WorldWideScience

Sample records for budding yeast meiosis

  1. A nutrient dependant switch explains mutually exclusive existence of meiosis and mitosis initiation in budding yeast.

    Science.gov (United States)

    Wannige, C T; Kulasiri, D; Samarasinghe, S

    2014-01-21

    Nutrients from living environment are vital for the survival and growth of any organism. Budding yeast diploid cells decide to grow by mitosis type cell division or decide to create unique, stress resistant spores by meiosis type cell division depending on the available nutrient conditions. To gain a molecular systems level understanding of the nutrient dependant switching between meiosis and mitosis initiation in diploid cells of budding yeast, we develop a theoretical model based on ordinary differential equations (ODEs) including the mitosis initiator and its relations to budding yeast meiosis initiation network. Our model accurately and qualitatively predicts the experimentally revealed temporal variations of related proteins under different nutrient conditions as well as the diverse mutant studies related to meiosis and mitosis initiation. Using this model, we show how the meiosis and mitosis initiators form an all-or-none type bistable switch in response to available nutrient level (mainly nitrogen). The transitions to and from meiosis or mitosis initiation states occur via saddle node bifurcation. This bidirectional switch helps the optimal usage of available nutrients and explains the mutually exclusive existence of meiosis and mitosis pathways. © 2013 Elsevier Ltd. All rights reserved.

  2. Cdc7-Dbf4 Regulates NDT80 Transcription as Well as Reductional Segregation during Budding Yeast Meiosis

    OpenAIRE

    Lo, Hsiao-Chi; Wan, Lihong; Rosebrock, Adam; Futcher, Bruce; Hollingsworth, Nancy M.

    2008-01-01

    In budding yeast, as in other eukaryotes, the Cdc7 protein kinase is important for initiation of DNA synthesis in vegetative cells. In addition, Cdc7 has crucial meiotic functions: it facilitates premeiotic DNA replication, and it is essential for the initiation of recombination. This work uses a chemical genetic approach to demonstrate that Cdc7 kinase has additional roles in meiosis. First, Cdc7 allows expression of NDT80, a meiosis-specific transcriptional activator required for the induct...

  3. Cdc7-Dbf4 regulates NDT80 transcription as well as reductional segregation during budding yeast meiosis.

    Science.gov (United States)

    Lo, Hsiao-Chi; Wan, Lihong; Rosebrock, Adam; Futcher, Bruce; Hollingsworth, Nancy M

    2008-11-01

    In budding yeast, as in other eukaryotes, the Cdc7 protein kinase is important for initiation of DNA synthesis in vegetative cells. In addition, Cdc7 has crucial meiotic functions: it facilitates premeiotic DNA replication, and it is essential for the initiation of recombination. This work uses a chemical genetic approach to demonstrate that Cdc7 kinase has additional roles in meiosis. First, Cdc7 allows expression of NDT80, a meiosis-specific transcriptional activator required for the induction of genes involved in exit from pachytene, meiotic progression, and spore formation. Second, Cdc7 is necessary for recruitment of monopolin to sister kinetochores, and it is necessary for the reductional segregation occurring at meiosis I. The use of the same kinase to regulate several distinct meiosis-specific processes may be important for the coordination of these processes during meiosis.

  4. Cdc7-Dbf4 Regulates NDT80 Transcription as Well as Reductional Segregation during Budding Yeast Meiosis

    Science.gov (United States)

    Lo, Hsiao-Chi; Wan, Lihong; Rosebrock, Adam; Futcher, Bruce

    2008-01-01

    In budding yeast, as in other eukaryotes, the Cdc7 protein kinase is important for initiation of DNA synthesis in vegetative cells. In addition, Cdc7 has crucial meiotic functions: it facilitates premeiotic DNA replication, and it is essential for the initiation of recombination. This work uses a chemical genetic approach to demonstrate that Cdc7 kinase has additional roles in meiosis. First, Cdc7 allows expression of NDT80, a meiosis-specific transcriptional activator required for the induction of genes involved in exit from pachytene, meiotic progression, and spore formation. Second, Cdc7 is necessary for recruitment of monopolin to sister kinetochores, and it is necessary for the reductional segregation occurring at meiosis I. The use of the same kinase to regulate several distinct meiosis-specific processes may be important for the coordination of these processes during meiosis. PMID:18768747

  5. Cdc14 phosphatase directs centrosome re-duplication at the meiosis I to meiosis II transition in budding yeast [version 2; referees: 3 approved, 1 approved with reservations

    Directory of Open Access Journals (Sweden)

    Colette Fox

    2017-02-01

    Full Text Available Background Gametes are generated through a specialized cell division called meiosis, in which ploidy is reduced by half because two consecutive rounds of chromosome segregation, meiosis I and meiosis II, occur without intervening DNA replication. This contrasts with the mitotic cell cycle where DNA replication and chromosome segregation alternate to maintain the same ploidy. At the end of mitosis, cyclin-dependent kinases (CDKs are inactivated. This low CDK state in late mitosis/G1 allows for critical preparatory events for DNA replication and centrosome/spindle pole body (SPB duplication. However, their execution is inhibited until S phase, where further preparatory events are also prevented. This “licensing” ensures that both the chromosomes and the centrosomes/SPBs replicate exactly once per cell cycle, thereby maintaining constant ploidy. Crucially, between meiosis I and meiosis II, centrosomes/SPBs must be re-licensed, but DNA re-replication must be avoided. In budding yeast, the Cdc14 protein phosphatase triggers CDK down regulation to promote exit from mitosis. Cdc14 also regulates the meiosis I to meiosis II transition, though its mode of action has remained unclear. Methods Fluorescence and electron microscopy was combined with proteomics to probe SPB duplication in cells with inactive or hyperactive Cdc14. Results We demonstrate that Cdc14 ensures two successive nuclear divisions by re-licensing SPBs at the meiosis I to meiosis II transition. We show that Cdc14 is asymmetrically enriched on a single SPB during anaphase I and provide evidence that this enrichment promotes SPB re-duplication. Cells with impaired Cdc14 activity fail to promote extension of the SPB half-bridge, the initial step in morphogenesis of a new SPB. Conversely, cells with hyper-active Cdc14 duplicate SPBs, but fail to induce their separation. Conclusion Our findings implicate reversal of key CDK-dependent phosphorylations in the differential licensing of

  6. Frequent and efficient use of the sister chromatid for DNA double-strand break repair during budding yeast meiosis.

    Directory of Open Access Journals (Sweden)

    Tamara Goldfarb

    2010-10-01

    Full Text Available Recombination between homologous chromosomes of different parental origin (homologs is necessary for their accurate segregation during meiosis. It has been suggested that meiotic inter-homolog recombination is promoted by a barrier to inter-sister-chromatid recombination, imposed by meiosis-specific components of the chromosome axis. Consistent with this, measures of Holliday junction-containing recombination intermediates (joint molecules [JMs] show a strong bias towards inter-homolog and against inter-sister JMs. However, recombination between sister chromatids also has an important role in meiosis. The genomes of diploid organisms in natural populations are highly polymorphic for insertions and deletions, and meiotic double-strand breaks (DSBs that form within such polymorphic regions must be repaired by inter-sister recombination. Efforts to study inter-sister recombination during meiosis, in particular to determine recombination frequencies and mechanisms, have been constrained by the inability to monitor the products of inter-sister recombination. We present here molecular-level studies of inter-sister recombination during budding yeast meiosis. We examined events initiated by DSBs in regions that lack corresponding sequences on the homolog, and show that these DSBs are efficiently repaired by inter-sister recombination. This occurs with the same timing as inter-homolog recombination, but with reduced (2- to 3-fold yields of JMs. Loss of the meiotic-chromosome-axis-associated kinase Mek1 accelerates inter-sister DSB repair and markedly increases inter-sister JM frequencies. Furthermore, inter-sister JMs formed in mek1Δ mutants are preferentially lost, while inter-homolog JMs are maintained. These findings indicate that inter-sister recombination occurs frequently during budding yeast meiosis, with the possibility that up to one-third of all recombination events occur between sister chromatids. We suggest that a Mek1-dependent reduction in

  7. Ndj1, a telomere-associated protein, regulates centrosome separation in budding yeast meiosis

    Science.gov (United States)

    Li, Ping; Shao, Yize; Jin, Hui

    2015-01-01

    Yeast centrosomes (called spindle pole bodies [SPBs]) remain cohesive for hours during meiotic G2 when recombination takes place. In contrast, SPBs separate within minutes after duplication in vegetative cells. We report here that Ndj1, a previously known meiosis-specific telomere-associated protein, is required for protecting SPB cohesion. Ndj1 localizes to the SPB but dissociates from it ∼16 min before SPB separation. Without Ndj1, meiotic SPBs lost cohesion prematurely, whereas overproduction of Ndj1 delayed SPB separation. When produced ectopically in vegetative cells, Ndj1 caused SPB separation defects and cell lethality. Localization of Ndj1 to the SPB depended on the SUN domain protein Mps3, and removal of the N terminus of Mps3 allowed SPB separation and suppressed the lethality of NDJ1-expressing vegetative cells. Finally, we show that Ndj1 forms oligomeric complexes with Mps3, and that the Polo-like kinase Cdc5 regulates Ndj1 protein stability and SPB separation. These findings reveal the underlying mechanism that coordinates yeast centrosome dynamics with meiotic telomere movement and cell cycle progression. PMID:25897084

  8. The protein expression landscape of mitosis and meiosis in diploid budding yeast.

    Science.gov (United States)

    Becker, Emmanuelle; Com, Emmanuelle; Lavigne, Régis; Guilleux, Marie-Hélène; Evrard, Bertrand; Pineau, Charles; Primig, Michael

    2017-03-06

    Saccharomyces cerevisiae is an established model organism for the molecular analysis of fundamental biological processes. The genomes of numerous strains have been sequenced, and the transcriptome and proteome ofmajor phases during the haploid and diploid yeast life cycle have been determined. However, much less is known about dynamic changes of the proteome when cells switch from mitotic growth to meiotic development. We report a quantitative protein profiling analysis of yeast cell division and differentiation based on mass spectrometry. Information about protein levels was integrated with strand-specific tiling array expression data. We identified a total of 2366 proteins in at least one condition, including 175 proteins showing a statistically significant>5-fold change across the sample set, and 136 proteins detectable in sporulating but not respiring cells. We correlate protein expression patterns with biological processes and molecular function by Gene Ontology term enrichment, chemoprofiling, transcription interference and the formation of double stranded RNAs by overlapping sense/antisense transcripts. Our work provides initial quantitative insight into protein expression in diploid respiring and differentiating yeast cells. Critically, it associates developmentally regulated induction of antisense long noncoding RNAs and double stranded RNAs with fluctuating protein concentrations during growth and development. This integrated genomics analysis helps better understand how the transcriptome and the proteome correlate in diploid yeast cells undergoing mitotic growth in the presence of acetate (respiration) versus meiotic differentiation (Meiosis I and II). The study (i) provides quantitative expression data for 2366 proteins and their cognate mRNAs in at least one sample, (ii) shows strongly fluctuating protein levels during growth and differentiation for 175 cases, and (iii) identifies 136 proteins absent in mitotic but present in meiotic yeast cells. We

  9. Separable Crossover-Promoting and Crossover-Constraining Aspects of Zip1 Activity during Budding Yeast Meiosis.

    Directory of Open Access Journals (Sweden)

    Karen Voelkel-Meiman

    2015-06-01

    Full Text Available Accurate chromosome segregation during meiosis relies on the presence of crossover events distributed among all chromosomes. MutSγ and MutLγ homologs (Msh4/5 and Mlh1/3 facilitate the formation of a prominent group of meiotic crossovers that mature within the context of an elaborate chromosomal structure called the synaptonemal complex (SC. SC proteins are required for intermediate steps in the formation of MutSγ-MutLγ crossovers, but whether the assembled SC structure per se is required for MutSγ-MutLγ-dependent crossover recombination events is unknown. Here we describe an interspecies complementation experiment that reveals that the mature SC is dispensable for the formation of Mlh3-dependent crossovers in budding yeast. Zip1 forms a major structural component of the budding yeast SC, and is also required for MutSγ and MutLγ-dependent crossover formation. Kluyveromyces lactis ZIP1 expressed in place of Saccharomyces cerevisiae ZIP1 in S. cerevisiae cells fails to support SC assembly (synapsis but promotes wild-type crossover levels in those nuclei that progress to form spores. While stable, full-length SC does not assemble in S. cerevisiae cells expressing K. lactis ZIP1, aggregates of K. lactis Zip1 displayed by S. cerevisiae meiotic nuclei are decorated with SC-associated proteins, and K. lactis Zip1 promotes the SUMOylation of the SC central element protein Ecm11, suggesting that K. lactis Zip1 functionally interfaces with components of the S. cerevisiae synapsis machinery. Moreover, K. lactis Zip1-mediated crossovers rely on S. cerevisiae synapsis initiation proteins Zip3, Zip4, Spo16, as well as the Mlh3 protein, as do the crossovers mediated by S. cerevisiae Zip1. Surprisingly, however, K. lactis Zip1-mediated crossovers are largely Msh4/Msh5 (MutSγ-independent. This separation-of-function version of Zip1 thus reveals that neither assembled SC nor MutSγ is required for Mlh3-dependent crossover formation per se in budding yeast

  10. A switch from a gradient to a threshold mode in the regulation of a transcriptional cascade promotes robust execution of meiosis in budding yeast.

    Directory of Open Access Journals (Sweden)

    Vyacheslav Gurevich

    Full Text Available Tight regulation of developmental pathways is of critical importance to all organisms, and is achieved by a transcriptional cascade ensuring the coordinated expression of sets of genes. We aimed to explore whether a strong signal is required to enter and complete a developmental pathway, by using meiosis in budding yeast as a model. We demonstrate that meiosis in budding yeast is insensitive to drastic changes in the levels of its consecutive positive regulators (Ime1, Ime2, and Ndt80. Entry into DNA replication is not correlated with the time of transcription of the early genes that regulate this event. Entry into nuclear division is directly regulated by the time of transcription of the middle genes, as premature transcription of their activator NDT80, leads to a premature entry into the first meiotic division, and loss of coordination between DNA replication and nuclear division. We demonstrate that Cdk1/Cln3 functions as a negative regulator of Ime2, and that ectopic expression of Cln3 delays entry into nuclear division as well as NDT80 transcription. Because Ime2 functions as a positive regulator for premeiotic DNA replication and NDT80 transcription, as well as a negative regulator of Cdk/Cln, we suggest that a double negative feedback loop between Ime2 and Cdk1/Cln3 promotes a bistable switch from the cell cycle to meiosis. Moreover, our results suggest a regulatory mode switch that ensures robust meiosis as the transcription of the early meiosis-specific genes responds in a graded mode to Ime1 levels, whereas that of the middle and late genes as well as initiation of DNA replication, are regulated in a threshold mode.

  11. Cleavage of the SUN-domain protein Mps3 at its N-terminus regulates centrosome disjunction in budding yeast meiosis.

    Directory of Open Access Journals (Sweden)

    Ping Li

    2017-06-01

    Full Text Available Centrosomes organize microtubules and are essential for spindle formation and chromosome segregation during cell division. Duplicated centrosomes are physically linked, but how this linkage is dissolved remains unclear. Yeast centrosomes are tethered by a nuclear-envelope-attached structure called the half-bridge, whose components have mammalian homologues. We report here that cleavage of the half-bridge protein Mps3 promotes accurate centrosome disjunction in budding yeast. Mps3 is a single-pass SUN-domain protein anchored at the inner nuclear membrane and concentrated at the nuclear side of the half-bridge. Using the unique feature in yeast meiosis that centrosomes are linked for hours before their separation, we have revealed that Mps3 is cleaved at its nucleus-localized N-terminal domain, the process of which is regulated by its phosphorylation at serine 70. Cleavage of Mps3 takes place at the yeast centrosome and requires proteasome activity. We show that noncleavable Mps3 (Mps3-nc inhibits centrosome separation during yeast meiosis. In addition, overexpression of mps3-nc in vegetative yeast cells also inhibits centrosome separation and is lethal. Our findings provide a genetic mechanism for the regulation of SUN-domain protein-mediated activities, including centrosome separation, by irreversible protein cleavage at the nuclear periphery.

  12. Cleavage of the SUN-domain protein Mps3 at its N-terminus regulates centrosome disjunction in budding yeast meiosis

    Science.gov (United States)

    Koch, Bailey A.; Han, Xuemei

    2017-01-01

    Centrosomes organize microtubules and are essential for spindle formation and chromosome segregation during cell division. Duplicated centrosomes are physically linked, but how this linkage is dissolved remains unclear. Yeast centrosomes are tethered by a nuclear-envelope-attached structure called the half-bridge, whose components have mammalian homologues. We report here that cleavage of the half-bridge protein Mps3 promotes accurate centrosome disjunction in budding yeast. Mps3 is a single-pass SUN-domain protein anchored at the inner nuclear membrane and concentrated at the nuclear side of the half-bridge. Using the unique feature in yeast meiosis that centrosomes are linked for hours before their separation, we have revealed that Mps3 is cleaved at its nucleus-localized N-terminal domain, the process of which is regulated by its phosphorylation at serine 70. Cleavage of Mps3 takes place at the yeast centrosome and requires proteasome activity. We show that noncleavable Mps3 (Mps3-nc) inhibits centrosome separation during yeast meiosis. In addition, overexpression of mps3-nc in vegetative yeast cells also inhibits centrosome separation and is lethal. Our findings provide a genetic mechanism for the regulation of SUN-domain protein-mediated activities, including centrosome separation, by irreversible protein cleavage at the nuclear periphery. PMID:28609436

  13. Condensin suppresses recombination and regulates double-strand break processing at the repetitive ribosomal DNA array to ensure proper chromosome segregation during meiosis in budding yeast

    Science.gov (United States)

    Li, Ping; Jin, Hui; Yu, Hong-Guo

    2014-01-01

    During meiosis, homologues are linked by crossover, which is required for bipolar chromosome orientation before chromosome segregation at anaphase I. The repetitive ribosomal DNA (rDNA) array, however, undergoes little or no meiotic recombination. Hyperrecombination can cause chromosome missegregation and rDNA copy number instability. We report here that condensin, a conserved protein complex required for chromosome organization, regulates double-strand break (DSB) formation and repair at the rDNA gene cluster during meiosis in budding yeast. Condensin is highly enriched at the rDNA region during prophase I, released at the prophase I/metaphase I transition, and reassociates with rDNA before anaphase I onset. We show that condensin plays a dual role in maintaining rDNA stability: it suppresses the formation of Spo11-mediated rDNA breaks, and it promotes DSB processing to ensure proper chromosome segregation. Condensin is unnecessary for the export of rDNA breaks outside the nucleolus but required for timely repair of meiotic DSBs. Our work reveals that condensin coordinates meiotic recombination with chromosome segregation at the repetitive rDNA sequence, thereby maintaining genome integrity. PMID:25103240

  14. Experimental evolution in budding yeast

    Science.gov (United States)

    Murray, Andrew

    2012-02-01

    I will discuss our progress in analyzing evolution in the budding yeast, Saccharomyces cerevisiae. We take two basic approaches. The first is to try and examine quantitative aspects of evolution, for example by determining how the rate of evolution depends on the mutation rate and the population size or asking whether the rate of mutation is uniform throughout the genome. The second is to try to evolve qualitatively novel, cell biologically interesting phenotypes and track the mutations that are responsible for the phenotype. Our efforts include trying to alter cell morphology, evolve multicellularity, and produce a biological oscillator.

  15. Sister kinetochores are mechanically fused during meiosis I in yeast.

    Science.gov (United States)

    Sarangapani, Krishna K; Duro, Eris; Deng, Yi; Alves, Flavia de Lima; Ye, Qiaozhen; Opoku, Kwaku N; Ceto, Steven; Rappsilber, Juri; Corbett, Kevin D; Biggins, Sue; Marston, Adèle L; Asbury, Charles L

    2014-10-10

    Production of healthy gametes requires a reductional meiosis I division in which replicated sister chromatids comigrate, rather than separate as in mitosis or meiosis II. Fusion of sister kinetochores during meiosis I may underlie sister chromatid comigration in diverse organisms, but direct evidence for such fusion has been lacking. We used laser trapping and quantitative fluorescence microscopy to study native kinetochore particles isolated from yeast. Meiosis I kinetochores formed stronger attachments and carried more microtubule-binding elements than kinetochores isolated from cells in mitosis or meiosis II. The meiosis I-specific monopolin complex was both necessary and sufficient to drive these modifications. Thus, kinetochore fusion directs sister chromatid comigration, a conserved feature of meiosis that is fundamental to Mendelian inheritance. Copyright © 2014, American Association for the Advancement of Science.

  16. Fungal Meiosis and Parasexual Reproduction – Lessons from Pathogenic Yeast

    OpenAIRE

    Sherwood, Racquel K.; Bennett, Richard J.

    2009-01-01

    Meiosis is an integral part of sexual reproduction in eukaryotic species. It performs the dual functions of halving the genetic content in the cell, as well as increasing genetic diversity by promoting recombination between chromosome homologs. Despite extensive studies of meiosis in model yeast, it is now apparent that both the regulation of meiosis and the machinery mediating recombination has significantly diverged, even between closely related species. To highlight this, we discuss new st...

  17. Sporulation in the Budding Yeast Saccharomyces cerevisiae

    Science.gov (United States)

    Neiman, Aaron M.

