase Yeast Community Similarity in a Natural Substrate

    OpenAIRE

    Stamps, Judy A.; Yang, Louie H; Morales, Vanessa M.; Boundy-Mills, Kyria L.

    2012-01-01

    Drosophila melanogaster adults and larvae, but especially larvae, had profound effects on the densities and community structure of yeasts that developed in banana fruits. Pieces of fruit exposed to adult female flies previously fed fly-conditioned bananas developed higher yeast densities than pieces of the same fruits that were not exposed to flies, supporting previous suggestions that adult Drosophila vector yeasts to new substrates. However, larvae alone had dramatic effects on yeast densit...

  1. OPTIMIZATION OF YEAST FOR ETHANOL PRODUCTION

    Directory of Open Access Journals (Sweden)

    Taghizadeh Ghassem

    2012-02-01

    Full Text Available The production of pure ethanol apparently begins in the 12-14th century. Improvements in the distillation process with the condensation of vapors of lower boiling liquids. Ethanol is produced commercially by chemical synthesis or biosynthesis. High ethanol producing yeast exhibits rapid metabolic activity and a high fermentation rate with high product output in less time.Yeasts were isolated from Corn, Curd, Grapes, Water 1, Water 2, and Paneer. Isolation was done on MGYP (Malt Extract Glucose Yeast extract Peptone media. Contamination was less in selected media. Grape sample yeast was observed as high in producing ethanol after optimization in jaggery broth. Curd yeast gives 4.6% alcohol by volume alcohol (a.b.v after fermentation .Paneer yeast gives 2.88% alcohol by volume alcohol (a.b.v after fermentation. Corn yeast gives 5.25% (a.b.v alcohol after fermentation Water-1 yeast gives 5.51% (a.b.v alcohol after fermentation.Water-2 yeast gives 4.98% (a.b.v alcohol after fermentation.

  2. Construction of Killer Wine Yeast Strain

    OpenAIRE

    Seki, Tetsuji; Choi, Eon-Ho; Ryu, Dewey

    1985-01-01

    A double-stranded RNA plasmid which confers the superkiller phenotype was transferred into a wine yeast (Montrachet strain 522) and its leucine-requiring derivative (strain 694) by cytoduction, using the protoplast fusion technique. The killer wine yeast constructed completely suppressed the growth of killer-sensitive strains of Saccharomyces cerevisiae in yeast extract-peptone-glucose medium at pH 4.5, whereas the killer effect was somewhat decreased at pH 3.5. The wine yeast harboring the k...

  3. Molecular profiling of tumour budding implicates TGFβ-mediated epithelial–mesenchymal transition as a therapeutic target in oral squamous cell carcinoma

    DEFF Research Database (Denmark)

    Jensen, David Hebbelstrup; Dabelsteen, Erik; Specht, Lena;

    2015-01-01

    Although tumour budding is an adverse prognostic factor for many cancer types, the molecular mechanisms governing this phenomenon are incompletely understood. Therefore, understanding the molecular basis of tumour budding may provide new therapeutic and diagnostic options. We employ digital image...

  4. 糙米芽制备及其在红曲保健酒中的应用%Studies on the preparation of brown rice bud and its application in red starter health wine

    Institute of Scientific and Technical Information of China (English)

    杨霞; 肖连冬

    2012-01-01

    对糙米芽制备及其红曲保健酒的生产工艺条件进行研究.通过单因素及正交试验,确定糙米发芽、糙米芽汁制备及复合菌种发酵等过程的最佳工艺条件.结果表明,糙米芽制备适宜的工艺条件为25℃浸泡10 h、30℃下发芽24h;糙米芽汁制备中,采用70℃液化2h、55℃糖化2h所得糙米汁质量较高;酵母接种量为0.5%(m/V),红曲霉接种量为15% (V/V),在32℃下发酵5d,可得到色香味俱佳的糙米芽红曲保健酿造酒.%This paper inquire into production process conditions of brown rice germination and brown rice bud red starter health wine. Single factor experiment and orthogonal experiment were adopted to study brown rice germination, preparation of brown rice bud extract and fermentation by mixed strains. The experimental results showed that the optimum brown rice germination conditions were 25 ℃ soak 10 h and 30 ℃ germinate 24 h ; The optimum conditions of preparation of brown rice bud extract were 70 ℃ liquefying 2 h and 55 ℃ saccharification 2 h; when yeast inoculum quantity was 0.5% (m/V), monascus inoculation quantity was 15% (V/V) and 32 ℃ fermentation 5d , the red starter Health Wine which was coloury , refreshing . tasty, and nourishing was obtained.

  5. Transcriptome Profiling of Tiller Buds Provides New Insights into PhyB Regulation of Tillering and Indeterminate Growth in Sorghum.

    Science.gov (United States)

    Kebrom, Tesfamichael H; Mullet, John E

    2016-04-01

    Phytochrome B (phyB) enables plants to modify shoot branching or tillering in response to varying light intensities and ratios of red and far-red light caused by shading and neighbor proximity. Tillering is inhibited in sorghum genotypes that lack phytochrome B (58M, phyB-1) until after floral initiation. The growth of tiller buds in the first leaf axil of wild-type (100M, PHYB) and phyB-1 sorghum genotypes is similar until 6 d after planting when buds of phyB-1 arrest growth, while wild-type buds continue growing and develop into tillers. Transcriptome analysis at this early stage of bud development identified numerous genes that were up to 50-fold differentially expressed in wild-type/phyB-1 buds. Up-regulation of terminal flower1, GA2oxidase, and TPPI could protect axillary meristems in phyB-1 from precocious floral induction and decrease bud sensitivity to sugar signals. After bud growth arrest in phyB-1, expression of dormancy-associated genes such as DRM1, GT1, AF1, and CKX1 increased and ENOD93, ACCoxidase, ARR3/6/9, CGA1, and SHY2 decreased. Continued bud outgrowth in wild-type was correlated with increased expression of genes encoding a SWEET transporter and cell wall invertases. The SWEET transporter may facilitate Suc unloading from the phloem to the apoplast where cell wall invertases generate monosaccharides for uptake and utilization to sustain bud outgrowth. Elevated expression of these genes was correlated with higher levels of cytokinin/sugar signaling in growing buds of wild-type plants. PMID:26893475

  6. A novel minimal in vitro system for analyzing HIV-1 Gag mediated budding

    CERN Document Server

    Gui, Dong; Xu, Jun; Zandi, Roya; Gill, Sarjeet; Huang, I-Chueh; Rao, A L N; Mohideen, Umar

    2013-01-01

    A biomimetic minimalist model membrane is used to study the mechanism and kinetics of the in vitro HIV-1 Gag budding from a giant unilamellar vesicle (GUV). The real time interaction of the Gag, RNA and lipid leading to the formation of minivesicles is measured in real time using confocal microscopy. The Gag is found to lead to resolution limited punctae on the lipid membranes of the GUV. The introduction of the Gag to a GUV solution containing RNA led to the budding of minivesicles on the inside surface of the GUV. The diameter of the GUV decreased due to the bud formation. The corresponding rate of decrease of the GUV diameter was found to be linear in time. The bud formation and the decrease in GUV size were found to be proportional to the Gag concentration. The method is promising and will allow the systematic study of the dynamics of assembly of immature HIV and help classify the hierarchy of factors that impact the Gag protein initiated assembly of retroviruses such as HIV. The GUV system might also be ...

