WorldWideScience

Sample records for budding yeast meiosis

  1. Post-transcriptional regulation in budding yeast meiosis.

    Science.gov (United States)

    Jin, Liang; Neiman, Aaron M

    2016-05-01

    The precise regulation of gene expression is essential for developmental processes in eukaryotic organisms. As an important post-transcriptional regulatory point, translational control is complementary to transcriptional regulation. Sporulation in the budding yeast Saccharomyces cerevisiae is a developmental process controlled by a well-studied transcriptional cascade that drives the cell through the events of DNA replication, meiotic chromosome segregation, and spore assembly. Recent studies have revealed that as cells begin the meiotic divisions, translational regulation of gene expression fine tunes this transcriptional cascade. The significance and mechanisms of this translational regulation are beginning to emerge. These studies may also provide insights into translational regulation in germ cell development of multicellular organisms. PMID:26613728

  2. The nuclear exosome is active and important during budding yeast meiosis.

    Directory of Open Access Journals (Sweden)

    Stephen Frenk

    Full Text Available Nuclear RNA degradation pathways are highly conserved across eukaryotes and play important roles in RNA quality control. Key substrates for exosomal degradation include aberrant functional RNAs and cryptic unstable transcripts (CUTs. It has recently been reported that the nuclear exosome is inactivated during meiosis in budding yeast through degradation of the subunit Rrp6, leading to the stabilisation of a subset of meiotic unannotated transcripts (MUTs of unknown function. We have analysed the activity of the nuclear exosome during meiosis by deletion of TRF4, which encodes a key component of the exosome targeting complex TRAMP. We find that TRAMP mutants produce high levels of CUTs during meiosis that are undetectable in wild-type cells, showing that the nuclear exosome remains functional for CUT degradation, and we further report that the meiotic exosome complex contains Rrp6. Indeed Rrp6 over-expression is insufficient to suppress MUT transcripts, showing that the reduced amount of Rrp6 in meiotic cells does not directly cause MUT accumulation. Lack of TRAMP activity stabilises ∼ 1600 CUTs in meiotic cells, which occupy 40% of the binding capacity of the nuclear cap binding complex (CBC. CBC mutants display defects in the formation of meiotic double strand breaks (DSBs, and we see similar defects in TRAMP mutants, suggesting that a key function of the nuclear exosome is to prevent saturation of the CBC complex by CUTs. Together, our results show that the nuclear exosome remains active in meiosis and has an important role in facilitating meiotic recombination.

  3. Frequent and efficient use of the sister chromatid for DNA double-strand break repair during budding yeast meiosis.

    Directory of Open Access Journals (Sweden)

    Tamara Goldfarb

    Full Text Available Recombination between homologous chromosomes of different parental origin (homologs is necessary for their accurate segregation during meiosis. It has been suggested that meiotic inter-homolog recombination is promoted by a barrier to inter-sister-chromatid recombination, imposed by meiosis-specific components of the chromosome axis. Consistent with this, measures of Holliday junction-containing recombination intermediates (joint molecules [JMs] show a strong bias towards inter-homolog and against inter-sister JMs. However, recombination between sister chromatids also has an important role in meiosis. The genomes of diploid organisms in natural populations are highly polymorphic for insertions and deletions, and meiotic double-strand breaks (DSBs that form within such polymorphic regions must be repaired by inter-sister recombination. Efforts to study inter-sister recombination during meiosis, in particular to determine recombination frequencies and mechanisms, have been constrained by the inability to monitor the products of inter-sister recombination. We present here molecular-level studies of inter-sister recombination during budding yeast meiosis. We examined events initiated by DSBs in regions that lack corresponding sequences on the homolog, and show that these DSBs are efficiently repaired by inter-sister recombination. This occurs with the same timing as inter-homolog recombination, but with reduced (2- to 3-fold yields of JMs. Loss of the meiotic-chromosome-axis-associated kinase Mek1 accelerates inter-sister DSB repair and markedly increases inter-sister JM frequencies. Furthermore, inter-sister JMs formed in mek1Δ mutants are preferentially lost, while inter-homolog JMs are maintained. These findings indicate that inter-sister recombination occurs frequently during budding yeast meiosis, with the possibility that up to one-third of all recombination events occur between sister chromatids. We suggest that a Mek1-dependent reduction in

  4. Meiosis in haploid yeast

    OpenAIRE

    Wagstaff, Joseph E.; Klapholz, Sue; Esposito, Rochelle Easton

    1982-01-01

    Haploid yeast cells normally contain either the MATa or MATα mating-type allele and cannot undergo meiosis and spore formation. If both mating-type alleles are present as a consequence of chromosome III disomy (MATa/MATα), haploids initiate meiosis but do not successfully form spores, probably because the haploid chromosome complement is irregularly partitioned during meiotic nuclear division. We have demonstrated that the ochre-suppressible mutation spo13-1 enables haploid yeast cells disomi...

  5. PP2A(Cdc55)'s role in reductional chromosome segregation during achiasmate meiosis in budding yeast is independent of its FEAR function.

    Science.gov (United States)

    Kerr, Gary W; Wong, Jin Huei; Arumugam, Prakash

    2016-01-01

    PP2A(Cdc55) is a highly conserved serine-threonine protein phosphatase that is involved in diverse cellular processes. In budding yeast, meiotic cells lacking PP2A(Cdc55) activity undergo a premature exit from meiosis I which results in a failure to form bipolar spindles and divide nuclei. This defect is largely due to its role in negatively regulating the Cdc Fourteen Early Anaphase Release (FEAR) pathway. PP2A(Cdc55) prevents nucleolar release of the Cdk (Cyclin-dependent kinase)-antagonising phosphatase Cdc14 by counteracting phosphorylation of the nucleolar protein Net1 by Cdk. CDC55 was identified in a genetic screen for monopolins performed by isolating suppressors of spo11Δ spo12Δ lethality suggesting that Cdc55 might have a role in meiotic chromosome segregation. We investigated this possibility by isolating cdc55 alleles that suppress spo11Δ spo12Δ lethality and show that this suppression is independent of PP2A(Cdc55)'s FEAR function. Although the suppressor mutations in cdc55 affect reductional chromosome segregation in the absence of recombination, they have no effect on chromosome segregation during wild type meiosis. We suggest that Cdc55 is required for reductional chromosome segregation during achiasmate meiosis and this is independent of its FEAR function. PMID:27455870

  6. PP2ACdc55’s role in reductional chromosome segregation during achiasmate meiosis in budding yeast is independent of its FEAR function

    Science.gov (United States)

    Kerr, Gary W.; Wong, Jin Huei; Arumugam, Prakash

    2016-01-01

    PP2ACdc55 is a highly conserved serine-threonine protein phosphatase that is involved in diverse cellular processes. In budding yeast, meiotic cells lacking PP2ACdc55 activity undergo a premature exit from meiosis I which results in a failure to form bipolar spindles and divide nuclei. This defect is largely due to its role in negatively regulating the Cdc Fourteen Early Anaphase Release (FEAR) pathway. PP2ACdc55 prevents nucleolar release of the Cdk (Cyclin-dependent kinase)-antagonising phosphatase Cdc14 by counteracting phosphorylation of the nucleolar protein Net1 by Cdk. CDC55 was identified in a genetic screen for monopolins performed by isolating suppressors of spo11Δ spo12Δ lethality suggesting that Cdc55 might have a role in meiotic chromosome segregation. We investigated this possibility by isolating cdc55 alleles that suppress spo11Δ spo12Δ lethality and show that this suppression is independent of PP2ACdc55’s FEAR function. Although the suppressor mutations in cdc55 affect reductional chromosome segregation in the absence of recombination, they have no effect on chromosome segregation during wild type meiosis. We suggest that Cdc55 is required for reductional chromosome segregation during achiasmate meiosis and this is independent of its FEAR function. PMID:27455870

  7. Ipl1/Aurora B kinase coordinates synaptonemal complex disassembly with cell cycle progression and crossover formation in budding yeast meiosis

    OpenAIRE

    Jordan, Philip; Copsey, Alice; Newnham, Louise; Kolar, E; Lichten, M; Hoffmann, Eva

    2009-01-01

    Several protein kinases collaborate to orchestrate and integrate cellular and chromosomal events at the G2/M transition in both mitotic and meiotic cells. During the G2/M transition in meiosis, this includes the completion of crossover recombination, spindle formation, and synaptonemal complex (SC) breakdown. We identified Ipl1/Aurora B kinase as the main regulator of SC disassembly. Mutants lacking Ipl1 or its kinase activity assemble SCs with normal timing, but fail to dissociate the centra...

  8. Sister kinetochores are mechanically fused during meiosis I in yeast

    OpenAIRE

    Sarangapani, Krishna K.; Duro, Eris; Deng, Yi; de Lima Alves, Flavia; Ye, Qiaozhen; Opoku, Kwaku N.; Ceto, Steven; Rappsilber, Juri; Corbett, Kevin D.; Biggins, Sue; Marston, Adèle L.; Asbury, Charles L.

    2014-01-01

    Production of healthy gametes requires a reductional meiosis I division in which replicated sister chromatids co-migrate, rather than separating as in mitosis or meiosis II. Fusion of sister kinetochores during meiosis I may underlie sister chromatid co-migration in diverse organisms, but direct evidence for such fusion has been lacking. Here we studied native kinetochore particles isolated from yeast using laser trapping and quantitative fluorescence microscopy. Meiosis I kinetochores formed...

  9. Tripartite organization of centromeric chromatin in budding yeast

    OpenAIRE

    Krassovsky, Kristina; Henikoff, Jorja G.; Henikoff, Steven

    2011-01-01

    The centromere is the genetic locus that organizes the proteinaceous kinetochore and is responsible for attachment of the chromosome to the spindle at mitosis and meiosis. In most eukaryotes, the centromere consists of highly repetitive DNA sequences that are occupied by nucleosomes containing the CenH3 histone variant, whereas in budding yeast, a ∼120-bp centromere DNA element (CDE) that is sufficient for centromere function is occupied by a single right-handed histone variant CenH3 (Cse4) n...

  10. Sociobiology of the budding yeast

    Indian Academy of Sciences (India)

    Dominika M Wloch-Salamon

    2014-04-01

    Social theory has provided a useful framework for research with microorganisms. Here I describe the advantages and possible risks of using a well-known model organism, the unicellular yeast Saccharomyces cerevisiae, for sociobiological research. I discuss the problems connected with clear classification of yeast behaviour based on the fitness-based Hamilton paradigm. Relevant traits include different types of communities, production of flocculins, invertase and toxins, and the presence of apoptosis.

  11. Bipolar budding in yeasts - an electron microscope study

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    Bud formation in yeasts with bipolar budding was studied by electron microscopy of thin sections. Budding in yeasts of the species Saccharomycodes ludwigii, Hanseniaspora valbyensis and Wickerhamia fluorescens resulted in concentric rings of scar ridges on the wall of the mother cell. The wall betwe

  12. The selective elimination of messenger RNA underlies the mitosis–meiosis switch in fission yeast

    OpenAIRE

    Yamamoto, Masayuki

    2010-01-01

    The cellular programs for meiosis and mitosis must be strictly distinguished but the mechanisms controlling the entry to meiosis remain largely elusive in higher organisms. In contrast, recent analyses in yeast have shed new light on the mechanisms underlying the mitosis–meiosis switch. In this review, the current understanding of these mechanisms in the fission yeast Schizosaccharomyces pombe is discussed. Meiosis-inducing signals in this microbe emanating from environmental conditions inclu...

  13. Ddb1 controls genome stability and meiosis in fission yeast

    DEFF Research Database (Denmark)

    Holmberg, Christian Henrik; Fleck, Oliver; Hansen, H. A.;

    2005-01-01

    The human UV-damaged DNA-binding protein Ddb1 associates with cullin 4 ubiquitin ligases implicated in nucleotide excision repair (NER). These complexes also contain the signalosome (CSN), but NER-relevant ubiquitination targets have not yet been identified. We report that fission yeast Ddb1, Cul...... degradation becomes essential when cells differentiate into meiosis. These results suggest that Ddb1, along with Cullin 4 and the signalosome, constitute a major pathway controlling genome stability, repair, and differentiation via RNR regulation....

  14. 5'-end sequences of budding yeast full-length cDNA clones - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Budding yeast cDNA sequencing project 5'-end sequences of budding yeast full-length cDNA clones Data detail Data name 5'-end sequence...s of budding yeast full-length cDNA clones Description of data contents cDNA sequence...e Update History of This Database Site Policy | Contact Us 5'-end sequences of budding yeast full-length cDNA clones - Budding yeast cDNA sequencing project | LSDB Archive ...

  15. Calling Card Analysis in Budding Yeast.

    Science.gov (United States)

    Mayhew, David; Mitra, Robi D

    2016-02-01

    Calling card analysis is a high-throughput method for identifying the genomic binding sites of multiple transcription factors in a single experiment in budding yeast. By tagging a DNA-binding protein with a targeting domain that directs the insertion of the Ty5 retrotransposon, the genomic binding sites for that transcription factor are marked. The transposition locations are then identified en masse by Illumina sequencing. The calling card protocol allows for simultaneous analysis of multiple transcription factors. By cloning barcodes into the Ty5 transposon, it is possible to pair a unique barcode with every transcription factor in the experiment. The method presented here uses expression of transcription factors from their native loci; however, it can also be altered to measure binding sites of transcription factors overexpressed from a plasmid. PMID:26832687

  16. Measuring mitotic spindle dynamics in budding yeast

    Science.gov (United States)

    Plumb, Kemp

    In order to carry out its life cycle and produce viable progeny through cell division, a cell must successfully coordinate and execute a number of complex processes with high fidelity, in an environment dominated by thermal noise. One important example of such a process is the assembly and positioning of the mitotic spindle prior to chromosome segregation. The mitotic spindle is a modular structure composed of two spindle pole bodies, separated in space and spanned by filamentous proteins called microtubules, along which the genetic material of the cell is held. The spindle is responsible for alignment and subsequent segregation of chromosomes into two equal parts; proper spindle positioning and timing ensure that genetic material is appropriately divided amongst mother and daughter cells. In this thesis, I describe fluorescence confocal microscopy and automated image analysis algorithms, which I have used to observe and analyze the real space dynamics of the mitotic spindle in budding yeast. The software can locate structures in three spatial dimensions and track their movement in time. By selecting fluorescent proteins which specifically label the spindle poles and cell periphery, mitotic spindle dynamics have been measured in a coordinate system relevant to the cell division. I describe how I have characterised the accuracy and precision of the algorithms by simulating fluorescence data for both spindle poles and the budding yeast cell surface. In this thesis I also describe the construction of a microfluidic apparatus that allows for the measurement of long time-scale dynamics of individual cells and the development of a cell population. The tools developed in this thesis work will facilitate in-depth quantitative analysis of the non-equilibrium processes in living cells.

  17. Tolerance of budding yeast Saccharomyces cerevisiae to ultra high pressure

    Science.gov (United States)

    Shibata, M.; Torigoe, M.; Matsumoto, Y.; Yamamoto, M.; Takizawa, N.; Hada, Y.; Mori, Y.; Takarabe, K.; Ono, F.

    2014-05-01

    Our studies on the tolerance of plants and animals against very high pressure of several GPa have been extended to a smaller sized fungus, the budding yeast Saccharomyces cerevisiae. Several pieces of budding yeast (dry yeast) were sealed in a small teflon capsule with a liquid pressure medium fluorinate, and exposed to 7.5 GPa by using a cubic anvil press. The pressure was kept constant for various duration of time from 2 to 24 h. After the pressure was released, the specimens were brought out from the teflon capsule, and they were cultivated on a potato dextrose agar. It was found that the budding yeast exposed to 7.5 GPa for up to 6 h showed multiplication. However, those exposed to 7.5 GPa for longer than 12 h were found dead. The high pressure tolerance of budding yeast is a little weaker than that of tardigrades.

  18. Dielectric modelling of cell division for budding and fission yeast

    International Nuclear Information System (INIS)

    The frequency dependence of complex permittivity or the dielectric spectrum of a system including a cell in cell division has been simulated by a numerical technique based on the three-dimensional finite difference method. Two different types of cell division characteristic of budding and fission yeast were examined. The yeast cells are both regarded as a body of rotation, and thus have anisotropic polarization, i.e. the effective permittivity of the cell depends on the orientation of the cell to the direction of an applied electric field. In the perpendicular orientation, where the rotational axis of the cell is perpendicular to the electric field direction, the dielectric spectra for both yeast cells included one dielectric relaxation and its intensity depended on the cell volume. In the parallel orientation, on the other hand, two dielectric relaxations appeared with bud growth for budding yeast and with septum formation for fission yeast. The low-frequency relaxation was shifted to a lower frequency region by narrowing the neck between the bud and the mother cell for budding yeast and by increasing the degree of septum formation for fission yeast. After cell separation, the low-frequency relaxation disappeared. The simulations well interpreted the oscillation of the relative permittivity of culture broth found for synchronous cell growth of budding yeast

  19. Dielectric modelling of cell division for budding and fission yeast

    Science.gov (United States)

    Asami, Koji; Sekine, Katsuhisa

    2007-02-01

    The frequency dependence of complex permittivity or the dielectric spectrum of a system including a cell in cell division has been simulated by a numerical technique based on the three-dimensional finite difference method. Two different types of cell division characteristic of budding and fission yeast were examined. The yeast cells are both regarded as a body of rotation, and thus have anisotropic polarization, i.e. the effective permittivity of the cell depends on the orientation of the cell to the direction of an applied electric field. In the perpendicular orientation, where the rotational axis of the cell is perpendicular to the electric field direction, the dielectric spectra for both yeast cells included one dielectric relaxation and its intensity depended on the cell volume. In the parallel orientation, on the other hand, two dielectric relaxations appeared with bud growth for budding yeast and with septum formation for fission yeast. The low-frequency relaxation was shifted to a lower frequency region by narrowing the neck between the bud and the mother cell for budding yeast and by increasing the degree of septum formation for fission yeast. After cell separation, the low-frequency relaxation disappeared. The simulations well interpreted the oscillation of the relative permittivity of culture broth found for synchronous cell growth of budding yeast.

  20. A Monitor for Bud Emergence in the Yeast Morphogenesis Checkpoint

    OpenAIRE

    Theesfeld, Chandra L.; Zyla, Trevin R.; Bardes, Elaine G.S.; Lew, Daniel J.

    2003-01-01

    Cell cycle transitions are subject to regulation by both external signals and internal checkpoints that monitor satisfactory progression of key cell cycle events. In budding yeast, the morphogenesis checkpoint arrests the cell cycle in response to perturbations that affect the actin cytoskeleton and bud formation. Herein, we identify a step in this checkpoint pathway that seems to be directly responsive to bud emergence. Activation of the kinase Hsl1p is dependent upon...

  1. Newly identified prions in budding yeast, and their possible functions

    OpenAIRE

    Crow, Emily T.; Li, Liming

    2011-01-01

    Yeast prions are atypical genetic elements that are transmitted as heritable protein conformations. [PSI+], [URE3], and [PIN+] are three well-studied prions in the budding yeast, Saccharomyces cerevisiae. In the last three years, several additional prions have been reported in yeast, including [SWI+], [OCT+], [MCA], [GAR+], [MOT3+], [ISP+], and [NSI+]. The growing number of yeast prions suggests that protein-based inheritance might be a widespread biological phenomenon. In this review, we sum...

  2. Mechanical feedback stabilizes budding yeast morphogenesis

    Science.gov (United States)

    Banavar, Samhita; Trogdon, Michael; Petzold, Linda; Campas, Otger

    Walled cells have the ability to remodel their shape while sustaining an internal turgor pressure that can reach values up to 10 atmospheres. This requires a tight and simultaneous regulation of cell wall assembly and mechanochemistry, but the underlying mechanisms by which this is achieved remain unclear. Using the growth of mating projections in budding yeast (S. cerevisiae) as a motivating example, we have developed a theoretical description that couples the mechanics of cell wall expansion and assembly via a mechanical feedback. In the absence of a mechanical feedback, cell morphogenesis is inherently unstable. The presence of a mechanical feedback stabilizes changes in cell shape and growth, and provides a mechanism to prevent cell lysis in a wide range of conditions. We solve for the dynamics of the system and obtain the different dynamical regimes. In particular, we show that several parameters affect the stability of growth, including the strength of mechanical feedback in the system. Finally, we compare our results to existing experimental data.

  3. Reconstruction of the Kinetochore during Meiosis in Fission Yeast Schizosaccharomyces pombe

    OpenAIRE

    Hayashi, Aki; Asakawa, Haruhiko; Haraguchi, Tokuko; Hiraoka, Yasushi

    2006-01-01

    During the transition from mitosis to meiosis, the kinetochore undergoes significant reorganization, switching from a bipolar to a monopolar orientation. To examine the centromere proteins that are involved in fundamental reorganization in meiosis, we observed the localization of 22 mitotic and 2 meiotic protein components of the kinetochore during meiosis in living cells of the fission yeast. We found that the 22 mitotic proteins can be classified into three groups: the Mis6-like group, the ...

  4. Measuring Replicative Life Span in the Budding Yeast

    OpenAIRE

    Steffen, Kristan K.; Kennedy, Brian K.; Kaeberlein, Matt

    2009-01-01

    Aging is a degenerative process characterized by a progressive deterioration of cellular components and organelles resulting in mortality. The budding yeast Saccharomyces cerevisiae has been used extensively to study the biology of aging, and several determinants of yeast longevity have been shown to be conserved in multicellular eukaryotes, including worms, flies, and mice 1. Due to the lack of easily quantified age-associated phenotypes, aging in yeast has been assayed almost exclusively by...

  5. ATP analog-sensitive Pat1 protein kinase for synchronous fission yeast meiosis at physiological temperature

    OpenAIRE

    Cipak, Lubos; Hyppa, Randy; Smith, Gerald; Gregan, Juraj

    2012-01-01

    To study meiosis, synchronous cultures are often indispensable, especially for physical analyses of DNA and proteins. A temperature-sensitive allele of the Pat1 protein kinase (pat1-114) has been widely used to induce synchronous meiosis in the fission yeast Schizosaccharomyces pombe, but pat1-114-induced meiosis differs from wild-type meiosis, and some of these abnormalities might be due to higher temperature needed to inactivate the Pat1 kinase. Here, we report an ATP analog-sensitive allel...

  6. A Monitor for Bud Emergence in the Yeast Morphogenesis Checkpoint

    Science.gov (United States)

    Theesfeld, Chandra L.; Zyla, Trevin R.; Bardes, Elaine G.S.; Lew, Daniel J.

    2003-01-01

    Cell cycle transitions are subject to regulation by both external signals and internal checkpoints that monitor satisfactory progression of key cell cycle events. In budding yeast, the morphogenesis checkpoint arrests the cell cycle in response to perturbations that affect the actin cytoskeleton and bud formation. Herein, we identify a step in this checkpoint pathway that seems to be directly responsive to bud emergence. Activation of the kinase Hsl1p is dependent upon its recruitment to a cortical domain organized by the septins, a family of conserved filament-forming proteins. Under conditions that delayed or blocked bud emergence, Hsl1p recruitment to the septin cortex still took place, but hyperphosphorylation of Hsl1p and recruitment of the Hsl1p-binding protein Hsl7p to the septin cortex only occurred after bud emergence. At this time, the septin cortex spread to form a collar between mother and bud, and Hsl1p and Hsl7p were restricted to the bud side of the septin collar. We discuss models for translating cellular geometry (in this case, the emergence of a bud) into biochemical signals regulating cell proliferation. PMID:12925763

  7. Evaluation and Properties of the Budding Yeast Phosphoproteome

    OpenAIRE

    Amoutzias, G. D.; He, Y.; Lilley, K. S.; Van de Peer, Y.; Oliver, S G

    2012-01-01

    We have assembled a reliable phosphoproteomic data set for budding yeast Saccharomyces cerevisiae and have investigated its properties. Twelve publicly available phosphoproteome data sets were triaged to obtain a subset of high-confidence phosphorylation sites (p-sites), free of "noisy" phosphorylations. Analysis of this combined data set suggests that the inventory of phosphoproteins in yeast is close to completion, but that these proteins may have many undiscovered p-sites. Proteins involve...

  8. Apoptosis at inflection point in liquid culture of budding yeasts.

    Directory of Open Access Journals (Sweden)

    Toshiyuki Hagiwara

    Full Text Available Budding yeasts are highly suitable for aging studies, because the number of bud scars (stage proportionally correlates with age. Its maximum stages are known to reach at 20-30 stages on an isolated agar medium. However, their stage dynamics in a liquid culture is virtually unknown. We investigate the population dynamics by counting scars in each cell. Here one cell division produces one new cell and one bud scar. This simple rule leads to a conservation law: "The total number of bud scars is equal to the total number of cells." We find a large discrepancy: extremely fewer cells with over 5 scars than expected. Almost all cells with 6 or more scars disappear within a short period of time in the late log phase (corresponds to the inflection point. This discrepancy is confirmed directly by the microscopic observations of broken cells. This finding implies apoptosis in older cells (6 scars or more.

  9. Synchronized fission yeast meiosis using an ATP analog-sensitive Pat1 protein kinase

    OpenAIRE

    Cipak, Lubos; Polakova, Silvia; Hyppa, Randy W.; Smith, Gerald R; Gregan, Juraj

    2014-01-01

    Synchronous cultures are often indispensable for studying meiosis. Here, we present an optimized protocol for induction of synchronous meiosis in the fission yeast Schizosaccharomyces pombe. Chemical inactivation of an ATP analog-sensitive form of the Pat1 kinase (pat1-as2) by adding the ATP-analog 1-NM-PP1 in G1-arrested cells allows induction of synchronous meiosis at optimal temperature (25 °C). Importantly, this protocol eliminates detrimental effects of elevated temperature (34 °C) which...

  10. Reconstitution of hemisomes on budding yeast centromeric DNA

    OpenAIRE

    Furuyama, Takehito; Codomo, Christine A.; Henikoff, Steven

    2013-01-01

    The structure of nucleosomes that contain the cenH3 histone variant has been controversial. In budding yeast, a single right-handed cenH3/H4/H2A/H2B tetramer wraps the ∼80-bp Centromere DNA Element II (CDE II) sequence of each centromere into a ‘hemisome’. However, attempts to reconstitute cenH3 particles in vitro have yielded exclusively ‘octasomes’, which are observed in vivo on chromosome arms only when Cse4 (yeast cenH3) is overproduced. Here, we show that Cse4 octamers remain intact unde...

  11. Dynamical Analysis of Protein Regulatory Network in Budding Yeast Nucleus

    Institute of Scientific and Technical Information of China (English)

    LI Fang-Ting; JIA Xun

    2006-01-01

    @@ Recent progresses in the protein regulatory network of budding yeast Saccharomyces cerevisiae have provided a global picture of its protein network for further dynamical research. We simplify and modularize the protein regulatory networks in yeast nucleus, and study the dynamical properties of the core 37-node network by a Boolean network model, especially the evolution steps and final fixed points. Our simulation results show that the number of fixed points N(k) for a given size of the attraction basin k obeys a power-law distribution N(k)∝k-2.024. The yeast network is more similar to a scale-free network than a random network in the above dynamical properties.

  12. Csm4, in collaboration with Ndj1, mediates telomere-led chromosome dynamics and recombination during yeast meiosis.

    Directory of Open Access Journals (Sweden)

    Jennifer J Wanat

    Full Text Available Chromosome movements are a general feature of mid-prophase of meiosis. In budding yeast, meiotic chromosomes exhibit dynamic movements, led by nuclear envelope (NE-associated telomeres, throughout the zygotene and pachytene stages. Zygotene motion underlies the global tendency for colocalization of NE-associated chromosome ends in a "bouquet." In this study, we identify Csm4 as a new molecular participant in these processes and show that, unlike the two previously identified components, Ndj1 and Mps3, Csm4 is not required for meiosis-specific telomere/NE association. Instead, it acts to couple telomere/NE ensembles to a force generation mechanism. Mutants lacking Csm4 and/or Ndj1 display the following closely related phenotypes: (i elevated crossover (CO frequencies and decreased CO interference without abrogation of normal pathways; (ii delayed progression of recombination, and recombination-coupled chromosome morphogenesis, with resulting delays in the MI division; and (iii nondisjunction of homologs at the MI division for some reason other than absence of (the obligatory CO(s. The recombination effects are discussed in the context of a model where the underlying defect is chromosome movement, the absence of which results in persistence of inappropriate chromosome relationships that, in turn, results in the observed mutant phenotypes.

  13. Red1 promotes the elimination of meiosis-specific mRNAs in vegetatively growing fission yeast

    OpenAIRE

    Sugiyama, Tomoyasu; Sugioka-Sugiyama, Rie

    2011-01-01

    In mitotic fission yeast cells, expression of meiosis-specific mRNAs is prevented by their selective degradation in nuclear bodies. A novel required factor, Red1, leaves these nuclear bodies during meiosis, offering first hints on the regulation of this process.

  14. The fission yeast MTREC and EJC orthologs ensure the maturation of meiotic transcripts during meiosis

    Science.gov (United States)

    Marayati, Bahjat Fadi; Hoskins, Victoria; Boger, Robert W.; Tucker, James F.; Fishman, Emily S.; Bray, Andrew S.; Zhang, Ke

    2016-01-01

    Meiosis is a highly regulated process by which genetic information is transmitted through sexual reproduction. It encompasses unique mechanisms that do not occur in vegetative cells, producing a distinct, well-regulated meiotic transcriptome. During vegetative growth, many meiotic genes are constitutively transcribed, but most of the resulting mRNAs are rapidly eliminated by the Mmi1-MTREC (Mtl1-Red1 core) complex. While Mmi1-MTREC targets premature meiotic RNAs for degradation by the nuclear 3′–5′ exoribonuclease exosome during mitotic growth, its role in meiotic gene expression during meiosis is not known. Here, we report that Red5, an essential MTREC component, interacts with pFal1, an ortholog of eukaryotic translation initiation factor eIF4aIII in the fission yeast Schizosaccharomyces pombe. In mammals, together with MAGO (Mnh1), Rnps1, and Y14, elF4AIII (pFal1) forms the core of the exon junction complex (EJC), which is essential for transcriptional surveillance and localization of mature mRNAs. In fission yeast, two EJC orthologs, pFal1 and Mnh1, are functionally connected with MTREC, specifically in the process of meiotic gene expression during meiosis. Although pFal1 interacts with Mnh1, Y14, and Rnps1, its association with Mnh1 is not disrupted upon loss of Y14 or Rnps1. Mutations of Red1, Red5, pFal1, or Mnh1 produce severe meiotic defects; the abundance of meiotic transcripts during meiosis decreases; and mRNA maturation processes such as splicing are impaired. Since studying meiosis in mammalian germline cells is difficult, our findings in fission yeast may help to define the general mechanisms involved in accurate meiotic gene expression in higher eukaryotes. PMID:27365210

  15. The fission yeast MTREC and EJC orthologs ensure the maturation of meiotic transcripts during meiosis.

    Science.gov (United States)

    Marayati, Bahjat Fadi; Hoskins, Victoria; Boger, Robert W; Tucker, James F; Fishman, Emily S; Bray, Andrew S; Zhang, Ke

    2016-09-01

    Meiosis is a highly regulated process by which genetic information is transmitted through sexual reproduction. It encompasses unique mechanisms that do not occur in vegetative cells, producing a distinct, well-regulated meiotic transcriptome. During vegetative growth, many meiotic genes are constitutively transcribed, but most of the resulting mRNAs are rapidly eliminated by the Mmi1-MTREC (Mtl1-Red1 core) complex. While Mmi1-MTREC targets premature meiotic RNAs for degradation by the nuclear 3'-5' exoribonuclease exosome during mitotic growth, its role in meiotic gene expression during meiosis is not known. Here, we report that Red5, an essential MTREC component, interacts with pFal1, an ortholog of eukaryotic translation initiation factor eIF4aIII in the fission yeast Schizosaccharomyces pombe In mammals, together with MAGO (Mnh1), Rnps1, and Y14, elF4AIII (pFal1) forms the core of the exon junction complex (EJC), which is essential for transcriptional surveillance and localization of mature mRNAs. In fission yeast, two EJC orthologs, pFal1 and Mnh1, are functionally connected with MTREC, specifically in the process of meiotic gene expression during meiosis. Although pFal1 interacts with Mnh1, Y14, and Rnps1, its association with Mnh1 is not disrupted upon loss of Y14 or Rnps1. Mutations of Red1, Red5, pFal1, or Mnh1 produce severe meiotic defects; the abundance of meiotic transcripts during meiosis decreases; and mRNA maturation processes such as splicing are impaired. Since studying meiosis in mammalian germline cells is difficult, our findings in fission yeast may help to define the general mechanisms involved in accurate meiotic gene expression in higher eukaryotes. PMID:27365210

  16. Virtual Nuclear Envelope Breakdown and Its Regulators in Fission Yeast Meiosis.

    Science.gov (United States)

    Asakawa, Haruhiko; Yang, Hui-Ju; Hiraoka, Yasushi; Haraguchi, Tokuko

    2016-01-01

    Ran, a small GTPase, is required for the spindle formation and nuclear envelope (NE) formation. After NE breakdown (NEBD) during mitosis in metazoan cells, the Ran-GTP gradient across the NE is lost and Ran-GTP becomes concentrated around chromatin, thus affecting the stability of microtubules and promoting the assembly of spindle microtubules and segregation of chromosomes. Mitosis in which chromosomes are segregated subsequent to NEBD is called "open mitosis." In contrast, many fungi undergo a process termed "closed mitosis" in which chromosome segregation and spindle formation occur without NEBD. Although the fission yeast Schizosaccharomyces pombe undergoes a closed mitosis, it exhibits a short period during meiosis (anaphase of the second meiosis; called "anaphase II") when nuclear and cytoplasmic proteins are mixed in the presence of intact NE and nuclear pore complexes (NPC). This "virtual" nuclear envelope breakdown (vNEBD) involves changes in the localization of RanGAP1, an activator of Ran-GTP hydrolysis. Recently, Nup132, a component of the structural core Nup107-160 subcomplex of the NPC, has been shown to be involved in the maintenance of the nuclear cytoplasmic barrier in yeast meiosis. In this review, we highlight the possible roles of RanGAP1 and Nup132 in vNEBD and discuss the biological significance of vNEBD in S. pombe meiosis. PMID:26870731

  17. Endocytosis is essential for dynamic translocation of a syntaxin 1 orthologue during fission yeast meiosis

    OpenAIRE

    Kashiwazaki, Jun; Yamasaki, Yuriko; Itadani, Akiko; Teraguchi, Erika; Maeda, Yukari; Shimoda, Chikashi; Nakamura, Taro

    2011-01-01

    Syntaxin is a component of the target soluble N-ethylmaleimide–sensitive factor attachment protein receptor complex, which is responsible for fusion of membrane vesicles at the target membrane. The fission yeast syntaxin 1 orthologue Psy1 is essential for both vegetative growth and spore formation. During meiosis, Psy1 disappears from the plasma membrane (PM) and dramatically relocalizes on the nascent forespore membrane, which becomes the PM of the spore. Here we report the molecular details...

  18. Proper Microtubule Structure Is Vital for Timely Progression through Meiosis in Fission Yeast

    OpenAIRE

    Akira Yamashita; Yoshihiro Fujita; Masayuki Yamamoto

    2013-01-01

    Cells of the fission yeast Schizosaccharomyces pombe normally reproduce by mitotic division in the haploid state. When subjected to nutrient starvation, two haploid cells fuse and undergo karyogamy, forming a diploid cell that initiates meiosis to form four haploid spores. Here, we show that deletion of the mal3 gene, which encodes a homolog of microtubule regulator EB1, produces aberrant asci carrying more than four spores. The mal3 deletion mutant cells have a disordered cytoplasmic microtu...

  19. Vector sequences - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Budding yeast cDNA sequencing project Vector sequences Data detail Data name Vector sequences Description of data contents Vector seq...wnload License Update History of This Database Site Policy | Contact Us Vector sequences - Budding yeast cDNA sequencing project | LSDB Archive ... ...uences used for sequencing. Multi FASTA format. 7 entries. Data file File name: vec

  20. Characterization of the minimum domain required for targeting budding yeast myosin II to the site of cell division

    Directory of Open Access Journals (Sweden)

    Tolliday Nicola J

    2006-06-01

    Full Text Available Abstract Background All eukaryotes with the exception of plants use an actomyosin ring to generate a constriction force at the site of cell division (cleavage furrow during mitosis and meiosis. The structure and filament forming abilities located in the C-terminal or tail region of one of the main components, myosin II, are important for localising the molecule to the contractile ring (CR during cytokinesis. However, it remains poorly understood how myosin II is recruited to the site of cell division and how this recruitment relates to myosin filament assembly. Significant conservation between species of the components involved in cytokinesis, including those of the CR, allows the use of easily genetically manipulated organisms, such as budding yeast (Saccharomyces cerevisiae, in the study of cytokinesis. Budding yeast has a single myosin II protein, named Myo1. Unlike most other class II myosins, the tail of Myo1 has an irregular coiled coil. In this report we use molecular genetics, biochemistry and live cell imaging to characterize the minimum localisation domain (MLD of budding yeast Myo1. Results We show that the MLD is a small region in the centre of the tail of Myo1 and that it is both necessary and sufficient for localisation of Myo1 to the yeast bud neck, the pre-determined site of cell division. Hydrodynamic measurements of the MLD, purified from bacteria or yeast, show that it is likely to exist as a trimer. We also examine the importance of a small region of low coiled coil forming probability within the MLD, which we call the hinge region. Removal of the hinge region prevents contraction of the CR. Using fluorescence recovery after photobleaching (FRAP, we show that GFP-tagged MLD is slightly more dynamic than the GFP-tagged full length molecule but less dynamic than the GFP-tagged Myo1 construct lacking the hinge region. Conclusion Our results define the intrinsic determinant for the localization of budding yeast myosin II and show

  1. Systems Level Modeling of the Cell Cycle Using Budding Yeast

    Directory of Open Access Journals (Sweden)

    D.R. Kim

    2007-01-01

    Full Text Available Proteins involved in the regulation of the cell cycle are highly conserved across all eukaryotes, and so a relatively simple eukaryote such as yeast can provide insight into a variety of cell cycle perturbations including those that occur in human cancer. To date, the budding yeast Saccharomyces cerevisiae has provided the largest amount of experimental and modeling data on the progression of the cell cycle, making it a logical choice for in-depth studies of this process. Moreover, the advent of methods for collection of high-throughput genome, transcriptome, and proteome data has provided a means to collect and precisely quantify simultaneous cell cycle gene transcript and protein levels, permitting modeling of the cell cycle on the systems level. With the appropriate mathematical framework and suffi cient and accurate data on cell cycle components, it should be possible to create a model of the cell cycle that not only effectively describes its operation, but can also predict responses to perturbations such as variation in protein levels and responses to external stimuli including targeted inhibition by drugs. In this review, we summarize existing data on the yeast cell cycle, proteomics technologies for quantifying cell cycle proteins, and the mathematical frameworks that can integrate this data into representative and effective models. Systems level modeling of the cell cycle will require the integration of high-quality data with the appropriate mathematical framework, which can currently be attained through the combination of dynamic modeling based on proteomics data and using yeast as a model organism.

  2. Dissecting ribosome assembly and transport in budding yeast.

    Science.gov (United States)

    Altvater, Martin; Schütz, Sabina; Chang, Yiming; Panse, Vikram Govind

    2014-01-01

    Construction of the eukaryotic ribosome begins in the nucleolus and requires >300 evolutionarily conserved nonribosomal trans-acting factors, which transiently associate with preribosomal subunits at distinct assembly stages. A subset of trans-acting and transport factors passage assembled preribosomal subunits in a functionally inactive state through the nuclear pore complexes (NPC) into the cytoplasm, where they undergo final maturation before initiating translation. Here, we summarize the repertoire of tools developed in the model organism budding yeast that are spearheading the functional analyses of trans-acting factors involved in the assembly and intracellular transport of preribosomal subunits. We elaborate on different GFP-tagged ribosomal protein reporters and a pre-rRNA reporter that reliably monitors the movement of preribosomal particles from the nucleolus to cytoplasm. We discuss the powerful yeast heterokaryon assay, which can be employed to uncover shuttling trans-acting factors that need to accompany preribosomal subunits to the cytoplasm to be released prior to initiating translation. Moreover, we present two biochemical approaches, namely sucrose gradient analyses and tandem affinity purification, that are rapidly facilitating the uncovering of regulatory processes that control the compositional dynamics of trans-acting factors on maturing preribosomal particles. Altogether, these approaches when combined with traditional analytical biochemistry, targeted proteomics and structural methodologies, will contribute to the dissection of the assembly and intracellular transport of preribosomal subunits, as well as other macromolecular assemblies that influence diverse biological pathways. PMID:24857742

  3. Genetic control of x-ray resistance in budding yeast cells

    International Nuclear Information System (INIS)

    Five x-ray-sensitive mutants were selected from 10,000 colonies arising from survivors of ultraviolet light. These were named XS5, XS6, XS7, XS8, and XS9. Mutant XS1 was donated by Nakai. These mutations affect the resistant budding cell survival component of the survival curve and, in diploids, the low-dose interdivisional cell shoulder. They are of two types: Class I, in which budding cells lack resistance; and Class II, in which budding cells show reduced resistance. When crossed with one another, they show a complex complementation pattern. Gene dosage effects are seen in XS1 heterozygotes, while budding but not between divisions. No direct correlation between radiation sensitivity, meiosis, and sporulation is observed; genes which influence radiation sensitivity do not affect meiotic recombination. A single mutation (XS1 or XS5) suppresses the shoulders of the survival curves of both budding haploid cells and diploid nonbudding cells

  4. The cellular robustness by genetic redundancy in budding yeast.

    Directory of Open Access Journals (Sweden)

    Jingjing Li

    2010-11-01

    Full Text Available The frequent dispensability of duplicated genes in budding yeast is heralded as a hallmark of genetic robustness contributed by genetic redundancy. However, theoretical predictions suggest such backup by redundancy is evolutionarily unstable, and the extent of genetic robustness contributed from redundancy remains controversial. It is anticipated that, to achieve mutual buffering, the duplicated paralogs must at least share some functional overlap. However, counter-intuitively, several recent studies reported little functional redundancy between these buffering duplicates. The large yeast genetic interactions released recently allowed us to address these issues on a genome-wide scale. We herein characterized the synthetic genetic interactions for ∼500 pairs of yeast duplicated genes originated from either whole-genome duplication (WGD or small-scale duplication (SSD events. We established that functional redundancy between duplicates is a pre-requisite and thus is highly predictive of their backup capacity. This observation was particularly pronounced with the use of a newly introduced metric in scoring functional overlap between paralogs on the basis of gene ontology annotations. Even though mutual buffering was observed to be prevalent among duplicated genes, we showed that the observed backup capacity is largely an evolutionarily transient state. The loss of backup capacity generally follows a neutral mode, with the buffering strength decreasing in proportion to divergence time, and the vast majority of the paralogs have already lost their backup capacity. These observations validated previous theoretic predictions about instability of genetic redundancy. However, departing from the general neutral mode, intriguingly, our analysis revealed the presence of natural selection in stabilizing functional overlap between SSD pairs. These selected pairs, both WGD and SSD, tend to have decelerated functional evolution, have higher propensities of co

  5. The fission yeast heterochromatin protein Rik1 is required for telomere clustering during meiosis

    DEFF Research Database (Denmark)

    Tuzon, Creighton T; Borgstrøm, Britta; Weilguny, Dietmar;

    2004-01-01

    Telomeres share the ability to silence nearby transcription with heterochromatin, but the requirement of heterochromatin proteins for most telomere functions is unknown. The fission yeast Rik1 protein is required for heterochromatin formation at centromeres and the mating-type locus, as it recrui...... meiosis. However, Rik1 is dispensable for the protective roles of telomeres in preventing chromosome end-fusion. Thus, a Swi6-independent heterochromatin function distinct from that at centromeres and the mating-type locus operates at telomeres during sexual differentiation....

  6. Stage-specific effects of X-irradiation on Yeast meiosis

    International Nuclear Information System (INIS)

    Previous work has shown that cdc 13 causes meiotic arrest of Saccharomyces cerevisiae following DNA replication by a RAD9-dependent mechanism. In the present work, the authors have further investigated the implicit effects of chromosomal lesions on progression through meiosis by exposing yeast cells to X-irradiation at various times during sporulation. They find that exposure of RAD9 cells to X-irradiation early in meiosis prevents sporulation, arresting the cells at a stage prior to premeiotic DNA replication. rad9 meiotic cells are much less responsive to X-irradiation damage, completing sporulation after treatment with doses sufficient to cause arrest of RAD9 strains. These findings thereby reveal a RAD9-dependent checkpoint function in meiosis that is distinct from the G2 arrest previously shown to result from cdc 13 dysfunction. Analysis of the spores that continued to be produced by either RAD9 or rad9 cultures that were X-irradiated in later stages of sporulation revealed most spores to be viable, even after exposure to radiation doses sufficient to kill most vegetative cells. This finding demonstrates that the lesions induced by X-irradiation at later times fail to trigger the checkpoint function revealed by cdc 13 arrest and suggests that the lesions may be subject to repair by serving as intermediates in the recombination process. Strains mutant for chromosomal synapsis and recombination, and therefore defective in meiotic disjunction, were tested for evidence that X-ray-induced lesions might alleviate inviability by promoting recombination. Enhancement of spore viability when spo 11 (but not hop 1) diploids were X-irradiated during meiosis indicates that induced lesions may partially substitute for SPO 11-dependent functions that are required for the initiation of recombination. 74 refs., 3 figs., 6 tabs

  7. Integrative analysis of cell cycle control in budding yeast.

    Science.gov (United States)

    Chen, Katherine C; Calzone, Laurence; Csikasz-Nagy, Attila; Cross, Frederick R; Novak, Bela; Tyson, John J

    2004-08-01

    The adaptive responses of a living cell to internal and external signals are controlled by networks of proteins whose interactions are so complex that the functional integration of the network cannot be comprehended by intuitive reasoning alone. Mathematical modeling, based on biochemical rate equations, provides a rigorous and reliable tool for unraveling the complexities of molecular regulatory networks. The budding yeast cell cycle is a challenging test case for this approach, because the control system is known in exquisite detail and its function is constrained by the phenotypic properties of >100 genetically engineered strains. We show that a mathematical model built on a consensus picture of this control system is largely successful in explaining the phenotypes of mutants described so far. A few inconsistencies between the model and experiments indicate aspects of the mechanism that require revision. In addition, the model allows one to frame and critique hypotheses about how the division cycle is regulated in wild-type and mutant cells, to predict the phenotypes of new mutant combinations, and to estimate the effective values of biochemical rate constants that are difficult to measure directly in vivo. PMID:15169868

  8. Timing robustness in the budding and fission yeast cell cycles.

    KAUST Repository

    Mangla, Karan

    2010-02-01

    Robustness of biological models has emerged as an important principle in systems biology. Many past analyses of Boolean models update all pending changes in signals simultaneously (i.e., synchronously), making it impossible to consider robustness to variations in timing that result from noise and different environmental conditions. We checked previously published mathematical models of the cell cycles of budding and fission yeast for robustness to timing variations by constructing Boolean models and analyzing them using model-checking software for the property of speed independence. Surprisingly, the models are nearly, but not totally, speed-independent. In some cases, examination of timing problems discovered in the analysis exposes apparent inaccuracies in the model. Biologically justified revisions to the model eliminate the timing problems. Furthermore, in silico random mutations in the regulatory interactions of a speed-independent Boolean model are shown to be unlikely to preserve speed independence, even in models that are otherwise functional, providing evidence for selection pressure to maintain timing robustness. Multiple cell cycle models exhibit strong robustness to timing variation, apparently due to evolutionary pressure. Thus, timing robustness can be a basis for generating testable hypotheses and can focus attention on aspects of a model that may need refinement.

  9. 5'-end sequences of budding yeast full-length cDNA clones and quality scores - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Budding yeast cDNA sequencing project 5'-end sequences of budding yeast full-length cDNA clones and quality ...scores Data detail Data name 5'-end sequences of budding yeast full-length cDNA clones and quality scores De...from the budding yeast full-length cDNA library by the vector-capping method, the sequence quality score gen...s accession only. Sequence 5'-end sequence data of budding yeast full-length cDNA clones. FASTA format. Quality Phred's quality... Update History of This Database Site Policy | Contact Us 5'-end sequences of budding yeast full-length cDNA clones and quality

  10. Specific residues of the GDP/GTP exchange factor Bud5p are involved in establishment of the cell type-specific budding pattern in yeast.

    Science.gov (United States)

    Kang, Pil Jung; Lee, Bongyong; Park, Hay-Oak

    2004-07-01

    Cells of the budding yeast undergo oriented cell division by choosing a specific site for growth depending on their cell type. Haploid a and alpha cells bud in an axial pattern whereas diploid a/alpha cells bud in a bipolar pattern. The Ras-like GTPase Rsr1p/Bud1p, its GDP-GTP exchange factor Bud5p, and its GTPase-activating protein Bud2p are essential for selecting the proper site for polarized growth in all cell types. Here we showed that specific residues at the N terminus and the C terminus of Bud5p were important for bipolar budding, while some residues were involved in both axial and bipolar budding. These bipolar-specific mutations of BUD5 disrupted proper localization of Bud5p in diploid a/alpha cells without affecting Bud5p localization in haploid alpha cells. In contrast, Bud5p expressed in the bud5 mutants defective in both budding patterns failed to localize in all cell types. Thus, these results identify specific residues of Bud5p that are likely to be involved in direct interaction with spatial landmarks, which recruit Bud5p to the proper bud site. Finally, we found a new start codon of BUD5, which extends the open reading frame to 210 bp upstream of the previously estimated start site, thus encoding a polypeptide of 608 amino acid residues. Bud5p with these additional N-terminal residues interacted with Bud8p, a potential bipolar landmark, suggesting that the N-terminal region is necessary for recognition of the spatial cues. PMID:15136576

  11. Chemical Genetics: Budding Yeast as a Platform for Drug Discovery and Mapping of Genetic Pathways

    Directory of Open Access Journals (Sweden)

    Jorrit M. Enserink

    2012-08-01

    Full Text Available The budding yeast Saccharomyces cerevisiae is a widely used model organism, and yeast genetic methods are powerful tools for discovery of novel functions of genes. Recent advancements in chemical-genetics and chemical-genomics have opened new avenues for development of clinically relevant drug treatments. Systematic mapping of genetic networks by high-throughput chemical-genetic screens have given extensive insight in connections between genetic pathways. Here, I review some of the recent developments in chemical-genetic techniques in budding yeast.

  12. The product of the mei3+ gene, expressed under control of the mating-type locus, induces meiosis and sporulation in fission yeast.

    OpenAIRE

    McLeod, M; Stein, M.; Beach, D

    1987-01-01

    In fission yeast the ability to undergo meiosis and sporulation is conferred by the matP+ and matM+ genes of the mating-type locus. Inactivation of ran1+, a negative regulator of meiosis, is thought to be an essential step in meiotic initiation. We have isolated a further meiotic control gene mei3+, and have shown the following: a null allele of mei3 totally inhibits meiosis; the mei3+ RNA transcript and its translational product are expressed only in matP+/matM+ diploids entering meiosis; fo...

  13. Whole lifespan microscopic observation of budding yeast aging through a microfluidic dissection platform

    OpenAIRE

    Lee, Sung Sik; Avalos Vizcarra, Ima; Huberts, Daphne H. E. W.; Lee, Luke P; Heinemann, Matthias

    2012-01-01

    Important insights into aging have been generated with the genetically tractable and short-lived budding yeast. However, it is still impossible today to continuously track cells by high-resolution microscopic imaging (e.g., fluorescent imaging) throughout their entire lifespan. Instead, the field still needs to rely on a 50-y-old laborious and time-consuming method to assess the lifespan of yeast cells and to isolate differentially aged cells for microscopic snapshots via manual dissection of...

  14. CENP-A exceeds microtubule attachment sites in centromere clusters of both budding and fission yeast

    OpenAIRE

    Coffman, Valerie C.; Wu, Pengcheng; Parthun, Mark R.; Wu, Jian-Qiu

    2011-01-01

    The stoichiometries of kinetochores and their constituent proteins in yeast and vertebrate cells were determined using the histone H3 variant CENP-A, known as Cse4 in budding yeast, as a counting standard. One Cse4-containing nucleosome exists in the centromere (CEN) of each chromosome, so it has been assumed that each anaphase CEN/kinetochore cluster contains 32 Cse4 molecules. We report that anaphase CEN clusters instead contained approximately fourfold more Cse4 in Saccharomyces cerevisiae...

  15. Study of budding yeast colony formation and its characterizations by using circular granular cell

    Science.gov (United States)

    Aprianti, D.; Haryanto, F.; Purqon, A.; Khotimah, S. N.; Viridi, S.

    2016-03-01

    Budding yeast can exhibit colony formation in solid substrate. The colony of pathogenic budding yeast can colonize various surfaces of the human body and medical devices. Furthermore, it can form biofilm that resists drug effective therapy. The formation of the colony is affected by the interaction between cells and with its growth media. The cell budding pattern holds an important role in colony expansion. To study this colony growth, the molecular dynamic method was chosen to simulate the interaction between budding yeast cells. Every cell was modelled by circular granular cells, which can grow and produce buds. Cohesion force, contact force, and Stokes force govern this model to mimic the interaction between cells and with the growth substrate. Characterization was determined by the maximum (L max) and minimum (L min) distances between two cells within the colony and whether two lines that connect the two cells in the maximum and minimum distances intersect each other. Therefore, it can be recognized the colony shape in circular, oval, and irregular shapes. Simulation resulted that colony formation are mostly in oval shape with little branch. It also shows that greater cohesion strength obtains more compact colony formation.

  16. The SpoMBe pathway drives membrane bending necessary for cytokinesis and spore formation in yeast meiosis

    OpenAIRE

    Maier, Peter; Rathfelder, Nicole; Maeder, Celine I.; Colombelli, Julien; Stelzer, Ernst H.K.; Knop, Michael

    2008-01-01

    Precise control over organelle shapes is essential for cellular organization and morphogenesis. During yeast meiosis, prospore membranes (PSMs) constitute bell-shaped organelles that enwrap the postmeiotic nuclei leading to the cellularization of the mother cell's cytoplasm and to spore formation. Here, we analysed how the PSMs acquire their curved bell-shaped structure. We discovered that two antagonizing forces ensure PSM shaping and proper closure during cytokinesis. The Ssp1p-containing c...

  17. Whole lifespan microscopic observation of budding yeast aging through a microfluidic dissection platform

    NARCIS (Netherlands)

    Lee, Sung Sik; Avalos Vizcarra, Ima; Huberts, Daphne H E W; Lee, Luke P; Heinemann, Matthias

    2012-01-01

    Important insights into aging have been generated with the genetically tractable and short-lived budding yeast. However, it is still impossible today to continuously track cells by high-resolution microscopic imaging (e.g., fluorescent imaging) throughout their entire lifespan. Instead, the field st

  18. Continuous High-resolution Microscopic Observation of Replicative Aging in Budding Yeast

    NARCIS (Netherlands)

    Huberts, Daphne H. E. W.; Janssens, Georges E.; Lee, Sung Sik; Vizcarra, Ima Avalos; Heinemann, Matthias

    2013-01-01

    We demonstrate the use of a simple microfluidic setup, in which single budding yeast cells can be tracked throughout their entire lifespan. The microfluidic chip exploits the size difference between mother and daughter cells using an array of micropads. Upon loading, cells are trapped underneath the

  19. Budding yeast PAK kinases regulate mitotic exit by two different mechanisms

    OpenAIRE

    Chiroli, Elena; Fraschini, Roberta; Beretta, Alessia; Tonelli, Mariagrazia; Lucchini, Giovanna; Piatti, Simonetta

    2003-01-01

    We report the characterization of the dominant-negative CLA4t allele of the budding yeast CLA4 gene, encoding a member of the p21-activated kinase (PAK) family of protein kinases, which, together with its homologue STE20, plays an essential role in promoting budding and cytokinesis. Overproduction of the Cla4t protein likely inhibits both endogenous Cla4 and Ste20 and causes a delay in the onset of anaphase that correlates with inactivation of Cdc20/anaphase-promoting complex (APC)–dependent ...

  20. Proliferation enhancement of budding yeast and mammalian cells with periodic oxygen radical treatment

    Science.gov (United States)

    Mori, Yosuke; Kobayashi, Jun; Murata, Tomiyasu; Hahizume, Hiroshi; Hori, Masaru; Ito, Masafumi

    2015-09-01

    Recently, nonequilibrium atmospheric-pressure plasmas have been intensively studied for biological applications. However, the each effect of species in plasmas to biological tissue has not been clarified yet because various factors exist in the plasmas. Accordingly, we have studied effects of atomic oxygen dose on cell growth such as budding yeast and mouse NIH3T3 fibroblasts of mammalian cells. Both of cells were suspended with PBS, and treated using oxygen radical source. In order to prevent the radicals from reacting with the ambient air, the treatment region was surrounded by a plastic cover and purged with Ar. The proliferative effect of 15 % was observed at the O3Pj dose of around 1 . 0 ×1017 cm-3 in NIH3T3 cells as well as in yeast cells. Moreover, periodic oxygen treatment enhanced the effect in budding yeast cells. The best interval of periodic oxygen radical treatment was around 2 hours, which is almost the same period as that of their cell cycle. With the optimum interval time, we have investigated the effect of the number of the treatments. As the number of treatments increases, the growth rate of budding yeast cells was gradually enhanced and saturated at thrice treatments. This work was partly supported by JSPS KAKENHI Grant Numbers 26286072 and project for promoting Research Center in Meijo University.

  1. Force Generation by Endocytic Actin Patches in Budding Yeast

    OpenAIRE

    Carlsson, Anders E.; Bayly, Philip V.

    2014-01-01

    Membrane deformation during endocytosis in yeast is driven by local, templated assembly of a sequence of proteins including polymerized actin and curvature-generating coat proteins such as clathrin. Actin polymerization is required for successful endocytosis, but it is not known by what mechanisms actin polymerization generates the required pulling forces. To address this issue, we develop a simulation method in which the actin network at the protein patch is modeled as an active gel. The def...

  2. The pachytene checkpoint prevents accumulation and phosphorylation of the meiosis-specific transcription factor Ndt80

    OpenAIRE

    Tung, Kuei-Shu; Hong, Eun-Jin Erica; Roeder, G. Shirleen

    2000-01-01

    In budding yeast, many mutants defective in meiotic recombination and chromosome synapsis undergo checkpoint-mediated arrest at the pachytene stage of meiotic prophase. We recovered the NDT80 gene in a screen for genes whose overexpression bypasses the pachytene checkpoint. Ndt80 is a meiosis-specific transcription factor that promotes expression of genes required for exit from pachytene and entry into meiosis I. Herein, we show that the Ndt80 protein accumulates a...