    2011-01-01

    In response to nitrogen starvation in the presence of a poor carbon source, diploid cells of the yeast Saccharomyces cerevisiae undergo meiosis and package the haploid nuclei produced in meiosis into spores. The formation of spores requires an unusual cell division event in which daughter cells are formed within the cytoplasm of the mother cell. This process involves the de novo generation of two different cellular structures: novel membrane compartments within the cell cytoplasm that give rise to the spore plasma membrane and an extensive spore wall that protects the spore from environmental insults. This article summarizes what is known about the molecular mechanisms controlling spore assembly with particular attention to how constitutive cellular functions are modified to create novel behaviors during this developmental process. Key regulatory points on the sporulation pathway are also discussed as well as the possible role of sporulation in the natural ecology of S. cerevisiae. PMID:22084423

  18. Trans-Lesion DNA Polymerases May Be Involved in Yeast Meiosis

    Science.gov (United States)

    Arbel-Eden, Ayelet; Joseph-Strauss, Daphna; Masika, Hagit; Printzental, Oxana; Rachi, Eléanor; Simchen, Giora

    2013-01-01

    Trans-lesion DNA polymerases (TLSPs) enable bypass of DNA lesions during replication and are also induced under stress conditions. Being only weakly dependent on their template during replication, TLSPs introduce mutations into DNA. The low processivity of these enzymes ensures that they fall off their template after a few bases are synthesized and are then replaced by the more accurate replicative polymerase. We find that the three TLSPs of budding yeast Saccharomyces cerevisiae Rev1, PolZeta (Rev3 and Rev7), and Rad30 are induced during meiosis at a time when DNA double-strand breaks (DSBs) are formed and homologous chromosomes recombine. Strains deleted for one or any combination of the three TLSPs undergo normal meiosis. However, in the triple-deletion mutant, there is a reduction in both allelic and ectopic recombination. We suggest that trans-lesion polymerases are involved in the processing of meiotic double-strand breaks that lead to mutations. In support of this notion, we report significant yeast two-hybrid (Y2H) associations in meiosis-arrested cells between the TLSPs and DSB proteins Rev1-Spo11, Rev1-Mei4, and Rev7-Rec114, as well as between Rev1 and Rad30. We suggest that the involvement of TLSPs in processing of meiotic DSBs could be responsible for the considerably higher frequency of mutations reported during meiosis compared with that found in mitotically dividing cells, and therefore may contribute to faster evolutionary divergence than previously assumed. PMID:23550131

  19. Positive Feedback of NDT80 Expression Ensures Irreversible Meiotic Commitment in Budding Yeast

    Science.gov (United States)

    Tsuchiya, Dai; Yang, Yang; Lacefield, Soni

    2014-01-01

    In budding yeast, meiotic commitment is the irreversible continuation of the developmental path of meiosis. After reaching meiotic commitment, cells finish meiosis and gametogenesis, even in the absence of the meiosis-inducing signal. In contrast, if the meiosis-inducing signal is removed and the mitosis-inducing signal is provided prior to reaching meiotic commitment, cells exit meiosis and return to mitosis. Previous work has shown that cells commit to meiosis after prophase I but before entering the meiotic divisions. Since the Ndt80 transcription factor induces expression of middle meiosis genes necessary for the meiotic divisions, we examined the role of the NDT80 transcriptional network in meiotic commitment. Using a microfluidic approach to analyze single cells, we found that cells commit to meiosis in prometaphase I, after the induction of the Ndt80-dependent genes. Our results showed that high-level expression of NDT80 is important for the timing and irreversibility of meiotic commitment. A modest reduction in NDT80 levels delayed meiotic commitment based on meiotic stages, although the timing of each meiotic stage was similar to that of wildtype cells. A further reduction of NDT80 resulted in the surprising finding of inappropriately uncommitted cells: withdrawal of the meiosis-inducing signal and addition of the mitosis-inducing signal to cells at stages beyond metaphase I caused return to mitosis, leading to multi-nucleate cells. Since Ndt80 enhances its own transcription through positive feedback, we tested whether positive feedback ensured the irreversibility of meiotic commitment. Ablating positive feedback in NDT80 expression resulted in a complete loss of meiotic commitment. These findings suggest that irreversibility of meiotic commitment is a consequence of the NDT80 transcriptional positive feedback loop, which provides the high-level of Ndt80 required for the developmental switch of meiotic commitment. These results also illustrate the

  20. Measuring mitotic spindle dynamics in budding yeast

    Science.gov (United States)

    Plumb, Kemp

    In order to carry out its life cycle and produce viable progeny through cell division, a cell must successfully coordinate and execute a number of complex processes with high fidelity, in an environment dominated by thermal noise. One important example of such a process is the assembly and positioning of the mitotic spindle prior to chromosome segregation. The mitotic spindle is a modular structure composed of two spindle pole bodies, separated in space and spanned by filamentous proteins called microtubules, along which the genetic material of the cell is held. The spindle is responsible for alignment and subsequent segregation of chromosomes into two equal parts; proper spindle positioning and timing ensure that genetic material is appropriately divided amongst mother and daughter cells. In this thesis, I describe fluorescence confocal microscopy and automated image analysis algorithms, which I have used to observe and analyze the real space dynamics of the mitotic spindle in budding yeast. The software can locate structures in three spatial dimensions and track their movement in time. By selecting fluorescent proteins which specifically label the spindle poles and cell periphery, mitotic spindle dynamics have been measured in a coordinate system relevant to the cell division. I describe how I have characterised the accuracy and precision of the algorithms by simulating fluorescence data for both spindle poles and the budding yeast cell surface. In this thesis I also describe the construction of a microfluidic apparatus that allows for the measurement of long time-scale dynamics of individual cells and the development of a cell population. The tools developed in this thesis work will facilitate in-depth quantitative analysis of the non-equilibrium processes in living cells.

  1. Tolerance of budding yeast Saccharomyces cerevisiae to ultra high pressure

    Science.gov (United States)

    Shibata, M.; Torigoe, M.; Matsumoto, Y.; Yamamoto, M.; Takizawa, N.; Hada, Y.; Mori, Y.; Takarabe, K.; Ono, F.

    2014-05-01

    Our studies on the tolerance of plants and animals against very high pressure of several GPa have been extended to a smaller sized fungus, the budding yeast Saccharomyces cerevisiae. Several pieces of budding yeast (dry yeast) were sealed in a small teflon capsule with a liquid pressure medium fluorinate, and exposed to 7.5 GPa by using a cubic anvil press. The pressure was kept constant for various duration of time from 2 to 24 h. After the pressure was released, the specimens were brought out from the teflon capsule, and they were cultivated on a potato dextrose agar. It was found that the budding yeast exposed to 7.5 GPa for up to 6 h showed multiplication. However, those exposed to 7.5 GPa for longer than 12 h were found dead. The high pressure tolerance of budding yeast is a little weaker than that of tardigrades.

  2. Dielectric modelling of cell division for budding and fission yeast

    International Nuclear Information System (INIS)

    Asami, Koji; Sekine, Katsuhisa

    2007-01-01

    The frequency dependence of complex permittivity or the dielectric spectrum of a system including a cell in cell division has been simulated by a numerical technique based on the three-dimensional finite difference method. Two different types of cell division characteristic of budding and fission yeast were examined. The yeast cells are both regarded as a body of rotation, and thus have anisotropic polarization, i.e. the effective permittivity of the cell depends on the orientation of the cell to the direction of an applied electric field. In the perpendicular orientation, where the rotational axis of the cell is perpendicular to the electric field direction, the dielectric spectra for both yeast cells included one dielectric relaxation and its intensity depended on the cell volume. In the parallel orientation, on the other hand, two dielectric relaxations appeared with bud growth for budding yeast and with septum formation for fission yeast. The low-frequency relaxation was shifted to a lower frequency region by narrowing the neck between the bud and the mother cell for budding yeast and by increasing the degree of septum formation for fission yeast. After cell separation, the low-frequency relaxation disappeared. The simulations well interpreted the oscillation of the relative permittivity of culture broth found for synchronous cell growth of budding yeast

  3. Mek1/Mre4 is a master regulator of meiotic recombination in budding yeast

    Directory of Open Access Journals (Sweden)

    Nancy M. Hollingsworth

    2016-02-01

    Full Text Available Sexually reproducing organisms create gametes with half the somatic cell chromosome number so that fusion of gametes at fertilization does not change the ploidy of the cell. This reduction in chromosome number occurs by the specialized cell division of meiosis in which two rounds of chromosome segregation follow a single round of chromosome duplication. Meiotic crossovers formed between the non-sister chromatids of homologous chromosomes, combined with sister chromatid cohesion, physically connect homologs, thereby allowing proper segregation at the first meiotic division. Meiotic recombination is initiated by programmed double strand breaks (DSBs whose repair is highly regulated such that (1 there is a bias for recombination with homologs rather than sister chromatids, (2 crossovers are distributed throughout the genome by a process called interference, (3 crossover homeostasis regulates the balance between crossover and non-crossover repair to maintain a critical number of crossovers and (4 each pair of homologs receives at least one crossover. It was previously known that the imposition of interhomolog bias in budding yeast requires meiosis-specific modifications to the DNA damage response and the local activation of the meiosis-specific Mek1/Mre4 (hereafter Mek1 kinase at DSBs. However, because inactivation of Mek1 results in intersister, rather than interhomolog DSB repair, whether Mek1 had a role in interhomolog pathway choice was unknown. A recent study by Chen et al. (2015 reveals that Mek1 indirectly regulates the crossover/non-crossover decision between homologs as well as genetic interference. It does this by enabling phosphorylation of Zip1, the meiosis-specific transverse filament protein of the synaptonemal complex (SC, by the conserved cell cycle kinase, Cdc7-Dbf4 (DDK. These results suggest that Mek1 is a “master regulator” of meiotic recombination in budding yeast.

  4. Autophagy is required for efficient meiosis progression and proper meiotic chromosome segregation in fission yeast.

    Science.gov (United States)

    Matsuhara, Hirotada; Yamamoto, Ayumu

    2016-01-01

    Autophagy is a conserved intracellular degradation system, which contributes to development and differentiation of various organisms. Yeast cells undergo meiosis under nitrogen-starved conditions and require autophagy for meiosis initiation. However, the precise roles of autophagy in meiosis remain unclear. Here, we show that autophagy is required for efficient meiosis progression and proper meiotic chromosome segregation in fission yeast. Autophagy-defective strains bearing a mutation in the autophagy core factor gene atg1, atg7, or atg14 exhibit deformed nuclear structures during meiosis. These mutant cells require an extracellular nitrogen supply for meiosis progression following their entry into meiosis and show delayed meiosis progression even with a nitrogen supply. In addition, they show frequent chromosome dissociation from the spindle together with spindle overextension, forming extra nuclei. Furthermore, Aurora kinase, which regulates chromosome segregation and spindle elongation, is significantly increased at the centromere and spindle in the mutant cells. Aurora kinase down-regulation eliminated delayed initiation of meiosis I and II, chromosome dissociation, and spindle overextension, indicating that increased Aurora kinase activity may cause these aberrances in the mutant cells. Our findings show a hitherto unrecognized relationship of autophagy with the nuclear structure, regulation of cell cycle progression, and chromosome segregation in meiosis. © 2015 The Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.

  5. Shaping meiotic chromosomes with SUMO: a feedback loop controls the assembly of the synaptonemal complex in budding yeast

    Directory of Open Access Journals (Sweden)

    Hideo Tsubouchi

    2016-02-01

    Full Text Available The synaptonemal complex (SC is a meiosis-specific chromosomal structure in which homologous chromosomes are intimately linked through arrays of specialized proteins called transverse filaments (TF. Widely conserved in eukaryote meiosis, the SC forms during prophase I and is essential for accurate segregation of homologous chromosomes at meiosis I. However, the basic mechanism overlooking formation and regulation of the SC has been poorly understood. By using the budding yeast Saccharomyces cerevisiae, we recently showed that SC formation is controlled through the attachment of multiple molecules of small ubiquitin-like modifier (SUMO to a regulator of TF assembly. Intriguingly, this SUMOylation is activated by TF, implicating the involvement of a positive feedback loop in the control of SC assembly. We discuss the implication of this finding and possible involvement of a similar mechanism in regulating other processes.

  6. Budding yeast for budding geneticists: a primer on the Saccharomyces cerevisiae model system.

    Science.gov (United States)

    Duina, Andrea A; Miller, Mary E; Keeney, Jill B

    2014-05-01

    The budding yeast Saccharomyces cerevisiae is a powerful model organism for studying fundamental aspects of eukaryotic cell biology. This Primer article presents a brief historical perspective on the emergence of this organism as a premier experimental system over the course of the past century. An overview of the central features of the S. cerevisiae genome, including the nature of its genetic elements and general organization, is also provided. Some of the most common experimental tools and resources available to yeast geneticists are presented in a way designed to engage and challenge undergraduate and graduate students eager to learn more about the experimental amenability of budding yeast. Finally, a discussion of several major discoveries derived from yeast studies highlights the far-reaching impact that the yeast system has had and will continue to have on our understanding of a variety of cellular processes relevant to all eukaryotes, including humans.

  7. Apoptosis at inflection point in liquid culture of budding yeasts.

    Directory of Open Access Journals (Sweden)

    Toshiyuki Hagiwara

    Full Text Available Budding yeasts are highly suitable for aging studies, because the number of bud scars (stage proportionally correlates with age. Its maximum stages are known to reach at 20-30 stages on an isolated agar medium. However, their stage dynamics in a liquid culture is virtually unknown. We investigate the population dynamics by counting scars in each cell. Here one cell division produces one new cell and one bud scar. This simple rule leads to a conservation law: "The total number of bud scars is equal to the total number of cells." We find a large discrepancy: extremely fewer cells with over 5 scars than expected. Almost all cells with 6 or more scars disappear within a short period of time in the late log phase (corresponds to the inflection point. This discrepancy is confirmed directly by the microscopic observations of broken cells. This finding implies apoptosis in older cells (6 scars or more.

  8. Actin and Endocytosis in Budding Yeast

    Science.gov (United States)

    Goode, Bruce L.; Eskin, Julian A.; Wendland, Beverly

    2015-01-01

    Endocytosis, the process whereby the plasma membrane invaginates to form vesicles, is essential for bringing many substances into the cell and for membrane turnover. The mechanism driving clathrin-mediated endocytosis (CME) involves > 50 different protein components assembling at a single location on the plasma membrane in a temporally ordered and hierarchal pathway. These proteins perform precisely choreographed steps that promote receptor recognition and clustering, membrane remodeling, and force-generating actin-filament assembly and turnover to drive membrane invagination and vesicle scission. Many critical aspects of the CME mechanism are conserved from yeast to mammals and were first elucidated in yeast, demonstrating that it is a powerful system for studying endocytosis. In this review, we describe our current mechanistic understanding of each step in the process of yeast CME, and the essential roles played by actin polymerization at these sites, while providing a historical perspective of how the landscape has changed since the preceding version of the YeastBook was published 17 years ago (1997). Finally, we discuss the key unresolved issues and where future studies might be headed. PMID:25657349

  9. Regulation of homologous recombination at telomeres in budding yeast

    DEFF Research Database (Denmark)

    Eckert-Boulet, Nadine; Lisby, Michael

    2010-01-01

    Homologous recombination is suppressed at normal length telomere sequences. In contrast, telomere recombination is allowed when telomeres erode in the absence of telomerase activity or as a consequence of nucleolytic degradation or incomplete replication. Here, we review the mechanisms that contr...... that contribute to regulating mitotic homologous recombination at telomeres and the role of these mechanisms in signalling short telomeres in the budding yeast Saccharomyces cerevisiae....

  10. Synchronization of Budding Yeast by Centrifugal Elutriation.

    Science.gov (United States)

    Rosebrock, Adam P

    2017-01-03

    In yeast, cell size is normally tightly linked to cell cycle progression. Centrifugal elutriation is a method that fractionates cells based on the physical properties of cell size-fluid drag and buoyant density. Using a specially modified centrifuge and rotor system, cells can be physically separated into one or more cohorts of similar size and therefore cell cycle position. Small G 1 daughters are collected first, followed by successively larger cells. Elutriated populations can be analyzed immediately or can be returned to medium and permitted to synchronously progress through the cell cycle. This protocol describes two different elutriation methods. In the first, one or more fractions of synchronized cells are obtained from an asynchronous starting population, reincubated, and followed prospectively across a time series. In the second, an asynchronous starting population is separated into multiple fractions of similarly sized cells, and each cohort of similarly sized cells can be analyzed separately without further growth. © 2017 Cold Spring Harbor Laboratory Press.

  11. Csm4, in collaboration with Ndj1, mediates telomere-led chromosome dynamics and recombination during yeast meiosis.

    Directory of Open Access Journals (Sweden)

    Jennifer J Wanat

    2008-09-01

    Full Text Available Chromosome movements are a general feature of mid-prophase of meiosis. In budding yeast, meiotic chromosomes exhibit dynamic movements, led by nuclear envelope (NE-associated telomeres, throughout the zygotene and pachytene stages. Zygotene motion underlies the global tendency for colocalization of NE-associated chromosome ends in a "bouquet." In this study, we identify Csm4 as a new molecular participant in these processes and show that, unlike the two previously identified components, Ndj1 and Mps3, Csm4 is not required for meiosis-specific telomere/NE association. Instead, it acts to couple telomere/NE ensembles to a force generation mechanism. Mutants lacking Csm4 and/or Ndj1 display the following closely related phenotypes: (i elevated crossover (CO frequencies and decreased CO interference without abrogation of normal pathways; (ii delayed progression of recombination, and recombination-coupled chromosome morphogenesis, with resulting delays in the MI division; and (iii nondisjunction of homologs at the MI division for some reason other than absence of (the obligatory CO(s. The recombination effects are discussed in the context of a model where the underlying defect is chromosome movement, the absence of which results in persistence of inappropriate chromosome relationships that, in turn, results in the observed mutant phenotypes.

  12. Naumovozyma castellii: an alternative model for budding yeast molecular biology.

    Science.gov (United States)

    Karademir Andersson, Ahu; Cohn, Marita

    2017-03-01

    Naumovozyma castellii (Saccharomyces castellii) is a member of the budding yeast family Saccharomycetaceae. It has been extensively used as a model organism for telomere biology research and has gained increasing interest as a budding yeast model for functional analyses owing to its amenability to genetic modifications. Owing to the suitable phylogenetic distance to S. cerevisiae, the whole genome sequence of N. castellii has provided unique data for comparative genomic studies, and it played a key role in the establishment of the timing of the whole genome duplication and the evolutionary events that took place in the subsequent genomic evolution of the Saccharomyces lineage. Here we summarize the historical background of its establishment as a laboratory yeast species, and the development of genetic and molecular tools and strains. We review the research performed on N. castellii, focusing on areas where it has significantly contributed to the discovery of new features of molecular biology and to the advancement of our understanding of molecular evolution. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

  13. Identification of SUMO conjugation sites in the budding yeast proteome

    Directory of Open Access Journals (Sweden)

    Miguel Esteras

    2017-10-01

    Full Text Available Post-translational modification by the small ubiquitin-like modifier (SUMO is an important mechanism regulating protein function. Identification of SUMO conjugation sites on substrates is a challenging task. Here we employed a proteomic method to map SUMO acceptor lysines in budding yeast proteins. We report the identification of 257 lysine residues where SUMO is potentially attached. Amongst the hits, we identified already known SUMO substrates and sites, confirming the success of the approach. In addition, we tested several of the novel substrates using SUMO immunoprecipitation analysis and confirmed that the SUMO acceptor lysines identified in these proteins are indeed bona fide SUMOylation sites. We believe that the collection of SUMO sites presented here is an important resource for future functional studies of SUMOylation in yeast.

  14. The RNA-binding protein Spo5 promotes meiosis II by regulating cyclin Cdc13 in fission yeast.

    Science.gov (United States)

    Arata, Mayumi; Sato, Masamitsu; Yamashita, Akira; Yamamoto, Masayuki

    2014-03-01

    Meiosis comprises two consecutive nuclear divisions, meiosis I and II. Despite this unique progression through the cell cycle, little is known about the mechanisms controlling the sequential divisions. In this study, we carried out a genetic screen to identify factors that regulate the initiation of meiosis II in the fission yeast Schizosaccharomyces pombe. We identified mutants deficient in meiosis II progression and repeatedly isolated mutants defective in spo5, which encodes an RNA-binding protein. Using fluorescence microscopy to visualize YFP-tagged protein, we found that spo5 mutant cells precociously lost Cdc13, the major B-type cyclin in fission yeast, before meiosis II. Importantly, the defect in meiosis II was rescued by increasing CDK activity. In wild-type cells, cdc13 transcripts increased during meiosis II, but this increase in cdc13 expression was weaker in spo5 mutants. Thus, Spo5 is a novel regulator of meiosis II that controls the level of cdc13 expression and promotes de novo synthesis of Cdc13. We previously reported that inhibition of Cdc13 degradation is necessary to initiate meiosis II; together with the previous information, the current findings indicate that the dual control of Cdc13 by de novo synthesis and suppression of proteolysis ensures the progression of meiosis II. © 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd.

  15. Genetic Approaches to Study Meiosis and Meiosis-Specific Gene Expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kassir, Yona; Stuart, David T

    2017-01-01

    The budding yeast Saccharomyces cerevisiae has a long history as a model organism for studies of meiosis and the cell cycle. The popularity of this yeast as a model is in large part due to the variety of genetic and cytological approaches that can be effectively performed with the cells. Cultures of the cells can be induced to synchronously progress through meiosis and sporulation allowing large-scale gene expression and biochemical studies to be performed. Additionally, the spore tetrads resulting from meiosis make it possible to characterize the haploid products of meiosis allowing investigation of meiotic recombination and chromosome segregation. Here we describe genetic methods for analysis progression of S. cerevisiae through meiosis and sporulation with an emphasis on strategies for the genetic analysis of regulators of meiosis-specific genes.

  16. Selection of G1 Phase Yeast Cells for Synchronous Meiosis and Sporulation.

    Science.gov (United States)

    Stuart, David T

    2017-01-01

    Centrifugal elutriation is a procedure that allows the fractionation of cell populations based upon their size and shape. This allows cells in distinct cell cycle stages can be captured from an asynchronous population. The technique is particularly helpful when performing an experiment to monitor the progression of cells through the cell cycle or meiosis. Yeast sporulation like gametogenesis in other eukaryotes initiates from the G1 phase of the cell cycle. Conveniently, S. cerevisiae arrest in G1 phase when starved for nutrients and so withdrawal of nitrogen and glucose allows cells to abandon vegetative growth in G1 phase before initiating the sporulation program. This simple starvation protocol yields a partial synchronization that has been used extensively in studies of progression through meiosis and sporulation. By using centrifugal elutriation it is possible to isolate a homogeneous population of G1 phase cells and induce them to sporulate synchronously, which is beneficial for investigating progression through meiosis and sporulation. An additionally benefit of this protocol is that cell populations can be isolated based upon size and both large and small cell populations can be tested for progression through meiosis and sporulation. Here we present a protocol for purification of G1 phase diploid cells for examining synchronous progression through meiosis and sporulation.

  17. The fission yeast MTREC and EJC orthologs ensure the maturation of meiotic transcripts during meiosis.

    Science.gov (United States)

    Marayati, Bahjat Fadi; Hoskins, Victoria; Boger, Robert W; Tucker, James F; Fishman, Emily S; Bray, Andrew S; Zhang, Ke

    2016-09-01

    Meiosis is a highly regulated process by which genetic information is transmitted through sexual reproduction. It encompasses unique mechanisms that do not occur in vegetative cells, producing a distinct, well-regulated meiotic transcriptome. During vegetative growth, many meiotic genes are constitutively transcribed, but most of the resulting mRNAs are rapidly eliminated by the Mmi1-MTREC (Mtl1-Red1 core) complex. While Mmi1-MTREC targets premature meiotic RNAs for degradation by the nuclear 3'-5' exoribonuclease exosome during mitotic growth, its role in meiotic gene expression during meiosis is not known. Here, we report that Red5, an essential MTREC component, interacts with pFal1, an ortholog of eukaryotic translation initiation factor eIF4aIII in the fission yeast Schizosaccharomyces pombe In mammals, together with MAGO (Mnh1), Rnps1, and Y14, elF4AIII (pFal1) forms the core of the exon junction complex (EJC), which is essential for transcriptional surveillance and localization of mature mRNAs. In fission yeast, two EJC orthologs, pFal1 and Mnh1, are functionally connected with MTREC, specifically in the process of meiotic gene expression during meiosis. Although pFal1 interacts with Mnh1, Y14, and Rnps1, its association with Mnh1 is not disrupted upon loss of Y14 or Rnps1. Mutations of Red1, Red5, pFal1, or Mnh1 produce severe meiotic defects; the abundance of meiotic transcripts during meiosis decreases; and mRNA maturation processes such as splicing are impaired. Since studying meiosis in mammalian germline cells is difficult, our findings in fission yeast may help to define the general mechanisms involved in accurate meiotic gene expression in higher eukaryotes. © 2016 Marayati et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  18. Characterization of the minimum domain required for targeting budding yeast myosin II to the site of cell division

    Directory of Open Access Journals (Sweden)

    Tolliday Nicola J

    2006-06-01

    Full Text Available Abstract Background All eukaryotes with the exception of plants use an actomyosin ring to generate a constriction force at the site of cell division (cleavage furrow during mitosis and meiosis. The structure and filament forming abilities located in the C-terminal or tail region of one of the main components, myosin II, are important for localising the molecule to the contractile ring (CR during cytokinesis. However, it remains poorly understood how myosin II is recruited to the site of cell division and how this recruitment relates to myosin filament assembly. Significant conservation between species of the components involved in cytokinesis, including those of the CR, allows the use of easily genetically manipulated organisms, such as budding yeast (Saccharomyces cerevisiae, in the study of cytokinesis. Budding yeast has a single myosin II protein, named Myo1. Unlike most other class II myosins, the tail of Myo1 has an irregular coiled coil. In this report we use molecular genetics, biochemistry and live cell imaging to characterize the minimum localisation domain (MLD of budding yeast Myo1. Results We show that the MLD is a small region in the centre of the tail of Myo1 and that it is both necessary and sufficient for localisation of Myo1 to the yeast bud neck, the pre-determined site of cell division. Hydrodynamic measurements of the MLD, purified from bacteria or yeast, show that it is likely to exist as a trimer. We also examine the importance of a small region of low coiled coil forming probability within the MLD, which we call the hinge region. Removal of the hinge region prevents contraction of the CR. Using fluorescence recovery after photobleaching (FRAP, we show that GFP-tagged MLD is slightly more dynamic than the GFP-tagged full length molecule but less dynamic than the GFP-tagged Myo1 construct lacking the hinge region. Conclusion Our results define the intrinsic determinant for the localization of budding yeast myosin II and show

  19. APC/C-Cdc20 mediates deprotection of centromeric cohesin at meiosis II in yeast.

    Science.gov (United States)

    Jonak, Katarzyna; Zagoriy, Ievgeniia; Oz, Tugce; Graf, Peter; Rojas, Julie; Mengoli, Valentina; Zachariae, Wolfgang

    2017-06-18

    Cells undergoing meiosis produce haploid gametes through one round of DNA replication followed by 2 rounds of chromosome segregation. This requires that cohesin complexes, which establish sister chromatid cohesion during S phase, are removed in a stepwise manner. At meiosis I, the separase protease triggers the segregation of homologous chromosomes by cleaving cohesin's Rec8 subunit on chromosome arms. Cohesin persists at centromeres because the PP2A phosphatase, recruited by the shugoshin protein, dephosphorylates Rec8 and thereby protects it from cleavage. While chromatids disjoin upon cleavage of centromeric Rec8 at meiosis II, it was unclear how and when centromeric Rec8 is liberated from its protector PP2A. One proposal is that bipolar spindle forces separate PP2A from Rec8 as cells enter metaphase II. We show here that sister centromere biorientation is not sufficient to "deprotect" Rec8 at meiosis II in yeast. Instead, our data suggest that the ubiquitin-ligase APC/C Cdc20 removes PP2A from centromeres by targeting for degradation the shugoshin Sgo1 and the kinase Mps1. This implies that Rec8 remains protected until entry into anaphase II when it is phosphorylated concurrently with the activation of separase. Here, we provide further support for this model and speculate on its relevance to mammalian oocytes.