  7. Buds of Parenting in Emerging Adult Males: What We Learned from Our Parents

    Science.gov (United States)

    Scharf, Miri; Mayseless, Ofra

    2011-01-01

    The authors examine the precursors of parenting buds (representations regarding parenting before actual parenting) by following 60 men from adolescence to emerging adulthood. Quality of relationships with parents, and attachment representations (state of mind with respect to attachment and attachment styles) assessed in adolescence, contribute to…

  8. Effect of floral bud reduction on flower longevity in Asiatic hybrids lilies.

    NARCIS (Netherlands)

    Meulen-Muisers, van der J.J.M.; Oeveren, van J.C.; Sandbrink, J.M.; Tuyl, van J.M.

    1995-01-01

    Floral bud abortion was found to be an undesirable source of non-genetic variation in breeding trials directed on the improvement of individual flower longevity in Asiatic hybrid lilies. It increased the longevity of the remaining flowers of the inflorescence. A similar response was found after elim

  9. Perception of photoperiod in individual buds of mature trees regulates leaf-out.

    Science.gov (United States)

    Zohner, Constantin M; Renner, Susanne S

    2015-12-01

    Experimental data on the perception of day length and temperature in dormant temperate zone trees are surprisingly scarce. In order to investigate when and where these environmental signals are perceived, we carried out bagging experiments in which buds on branches of Fagus sylvatica, Aesculus hippocastanum and Picea abies trees were exposed to natural light increase or kept at constant 8-h days from December until June. Parallel experiments used twigs cut from the same trees, harvesting treated and control twigs seven times and then exposing them to 8- or 16-h days in a glasshouse. Under 8-h days, budburst in Fagus outdoors was delayed by 41 d and in Aesculus by 4 d; in Picea, day length had no effect. Buds on nearby branches reacted autonomously, and leaf primordia only reacted to light cues in late dormancy after accumulating warm days. Experiments applying different wavelength spectra and high-resolution spectrometry to buds indicate a phytochrome-mediated photoperiod control. By demonstrating local photoperiodic control of buds, revealing the time when these signals are perceived, and showing the interplay between photoperiod and chilling, this study contributes to improved modelling of the impact of climate warming on photosensitive species. PMID:26096967

  10. Gall mite inspection on dormant black currant buds using machine vision

    DEFF Research Database (Denmark)

    Nielsen, M. R.; Stigaard Laursen, Morten; Jonassen, M. S.;

    2013-01-01

    This paper presents a novel machine vision-based approach detecting and mapping gall mite infection in dormant buds on black currant bushes. A vehicle was fitted with four cameras and RTK-GPS. Results compared automatic detection to human decisions based on the images, and by mapping the results ...

  11. DNA methylation/demethylation programming during peach flower bud dormancy release, development and blooming

    Science.gov (United States)

    Peach flower bud development undergoes a long, complex and temperature-dependent regulation process with cessation of growth in response to cool temperatures in late fall, a slow but gradual development during the chilling period in winter, and eventually blooming in early spring. It has been demon...

  12. Visualization of Assembly Intermediates and Budding Vacuoles of Singapore Grouper Iridovirus in Grouper Embryonic Cells

    Science.gov (United States)

    Liu, Yang; Tran, Bich Ngoc; Wang, Fan; Ounjai, Puey; Wu, Jinlu; Hew, Choy L.

    2016-01-01

    Iridovirid infection is associated with the catastrophic loss in aquaculture industry and the population decline of wild amphibians and reptiles, but none of the iridovirid life cycles have been well explored. Here, we report the detailed visualization of the life cycle of Singapore grouper iridovirus (SGIV) in grouper cells by cryo-electron microscopy (cryoEM) and tomography (ET). EM imaging revealed that SGIV viral particles have an outer capsid layer, and the interaction of this layer with cellular plasma membrane initiates viral entry. Subsequent viral replication leads to formation of a viral assembly site (VAS), where membranous structures emerge as precursors to recruit capsid proteins to form an intermediate, double-shell, crescent-shaped structure, which curves to form icosahedral capsids. Knockdown of the major capsid protein eliminates the formation of viral capsids. As capsid formation progresses, electron-dense materials known to be involved in DNA encapsidation accumulate within the capsid until it is fully occupied. Besides the well-known budding mechanism through the cell periphery, we demonstrate a novel budding process in which viral particles bud into a tubular-like structure within vacuoles. This budding process may denote a new strategy used by SGIV to disseminate viral particles into neighbor cells while evading host immune response. PMID:26727547

  13. Viral and cellular requirements for the budding of Feline Endogenous Retrovirus RD-114

    Directory of Open Access Journals (Sweden)

    Fukuma Aiko

    2011-12-01

    Full Text Available Abstract Background RD-114 virus is a feline endogenous retrovirus and produced as infectious viruses in some feline cell lines. Recently, we reported the contamination of an infectious RD-114 virus in a proportion of live attenuated vaccines for dogs and cats. It is very difficult to completely knock out the RD-114 proviruses from cells, as endogenous retroviruses are usually integrated multiply into the host genome. However, it may be possible to reduce the risk of contamination of RD-114 virus by regulating the viral release from cells. Results In this study, to understand the molecular mechanism of RD-114 virus budding, we attempted to identify the viral and cellular requirements for RD-114 virus budding. Analyses of RD-114 L-domain mutants showed that the PPPY sequence in the pp15 region of Gag plays a critical role in RD-114 virus release as viral L-domain. Furthermore, we investigated the cellular factors required for RD-114 virus budding. We demonstrated that RD-114 virus release was inhibited by overexpression of dominant negative mutants of Vps4A, Vps4B, and WWP2. Conclusions These results strongly suggest that RD-114 budding utilizes the cellular multivesicular body sorting pathway similar to many other retroviruses.

  14. Potential Bud Bank Responses to Apical Meristem Damage and Environmental Variables: Matching or Complementing Axillary Meristems?

    Czech Academy of Sciences Publication Activity Database

    Klimešová, Jitka; Malíková, Lenka; Rosenthal, J.; Šmilauer, P.

    2014-01-01

    Roč. 9, č. 2 (2014), e88093. E-ISSN 1932-6203 R&D Projects: GA ČR GPP504/12/P540; GA ČR GA526/09/0963 Institutional support: RVO:67985939 Keywords : bud bank * axillary meristem * disturbance Subject RIV: EH - Ecology, Behaviour Impact factor: 3.234, year: 2014

  15. Mutation breeding in sweet potato with fast neutrons by inducing hypocotyl adventitious buds

    International Nuclear Information System (INIS)

    Hybrid sweet potato seeds were irradiated by fast neutrons. After the irradiation, adventitious buds were induced from the epidermal cells of the hypocotyls of the seedlings. The adventitious buds appeared from the hypocotyls 2 - 3 cm below the cotyledonary node. Detailed observations of cell division and tissue dissection showed that some adventitious buds emerged in 20 - 45 days after seedling emergence. Most of them originated from a single cell. These adventitious bud clones showed a wide mutation spectrum at high frequency, mostly non-chimeric. The mutant characters included the color of leaf, vine, vein, root-tuber skin and the leaf shape, yield, root-tuber dry matter rates, root-tuber numbers, sprouting, early tuber formation, resistance to black rot, root rot, nematodes etc. The results were confirmed in the field; the observed mutant characters were stable and non-chimeric. Such a method of inducing mutations is advantageous for the improvement of economic characters. Actually, there were examples of increasing the dry matter content of the tubers by 1.0 - 5.5%, the yield of tubers increased by 3.6 - 53.8%, and tubers per plant increased by 0.6 - 4.2%. The resistances to black rot, root rot, nematodes etc. were also improved. Three multiple resistance varieties Yanshu 568, Yanshu 571-1, 84-C-2 and two good quality varieties Yanshu 759 and 781 have been selected. (author). 9 refs, 3 tabs

  16. Destinace České Budějovice na trhu cestovního ruchu

    OpenAIRE

    DUŠEK, Pavel

    2013-01-01

    Main target of this bachelor thesis was to evaluate the primary and secondary destination offers of České Budějovice based on situational analysis, identification of competitive destinations and position in the market with tourism. At the same time establishing a competitive advantage of this destination and offering a way of enforcing.