  3. Clathrin-mediated endocytosis in budding yeast at a glance.

    Science.gov (United States)

    Lu, Rebecca; Drubin, David G; Sun, Yidi

    2016-04-15

    Clathrin-mediated endocytosis is an essential cellular process that involves the concerted assembly and disassembly of many different proteins at the plasma membrane. In yeast, live-cell imaging has shown that the spatiotemporal dynamics of these proteins is highly stereotypical. Recent work has focused on determining how the timing and functions of endocytic proteins are regulated. In this Cell Science at a Glance article and accompanying poster, we review our current knowledge of the timeline of endocytic site maturation and discuss recent works focusing on how phosphorylation, ubiquitylation and lipids regulate various aspects of the process. PMID:27084361

  4. The conserved protein kinase Ipl1 regulates microtubule binding to kinetochores in budding yeast

    OpenAIRE

    Biggins, Sue; Fedor F. Severin; Bhalla, Needhi; Sassoon, Ingrid; Hyman, Anthony A.; Murray, Andrew W.

    1999-01-01

    Chromosome segregation depends on kinetochores, the structures that mediate chromosome attachment to the mitotic spindle. We isolated mutants in IPL1, which encodes a protein kinase, in a screen for budding yeast mutants that have defects in sister chromatid separation and segregation. Cytological tests show that ipl1 mutants can separate sister chromatids but are defective in chromosome segregation. Kinetochores assembled in extracts from ipl1 mutants show altered binding to microtubules. Ip...

  5. The budding yeast Ipl1/Aurora protein kinase regulates mitotic spindle disassembly

    OpenAIRE

    Buvelot, Stéphanie; Tatsutani, Sean Y.; Vermaak, Danielle; Biggins, Sue

    2003-01-01

    Ipl1p is the budding yeast member of the Aurora family of protein kinases, critical regulators of genomic stability that are required for chromosome segregation, the spindle checkpoint, and cytokinesis. Using time-lapse microscopy, we found that Ipl1p also has a function in mitotic spindle disassembly that is separable from its previously identified roles. Ipl1–GFP localizes to kinetochores from G1 to metaphase, transfers to the spindle after metaphase, and accumulates at the spindle midzone ...

  6. Biophysical Characterization of the Centromere-specific Nucleosome from Budding Yeast*

    OpenAIRE

    Kingston, Isabel J.; Yung, Jasmine S. Y.; Singleton, Martin R

    2010-01-01

    The centromeric DNA of all eukaryotes is assembled upon a specialized nucleosome containing a histone H3 variant known as CenH3. Despite the importance and conserved nature of this protein, the characteristics of the centromeric nucleosome are still poorly understood. In particular, the stoichiometry and DNA-binding properties of the CenH3 nucleosome have been the subject of some debate. We have characterized the budding yeast centromeric nucleosome by biochemical and biophysical methods and ...

  7. Cse4 is Part of an Octameric Nucleosome in Budding Yeast

    OpenAIRE

    Camahort, Raymond; Shivaraju, Manjunatha; Mattingly, Mark; Li, Bing; Nakanishi, Shima; Zhu, Dongxiao; Shilatifard, Ali; Workman, Jerry L.; Gerton, Jennifer L.

    2009-01-01

    The budding yeast CenH3 histone variant Cse4 localizes to centromeric nucleosomes and is required for kinetochore assembly and chromosome segregation. The exact composition of centromeric Cse4–containing nucleosomes is a subject of debate. ChIP-chip experiments and high resolution quantitative PCR confirm that there is a single Cse4 nucleosome at each centromere, and additional regions of the genome contain Cse4 nucleosomes at low levels. Using unbiased biochemical, cell biological, and genet...

  8. Screening the Budding Yeast Genome Reveals Unique Factors Affecting K2 Toxin Susceptibility

    OpenAIRE

    Elena Servienė; Juliana Lukša; Irma Orentaitė; Lafontaine, Denis L. J.; Jaunius Urbonavičius

    2012-01-01

    BACKGROUND: Understanding how biotoxins kill cells is of prime importance in biomedicine and the food industry. The budding yeast (S. cerevisiae) killers serve as a convenient model to study the activity of biotoxins consistently supplying with significant insights into the basic mechanisms of virus-host cell interactions and toxin entry into eukaryotic target cells. K1 and K2 toxins are active at the cell wall, leading to the disruption of the plasma membrane and subsequent cell death by ion...

  9. cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Budding yeast cDNA sequencing project cDNA sequence quality data Data detail Data name cDNA sequence quality... data Description of data contents Phred's quality score. PHD format, one file to a single cDNA data, and co...ription Download License Update History of This Database Site Policy | Contact Us cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive ...

  10. The Malleable Nature of the Budding Yeast Nuclear Envelope: Flares, Fusion, and Fenestrations.

    Science.gov (United States)

    Meseroll, Rebecca A; Cohen-Fix, Orna

    2016-11-01

    In eukaryotes, the nuclear envelope (NE) physically separates nuclear components and activities from rest of the cell. The NE also provides rigidity to the nucleus and contributes to chromosome organization. At the same time, the NE is highly dynamic; it must change shape and rearrange its components during development and throughout the cell cycle, and its morphology can be altered in response to mutation and disease. Here we focus on the NE of budding yeast, Saccharomyces cerevisiae, which has several unique features: it remains intact throughout the cell cycle, expands symmetrically during interphase, elongates during mitosis and, expands asymmetrically during mitotic delay. Moreover, its NE is safely breached during mating and when large structures, such as nuclear pore complexes and the spindle pole body, are embedded into its double membrane. The budding yeast NE lacks lamins and yet the nucleus is capable of maintaining a spherical shape throughout interphase. Despite these eccentricities, studies of the budding yeast NE have uncovered interesting, and likely conserved, processes that contribute to NE dynamics. In particular, we discuss the processes that drive and enable NE expansion and the dramatic changes in the NE that lead to extensions and fenestrations. J. Cell. Physiol. 231: 2353-2360, 2016. Published 2016. This article is a U.S. Government work and is in the public domain in the USA. PMID:26909870

  11. Relationship between sensitivity to ultraviolet light and budding in yeast cells of different culture ages

    International Nuclear Information System (INIS)

    Subpopulations of yeast cells, consisting of cells of different sizes and different percentages of budding cells, were prepared by centrifugation through sucrose solutions with linear density gradients of cultures at different phases of the growth cycle. Ultraviolet survival of these cells was determined by colony counting, and the survival rate was compared with the cells' respiratory rates. Individual budding cells and interdivisional cells, and also mother cells and daughter cells derived from irradiated budding cells, were isolated by the micromanipulation technique. The number of divisions in each cell was measured during a 21-hr incubation period immediately after irradiation. In the population in the logarithmic phase consisting of homogeneous cells of middle size, no difference in uv sensitivity was observed between mother cells and daughter cells, irrespective of mutual adhesion. Budding cell resistance was observed in the population in the transitional phase; this was due to the lesser uv sensitivity of daughter cells in the fresh medium. In the stationary phase, daughter cells were rather more sensitive than mother cells or interdivisional cells, so there was little difference in uv sensitivity between budding cells and interdivisional cells

  12. Acetylation regulates monopolar attachment at multiple levels during meiosis I in fission yeast

    OpenAIRE

    Kagami, Ayano; Sakuno, Takeshi; Yamagishi, Yuya; Ishiguro, Tadashi; Tsukahara, Tatsuya; Shirahige, Katsuhiko; Tanaka, Koichi; Watanabe, Yoshinori

    2011-01-01

    This study shows that multiple acetylations are crucial for establishing and maintaining core centromere cohesion in meiosis. Eso1 establishes it during S phase, whereas Moa1 maintains cohesion after S phase.

  13. Direct and indirect control of the initiation of meiotic recombination by DNA damage checkpoint mechanisms in budding yeast.

    Directory of Open Access Journals (Sweden)

    Bilge Argunhan

    Full Text Available Meiotic recombination plays an essential role in the proper segregation of chromosomes at meiosis I in many sexually reproducing organisms. Meiotic recombination is initiated by the scheduled formation of genome-wide DNA double-strand breaks (DSBs. The timing of DSB formation is strictly controlled because unscheduled DSB formation is detrimental to genome integrity. Here, we investigated the role of DNA damage checkpoint mechanisms in the control of meiotic DSB formation using budding yeast. By using recombination defective mutants in which meiotic DSBs are not repaired, the effect of DNA damage checkpoint mutations on DSB formation was evaluated. The Tel1 (ATM pathway mainly responds to unresected DSB ends, thus the sae2 mutant background in which DSB ends remain intact was employed. On the other hand, the Mec1 (ATR pathway is primarily used when DSB ends are resected, thus the rad51 dmc1 double mutant background was employed in which highly resected DSBs accumulate. In order to separate the effect caused by unscheduled cell cycle progression, which is often associated with DNA damage checkpoint defects, we also employed the ndt80 mutation which permanently arrests the meiotic cell cycle at prophase I. In the absence of Tel1, DSB formation was reduced in larger chromosomes (IV, VII, II and XI whereas no significant reduction was found in smaller chromosomes (III and VI. On the other hand, the absence of Rad17 (a critical component of the ATR pathway lead to an increase in DSB formation (chromosomes VII and II were tested. We propose that, within prophase I, the Tel1 pathway facilitates DSB formation, especially in bigger chromosomes, while the Mec1 pathway negatively regulates DSB formation. We also identified prophase I exit, which is under the control of the DNA damage checkpoint machinery, to be a critical event associated with down-regulating meiotic DSB formation.

  14. Mek1 Down Regulates Rad51 Activity during Yeast Meiosis by Phosphorylation of Hed1.

    Science.gov (United States)

    Callender, Tracy L; Laureau, Raphaelle; Wan, Lihong; Chen, Xiangyu; Sandhu, Rima; Laljee, Saif; Zhou, Sai; Suhandynata, Ray T; Prugar, Evelyn; Gaines, William A; Kwon, YoungHo; Börner, G Valentin; Nicolas, Alain; Neiman, Aaron M; Hollingsworth, Nancy M

    2016-08-01

    During meiosis, programmed double strand breaks (DSBs) are repaired preferentially between homologs to generate crossovers that promote proper chromosome segregation at Meiosis I. In many organisms, there are two strand exchange proteins, Rad51 and the meiosis-specific Dmc1, required for interhomolog (IH) bias. This bias requires the presence, but not the strand exchange activity of Rad51, while Dmc1 is responsible for the bulk of meiotic recombination. How these activities are regulated is less well established. In dmc1Δ mutants, Rad51 is actively inhibited, thereby resulting in prophase arrest due to unrepaired DSBs triggering the meiotic recombination checkpoint. This inhibition is dependent upon the meiosis-specific kinase Mek1 and occurs through two different mechanisms that prevent complex formation with the Rad51 accessory factor Rad54: (i) phosphorylation of Rad54 by Mek1 and (ii) binding of Rad51 by the meiosis-specific protein Hed1. An open question has been why inhibition of Mek1 affects Hed1 repression of Rad51. This work shows that Hed1 is a direct substrate of Mek1. Phosphorylation of Hed1 at threonine 40 helps suppress Rad51 activity in dmc1Δ mutants by promoting Hed1 protein stability. Rad51-mediated recombination occurring in the absence of Hed1 phosphorylation results in a significant increase in non-exchange chromosomes despite wild-type levels of crossovers, confirming previous results indicating a defect in crossover assurance. We propose that Rad51 function in meiosis is regulated in part by the coordinated phosphorylation of Rad54 and Hed1 by Mek1. PMID:27483004

  15. Screening the budding yeast genome reveals unique factors affecting K2 toxin susceptibility.

    Directory of Open Access Journals (Sweden)

    Elena Servienė

    Full Text Available BACKGROUND: Understanding how biotoxins kill cells is of prime importance in biomedicine and the food industry. The budding yeast (S. cerevisiae killers serve as a convenient model to study the activity of biotoxins consistently supplying with significant insights into the basic mechanisms of virus-host cell interactions and toxin entry into eukaryotic target cells. K1 and K2 toxins are active at the cell wall, leading to the disruption of the plasma membrane and subsequent cell death by ion leakage. K28 toxin is active in the cell nucleus, blocking DNA synthesis and cell cycle progression, thereby triggering apoptosis. Genome-wide screens in the budding yeast S. cerevisiae identified several hundred effectors of K1 and K28 toxins. Surprisingly, no such screen had been performed for K2 toxin, the most frequent killer toxin among industrial budding yeasts. PRINCIPAL FINDINGS: We conducted several concurrent genome-wide screens in S. cerevisiae and identified 332 novel K2 toxin effectors. The effectors involved in K2 resistance and hypersensitivity largely map in distinct cellular pathways, including cell wall and plasma membrane structure/biogenesis and mitochondrial function for K2 resistance, and cell wall stress signaling and ion/pH homeostasis for K2 hypersensitivity. 70% of K2 effectors are different from those involved in K1 or K28 susceptibility. SIGNIFICANCE: Our work demonstrates that despite the fact that K1 and K2 toxins share some aspects of their killing strategies, they largely rely on different sets of effectors. Since the vast majority of the host factors identified here is exclusively active towards K2, we conclude that cells have acquired a specific K2 toxin effectors set. Our work thus indicates that K1 and K2 have elaborated different biological pathways and provides a first step towards the detailed characterization of K2 mode of action.

  16. Cdc7-Dbf4 Is a Gene-Specific Regulator of Meiotic Transcription in Yeast

    OpenAIRE

    Lo, Hsiao-Chi; Kunz, Ryan C.; Chen, Xiangyu; Marullo, Allison; Steven P Gygi; Hollingsworth, Nancy M.

    2012-01-01

    Meiosis divides the chromosome number of the cell in half by having two rounds of chromosome segregation follow a single round of chromosome duplication. The first meiotic division is unique in that homologous pairs of sister chromatids segregate to opposite poles. Recent work in budding and fission yeast has shown that the cell cycle kinase, Cdc7-Dbf4, is required for many meiosis-specific chromosomal functions necessary for proper disjunction at meiosis I. This work reveals another role for...

  17. The centromeric nucleosome of budding yeast is perfectly positioned and covers the entire centromere

    OpenAIRE

    Cole, Hope A.; Howard, Bruce H.; David J Clark

    2011-01-01

    The centromeres of budding yeast are ∼120 bp in size and contain three functional elements: an AT-rich region flanked by binding sites for Cbf1 and CBF3. A specialized nucleosome containing the H3 variant Cse4 (CenH3) is formed at the centromere. Our genome-wide paired-end sequencing of nucleosomal DNA reveals that the centromeric nucleosome contains a micrococcal nuclease-resistant kernel of 123–135 bp, depending on the centromere, and is therefore significantly shorter than the canonical nu...

  18. CENP-A exceeds microtubule attachment sites in centromere clusters of both budding and fission yeast.

    Science.gov (United States)

    Coffman, Valerie C; Wu, Pengcheng; Parthun, Mark R; Wu, Jian-Qiu

    2011-11-14

    The stoichiometries of kinetochores and their constituent proteins in yeast and vertebrate cells were determined using the histone H3 variant CENP-A, known as Cse4 in budding yeast, as a counting standard. One Cse4-containing nucleosome exists in the centromere (CEN) of each chromosome, so it has been assumed that each anaphase CEN/kinetochore cluster contains 32 Cse4 molecules. We report that anaphase CEN clusters instead contained approximately fourfold more Cse4 in Saccharomyces cerevisiae and ~40-fold more CENP-A (Cnp1) in Schizosaccharomyces pombe than predicted. These results suggest that the number of CENP-A molecules exceeds the number of kinetochore-microtubule (MT) attachment sites on each chromosome and that CENP-A is not the sole determinant of kinetochore assembly sites in either yeast. In addition, we show that fission yeast has enough Dam1-DASH complex for ring formation around attached MTs. The results of this study suggest the need for significant revision of existing CEN/kinetochore architectural models. PMID:22084306

  19. Astral microtubule pivoting promotes their search for cortical anchor sites during mitosis in budding yeast.

    Directory of Open Access Journals (Sweden)

    Stephan Baumgärtner

    Full Text Available Positioning of the mitotic spindle is crucial for proper cell division. In the budding yeast Saccharomyces cerevisiae, two mechanisms contribute to spindle positioning. In the Kar9 pathway, astral microtubules emanating from the daughter-bound spindle pole body interact via the linker protein Kar9 with the myosin Myo2, which moves the microtubule along the actin cables towards the neck. In the dynein pathway, astral microtubules off-load dynein onto the cortical anchor protein Num1, which is followed by dynein pulling on the spindle. Yet, the mechanism by which microtubules target cortical anchor sites is unknown. Here we quantify the pivoting motion of astral microtubules around the spindle pole bodies, which occurs during spindle translocation towards the neck and through the neck. We show that this pivoting is largely driven by the Kar9 pathway. The microtubules emanating from the daughter-bound spindle pole body pivot faster than those at the mother-bound spindle pole body. The Kar9 pathway reduces the time needed for an astral microtubule inside the daughter cell to start pulling on the spindle. Thus, we propose a new role for microtubule pivoting: By pivoting around the spindle pole body, microtubules explore the space laterally, which helps them search for cortical anchor sites in the context of spindle positioning in budding yeast.

  20. Divergence of a conserved elongation factor and transcription regulation in budding and fission yeast.

    Science.gov (United States)

    Booth, Gregory T; Wang, Isabel X; Cheung, Vivian G; Lis, John T

    2016-06-01

    Complex regulation of gene expression in mammals has evolved from simpler eukaryotic systems, yet the mechanistic features of this evolution remain elusive. Here, we compared the transcriptional landscapes of the distantly related budding and fission yeast. We adapted the Precision Run-On sequencing (PRO-seq) approach to map the positions of RNA polymerase active sites genome-wide in Schizosaccharomyces pombe and Saccharomyces cerevisiae. Additionally, we mapped preferred sites of transcription initiation in each organism using PRO-cap. Unexpectedly, we identify a pause in early elongation, specific to S. pombe, that requires the conserved elongation factor subunit Spt4 and resembles promoter-proximal pausing in metazoans. PRO-seq profiles in strains lacking Spt4 reveal globally elevated levels of transcribing RNA Polymerase II (Pol II) within genes in both species. Messenger RNA abundance, however, does not reflect the increases in Pol II density, indicating a global reduction in elongation rate. Together, our results provide the first base-pair resolution map of transcription elongation in S. pombe and identify divergent roles for Spt4 in controlling elongation in budding and fission yeast. PMID:27197211

  1. Ingression Progression Complexes Control Extracellular Matrix Remodelling during Cytokinesis in Budding Yeast

    Science.gov (United States)

    Foltman, Magdalena; Molist, Iago; Arcones, Irene; Sacristan, Carlos; Filali-Mouncef, Yasmina; Roncero, Cesar; Sanchez-Diaz, Alberto

    2016-01-01

    Eukaryotic cells must coordinate contraction of the actomyosin ring at the division site together with ingression of the plasma membrane and remodelling of the extracellular matrix (ECM) to support cytokinesis, but the underlying mechanisms are still poorly understood. In eukaryotes, glycosyltransferases that synthesise ECM polysaccharides are emerging as key factors during cytokinesis. The budding yeast chitin synthase Chs2 makes the primary septum, a special layer of the ECM, which is an essential process during cell division. Here we isolated a group of actomyosin ring components that form complexes together with Chs2 at the cleavage site at the end of the cell cycle, which we named ‘ingression progression complexes’ (IPCs). In addition to type II myosin, the IQGAP protein Iqg1 and Chs2, IPCs contain the F-BAR protein Hof1, and the cytokinesis regulators Inn1 and Cyk3. We describe the molecular mechanism by which chitin synthase is activated by direct association of the C2 domain of Inn1, and the transglutaminase-like domain of Cyk3, with the catalytic domain of Chs2. We used an experimental system to find a previously unanticipated role for the C-terminus of Inn1 in preventing the untimely activation of Chs2 at the cleavage site until Cyk3 releases the block on Chs2 activity during late mitosis. These findings support a model for the co-ordinated regulation of cell division in budding yeast, in which IPCs play a central role. PMID:26891268

  2. Mek1 stabilizes Hop1-Thr318 phosphorylation to promote interhomolog recombination and checkpoint responses during yeast meiosis.

    Science.gov (United States)

    Chuang, Chi-Ning; Cheng, Yun-Hsin; Wang, Ting-Fang

    2012-12-01

    Red1, Hop1 and Mek1 are three yeast meiosis-specific chromosomal proteins that uphold the interhomolog (IH) bias of meiotic recombination. Mek1 is also an effector protein kinase in a checkpoint that responds to aberrant DNA and/or axis structure. The activation of Mek1 requires Red1-dependent Hop1-Thr(T)318 phosphorylation, which is mediated by Mec1 and Tel1, the yeast homologs of the mammalian DNA damage sensor kinases ATR and ATM. As the ectopic expression of Mek1-glutathione S-transferase (GST) was shown to promote IH recombination in the absence of Mec1/Tel1-dependent checkpoint function, it was proposed that Mek1 might play dual roles during meiosis by directly phosphorylating targets that are involved in the recombination checkpoint. Here, we report that Mek1 has a positive feedback activity in the stabilization of Mec1/Tel1-mediated Hop1-T318 phosphorylation against the dephosphorylation mediated by protein phosphatase 4. Our results also reveal that GST-Mek1 or Mek1-GST further increases Hop1-T318 phosphorylation. This positive feedback function of Mek1 is independent of Mek1's kinase activity, but dependent on Mek1's forkhead-associated (FHA) domain and its arginine 51 residue. Arginine 51 directly mediates the interaction of Mek1-FHA and phosphorylated Hop1-T318. We suggest that the Hop1-Mek1 interaction is similar to the Rad53-Dun1 signaling pathway, which is mediated through the interaction of phosphorylated Rad53 and Dun1-FHA. PMID:23047948

  3. Requirements for Recruitment of a G Protein-coupled Receptor to Clathrin-coated Pits in Budding Yeast

    OpenAIRE

    Toshima, Junko Y.; Nakanishi, Jun-ichi; Mizuno, Kensaku; Toshima, Jiro; Drubin, David G.

    2009-01-01

    Endocytic internalization of G protein-coupled receptors (GPCRs) plays a critical role in down-regulation of GPCR signaling. The yeast mating pheromone receptor Ste2p has been used as a model to investigate mechanisms of signal transduction, modification, and endocytic internalization of GPCRs. We previously used a fluorescently labeled mating pheromone derivative to reveal unappreciated molecular and spatiotemporal features of GPCR endocytosis in budding yeast. Here, we identify recruitment ...

  4. Mitochondrial quality control during inheritance is associated with lifespan and mother-daughter age asymmetry in budding yeast

    OpenAIRE

    McFaline-Figueroa, José Ricardo; Vevea, Jason; Swayne, Theresa C.; Zhou, Chun; Liu, Christopher; Leung, Galen; Boldogh, Istvan R.; Pon, Liza A.

    2011-01-01

    Fluorescence loss in photobleaching experiments and analysis of mitochondrial function using superoxide and redox potential biosensors revealed that mitochondria within individual yeast cells are physically and functionally distinct. Mitochondria that are retained in mother cells during yeast cell division have significantly lower redox potential and higher superoxide levels compared to mitochondria in buds. Retention of mitochondria with lower redox potential in mother cells occurs to the sa...

  5. Constitutive Activation of the Fission Yeast Pheromone-Responsive Pathway Induces Ectopic Meiosis and Reveals Ste11 as a Mitogen-Activated Protein Kinase Target

    DEFF Research Database (Denmark)

    Kjærulff, Søren; Lautrup-Larsen, I.; Truelsen, S.;

    2005-01-01

    In the fission yeast Schizosaccharomyces pombe, meiosis normally takes place in diploid zygotes resulting from conjugation of haploid cells. In the present study, we report that the expression of a constitutively activated version of the pheromone-responsive mitogen-activated protein kinase kinase...... kinase (MAP3K) Byr2 can induce ectopic meiosis directly in haploid cells. We find that the Ste11 transcription factor becomes constitutively expressed in these cells and that the expression of pheromone-responsive genes no longer depends on nitrogen starvation. Epistasis analysis revealed that these...... conditions bypassed the requirement for the meiotic activator Mei3. Since Mei3 is normally needed for inactivation of the meiosis-repressing protein kinase Pat1, this finding suggests that the strong Byr2 signal causes inactivation of Pat1 by an alternative mechanism. Consistent with this possibility, we...

  6. Update History of This Database - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ...Budding yeast cDNA sequencing project Update History of This Database Date Update contents 2010/03/29 Buddin...tio About This Database Database Description Download License Update History of This Database Site Policy | Contact Us Update History

  7. Development of automatic image analysis algorithms for protein localization studies in budding yeast

    Science.gov (United States)

    Logg, Katarina; Kvarnström, Mats; Diez, Alfredo; Bodvard, Kristofer; Käll, Mikael

    2007-02-01

    Microscopy of fluorescently labeled proteins has become a standard technique for live cell imaging. However, it is still a challenge to systematically extract quantitative data from large sets of images in an unbiased fashion, which is particularly important in high-throughput or time-lapse studies. Here we describe the development of a software package aimed at automatic quantification of abundance and spatio-temporal dynamics of fluorescently tagged proteins in vivo in the budding yeast Saccharomyces cerevisiae, one of the most important model organisms in proteomics. The image analysis methodology is based on first identifying cell contours from bright field images, and then use this information to measure and statistically analyse protein abundance in specific cellular domains from the corresponding fluorescence images. The applicability of the procedure is exemplified for two nuclear localized GFP-tagged proteins, Mcm4p and Nrm1p.

  8. Daughter-specific transcription factors regulate cell size control in budding yeast.

    Directory of Open Access Journals (Sweden)

    Stefano Di Talia

    2009-10-01

    Full Text Available In budding yeast, asymmetric cell division yields a larger mother and a smaller daughter cell, which transcribe different genes due to the daughter-specific transcription factors Ace2 and Ash1. Cell size control at the Start checkpoint has long been considered to be a main regulator of the length of the G1 phase of the cell cycle, resulting in longer G1 in the smaller daughter cells. Our recent data confirmed this concept using quantitative time-lapse microscopy. However, it has been proposed that daughter-specific, Ace2-dependent repression of expression of the G1 cyclin CLN3 had a dominant role in delaying daughters in G1. We wanted to reconcile these two divergent perspectives on the origin of long daughter G1 times. We quantified size control using single-cell time-lapse imaging of fluorescently labeled budding yeast, in the presence or absence of the daughter-specific transcriptional regulators Ace2 and Ash1. Ace2 and Ash1 are not required for efficient size control, but they shift the domain of efficient size control to larger cell size, thus increasing cell size requirement for Start in daughters. Microarray and chromatin immunoprecipitation experiments show that Ace2 and Ash1 are direct transcriptional regulators of the G1 cyclin gene CLN3. Quantification of cell size control in cells expressing titrated levels of Cln3 from ectopic promoters, and from cells with mutated Ace2 and Ash1 sites in the CLN3 promoter, showed that regulation of CLN3 expression by Ace2 and Ash1 can account for the differential regulation of Start in response to cell size in mothers and daughters. We show how daughter-specific transcriptional programs can interact with intrinsic cell size control to differentially regulate Start in mother and daughter cells. This work demonstrates mechanistically how asymmetric localization of cell fate determinants results in cell-type-specific regulation of the cell cycle.

  9. Ndc10 is a platform for inner kinetochore assembly in budding yeast

    Energy Technology Data Exchange (ETDEWEB)

    Cho, Uhn-Soo; Harrison, Stephen C. (Harvard-Med)

    2012-01-10

    Kinetochores link centromeric DNA to spindle microtubules and ensure faithful chromosome segregation during mitosis. In point-centromere yeasts, the CBF3 complex Skp1-Ctf13-(Cep3){sub 2}-(Ndc10){sub 2} recognizes a conserved centromeric DNA element through contacts made by Cep3 and Ndc10. We describe here the five-domain organization of Kluyveromyces lactis Ndc10 and the structure at 2.8 {angstrom} resolution of domains I-II (residues 1-402) bound to DNA. The structure resembles tyrosine DNA recombinases, although it lacks both endonuclease and ligase activities. Structural and biochemical data demonstrate that each subunit of the Ndc10 dimer binds a separate fragment of DNA, suggesting that Ndc10 stabilizes a DNA loop at the centromere. We describe in vitro association experiments showing that specific domains of Ndc10 interact with each of the known inner-kinetochore proteins or protein complexes in budding yeast. We propose that Ndc10 provides a central platform for inner-kinetochore assembly.

  10. Maintenance of cellular ATP level by caloric restriction correlates chronological survival of budding yeast

    International Nuclear Information System (INIS)

    Highlights: •CR decreases total ROS and mitochondrial superoxide during the chronological aging. •CR does not affect the levels of oxidative damage on protein and DNA. •CR contributes extension of chronological lifespan by maintenance of ATP level -- Abstract: The free radical theory of aging emphasizes cumulative oxidative damage in the genome and intracellular proteins due to reactive oxygen species (ROS), which is a major cause for aging. Caloric restriction (CR) has been known as a representative treatment that prevents aging; however, its mechanism of action remains elusive. Here, we show that CR extends the chronological lifespan (CLS) of budding yeast by maintaining cellular energy levels. CR reduced the generation of total ROS and mitochondrial superoxide; however, CR did not reduce the oxidative damage in proteins and DNA. Subsequently, calorie-restricted yeast had higher mitochondrial membrane potential (MMP), and it sustained consistent ATP levels during the process of chronological aging. Our results suggest that CR extends the survival of the chronologically aged cells by improving the efficiency of energy metabolism for the maintenance of the ATP level rather than reducing the global oxidative damage of proteins and DNA

  11. Maintenance of cellular ATP level by caloric restriction correlates chronological survival of budding yeast

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Joon-Seok; Lee, Cheol-Koo, E-mail: cklee2005@korea.ac.kr

    2013-09-13

    Highlights: •CR decreases total ROS and mitochondrial superoxide during the chronological aging. •CR does not affect the levels of oxidative damage on protein and DNA. •CR contributes extension of chronological lifespan by maintenance of ATP level -- Abstract: The free radical theory of aging emphasizes cumulative oxidative damage in the genome and intracellular proteins due to reactive oxygen species (ROS), which is a major cause for aging. Caloric restriction (CR) has been known as a representative treatment that prevents aging; however, its mechanism of action remains elusive. Here, we show that CR extends the chronological lifespan (CLS) of budding yeast by maintaining cellular energy levels. CR reduced the generation of total ROS and mitochondrial superoxide; however, CR did not reduce the oxidative damage in proteins and DNA. Subsequently, calorie-restricted yeast had higher mitochondrial membrane potential (MMP), and it sustained consistent ATP levels during the process of chronological aging. Our results suggest that CR extends the survival of the chronologically aged cells by improving the efficiency of energy metabolism for the maintenance of the ATP level rather than reducing the global oxidative damage of proteins and DNA.

  12. Measurement of the volume growth rate of single budding yeast with the MOSFET-based microfluidic Coulter counter.

    Science.gov (United States)

    Sun, Jiashu; Stowers, Chris C; Boczko, Erik M; Li, Deyu

    2010-11-01

    We report on measurements of the volume growth rate of ten individual budding yeast cells using a recently developed MOSFET-based microfluidic Coulter counter. The MOSFET-based microfluidic Coulter counter is very sensitive, provides signals that are immune from the baseline drift, and can work with cell culture media of complex composition. These desirable features allow us to directly measure the volume growth rate of single cells of Saccharomyces cerevisiae LYH3865 strain budding yeast in YNB culture media over a whole cell cycle. Results indicate that all budding yeast follow a sigmoid volume growth profile with reduced growth rates at the initial stage before the bud emerges and the final stage after the daughter gets mature. Analysis of the data indicates that even though all piecewise linear, Gomperitz, and Hill's function models can fit the global growth profile equally well, the data strongly support local exponential growth phenomenon. Accurate volume growth measurements are important for applications in systems biology where quantitative parameters are required for modeling and simulation. PMID:20717618

  13. Ctf3p, the Mis6 budding yeast homolog, interacts with Mcm22p and Mcm16p at the yeast outer kinetochore.

    Science.gov (United States)

    Measday, Vivien; Hailey, Dale W; Pot, Isabelle; Givan, Scott A; Hyland, Katherine M; Cagney, Gerard; Fields, Stan; Davis, Trisha N; Hieter, Philip

    2002-01-01

    The budding yeast kinetochore is composed of an inner and outer protein complex, which binds to centromere (CEN) DNA and attaches to microtubules. We performed a genetic synthetic dosage lethality screen to identify novel kinetochore proteins in a collection of chromosome transmission fidelity mutants. Our screen identified several new kinetochore-related proteins including YLR381Wp/Ctf3p, which is a member of a conserved family of centromere-binding proteins. Ctf3p interacts with Mcm22p, Mcm16p, and the outer kinetochore protein Ctf19p. We used chromatin immunoprecipitation to demonstrate that Ctf3p, Mcm22p, and Mcm16p bind to CEN DNA in a Ctf19p-dependent manner. In addition, Ctf3p, Mcm22p, and Mcm16p have a localization pattern similar to other kinetochore proteins. The fission yeast Ctf3p homolog, Mis6, is required for loading of a CENP-A centromere specific histone, Cnp1, onto centromere DNA. We find however that Ctf3p is not required for loading of the budding yeast CENP-A homolog, Cse4p, onto CEN DNA. In contrast, Ctf3p and Ctf19p fail to bind properly to the centromere in a cse4-1 mutant strain. We conclude that the requirements for CENP-A loading onto centromere DNA differ in fission versus budding yeast. PMID:11782448

  14. Mps1 and Ipl1/Aurora B Act Sequentially to Correctly Orient Chromosomes on the Meiotic Spindle of Budding Yeast

    OpenAIRE

    Meyer, Régis E; Kim, Seoyoung; Obeso, David; Straight, Paul D.; Winey, Mark; Dawson, Dean S.

    2013-01-01

    The conserved kinases Mps1 and Ipl1/Aurora B are critical for enabling chromosomes to attach to microtubules such that partner chromosomes will be segregated correctly from each other, but the precise roles of these kinases have been unclear. Here, imaging of live yeast cells was performed to elucidate the stages of chromosome-microtubule interactions, and their regulation by Ipl1 and Mps1, through meiosis I. Ipl1 was found to release kinetochore-microtubule (kMT) associations following meiot...

  15. The budding yeast protein kinase Ipl1/Aurora allows the absence of tension to activate the spindle checkpoint

    OpenAIRE

    Biggins, Sue; Murray, Andrew W.

    2001-01-01

    The spindle checkpoint prevents cell cycle progression in cells that have mitotic spindle defects. Although several spindle defects activate the spindle checkpoint, the exact nature of the primary signal is unknown. We have found that the budding yeast member of the Aurora protein kinase family, Ipl1p, is required to maintain a subset of spindle checkpoint arrests. Ipl1p is required to maintain the spindle checkpoint that is induced by overexpression of the protein kinase Mps1. Inactivating I...

  16. The budding yeast protein Chl1p is required to preserve genome integrity upon DNA damage in S-phase

    OpenAIRE

    Laha, Suparna; Das, Shankar Prasad; Hajra, Sujata; Sau, Soumitra; Sinha, Pratima

    2006-01-01

    The budding yeast protein, Chl1p, is required for sister-chromatid cohesion, transcriptional silencing, rDNA recombination and aging. In this work, we show that Chl1p is also required for viability when DNA replication is stressed, either due to mutations or if cells are treated with genotoxic agents like methylmethane sulfonate (MMS) and ultraviolet (UV) rays. The chl1 mutation caused synthetic growth defects with mutations in DNA replication genes. At semi-permissive temperatures, the doubl...

  17. FLO1 Is a Variable Green Beard Gene that Drives Biofilm-like Cooperation in Budding Yeast

    OpenAIRE

    Smukalla, Scott; Caldara, Marina; Pochet, Nathalie; Beauvais, Anne; Guadagnini, Stephanie; Yan, Chen; Vinces, Marcelo; Jansen, An; Prevost, Marie Christine; Latge, Jean-Paul; Fink, Gerald R.; Foster, Kevin R.; Verstrepen, Kevin

    2008-01-01

    The budding yeast, Saccharomyces cerevisiae, has emerged as an archetype of eukaryotic cell biology. Here we show that S. cerevisiae is also a model for the evolution of cooperative behavior by revisiting flocculation, a self-adherence phenotype lacking in most laboratory strains. Expression of the gene FLO1 in the laboratory strain S288C restores flocculation, an altered physiological state, reminiscent of bacterial biofilms. Flocculation protects the FLO1 expressing cells from multiple stre...

  18. Ctf3p, the Mis6 budding yeast homolog, interacts with Mcm22p and Mcm16p at the yeast outer kinetochore

    OpenAIRE

    Measday, Vivien; Hailey, Dale W.; Pot, Isabelle; Givan, Scott A.; Hyland, Katherine M.; Cagney, Gerard; Fields, Stan; Davis, Trisha N.; Hieter, Philip

    2002-01-01

    The budding yeast kinetochore is composed of an inner and outer protein complex, which binds to centromere (CEN) DNA and attaches to microtubules. We performed a genetic synthetic dosage lethality screen to identify novel kinetochore proteins in a collection of chromosome transmission fidelity mutants. Our screen identified several new kinetochore-related proteins including YLR381Wp/Ctf3p, which is a member of a conserved family of centromere-binding proteins. Ctf3p interacts with Mcm22p, Mcm...

  19. Visual screening for localized RNAs in yeast revealed novel RNAs at the bud-tip

    International Nuclear Information System (INIS)

    Several RNAs, including rRNAs, snRNAs, snoRNAs, and some mRNAs, are known to be localized at specific sites in a cell. Although methods have been established to visualize RNAs in a living cell, no large-scale visual screening of localized RNAs has been performed. In this study, we constructed a genomic library in which random genomic fragments were inserted downstream of U1A-tag sequences under a GAL1 promoter. In a living yeast cell, transcribed U1A-tagged RNAs were visualized by U1A-GFP that binds the RNA sequence of the U1A-tag. In this screening, many RNAs showed nuclear signals. Since the nuclear signals of some RNAs were not seen when the U1A-tag was connected to the 3' ends of the RNAs, it is suggested that their nuclear signals correspond to nascent transcripts on GAL1 promoter plasmids. Using this screening method, we successfully identified two novel localized mRNAs, CSR2 and DAL81, which showed bud-tip localization

  20. Dynamic behaviour of the 'Raman spectroscopic signature of life' in a starving budding yeast cell

    International Nuclear Information System (INIS)

    Complete text of publication follows. In vivo molecular-level information is essentially important for understanding the structure, dynamics and functions of living cells. We use Raman microspectroscopy to single living budding yeast cells under a starving condition and study the dynamic behaviour of the 'Raman spectroscopic signature of life' (Y. Naito et al., J. Raman. Spectrosc., 36 (2005) 837-839. and Y-S. Huang et al., Biochemistry, 44 (2005) 10009-10019.) in relation to the formation and disappearance of a 'dancing body' in a vacuole. A focus is placed on the cell death process and the recovery from it. Our previous studies have shown that, under a starving condition, a dancing body appears suddenly in a vacuole and that the 'Raman spectroscopic signature of life' disappears concomitantly indicating the loss of the mitochondrial metabolic activity. This event is followed by gradual deterioration of the cell structure leading to death. This cell death process was visualized at the molecular level by time-resolved Raman imaging. In the present study, we show strong correlations not only between the appearance of a dancing body and the loss of the mitochondrial activity but also between the disappearance of the dancing body and the recovery of the activity. Time- and space-resolved Raman spectra of a single living budding yeast cell were recorded on a confocal Raman microspectrometer with 632.8 nm line of a He-Ne laser for excitation. The laser power at the sample was about 5 mW. The lateral and depth resolutions were about 300 nm with a 100 x oil immersion objective lens (N.A.=1.3) and about 2 μm with a 100 μm pinhole for a confocal detection. Raman spectra were recorded in the wavenumber range 300 - 1800 cm-1 with a spectral resolution of 3 cm-1. The exposure time was 150 sec. Saccharomyces cerevisiae/ Saccharomyces Bayanus hybrid, strain AJL3062 from, was grown at 30 deg C under a stationary cultivation condition in wort medium. The cells dispersed in 1 ml

  1. Novel E3 ubiquitin ligases that regulate histone protein levels in the budding yeast Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Rakesh Kumar Singh

    Full Text Available Core histone proteins are essential for packaging the genomic DNA into chromatin in all eukaryotes. Since multiple genes encode these histone proteins, there is potential for generating more histones than what is required for chromatin assembly. The positively charged histones have a very high affinity for negatively charged molecules such as DNA, and any excess of histone proteins results in deleterious effects on genomic stability and cell viability. Hence, histone levels are known to be tightly regulated via transcriptional, posttranscriptional and posttranslational mechanisms. We have previously elucidated the posttranslational regulation of histone protein levels by the ubiquitin-proteasome pathway involving the E2 ubiquitin conjugating enzymes Ubc4/5 and the HECT (Homologous to E6-AP C-Terminus domain containing E3 ligase Tom1 in the budding yeast. Here we report the identification of four additional E3 ligases containing the RING (Really Interesting New Gene finger domains that are involved in the ubiquitylation and subsequent degradation of excess histones in yeast. These E3 ligases are Pep5, Snt2 as well as two previously uncharacterized Open Reading Frames (ORFs YKR017C and YDR266C that we have named Hel1 and Hel2 (for Histone E3 Ligases respectively. Mutants lacking these E3 ligases are sensitive to histone overexpression as they fail to degrade excess histones and accumulate high levels of endogenous histones on histone chaperones. Co-immunoprecipitation assays showed that these E3 ligases interact with the major E2 enzyme Ubc4 that is involved in the degradation related ubiquitylation of histones. Using mutagenesis we further demonstrate that the RING domains of Hel1, Hel2 and Snt2 are required for histone regulation. Lastly, mutants corresponding to Hel1, Hel2 and Pep5 are sensitive to replication inhibitors. Overall, our results highlight the importance of posttranslational histone regulatory mechanisms that employ multiple E3

  2. The Budding Yeast “Saccharomyces cerevisiae” as a Drug Discovery Tool to Identify Plant-Derived Natural Products with Anti-Proliferative Properties

    Directory of Open Access Journals (Sweden)

    Bouchra Qaddouri

    2011-01-01

    Full Text Available The budding yeast Saccharomyces cerevisiae is a valuable system to study cell-cycle regulation, which is defective in cancer cells. Due to the highly conserved nature of the cell-cycle machinery between yeast and humans, yeast studies are directly relevant to anticancer-drug discovery. The budding yeast is also an excellent model system for identifying and studying antifungal compounds because of the functional conservation of fungal genes. Moreover, yeast studies have also contributed greatly to our understanding of the biological targets and modes of action of bioactive compounds. Understanding the mechanism of action of clinically relevant compounds is essential for the design of improved second-generation molecules. Here we describe our methodology for screening a library of plant-derived natural products in yeast in order to identify and characterize new compounds with anti-proliferative properties.

  3. The Histone Fold Domain of Cse4 Is Sufficient for CEN Targeting and Propagation of Active Centromeres in Budding Yeast

    OpenAIRE

    Morey, Lisa; Barnes, Kelly; Chen, Yinhuai; Fitzgerald-Hayes, Molly; Baker, Richard E.

    2004-01-01

    Centromere-specific H3-like proteins (CenH3s) are conserved across the eukaryotic kingdom and are required for packaging centromere DNA into a specialized chromatin structure required for kinetochore assembly. Cse4 is the CenH3 protein of the budding yeast Saccharomyces cerevisiae. Like all CenH3 proteins, Cse4 consists of a conserved histone fold domain (HFD) and a divergent N terminus (NT). The Cse4 NT contains an essential domain designated END (for essential N-terminal domain); deletion o...

  4. Fusion of nearby inverted repeats by a replication-based mechanism leads to formation of dicentric and acentric chromosomes that cause genome instability in budding yeast

    OpenAIRE

    Paek, Andrew L.; Kaochar, Salma; Jones, Hope; Elezaby, Aly; Shanks, Lisa; Weinert, Ted

    2009-01-01

    Large-scale changes (gross chromosomal rearrangements [GCRs]) are common in genomes, and are often associated with pathological disorders. We report here that a specific pair of nearby inverted repeats in budding yeast fuse to form a dicentric chromosome intermediate, which then rearranges to form a translocation and other GCRs. We next show that fusion of nearby inverted repeats is general; we found that many nearby inverted repeats that are present in the yeast genome also fuse, as does a p...

  5. Isolation of a cdc28 mutation that abrogates the dependence of S phase on completion of M phase of the budding yeast cell cycle

    Indian Academy of Sciences (India)

    Santanu Kumar Ghosh; Pratima Sinha

    2000-01-01

    We have isolated a mutation in the budding yeast Saccharomyces cerevisisae CDC28 gene that allows cdc13 cells, carrying damaged DNA, to continue with the cell division cycle. While cdc13 mutant cells are arrested as large-budded cells at the nonpermissive temperature 37°C, the cdc13 cdc28 double mutant culture showed cells with one or more buds, most of which showed apical growth. The additional buds emerged without the intervening steps of nuclear division and cell separation. We suggest that the cdc28 mutation abrogates a checkpoint function and allows cells with damaged or incompletely replicated DNA an entry to another round of cell cycle and bypasses the mitotic phase of the cell cycle.

  6. Stable Pseudohyphal Growth in Budding Yeast Induced by Synergism between Septin Defects and Altered MAP-kinase Signaling.

    Science.gov (United States)

    Kim, Junwon; Rose, Mark D

    2015-12-01

    Upon nutrient limitation, budding yeasts like Saccharomyces cerevisiae can be induced to adopt alternate filament-like growth patterns called diploid pseudohyphal or invasive haploid growth. Here, we report a novel constitutive pseudohyphal growth state, sharing some characteristics with classic forms of filamentous growth, but differing in crucial aspects of morphology, growth conditions and genetic regulation. The constitutive pseudohyphal state is observed in fus3 mutants containing various septin assembly defects, which we refer to as sadF growth (septin assembly defect induced filamentation) to distinguish it from classic filamentation pathways. Similar to other filamentous states, sadF cultures comprise aggregated chains of highly elongated cells. Unlike the classic pathways, sadF growth occurs in liquid rich media, requiring neither starvation nor the key pseudohyphal proteins, Flo8p and Flo11p. Moreover sadF growth occurs in haploid strains of S288C genetic background, which normally cannot undergo pseudohyphal growth. The sadF cells undergo highly polarized bud growth during prolonged G2 delays dependent on Swe1p. They contain septin structures distinct from classical pseudo-hyphae and FM4-64 labeling at actively growing tips similar to the Spitzenkörper observed in true hyphal growth. The sadF growth state is induced by synergism between Kss1p-dependent signaling and septin assembly defects; mild disruption of mitotic septins activates Kss1p-dependent gene expression, which exacerbates the septin defects, leading to hyper-activation of Kss1p. Unlike classical pseudo-hyphal growth, sadF signaling requires Ste5, Ste4 and Ste18, the scaffold protein and G-protein β and γ subunits from the pheromone response pathway, respectively. A swe1 mutation largely abolished signaling, breaking the positive feedback that leads to amplification of sadF signaling. Taken together, our findings show that budding yeast can access a stable constitutive pseudohyphal growth

  7. Stable Pseudohyphal Growth in Budding Yeast Induced by Synergism between Septin Defects and Altered MAP-kinase Signaling.

    Directory of Open Access Journals (Sweden)

    Junwon Kim

    2015-12-01

    Full Text Available Upon nutrient limitation, budding yeasts like Saccharomyces cerevisiae can be induced to adopt alternate filament-like growth patterns called diploid pseudohyphal or invasive haploid growth. Here, we report a novel constitutive pseudohyphal growth state, sharing some characteristics with classic forms of filamentous growth, but differing in crucial aspects of morphology, growth conditions and genetic regulation. The constitutive pseudohyphal state is observed in fus3 mutants containing various septin assembly defects, which we refer to as sadF growth (septin assembly defect induced filamentation to distinguish it from classic filamentation pathways. Similar to other filamentous states, sadF cultures comprise aggregated chains of highly elongated cells. Unlike the classic pathways, sadF growth occurs in liquid rich media, requiring neither starvation nor the key pseudohyphal proteins, Flo8p and Flo11p. Moreover sadF growth occurs in haploid strains of S288C genetic background, which normally cannot undergo pseudohyphal growth. The sadF cells undergo highly polarized bud growth during prolonged G2 delays dependent on Swe1p. They contain septin structures distinct from classical pseudo-hyphae and FM4-64 labeling at actively growing tips similar to the Spitzenkörper observed in true hyphal growth. The sadF growth state is induced by synergism between Kss1p-dependent signaling and septin assembly defects; mild disruption of mitotic septins activates Kss1p-dependent gene expression, which exacerbates the septin defects, leading to hyper-activation of Kss1p. Unlike classical pseudo-hyphal growth, sadF signaling requires Ste5, Ste4 and Ste18, the scaffold protein and G-protein β and γ subunits from the pheromone response pathway, respectively. A swe1 mutation largely abolished signaling, breaking the positive feedback that leads to amplification of sadF signaling. Taken together, our findings show that budding yeast can access a stable constitutive

  8. Marshmallow Meiosis.

    Science.gov (United States)

    Soderberg, Patti

    1992-01-01

    Presents an activity in which students model the processes of meiosis, fertilization, development, and birth using model creatures called reebops. Students breed reebops to analyze chromosome combinations. Makes recommendations for activity utilization and identifies the strengths of the activity. (MDH)

  9. The glyoxylate shunt is essential for desiccation tolerance in C. elegans and budding yeast.

    Science.gov (United States)

    Erkut, Cihan; Gade, Vamshidhar R; Laxman, Sunil; Kurzchalia, Teymuras V

    2016-01-01

    Many organisms, including species from all kingdoms of life, can survive desiccation by entering a state with no detectable metabolism. To survive, C. elegans dauer larvae and stationary phase S. cerevisiae require elevated amounts of the disaccharide trehalose. We found that dauer larvae and stationary phase yeast switched into a gluconeogenic mode in which metabolism was reoriented toward production of sugars from non-carbohydrate sources. This mode depended on full activity of the glyoxylate shunt (GS), which enables synthesis of trehalose from acetate. The GS was especially critical during preparation of worms for harsh desiccation (preconditioning) and during the entry of yeast into stationary phase. Loss of the GS dramatically decreased desiccation tolerance in both organisms. Our results reveal a novel physiological role for the GS and elucidate a conserved metabolic rewiring that confers desiccation tolerance on organisms as diverse as worm and yeast. PMID:27090086

  10. Molecular analysis of heavy ion induced mutations in the budding yeast

    International Nuclear Information System (INIS)

    This study is intended to elucidate the molecular mechanism of the mutagenesis caused by High-linear energy transfer (LET) ion beam. The frequency of DNA double stranded breaks (DSBs) was estimated by agarose gel electrophoresis. Moreover, the mutation sites of ura3 mutants were determined by DNA sequencing. The yeast cells were irradiated with carbon ions (12C5+; 290 MeV) with the dose 50 to 200 Gy. Carbon ion beam was generated from synchrotron in HIMAC. The carbon ion beams at 100 Gy generate mutations 10.3 - fold more than spontaneous mutation. The mutation frequency increased consistently with LET. This result indicates the high LET ion beam is more mutagenic than low LET ion beam. The remarkable feature of yeast mutations induced by carbon ions was that the mutation sites were localized near the linker regions of nucleosomes, whereas mutations induced by gamma-ray irradiation were located uniformly throughout the gene. (author)

  11. Molecular analysis of heavy ion induced mutations in the budding yeast

    International Nuclear Information System (INIS)

    The aim of this study is to elucidate the molecular mechanism of mutagenesis caused with heavy ion irradiation. Yeast cells were irradiated with accelerated carbon ion (290 MeV/u, 13-75 keV/mm) and helium ion (150 MeV/u, 2.2 keV/mm). The survival rate of carbon ion beam irradiated cells was reduced with linear energy transfer (LET), and the mutation frequency increased consistently with LET. The survival rate of helium ion beam (0.45 keV/mm) was slightly higher than that of carbon ion beam (LET: 25 keV/ mm) irradiated cells. (author)

  12. High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation.

    Science.gov (United States)

    Hoggard, Timothy; Liachko, Ivan; Burt, Cassaundra; Meikle, Troy; Jiang, Katherine; Craciun, Gheorghe; Dunham, Maitreya J; Fox, Catherine A

    2016-01-01

    The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chromosomal regions that can function as plasmid partitioning elements. The Rap1 protein-binding site (RAP1) present in transcriptional silencers and telomeres of budding yeast is a known plasmid-partitioning element that functions to anchor a plasmid to the inner nuclear membrane (INM), which in turn facilitates plasmid distribution to daughter cells. This Rap1-dependent INM-anchoring also has an important chromosomal role in higher-order chromosomal structures that enhance transcriptional silencing and telomere stability. Thus, plasmid partitioning can reflect fundamental features of chromosome structure and biology, yet a systematic screen for plasmid partitioning elements has not been reported. Here, we couple deep sequencing with competitive growth experiments of a plasmid library containing thousands of short ARS fragments to identify new plasmid partitioning elements. Competitive growth experiments were performed with libraries that differed only in terms of the presence or absence of a centromere. Comparisons of the behavior of ARS fragments in the two experiments allowed us to identify sequences that were likely to drive plasmid partitioning. In addition to the silencer RAP1 site, we identified 74 new putative plasmid-partitioning motifs predicted to act as binding sites for DNA binding proteins enriched for roles in negative regulation of gene expression and G2/M-phase associated biology. These data expand our knowledge of chromosomal elements that may function in plasmid

  13. Whole-cell imaging of the budding yeast Saccharomyces cerevisiae by high-voltage scanning transmission electron tomography

    International Nuclear Information System (INIS)

    Electron tomography using a high-voltage electron microscope (HVEM) provides three-dimensional information about cellular components in sections thicker than 1 μm, although in bright-field mode image degradation caused by multiple inelastic scattering of transmitted electrons limit the attainable resolution. Scanning transmission electron microscopy (STEM) is believed to give enhanced contrast and resolution compared to conventional transmission electron microscopy (CTEM). Samples up to 1 μm in thickness have been analyzed with an intermediate-voltage electron microscope because inelastic scattering is not a critical limitation, and probe broadening can be minimized. Here, we employed STEM at 1 MeV high-voltage to extend the useful specimen thickness for electron tomography, which we demonstrate by a seamless tomographic reconstruction of a whole, budding Saccharomyces cerevisiae yeast cell, which is ∼3 μm in thickness. High-voltage STEM tomography, especially in the bright-field mode, demonstrated sufficiently enhanced contrast and intensity, compared to CTEM tomography, to permit segmentation of major organelles in the whole cell. STEM imaging also reduced specimen shrinkage during tilt-series acquisition. The fidelity of structural preservation was limited by cytoplasmic extraction, and the spatial resolution was limited by the relatively large convergence angle of the scanning probe. However, the new technique has potential to solve longstanding problems of image blurring in biological specimens beyond 1 μm in thickness, and may facilitate new research in cellular structural biology. - Highlights: • High voltage TEM and STEM tomography were compared to visualize whole yeast cells. • 1-MeV STEM-BF tomography had significant improvements in image contrast and SNR. • 1-MeV STEM tomography showed less specimen shrinkage than the TEM tomography. • KMnO4 post-treatment permitted segmenting the major cellular components

  14. Whole-cell imaging of the budding yeast Saccharomyces cerevisiae by high-voltage scanning transmission electron tomography

    Energy Technology Data Exchange (ETDEWEB)

    Murata, Kazuyoshi, E-mail: kazum@nips.ac.jp [National Institute for Physiological Sciences, Okazaki, Aichi 444-8585 (Japan); Esaki, Masatoshi; Ogura, Teru [Institute of Molecular Embryology and Genetics, Kumamoto University, Kumamoto 860-0811 (Japan); Arai, Shigeo; Yamamoto, Yuta; Tanaka, Nobuo [Ecotopia Science Institute, Nagoya University, Nagoya, Aichi 464-8603 (Japan)

    2014-11-15

    Electron tomography using a high-voltage electron microscope (HVEM) provides three-dimensional information about cellular components in sections thicker than 1 μm, although in bright-field mode image degradation caused by multiple inelastic scattering of transmitted electrons limit the attainable resolution. Scanning transmission electron microscopy (STEM) is believed to give enhanced contrast and resolution compared to conventional transmission electron microscopy (CTEM). Samples up to 1 μm in thickness have been analyzed with an intermediate-voltage electron microscope because inelastic scattering is not a critical limitation, and probe broadening can be minimized. Here, we employed STEM at 1 MeV high-voltage to extend the useful specimen thickness for electron tomography, which we demonstrate by a seamless tomographic reconstruction of a whole, budding Saccharomyces cerevisiae yeast cell, which is ∼3 μm in thickness. High-voltage STEM tomography, especially in the bright-field mode, demonstrated sufficiently enhanced contrast and intensity, compared to CTEM tomography, to permit segmentation of major organelles in the whole cell. STEM imaging also reduced specimen shrinkage during tilt-series acquisition. The fidelity of structural preservation was limited by cytoplasmic extraction, and the spatial resolution was limited by the relatively large convergence angle of the scanning probe. However, the new technique has potential to solve longstanding problems of image blurring in biological specimens beyond 1 μm in thickness, and may facilitate new research in cellular structural biology. - Highlights: • High voltage TEM and STEM tomography were compared to visualize whole yeast cells. • 1-MeV STEM-BF tomography had significant improvements in image contrast and SNR. • 1-MeV STEM tomography showed less specimen shrinkage than the TEM tomography. • KMnO{sub 4} post-treatment permitted segmenting the major cellular components.

  15. Transcription factor genes essential for cell proliferation and replicative lifespan in budding yeast

    Energy Technology Data Exchange (ETDEWEB)

    Kamei, Yuka; Tai, Akiko; Dakeyama, Shota; Yamamoto, Kaori; Inoue, Yamato; Kishimoto, Yoshifumi; Ohara, Hiroya; Mukai, Yukio, E-mail: y_mukai@nagahama-i-bio.ac.jp

    2015-07-31

    Many of the lifespan-related genes have been identified in eukaryotes ranging from the yeast to human. However, there is limited information available on the longevity genes that are essential for cell proliferation. Here, we investigated whether the essential genes encoding DNA-binding transcription factors modulated the replicative lifespan of Saccharomyces cerevisiae. Heterozygous diploid knockout strains for FHL1, RAP1, REB1, and MCM1 genes showed significantly short lifespan. {sup 1}H-nuclear magnetic resonance analysis indicated a characteristic metabolic profile in the Δfhl1/FHL1 mutant. These results strongly suggest that FHL1 regulates the transcription of lifespan related metabolic genes. Thus, heterozygous knockout strains could be the potential materials for discovering further novel lifespan genes. - Highlights: • Involvement of yeast TF genes essential for cell growth in lifespan was evaluated. • The essential TF genes, FHL1, RAP1, REB1, and MCM1, regulate replicative lifespan. • Heterozygous deletion of FHL1 changes cellular metabolism related to lifespan.