  20. Genetic control of x-ray resistance in budding yeast cells

    International Nuclear Information System (INIS)

    Benathen, I.A.; Beam, C.A.

    1977-01-01

    Five x-ray-sensitive mutants were selected from 10,000 colonies arising from survivors of ultraviolet light. These were named XS5, XS6, XS7, XS8, and XS9. Mutant XS1 was donated by Nakai. These mutations affect the resistant budding cell survival component of the survival curve and, in diploids, the low-dose interdivisional cell shoulder. They are of two types: Class I, in which budding cells lack resistance; and Class II, in which budding cells show reduced resistance. When crossed with one another, they show a complex complementation pattern. Gene dosage effects are seen in XS1 heterozygotes, while budding but not between divisions. No direct correlation between radiation sensitivity, meiosis, and sporulation is observed; genes which influence radiation sensitivity do not affect meiotic recombination. A single mutation (XS1 or XS5) suppresses the shoulders of the survival curves of both budding haploid cells and diploid nonbudding cells

  1. The cellular robustness by genetic redundancy in budding yeast.

    Directory of Open Access Journals (Sweden)

    Jingjing Li

    2010-11-01

    Full Text Available The frequent dispensability of duplicated genes in budding yeast is heralded as a hallmark of genetic robustness contributed by genetic redundancy. However, theoretical predictions suggest such backup by redundancy is evolutionarily unstable, and the extent of genetic robustness contributed from redundancy remains controversial. It is anticipated that, to achieve mutual buffering, the duplicated paralogs must at least share some functional overlap. However, counter-intuitively, several recent studies reported little functional redundancy between these buffering duplicates. The large yeast genetic interactions released recently allowed us to address these issues on a genome-wide scale. We herein characterized the synthetic genetic interactions for ∼500 pairs of yeast duplicated genes originated from either whole-genome duplication (WGD or small-scale duplication (SSD events. We established that functional redundancy between duplicates is a pre-requisite and thus is highly predictive of their backup capacity. This observation was particularly pronounced with the use of a newly introduced metric in scoring functional overlap between paralogs on the basis of gene ontology annotations. Even though mutual buffering was observed to be prevalent among duplicated genes, we showed that the observed backup capacity is largely an evolutionarily transient state. The loss of backup capacity generally follows a neutral mode, with the buffering strength decreasing in proportion to divergence time, and the vast majority of the paralogs have already lost their backup capacity. These observations validated previous theoretic predictions about instability of genetic redundancy. However, departing from the general neutral mode, intriguingly, our analysis revealed the presence of natural selection in stabilizing functional overlap between SSD pairs. These selected pairs, both WGD and SSD, tend to have decelerated functional evolution, have higher propensities of co

  2. Fission yeast APC/C activators Slp1 and Fzr1 sequentially trigger two consecutive nuclear divisions during meiosis.

    Science.gov (United States)

    Chikashige, Yuji; Yamane, Miho; Okamasa, Kasumi; Osakada, Hiroko; Tsutsumi, Chihiro; Nagahama, Yuki; Fukuta, Noriko; Haraguchi, Tokuko; Hiraoka, Yasushi

    2017-04-01

    In meiosis, two rounds of nuclear division occur consecutively without DNA replication between the divisions. We isolated a fission yeast mutant in which the nucleus divides only once to generate two spores, as opposed to four, in meiosis. In this mutant, we found that the initiation codon of the slp1 + gene is converted to ATA, producing a reduced amount of Slp1. As a member of the Fizzy family of anaphase-promoting complex/cyclosome (APC/C) activators, Slp1 is essential for vegetative growth; however, the mutant allele shows a phenotype only in meiosis. Slp1 insufficiency delays degradation of maturation-promoting factor at the first meiotic division, and another APC/C activator, Fzr1, which acts late in meiosis, terminates meiosis immediately after the delayed first division to produce two viable spores. © 2017 Federation of European Biochemical Societies.

  3. Ddb1 controls genome stability and meiosis in fission yeast

    DEFF Research Database (Denmark)

    Holmberg, Christian Henrik; Fleck, Oliver; Hansen, H. A.

    2005-01-01

    The human UV-damaged DNA-binding protein Ddb1 associates with cullin 4 ubiquitin ligases implicated in nucleotide excision repair (NER). These complexes also contain the signalosome (CSN), but NER-relevant ubiquitination targets have not yet been identified. We report that fission yeast Ddb1......, Cullin 4 (Pcu4), and CSN subunits Csn1 and Csn2 are required for degradation of the ribonucleotide reductase (RNR) inhibitor protein Spd1. Ddb1-deficient cells have >20-fold increased spontaneous mutation rate. This is partly dependent on the error-prone translesion DNA polymerases. Spd1 deletion...... substantially reduced the mutation rate, suggesting that insufficient RNR activity accounts for ~50% of observed mutations. Epistasis analysis indicated that Ddb1 contributed to mutation avoidance and tolerance to DNA damage in a pathway distinct from NER. Finally, we show that Ddb1/Csn1/Cullin 4-mediated Spd1...

  4. Characterization of dependencies between growth and division in budding yeast.

    Science.gov (United States)

    Mayhew, Michael B; Iversen, Edwin S; Hartemink, Alexander J

    2017-02-01

    Cell growth and division are processes vital to the proliferation and development of life. Coordination between these two processes has been recognized for decades in a variety of organisms. In the budding yeast Saccharomyces cerevisiae , this coordination or 'size control' appears as an inverse correlation between cell size and the rate of cell-cycle progression, routinely observed in G 1 prior to cell division commitment. Beyond this point, cells are presumed to complete S/G 2 /M at similar rates and in a size-independent manner. As such, studies of dependence between growth and division have focused on G 1 Moreover, in unicellular organisms, coordination between growth and division has commonly been analysed within the cycle of a single cell without accounting for correlations in growth and division characteristics between cycles of related cells. In a comprehensive analysis of three published time-lapse microscopy datasets, we analyse both intra- and inter-cycle dependencies between growth and division, revisiting assumptions about the coordination between these two processes. Interestingly, we find evidence (i) that S/G 2 /M durations are systematically longer in daughters than in mothers, (ii) of dependencies between S/G 2 /M and size at budding that echo the classical G 1 dependencies, and (iii) in contrast with recent bacterial studies, of negative dependencies between size at birth and size accumulated during the cell cycle. In addition, we develop a novel hierarchical model to uncover inter-cycle dependencies, and we find evidence for such dependencies in cells growing in sugar-poor environments. Our analysis highlights the need for experimentalists and modellers to account for new sources of cell-to-cell variation in growth and division, and our model provides a formal statistical framework for the continued study of dependencies between biological processes. © 2017 The Author(s).

  5. The fission yeast heterochromatin protein Rik1 is required for telomere clustering during meiosis

    DEFF Research Database (Denmark)

    Tuzon, Creighton T; Borgstrøm, Britta; Weilguny, Dietmar

    2004-01-01

    Telomeres share the ability to silence nearby transcription with heterochromatin, but the requirement of heterochromatin proteins for most telomere functions is unknown. The fission yeast Rik1 protein is required for heterochromatin formation at centromeres and the mating-type locus, as it recrui...... meiosis. However, Rik1 is dispensable for the protective roles of telomeres in preventing chromosome end-fusion. Thus, a Swi6-independent heterochromatin function distinct from that at centromeres and the mating-type locus operates at telomeres during sexual differentiation....

  6. Analysis of the Budding Yeast Cell Cycle by Flow Cytometry.

    Science.gov (United States)

    Rosebrock, Adam P

    2017-01-03

    DNA synthesis is one of the landmark events in the cell cycle: G 1 cells have one copy of the genome, S phase cells are actively engaged in DNA synthesis, and G 2 cells have twice as much nuclear DNA as G 1 cells. Cellular DNA content can be measured by staining with a fluorescent dye followed by a flow-cytometric readout. This method provides a quantitative measurement of cell cycle position on a cell-by-cell basis at high speed. Using flow cytometry, tens of thousands of single-cell measurements can be generated in a few seconds. This protocol details staining of cells of the budding yeast Saccharomyces cerevisiae for flow cytometry using Sytox Green dye in a method that can be scaled widely-from one sample to many thousands and operating on inputs ranging from 1 million to more than 100 million cells. Flow cytometry is preferred over light microscopy or Coulter analyses for the analysis of the cell cycle as DNA content and cell cycle position are being directly measured. © 2017 Cold Spring Harbor Laboratory Press.

  7. Timing robustness in the budding and fission yeast cell cycles.

    KAUST Repository

    Mangla, Karan

    2010-02-01

    Robustness of biological models has emerged as an important principle in systems biology. Many past analyses of Boolean models update all pending changes in signals simultaneously (i.e., synchronously), making it impossible to consider robustness to variations in timing that result from noise and different environmental conditions. We checked previously published mathematical models of the cell cycles of budding and fission yeast for robustness to timing variations by constructing Boolean models and analyzing them using model-checking software for the property of speed independence. Surprisingly, the models are nearly, but not totally, speed-independent. In some cases, examination of timing problems discovered in the analysis exposes apparent inaccuracies in the model. Biologically justified revisions to the model eliminate the timing problems. Furthermore, in silico random mutations in the regulatory interactions of a speed-independent Boolean model are shown to be unlikely to preserve speed independence, even in models that are otherwise functional, providing evidence for selection pressure to maintain timing robustness. Multiple cell cycle models exhibit strong robustness to timing variation, apparently due to evolutionary pressure. Thus, timing robustness can be a basis for generating testable hypotheses and can focus attention on aspects of a model that may need refinement.

  8. The Genetic Requirements for Pentose Fermentation in Budding Yeast

    Directory of Open Access Journals (Sweden)

    Karin Mittelman

    2017-06-01

    Full Text Available Cells grow on a wide range of carbon sources by regulating substrate flow through the metabolic network. Incoming sugar, for example, can be fermented or respired, depending on the carbon identity, cell type, or growth conditions. Despite this genetically-encoded flexibility of carbon metabolism, attempts to exogenously manipulate central carbon flux by rational design have proven difficult, suggesting a robust network structure. To examine this robustness, we characterized the ethanol yield of 411 regulatory and metabolic mutants in budding yeast. The mutants showed little variation in ethanol productivity when grown on glucose or galactose, yet diversity was revealed during growth on xylulose, a rare pentose not widely available in nature. While producing ethanol at high yield, cells grown on xylulose produced ethanol at high yields, yet induced expression of respiratory genes, and were dependent on them. Analysis of mutants that affected ethanol productivity suggested that xylulose fermentation results from metabolic overflow, whereby the flux through glycolysis is higher than the maximal flux that can enter respiration. We suggest that this overflow results from a suboptimal regulatory adjustment of the cells to this unfamiliar carbon source.

  9. Down-regulation of Rad51 activity during meiosis in yeast prevents competition with Dmc1 for repair of double-strand breaks.

    Directory of Open Access Journals (Sweden)

    Yan Liu

    2014-01-01

    Full Text Available Interhomolog recombination plays a critical role in promoting proper meiotic chromosome segregation but a mechanistic understanding of this process is far from complete. In vegetative cells, Rad51 is a highly conserved recombinase that exhibits a preference for repairing double strand breaks (DSBs using sister chromatids, in contrast to the conserved, meiosis-specific recombinase, Dmc1, which preferentially repairs programmed DSBs using homologs. Despite the different preferences for repair templates, both Rad51 and Dmc1 are required for interhomolog recombination during meiosis. This paradox has recently been explained by the finding that Rad51 protein, but not its strand exchange activity, promotes Dmc1 function in budding yeast. Rad51 activity is inhibited in dmc1Δ mutants, where the failure to repair meiotic DSBs triggers the meiotic recombination checkpoint, resulting in prophase arrest. The question remains whether inhibition of Rad51 activity is important during wild-type meiosis, or whether inactivation of Rad51 occurs only as a result of the absence of DMC1 or checkpoint activation. This work shows that strains in which mechanisms that down-regulate Rad51 activity are removed exhibit reduced numbers of interhomolog crossovers and noncrossovers. A hypomorphic mutant, dmc1-T159A, makes less stable presynaptic filaments but is still able to mediate strand exchange and interact with accessory factors. Combining dmc1-T159A with up-regulated Rad51 activity reduces interhomolog recombination and spore viability, while increasing intersister joint molecule formation. These results support the idea that down-regulation of Rad51 activity is important during meiosis to prevent Rad51 from competing with Dmc1 for repair of meiotic DSBs.

  10. Stage-specific effects of X-irradiation on Yeast meiosis

    International Nuclear Information System (INIS)

    Thorne, L.W.; Byers, B.

    1993-01-01

    Previous work has shown that cdc 13 causes meiotic arrest of Saccharomyces cerevisiae following DNA replication by a RAD9-dependent mechanism. In the present work, the authors have further investigated the implicit effects of chromosomal lesions on progression through meiosis by exposing yeast cells to X-irradiation at various times during sporulation. They find that exposure of RAD9 cells to X-irradiation early in meiosis prevents sporulation, arresting the cells at a stage prior to premeiotic DNA replication. rad9 meiotic cells are much less responsive to X-irradiation damage, completing sporulation after treatment with doses sufficient to cause arrest of RAD9 strains. These findings thereby reveal a RAD9-dependent checkpoint function in meiosis that is distinct from the G 2 arrest previously shown to result from cdc 13 dysfunction. Analysis of the spores that continued to be produced by either RAD9 or rad9 cultures that were X-irradiated in later stages of sporulation revealed most spores to be viable, even after exposure to radiation doses sufficient to kill most vegetative cells. This finding demonstrates that the lesions induced by X-irradiation at later times fail to trigger the checkpoint function revealed by cdc 13 arrest and suggests that the lesions may be subject to repair by serving as intermediates in the recombination process. Strains mutant for chromosomal synapsis and recombination, and therefore defective in meiotic disjunction, were tested for evidence that X-ray-induced lesions might alleviate inviability by promoting recombination. Enhancement of spore viability when spo 11 (but not hop 1) diploids were X-irradiated during meiosis indicates that induced lesions may partially substitute for SPO 11-dependent functions that are required for the initiation of recombination. 74 refs., 3 figs., 6 tabs

  11. Significant competitive advantage conferred by meiosis and syngamy in the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Birdsell, J; Wills, C

    1996-01-01

    The presumed advantages of genetic recombinations are difficult to demonstrate directly. To investigate the effects of recombination and background heterozygosity on competitive ability, we have performed serial-transfer competition experiments between isogenic sexual and asexual strains of the yeast Saccharomyces cerevisiae. The members of these diploid pairs of strains differed only in being heterozygous (sexual) or homozygous (asexual) at the mating type or MAT locus. Competing pairs had either a completely homozygous or a heterozygous genetic background, the latter being heterozygous at many different loci throughout the genome. A round of meiotic recombination (automixis) conferred a large and statistically significant enhancement of competitive ability on sexual strains with a heterozygous genetic background. By contrast, in homozygous background competitions, meiosis decreased the sexual strains' initial relative competitive ability. In all cases, however, the sexual strains outcompeted their isogenic asexual counterparts, whether meiotic recombination had occurred or not. In some genetic backgrounds, this was due in part to an overdominance effect on competitive advantage of heterozygosity at the MAT locus. The advantage of the sexual strains also increased significantly during the course of the homozygous background competitions, particularly when meiosis had occurred. This latter effect either did not occur or was very weak in heterozygous background competitions. Overall, sexual strains with heterozygous genetic backgrounds had a significantly higher initial relative competitive ability than those with homozygous backgrounds. The advantage of mating type heterozygosity in this organism extends far beyond the ability to recombine meiotically. PMID:8570658

  12. Implication of Ca2+ in the Regulation of Replicative Life Span of Budding Yeast*

    OpenAIRE

    Tsubakiyama, Ryohei; Mizunuma, Masaki; Gengyo, Anri; Yamamoto, Josuke; Kume, Kazunori; Miyakawa, Tokichi; Hirata, Dai

    2011-01-01

    In eukaryotic cells, Ca2+-triggered signaling pathways are used to regulate a wide variety of cellular processes. Calcineurin, a highly conserved Ca2+/calmodulin-dependent protein phosphatase, plays key roles in the regulation of diverse biological processes in organisms ranging from yeast to humans. We isolated a mutant of the SIR3 gene, implicated in the regulation of life span, as a suppressor of the Ca2+ sensitivity of zds1Δ cells in the budding yeast Saccharomyces cerevisiae. Therefore, ...

  13. Continuous High-resolution Microscopic Observation of Replicative Aging in Budding Yeast

    OpenAIRE

    Huberts, Daphne H. E. W.; Janssens, Georges E.; Lee, Sung Sik; Vizcarra, Ima Avalos; Heinemann, Matthias

    2013-01-01

    We demonstrate the use of a simple microfluidic setup, in which single budding yeast cells can be tracked throughout their entire lifespan. The microfluidic chip exploits the size difference between mother and daughter cells using an array of micropads. Upon loading, cells are trapped underneath these micropads, because the distance between the micropad and cover glass is similar to the diameter of a yeast cell (3-4 μm). After the loading procedure, culture medium is continuously flushed thro...

  14. Study of budding yeast colony formation and its characterizations by using circular granular cell

    Science.gov (United States)

    Aprianti, D.; Haryanto, F.; Purqon, A.; Khotimah, S. N.; Viridi, S.

    2016-03-01

    Budding yeast can exhibit colony formation in solid substrate. The colony of pathogenic budding yeast can colonize various surfaces of the human body and medical devices. Furthermore, it can form biofilm that resists drug effective therapy. The formation of the colony is affected by the interaction between cells and with its growth media. The cell budding pattern holds an important role in colony expansion. To study this colony growth, the molecular dynamic method was chosen to simulate the interaction between budding yeast cells. Every cell was modelled by circular granular cells, which can grow and produce buds. Cohesion force, contact force, and Stokes force govern this model to mimic the interaction between cells and with the growth substrate. Characterization was determined by the maximum (L max) and minimum (L min) distances between two cells within the colony and whether two lines that connect the two cells in the maximum and minimum distances intersect each other. Therefore, it can be recognized the colony shape in circular, oval, and irregular shapes. Simulation resulted that colony formation are mostly in oval shape with little branch. It also shows that greater cohesion strength obtains more compact colony formation.

  15. Integrated RNA- and protein profiling of fermentation and respiration in diploid budding yeast provides insight into nutrient control of cell growth and development.

    Science.gov (United States)

    Becker, Emmanuelle; Liu, Yuchen; Lardenois, Aurélie; Walther, Thomas; Horecka, Joe; Stuparevic, Igor; Law, Michael J; Lavigne, Régis; Evrard, Bertrand; Demougin, Philippe; Riffle, Michael; Strich, Randy; Davis, Ronald W; Pineau, Charles; Primig, Michael

    2015-04-24

    Diploid budding yeast undergoes rapid mitosis when it ferments glucose, and in the presence of a non-fermentable carbon source and the absence of a nitrogen source it triggers sporulation. Rich medium with acetate is a commonly used pre-sporulation medium, but our understanding of the molecular events underlying the acetate-driven transition from mitosis to meiosis is still incomplete. We identified 263 proteins for which mRNA and protein synthesis are linked or uncoupled in fermenting and respiring cells. Using motif predictions, interaction data and RNA profiling we find among them 28 likely targets for Ume6, a subunit of the conserved Rpd3/Sin3 histone deacetylase-complex regulating genes involved in metabolism, stress response and meiosis. Finally, we identify 14 genes for which both RNA and proteins are detected exclusively in respiring cells but not in fermenting cells in our sample set, including CSM4, SPR1, SPS4 and RIM4, which were thought to be meiosis-specific. Our work reveals intertwined transcriptional and post-transcriptional control mechanisms acting when a MATa/α strain responds to nutritional signals, and provides molecular clues how the carbon source primes yeast cells for entering meiosis. Our integrated genomics study provides insight into the interplay between the transcriptome and the proteome in diploid yeast cells undergoing vegetative growth in the presence of glucose (fermentation) or acetate (respiration). Furthermore, it reveals novel target genes involved in these processes for Ume6, the DNA binding subunit of the conserved histone deacetylase Rpd3 and the co-repressor Sin3. We have combined data from an RNA profiling experiment using tiling arrays that cover the entire yeast genome, and a large-scale protein detection analysis based on mass spectrometry in diploid MATa/α cells. This distinguishes our study from most others in the field-which investigate haploid yeast strains-because only diploid cells can undergo meiotic development

  16. The meiosis-specific nuclear passenger protein is required for proper assembly of forespore membrane in fission yeast.

    Science.gov (United States)

    Takaine, Masak; Imada, Kazuki; Numata, Osamu; Nakamura, Taro; Nakano, Kentaro

    2014-10-15

    Sporulation, gametogenesis in yeast, consists of meiotic nuclear division and spore morphogenesis. In the fission yeast Schizosaccharomyces pombe, the four haploid nuclei produced after meiosis II are encapsulated by the forespore membrane (FSM), which is newly synthesized from spindle pole bodies (SPBs) in the cytoplasm of the mother cell as spore precursors. Although the coordination between meiosis and FSM assembly is vital for proper sporulation, the underlying mechanism remains unclear. In the present study, we identified a new meiosis-specific protein Npg1, and found that it was involved in the efficient formation of spores and spore viability. The accumulation and organization of the FSM was compromised in npg1-null cells, leading to the error-prone envelopment of nuclei. Npg1 was first seen as internuclear dots and translocated to the SPBs before the FSM assembled. Genetic analysis revealed that Npg1 worked in conjunction with the FSM proteins Spo3 and Meu14. These results suggest a possible signaling link from the nucleus to the meiotic SPBs in order to associate the onset of FSM assembly with meiosis II, which ensures the successful partitioning of gametic nuclei. © 2014. Published by The Company of Biologists Ltd.