  17. CLO-PLA: the database of clonal and bud bank traits of Central European flora

    Czech Academy of Sciences Publication Activity Database

    Klimešová, Jitka; de Bello, F.

    2009-01-01

    Roč. 20, č. 3 (2009), s. 511-516. ISSN 1100-9233 R&D Projects: GA ČR(CZ) GA526/06/0723 Institutional research pla n: CEZ:AV0Z60050516 Keywords : bud bank * clonal traits * database Subject RIV: EF - Botanics Impact factor: 2.376, year: 2009

  18. YMDB: the Yeast Metabolome Database.

    Science.gov (United States)

    Jewison, Timothy; Knox, Craig; Neveu, Vanessa; Djoumbou, Yannick; Guo, An Chi; Lee, Jacqueline; Liu, Philip; Mandal, Rupasri; Krishnamurthy, Ram; Sinelnikov, Igor; Wilson, Michael; Wishart, David S

    2012-01-01

    The Yeast Metabolome Database (YMDB, http://www.ymdb.ca) is a richly annotated 'metabolomic' database containing detailed information about the metabolome of Saccharomyces cerevisiae. Modeled closely after the Human Metabolome Database, the YMDB contains >2000 metabolites with links to 995 different genes/proteins, including enzymes and transporters. The information in YMDB has been gathered from hundreds of books, journal articles and electronic databases. In addition to its comprehensive literature-derived data, the YMDB also contains an extensive collection of experimental intracellular and extracellular metabolite concentration data compiled from detailed Mass Spectrometry (MS) and Nuclear Magnetic Resonance (NMR) metabolomic analyses performed in our lab. This is further supplemented with thousands of NMR and MS spectra collected on pure, reference yeast metabolites. Each metabolite entry in the YMDB contains an average of 80 separate data fields including comprehensive compound description, names and synonyms, structural information, physico-chemical data, reference NMR and MS spectra, intracellular/extracellular concentrations, growth conditions and substrates, pathway information, enzyme data, gene/protein sequence data, as well as numerous hyperlinks to images, references and other public databases. Extensive searching, relational querying and data browsing tools are also provided that support text, chemical structure, spectral, molecular weight and gene/protein sequence queries. Because of S. cervesiae's importance as a model organism for biologists and as a biofactory for industry, we believe this kind of database could have considerable appeal not only to metabolomics researchers, but also to yeast biologists, systems biologists, the industrial fermentation industry, as well as the beer, wine and spirit industry. PMID:22064855

  19. Dehydration improves cryopreservation of mat rush (Juncus decipiens Nakai) basal stem buds on cryo-plates.

    Science.gov (United States)

    Niino, T; Yamamoto, S I; Fukui, K; Castillo Martinez, C R; Arizaga, M V; Matsumoto, T; Engelmann, F

    2013-01-01

    Two cryopreservation procedures using aluminium cryo-plates, termed V-Cryo-plate and D-Cryo-plate, were successfully developed for in vitro mat rush (Juncus decipiens Nakai) basal stem buds. Multiple stems induced in liquid MS medium containing 8.9 μM BA by roller culture were cut into small clumps, plated on solid MS medium and cultured for 1 week at 25 degree C. Clumps that had produced many buds were cold-hardened at 5 degree C for 1-2 months. The buds with basal stems were dissected from small clumps and precultured overnight at 25 degree C on solid MS medium containing 0.3 M sucrose. Precultured buds were placed on aluminium cryo-plates and embedded in calcium alginate gel. Osmoprotection was performed by immersing the cryo-plates for 30 min at 25 degree C in loading solution (2 M glycerol + 1.0 M sucrose). In the D-Cryo-plate procedure, the buds were dehydrated to 27-25% moisture content (fresh weight) by placing the cryo-plates in the air current of a laminar flow cabinet for 2 to 3 h. In the V-Cryo-plate procedure, buds were dehydrated by immersing the cryo-plates in PVS2 vitrification solution for 40 min at 25 degree C. In both procedures, cooling was performed by placing the cryo-plates in uncapped cryotubes, which were immersed in liquid nitrogen. For rewarming, cryo-plates were immersed in medium with 1.0 M sucrose for 20 min at room temperature. Regrowth of cryopreserved buds of line 'Kitakei 2' using D-Cryo-plate and V-Cryo-plate procedures, was 90% and 80%, respectively. The two procedures were applied to 20 additional mat rush lines. Using the V-Cryo-plate procedure resulted in regrowth ranging between 13.3 and 86.7%, with an average of 52.5%. The D-Cryo-plate led to regrowth ranging between 73.3 and 96.7%, with an average of 86.3%. The D-Cryo-plate procedure will facilitate cryostorage of mat rush germplasm. PMID:24441366

  20. Hydrogen Peroxide Metabolism in Yeasts

    OpenAIRE

    Verduyn, C; Giuseppin, M L; Scheffers, W A; van Dijken, J P

    1988-01-01

    A catalase-negative mutant of the yeast Hansenula polymorpha consumed methanol in the presence of glucose when the organism was grown in carbon-limited chemostat cultures. The organism was apparently able to decompose the H2O2 generated in the oxidation of methanol by alcohol oxidase. Not only H2O2 generated intracellularly but also H2O2 added extracellularly was effectively destroyed by the catalase-negative mutant. From the rate of H2O2 consumption during growth in chemostat cultures on mix...

  1. NetPhosYeast: prediction of protein phosphorylation sites in yeast

    DEFF Research Database (Denmark)

    Ingrell, C.R.; Miller, Martin Lee; Jensen, O.N.; Blom, Nikolaj

    2007-01-01

    We here present a neural network-based method for the prediction of protein phosphorylation sites in yeast-an important model organism for basic research. Existing protein phosphorylation site predictors are primarily based on mammalian data and show reduced sensitivity on yeast phosphorylation...... sites compared to those in humans, suggesting the need for an yeast-specific phosphorylation site predictor. NetPhosYeast achieves a correlation coefficient close to 0.75 with a sensitivity of 0.84 and specificity of 0.90 and outperforms existing predictors in the identification of phosphorylation sites...... in yeast....

  2. The bud break process and its variation among local populations of boreal black spruce.

    Science.gov (United States)

    Rossi, Sergio; Bousquet, Jean

    2014-01-01

    Phenology of local populations can exhibit adaptations to the current environmental conditions resulting from a close interaction between climate and genotype. The bud break process and its variations among populations were analyzed in greenhouse by monitoring the growth resumption in black spruce [Picea mariana (Mill.) BSP] seedlings originating from seeds of five stands across the closed boreal forest in Quebec, Canada. Bud break lasted 15 days and occurred earlier and quicker in northern provenances. Provenance explained between 10.2 and 32.3% of the variance in bud break, while the families accounted for a smaller but still significant part of the variance. The late occurrence of one phenological phase corresponded to a delayed occurrence of the others according to linear relationships. A causal model was proposed in the form of a chain of events with each phase of bud break being related to the previous and successive one, while no link was observed between non-adjacent phases. The adaptation of black spruce populations along the latitudinal gradient points toward a strategy based on rapid physiological processes triggered by temperature increase inducing high metabolic activity. The variation observed in bud break reflects an evolutionary trade-off between maximization of security and taking advantage of the short growing season. This work provides evidence of the phenological adaptations of black spruce to its local environmental conditions while retaining sizeable genetic diversity within populations. Because of the multigenic nature of phenology, this diversity should provide some raw material for adaptation to changing local environmental conditions. PMID:25389430