  16. Direct TFIIA-TFIID protein contacts drive budding yeast ribosomal protein gene transcription.

    Science.gov (United States)

    Layer, Justin H; Weil, P Anthony

    2013-08-01

    We have previously shown that yeast TFIID provides coactivator function on the promoters of ribosomal protein-encoding genes (RPGs) by making direct contact with the transactivator repressor activator protein 1 (Rap1). Further, our structural studies of assemblies generated with purified Rap1, TFIID, and TFIIA on RPG enhancer-promoter DNA indicate that Rap1-TFIID interaction induces dramatic conformational rearrangements of enhancer-promoter DNA and TFIID-bound TFIIA. These data indicate a previously unknown yet critical role for yeast TFIIA in the integration of activator-TFIID contacts with promoter conformation and downstream preinitiation complex formation and/or function. Here we describe the use of systematic mutagenesis to define how specific TFIIA contacts contribute to these processes. We have verified that TFIIA is required for RPG transcription in vivo and in vitro, consistent with the existence of a critical Rap1-TFIIA-TFIID interaction network. We also identified essential points of contact for TFIIA and Rap1 within the Rap1 binding domain of the Taf4 subunit of TFIID. These data suggest a mechanism for how interactions between TFIID, TFIIA, and Rap1 contribute to the high rate of transcription initiation seen on RPGs in vivo. PMID:23814059

  17. Transcription factor genes essential for cell proliferation and replicative lifespan in budding yeast

    International Nuclear Information System (INIS)

    Many of the lifespan-related genes have been identified in eukaryotes ranging from the yeast to human. However, there is limited information available on the longevity genes that are essential for cell proliferation. Here, we investigated whether the essential genes encoding DNA-binding transcription factors modulated the replicative lifespan of Saccharomyces cerevisiae. Heterozygous diploid knockout strains for FHL1, RAP1, REB1, and MCM1 genes showed significantly short lifespan. 1H-nuclear magnetic resonance analysis indicated a characteristic metabolic profile in the Δfhl1/FHL1 mutant. These results strongly suggest that FHL1 regulates the transcription of lifespan related metabolic genes. Thus, heterozygous knockout strains could be the potential materials for discovering further novel lifespan genes. - Highlights: • Involvement of yeast TF genes essential for cell growth in lifespan was evaluated. • The essential TF genes, FHL1, RAP1, REB1, and MCM1, regulate replicative lifespan. • Heterozygous deletion of FHL1 changes cellular metabolism related to lifespan

  18. Checkpoints Studies Using the Budding Yeast Saccharomyces cerevisiae: Analysis of changes in protein level and subcellular localization during cell cycle progression

    OpenAIRE

    Wu, Xiaorong; Liu, Lili; HUANG, Mingxia

    2011-01-01

    Methods are described here to monitor changes in protein level and subcellular localization during the cell cycle progression in the budding yeast S. cerevisiae. Cell synchronization is achieved by an α-factor mediated block-and-release protocol. Cells are collected at different time points for the first two cell cycles upon release. Cellular DNA contents are analyzed by flow cytometry. Trichloroacetic acid protein precipitates are prepared for monitoring levels of cell cycle regulated protei...

  19. Positive feedback promotes mitotic exit via the APC/C-Cdh1-separase-Cdc14 axis in budding yeast.

    Science.gov (United States)

    Hatano, Yuhki; Naoki, Koike; Suzuki, Asuka; Ushimaru, Takashi

    2016-10-01

    The mitotic inhibitor securin is degraded via the ubiquitin ligase anaphase-promoting complex/cyclosome (APC/C)-Cdc20 after anaphase onset. This triggers activation of the mitotic protease separase and thereby sister chromatid separation. However, only a proportion of securin molecules are degraded at metaphase-anaphase transition and the remaining molecules are still present in anaphase. The roles of securin and separase in late mitosis remain elusive. Here, we show that securin still inhibits separase to repress mitotic exit in anaphase in budding yeast. APC/C-Cdh1-mediated securin degradation at telophase further liberated separase, which promotes Cdc14 release and mitotic exit. Separase executed these events via its proteolytic action and that in the Cdc14 early release (FEAR) network. Cdc14 release further activated APC/C-Cdh1 in the manner of a positive feedback loop. Thus, the positive feedback promotes mitotic exit via the APC/C-Cdh1-separase-Cdc14 axis. This study shows the importance of the two-step degradation mode of securin and the role of separase in mitotic exit. PMID:27418100

  20. Molecular analysis of heavy ion induced mutations in the budding yeast

    International Nuclear Information System (INIS)

    The aim of this study is to elucidate the relation between linear energy transfer (LET) and mutagenesis. Carbon ion beams with varied LET generated by Heavy Ion Medical Accelerator in Chiba (HIMAC) synchrotron were irradiated to several types of yeast cells, and we examined the survival rate and mutation frequencies. The results showed that the survival rates were reduced along with the LET, while the mutation frequencies were enhanced along with the LET, and the mutation frequencies increased consistently with LET. The sequencing analysis of mutations showed that the low LET carbon ion beams induced more deletion and insertion mutations than high LET carbon ion beams did. Furthermore, we also examined the gene expression analysis of RAD50, RAD52 and OGG1 after ion beam radiation to cells. The result indicated that the high-LET carbon-ion beams induced the expression of RAD50 gene. (author)

  1. Multiple stable states and hysteresis in continuous, oscillating cultures of budding yeast.

    Science.gov (United States)

    Zamamiri, A Q; Birol, G; Hjortsø, M A

    2001-11-01

    The conditions that precede the onset of autonomous oscillations in continuous yeast cultures were studied in three different types of experiments. It was found that the final state of the culture depended on the protocol used to start up the reactor. Batch cultures, switched to continuous operation at different stages of the batch growth curve, all exhibited similar dynamics-ethanol depletion followed by autonomous oscillations. Small perturbations of the distribution of states in the reactor, achieved by addition of externally grown cells, were able to quench the oscillatory dynamics. Reaching the desired operating point by slow dilution rate changes gave rise to different final states, two oscillatory states and one steady state, depending on the rate of change in dilution rate. The multiplicity of stable states at a single operating point is not explained by any current distributed model and points toward a segregated mechanism of these oscillations. PMID:11590603

  2. The dynamics of homologous pairing during mating type interconversion in budding yeast.

    Directory of Open Access Journals (Sweden)

    Peter L Houston

    2006-06-01

    Full Text Available Cells repair most double-strand breaks (DSBs that arise during replication or by environmental insults through homologous recombination, a high-fidelity process critical for maintenance of genomic integrity. However, neither the detailed mechanism of homologous recombination nor the specific roles of critical components of the recombination machinery-such as Bloom and Werner syndrome proteins-have been resolved. We have taken a novel approach to examining the mechanism of homologous recombination by tracking both a DSB and the template from which it is repaired during the repair process in individual yeast cells. The two loci were labeled with arrays of DNA binding sites and visualized in live cells expressing green fluorescent protein-DNA binding protein chimeras. Following induction of an endonuclease that introduces a DSB next to one of the marked loci, live cells were imaged repeatedly to determine the relative positions of the DSB and the template locus. We found a significant increase in persistent associations between donor and recipient loci following formation of the DSB, demonstrating DSB-induced pairing between donor and template. However, such associations were transient and occurred repeatedly in every cell, a result not predicted from previous studies on populations of cells. Moreover, these associations were absent in sgs1 or srs2 mutants, yeast homologs of the Bloom and Werner syndrome genes, but were enhanced in a rad54 mutant, whose protein product promotes efficient strand exchange in vitro. Our results indicate that a DSB makes multiple and reversible contacts with a template during the repair process, suggesting that repair could involve interactions with multiple templates, potentially creating novel combinations of sequences at the repair site. Our results further suggest that both Sgs1 and Srs2 are required for efficient completion of recombination and that Rad54 may serve to dissociate such interactions. Finally, these

  3. Identification of She3 as an SCF(Grr1 substrate in budding yeast.

    Directory of Open Access Journals (Sweden)

    Ruiwen Wang

    Full Text Available The highly orchestrated progression of the cell cycle depends on the degradation of many regulatory proteins at different cell cycle stages. One of the key cell cycle ubiquitin ligases is the Skp1-cullin-F-box (SCF complex. Acting in concert with the substrate-binding F-box protein Grr1, SCF(Grr1 promotes the degradation of cell cycle regulators as well as various metabolic enzymes. Using a yeast two-hybrid assay with a Grr1 derivative as the bait, we identified She3, which is an adaptor protein in the asymmetric mRNA transport system, as a novel Grr1 substrate. We generated stabilized She3 mutants, which no longer bound to Grr1, and found that the degradation of She3 is not required for regulating asymmetric mRNA transport. However, She3 stabilization leads to slower growth compared to wild-type cells in a co-culture assay, demonstrating that the degradation of She3 by Grr1 is required for optimal cell growth.

  4. A septin from the filamentous fungus A. nidulans induces atypical pseudohyphae in the budding yeast S. cerevisiae

    Science.gov (United States)

    Septins were first discovered in Saccharomyces cerevisiae where they form a scaffold that organizes the bud site and are a component of the morphogenesis checkpoint that coordinates budding with mitosis. Five of the seven S. cerevisiae septins (Cdc3, Cdc10, Cdc11, Cdc12 and Shs1) colocalize as a rin...

  5. The Arabidopsis MutS homolog AtMSH5 is required for normal meiosis

    Institute of Scientific and Technical Information of China (English)

    Xiaoduo Lu; Xiaolin Liu; Lizhe An; Wei Zhang; Jian Sun; Huijuan Pei; Hongyan Meng; Yunliu Fan; Chunyi Zhang

    2008-01-01

    MSH5,a member of the MutS homolog DNA mismatch repair protein family,has been shown to be required for proper homologous chromosome recombination in diverse organisms such as mouse,budding yeast and Caenorhabditis elegans.In this paper,we show that a mutant Arabidopsis plant carrying the putative disrupted AtMSH5 gene exhibits defects during meiotic division,producing a proportion of nonviable pollen grains and abnormal embryo sacs,and thereby leading to a decrease in fertility.AtMSH5 expression is confined to meiotic floral buds,which is consistent with a possible role during meiosis.Cytological analysis of male meiosis revealed the presence of numerous univalents from diplotene to metaphase I,which were associated with a great reduction in chiasma frequencies.The average number of residual chiasmata in the mutant is reduced to 2.54 per meiocyte,which accounts for~25% of the amount in the wild type.Here,quantitative cytogenetical analysis reveals that the residual chiasmata in Atmsh5 mutants are randomly distributed among meiocytes,suggesting that AtMSH5 has an essential role during interferencesensitive chiasma formation.Taken together,the evidence indicates that AtMSH5 promotes homologous recombination through facilitating chiasma formation during prophase I in Arabidopsis.

  6. A transcriptional cascade governs entry into meiosis in Saccharomyces cerevisiae.

    OpenAIRE

    Smith, H E; Mitchell, A. P.

    1989-01-01

    Two signals activate meiosis in yeast: starvation and expression of the a1 and alpha 2 products of the mating-type locus. Prior studies suggest that these signals stimulate expression of an activator of meiosis, the IME1 (inducer of meiosis) product. We have cloned a gene, IME2, with properties similar to those of IME1: both genes are required for meiosis, and both RNAs are induced in meiotic cells. Elevated dosage of IME1 or IME2 stimulates the meiotic recombination pathway without starvatio...

  7. Assay for Spore Wall Integrity Using a Yeast Predator.

    Science.gov (United States)

    Okada, Hiroki; Neiman, Aaron M; Ohya, Yoshikazu

    2016-01-01

    During the budding yeast life cycle, a starved diploid cell undergoes meiosis followed by production of four haploid spores, each surrounded by a spore wall. The wall allows the spores to survive in harsh environments until conditions improve. Spores are also more resistant than vegetative cells to treatments such as ether vapor, glucanases, heat shock, high salt concentrations, and exposure to high or low pH, but the relevance of these treatments to natural environmental stresses remains unclear. This protocol describes a method for assaying the yeast spore wall under natural environmental conditions by quantifying the survival of yeast spores that have passed through the digestive system of a yeast predator, the fruit fly. PMID:27480715

  8. PRIMED: PRIMEr database for deleting and tagging all fission and budding yeast genes developed using the open-source genome retrieval script (GRS.

    Directory of Open Access Journals (Sweden)

    Michael T Cummings

    Full Text Available The fission (Schizosaccharomyces pombe and budding (Saccharomyces cerevisiae yeasts have served as excellent models for many seminal discoveries in eukaryotic biology. In these organisms, genes are deleted or tagged easily by transforming cells with PCR-generated DNA inserts, flanked by short (50-100 bp regions of gene homology. These PCR reactions use especially designed long primers, which, in addition to the priming sites, carry homology for gene targeting. Primer design follows a fixed method but is tedious and time-consuming especially when done for a large number of genes. To automate this process, we developed the Python-based Genome Retrieval Script (GRS, an easily customizable open-source script for genome analysis. Using GRS, we created PRIMED, the complete PRIMEr D atabase for deleting and C-terminal tagging genes in the main S. pombe and five of the most commonly used S. cerevisiae strains. Because of the importance of noncoding RNAs (ncRNAs in many biological processes, we also included the deletion primer set for these features in each genome. PRIMED are accurate and comprehensive and are provided as downloadable Excel files, removing the need for future primer design, especially for large-scale functional analyses. Furthermore, the open-source GRS can be used broadly to retrieve genome information from custom or other annotated genomes, thus providing a suitable platform for building other genomic tools by the yeast or other research communities.

  9. High Throughput Analyses of Budding Yeast ARSs Reveal New DNA Elements Capable of Conferring Centromere-Independent Plasmid Propagation

    OpenAIRE

    Timothy Hoggard; Ivan Liachko; Cassaundra Burt; Troy Meikle; Katherine Jiang; Gheorghe Craciun; Dunham, Maitreya J.; Fox, Catherine A.

    2016-01-01

    The ability of plasmids to propagate in Saccharomyces cerevisiae has been instrumental in defining eukaryotic chromosomal control elements. Stable propagation demands both plasmid replication, which requires a chromosomal replication origin (i.e., an ARS), and plasmid distribution to dividing cells, which requires either a chromosomal centromere for segregation or a plasmid-partitioning element. While our knowledge of yeast ARSs and centromeres is relatively advanced, we know less about chrom...

  10. Exposure of ELF-EMF and RF-EMF Increase the Rate of Glucose Transport and TCA Cycle in Budding Yeast

    Science.gov (United States)

    Lin, Kang-Wei; Yang, Chuan-Jun; Lian, Hui-Yong; Cai, Peng

    2016-01-01

    In this study, we investigated the transcriptional response to 50 Hz extremely low frequency electromagnetic field (ELF-EMF) and 2.0 GHz radio frequency electromagnetic field (RF-EMF) exposure by Illumina sequencing technology using budding yeast as the model organism. The transcription levels of 28 genes were upregulated and those of four genes were downregulated under ELF-EMF exposure, while the transcription levels of 29 genes were upregulated and those of 24 genes were downregulated under RF-EMF exposure. After validation by reverse transcription quantitative polymerase chain reaction (RT-qPCR), a concordant direction of change both in differential gene expression (DGE) and RT-qPCR was demonstrated for nine genes under ELF-EMF exposure and for 10 genes under RF-EMF exposure. The RT-qPCR results revealed that ELF-EMF and RF-EMF exposure can upregulate the expression of genes involved in glucose transportation and the tricarboxylic acid (TCA) cycle, but not the glycolysis pathway. Energy metabolism is closely related with the cell response to environmental stress including EMF exposure. Our findings may throw light on the mechanism underlying the biological effects of EMF.

  11. Doing the Meiosis Shuffle.

    Science.gov (United States)

    Krauskopf, Sara

    1999-01-01

    Presents a game called the Meiosis Shuffle that helps students simulate the process of meiosis in which homologous cards representing chromosomes pair up, line up, and split apart. Students respond well to the simulation and are better able to conceptualize what chromosomes do and how independent assortment causes genetic variation. (CCM)

  12. H2B ubiquitylation is part of chromatin architecture that marks exon-intron structure in budding yeast

    LENUS (Irish Health Repository)

    Shieh, Grace S.

    2011-12-22

    Abstract Background The packaging of DNA into chromatin regulates transcription from initiation through 3\\' end processing. One aspect of transcription in which chromatin plays a poorly understood role is the co-transcriptional splicing of pre-mRNA. Results Here we provide evidence that H2B monoubiquitylation (H2BK123ub1) marks introns in Saccharomyces cerevisiae. A genome-wide map of H2BK123ub1 in this organism reveals that this modification is enriched in coding regions and that its levels peak at the transcribed regions of two characteristic subgroups of genes. First, long genes are more likely to have higher levels of H2BK123ub1, correlating with the postulated role of this modification in preventing cryptic transcription initiation in ORFs. Second, genes that are highly transcribed also have high levels of H2BK123ub1, including the ribosomal protein genes, which comprise the majority of intron-containing genes in yeast. H2BK123ub1 is also a feature of introns in the yeast genome, and the disruption of this modification alters the intragenic distribution of H3 trimethylation on lysine 36 (H3K36me3), which functionally correlates with alternative RNA splicing in humans. In addition, the deletion of genes encoding the U2 snRNP subunits, Lea1 or Msl1, in combination with an htb-K123R mutation, leads to synthetic lethality. Conclusion These data suggest that H2BK123ub1 facilitates cross talk between chromatin and pre-mRNA splicing by modulating the distribution of intronic and exonic histone modifications.

  13. Divergent Evolution of the Transcriptional Network Controlled by Snf1-Interacting Protein Sip4 in Budding Yeasts.

    Directory of Open Access Journals (Sweden)

    Constance Mehlgarten

    Full Text Available Cellular responses to starvation are of ancient origin since nutrient limitation has always been a common challenge to the stability of living systems. Hence, signaling molecules involved in sensing or transducing information about limiting metabolites are highly conserved, whereas transcription factors and the genes they regulate have diverged. In eukaryotes the AMP-activated protein kinase (AMPK functions as a central regulator of cellular energy homeostasis. The yeast AMPK ortholog SNF1 controls the transcriptional network that counteracts carbon starvation conditions by regulating a set of transcription factors. Among those Cat8 and Sip4 have overlapping DNA-binding specificity for so-called carbon source responsive elements and induce target genes upon SNF1 activation. To analyze the evolution of the Cat8-Sip4 controlled transcriptional network we have compared the response to carbon limitation of Saccharomyces cerevisiae to that of Kluyveromyces lactis. In high glucose, S. cerevisiae displays tumor cell-like aerobic fermentation and repression of respiration (Crabtree-positive while K. lactis has a respiratory-fermentative life-style, respiration being regulated by oxygen availability (Crabtree-negative, which is typical for many yeasts and for differentiated higher cells. We demonstrate divergent evolution of the Cat8-Sip4 network and present evidence that a role of Sip4 in controlling anabolic metabolism has been lost in the Saccharomyces lineage. We find that in K. lactis, but not in S. cerevisiae, the Sip4 protein plays an essential role in C2 carbon assimilation including induction of the glyoxylate cycle and the carnitine shuttle genes. Induction of KlSIP4 gene expression by KlCat8 is essential under these growth conditions and a primary function of KlCat8. Both KlCat8 and KlSip4 are involved in the regulation of lactose metabolism in K. lactis. In chromatin-immunoprecipitation experiments we demonstrate binding of both, KlSip4 and

  14. Important role of catalase in the cellular response of the budding yeast Saccharomyces cerevisiae exposed to ionizing radiation.

    Science.gov (United States)

    Nishimoto, Takuto; Furuta, Masakazu; Kataoka, Michihiko; Kishida, Masao

    2015-03-01

    Ionizing radiation indirectly causes oxidative stress in cells via reactive oxygen species (ROS), such as hydroxyl radicals (OH(-)) generated by the radiolysis of water. We investigated how the catalase function was affected by ionizing radiation and analyzed the phenotype of mutants with a disrupted catalase gene in Saccharomyces cerevisiae exposed to radiation. The wild-type yeast strain and isogenic mutants with disrupted catalase genes were exposed to various doses of (60)Co gamma-rays. There was no difference between the wild-type strain and the cta1 disruption mutant following exposure to gamma-ray irradiation. In contrast, there was a significant decrease in the ctt1 disruption mutant, suggesting that this strain exhibited decreased survival on gamma-ray exposure compared with other strains. In all three strains, stationary phase cells were more tolerant to the exposure of gamma-rays than exponential phase cells, whereas the catalase activity in the wild-type strain and cta1 disruption mutant was higher in the stationary phase than in the exponential phase. These data suggest a correlation between catalase activity and survival following gamma-ray exposure. However, this correlation was not clear in the ctt1 disruption mutant, suggesting that other factors are involved in the tolerance to ROS induced by irradiation. PMID:25416226

  15. RIM15 antagonistic pleiotropy is responsible for differences in fermentation and stress response kinetics in budding yeast.

    Science.gov (United States)

    Kessi-Pérez, Eduardo I; Araos, Sebastián; García, Verónica; Salinas, Francisco; Abarca, Valentina; Larrondo, Luis F; Martínez, Claudio; Cubillos, Francisco A

    2016-05-01

    Different natural yeast populations have faced dissimilar selective pressures due to the heterogeneous fermentation substrates available around the world; this increases the genetic and phenotypic diversity in Saccharomyces cerevisiae In this context, we expect prominent differences between isolates when exposed to a particular condition, such as wine or sake musts. To better comprehend the mechanisms underlying niche adaptation between two S. cerevisiae isolates obtained from wine and sake fermentation processes, we evaluated fermentative and fungicide resistance phenotypes and identify the molecular origin of such adaptive variation. Multiple regions were associated with fermentation rate under different nitrogen conditions and fungicide resistance, with a single QTL co-localizing in all traits. Analysis around this region identified RIM15 as the causative locus driving fungicide sensitivity, together with efficient nitrogen utilization and glycerol production in the wine strain. A null RIM15 variant confers a greater fermentation rate through the utilization of available glucose instead of its storage. However, this variant has a detrimental effect on fungicide resistance since complex sugars are not synthesized and transported into the membrane. Together, our results reveal the antagonist pleiotropic nature of a RIM15 null variant, positively affecting a series of fermentation related phenotypes, but apparently detrimental in the wild. PMID:26945894

  16. Meiotic chromosome mobility in fission yeast is resistant to environmental stress

    Science.gov (United States)

    Illner, Doris; Lorenz, Alexander; Scherthan, Harry

    2016-01-01

    The formation of healthy gametes requires pairing of homologous chromosomes (homologs) as a prerequisite for their correct segregation during meiosis. Initially, homolog alignment is promoted by meiotic chromosome movements feeding into intimate homolog pairing by homologous recombination and/or synaptonemal complex formation. Meiotic chromosome movements in the fission yeast, Schizosaccharomyces pombe, depend on astral microtubule dynamics that drag the nucleus through the zygote; known as horsetail movement. The response of microtubule-led meiotic chromosome movements to environmental stresses such as ionizing irradiation (IR) and associated reactive oxygen species (ROS) is not known. Here, we show that, in contrast to budding yeast, the horsetail movement is largely radiation-resistant, which is likely mediated by a potent antioxidant defense. IR exposure of sporulating S. pombe cells induced misrepair and irreparable DNA double strand breaks causing chromosome fragmentation, missegregation and gamete death. Comparing radiation outcome in fission and budding yeast, and studying meiosis with poisoned microtubules indicates that the increased gamete death after IR is innate to fission yeast. Inhibition of meiotic chromosome mobility in the face of IR failed to influence the course of DSB repair, indicating that paralysis of meiotic chromosome mobility in a genotoxic environment is not a universal response among species. PMID:27074839

  17. Meiotic chromosome mobility in fission yeast is resistant to environmental stress.

    Science.gov (United States)

    Illner, Doris; Lorenz, Alexander; Scherthan, Harry

    2016-01-01

    The formation of healthy gametes requires pairing of homologous chromosomes (homologs) as a prerequisite for their correct segregation during meiosis. Initially, homolog alignment is promoted by meiotic chromosome movements feeding into intimate homolog pairing by homologous recombination and/or synaptonemal complex formation. Meiotic chromosome movements in the fission yeast, Schizosaccharomyces pombe, depend on astral microtubule dynamics that drag the nucleus through the zygote; known as horsetail movement. The response of microtubule-led meiotic chromosome movements to environmental stresses such as ionizing irradiation (IR) and associated reactive oxygen species (ROS) is not known. Here, we show that, in contrast to budding yeast, the horsetail movement is largely radiation-resistant, which is likely mediated by a potent antioxidant defense. IR exposure of sporulating S. pombe cells induced misrepair and irreparable DNA double strand breaks causing chromosome fragmentation, missegregation and gamete death. Comparing radiation outcome in fission and budding yeast, and studying meiosis with poisoned microtubules indicates that the increased gamete death after IR is innate to fission yeast. Inhibition of meiotic chromosome mobility in the face of IR failed to influence the course of DSB repair, indicating that paralysis of meiotic chromosome mobility in a genotoxic environment is not a universal response among species. PMID:27074839

  18. Identification of Putative Mek1 Substrates during Meiosis in Saccharomyces cerevisiae Using Quantitative Phosphoproteomics

    Science.gov (United States)

    Suhandynata, Raymond T.; Wan, Lihong; Zhou, Huilin; Hollingsworth, Nancy M.

    2016-01-01

    Meiotic recombination plays a key role in sexual reproduction as it generates crossovers that, in combination with sister chromatid cohesion, physically connect homologous chromosomes, thereby promoting their proper segregation at the first meiotic division. Meiotic recombination is initiated by programmed double strand breaks (DSBs) catalyzed by the evolutionarily conserved, topoisomerase-like protein Spo11. Repair of these DSBs is highly regulated to create crossovers between homologs that are distributed throughout the genome. This repair requires the presence of the mitotic recombinase, Rad51, as well as the strand exchange activity of the meiosis-specific recombinase, Dmc1. A key regulator of meiotic DSB repair in Saccharomyces cerevisiae is the meiosis-specific kinase Mek1, which promotes interhomolog strand invasion and is required for the meiotic recombination checkpoint and the crossover/noncrossover decision. Understanding how Mek1 regulates meiotic recombination requires the identification of its substrates. Towards that end, an unbiased phosphoproteomic approach utilizing Stable Isotope Labeling by Amino Acids in Cells (SILAC) was utilized to generate a list of potential Mek1 substrates, as well as proteins containing consensus phosphorylation sites for cyclin-dependent kinase, the checkpoint kinases, Mec1/Tel1, and the polo-like kinase, Cdc5. These experiments represent the first global phosphoproteomic dataset for proteins in meiotic budding yeast. PMID:27214570

  19. Identification of Putative Mek1 Substrates during Meiosis in Saccharomyces cerevisiae Using Quantitative Phosphoproteomics.

    Directory of Open Access Journals (Sweden)

    Raymond T Suhandynata

    Full Text Available Meiotic recombination plays a key role in sexual reproduction as it generates crossovers that, in combination with sister chromatid cohesion, physically connect homologous chromosomes, thereby promoting their proper segregation at the first meiotic division. Meiotic recombination is initiated by programmed double strand breaks (DSBs catalyzed by the evolutionarily conserved, topoisomerase-like protein Spo11. Repair of these DSBs is highly regulated to create crossovers between homologs that are distributed throughout the genome. This repair requires the presence of the mitotic recombinase, Rad51, as well as the strand exchange activity of the meiosis-specific recombinase, Dmc1. A key regulator of meiotic DSB repair in Saccharomyces cerevisiae is the meiosis-specific kinase Mek1, which promotes interhomolog strand invasion and is required for the meiotic recombination checkpoint and the crossover/noncrossover decision. Understanding how Mek1 regulates meiotic recombination requires the identification of its substrates. Towards that end, an unbiased phosphoproteomic approach utilizing Stable Isotope Labeling by Amino Acids in Cells (SILAC was utilized to generate a list of potential Mek1 substrates, as well as proteins containing consensus phosphorylation sites for cyclin-dependent kinase, the checkpoint kinases, Mec1/Tel1, and the polo-like kinase, Cdc5. These experiments represent the first global phosphoproteomic dataset for proteins in meiotic budding yeast.

  20. Sisters dancing in meiosis

    OpenAIRE

    Baarends, Willy; Mercier, Raphael

    2010-01-01

    The EMBO Conference on Meiosis held last September highlighted the dynamic aspects of this process, including the variability of hotspots for break formation, switches between partners during repair and the dynamics of sister chromatid cohesion.

  1. Transcript profiling to analyse gene expression during male meiosis in Petunia hybrida

    NARCIS (Netherlands)

    Cnudde, Filip

    2004-01-01

    Meiosis is a key feature of eukaryotic sexual reproduction. So far, the molecular and functional analysis of meiosis is relatively underdeveloped in plants, but the flood of genomics data from yeast research and the availability of large mutant collections cause a growing interest in molecular studi

  2. Microscopic Procedures for Plant Meiosis.

    Science.gov (United States)

    Braselton, James P.

    1997-01-01

    Describes laboratory techniques designed to familiarize students with meiosis and how microscopic preparations of meiosis are made. These techniques require the use of fresh or fixed flowers. Contains 18 references. (DDR)

  3. Meiosis and SUMO

    DEFF Research Database (Denmark)

    Holm, Lærke Rebekka

    target proteins can be catalyzed by the SUMO E3 ligase Pli1. In this study we investigate the role of Pli1 and Pmt3 during meiotic differentiation and at repetitive DNA during mitotic growth. Target proteins for Pmt3 are many; however, Pli1 has a meiosis-specic function regulating meiotic recombination...

  4. Spindle checkpoint activation at meiosis I advances anaphase II onset via meiosis-specific APC/C regulation

    OpenAIRE

    Yamamoto, Ayumu; Kitamura, Kenji; Hihara, Daisuke; Hirose, Yukinobu; Katsuyama, Satoshi; Hiraoka, Yasushi

    2008-01-01

    During mitosis, the spindle assembly checkpoint (SAC) inhibits the Cdc20-activated anaphase-promoting complex/cyclosome (APC/CCdc20), which promotes protein degradation, and delays anaphase onset to ensure accurate chromosome segregation. However, the SAC function in meiotic anaphase regulation is poorly understood. Here, we examined the SAC function in fission yeast meiosis. As in mitosis, a SAC factor, Mad2, delayed anaphase onset via Slp1 (fission yeast Cdc20) when chromosomes attach to th...

  5. Biotechnical Microbiology, yeast and bacteria

    DEFF Research Database (Denmark)

    Villadsen, Ingrid Stampe

    1999-01-01

    This section contains the following single lecture notes: Eukaryotic Cell Biology. Kingdom Fungi. Cell Division. Meiosis and Recombination. Genetics of Yeast. Organisation of the Chromosome. Organization and genetics of the mitochondrial Geneme. Regulatio of Gene Expression. Intracellular Compart...

  6. Live cell imaging of the assembly, disassembly, and actin cable–dependent movement of endosomes and actin patches in the budding yeast, Saccharomyces cerevisiae

    OpenAIRE

    Huckaba, Thomas M.; Gay, Anna Card; Pantalena, Luiz Fernando; Yang, Hyeong-Cheol; Liza A Pon

    2004-01-01

    Using FM4-64 to label endosomes and Abp1p-GFP or Sac6p-GFP to label actin patches, we find that (1) endosomes colocalize with actin patches as they assemble at the bud cortex; (2) endosomes colocalize with actin patches as they undergo linear, retrograde movement from buds toward mother cells; and (3) actin patches interact with and disassemble at FM4-64–labeled internal compartments. We also show that retrograde flow of actin cables mediates retrograde actin patch movement. An Arp2/3 complex...

  7. Meiosis: inducing variation by reduction

    NARCIS (Netherlands)

    Cnudde, F.; Gerats, A.G.M.

    2005-01-01

    A brief introduction is presented with some thought on the origin of meiosis. Subsequently, a sequential overview of the diverse processes that take place during meiosis is provided, with an eye to similarities and differences between the different eukaryotic systems. In the final part, we try to su

  8. Importance of Mitochondrial Dynamics During Meiosis and Sporulation

    OpenAIRE

    Gorsich, Steven W; Janet M Shaw

    2004-01-01

    Opposing fission and fusion events maintain the yeast mitochondrial network. Six proteins regulate these membrane dynamics during mitotic growth—Dnm1p, Mdv1p, and Fis1p mediate fission; Fzo1p, Mgm1p, and Ugo1p mediate fusion. Previous studies established that mitochondria fragment and rejoin at distinct stages during meiosis and sporulation, suggesting that mitochondrial fission and fusion are required during this process. Here we report that strains defective for mitochondrial fission alone,...

  9. Unique geometry of sister kinetochores in human oocytes during meiosis I may explain maternal age-associated increases in chromosomal abnormalities

    Directory of Open Access Journals (Sweden)

    Jessica Patel

    2016-02-01

    Full Text Available The first meiotic division in human oocytes is highly error-prone and contributes to the uniquely high incidence of aneuploidy observed in human pregnancies. A successful meiosis I (MI division entails separation of homologous chromosome pairs and co-segregation of sister chromatids. For this to happen, sister kinetochores must form attachments to spindle kinetochore-fibres emanating from the same pole. In mouse and budding yeast, sister kinetochores remain closely associated with each other during MI, enabling them to act as a single unified structure. However, whether this arrangement also applies in human meiosis I oocytes was unclear. In this study, we perform high-resolution imaging of over 1900 kinetochores in human oocytes, to examine the geometry and architecture of the human meiotic kinetochore. We reveal that sister kinetochores in MI are not physically fused, and instead individual kinetochores within a pair are capable of forming independent attachments to spindle k-fibres. Notably, with increasing female age, the separation between kinetochores increases, suggesting a degradation of centromeric cohesion and/or changes in kinetochore architecture. Our data suggest that the differential arrangement of sister kinetochores and dual k-fibre attachments may explain the high proportion of unstable attachments that form in MI and thus indicate why human oocytes are prone to aneuploidy, particularly with increasing maternal age.

  10. Puf3p, a Pumilio family RNA binding protein, localizes to mitochondria and regulates mitochondrial biogenesis and motility in budding yeast

    Science.gov (United States)

    García-Rodríguez, Luis J.; Gay, Anna Card; Pon, Liza A.

    2007-01-01

    Puf3p binds preferentially to messenger RNAs (mRNAs) for nuclear-encoded mitochondrial proteins. We find that Puf3p localizes to the cytosolic face of the mitochondrial outer membrane. Overexpression of PUF3 results in reduced mitochondrial respiratory activity and reduced levels of Pet123p, a protein encoded by a Puf3p-binding mRNA. Puf3p levels are reduced during the diauxic shift and growth on a nonfermentable carbon source, conditions that stimulate mitochondrial biogenesis. These findings support a role for Puf3p in mitochondrial biogenesis through effects on mRNA interactions. In addition, Puf3p links the mitochore, a complex required for mitochondrial–cytoskeletal interactions, to the Arp2/3 complex, the force generator for actin-dependent, bud-directed mitochondrial movement. Puf3p, the mitochore, and the Arp2/3 complex coimmunoprecipitate and have two-hybrid interactions. Moreover, deletion of PUF3 results in reduced interaction between the mitochore and the Arp2/3 complex and defects in mitochondrial morphology and motility similar to those observed in Arp2/3 complex mutants. Thus, Puf3p is a mitochondrial protein that contributes to the biogenesis and motility of the organelle. PMID:17210948

  11. Black Hole Meiosis

    CERN Document Server

    Van Herck, Walter

    2009-01-01

    The enumeration of BPS bound states in string theory needs refinement. Studying partition functions of particles made from D-branes wrapped on algebraic Calabi-Yau 3-folds, and classifying states using split attractor flow trees, we extend the method for computing a refined BPS index, arXiv:0810.4301. For certain D-particles, a finite number of microstates, namely polar states, exclusively realized as bound states, determine an entire partition function (elliptic genus). This underlines their crucial importance: one might call them the `chromosomes' of a D-particle or a black hole. As polar states also can be affected by our refinement, previous predictions on elliptic genera are modified. This can be metaphorically interpreted as `crossing-over in the meiosis of a D-particle'. Our results improve on hep-th/0702012, provide non-trivial evidence for a strong split attractor flow tree conjecture, and thus suggest that we indeed exhaust the BPS spectrum. In the D-brane description of a bound state, the necessity...

  12. Black hole meiosis

    Science.gov (United States)

    van Herck, Walter; Wyder, Thomas

    2010-04-01

    The enumeration of BPS bound states in string theory needs refinement. Studying partition functions of particles made from D-branes wrapped on algebraic Calabi-Yau 3-folds, and classifying states using split attractor flow trees, we extend the method for computing a refined BPS index, [1]. For certain D-particles, a finite number of microstates, namely polar states, exclusively realized as bound states, determine an entire partition function (elliptic genus). This underlines their crucial importance: one might call them the ‘chromosomes’ of a D-particle or a black hole. As polar states also can be affected by our refinement, previous predictions on elliptic genera are modified. This can be metaphorically interpreted as ‘crossing-over in the meiosis of a D-particle’. Our results improve on [2], provide non-trivial evidence for a strong split attractor flow tree conjecture, and thus suggest that we indeed exhaust the BPS spectrum. In the D-brane description of a bound state, the necessity for refinement results from the fact that tachyonic strings split up constituent states into ‘generic’ and ‘special’ states. These are enumerated separately by topological invariants, which turn out to be partitions of Donaldson-Thomas invariants. As modular predictions provide a check on many of our results, we have compelling evidence that our computations are correct.

  13. Detection of Multiple Budding Yeast Cells and a Partial Sequence of 43-kDa Glycoprotein Coding Gene of Paracoccidioides brasiliensis from a Case of Lacaziosis in a Female Pacific White-Sided Dolphin (Lagenorhynchus obliquidens).

    Science.gov (United States)

    Minakawa, Tomoko; Ueda, Keiichi; Tanaka, Miyuu; Tanaka, Natsuki; Kuwamura, Mitsuru; Izawa, Takeshi; Konno, Toshihiro; Yamate, Jyoji; Itano, Eiko Nakagawa; Sano, Ayako; Wada, Shinpei

    2016-08-01

    Lacaziosis, formerly called as lobomycosis, is a zoonotic mycosis, caused by Lacazia loboi, found in humans and dolphins, and is endemic in the countries on the Atlantic Ocean, Indian Ocean and Pacific Ocean of Japanese coast. Susceptible Cetacean species include the bottlenose dolphin (Tursiops truncatus), the Indian Ocean bottlenose dolphin (T. aduncus), and the estuarine dolphin (Sotalia guianensis); however, no cases have been recorded in other Cetacean species. We diagnosed a case of Lacaziosis in a Pacific white-sided dolphin (Lagenorhynchus obliquidens) nursing in an aquarium in Japan. The dolphin was a female estimated to be more than 14 years old at the end of June 2015 and was captured in a coast of Japan Sea in 2001. Multiple, lobose, and solid granulomatous lesions with or without ulcers appeared on her jaw, back, flipper and fluke skin, in July 2014. The granulomatous skin lesions from the present case were similar to those of our previous cases. Multiple budding and chains of round yeast cells were detected in the biopsied samples. The partial sequence of 43-kDa glycoprotein coding gene confirmed by a nested PCR and sequencing, which revealed a different genotype from both Amazonian and Japanese lacaziosis in bottlenose dolphins, and was 99 % identical to those derived from Paracoccidioides brasiliensis; a sister fungal species to L. loboi. This is the first case of lacaziosis in Pacific white-sided dolphin. PMID:26883513

  14. Pch2 acts through Xrs2 and Tel1/ATM to modulate interhomolog bias and checkpoint function during meiosis.

    Directory of Open Access Journals (Sweden)

    Hsuan-Chung Ho

    2011-11-01

    Full Text Available Proper segregation of chromosomes during meiosis requires the formation and repair of double-strand breaks (DSBs to form crossovers. Repair is biased toward using the homolog as a substrate rather than the sister chromatid. Pch2 is a conserved member of the AAA(+-ATPase family of proteins and is implicated in a wide range of meiosis-specific processes including the recombination checkpoint, maturation of the chromosome axis, crossover control, and synapsis. We demonstrate a role for Pch2 in promoting and regulating interhomolog bias and the meiotic recombination checkpoint in response to unprocessed DSBs through the activation of axial proteins Hop1 and Mek1 in budding yeast. We show that Pch2 physically interacts with the putative BRCT repeats in the N-terminal region of Xrs2, a member of the MRX complex that acts at sites of unprocessed DSBs. Pch2, Xrs2, and the ATM ortholog Tel1 function in the same pathway leading to the phosphorylation of Hop1, independent of Rad17 and the ATR ortholog Mec1, which respond to the presence of single-stranded DNA. An N-terminal deletion of Xrs2 recapitulates the pch2Δ phenotypes for signaling unresected breaks. We propose that interaction with Xrs2 may enable Pch2 to remodel chromosome structure adjacent to the site of a DSB and thereby promote accessibility of Hop1 to the Tel1 kinase. In addition, Xrs2, like Pch2, is required for checkpoint-mediated delay conferred by the failure to synapse chromosomes.

  15. Development of a Meiosis Concept Inventory

    Science.gov (United States)

    Kalas, Pamela; O'Neill, Angie; Pollock, Carol; Birol, Gulnur

    2013-01-01

    We have designed, developed, and validated a 17-question Meiosis Concept Inventory (Meiosis CI) to diagnose student misconceptions on meiosis, which is a fundamental concept in genetics. We targeted large introductory biology and genetics courses and used published methodology for question development, which included the validation of questions by…

  16. Distinct functions of S. pombe Rec12 (Spo11) protein and Rec12-dependent crossover recombination (chiasmata) in meiosis I; and a requirement for Rec12 in meiosis II

    OpenAIRE

    Sharif, Wallace D.; Glick, Gloria G.; Davidson, Mari K.; Wahls, Wayne P.

    2002-01-01

    Background In most organisms proper reductional chromosome segregation during meiosis I is strongly correlated with the presence of crossover recombination structures (chiasmata); recombination deficient mutants lack crossovers and suffer meiosis I nondisjunction. We report that these functions are separable in the fission yeast Schizosaccharomyces pombe. Results Intron mapping and expression studies confirmed that Rec12 is a member of the Spo11/Top6A topoisomerase family required for the for...

  17. A selfish DNA element engages a meiosis-specific motor and telomeres for germ-line propagation

    OpenAIRE

    Sau, Soumitra; Conrad, Michael N.; Lee, Chih-Ying; Kaback, David B; Dresser, Michael E.; Jayaram, Makkuni

    2014-01-01

    The chromosome-like mitotic stability of the yeast 2 micron plasmid is conferred by the plasmid proteins Rep1-Rep2 and the cis-acting locus STB, likely by promoting plasmid-chromosome association and segregation by hitchhiking. Our analysis reveals that stable plasmid segregation during meiosis requires the bouquet proteins Ndj1 and Csm4. Plasmid relocalization from the nuclear interior in mitotic cells to the periphery at or proximal to telomeres rises from early meiosis to pachytene. Analog...

  18. A novel role for the GTPase-activating protein Bud2 in the spindle position checkpoint.

    Directory of Open Access Journals (Sweden)

    Scott A Nelson

    Full Text Available The spindle position checkpoint (SPC ensures correct mitotic spindle position before allowing mitotic exit in the budding yeast Saccharomyces cerevisiae. In a candidate screen for checkpoint genes, we identified bud2Δ as deficient for the SPC. Bud2 is a GTPase activating protein (GAP, and the only known substrate of Bud2 was Rsr1/Bud1, a Ras-like GTPase and a central component of the bud-site-selection pathway. Mutants lacking Rsr1/Bud1 had no checkpoint defect, as did strains lacking and overexpressing Bud5, a guanine-nucleotide exchange factor (GEF for Rsr1/Bud1. Thus, the checkpoint function of Bud2 is distinct from its role in bud site selection. The catalytic activity of the Bud2 GAP domain was required for the checkpoint, based on the failure of the known catalytic point mutant Bud2(R682A to function in the checkpoint. Based on assays of heterozygous diploids, bud2(R682A, was dominant for loss of checkpoint but recessive for bud-site-selection failure, further indicating a separation of function. Tem1 is a Ras-like protein and is the critical regulator of mitotic exit, sitting atop the mitotic exit network (MEN. Tem1 is a likely target for Bud2, supported by genetic analyses that exclude other Ras-like proteins.

  19. ALT Telomeres borrow from meiosis

    OpenAIRE

    Arnoult, Nausica; Karlseder, Jan

    2014-01-01

    The clustering of telomeres is required for the homologous recombination events that maintain chromosome ends in cells relying on alternative lengthening of telomeres (ALT). New data emerged to demonstrate that damage signaling at telomeres induces directional movement and synapsis, driven by the machinery responsible for recombination in meiosis.

  20. Pexophagy in yeasts.

    Science.gov (United States)

    Oku, Masahide; Sakai, Yasuyoshi

    2016-05-01

    Pexophagy, selective degradation of peroxisomes via autophagy, is the main system for reducing organelle abundance. Elucidation of the molecular machinery of pexophagy has been pioneered in studies of the budding yeast Saccharomyces cerevisiae and the methylotrophic yeasts Pichia pastoris and Hansenula polymorpha. Recent analyses using these yeasts have elucidated the molecular machineries of pexophagy, especially in terms of the interactions and modifications of the so-called adaptor proteins required for guiding autophagic membrane biogenesis on the organelle surface. Based on the recent findings, functional relevance of pexophagy and another autophagic pathway, mitophagy (selective autophagy of mitochondria), is discussed. We also discuss the physiological importance of pexophagy in these yeast systems. PMID:26409485

  1. Chromosome segregation in plant meiosis

    Directory of Open Access Journals (Sweden)

    Linda eZamariola

    2014-06-01

    Full Text Available Faithful chromosome segregation in meiosis is essential for ploidy stability over sexual life cycles. In plants, defective chromosome segregation caused by gene mutations or other factors leads to the formation of unbalanced or unreduced gametes creating aneuploid or polyploid progeny, respectively. Accurate segregation requires the coordinated execution of conserved processes occurring throughout the two meiotic cell divisions. Synapsis and recombination ensure the establishment of chiasmata that hold homologous chromosomes together allowing their correct segregation in the first meiotic division, which is also tightly regulated by cell-cycle dependent release of cohesin and monopolar attachment of sister kinetochores to microtubules. In meiosis II, bi-orientation of sister kinetochores and proper spindle orientation correctly segregate chromosomes in four haploid cells. Checkpoint mechanisms acting at kinetochores control the accuracy of kinetochore-microtubule attachment, thus ensuring the completion of segregation. Here we review the current knowledge on the processes taking place during chromosome segregation in plant meiosis, focusing on the characterization of the molecular factors involved.

  2. Holocentric plant meiosis: first sisters, then homologues

    OpenAIRE

    Heckmann, Stefan; Schubert, Veit; Houben, Andreas

    2014-01-01

    Meiosis is a crucial process of sexual reproduction by forming haploid gametes from diploid precursor cells. It involves 2 subsequent divisions (meiosis I and meiosis II) after one initial round of DNA replication. Homologous monocentric chromosomes are separated during the first and sister chromatids during the second meiotic division. The faithful segregation of monocentric chromosomes is realized by mono-orientation of fused sister kinetochores at metaphase I and by bi-orientation of siste...

  3. ERAD substrate recognition in budding yeast.

    Science.gov (United States)

    Xie, Wei; Ng, Davis T W

    2010-07-01

    During protein synthesis, the orderly progression of folding, modification, and assembly is paramount to function and vis-à-vis cellular viability. Accordingly, sophisticated quality control mechanisms have evolved to monitor protein maturation throughout the cell. Proteins failing at any step are segregated and degraded as a preventative measure against potential toxicity. Although protein quality control is generally poorly understood, recent research advances in endoplasmic reticulum-associated degradation (ERAD) pathways have provided the most detailed view so far. The discovery of distinct substrate processing sites established a biochemical basis for genetic profiles of model misfolded proteins. Detailed mechanisms for substrate recognition were recently uncovered. For some proteins, sequential glycan trimming steps set a time window for folding. Proteins still unfolded at the final stage expose a specific degradation signal recognized by the ERAD machinery. Through this mechanism, the system does not in fact know that a molecule is "misfolded". Instead, it goes by the premise that proteins past due have veered off their normal folding pathways and therefore aberrant. PMID:20178855

  4. Analysis of meiosis regulators in human gonads

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Nielsen, John E; Jensen, Martin Blomberg;

    2012-01-01

    The mitosis-meiosis switch is a key event in the differentiation of germ cells. In humans, meiosis is initiated in fetal ovaries, whereas in testes meiotic entry is inhibited until puberty. The purpose of this study was to examine the expression pattern of meiosis regulators in human gonads and to...... with rodents, but with some minor differences, such as a stable expression of CYP26B1 in human fetal ovaries. The sexually dimorphic expression pattern of DMRT1 indicates a similar role in the mitosis-meiosis switch in human gonads as previously demonstrated in mice. The biological importance of the...

  5. Bud Dormancy and Growth

    Science.gov (United States)

    Nearly all land plants produce ancillary meristems in the form of axillary or adventitious buds in addition to the shoot apical meristem. Outgrowth of these buds has a significant impact on plant architecture and the ability of plants to compete with neighboring plants, as well as to respond to and ...

  6. Sexual differentiation in fission yeast

    DEFF Research Database (Denmark)

    Egel, R; Nielsen, O; Weilguny, D;

    1990-01-01

    The regulation of sexual reproduction in yeast constitutes the highest level of differentiation observed in these unicellular organisms. The various ramifications of this system involve DNA rearrangement, transcriptional control, post-translational modification (such as protein phosphorylation) a......) and receptor/signal processing. A few basic similarities are common to both fission and budding yeasts. The wiring of the regulatory circuitry, however, varies considerably between these divergent yeast groups....

  7. Meiosis-specific loading of the centromere-specific histone CENH3 in Arabidopsis thaliana.

    Science.gov (United States)

    Ravi, Maruthachalam; Shibata, Fukashi; Ramahi, Joseph S; Nagaki, Kiyotaka; Chen, Changbin; Murata, Minoru; Chan, Simon W L

    2011-06-01

    Centromere behavior is specialized in meiosis I, so that sister chromatids of homologous chromosomes are pulled toward the same side of the spindle (through kinetochore mono-orientation) and chromosome number is reduced. Factors required for mono-orientation have been identified in yeast. However, comparatively little is known about how meiotic centromere behavior is specialized in animals and plants that typically have large tandem repeat centromeres. Kinetochores are nucleated by the centromere-specific histone CENH3. Unlike conventional histone H3s, CENH3 is rapidly evolving, particularly in its N-terminal tail domain. Here we describe chimeric variants of CENH3 with alterations in the N-terminal tail that are specifically defective in meiosis. Arabidopsis thaliana cenh3 mutants expressing a GFP-tagged chimeric protein containing the H3 N-terminal tail and the CENH3 C-terminus (termed GFP-tailswap) are sterile because of random meiotic chromosome segregation. These defects result from the specific depletion of GFP-tailswap protein from meiotic kinetochores, which contrasts with its normal localization in mitotic cells. Loss of the GFP-tailswap CENH3 variant in meiosis affects recruitment of the essential kinetochore protein MIS12. Our findings suggest that CENH3 loading dynamics might be regulated differently in mitosis and meiosis. As further support for our hypothesis, we show that GFP-tailswap protein is recruited back to centromeres in a subset of pollen grains in GFP-tailswap once they resume haploid mitosis. Meiotic recruitment of the GFP-tailswap CENH3 variant is not restored by removal of the meiosis-specific cohesin subunit REC8. Our results reveal the existence of a specialized loading pathway for CENH3 during meiosis that is likely to involve the hypervariable N-terminal tail. Meiosis-specific CENH3 dynamics may play a role in modulating meiotic centromere behavior. PMID:21695238

  8. Meiosis-specific loading of the centromere-specific histone CENH3 in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Maruthachalam Ravi

    2011-06-01

    Full Text Available Centromere behavior is specialized in meiosis I, so that sister chromatids of homologous chromosomes are pulled toward the same side of the spindle (through kinetochore mono-orientation and chromosome number is reduced. Factors required for mono-orientation have been identified in yeast. However, comparatively little is known about how meiotic centromere behavior is specialized in animals and plants that typically have large tandem repeat centromeres. Kinetochores are nucleated by the centromere-specific histone CENH3. Unlike conventional histone H3s, CENH3 is rapidly evolving, particularly in its N-terminal tail domain. Here we describe chimeric variants of CENH3 with alterations in the N-terminal tail that are specifically defective in meiosis. Arabidopsis thaliana cenh3 mutants expressing a GFP-tagged chimeric protein containing the H3 N-terminal tail and the CENH3 C-terminus (termed GFP-tailswap are sterile because of random meiotic chromosome segregation. These defects result from the specific depletion of GFP-tailswap protein from meiotic kinetochores, which contrasts with its normal localization in mitotic cells. Loss of the GFP-tailswap CENH3 variant in meiosis affects recruitment of the essential kinetochore protein MIS12. Our findings suggest that CENH3 loading dynamics might be regulated differently in mitosis and meiosis. As further support for our hypothesis, we show that GFP-tailswap protein is recruited back to centromeres in a subset of pollen grains in GFP-tailswap once they resume haploid mitosis. Meiotic recruitment of the GFP-tailswap CENH3 variant is not restored by removal of the meiosis-specific cohesin subunit REC8. Our results reveal the existence of a specialized loading pathway for CENH3 during meiosis that is likely to involve the hypervariable N-terminal tail. Meiosis-specific CENH3 dynamics may play a role in modulating meiotic centromere behavior.

  9. Meiosis.

    Science.gov (United States)

    Henderson, Paula

    This autoinstructional lesson deals with the study of cytology (or cells) with emphasis placed on cell reproduction. Knowledge of the structure of the DNA molecule and of the stages of mitotic cell division are considered prerequisites for this lesson. Approximately 15 minutes is the established time set for the activity. The behavioral objectives…

  10. Functional specialization of chordate CDK1 paralogs during oogenic meiosis.

    Science.gov (United States)

    Øvrebø, Jan Inge; Campsteijn, Coen; Kourtesis, Ioannis; Hausen, Harald; Raasholm, Martina; Thompson, Eric M

    2015-01-01

    Cyclin-dependent kinases (CDKs) are central regulators of eukaryotic cell cycle progression. In contrast to interphase CDKs, the mitotic phase CDK1 is the only CDK capable of driving the entire cell cycle and it can do so from yeast to mammals. Interestingly, plants and the marine chordate, Oikopleura dioica, possess paralogs of the highly conserved CDK1 regulator. However, whereas in plants the 2 CDK1 paralogs replace interphase CDK functions, O. dioica has a full complement of interphase CDKs in addition to its 5 odCDK1 paralogs. Here we show specific sub-functionalization of odCDK1 paralogs during oogenesis. Differential spatiotemporal dynamics of the odCDK1a, d and e paralogs and the meiotic polo-like kinase 1 (Plk1) and aurora kinase determine the subset of meiotic nuclei in prophase I arrest that will seed growing oocytes and complete meiosis. Whereas we find odCDK1e to be non-essential, knockdown of the odCDK1a paralog resulted in the spawning of non-viable oocytes of reduced size. Knockdown of odCDK1d also resulted in the spawning of non-viable oocytes. In this case, the oocytes were of normal size, but were unable to extrude polar bodies upon exposure to sperm, because they were unable to resume meiosis from prophase I arrest, a classical function of the sole CDK1 during meiosis in other organisms. Thus, we reveal specific sub-functionalization of CDK1 paralogs, during the meiotic oogenic program. PMID:25714331

  11. Forskolin and the meiosis inducing substance synergistically initiate meiosis in fetal male germ cells

    DEFF Research Database (Denmark)

    Byskov, A G; Fenger, M; Westergaard, L;

    1993-01-01

    We have shown that Meiosis Inducing Substance (MIS) and forskolin synergistically and dose dependently induce meiosis in germ cells of cultured fetal mouse testes. We used a bioassay which consists of fetal mouse testes and ovaries cultured for 6 days. In this study MIS media are spent culture...... fixed, squashed, and DNA-stained. In these preparations germ cells and somatic cells can be distinguished, and the number of germ cells in the different stages of meiosis is counted as is the number of somatic cells in mitosis. MIS activity is defined to be present in a medium when meiosis is induced in...... male germ cells during culture. We found that MIS media as well as forskolin induced meiosis in fetal male germ cells in a dose-dependent manner. In addition, MIS media and forskolin acted synergistically by inducing meiosis. Female germ cells seem to be unaffected by the various culture media. These...

  12. Forskolin and the meiosis inducing substance synergistically initiate meiosis in fetal male germ cells

    DEFF Research Database (Denmark)

    Byskov, A G; Fenger, M; Westergaard, L;

    1993-01-01

    We have shown that Meiosis Inducing Substance (MIS) and forskolin synergistically and dose dependently induce meiosis in germ cells of cultured fetal mouse testes. We used a bioassay which consists of fetal mouse testes and ovaries cultured for 6 days. In this study MIS media are spent culture...... male germ cells during culture. We found that MIS media as well as forskolin induced meiosis in fetal male germ cells in a dose-dependent manner. In addition, MIS media and forskolin acted synergistically by inducing meiosis. Female germ cells seem to be unaffected by the various culture media. These...

  13. Tradescantia: A Tool for Teaching Meiosis.

    Science.gov (United States)

    Hammersmith, Robert L.; Mertens, Thomas R.

    1997-01-01

    Describes a procedure for making slides of microsporogenesis in Tradescantia. Uses photographs to demonstrate that Tradescantia is an ideal organism for studying meiosis in the classroom. Contains 17 references. (JRH)

  14. Assessing Understanding of Biological Processes: Elucidating Students' Models of Meiosis.

    Science.gov (United States)

    Kindfield, Ann C.

    1994-01-01

    Presents a meiosis reasoning problem that provides direct access to students' current models of chromosomes and meiosis. Also included in the article are tips for classroom implementation and a summary of the solution evaluation. (ZWH)

  15. The roles of the catalytic and noncatalytic activities of Rpd3L and Rpd3S in the regulation of gene transcription in yeast.

    Science.gov (United States)

    Yeheskely-Hayon, Daniella; Kotler, Anat; Stark, Michal; Hashimshony, Tamar; Sagee, Shira; Kassir, Yona

    2013-01-01

    In budding yeasts, the histone deacetylase Rpd3 resides in two different complexes called Rpd3L (large) and Rpd3S (small) that exert opposing effects on the transcription of meiosis-specific genes. By introducing mutations that disrupt the integrity and function of either Rpd3L or Rpd3S, we show here that Rpd3 function is determined by its association with either of these complexes. Specifically, the catalytic activity of Rpd3S activates the transcription of the two major positive regulators of meiosis, IME1 and IME2, under all growth conditions and activates the transcription of NDT80 only during vegetative growth. In contrast, the effects of Rpd3L depends on nutrients; it represses or activates transcription in the presence or absence of a nitrogen source, respectively. Further, we show that transcriptional activation does not correlate with histone H4 deacetylation, suggesting an effect on a nonhistone protein. Comparison of rpd3-null and catalytic-site point mutants revealed an inhibitory activity that is independent of either the catalytic activity of Rpd3 or the integrity of Rpd3L and Rpd3S. PMID:24358376

  16. High School Students' Use of Meiosis When Solving Genetics Problems.

    Science.gov (United States)

    Wynne, Cynthia F.; Stewart, Jim; Passmore, Cindy

    2001-01-01

    Paints a different picture of students' reasoning with meiosis as they solved complex, computer-generated genetics problems, some of which required them to revise their understanding of meiosis in response to anomalous data. Students were able to develop a rich understanding of meiosis and can utilize that knowledge to solve genetics problems.…

  17. Meiosis-Driven Genome Variation in Plants

    Science.gov (United States)

    Meiosis includes two successive divisions of the nucleus with one round of DNA replication and leads to the formation of gametes with half the chromosomes of the mother cell during sexual reproduction. It provides a cytological basis for gametogenesis and inheritance in eukaryotes. Meiotic cell di...