  17. Continuous High-resolution Microscopic Observation of Replicative Aging in Budding Yeast

    NARCIS (Netherlands)

    Huberts, Daphne H. E. W.; Janssens, Georges E.; Lee, Sung Sik; Vizcarra, Ima Avalos; Heinemann, Matthias

    We demonstrate the use of a simple microfluidic setup, in which single budding yeast cells can be tracked throughout their entire lifespan. The microfluidic chip exploits the size difference between mother and daughter cells using an array of micropads. Upon loading, cells are trapped underneath

  18. Whole lifespan microscopic observation of budding yeast aging through a microfluidic dissection platform

    NARCIS (Netherlands)

    Lee, Sung Sik; Avalos Vizcarra, Ima; Huberts, Daphne H E W; Lee, Luke P; Heinemann, Matthias

    2012-01-01

    Important insights into aging have been generated with the genetically tractable and short-lived budding yeast. However, it is still impossible today to continuously track cells by high-resolution microscopic imaging (e.g., fluorescent imaging) throughout their entire lifespan. Instead, the field

  19. 5'-end sequences of budding yeast full-length cDNA clones and quality scores - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available east_seq_qual.zip File URL: ftp://ftp.biosciencedbc.jp/archive/yeast_cdna/LATEST/...yeast_seq_qual.zip File size: 59.9MB Simple search URL http://togodb.biosciencedbc.jp/togodb/view/budding_yeast_cdna

  20. Downsides and benefits of unicellularity in budding yeast

    Science.gov (United States)

    Balazsi, Gabor; Chen, Lin; Kuzdzal-Fick, Jennie

    Yeast cells that do not separate after cell division form clumps. Clumping was shown to aid utilization of certain sugars, but its effects in stressful conditions are unknown. Generally speaking, what are the costs and benefits of unicellularity versus clumping multicellularity in normal and stressful conditions? To address this question, we evolved clumping yeast towards unicellularity by continuously propagating only those cells that remain suspended in liquid culture after settling. Whole-genome sequencing indicated that mutations in the AMN1 (antagonist of mitotic exit network) gene underlie the changes from clumping to unicellular phenotypes in these evolved yeast cells. Simple models predict that clumping should hinder growth in normal conditions while being protective in stress. Accordingly, we find experimentally that yeast clumps are more resistant to freeze/thaw, hydrogen peroxide, and ethanol stressors than their unicellular counterparts. On the other hand, unicellularity seems to be advantageous in normal conditions. Overall, these results reveal the downsides and benefits of unicellularity in different environmental conditions and uncover its genetic bases in yeast. This research was supported by the NIH Director's New Innovator Award Program (1DP2 OD006481-01), by NSF/IOS 1021675 and the Laufer Center for Physical & Quantitative Biology.

  1. Distinct temporal requirements for autophagy and the proteasome in yeast meiosis.

    Science.gov (United States)

    Wen, Fu-ping; Guo, Yue-shuai; Hu, Yang; Liu, Wei-xiao; Wang, Qian; Wang, Yuan-ting; Yu, Hai-Yan; Tang, Chao-ming; Yang, Jun; Zhou, Tao; Xie, Zhi-ping; Sha, Jia-hao; Guo, Xuejiang; Li, Wei

    2016-01-01

    Meiosis is a special type of cellular renovation that involves 2 successive cell divisions and a single round of DNA replication. Two major degradation systems, the autophagy-lysosome and the ubiquitin-proteasome, are involved in meiosis, but their roles have yet to be elucidated. Here we show that autophagy mainly affects the initiation of meiosis but not the nuclear division. Autophagy works not only by serving as a dynamic recycling system but also by eliminating some negative meiotic regulators such as Ego4 (Ynr034w-a). In a quantitative proteomics study, the proteasome was found to be significantly upregulated during meiotic divisions. We found that proteasomal activity is essential to the 2 successive meiotic nuclear divisions but not for the initiation of meiosis. Our study defines the roles of autophagy and the proteasome in meiosis: Autophagy mainly affects the initiation of meiosis, whereas the proteasome mainly affects the 2 successive meiotic divisions.

  2. The duration of mitosis and daughter cell size are modulated by nutrients in budding yeast.

    Science.gov (United States)

    Leitao, Ricardo M; Kellogg, Douglas R

    2017-11-06

    The size of nearly all cells is modulated by nutrients. Thus, cells growing in poor nutrients can be nearly half the size of cells in rich nutrients. In budding yeast, cell size is thought to be controlled almost entirely by a mechanism that delays cell cycle entry until sufficient growth has occurred in G1 phase. Here, we show that most growth of a new daughter cell occurs in mitosis. When the rate of growth is slowed by poor nutrients, the duration of mitosis is increased, which suggests that cells compensate for slow growth in mitosis by increasing the duration of growth. The amount of growth required to complete mitosis is reduced in poor nutrients, leading to a large reduction in cell size. Together, these observations suggest that mechanisms that control the extent of growth in mitosis play a major role in cell size control in budding yeast. © 2017 Leitao and Kellogg.

  3. Considerations for creating and annotating the budding yeast Genome Map at SGD: a progress report.

    Science.gov (United States)

    Chan, Esther T; Cherry, J Michael

    2012-01-01

    The Saccharomyces Genome Database (SGD) is compiling and annotating a comprehensive catalogue of functional sequence elements identified in the budding yeast genome. Recent advances in deep sequencing technologies have enabled for example, global analyses of transcription profiling and assembly of maps of transcription factor occupancy and higher order chromatin organization, at nucleotide level resolution. With this growing influx of published genome-scale data, come new challenges for their storage, display, analysis and integration. Here, we describe SGD's progress in the creation of a consolidated resource for genome sequence elements in the budding yeast, the considerations taken in its design and the lessons learned thus far. The data within this collection can be accessed at http://browse.yeastgenome.org and downloaded from http://downloads.yeastgenome.org. DATABASE URL: http://www.yeastgenome.org.

  4. Evolution of multinucleated Ashbya gossypii hyphae from a budding yeast-like ancestor.

    Science.gov (United States)

    Schmitz, Hans-Peter; Philippsen, Peter

    2011-06-01

    In the filamentous ascomycete Ashbya gossypii polarity establishment at sites of germ tube and lateral branch emergence depends on homologues of Saccharomyces cerevisiae factors controlling bud site selection and bud emergence. Maintenance of polar growth involves homologues of well-known polarity factors of budding yeast. To achieve the much higher rates of sustained polar surface expansion of hyphae compared to mainly non-polarly growing yeast buds five important alterations had to evolve. Permanent presence of the polarity machinery at a confined area in the rapidly expanding hyphal tip, increased cytoplasmic space with a much enlarged ER surface for generating secretory vesicles, efficient directed transport of secretory vesicles to and accumulation at the tip, increased capacity of the exocytosis system to process these vesicles, and an efficient endocytosis system for membrane and polarity factor recycling adjacent to the zone of exocytosis. Morphological, cell biological, and molecular aspects of this evolution are discussed based on experiments performed within the past 10 y. Copyright © 2011 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  5. Implication of Ca2+ in the regulation of replicative life span of budding yeast.

    Science.gov (United States)

    Tsubakiyama, Ryohei; Mizunuma, Masaki; Gengyo, Anri; Yamamoto, Josuke; Kume, Kazunori; Miyakawa, Tokichi; Hirata, Dai

    2011-08-19

    In eukaryotic cells, Ca(2+)-triggered signaling pathways are used to regulate a wide variety of cellular processes. Calcineurin, a highly conserved Ca(2+)/calmodulin-dependent protein phosphatase, plays key roles in the regulation of diverse biological processes in organisms ranging from yeast to humans. We isolated a mutant of the SIR3 gene, implicated in the regulation of life span, as a suppressor of the Ca(2+) sensitivity of zds1Δ cells in the budding yeast Saccharomyces cerevisiae. Therefore, we investigated a relationship between Ca(2+) signaling and life span in yeast. Here we show that Ca(2+) affected the replicative life span (RLS) of yeast. Increased external and intracellular Ca(2+) levels caused a reduction in their RLS. Consistently, the increase in calcineurin activity by either the zds1 deletion or the constitutively activated calcineurin reduced RLS. Indeed, the shortened RLS of zds1Δ cells was suppressed by the calcineurin deletion. Further, the calcineurin deletion per se promoted aging without impairing the gene silencing typically observed in short-lived sir mutants, indicating that calcineurin plays an important role in a regulation of RLS even under normal growth condition. Thus, our results indicate that Ca(2+) homeostasis/Ca(2+) signaling are required to regulate longevity in budding yeast.

  6. Phosphorylation of the Synaptonemal Complex Protein Zip1 Regulates the Crossover/Noncrossover Decision during Yeast Meiosis.

    Directory of Open Access Journals (Sweden)

    Xiangyu Chen

    2015-12-01

    Full Text Available Interhomolog crossovers promote proper chromosome segregation during meiosis and are formed by the regulated repair of programmed double-strand breaks. This regulation requires components of the synaptonemal complex (SC, a proteinaceous structure formed between homologous chromosomes. In yeast, SC formation requires the "ZMM" genes, which encode a functionally diverse set of proteins, including the transverse filament protein, Zip1. In wild-type meiosis, Zmm proteins promote the biased resolution of recombination intermediates into crossovers that are distributed throughout the genome by interference. In contrast, noncrossovers are formed primarily through synthesis-dependent strand annealing mediated by the Sgs1 helicase. This work identifies a conserved region on the C terminus of Zip1 (called Zip1 4S, whose phosphorylation is required for the ZMM pathway of crossover formation. Zip1 4S phosphorylation is promoted both by double-strand breaks (DSBs and the meiosis-specific kinase, MEK1/MRE4, demonstrating a role for MEK1 in the regulation of interhomolog crossover formation, as well as interhomolog bias. Failure to phosphorylate Zip1 4S results in meiotic prophase arrest, specifically in the absence of SGS1. This gain of function meiotic arrest phenotype is suppressed by spo11Δ, suggesting that it is due to unrepaired breaks triggering the meiotic recombination checkpoint. Epistasis experiments combining deletions of individual ZMM genes with sgs1-md zip1-4A indicate that Zip1 4S phosphorylation functions prior to the other ZMMs. These results suggest that phosphorylation of Zip1 at DSBs commits those breaks to repair via the ZMM pathway and provides a mechanism by which the crossover/noncrossover decision can be dynamically regulated during yeast meiosis.

  7. The Malleable Nature of the Budding Yeast Nuclear Envelope: Flares, Fusion, and Fenestrations.

    Science.gov (United States)

    Meseroll, Rebecca A; Cohen-Fix, Orna

    2016-11-01

    In eukaryotes, the nuclear envelope (NE) physically separates nuclear components and activities from rest of the cell. The NE also provides rigidity to the nucleus and contributes to chromosome organization. At the same time, the NE is highly dynamic; it must change shape and rearrange its components during development and throughout the cell cycle, and its morphology can be altered in response to mutation and disease. Here we focus on the NE of budding yeast, Saccharomyces cerevisiae, which has several unique features: it remains intact throughout the cell cycle, expands symmetrically during interphase, elongates during mitosis and, expands asymmetrically during mitotic delay. Moreover, its NE is safely breached during mating and when large structures, such as nuclear pore complexes and the spindle pole body, are embedded into its double membrane. The budding yeast NE lacks lamins and yet the nucleus is capable of maintaining a spherical shape throughout interphase. Despite these eccentricities, studies of the budding yeast NE have uncovered interesting, and likely conserved, processes that contribute to NE dynamics. In particular, we discuss the processes that drive and enable NE expansion and the dramatic changes in the NE that lead to extensions and fenestrations. J. Cell. Physiol. 231: 2353-2360, 2016. Published 2016. This article is a U.S. Government work and is in the public domain in the USA. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

  8. Relationship between sensitivity to ultraviolet light and budding in yeast cells of different culture ages

    International Nuclear Information System (INIS)

    Atsuta, J.; Okajima, S.

    1976-01-01

    Subpopulations of yeast cells, consisting of cells of different sizes and different percentages of budding cells, were prepared by centrifugation through sucrose solutions with linear density gradients of cultures at different phases of the growth cycle. Ultraviolet survival of these cells was determined by colony counting, and the survival rate was compared with the cells' respiratory rates. Individual budding cells and interdivisional cells, and also mother cells and daughter cells derived from irradiated budding cells, were isolated by the micromanipulation technique. The number of divisions in each cell was measured during a 21-hr incubation period immediately after irradiation. In the population in the logarithmic phase consisting of homogeneous cells of middle size, no difference in uv sensitivity was observed between mother cells and daughter cells, irrespective of mutual adhesion. Budding cell resistance was observed in the population in the transitional phase; this was due to the lesser uv sensitivity of daughter cells in the fresh medium. In the stationary phase, daughter cells were rather more sensitive than mother cells or interdivisional cells, so there was little difference in uv sensitivity between budding cells and interdivisional cells

  9. Genetic variation in adaptability and pleiotropy in budding yeast.

    Science.gov (United States)

    Jerison, Elizabeth R; Kryazhimskiy, Sergey; Mitchell, James Kameron; Bloom, Joshua S; Kruglyak, Leonid; Desai, Michael M

    2017-08-17

    Evolution can favor organisms that are more adaptable, provided that genetic variation in adaptability exists. Here, we quantify this variation among 230 offspring of a cross between diverged yeast strains. We measure the adaptability of each offspring genotype, defined as its average rate of adaptation in a specific environmental condition, and analyze the heritability, predictability, and genetic basis of this trait. We find that initial genotype strongly affects adaptability and can alter the genetic basis of future evolution. Initial genotype also affects the pleiotropic consequences of adaptation for fitness in a different environment. This genetic variation in adaptability and pleiotropy is largely determined by initial fitness, according to a rule of declining adaptability with increasing initial fitness, but several individual QTLs also have a significant idiosyncratic role. Our results demonstrate that both adaptability and pleiotropy are complex traits, with extensive heritable differences arising from naturally occurring variation.

  10. Budding yeast ATM/ATR control meiotic double-strand break (DSB levels by down-regulating Rec114, an essential component of the DSB-machinery.

    Directory of Open Access Journals (Sweden)

    Jesús A Carballo

    2013-06-01

    Full Text Available An essential feature of meiosis is Spo11 catalysis of programmed DNA double strand breaks (DSBs. Evidence suggests that the number of DSBs generated per meiosis is genetically determined and that this ability to maintain a pre-determined DSB level, or "DSB homeostasis", might be a property of the meiotic program. Here, we present direct evidence that Rec114, an evolutionarily conserved essential component of the meiotic DSB-machinery, interacts with DSB hotspot DNA, and that Tel1 and Mec1, the budding yeast ATM and ATR, respectively, down-regulate Rec114 upon meiotic DSB formation through phosphorylation. Mimicking constitutive phosphorylation reduces the interaction between Rec114 and DSB hotspot DNA, resulting in a reduction and/or delay in DSB formation. Conversely, a non-phosphorylatable rec114 allele confers a genome-wide increase in both DSB levels and in the interaction between Rec114 and the DSB hotspot DNA. These observations strongly suggest that Tel1 and/or Mec1 phosphorylation of Rec114 following Spo11 catalysis down-regulates DSB formation by limiting the interaction between Rec114 and DSB hotspots. We also present evidence that Ndt80, a meiosis specific transcription factor, contributes to Rec114 degradation, consistent with its requirement for complete cessation of DSB formation. Loss of Rec114 foci from chromatin is associated with homolog synapsis but independent of Ndt80 or Tel1/Mec1 phosphorylation. Taken together, we present evidence for three independent ways of regulating Rec114 activity, which likely contribute to meiotic DSBs-homeostasis in maintaining genetically determined levels of breaks.

  11. Budding Yeast ATM/ATR Control Meiotic Double-Strand Break (DSB) Levels by Down-Regulating Rec114, an Essential Component of the DSB-machinery

    Science.gov (United States)

    Carballo, Jesús A.; Panizza, Silvia; Serrentino, Maria Elisabetta; Johnson, Anthony L.; Geymonat, Marco; Borde, Valérie; Klein, Franz; Cha, Rita S.

    2013-01-01

    An essential feature of meiosis is Spo11 catalysis of programmed DNA double strand breaks (DSBs). Evidence suggests that the number of DSBs generated per meiosis is genetically determined and that this ability to maintain a pre-determined DSB level, or “DSB homeostasis”, might be a property of the meiotic program. Here, we present direct evidence that Rec114, an evolutionarily conserved essential component of the meiotic DSB-machinery, interacts with DSB hotspot DNA, and that Tel1 and Mec1, the budding yeast ATM and ATR, respectively, down-regulate Rec114 upon meiotic DSB formation through phosphorylation. Mimicking constitutive phosphorylation reduces the interaction between Rec114 and DSB hotspot DNA, resulting in a reduction and/or delay in DSB formation. Conversely, a non-phosphorylatable rec114 allele confers a genome-wide increase in both DSB levels and in the interaction between Rec114 and the DSB hotspot DNA. These observations strongly suggest that Tel1 and/or Mec1 phosphorylation of Rec114 following Spo11 catalysis down-regulates DSB formation by limiting the interaction between Rec114 and DSB hotspots. We also present evidence that Ndt80, a meiosis specific transcription factor, contributes to Rec114 degradation, consistent with its requirement for complete cessation of DSB formation. Loss of Rec114 foci from chromatin is associated with homolog synapsis but independent of Ndt80 or Tel1/Mec1 phosphorylation. Taken together, we present evidence for three independent ways of regulating Rec114 activity, which likely contribute to meiotic DSBs-homeostasis in maintaining genetically determined levels of breaks. PMID:23825959

  12. Direct and indirect control of the initiation of meiotic recombination by DNA damage checkpoint mechanisms in budding yeast.

    Directory of Open Access Journals (Sweden)

    Bilge Argunhan

    Full Text Available Meiotic recombination plays an essential role in the proper segregation of chromosomes at meiosis I in many sexually reproducing organisms. Meiotic recombination is initiated by the scheduled formation of genome-wide DNA double-strand breaks (DSBs. The timing of DSB formation is strictly controlled because unscheduled DSB formation is detrimental to genome integrity. Here, we investigated the role of DNA damage checkpoint mechanisms in the control of meiotic DSB formation using budding yeast. By using recombination defective mutants in which meiotic DSBs are not repaired, the effect of DNA damage checkpoint mutations on DSB formation was evaluated. The Tel1 (ATM pathway mainly responds to unresected DSB ends, thus the sae2 mutant background in which DSB ends remain intact was employed. On the other hand, the Mec1 (ATR pathway is primarily used when DSB ends are resected, thus the rad51 dmc1 double mutant background was employed in which highly resected DSBs accumulate. In order to separate the effect caused by unscheduled cell cycle progression, which is often associated with DNA damage checkpoint defects, we also employed the ndt80 mutation which permanently arrests the meiotic cell cycle at prophase I. In the absence of Tel1, DSB formation was reduced in larger chromosomes (IV, VII, II and XI whereas no significant reduction was found in smaller chromosomes (III and VI. On the other hand, the absence of Rad17 (a critical component of the ATR pathway lead to an increase in DSB formation (chromosomes VII and II were tested. We propose that, within prophase I, the Tel1 pathway facilitates DSB formation, especially in bigger chromosomes, while the Mec1 pathway negatively regulates DSB formation. We also identified prophase I exit, which is under the control of the DNA damage checkpoint machinery, to be a critical event associated with down-regulating meiotic DSB formation.

  13. Focal accumulation of preribosomes outside the nucleolus during metaphase-anaphase in budding yeast.

    Science.gov (United States)

    Moriggi, Giulia; Gaspar, Sonia G; Nieto, Blanca; Bustelo, Xosé R; Dosil, Mercedes

    2017-09-01

    Saccharomyces cerevisiae contains one nucleolus that remains intact in the mother-cell side of the nucleus throughout most of mitosis. Based on this, it is assumed that the bulk of ribosome production during cell division occurs in the mother cell. Here, we show that the ribosome synthesis machinery localizes not only in the nucleolus but also at a center that is present in the bud side of the nucleus after the initiation of mitosis. This center can be visualized by live microscopy as a punctate body located in close proximity to the nuclear envelope and opposite to the nucleolus. It contains ribosomal DNA (rDNA) and precursors of both 40S and 60S ribosomal subunits. Proteins that actively participate in ribosome synthesis, but not functionally defective variants, accumulate in that site. The formation of this body occurs in the metaphase-to-anaphase transition when discrete regions of rDNA occasionally exit the nucleolus and move into the bud. Collectively, our data unveil the existence of a previously unknown mechanism for preribosome accumulation at the nuclear periphery in budding yeast. We propose that this might be a strategy to expedite the delivery of ribosomes to the growing bud. © 2017 Moriggi et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  14. Focal accumulation of preribosomes outside the nucleolus during metaphase–anaphase in budding yeast

    Science.gov (United States)

    Moriggi, Giulia; Gaspar, Sonia G.; Nieto, Blanca; Bustelo, Xosé R.

    2017-01-01

    Saccharomyces cerevisiae contains one nucleolus that remains intact in the mother-cell side of the nucleus throughout most of mitosis. Based on this, it is assumed that the bulk of ribosome production during cell division occurs in the mother cell. Here, we show that the ribosome synthesis machinery localizes not only in the nucleolus but also at a center that is present in the bud side of the nucleus after the initiation of mitosis. This center can be visualized by live microscopy as a punctate body located in close proximity to the nuclear envelope and opposite to the nucleolus. It contains ribosomal DNA (rDNA) and precursors of both 40S and 60S ribosomal subunits. Proteins that actively participate in ribosome synthesis, but not functionally defective variants, accumulate in that site. The formation of this body occurs in the metaphase-to-anaphase transition when discrete regions of rDNA occasionally exit the nucleolus and move into the bud. Collectively, our data unveil the existence of a previously unknown mechanism for preribosome accumulation at the nuclear periphery in budding yeast. We propose that this might be a strategy to expedite the delivery of ribosomes to the growing bud. PMID:28588079

  15. Screening the budding yeast genome reveals unique factors affecting K2 toxin susceptibility.

    Science.gov (United States)

    Servienė, Elena; Lukša, Juliana; Orentaitė, Irma; Lafontaine, Denis L J; Urbonavičius, Jaunius

    2012-01-01

    Understanding how biotoxins kill cells is of prime importance in biomedicine and the food industry. The budding yeast (S. cerevisiae) killers serve as a convenient model to study the activity of biotoxins consistently supplying with significant insights into the basic mechanisms of virus-host cell interactions and toxin entry into eukaryotic target cells. K1 and K2 toxins are active at the cell wall, leading to the disruption of the plasma membrane and subsequent cell death by ion leakage. K28 toxin is active in the cell nucleus, blocking DNA synthesis and cell cycle progression, thereby triggering apoptosis. Genome-wide screens in the budding yeast S. cerevisiae identified several hundred effectors of K1 and K28 toxins. Surprisingly, no such screen had been performed for K2 toxin, the most frequent killer toxin among industrial budding yeasts. We conducted several concurrent genome-wide screens in S. cerevisiae and identified 332 novel K2 toxin effectors. The effectors involved in K2 resistance and hypersensitivity largely map in distinct cellular pathways, including cell wall and plasma membrane structure/biogenesis and mitochondrial function for K2 resistance, and cell wall stress signaling and ion/pH homeostasis for K2 hypersensitivity. 70% of K2 effectors are different from those involved in K1 or K28 susceptibility. Our work demonstrates that despite the fact that K1 and K2 toxins share some aspects of their killing strategies, they largely rely on different sets of effectors. Since the vast majority of the host factors identified here is exclusively active towards K2, we conclude that cells have acquired a specific K2 toxin effectors set. Our work thus indicates that K1 and K2 have elaborated different biological pathways and provides a first step towards the detailed characterization of K2 mode of action.