  3. The role of spatially controlled cell proliferation in limb bud morphogenesis.

    Directory of Open Access Journals (Sweden)

    Bernd Boehm

    Full Text Available Although the vertebrate limb bud has been studied for decades as a model system for spatial pattern formation and cell specification, the cellular basis of its distally oriented elongation has been a relatively neglected topic by comparison. The conventional view is that a gradient of isotropic proliferation exists along the limb, with high proliferation rates at the distal tip and lower rates towards the body, and that this gradient is the driving force behind outgrowth. Here we test this hypothesis by combining quantitative empirical data sets with computer modelling to assess the potential role of spatially controlled proliferation rates in the process of directional limb bud outgrowth. In particular, we generate two new empirical data sets for the mouse hind limb--a numerical description of shape change and a quantitative 3D map of cell cycle times--and combine these with a new 3D finite element model of tissue growth. By developing a parameter optimization approach (which explores spatial patterns of tissue growth our computer simulations reveal that the observed distribution of proliferation rates plays no significant role in controlling the distally extending limb shape, and suggests that directional cell activities are likely to be the driving force behind limb bud outgrowth. This theoretical prediction prompted us to search for evidence of directional cell orientations in the limb bud mesenchyme, and we thus discovered a striking highly branched and extended cell shape composed of dynamically extending and retracting filopodia, a distally oriented bias in Golgi position, and also a bias in the orientation of cell division. We therefore provide both theoretical and empirical evidence that limb bud elongation is achieved by directional cell activities, rather than a PD gradient of proliferation rates.

  4. Mapping of Candidate Genes Involved in Bud Dormancy and Flowering Time in Sweet Cherry (Prunus avium.

    Directory of Open Access Journals (Sweden)

    Sophie Castède

    Full Text Available The timing of flowering in perennial plants is crucial for their survival in temperate climates and is regulated by the duration of bud dormancy. Bud dormancy release and bud break depend on the perception of cumulative chilling during endodormancy and heat during the bud development. The objectives of this work were to identify candidate genes involved in dormancy and flowering processes in sweet cherry, their mapping in two mapping progenies 'Regina' × 'Garnet' and 'Regina' × 'Lapins', and to select those candidate genes which co-localized with quantitative trait loci (QTLs associated with temperature requirements for bud dormancy release and flowering. Based on available data on flowering processes in various species, a list of 79 candidate genes was established. The peach and sweet cherry orthologs were identified and primers were designed to amplify sweet cherry candidate gene fragments. Based on the amplified sequences of the three parents of the mapping progenies, SNPs segregations in the progenies were identified. Thirty five candidate genes were genetically mapped in at least one of the two progenies and all were in silico mapped. Co-localization between candidate genes and QTLs associated with temperature requirements and flowering date were identified for the first time in sweet cherry. The allelic composition of the candidate genes located in the major QTL for heat requirements and flowering date located on linkage group 4 have a significant effect on these two traits indicating their potential use for breeding programs in sweet cherry to select new varieties adapted to putative future climatic conditions.

  5. Mapping of Candidate Genes Involved in Bud Dormancy and Flowering Time in Sweet Cherry (Prunus avium).

    Science.gov (United States)

    Castède, Sophie; Campoy, José Antonio; Le Dantec, Loïck; Quero-García, José; Barreneche, Teresa; Wenden, Bénédicte; Dirlewanger, Elisabeth

    2015-01-01

    The timing of flowering in perennial plants is crucial for their survival in temperate climates and is regulated by the duration of bud dormancy. Bud dormancy release and bud break depend on the perception of cumulative chilling during endodormancy and heat during the bud development. The objectives of this work were to identify candidate genes involved in dormancy and flowering processes in sweet cherry, their mapping in two mapping progenies 'Regina' × 'Garnet' and 'Regina' × 'Lapins', and to select those candidate genes which co-localized with quantitative trait loci (QTLs) associated with temperature requirements for bud dormancy release and flowering. Based on available data on flowering processes in various species, a list of 79 candidate genes was established. The peach and sweet cherry orthologs were identified and primers were designed to amplify sweet cherry candidate gene fragments. Based on the amplified sequences of the three parents of the mapping progenies, SNPs segregations in the progenies were identified. Thirty five candidate genes were genetically mapped in at least one of the two progenies and all were in silico mapped. Co-localization between candidate genes and QTLs associated with temperature requirements and flowering date were identified for the first time in sweet cherry. The allelic composition of the candidate genes located in the major QTL for heat requirements and flowering date located on linkage group 4 have a significant effect on these two traits indicating their potential use for breeding programs in sweet cherry to select new varieties adapted to putative future climatic conditions. PMID:26587668

  6. Socio-cultural practices of deciduous canine tooth bud removal among Maasai children.

    Science.gov (United States)

    Mutai, J; Muniu, E; Sawe, J; Hassanali, J; Kibet, P; Wanzala, P

    2010-04-01

    The removal of teeth amongst the Maasai is a traditional practice as part of an initiation or to make space for feeding in an event of diseases locking the jaw. Removal of deciduous canine tooth buds (DCB) among infants below 2 years has been reported in several studies to be common mainly amongst communities in East Africa, Ethiopia and Sudan. The main reason for the practice revolves around the belief that tooth buds or 'maggots' are false teeth, nylon or worms and are responsible for diarrhoea, vomiting, fever and growth retardation in children, amongst other illnesses. The main objective of this study was to assess the socio-cultural factors which contribute to this practice. The main methods of data collected included Focus Group Discussions (FGD) with mothers of children in that age group and Traditional Birth Attendants (TBA). In-depth interviews (IDI)were conducted with key informants versed with Maasai traditions whereas observations were done within the manyattas where participants live. Proceedings at both the FGD and the IDI were recorded on paper and were analysed thematically. The study showed that the removal of canine tooth buds amongst children that started initially with calves--that diseases that cause diarrhoea in calves were brought about by the canine tooth buds that were turning reddish in colour--is deeply rooted and practised in the community despite sensitisation interventions mounted jointly by the University of Nairobi, Kenya Medical Research Institute and the Kenya Medical Training College, among others. This study discovered that canine tooth buds are associated with bad spirits that cause diarrhoea and vomiting and the belief that removing them is a sure way of providing a cure for all children's ailments. PMID:20476714

  7. Developmental Coordination of Gamete Differentiation with Programmed Cell Death in Sporulating Yeast.

    Science.gov (United States)

    Eastwood, Michael D; Meneghini, Marc D

    2015-09-01

    The gametogenesis program of the budding yeast Saccharomyces cerevisiae, also known as sporulation, employs unusual internal meiotic divisions, after which all four meiotic products differentiate within the parental cell. We showed previously that sporulation is typically accompanied by the destruction of discarded immature meiotic products through their exposure to proteases released from the mother cell vacuole, which undergoes an apparent programmed rupture. Here we demonstrate that vacuolar rupture contributes to de facto programmed cell death (PCD) of the meiotic mother cell itself. Meiotic mother cell PCD is accompanied by an accumulation of depolarized mitochondria, organelle swelling, altered plasma membrane characteristics, and cytoplasmic clearance. To ensure that the gametes survive the destructive consequences of developing within a cell that is executing PCD, we hypothesized that PCD is restrained from occurring until spores have attained a threshold degree of differentiation. Consistent with this hypothesis, gene deletions that perturb all but the most terminal postmeiotic spore developmental stages are associated with altered PCD. In these mutants, meiotic mother cells exhibit a delay in vacuolar rupture and then appear to undergo an alternative form of PCD associated with catastrophic consequences for the underdeveloped spores. Our findings reveal yeast sporulation as a context of bona fide PCD that is developmentally coordinated with gamete differentiation. PMID:26092920