  18. The transcriptome landscape of early maize meiosis

    Science.gov (United States)

    Meiosis, particularly meiotic recombination, is a major factor affecting yield and breeding of plants. To gain insight into the transcriptome landscape during early initiation steps of meiotic recombination, we profiled early prophase I meiocytes from maize using RNA-seq. Our analyses of genes prefe...

  19. Robust heat shock induces eIF2α-phosphorylation-independent assembly of stress granules containing eIF3 and 40S ribosomal subunits in budding yeast, Saccharomyces cerevisiae

    Czech Academy of Sciences Publication Activity Database

    Groušl, Tomáš; Ivanov, P.; Frýdlová, Ivana; Vašicová, Pavla; Janda, Filip; Vojtová, Jana; Malínská, Kateřina; Malcová-Janatová, Ivana; Nováková, Lenka; Janošková, Dana; Valášek, Leoš; Hašek, Jiří

    2009-01-01

    Roč. 122, č. 12 (2009), s. 2078-2088. ISSN 0021-9533 R&D Projects: GA ČR GA204/02/1424; GA ČR GA204/05/0838; GA ČR GA204/09/1924; GA MŠk LC545; GA MŠk ME 939 Institutional research plan: CEZ:AV0Z50200510 Keywords : p-bodies * stress granules * yeast Subject RIV: EE - Microbiology, Virology Impact factor: 6.144, year: 2009

  20. Identification of the C. elegans anaphase promoting complex subunit Cdc26 by phenotypic profiling and functional rescue in yeast

    Directory of Open Access Journals (Sweden)

    Zachariae Wolfgang

    2007-03-01

    Full Text Available Abstract Background RNA interference coupled with videorecording of C. elegans embryos is a powerful method for identifying genes involved in cell division processes. Here we present a functional analysis of the gene B0511.9, previously identified as a candidate cell polarity gene in an RNAi videorecording screen of chromosome I embryonic lethal genes. Results Whereas weak RNAi inhibition of B0511.9 causes embryonic cell polarity defects, strong inhibition causes embryos to arrest in metaphase of meiosis I. The range of defects induced by RNAi of B0511.9 is strikingly similar to those displayed by mutants of anaphase-promoting complex/cyclosome (APC/C components. Although similarity searches did not reveal any obvious homologue of B0511.9 in the non-redundant protein database, we found that the N-terminus shares a conserved sequence pattern with the N-terminus of the small budding yeast APC/C subunit Cdc26 and its orthologues from a variety of other organisms. Furthermore, we show that B0511.9 robustly complements the temperature-sensitive growth defect of a yeast cdc26Δ mutant. Conclusion These data demonstrate that B0511.9 encodes the C. elegans APC/C subunit CDC-26.

  1. The final cut: cell polarity meets cytokinesis at the bud neck in S. cerevisiae.

    Science.gov (United States)

    Juanes, Maria Angeles; Piatti, Simonetta

    2016-08-01

    Cell division is a fundamental but complex process that gives rise to two daughter cells. It includes an ordered set of events, altogether called "the cell cycle", that culminate with cytokinesis, the final stage of mitosis leading to the physical separation of the two daughter cells. Symmetric cell division equally partitions cellular components between the two daughter cells, which are therefore identical to one another and often share the same fate. In many cases, however, cell division is asymmetrical and generates two daughter cells that differ in specific protein inheritance, cell size, or developmental potential. The budding yeast Saccharomyces cerevisiae has proven to be an excellent system to investigate the molecular mechanisms governing asymmetric cell division and cytokinesis. Budding yeast is highly polarized during the cell cycle and divides asymmetrically, producing two cells with distinct sizes and fates. Many components of the machinery establishing cell polarization during budding are relocalized to the division site (i.e., the bud neck) for cytokinesis. In this review we recapitulate how budding yeast cells undergo polarized processes at the bud neck for cell division. PMID:27085703

  2. Tumor Budding in Colorectal Carcinomas

    Directory of Open Access Journals (Sweden)

    Sevda SERT BEKTAŞ

    2012-01-01

    Full Text Available Objective: In colorectal carcinomas, tumor budding has been defined as the presence of isolated single tumor cells or small cell clusters in the stroma at the invasive tumor margin. In this study, the relationship between tumor budding density at the invasive tumor margin and pathological parameters is investigated.Material and Method: Haematoxylin and eosin stained slides of 73 cases with colorectal carcinoma were retrospectively evaluated for the presence and intensity of tumor budding by 2 observers. After the specimens were assessed, the highest density of tumor budding area was counted in a microscopic field of x200. Cases were separated into 2 groups according to tumor budding density as low grade (<10 and high grade (≥10. The relationship of these groups with depth of tumor invasion, histological grade, vascular invasion and lymph node involvement was investigated.Results: Of the 73 colorectal carcinoma cases, 33 (45.2% had low and 40 (54.8% had high grade tumor budding density, respectively. There was a statistically significant relationship between high grade tumor budding density and histological grade (p=0.042, lymph node involvement (p=0.0001 and vascular invasion (p=0.0034.Conclusion: High grade tumor budding density is associated with aggressive phenotypical features in colorectal carcinoma.

  3. Two-step activation of meiosis by the mat1 locus in Schizosaccharomyces pombe

    DEFF Research Database (Denmark)

    Willer, M; Hoffmann, Ulla-Lisbeth; Styrkársdóttir, U;

    1995-01-01

    The mat1 locus is a key regulator of both conjugation and meiosis in the fission yeast Schizosaccharomyces pombe. Two alternative DNA segments of this locus, mat1-P and mat1-M, specify the haploid cell types (Plus and Minus). Each segment includes two genes: mat1-P includes mat1-Pc and mat1-Pm......, while mat1-M includes mat1-Mc and mat1-Mm. The mat1-Pc and mat1-Mc genes are responsible for establishing the pheromone communication system that mediates conjugation between P and M cells, while all four mat1 genes are required for meiosis in diploid P/M cells. Our understanding of the initiation of...... meiosis is based largely on indirect observations, and a more precise investigation of these events was required to define the interaction between the mat1 genes. Here we resolve this issue using synthetic pheromones and P/M strains with mutations in either mat1-Pc or mat1-Mc. Our results suggest a model...

  4. Meiosis I: When Chromosomes Undergo Extreme Makeover

    OpenAIRE

    Miller, Matthew P.; Amon, Angelika; Ünal, Elçin

    2013-01-01

    The ultimate success of cell division relies on the accurate partitioning of the genetic material. Errors in this process occur in nearly all tumors and are the leading cause of miscarriages and congenital birth defects in humans. Two cell divisions, mitosis and meiosis, use common as well as unique mechanisms to ensure faithful chromosome segregation. In mitosis, alternating rounds of DNA replication and chromosome segregation preserves the chromosome complement of the progenitor cell. In co...

  5. 澳洲坚果花粉母细胞减数分裂观察%Microscopic Observation of Meiosis of Macadamia Pollen Mother Cells

    Institute of Scientific and Technical Information of China (English)

    孔广红; 柳觐; 倪书邦; 贺熙勇

    2013-01-01

    The complete process of meiosis of Macadamia pollen mother cells (PMC) was investigated, u-sing the squashing technique. Our results showed that meiosis of Macadamia started in December and the meiosis process was closely correlated with the bud length, and difference in the stages of meiosis was observed in same bud and in the same anther. Diplotene lasted for a long time and presented many shapes. The number and structure of Macadamia chromosome could be observed clearly in the stages of diakme-sis, metaphase Ⅰ, anaphase Ⅰ and anaphase Ⅱ. No variation in number and structure were detected of Macadamia chromosomes in meiosis, which was a typical division process of diploid species.%采用压片法观察了澳洲坚果花粉母细胞(PMC)减数分裂的完整过程,证实澳洲坚果PMC减数分裂始于12月份,其减数分裂进程与单花大小有密切关系,且同一花蕾甚至同一花药中表现不同步.减数分裂双线期历时时间长且形态多样,可于终变期、中期Ⅰ、后期Ⅰ以及后期Ⅱ观察到染色体数目和结构.澳洲坚果PMC减数分裂过程中无染色体结构和数目的变异,属二倍体的标准分裂进程.

  6. Is there evidence of sexual reproduction (meiosis) in Acanthamoeba?

    Science.gov (United States)

    Khan, Naveed A.; Siddiqui, Ruqaiyyah

    2015-01-01

    Evolution of independently breeding species into males and females (gametes) has remained a puzzle. Given the significant advantages of sexual reproduction over asexual reproduction as a long-term species survival strategy; here, we pose the question whether there is some form of meiosis in Acanthamoeba species, which represents our ancient lineage. The recently available Acanthamoeba genome revealed several genes implicated in meiosis in sexual eukaryotes such as Spo11, Mre11, Rad50, Rad51, Rad52, Mnd1, Dmc1, Msh, and Mlh, suggesting that Acanthamoeba is capable of some form of meiosis, inferring the presence of sexual reproduction in Acanthamoeba, and that meiosis evolved early in eukaryotic evolution. PMID:25800982

  7. Fission yeast mating-type switching: programmed damage and repair

    DEFF Research Database (Denmark)

    Egel, Richard

    2005-01-01

    Mating-type switching in fission yeast follows similar rules as in budding yeast, but the underlying mechanisms are entirely different. Whilst the initiating double-strand cut in Saccharomyces cerevisiae requires recombinational repair for survival, the initial damage in Schizosaccharomyces pombe...

  8. Principles of chromosomal organization: lessons from yeast

    OpenAIRE

    Zimmer, Christophe; Fabre, Emmanuelle

    2011-01-01

    The spatial organization of genes and chromosomes plays an important role in the regulation of several DNA processes. However, the principles and forces underlying this nonrandom organization are mostly unknown. Despite its small dimension, and thanks to new imaging and biochemical techniques, studies of the budding yeast nucleus have led to significant insights into chromosome arrangement and dynamics. The dynamic organization of the yeast genome during interphase argues for both the physica...

  9. Protein patterns of yeast during sporulation

    International Nuclear Information System (INIS)

    High resolution two-dimensional gel electrophoresis was used to study protein synthesis during synchronous meiosis and ascospore formation of Saccharomyces cerevisiae. The stained protein patterns of samples harvested at any stage between meiotic prophase and the four-spore stage in two sporulating strains showed the same approximately 250 polypeptides. Of these only a few seemed to increase or decrease in concentration during sporulation. The characteristic pattern of sporulating yeast was identical to the pattern of glucose-grown staitonary yeast cells adapted to respiration. The latter type of cells readily initiates meiosis when transferred to sporulation medium. This pattern differed from the protein patterns of exponentially growing cells in glucose or acetate presporulation medium. Five major proteins in stationary and sporulating yeast cells were not detected in either type of exponential culture. Two-dimensional autoradiograms of [35S]methionine-labelled yeast proteins revealed that some proteins were preferentially labelled during sporulation, while other proteins were labelled at later stages. These patterns differed from the auroradiograms of exponentially growing yeast cells in glucose presporulation medium in a number of spots. No differences were observed when stained gels or autoradiograms of sporulating cultures and non-sporulating strains in sporulation medium were compared. (author)

  10. The Retention of Meaningful Understanding of Meiosis and Genetics.

    Science.gov (United States)

    Cavallo, Ann Liberatore

    This study investigated the retention of meaningful understanding of the biological topics of meiosis, the Punnett square method and the relations between these two topics. This study also explored the predictive influence of students' general tendency to learn meaningfully or by rote (meaningful learning orientation), prior knowledge of meiosis,…

  11. Complex regulation of sister kinetochore orientation in meiosis-I

    Indian Academy of Sciences (India)

    Amit Bardhan

    2010-09-01

    Kinetochores mediate chromosome movement during cell division by interacting with the spindle microtubules. Sexual reproduction necessitates the daunting task of reducing ploidy (number of chromosome sets) in the gametes, which depends upon the specialized properties of meiosis. Kinetochores have a central role in the reduction process. In this review, we discuss the complexity of this role of kinetochores in meiosis-I.

  12. Roles of MAP kinase signaling pathway in oocyte meiosis

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Mitogen-activated protein kinase (MAPK) is a family of Ser/Thr protein kinases expressed widely in eukaryotic cells. MAPK is activated by a cascade of protein kinase phosphorylation and plays pivotal roles in regulating meiosis process in oocytes. As an important physical substrate of MAPK, p90rsk mediates numerous MAPK functions. MAPK was activated at G2/M transition during meiosis. Its activity reached the peak at MⅠ stage and maintained at this level until the time before the pronuclear formation after fertilization. There is complex interplay between MAPK and MPF in the meiosis regulation. Furthermore, other intracellular signal transducers, such as cAMP, protein kinase C and protein phosphotase, ect., also regulated the activity of MAPK at different stages during meiosis in oocytes. In the present article, the roles of MAPK signaling pathway in oocyte meiosis are reviewed and discussed.

  13. Molecular visualization of the yeast Dmc1 protein ring and Dmc1-ssDNA nucleoprotein complex.

    Science.gov (United States)

    Chang, Yuan-Chih; Lo, Yu-Hui; Lee, Ming-Hui; Leng, Chih-Hsiang; Hu, Su-Ming; Chang, Chia-Seng; Wang, Ting-Fang

    2005-04-26

    Saccharomyces cerevisiae Dmc1, a meiosis-specific homologue of RecA, catalyzes homologous pairing and strand exchange during meiotic DNA recombination. The purified budding yeast Dmc1 (ScDmc1) protein exhibits much weaker recombinase activity in vitro as compared to that of the Escherichia coli RecA protein. Using atomic force microscopy (AFM) with carbon nanotube tips, we found ScDmc1 forms rings with an external diameter of 18 nm and a central cavity of 4 nm. In the presence of single-stranded DNA (ssDNA), the majority of the ScDmc1 protein (90%) bound DNA as protein rings; only a small faction (10%) was able to form filamentous structure. In contrast, nearly all RecA proteins form fine helical nucleoprotein filaments with ssDNA under identical conditions. RecA-mediated recombinase activity is initiated through the nucleation of RecA onto ssDNA to form helical nucleoprotein filaments. Our results support the notion that ScDmc1 becomes catalytically active only when it forms a helical nucleoprotein filament with ssDNA. PMID:15835894

  14. Functional conservation between Schizosaccharomyces pombe ste8 and Saccharomyces cerevisiae STE11 protein kinases in yeast signal transduction

    DEFF Research Database (Denmark)

    Styrkársdóttir, U; Egel, R; Nielsen, O;

    1992-01-01

    In fission yeast (Schizosaccharomyces pombe), the mat1-Pm gene, which is required for entry into meiosis, is expressed in response to a pheromone signal. Cells carrying a mutation in the ste8 gene are unable to induce transcription of mat1-Pm in response to pheromone, suggesting that the ste8 gene......, ste8 mutant cells will enter meiosis. This demonstrates that the meiotic defect of ste8 mutants is due to the absence of the mat1-Pm gene product....

  15. Onset of meiosis in the chicken embryo; evidence of a role for retinoic acid

    OpenAIRE

    Koopman Peter; Bowles Josephine; Roeszler Kelly N; Smith Craig A; Sinclair Andrew H

    2008-01-01

    Abstract Background Meiosis in higher vertebrates shows a dramatic sexual dimorphism: germ cells enter meiosis and arrest at prophase I during embryogenesis in females, whereas in males they enter mitotic arrest during embryogenesis and enter meiosis only after birth. Here we report the molecular analysis of meiosis onset in the chicken model and provide evidence for conserved regulation by retinoic acid. Results Meiosis in the chicken embryo is initiated late in embryogenesis (day 15.5), rel...

  16. Sgo1 is required for co-segregation of sister chromatids during achiasmate meiosis I

    OpenAIRE

    Dudas, Andrej; Ahmad, Shazia; Gregan, Juraj

    2011-01-01

    The reduction of chromosome number during meiosis is achieved by two successive rounds of chromosome segregation, called meiosis I and meiosis II. While meiosis II is similar to mitosis in that sister kinetochores are bi-oriented and segregate to opposite poles, recombined homologous chromosomes segregate during the first meiotic division. Formation of chiasmata, mono-orientation of sister kinetochores and protection of centromeric cohesion are three major features of meiosis I chromosomes wh...

  17. Flow cytometry for age assessment of a yeast population and its application in beer fermentations

    OpenAIRE

    Kuřec, Michal; Baszczyňski, Martin; Lehnert, Radek; Mota, André; Teixeira, J.A.; Brányik, Tomáš

    2009-01-01

    An expeditious method of yeast age estimation was developed based on selective bud scar staining (Alexa Fluor 488-labelled wheat-germ agglutinin) and subsequent fluorescence intensity measurement by flow cytometry. The calibration curve resulting from the cytometric determination of average bud scar fluorescence intensities vs. microscopically counted average bud scar numbers of the same cell populations showed a good correlation and allowed routine cell age estimation by...

  18. Regulation of homologous recombination at telomeres in budding yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael

    2010-01-01

    Homologous recombination is suppressed at normal length telomere sequences. In contrast, telomere recombination is allowed when telomeres erode in the absence of telomerase activity or as a consequence of nucleolytic degradation or incomplete replication. Here, we review the mechanisms that...

  19. Septin Filament Formation is Essential in Budding Yeast

    OpenAIRE

    McMurray, Michael A.; Bertin, Aurelie; Garcia, Galo; Lam, Lisa; Nogales, Eva; Thorner, Jeremy

    2011-01-01

    Septins are GTP-binding proteins that form ordered, rod-like multimeric complexes and polymerize into filaments, but how such supramolecular structure is related to septin function was unclear. In Saccharomyces cerevisiae, four septins form an apolar hetero-octamer (Cdc11–Cdc12–Cdc3–Cdc10–Cdc10–Cdc3–Cdc12–Cdc11) that associates end-to-end to form filaments. We show that septin filament assembly displays previously unanticipated plasticity. Cells lacking Cdc10 or Cdc11 are able to divide becau...

  20. H4K44 Acetylation Facilitates Chromatin Accessibility during Meiosis

    Directory of Open Access Journals (Sweden)

    Jialei Hu

    2015-12-01

    Full Text Available Meiotic recombination hotspots are associated with histone post-translational modifications and open chromatin. However, it remains unclear how histone modifications and chromatin structure regulate meiotic recombination. Here, we identify acetylation of histone H4 at Lys44 (H4K44ac occurring on the nucleosomal lateral surface. We show that H4K44 is acetylated at pre-meiosis and meiosis and displays genome-wide enrichment at recombination hotspots in meiosis. Acetylation at H4K44 is required for normal meiotic recombination, normal levels of double-strand breaks (DSBs during meiosis, and optimal sporulation. Non-modifiable H4K44R results in increased nucleosomal occupancy around DSB hotspots. Our results indicate that H4K44ac functions to facilitate chromatin accessibility favorable for normal DSB formation and meiotic recombination.

  1. Atypical ploidy cycles, Spo11, and the evolution of meiosis.

    Science.gov (United States)

    Bloomfield, Gareth

    2016-06-01

    The Spo11 protein induces DNA double strand breaks before the first division of meiosis, enabling the formation of the chiasmata that physically link homologous chromosomes as they align. Spo11 is an ancient and well conserved protein, related in sequence and structure to a DNA topoisomerase subunit found in Archaea as well as a subset of eukaryotes. However the origins of its meiotic function are unclear. This review examines some apparent exceptions to the rule that Spo11 activity is specific to, and required for meiosis. Spo11 appears to function in the context of unusual forms of ploidy reduction in some protists and fungi. One lineage of amoebae, the dictyostelids, is thought to undergo meiosis during its sexual cycle despite having lost Spo11 entirely. Further experimental characterisation of these and other non-canonical ploidy cycling mechanisms may cast light of the evolution of meiosis. PMID:26811992

  2. Selection on meiosis genes in diploid and tetraploid Arabidopsis arenosa

    Czech Academy of Sciences Publication Activity Database

    Wright, K. M.; Arnold, B.; Xue, K.; Šurinová, Mária; O´Connell, J.; Bomblies, K.

    2015-01-01

    Roč. 32, č. 4 (2015), s. 944-955. ISSN 0737-4038 Institutional support: RVO:67985939 Keywords : meiosis * evolution * polyploidy Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 9.105, year: 2014

  3. Is there evidence of sexual reproduction (meiosis) in Acanthamoeba?

    OpenAIRE

    Khan, Naveed A.; Siddiqui, Ruqaiyyah

    2015-01-01

    Evolution of independently breeding species into males and females (gametes) has remained a puzzle. Given the significant advantages of sexual reproduction over asexual reproduction as a long-term species survival strategy; here, we pose the question whether there is some form of meiosis in Acanthamoeba species, which represents our ancient lineage. The recently available Acanthamoeba genome revealed several genes implicated in meiosis in sexual eukaryotes such as Spo11, Mre...

  4. Dual mechanisms prevent premature chromosome segregation during meiosis

    OpenAIRE

    Kim, Seoyoung; Meyer, Régis; Chuong, Hoa; Dawson, Dean S.

    2013-01-01

    In meiosis I, the segregation of homologous chromosomes before pairing would be catastrophic. Kim et al. describe two mechanisms that prevent this. In early meiosis, Ipl1 triggers shedding of a kinetochore protein and prevents microtubule attachment. Ipl1 localizes to the spindle pole bodies (SPBs), where it blocks spindle assembly. These processes are reversed upon expression of Ndt80. CDK phosphorylates Ipl1, delocalizing it from SPBs and triggering spindle assembly. Ipl1 and Ntd80 coordina...

  5. Biotechnological Applications of Dimorphic Yeasts

    Science.gov (United States)

    Doiphode, N.; Joshi, C.; Ghormade, V.; Deshpande, M. V.

    The dimorphic yeasts have the equilibrium between spherical growth (budding) and polarized (hyphal or pseudohyphal tip elongation) which can be triggered by change in the environmental conditions. The reversible growth phenomenon has made dimorphic yeasts as an useful model to understand fungal evolution and fungal differentiation, in general. In nature dimorphism is clearly evident in plant and animal fungal pathogens, which survive and most importantly proliferate in the respective hosts. However, number of organisms with no known pathogenic behaviour also show such a transition, which can be exploited for the technological applications due to their different biochemical make up under different morphologies. For instance, chitin and chitosan production using dimorphic Saccharomyces, Mucor, Rhizopus and Benjaminiella, oil degradation and biotransformation with yeast-form of Yarrowia species, bioremediation of organic pollutants, exopolysac-charide production by yeast-phase of Aureobasidium pullulans, to name a few. Myrothecium verrucaria can be used for seed dressing in its yeast form and it produces a mycolytic enzyme complex in its hyphal-form for the biocontrol of fungal pathogens, while Beauveria bassiana and other entomopathogens kill the insect pest by producing yeast- like cells in the insect body. The form-specific expression of protease, chitinase, lipase, ornithine decarboxylase, glutamate dehydrogenases, etc. make Benjaminiella poitrasii, Basidiobolus sp., and Mucor rouxii strains important in bioremediation, nanobiotechnology, fungal evolution and other areas.

  6. The induction of mutation and recombination following UV irradiation during meiosis in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Irradiation of yeast cultures with ultraviolet light at discrete stages during meiosis produces cyclic variations in sensitivity, i.e. cells are more sensitive to the lethal effects of UV light prior to entry into the meiotic DNA synthesis, and this corresponds to a peak of induction of point mutation. Cells become more resistant to both induced point mutation and lethality as they enter meiotic DNA synthesis, but become more sensitive again during spore formation. The induced level of intragenic recombination rises during the period of commitment ot recombination to a level indistinguishable from the full meiotic level of spontaneous intragenic recombination. Induced reciprocal recombination remains above the spontaneous level up to the point of commitment to sporulation. (orig.)

  7. Paired arrangement of kinetochores together with microtubule pivoting and dynamics drive kinetochore capture in meiosis I.

    Science.gov (United States)

    Cojoc, Gheorghe; Florescu, Ana-Maria; Krull, Alexander; Klemm, Anna H; Pavin, Nenad; Jülicher, Frank; Tolić, Iva M

    2016-01-01

    Kinetochores are protein complexes on the chromosomes, whose function as linkers between spindle microtubules and chromosomes is crucial for proper cell division. The mechanisms that facilitate kinetochore capture by microtubules are still unclear. In the present study, we combine experiments and theory to explore the mechanisms of kinetochore capture at the onset of meiosis I in fission yeast. We show that kinetochores on homologous chromosomes move together, microtubules are dynamic and pivot around the spindle pole, and the average capture time is 3-4 minutes. Our theory describes paired kinetochores on homologous chromosomes as a single object, as well as angular movement of microtubules and their dynamics. For the experimentally measured parameters, the model reproduces the measured capture kinetics and shows that the paired configuration of kinetochores accelerates capture, whereas microtubule pivoting and dynamics have a smaller contribution. Kinetochore pairing may be a general feature that increases capture efficiency in meiotic cells. PMID:27166749

  8. Budding yeast cDNA sequencing project: S03052-35_D14 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available S03052-35_D14 S03052-35_D14 - - Show S03052-35_D14 Seqid S03052-35_D14 Link to SGD S03052-35_D14 ... AACTGCGGCNCAAATGAGGATCTATTCTCTCTCTATCAGTAT GAATTTACCAT CTGTCCTATTTGCTGCCAGTTAAAAAAGGACTACTTTGGCCCAATTTTC C ... AACGGTGGATCTGCTTCTTCCACCGATGTAGCTTCCTCCTCNTCCAT CTCCACTTCCTC TGGCTCAGTATTTATCACNNCTTCTGAACCTTCAT AAT ...

  9. Budding yeast cDNA sequencing project: S03036-24_C13 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available S03036-24_C 13 - - - Show S03036-24_C 13 Seqid S03036-24_C 13 Link to SGD - Link to dbEST - Link to ... UC SC ... Genome Browser - Sequenc e >S03036-24_C 13.phd NNN ... NNNNNNNNNNNNNNANNNNNNNNTGNNGGNNNNNTNNNNNN ANTTGNTATC GAC TTNNTTCC NNNNGAGANNNNNNTGGANAANGANGAGNNNNNGNANAC ... TTNNGANAAANANNC NNANGGTGAGAGCC AGATCC NNNNNNGC GGATTGNGAGC AAATC G TTAAG ... TTC AGGTC AAGTAAAAATTGATTTC NAAAAC TAATTTC TC TTATAC NANNNTTT ...

  10. Budding yeast cDNA sequencing project: S03052-35_P07 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available S03052-35_P07 S03052-35_P07 - - Show S03052-35_P07 Seqid S03052-35_P07 Link to SGD S03052-35_P07 ... Browser - Sequence >S03052-35_P07.phd CGGNNNNNNNTTTTNT CAGAATCTNNNNNNTNNATACGACTCACTNT AGGGCGAATTGGC GGCCAA ... TCATANCTGTTT CCTGTGTGAAATTGTTATCCGCTNAAAATTCCACACAATNT ACGATCNNNAANCATAAAG TGTAAAGCCTGGGGGTGCCTAATGGAGTGAG ... TCCCTCCCGCANNCCTGAGGAGGGAGAGGGGATTTATGGATCTTCTAAGA TNT ... Quality >S03052-35_P07.phd 9 8 8 5 4 4 5 4 4 5 8 1 ...

  11. The multiple roles of Bub1 in chromosome segregation during mitosis and meiosis

    Energy Technology Data Exchange (ETDEWEB)

    Marchetti, Francesco; Venkatachalam, Sundaresan

    2009-06-19

    Aneuploidy, any deviation from an exact multiple of the haploid number of chromosomes, is a common occurrence in cancer and represents the most frequent chromosomal disorder in newborns. Eukaryotes have evolved mechanisms to assure the fidelity of chromosome segregation during cell division that include a multiplicity of checks and controls. One of the main cell division control mechanisms is the spindle assembly checkpoint (SAC) that monitors the proper attachment of chromosomes to spindle fibers and prevents anaphase until all kinetochores are properly attached. The mammalian SAC is composed by at least 14 evolutionary-conserved proteins that work in a coordinated fashion to monitor the establishment of amphitelic attachment of all chromosomes before allowing cell division to occur. Among the SAC proteins, the budding uninhibited by benzimidazole protein 1 (Bub1), is a highly conserved protein of prominent importance for the proper functioning of the SAC. Studies have revealed many roles for Bub1 in both mitosis and meiosis, including the localization of other SAC proteins to the kinetochore, SAC signaling, metaphase congression and the protection of the sister chromatid cohesion. Recent data show striking sex specific differences in the response to alterations in Bub1 activity. Proper Bub1 functioning is particularly important during oogenesis in preventing the generation of aneuploid gametes that can have detrimental effects on the health status of the fetus and the newborn. These data suggest that Bub1 is a master regulator of SAC and chromosomal segregation in both mitosis and meiosis. Elucidating its many essential functions in regulating proper chromosome segregation can have important consequences for preventing tumorigenesis and developmental abnormalities.

  12. Chiasmata promote monopolar attachment of sister chromatids and their co-segregation toward the proper pole during meiosis I.

    Directory of Open Access Journals (Sweden)

    Yukinobu Hirose

    2011-03-01

    Full Text Available The chiasma is a structure that forms between a pair of homologous chromosomes by crossover recombination and physically links the homologous chromosomes during meiosis. Chiasmata are essential for the attachment of the homologous chromosomes to opposite spindle poles (bipolar attachment and their subsequent segregation to the opposite poles during meiosis I. However, the overall function of chiasmata during meiosis is not fully understood. Here, we show that chiasmata also play a crucial role in the attachment of sister chromatids to the same spindle pole and in their co-segregation during meiosis I in fission yeast. Analysis of cells lacking chiasmata and the cohesin protector Sgo1 showed that loss of chiasmata causes frequent bipolar attachment of sister chromatids during anaphase. Furthermore, high time-resolution analysis of centromere dynamics in various types of chiasmate and achiasmate cells, including those lacking the DNA replication checkpoint factor Mrc1 or the meiotic centromere protein Moa1, showed the following three outcomes: (i during the pre-anaphase stage, the bipolar attachment of sister chromatids occurs irrespective of chiasma formation; (ii the chiasma contributes to the elimination of the pre-anaphase bipolar attachment; and (iii when the bipolar attachment remains during anaphase, the chiasmata generate a bias toward the proper pole during poleward chromosome pulling that results in appropriate chromosome segregation. Based on these results, we propose that chiasmata play a pivotal role in the selection of proper attachments and provide a backup mechanism that promotes correct chromosome segregation when improper attachments remain during anaphase I.

  13. The Role of Cdc2 and Other Genes in Meiosis in Schizosaccharomyces Pombe

    OpenAIRE

    Iino, Y.; Hiramine, Y.; Yamamoto, M.

    1995-01-01

    The requirement of the cdc2, cdc13 and cdc25 genes for meiosis in Schizosaccharomyces pombe was investigated using three different conditions to induce meiosis. These genes were known to be required for meiosis II. cdc13 and cdc25 are essential for meiosis I. The cdc2 gene, which is required for the initiation of both mitotic S-phase and M-phase, is essential for premeiotic DNA synthesis and meiosis II. The requirement of cdc2 for meiosis I was unclear. This contrasts with Saccharomyces cerev...

  14. Coevolutionary patterning of teeth and taste buds.

    Science.gov (United States)

    Bloomquist, Ryan F; Parnell, Nicholas F; Phillips, Kristine A; Fowler, Teresa E; Yu, Tian Y; Sharpe, Paul T; Streelman, J Todd

    2015-11-01

    Teeth and taste buds are iteratively patterned structures that line the oro-pharynx of vertebrates. Biologists do not fully understand how teeth and taste buds develop from undifferentiated epithelium or how variation in organ density is regulated. These organs are typically studied independently because of their separate anatomical location in mammals: teeth on the jaw margin and taste buds on the tongue. However, in many aquatic animals like bony fishes, teeth and taste buds are colocalized one next to the other. Using genetic mapping in cichlid fishes, we identified shared loci controlling a positive correlation between tooth and taste bud densities. Genome intervals contained candidate genes expressed in tooth and taste bud fields. sfrp5 and bmper, notable for roles in Wingless (Wnt) and bone morphogenetic protein (BMP) signaling, were differentially expressed across cichlid species with divergent tooth and taste bud density, and were expressed in the development of both organs in mice. Synexpression analysis and chemical manipulation of Wnt, BMP, and Hedgehog (Hh) pathways suggest that a common cichlid oral lamina is competent to form teeth or taste buds. Wnt signaling couples tooth and taste bud density and BMP and Hh mediate distinct organ identity. Synthesizing data from fish and mouse, we suggest that the Wnt-BMP-Hh regulatory hierarchy that configures teeth and taste buds on mammalian jaws and tongues may be an evolutionary remnant inherited from ancestors wherein these organs were copatterned from common epithelium. PMID:26483492

  15. Syncytes during male meiosis resulting in 2n pollen grain formation in Lindelofia longiflora var.falconeri

    Institute of Scientific and Technical Information of China (English)

    Vijay Kumar SINGHAL; Pawan Kumar RANA; Puneet KUMAR

    2011-01-01

    Lindelofia longiflora (Royle ex Benth.) Baill.var.falconeri (Cl.) Brand (Family:Boraginaceae) is investigated cytologically (n =12) for the first time from the cold deserts of Pangi Valley,Chamba District (Himachal Pradesh) in India.We report the formation of syncytes and 2n pollen grains in the species.During meiosis,the majority of the pollen mother cells (PMCs) exhibited 12 bivalents,equal segregation of chromosomes during anaphases,regular tetrads,and normal-sized pollen grain formation.Occasionally,two proximate PMCs fused during the early stages ofprophase-I and resulted in the formation of syncytes.The frequency of syncytes in the accession is rather low,at 25 out of 1866 (1.33%).Such syncyte PMCs are detectable during meiosis due to their larger size compared to typical PMCs.The syncytes or polyploid cells showed normal 24 bivalents and depicted perfectly regular meiotic course.But the products of such PMCs yield 2n or larger sized pollen grains that are almost double the size of typical normal or n pollen grains.The origin of syncytes as a consequence of the fusion of meiocytes during the early stages of meiosis-I could be attributed to low temperature stress conditions prevailing in the Pangi Valley,where temperature during May and June dip to below freezing,the time the plants enters the reproductive/flowering bud stage.It is possible that such apparently fertile 2n pollen grains originating from syncytes might play a role in the origin of intraspecific polyploids in the species.

  16. Role of SAGA in the asymmetric segregation of DNA circles during yeast ageing

    OpenAIRE

    Denoth-Lippuner, Annina; Krzyzanowski, Marek Konrad; Stober, Catherine; Barral, Yves

    2014-01-01

    eLife digest Budding yeast is a microorganism that has been widely studied to understand how it and many other organisms, including animals, age over time. This yeast is so named because it proliferates by ‘budding’ daughter cells out of the surface of a mother cell. For each daughter cell that buds, the mother cell loses some fitness and eventually dies after a certain number of budding events. This process is called ‘replicative ageing’, and it also resembles the way that stem cells age. In...

  17. HIV Pol inhibits HIV budding and mediates the severe budding defect of Gag-Pol.

    Directory of Open Access Journals (Sweden)

    Xin Gan

    Full Text Available The prevailing hypothesis of HIV budding posits that the viral Gag protein drives budding, and that the Gag p6 peptide plays an essential role by recruiting host-cell budding factors to sites of HIV assembly. HIV also expresses a second Gag protein, p160 Gag-Pol, which lacks p6 and fails to bud from cells, consistent with the prevailing hypothesis of HIV budding. However, we show here that the severe budding defect of Gag-Pol is not caused by the absence of p6, but rather, by the presence of Pol. Specifically, we show that (i the budding defect of Gag-Pol is unaffected by loss of HIV protease activity and is therefore an intrinsic property of the Gag-Pol polyprotein, (ii the N-terminal 433 amino acids of Gag and Gag-Pol are sufficient to drive virus budding even though they lack p6, (iii the severe budding defect of Gag-Pol is caused by a dominant, cis-acting inhibitor of budding in the HIV Pol domain, and (iv Gag-Pol inhibits Gag and virus budding in trans, even at normal levels of Gag and Gag-Pol expression. These and other data support an alternative hypothesis of HIV budding as a process that is mediated by the normal, non-viral pathway of exosome/microvesicle biogenesis.

  18. c-Mos forces the mitotic cell cycle to undergo meiosis II to produce haploid gametes

    OpenAIRE

    Tachibana, Kazunori; Tanaka, Daisuke; Isobe, Tomohiro; Kishimoto, Takeo

    2000-01-01

    The meiotic cycle reduces ploidy through two consecutive M phases, meiosis I and meiosis II, without an intervening S phase. To maintain ploidy through successive generations, meiosis must be followed by mitosis after the recovery of diploidy by fertilization. However, the coordination from meiotic to mitotic cycle is still unclear. Mos, the c-mos protooncogene product, is a key regulator of meiosis in vertebrates. In contrast to the previous observation that Mos f...

  19. The Reduction of Chromosome Number in Meiosis Is Determined by Properties Built into the Chromosomes

    OpenAIRE

    Paliulis, Leocadia V.; Nicklas, R. Bruce

    2000-01-01

    In meiosis I, two chromatids move to each spindle pole. Then, in meiosis II, the two are distributed, one to each future gamete. This requires that meiosis I chromosomes attach to the spindle differently than meiosis II chromosomes and that they regulate chromosome cohesion differently. We investigated whether the information that dictates the division type of the chromosome comes from the whole cell, the spindle, or the chromosome itself. Also, we determined when chromosomes can switch from ...

  20. The colocalization transition of homologous chromosomes at meiosis

    Science.gov (United States)

    Nicodemi, Mario; Panning, Barbara; Prisco, Antonella

    2008-06-01

    Meiosis is the specialized cell division required in sexual reproduction. During its early stages, in the mother cell nucleus, homologous chromosomes recognize each other and colocalize in a crucial step that remains one of the most mysterious of meiosis. Starting from recent discoveries on the system molecular components and interactions, we discuss a statistical mechanics model of chromosome early pairing. Binding molecules mediate long-distance interaction of special DNA recognition sequences and, if their concentration exceeds a critical threshold, they induce a spontaneous colocalization transition of chromosomes, otherwise independently diffusing.

  1. Germ cell sex prior to meiosis in the rainbow trout

    OpenAIRE

    Li, Mingyou; Shen, Qian; Wong, Foong Mei; Xu, Hongyan; Hong, Ni; Zeng, Lingbing; Liu, Lin; Wei, Qiwei; Hong, Yunhan

    2011-01-01

    Germ cells make two major decisions when they move from an indeterminate state to their final stage of gamete production. One decision is sexual commitment for sperm or egg production, and the other is to maintain mitotic division or entry into meiosis. It is unclear whether the two decisions are made as a single event or separate events, because there has been no evidence for the presence of germ cell sex prior to meiosis. Here we report direct evidence in the fish rainbow trout that gonia h...

  2. Dissection and design of yeast prions.

    OpenAIRE

    Osherovich, Lev Z; Cox, Brian S; Mick F Tuite; Weissman, Jonathan S

    2004-01-01

    Many proteins can misfold into beta-sheet-rich, self-seeding polymers (amyloids). Prions are exceptional among such aggregates in that they are also infectious. In fungi, prions are not pathogenic but rather act as epigenetic regulators of cell physiology, providing a powerful model for studying the mechanism of prion replication. We used prion-forming domains from two budding yeast proteins (Sup35p and New1p) to examine the requirements for prion formation and inheritance. In both proteins, ...

  3. Conflict between noise and plasticity in yeast.

    OpenAIRE

    Lehner, Ben

    2010-01-01

    Gene expression responds to changes in conditions but also stochastically among individuals. In budding yeast, both expression responsiveness across conditions (“plasticity”) and cell-to-cell variation (“noise”) have been quantified for thousands of genes and found to correlate across genes. It has been argued therefore that noise and plasticity may be strongly coupled and mechanistically linked. This is consistent with some theoretical ideas, but a strong coupling between noise and plasticit...

  4. Understanding a Basic Biological Process: Expert and Novice Models of Meiosis.

    Science.gov (United States)

    Kindfield, Ann C. H.

    The results of a study of the meiosis models utilized by individuals at varying levels of expertise while reasoning about the process of meiosis are presented. Based on these results, the issues of sources of misconceptions/difficulties and the construction of a sound understanding of meiosis are discussed. Five individuals from each of three…

  5. Students as "Humans Chromosomes" in Role-Playing Mitosis and Meiosis

    Science.gov (United States)

    Chinnici, Joseph P.; Yue, Joyce W.; Torres, Kieron M.

    2004-01-01

    Students often find it challenging to understand mitosis and meiosis and determine their processes. To develop an easier way to understand these terms, students are asked to role-play mitosis and meiosis and students themselves act as human chromosomes, which help students to learn differences between mitosis and meiosis.

  6. Repellence of the red bud borer (Resseliella oculiperda) to grafted apple trees by impregnation of budding tape with essential oils

    NARCIS (Netherlands)

    Tol, van R.W.H.M.; Linden, van der A.; Swarts, H.J.; Visser, J.H.

    2007-01-01

    The red bud borer Resseliella oculiperda (Rübs.) is a pest insect of apple trees when rootstocks are grafted with scion buds by shield budding. The female midges are attracted to the wounds of the grafted buds where they lay their eggs. The larvae feed on the cambium and destroy the buds completely

  7. Mum, this bud’s for you: where do you want it? Roles for Cdc42 in controlling bud site selection in Saccharomyces cerevisiae

    OpenAIRE

    Nelson, W. James

    2003-01-01

    The generation of asymmetric cell shapes is a recurring theme in biology. In budding yeast, one form of cell asymmetry occurs for division and is generated by anisotropic growth of the mother cell to form a daughter cell bud. Previous genetic studies uncovered key roles for the small GTPase Cdc42 in organizing the actin cytoskeleton and vesicle delivery to the site of bud growth,(1,2) but a recent paper has also raised questions about how control of Cdc42 activity is integrated into a propose...

  8. "Dropping Your Genes." A Genetics Simulation in Meiosis, Fertilization & Reproduction.

    Science.gov (United States)

    Atkins, Thomas; Roderick, Joyce MacFall

    1991-01-01

    An activity that introduces students to the concepts of independent assortment of alleles during meiosis and gametogenesis, the richness of the variation that occurs as a result of allele recombination, and the unique phenotypes of offspring. Reproducible handouts with the directions and model chromosomes are provided. (KR)

  9. Meiosis: Cohesins Are Not Just for Sisters Any More.

    Science.gov (United States)

    Cahoon, Cori K; Hawley, R Scott

    2016-07-11

    Multiple meiosis-specific cohesion proteins act to facilitate homolog segregation at the first meiotic division. A recent paper demonstrates that meiotic cohesins can be separated into two complexes, one that establishes and maintains intersister cohesion and one that promotes interhomolog adhesion by regulating synaptonemal complex assembly. PMID:27404236

  10. A computational approach to developing mathematical models of polyploid meiosis.

    Science.gov (United States)

    Rehmsmeier, Marc

    2013-04-01

    Mathematical models of meiosis that relate offspring to parental genotypes through parameters such as meiotic recombination frequency have been difficult to develop for polyploids. Existing models have limitations with respect to their analytic potential, their compatibility with insights into mechanistic aspects of meiosis, and their treatment of model parameters in terms of parameter dependencies. In this article I put forward a computational approach to the probabilistic modeling of meiosis. A computer program enumerates all possible paths through the phases of replication, pairing, recombination, and segregation, while keeping track of the probabilities of the paths according to the various parameters involved. Probabilities for classes of genotypes or phenotypes are added, and the resulting formulas are simplified by the symbolic-computation system Mathematica. An example application to autotetraploids results in a model that remedies the limitations of previous models mentioned above. In addition to the immediate implications, the computational approach presented here can be expected to be useful through opening avenues for modeling a host of processes, including meiosis in higher-order ploidies. PMID:23335332

  11. Using Pool Noodles to Teach Mitosis and Meiosis

    OpenAIRE

    Locke, John; McDermid, Heather E.

    2005-01-01

    Although mitosis and meiosis are fundamental to understanding genetics, students often find them difficult to learn. We suggest using common “pool noodles” as teaching aids to represent chromatids in classroom demonstrations. Students use these noodles to demonstrate the processes of synapsis, segregation, and recombination. Student feedback has been overwhelmingly positive.

  12. Role of vinculin in meiosis during the mouse spermatobenesis

    Czech Academy of Sciences Publication Activity Database

    Rohožková, Jana; Hozák, Pavel

    Kyoto : International Federation of Societies for Histochemistry and Cytochemistry, 2012. [14th International Congress of Histochemistry and Cytochemistry. Kyoto (JP), 26.08.2012-29.08.2012] Grant ostatní: FEI(US) 250694 Institutional support: RVO:68378050 Keywords : Vinculin * meiosis * synaptonemal complex Subject RIV: EB - Genetics ; Molecular Biology

  13. Multistep Phosphorelay Proteins Transmit Oxidative Stress Signals to the Fission Yeast Stress-activated Protein Kinase

    OpenAIRE

    Nguyen, Aaron Ngocky; Lee, Albert; Place, Warren; Shiozaki, Kazuhiro

    2000-01-01

    In response to oxidative stress, eukaryotic cells induce transcription of genes required for detoxification of oxidants. Here we present evidence that oxidative stress stimuli are transmitted by a multistep phosphorelay system to the Spc1/Sty1 stress-activated protein kinase in the fission yeast Schizosaccharomyces pombe. The fission yeast mpr1+ gene encodes a novel protein with a histidine-containing phosphotransfer domain homologous to the budding yeast Ypd1. Spc1 activation upon oxidative ...

  14. Off-Target Effects of Psychoactive Drugs Revealed by Genome-Wide Assays in Yeast

    OpenAIRE

    Ericson, Elke; Gebbia, Marinella; Heisler, Lawrence E.; Wildenhain, Jan; Tyers, Mike; Giaever, Guri; Nislow, Corey

    2008-01-01

    To better understand off-target effects of widely prescribed psychoactive drugs, we performed a comprehensive series of chemogenomic screens using the budding yeast Saccharomyces cerevisiae as a model system. Because the known human targets of these drugs do not exist in yeast, we could employ the yeast gene deletion collections and parallel fitness profiling to explore potential off-target effects in a genome-wide manner. Among 214 tested, documented psychoactive drugs, we identified 81 comp...

  15. Assessment of pheromone production and response in fission yeast by a halo test of induced sporulation

    DEFF Research Database (Denmark)

    Egel, R; Willer, M; Kjaerulff, S;

    1994-01-01

    We describe a rapid, sensitive and semi-quantitative plate assay for monitoring pheromone activity in the fission yeast Schizosaccharomyces pombe. It is based on the observation that meiosis requires stimulation by pheromone and exploits diploid strains that will only sporulate after addition of...... exogenous pheromone. The tester strains are heterozygous for mating type, are non-switching, and are mutated in one of the early subfunctions (either mat1-Mc or mat1-Pc), so that meiosis is only induced after exposure to exogenous pheromone (M-factor or P-factor, respectively). Pheromone activity is...

  16. Onset of meiosis in the chicken embryo; evidence of a role for retinoic acid

    Directory of Open Access Journals (Sweden)

    Koopman Peter

    2008-09-01

    Full Text Available Abstract Background Meiosis in higher vertebrates shows a dramatic sexual dimorphism: germ cells enter meiosis and arrest at prophase I during embryogenesis in females, whereas in males they enter mitotic arrest during embryogenesis and enter meiosis only after birth. Here we report the molecular analysis of meiosis onset in the chicken model and provide evidence for conserved regulation by retinoic acid. Results Meiosis in the chicken embryo is initiated late in embryogenesis (day 15.5, relative to gonadal sex differentiation (from day 6. Meiotic germ cells are first detectable only in female gonads from day 15.5, correlating with the expression of the meiosis marker, SCP3. Gonads isolated from day 10.5 female embryos and grown in serum-free medium could still initiate meiosis at day 16.5, suggesting that this process is controlled by an endogenous clock in the germ cells themselves, and/or that germ cells are already committed to meiosis at the time of explantation. Early commitment is supported by the analysis of chicken STRA8, a pre-meiotic marker shown to be essential for meiosis in mouse. Chicken STRA8 is expressed female-specifically from embryonic day 12.5, preceding morphological evidence of meiosis at day 15.5. Previous studies have shown that, in the mouse embryo, female-specific induction of STRA8 and meiosis are triggered by retinoic acid. A comprehensive analysis of genes regulating retinoic acid metabolism in chicken embryos reveals dynamic expression in the gonads. In particular, the retinoic acid-synthesising enzyme, RALDH2, is expressed in the left ovarian cortex at the time of STRA8 up-regulation, prior to meiosis. Conclusion This study presents the first molecular analysis of meiosis onset in an avian embryo. Although aspects of avian meiosis differ from that of mammals, a role for retinoic acid may be conserved.

  17. 响叶杨小孢子母细胞减数分裂及染色体行为的研究%Meiosis and Chromosome Behavior of Microsporocytes in Populus adenopoda Maxim

    Institute of Scientific and Technical Information of China (English)

    鲁敏; 王君; 王旭军; 吴际友; 康向阳

    2011-01-01

    The meiosis and chromosome behavior of microsporocytes in Populus adenopoda were studied by aceto-carmine squash technique. The meiosis of the pollen mother cells of P.adenopoda showed a high correlation to external characters of male flower buds/inflorescences and anther color. The normal behavior of chromosome indicated a high degree of homology among the homologous chromosomes of P. adenopoda. However, the appearance of paralleled spindles at metaphase Ⅱ may result in big pollen grains. The varied number of nucleoli during meiosis of microsporocytes was probably due to ancient polyploid origin of Populus. The differences in the processes of meiosis in P. adenopoda occurred not only in different buds, but also in different parts of the flower bud. This meiosis asynchronicity was an important character of evolution for environmental adaptation during sexual reproduction of the genus.%采用醋酸洋红压片法对响叶杨(Populus adenopoda)小孢子母细胞减数分裂进程中的染色体行为进行了研究.结果表明:响叶杨小孢子发生发育过程与其雄花芽/花序的外部特征和花药颜色有着密切关系;在其减数分裂进程中染色体行为正常,表明响叶杨同源染色体间表现出了较高的同源性,在中期Ⅱ平行纺锤体的出现与天然花粉中大花粉的存在可能有一定的联系;同时,减数分裂过程中核仁数目存在着动态变化,这种现象可能与杨属植物古多倍性起源有关.同一花芽的不同部位,减数分裂进程较不同步,这种不同步性是响叶杨适应环境的一种进化表现.

  18. Maize AMEIOTIC1 is essential for multiple early meiotic processes and likely required for the initiation of meiosis

    OpenAIRE

    Pawlowski, Wojciech P.; Wang, Chung-Ju Rachel; Golubovskaya, Inna N.; Szymaniak, Jessica M.; Shi, Liang; Hamant, Olivier; Zhu, Tong; Harper, Lisa; Sheridan, William F.; Cande, W. Zacheus

    2009-01-01

    Molecular mechanisms that initiate meiosis have been studied in fungi and mammals, but little is known about the mechanisms directing the meiosis transition in other organisms. To elucidate meiosis initiation in plants, we characterized and cloned the ameiotic1 (am1) gene, which affects the transition to meiosis and progression through the early stages of meiotic prophase in maize. We demonstrate that all meiotic processes require am1, including expression of meiosis-specific genes, establish...

  19. High-throughput knockout screen in Schizosaccharomyces pombe identifies a novel gene required for efficient homolog disjunction during meiosis I

    OpenAIRE

    Rumpf, Cornelia; Cipak, Lubos; Novatchkova, Maria; LI, ZHANG; Polakova, Silvia; Dudas, Andrej; Kovacikova, Ines; Miadokova, Eva; Ammerer, Gustav; Gregan, Juraj

    2010-01-01

    Meiosis is the process which produces haploid gametes from diploid precursor cells. This reduction of chromosome number is achieved by two successive divisions. Whereas homologs segregate during meiosis I, sister chromatids segregate during meiosis II. To identify novel proteins required for proper segregation of chromosomes during meiosis, we applied a high-throughput knockout technique to delete 87 S. pombe genes whose expression is upregulated during meiosis and analyzed the mutant phenoty...

  20. Un-“ESCRT”-ed Budding

    Directory of Open Access Journals (Sweden)

    Mark Yondola

    2011-01-01

    Full Text Available In their recent publication, Rossman et al. [1] describe how the inherent budding capability of its M2 protein allows influenza A virus to bypass recruitment of the cellular ESCRT machinery enlisted by several other enveloped RNA and DNA viruses, including HIV, Ebola, rabies, herpes simplex type 1 and hepatitis B. Studies from the same laboratory [2] and other laboratories [3–6] indicate that budding of plasmid-derived virus-like particles can be mediated by the influenza virus hemagglutinin and neuraminidase proteins in the absence of M2. These events are also independent of canonical ESCRT components [2,7]. Understanding how intrinsic properties of these influenza virus proteins permit ESCRT-independent budding expands our understanding of the budding process itself.

  1. Meiosis specific coiled-coil proteins in Shizosaccharomyces pombe

    Directory of Open Access Journals (Sweden)

    Okuzaki Daisuke

    2007-05-01

    Full Text Available Abstract Many meiosis-specific proteins in Schizosaccharomyces pombe contain coiled-coil motifs which play essential roles for meiotic progression. For example, the coiled-coil motifs present in Meu13 and Mcp7 are required for their function as a putative recombinase cofactor complex during meiotic recombination. Mcp6/Hrs1 and Mcp5/Num1 control horsetail chromosome movement by astral microtubule organization and anchoring dynein respectively. Dhc1 and Ssm4 are also required for horsetail chromosome movement. It is clear from these examples that the coiled-coil motif in these proteins plays an important role during the progression of cells through meiosis. However, there are still many unanswered questions on how these proteins operate. In this paper, we briefly review recent studies on the meiotic coiled-coil proteins in Sz. pombe.

  2. Meiosis and chromosome painting of sex chromosome systems in Ceboidea.

    Science.gov (United States)

    Mudry, M D; Rahn, I M; Solari, A J

    2001-06-01

    The identity of the chromosomes involved in the multiple sex system of Alouatta caraya (Aca) and the possible distribution of this system among other Ceboidea were investigated by chromosome painting of mitotic cells from five species and by analysis of meiosis at pachytene in two species. The identity of the autosome #7 (X2) involved in the multiple system of Aca and its breakage points were demonstrated by both meiosis and chromosome painting. These features are identical to those described by Consigliere et al. [1996] in Alouatta seniculus sara (Assa) and Alouatta seniculus arctoidea (Asar). This multiple system was absent in the other four Ceboidea species studied here. However, data from the literature strongly suggest the presence of this multiple in other members of this genus. The presence of this multiple system among several species and subspecies that show high levels of chromosome rearrangements may suggest a special selective value of this multiple. The meiotic features of the sex systems of Aca and Cebus apella paraguayanus (Cap) are strikingly different at pachytene, as the latter system is similar to the sex pair of man and other primates. The relatively large genetic distances between species presently showing this multiple system suggest that its origin is not recent. Other members of the same genus should be investigated at meiosis and by chromosome painting in order to know the extent and distribution of this complex sex-chromosome system. PMID:11376445

  3. Polo kinase Cdc5 is a central regulator of meiosis I

    OpenAIRE

    Attner, Michelle A.; Miller, Matthew P.; Ee, Ly-Sha; Elkin, Sheryl K; Amon, Angelika

    2013-01-01

    During meiosis, two consecutive rounds of chromosome segregation yield four haploid gametes from one diploid cell. The Polo kinase Cdc5 is required for meiotic progression, but how Cdc5 coordinates multiple cell-cycle events during meiosis I is not understood. Here we show that CDC5-dependent phosphorylation of Rec8, a subunit of the cohesin complex that links sister chromatids, is required for efficient cohesin removal from chromosome arms, which is a prerequisite for meiosis I chromosome se...

  4. Microinjection of antisense c-mos oligonucleotides prevents meiosis II in the maturing mouse egg.

    OpenAIRE

    O'Keefe, S J; Wolfes, H; Kiessling, A A; Cooper, G M

    1989-01-01

    Injection of antisense oligonucleotides was used to investigate the function of c-mos in murine oocytes. Oocytes injected with antisense c-mos oligonucleotides completed the first meiotic division but failed to initiate meiosis II. Instead, loss of c-mos function led to chromosome decondensation, reformation of a nucleus after meiosis I, and cleavage to two cells. Therefore, c-mos is required for meiosis II during murine oocyte maturation.

  5. Reducing CYP51 inhibits follicle-stimulating hormone induced resumption of mouse oocyte meiosis in vitro

    OpenAIRE

    Wang, Chao; Xu, Baoshan; Bo ZHOU; Zhang, Cheng; Yang, Jie; Ouyang, Hong; Ning, Gang; Zhang, Meijia; Shen, Jianzhong; Xia, Guoliang

    2009-01-01

    Meiosis activating sterol, produced directly by lanosterol 14-α-demethylase (CYP51) during cholesterol biosynthesis, has been shown to promote the initiation of oocyte meiosis. However, the physiological significance of CYP51 action on oocyte meiosis in response to gonadotrophins’ induction remained to be further explored. Herein, we analyzed the role of CYP51 in gonadotrophin-induced in vitro oocyte maturation via RNA interference (RNAi). We showed that although both luteinizing hormone (LH)...

  6. Recent advances in understanding of meiosis initiation and the apomictic pathway in plants

    OpenAIRE

    Wang, Chung-Ju R.; Tseng, Ching-Chih

    2014-01-01

    Meiosis, a specialized cell division to produce haploid cells, marks the transition from a sporophytic to a gametophytic generation in the life cycle of plants. In angiosperms, meiosis takes place in sporogenous cells that develop de novo from somatic cells in anthers or ovules. A successful transition from the mitotic cycle to the meiotic program in sporogenous cells is crucial for sexual reproduction. By contrast, when meiosis is bypassed or a mitosis-like division occurs to produce unreduc...

  7. Shrinkage of ipsilateral taste buds and hyperplasia of contralateral taste buds following chorda tympani nerve transection

    Directory of Open Access Journals (Sweden)

    Yi-ke Li

    2015-01-01

    Full Text Available The morphological changes that occur in the taste buds after denervation are not well understood in rats, especially in the contralateral tongue epithelium. In this study, we investigated the time course of morphological changes in the taste buds following unilateral nerve transection. The role of the trigeminal component of the lingual nerve in maintaining the structural integrity of the taste buds was also examined. Twenty-four Sprague-Dawley rats were randomly divided into three groups: control, unilateral chorda tympani nerve transection and unilateral chorda tympani nerve transection + lingual nerve transection. Rats were allowed up to 42 days of recovery before being euthanized. The taste buds were visualized using a cytokeratin 8 antibody. Taste bud counts, volumes and taste receptor cell numbers were quantified and compared among groups. No significant difference was detected between the chorda tympani nerve transection and chorda tympani nerve transection + lingual nerve transection groups. Taste bud counts, volumes and taste receptor cell numbers on the ipsilateral side all decreased significantly compared with control. On the contralateral side, the number of taste buds remained unchanged over time, but they were larger, and taste receptor cells were more numerous postoperatively. There was no evidence for a role of the trigeminal branch of the lingual nerve in maintaining the structural integrity of the anterior taste buds.

  8. Comparative live-cell imaging analyses of SPA-2, BUD-6 and BNI-1 in Neurospora crassa reveal novel features of the filamentous fungal polarisome.