  16. License - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project License to Use This Database Last updated : 2010/02/15 You may use this databas...ional License described below. The Standard License specifies the license terms regarding the use of this database... and the requirements you must follow in using this database. The Additiona...n the Standard License. Standard License The Standard License for this database is the license specified in ...the Creative Commons Attribution-Share Alike 2.1 Japan . If you use data from this database

  17. Mek1 Down Regulates Rad51 Activity during Yeast Meiosis by Phosphorylation of Hed1.

    Science.gov (United States)

    Callender, Tracy L; Laureau, Raphaelle; Wan, Lihong; Chen, Xiangyu; Sandhu, Rima; Laljee, Saif; Zhou, Sai; Suhandynata, Ray T; Prugar, Evelyn; Gaines, William A; Kwon, YoungHo; Börner, G Valentin; Nicolas, Alain; Neiman, Aaron M; Hollingsworth, Nancy M

    2016-08-01

    During meiosis, programmed double strand breaks (DSBs) are repaired preferentially between homologs to generate crossovers that promote proper chromosome segregation at Meiosis I. In many organisms, there are two strand exchange proteins, Rad51 and the meiosis-specific Dmc1, required for interhomolog (IH) bias. This bias requires the presence, but not the strand exchange activity of Rad51, while Dmc1 is responsible for the bulk of meiotic recombination. How these activities are regulated is less well established. In dmc1Δ mutants, Rad51 is actively inhibited, thereby resulting in prophase arrest due to unrepaired DSBs triggering the meiotic recombination checkpoint. This inhibition is dependent upon the meiosis-specific kinase Mek1 and occurs through two different mechanisms that prevent complex formation with the Rad51 accessory factor Rad54: (i) phosphorylation of Rad54 by Mek1 and (ii) binding of Rad51 by the meiosis-specific protein Hed1. An open question has been why inhibition of Mek1 affects Hed1 repression of Rad51. This work shows that Hed1 is a direct substrate of Mek1. Phosphorylation of Hed1 at threonine 40 helps suppress Rad51 activity in dmc1Δ mutants by promoting Hed1 protein stability. Rad51-mediated recombination occurring in the absence of Hed1 phosphorylation results in a significant increase in non-exchange chromosomes despite wild-type levels of crossovers, confirming previous results indicating a defect in crossover assurance. We propose that Rad51 function in meiosis is regulated in part by the coordinated phosphorylation of Rad54 and Hed1 by Mek1.

  18. Mek1 Down Regulates Rad51 Activity during Yeast Meiosis by Phosphorylation of Hed1.

    Directory of Open Access Journals (Sweden)

    Tracy L Callender

    2016-08-01

    Full Text Available During meiosis, programmed double strand breaks (DSBs are repaired preferentially between homologs to generate crossovers that promote proper chromosome segregation at Meiosis I. In many organisms, there are two strand exchange proteins, Rad51 and the meiosis-specific Dmc1, required for interhomolog (IH bias. This bias requires the presence, but not the strand exchange activity of Rad51, while Dmc1 is responsible for the bulk of meiotic recombination. How these activities are regulated is less well established. In dmc1Δ mutants, Rad51 is actively inhibited, thereby resulting in prophase arrest due to unrepaired DSBs triggering the meiotic recombination checkpoint. This inhibition is dependent upon the meiosis-specific kinase Mek1 and occurs through two different mechanisms that prevent complex formation with the Rad51 accessory factor Rad54: (i phosphorylation of Rad54 by Mek1 and (ii binding of Rad51 by the meiosis-specific protein Hed1. An open question has been why inhibition of Mek1 affects Hed1 repression of Rad51. This work shows that Hed1 is a direct substrate of Mek1. Phosphorylation of Hed1 at threonine 40 helps suppress Rad51 activity in dmc1Δ mutants by promoting Hed1 protein stability. Rad51-mediated recombination occurring in the absence of Hed1 phosphorylation results in a significant increase in non-exchange chromosomes despite wild-type levels of crossovers, confirming previous results indicating a defect in crossover assurance. We propose that Rad51 function in meiosis is regulated in part by the coordinated phosphorylation of Rad54 and Hed1 by Mek1.

  19. Global study of holistic morphological effectors in the budding yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Suzuki, Godai; Wang, Yang; Kubo, Karen; Hirata, Eri; Ohnuki, Shinsuke; Ohya, Yoshikazu

    2018-02-20

    The size of the phenotypic effect of a gene has been thoroughly investigated in terms of fitness and specific morphological traits in the budding yeast Saccharomyces cerevisiae, but little is known about gross morphological abnormalities. We identified 1126 holistic morphological effectors that cause severe gross morphological abnormality when deleted, and 2241 specific morphological effectors with weak holistic effects but distinctive effects on yeast morphology. Holistic effectors fell into many gene function categories and acted as network hubs, affecting a large number of morphological traits, interacting with a large number of genes, and facilitating high protein expression. Holistic morphological abnormality was useful for estimating the importance of a gene to morphology. The contribution of gene importance to fitness and morphology could be used to efficiently classify genes into functional groups. Holistic morphological abnormality can be used as a reproducible and reliable gene feature for high-dimensional morphological phenotyping. It can be used in many functional genomic applications.

  20. Comparative proteomics of mitosis and meiosis in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kumar, Ravinder; Dhali, Snigdha; Srikanth, Rapole; Ghosh, Santanu Kumar; Srivastava, Sanjeeva

    2014-09-23

    Precise and timely segregation of genetic material and conservation of ploidy are the two foremost requirements for survival of a eukaryotic organism. Two highly regulated cell division processes, namely mitosis and meiosis are central to achieve this objective. The modes of chromosome segregation are distinct in these two processes that generate progeny cells of equal ploidy and half the ploidy in mitosis and meiosis, respectively. Additionally, the nutritional requirement and intracellular processing of biological cue also differ in these two processes. From this, it can be envisaged that proteome of mitotic and meiotic cells will differ significantly. Therefore, identification of proteins that differ in their level of expression between mitosis and meiosis would further reveal the mechanistic detail of these processes. In the present study, we have investigated the protein expression profile of mitosis and meiosis by comparing proteome of budding yeast cultures arrested at mitotic metaphase and metaphase-I of meiosis using proteomic approach. Approximately 1000 and 2000 protein spots were visualized on 2-DE and 2D-DIGE gels respectively, out of which 14 protein spots were significant in 2-DE and 22 in 2D-DIGE (pmitosis, an up-regulation of actin cytoskeleton and its negative regulator occurs in meiosis. Mitosis and meiosis are two different types of cell division cycles with entirely different outcomes with definite biological implication for almost all eukaryotic species. In this work, we investigated, for the first time, the differential proteomic profile of Saccharomyces cerevisiae culture arrested at mitotic metaphase (M) and metaphase-I (MI) of meiosis using 2-DE and 2D-DIGE. Our findings of up-regulation of actin and its negative regulator cofilin during meiosis suggest that the rate of actin cytoskeleton turnover is more in meiosis and actin cytoskeleton may play more crucial role during meiosis compared to mitosis. Present study also suggests that actin

  1. Synchronization and Arrest of the Budding Yeast Cell Cycle Using Chemical and Genetic Methods.

    Science.gov (United States)

    Rosebrock, Adam P

    2017-01-03

    The cell cycle of budding yeast can be arrested at specific positions by different genetic and chemical methods. These arrests enable study of cell cycle phase-specific phenotypes that would be missed during examination of asynchronous cultures. Some methods for arrest are reversible, with kinetics that enable release of cells back into a synchronous cycling state. Benefits of chemical and genetic methods include scalability across a large range of culture sizes from a few milliliters to many liters, ease of execution, the absence of specific equipment requirements, and synchronization and release of the entire culture. Of note, cell growth and division are decoupled during arrest and block-release experiments. Cells will continue transcription, translation, and accumulation of protein while arrested. If allowed to reenter the cell cycle, cells will do so as a population of mixed, larger-than-normal cells. Despite this important caveat, many aspects of budding yeast physiology are accessible using these simple chemical and genetic tools. Described here are methods for the block and release of cells in G 1 phase and at the M/G 1 transition using α-factor mating pheromone and the temperature-sensitive cdc15-2 allele, respectively, in addition to methods for arresting the cell cycle in early S phase and at G 2 /M by using hydroxyurea and nocodazole, respectively. © 2017 Cold Spring Harbor Laboratory Press.

  2. An insight into the complex prion-prion interaction network in the budding yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Du, Zhiqiang; Valtierra, Stephanie; Li, Liming

    2014-01-01

    The budding yeast Saccharomyces cerevisiae is a valuable model system for studying prion-prion interactions as it contains multiple prion proteins. A recent study from our laboratory showed that the existence of Swi1 prion ([SWI(+)]) and overproduction of Swi1 can have strong impacts on the formation of 2 other extensively studied yeast prions, [PSI(+)] and [PIN(+)] ([RNQ(+)]) (Genetics, Vol. 197, 685-700). We showed that a single yeast cell is capable of harboring at least 3 heterologous prion elements and these prions can influence each other's appearance positively and/or negatively. We also showed that during the de novo [PSI(+)] formation process upon Sup35 overproduction, the aggregation patterns of a preexisting inducer ([RNQ(+)] or [SWI(+)]) can undergo significant remodeling from stably transmitted dot-shaped aggregates to aggregates that co-localize with the newly formed Sup35 aggregates that are ring/ribbon/rod- shaped. Such co-localization disappears once the newly formed [PSI(+)] prion stabilizes. Our finding provides strong evidence supporting the "cross-seeding" model for prion-prion interactions and confirms earlier reports that the interactions among different prions and their prion proteins mostly occur at the initiation stages of prionogenesis. Our results also highlight a complex prion interaction network in yeast. We believe that elucidating the mechanism underlying the yeast prion-prion interaction network will not only provide insight into the process of prion de novo generation and propagation in yeast but also shed light on the mechanisms that govern protein misfolding, aggregation, and amyloidogenesis in higher eukaryotes.

  3. Live cell imaging of mitochondrial movement along actin cables in budding yeast.

    Science.gov (United States)

    Fehrenbacher, Kammy L; Yang, Hyeong-Cheol; Gay, Anna Card; Huckaba, Thomas M; Pon, Liza A

    2004-11-23

    Mitochondrial inheritance is essential for cell division. In budding yeast, mitochondrial movement from mother to daughter requires (1) actin cables, F-actin bundles that undergo retrograde movement during elongation from buds into mother cells; (2) the mitochore, a mitochondrial protein complex implicated in linking mitochondria to actin cables; and (3) Arp2/3 complex-mediated force generation on mitochondria. We observed three new classes of mitochondrial motility: anterograde movement at velocities of 0.2-0.33 microm/s, retrograde movement at velocities of 0.26-0.51 microm/s, and no net anterograde or retrograde movement. In all cases, motile mitochondria were associated with actin cables undergoing retrograde flow at velocities of 0.18-0.62 microm/s. Destabilization of actin cables or mutations of the mitochore blocked all mitochondrial movements. In contrast, mutations in the Arp2/3 complex affected anterograde but not retrograde mitochondrial movements. Actin cables are required for movement of mitochondria, secretory vesicles, mRNA, and spindle alignment elements in yeast. We provide the first direct evidence that one of the proposed cargos use actin cables as tracks. In the case of mitochondrial inheritance, anterograde movement drives transfer of the organelle from mothers to buds, while retrograde movement contributes to retention of the organelle in mother cells. Interaction of mitochondria with actin cables is required for anterograde and retrograde movement. In contrast, force generation on mitochondria is required only for anterograde movement. Finally, we propose a novel mechanism in which actin cables serve as "conveyor belts" that drive retrograde organelle movement.

  4. Control of the mitotic exit network during meiosis

    Science.gov (United States)

    Attner, Michelle A.; Amon, Angelika

    2012-01-01

    The mitotic exit network (MEN) is an essential GTPase signaling pathway that triggers exit from mitosis in budding yeast. We show here that during meiosis, the MEN is dispensable for exit from meiosis I but contributes to the timely exit from meiosis II. Consistent with a role for the MEN during meiosis II, we find that the signaling pathway is active only during meiosis II. Our analysis further shows that MEN signaling is modulated during meiosis in several key ways. Whereas binding of MEN components to spindle pole bodies (SPBs) is necessary for MEN signaling during mitosis, during meiosis MEN signaling occurs off SPBs and does not require the SPB recruitment factor Nud1. Furthermore, unlike during mitosis, MEN signaling is controlled through the regulated interaction between the MEN kinase Dbf20 and its activating subunit Mob1. Our data lead to the conclusion that a pathway essential for vegetative growth is largely dispensable for the specialized meiotic divisions and provide insights into how cell cycle regulatory pathways are modulated to accommodate different modes of cell division. PMID:22718910

  5. The phytopathogenic virulent effector protein RipI induces apoptosis in budding yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Deng, Meng-Ying; Sun, Yun-Hao; Li, Pai; Fu, Bei; Shen, Dong; Lu, Yong-Jun

    2016-10-01

    Virulent protein toxins secreted by the bacterial pathogens can cause cytotoxicity by various molecular mechanisms to combat host cell defense. On the other hand, these proteins can also be used as probes to investigate the defense pathway of host innate immunity. Ralstonia solanacearum, one of the most virulent bacterial phytopathogens, translocates more than 70 effector proteins via type III secretion system during infection. Here, we characterized the cytotoxicity of effector RipI in budding yeast Saccharomyce scerevisiae, an alternative host model. We found that over-expression of RipI resulted in severe growth defect and arginine (R) 117 within the predicted integrase motif was required for inhibition of yeast growth. The phenotype of death manifested the hallmarks of apoptosis. Our data also revealed that RipI-induced apoptosis was independent of Yca1 and mitochondria-mediated apoptotic pathways because Δyca1 and Δaif1 were both sensitive to RipI as compared with the wild type. We further demonstrated that RipI was localized in the yeast nucleus and the N-terminal 1-174aa was required for the localization. High-throughput RNA sequencing analysis showed that upon RipI over-expression, 101 unigenes of yeast ribosome presented lower expression level, and 42 GO classes related to the nucleus or recombination were enriched with differential expression levels. Taken together, our data showed that a nuclear-targeting effector RipI triggers yeast apoptosis, potentially dependent on its integrase function. Our results also provided an alternative strategy to dissect the signaling pathway of cytotoxicity induced by the protein toxins. Copyright © 2016 Elsevier Ltd. All rights reserved.

  6. Methods for Synchronization and Analysis of the Budding Yeast Cell Cycle.

    Science.gov (United States)

    Rosebrock, Adam P

    2017-01-03

    Like other eukaryotes, budding yeast temporally separate cell growth and division. DNA synthesis is distinct from chromosome segregation. Storage carbohydrates are accumulated slowly and then rapidly liquidated once per cycle. Cyclin-dependent kinase associates with multiple different transcriptionally and posttranslationally regulated cyclins to drive the cell cycle. These and other crucial events of cellular growth and division are limited to narrow windows of the cell cycle. Many experiments in the yeast laboratory treat a culture of cells as a homogeneous mixture. Measurements of asynchronous cultures are, however, confounded by the presence of cells in various cell cycle stages; measuring a population average in unsynchronized cells provides at best a decreased signal and at worst an artifactual result. A number of experimentally tractable methods have been developed to generate populations of yeast cells that are synchronized with respect to cell cycle phase. Robust methods for determining cell cycle position have also been developed. These methods are introduced here. © 2017 Cold Spring Harbor Laboratory Press.

  7. Specificity of mutations induced by carbon ions in budding yeast Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Matuo, Youichirou; Nishijima, Shigehiro; Hase, Yoshihiro; Sakamoto, Ayako; Tanaka, Atsushi; Shimizu, Kikuo

    2006-01-01

    To investigate the nature of mutations induced by accelerated ions in eukaryotic cells, the effects of carbon-ion irradiation were compared with those of γ-ray irradiation in the budding yeast Saccharomyces cerevisiae. The mutational effect and specificity of carbon-ion beams were studied in the URA3 gene of the yeast. Our experiments showed that the carbon ions generated more than 10 times the number of mutations induced by γ-rays, and that the types of base changes induced by carbon ions include transversions (68.7%), transitions (13.7%) and deletions/insertions (17.6%). The transversions were mainly G:C → T:A, and all the transitions were G:C → A:T. In comparison with the surrounding sequence context of mutational base sites, the C residues in the 5'-AC(A/T)-3' sequence were found to be easily changed. Large deletions and duplications were not observed, whereas ion-induced mutations in Arabidopsis thaliana were mainly short deletions and rearrangements. The remarkable feature of yeast mutations induced by carbon ions was that the mutation sites were localized near the linker regions of nucleosomes, whereas mutations induced by γ-ray irradiation were located uniformly throughout the gene

  8. Specificity of mutations induced by carbon ions in budding yeast Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Matuo, Youichirou [Graduate School of Engineering, Osaka University, Yamada-oka 2-1, Suita, Osaka 565-0871 (Japan); Nishijima, Shigehiro [Graduate School of Engineering, Osaka University, Yamada-oka 2-1, Suita, Osaka 565-0871 (Japan); Hase, Yoshihiro [Radiation-Applied Biology Division, Quantum Beam Science Directorate, Japan Atomic Energy Agency (JAEA), Watanuki-machi 1233, Takasaki, Gunma 370-1292 (Japan); Sakamoto, Ayako [Radiation-Applied Biology Division, Quantum Beam Science Directorate, Japan Atomic Energy Agency (JAEA), Watanuki-machi 1233, Takasaki, Gunma 370-1292 (Japan); Tanaka, Atsushi [Radiation-Applied Biology Division, Quantum Beam Science Directorate, Japan Atomic Energy Agency (JAEA), Watanuki-machi 1233, Takasaki, Gunma 370-1292 (Japan); Shimizu, Kikuo [Radioisotope Research Center, Osaka University, Yamada-oka 2-4, Suita, Osaka 565-0871 (Japan)]. E-mail: shimizu@rirc.osaka-u.ac.jp

    2006-12-01

    To investigate the nature of mutations induced by accelerated ions in eukaryotic cells, the effects of carbon-ion irradiation were compared with those of {gamma}-ray irradiation in the budding yeast Saccharomyces cerevisiae. The mutational effect and specificity of carbon-ion beams were studied in the URA3 gene of the yeast. Our experiments showed that the carbon ions generated more than 10 times the number of mutations induced by {gamma}-rays, and that the types of base changes induced by carbon ions include transversions (68.7%), transitions (13.7%) and deletions/insertions (17.6%). The transversions were mainly G:C {sup {yields}} T:A, and all the transitions were G:C {sup {yields}} A:T. In comparison with the surrounding sequence context of mutational base sites, the C residues in the 5'-AC(A/T)-3' sequence were found to be easily changed. Large deletions and duplications were not observed, whereas ion-induced mutations in Arabidopsis thaliana were mainly short deletions and rearrangements. The remarkable feature of yeast mutations induced by carbon ions was that the mutation sites were localized near the linker regions of nucleosomes, whereas mutations induced by {gamma}-ray irradiation were located uniformly throughout the gene.

  9. Analysis of Schizosaccharomyces pombe Meiosis.

    Science.gov (United States)

    Yamashita, Akira; Sakuno, Takeshi; Watanabe, Yoshinori; Yamamoto, Masayuki

    2017-09-01

    Meiosis is a specialized cell cycle that generates haploid gametes from diploid cells. The fission yeast Schizosaccharomyces pombe is one of the best model organisms for studying the regulatory mechanisms of meiosis. S. pombe cells, which normally grow in the haploid state, diploidize by conjugation and initiate meiosis when starved for nutrients, especially nitrogen. Following two rounds of chromosome segregation, spore formation takes place. The switch from mitosis to meiosis is controlled by a kinase, Pat1, and an RNA-binding protein, Mei2. Mei2 is also a key factor for meiosis-specific gene expression. Studies on S. pombe have offered insights into cell cycle regulation and chromosome segregation during meiosis. Here we outline the current understanding of the molecular mechanisms regulating the initiation and progression of meiosis, and introduce methods for the study of meiosis in fission yeast. © 2017 Cold Spring Harbor Laboratory Press.

  10. Constitutive Activation of the Fission Yeast Pheromone-Responsive Pathway Induces Ectopic Meiosis and Reveals Ste11 as a Mitogen-Activated Protein Kinase Target

    DEFF Research Database (Denmark)

    Kjærulff, Søren; Lautrup-Larsen, I.; Truelsen, S.

    2005-01-01

    In the fission yeast Schizosaccharomyces pombe, meiosis normally takes place in diploid zygotes resulting from conjugation of haploid cells. In the present study, we report that the expression of a constitutively activated version of the pheromone-responsive mitogen-activated protein kinase kinase...... found that haploid meiosis was dramatically reduced when Ste11 was mutated to mimic phosphorylation by Pat1. The mutation of two putative MAPK sites in Ste11 also dramatically reduced the level of haploid meiosis, suggesting that Ste11 is a direct target of Spk1. Supporting this, we show that Spk1 can...... interact physically with Ste11 and also phosphorylate the transcription factor in vitro. Finally, we demonstrate that ste11 is required for pheromone-induced G1 arrest. Interestingly, when we mutated Ste11 in the sites for Pat1 and Spk1 phosphorylation simultaneously, the cells could still arrest in G1...

  11. A microfluidic system for studying ageing and dynamic single-cell responses in budding yeast.

    Directory of Open Access Journals (Sweden)

    Matthew M Crane

    Full Text Available Recognition of the importance of cell-to-cell variability in cellular decision-making and a growing interest in stochastic modeling of cellular processes has led to an increased demand for high density, reproducible, single-cell measurements in time-varying surroundings. We present ALCATRAS (A Long-term Culturing And TRApping System, a microfluidic device that can quantitatively monitor up to 1000 cells of budding yeast in a well-defined and controlled environment. Daughter cells are removed by fluid flow to avoid crowding allowing experiments to run for over 60 hours, and the extracellular media may be changed repeatedly and in seconds. We illustrate use of the device by measuring ageing through replicative life span curves, following the dynamics of the cell cycle, and examining history-dependent behaviour in the general stress response.