  8. Canonical Modeling of the Multi-Scale Regulation of the Heat Stress Response in Yeast

    Directory of Open Access Journals (Sweden)

    Luis L. Fonseca

    2012-02-01

    Full Text Available Heat is one of the most fundamental and ancient environmental stresses, and response mechanisms are found in prokaryotes and shared among most eukaryotes. In the budding yeast Saccharomyces cerevisiae, the heat stress response involves coordinated changes at all biological levels, from gene expression to protein and metabolite abundances, and to temporary adjustments in physiology. Due to its integrative multi-level-multi-scale nature, heat adaptation constitutes a complex dynamic process, which has forced most experimental and modeling analyses in the past to focus on just one or a few of its aspects. Here we review the basic components of the heat stress response in yeast and outline what has been done, and what needs to be done, to merge the available information into computational structures that permit comprehensive diagnostics, interrogation, and interpretation. We illustrate the process in particular with the coordination of two metabolic responses, namely the dramatic accumulation of the protective disaccharide trehalose and the substantial change in the profile of sphingolipids, which in turn affect gene expression. The proposed methods primarily use differential equations in the canonical modeling framework of Biochemical Systems Theory (BST, which permits the relatively easy construction of coarse, initial models even in systems that are incompletely characterized.

  9. Mutant allele of rna14 in fission yeast affects pre-mRNA splicing

    Indian Academy of Sciences (India)

    SUDHANSHU YADAV; AMIT SONKAR; NAFEES AHAMAD; SHAKIL AHMED

    2016-06-01

    complex removes noncoding introns, while 3'end processing involves in cleavage and addition of poly(A) tails to the nascent transcript. Rna14 protein in budding yeast has been implicated in cleavage and polyadenylation of mRNA in the nucleus but their role in the pre-mRNA splicing has not been studied. Here, we report the isolation of a mutant allele of rna14 in fission yeast,Schizosaccharomyces pombe that exhibits reduction in protein level of Chk1 at the nonpermissive temperature, primarily due to the defects in posttranscriptional processing. Reverse transcriptase-polymerase chain reaction analysis reveals defective splicing of the chk1¹+transcript at the nonpermissive temperature. Apart from chk1¹+, the splicing of some other genes were also found to be defective at the nonpermissive temperature suggesting that Rna14 might be involved in pre-mRNA splicing. Subsequently, genetic interaction of Rna14 with prp1 and physical interactions with Prp28 suggest that the Rna14 might be part of a larger protein complex responsible for the pre-mRNA maturation.

  10. Biological repair of Pichia Pinus yeasts

    International Nuclear Information System (INIS)

    The effectiveness of liquid-holding recovery of Pichia pinus yeast after γ- and α-irradiation was determined. Haploid cells are not capable of recovery involved. Nonreparable component of diploid yeast recovery is 0.7 after γ-irradiation and 0.8 after α-irradiation

  11. Epigenetic drug 5-azacytidine impairs proliferation of rat limb buds in an organotypic model-system in vitro

    Science.gov (United States)

    Mužić, Vedrana; Katušić Bojanac, Ana; Jurić-Lekić, Gordana; Himelreich, Marta; Tupek, Katarina; Šerman, Ljiljana; Marn, Nina; Sinčić, Nino; Vlahović, Maja; Bulić-Jakuš, Floriana

    2013-01-01

    Aim To establish an organotypic in vitro model of limb bud development to verify whether epigenetic drug and teratogen 5-azacytidine (5azaC) has an effect on limb buds independent of its effects on the placenta. Methods Fischer strain rat fore- and hindlimb buds were microsurgically isolated from 13 days old embryos and cultivated in vitro for two weeks at the air-liquid interface in Eagle's minimum essential medium (MEM) with 50% rat serum. 30 µmol of 5azaC was added to the fresh medium. Overall growth was measured by an ocular micrometer. Routine histology, immunohistochemical detection of the proliferating cell nuclear antigen (PCNA), and stereological quantification of PCNA expression were performed. Results At four time points, significantly lower overall growth was detected for fore- and hindlimb bud explants cultivated with 5azaC in comparison to controls. After the culture period, numerical density of the PCNA signal for both types of limb buds was lower than for controls (P < 0.001). Limb buds were initially covered by immature epithelium and contained mesenchyme, myotubes, single hemangioblasts, hemangioblast aggregates, blood islands, and capillaries. Regardless of the treatment, cartilage and epidermis differentiated, but cells and structures typical for vasculogenesis disappeared. Conclusion Our findings, obtained outside of the maternal organism, stress the importance of compromised cell proliferation for 5azaC impact on limb buds. This investigation points to the necessity to establish alternatives to in vivo research on animals using teratogenic agents. PMID:24170728

  12. Synthesis and electrochemical performance of bud-like FeS2 microspheres as anode materials for rechargeable lithium batteries

    International Nuclear Information System (INIS)

    Highlights: ► Bud-like FeS2 microshperes was synthesized through solvothermal reaction with polyvinylpyrrolidone (PVP). ► Bud-like microshperes in the range of 2.0–3.0 μm are built by nanoflakes with the size of 0.5–1 μm in width and length. ► The bud-like FeS2 is investigated by many tests such as CV, GITT and EIS. ► The bud-like powder shows the highest initial specific capacity, coulombic efficiency and lowest polarization. -- Abstract: Bud-like FeS2 powder was synthesized by a solvothermal method with the help of polyvinylpyrrolidone (PVP). The bud-like FeS2 microshperes with the diameters of 2.0–3.0 μm were consisted of the submicro-flakes with 0.5–1μm in width and length, and about 60 nm in thickness. As an anode material for Li-ion batteries, the bud-like FeS2 delivered initial specific discharge capacity of 773 and 749 mAh g−1, and could sustain 387 and 368 mAh g−1 after 30 cycles at current densities of 45 and 89 mA g−1, respectively, much higher than the solid one obtained without PVP. The bud-like FeS2 microshperes also showed large diffusion coefficient of Li-ions (DLi+) calculated by Galvanostatic intermittent titration (GITT). The improved electrochemical performance of bud-like FeS2 was due to the unique structure which provides large contact area between the FeS2 microspheres and electrolyte, decreased polarization and large DLi+, leading to enhanced electrode reaction kinetics

  13. Use of Yeast Chemigenomics and COXEN Informatics in Preclinical Evaluation of Anticancer Agents

    Directory of Open Access Journals (Sweden)

    Steven C. Smith

    2011-01-01

    Full Text Available Bladder cancer metastasis is virtually incurable with current platinum-based chemotherapy. We used the novel COXEN informatic approach for in silico drug discovery and identified NSC-637993 and NSC-645809 (C1311, both imidazoacridinones, as agents with high-predicted activity in human bladder cancer. Because even highly effective monotherapy is unlikely to cure most patients with metastasis and NSC-645809 is undergoing clinical trials in other tumor types, we sought to develop the basis for use of C1311 in rational combination with other agents in bladder cancer. Here, we demonstrate in 40 human bladder cancer cells that the in vitro cytotoxicity profile for C1311 correlates with that of NSC-637993 and compares favorably to that of standard of care chemotherapeutics. Using genomewide patterns of synthetic lethality of C1311 with open reading frame knockouts in budding yeast, we determined that combining C1311 with a taxane could provide mechanistically rational combinations. To determine the preclinical relevance of these yeast findings, we evaluated C1311 singly and in doublet combination with paclitaxel in human bladder cancer in the in vivo hollow fiber assay and observed efficacy. By applying COXEN to gene expression data from 40 bladder cancer cell lines and 30 human tumors with associated clinical response data to platinum-based chemotherapy, we provide evidence that signatures of C1311 sensitivity exist within nonresponders to this regimen. Coupling COXEN and yeast chemigenomics provides rational combinations with C1311 and tumor genomic signatures that can be used to select bladder cancer patients for clinical trials with this agent.