    Directory of Open Access Journals (Sweden)

    Alexander Lichius

    Full Text Available A key multiprotein complex involved in regulating the actin cytoskeleton and secretory machinery required for polarized growth in fungi, is the polarisome. Recognized core constituents in budding yeast are the proteins Spa2, Pea2, Aip3/Bud6, and the key effector Bni1. Multicellular fungi display a more complex polarized morphogenesis than yeasts, suggesting that the filamentous fungal polarisome might fulfill additional functions. In this study, we compared the subcellular organization and dynamics of the putative polarisome components BUD-6 and BNI-1 with those of the bona fide polarisome marker SPA-2 at various developmental stages of Neurospora crassa. All three proteins exhibited a yeast-like polarisome configuration during polarized germ tube growth, cell fusion, septal pore plugging and tip repolarization. However, the localization patterns of all three proteins showed spatiotemporally distinct characteristics during the establishment of new polar axes, septum formation and cytokinesis, and maintained hyphal tip growth. Most notably, in vegetative hyphal tips BUD-6 accumulated as a subapical cloud excluded from the Spitzenkörper (Spk, whereas BNI-1 and SPA-2 partially colocalized with the Spk and the tip apex. Novel roles during septal plugging and cytokinesis, connected to the reinitiation of tip growth upon physical injury and conidial maturation, were identified for BUD-6 and BNI-1, respectively. Phenotypic analyses of gene deletion mutants revealed additional functions for BUD-6 and BNI-1 in cell fusion regulation, and the maintenance of Spk integrity. Considered together, our findings reveal novel polarisome-independent functions of BUD-6 and BNI-1 in Neurospora, but also suggest that all three proteins cooperate at plugged septal pores, and their complex arrangement within the apical dome of mature hypha might represent a novel aspect of filamentous fungal polarisome architecture.

  9. Oxytocin signaling in mouse taste buds.

    Directory of Open Access Journals (Sweden)

    Michael S Sinclair

    Full Text Available BACKGROUND: The neuropeptide, oxytocin (OXT, acts on brain circuits to inhibit food intake. Mutant mice lacking OXT (OXT knockout overconsume salty and sweet (i.e. sucrose, saccharin solutions. We asked if OXT might also act on taste buds via its receptor, OXTR. METHODOLOGY/PRINCIPAL FINDINGS: Using RT-PCR, we detected the expression of OXTR in taste buds throughout the oral cavity, but not in adjacent non-taste lingual epithelium. By immunostaining tissues from OXTR-YFP knock-in mice, we found that OXTR is expressed in a subset of Glial-like (Type I taste cells, and also in cells on the periphery of taste buds. Single-cell RT-PCR confirmed this cell-type assignment. Using Ca2+ imaging, we observed that physiologically appropriate concentrations of OXT evoked [Ca2+]i mobilization in a subset of taste cells (EC50 approximately 33 nM. OXT-evoked responses were significantly inhibited by the OXTR antagonist, L-371,257. Isolated OXT-responsive taste cells were neither Receptor (Type II nor Presynaptic (Type III cells, consistent with our immunofluorescence observations. We also investigated the source of OXT peptide that may act on taste cells. Both RT-PCR and immunostaining suggest that the OXT peptide is not produced in taste buds or in their associated nerves. Finally, we also examined the morphology of taste buds from mice that lack OXTR. Taste buds and their constituent cell types appeared very similar in mice with two, one or no copies of the OXTR gene. CONCLUSIONS/SIGNIFICANCE: We conclude that OXT elicits Ca2+ signals via OXTR in murine taste buds. OXT-responsive cells are most likely a subset of Glial-like (Type I taste cells. OXT itself is not produced locally in taste tissue and is likely delivered through the circulation. Loss of OXTR does not grossly alter the morphology of any of the cell types contained in taste buds. Instead, we speculate that OXT-responsive Glial-like (Type I taste bud cells modulate taste signaling and afferent

  10. Single-particle tracking of quantum dot-conjugated prion proteins inside yeast cells

    International Nuclear Information System (INIS)

    Research highlights: → We develop a method to track a quantum dot-conjugated protein in yeast cells. → We incorporate the conjugated quantum dot proteins into yeast spheroplasts. → We track the motions by conventional or 3D tracking microscopy. -- Abstract: Yeast is a model eukaryote with a variety of biological resources. Here we developed a method to track a quantum dot (QD)-conjugated protein in the budding yeast Saccharomyces cerevisiae. We chemically conjugated QDs with the yeast prion Sup35, incorporated them into yeast spheroplasts, and tracked the motions by conventional two-dimensional or three-dimensional tracking microscopy. The method paves the way toward the individual tracking of proteins of interest inside living yeast cells.

  11. Single-particle tracking of quantum dot-conjugated prion proteins inside yeast cells

    Energy Technology Data Exchange (ETDEWEB)

    Tsuji, Toshikazu; Kawai-Noma, Shigeko [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan); Pack, Chan-Gi [Cellular Informatics Laboratory, RIKEN Advanced Science Institute, Wako-shi, Saitama 351-0198 (Japan); Terajima, Hideki [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan); Yajima, Junichiro; Nishizaka, Takayuki [Department of Physics, Gakushuin University, 1-5-1 Mejiro, Toshima-ku, Tokyo 171-8588 (Japan); Kinjo, Masataka [Laboratory of Molecular Cell Dynamics, Graduate School of Life Sciences, Hokkaido University, Sapporo 001-0021 (Japan); Taguchi, Hideki, E-mail: taguchi@bio.titech.ac.jp [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan)

    2011-02-25

    Research highlights: {yields} We develop a method to track a quantum dot-conjugated protein in yeast cells. {yields} We incorporate the conjugated quantum dot proteins into yeast spheroplasts. {yields} We track the motions by conventional or 3D tracking microscopy. -- Abstract: Yeast is a model eukaryote with a variety of biological resources. Here we developed a method to track a quantum dot (QD)-conjugated protein in the budding yeast Saccharomyces cerevisiae. We chemically conjugated QDs with the yeast prion Sup35, incorporated them into yeast spheroplasts, and tracked the motions by conventional two-dimensional or three-dimensional tracking microscopy. The method paves the way toward the individual tracking of proteins of interest inside living yeast cells.

  12. Meiotic Recombination Hotspots of Fission Yeast Are Directed to Loci that Express Non-Coding RNA

    OpenAIRE

    Wahls, Wayne P; Siegel, Eric R.; Davidson, Mari K.

    2008-01-01

    Background Polyadenylated, mRNA-like transcripts with no coding potential are abundant in eukaryotes, but the functions of these long non-coding RNAs (ncRNAs) are enigmatic. In meiosis, Rec12 (Spo11) catalyzes the formation of dsDNA breaks (DSBs) that initiate homologous recombination. Most meiotic recombination is positioned at hotspots, but knowledge of the mechanisms is nebulous. In the fission yeast genome DSBs are located within 194 prominent peaks separated on average by 65-kbp interval...

  13. Competitive canalization of PIN-dependent auxin flow from axillary buds controls pea bud outgrowth.

    Science.gov (United States)

    Balla, Jozef; Kalousek, Petr; Reinöhl, Vilém; Friml, Jiří; Procházka, Stanislav

    2011-02-01

    Shoot branching is one of the major determinants of plant architecture. Polar auxin transport in stems is necessary for the control of bud outgrowth by a dominant apex. Here, we show that following decapitation in pea (Pisum sativum L.), the axillary buds establish directional auxin export by subcellular polarization of PIN auxin transporters. Apical auxin application on the decapitated stem prevents this PIN polarization and canalization of laterally applied auxin. These results support a model in which the apical and lateral auxin sources compete for primary channels of auxin transport in the stem to control the outgrowth of axillary buds. PMID:21219506

  14. Assessment of Yeast Aging by Flow Cytometry

    Czech Academy of Sciences Publication Activity Database

    Baszczyňski, Martin; Kuřec, M.; Novák, Pavel; Brányik, Tomáš; Růžička, Marek; Drahoš, Jiří

    Bratislava : Slovak University of Technology, 2009 - (Markoš, J.), s. 317 ISBN 978-80-227-3072-3. [International Conference of Slovak Society of Chemical Engineering /36./. Tatranské Matliare (SK), 25.05.2009-29.05.2009] R&D Projects: GA ČR GA104/07/1110; GA ČR(CZ) GD104/08/H055; GA ČR GA104/06/1418 Institutional research plan: CEZ:AV0Z40720504 Keywords : yeast * aging * bud scars Subject RIV: CI - Industrial Chemistry, Chemical Engineering

  15. Global gene expression analysis in fetal mouse ovaries with and without meiosis and comparison of selected genes with meiosis in the testis

    DEFF Research Database (Denmark)

    Olesen, C.; Nyeng, P.; Kalisz, M.;

    2007-01-01

    In order to identify novel genes involved in early meiosis and early ovarian development in the mouse, we used microarray technology to compare transcriptional activity in ovaries without meiotic germ cells at embryonic age 11.5 (E11.5) and E13.5 ovaries with meiosis. Overall, 182 genes were...... differentially expressed; 134 were known genes and 48 were functionally uncharacterized. A comparison of our data with the literature associated, for the first time, at least eight of the known genes with female meiosis/germ cell differentiation (Aldh1a1, C2pa, Tex12, Stk31, Lig3, Id4, Recq1, Piwil2). These......-expressed transcript 1" (Get-1). In situ hybridization showed that Get-1 was expressed in meiotic germ cells in both fetal ovaries and mature testis. Get-1 is therefore a novel gene in both male and female meiosis....

  16. An Interactive Modeling Lesson Increases Students' Understanding of Ploidy during Meiosis

    Science.gov (United States)

    Wright, L. Kate; Newman, Dina L.

    2011-01-01

    Chromosome structure is confusing to students at all levels, and chromosome behavior during meiosis is a notoriously difficult topic. Undergraduate biology majors are exposed to the process of meiosis numerous times during their presecondary and postsecondary education, yet understanding of key concepts, such as the point at which haploidy is…

  17. Development and Meiosis of Three Interspecific Hybrids with Cultivated Barley (Hordeum vulgare L.)

    DEFF Research Database (Denmark)

    Von Bothmer, R.; Flink, J.; Linde-Laursen, Ib

    1986-01-01

    The development and meiosis of three interspecific hybrids between cultivated barley (Hordeum vulgare L.) and H. secalinum Schreb., H. tetraploidum Covas, and H. parodii Covas, respectively, were studied. All three hybrid combinations developed very slowly vegetatively. Meiosis of the hybrids was...

  18. First-Year Biology Students' Understandings of Meiosis: An Investigation Using a Structural Theoretical Framework

    Science.gov (United States)

    Quinn, Frances; Pegg, John; Panizzon, Debra

    2009-01-01

    Meiosis is a biological concept that is both complex and important for students to learn. This study aims to explore first-year biology students' explanations of the process of meiosis, using an explicit theoretical framework provided by the Structure of the Observed Learning Outcome (SOLO) model. The research was based on responses of 334…

  19. Dysregulation of the mitosis-meiosis switch in testicular carcinoma in situ

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Nielsen, John E; Almstrup, Kristian;

    2013-01-01

    TGCT, except in spermatocytic seminoma (not derived from CIS). In conclusion, this study indicates that meiosis signalling is dysregulated in CIS cells and that a key regulator of the mitosis-meiosis switch, DMRT1, is expressed in 'early-stage' CIS cells but is down-regulated with further invasive...

  20. Meiosis-specific gene discovery in plants: RNA-Seq applied to isolated Arabidopsis male meiocytes

    Directory of Open Access Journals (Sweden)

    May Gregory D

    2010-12-01

    Full Text Available Abstract Background Meiosis is a critical process in the reproduction and life cycle of flowering plants in which homologous chromosomes pair, synapse, recombine and segregate. Understanding meiosis will not only advance our knowledge of the mechanisms of genetic recombination, but also has substantial applications in crop improvement. Despite the tremendous progress in the past decade in other model organisms (e.g., Saccharomyces cerevisiae and Drosophila melanogaster, the global identification of meiotic genes in flowering plants has remained a challenge due to the lack of efficient methods to collect pure meiocytes for analyzing the temporal and spatial gene expression patterns during meiosis, and for the sensitive identification and quantitation of novel genes. Results A high-throughput approach to identify meiosis-specific genes by combining isolated meiocytes, RNA-Seq, bioinformatic and statistical analysis pipelines was developed. By analyzing the studied genes that have a meiosis function, a pipeline for identifying meiosis-specific genes has been defined. More than 1,000 genes that are specifically or preferentially expressed in meiocytes have been identified as candidate meiosis-specific genes. A group of 55 genes that have mitochondrial genome origins and a significant number of transposable element (TE genes (1,036 were also found to have up-regulated expression levels in meiocytes. Conclusion These findings advance our understanding of meiotic genes, gene expression and regulation, especially the transcript profiles of MGI genes and TE genes, and provide a framework for functional analysis of genes in meiosis.

  1. Identification and Quality Assessment of Chrysanthemum Buds by CE Fingerprinting

    Directory of Open Access Journals (Sweden)

    Xiaoping Xing

    2015-01-01

    Full Text Available A simple and efficient fingerprinting method for chrysanthemum buds was developed with the aim of establishing a quality control protocol based on biochemical makeup. Chrysanthemum bud samples were successively extracted by water and alcohol. The fingerprints of the chrysanthemum buds samples were obtained using capillary electrophoresis and electrochemical detection (CE-ED employing copper and carbon working electrodes to capture all of the chemical information. 10 batches of chrysanthemum buds were collected from different regions and various factories to establish the baseline fingerprint. The experimental data of 10 batches electropherogram buds by CE were analyzed by correlation coefficient and the included angle cosine methods. A standard chrysanthemum bud fingerprint including 24 common peaks was established, 12 from each electrode, which was successfully applied to identify and distinguish between chrysanthemum buds from 2 other chrysanthemum species. These results demonstrate that fingerprint analysis can be used as an important criterion for chrysanthemum buds quality control.

  2. Absence of Positive Selection on Centromeric Histones in Tetrahymena Suggests Unsuppressed Centromere-Drive in Lineages Lacking Male Meiosis

    OpenAIRE

    Elde, Nels C.; Kevin C Roach; Yao, Meng-Chao; Harmit S Malik

    2011-01-01

    Centromere-drive is a process where centromeres compete for transmission through asymmetric "female" meiosis for inclusion into the oocyte. In symmetric "male" meiosis, all meiotic products form viable germ cells. Therefore, the primary incentive for centromere-drive, a potential transmission bias, is believed to be missing from male meiosis. In this article, we consider whether male meiosis also bears the primary cost of centromere-drive. Because different taxa carry out different combinatio...

  3. Shugoshin1 May Play Important Roles in Separation of Homologous Chromosomes and Sister Chromatids during Mouse Oocyte Meiosis

    OpenAIRE

    Shen Yin; Jun-Shu Ai; Li-Hong Shi; Liang Wei; Ju Yuan; Ying-Chun Ouyang; Yi Hou; Da-Yuan Chen; Heide Schatten; Qing-Yuan Sun

    2008-01-01

    BACKGROUND: Homologous chromosomes separate in meiosis I and sister chromatids separate in meiosis II, generating haploid gametes. To address the question why sister chromatids do not separate in meiosis I, we explored the roles of Shogoshin1 (Sgo1) in chromosome separation during oocyte meiosis. METHODOLOGY/PRINCIPAL FINDINGS: Sgo1 function was evaluated by exogenous overexpression to enhance its roles and RNAi to suppress its roles during two meioses of mouse oocytes. Immunocytochemistry an...

  4. Bilingual Buds: The Evolution of a Program

    Science.gov (United States)

    Huang, Sharon

    2009-01-01

    The impetus to begin Bilingual Buds came about six years ago when the author, pregnant with twins and commuting into New York City, was reading about the numerous cognitive benefits for children of acquiring a second language early in their lives. She was surprised to learn that even by the age of six months, children begin to lose the ability to…

  5. Traits and meiosis in mutant of impatiens balsamina induced by space treatment

    International Nuclear Information System (INIS)

    A mutant of Impatiens balsamina was obtained after space induction, and its traits and meiosis were investigated. Characters such as color and form of the mutant expressed great variation. Observation of meiosis showed that most of pollen mother cells were normal in meiosis phase I, except the disproportion of chromosomal segregation, lagging chromosome and dispersal chromosome in anaphase I. Most pollen mother cells developed into microspores tetrad after meiosis, but paraspores also appeared. The number of chromosome in microspore varied from 1 to 21, even more than 30. The shape and size of the microspores fluctuated apparently, and the size of the microspores was in positive correlation to chromosome number. When staining with iodic solution, most of the pollens showed sterility, which was in consistence with the low setting percentage of the mutant plant. It was thought that space induction caused the variation of size, fertility and the abnormal meiosis

  6. Retinoic acid activates two pathways required for meiosis in mice.

    Directory of Open Access Journals (Sweden)

    Jana Koubova

    2014-08-01

    Full Text Available In all sexually reproducing organisms, cells of the germ line must transition from mitosis to meiosis. In mice, retinoic acid (RA, the extrinsic signal for meiotic initiation, activates transcription of Stra8, which is required for meiotic DNA replication and the subsequent processes of meiotic prophase. Here we report that RA also activates transcription of Rec8, which encodes a component of the cohesin complex that accumulates during meiotic S phase, and which is essential for chromosome synapsis and segregation. This RA induction of Rec8 occurs in parallel with the induction of Stra8, and independently of Stra8 function, and it is conserved between the sexes. Further, RA induction of Rec8, like that of Stra8, requires the germ-cell-intrinsic competence factor Dazl. Our findings strengthen the importance of RA and Dazl in the meiotic transition, provide important details about the Stra8 pathway, and open avenues to investigate early meiosis through analysis of Rec8 induction and function.

  7. Requirement of RNA synthesis for bud morphogenesis in hydra

    International Nuclear Information System (INIS)

    Inhibition of RNA synthesis in hydra resulted in complete suppression of bud morphogenesis. A partial inhibition allowed the bud formation, but affected the development of nematocysts, gland cells and interstitial cells. These results indicate that bud morphogenesis in hydra is associated with new DNA-dependent RNA synthesis. (author)

  8. Concentration-Dependent Effects of Rhodiola Rosea on Long-Term Survival and Stress Resistance of Yeast Saccharomyces Cerevisiae: The Involvement of YAP 1 and MSN2/4 Regulatory Proteins

    OpenAIRE

    Bayliak, Maria M.; Burdyliuk, Nadia I.; Izers’ka, Lilia I.; Lushchak, Volodymyr I.

    2013-01-01

    Concentration-dependent effects of aqueous extract from R. rosea root on long-term survival and stress resistance of budding yeast Saccharomyces cerevisiae were studied. At low concentrations, R. rosea aqueous extract extended yeast chronological lifespan, enhanced oxidative stress resistance of stationary-phase cells and resistance to number stressors in exponentially growing cultures. At high concentrations, R. rosea extract sensitized yeast cells to stresses and shortened yeast lifespan. T...

  9. Testing a Mathematical Model of the Yeast Cell Cycle

    OpenAIRE

    Cross, Frederick R.; Archambault, Vincent; Miller, Mary; Klovstad, Martha

    2002-01-01

    We derived novel, testable predictions from a mathematical model of the budding yeast cell cycle. A key qualitative prediction of bistability was confirmed in a strain simultaneously lacking cdc14 and G1 cyclins. The model correctly predicted quantitative dependence of cell size on gene dosage of the G1 cyclin CLN3, but it incorrectly predicted strong genetic interactions between G1 cyclins and the anaphase- promoting complex specificity factor Cdh1. To provide cons...

  10. The cyclin-A CYCA1;2/TAM is required for the meiosis I to meiosis II transition and cooperates with OSD1 for the prophase to first meiotic division transition

    OpenAIRE

    Isabelle d'Erfurth; Laurence Cromer; Sylvie Jolivet; Chloé Girard; Christine Horlow; Yujin Sun; Jennifer P C To; Berchowitz, Luke E; Copenhaver, Gregory P.; Raphael Mercier

    2010-01-01

    Meiosis halves the chromosome number because its two divisions follow a single round of DNA replication. This process involves two cell transitions, the transition from prophase to the first meiotic division (meiosis I) and the unique meiosis I to meiosis II transition. We show here that the A-type cyclin CYCA1;2/TAM plays a major role in both transitions in Arabidopsis. A series of tam mutants failed to enter meiosis II and thus produced diploid spores and functional diploid gametes. These d...

  11. Hormad1 mutation disrupts synaptonemal complex formation, recombination, and chromosome segregation in mammalian meiosis.

    Directory of Open Access Journals (Sweden)

    Yong-Hyun Shin

    2010-11-01

    Full Text Available Meiosis is unique to germ cells and essential for reproduction. During the first meiotic division, homologous chromosomes pair, recombine, and form chiasmata. The homologues connect via axial elements and numerous transverse filaments to form the synaptonemal complex. The synaptonemal complex is a critical component for chromosome pairing, segregation, and recombination. We previously identified a novel germ cell-specific HORMA domain encoding gene, Hormad1, a member of the synaptonemal complex and a mammalian counterpart to the yeast meiotic HORMA domain protein Hop1. Hormad1 is essential for mammalian gametogenesis as knockout male and female mice are infertile. Hormad1 deficient (Hormad1(-/ (- testes exhibit meiotic arrest in the early pachytene stage, and synaptonemal complexes cannot be visualized by electron microscopy. Hormad1 deficiency does not affect localization of other synaptonemal complex proteins, SYCP2 and SYCP3, but disrupts homologous chromosome pairing. Double stranded break formation and early recombination events are disrupted in Hormad1(-/ (- testes and ovaries as shown by the drastic decrease in the γH2AX, DMC1, RAD51, and RPA foci. HORMAD1 co-localizes with γH2AX to the sex body during pachytene. BRCA1, ATR, and γH2AX co-localize to the sex body and participate in meiotic sex chromosome inactivation and transcriptional silencing. Hormad1 deficiency abolishes γH2AX, ATR, and BRCA1 localization to the sex chromosomes and causes transcriptional de-repression on the X chromosome. Unlike testes, Hormad1(-/ (- ovaries have seemingly normal ovarian folliculogenesis after puberty. However, embryos generated from Hormad1(-/ (- oocytes are hyper- and hypodiploid at the 2 cell and 8 cell stage, and they arrest at the blastocyst stage. HORMAD1 is therefore a critical component of the synaptonemal complex that affects synapsis, recombination, and meiotic sex chromosome inactivation and transcriptional silencing.

  12. Cell Biological Characterization of Male Meiosis and Pollen Development in Rice

    Institute of Scientific and Technical Information of China (English)

    Chang-Bin CHEN; Yun-Yuan XU; Hong MA; Kang CHONG

    2005-01-01

    Little systematic analysis has been undertaken in rice (Oryza sativa L.) on the stages of male meiosis from leptotene to telophase Ⅱ or of pollen development from microspores to mature pollen grains.The present study describes multiple stages in detail from analysis of rice chromosome spreading with staining of 4',6-diamidino-2-phenylindole. The description of normal wild-type male meiosis provides an important morphological reference for analyses of meiotic mutants. Meiosis in rice is largely similar to those of the well characterizing model plants Arabidopsis thaliana L. and Zea mays L. However, rice meiosis differs from that in Arabidopsis in that rice meiosis I is followed by the formation of a cell plate, instead of an organelle band that forms between the two nuclei and persist through meiosis Ⅱ. This suggests a difference in the control of organelle biogenesis and distribution and cytokinesis. Our results should facilitate studies of rice meiosis and pollen development using molecular genetic and cell biological approaches.

  13. Meiosis in untreated and irradiated cyperus eragrostis vahl

    International Nuclear Information System (INIS)

    A cytological investigation of meiosis is seed irradiated Cyperus eragrostis has shown that the diffuse centromeric type of chromosome organisation leads to the formation of inviable chromosome complements, in which complex configurations resulting from stickiness as well as pairing of homologous regions, and numerous fragments, persist to the formation of pollen grains. At the higher doses, however, there is complete sterility, and low fertility even at the lower doses. The small numbers of M2 and M3 plants produced at lower doses show much reduced chromosomal abnormalities, indicating severe selection among the gametes and zygotes formed. There is little advantage in terms of survival from radiation damage, resulting from the possession of the diffuse centromere. (auth.)

  14. Molecular Mechanism of Arenavirus Assembly and Budding

    OpenAIRE

    Shuzo Urata; Jiro Yasuda

    2012-01-01

    Arenaviruses have a bisegmented negative-strand RNA genome, which encodes four viral proteins: GP and NP by the S segment and L and Z by the L segment. These four viral proteins possess multiple functions in infection, replication and release of progeny viruses from infected cells. The small RING finger protein, Z protein is a matrix protein that plays a central role in viral assembly and budding. Although all arenaviruses encode Z protein, amino acid sequence alignment showed a huge variety ...

  15. Genomewide identification of pheromone-targeted transcription in fission yeast

    Directory of Open Access Journals (Sweden)

    Wright Anthony

    2006-11-01

    Full Text Available Abstract Background Fission yeast cells undergo sexual differentiation in response to nitrogen starvation. In this process haploid M and P cells first mate to form diploid zygotes, which then enter meiosis and sporulate. Prior to mating, M and P cells communicate with diffusible mating pheromones that activate a signal transduction pathway in the opposite cell type. The pheromone signalling orchestrates mating and is also required for entry into meiosis. Results Here we use DNA microarrays to identify genes that are induced by M-factor in P cells and by P-factor in M-cells. The use of a cyr1 genetic background allowed us to study pheromone signalling independently of nitrogen starvation. We identified a total of 163 genes that were consistently induced more than two-fold by pheromone stimulation. Gene disruption experiments demonstrated the involvement of newly discovered pheromone-induced genes in the differentiation process. We have mapped Gene Ontology (GO categories specifically associated with pheromone induction. A direct comparison of the M- and P-factor induced expression pattern allowed us to identify cell-type specific transcripts, including three new M-specific genes and one new P-specific gene. Conclusion We found that the pheromone response was very similar in M and P cells. Surprisingly, pheromone control extended to genes fulfilling their function well beyond the point of entry into meiosis, including numerous genes required for meiotic recombination. Our results suggest that the Ste11 transcription factor is responsible for the majority of pheromone-induced transcription. Finally, most cell-type specific genes now appear to be identified in fission yeast.

  16. Specialization of B-Type Cyclins for Mitosis or Meiosis in S. Cerevisiae

    OpenAIRE

    Dahmann, C.; Futcher, B.

    1995-01-01

    The CLB1, CLB2, and CLB3 genes encode B-type cyclins important for mitosis in Saccharomyces cerevisiae, while a fourth B-type cyclin gene, CLB4, has no clear role. The effects of homozygous clb mutations on meiosis were examined. Mutants homozygous for clb1 clb3, or for clb1 clb4, gave high levels of sporulation, but produced mainly two-spored asci instead of four-spored asci. The cells had completed meiosis I but not meiosis II, producing viable diploid ascospores. CLB1 and CLB4 seem to be m...

  17. Use of the BioGRID Database for Analysis of Yeast Protein and Genetic Interactions.

    Science.gov (United States)

    Oughtred, Rose; Chatr-aryamontri, Andrew; Breitkreutz, Bobby-Joe; Chang, Christie S; Rust, Jennifer M; Theesfeld, Chandra L; Heinicke, Sven; Breitkreutz, Ashton; Chen, Daici; Hirschman, Jodi; Kolas, Nadine; Livstone, Michael S; Nixon, Julie; O'Donnell, Lara; Ramage, Lindsay; Winter, Andrew; Reguly, Teresa; Sellam, Adnane; Stark, Chris; Boucher, Lorrie; Dolinski, Kara; Tyers, Mike

    2016-01-01

    The BioGRID database is an extensive repository of curated genetic and protein interactions for the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe, and the yeast Candida albicans SC5314, as well as for several other model organisms and humans. This protocol describes how to use the BioGRID website to query genetic or protein interactions for any gene of interest, how to visualize the associated interactions using an embedded interactive network viewer, and how to download data files for either selected interactions or the entire BioGRID interaction data set. PMID:26729909

  18. Characterisation of the nascent polypeptide-associated complex in fission yeast

    DEFF Research Database (Denmark)

    Andersen, Katrine M; Semple, Colin A; Hartmann-Petersen, Rasmus

    2007-01-01

    with other cell proteins, but has also been found to associate with DNA junctions, and to be involved in other processes including transcription regulation and mitochondrial protein import.Here, we characterize NAC in fission yeast. We find that NAC is associated with ribosomes, while a significant fraction...... defects in protein degradation. Accordingly, we find that the NAC UBA domain belongs to an ancient and distinct subgroup of the UBA family. In contrast to the situation with budding yeast, fission yeast cells devoid of NAC were not temperature sensitive. However, they displayed resistance to the amino...

  19. Fission Yeast Scm3: A CENP-A Receptor Required for Integrity of Subkinetochore Chromatin

    OpenAIRE

    Pidoux, Alison L.; Choi, Eun Shik; Abbott, Johanna K.R.; Liu, Xingkun; Kagansky, Alexander; Castillo, Araceli G.; Hamilton, Georgina L.; Richardson, William; Rappsilber, Juri; He, Xiangwei; Allshire, Robin C.

    2009-01-01

    Summary The mechanisms ensuring specific incorporation of CENP-A at centromeres are poorly understood. Mis16 and Mis18 are required for CENP-A localization at centromeres and form a complex that is conserved from fission yeast to human. Fission yeast sim1 mutants that alleviate kinetochore domain silencing are defective in Scm3Sp, the ortholog of budding yeast Scm3Sc. Scm3Sp depends on Mis16/18 for its centromere localization and like them is recruited to centromeres in late anaphase. Importa...

  20. Rif1 Controls DNA Replication Timing in Yeast through the PP1 Phosphatase Glc7

    OpenAIRE

    Stefano Mattarocci; Maksym Shyian; Laure Lemmens; Pascal Damay; Dogus Murat Altintas; Tianlai Shi; Clinton R. Bartholomew; Thomä, Nicolas H.; Christopher F.J. Hardy; David Shore

    2014-01-01

    The Rif1 protein, originally identified as a telomere-binding factor in yeast, has recently been implicated in DNA replication control from yeast to metazoans. Here, we show that budding yeast Rif1 protein inhibits activation of prereplication complexes (pre-RCs). This inhibitory function requires two N-terminal motifs, RVxF and SILK, associated with recruitment of PP1 phosphatase (Glc7). In G1 phase, we show both that Glc7 interacts with Rif1 in an RVxF/SILK-dependent manner and that two pro...

  1. R-loops cause replication impairment and genome instability during meiosis

    OpenAIRE

    Castellano-Pozo, Maikel; García-Muse, Tatiana; Aguilera, Andrés

    2012-01-01

    This study provides the first evidence that R-loops can form during meiosis in Saccharomyces cerevisiae and Caenorhabditis elegans, and that they impair pre-meiotic replication leading to meiotic accumulation of DNA breaks and genome instability.

  2. Induction of spontaneous and UV-induced mutations during commitment to meiosis in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Inductions of reversions of nonsense, missense and frameshift-type mutations were investigated in a diploid cell population of Saccharomyces cerevisiae during commitment to meiosis, by using the medium-transfer technique from sporulation medium to vegetative medium. The yields of spontaneous reverse mutations obtained from the cells that were committed to different stages during meiosis were rather constant irrespective of the alleles tested, although the yields of both intergenic and intragenic recombinations markedly increased. The susceptibilities to UV-induced reverse mutations examined during commitment to meiosis were not changed appreciably. It is concluded that induction of base-change-type mutations in meiosis is not essentially different from that in mitosis. (orig.)

  3. Meiosis I in Xenopus oocytes is not error-prone despite lacking spindle assembly checkpoint.

    Science.gov (United States)

    Liu, Dandan; Shao, Hua; Wang, Hongmei; Liu, X Johné

    2014-01-01

    The spindle assembly checkpoint, SAC, is a surveillance mechanism to control the onset of anaphase during cell division. SAC prevents anaphase initiation until all chromosome pairs have achieved bipolar attachment and aligned at the metaphase plate of the spindle. In doing so, SAC is thought to be the key mechanism to prevent chromosome nondisjunction in mitosis and meiosis. We have recently demonstrated that Xenopus oocyte meiosis lacks SAC control. This prompted the question of whether Xenopus oocyte meiosis is particularly error-prone. In this study, we have karyotyped a total of 313 Xenopus eggs following in vitro oocyte maturation. We found no hyperploid egg, out of 204 metaphase II eggs with countable chromosome spreads. Therefore, chromosome nondisjunction is very rare during Xenopus oocyte meiosis I, despite the lack of SAC. PMID:24646611

  4. Microscopy of Fission Yeast Sexual Lifecycle.

    Science.gov (United States)

    Vjestica, Aleksandar; Merlini, Laura; Dudin, Omaya; Bendezu, Felipe O; Martin, Sophie G

    2016-01-01

    The fission yeast Schizosaccharomyces pombe has been an invaluable model system in studying the regulation of the mitotic cell cycle progression, the mechanics of cell division and cell polarity. Furthermore, classical experiments on its sexual reproduction have yielded results pivotal to current understanding of DNA recombination and meiosis. More recent analysis of fission yeast mating has raised interesting questions on extrinsic stimuli response mechanisms, polarized cell growth and cell-cell fusion. To study these topics in detail we have developed a simple protocol for microscopy of the entire sexual lifecycle. The method described here is easily adjusted to study specific mating stages. Briefly, after being grown to exponential phase in a nitrogen-rich medium, cell cultures are shifted to a nitrogen-deprived medium for periods of time suited to the stage of the sexual lifecycle that will be explored. Cells are then mounted on custom, easily built agarose pad chambers for imaging. This approach allows cells to be monitored from the onset of mating to the final formation of spores. PMID:27022830

  5. The Saccharomyces cerevisiae centromere protein Slk19p is required for two successive divisions during meiosis.

    OpenAIRE

    Zeng, X.; Saunders, W S

    2000-01-01

    Meiotic cell division includes two separate and distinct types of chromosome segregation. In the first segregational event the sister chromatids remain attached at the centromere; in the second the chromatids are separated. The factors that control the order of chromosome segregation during meiosis have not yet been identified but are thought to be confined to the centromere region. We showed that the centromere protein Slk19p is required for the proper execution of meiosis in Saccharomyces c...

  6. Meiosis-specific gene discovery in plants: RNA-Seq applied to isolated Arabidopsis male meiocytes

    OpenAIRE

    May Gregory D; Crow John A; Mudge Joann; Langley Raymond J; Farmer Andrew D; Chen Changbin; Huntley James; Smith Alan G; Retzel Ernest F

    2010-01-01

    Abstract Background Meiosis is a critical process in the reproduction and life cycle of flowering plants in which homologous chromosomes pair, synapse, recombine and segregate. Understanding meiosis will not only advance our knowledge of the mechanisms of genetic recombination, but also has substantial applications in crop improvement. Despite the tremendous progress in the past decade in other model organisms (e.g., Saccharomyces cerevisiae and Drosophila melanogaster), the global identifica...

  7. Yeast Interacting Proteins Database: YMR124W, YLR031W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available in localizes to the cell periphery, cytoplasm, bud, and bud neck; interacts with Crm1p in two-hybrid assay; ... periphery, cytoplasm, bud, and bud neck; interacts with Crm1p in two-hybrid assay

  8. Budding yeast cDNA sequencing project: Y053_E12_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y053_E12_F.ab1 Y053_E12_F.ab1 - - Show Y053_E12_F.ab1 Seqid Y053_E12_F.ab1 Link to SGD Y053_E12_ ... 0 753 ABI TCTTCTGCTCTAAGCTGCTCGAGTGTAAACGACTTACACTACAT AGTTAA TACGACTCACTATTTGGCAT TCCTTAAGATTTGATCGAAATAGA ... TATTAA GAAAAACAAACTGTACAATCAATCAATCAATCAT CACAT AAAATGTTCAG CGAATTAATTAACTTCCAAAATGAAGGTCAT GAG ...

  9. Budding yeast cDNA sequencing project: Y004_M09_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y004_M09_F.ab1 Y004_M09_F.ab1 DB652777 DB652777 Show Y004_M09_F.ab1 Seqid Y004_M09_F.ab1 Link to ... TAGACGATGAGGTGTTTCCCTTATCTTTTGCCAATTA TCAATTTACCGAGCAT GTGTCACTTGGTGAGCAT TATTCACTCAATACTT CGGAAGATGCCAAATA ... ACTGT GTTCTCGTTAGATAACCCTCAAGAAAACAACTACAAACACCAAGCCAT GA ATAACGTCCAGGATTGTCGCAT GGCCGTCGCGGCCAAAACTACCCAGT ...

  10. Budding yeast cDNA sequencing project: Y031_N21_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y031_N21_F.ab1 - - - Show Y031_N21_F.ab1 Seqid Y031_N21_F.ab1 Link to SGD - Link to dbEST - Link ... TGGTACCGCGGCCGCG GATCTCCCTTTAGTGAGGGTTAATTGGATCCAGACAT GATAAGATACAT T GATGAGTTTGGACAAACCACAACTAGAATGCAGTGAA ... AAAAATGCTTTAT TTGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCAT TATAAGCTGCA ATAAACAAGTTAACAACAACAATTGCAT TCAT TTTATGT ...

  11. Budding yeast cDNA sequencing project: Y045_B09_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y045_B09_F.ab1 Y045_B09_F.ab1 - - Show Y045_B09_F.ab1 Seqid Y045_B09_F.ab1 Link to SGD Y045_B09_ ... b1 753 0 753 ABI ATTCTGCTTAAGCTGCTCGAGTGTAAACGACGGCCAT TCCCCAT TAAAGA CGACTCACTATAGGGAATTCCTTAAGATTTGGAGCAC ... TCACAACAAATAGCCAAAAATGCCCGTAAAGCAGGGA ATATTTTGAAAACCAT CTCAAACGAGGGCAGATCAGATATTTTATACAAA ATTCACGATGCCCTGA ...

  12. Budding yeast cDNA sequencing project: Y072_P20_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y072_P20_F.ab1 Y072_P20_F.ab1 DB661654 DB661654 Show Y072_P20_F.ab1 Seqid Y072_P20_F.ab1 Link to ... AATGCTGAGAT CGTTATTGCAAAGCGGCCACCGCAGGGTGGTTGCTTCTTCAT GTGCTACC AT GGTGCGTTGCAGTTCCTCGTCGACCTCCGCGTTGGCGTAC ... TCCCTTGCCCACACTAGACACTCCTTCCT GGAATGCCAACAGTGCCGTTTCAT CCATCAT TTACGAAACACCAGCGCCT TCTCGTCAACCAAGAAAACAGCAT ...

  13. Budding yeast cDNA sequencing project: Y073_K23_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y073_K23_F.ab1 - - - Show Y073_K23_F.ab1 Seqid Y073_K23_F.ab1 Link to SGD - Link to dbEST - Link ... TGGTACCGCGGCCGCGG ATCTCCCTTTAGTGAGGGTTAATTGGATCCAGACAT GATAAGATACAT TG ATGAGTTTGGACAAACCACAACTAGAATGCAGTGAA ... AAAAATGCTTTATT TGTGAAATTTGTGATGCTATTGCTTTATTTGTAACCAT TATAAGCTGCAA TAAACAAGTTAACAACAACAATTGCAT TCAT TTTATGT ...

  14. Budding yeast cDNA sequencing project: Y102_E19_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y102_E19_F.ab1 - - - Show Y102_E19_F.ab1 Seqid Y102_E19_F.ab1 Link to SGD - Link to dbEST - Link ... _F.ab1 753 0 753 ABI GCTCTAAGCTGCTCGAGTGTAAACGACGGCCAT TACGTATTTTATACGAC TCACTATAGGGAATTCCTTAAGATTAAATGTGG ... AAACTGGATAAAAACCTTTGAA GAATTTGGAACAACCCCCACCTAAATGGCAT GGAAAAAAAGGCTTTATTT GTAAAATTTGTGAGGCTATTGCTTTATTTGT ...

  15. Budding yeast cDNA sequencing project: Y114_D11_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y114_D11_F.ab1 Y114_D11_F.ab1 DB668015 DB668015 Show Y114_D11_F.ab1 Seqid Y114_D11_F.ab1 Link to ... CGAGTGTNNNAAGAGGNCATCTCTNAAATAGGG GANTNANNATAGGGAATTCC TTAAGATTTGGCGAGCAAATTAACAGACCT AATTGAACTGGAAAACATGT ... AAACCCATTGACAACTACATCACGA ACAGTGTTCGCCTTTTTGAGGTGAATCC ATCTCAAACGCTCTTCTCC ATA TCGTATAAACCACCAACACAGAAGACAG ... ACACCAAAGTGTCC TTTAGAAC TCATAACTCGCATTTATCC TTGAACTATAAATTTACTACTAA ... GATGTTTCAAGATTACTTAGTGCATTAGGCCCACGAGGCGTATCTATA ACTCC AGGTAAAATTGAAAAAATAGCACAGTCGAAGAAGAAAAATAACAA AATAA ...

  16. Budding yeast cDNA sequencing project: Y077_A07_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y077_A07_F.ab1 - - - Show Y077_A07_F.ab1 Seqid Y077_A07_F.ab1 Link to SGD - Link to dbEST - Link ... GGGGGGG GGGGGGGGGGGGGTATTCGTTTTAAAGGAATAAATTCGGGGTTTCC CCTT TCC ... Quality >Y077_A07_F.ab1 203 0 203 ABI 7 7 ...

  17. Budding yeast cDNA sequencing project: Y102_P06_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y102_P06_F.ab1 - - - Show Y102_P06_F.ab1 Seqid Y102_P06_F.ab1 Link to SGD - Link to dbEST - Link ... TTGACTGNNGCGTGTGTT GAGGTGGGGGGGAGGGAAATTATAAAAGAGGATCC GGGGAGAGGGGGGTT TCTCC ANTTNTTNGGNGNNNNNNNNNNNNNNNCNT ... NANNNNNNNTGTTTTAGGGGGGGGGG AGACTTTTTTTTGGGGGGGTTTTTTCC CCCCAAAAAAAAAAATTTTTGTG TGTGGGCCCCCCCCCCACCGGGGGAAA ... AAAAAATTTTTTTTAAAAAAGGG GGGGGTTTTTTTTTTTTCC CCCCGCGGGGAAAAAAAAAAAAAAAAAGCCC TCTTTTTTTTTTTTGGAGG ... TTAAATAAACCCCCCGCCAACCCCCCCCGGGAGGTTTTTGGGCGCCCCTT TCC ... Quality >Y102_P06_F.ab1 653 0 653 ABI 12 12 12 12 ...

  18. Budding yeast cDNA sequencing project: Y086_E03_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y086_E03_F.ab1 Y086_E03_F.ab1 DB663490 DB663490 Show Y086_E03_F.ab1 Seqid Y086_E03_F.ab1 Link to ... CGAGTGTAAAAGTACGGATACAAAAGAGGGGAC GACTCACTATAGTTACTTCC TTAAGATTTGAGCGATGAGAGCAGCTACAT AACACATAGTAAATCACACA ... TCTACGCAACACACACACACACGCATACAC TCACCCTCATGACAGATCC CCACTTGAACACGCCCCAAGTGAGCACGTCA CCCACATTTGAAAGATCAC ... AGGACTTCC TCAACATCGACGAACCGCCCTG TGCACAGGAAACACCTAGTGTTTCTACA ... TTCAACCTCC CGGGTCC AAGCG CTCC CGCTCAAAGCGTAGACAAGCCAGTCC CCATGATT ...

  19. Budding yeast cDNA sequencing project: Y108_J23_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y108_J23_F.ab1 Y108_J23_F.ab1 - - Show Y108_J23_F.ab1 Seqid Y108_J23_F.ab1 Link to SGD Y108_J23_ ... GAGTGTAAACGACGGCCATAACTTATTTAAT ACGACTCACTATAGGGAATTCC TTAAGATTTTAGGGATGCTGTGGAAAAG GCTCTTAAACAGACTAACGGAA ... ATGCAGAATTTGCTGCATCC CTCC TTTT CC AATGAGCAACCACTGATATTGTGATCGGCCTCTACTTATG ... CTGTTAATATATAATATGCA TAGTTGTATTTGTGCCTCAATGTGCGCCATTCC TGTGTTGGACAAAGCCG CAAGGGCCAAGGCAAGATCC CAGTTTGAAAACG ... ACCCCCGGCCGCTAGAT GCTCC CTTTAGTGACGGTAAATTGCATCC GCACTGACAAGATACTTTGAC GAGTT ...

  20. Budding yeast cDNA sequencing project: Y094_K12_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y094_K12_F.ab1 Y094_K12_F.ab1 DB664754 DB664754 Show Y094_K12_F.ab1 Seqid Y094_K12_F.ab1 Link to ... GAGTGTAAACGACGGCCAGTACGTATTTAATA CGACTCACTATAGGGAATTCC TTAAGATTTGAACCACGTCACATTATACT CATAACCATAGAATTCACAGA ... TATATTACACCTTG GTTTTTGCCATTCTAGTGGTGGAGATTTTCATGTTCTCC ATTCTAGCCCT ACCAATCC CTTCTAGATACCGTAGGCCTCTCACCTTACT ... GTTATTAAAGC CGTTCAAATCCTCC ACAGTGCAAGTTGCGATCAAGTGTGTACTTGGGTTC ATTCTTTTGCT ... GGGCTAGTCATAGAACTTTTAACCATGAAAGACATATACAGAGCATCGC CTCC AGTAGCCTCC AGCGATGTCAAGAAGAACGACTCTGTTACTGCCGAA GCTG ...

  1. Budding yeast cDNA sequencing project: Y091_K02_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y091_K02_F.ab1 - - - Show Y091_K02_F.ab1 Seqid Y091_K02_F.ab1 Link to SGD - Link to dbEST - Link ... GNNATATACAGATATAAAAGAAGATAAATAAAATTTTTGT TTATAACCAATCC ACGAGATAAATTATTATTCATAACTTGGTTAAACTTT AAAGTGGGGGTGT ... TGACTAAGAATATATCTTACTATA ATTTATTAAAAAAAAAATAACTACCTTCC AGTATTAATATATTATTTTGT AATATCTAAAACAATATTTTTACGAAATG ... T TTTCTAAGATAAAACAAAAACTAATAATAAAATTTTTTTTTTCTTTTAAT CC AAAATTGGGAGGGGGGTGGATTTAATATCTCTATAAAAGATTTTCTTC C ... ACATACCGCATAACATAATGATTTAAA AGAGTGAGAGTATTTATAAACAATCC ATATTCC TTATATCATAATATATT TACTATACTTACACCTTAAGCTTATT ...

  2. Budding yeast cDNA sequencing project: Y102_K19_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y102_K19_F.ab1 Y102_K19_F.ab1 - - Show Y102_K19_F.ab1 Seqid Y102_K19_F.ab1 Link to SGD Y102_K19_ ... GAGTGTAAACGACGGCCAGCACGTATTTAATACGA CTCACTATAGGGAATTCC TTAAGATTTATCAAGAACTTGGTTTGATATTT CACCAACACACACAAAAA ... T TGAGATTGGCTTTGCAAAGAAAAGACATTGAGGTTGTTGCTGTCAACGAT CC ATTTATCTCTAACGATTATGCTGCTTACATGGTCAAGTACGATTCTAC T ... CATGGTAGATACAAGGGTACTGTTTCC CATGACGACAAGCACATCATCA TTGATGGTGTCAAGATCGCTACCTACCA ... ACCCAGCTAACTTG CCATGGGGTTCTCTAAAGATCGATGTCGCTGTTGACTCC ACTGGTGTTTT CAAGGAATTGGACACCGCTCAAAAGCACATTGACGCTGG ...

  3. Budding yeast cDNA sequencing project: Y016_M23_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y016_M23_F.ab1 Y016_M23_F.ab1 - - Show Y016_M23_F.ab1 Seqid Y016_M23_F.ab1 Link to SGD Y016_M23_ ... GAGTGTAAACGACGGCCAGTATCTATTTAATA CGACTCACTATAGGGAATTCC TTAAGATTTACTCC TCTCAGCCTCAGTCA TCATCC GCTCAAACCCAGCCG ... TCGTTCC AACCTAAAGAAAACCTTTTCGT ACCACGGGTAAAAATTTTGCATCGTGAT ... TAAAATAATA AGAATTATATATTTTATGATTATATTATTACATAAAGTATTCC CCATTAT AAATTCTGAGTTTCGTAAAAAAAAAAAAAAAAAAAAAAAAAAA ... AAAAAAA AAAAAAAAAAAAAAAAAAGTACCGCGGCCGCGGATCTCC CTTTAGGGAGG GTTAATTGGATCC AAACATGATAAAATACATTGATGAGT ...

  4. Budding yeast cDNA sequencing project: Y074_N01_F.ab1 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available Y074_N01_F.ab1 - - - Show Y074_N01_F.ab1 Seqid Y074_N01_F.ab1 Link to SGD - Link to dbEST - Link ... to UC SC ... Genome Browser - Sequenc e >Y074_N01_F.ab1 301 0 ... 301 ABI GAACCCC AACCCCC AAAAAAGGC ATC AGGNATTCC GAAAC AC ACCCCC AA CC AC C AAAC AC ACC AAC ACC AAC AAC AAC AC AC AC AAC AAACCC ACCCCC ... AAAAAAAAC ... AC ACCC AC AC AACCCC AAAC AC AAC AAAC AC AAAAAAAC AA AAAAACC AC AA ...

  5. Image processing and classification algorithm for yeast cell morphology in a microfluidic chip

    Science.gov (United States)

    Yang Yu, Bo; Elbuken, Caglar; Ren, Carolyn L.; Huissoon, Jan P.

    2011-06-01

    The study of yeast cell morphology requires consistent identification of cell cycle phases based on cell bud size. A computer-based image processing algorithm is designed to automatically classify microscopic images of yeast cells in a microfluidic channel environment. The images were enhanced to reduce background noise, and a robust segmentation algorithm is developed to extract geometrical features including compactness, axis ratio, and bud size. The features are then used for classification, and the accuracy of various machine-learning classifiers is compared. The linear support vector machine, distance-based classification, and k-nearest-neighbor algorithm were the classifiers used in this experiment. The performance of the system under various illumination and focusing conditions were also tested. The results suggest it is possible to automatically classify yeast cells based on their morphological characteristics with noisy and low-contrast images.

  6. Breadth of Tuning and Taste Coding in Mammalian Taste Buds

    OpenAIRE

    Tomchik, Seth M.; Berg, Stephanie; Kim, Joung Woul; Chaudhari, Nirupa; Roper, Stephen D.

    2007-01-01

    A longstanding question in taste research concerns taste coding and, in particular, how broadly are individual taste bud cells tuned to taste qualities (sweet, bitter, umami, salty, and sour). Taste bud cells express G-protein-coupled receptors for sweet, bitter, or umami tastes but not in combination. However, responses to multiple taste qualities have been recorded in individual taste cells. We and others have shown previously there are two classes of taste bud cells directly involved in gu...

  7. Processing Umami and Other Tastes in Mammalian Taste Buds

    OpenAIRE

    Roper, Stephen D.; Chaudhari, Nirupa

    2009-01-01

    Neuroscientists are now coming to appreciate that a significant degree of information processing occurs in the peripheral sensory organs of taste prior to signals propagating to the brain. Gustatory stimulation causes taste bud cells to secrete neurotransmitters that act on adjacent taste bud cells (paracrine transmitters) as well as on primary sensory afferent fibers (neurocrine transmitters). Paracrine transmission, representing cell-cell communication within the taste bud, has the potentia...

  8. BioGRID: A Resource for Studying Biological Interactions in Yeast.

    Science.gov (United States)

    Oughtred, Rose; Chatr-aryamontri, Andrew; Breitkreutz, Bobby-Joe; Chang, Christie S; Rust, Jennifer M; Theesfeld, Chandra L; Heinicke, Sven; Breitkreutz, Ashton; Chen, Daici; Hirschman, Jodi; Kolas, Nadine; Livstone, Michael S; Nixon, Julie; O'Donnell, Lara; Ramage, Lindsay; Winter, Andrew; Reguly, Teresa; Sellam, Adnane; Stark, Chris; Boucher, Lorrie; Dolinski, Kara; Tyers, Mike

    2016-01-01

    The Biological General Repository for Interaction Datasets (BioGRID) is a freely available public database that provides the biological and biomedical research communities with curated protein and genetic interaction data. Structured experimental evidence codes, an intuitive search interface, and visualization tools enable the discovery of individual gene, protein, or biological network function. BioGRID houses interaction data for the major model organism species--including yeast, nematode, fly, zebrafish, mouse, and human--with particular emphasis on the budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe as pioneer eukaryotic models for network biology. BioGRID has achieved comprehensive curation coverage of the entire literature for these two major yeast models, which is actively maintained through monthly curation updates. As of September 2015, BioGRID houses approximately 335,400 biological interactions for budding yeast and approximately 67,800 interactions for fission yeast. BioGRID also supports an integrated posttranslational modification (PTM) viewer that incorporates more than 20,100 yeast phosphorylation sites curated through its sister database, the PhosphoGRID. PMID:26729913

  9. Signal transduction during mating and meiosis in S. pombe

    DEFF Research Database (Denmark)

    Nielsen, O; Nielsen, Olaf

    1993-01-01

    When starved, the fission yeast Schizosaccharomyces pombe responds by producing mating factors or pheromones that signal to cells of the opposite sex to initiate mating. Like its distant relative Saccharomyces cerevisiae, cells of the two mating types of S. pombe each produce a distinct pheromone...

  10. Essential Oil of Betula pendula Roth. Buds

    Directory of Open Access Journals (Sweden)

    Betül Demirci

    2004-01-01

    Full Text Available The essential oil of Betula pendula Roth. buds was obtained using both hydrodistillation and microdistillation techniques and their chemical compositions were analyzed using both gas chromatography (GC and gas chromatography–mass spectrometry (GC-MS. Overall, more than 50 compounds were identified representing 80% and 92% for hydrodistillation and microdistillation, respectively. The main components (by hydrodistillation and microdistillation, respectively found were α-copaene (12% and 10%, germacrene D (11% and 18% and δ-cadinene (11% and 15% in the analyzed essential oils. The microdistillation technique proved to be a useful tool and compliant alternative when compared to hydrodistillation.

  11. Essential Oil of Betula pendula Roth. Buds.

    Science.gov (United States)

    Demirci, Betül; Paper, Dietrich H; Demirci, Fatih; Can Başer, K Hüsnü; Franz, Gerhard

    2004-12-01

    The essential oil of Betula pendula Roth. buds was obtained using both hydrodistillation and microdistillation techniques and their chemical compositions were analyzed using both gas chromatography (GC) and gas chromatography-mass spectrometry (GC-MS). Overall, more than 50 compounds were identified representing 80% and 92% for hydrodistillation and microdistillation, respectively. The main components (by hydrodistillation and microdistillation, respectively) found were alpha-copaene (12% and 10%), germacrene D (11% and 18%) and delta-cadinene (11% and 15%) in the analyzed essential oils. The microdistillation technique proved to be a useful tool and compliant alternative when compared to hydrodistillation. PMID:15841263

  12. Cell surface recycling in yeast: mechanisms and machineries.

    Science.gov (United States)

    MacDonald, Chris; Piper, Robert C

    2016-04-15

    Sorting internalized proteins and lipids back to the cell surface controls the supply of molecules throughout the cell and regulates integral membrane protein activity at the surface. One central process in mammalian cells is the transit of cargo from endosomes back to the plasma membrane (PM) directly, along a route that bypasses retrograde movement to the Golgi. Despite recognition of this pathway for decades we are only beginning to understand the machinery controlling this overall process. The budding yeastSaccharomyces cerevisiae, a stalwart genetic system, has been routinely used to identify fundamental proteins and their modes of action in conserved trafficking pathways. However, the study of cell surface recycling from endosomes in yeast is hampered by difficulties that obscure visualization of the pathway. Here we briefly discuss how recycling is likely a more prevalent process in yeast than is widely appreciated and how tools might be built to better study the pathway. PMID:27068957

  13. Development Correlations of the Buds of Grapevine (Vitis vinifera L.

    Directory of Open Access Journals (Sweden)

    Liliana ROTARU

    2010-06-01

    Full Text Available The development characteristics of different buds of the grapevine are mainly related by stimulation and/or inhibition effects, the action of which is still inexplicable. The present study examines the development dynamics of the buds of a one-year old branch after excision of different buds and the application of ?-naphtyl acetic acid (ANA, as well as the growth capacity of each bud individually. We verified the effects of acrotony cited previously by various researchers. These effects are due to different developmental characteristics of which could to lay the groundwork for the improvement of different productions methods.

  14. Meiosis of anther culture regenerants in asparagus (Asparagus officinalis L.

    Directory of Open Access Journals (Sweden)

    Leonardo Galli

    1998-03-01

    Full Text Available Pollen mother cells obtained from regenerated plants of asparagus (Asparagus officinalis L., in a population composed exclusively of male plants, through the process of anther culture from the hybrid G27 X 22-8, were analyzed during meiosis. It was observed that, during theprocess of anther culture by organogenesis, the pollen mother cells of the regenerants had great genomic instability, as evidenced by disturbances in all the meiotic phases of the first and second division. Furthermore, structural chromosomal abnormalities, in addition to aneuploidy and polyploidy, were observed.Foi analisada a meiose em células mãe de pólen de plantas de aspargo (Asparagus officinalis L. de uma população composta exclusivamente de plantas masculinas, obtidas através do processo de cultura de anteras do híbrido G27 X 22-8. Foi observado que, durante o processo de cultura de anteras, via calogênese, as células mãe de pólen dos regenerantes apresentaram grande instabilidade genômica, evidenciada por irregularidades nas fases de diacinese, assim como de metáfase, anáfase, telófase da primeira e segunda divisão meiótica. Além disto, o processo originou anormalidades cromossômicas estruturais em adição às aneuploidias e poliploidias.

  15. Yeast Infection (Candidiasis)

    Science.gov (United States)

    ... rash and rashes clinical tools newsletter | contact Share | Yeast Infection (Candidiasis) Information for adults A A A This is a candida (yeast) infection of the skin folds of the abdomen. Overview ...

  16. Vaginal yeast infection

    Science.gov (United States)

    Yeast infection - vagina; Vaginal candidiasis; Monilial vaginitis ... Most women have a vaginal yeast infection at some time. Candida albicans is a common type of fungus. It is often found in small amounts in the ...

  17. Multiple subunits of the Caenorhabditis elegans anaphase-promoting complex are required for chromosome segregation during meiosis I.

    OpenAIRE

    Davis, Edward S.; Wille, Lucia; Chestnut, Barry A.; Sadler, Penny L.; Shakes, Diane C; Golden, Andy

    2002-01-01

    Two genes, originally identified in genetic screens for Caenorhabditis elegans mutants that arrest in metaphase of meiosis I, prove to encode subunits of the anaphase-promoting complex or cyclosome (APC/C). RNA interference studies reveal that these and other APC/C subunits are essential for the segregation of chromosomal homologs during meiosis I. Further, chromosome segregation during meiosis I requires APC/C functions in addition to the release of sister chromatid cohesion.