  12. Daughter-specific transcription factors regulate cell size control in budding yeast.

    Science.gov (United States)

    Di Talia, Stefano; Wang, Hongyin; Skotheim, Jan M; Rosebrock, Adam P; Futcher, Bruce; Cross, Frederick R

    2009-10-01

    In budding yeast, asymmetric cell division yields a larger mother and a smaller daughter cell, which transcribe different genes due to the daughter-specific transcription factors Ace2 and Ash1. Cell size control at the Start checkpoint has long been considered to be a main regulator of the length of the G1 phase of the cell cycle, resulting in longer G1 in the smaller daughter cells. Our recent data confirmed this concept using quantitative time-lapse microscopy. However, it has been proposed that daughter-specific, Ace2-dependent repression of expression of the G1 cyclin CLN3 had a dominant role in delaying daughters in G1. We wanted to reconcile these two divergent perspectives on the origin of long daughter G1 times. We quantified size control using single-cell time-lapse imaging of fluorescently labeled budding yeast, in the presence or absence of the daughter-specific transcriptional regulators Ace2 and Ash1. Ace2 and Ash1 are not required for efficient size control, but they shift the domain of efficient size control to larger cell size, thus increasing cell size requirement for Start in daughters. Microarray and chromatin immunoprecipitation experiments show that Ace2 and Ash1 are direct transcriptional regulators of the G1 cyclin gene CLN3. Quantification of cell size control in cells expressing titrated levels of Cln3 from ectopic promoters, and from cells with mutated Ace2 and Ash1 sites in the CLN3 promoter, showed that regulation of CLN3 expression by Ace2 and Ash1 can account for the differential regulation of Start in response to cell size in mothers and daughters. We show how daughter-specific transcriptional programs can interact with intrinsic cell size control to differentially regulate Start in mother and daughter cells. This work demonstrates mechanistically how asymmetric localization of cell fate determinants results in cell-type-specific regulation of the cell cycle.

  13. Daughter-Specific Transcription Factors Regulate Cell Size Control in Budding Yeast

    Science.gov (United States)

    Di Talia, Stefano; Wang, Hongyin; Skotheim, Jan M.; Rosebrock, Adam P.; Futcher, Bruce; Cross, Frederick R.

    2009-01-01

    In budding yeast, asymmetric cell division yields a larger mother and a smaller daughter cell, which transcribe different genes due to the daughter-specific transcription factors Ace2 and Ash1. Cell size control at the Start checkpoint has long been considered to be a main regulator of the length of the G1 phase of the cell cycle, resulting in longer G1 in the smaller daughter cells. Our recent data confirmed this concept using quantitative time-lapse microscopy. However, it has been proposed that daughter-specific, Ace2-dependent repression of expression of the G1 cyclin CLN3 had a dominant role in delaying daughters in G1. We wanted to reconcile these two divergent perspectives on the origin of long daughter G1 times. We quantified size control using single-cell time-lapse imaging of fluorescently labeled budding yeast, in the presence or absence of the daughter-specific transcriptional regulators Ace2 and Ash1. Ace2 and Ash1 are not required for efficient size control, but they shift the domain of efficient size control to larger cell size, thus increasing cell size requirement for Start in daughters. Microarray and chromatin immunoprecipitation experiments show that Ace2 and Ash1 are direct transcriptional regulators of the G1 cyclin gene CLN3. Quantification of cell size control in cells expressing titrated levels of Cln3 from ectopic promoters, and from cells with mutated Ace2 and Ash1 sites in the CLN3 promoter, showed that regulation of CLN3 expression by Ace2 and Ash1 can account for the differential regulation of Start in response to cell size in mothers and daughters. We show how daughter-specific transcriptional programs can interact with intrinsic cell size control to differentially regulate Start in mother and daughter cells. This work demonstrates mechanistically how asymmetric localization of cell fate determinants results in cell-type-specific regulation of the cell cycle. PMID:19841732

  14. Daughter-specific transcription factors regulate cell size control in budding yeast.

    Directory of Open Access Journals (Sweden)

    Stefano Di Talia

    2009-10-01

    Full Text Available In budding yeast, asymmetric cell division yields a larger mother and a smaller daughter cell, which transcribe different genes due to the daughter-specific transcription factors Ace2 and Ash1. Cell size control at the Start checkpoint has long been considered to be a main regulator of the length of the G1 phase of the cell cycle, resulting in longer G1 in the smaller daughter cells. Our recent data confirmed this concept using quantitative time-lapse microscopy. However, it has been proposed that daughter-specific, Ace2-dependent repression of expression of the G1 cyclin CLN3 had a dominant role in delaying daughters in G1. We wanted to reconcile these two divergent perspectives on the origin of long daughter G1 times. We quantified size control using single-cell time-lapse imaging of fluorescently labeled budding yeast, in the presence or absence of the daughter-specific transcriptional regulators Ace2 and Ash1. Ace2 and Ash1 are not required for efficient size control, but they shift the domain of efficient size control to larger cell size, thus increasing cell size requirement for Start in daughters. Microarray and chromatin immunoprecipitation experiments show that Ace2 and Ash1 are direct transcriptional regulators of the G1 cyclin gene CLN3. Quantification of cell size control in cells expressing titrated levels of Cln3 from ectopic promoters, and from cells with mutated Ace2 and Ash1 sites in the CLN3 promoter, showed that regulation of CLN3 expression by Ace2 and Ash1 can account for the differential regulation of Start in response to cell size in mothers and daughters. We show how daughter-specific transcriptional programs can interact with intrinsic cell size control to differentially regulate Start in mother and daughter cells. This work demonstrates mechanistically how asymmetric localization of cell fate determinants results in cell-type-specific regulation of the cell cycle.

  15. Maintenance of cellular ATP level by caloric restriction correlates chronological survival of budding yeast

    International Nuclear Information System (INIS)

    Choi, Joon-Seok; Lee, Cheol-Koo

    2013-01-01

    Highlights: •CR decreases total ROS and mitochondrial superoxide during the chronological aging. •CR does not affect the levels of oxidative damage on protein and DNA. •CR contributes extension of chronological lifespan by maintenance of ATP level -- Abstract: The free radical theory of aging emphasizes cumulative oxidative damage in the genome and intracellular proteins due to reactive oxygen species (ROS), which is a major cause for aging. Caloric restriction (CR) has been known as a representative treatment that prevents aging; however, its mechanism of action remains elusive. Here, we show that CR extends the chronological lifespan (CLS) of budding yeast by maintaining cellular energy levels. CR reduced the generation of total ROS and mitochondrial superoxide; however, CR did not reduce the oxidative damage in proteins and DNA. Subsequently, calorie-restricted yeast had higher mitochondrial membrane potential (MMP), and it sustained consistent ATP levels during the process of chronological aging. Our results suggest that CR extends the survival of the chronologically aged cells by improving the efficiency of energy metabolism for the maintenance of the ATP level rather than reducing the global oxidative damage of proteins and DNA

  16. Maintenance of cellular ATP level by caloric restriction correlates chronological survival of budding yeast

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Joon-Seok; Lee, Cheol-Koo, E-mail: cklee2005@korea.ac.kr

    2013-09-13

    Highlights: •CR decreases total ROS and mitochondrial superoxide during the chronological aging. •CR does not affect the levels of oxidative damage on protein and DNA. •CR contributes extension of chronological lifespan by maintenance of ATP level -- Abstract: The free radical theory of aging emphasizes cumulative oxidative damage in the genome and intracellular proteins due to reactive oxygen species (ROS), which is a major cause for aging. Caloric restriction (CR) has been known as a representative treatment that prevents aging; however, its mechanism of action remains elusive. Here, we show that CR extends the chronological lifespan (CLS) of budding yeast by maintaining cellular energy levels. CR reduced the generation of total ROS and mitochondrial superoxide; however, CR did not reduce the oxidative damage in proteins and DNA. Subsequently, calorie-restricted yeast had higher mitochondrial membrane potential (MMP), and it sustained consistent ATP levels during the process of chronological aging. Our results suggest that CR extends the survival of the chronologically aged cells by improving the efficiency of energy metabolism for the maintenance of the ATP level rather than reducing the global oxidative damage of proteins and DNA.

  17. Experimental testing of a new integrated model of the budding yeast Start transition.

    Science.gov (United States)

    Adames, Neil R; Schuck, P Logan; Chen, Katherine C; Murali, T M; Tyson, John J; Peccoud, Jean

    2015-11-05

    The cell cycle is composed of bistable molecular switches that govern the transitions between gap phases (G1 and G2) and the phases in which DNA is replicated (S) and partitioned between daughter cells (M). Many molecular details of the budding yeast G1-S transition (Start) have been elucidated in recent years, especially with regard to its switch-like behavior due to positive feedback mechanisms. These results led us to reevaluate and expand a previous mathematical model of the yeast cell cycle. The new model incorporates Whi3 inhibition of Cln3 activity, Whi5 inhibition of SBF and MBF transcription factors, and feedback inhibition of Whi5 by G1-S cyclins. We tested the accuracy of the model by simulating various mutants not described in the literature. We then constructed these novel mutant strains and compared their observed phenotypes to the model's simulations. The experimental results reported here led to further changes of the model, which will be fully described in a later article. Our study demonstrates the advantages of combining model design, simulation, and testing in a coordinated effort to better understand a complex biological network. © 2015 Adames et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  18. Measurement of the volume growth rate of single budding yeast with the MOSFET-based microfluidic Coulter counter.

    Science.gov (United States)

    Sun, Jiashu; Stowers, Chris C; Boczko, Erik M; Li, Deyu

    2010-11-07

    We report on measurements of the volume growth rate of ten individual budding yeast cells using a recently developed MOSFET-based microfluidic Coulter counter. The MOSFET-based microfluidic Coulter counter is very sensitive, provides signals that are immune from the baseline drift, and can work with cell culture media of complex composition. These desirable features allow us to directly measure the volume growth rate of single cells of Saccharomyces cerevisiae LYH3865 strain budding yeast in YNB culture media over a whole cell cycle. Results indicate that all budding yeast follow a sigmoid volume growth profile with reduced growth rates at the initial stage before the bud emerges and the final stage after the daughter gets mature. Analysis of the data indicates that even though all piecewise linear, Gomperitz, and Hill's function models can fit the global growth profile equally well, the data strongly support local exponential growth phenomenon. Accurate volume growth measurements are important for applications in systems biology where quantitative parameters are required for modeling and simulation.

  19. Effects of intense magnetic fields on sedimentation pattern and gene expression profile in budding yeast

    Science.gov (United States)

    Ikehata, Masateru; Iwasaka, Masakazu; Miyakoshi, Junji; Ueno, Shoogo; Koana, Takao

    2003-05-01

    Effects of magnetic fields (MFs) on biological systems are usually investigated using biological indices such as gene expression profiles. However, to precisely evaluate the biological effects of MF, the effects of intense MFs on systematic material transport processes including experimental environment must be seriously taken into consideration. In this study, a culture of the budding yeast, Saccharomyces cerevisiae, was used as a model for an in vitro biological test system. After exposure to 5 T static vertical MF, we found a difference in the sedimentation pattern of cells depending on the location of the dish in the magnet bore. Sedimented cells were localized in the center of the dish when they were placed in the lower part of the magnet bore while the sedimentation of the cells was uniform in dishes placed in the upper part of the bore because of the diamagnetic force. Genome wide gene expression profile of the yeast cells after exposure to 5 T static MF for 2 h suggested that the MF did not affect the expression level of any gene in yeast cells although the sedimentation pattern was altered. In addition, exposure to 10 T for 1 h and 5 T for 24 h also did not affect the gene expression. On the other hand, a slight change in expressions of several genes which are related to respiration was observed by exposure to a 14 T static MF for 24 h. The necessity of estimating the indirect effects of MFs on a study of its biological effect of MF in vitro will be discussed.

  20. High-Throughput Screening to Identify Regulators of Meiosis-Specific Gene Expression in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kassir, Yona

    2017-01-01

    Meiosis and gamete formation are processes that are essential for sexual reproduction in all eukaryotic organisms. Multiple intracellular and extracellular signals feed into pathways that converge on transcription factors that induce the expression of meiosis-specific genes. Once triggered the meiosis-specific gene expression program proceeds in a cascade that drives progress through the events of meiosis and gamete formation. Meiosis-specific gene expression is tightly controlled by a balance of positive and negative regulatory factors that respond to a plethora of signaling pathways. The budding yeast Saccharomyces cerevisiae has proven to be an outstanding model for the dissection of gametogenesis owing to the sophisticated genetic manipulations that can be performed with the cells. It is possible to use a variety selection and screening methods to identify genes and their functions. High-throughput screening technology has been developed to allow an array of all viable yeast gene deletion mutants to be screened for phenotypes and for regulators of gene expression. This chapter describes a protocol that has been used to screen a library of homozygous diploid yeast deletion strains to identify regulators of the meiosis-specific IME1 gene.

  1. Single-Cell Analysis of Growth in Budding Yeast and Bacteria Reveals a Common Size Regulation Strategy.

    Science.gov (United States)

    Soifer, Ilya; Robert, Lydia; Amir, Ariel

    2016-02-08

    To maintain a constant cell size, dividing cells have to coordinate cell-cycle events with cell growth. This coordination has long been supposed to rely on the existence of size thresholds determining cell-cycle progression [1]. In budding yeast, size is controlled at the G1/S transition [2]. In agreement with this hypothesis, the size at birth influences the time spent in G1: smaller cells have a longer G1 period [3]. Nevertheless, even though cells born smaller have a longer G1, the compensation is imperfect and they still bud at smaller cell sizes. In bacteria, several recent studies have shown that the incremental model of size control, in which size is controlled by addition of a constant volume (in contrast to a size threshold), is able to quantitatively explain the experimental data on four different bacterial species [4-7]. Here, we report on experimental results for the budding yeast Saccharomyces cerevisiae, finding, surprisingly, that cell size control in this organism is very well described by the incremental model, suggesting a common strategy for cell size control with bacteria. Additionally, we argue that for S. cerevisiae the "volume increment" is not added from birth to division, but rather between two budding events. Copyright © 2016 Elsevier Ltd. All rights reserved.

  2. cDNA sequence quality data - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available List Contact us Budding yeast cDNA sequencing project cDNA sequence quality data Data detail Data name cDNA sequence quality... data DOI 10.18908/lsdba.nbdc00838-003 Description of data contents Phred's quality score. P...tion Download License Update History of This Database Site Policy | Contact Us cDNA sequence quality

  3. A role for the budding yeast separase, Esp1, in Ty1 element retrotransposition.

    Directory of Open Access Journals (Sweden)

    Krystina L Ho

    2015-03-01

    Full Text Available Separase/Esp1 is a protease required at the onset of anaphase to cleave cohesin and thereby enable sister chromatid separation. Esp1 also promotes release of the Cdc14 phosphatase from the nucleolus to enable mitotic exit. To uncover other potential roles for separase, we performed two complementary genome-wide genetic interaction screens with a strain carrying the budding yeast esp1-1 separase mutation. We identified 161 genes that when mutated aggravate esp1-1 growth and 44 genes that upon increased dosage are detrimental to esp1-1 viability. In addition to the expected cell cycle and sister chromatid segregation genes that were identified, 24% of the genes identified in the esp1-1 genetic screens have a role in Ty1 element retrotransposition. Retrotransposons, like retroviruses, replicate through reverse transcription of an mRNA intermediate and the resultant cDNA product is integrated into the genome by a conserved transposon or retrovirus encoded integrase protein. We purified Esp1 from yeast and identified an interaction between Esp1 and Ty1 integrase using mass spectrometry that was subsequently confirmed by co-immunoprecipitation analysis. Ty1 transposon mobility and insertion upstream of the SUF16 tRNA gene are both reduced in an esp1-1 strain but increased in cohesin mutant strains. Securin/Pds1, which is required for efficient localization of Esp1 to the nucleus, is also required for efficient Ty1 transposition. We propose that Esp1 serves two roles to mediate Ty1 transposition - one to remove cohesin and the second to target Ty1-IN to chromatin.

  4. Anethole potentiates dodecanol's fungicidal activity by reducing PDR5 expression in budding yeast.

    Science.gov (United States)

    Fujita, Ken-Ichi; Ishikura, Takayuki; Jono, Yui; Yamaguchi, Yoshihiro; Ogita, Akira; Kubo, Isao; Tanaka, Toshio

    2017-02-01

    trans-Anethole (anethole), a major component of anise oil, has a broad antimicrobial spectrum and a weaker antimicrobial potency than other available antibiotics. When combined with polygodial, nagilactone E, and n-dodecanol, anethole has been shown to exhibit synergistic antifungal activity against a budding yeast, Saccharomyces cerevisiae, and a human opportunistic pathogenic yeast, Candida albicans. However, the mechanism underlying this synergistic effect of anethole has not been characterized. We studied this mechanism using dodecanol-treated S. cerevisiae cells and focusing on genes related to multidrug efflux. Although dodecanol transiently reduced the number of colony forming units, this recovered to levels similar to those of untreated cells with continued incubation beyond 24h. Reverse transcription polymerase chain reaction analysis revealed overexpression of an ATP-binding cassette (ABC) transporter gene, PDR5, in addition to a slight increase in PDR11, PDR12, and PDR15 transcriptions in dodecanol-treated cells. In the presence of anethole, these effects were attenuated and the fungicidal activity of dodecanol was extended. Dodecanol showed longer lasting fungicidal activity against a Δpdr5. In addition, Δpdr3 and Δlge1, lack transcription factors of PDR5 and PDR3, were partly and completely susceptible to dodecanol, respectively. Furthermore, combination of anethole with fluconazole was also found to exhibit synergy on C. albicans. These results indicated that although anethole reduced the transcription of several transporters, PDR5 expression was particularly relevant to dodecanol efflux. Anethole is expected to be a promising candidate drug for the inhibition of efflux by reducing the transcription of several ABC transporters. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Biology of the Heat Shock Response and Protein Chaperones: Budding Yeast (Saccharomyces cerevisiae) as a Model System

    Science.gov (United States)

    Verghese, Jacob; Abrams, Jennifer; Wang, Yanyu

    2012-01-01

    Summary: The eukaryotic heat shock response is an ancient and highly conserved transcriptional program that results in the immediate synthesis of a battery of cytoprotective genes in the presence of thermal and other environmental stresses. Many of these genes encode molecular chaperones, powerful protein remodelers with the capacity to shield, fold, or unfold substrates in a context-dependent manner. The budding yeast Saccharomyces cerevisiae continues to be an invaluable model for driving the discovery of regulatory features of this fundamental stress response. In addition, budding yeast has been an outstanding model system to elucidate the cell biology of protein chaperones and their organization into functional networks. In this review, we evaluate our understanding of the multifaceted response to heat shock. In addition, the chaperone complement of the cytosol is compared to those of mitochondria and the endoplasmic reticulum, organelles with their own unique protein homeostasis milieus. Finally, we examine recent advances in the understanding of the roles of protein chaperones and the heat shock response in pathogenic fungi, which is being accelerated by the wealth of information gained for budding yeast. PMID:22688810

  6. Visual screening for localized RNAs in yeast revealed novel RNAs at the bud-tip

    International Nuclear Information System (INIS)

    Andoh, Tomoko; Oshiro, Yukiko; Hayashi, Sachiko; Takeo, Hideki; Tani, Tokio

    2006-01-01

    Several RNAs, including rRNAs, snRNAs, snoRNAs, and some mRNAs, are known to be localized at specific sites in a cell. Although methods have been established to visualize RNAs in a living cell, no large-scale visual screening of localized RNAs has been performed. In this study, we constructed a genomic library in which random genomic fragments were inserted downstream of U1A-tag sequences under a GAL1 promoter. In a living yeast cell, transcribed U1A-tagged RNAs were visualized by U1A-GFP that binds the RNA sequence of the U1A-tag. In this screening, many RNAs showed nuclear signals. Since the nuclear signals of some RNAs were not seen when the U1A-tag was connected to the 3' ends of the RNAs, it is suggested that their nuclear signals correspond to nascent transcripts on GAL1 promoter plasmids. Using this screening method, we successfully identified two novel localized mRNAs, CSR2 and DAL81, which showed bud-tip localization

  7. Regulation of ER-Golgi Transport Dynamics by GTPases in Budding Yeast

    Directory of Open Access Journals (Sweden)

    Yasuyuki Suda

    2018-01-01

    Full Text Available A large number of proteins are synthesized de novo in the endoplasmic reticulum (ER. They are transported through the Golgi apparatus and then delivered to their proper destinations. The ER and the Golgi play a central role in protein processing and sorting and show dynamic features in their forms. Ras super family small GTPases mediate the protein transport through and between these organelles. The ER-localized GTPase, Sar1, facilitates the formation of COPII transport carriers at the ER exit sites (ERES on the ER for the transport of cargo proteins from the ER to the Golgi. The Golgi-localized GTPase, Arf1, controls intra-Golgi, and Golgi-to-ER transport of cargo proteins by the formation of COPI carriers. Rab GTPases localized at the Golgi, which are responsible for fusion of membranes, are thought to establish the identities of compartments. Recent evidence suggests that these small GTPases regulate not only discrete sites for generation/fusion of transport carriers, but also membrane dynamics of the organelles where they locate to ensure the integrity of transport. Here we summarize the current understandings about the membrane traffic between these organelles and highlight the cutting-edge advances from super-resolution live imaging of budding yeast, Saccharomyces cerevisiae.

  8. The step-wise pathway of septin hetero-octamer assembly in budding yeast.

    Science.gov (United States)

    Weems, Andrew; McMurray, Michael

    2017-05-25

    Septin proteins bind guanine nucleotides and form rod-shaped hetero-oligomers. Cells choose from a variety of available septins to assemble distinct hetero-oligomers, but the underlying mechanism was unknown. Using a new in vivo assay, we find that a stepwise assembly pathway produces the two species of budding yeast septin hetero-octamers: Cdc11/Shs1-Cdc12-Cdc3-Cdc10-Cdc10-Cdc3-Cdc12-Cdc11/Shs1. Rapid GTP hydrolysis by monomeric Cdc10 drives assembly of the core Cdc10 homodimer. The extended Cdc3 N terminus autoinhibits Cdc3 association with Cdc10 homodimers until prior Cdc3-Cdc12 interaction. Slow hydrolysis by monomeric Cdc12 and specific affinity of Cdc11 for transient Cdc12•GTP drive assembly of distinct trimers, Cdc11-Cdc12-Cdc3 or Shs1-Cdc12-Cdc3. Decreasing the cytosolic GTP:GDP ratio increases the incorporation of Shs1 vs Cdc11, which alters the curvature of filamentous septin rings. Our findings explain how GTP hydrolysis controls septin assembly, and uncover mechanisms by which cells construct defined septin complexes.

  9. HRR25, a putative protein kinase from budding yeast: Association with repair of damaged DNA

    International Nuclear Information System (INIS)

    Hoekstra, M.F.; Ou, A.C.; DeMaggio, A.J.; Burbee, D.G.; Liskay, R.M.; Heffron, F.

    1991-01-01

    In simple eukaryotes, protein kinases regulate mitotic and meiotic cell cycles, the response to polypeptide pheromones, and the initiation of nuclear DNA synthesis. The protein HRR25 from the budding yeast Saccharomyces cerevisiae was defined by the mutation hrr25-1. This mutation resulted in sensitivity to continuous expression of the HO double-strand endonuclease, to methyl methanesulfonate, and to x-irradiation. Homozygotes of hrr25-1 were unable to sporulate and disruption and deletion of HRR25 interfered with mitotic and meiotic cell division. Sequence analysis revealed two distinctive regions in the protein. The NH 2 -terminus of HRR25 contains the hallmark features of protein kinases, whereas the COOH-terminus is rich in proline and glutamine. Mutations in HRR25 at conserved residues found in all protein kinases inactivated the gene, and these mutants exhibited the hrr25 null phenotypes. Taken together, the hrr25 mutant phenotypes and the features of the gene product indicate that HRR25 is a distinctive member of the protein kinase superfamily

  10. A conserved signaling network monitors delivery of sphingolipids to the plasma membrane in budding yeast.

    Science.gov (United States)

    Clarke, Jesse; Dephoure, Noah; Horecka, Ira; Gygi, Steven; Kellogg, Douglas

    2017-10-01

    In budding yeast, cell cycle progression and ribosome biogenesis are dependent on plasma membrane growth, which ensures that events of cell growth are coordinated with each other and with the cell cycle. However, the signals that link the cell cycle and ribosome biogenesis to membrane growth are poorly understood. Here we used proteome-wide mass spectrometry to systematically discover signals associated with membrane growth. The results suggest that membrane trafficking events required for membrane growth generate sphingolipid-dependent signals. A conserved signaling network appears to play an essential role in signaling by responding to delivery of sphingolipids to the plasma membrane. In addition, sphingolipid-dependent signals control phosphorylation of protein kinase C (Pkc1), which plays an essential role in the pathways that link the cell cycle and ribosome biogenesis to membrane growth. Together these discoveries provide new clues as to how growth--dependent signals control cell growth and the cell cycle. © 2017 Clarke et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  11. Proteomics analysis for asymmetric inheritance of preexisting proteins between mother and daughter cells in budding yeast.