  14. Effects of 6-BA and MET on the induction of adventitious buds from rice seedlings and its application

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    @@Different levels of 6-BA (6-Benezyla-mino purine) and MET (Paclobutra-zol) were added into MS media to culture the mature seeds of six varieties and two F2 populations of Nanjing11 ( indica ) / Balilla (japoni-ca) and Dular( indica)/Balilla( japonica) . Results were as follows:1) 6-BA was effective in inducing the formation of adventitious buds (Table 1).Only using MET could not induce adventitious buds formation. Compared with the use of 6-BA only, it was more useful for inducing the adventitious buds by using MET and 6-BA together, especially for japonica rice.

  15. Epigenetic drug 5-azacytidine impairs proliferation of rat limb buds in an organotypic model-system in vitro

    OpenAIRE

    Mužić, Vedrana; Katušić Bojanac, Ana; Jurić-Lekić, Gordana; Himelreich, Marta; Tupek, Katarina; Šerman, Ljiljana; Marn, Nina; Sinčić, Nino; Vlahović, Maja; Bulić-Jakuš, Floriana

    2013-01-01

    Aim To establish an organotypic in vitro model of limb bud development to verify whether epigenetic drug and teratogen 5-azacytidine (5azaC) has an effect on limb buds independent of its effects on the placenta. Methods Fischer strain rat fore- and hindlimb buds were microsurgically isolated from 13 days old embryos and cultivated in vitro for two weeks at the air-liquid interface in Eagle’s minimum essential medium (MEM) with 50% rat serum. 30 μmol of 5azaC was added ...

  16. Annexin VI-mediated Loss of Spectrin during Coated Pit Budding Is Coupled to Delivery of LDL to Lysosomes

    OpenAIRE

    Kamal, Adeela; Ying, Yun-shu; Anderson, Richard G. W.

    1998-01-01

    Previously we reported that annexin VI is required for the budding of clathrin-coated pits from human fibroblast plasma membranes in vitro. Here we show that annexin VI bound to the NH2-terminal 28-kD portion of membrane spectrin is as effective as cytosolic annexin VI in supporting coated pit budding. Annexin VI–dependent budding is accompanied by the loss of ∼50% of the spectrin from the membrane and is blocked by the cysteine protease inhibitor N-acetyl-leucyl-leucyl-norleucinal (ALLN). In...

  17. Plasmid construction using recombination activity in the fission yeast Schizosaccharomyces pombe.

    Directory of Open Access Journals (Sweden)

    Ayako Chino

    Full Text Available BACKGROUND: Construction of plasmids is crucial in modern genetic manipulation. As of now, the common method for constructing plasmids is to digest specific DNA sequences with restriction enzymes and to ligate the resulting DNA fragments with DNA ligase. Another potent method to construct plasmids, known as gap-repair cloning (GRC, is commonly used in the budding yeast Saccharomyces cerevisiae. GRC makes use of the homologous recombination activity that occurs within the yeast cells. Due to its flexible design and efficiency, GRC has been frequently used for constructing plasmids with complex structures as well as genome-wide plasmid collections. Although there have been reports indicating GRC feasibility in the fission yeast Schizosaccharomyces pombe, this species is not commonly used for GRC as systematic studies of reporting GRC efficiency in S. pombe have not been performed till date. METHODOLOGY/PRINCIPAL FINDINGS: We investigated GRC efficiency in S. pombe in this study. We first showed that GRC was feasible in S. pombe by constructing a plasmid that contained the LEU2 auxotrophic marker gene in vivo and showed sufficient efficiency with short homology sequences (>25 bp. No preference was shown for the sequence length from the cut site in the vector plasmid. We next showed that plasmids could be constructed in a proper way using 3 DNA fragments with 70% efficiency without any specific selections being made. The GRC efficiency with 3 DNA fragments was dramatically increased >95% in lig4Delta mutant cell, where non-homologous end joining is deficient. Following this approach, we successfully constructed plasmid vectors with leu1+, ade6+, his5+, and lys1+ markers with the low-copy stable plasmid pDblet as a backbone by applying GRC in S. pombe. CONCLUSIONS/SIGNIFICANCE: We concluded that GRC was sufficiently feasible in S. pombe for genome-wide gene functional analysis as well as for regular plasmid construction. Plasmids with different

  18. Accelerating Yeast Prion Biology using Droplet Microfluidics

    Science.gov (United States)

    Ung, Lloyd; Rotem, Assaf; Jarosz, Daniel; Datta, Manoshi; Lindquist, Susan; Weitz, David

    2012-02-01

    Prions are infectious proteins in a misfolded form, that can induce normal proteins to take the misfolded state. Yeast prions are relevant, as a model of human prion diseases, and interesting from an evolutionary standpoint. Prions may also be a form of epigenetic inheritance, which allow yeast to adapt to stressful conditions at rates exceeding those of random mutations and propagate that adaptation to their offspring. Encapsulation of yeast in droplet microfluidic devices enables high-throughput measurements with single cell resolution, which would not be feasible using bulk methods. Millions of populations of yeast can be screened to obtain reliable measurements of prion induction and loss rates. The population dynamics of clonal yeast, when a fraction of the cells are prion expressing, can be elucidated. Furthermore, the mechanism by which certain strains of bacteria induce yeast to express prions in the wild can be deduced. Integrating the disparate fields of prion biology and droplet microfluidics reveals a more complete picture of how prions may be more than just diseases and play a functional role in yeast.

  19. Overview of fission yeast septation.

    Science.gov (United States)

    Pérez, Pilar; Cortés, Juan C G; Martín-García, Rebeca; Ribas, Juan C

    2016-09-01

    Cytokinesis is the final process of the vegetative cycle, which divides a cell into two independent daughter cells once mitosis is completed. In fungi, as in animal cells, cytokinesis requires the formation of a cleavage furrow originated by constriction of an actomyosin ring which is connected to the plasma membrane and causes its invagination. Additionally, because fungal cells have a polysaccharide cell wall outside the plasma membrane, cytokinesis requires the formation of a septum coincident with the membrane ingression. Fission yeast Schizosaccharomyces pombe is a unicellular, rod-shaped fungus that has become a popular model organism for the study of actomyosin ring formation and constriction during cell division. Here we review the current knowledge of the septation and separation processes in this fungus, as well as recent advances in understanding the functional interaction between the transmembrane enzymes that build the septum and the actomyosin ring proteins. PMID:27155541

  20. Modeling competition between yeast strains

    Science.gov (United States)

    de Gee, Maarten; van Mourik, Hilda; de Visser, Arjan; Molenaar, Jaap

    2016-04-01

    We investigate toxin interference competition between S. cerevisiae colonies grown on a solid medium. In vivo experiments show that the outcome of this competition depends strongly on nutrient availability and cell densities. Here we present a new model for S. cerevisiae colonies, calculating the local height and composition of the colonies. The model simulates yeast colonies that show a good fit to experimental data. Simulations of colonies that start out with a homogeneous mixture of toxin producing and toxin sensitive cells can display remarkable pattern formation, depending on the initial ratio of the strains. Simulations in which the toxin producing and toxin sensitive species start at nearby positions clearly show that toxin production is advantageous.