  18. Progestin is an essential factor for the initiation of the meiosis in spermatogenetic cells of the eel

    OpenAIRE

    Miura, Takeshi; Higuchi, Masato; Ozaki, Yuichi; Ohta, Takashi; Miura, Chiemi

    2006-01-01

    Meiosis is an indispensable process of sexual reproduction. However, detailed information on the regulatory mechanisms that initiate meiosis is not available. Progestins are important steroids regulating final maturation in male and female vertebrates. In male teleosts, it is known that progestin induces spermiation and sperm maturation. However, a role for progestin in early spermatogenesis or meiosis has not yet been described. In this study, we examined the functions of progestin on the in...

  19. Separase Is Required for Homolog and Sister Disjunction during Drosophila melanogaster Male Meiosis, but Not for Biorientation of Sister Centromeres.

    OpenAIRE

    Blattner, Ariane C.; Soumya Chaurasia; McKee, Bruce D.; Lehner, Christian F.

    2016-01-01

    Spatially controlled release of sister chromatid cohesion during progression through the meiotic divisions is of paramount importance for error-free chromosome segregation during meiosis. Cohesion is mediated by the cohesin protein complex and cleavage of one of its subunits by the endoprotease separase removes cohesin first from chromosome arms during exit from meiosis I and later from the pericentromeric region during exit from meiosis II. At the onset of the meiotic divisions, cohesin has ...

  20. Separase Is Required for Homolog and Sister Disjunction during Drosophila melanogaster Male Meiosis, but Not for Biorientation of Sister Centromeres.

    Science.gov (United States)

    Blattner, Ariane C; Chaurasia, Soumya; McKee, Bruce D; Lehner, Christian F

    2016-04-01

    Spatially controlled release of sister chromatid cohesion during progression through the meiotic divisions is of paramount importance for error-free chromosome segregation during meiosis. Cohesion is mediated by the cohesin protein complex and cleavage of one of its subunits by the endoprotease separase removes cohesin first from chromosome arms during exit from meiosis I and later from the pericentromeric region during exit from meiosis II. At the onset of the meiotic divisions, cohesin has also been proposed to be present within the centromeric region for the unification of sister centromeres into a single functional entity, allowing bipolar orientation of paired homologs within the meiosis I spindle. Separase-mediated removal of centromeric cohesin during exit from meiosis I might explain sister centromere individualization which is essential for subsequent biorientation of sister centromeres during meiosis II. To characterize a potential involvement of separase in sister centromere individualization before meiosis II, we have studied meiosis in Drosophila melanogaster males where homologs are not paired in the canonical manner. Meiosis does not include meiotic recombination and synaptonemal complex formation in these males. Instead, an alternative homolog conjunction system keeps homologous chromosomes in pairs. Using independent strategies for spermatocyte-specific depletion of separase complex subunits in combination with time-lapse imaging, we demonstrate that separase is required for the inactivation of this alternative conjunction at anaphase I onset. Mutations that abolish alternative homolog conjunction therefore result in random segregation of univalents during meiosis I also after separase depletion. Interestingly, these univalents become bioriented during meiosis II, suggesting that sister centromere individualization before meiosis II does not require separase. PMID:27120695

  1. Prions in Yeast

    OpenAIRE

    Liebman, Susan W; Chernoff, Yury O.

    2012-01-01

    The concept of a prion as an infectious self-propagating protein isoform was initially proposed to explain certain mammalian diseases. It is now clear that yeast also has heritable elements transmitted via protein. Indeed, the “protein only” model of prion transmission was first proven using a yeast prion. Typically, known prions are ordered cross-β aggregates (amyloids). Recently, there has been an explosion in the number of recognized prions in yeast. Yeast continues to lead the way in unde...

  2. RALDH2, the enzyme for retinoic acid synthesis, mediates meiosis initiation in germ cells of the female embryonic chickens.

    Science.gov (United States)

    Yu, Minli; Yu, Ping; Leghari, Imdad H; Ge, Chutian; Mi, Yuling; Zhang, Caiqiao

    2013-02-01

    Meiosis is a process unique to the differentiation of germ cells and exhibits sex-specific in timing. Previous studies showed that retinoic acid (RA) as the vitamin A metabolite is crucial for controlling Stra8 (Stimulated by retinoic acid gene 8) expression in the gonad and to initiate meiosis; however, the mechanism by which retinoid-signaling acts has remained unclear. In the present study, we investigated the role of the enzyme retinaldehyde dehydrogenase 2 (RALDH2) which catalyzes RA synthesizes by initiating meiosis in chicken ovarian germ cells. Meiotic germ cells were first detected at day 15.5 in chicken embryo ovary when the expression of synaptonemal complex protein 3 (Scp3) and disrupted meiotic cDNA 1 homologue (Dmc1) became elevated, while Stra8 expression was specifically up-regulated at day 12.5 before meiosis onset. It was observed from the increase in Raldh2 mRNA expression levels and decreases in Cyp26b1 (the enzyme for RA catabolism) expression levels during meiosis that requirement for RA accumulation is essential to sustain meiosis. This was also revealed by RA stimulation of the cultured ovaries with the initiation of meiosis response, and the knocking down of the Raldh2 expression during meiosis, leading to abolishment of RA-dependent action. Altogether, these studies indicate that RA synthesis by the enzyme RALDH2 and signaling through its receptor is crucial for meiosis initiation in chicken embryonic ovary. PMID:22733143

  3. Kinetics of human immunodeficiency virus budding and assembly

    Science.gov (United States)

    Zhang, Rui; Nguyen, Toan

    2009-03-01

    Human immunodeficiency virus (HIV) belongs to a large family of RNA viruses, retroviruses. Unlike budding of regular enveloped viruses, retroviruses bud concurrently with the assembly of retroviral capsids on the cell membrane. The kinetics of HIV (and other retroviruses) budding and assembly is therefore strongly affected by the elastic energy of the membrane and fundamentally different from regular viruses. The main result of this work shows that the kinetics is tunable from a fast budding process to a slow and effectively trapped partial budding process, by varying the attractive energy of retroviral proteins (call Gags), relative to the membrane elastic energy. When the Gag-Gag attraction is relatively high, the membrane elastic energy provides a kinetic barrier for the two pieces of the partial capsids to merge. This energy barrier determines the slowest step in the kinetics and the budding time. In the opposite limit, the membrane elastic energy provides not only a kinetic energy barrier, but a free energy barrier. The budding and assembly is effectively trapped at local free energy minimum, corresponding to a partially budded state. The time scale to escape from this metastable state is exponentially large. In both cases, our result fit with experimental measurements pretty well.

  4. An elastic model of partial budding of retroviruses

    Science.gov (United States)

    Zhang, Rui; Nguyen, Toan

    2008-03-01

    Retroviruses are characterized by their unique infection strategy of reverse transcription, in which the genetic information flows from RNA back to DNA. The most well known representative is the human immunodeficiency virus (HIV). Unlike budding of traditional enveloped viruses, retrovirus budding happens together with the formation of spherical virus capsids at the cell membrane. Led by this unique budding mechanism, we proposed an elastic model of retrovirus budding in this work. We found that if the lipid molecules of the membrane are supplied fast enough from the cell interior, the budding always proceeds to completion. In the opposite limit, there is an optimal size of partially budded virions. The zenith angle of these partially spherical capsids, α, is given by α˜(2̂/κσ)^1/4, where κ is the bending modulus of the membrane, σ is the surface tension of the membrane, and τ characterizes the strength of capsid protein interaction. If τ is large enough such that α˜π, the budding is complete. Our model explained many features of retrovirus partial budding observed in experiments.

  5. Genotyping 1000 yeast strains by next-generation sequencing

    Directory of Open Access Journals (Sweden)

    Wilkening Stefan

    2013-02-01

    Full Text Available Abstract Background The throughput of next-generation sequencing machines has increased dramatically over the last few years; yet the cost and time for library preparation have not changed proportionally, thus representing the main bottleneck for sequencing large numbers of samples. Here we present an economical, high-throughput library preparation method for the Illumina platform, comprising a 96-well based method for DNA isolation for yeast cells, a low-cost DNA shearing alternative, and adapter ligation using heat inactivation of enzymes instead of bead cleanups. Results Up to 384 whole-genome libraries can be prepared from yeast cells in one week using this method, for less than 15 euros per sample. We demonstrate the robustness of this protocol by sequencing over 1000 yeast genomes at ~30x coverage. The sequence information from 768 yeast segregants derived from two divergent S. cerevisiae strains was used to generate a meiotic recombination map at unprecedented resolution. Comparisons to other datasets indicate a high conservation of recombination at a chromosome-wide scale, but differences at the local scale. Additionally, we detected a high degree of aneuploidy (3.6% by examining the sequencing coverage in these segregants. Differences in allele frequency allowed us to attribute instances of aneuploidy to gains of chromosomes during meiosis or mitosis, both of which showed a strong tendency to missegregate specific chromosomes. Conclusions Here we present a high throughput workflow to sequence genomes of large number of yeast strains at a low price. We have used this workflow to obtain recombination and aneuploidy data from hundreds of segregants, which can serve as a foundation for future studies of linkage, recombination, and chromosomal aberrations in yeast and higher eukaryotes.

  6. Yeast That Smell

    Directory of Open Access Journals (Sweden)

    Eugenia Y Xu

    2008-08-01

    Full Text Available The fundamental mechanism of olfactory receptor activation has been conserved from yeast to humans. Engineered yeast cells can smell some of the same odorants as humans can, which makes yeast an ideal model system for studying human olfaction. Furthermore, if engineered yeast cells are incorporated into sensory arrays, they can be used as biosensors or artificial noses.Keywords: Yeast, olfactory receptor, G protein-coupled receptor, biosensor, smellReceived: 31 July 2008 / Received in revised form: 6 August 2008, Accepted: 13 August 2008, Published online: 17 August 2008

  7. Development of Crystalline Peroxisomes in Methanol-Grown Cells of the Yeast Hansenula polymorpha and Its Relation to Environmental Conditions

    NARCIS (Netherlands)

    Veenhuis, M.; Dijken, J.P. van; Pilon, S.A.F.; Harder, W.

    1978-01-01

    The development of peroxisomes has been studied in cells of the yeast Hansenula polymorpha during growth on methanol in batch and chemostat cultures. During bud formation, new peroxisomes were generated by the separation of small peroxisomes from mature organelles in the mother cells. The number of

  8. Yeast Interacting Proteins Database: YDR439W, YCR086W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available inetochores during meiosis I to mediate accurate homolog segregation; required for condensin recruitment to ...and then Mam1p at kinetochores during meiosis I to mediate accurate homolog segregation; required for condensin recruitment...p, and then Mam1p at kinetochores during meiosis I to mediate accurate homolog segregation; required for condensin recruitment...with Lrs4p and then Mam1p at kinetochores during meiosis I to mediate accurate homolog segregation; required for condensin recruitmen

  9. This bud's for you: mechanisms of cellular nucleocytoplasmic trafficking via nuclear envelope budding.

    Science.gov (United States)

    Fradkin, Lee G; Budnik, Vivian

    2016-08-01

    The nuclear envelope (NE) physically separates the cytoplasmic and nuclear compartments. While this barrier provides advantages, it also presents a challenge for the nuclear export of large ribonucleoprotein (RNP) complexes. Decades-old dogma holds that all such border-crossing is via the nuclear pore complex (NPC). However, the diameter of the NPC central channel limits the passage of large cargos. Here, we review evidence that such large RNPs employ an endogenous NE-budding pathway, previously thought to be exclusive to the nuclear egress of Herpes viruses. We discuss this and other models proposed, the likelihood that this pathway is conserved, and the consequences of disrupting NE-budding for synapse development, localized translation of synaptic mRNAs, and laminopathies inducing accelerated aging. PMID:27236823

  10. Budding and Fission of a multiphase vesicle

    CERN Document Server

    Allain, J M; Allain, Jean-Marc; Amar, Martine Ben

    2005-01-01

    We present a model of bi-phasic vesicle in the limit of large surface tension. In this regime, the vesicle is completely stretched and well described by two spherical caps with a fold which concentrates the membrane stress. The conservation laws and geometric constraints restrict the space of possible shapes to a pair of solutions labeled by a parameter $\\tau$ given by {\\it line tension/pressure}. For a given $\\tau$ value, the two solutions differ by the length of the interface between domains. For a critical value $\\tau\\_c$, the two vesicle shapes become identical and no solution exists above this critical value. This model sheds new light on two proposed mechanisms (osmotic shocks and molecule absorption) to explain the budding and the fission in recent experiments.

  11. A Predictive Model for Yeast Cell Polarization in Pheromone Gradients

    Science.gov (United States)

    Calvez, Vincent; Voituriez, Raphaël; Gonçalves-Sá, Joana; Guo, Chin-Lin; Jiang, Xingyu; Murray, Andrew; Meunier, Nicolas

    2016-01-01

    Budding yeast cells exist in two mating types, a and α, which use peptide pheromones to communicate with each other during mating. Mating depends on the ability of cells to polarize up pheromone gradients, but cells also respond to spatially uniform fields of pheromone by polarizing along a single axis. We used quantitative measurements of the response of a cells to α-factor to produce a predictive model of yeast polarization towards a pheromone gradient. We found that cells make a sharp transition between budding cycles and mating induced polarization and that they detect pheromone gradients accurately only over a narrow range of pheromone concentrations corresponding to this transition. We fit all the parameters of the mathematical model by using quantitative data on spontaneous polarization in uniform pheromone concentration. Once these parameters have been computed, and without any further fit, our model quantitatively predicts the yeast cell response to pheromone gradient providing an important step toward understanding how cells communicate with each other. PMID:27077831

  12. A Predictive Model for Yeast Cell Polarization in Pheromone Gradients.

    Science.gov (United States)

    Muller, Nicolas; Piel, Matthieu; Calvez, Vincent; Voituriez, Raphaël; Gonçalves-Sá, Joana; Guo, Chin-Lin; Jiang, Xingyu; Murray, Andrew; Meunier, Nicolas

    2016-04-01

    Budding yeast cells exist in two mating types, a and α, which use peptide pheromones to communicate with each other during mating. Mating depends on the ability of cells to polarize up pheromone gradients, but cells also respond to spatially uniform fields of pheromone by polarizing along a single axis. We used quantitative measurements of the response of a cells to α-factor to produce a predictive model of yeast polarization towards a pheromone gradient. We found that cells make a sharp transition between budding cycles and mating induced polarization and that they detect pheromone gradients accurately only over a narrow range of pheromone concentrations corresponding to this transition. We fit all the parameters of the mathematical model by using quantitative data on spontaneous polarization in uniform pheromone concentration. Once these parameters have been computed, and without any further fit, our model quantitatively predicts the yeast cell response to pheromone gradient providing an important step toward understanding how cells communicate with each other. PMID:27077831

  13. Mitochondrial localization of fission yeast manganese superoxide dismutase is required for its lysine acetylation and for cellular stress resistance and respiratory growth

    International Nuclear Information System (INIS)

    Research highlights: → Fission yeast manganese superoxide dismutase (MnSOD) is acetylated. → The mitochondrial targeting sequence (MTS) is required for the acetylation of MnSOD. → The MTS is not crucial for MnSOD activity, but is important for respiratory growth. → Posttranslational regulation of MnSOD differs between budding and fission yeast. -- Abstract: Manganese-dependent superoxide dismutase (MnSOD) is localized in the mitochondria and is important for oxidative stress resistance. Although transcriptional regulation of MnSOD has been relatively well studied, much less is known about the protein's posttranslational regulation. In budding yeast, MnSOD is activated after mitochondrial import by manganese ion incorporation. Here we characterize posttranslational modification of MnSOD in the fission yeast Schizosaccharomyces pombe. Fission yeast MnSOD is acetylated at the 25th lysine residue. This acetylation was diminished by deletion of N-terminal mitochondrial targeting sequence, suggesting that MnSOD is acetylated after import into mitochondria. Mitochondrial localization of MnSOD is not essential for the enzyme activity, but is crucial for oxidative stress resistance and growth under respiratory conditions of fission yeast. These results suggest that, unlike the situation in budding yeast, S. pombe MnSOD is already active even before mitochondrial localization; nonetheless, mitochondrial localization is critical to allow the cell to cope with reactive oxygen species generated inside or outside of mitochondria.

  14. A new Speedy/RINGO protein may help regulate male meiosis

    Institute of Scientific and Technical Information of China (English)

    Yukiko Yamazaki; W Steven Ward

    2011-01-01

    @@ Reproductive biology, although seen as a specialty study area, has many unique biology models that offer insight into the regulation of cellular processes that are shared by many different cell types.The most celebrated example of this was the discovery of the cyclins and their role in cell cycle regulation in Xenopus oocytes.1-4 Meiosis is one such aspect of this field that presents an important window for the study of both cell cycle regulation and chromatin structure.Meiosis only occurs in the testis and ovaries, and only in the germ cells that eventually produce sper-matogonia and oocytes.5 In this issue, Cheng and colleagues6 present data to suggest that a novel protein they originally identified in the rat testis, called LM23, is crucial for the regulation of meiosis in spermatogenesis.It is perhaps fitting that LM23 is a member of a family of proteins called Speedy/RINGO that regulate cyclins.7

  15. Assembly of fission yeast eisosomes in the plasma membrane of budding yeast: Import of foreign membrane microdomains

    Czech Academy of Sciences Publication Activity Database

    Vaškovičová, Katarína; Strádalová, Vendula; Efenberk, Aleš; Opekarová, Miroslava; Malínský, Jan

    2015-01-01

    Roč. 94, č. 1 (2015), s. 1-11. ISSN 0171-9335 R&D Projects: GA ČR(CZ) GAP302/11/0146 Institutional support: RVO:68378041 Keywords : plasma membrane * membrane microdomain * MCC Subject RIV: EA - Cell Biology Impact factor: 3.825, year: 2014

  16. Identification of a small molecule yeast TORC1 inhibitor with a flow cytometry-based multiplex screen

    OpenAIRE

    Chen, Jun; Young, Susan M.; Allen, Chris; Seeber, Andrew; Péli-Gulli, Marie-Pierre; Panchaud, Nicolas; Waller, Anna; Ursu, Oleg; Yao, Tuanli; Golden, Jennifer E.; Strouse, J. Jacob; Carter, Mark B.; Kang, Huining; Bologa, Cristian G.; Foutz, Terry D.

    2012-01-01

    TOR (target of rapamycin) is a serine/threonine kinase, evolutionarily conserved from yeast to human, which functions as a fundamental controller of cell growth. The moderate clinical benefit of rapamycin in mTOR-based therapy of many cancers favors the development of new TOR inhibitors. Here we report a high throughput flow cytometry multiplexed screen using five GFP-tagged yeast clones that represent the readouts of four branches of the TORC1 signaling pathway in budding yeast. Each GFP-tag...

  17. Nuclear vlimata and aneuploidy in embryonic cells is caused by meiosis. Behaviour and properties of meiotic cells

    OpenAIRE

    Logothetou-Rella, H.

    1995-01-01

    This study demonstrates that human embryonic cells divide by meiosis. The use of trophoblastic tissue cells (early embryo) and amniotic cells (late embryo) exhibited the following characteristic events of meiosis: nuclear (NVs) and nucleolar (NuVs) vlimata formation; NV invasion in host cells; extrusion of chromosomes; nuclear fusion; metaphase fusion; hybrid cell formation; nuclear, nucleolar and cytoplasmic bridges, chromosomal transfer, variablesized nuc...

  18. A Paper-and-Pencil Strategy for Teaching Mitosis and Meiosis, Diagnosing Learning Problems and Predicting Examination Performance.

    Science.gov (United States)

    Mertens, Thomas R.; Walker, Julie O.

    1992-01-01

    Describes the Bajema strategy for teaching meiosis and how it is used in the general genetics course at Ball State University and can be used to identify students who have misconceptions of meiosis that can interfere with their learning the basics of Mendelian inheritance. (Contains 11 references.) (MDH)

  19. "Chromoseratops Meiosus": A Simple, Two-Phase Exercise to Represent the Connection between Meiosis & Increased Genetic Diversity

    Science.gov (United States)

    Eliyahu, Dorit

    2014-01-01

    I present an activity to help students make the connection between meiosis and genetic variation. The students model meiosis in the first phase of the activity, and by that process they produce gametes of a fictitious reptilobird species, "Chromoseratops meiosus." Later on, they will "mate" their gametes and produce a zygote…

  20. Meiosis peculiarities featured by first-generation spring wheat (Triticum aestivum L.) under the influence of gamma-radiation

    International Nuclear Information System (INIS)

    The study of meiosis of spring wheat represented by three varieties revealed intervarietal differences according to the frequency and types of disturbances. Gamma-irradiation with 10 kCi dose increased the disturbance frequency during meiosis in all varieties. However, there were substantial differences in the variety response to the irradiation. (authors)

  1. Bovine ovarian cells have (pro)renin receptors and prorenin induces resumption of meiosis in vitro.

    Science.gov (United States)

    Dau, Andressa Minussi Pereira; da Silva, Eduardo Pradebon; da Rosa, Paulo Roberto Antunes; Bastiani, Felipe Tusi; Gutierrez, Karina; Ilha, Gustavo Freitas; Comim, Fabio Vasconcellos; Gonçalves, Paulo Bayard Dias

    2016-07-01

    The discovery of a receptor that binds prorenin and renin in human endothelial and mesangial cells highlights the possible effect of renin-independent prorenin in the resumption of meiosis in oocytes that was postulated in the 1980s.This study aimed to identify the (pro)renin receptor in the ovary and to assess the effect of prorenin on meiotic resumption. The (pro)renin receptor protein was detected in bovine cumulus-oocyte complexes, theca cells, granulosa cells, and in the corpus luteum. Abundant (pro)renin receptor messenger ribonucleic acid (mRNA) was detected in the oocytes and cumulus cells, while prorenin mRNA was identified in the cumulus cells only. Prorenin at concentrations of 10(-10), 10(-9), and 10(-8)M incubated with oocytes co-cultured with follicular hemisections for 15h caused the resumption of oocyte meiosis. Aliskiren, which inhibits free renin and receptor-bound renin/prorenin, at concentrations of 10(-7), 10(-5), and 10(-3)M blocked this effect (P<0.05). To determine the involvement of angiotensin II in prorenin-induced meiosis resumption, cumulus-oocyte complexes and follicular hemisections were treated with prorenin and with angiotensin II or saralasin (angiotensin II antagonist). Prorenin induced the resumption of meiosis independently of angiotensin II. Furthermore, cumulus-oocyte complexes cultured with forskolin (200μM) and treated with prorenin and aliskiren did not exhibit a prorenin-induced resumption of meiosis (P<0.05). Only the oocytes' cyclic adenosine monophosphate levels seemed to be regulated by prorenin and/or forskolin treatment after incubation for 6h. To the best of our knowledge, this is the first study to identify the (pro)renin receptor in ovarian cells and to demonstrate the independent role of prorenin in the resumption of oocyte meiosis in cattle. PMID:27060674

  2. Glucose monitoring in fission yeast via the Gpa2 galpha, the git5 Gbeta and the git3 putative glucose receptor.

    OpenAIRE

    Welton, R M; Hoffman, C. S.

    2000-01-01

    The fission yeast Schizosaccharomyces pombe responds to environmental glucose by activating adenylate cyclase. The resulting cAMP signal activates protein kinase A (PKA). PKA inhibits glucose starvation-induced processes, such as conjugation and meiosis, and the transcription of the fbp1 gene that encodes the gluconeogenic enzyme fructose-1,6-bisphosphatase. We previously identified a collection of git genes required for glucose repression of fbp1 transcription, including pka1/git6, encoding ...

  3. Rec8p, a meiotic recombination and sister chromatid cohesion phosphoprotein of the Rad21p family conserved from fision yeast to humans.

    OpenAIRE

    Parisi, S.; McKay, Michael; Molnar, M; Thompson, Anne; van der Spek, Peter; Drunen-Schoenmaker, E.; Kanaar, Roland; Lehmann, E.; Hoeijmakers, Jan; Kohli, J

    1999-01-01

    textabstractOur work and that of others defined mitosis-specific (Rad21 subfamily) and meiosis-specific (Rec8 subfamily) proteins involved in sister chromatid cohesion in several eukaryotes, including humans. Mutation of the fission yeast Schizosaccharomyces pombe rec8 gene was previously shown to confer a number of meiotic phenotypes, including strong reduction of recombination frequencies in the central region of chromosome III, absence of linear element polymerization, reduced pairing of h...

  4. Observation on Meiosis of Pollen Mother Cells in Apium graveolens%芹菜花粉母细胞减数分裂观察

    Institute of Scientific and Technical Information of China (English)

    赵冬; 张蜀宁; 张宇; 李俊星; 刘惠吉

    2011-01-01

    The flower buds of celery (Apium graveolens ) were used to study the mitosis in pollen mother cells with enzyme - dye -squash technique.The results showed that the pollen mother cells carried on their meiosis and cytokinesis simultaneously and their tetrads were tetrahedral or decussate type; at metaphases Ⅰ and Ⅱ there showed a small number of chromosomes scattered outside their equatorial plate; at anaphases Ⅰ and Ⅱ there appeared chromosome bridges and lagged chromosomes in some pollen mother cells.%以中国芹品种铁杆芹花蕾为材料,采用改良卡宝染色压片法对芹菜花粉母细胞减数分裂进行了细胞学研究.结果表明:花粉母细胞减数分裂为胞质同时型,四分体为正四面体型或十字交叉型,中期Ⅰ和中期Ⅱ细胞可见赤道板外染色体,后期Ⅰ和后期Ⅱ部分细胞出现染色体桥及落后染色体.

  5. Symmetric cell division in pseudohyphae of the yeast Saccharomyces cerevisiae.

    OpenAIRE

    Kron, S J; Styles, C. A.; Fink, G R

    1994-01-01

    Laboratory strains of Saccharomyces cerevisiae are dimorphic; in response to nitrogen starvation they switch from a yeast form (YF) to a filamentous pseudohyphal (PH) form. Time-lapse video microscopy of dividing cells reveals that YF and PH cells differ in their cell cycles and budding polarity. The YF cell cycle is controlled at the G1/S transition by the cell-size checkpoint Start. YF cells divide asymmetrically, producing small daughters from full-sized mothers. As a result, mothers and d...

  6. Cryptococcus friedmannii, a new species of yeast from the Antarctic

    Science.gov (United States)

    Vishniac, H. S.

    1985-01-01

    Cryptococcus friedmannii Vishniac sp. nov. from an Antarctic cryptoendolithic community is a psychrophilic basidioblastomycete characterized by cream-colored colonies of cells with smooth, layered walls, budding monopolarly, producing amylose and extracellular proteinase, utilizing nitrate and D-alanine (inter alia) as nitrogen sources and L-arabinose, arbutin, cellobiose, D-glucuronate, maltose, melezitose, salicin, soluble starch, trehalose, and D-xylose as carbon sources. This species differs from all other basidiomycetous yeasts in possessing the following combination of characters: amylose production (positive), assimilation of cellobiose (positive), D-galactose (negative), myo-inositol (negative), D-mannitol (negative), and sucrose (negative).

  7. Dynamics of Cdc42 network embodies a Turing-type mechanism of yeast cell polarity.

    Science.gov (United States)

    Goryachev, Andrew B; Pokhilko, Alexandra V

    2008-04-30

    Complex biochemical networks can be understood by identifying their principal regulatory motifs and mode of action. We model the early phase of budding yeast cellular polarization and show that the biochemical processes in the presumptive bud site comprise a Turing-type mechanism. The roles of the prototypical activator and substrate are played by GTPase Cdc42 in its active and inactive states, respectively. We demonstrate that the nucleotide cycling of Cdc42 converts cellular energy into a stable cluster of activated Cdc42. This energy drives a continuous membrane-cytoplasmic exchange of the cluster components to counteract diffusive spread of the cluster. This exchange explains why only one bud forms per cell cycle, because the winner-takes-all competition of candidate sites inevitably selects a single site. PMID:18381072

  8. Micropropagation of Helleborus through axillary budding.

    Science.gov (United States)

    Beruto, Margherita; Viglione, Serena; Bisignano, Alessandro

    2013-01-01

    Helleborus genus, belonging to the Ranunculaceae family, has 20 species of herbaceous perennial flowering plants. The commercial exploitation of this plant is dependent on the selection and propagation of appropriate lines. High propagation rate could be accomplished by using a suitable tissue culture method enabling the rapid introduction of valuable selections in the market. However, in vitro cultivation of Helleborus is still very difficult. Thereby the development of reliable in vitro propagation procedures is crucial for future production systems. Axillary buds cultured on agar-solidified Murashige and Skoog medium supplemented with 1 mg/L benzyladenine, 0.1 mg/L β-naphthoxyacetic acid, and 2 mg/L isopentenyl adenine develop shoots after 16 weeks of culture under 16 h light regime, 50-60 μmol/s/m(2), and 19 ± 1°C. The multiplication rate ranges from 1.4 to 2.1. However, the genotype and the number of subcultures affect the efficiency of the micropropagation process. The rooting of shoots is about 80% in solidified MS medium containing 1 mg/L 1-naphthaleneacetic acid and 3 mg/L indole-3-butyric acid. The described protocol provides information which can contribute to the commercial production of Helleborus plants. PMID:23179705

  9. Ubiquitin is part of the retrovirus budding machinery

    Science.gov (United States)

    Patnaik, Akash; Chau, Vincent; Wills, John W.

    2000-11-01

    Retroviruses contain relatively large amounts of ubiquitin, but the significance of this finding has been unknown. Here, we show that drugs that are known to reduce the level of free ubiquitin in the cell dramatically reduced the release of Rous sarcoma virus, an avian retrovirus. This effect was suppressed by overexpressing ubiquitin and also by directly fusing ubiquitin to the C terminus of Gag, the viral protein that directs budding and particle release. The block to budding was found to be at the plasma membrane, and electron microscopy revealed that the reduced level of ubiquitin results in a failure of mature virus particles to separate from each other and from the plasma membrane during budding. These data indicate that ubiquitin is actually part of the budding machinery.

  10. Real Life Science with Dandelions and Project BudBurst

    OpenAIRE

    Johnson, Katherine A.

    2016-01-01

    Project BudBurst is a national citizen-science project that tracks bloom times and other phenological data for plants across the country. Data from Project BudBurst are being used to measure the effects of climate change. Students can participate in this project by watching any of the plants on the list, including the common dandelion, which makes the program easy and accessible to everyone. Journal of Microbiology & Biology Education

  11. Real Life Science with Dandelions and Project BudBurst

    Directory of Open Access Journals (Sweden)

    Katherine A. Johnson

    2015-12-01

    Full Text Available Project BudBurst is a national citizen-science project that tracks bloom times and other phenological data for plants across the country. Data from Project BudBurst are being used to measure the effects of climate change. Students can participate in this project by watching any of the plants on the list, including the common dandelion, which makes the program easy and accessible to everyone.

  12. Real Life Science with Dandelions and Project BudBurst.

    Science.gov (United States)

    Johnson, Katherine A

    2016-03-01

    Project BudBurst is a national citizen-science project that tracks bloom times and other phenological data for plants across the country. Data from Project BudBurst are being used to measure the effects of climate change. Students can participate in this project by watching any of the plants on the list, including the common dandelion, which makes the program easy and accessible to everyone. Journal of Microbiology & Biology Education. PMID:27047605

  13. YALI0E32769g (DGA1) and YALI0E16797g (LRO1) encode major triacylglycerol synthases of the oleaginous yeast Yarrowia lipolytica

    OpenAIRE

    Athenstaedt, Karin

    2011-01-01

    The oleaginous yeast Yarrowia lipolytica has an outstanding capacity to produce and store triacylglycerols resembling adipocytes of higher eukaryotes. Here, the identification of two genes YALI0E32769g (DGA1) and YALI0E16797g (LRO1) encoding major triacylglycerol synthases of Yarrowia lipolytica is reported. Heterologous expression of either DGA1 or LRO1 in a mutant of the budding yeast Saccharomyces cerevisiae defective in triacylglycerol synthesis restores the formation of this neutral lipi...

  14. Download - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available [ Credits ] BLAST Search Image Search Home About Archive Update History Contact us ...Downlaod via FTP Joomla SEF URLs by Artio About This Database Database Description Download License Update History

  15. High-resolution transcription atlas of the mitotic cell cycle in budding yeast

    DEFF Research Database (Denmark)

    Granovskaia, Marina V; Jensen, Lars J; Ritchie, Matthew E;

    2010-01-01

    Extensive transcription of non-coding RNAs has been detected in eukaryotic genomes and is thought to constitute an additional layer in the regulation of gene expression. Despite this role, their transcription through the cell cycle has not been studied; genome-wide approaches have only focused on...

  16. Heterologous Expression in Budding Yeast as a Tool for Studying the Plant Cell Morphogenesis Machinery

    Czech Academy of Sciences Publication Activity Database

    Cvrčková, F.; Hála, Michal

    Vol. 1080. New York : Humana Press, 2014 - (Žárský, V.; Cvrčková, F.), s. 267-282 ISBN 978-1-62703-643-6. - (Methods in Molecular Biology) Institutional support: RVO:61389030 Keywords : Saccharomyces cerevisiae * Heterologous gene expression * Inducible expression system Subject RIV: EB - Genetics ; Molecular Biology

  17. Vps Factors Are Required for Efficient Transcription Elongation in Budding Yeast

    Czech Academy of Sciences Publication Activity Database

    Gaur, N. A.; Hašek, Jiří; Brickner, D. G.; Qiu, H.; Zhang, F.; Wong, Ch.; M.; Malcová, Ivana; Vašicová, Pavla; Brickner, J. H.; Hinnebusch, A. G.

    2013-01-01

    Roč. 193, č. 3 (2013), s. 829-851. ISSN 0016-6731 R&D Projects: GA ČR GAP305/12/0480 Institutional support: RVO:61388971 Keywords : RNA-POLYMERASE-II * SACCHAROMYCES - CEREVISIAE GENOME * ELL-ASSOCIATED PROTEINS Subject RIV: EE - Microbiology, Virology Impact factor: 4.389, year: 2012

  18. Database Description - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available e University of Tokyo(when creating) Creator Name: Takashi Ito* Creator Affiliation: Department of Computati...onal Biology, Graduate School of Frontier Sciences, The University of Tokyo(when creating) Contact address G

  19. License - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available ecified in the Creative Commons Attribution-Share Alike 2.1 Japan . If you use data from this database, plea...i Ito(the University of Tokyo) licensed under CC Attribution-Share Alike 2.1 Japa...n . The summary of the Creative Commons Attribution-Share Alike 2.1 Japan is found here . With regard to thi

  20. Centromere identity is specified by a single centromeric nucleosome in budding yeast

    OpenAIRE

    Furuyama, Suzanne; Biggins, Sue

    2007-01-01

    Chromosome segregation ensures that DNA is equally divided between daughter cells during each round of cell division. The centromere (CEN) is the specific locus on each chromosome that directs formation of the kinetochore, the multiprotein complex that interacts with the spindle microtubules to promote proper chromosomal alignment and segregation during mitosis. CENs are organized into a specialized chromatin structure due to the incorporation of an essential CEN-specific histone H3 variant (...

  1. Buffering the pH of the culture medium does not extend yeast replicative lifespan

    OpenAIRE

    Wasko, Brian M.; Carr, Daniel T; Herman Tung; Ha Doan; Nathan Schurman; Neault, Jillian R; Joey Feng; Janet Lee; Ben Zipkin; Jacob Mouser; Edward Oudanonh; Tina Nguyen; Torin Stetina; Anna Shemorry; Mekedes Lemma

    2013-01-01

    During chronological aging of budding yeast cells, the culture medium can become acidified, and this acidification limits cell survival.  As a consequence, buffering the culture medium to pH 6 significantly extends chronological life span under standard conditions in synthetic medium.  In this study, we assessed whether a similar process occurs during replicative aging of yeast cells.  We find no evidence that buffering the pH of the culture medium to pH levels either higher or lower than the...

  2. Students' Meaningful Learning Orientation and Their Meaningful Understandings of Meiosis and Genetics.

    Science.gov (United States)

    Cavallo, Ann Liberatore

    This 1-week study explored the extent to which high school students (n=140) acquired meaningful understanding of selected biological topics (meiosis and the Punnett square method) and the relationship between these topics. This study: (1) examined "mental modeling" as a technique for measuring students' meaningful understanding of the topics; (2)…

  3. Meiosis Drives Extraordinary Genome Plasticity in the Haploid Fungal Plant Pathogen Mycosphaerella Graminicola

    Science.gov (United States)

    Meiosis in the plant-pathogenic fungus Mycosphaerella graminicola results in eight ascospores due to a mitotic division following the two meiotic divisions. The transient diploid phase allows for recombination among homologous chromosomes. However, some chromosomes of M. graminicola lack homologs an...

  4. TRAIP is involved in chromosome alignment and SAC regulation in mouse oocyte meiosis.

    Science.gov (United States)

    Yuan, Yi-Feng; Ren, Yi-Xin; Yuan, Peng; Yan, Li-Ying; Qiao, Jie

    2016-01-01

    Recent whole-exome sequencing (WES) studies demonstrated that TRAIP is associated with primordial dwarfism. Although TRAIP was partially studied in mitosis, its function in oocyte meiosis remained unknown. In this study, we investigated the roles of TRAIP during mouse oocyte meiosis. TRAIP was stably expressed during oocytes meiosis and co-localized with CREST at the centromere region. Knockdown of TRAIP led to DNA damage, as revealed by the appearance of γH2AX. Although oocytes meiotic maturation was not affected, the proportions of misaligned chromosomes and aneuploidy were elevated after TRAIP knockdown, suggesting TRAIP is required for stable kinetochore-microtubule (K-MT) attachment. TRAIP knockdown decreased the accumulation of Mad2 on centromeres, potentially explaining why oocyte maturation was not affected following formation of DNA lesions. Securin, a protein which was prevent from precocious degradation by Mad2, was down-regulated after TRAIP knockdown. Inhibition of TRAIP by microinjection of antibody into pro-metaphase I (pro-MI) stage oocytes resulted in precocious first polar body (PB1) extrusion, and live-cell imaging clearly revealed misaligned chromosomes after TRAIP knockdown. Taken together, these data indicate that TRAIP plays important roles in oocyte meiosis regulation. PMID:27405720

  5. Dance of the Chromosomes: A Kinetic Learning Approach to Mitosis and Meiosis

    Science.gov (United States)

    Kreiser, Brian; Hairston, Rosalina

    2007-01-01

    Understanding mitosis and meiosis is fundamental to understanding the basics of Mendelian inheritance, yet many students find these concepts challenging or confusing. Here we present a visually and physically stimulating activity using minimal supplies to supplement traditional instruction in order to engage the students and facilitate…

  6. Creating a Double-Spring Model to Teach Chromosome Movement during Mitosis & Meiosis

    Science.gov (United States)

    Luo, Peigao

    2012-01-01

    The comprehension of chromosome movement during mitosis and meiosis is essential for understanding genetic transmission, but students often find this process difficult to grasp in a classroom setting. I propose a "double-spring model" that incorporates a physical demonstration and can be used as a teaching tool to help students understand this…

  7. Silencing of meiosis-critical genes for engineering male sterility in plants

    Science.gov (United States)

    Engineering sterile traits in plants through the tissue-specific expression of a cytotoxic gene provides an effective way for containing transgene flow; however, the microbial origin of cytotoxic genes has raised concerns. In an attempt to develop a safe alternative, we have chosen the meiosis-crit...

  8. Regulation of mitogen-activated protein kinase 3/1 activity during meiosis resumption in mammals

    Czech Academy of Sciences Publication Activity Database

    Procházka, Radek; Blaha, Milan

    2015-01-01

    Roč. 61, č. 6 (2015), s. 495-502. ISSN 0916-8818 R&D Projects: GA MZe(CZ) QJ1510138 Institutional support: RVO:67985904 Keywords : cumulus oocyte complexes * meiosis resumption * mitogen-activated protein kinase 3/1 (MAPK3/1) Subject RIV: GI - Animal Husbandry ; Breeding Impact factor: 1.515, year: 2014

  9. Aurora-A is involved in resumption of meiosis and spindle formation in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Šašková, Adéla; Šolc, Petr; Baran, V.; Kubelka, Michal; Motlík, Jan

    Mělník : ÚŽFG, 2007, s. 8-8. [Conference on Reproductive and Developmental Biology. Praha (CZ), 21.06.2007-22.06.2007] Institutional research plan: CEZ:AV0Z50450515 Keywords : meiosis Subject RIV: EB - Genetics ; Molecular Biology

  10. Aurora-A is involved in resumption of meiosis and spindle formation in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Šašková, Adéla; Šolc, Petr; Baran, V.; Kubelka, Michal; Motlík, Jan

    Brno : -, 2007, s. 4-4. [Cytoskeletální klub /XV./. Vranovská Ves (CZ), 09.05.2007-11.05.2007] Institutional research plan: CEZ:AV0Z50450515 Keywords : meiosis Subject RIV: EB - Genetics ; Molecular Biology

  11. Aurora-A is involved in resumption of meiosis and spindle formation in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Šašková, Adéla; Šolc, Petr; Baran, V.; Kubelka, Michal; Motlík, Jan

    Göttingen : -, 2007, s. 71-71. [Horizons in Molecular Biology International PhD Student Symposium and Career Fair for Scientists /4./. Göttingen (DE), 12.09.2007-15.09.2007] Institutional research plan: CEZ:AV0Z50450515 Keywords : meiosis Subject RIV: EB - Genetics ; Molecular Biology

  12. Homologous recombination, sister chromatid cohesion, and chromosome condensation in mammalian meiosis

    NARCIS (Netherlands)

    Eijpe, M.

    2002-01-01

    In the life cycle of sexually reproducing eukaryotes, haploid and diploid generations of cells alternate. Two types of cell division occur in such a life cycle: mitosis and meiosis. They are compared in chapter 1 . Haploid and diploid cells can multiply by mitoses.

  13. Genome-wide Fitness Profiles Reveal a Requirement for Autophagy During Yeast Fermentation

    OpenAIRE

    Piggott, Nina; Cook, Michael A.; Tyers, Mike; Measday, Vivien

    2011-01-01

    The ability of cells to respond to environmental changes and adapt their metabolism enables cell survival under stressful conditions. The budding yeast Saccharomyces cerevisiae (S. cerevisiae) is particularly well adapted to the harsh conditions of anaerobic wine fermentation. However, S. cerevisiae gene function has not been previously systematically interrogated under conditions of industrial fermentation. We performed a genome-wide study of essential and nonessential S. cerevisiae gene req...

  14. Canonical Modeling of the Multi-Scale Regulation of the Heat Stress Response in Yeast

    OpenAIRE

    Fonseca, Luis L.; Po-Wei Chen; Voit, Eberhard O.

    2012-01-01

    Heat is one of the most fundamental and ancient environmental stresses, and response mechanisms are found in prokaryotes and shared among most eukaryotes. In the budding yeast Saccharomyces cerevisiae, the heat stress response involves coordinated changes at all biological levels, from gene expression to protein and metabolite abundances, and to temporary adjustments in physiology. Due to its integrative multi-level-multi-scale nature, heat adaptation constitutes a complex dynamic process, wh...

  15. Designer Yeasts for the Fermentation Industry of the 21st Century

    OpenAIRE

    Pretorius, Isak S.; du Toit, Maret; van Rensburg, Pierre

    2003-01-01

    The budding yeast, Saccharomyces cerevisiae, has enjoyed a long and distinguished history in the fermention industry. Owing to its efficiency in producing alcohol, S. cerevisiae is, without doubt, the most important commercial microorganism with GRAS (Generally Regarded As Safe) status. By brewing beer and sparkling wine, mankind’s oldest domesticated organism made possible the world’s first biotechnological processes. With the emergence of modern molecular genetics, S. cerevisiae has again b...

  16. Yeast prt1 mutations alter heat-shock gene expression through transcript fragmentation.

    OpenAIRE

    Barnes, C.A.; Singer, R A; Johnston, G C

    1993-01-01

    The inhibition of translation initiation by modification or mutation of initiation factors can lead to disproportionate effects on gene expression. Here we report disproportionate decreases in gene expression in cells with mutated Prt1 activity. The PRT1 gene product of the budding yeast Saccharomyces cerevisiae is necessary for translation initiation and is thought to be a component of initiation factor 3. At a restrictive temperature the prt1-1 mutation, in addition to decreasing global pro...

  17. Live longer on MARS: a yeast paradigm of mitochondrial adaptive ROS signaling in aging

    Directory of Open Access Journals (Sweden)

    Gerald S. Shadel

    2014-04-01

    Full Text Available Adaptive responses to stress, including hormesis, have been implicated in longevity, but their mechanisms and out comes are not fully understood. Here, I briefly summarize a longevity mechanism elucidated in the budding yeast chronological lifespan model by which Mitochondrial Adaptive ROS Signaling (MARS promotes beneficial epigenetic and metabolic remodeling. The potential relevance of MARS to the human disease Ataxia-Telangiectasia and as a potential anti-aging target is discussed.

  18. ARF Is Required for Maintenance of Yeast Golgi and Endosome Structure and Function

    OpenAIRE

    Gaynor, Erin C.; Chen, Chih-Ying; Emr, Scott D.; Graham, Todd R.

    1998-01-01

    ADP ribosylation factor (ARF) is thought to play a critical role in recruiting coatomer (COPI) to Golgi membranes to drive transport vesicle budding. Yeast strains harboring mutant COPI proteins exhibit defects in retrograde Golgi to endoplasmic reticulum protein transport and striking cargo-selective defects in anterograde endoplasmic reticulum to Golgi protein transport. To determine whether arf mutants exhibit similar phenotypes, the anterograde transport kinetics of multiple cargo protein...

  19. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity.

    Science.gov (United States)

    Nabti, Ibtissem; Marangos, Petros; Bormann, Jenny; Kudo, Nobuaki R; Carroll, John

    2014-03-17

    Female meiosis is driven by the activities of two major kinases, cyclin-dependent kinase 1 (Cdk1) and mitogen-activated protein kinase (MAPK). To date, the role of MAPK in control of meiosis is thought to be restricted to maintaining metaphase II arrest through stabilizing Cdk1 activity. In this paper, we find that MAPK and Cdk1 play compensatory roles to suppress the anaphase-promoting complex/cyclosome (APC/C) activity early in prometaphase, thereby allowing accumulation of APC/C substrates essential for meiosis I. Furthermore, inhibition of MAPK around the onset of APC/C activity at the transition from meiosis I to meiosis II led to accelerated completion of meiosis I and an increase in aneuploidy at metaphase II. These effects appear to be mediated via a Cdk1/MAPK-dependent stabilization of the spindle assembly checkpoint, which when inhibited leads to increased APC/C activity. These findings demonstrate new roles for MAPK in the regulation of meiosis in mammalian oocytes. PMID:24637322

  20. The determination of mother cell-specific mating type of switching in yeast by a specific regulator of HO transcription

    OpenAIRE

    Nasmyth, Kim

    1987-01-01

    In haploid homothallic budding yeast, cell division gives rise to a mother cell which proceeds to switch its mating type and a daughter cell (the bud) which does not. Switching is initiated by a specific double strand cleavage of mating type DNA by an endonuclease encoded by the HO gene. Previous data suggest that the pattern of HO transcription is responsible for the mother cell specificity of switching. HO is transcribed transiently, at START, during the cell cycle of mother cells but not a...

  1. Genome-wide identification of pheromone-targeted transcrption in fission yeast

    DEFF Research Database (Denmark)

    Xue-Franzen, Y.; Kjærulff, S.; Holmberg, C.;

    2006-01-01

    Background Fission yeast cells undergo sexual differentiation in response to nitrogen starvation. In this process haploid M and P cells first mate to form diploid zygotes, which then enter meiosis and sporulate. Prior to mating, M and P cells communicate with diffusible mating pheromones...... in the differentiation process. We have mapped Gene Ontology (GO) categories specifically associated with pheromone induction. A direct comparison of the M- and P-factor induced expression pattern allowed us to identify cell-type specific transcripts, including three new M-specific genes and one new P-specific gene...... transcription factor is responsible for the majority of pheromone-induced transcription. Finally, most cell-type specific genes now appear to be identified in fission yeast....

  2. Unidirectional P-body transport during the yeast cell cycle.

    Directory of Open Access Journals (Sweden)

    Cecilia Garmendia-Torres

    Full Text Available P-bodies belong to a large family of RNA granules that are associated with post-transcriptional gene regulation, conserved from yeast to mammals, and influence biological processes ranging from germ cell development to neuronal plasticity. RNA granules can also transport RNAs to specific locations. Germ granules transport maternal RNAs to the embryo, and neuronal granules transport RNAs long distances to the synaptic dendrites. Here we combine microfluidic-based fluorescent microscopy of single cells and automated image analysis to follow p-body dynamics during cell division in yeast. Our results demonstrate that these highly dynamic granules undergo a unidirectional transport from the mother to the daughter cell during mitosis as well as a constrained "hovering" near the bud site half an hour before the bud is observable. Both behaviors are dependent on the Myo4p/She2p RNA transport machinery. Furthermore, single cell analysis of cell size suggests that PBs play an important role in daughter cell growth under nutrient limiting conditions.

  3. On the Causes of the Substitution of Litotes and Meiosis by Understatement%Litotes(反叙)与Meiosis(弱陈)由Understatement(低调陈述)逐渐取代的原因探析

    Institute of Scientific and Technical Information of China (English)

    胡蓉

    2007-01-01

    Litotes(反叙)与Meiosis(弱陈)由Understatement (低调陈述)逐渐取代,在学界已渐成为共识,但我们认为其内在的原因是downtoners (低调词)的特殊性可将litotes(反叙)与meiosis(弱陈)打通或融合,使仅采用一个understatement来统领litotes(反叙)与meiosis(弱陈),以避免歧义和误解成为可能,因为understatement (低调陈述),litotes(反叙),以及meiosis(弱陈)三者均有一个通用的原则,即"含糊或弱化的表述可获得强调的效果".

  4. Electron tomography reveals the steps in filovirus budding.

    Directory of Open Access Journals (Sweden)

    Sonja Welsch

    2010-04-01

    Full Text Available The filoviruses, Marburg and Ebola, are non-segmented negative-strand RNA viruses causing severe hemorrhagic fever with high mortality rates in humans and nonhuman primates. The sequence of events that leads to release of filovirus particles from cells is poorly understood. Two contrasting mechanisms have been proposed, one proceeding via a "submarine-like" budding with the helical nucleocapsid emerging parallel to the plasma membrane, and the other via perpendicular "rocket-like" protrusion. Here we have infected cells with Marburg virus under BSL-4 containment conditions, and reconstructed the sequence of steps in the budding process in three dimensions using electron tomography of plastic-embedded cells. We find that highly infectious filamentous particles are released at early stages in infection. Budding proceeds via lateral association of intracellular nucleocapsid along its whole length with the plasma membrane, followed by rapid envelopment initiated at one end of the nucleocapsid, leading to a protruding intermediate. Scission results in local membrane instability at the rear of the virus. After prolonged infection, increased vesiculation of the plasma membrane correlates with changes in shape and infectivity of released viruses. Our observations demonstrate a cellular determinant of virus shape. They reconcile the contrasting models of filovirus budding and allow us to describe the sequence of events taking place during budding and release of Marburg virus. We propose that this represents a general sequence of events also followed by other filamentous and rod-shaped viruses.

  5. The pat1 protein kinase controls transcription of the mating-type genes in fission yeast

    DEFF Research Database (Denmark)

    Nielsen, O; Egel, R; Nielsen, Olaf

    1990-01-01

    The developmental programme of fission yeast brings about a transition from mitotic cell division to the dormant state of ascospores. In response to nitrogen starvation, two cells of opposite mating type conjugate to form a diploid zygote, which then undergoes meiosis and sporulation. This differ......The developmental programme of fission yeast brings about a transition from mitotic cell division to the dormant state of ascospores. In response to nitrogen starvation, two cells of opposite mating type conjugate to form a diploid zygote, which then undergoes meiosis and sporulation....... This differentiation process is characterized by a transcriptional induction of the mating-type genes. Conjugation can also be induced in pat1-ts mutants by a shift to a semi-permissive temperature. The pat1 gene encodes a protein kinase, which also functions further downstream in the developmental pathway controlling...... gene are defective in this process. In the following step the mat1-Pm gene is expressed in response to a pheromone signal generated by cells of M mating type. Both these controls are derepressed in the pat1-ts mutant at semipermissive temperature. Previous work has established that expression...

  6. Yeast identification in floral nectar of Mimulus aurantiacus (Invited)

    Science.gov (United States)

    Kyauk, C.; Belisle, M.; Fukami, T.

    2009-12-01

    Nectar is such a sugar-rich resource that serves as a natural habitat in which microbes thrive. As a result, yeasts arrive to nectar on the bodies of pollinators such as hummingbirds and bees. Yeasts use the sugar in nectar for their own needs when introduced. This research focuses on the identification of different types of yeast that are found in the nectar of Mimulus aurantiacus (commonly known as sticky monkey-flower). Unopened Mimulus aurantiacus flower buds were tagged at Jasper Ridge and bagged three days later. Floral nectar was then extracted and plated on potato dextrose agar. Colonies on the plates were isolated and DNA was extracted from each sample using QIAGEN DNeasy Plant Mini Kit. The DNA was amplified through PCR and ran through gel electrophoresis. The PCR product was used to clone the nectar samples into an E.coli vector. Finally, a phylogenetic tree was created by BLAST searching sequences in GenBank using the Internal Transcribed Space (ITS) locus. It was found that 18 of the 50 identified species were Candida magnifica, 14 was Candida rancensis, 6 were Crytococcus albidus and there were 3 or less of the following: Starmella bombicola, Candida floricola, Aureobasidium pullulans, Pichia kluyvera, Metschnikowa cibodaserisis, Rhodotorua colostri, and Malassezia globosa. The low diversity of the yeast could have been due to several factors: time of collection, demographics of Jasper Ridge, low variety of pollinators, and sugar concentration of the nectar. The results of this study serve as a necessary first step for a recently started research project on ecological interactions between plants, pollinators, and nectar-living yeast. More generally, this research studies the use of the nectar-living yeast community as a natural microcosm for addressing basic questions about the role of dispersal and competitive and facilitative interactions in ecological succession.

  7. How-to-Do-It: Hands-on Activity for Mitosis, Meiosis and the Fundamentals of Heredity.

    Science.gov (United States)

    Taylor, Mark F.

    1988-01-01

    Described is an exercise which uses inexpensive and easy-to-make materials to demonstrate the basic fundamentals of heredity. Discusses two approaches using a hypothetical insert to demonstrate inheritance, mitosis, meiosis, and genotypic and phenotypic frequencies. (CW)

  8. Effect of space flight on meiosis of pollen mother cells and its derived pollens in impatiens balsamina

    International Nuclear Information System (INIS)

    Effects of space flight on meiosis of pollen mother cells and meiosis of microspores in Impatiens balsamina were investigated. It was found that meiosis showed abnormal in most plants germinated from seeds after space flight, and chromosome fragment, chromosomal bridge and lagging chromosome were observed in the process of meiosis in these plants. Disproportional segregation of chromosome, multipolar division and multinucleus were also observed in most plants, which developed into paraspores with different chromosome number. Mitosis of microspores was found to be abnormal in most plants, and the number of chromosome in microspore unequal. The fertility of the pollens was tested with iodic solution; it was found that the fertility of pollens varied in different plants. (authors)

  9. Cytomixis impairs meiosis and influences reproductive success in Chlorophytum comosum (Thunb) Jacq. – an additional strategy and possible implications

    Indian Academy of Sciences (India)

    S K Lattoo; S Khan; S Bamotra; A K Dhar

    2006-12-01

    Spontaneous intercellular chromatin migration/cytomixis was observed to occur in the pollen mother cells (PMCs) of the Chlorophytum comosum for the first time. The migration through cytomictic channels was more pronounced in meiosis-I and very rare in meiosis-II. The process was associated with erratic meiosis, which was characterized by defects in chromosome organization and segregation. Cytomixis was more intense in the month of April than in July and consequently the frequency of meiotic irregularities was much more pronounced during the month of April. As a consequence of abnormal meiosis, fertility was drastically reduced resulting in meager seed efficiency of 17% only. Recombination system also does not guarantee the release of sufficient variability. We view the phenomenon of cytomixis as genetically controlled mechanism involving meiotic genes and operating through signal transduction pathway triggered by the environmental stimuli. The evolutionary significance and tenable hypothesis in the backdrop of existing literature is also proposed.

  10. Vaginal Yeast Infection

    Science.gov (United States)

    ... Centers for Diseases Control and Prevention. Micrograph showing Candida albicans from a patient with vaginal candidiasis, also known ... caused by an overgrowth of a fungus called Candida albicans in the vagina. Candida is yeast, which is ...

  11. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  12. Optical properties of bud scales and protochlorophyll(ide) forms in leaf primordia of closed and opened buds.

    Science.gov (United States)

    Solymosi, Katalin; Böddi, Béla

    2006-08-01

    The transmission spectra of bud scales of 14 woody species and the 77 K fluorescence emission spectra of the innermost leaf primordia of closed and opened buds of 37 woody species were studied. Pigment concentrations were determined in some species. Bud scales had low transmittance between 400 and 680 nm with a local minimum around 680 nm. Transmittance increased steeply above 680 nm and was > 80% in the 700-800 nm spectral region. Significant protochlorophyllide (Pchlide) accumulation was observed in leaf primordia of tightly packed, closed buds with relatively thick, dark bud scales. In common ash (Fraxinus excelsior L.) and Hungarian ash (Fraxinus angustifolia Vahl.), the innermost leaf primordia of the closed buds contained protochlorophyll (Pchl) and Pchlide (abbreviated as Pchl(ide)), but no chlorophyll. We observed Pchl(ide) forms with emission maxima at 633, 643 and 655 nm in these leaves. Complete transformation of Pchlide(655) (protochlorophyllide form with maximum emission at 655 nm) into Chlide(692) (chlorophyllide form with maximum emission at 692 nm) occurred after irradiation for 10 s. The innermost leaf primordia of the buds of four species (flowering ash (Fraxinus ornus L.), horse chestnut (Aesculus hippocastanum L.), tree of heaven (Ailanthus altissima P. Mill.) and common walnut (Juglans regia L.)) contained Pchl(ide)(633), Pchl(ide)(643) and Pchlide(655) as well as an emission band at 688 nm corresponding to a chlorophyll form. The Pchlide(655) was fully photoactive in these species. The outermost leaf primordia of these four species and the innermost leaf primordia of 28 other species contained all of the above described Pchl(ide) forms in various ratios but in small amounts. In addition, Chl forms were present and the main bands in the fluorescence emission spectra were at 690 or 740 nm, or both. The results indicate that Pchl(ide) accumulation occurs in leaf primordia in near darkness inside the tightly closed buds, where the bud scales and

  13. Respiratory Response of Dormant Nectarine Floral Buds on Chilling Deficiency

    Institute of Scientific and Technical Information of China (English)

    TAN Yue; GAO Dong-sheng; LI Ling; CHEN Xiu-de; XU Ai-hong

    2010-01-01

    Changes in main biochemical respiratory pathways in dormant nectarine floral buds were studied with nectarine trees (Prunus persica.var,nectariana cv.Shuguang) in order to determine the function of respiration in dormancy release.Oxygen-electrode system and respiratory inhibitors were used to measure total respiratory rates and rates of respiratory pathways.Results showed that chilling deficiency blocked the transition of respiratory mode,and made buds stay in a state of high level pentose phosphate pathway (PPP) and low level tricarboxylic acid cycle (TCA).The decline of PPP and activation of TCA occurred synchronously with the release of dormancy.In addition,the inhibition of PPP stimulated a respiration increase related with TCA.It could be concluded that the function of PPP activation in dormancy release might be limited and PPP declination inducing TCA activation might be part of respiration mode transition mechanism during bud sprouting.