    Science.gov (United States)

    Okada, Mitsuhiro; Kusunoki, Shunta; Ishibashi, Yuko; Kito, Keiji

    2017-06-01

    In budding yeast, a mother cell can produce a finite number of daughter cells over its life. The accumulation of a variety of types of damaged components has an impact on the aging process. Asymmetrical inheritance during cell division causes these aberrant intracellular constituents to be retained in mother cells and prevents them from segregating to daughter cells. However, the understanding of asymmetrical inheritance of individual proteins that are damaged or old age, and their relevance to the aging process, has been limited. The aim of this study is to propose a proteomics strategy for asymmetrical inheritance of preexisting proteins between mother and daughter cells. During synchronous culture for one generation, newly synthesized proteins were labeled with stable isotope amino acids to discriminate preexisting proteins originally expressed in mother cells, followed by separation of mother and daughter cells using a conventional method based on biotin labeling. Isotope incorporation ratios for individual proteins were quantified using mass spectrometry. We successfully identified 21 proteins whose preexisting versions were asymmetrically inherited in mother cells, including plasma membrane transporter involved in the aging process and organelle-anchoring proteins related to the stress response to misfolded proteins. Thus, our approach would be useful for making catalog of asymmetrically inherited proteins. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  12. SAGA complex and Gcn5 are necessary for respiration in budding yeast.

    Science.gov (United States)

    Canzonetta, Claudia; Leo, Manuela; Guarino, Salvatore Rocco; Montanari, Arianna; Francisci, Silvia; Filetici, Patrizia

    2016-12-01

    In budding yeast, growth through fermentation and/or respiration is dependent on the type of carbon source present in the medium. SAGA complex is the main acetylation complex and is required, together with Rtg factors, for nucleus-mitochondria communication and transcriptional activation of specific nuclear genes. Even though acetylation is necessary for mitochondria activity and respiratory pathways the direct role of histone acetyltransferases and SAGA complex has never been investigated directly. In this study we demonstrate, for the first time, that Gcn5 and SAGA are needed for respiratory metabolism and oxygen consumption. According to a central role for acetylation in respiration we find that the Gcn5 inhibitor CPTH2 had higher efficacy on cells grown in glycerol containing media. We also demonstrated that the opposing activities of Gcn5 and Hda1 modify selectively H3-AcK18 and are essential for respiration. Taken together our results suggest a novel paradigm coupling acetyltransferase activity to respiratory metabolism. Correspondingly we propose the selective utilization of KAT inhibitor CPTH2, combined to the modulation of the respiratory metabolism of the cell, as a promising novel tool of intervention in cancer cells. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. DNA degradation and reduced recombination following UV irradiation during meiosis in yeast (Saccharomyces cerevisiae)

    International Nuclear Information System (INIS)

    Salts, Y.; Pinon, R.; Simchen, G.

    1976-01-01

    Irradiation of meiotic yeast cells with moderate doses of ultraviolet irradiation (1,600 erg/mm 2 ) leads to the arrest of premeiotic DNA synthesis, massive (5-40%) DNA degradation, and a 40-50% loss of cell viability. In contrast, such doses of UV irradiation had a minor effect on viability (15-20% loss) of logarithmically growing cells, and no comparable DNA degradation was observed in irradiated synchronized vegetative cells. Meiotic recombination is also affected by UV irradiation. When administered at a stage comparable to meiotic prophase, low doses of irradiation result in a reduction in recombination frequency without significantly affecting cell viability. (orig.) [de

  14. Role for cER and Mmr1p in anchorage of mitochondria at sites of polarized surface growth in budding yeast.

    Science.gov (United States)

    Swayne, Theresa C; Zhou, Chun; Boldogh, Istvan R; Charalel, Joseph K; McFaline-Figueroa, José Ricardo; Thoms, Sven; Yang, Christine; Leung, Galen; McInnes, Joseph; Erdmann, Ralf; Pon, Liza A

    2011-12-06

    Mitochondria accumulate at neuronal and immunological synapses and yeast bud tips and associate with the ER during phospholipid biosynthesis, calcium homeostasis, and mitochondrial fission. Here we show that mitochondria are associated with cortical ER (cER) sheets underlying the plasma membrane in the bud tip and confirm that a deletion in YPT11, which inhibits cER accumulation in the bud tip, also inhibits bud tip anchorage of mitochondria. Time-lapse imaging reveals that mitochondria are anchored at specific sites in the bud tip. Mmr1p, a member of the DSL1 family of tethering proteins, localizes to punctate structures on opposing surfaces of mitochondria and cER sheets underlying the bud tip and is recovered with isolated mitochondria and ER. Deletion of MMR1 impairs bud tip anchorage of mitochondria without affecting mitochondrial velocity or cER distribution. Deletion of the phosphatase PTC1 results in increased Mmr1p phosphorylation, mislocalization of Mmr1p, defects in association of Mmr1p with mitochondria and ER, and defects in bud tip anchorage of mitochondria. These findings indicate that Mmr1p contributes to mitochondrial inheritance as a mediator of anchorage of mitochondria to cER sheets in the yeast bud tip and that Ptc1p regulates Mmr1p phosphorylation, localization, and function. Copyright © 2011 Elsevier Ltd. All rights reserved.

  15. Phosphorylation and cellular function of the human Rpa2 N-terminus in the budding yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Ghospurkar, Padmaja L; Wilson, Timothy M; Liu, Shengqin; Herauf, Anna; Steffes, Jenna; Mueller, Erica N; Oakley, Gregory G; Haring, Stuart J

    2015-02-01

    Maintenance of genome integrity is critical for proper cell growth. This occurs through accurate DNA replication and repair of DNA lesions. A key factor involved in both DNA replication and the DNA damage response is the heterotrimeric single-stranded DNA (ssDNA) binding complex Replication Protein A (RPA). Although the RPA complex appears to be structurally conserved throughout eukaryotes, the primary amino acid sequence of each subunit can vary considerably. Examination of sequence differences along with the functional interchangeability of orthologous RPA subunits or regions could provide insight into important regions and their functions. This might also allow for study in simpler systems. We determined that substitution of yeast Replication Factor A (RFA) with human RPA does not support yeast cell viability. Exchange of a single yeast RFA subunit with the corresponding human RPA subunit does not function due to lack of inter-species subunit interactions. Substitution of yeast Rfa2 with domains/regions of human Rpa2 important for Rpa2 function (i.e., the N-terminus and the loop 3-4 region) supports viability in yeast cells, and hybrid proteins containing human Rpa2 N-terminal phospho-mutations result in similar DNA damage phenotypes to analogous yeast Rfa2 N-terminal phospho-mutants. Finally, the human Rpa2 N-terminus (NT) fused to yeast Rfa2 is phosphorylated in a manner similar to human Rpa2 in human cells, indicating that conserved kinases recognize the human domain in yeast. The implication is that budding yeast represents a potential model system for studying not only human Rpa2 N-terminal phosphorylation, but also phosphorylation of Rpa2 N-termini from other eukaryotic organisms. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  16. Novel E3 ubiquitin ligases that regulate histone protein levels in the budding yeast Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Rakesh Kumar Singh

    Full Text Available Core histone proteins are essential for packaging the genomic DNA into chromatin in all eukaryotes. Since multiple genes encode these histone proteins, there is potential for generating more histones than what is required for chromatin assembly. The positively charged histones have a very high affinity for negatively charged molecules such as DNA, and any excess of histone proteins results in deleterious effects on genomic stability and cell viability. Hence, histone levels are known to be tightly regulated via transcriptional, posttranscriptional and posttranslational mechanisms. We have previously elucidated the posttranslational regulation of histone protein levels by the ubiquitin-proteasome pathway involving the E2 ubiquitin conjugating enzymes Ubc4/5 and the HECT (Homologous to E6-AP C-Terminus domain containing E3 ligase Tom1 in the budding yeast. Here we report the identification of four additional E3 ligases containing the RING (Really Interesting New Gene finger domains that are involved in the ubiquitylation and subsequent degradation of excess histones in yeast. These E3 ligases are Pep5, Snt2 as well as two previously uncharacterized Open Reading Frames (ORFs YKR017C and YDR266C that we have named Hel1 and Hel2 (for Histone E3 Ligases respectively. Mutants lacking these E3 ligases are sensitive to histone overexpression as they fail to degrade excess histones and accumulate high levels of endogenous histones on histone chaperones. Co-immunoprecipitation assays showed that these E3 ligases interact with the major E2 enzyme Ubc4 that is involved in the degradation related ubiquitylation of histones. Using mutagenesis we further demonstrate that the RING domains of Hel1, Hel2 and Snt2 are required for histone regulation. Lastly, mutants corresponding to Hel1, Hel2 and Pep5 are sensitive to replication inhibitors. Overall, our results highlight the importance of posttranslational histone regulatory mechanisms that employ multiple E3

  17. Systematic Analysis of the DNA Damage Response Network in Telomere Defective Budding Yeast

    Directory of Open Access Journals (Sweden)

    Eva-Maria Holstein

    2017-07-01

    Full Text Available Functional telomeres are critically important to eukaryotic genetic stability. Scores of proteins and pathways are known to affect telomere function. Here, we report a series of related genome-wide genetic interaction screens performed on budding yeast cells with acute or chronic telomere defects. Genetic interactions were examined in cells defective in Cdc13 and Stn1, affecting two components of CST, a single stranded DNA (ssDNA binding complex that binds telomeric DNA. For comparison, genetic interactions were also examined in cells with defects in Rfa3, affecting the major ssDNA binding protein, RPA, which has overlapping functions with CST at telomeres. In more complex experiments, genetic interactions were measured in cells lacking EXO1 or RAD9, affecting different aspects of the DNA damage response, and containing a cdc13-1 induced telomere defect. Comparing fitness profiles across these data sets helps build a picture of the specific responses to different types of dysfunctional telomeres. The experiments show that each context reveals different genetic interactions, consistent with the idea that each genetic defect causes distinct molecular defects. To help others engage with the large volumes of data, the data are made available via two interactive web-based tools: Profilyzer and DIXY. One particularly striking genetic interaction observed was that the chk1∆ mutation improved fitness of cdc13-1 exo1∆ cells more than other checkpoint mutations (ddc1∆, rad9∆, rad17∆, and rad24∆, whereas, in cdc13-1 cells, the effects of all checkpoint mutations were similar. We show that this can be explained by Chk1 stimulating resection—a new function for Chk1 in the eukaryotic DNA damage response network.

  18. Altered sterol metabolism in budding yeast affects mitochondrial iron-sulfur (Fe-S) cluster synthesis.

    Science.gov (United States)

    Ward, Diane M; Chen, Opal S; Li, Liangtao; Kaplan, Jerry; Bhuiyan, Shah Alam; Natarajan, Selvamuthu K; Bard, Martin; Cox, James E

    2018-05-17

    Ergosterol synthesis is essential for cellular growth and viability of the budding yeast Saccharomyces cerevisiae, and intracellular sterol distribution and homeostasis are therefore highly regulated in this species. Erg25 is an iron-containing C4-methyl sterol oxidase that contributes to the conversion of 4,4-dimethylzymosterol to zymosterol, a precursor of ergosterol. The ERG29 gene encodes an endoplasmic reticulum (ER)-associated protein, and here we identified a role for Erg29 in the methyl sterol oxidase step of ergosterol synthesis. ERG29 deletion resulted in lethality in respiring cells, but respiration-incompetent (Rho- or Rho0) cells survived, suggesting that Erg29 loss leads to accumulation of oxidized sterol metabolites that affect cell viability. Down-regulation of ERG29 expression in Δerg29 cells indeed led to accumulation of methyl sterol metabolites, resulting in increased mitochondrial oxidants and a decreased ability of mitochondria to synthesize iron-sulfur (Fe-S) clusters due to reduced levels of Yfh1, the mammalian frataxin homolog, which is involved in mitochondrial Fe metabolism. Using a high-copy genomic library, we identified suppressor genes that permitted growth of Δerg29 cells on respiratory substrates, and these included genes encoding the mitochondrial proteins Yfh1, Mmt1, Mmt2, and Pet20, which reversed all phenotypes associated with loss of ERG29. Of note, loss of Erg25 also resulted in accumulation of methyl sterol metabolites and also increased mitochondrial oxidants and degradation of Yfh1. We propose that accumulation of toxic intermediates of the methyl sterol oxidase reaction increase mitochondrial oxidants, which affect Yfh1 protein stability. These results indicate an interaction between sterols generated by ER proteins and mitochondrial iron metabolism. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Regulation of Budding Yeast CENP-A levels Prevents Misincorporation at Promoter Nucleosomes and Transcriptional Defects.

    Directory of Open Access Journals (Sweden)

    Erica M Hildebrand

    2016-03-01

    Full Text Available The exclusive localization of the histone H3 variant CENP-A to centromeres is essential for accurate chromosome segregation. Ubiquitin-mediated proteolysis helps to ensure that CENP-A does not mislocalize to euchromatin, which can lead to genomic instability. Consistent with this, overexpression of the budding yeast CENP-A(Cse4 is lethal in cells lacking Psh1, the E3 ubiquitin ligase that targets CENP-A(Cse4 for degradation. To identify additional mechanisms that prevent CENP-A(Cse4 misincorporation and lethality, we analyzed the genome-wide mislocalization pattern of overexpressed CENP-A(Cse4 in the presence and absence of Psh1 by chromatin immunoprecipitation followed by high throughput sequencing. We found that ectopic CENP-A(Cse4 is enriched at promoters that contain histone H2A.Z(Htz1 nucleosomes, but that H2A.Z(Htz1 is not required for CENP-A(Cse4 mislocalization. Instead, the INO80 complex, which removes H2A.Z(Htz1 from nucleosomes, promotes the ectopic deposition of CENP-A(Cse4. Transcriptional profiling revealed gene expression changes in the psh1Δ cells overexpressing CENP-A(Cse4. The down-regulated genes are enriched for CENP-A(Cse4 mislocalization to promoters, while the up-regulated genes correlate with those that are also transcriptionally up-regulated in an htz1Δ strain. Together, these data show that regulating centromeric nucleosome localization is not only critical for maintaining centromere function, but also for ensuring accurate promoter function and transcriptional regulation.

  20. The Budding Yeast “Saccharomyces cerevisiae” as a Drug Discovery Tool to Identify Plant-Derived Natural Products with Anti-Proliferative Properties

    Directory of Open Access Journals (Sweden)

    Bouchra Qaddouri

    2011-01-01

    Full Text Available The budding yeast Saccharomyces cerevisiae is a valuable system to study cell-cycle regulation, which is defective in cancer cells. Due to the highly conserved nature of the cell-cycle machinery between yeast and humans, yeast studies are directly relevant to anticancer-drug discovery. The budding yeast is also an excellent model system for identifying and studying antifungal compounds because of the functional conservation of fungal genes. Moreover, yeast studies have also contributed greatly to our understanding of the biological targets and modes of action of bioactive compounds. Understanding the mechanism of action of clinically relevant compounds is essential for the design of improved second-generation molecules. Here we describe our methodology for screening a library of plant-derived natural products in yeast in order to identify and characterize new compounds with anti-proliferative properties.

  1. Molecular Genetic Characterization of Mutagenesis Using a Highly Sensitive Single-Stranded DNA Reporter System in Budding Yeast.

    Science.gov (United States)

    Chan, Kin

    2018-01-01

    Mutations are permanent alterations to the coding content of DNA. They are starting material for the Darwinian evolution of species by natural selection, which has yielded an amazing diversity of life on Earth. Mutations can also be the fundamental basis of serious human maladies, most notably cancers. In this chapter, I describe a highly sensitive reporter system for the molecular genetic analysis of mutagenesis, featuring controlled generation of long stretches of single-stranded DNA in budding yeast cells. This system is ~100- to ~1000-fold more susceptible to mutation than conventional double-stranded DNA reporters, and is well suited for generating large mutational datasets to investigate the properties of mutagens.

  2. Construction and use of a microfluidic dissection platform for long-term imaging of cellular processes in budding yeast.

    Science.gov (United States)

    Huberts, Daphne H E W; Sik Lee, Sung; Gonzáles, Javier; Janssens, Georges E; Vizcarra, Ima Avalos; Heinemann, Matthias

    2013-06-01

    This protocol describes the production and operation of a microfluidic dissection platform for long-term, high-resolution imaging of budding yeast cells. At the core of this platform is an array of micropads that trap yeast cells in a single focal plane. Newly formed daughter cells are subsequently washed away by a continuous flow of fresh culture medium. In a typical experiment, 50-100 cells can be tracked during their entire replicative lifespan. Apart from aging-related research, the microfluidic platform can also be a valuable tool for other studies requiring the monitoring of single cells over time. Here we provide step-by-step instructions on how to fabricate the silicon wafer mold, how to produce and operate the microfluidic device and how to analyze the obtained data. Production of the microfluidic dissection platform and setting up an aging experiment takes ~7 h.

  3. Casein Kinase 1 Coordinates Cohesin Cleavage, Gametogenesis, and Exit from M Phase in Meiosis II.

    Science.gov (United States)

    Argüello-Miranda, Orlando; Zagoriy, Ievgeniia; Mengoli, Valentina; Rojas, Julie; Jonak, Katarzyna; Oz, Tugce; Graf, Peter; Zachariae, Wolfgang

    2017-01-09

    Meiosis consists of DNA replication followed by two consecutive nuclear divisions and gametogenesis or spore formation. While meiosis I has been studied extensively, less is known about the regulation of meiosis II. Here we show that Hrr25, the conserved casein kinase 1δ of budding yeast, links three mutually independent key processes of meiosis II. First, Hrr25 induces nuclear division by priming centromeric cohesin for cleavage by separase. Hrr25 simultaneously phosphorylates Rec8, the cleavable subunit of cohesin, and removes from centromeres the cohesin protector composed of shugoshin and the phosphatase PP2A. Second, Hrr25 initiates the sporulation program by inducing the synthesis of membranes that engulf the emerging nuclei at anaphase II. Third, Hrr25 mediates exit from meiosis II by activating pathways that trigger the destruction of M-phase-promoting kinases. Thus, Hrr25 synchronizes formation of the single-copy genome with gamete differentiation and termination of meiosis. Copyright © 2017 Elsevier Inc. All rights reserved.

  4. Marshmallow Meiosis.

    Science.gov (United States)

    Soderberg, Patti

    1992-01-01

    Presents an activity in which students model the processes of meiosis, fertilization, development, and birth using model creatures called reebops. Students breed reebops to analyze chromosome combinations. Makes recommendations for activity utilization and identifies the strengths of the activity. (MDH)

  5. The Adder Phenomenon Emerges from Independent Control of Pre- and Post-Start Phases of the Budding Yeast Cell Cycle.

    Science.gov (United States)

    Chandler-Brown, Devon; Schmoller, Kurt M; Winetraub, Yonatan; Skotheim, Jan M

    2017-09-25

    Although it has long been clear that cells actively regulate their size, the molecular mechanisms underlying this regulation have remained poorly understood. In budding yeast, cell size primarily modulates the duration of the cell-division cycle by controlling the G1/S transition known as Start. We have recently shown that the rate of progression through Start increases with cell size, because cell growth dilutes the cell-cycle inhibitor Whi5 in G1. Recent phenomenological studies in yeast and bacteria have shown that these cells add an approximately constant volume during each complete cell cycle, independent of their size at birth. These results seem to be in conflict, as the phenomenological studies suggest that cells measure the amount they grow, rather than their size, and that size control acts over the whole cell cycle, rather than specifically in G1. Here, we propose an integrated model that unifies the adder phenomenology with the molecular mechanism of G1/S cell-size control. We use single-cell microscopy to parameterize a full cell-cycle model based on independent control of pre- and post-Start cell-cycle periods. We find that our model predicts the size-independent amount of cell growth during the full cell cycle. This suggests that the adder phenomenon is an emergent property of the independent regulation of pre- and post-Start cell-cycle periods rather than the consequence of an underlying molecular mechanism measuring a fixed amount of growth. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Transcription factor genes essential for cell proliferation and replicative lifespan in budding yeast

    Energy Technology Data Exchange (ETDEWEB)

    Kamei, Yuka; Tai, Akiko; Dakeyama, Shota; Yamamoto, Kaori; Inoue, Yamato; Kishimoto, Yoshifumi; Ohara, Hiroya; Mukai, Yukio, E-mail: y_mukai@nagahama-i-bio.ac.jp

    2015-07-31

    Many of the lifespan-related genes have been identified in eukaryotes ranging from the yeast to human. However, there is limited information available on the longevity genes that are essential for cell proliferation. Here, we investigated whether the essential genes encoding DNA-binding transcription factors modulated the replicative lifespan of Saccharomyces cerevisiae. Heterozygous diploid knockout strains for FHL1, RAP1, REB1, and MCM1 genes showed significantly short lifespan. {sup 1}H-nuclear magnetic resonance analysis indicated a characteristic metabolic profile in the Δfhl1/FHL1 mutant. These results strongly suggest that FHL1 regulates the transcription of lifespan related metabolic genes. Thus, heterozygous knockout strains could be the potential materials for discovering further novel lifespan genes. - Highlights: • Involvement of yeast TF genes essential for cell growth in lifespan was evaluated. • The essential TF genes, FHL1, RAP1, REB1, and MCM1, regulate replicative lifespan. • Heterozygous deletion of FHL1 changes cellular metabolism related to lifespan.

  7. Energy landscape reveals that the budding yeast cell cycle is a robust and adaptive multi-stage process.

    Directory of Open Access Journals (Sweden)

    Cheng Lv

    2015-03-01

    Full Text Available Quantitatively understanding the robustness, adaptivity and efficiency of cell cycle dynamics under the influence of noise is a fundamental but difficult question to answer for most eukaryotic organisms. Using a simplified budding yeast cell cycle model perturbed by intrinsic noise, we systematically explore these issues from an energy landscape point of view by constructing an energy landscape for the considered system based on large deviation theory. Analysis shows that the cell cycle trajectory is sharply confined by the ambient energy barrier, and the landscape along this trajectory exhibits a generally flat shape. We explain the evolution of the system on this flat path by incorporating its non-gradient nature. Furthermore, we illustrate how this global landscape changes in response to external signals, observing a nice transformation of the landscapes as the excitable system approaches a limit cycle system when nutrients are sufficient, as well as the formation of additional energy wells when the DNA replication checkpoint is activated. By taking into account the finite volume effect, we find additional pits along the flat cycle path in the landscape associated with the checkpoint mechanism of the cell cycle. The difference between the landscapes induced by intrinsic and extrinsic noise is also discussed. In our opinion, this meticulous structure of the energy landscape for our simplified model is of general interest to other cell cycle dynamics, and the proposed methods can be applied to study similar biological systems.

  8. FLO1 is a variable green beard gene that drives biofilm-like cooperation in budding yeast

    Science.gov (United States)

    Smukalla, Scott; Caldara, Marina; Pochet, Nathalie; Beauvais, Anne; Guadagnini, Stephanie; Yan, Chen; Vinces, Marcelo D.; Jansen, An; Prevost, Marie Christine; Latgé, Jean-Paul; Fink, Gerald R.; Foster, Kevin R.; Verstrepen, Kevin J.