  1. 21 CFR 184.1983 - Bakers yeast extract.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bakers yeast extract. 184.1983 Section 184.1983... Listing of Specific Substances Affirmed as GRAS § 184.1983 Bakers yeast extract. (a) Bakers yeast extract... a selected strain of yeast, Saccharomyces cerevisiae. It may be concentrated or dried. (b)...

  2. 21 CFR 172.898 - Bakers yeast glycan.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bakers yeast glycan. 172.898 Section 172.898 Food... Multipurpose Additives § 172.898 Bakers yeast glycan. Bakers yeast glycan may be safely used in food in accordance with the following conditions: (a) Bakers yeast glycan is the comminuted, washed, pasteurized,...

  3. 21 CFR 172.325 - Bakers yeast protein.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Bakers yeast protein. 172.325 Section 172.325 Food... Special Dietary and Nutritional Additives § 172.325 Bakers yeast protein. Bakers yeast protein may be safely used in food in accordance with the following conditions: (a) Bakers yeast protein is...

  4. Biofuels. Altered sterol composition renders yeast thermotolerant

    DEFF Research Database (Denmark)

    Caspeta, Luis; Chen, Yun; Ghiaci, Payam;

    2014-01-01

    Ethanol production for use as a biofuel is mainly achieved through simultaneous saccharification and fermentation by yeast. Operating at ≥40°C would be beneficial in terms of increasing efficiency of the process and reducing costs, but yeast does not grow efficiently at those temperatures. We used...... adaptive laboratory evolution to select yeast strains with improved growth and ethanol production at ≥40°C. Sequencing of the whole genome, genome-wide gene expression, and metabolic-flux analyses revealed a change in sterol composition, from ergosterol to fecosterol, caused by mutations in the C-5 sterol...

  5. Yeast Exocytic v-SNAREs Confer Endocytosis

    OpenAIRE

    Gurunathan, Sangiliyandi; Chapman-Shimshoni, Daphne; Trajkovic, Selena; Gerst, Jeffrey E.

    2000-01-01

    In yeast, homologues of the synaptobrevin/VAMP family of v-SNAREs (Snc1 and Snc2) confer the docking and fusion of secretory vesicles at the cell surface. As no v-SNARE has been shown to confer endocytosis, we examined whether yeast lacking the SNC genes, or possessing a temperature-sensitive allele of SNC1 (SNC1ala43), are deficient in the endocytic uptake of components from the cell surface. We found that both SNC and temperature-shifted SNC1ala43 yeast are d...

  6. Yeast cell factories on the horizon

    DEFF Research Database (Denmark)

    Nielsen, Jens

    2015-01-01

    For thousands of years, yeast has been used for making beer, bread, and wine. In modern times, it has become a commercial workhorse for producing fuels, chemicals, and pharmaceuticals such as insulin, human serum albumin, and vaccines against hepatitis virus and human papillomavirus. Yeast has also...... been engineered to make chemicals at industrial scale (e.g., succinic acid, lactic acid, resveratrol) and advanced biofuels (e.g., isobutanol) (1). On page 1095 of this issue, Galanie et al. (2) demonstrate that yeast can now be engineered to produce opioids (2), a major class of compounds used for...

  7. [Antiradical properties of essential oils and extracts from clove bud and pimento].

    Science.gov (United States)

    Misharina, T A; Alinkina, E S; Medvedeva, I B

    2015-01-01

    The antiradical properties of essential oils and extracts from the clove bud (Eugenia caryophyllata Thumb.) and berries of tree (Pimenta dioica (L.) Meriff) were studied and compared with the properties of synthetic antioxidant ionol (2,6-ditret-butyl-4-hydroxytoluene, BHT) in model reactions with the stable free 2,2-diphenyl-1-picrylhydrazyl (DPPH) radical. The essential oils of clove bud and pimento had qualitatively close composition of the main components but differed by their quantitative content. In the studied samples, eugenol was the main compound with high antiradical activity. The reaction rates of essential oils and extracts with the DPPH radical were practically the same for essential oils and twice the reaction rate of BHT. The values of antiradical efficiency (AE) were also close for essential oils and were twice that for extracts and ionol. A synergetic action of components in the essential oil and extract of pimento on antiradical efficiency values was found. PMID:25842910

  8. ALIX is recruited temporarily into HIV-1 budding sites at the end of gag assembly.

    Directory of Open Access Journals (Sweden)

    Pei-I Ku

    Full Text Available Polymerization of Gag on the inner leaflet of the plasma membrane drives the assembly of Human Immunodeficiency Virus 1 (HIV-1. Gag recruits components of the endosomal sorting complexes required for transport (ESCRT to facilitate membrane fission and virion release. ESCRT assembly is initiated by recruitment of ALIX and TSG101/ESCRT-I, which bind directly to the viral Gag protein and then recruit the downstream ESCRT-III and VPS4 factors to complete the budding process. In contrast to previous models, we show that ALIX is recruited transiently at the end of Gag assembly, and that most ALIX molecules are recycled into the cytosol as the virus buds, although a subset remains within the virion. Our experiments imply that ALIX is recruited to the neck of the assembling virion and is mostly recycled after virion release.

  9. The essential oil of Populus balsamifera buds: its chemical composition and cytotoxic activity.

    Science.gov (United States)

    Piochon-Gauthier, Marianne; Legault, Jean; Sylvestre, Muriel; Pichette, André

    2014-02-01

    The chemical composition of Populus balsamifera essential oils obtained from spring buds, fall buds, and young leaves were determined by GC and GC-MS analyses. The major constituent, (+)-alpha-bisabolol, a rare sesquiterpene, was isolated from spring oil using reverse-phase preparative HPLC. The cytotoxic activity of balsam poplar oils and isolated (+)-alpha-bisabolol was assessed in vitro against human lung carcinoma (A549) and colorectal adenocarcinoma (DLD-1) cell lines. Essential oils were cytotoxic with IC50 ranging from 35 to 50 microg/mL. (+)-alpha-Bisabolol exhibited pronounced activity (IC50 14 microg/mL) against both cancer cell lines. It also exhibited interesting cytotoxic activity (IC50 23 microg/mL) against human glioma (U251), higher than the one observed for (-)-alpha-bisabolol (IC50 34 microg/mL), which is known for its apoptosis-inducing effect against glioma cells. PMID:24689304

  10. Assessment of factors affecting in vitro shoot regeneration from axillary bud explant of Camptotheca acuminata

    Institute of Scientific and Technical Information of China (English)

    WANG Hui-Mei; ZU Yuan-Gang; DONG Feng-Li; ZHAO Xiao-Ju

    2005-01-01

    Axillary buds from 3-yr.-old seedlings of Camptotheca acuminata in the greenhouse were cultured on the different basal media with different concentrations of growth regulators for shoot regeneration for studying the effects of different basal media, different concentrations of growth regulators (BA or TDZ), sucrose, agar and pH value on shoot regeneration from axillary bud. The results showed that B5 and WPM media were the optimal basal media and the optimal phyotohormone was BA of 1.0 mg/L or TDZ of 0.1mg/L; The concentrations of sucrose of 30g/L and agar of 6g/L were most suitable for the shoot regeneration; pH value from 5.8 to 6.6 were broadly effective, but the best at pH 5.8.