  14. Adventitious bud regeneration from the stigma of Sinapis alba L.

    Directory of Open Access Journals (Sweden)

    Elżbieta Zenkteler

    2012-12-01

    Full Text Available Stigmas isolated from flower buds of 'Nakielska' variety of Sinapis alba were used to develop a micropropagation method suitable for breeding of new cultivars. The origin of adventitious bud regeneration was studied on MS medium, under stimulation by bezylaminopurine (BAP in combination with 2,4-D - dichlorophenoxyacetic acid (2,4-D. Histological analysis showed the structure of Sinapis stigma (composed from four types of tissue: papillae, transmitting tissue, parenchyma and vascular bundles and revealed that numerous meristematic centers developed from parenchyma cells in close vicinity of vascular bundles. Buds very quickly appeared on the surface of initial explants and later formed multiplantlets that were easily rooted in the soil.

  15. Mouse HFM1/Mer3 Is Required for Crossover Formation and Complete Synapsis of Homologous Chromosomes during Meiosis

    OpenAIRE

    Guiraldelli, Michel F.; Eyster, Craig; Wilkerson, Joseph L.; Dresser, Michael E.; Pezza, Roberto J.

    2013-01-01

    Faithful chromosome segregation during meiosis requires that homologous chromosomes associate and recombine. Chiasmata, the cytological manifestation of recombination, provide the physical link that holds the homologs together as a pair, facilitating their orientation on the spindle at meiosis I. Formation of most crossover (CO) events requires the assistance of a group of proteins collectively known as ZMM. HFM1/Mer3 is in this group of proteins and is required for normal progression of homo...

  16. Regulation of Heterochromatin Assembly on Unpaired Chromosomes during Caenorhabditis elegans Meiosis by Components of a Small RNA-Mediated Pathway

    OpenAIRE

    Xingyu She; Xia Xu; Alexander Fedotov; Kelly, William G; Maine, Eleanor M.

    2009-01-01

    Many organisms have a mechanism for down regulating the expression of non-synapsed chromosomes and chromosomal regions during meiosis. This phenomenon is thought to function in genome defense. During early meiosis in Caenorhabditis elegans, unpaired chromosomes (e.g., the male X chromosome) become enriched for a modification associated with heterochromatin and transcriptional repression, dimethylation of histone H3 on lysine 9 (H3K9me2). This enrichment requires activity of the cellular RNA-d...

  17. EARLY BUD-BREAK1 (EBB1) defines a conserved mechanism for control of bud-break in woody perennials

    Science.gov (United States)

    Busov, Victor; Carneros, Elena; Yakovlev, Igor

    2016-01-01

    Bud-break is an environmentally and economically important trait in trees, shrubs and vines from temperate latitudes. Poor synchronization of bud-break timing with local climates can lead to frost injuries, susceptibility to pests and pathogens and poor crop yields in fruit trees and vines. The rapid climate changes outpace the adaptive capacities of plants to respond through natural selection. This is particularly true for trees which have long generation cycle and thus the adaptive changes are significantly delayed. Therefore, to devise appropriate breeding and conservation strategies, it is imperative to understand the molecular underpinnings that govern dormancy mechanisms. We have recently identified and characterized the poplar EARLY BUD-BREAK 1 (EBB1) gene. EBB1 is a positive regulator of bud-break and encodes a transcription factor from the AP2/ERF family. Here, using comparative and functional genomics approaches we show that EBB1 function in regulation of bud-break is likely conserved across wide range of woody perennial species with importance to forestry and agriculture. PMID:26317150

  18. Nitrile Metabolizing Yeasts

    Science.gov (United States)

    Bhalla, Tek Chand; Sharma, Monica; Sharma, Nitya Nand

    Nitriles and amides are widely distributed in the biotic and abiotic components of our ecosystem. Nitrile form an important group of organic compounds which find their applications in the synthesis of a large number of compounds used as/in pharmaceutical, cosmetics, plastics, dyes, etc>. Nitriles are mainly hydro-lyzed to corresponding amide/acid in organic chemistry. Industrial and agricultural activities have also lead to release of nitriles and amides into the environment and some of them pose threat to human health. Biocatalysis and biotransformations are increasingly replacing chemical routes of synthesis in organic chemistry as a part of ‘green chemistry’. Nitrile metabolizing organisms or enzymes thus has assumed greater significance in all these years to convert nitriles to amides/ acids. The nitrile metabolizing enzymes are widely present in bacteria, fungi and yeasts. Yeasts metabolize nitriles through nitrilase and/or nitrile hydratase and amidase enzymes. Only few yeasts have been reported to possess aldoxime dehydratase. More than sixty nitrile metabolizing yeast strains have been hither to isolated from cyanide treatment bioreactor, fermented foods and soil. Most of the yeasts contain nitrile hydratase-amidase system for metabolizing nitriles. Transformations of nitriles to amides/acids have been carried out with free and immobilized yeast cells. The nitrilases of Torulopsis candida>and Exophiala oligosperma>R1 are enantioselec-tive and regiospecific respectively. Geotrichum>sp. JR1 grows in the presence of 2M acetonitrile and may have potential for application in bioremediation of nitrile contaminated soil/water. The nitrilase of E. oligosperma>R1 being active at low pH (3-6) has shown promise for the hydroxy acids. Immobilized yeast cells hydrolyze some additional nitriles in comparison to free cells. It is expected that more focus in future will be on purification, characterization, cloning, expression and immobilization of nitrile metabolizing

  19. 卷丹小孢子母细胞减数分裂染色体行为的研究%Chromosom Behavior of Pollen Mother Cell in Meiosis Process for Lilium lancifolium

    Institute of Scientific and Technical Information of China (English)

    刘晓丽; 贾桂霞

    2013-01-01

    对引种于陕西汉中地区的三倍体卷丹的小孢子母细胞减数分裂进程、花粉生活力和可育性进行了分析.结果显示:减数分裂时期与花蕾、花药长度及花药壁颜色呈现出一定的相关性,处于减数分裂时期的卷丹花蕾长度在2.5 ~3.2 cm之间,花药长度在1.4~1.8 cm之间;从细线期到成熟花粉粒,花药壁的颜色呈现出淡绿色-淡黄绿色-黄绿色-橘黄色的变化趋势,花药内容物颜色也从透明逐渐变为粘稠的橘红色.减数分裂终变期染色体构型以三价体为主,平均构型为:11.6Ⅲ+2Ⅱ+1.1Ⅰ,可判断该种源地卷丹为同源三倍体.减数分裂中出现染色体不均等分裂、染色体落后、染色体桥及微核现象,同时观察到成熟花粉粒大小差异较大,极轴与赤道轴秉积在839.465 ~3327.907μm2范围内,趋于正态分布,为三倍体卷丹花粉的高度不育提供了细胞学证据.以卷丹为母本与大花卷丹进行杂交,得到一定数量的种子,其中有胚率达到了43.0%,成苗率为67.4%,说明三倍体卷丹在百合育种中具有一定的价值.%The meiosis process of pollen mother cell, the pollen grains vitality of Lilium lancifolium from Hanzhong district,Shanxi province,was observed. The results showed that the length of buds and anthers, and the color of the anther wall were related to the stage of the meiosis process. The length of buds and anther which were in the meiosis process were between 2. 5 and 3.2 cm /1.4 and 1.8 cm,respectively. The main chromosome configurations were trivalent in diakinesis stage, and the average configuration was 11.6Ⅲ+2Ⅱ+1.1Ⅰ , which showed that the L. lancifolium was used in this experiment was autotriploid. The asymmetric division, chromosome lag, chromosome bridge, and micronucleus were present in distinct meiosis stages, which provided the cytological evidence for the low fertility of pollen grain. The prospect of application of tripolid L. lancifolium

  20. Mitofusin 2 regulates the oocytes development and quality by modulating meiosis and mitochondrial function.

    Science.gov (United States)

    Liu, Qun; Kang, Lina; Wang, Lingjuan; Zhang, Ling; Xiang, Wenpei

    2016-01-01

    Mitofusin-2 (Mfn2), one of the mitochondrial dynamic proteins plays a key role in maintaining the integrity of mitochondrial morphology and function. However, it is unknown if Mfn2 influences the quality of oocytes in the process of development by modulating mitochondrial function in vitro. In this study, immature oocytes were transfected with Mfn2-siRNA for 16 h. We found that the expression level of the Mfn2 gene was significantly lower than those of the control group. The rates of maturation and fertility were also found to have declined. Moreover, mitochondrial structure and function, especially the morphogenesis of spindles, were observed as abnormal during meiosis. Thus, the above findings indicate that down-regulation of Mfn2 may have an impact on the maturation and fertilization of immature oocytes in vitro by modulating meiosis and mitochondrial function. PMID:27469431

  1. Meiosis observation of the sterile mutant after injection of exogenous DNA into wheat

    International Nuclear Information System (INIS)

    A male sterile mutant was obtained after injection of exogenous λ DNA into wheat line 814527. Meiosis of pollen mother cells (PMC) of the mutant and its receptor (line 814527) were observed. The results showed that the frequency of chromosomal variation of the sterile line was 18%, and that of the receptor was 0.8%. The main types of variation included univalent, chromosome lagging, chromosome fragment, chromosome bridge, micronucleus, abnormal ditrad and tetrad. The fragment of DNA injected into the receptor may influence the normal genetic process of chromosomes in pollen mother cells, and this may cause variations of chromosomes. The chromosome variation in meiosis may cause a part of pollen mother cells to abort, but it is not the main cause of abortion

  2. A few of our favorite things: Pairing, the bouquet, crossover interference and evolution of meiosis.

    Science.gov (United States)

    Zickler, Denise; Kleckner, Nancy

    2016-06-01

    Meiosis presents many important mysteries that await elucidation. Here we discuss two such aspects. First, we consider how the current meiotic program might have evolved. We emphasize the central feature of this program: how homologous chromosomes find one another ("pair") so as to create the connections required for their regular segregation at Meiosis I. Points of emphasis include the facts that: (i) the classical "bouquet stage" is not required for initial homolog contacts in the current evolved meiotic program; and (ii) diverse observations point to commonality between molecules that mediate meiotic inter-homolog interactions and molecules that are integral to centromeres and/or to microtubule organizing centers (a.k.a. spindle pole bodies or centrosomes). Second, we provide an overview of the classical phenomenon of crossover (CO) interference in an effort to bridge the gap between description on the one hand versus logic and mechanism on the other. PMID:26927691

  3. Hydra meiosis reveals unexpected conservation of structural synaptonemal complex proteins across metazoans

    Science.gov (United States)

    Fraune, Johanna; Alsheimer, Manfred; Volff, Jean-Nicolas; Busch, Karoline; Fraune, Sebastian; Bosch, Thomas C. G.; Benavente, Ricardo

    2012-01-01

    The synaptonemal complex (SC) is a key structure of meiosis, mediating the stable pairing (synapsis) of homologous chromosomes during prophase I. Its remarkable tripartite structure is evolutionarily well conserved and can be found in almost all sexually reproducing organisms. However, comparison of the different SC protein components in the common meiosis model organisms Saccharomyces cerevisiae, Arabidopsis thaliana, Caenorhabditis elegans, Drosophila melanogaster, and Mus musculus revealed no sequence homology. This discrepancy challenged the hypothesis that the SC arose only once in evolution. To pursue this matter we focused on the evolution of SYCP1 and SYCP3, the two major structural SC proteins of mammals. Remarkably, our comparative bioinformatic and expression studies revealed that SYCP1 and SYCP3 are also components of the SC in the basal metazoan Hydra. In contrast to previous assumptions, we therefore conclude that SYCP1 and SYCP3 form monophyletic groups of orthologous proteins across metazoans. PMID:23012415

  4. Mitofusin 2 regulates the oocytes development and quality by modulating meiosis and mitochondrial function

    Science.gov (United States)

    Liu, Qun; Kang, Lina; Wang, Lingjuan; Zhang, Ling; Xiang, Wenpei

    2016-01-01

    Mitofusin-2 (Mfn2), one of the mitochondrial dynamic proteins plays a key role in maintaining the integrity of mitochondrial morphology and function. However, it is unknown if Mfn2 influences the quality of oocytes in the process of development by modulating mitochondrial function in vitro. In this study, immature oocytes were transfected with Mfn2-siRNA for 16 h. We found that the expression level of the Mfn2 gene was significantly lower than those of the control group. The rates of maturation and fertility were also found to have declined. Moreover, mitochondrial structure and function, especially the morphogenesis of spindles, were observed as abnormal during meiosis. Thus, the above findings indicate that down-regulation of Mfn2 may have an impact on the maturation and fertilization of immature oocytes in vitro by modulating meiosis and mitochondrial function. PMID:27469431

  5. GABA, its receptors, and GABAergic inhibition in mouse taste buds

    OpenAIRE

    Dvoryanchikov, Gennady; Huang, Yijen A.; Barro-Soria, Rene; Chaudhari, Nirupa; Roper, Stephen D.

    2011-01-01

    Taste buds consist of at least three principal cell types that have different functions in processing gustatory signals — glial-like Type I cells, Receptor (Type II) cells, and Presynaptic (Type III) cells. Using a combination of Ca2+ imaging, single cell RT-PCR, and immunostaining, we show that γ-amino butyric acid (GABA) is an inhibitory transmitter in mouse taste buds, acting on GABA-A and GABA-B receptors to suppress transmitter (ATP) secretion from Receptor cells during taste stimulation...

  6. Project BudBurst: People, Plants, and Climate Change

    Science.gov (United States)

    Henderson, S.; Ward, D.; Havens, K.; Gardiner, L. S.; Alaback, P.

    2010-12-01

    Providing opportunities for individuals to contribute to a better understanding of climate change is the hallmark of Project BudBurst (www.budburst.org). This highly successful, national citizen science program, now in its third year, is bringing climate change education outreach to thousands of individuals. Project BudBurst is a national citizen science initiative designed to engage the public in observations of phenological (plant life cycle) events that raise awareness of climate change, and create a cadre of informed citizen scientists. Citizen science programs such as Project BudBurst provide the opportunity for students and interested laypersons to actively participate in scientific research. Such programs are important not only from an educational perspective, but because they also enable scientists to broaden the geographic and temporal scale of their observations. The goals of Project BudBurst are to 1) increase awareness of phenology as an area of scientific study; 2) Increase awareness of the impacts of changing climates on plants; and 3) increase science literacy by engaging participants in the scientific process. From its 2008 launch in February, this on-line educational and data-entry program, engaged participants of all ages and walks of life in recording the timing of the leafing and flowering of wild and cultivated species found across the continent. Thus far, thousands of participants from all 50 states have submitted data. Project BudBurst has been the subject of almost 200 media outlets including NPR, national and regional television broadcasts, and most of the major national and regional newspapers. This presentation will provide an overview of Project BudBurst and will report on the results of the 2009 field campaign and discuss plans to expand Project BudBurst in 2010 including the use of mobile phones applications for data collection and reporting from the field. Project BudBurst co managed by the National Ecological Observatory Network and

  7. Fission yeast Scm3: A CENP-A receptor required for integrity of subkinetochore chromatin.

    Science.gov (United States)

    Pidoux, Alison L; Choi, Eun Shik; Abbott, Johanna K R; Liu, Xingkun; Kagansky, Alexander; Castillo, Araceli G; Hamilton, Georgina L; Richardson, William; Rappsilber, Juri; He, Xiangwei; Allshire, Robin C

    2009-02-13

    The mechanisms ensuring specific incorporation of CENP-A at centromeres are poorly understood. Mis16 and Mis18 are required for CENP-A localization at centromeres and form a complex that is conserved from fission yeast to human. Fission yeast sim1 mutants that alleviate kinetochore domain silencing are defective in Scm3(Sp), the ortholog of budding yeast Scm3(Sc). Scm3(Sp) depends on Mis16/18 for its centromere localization and like them is recruited to centromeres in late anaphase. Importantly, Scm3(Sp) coaffinity purifies with CENP-A(Cnp1) and associates with CENP-A(Cnp1) in vitro, yet localizes independently of intact CENP-A(Cnp1) chromatin and is differentially released from chromatin. While Scm3(Sc) has been proposed to form a unique hexameric nucleosome with CENP-A(Cse4) and histone H4 at budding yeast point centromeres, we favor a model in which Scm3(Sp) acts as a CENP-A(Cnp1) receptor/assembly factor, cooperating with Mis16 and Mis18 to receive CENP-A(Cnp1) from the Sim3 escort and mediate assembly of CENP-A(Cnp1) into subkinetochore chromatin. PMID:19217404

  8. PGRMC1 participates in late events of bovine granulosa cells mitosis and oocyte meiosis.

    Science.gov (United States)

    Terzaghi, L; Tessaro, I; Raucci, F; Merico, V; Mazzini, G; Garagna, S; Zuccotti, M; Franciosi, F; Lodde, V

    2016-08-01

    Progesterone Receptor Membrane Component 1 (PGRMC1) is expressed in both oocyte and ovarian somatic cells, where it is found in multiple cellular sub-compartments including the mitotic spindle apparatus. PGRMC1 localization in the maturing bovine oocytes mirrors its localization in mitotic cells, suggesting a possible common action in mitosis and meiosis. To test the hypothesis that altering PGRMC1 activity leads to similar defects in mitosis and meiosis, PGRMC1 function was perturbed in cultured bovine granulosa cells (bGC) and maturing oocytes and the effect on mitotic and meiotic progression assessed. RNA interference-mediated PGRMC1 silencing in bGC significantly reduced cell proliferation, with a concomitant increase in the percentage of cells arrested at G2/M phase, which is consistent with an arrested or prolonged M-phase. This observation was confirmed by time-lapse imaging that revealed defects in late karyokinesis. In agreement with a role during late mitotic events, a direct interaction between PGRMC1 and Aurora Kinase B (AURKB) was observed in the central spindle at of dividing cells. Similarly, treatment with the PGRMC1 inhibitor AG205 or PGRMC1 silencing in the oocyte impaired completion of meiosis I. Specifically the ability of the oocyte to extrude the first polar body was significantly impaired while meiotic figures aberration and chromatin scattering within the ooplasm increased. Finally, analysis of PGRMC1 and AURKB localization in AG205-treated oocytes confirmed an altered localization of both proteins when meiotic errors occur. The present findings demonstrate that PGRMC1 participates in late events of both mammalian mitosis and oocyte meiosis, consistent with PGRMC1's localization at the mid-zone and mid-body of the mitotic and meiotic spindle. PMID:27260975

  9. Microtubule Flux Mediates Poleward Motion of Acentric Chromosome Fragments during Meiosis in Insect SpermatocytesV⃞

    OpenAIRE

    LaFountain, James R.; Oldenbourg, Rudolf; Cole, Richard W.; Rieder, Conly L

    2001-01-01

    We applied a combination of laser microsurgery and quantitative polarization microscopy to study kinetochore-independent forces that act on chromosome arms during meiosis in crane fly spermatocytes. When chromosome arms located within one of the half-spindles during prometa- or metaphase were cut with the laser, the acentric fragments (lacking kinetochores) that were generated moved poleward with velocities similar to those of anaphase chromosomes (∼0.5 μm/min). To determine the mechanism und...

  10. Evidence that masking of synapsis imperfections counterbalances quality control to promote efficient meiosis.

    Directory of Open Access Journals (Sweden)

    Susanna Mlynarczyk-Evans

    Full Text Available Reduction in ploidy to generate haploid gametes during sexual reproduction is accomplished by the specialized cell division program of meiosis. Pairing between homologous chromosomes and assembly of the synaptonemal complex at their interface (synapsis represent intermediate steps in the meiotic program that are essential to form crossover recombination-based linkages between homologs, which in turn enable segregation of the homologs to opposite poles at the meiosis I division. Here, we challenge the mechanisms of pairing and synapsis during C. elegans meiosis by disrupting the normal 1:1 correspondence between homologs through karyotype manipulation. Using a combination of cytological tools, including S-phase labeling to specifically identify X chromosome territories in highly synchronous cohorts of nuclei and 3D rendering to visualize meiotic chromosome structures and organization, our analysis of trisomic (triplo-X and polyploid meiosis provides insight into the principles governing pairing and synapsis and how the meiotic program is "wired" to maximize successful sexual reproduction. We show that chromosomes sort into homologous groups regardless of chromosome number, then preferentially achieve pairwise synapsis during a period of active chromosome mobilization. Further, comparisons of synapsis configurations in triplo-X germ cells that are proficient or defective for initiating recombination suggest a role for recombination in restricting chromosomal interactions to a pairwise state. Increased numbers of homologs prolong markers of the chromosome mobilization phase and/or boost germline apoptosis, consistent with triggering quality control mechanisms that promote resolution of synapsis problems and/or cull meiocytes containing synapsis defects. However, we also uncover evidence for the existence of mechanisms that "mask" defects, thus allowing resumption of prophase progression and survival of germ cells despite some asynapsis. We propose

  11. RNA synthesis during meiosis and spermiogenesis in Tylototriton verrucosus anderson - an annual testicular cycle

    International Nuclear Information System (INIS)

    RNA synthetic activity during various stages of meiosis and spermiogenesis in Tylotatriton verrucosus has been studied throughout the testicular cycle by autoradiographic technique. Meiocytes are 'hot' during breeding months while spermatids as well as spermatozoa has shown RNA synthetic activity during breeding and non breeding months. Continuation of RNA synthetic activity in spermatozoa suggests continued transcription necessary for sperm preservation of this seasonal breeder. (author). 8 refs., 1 tab

  12. Proteasomal degradation of ubiquitinated proteins in oocyte meiosis and fertilization in mammals

    Czech Academy of Sciences Publication Activity Database

    Karabínová, Pavla; Kubelka, Michal; Šušor, Andrej

    2011-01-01

    Roč. 346, č. 1 (2011), s. 1-9. ISSN 0302-766X R&D Projects: GA ČR GAP502/10/0944; GA ČR(CZ) GD204/09/H084 Institutional research plan: CEZ:AV0Z50450515 Keywords : Oocyte * Proteasome * Meiosis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.114, year: 2011

  13. Ruffed grouse feeding behavior and its relationship to secondary metabolites of quaking aspen flower buds.

    Science.gov (United States)

    Jakubas, W J; Gullion, G W; Clausen, T P

    1989-06-01

    Quaking aspen (Populus tremuloides Michx.) staminate flower buds and the extended catkins are primary food resources for ruffed grouse (Bonasa umbellus). Winter feeding observations indicate that ruffed grouse select specific trees or clones of quaking aspen to feed in. Flower buds and catkins of quaking aspen were analyzed for secondary compounds (tannins, alkaloids, and phenolics) that might cause ruffed grouse to avoid trees with high levels of these compounds. Coniferyl benzoate, a compound that has not been previously found in quaking aspen, exists in significantly higher concentrations in buds from trees with no feeding history as compared to ruffed grouse feeding trees. Aspen catkins were also significantly lower in coniferyl benzoate than buds from the same tree. Ruffed grouse feeding preference was not related to the tannin or total phenolic levels found in buds or catkins. Buds from feeding trees had higher protein levels than trees with no feeding history; however, catkins did not differ from buds in protein concentration. The high use of extended catkins in the spring by ruffed grouse is probably due to a lower percentage of bud scale material in the catkin as opposed to the dormant bud. Bud scales contain almost all of the nontannin phenolics in catkins and dormant buds. A feeding strategy where bud scales are avoided may exist for other bird species that feed on quaking aspen. Dormant flower buds are significantly lower in protein-precipitable tannins than catkins and differ in secondary metabolite composition from other aspen foliage. PMID:24272191

  14. Chromosome complement and meiosis of Holmbergiana weyenberghii (Opiliones: Sclerosomatidae: Gagrellinae from Argentina Complemento cromosómico y meiosis de Holmbergiana weyenberghii (Opiliones: Sclerosomatidae: Gagrellinae de Argentina

    Directory of Open Access Journals (Sweden)

    Sergio G. Rodríguez Gil

    2010-12-01

    Full Text Available The cytogenetical analysis of the harvestman Holmbergiana weyenberghii (Holmberg (Eupnoi, Sclerosomatidae, Gagrellinae from Argentina is reported for the first time. The complement of males is composed of 18 chromosomes. In meiosis there are nine homomorphic bivalents: one large, five medium-sized and three small. The chromosome number of H. weyenberghii is within the range of diploid numbers of the subfamily Gagrellinae Thorell, which shows the lowest chromosome numbers among the sclerosomatids.Se analiza citogenéticamente, por primera vez, una especie de opilión proveniente de Argentina: Holmbergiana weyenberghii (Holmberg (Eupnoi, Sclerosomatidae, Gagrellinae. Los machos tienen un complemento cromosómico compuesto por 18 cromosomas. En meiosis, hay nueve bivalentes homomórficos: uno mayor, cinco medianos y tres menores. El número cromosómico de H. weyenberghii se encuentra dentro del rango de números diploides de los Gagrellinae Thorell; esta subfamilia presenta los números cromosómicos más bajos de Sclerosomatidae.

  15. PP2A regulates kinetochore-microtubule attachment during meiosis I in oocyte.

    Science.gov (United States)

    Tang, An; Shi, Peiliang; Song, Anying; Zou, Dayuan; Zhou, Yue; Gu, Pengyu; Huang, Zan; Wang, Qinghua; Lin, Zhaoyu; Gao, Xiang

    2016-06-01

    Studies using in vitro cultured oocytes have indicated that the protein phosphatase 2A (PP2A), a major serine/threonine protein phosphatase, participates in multiple steps of meiosis. Details of oocyte maturation regulation by PP2A remain unclear and an in vivo model can provide more convincing information. Here, we inactivated PP2A by mutating genes encoding for its catalytic subunits (PP2Acs) in mouse oocytes. We found that eliminating both PP2Acs caused female infertility. Oocytes lacking PP2Acs failed to complete 1(st) meiotic division due to chromosome misalignment and abnormal spindle assembly. In mitosis, PP2A counteracts Aurora kinase B/C (AurkB/C) to facilitate correct kinetochore-microtubule (KT-MT) attachment. In meiosis I in oocyte, we found that PP2Ac deficiency destabilized KT-MT attachments. Chemical inhibition of AurkB/C in PP2Ac-null oocytes partly restored the formation of lateral/merotelic KT-MT attachments but not correct KT-MT attachments. Taken together, our findings demonstrate that PP2Acs are essential for chromosome alignments and regulate the formation of correct KT-MT attachments in meiosis I in oocytes. PMID:27096707

  16. The effects of proteasome inhibitor lactacystin on mouse oocyte meiosis and first cleavage

    Institute of Scientific and Technical Information of China (English)

    TAN; Xin; PENG; An; WANG; Yongchao; TANG; Zuoqing

    2005-01-01

    In order to study the effects of ubiquitin-proteasome pathway (UPP) on mouse oocyte meiosis and cleavage, oocytes undergoing maturation and parthenogenetic activation and 1-cell embryos were treated with lactacystin, a specific inhibitor of proteasome. The results indicared that the rate of GVBD was not influenced by the treatment, but polar body extrusion, parthenogenesis and first cleavage were inhibited. Immunofluorescent staining using anti β-tubulin antibody indicated that the continuous treatment of lactacystin from GV stage disorganized microtubules and spindle assembly. When metaphase stage oocytes were treated with the drug,the already formed spindle structure was not affected, but the oocytes were arrested at metaphases. The 1-cell embryos were arrested at interphase or metaphase of first mitosis when they were incubated in the drug. Proteasome regulatory subunit PA700 was located in the spindle region, as indicated by immunofluorescence. These results suggest that UPP has effects on the process of oocyte meiosis and early cleavage in many aspects, including normal organization of spindle at prophase and segregation of chromosomes at anaphase for normal meiosis.

  17. Arabidopsis thaliana WAPL is essential for the prophase removal of cohesin during meiosis.

    Directory of Open Access Journals (Sweden)

    Kuntal De

    2014-07-01

    Full Text Available Sister chromatid cohesion, which is mediated by the cohesin complex, is essential for the proper segregation of chromosomes in mitosis and meiosis. The establishment of stable sister chromatid cohesion occurs during DNA replication and involves acetylation of the complex by the acetyltransferase CTF7. In higher eukaryotes, the majority of cohesin complexes are removed from chromosomes during prophase. Studies in fly and human have shown that this process involves the WAPL mediated opening of the cohesin ring at the junction between the SMC3 ATPase domain and the N-terminal domain of cohesin's α-kleisin subunit. We report here the isolation and detailed characterization of WAPL in Arabidopsis thaliana. We show that Arabidopsis contains two WAPL genes, which share overlapping functions. Plants in which both WAPL genes contain T-DNA insertions show relatively normal growth and development but exhibit a significant reduction in male and female fertility. The removal of cohesin from chromosomes during meiotic prophase is blocked in Atwapl mutants resulting in chromosome bridges, broken chromosomes and uneven chromosome segregation. In contrast, while subtle mitotic alterations are observed in some somatic cells, cohesin complexes appear to be removed normally. Finally, we show that mutations in AtWAPL suppress the lethality associated with inactivation of AtCTF7. Taken together our results demonstrate that WAPL plays a critical role in meiosis and raises the possibility that mechanisms involved in the prophase removal of cohesin may vary between mitosis and meiosis in plants.

  18. Mouse Tafazzin Is Required for Male Germ Cell Meiosis and Spermatogenesis.

    Science.gov (United States)

    Cadalbert, Laurence C; Ghaffar, Farah Naz; Stevenson, David; Bryson, Sheila; Vaz, Frédéric M; Gottlieb, Eyal; Strathdee, Douglas

    2015-01-01

    Barth syndrome is an X-linked mitochondrial disease, symptoms of which include neutropenia and cardiac myopathy. These symptoms are the most significant clinical consequences of a disease, which is increasingly recognised to have a variable presentation. Mutation in the Taz gene in Xq28 is thought to be responsible for the condition, by altering mitochondrial lipid content and mitochondrial function. Male chimeras carrying a targeted mutation of Taz on their X-chromosome were infertile. Testes from the Taz knockout chimeras were smaller than their control counterparts and this was associated with a disruption of the progression of spermatocytes through meiosis to spermiogenesis. Taz knockout ES cells also showed a defect when differentiated to germ cells in vitro. Mutant spermatocytes failed to progress past the pachytene stage of meiosis and had higher levels of DNA double strand damage and increased levels of endogenous retrotransposon activity. Altogether these data revealed a novel role for Taz in helping to maintain genome integrity in meiosis and facilitating germ cell differentiation. We have unravelled a novel function for the Taz protein, which should contribute to an understanding of how a disruption of the Taz gene results in the complex symptoms underlying Barth Syndrome. PMID:26114544

  19. Yeast Interacting Proteins Database: YLR423C, YMR124W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available phery, cytoplasm, bud, and bud neck; interacts with Crm1p in two-hybrid assay; YMR124W is not an essential g...fusion protein localizes to the cell periphery, cytoplasm, bud, and bud neck; interacts with Crm1p in two-hybrid assay

  20. Yeast Interacting Proteins Database: YGR218W, YMR124W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available ry, cytoplasm, bud, and bud neck; interacts with Crm1p in two-hybrid assay; YMR12...bud, and bud neck; interacts with Crm1p in two-hybrid assay; YMR124W is not an essential gene Rows with this

  1. Dissecting the fission yeast regulatory network reveals phase-specific control elements of its cell cycle

    Directory of Open Access Journals (Sweden)

    Liu Liwen

    2009-09-01

    Full Text Available Abstract Background Fission yeast Schizosaccharomyces pombe and budding yeast Saccharomyces cerevisiae are among the original model organisms in the study of the cell-division cycle. Unlike budding yeast, no large-scale regulatory network has been constructed for fission yeast. It has only been partially characterized. As a result, important regulatory cascades in budding yeast have no known or complete counterpart in fission yeast. Results By integrating genome-wide data from multiple time course cell cycle microarray experiments we reconstructed a gene regulatory network. Based on the network, we discovered in addition to previously known regulatory hubs in M phase, a new putative regulatory hub in the form of the HMG box transcription factor SPBC19G7.04. Further, we inferred periodic activities of several less known transcription factors over the course of the cell cycle, identified over 500 putative regulatory targets and detected many new phase-specific and conserved cis-regulatory motifs. In particular, we show that SPBC19G7.04 has highly significant periodic activity that peaks in early M phase, which is coordinated with the late G2 activity of the forkhead transcription factor fkh2. Finally, using an enhanced Bayesian algorithm to co-cluster the expression data, we obtained 31 clusters of co-regulated genes 1 which constitute regulatory modules from different phases of the cell cycle, 2 whose phase order is coherent across the 10 time course experiments, and 3 which lead to identification of phase-specific control elements at both the transcriptional and post-transcriptional levels in S. pombe. In particular, the ribosome biogenesis clusters expressed in G2 phase reveal new, highly conserved RNA motifs. Conclusion Using a systems-level analysis of the phase-specific nature of the S. pombe cell cycle gene regulation, we have provided new testable evidence for post-transcriptional regulation in the G2 phase of the fission yeast cell cycle

  2. RESEARCH OF SOPHORA JAPONICA L. FLOWER BUDS VOLATILE COMPOUNDS WITH GAS-CHROMATOGRAPHY/MASS- SPECTROMETRY METHOD

    Directory of Open Access Journals (Sweden)

    Cholak I.S.

    2013-10-01

    Full Text Available This work represents the results of the research ofessential oil contained in Sophora japonica L. flowerbuds volatile compounds collected during the nextstages of their development: green flower buds, formedflower buds and the beginning of flower buds opening.Essential oil assay content in Sophora japonica L.flower buds was determined with hydrodistillationmethod. Content of essential oil in the raw material isless than 0,1%. Qualitative composition and assaycontent of Sophora japonica L. flower buds essential oilconstituents were determined with chromato-massspectrometry method. In consequence of the research 80constituents were identified in Sophora japonica L.flower buds out of which 61 substances are during thegreen flower buds and beginning of flower budsopening stages, 66 substances are during formed flowerbuds stage. Substances are represented by aliphatic andcyclic terpenoids, their alcohols and ketones. Mostvolatile substances were extracted on the stage offormed buds.

  3. Effect of gamma irradiated parenchyma on the growth of irradiated potato tuber buds

    International Nuclear Information System (INIS)

    The development of buds greffed on irradiated potato parenchyma was studied. The irradiated parenchyma does not influence the sprouting capacity of buds, but it affects the way they develop. (Author) 9 refs

  4. A comprehensive web resource on RNA helicases from the baker's yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Linder, P; Gasteiger, E; Bairoch, A

    2000-04-01

    Members of the RNA helicase protein family are defined by several motifs that have been widely conserved during evolution. They are found in all organisms-from bacteria to humans-and many viruses. The minimum number of RNA helicases present within a eukaryotic cell can be predicted from the complete sequence of the Saccharomyces cerevisiae genome. Recent progress in the functional analysis of various family members has confirmed the significance of RNA helicases for most cellular RNA metabolic processes. We have assembled a web resource that focuses on RNA helicases from the budding yeast Saccharomyces cerevisiae. It includes descriptions of RNA helicases and their functions, links to sequence- and yeast-specific databases, an extensive list of references, and links to non-yeast helicase web resources. PMID:10790687

  5. Extending the dormant bud cryopreservation method to new tree species

    Science.gov (United States)

    In cryopreservation of germplasm, using dormant winter buds (DB) as source plant material is economically favorable over tissue culture options. Although the DB cryopreservation method has been known for many years, the approach is feasible only for cryopreserving a select number of temperate tree s...

  6. Contribution of the tooth bud mesenchyme to alveolar bone

    Czech Academy of Sciences Publication Activity Database

    Diep, L.; Matalová, Eva; Mitsiadis, T. A.; Tucker, A. S.

    312B, č. 5 (2009), 510-517. ISSN 1552-5007 R&D Projects: GA ČR GC524/08/J032; GA AV ČR KJB500450802 Institutional research plan: CEZ:AV0Z50450515 Keywords : tooth * alveolar bone * bud Subject RIV: FF - HEENT, Dentistry Impact factor: 2.938, year: 2009

  7. Detection of γ-irradiation induced DNA damage and radioprotection of compounds in yeast using comet assay

    International Nuclear Information System (INIS)

    The single cell gel electrophoresis assay (SCGE), a very rapid and sensitive method, has been applied to follow γ-irradiation induced DNA damage in budding yeast, Saccharomyces cerevisiae. Spheroplasting the γ-irradiated yeast cells by enzyme glusulase, before subjecting them to electrophoresis, resulted in a well-defined appearance of comets. Yeast comets look quite different from mammalian comets. A linear relationship was observed between the doses of irradiation and the tail moments of comets. These studies were extended to follow the action of known radio-protectors, i.e., caffeine and disulfiram. The results revealed the usefulness SCGE as applied to yeast in studies of the γ-irradiation-induced DNA breaks and also radio-protection by chemicals at doses that are not feasible with other eukaryotes. (author)

  8. Project BudBurst: Citizen Science for All Seasons

    Science.gov (United States)

    Meymaris, K.; Henderson, S.; Alaback, P.; Havens, K.

    2008-12-01

    Providing opportunities for individuals to contribute to a better understanding of climate change is the hallmark of Project BudBurst (www.budburst.org). This highly successful, national citizen science program, now in its second year, is bringing climate change education outreach to thousands of individuals. Project BudBurst is a national citizen science initiative designed to engage the public in observations of phenological (plant life cycle) events that raise awareness of climate change, and create a cadre of informed citizen scientists. Citizen science programs such as Project BudBurst provide the opportunity for students and interested laypersons to actively participate in scientific research. Such programs are important not only from an educational perspective, but because they also enable scientists to broaden the geographic and temporal scale of their observations. The goals of Project BudBurst are to 1) increase awareness of phenology as an area of scientific study; 2) Increase awareness of the impacts of changing climates on plants; and 3) increase science literacy by engaging participants in the scientific process. From its 2008 launch in February, this on-line educational and data-entry program, engaged participants of all ages and walks of life in recording the timing of the leafing and flowering of wild and cultivated species found across the continent. Thus far, participants from 49 states have submitted data that is being submitted to the USA National Phenology Network (www.usanpn.org) database. Project BudBurst has been the subject of almost 200 media outlets including NPR, national and regional television broadcasts, and most of the major national and regional newspapers. This presentation will provide an overview of Project Budburst and will report on the results of the 2008 field campaign and discuss plans to expand Project BudBurst in 2009. Project BudBurst is a Windows to the Universe Citizen Science program managed by the University

  9. TEP1, the yeast homolog of the human tumor suppressor gene PTEN/MMAC1/TEP1, is linked to the phosphatidylinositol pathway and plays a role in the developmental process of sporulation

    OpenAIRE

    Heymont, Jennifer; Berenfeld, Ludmilla; Collins, Jennifer; Kaganovich, Alexandra; Maynes, Bradford; Moulin, Aaron; Ratskovskaya, Irina; Poon, Pak P.; Johnston, Gerald C.; Kamenetsky, Margarita; DeSilva, John; Sun, Hong; Petsko, Gregory A; Engebrecht, JoAnne

    2000-01-01

    PTEN/MMAC1/TEP1 (PTEN, phosphatase deleted on chromosome ten; MMAC1, mutated in multiple advanced cancers; TEP1, tensin-like phosphatase) is a major human tumor suppressor gene whose suppressive activity operates on the phosphatidylinositol pathway. A single homologue of this gene, TEP1 (YNL128w), exists in the budding yeast Saccharomyces cerevisiae. Yeast strains deleted for TEP1 exhibit essentially no phenotype in haploids; however, diploids exhibit resistance to...

  10. [Fructose transporter in yeasts].

    Science.gov (United States)

    Lazar, Zbigniew; Dobrowolski, Adam; Robak, Małgorzata

    2014-01-01

    Study of hexoses transporter started with discovery of galactose permease in Saccharomyces cerevisiae. Glucose, fructose and mannose assimilation is assumed by numerous proteins encoded by different genes. To date over 20 hexoses transporters, belonging to Sugar Porter family and to Major Facilitator Superfamily, were known. Genome sequence analysis of Candida glabrata, Kluyveromyces lactis, Yarrowia lipolytica, S. cerevisaie and Debaryomyces hansenii reveled potential presence of 17-48 sugar porter proteins. Glucose transporters in S. cerevisiae have been already characterized. In this paper, hexoses transporters, responsible for assimilation of fructose by cells, are presented and compared. Fructose specific transporter are described for yeasts: Zygosaccharomyces rouxii, Zygosaccharomyces bailli, K. lactis, Saccharomyces pastorianus, S. cerevisiae winemaking strain and for fungus Botritys cinerea and human (Glut5p). Among six yeasts transporters, five are fructose specific, acting by facilitated diffusion or proton symport. Yeasts monosaccharides transporter studies allow understanding of sugars uptake and metabolism important aspects, even in higher eukaryotes cells. PMID:25033548

  11. The Yin and Yang of Yeast Transcription: Elements of a Global Feedback System between Metabolism and Chromatin

    OpenAIRE

    Machné, Rainer; Murray, Douglas B.

    2012-01-01

    When grown in continuous culture, budding yeast cells tend to synchronize their respiratory activity to form a stable oscillation that percolates throughout cellular physiology and involves the majority of the protein-coding transcriptome. Oscillations in batch culture and at single cell level support the idea that these dynamics constitute a general growth principle. The precise molecular mechanisms and biological functions of the oscillation remain elusive. Fourier analysis of transcriptome...

  12. Cellular localization of Sun4p and its interaction with proteins in the yeast birth scar.

    Science.gov (United States)

    Kuznetsov, Evgeny; Váchová, Libuše; Palková, Zdena

    2016-07-17

    Yeast harbor several proteins with predicted glucanase activity that are potentially involved in cell wall remodeling during different processes, including mitosis. Here, we showed that 2 of these putative glucanases, Sun4p and Dse2p, co-localize to the yeast birth scar, dependently on presence of the third glucanase, Egt2p. The absence of these glucanases results in inefficient mother-daughter cell separation. The Sun4p, Dse2p and Egt2p localize to the daughter side of the bud neck, possibly forming a complex, and are involved in the separation of the virgin daughter from the mother cell during mitosis. The formation of properly assembled birth scars that delimitate cell wall area restricted in the next budding is dependent on the presence of Aim44p and its transcriptional regulator, Swi5p. AIM44 or SWI5 deletion caused the "budding within the birth scar" phenotype, together with altered localization of the birth scar proteins Sun4p and Dse2p, indicating the impairment of birth scar protein complexes. PMID:27229769

  13. Genetics of Yeasts

    Science.gov (United States)

    Querol, Amparo; Fernández-Espinar, M. Teresa; Belloch, Carmela

    The use of yeasts in biotechnology processes dates back to ancient days. Before 7000 BC, beer was produced in Sumeria. Wine was made in Assyria in 3500 BC, and ancient Rome had over 250 bakeries, which were making leavened bread by 100 BC. And milk has been made into Kefyr and Koumiss in Asia for many centuries (Demain, Phaff, & Kurtzman, 1999). However, the importance of yeast in the food and beverage industries was only realized about 1860, when their role in food manufacturing became evident.

  14. Molecular Genetic Tools and Techniques in Fission Yeast.

    Science.gov (United States)

    Murray, Johanne M; Watson, Adam T; Carr, Antony M

    2016-01-01

    The molecular genetic tools used in fission yeast have generally been adapted from methods and approaches developed for use in the budding yeast, Saccharomyces cerevisiae Initially, the molecular genetics of Schizosaccharomyces pombe was developed to aid gene identification, but it is now applied extensively to the analysis of gene function and the manipulation of noncoding sequences that affect chromosome dynamics. Much current research using fission yeast thus relies on the basic processes of introducing DNA into the organism and the extraction of DNA for subsequent analysis. Targeted integration into specific genomic loci is often used to create site-specific mutants or changes to noncoding regulatory elements for subsequent phenotypic analysis. It is also regularly used to introduce additional sequences that generate tagged proteins or to create strains in which the levels of wild-type protein can be manipulated through transcriptional regulation and/or protein degradation. Here, we draw together a collection of core molecular genetic techniques that underpin much of modern research using S. pombe We summarize the most useful methods that are routinely used and provide guidance, learned from experience, for the successful application of these methods. PMID:27140925

  15. Yeast metabolic state identification using micro-fiber optics spectroscopy

    Science.gov (United States)

    Silva, J. S.; Castro, C. C.; Vicente, A. A.; Tafulo, P.; Jorge, P. A. S.; Martins, R. C.

    2011-05-01

    Saccharomyces cerevisiae morphology is known to be dependent on the cell physiological state and environmental conditions. On their environment, wild yeasts tend to form complex colonies architectures, such as stress response and pseudohyphal filaments morphologies, far away from the ones found inside bioreactors, where the regular cell cycle is observed under controlled conditions (e.g. budding and flocculating colonies). In this work we explore the feasibility of using micro-fiber optics spectroscopy to classify Saccharomyces cerevisiae S288C colony structures in YPD media, under different growth conditions, such as: i) no alcohol; ii) 1 % (v/v) Ethanol; iii) 1 % (v/v) 1-butanol; iv) 1 % (v/v) Isopropanol; v) 1 % (v/v) Tert-Amyl alcohol (2 Methyl-2-butanol); vi) 0,2 % (v/v) 2-Furaldehyde; vii) 5 % (w/v) 5 (Hydroxymethyl)-furfural; and viii) 1 % (w/v) (-)-Adenosine3', 5'cyclic monophosphate. The microscopy system includes a hyperspectral camera apparatus and a micro fiber (sustained by micro manipulator) optics system for spectroscopy. Results show that micro fiber optics system spectroscopy has the potential for yeasts metabolic state identification once the spectral signatures of colonies differs from each others. This technique associated with others physico-chemical information can benefit the creation of an information system capable of providing extremely detailed information about yeast metabolic state that will aid both scientists and engineers to study and develop new biotechnological products.

  16. Quantifying yeast chronological life span by outgrowth of aged cells.

    Science.gov (United States)

    Murakami, Christopher; Kaeberlein, Matt

    2009-01-01

    The budding yeast Saccharomyces cerevisiae has proven to be an important model organism in the field of aging research. The replicative and chronological life spans are two established paradigms used to study aging in yeast. Replicative aging is defined as the number of daughter cells a single yeast mother cell produces before senescence; chronological aging is defined by the length of time cells can survive in a non-dividing, quiescence-like state. We have developed a high-throughput method for quantitative measurement of chronological life span. This method involves aging the cells in a defined medium under agitation and at constant temperature. At each age-point, a sub-population of cells is removed from the aging culture and inoculated into rich growth medium. A high-resolution growth curve is then obtained for this sub-population of aged cells using a Bioscreen C MBR machine. An algorithm is then applied to determine the relative proportion of viable cells in each sub-population based on the growth kinetics at each age-point. This method requires substantially less time and resources compared to other chronological lifespan assays while maintaining reproducibility and precision. The high-throughput nature of this assay should allow for large-scale genetic and chemical screens to identify novel longevity modifiers for further testing in more complex organisms. PMID:19421136

  17. Structural properties of replication origins in yeast DNA sequences

    International Nuclear Information System (INIS)

    Sequence-dependent DNA flexibility is an important structural property originating from the DNA 3D structure. In this paper, we investigate the DNA flexibility of the budding yeast (S. Cerevisiae) replication origins on a genome-wide scale using flexibility parameters from two different models, the trinucleotide and the tetranucleotide models. Based on analyzing average flexibility profiles of 270 replication origins, we find that yeast replication origins are significantly rigid compared with their surrounding genomic regions. To further understand the highly distinctive property of replication origins, we compare the flexibility patterns between yeast replication origins and promoters, and find that they both contain significantly rigid DNAs. Our results suggest that DNA flexibility is an important factor that helps proteins recognize and bind the target sites in order to initiate DNA replication. Inspired by the role of the rigid region in promoters, we speculate that the rigid replication origins may facilitate binding of proteins, including the origin recognition complex (ORC), Cdc6, Cdt1 and the MCM2-7 complex

  18. Yeast Interacting Proteins Database: YGL070C, YER180C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available prey (0) YER180C ISC10 Protein required for sporulation, transcript is induced 7.5 hours after induction of meiosis, expected...s induced 7.5 hours after induction of meiosis, expected to play significant role

  19. Kinetics of Formation and Asymmetrical Distribution of Hsp104-Bound Protein Aggregates in Yeast.

    Science.gov (United States)

    Paoletti, Camille; Quintin, Sophie; Matifas, Audrey; Charvin, Gilles

    2016-04-12

    Budding yeast cells have a finite replicative life span; that is, a mother cell produces only a limited number of daughter cells before it slows division and dies. Despite the gradual aging of the mother cell, all daughters are born rejuvenated and enjoy a full replicative lifespan. It has been proposed that entry of mother cells into senescence is driven by the progressive accumulation and retention of damaged material, including protein aggregates. This additionally allows the daughter cells to be born damage free. However, the mechanism underlying such asymmetrical segregation of protein aggregates by mother and daughter cells remains controversial, in part because of the difficulties inherent in tracking the dynamics and fate of protein aggregates in vivo. To overcome such limitations, we have developed single-cell real-time imaging methodology to track the formation of heat-induced protein aggregates in otherwise unperturbed dividing cells. By combining the imaging data with a simple computational model of protein aggregation, we show that the establishment of asymmetrical partitioning of protein aggregates upon division is driven by the large bud-specific dilution rate associated with polarized growth and the absence of significant mother/bud exchange of protein aggregates during the budded phase of the cell cycle. To our knowledge, this study sheds new light on the mechanism of establishment of a segregation bias, which can be accounted for by simple physical arguments. PMID:27074685

  20. The function of Msx1 gene in promoting meiosis of dairy goat male germline stem cells (mGSCs).

    Science.gov (United States)

    Mu, Hailong; Wu, Jiang; Zhu, Haijing; Li, Na; Tang, Furong; Yao, Xi; Yang, Churong; Peng, Sha; Li, Guangpeng; Hua, Jinlian

    2013-12-01

    During sequential stages of meiosis, numerous cytoplasmic and nuclear events take place in which many germline and non-germline genes involved. It is demonstrated that the germline gene Stra8 and synaptonemal complex protein 3 (Scp3) play an important role in the meiosis. Recently, studies showed Msx1, a DNA-binding protein taking part in the skeletal development, also having a functional attractive factor to Stra8 and Scp3 in the meiosis. In this study, we cloned the gene Msx1 then transfected the Msx1 constructed recombination plasmid, pMsx1-Ires2-AcGFP, into the dairy goat germline stem cells (male germline stem cells) and analysed the effects of Msx1 on the expression of Stra8 and Scp3. The results showed that Msx1 could enhance the expression of Stra8 and Scp3 and promote the meiosis in goat testicular cells. Bmp4 activated the expression of Msx1 and Stra8. This study suggests that Msx1 plays an important role in spermatogenesis and meiosis. PMID:24123057

  1. Dissection and Design of Yeast Prions

    Directory of Open Access Journals (Sweden)

    Osherovich Lev Z

    2004-01-01

    Full Text Available Many proteins can misfold into beta-sheet-rich, self-seeding polymers (amyloids. Prions are exceptional among such aggregates in that they are also infectious. In fungi, prions are not pathogenic but rather act as epigenetic regulators of cell physiology, providing a powerful model for studying the mechanism of prion replication. We used prion-forming domains from two budding yeast proteins (Sup35p and New1p to examine the requirements for prion formation and inheritance. In both proteins, a glutamine/asparagine-rich (Q/N-rich tract mediates sequence-specific aggregation, while an adjacent motif, the oligopeptide repeat, is required for the replication and stable inheritance of these aggregates. Our findings help to explain why although Q/N-rich proteins are relatively common, few form heritable aggregates: prion inheritance requires both an aggregation sequence responsible for self-seeded growth and an element that permits chaperone-dependent replication of the aggregate. Using this knowledge, we have designed novel artificial prions by fusing the replication element of Sup35p to aggregation-prone sequences from other proteins, including pathogenically expanded polyglutamine.

  2. Yeast fluorescence microscopy

    Czech Academy of Sciences Publication Activity Database

    Hašek, Jiří

    New Jersey : Humana Press, 2005, s. 85-96. ISBN 1-59259-958-3 R&D Projects: GA AV ČR IAA5020102; GA ČR GA204/02/1424 Institutional research plan: CEZ:AV0Z50200510 Keywords : yeast * fluorescence microscopy * immunofluorescence Subject RIV: EE - Microbiology, Virology

  3. Polysome Profile Analysis - Yeast

    Czech Academy of Sciences Publication Activity Database

    Pospíšek, M.; Valášek, Leoš

    2013-01-01

    Roč. 530, č. 2013 (2013), s. 173-181. ISSN 0076-6879 Institutional support: RVO:61388971 Keywords : grow yeast cultures * polysome profile analysis * sucrose density gradient centrifugation Subject RIV: CE - Biochemistry Impact factor: 2.194, year: 2013

  4. Opportunistic Pathogenic Yeasts

    Science.gov (United States)

    Banerjee, Uma

    Advances in medical research, made during the last few decades, have improved the prophylactic, diagnostic and therapeutic capabilities for variety of infections/diseases. However, many of the prophylactic and therapeutic procedures have been seen in many instances to exact a price of host-vulnerability to an expanding group of opportunistic pathogens and yeasts are one of the important members in it. Fortunately amongst the vast majority of yeasts present in nature only few are considered to have the capability to cause infections when certain opportunities predisposes and these are termed as ‘opportunistic pathogenic yeasts.’ However, the term ‘pathogenic’ is quite tricky, as it depends of various factors of the host, the ‘bug’ and the environment to manifest the clinical infection. The borderline is expanding. In the present century with unprecedented increase in number of immune-compromised host in various disciplines of health care settings, where any yeast, which has the capability to grow at 37 ° C (normal body temperature of human), can be pathogenic and cause infection in particular situation

  5. Membrane-elasticity model of Coatless vesicle budding induced by ESCRT complexes.

    Directory of Open Access Journals (Sweden)

    Bartosz Różycki

    Full Text Available The formation of vesicles is essential for many biological processes, in particular for the trafficking of membrane proteins within cells. The Endosomal Sorting Complex Required for Transport (ESCRT directs membrane budding away from the cytosol. Unlike other vesicle formation pathways, the ESCRT-mediated budding occurs without a protein coat. Here, we propose a minimal model of ESCRT-induced vesicle budding. Our model is based on recent experimental observations from direct fluorescence microscopy imaging that show ESCRT proteins colocalized only in the neck region of membrane buds. The model, cast in the framework of membrane elasticity theory, reproduces the experimentally observed vesicle morphologies with physically meaningful parameters. In this parameter range, the minimum energy configurations of the membrane are coatless buds with ESCRTs localized in the bud neck, consistent with experiment. The minimum energy configurations agree with those seen in the fluorescence images, with respect to both bud shapes and ESCRT protein localization. On the basis of our model, we identify distinct mechanistic pathways for the ESCRT-mediated budding process. The bud size is determined by membrane material parameters, explaining the narrow yet different bud size distributions in vitro and in vivo. Our membrane elasticity model thus sheds light on the energetics and possible mechanisms of ESCRT-induced membrane budding.

  6. Influences of polar auxin transport on polarity of adventitious bud formation in hybrid populas

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Myung Won (Yonsei Univ. Kangwondo (Korea)); Hackett, W. (Univ of Minnesota, St. Paul (USA))

    1989-04-01

    The role of auxin and cytokinin distribution of polar regeneration of adventitious bud has been investigated. Explants from leaf midvein were labelled with {sup 14}C-NAA and {sup 14}C-BA and the radioactivity in proximal, mid, and distal portions was counted after 24h and 48h. Explants showing polar regeneration of buds on the proximal end showed a clear polar distribution of {sup 14}CNAA. Auxin transport inhibitors (NPA, TIBA) eliminated polar distribution of auxin and reduced polarity of bud formation and the total number of buds formed, but did not reduce callus formation. Increased concentration of Ca(NO{sub 3}){sub 2} decreased polarity of bud formation and increased the number of buds formed but did not affect the distribution of auxin of cytokinin. Some factor in addition to polar distribution of auxin or cytokinin-auxin ratio appears to influence the polarity of adventitious bud formation.

  7. L-arabinose fermenting yeast

    Energy Technology Data Exchange (ETDEWEB)

    Zhang, Min; Singh, Arjun; Suominen, Pirkko; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric

    2014-09-23

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

  8. L-arabinose fermenting yeast

    Science.gov (United States)

    Zhang, Min; Singh, Arjun; Suominen, Pirkko; Knoshaug, Eric; Franden, Mary Ann; Jarvis, Eric

    2013-02-12

    An L-arabinose utilizing yeast strain is provided for the production of ethanol by introducing and expressing bacterial araA, araB and araD genes. L-arabinose transporters are also introduced into the yeast to enhance the uptake of arabinose. The yeast carries additional genomic mutations enabling it to consume L-arabinose, even as the only carbon source, and to produce ethanol. A yeast strain engineered to metabolize arabinose through a novel pathway is also disclosed. Methods of producing ethanol include utilizing these modified yeast strains.

  9. Double nondisjunction in maternal meiosis II giving rise to a fetus with 48,XXX,+21

    Energy Technology Data Exchange (ETDEWEB)

    Bravo, R.R.; Shulman, L.P.; Tharapel, A.T. [Univ. of Tennessee, Memphis (United States)] [and others

    1994-09-01

    The occurrence of multiple aneuploidy is quite rare, and the mechanisms by which it arises have not been well-characterized except in cases of 49,XXXXX and 49,XXXXY. These originate by successive nondisjunction of the X chromosomes in meiosis I and meiosis II, giving rise to a gamete with four X chromosomes. Here, we describe a case of double trisomy involving chromosome 21 and the X chromosome. The 19-year-old patient underwent amniocentesis at 17.5 weeks gestation following a positive serum analyte screen (estimated 1/120 risk of Down syndrome). Ultrasound findings at the time of the procedure were ventricular septal defect, dilated renal calyx, clinodactyly, and a two-vessel cord. Cytogenetic analysis revealed a nonmosaic karyotype of 48,XXX,+21. The couple opted for pregnancy termination. A comfimatory karyotype could not be obtained due to microbial contamination of the products of conception. Therefore, we used a {open_quotes}touch prep{close_quotes} procedure to deposit fetal cells on microscope slides and performed interphase FISH (fluorescence in situ hybridization) to confirm the presence of three X chromosomes and three copies of chromosome 21. Microsatellite polymorphisms in the mother, father, and fetus were used to evaluate segregation of the X and 21 chromosomes. Based on the results obtained with the most centromeric loci, both extra chromosomes arose from nondisjunction in maternal meiosis II. More distal markers showed evidence of recombination in both chromosomes. To our knowledge, this is the first report of a double trisomy arising by this mechanism. Based on our results and those reported for tetrasomy/pentasomy X, we postulate that multiple aneuploidies are more likely to arise by related errors (involving a single chromosome or a single cell division) than by independent errors (in different cell divisions or different gametes).