  11. The relationship between differentiation of flower bud and metabolism of phosphate in apple

    International Nuclear Information System (INIS)

    Contents of phosphate both in exposed and in shade branches of the apples were examined. It was found that in the control the glycophosphate was lower but the nucleoprotein was higher than in the shade treatment during the period from the end of shoot growth to the morphological differentiation of flower buds. It has also been shown that in the control the incorporation of 32P was lower in glycophosphate but higher in glycophosphate ester, phospholipid and nucleopretein. The results suggest that the more shortage of nutrient supply, the lower of conversion of glycophosphate and the lower level of synthesis of glycophosphate ester, phospholipid and nucleoprotein in normal metabolic pathway, so that the flower buds under treatment can not be formed

  12. Effects of γ-irradiation on the embryonic bud structure of chestnut

    International Nuclear Information System (INIS)

    Effects of γ-irradiation on the structure of the embryonic bud in chestnut seed were investigated by using electronic transmittance microscope. The results indicated that γ-irradiation had great effects on the starch granules in the embryo of chestnut. No significant effects were found under the irradiation dose of 0.5 kGy; the outside of starch granule began to gelatinize at 1 kGy treatment, while significant gelatinization happened with the dose higher than 6 kGy. Correspondingly, the viscosity of the wholemeal flour of the chestnut seeds decreased with the increasing dose of irradiation. It was also found the thickness of the cell wall in the embryonic bud became thinner with the irradiation

  13. Gravity-dependent regulation of red light induced moss protonemata branching and gametophore bud formation

    Science.gov (United States)

    Ripetskyj, R. T.; Kit, N. A.

    Isolated leafy shoots of the moss Pottia intermedia positioned horizontally on the agar surface in vertically oriented petri dishes regenerate unbranching negatively gravitropic protonemata on upper side of the regenerant. Gravity determines the site of regeneration not the process itself. White light of low intensity unsufficient to induce positive phototropism of dark-grown protonemata can, however, provoke their branching and gametophore bud formation (Ripetskyj et al., 1998; 1999). The presented experiments have been carried out with red light in Biological Research in Canisters/Light Emitting Diode (BRIC/LED) hardware developed at Kennedy Space Center, USA. Seven-day-old dark-grown negatively gravitropic secondary P. intermedia protonemata were positioned differently with respect to gravity vector and to the source of red light of low, 1 or 2 μ mol\\cdot m-2\\cdot s-1, intensities. The light induced intensive branching of the protonemata and gametophore bud formation initiation site of both processes as well as the direction of growth of branches and buds being depent on the position of protonemata with respect to gravity and light vectors. Vertically positioned, i.e. ungravistimulated, dark grown protonemata illuminated from one side with red light of 2 μ mol\\cdot m-2\\cdot s-1 intensity produced 96,9 ± 2,2% of side branches and buds growing directly towards the light source from the lit protonema side. Horizontally disposed protonemata irradiated from below with red light of the same intensity regenerate 31,7 ± 3,9% of branches and buds on the upper, i.e. shaded protonemata side, the upward growth of which should undoubtedly be determined by gravity. In vertically disposed protonemata illuminated with red light of 1 μ mol\\cdot m-2\\cdot s-1 intensity from aside 31,9 ± 5,5% of side branches and buds arised on shaded protonema side and grew away from the light. Illumination of the protonemata in horizontal position from below increased the number of

  14. Immobilization of yeast cells by radiation-induced polymerization

    International Nuclear Information System (INIS)

    Radiation-induced polymerization method was applied to the immobilization of yeast cells. The effects of irradiation, cooling and monomer, which are neccessary for polymerization, were recovered completely by subsequent aerobical incubation of yeast cells. The ethanol productive in immobilized yeast cells increased with the increase of aerobical incubation period. The growth of yeast cells in immobilized yeast cells was indicated. The maximum ethanol productivity in immobilized yeast cell system was around three times as much as that in free yeast cell system. (orig.)

  15. Genetic characterization of pathogenic fluorescent pseudomonads isolated from necrotic cherry and plum buds in Serbia

    OpenAIRE

    Gavrilović Veljko; Ivanović Žarko; Popović Tatjana; Živković Svetlana; Stanković Slaviša; Berić Tanja; Fira Đorđe

    2013-01-01

    During past few years a symptoms of plum and cherry bud necrosis were observed in some regions with significant cherry production in Serbia. Gram negative, fluorescent, oxidative bacterial strains were isolated from the margin of necrotic tissue. All investigated strains are levan and HR positive, while negative results are recorded in oxidase, pectinase and arginin dihydrolase tests (LOPAT+---+). Symptoms similar to those observed in natural infection were...

  16. Expression of Podoplanin in the Mouse Tooth Germ and Apical Bud Cells

    OpenAIRE

    Sawa, Yoshihiko; Iwasawa, Kana; Ishikawa, Hiroyuki

    2008-01-01

    This study was designed to investigate the distribution of cells expressing podoplanin in the mouse tooth bud. Podoplanin expression was detected in enamel epithelia of the cervical loop at cell-cell contacts strongly, and weakly on the loosely aggregated stellate reticulum in the center and the neighboring stratum intermedium. Odontoblasts exhibited intense podoplanin expression at the junction with predentin while no expression was detected in the enamel organ containing ameloblasts. These ...

  17. Potential Bud Bank Responses to Apical Meristem Damage and Environmental Variables: Matching or Complementing Axillary Meristems?

    OpenAIRE

    Klimešová, Jitka; Malíková, Lenka; Rosenthal, Jonathan; Šmilauer, Petr

    2014-01-01

    Soil nutrients, dormant axillary meristem availability, and competition can influence plant tolerance to damage. However, the role of potential bud banks (adventitious meristems initiated only after injury) is not known. Examining Central European field populations of 22 species of short-lived monocarpic herbs exposed to various sources of damage, we hypothesized that: (1) with increasing injury severity, the number of axillary branches would decrease, due to axillary meristem limitation, whe...

  18. Effect of gamma rays on vegetative buds of physalis peruviana l

    OpenAIRE

    Caro Melgarejo, Diana Patricia; Estupiñán-Rincón, Sandra Yaneth; Rache Cardenal, Leidy Yanira; Pacheco-Maldonado, José Constantino

    2013-01-01

    In Colombia, studies carried out to establish modern methods for propagation and selection of plant of ribes gooseberry (Physalis peruviana) are scarce so, it is necessary to explore alternative techniques such as the application of ionizing radiation, which enables greater genetic variability and to obtain seedlings with phenotypic characteristics that could be beneficial to contribute to improve productivity. To induce chromosomal alterations, axillary buds of P. peruviana with 50, 100, :00...

  19. Analisis Histologi Embriogenesis Somatik Dari Apikal Bud Kelapa Sawit (Elaeis guineensis Jacq.) var Tenera

    OpenAIRE

    Meilvana, Tengku Nilayanda

    2014-01-01

    A study of Histological Analysis of Somatic Embryogenesis from Apical Bud of Oil Palm (Elaeis guineensis Jacq.) var. Tenera has been conducted at Plant Tissue Culture Laboratory of FMIPA USU. The experimental design was completely randomized with three levels of 2,4-D concentrations: 110; 120; 130 mg/L and three position of explants: apical, median, and basal. The statistical analysis showed that 120 mg/L of 2,4-D significantly affected the primary and embryogenic calluses initiation. Explant...

  20. Estimation of the junctional resistance between electrically coupled receptor cells in Necturus taste buds

    OpenAIRE

    1995-01-01

    Junctional resistance between coupled receptor cells in Necturus taste buds was estimated by modeling the results from single patch pipette voltage clamp studies on lingual slices. The membrane capacitance and input resistance of coupled taste receptor cells were measured to monitor electrical coupling and the results compared with those calculated by a simple model of electrically coupled taste cells. Coupled receptor cells were modeled by two identical receptor cells connected via a junctio...