  10. Meiosis genes in Daphnia pulex and the role of parthenogenesis in genome evolution

    Directory of Open Access Journals (Sweden)

    Eads Brian D

    2009-04-01

    Full Text Available Abstract Background Thousands of parthenogenetic animal species have been described and cytogenetic manifestations of this reproductive mode are well known. However, little is understood about the molecular determinants of parthenogenesis. The Daphnia pulex genome must contain the molecular machinery for different reproductive modes: sexual (both male and female meiosis and parthenogenetic (which is either cyclical or obligate. This feature makes D. pulex an ideal model to investigate the genetic basis of parthenogenesis and its consequences for gene and genome evolution. Here we describe the inventory of meiotic genes and their expression patterns during meiotic and parthenogenetic reproduction to help address whether parthenogenesis uses existing meiotic and mitotic machinery, or whether novel processes may be involved. Results We report an inventory of 130 homologs representing over 40 genes encoding proteins with diverse roles in meiotic processes in the genome of D. pulex. Many genes involved in cell cycle regulation and sister chromatid cohesion are characterized by expansions in copy number. In contrast, most genes involved in DNA replication and homologous recombination are present as single copies. Notably, RECQ2 (which suppresses homologous recombination is present in multiple copies while DMC1 is the only gene in our inventory that is absent in the Daphnia genome. Expression patterns for 44 gene copies were similar during meiosis versus parthenogenesis, although several genes displayed marked differences in expression level in germline and somatic tissues. Conclusion We propose that expansions in meiotic gene families in D. pulex may be associated with parthenogenesis. Taking into account our findings, we provide a mechanistic model of parthenogenesis, highlighting steps that must differ from meiosis including sister chromatid cohesion and kinetochore attachment.

  11. POLO-LIKE KINASE I CONTROLS NUCLEAR ENVELOPE BREAK DOWN AND CHROMOSOME DYNAMICS IN MEIOSIS I

    Czech Academy of Sciences Publication Activity Database

    Šolc, Petr; Kitajima, T.; Baran, V.; Brzáková, Adéla; Mayer, Alexandra; Samalová, Pavlína; Motlík, Jan; Ellenberg, J.

    Montpellier : EMBO, 2011. s. 203-203. [15th European Cell Cycle Conference and EMBO Workshop. 02.09.2011-05.09.2011, Montpellier] R&D Projects: GA ČR(CZ) GC301/09/J036; GA MŠk ME08030; GA ČR(CZ) GPP301/11/P081 Institutional research plan: CEZ:AV0Z50450515 Keywords : polo-like kinase * chromosome * meiosis I Subject RIV: EB - Genetics ; Molecular Biology http://events.embo.org/11-cell-cycle/

  12. CDC25A phosphatase controls meiosis I progression in mouse oocytes

    Czech Academy of Sciences Publication Activity Database

    Šolc, Petr; Šašková, Adéla; Baran, V.; Kubelka, Michal; Schultz, R. M.; Motlík, Jan

    2008-01-01

    Roč. 317, č. 1 (2008), s. 260-269. ISSN 0012-1606 R&D Projects: GA ČR GA305/06/1413; GA ČR GD204/05/H023 Grant ostatní: Czech-US cooperation(CZ) ME08030; Slovenská Akademie vied(SK) VEGA 2/6176/26 Institutional research plan: CEZ:AV0Z50450515 Keywords : resumption of meiosis * meiotic maturation * mouse oocytes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.416, year: 2008

  13. Recurrent peripheral odontogenic fibroma associated with basal cell budding

    Directory of Open Access Journals (Sweden)

    C Sreeja

    2014-01-01

    Full Text Available Peripheral odontogenic fibroma (POdF is a rare benign odontogenic neoplasm. It represents the soft tissue counterpart of central odontogenic fibroma. The embryonic source of POdF has been suggested by many as arising from the rest of dental lamina that has persisted in the gingiva following its disintegration. It presents clinically as a firm, slow growing and sessile gingival mass, which is difficult to distinguish with more common inflammatory lesions. Very few cases of recurrence have been documented. It has been stated that histological budding of basal cell layer of the surface squamous epithelium is associated with higher recurrence and the presence of calcification in direct apposition to the epithelial rest is associated with lower recurrence. Hereby, we present a case which histologically exhibited budding of the basal cell layer, which could have been the reason for its recurrence.

  14. Budding Transition of Asymmetric Two-component Lipid Domains

    CERN Document Server

    Wolff, Jean; Andelman, David

    2016-01-01

    We propose a model that accounts for the budding transition of asymmetric two-component lipid domains, where the two monolayers (leaflets) have different average compositions controlled by independent chemical potentials. Assuming a coupling between the local curvature and local lipid composition in each of the leaflets, we discuss the morphology and thermodynamic behavior of asymmetric lipid domains. The membrane free-energy contains three contributions: the bending energy, the line tension, and a Landau free-energy for a lateral phase separation. Within a mean-field treatment, we obtain various phase diagrams containing fully budded, dimpled, and flat states as a function of the two leaflet compositions. The global phase behavior is analyzed, and depending on system parameters, the phase diagrams include one-phase, two-phase and three-phase regions. In particular, we predict various phase coexistence regions between different morphologies of domains, which may be observed in multi-component membranes or ves...

  15. Tumor budding is a strong and reproducible prognostic marker in T3N0 colorectal cancer.

    LENUS (Irish Health Repository)

    Wang, Lai Mun

    2012-02-01

    BACKGROUND: Tumor budding along the advancing front of colorectal adenocarcinoma is an early event in the metastatic process. A reproducible, prognostic budding scoring system based on outcomes in early stage colorectal cancer has not been established. DESIGN: One hundred twenty-eight T3N0M0 colorectal carcinoma patients with known outcome were identified. Tumor budding was defined as isolated tumor cells or clusters of <5 cells at the invasive tumor front. Tumor bud counts were generated in 5 regions at 200x by 2 pathologists (conventional bud count method). The median bud count per case was used to divide cases into low (median=0) and high budding (median > or =1) groups. Forty cases were reevaluated to assess reproducibility using the conventional and a novel rapid bud count method. RESULTS: Fifty-seven (45%) carcinomas had high and 71 (55%) had low budding scores. High budding was associated with an infiltrative growth pattern (P<0.0001) and lymphovascular invasion (P=0.005). Five-year cancer-specific survival was significantly poorer in high compared with low budding groups: 63% versus 91%, respectively, P<0.0001. Multivariate analysis demonstrated tumor budding to be independently prognostic (hazard ratio=4.76, P<0.001). Interobserver agreement was at least equivalent comparing the conventional to the rapid bud count methods: 87.5% agreement (kappa=0.75) versus 92.5% agreement (kappa=0.85), respectively. CONCLUSIONS: Tumor budding is a strong, reproducible, and independent prognostic marker of outcome that is easily assessed on hematoxylin and eosin slides. This may be useful for identifying the subset of T3N0M0 patients at high risk of recurrence who may benefit from adjuvant therapy.

  16. Meiosis en mutantes desinápticos con restitución cromosómica en Rhoeo spathacea (Commelinaceae) Meiosis in desynaptic-chromosomal restitution mutants in Rhoeo spathacea (Commelinaceae)

    OpenAIRE

    Armando García-Velázquez

    2008-01-01

    El estudio se llevó a cabo en recolectas de Rhoeo spathacea realizadas en Veracruz, Chiapas, Tabasco, Yucatán, Quintana Roo y Michoacán, México. Las plantas presentaron número diploide de cromosomas (2n=12) en mitosis. En meiosis los individuos formaron anillo y/o cadenas en metafase I, con excepción de varios mutantes desinápticos-RSD (separación de cromosomas apareados). En meiosis de Rhoeo no se observan bivalentes ni hay posibilidades de entrecruzamiento, y consecuentemente no habrá quias...

  17. The protein machinery of vesicle budding and fusion.

    OpenAIRE

    Rothman, J E

    1996-01-01

    A general protein machinery that buds and fuses transport vesicles is harnessed to generate the complex web of intracellular transport pathways critical for such diverse processes as cell growth, endocytosis, hormone release, and neurotransmission. With this appreciation, the challenge of understanding the precise molecular mechanisms of these many facets of cell biology has been reduced to a series of problems in protein structure and chemistry.

  18. Signal transduction and information processing in mammalian taste buds

    OpenAIRE

    Roper, Stephen D.

    2007-01-01

    The molecular machinery for chemosensory transduction in taste buds has received considerable attention within the last decade. Consequently, we now know a great deal about sweet, bitter, and umami taste mechanisms and are gaining ground rapidly on salty and sour transduction. Sweet, bitter, and umami tastes are transduced by G-protein-coupled receptors. Salty taste may be transduced by epithelial Na channels similar to those found in renal tissues. Sour transduction appears to be initiated b...

  19. Clonal and bud bank traits: patterns across temperate plant communities

    Czech Academy of Sciences Publication Activity Database

    Klimešová, Jitka; Herben, Tomáš

    2015-01-01

    Roč. 26, č. 2 (2015), s. 243-253. ISSN 1100-9233 R&D Projects: GA ČR GB14-36079G; GA ČR GA13-17118S; GA ČR GAP505/12/1007 Institutional support: RVO:67985939 Keywords : clonal and bud bank traits * vegetation * central Europe Subject RIV: EH - Ecology, Behaviour Impact factor: 3.709, year: 2014

  20. Cyc17, a meiosis-specific cyclin, is essential for anaphase initiation and chromosome segregation in Tetrahymena thermophila.

    Science.gov (United States)

    Yan, Guan-Xiong; Dang, Huai; Tian, Miao; Zhang, Jing; Shodhan, Anura; Ning, Ying-Zhi; Xiong, Jie; Miao, Wei

    2016-07-17

    Although the role of cyclins in controlling nuclear division is well established, their function in ciliate meiosis remains unknown. In ciliates, the cyclin family has undergone massive expansion which suggests that diverse cell cycle systems exist, and this warrants further investigation. A screen for cyclins in the model ciliate Tetrahymena thermophila showed that there are 34 cyclins in this organism. Only 1 cyclin, Cyc17, contains the complete cyclin core and is specifically expressed during meiosis. Deletion of CYC17 led to meiotic arrest at the diakinesis-like metaphase I stage. Expression of genes involved in DNA metabolism and chromosome organization (chromatin remodeling and basic chromosomal structure) was repressed in cyc17 knockout matings. Further investigation suggested that Cyc17 is involved in regulating spindle pole attachment, and is thus essential for chromosome segregation at meiosis. These findings suggest a simple model in which chromosome segregation is influenced by Cyc17. PMID:27192402

  1. Trichomes control flower bud shape by linking together young petals.

    Science.gov (United States)

    Tan, Jiafu; Walford, Sally-Anne; Dennis, Elizabeth S; Llewellyn, Danny

    2016-01-01

    Trichomes are widespread in plants and develop from surface cells on different tissues(1). They have many forms and functions, from defensive spines to physical barriers that trap layers of air to insulate against desiccation, but there is growing evidence that trichomes can also have developmental roles in regulating flower structure(2,3). We report here that the trichomes on petals of cotton, Gossypium hirsutum L., are essential for correct flower bud shape through a mechanical entanglement of the trichomes on adjacent petals that anchor the edges to counter the opposing force generated by asymmetric expansion of overlapping petals. Silencing a master regulator of petal trichomes, GhMYB-MIXTA-Like10 (GhMYBML10), by RNA interference (RNAi) suppressed petal trichome growth and resulted in flower buds forming into abnormal corkscrew shapes that exposed developing anthers and stigmas to desiccation damage. Artificially gluing petal edges together could partially restore correct bud shape and fertility. Such petal 'Velcro' is present in other Malvaceae and perhaps more broadly in other plant families, although it is not ubiquitous. This mechanism for physical association between separate organs to regulate flower shape and function is different from the usual organ shape control(4) exerted through cell-to-cell communication and differential cell expansion within floral tissues(5,6). PMID:27322517

  2. Ecological conditions favoring budding in colonial organisms under environmental disturbance.

    Directory of Open Access Journals (Sweden)

    Mayuko Nakamaru

    Full Text Available Dispersal is a topic of great interest in ecology. Many organisms adopt one of two distinct dispersal tactics at reproduction: the production of small offspring that can disperse over long distances (such as seeds and spawned eggs, or budding. The latter is observed in some colonial organisms, such as clonal plants, corals and ants, in which (superorganisms split their body into components of relatively large size that disperse to a short distance. Contrary to the common dispersal viewpoint, short-dispersal colonial organisms often flourish even in environments with frequent disturbances. In this paper, we investigate the conditions that favor budding over long-distance dispersal of small offspring, focusing on the life history of the colony growth and the colony division ratio. These conditions are the relatively high mortality of very small colonies, logistic growth, the ability of dispersers to peacefully seek and settle unoccupied spaces, and small spatial scale of environmental disturbance. If these conditions hold, budding is advantageous even when environmental disturbance is frequent. These results suggest that the demography or life history of the colony underlies the behaviors of the colonial organisms.

  3. Bud dormancy in apple trees after thermal fluctuations

    Directory of Open Access Journals (Sweden)

    Rafael Anzanello

    2014-06-01

    Full Text Available The objective of this work was to evaluate the effect of heat waves on the evolution of bud dormancy, in apple trees with contrasting chilling requirements. Twigs of 'Castel Gala' and 'Royal Gala' were collected in orchards in Papanduva, state of Santa Catarina, Brazil, and were exposed to constant (3°C or alternating (3 and 15°C for 12/12 hours temperature, combined with zero, one or two days a week at 25°C. Two additional treatments were evaluated: constant temperature (3°C, with a heat wave of seven days at 25°C, in the beginning or in the middle of the experimental period. Periodically, part of the twigs was transferred to 25°C for daily budburst evaluation of apical and lateral buds. Endodormancy (dormancy induced by cold was overcome with less than 330 chilling hours (CH of constant cold in 'Castel Gala' and less than 618 CH in 'Royal Gala'. A daily 15°C-temperature cycle did not affect the endodormancy process. Heat waves during endodormancy resulted in an increased CH to achieve bud requirements. The negative effect of high temperature depended on the lasting of this condition. Chilling was partly cancelled during dormancy when the heat wave lasted 36 continuous hours or more. Therefore, budburst prediction models need adjustments, mainly for regions with mild and irregular winters, such as those of Southern Brazil.

  4. Removal of deciduous canine tooth buds in Kenyan rural Maasai.

    Science.gov (United States)

    Hassanali, J; Amwayi, P; Muriithi, A

    1995-04-01

    The removal of deciduous canine tooth buds in early childhood is a practice that has been documented in Kenya and in neighboring countries. This paper describes the occurrence, rationale and method of this practice amongst rural Kenyan Maasai. In a group of 95 children aged between six months and two years, who were examined in 1991/92, 87% were found to have undergone the removal of one or more deciduous canine tooth buds. In an older age group (3-7 years of age), 72% of the 111 children examined exhibited missing mandibular or maxillary deciduous canines. It was found that the actual removal of a deciduous tooth bud is often performed by middle-aged Maasai women who enucleate the developing tooth using a pointed pen-knife. There exists a strong belief among the Maasai that diarrhoea, vomiting and other febrile illnesses of early childhood are caused by the gingival swelling over the canine region, and which is thought to contain 'worms' or 'nylon' teeth. The immediate and long-term hazards of this practice include profuse bleeding, infection and damage to the developing permanent canines. A multi-disciplinary approach involving social anthropologists in addition to dental and medical personnel, is recommend in order to discourage this harmful operation that appears to be on the increase. PMID:7621751

  5. Construction of the first compendium of chemical-genetic profiles in the fission yeast Schizosaccharomyces pombe and comparative compendium approach

    Energy Technology Data Exchange (ETDEWEB)

    Han, Sangjo [Bioinformatics Lab, Healthcare Group, SK Telecom, 9-1, Sunae-dong, Pundang-gu, Sungnam-si, Kyunggi-do 463-784 (Korea, Republic of); Lee, Minho [Department of Bio and Brain Engineering, Korea Advanced Institute of Science and Technology, 291 Daehak-ro, Yuseong-gu, Daejeon 305-701 (Korea, Republic of); Chang, Hyeshik [Department of Biological Science, Seoul National University, 599 Gwanakro, Gwanak-gu, Seoul 151-747 (Korea, Republic of); Nam, Miyoung [Department of New Drug Discovery and Development, Chungnam National University, 99 Daehak-ro, Yuseong-gu, Daejeon, 305-764 (Korea, Republic of); Park, Han-Oh [Bioneer Corp., 8-11 Munpyeongseo-ro, Daedeok-gu, Daejeon 306-220 (Korea, Republic of); Kwak, Youn-Sig [Department of Applied Biology, Gyeongsang National University, 501 Jinju-daero, Jinju, Gyeongnam 660-701 (Korea, Republic of); Ha, Hye-jeong [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-Gu, Daejeon 305-806 (Korea, Republic of); Kim, Dongsup [Department of Bio and Brain Engineering, Korea Advanced Institute of Science and Technology, 291 Daehak-ro, Yuseong-gu, Daejeon 305-701 (Korea, Republic of); Hwang, Sung-Ook [Department of Obstetrics and Gynecology, Inha University Hospital, 7-206 Sinheung-dong, Jung-gu, Incheon 400-711 (Korea, Republic of); Hoe, Kwang-Lae [Department of New Drug Discovery and Development, Chungnam National University, 99 Daehak-ro, Yuseong-gu, Daejeon, 305-764 (Korea, Republic of); Kim, Dong-Uk [Aging Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-Gu, Daejeon 305-806 (Korea, Republic of)

    2013-07-12

    Highlights: •The first compendium of chemical-genetic profiles form fission yeast was generated. •The first HTS of drug mode-of-action in fission yeast was performed. •The first comparative chemical genetic analysis between two yeasts was conducted. -- Abstract: Genome-wide chemical genetic profiles in Saccharomyces cerevisiae since the budding yeast deletion library construction have been successfully used to reveal unknown mode-of-actions of drugs. Here, we introduce comparative approach to infer drug target proteins more accurately using two compendiums of chemical-genetic profiles from the budding yeast S. cerevisiae and the fission yeast Schizosaccharomyces pombe. For the first time, we established DNA-chip based growth defect measurement of genome-wide deletion strains of S. pombe, and then applied 47 drugs to the pooled heterozygous deletion strains to generate chemical-genetic profiles in S. pombe. In our approach, putative drug targets were inferred from strains hypersensitive to given drugs by analyzing S. pombe and S. cerevisiae compendiums. Notably, many evidences in the literature revealed that the inferred target genes of fungicide and bactericide identified by such comparative approach are in fact the direct targets. Furthermore, by filtering out the genes with no essentiality, the multi-drug sensitivity genes, and the genes with less eukaryotic conservation, we created a set of drug target gene candidates that are expected to be directly affected by a given drug in human cells. Our study demonstrated that it is highly beneficial to construct the multiple compendiums of chemical genetic profiles using many different species. The fission yeast chemical-genetic compendium is available at (http://pombe.kaist.ac.kr/compendium)

  6. Construction of the first compendium of chemical-genetic profiles in the fission yeast Schizosaccharomyces pombe and comparative compendium approach

    International Nuclear Information System (INIS)

    Highlights: •The first compendium of chemical-genetic profiles form fission yeast was generated. •The first HTS of drug mode-of-action in fission yeast was performed. •The first comparative chemical genetic analysis between two yeasts was conducted. -- Abstract: Genome-wide chemical genetic profiles in Saccharomyces cerevisiae since the budding yeast deletion library construction have been successfully used to reveal unknown mode-of-actions of drugs. Here, we introduce comparative approach to infer drug target proteins more accurately using two compendiums of chemical-genetic profiles from the budding yeast S. cerevisiae and the fission yeast Schizosaccharomyces pombe. For the first time, we established DNA-chip based growth defect measurement of genome-wide deletion strains of S. pombe, and then applied 47 drugs to the pooled heterozygous deletion strains to generate chemical-genetic profiles in S. pombe. In our approach, putative drug targets were inferred from strains hypersensitive to given drugs by analyzing S. pombe and S. cerevisiae compendiums. Notably, many evidences in the literature revealed that the inferred target genes of fungicide and bactericide identified by such comparative approach are in fact the direct targets. Furthermore, by filtering out the genes with no essentiality, the multi-drug sensitivity genes, and the genes with less eukaryotic conservation, we created a set of drug target gene candidates that are expected to be directly affected by a given drug in human cells. Our study demonstrated that it is highly beneficial to construct the multiple compendiums of chemical genetic profiles using many different species. The fission yeast chemical-genetic compendium is available at (http://pombe.kaist.ac.kr/compendium)

  7. Continuous crossbreeding of sake yeasts using growth selection systems for a-type and α-type cells.

    Science.gov (United States)

    Fukuda, Nobuo; Kaishima, Misato; Ishii, Jun; Kondo, Akihiko; Honda, Shinya

    2016-12-01

    Sake yeasts belong to the budding yeast species Saccharomyces cerevisiae and have high fermentation activity and ethanol production. Although the traditional crossbreeding of sake yeasts is a time-consuming and inefficient process due to the low sporulation rates and spore viability of these strains, considerable effort has been devoted to the development of hybrid strains with superior brewing characteristics. In the present work, we describe a growth selection system for a- and α-type cells aimed at the crossbreeding of industrial yeasts, and performed hybridizations with sake yeast strains Kyokai No. 6, No. 7 and No. 9 to examine the feasibility of this approach. We successfully generated both a- and α-type strains from all parental strains, and acquired six types of hybrids by outcrossing. One of these hybrid strains was subjected to continuous crossbreeding, yielding the multi-hybrid strain, which inherited the genetic characteristics of Kyokai No. 6, No. 7 and No. 9. Notably, because all of the genetic modifications of the yeast cells were introduced using plasmids, these traits can be easily removed. The approach described here has the potential to markedly accelerate the crossbreeding of industrial yeast strains with desirable properties. PMID:27392493

  8. Multisite phosphorylation of the guanine nucleotide exchange factor Cdc24 during yeast cell polarization.

    Directory of Open Access Journals (Sweden)

    Stephanie C Wai

    Full Text Available BACKGROUND: Cell polarization is essential for processes such as cell migration and asymmetric cell division. A common regulator of cell polarization in most eukaryotic cells is the conserved Rho GTPase, Cdc42. In budding yeast, Cdc42 is activated by a single guanine nucleotide exchange factor, Cdc24. The mechanistic details of Cdc24 activation at the onset of yeast cell polarization are unclear. Previous studies have suggested an important role for phosphorylation of Cdc24, which may regulate activity or function of the protein, representing a key step in the symmetry breaking process. METHODOLOGY/PRINCIPAL FINDINGS: Here, we directly ask whether multisite phosphorylation of Cdc24 plays a role in its regulation. We identify through mass spectrometry analysis over thirty putative in vivo phosphorylation sites. We first focus on sites matching consensus sequences for cyclin-dependent and p21-activated kinases, two kinase families that have been previously shown to phosphorylate Cdc24. Through site-directed mutagenesis, yeast genetics, and light and fluorescence microscopy, we show that nonphosphorylatable mutations of these consensus sites do not lead to any detectable consequences on growth rate, morphology, kinetics of polarization, or localization of the mutant protein. We do, however, observe a change in the mobility shift of mutant Cdc24 proteins on SDS-PAGE, suggesting that we have indeed perturbed its phosphorylation. Finally, we show that mutation of all identified phosphorylation sites does not cause observable defects in growth rate or morphology. CONCLUSIONS/SIGNIFICANCE: We conclude that lack of phosphorylation on Cdc24 has no overt functional consequences in budding yeast. Yeast cell polarization may be more tightly regulated by inactivation of Cdc42 by GTPase activating proteins or by alternative methods of Cdc24 regulation, such as conformational changes or oligomerization.

  9. Dual-mode regulation of the APC/C by CDK1 and MAPK controls meiosis I progression and fidelity

    OpenAIRE

    Nabti, Ibtissem; Marangos, Petros; Bormann, Jenny; Kudo, Nobuaki R; Carroll, John

    2014-01-01

    Female meiosis is driven by the activities of two major kinases, cyclin-dependent kinase 1 (Cdk1) and mitogen-activated protein kinase (MAPK). To date, the role of MAPK in control of meiosis is thought to be restricted to maintaining metaphase II arrest through stabilizing Cdk1 activity. In this paper, we find that MAPK and Cdk1 play compensatory roles to suppress the anaphase-promoting complex/cyclosome (APC/C) activity early in prometaphase, thereby allowing accumulation of APC/C substrates...

  10. Dissecting the first and the second meiotic divisions using a marker-less drug-hypersensitive fission yeast

    OpenAIRE

    Aoi, Yuki; Sato, Masamitsu; Sutani, Takashi; Shirahige, Katsuhiko; Kapoor, Tarun M.; Kawashima, Shigehiro A

    2014-01-01

    Faithful chromosome segregation during meiosis is indispensable to prevent birth defects and infertility. Canonical genetic manipulations have not been very useful for studying meiosis II, since mutations of genes involved in cell cycle regulation or chromosome segregation may affect meiosis I, making interpretations of any defects observed in meiosis II complicated. Here we present a powerful strategy to dissect meiosis I and meiosis II, using chemical inhibitors in genetically tractable mod...

  11. Biochemical and Structural Studies of YEast Vps4 Oligomerization

    Energy Technology Data Exchange (ETDEWEB)

    Gonciarz, M.; Whitby, F; Eckert, D; Kieffer, C; Heroux, A; Sundquist, W; Hill, C

    2008-01-01

    The ESCRT (endosomal sorting complexes required for transport) pathway functions in vesicle formation at the multivesicular body, the budding of enveloped RNA viruses such as HIV-1, and the final abscission stage of cytokinesis. As the only known enzyme in the ESCRT pathway, the AAA ATPase (ATPase associated with diverse cellular activities) Vps4 provides the energy required for multiple rounds of vesicle formation. Like other Vps4 proteins, yeast Vps4 cycles through two states: a catalytically inactive disassembled state that we show here is a dimer and a catalytically active higher-order assembly that we have modeled as a dodecamer composed of two stacked hexameric rings. We also report crystal structures of yeast Vps4 proteins in the apo- and ATPS (adenosine 5'-O-(3-thiotriphosphate))-bound states. In both cases, Vps4 subunits assembled into continuous helices with 6-fold screw axes that are analogous to helices seen previously in other Vps4 crystal forms. The helices are stabilized by extensive interactions between the large and small AAA ATPase domains of adjacent Vps4 subunits, suggesting that these contact surfaces may be used to build both the catalytically active dodecamer and catalytically inactive dimer. Consistent with this model, we have identified interface mutants that specifically inhibit Vps4 dimerization, dodecamerization, or both. Thus, the Vps4 dimer and dodecamer likely form distinct but overlapping interfaces. Finally, our structural studies have allowed us to model the conformation of a conserved loop (pore loop 2) that is predicted to form an arginine-rich pore at the center of one of the Vps4 hexameric rings. Our mutational analyses demonstrate that pore loop 2 residues Arg241 and Arg251 are required for efficient HIV-1 budding, thereby supporting a role for this 'arginine collar' in Vps4 function.

  12. Extracellular Polysaccharides Produced by Yeasts and Yeast-Like Fungi

    Science.gov (United States)

    van Bogaert, Inge N. A.; de Maeseneire, Sofie L.; Vandamme, Erick J.

    Several yeasts and yeast-like fungi are known to produce extracellular polysaccharides. Most of these contain D-mannose, either alone or in combination with other sugars or phosphate. A large chemical and structural variability is found between yeast species and even among different strains. The types of polymers that are synthesized can be chemically characterized as mannans, glucans, phosphoman-nans, galactomannans, glucomannans and glucuronoxylomannans. Despite these differences, almost all of the yeast exopolysaccharides display some sort of biological activity. Some of them have already applications in chemistry, pharmacy, cosmetics or as probiotic. Furthermore, some yeast exopolysaccharides, such as pullulan, exhibit specific physico-chemical and rheological properties, making them useful in a wide range of technical applications. A survey is given here of the production, the characteristics and the application potential of currently well studied yeast extracellular polysaccharides.

  13. Differentiation of Apical Bud Cells in a Newly Developed Apical Bud Transplantation Model Using GFP Transgenic Mice as Donor.

    Directory of Open Access Journals (Sweden)

    Naoki Maruo

    Full Text Available Rodent mandibular incisors have a unique anatomical structure that allows teeth to grow throughout the lifetime of the rodent. This report presents a novel transplantation technique for studying the apical bud differentiation of rodent mandibular incisors. Incisal apical end tissue with green fluorescent protein from transgenic mouse was transplanted to wild type mice, and the development of the transplanted cells were immunohistologically observed for 12 weeks after the transplantation. Results indicate that the green fluorescent apical end tissue replaced the original tissue, and cells from the apical bud differentiated and extended toward the incisal edge direction. The immunostaining with podoplanin also showed that the characteristics of the green fluorescent tissue were identical to those of the original. The green fluorescent cells were only found in the labial side of the incisor up to 4 weeks. After 12 weeks, however, they were also found in the lingual side. Here the green fluorescent cementocyte-like cells were only present in the cementum close to the dentin surface. This study suggests that some of the cells that form the cellular cementum come from the apical tissue including the apical bud in rodent incisors.

  14. Differentiation of Apical Bud Cells in a Newly Developed Apical Bud Transplantation Model Using GFP Transgenic Mice as Donor

    Science.gov (United States)

    Sakagami, Ryuji; Yoshinaga, Yasunori; Okamura, Kazuhiko

    2016-01-01

    Rodent mandibular incisors have a unique anatomical structure that allows teeth to grow throughout the lifetime of the rodent. This report presents a novel transplantation technique for studying the apical bud differentiation of rodent mandibular incisors. Incisal apical end tissue with green fluorescent protein from transgenic mouse was transplanted to wild type mice, and the development of the transplanted cells were immunohistologically observed for 12 weeks after the transplantation. Results indicate that the green fluorescent apical end tissue replaced the original tissue, and cells from the apical bud differentiated and extended toward the incisal edge direction. The immunostaining with podoplanin also showed that the characteristics of the green fluorescent tissue were identical to those of the original. The green fluorescent cells were only found in the labial side of the incisor up to 4 weeks. After 12 weeks, however, they were also found in the lingual side. Here the green fluorescent cementocyte-like cells were only present in the cementum close to the dentin surface. This study suggests that some of the cells that form the cellular cementum come from the apical tissue including the apical bud in rodent incisors. PMID:26978064

  15. Iron toxicity in yeast.

    Science.gov (United States)

    Wiśnicka, R; Krzepiłko, A; Wawryn, J; Biliński, T

    1997-01-01

    It has been found that yeast cells are sensitive to iron overload only when grown on glucose as a carbon source. Effective concentration of ferrous iron is much higher than that found in natural environments. Effects of ferrous iron are strictly oxygen dependent, what suggest that the formation of hydroxyl radicals in the Fenton reaction is a cause of the toxicity. Respiratory deficiency and pretreatment of cells with antimycin A prevent toxic effects in the late exponential phase of growth, whereas uncouplers and 2mM magnesium salts completely protect even the most vulnerable exponential cells. Generally, toxic effects correlate with the ability of cells to take up this metal. The results presented suggest that during ferrous iron overload iron is transported through the unspecific divalent cation uptake system which is known in fungi. The data suggest that recently described high and low affinity systems of iron uptake in yeast are the only source of iron in natural environments. PMID:9516981

  16. Strigolactone acts downstream of auxin to regulate bud outgrowth in pea and Arabidopsis.

    Science.gov (United States)

    Brewer, Philip B; Dun, Elizabeth A; Ferguson, Brett J; Rameau, Catherine; Beveridge, Christine A

    2009-05-01

    During the last century, two key hypotheses have been proposed to explain apical dominance in plants: auxin promotes the production of a second messenger that moves up into buds to repress their outgrowth, and auxin saturation in the stem inhibits auxin transport from buds, thereby inhibiting bud outgrowth. The recent discovery of strigolactone as the novel shoot-branching inhibitor allowed us to test its mode of action in relation to these hypotheses. We found that exogenously applied strigolactone inhibited bud outgrowth in pea (Pisum sativum) even when auxin was depleted after decapitation. We also found that strigolactone application reduced branching in Arabidopsis (Arabidopsis thaliana) auxin response mutants, suggesting that auxin may act through strigolactones to facilitate apical dominance. Moreover, strigolactone application to tiny buds of mutant or decapitated pea plants rapidly stopped outgrowth, in contrast to applying N-1-naphthylphthalamic acid (NPA), an auxin transport inhibitor, which significantly slowed growth only after several days. Whereas strigolactone or NPA applied to growing buds reduced bud length, only NPA blocked auxin transport in the bud. Wild-type and strigolactone biosynthesis mutant pea and Arabidopsis shoots were capable of instantly transporting additional amounts of auxin in excess of endogenous levels, contrary to predictions of auxin transport models. These data suggest that strigolactone does not act primarily by affecting auxin transport from buds. Rather, the primary repressor of bud outgrowth appears to be the auxin-dependent production of strigolactones. PMID:19321710

  17. The methyltransferase Setdb1 is essential for meiosis and mitosis in mouse oocytes and early embryos.

    Science.gov (United States)

    Eymery, Angeline; Liu, Zichuan; Ozonov, Evgeniy A; Stadler, Michael B; Peters, Antoine H F M

    2016-08-01

    Oocytes develop the competence for meiosis and early embryogenesis during their growth. Setdb1 is a histone H3 lysine 9 (H3K9) methyltransferase required for post-implantation development and has been implicated in the transcriptional silencing of genes and endogenous retroviral elements (ERVs). To address its role in oogenesis and pre-implantation development, we conditionally deleted Setdb1 in growing oocytes. Loss of Setdb1 expression greatly impaired meiosis. It delayed meiotic resumption, altered the dynamics of chromatin condensation, and impaired kinetochore-spindle interactions, bipolar spindle organization and chromosome segregation in more mature oocytes. The observed phenotypes related to changes in abundance of specific transcripts in mutant oocytes. Setdb1 maternally deficient embryos arrested during pre-implantation development and showed comparable defects during cell cycle progression and in chromosome segregation. Finally, transcriptional profiling data indicate that Setdb1 downregulates rather than silences expression of ERVK and ERVL-MaLR retrotransposons and associated chimearic transcripts during oogenesis. Our results identify Setdb1 as a newly discovered meiotic and embryonic competence factor safeguarding genome integrity at the onset of life. PMID:27317807

  18. Microtubule flux mediates poleward motion of acentric chromosome fragments during meiosis in insect spermatocytes.

    Science.gov (United States)

    LaFountain, J R; Oldenbourg, R; Cole, R W; Rieder, C L

    2001-12-01

    We applied a combination of laser microsurgery and quantitative polarization microscopy to study kinetochore-independent forces that act on chromosome arms during meiosis in crane fly spermatocytes. When chromosome arms located within one of the half-spindles during prometa- or metaphase were cut with the laser, the acentric fragments (lacking kinetochores) that were generated moved poleward with velocities similar to those of anaphase chromosomes (approximately 0.5 microm/min). To determine the mechanism underlying this poleward motion of detached arms, we treated spermatocytes with the microtubule-stabilizing drug taxol. Spindles in taxol-treated cells were noticeably short, yet with polarized light, the distribution and densities of microtubules in domains where fragment movement occurred were not different from those in control cells. When acentric fragments were generated in taxol-treated spermatocytes, 22 of 24 fragments failed to exhibit poleward motion, and the two that did move had velocities attenuated by 80% (to approximately 0.1 microm/min). In these cells, taxol did not inhibit the disjunction of chromosomes nor prevent their poleward segregation during anaphase, but the velocity of anaphase was also decreased 80% (approximately 0.1 microm/min) relative to untreated controls. Together, these data reveal that microtubule flux exerts pole-directed forces on chromosome arms during meiosis in crane fly spermatocytes and strongly suggest that the mechanism underlying microtubule flux also is used in the anaphase motion of kinetochores in these cells. PMID:11739800

  19. Meiosis in elephant grass (Pennisetum purpureum, pearl millet (Pennisetum glaucum (Poaceae, Poales and their interspecific hybrids

    Directory of Open Access Journals (Sweden)

    Vânia Helena Techio

    2006-01-01

    Full Text Available The cultivated and sexually compatible species Pennisetum purpureum (elephant grass, 2n = 4x = 28 and Pennisetum glaucum (pearl millet, 2n = 2x = 14 can undergo hybridization which favors the amplification of their genetic background and the introgression of favorable alleles into breeding programs. The main problem with interspecific hybrids of these species is infertility due to triploidy (2n = 3x = 21. This study describes meiosis in elephant grass x pearl millet hybrids and their progenitors. Panicles were prepared according to the conventional protocol for meiotic studies and Alexander’s stain was used for assessing pollen viability. Pearl millet accessions presented regular meiosis with seven bivalents and high pollen viability. For elephant grass, 14 bivalents in diakinesis and metaphase I were observed. The BAG 63 elephant grass accession, derived from tissue culture, presented a high frequency of meiotic abnormalities. The three hybrid accessions presented a high frequency of abnormalities characterized by irregular chromosomal segregation which resulted in the formation of sterile pollen.

  20. STAG3-mediated stabilization of REC8 cohesin complexes promotes chromosome synapsis during meiosis.

    Science.gov (United States)

    Fukuda, Tomoyuki; Fukuda, Nanaho; Agostinho, Ana; Hernández-Hernández, Abrahan; Kouznetsova, Anna; Höög, Christer

    2014-06-01

    Cohesion between sister chromatids in mitotic and meiotic cells is promoted by a ring-shaped protein structure, the cohesin complex. The cohesin core complex is composed of four subunits, including two structural maintenance of chromosome (SMC) proteins, one α-kleisin protein, and one SA protein. Meiotic cells express both mitotic and meiosis-specific cohesin core subunits, generating cohesin complexes with different subunit composition and possibly separate meiotic functions. Here, we have analyzed the in vivo function of STAG3, a vertebrate meiosis-specific SA protein. Mice with a hypomorphic allele of Stag3, which display a severely reduced level of STAG3, are viable but infertile. We show that meiocytes in homozygous mutant Stag3 mice display chromosome axis compaction, aberrant synapsis, impaired recombination and developmental arrest. We find that the three different α-kleisins present in meiotic cells show different dosage-dependent requirements for STAG3 and that STAG3-REC8 cohesin complexes have a critical role in supporting meiotic chromosome structure and functions. PMID:24797475

  1. When does maternal age-dependent trisomy 21 arise relative to meiosis?

    Energy Technology Data Exchange (ETDEWEB)

    Chang-Jiang Zheng [National Inst. of Deafness and Other Communication Disorders, Bethesda, MD (United States); Byers, B. [Univ. of Washington, Seattle, WA (United States)

    1996-07-01

    Polymorphic DNA markers have recently been used to estimate the fraction of trisomy 21 (Down syndrome) cases that may be attributable to postzygotic nondisjunction - indicative of a loss in the fidelity of the first few cell divisions after fertilization. In these studies, a postzygotic nondisjunction is defined as a case in which two chromosomes of the trisomic set are homozygous for all informative markers (i.e., for those markers that were heterozygous in their parent of origin). These studies estimate that the postzygotic mutation mechanism accounts for 4.5% (11/238) and 3.5% (9/255) of their cases, respectively, but their estimates may actually be conservative, since all noninformative haplotypes (frequency not reported) are arbitrarily attributed to meiosis II-type nondisjunction. Nevertheless, even the conservative estimates would, if confirmed, constitute a new and nonnegligible source of chromosomal segregation errors leading to trisomy. These studies` conclusions are supported by the observation that the 20 reported {open_quotes}postzygotic{close_quotes} cases (5 paternal and 15 maternal) appear to be less dependent on maternal age (mean maternal age 28.4 years) than maternal meiosis I-type failures (mean maternal age 31.2 years). However, given the limited sample size involved, one should be cautious in positing the absence of a maternal age effect. 5 refs., 1 fig.

  2. Meiosis in a triploid hybrid of Gossypium: high frequency of secondary bipolar spindles at metaphase II

    Indian Academy of Sciences (India)

    Mosareza Vafaie-Tabar; Shanti Chandrashekaran

    2007-01-01

    Studies on meiosis in pollen mother cells (PMCs) of a triploid interspecific hybrid ($3x = 39$ chromosomes, AAD) between tetraploid Gossypium hirsutum ($4n = 2x = 52$,AADD) and diploid G. arboreum ($2n = 2x = 26$,AA) are reported. During meiotic metaphase I, 13 AA bivalents and 13 D univalents are expected in the hybrid. However, only 28% of the PMCs had this expected configuration. The rest of the PMCs had between 8 and 12 bivalents and between 12 and 17 univalents. Univalents lagged at anaphase I, and at metaphase II one or a group of univalents remained scattered in the cytoplasm and failed to assemble at a single metaphase plate. Primary bipolar spindles organized around the bivalents and multivalents. In addition to the primary spindle, several secondary and smaller bipolar spindles organized themselves around individual univalents and groups of univalents. Almost all (97%) of the PMCs showed secondary spindles. Each spindle functioned independently and despite their multiple numbers in a cell, meiosis I proceeded normally, with polyad formation. These observations strongly support the view that in plant meiocytes bilateral kinetochore symmetry is not required for establishing a bipolar spindle and that single unpaired chromosomes can initiate and stabilize the formation of a functional bipolar spindle.

  3. The synaptonemal complex of basal metazoan hydra: more similarities to vertebrate than invertebrate meiosis model organisms.

    Science.gov (United States)

    Fraune, Johanna; Wiesner, Miriam; Benavente, Ricardo

    2014-03-20

    The synaptonemal complex (SC) is an evolutionarily well-conserved structure that mediates chromosome synapsis during prophase of the first meiotic division. Although its structure is conserved, the characterized protein components in the current metazoan meiosis model systems (Drosophila melanogaster, Caenorhabditis elegans, and Mus musculus) show no sequence homology, challenging the question of a single evolutionary origin of the SC. However, our recent studies revealed the monophyletic origin of the mammalian SC protein components. Many of them being ancient in Metazoa and already present in the cnidarian Hydra. Remarkably, a comparison between different model systems disclosed a great similarity between the SC components of Hydra and mammals while the proteins of the ecdysozoan systems (D. melanogaster and C. elegans) differ significantly. In this review, we introduce the basal-branching metazoan species Hydra as a potential novel invertebrate model system for meiosis research and particularly for the investigation of SC evolution, function and assembly. Also, available methods for SC research in Hydra are summarized. PMID:24656231

  4. Karyotype, heterochromatin distribution and meiosis of Zabrotes subfasciatus (Bohemann) (Coleoptera: Chrysomelidae, Bruchinae).

    Science.gov (United States)

    Corrêa, Ronan X; Pompolo, Sílvia G; Santos, Igor S; Silva, Janisete G; Costa, Marco A

    2008-01-01

    Zabrotes subfasciatus (Boh.) has been extensively studied in its agronomic and biochemical aspects due to its importance as a damaging insect to leguminous grains during storage. The few cytogenetic studies published on this species yielded conflicting results. In this study, the karyotype was analyzed in order to accurately describe the chromosome C-banding patterns and meiosis. The brain ganglion at the prepupa and the adult and pupal testes were analyzed. All individuals had 26 chromosomes in both brain ganglion and spermatogonic mitotic metaphases. These chromosomes were classified as follows: the 12th pair and the Y chromosome were telocentric; the X chromosome was acrocentric; the 4th and 5th pairs were submetacentric; and the remaining pairs were all metacentric. One of the members of the 5th pair presented a secondary constriction. All chromosomes presented pericentromeric heterochromatin. The large arms of the pairs 5, 9 and X presented heterochromatin. The X chromosome showed to be heteropyknotic throughout the prophase of the first meiotic division. The subphases of prophase I were atypical and meiosis II was rarely identified. Testes of all males showed a few cells; the bivalents were rod-like shaped in metaphase I. Karyological formulae were 2n = 24 + XX in females and 2n = 24 + XYp and either n = 12 + X or n = 12 + Y in males. PMID:19061039

  5. Karyotype, heterochromatin distribution and meiosis of Zabrotes subfasciatus (Bohemann) (Coleoptera: Chrysomelidae, Bruchinae)

    Energy Technology Data Exchange (ETDEWEB)

    Correa, Ronan X.; Santos, Igor S.; Silva, Janisete G.; Costa, Marco A. [Universidade Estadual de Santa Cruz, Ilheus, BA (Brazil). Dept. de Ciencias Biologicas; Pompolo, Silvia G. [Universidade Federal de Vicosa, MG (Brazil). Dept. de Biologia Geral

    2008-09-15

    Zabrotes subfasciatus (Boh.) has been extensively studied in its agronomic and biochemical aspects due to its importance as a damaging insect to leguminous grains during storage. The few cytogenetic studies published on this species yielded conflicting results. In this study, the karyotype was analyzed in order to accurately describe the chromosome C-banding patterns and meiosis. The brain ganglion at the pre pupa and the adult and pupal testes were analyzed. All individuals had 26 chromosomes in both brain ganglion and spermatogonic mitotic metaphases. These chromosomes were classified as follows: the 12{sup th} pair and the Y chromosome were telocentric; the X chromosome was acrocentric; the 4{sup th} and 5{sup th} pairs were sub metacentric; and the remaining pairs were all metacentric. One of the members of the 5{sup th} pair presented a secondary constriction. All chromosomes presented pericentromeric heterochromatin. The large arms of the pairs 5, 9 and X presented heterochromatin. The X chromosome showed to be heteropyknotic throughout the prophase of the fi rst meiotic division. The sub phases of prophase I were atypical and meiosis II was rarely identified. Testes of all males showed a few cells; the bivalents were rod-like shaped in metaphase I. Karyological formulae were 2n = 24 + XX in females and 2n = 24 + XYp and either n = 12 + X or n = 12 + Y in males. (author)

  6. Genome-wide analysis of gene expression in primate taste buds reveals links to diverse processes.

    Directory of Open Access Journals (Sweden)

    Peter Hevezi

    Full Text Available Efforts to unravel the mechanisms underlying taste sensation (gustation have largely focused on rodents. Here we present the first comprehensive characterization of gene expression in primate taste buds. Our findings reveal unique new insights into the biology of taste buds. We generated a taste bud gene expression database using laser capture microdissection (LCM procured fungiform (FG and circumvallate (CV taste buds from primates. We also used LCM to collect the top and bottom portions of CV taste buds. Affymetrix genome wide arrays were used to analyze gene expression in all samples. Known taste receptors are preferentially expressed in the top portion of taste buds. Genes associated with the cell cycle and stem cells are preferentially expressed in the bottom portion of taste buds, suggesting that precursor cells are located there. Several chemokines including CXCL14 and CXCL8 are among the highest expressed genes in taste buds, indicating that immune system related processes are active in taste buds. Several genes expressed specifically in endocrine glands including growth hormone releasing hormone and its receptor are also strongly expressed in taste buds, suggesting a link between metabolism and taste. Cell type-specific expression of transcription factors and signaling molecules involved in cell fate, including KIT, reveals the taste bud as an active site of cell regeneration, differentiation, and development. IKBKAP, a gene mutated in familial dysautonomia, a disease that results in loss of taste buds, is expressed in taste cells that communicate with afferent nerve fibers via synaptic transmission. This database highlights the power of LCM coupled with transcriptional profiling to dissect the molecular composition of normal tissues, represents the most comprehensive molecular analysis of primate taste buds to date, and provides a foundation for further studies in diverse aspects of taste biology.

  7. Ultrastructure of methanotrophic yeasts.

    OpenAIRE

    Wolf, H. J.; Christiansen, M.; Hanson, R. S.

    1980-01-01

    The cellular structure of two yeast strains capable of growth on methane was investigated by electron microscopy. Microbodies were observed in cells of Sporobolomyces roseus strain Y and Rhodotorula glutinis strain CY when grown on methane but rarely when grown on glucose. The size of the microbodies and the number observed per cell in a thin section did not increase with culture age. No crystalline organization was observed within these organelles. Similar microbodies were also observed in c...

  8. Fungal spore germination into yeast or mycelium: possible implications of dimorphism in evolution and human pathogenesis

    Science.gov (United States)

    Ghormade, Vandana; Deshpande, M. V.

    The ability of dimorphism in fungi is conventionally regarded as a reversible change between the two vegetative forms, yeast and mycelium, in response to environmental change. A zygomycetous isolate, Benjaminiella poitrasii, exhibited yeast-mycelium transition in response to the change in temperature (37-28 °C) and decrease in glucose concentration. For the first time the presence of dimorphic response during asexual and sexual spore germination is reported under the dimorphism-triggering conditions in B. poitrasii. The zygospores germinated into budding yeast when subjected to yeast-form supporting conditions. The mycelium-form favoring conditions gave rise to true mycelium. Similarly, the asexual spores displayed a dimorphic response during germination. Our observations suggest that dimorphism is an intrinsic ability present in the vegetative, asexual, and sexual forms of the fungus. As dimorphic fungi are intermediate to the unicellular yeast and the filamentous forms, understanding of the dimorphic character could be useful to trace the evolutionary relationships among taxonomically different fungi. Moreover, the implications of spore germination during the onset of pathogenesis and in drug development for human health care are discussed.

  9. Off-target effects of psychoactive drugs revealed by genome-wide assays in yeast.

    Directory of Open Access Journals (Sweden)

    Elke Ericson

    Full Text Available To better understand off-target effects of widely prescribed psychoactive drugs, we performed a comprehensive series of chemogenomic screens using the budding yeast Saccharomyces cerevisiae as a model system. Because the known human targets of these drugs do not exist in yeast, we could employ the yeast gene deletion collections and parallel fitness profiling to explore potential off-target effects in a genome-wide manner. Among 214 tested, documented psychoactive drugs, we identified 81 compounds that inhibited wild-type yeast growth and were thus selected for genome-wide fitness profiling. Many of these drugs had a propensity to affect multiple cellular functions. The sensitivity profiles of half of the analyzed drugs were enriched for core cellular processes such as secretion, protein folding, RNA processing, and chromatin structure. Interestingly, fluoxetine (Prozac interfered with establishment of cell polarity, cyproheptadine (Periactin targeted essential genes with chromatin-remodeling roles, while paroxetine (Paxil interfered with essential RNA metabolism genes, suggesting potential secondary drug targets. We also found that the more recently developed atypical antipsychotic clozapine (Clozaril had no fewer off-target effects in yeast than the typical antipsychotics haloperidol (Haldol and pimozide (Orap. Our results suggest that model organism pharmacogenetic studies provide a rational foundation for understanding the off-target effects of clinically important psychoactive agents and suggest a rational means both for devising compound derivatives with fewer side effects and for tailoring drug treatment to individual patient genotypes.

  10. Yeast Interacting Proteins Database: YLR319C, YGL015C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available ion and polarized cell growth; isolated as bipolar budding mutant; potential Cdc28p substrate Rows with this...in actin cable nucleation and polarized cell growth; isolated as bipolar budding mutant; potential Cdc28p su

  11. Soft X-Ray Diffraction Microscopy of a Frozen Hydrated Yeast Cell

    OpenAIRE

    Huang, Xiaojing; Nelson, Johanna; Kirz, Janos; Lima, Enju; Marchesini, Stefano; Miao, Huijie; Neiman, Aaron M.; Shapiro, David; Steinbrener, Jan; Stewart, Andrew; Turner, Joshua J.; Jacobsen, Chris

    2009-01-01

    We report the first image of an intact, frozen hydrated eukaryotic cell using x-ray diffraction microscopy, or coherent x-ray diffraction imaging. By plunge freezing the specimen in liquid ethane and maintaining it below −170 °C, artifacts due to dehydration, ice crystallization, and radiation damage are greatly reduced. In this example, coherent diffraction data using 520 eV x rays were recorded and reconstructed to reveal a budding yeast cell at a resolution better than 25 nm. This demonstr...

  12. A sphingolipid-dependent diffusion barrier confines ER stress to the yeast mother cell

    OpenAIRE

    Lori Clay; Fabrice Caudron; Annina Denoth-Lippuner; Barbara Boettcher; St\\xfdphanie Buvelot Frei; Erik Lee Snapp; Yves Barral

    2014-01-01

    eLife digest Cell division isn't always about splitting a cell into two identical parts. The diversity of many of our own cells relies on asymmetric cell divisions. The yeast used to make bread rely on a process called ‘budding’ that involves a small daughter cell emerging from the surface of the mother cell. Mother cells can only produce around 20–50 daughter cells before dying from old age. However, their daughters are always born rejuvenated, and not aged like their mothers. Budding involv...

  13. Association of a centromere specific nucleosome with the yeast plasmid partitioning locus: Implications beyond plasmid partitioning

    OpenAIRE

    Jayaram, Makkuni

    2011-01-01

    The genetically defined point centromeres of budding yeasts and the epigenetically specified regional centromeres of all other eukaryotes harbor a common epigenetic mark in the form of a non-standard nucleosome. Although, the composition of the protein core of the centromere specific nucleosome and the nature of the DNA wrap around it are at present controversial, there is no doubt that this specialized nucleosome harbors a variant of the standard histone H3 (cenH3). The association of cenH3,...

  14. Bimolecular Fluorescence Complementation to Assay the Interactions of Ubiquitylation Enzymes in Living Yeast Cells.

    Science.gov (United States)

    Blaszczak, Ewa; Prigent, Claude; Rabut, Gwenaël

    2016-01-01

    Ubiquitylation is a versatile posttranslational protein modification catalyzed through the concerted action of ubiquitin-conjugating enzymes (E2s) and ubiquitin ligases (E3s). These enzymes form transient complexes with each other and their modification substrates and determine the nature of the ubiquitin signals attached to their substrates. One challenge in the field of protein ubiquitylation is thus to identify the E2-E3 pairs that function in the cell. In this chapter, we describe the use of bimolecular fluorescence complementation to assay E2-E3 interactions in living cells, using budding yeast as a model organism. PMID:27613039

  15. Rif1 supports the function of the CST complex in yeast telomere capping

    OpenAIRE

    S. Anbalagan; Bonetti, D; Lucchini, G; Longhese, MP

    2011-01-01

    Background: Telomere integrity in budding yeast depends on the CST (Cdc13-Stn1-Ten1) and shelterin-like (Rap1-Rif1-Rif2) complexes, which are thought to act independently from each other. Methodology: Here we show that a specific functional interaction indeed exists among components of the two complexes. In particular, unlike RIF2 deletion, the lack of Rif1 is lethal for stn1ΔC cells and causes a dramatic reduction in viability of cdc13-1 and cdc13-5 mutants. This synthetic interaction ...

  16. Membrane tension is a key determinant of bud morphology in clathrin-mediated endocytosis

    CERN Document Server

    Hassinger, Julian E; Drubin, David G; Rangamani, Padmini

    2016-01-01

    In clathrin-mediated endocytosis (CME), clathrin and various adaptor proteins coat a patch of the plasma membrane, which is reshaped to form a budded vesicle. Experimental studies have demonstrated that elevated membrane tension can inhibit bud formation by a clathrin coat. In this study, we investigate the impact of membrane tension on the mechanics of membrane budding by simulating clathrin coats that either grow in area or progressively induce greater curvature. At low membrane tension, progressively increasing the area of a curvature-generating coat causes the membrane to smoothly evolve from a flat to budded morphology, whereas the membrane remains essentially flat at high membrane tensions. Interestingly, at physiologically relevant, intermediate membrane tensions, the shape evolution of the membrane undergoes a snapthrough instability in which increasing coat area causes the membrane to "snap" from an open, U-shaped bud to a closed, $\\Omega$-shaped bud. This instability is accompanied by a large energy...

  17. Flavour-active wine yeasts

    OpenAIRE

    Cordente, Antonio G.; Curtin, Christopher D.; Varela, Cristian; Pretorius, Isak S.

    2012-01-01

    The flavour of fermented beverages such as beer, cider, saké and wine owe much to the primary fermentation yeast used in their production, Saccharomyces cerevisiae. Where once the role of yeast in fermented beverage flavour was thought to be limited to a small number of volatile esters and higher alcohols, the discovery that wine yeast release highly potent sulfur compounds from non-volatile precursors found in grapes has driven researchers to look more closely at how choice of yeast can infl...

  18. Yeast Interacting Proteins Database: YNL078W, YKR048C [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available YNL078W NIS1 Protein localized in the bud neck at G2/M phase; physically interacts with septins; ... Clb2p; required for the regulation of microtubule dynamics ... during mitosis; controls bud morphogenesis; involv ... Clb2p; required for the regulation of microtubule dynamics ... during mitosis; controls bud morphogenesis; involv ...

  19. Characterization of membrane occupation and recognition nexus repeat containing 3, meiosis expressed gene 1 binding partner, in mouse male germ cells

    Institute of Scientific and Technical Information of China (English)

    Ling Zhang; ZhiBing Zhang; XueJun Shang; HongFei Li; YuQin Shi; Wei Li; Maria E Teves; ZhiQiong Wang; GaoFeng Jiang; ShiZhen Song

    2015-01-01

    Mammalian spermatogenesis is a well‑organized process of cell development and differentiation. Meiosis expressed gene 1 (MEIG1) plays an essential role in the regulation of spermiogenesis. To explore potential mechanisms of MEIG1’s action, a yeast two‑hybrid screen was conducted, and several potential binding partners were identified; one of them was membrane occupation and recognition nexus repeat containing 3 (MORN3). MORN3 mRNA is only abundant in mouse testis. In the testis, Morn3 mRNA is highly expressed in the spermiogenesis stage. Specific anti‑MORN3 polyclonal antibody was generated against N‑terminus of the full‑length MORN3 protein, and MORN3 expression and localization was examined in vitro and in vivo. In transfected Chinese hamster ovary cells, the antibody specifically crossed‑reacted the full‑length MORN3 protein, and immunofluorescence staining revealed that MORN3 was localized throughout the cytoplasm. Among multiple mouse tissues, about 25 kDa protein, was identified only in the testis. The protein was highly expressed after day 20 of birth. Immunofluorescence staining on mixed testicular cells isolated from adult wild‑type mice demonstrated that MORN3 was expressed in the acrosome in germ cells throughout spermiogenesis. The protein was also present in the manchette of elongating spermatids. The total MORN3 expression and acrosome localization were not changed in the Meig 1‑deficient mice. However, its expression in manchette was dramatically reduced in the mutant mice. Our studies suggest that MORN3 is another regulator for spermatogenesis, probably together with MEIG1.

  20. Distribution pattern of histone H3 phosphorylation at serine 10 during mitosis and meiosis in Brachiaria species

    Indian Academy of Sciences (India)

    C. M. P. Paula; V. H. Techio; F. Souza Sobrinho; A. S. Freitas

    2013-08-01

    Histones are the major eukaryotic DNA-binding proteins. Posttranslational modifications on N-terminal tails of histones that form nucleosomes are often associated with distinct biological functions. Some theories suggest that one of these modifications, the phosphorylation of histone H3 at serine 10 (H3S10ph) plays a role in both chromosome condensation and sister chromatid cohesion. Although histones and some of their modifications are highly conserved, studies have shown that role and distribution of H3S10ph may differ between species. We evaluated the pattern of H3 phosphorylation using immunodetection during mitosis and meiosis in both diploid and tetraploid genotypes of Brachiaria species. Results revealed differences in chromosome distribution of H3S10ph when mitosis and meiosis were compared. Whole chromosomes were phosphorylated during meiosis I, whereas phosphorylation was restricted to the pericentromeric region in both meiosis II and mitosis. There was no variation in phosphorylation patterns between Brachiaria species and diploid and tetraploid genotypes. Regarding spatiotemporal coordination in the Brachiaria species evaluated, H3S10ph is related to maintenance of sister chromatid cohesion during cell divisions.