    2008-01-01

    Summary The budding yeast, Saccharomyces cerevisiae, has emerged as an archetype of eukaryotic cell biology. Here we show that S. cerevisiae is also a model for the evolution of cooperative behavior by revisiting flocculation, a self-adherence phenotype lacking in most laboratory strains. Expression of the gene FLO1 in the laboratory strain S288C restores flocculation, an altered physiological state, reminiscent of bacterial biofilms. Flocculation protects the FLO1-expressing cells from multiple stresses, including antimicrobials and ethanol. Furthermore, FLO1+ cells avoid exploitation by non-expressing flo1 cells by self/non-self recognition: FLO1+ cells preferentially stick to one another, regardless of genetic relatedness across the rest of the genome. Flocculation, therefore, is driven by one of a few known “green beard genes”, which direct cooperation towards other carriers of the same gene. Moreover, FLO1 is highly variable among strains both in expression and in sequence, suggesting that flocculation in S. cerevisiae is a dynamic, rapidly-evolving social trait. PMID:19013280

  9. Decoding the principles underlying the frequency of association with nucleoli for RNA polymerase III–transcribed genes in budding yeast

    Science.gov (United States)

    Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier

    2016-01-01

    The association of RNA polymerase III (Pol III)–transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III–transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements—centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III–transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III–transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III–dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III–transcribed genes required active transcription. We conclude that the association of Pol III–transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. PMID:27559135

  10. Rif1 acts through Protein Phosphatase 1 but independent of replication timing to suppress telomere extension in budding yeast.

    Science.gov (United States)

    Kedziora, Sylwia; Gali, Vamsi K; Wilson, Rosemary H C; Clark, Kate R M; Nieduszynski, Conrad A; Hiraga, Shin-Ichiro; Donaldson, Anne D

    2018-05-04

    The Rif1 protein negatively regulates telomeric TG repeat length in the budding yeast Saccharomyces cerevisiae, but how it prevents telomere over-extension is unknown. Rif1 was recently shown to control DNA replication by acting as a Protein Phosphatase 1 (PP1)-targeting subunit. Therefore, we investigated whether Rif1 controls telomere length by targeting PP1 activity. We find that a Rif1 mutant defective for PP1 interaction causes a long-telomere phenotype, similar to that of rif1Δ cells. Tethering PP1 at a specific telomere partially substitutes for Rif1 in limiting TG repeat length, confirming the importance of PP1 in telomere length control. Ablating Rif1-PP1 interaction is known to cause precocious activation of telomere-proximal replication origins and aberrantly early telomere replication. However, we find that Rif1 still limits telomere length even if late replication is forced through deletion of nearby replication origins, indicating that Rif1 can control telomere length independent of replication timing. Moreover we find that, even at a de novo telomere created after DNA synthesis during a mitotic block, Rif1-PP1 interaction is required to suppress telomere lengthening and prevent inappropriate recruitment of Tel1 kinase. Overall, our results show that Rif1 controls telomere length by recruiting PP1 to directly suppress telomerase-mediated TG repeat lengthening.

  11. Functional conservation of RNA polymerase II in fission and budding yeasts.

    Science.gov (United States)

    Shpakovski, G V; Gadal, O; Labarre-Mariotte, S; Lebedenko, E N; Miklos, I; Sakurai, H; Proshkin, S A; Van Mullem, V; Ishihama, A; Thuriaux, P

    2000-02-04

    The complementary DNAs of the 12 subunits of fission yeast (Schizosaccharomyces pombe) RNA polymerase II were expressed from strong promoters in Saccharomyces cerevisiae and tested for heterospecific complementation by monitoring their ability to replace in vivo the null mutants of the corresponding host genes. Rpb1 and Rpb2, the two largest subunits and Rpb8, a small subunit shared by all three polymerases, failed to support growth in S. cerevisiae. The remaining nine subunits were all proficient for heterospecific complementation and led in most cases to a wild-type level of growth. The two alpha-like subunits (Rpb3 and Rpb11), however, did not support growth at high (37 degrees C) or low (25 degrees C) temperatures. In the case of Rpb3, growth was restored by increasing the gene dosage of the host Rpb11 or Rpb10 subunits, confirming previous evidence of a close genetic interaction between these three subunits. Copyright 2000 Academic Press.

  12. Spatial organization of the budding yeast genome in the cell nucleus and identification of specific chromatin interactions from multi-chromosome constrained chromatin model.

    Science.gov (United States)

    Gürsoy, Gamze; Xu, Yun; Liang, Jie

    2017-07-01

    Nuclear landmarks and biochemical factors play important roles in the organization of the yeast genome. The interaction pattern of budding yeast as measured from genome-wide 3C studies are largely recapitulated by model polymer genomes subject to landmark constraints. However, the origin of inter-chromosomal interactions, specific roles of individual landmarks, and the roles of biochemical factors in yeast genome organization remain unclear. Here we describe a multi-chromosome constrained self-avoiding chromatin model (mC-SAC) to gain understanding of the budding yeast genome organization. With significantly improved sampling of genome structures, both intra- and inter-chromosomal interaction patterns from genome-wide 3C studies are accurately captured in our model at higher resolution than previous studies. We show that nuclear confinement is a key determinant of the intra-chromosomal interactions, and centromere tethering is responsible for the inter-chromosomal interactions. In addition, important genomic elements such as fragile sites and tRNA genes are found to be clustered spatially, largely due to centromere tethering. We uncovered previously unknown interactions that were not captured by genome-wide 3C studies, which are found to be enriched with tRNA genes, RNAPIII and TFIIS binding. Moreover, we identified specific high-frequency genome-wide 3C interactions that are unaccounted for by polymer effects under landmark constraints. These interactions are enriched with important genes and likely play biological roles.

  13. Temporal Expression of a Master Regulator Drives Synchronous Sporulation in Budding Yeast

    Directory of Open Access Journals (Sweden)

    Minghao Chia

    2016-11-01

    Full Text Available Yeast cells enter and undergo gametogenesis relatively asynchronously, making it technically challenging to perform stage-specific genomic and biochemical analyses. Cell-to-cell variation in the expression of the master regulator of entry into sporulation, IME1, has been implicated to be the underlying cause of asynchronous sporulation. Here, we find that timing of IME1 expression is of critical importance for inducing cells to undergo sporulation synchronously. When we force expression of IME1 from an inducible promoter in cells incubated in sporulation medium for 2 hr, the vast majority of cells exhibit synchrony during premeiotic DNA replication and meiotic divisions. Inducing IME1 expression too early or too late affects the synchrony of sporulation. Surprisingly, our approach for synchronous sporulation does not require growth in acetate-containing medium, but can be achieved in cells grown in rich medium until saturation. Our system requires solely IME1, because the expression of the N6-methyladenosine methyltransferase IME4, another key regulator of early sporulation, is controlled by IME1 itself. The approach described here can be combined easily with other stage-specific synchronization methods, and thereby applied to study specific stages of sporulation, or the complete sporulation program.

  14. Temporal Expression of a Master Regulator Drives Synchronous Sporulation in Budding Yeast.

    Science.gov (United States)

    Chia, Minghao; van Werven, Folkert J

    2016-09-07

    Yeast cells enter and undergo gametogenesis relatively asynchronously, making it technically challenging to perform stage-specific genomic and biochemical analyses. Cell-to-cell variation in the expression of the master regulator of entry into sporulation IME1, has been implicated to be the underlying cause of asynchronous sporulation. Here we find that timing of IME1 expression is of critical importance for inducing cells to undergo sporulation synchronously. When we force expression of IME1 from an inducible promoter in cells incubated in sporulation medium for two hours, the vast majority of cells exhibit synchrony during pre-meiotic DNA replication and meiotic divisions. Inducing IME1 expression too early or too late affects the synchrony of sporulation. Surprisingly, our approach for synchronous sporulation does not require growth in acetate containing medium, but can be achieved in cells grown in rich medium until saturation. Our system solely requires IME1 because the expression of the N6-methyladenosine methyltransferase IME4, another key regulator of early sporulation, is controlled by IME1 itself. The approach described here can be easily combined with other stage specific synchronization methods, and thereby applied to study specific stages of sporulation or the complete sporulation program. Copyright © 2016 Author et al.

  15. RPA facilitates telomerase activity at chromosome ends in budding and fission yeasts.

    Science.gov (United States)

    Luciano, Pierre; Coulon, Stéphane; Faure, Virginie; Corda, Yves; Bos, Julia; Brill, Steven J; Gilson, Eric; Simon, Marie-Noelle; Géli, Vincent

    2012-04-18

    In Saccharomyces cerevisiae, the telomerase complex binds to chromosome ends and is activated in late S-phase through a process coupled to the progression of the replication fork. Here, we show that the single-stranded DNA-binding protein RPA (replication protein A) binds to the two daughter telomeres during telomere replication but only its binding to the leading-strand telomere depends on the Mre11/Rad50/Xrs2 (MRX) complex. We further demonstrate that RPA specifically co-precipitates with yKu, Cdc13 and telomerase. The interaction of RPA with telomerase appears to be mediated by both yKu and the telomerase subunit Est1. Moreover, a mutation in Rfa1 that affects both the interaction with yKu and telomerase reduces the dramatic increase in telomere length of a rif1Δ, rif2Δ double mutant. Finally, we show that the RPA/telomerase association and function are conserved in Schizosaccharomyces pombe. Our results indicate that in both yeasts, RPA directly facilitates telomerase activity at chromosome ends.

  16. Effect of nagilactone E on cell morphology and glucan biosynthesis in budding yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Hayashi, Kengo; Yamaguchi, Yoshihiro; Ogita, Akira; Tanaka, Toshio; Kubo, Isao; Fujita, Ken-Ichi

    2018-05-14

    Nagilactones are norditerpene dilactones isolated from the root bark of Podocarpus nagi. Although nagilactone E has been reported to show antifungal activities, its activity is weaker than that of antifungals on the market. Nagilactone E enhances the antifungal activity of phenylpropanoids such as anethole and isosafrole against nonpathogenic Saccharomyces cerevisiae and pathogenic Candida albicans. However, the detailed mechanisms underlying the antifungal activity of nagilactone E itself have not yet been elucidated. Therefore, we investigated the antifungal mechanisms of nagilactone E using S. cerevisiae. Although nagilactone E induced lethality in vegetatively growing cells, it did not affect cell viability in non-growing cells. Nagilactone E-induced morphological changes in the cells, such as inhomogeneous thickness of the glucan layer and leakage of cytoplasm. Furthermore, a dose-dependent decrease in the amount of newly synthesized (1, 3)-β-glucan was detected in the membrane fractions of the yeast incubated with nagilactone E. These results suggest that nagilactone E exhibits an antifungal activity against S. cerevisiae by depending on cell wall fragility via the inhibition of (1, 3)-β-glucan biosynthesis. Additionally, we confirmed nagilactone E-induced morphological changes of a human pathogenic fungus Aspergillus fumigatus. Therefore, nagilactone E is a potential antifungal drug candidate with fewer adverse effects. Copyright © 2018 Elsevier B.V. All rights reserved.

  17. Identification of She3 as an SCF(Grr1 substrate in budding yeast.

    Directory of Open Access Journals (Sweden)

    Ruiwen Wang

    Full Text Available The highly orchestrated progression of the cell cycle depends on the degradation of many regulatory proteins at different cell cycle stages. One of the key cell cycle ubiquitin ligases is the Skp1-cullin-F-box (SCF complex. Acting in concert with the substrate-binding F-box protein Grr1, SCF(Grr1 promotes the degradation of cell cycle regulators as well as various metabolic enzymes. Using a yeast two-hybrid assay with a Grr1 derivative as the bait, we identified She3, which is an adaptor protein in the asymmetric mRNA transport system, as a novel Grr1 substrate. We generated stabilized She3 mutants, which no longer bound to Grr1, and found that the degradation of She3 is not required for regulating asymmetric mRNA transport. However, She3 stabilization leads to slower growth compared to wild-type cells in a co-culture assay, demonstrating that the degradation of She3 by Grr1 is required for optimal cell growth.

  18. Cell cycle commitment in budding yeast emerges from the cooperation of multiple bistable switches

    Science.gov (United States)

    Zhang, Tongli; Schmierer, Bernhard; Novák, Béla

    2011-01-01

    The start-transition (START) in the G1 phase marks the point in the cell cycle at which a yeast cell initiates a new round of cell division. Once made, this decision is irreversible and the cell is committed to progressing through the entire cell cycle, irrespective of arrest signals such as pheromone. How commitment emerges from the underlying molecular interaction network is poorly understood. Here, we perform a dynamical systems analysis of an established cell cycle model, which has never been analysed from a commitment perspective. We show that the irreversibility of the START transition and subsequent commitment can be consistently explained in terms of the interplay of multiple bistable molecular switches. By applying an existing mathematical model to a novel problem and by expanding the model in a self-consistent manner, we achieve several goals: we bring together a large number of experimental findings into a coherent theoretical framework; we increase the scope and the applicability of the original model; we give a systems level explanation of how the START transition and the cell cycle commitment arise from the dynamical features of the underlying molecular interaction network; and we make clear, experimentally testable predictions. PMID:22645649

  19. Caloric Restriction-Induced Extension of Chronological Lifespan Requires Intact Respiration in Budding Yeast.

    Science.gov (United States)

    Kwon, Young-Yon; Lee, Sung-Keun; Lee, Cheol-Koo

    2017-04-01

    Caloric restriction (CR) has been shown to extend lifespan and prevent cellular senescence in various species ranging from yeast to humans. Many effects of CR may contribute to extend lifespan. Specifically, CR prevents oxidative damage from reactive oxygen species (ROS) by enhancing mitochondrial function. In this study, we characterized 33 single electron transport chain (ETC) gene-deletion strains to identify CR-induced chronological lifespan (CLS) extension mechanisms. Interestingly, defects in 17 of these 33 ETC gene-deleted strains showed loss of both respiratory function and CR-induced CLS extension. On the contrary, the other 16 respiration-capable mutants showed increased CLS upon CR along with increased mitochondrial membrane potential (MMP) and intracellular adenosine triphosphate (ATP) levels, with decreased mitochondrial superoxide generation. We measured the same parameters in the 17 non-respiratory mutants upon CR. CR simultaneously increased MMP and mitochondrial superoxide generation without altering intracellular ATP levels. In conclusion, respiration is essential for CLS extension by CR and is important for balancing MMP, ROS, and ATP levels.

  20. Four linked genes participate in controlling sporulation efficiency in budding yeast.

    Directory of Open Access Journals (Sweden)

    Giora Ben-Ari

    2006-11-01

    Full Text Available Quantitative traits are conditioned by several genetic determinants. Since such genes influence many important complex traits in various organisms, the identification of quantitative trait loci (QTLs is of major interest, but still encounters serious difficulties. We detected four linked genes within one QTL, which participate in controlling sporulation efficiency in Saccharomyces cerevisiae. Following the identification of single nucleotide polymorphisms by comparing the sequences of 145 genes between the parental strains SK1 and S288c, we analyzed the segregating progeny of the cross between them. Through reciprocal hemizygosity analysis, four genes, RAS2, PMS1, SWS2, and FKH2, located in a region of 60 kilobases on Chromosome 14, were found to be associated with sporulation efficiency. Three of the four "high" sporulation alleles are derived from the "low" sporulating strain. Two of these sporulation-related genes were verified through allele replacements. For RAS2, the causative variation was suggested to be a single nucleotide difference in the upstream region of the gene. This quantitative trait nucleotide accounts for sporulation variability among a set of ten closely related winery yeast strains. Our results provide a detailed view of genetic complexity in one "QTL region" that controls a quantitative trait and reports a single nucleotide polymorphism-trait association in wild strains. Moreover, these findings have implications on QTL identification in higher eukaryotes.

  1. Cytosolic chaperones mediate quality control of higher-order septin assembly in budding yeast.

    Science.gov (United States)

    Johnson, Courtney R; Weems, Andrew D; Brewer, Jennifer M; Thorner, Jeremy; McMurray, Michael A

    2015-04-01

    Septin hetero-oligomers polymerize into cytoskeletal filaments with essential functions in many eukaryotic cell types. Mutations within the oligomerization interface that encompasses the GTP-binding pocket of a septin (its "G interface") cause thermoinstability of yeast septin hetero-oligomer assembly, and human disease. When coexpressed with its wild-type counterpart, a G interface mutant is excluded from septin filaments, even at moderate temperatures. We show that this quality control mechanism is specific to G interface mutants, operates during de novo septin hetero-oligomer assembly, and requires specific cytosolic chaperones. Chaperone overexpression lowers the temperature permissive for proliferation of cells expressing a G interface mutant as the sole source of a given septin. Mutations that perturb the septin G interface retard release from these chaperones, imposing a kinetic delay on the availability of nascent septin molecules for higher-order assembly. Un-expectedly, the disaggregase Hsp104 contributes to this delay in a manner that does not require its "unfoldase" activity, indicating a latent "holdase" activity toward mutant septins. These findings provide new roles for chaperone-mediated kinetic partitioning of non-native proteins and may help explain the etiology of septin-linked human diseases. © 2015 Johnson et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  2. CRISPR/Cas9 cleavages in budding yeast reveal templated insertions and strand-specific insertion/deletion profiles.

    Science.gov (United States)

    Lemos, Brenda R; Kaplan, Adam C; Bae, Ji Eun; Ferrazzoli, Alexander E; Kuo, James; Anand, Ranjith P; Waterman, David P; Haber, James E

    2018-02-27

    Harnessing CRISPR-Cas9 technology provides an unprecedented ability to modify genomic loci via DNA double-strand break (DSB) induction and repair. We analyzed nonhomologous end-joining (NHEJ) repair induced by Cas9 in budding yeast and found that the orientation of binding of Cas9 and its guide RNA (gRNA) profoundly influences the pattern of insertion/deletions (indels) at the site of cleavage. A common indel created by Cas9 is a 1-bp (+1) insertion that appears to result from Cas9 creating a 1-nt 5' overhang that is filled in by a DNA polymerase and ligated. The origin of +1 insertions was investigated by using two gRNAs with PAM sequences located on opposite DNA strands but designed to cleave the same sequence. These templated +1 insertions are dependent on the X-family DNA polymerase, Pol4. Deleting Pol4 also eliminated +2 and +3 insertions, which are biased toward homonucleotide insertions. Using inverted PAM sequences, we also found significant differences in overall NHEJ efficiency and repair profiles, suggesting that the binding of the Cas9:gRNA complex influences subsequent NHEJ processing. As with events induced by the site-specific HO endonuclease, CRISPR-Cas9-mediated NHEJ repair depends on the Ku heterodimer and DNA ligase 4. Cas9 events are highly dependent on the Mre11-Rad50-Xrs2 complex, independent of Mre11's nuclease activity. Inspection of the outcomes of a large number of Cas9 cleavage events in mammalian cells reveals a similar templated origin of +1 insertions in human cells, but also a significant frequency of similarly templated +2 insertions.

  3. Decoding the principles underlying the frequency of association with nucleoli for RNA polymerase III-transcribed genes in budding yeast.

    Science.gov (United States)

    Belagal, Praveen; Normand, Christophe; Shukla, Ashutosh; Wang, Renjie; Léger-Silvestre, Isabelle; Dez, Christophe; Bhargava, Purnima; Gadal, Olivier

    2016-10-15

    The association of RNA polymerase III (Pol III)-transcribed genes with nucleoli seems to be an evolutionarily conserved property of the spatial organization of eukaryotic genomes. However, recent studies of global chromosome architecture in budding yeast have challenged this view. We used live-cell imaging to determine the intranuclear positions of 13 Pol III-transcribed genes. The frequency of association with nucleolus and nuclear periphery depends on linear genomic distance from the tethering elements-centromeres or telomeres. Releasing the hold of the tethering elements by inactivating centromere attachment to the spindle pole body or changing the position of ribosomal DNA arrays resulted in the association of Pol III-transcribed genes with nucleoli. Conversely, ectopic insertion of a Pol III-transcribed gene in the vicinity of a centromere prevented its association with nucleolus. Pol III-dependent transcription was independent of the intranuclear position of the gene, but the nucleolar recruitment of Pol III-transcribed genes required active transcription. We conclude that the association of Pol III-transcribed genes with the nucleolus, when permitted by global chromosome architecture, provides nucleolar and/or nuclear peripheral anchoring points contributing locally to intranuclear chromosome organization. © 2016 Belagal et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

  4. Depletion of a Drosophila homolog of yeast Sup35p disrupts spindle assembly, chromosome segregation, and cytokinesis during male meiosis.

    Science.gov (United States)

    Basu, J; Williams, B C; Li, Z; Williams, E V; Goldberg, M L

    1998-01-01

    In the course of a genetic screen for male-sterile mutations in Drosophila affecting chromosome segregation during the meiotic divisions in spermatocytes, we identified the mutation dsup35(63D). Examination of mutant testes showed that chromosome misbehavior was a consequence of major disruptions in meiotic spindle assembly. These perturbations included problems in aster formation, separation, and migration around the nuclear envelope; aberrations in spindle organization and integrity; and disappearance of the ana/telophase central spindle, which in turn disrupts cytokinesis. The dsup35(63D) mutation is caused by a P element insertion that affects, specifically in the testis, the expression of a gene (dsup35) encoding the Drosophila homolog of the yeast Sup35p and Xenopus eRF3 proteins. These proteins are involved in the termination of polypeptide synthesis on ribosomes, but previous studies have suggested that Sup35p and closely related proteins of the same family also interact directly with microtubules. An affinity-purified antibody directed against the product of the dsup35 gene was prepared; interestingly, this antibody specifically labels primary spermatocytes in one or two discrete foci of unknown structure within the nucleoplasm. We discuss how depletion of the dsup35 gene product in spermatocytes might lead to the global disruptions in meiotic spindle assembly seen in mutant spermatocytes.

  5. Timely activation of budding yeast APCCdh1 involves degradation of its inhibitor, Acm1, by an unconventional proteolytic mechanism.

    Directory of Open Access Journals (Sweden)

    Michael Melesse

    Full Text Available Regulated proteolysis mediated by the ubiquitin proteasome system is a fundamental and essential feature of the eukaryotic cell division cycle. Most proteins with cell cycle-regulated stability are targeted for degradation by one of two related ubiquitin ligases, the Skp1-cullin-F box protein (SCF complex or the anaphase-promoting complex (APC. Here we describe an unconventional cell cycle-regulated proteolytic mechanism that acts on the Acm1 protein, an inhibitor of the APC activator Cdh1 in budding yeast. Although Acm1 can be recognized as a substrate by the Cdc20-activated APC (APCCdc20 in anaphase, APCCdc20 is neither necessary nor sufficient for complete Acm1 degradation at the end of mitosis. An APC-independent, but 26S proteasome-dependent, mechanism is sufficient for complete Acm1 clearance from late mitotic and G1 cells. Surprisingly, this mechanism appears distinct from the canonical ubiquitin targeting pathway, exhibiting several features of ubiquitin-independent proteasomal degradation. For example, Acm1 degradation in G1 requires neither lysine residues in Acm1 nor assembly of polyubiquitin chains. Acm1 was stabilized though by conditional inactivation of the ubiquitin activating enzyme Uba1, implying some requirement for the ubiquitin pathway, either direct or indirect. We identified an amino terminal predicted disordered region in Acm1 that contributes to its proteolysis in G1. Although ubiquitin-independent proteasome substrates have been described, Acm1 appears unique in that its sensitivity to this mechanism is strictly cell cycle-regulated via cyclin-dependent kinase (Cdk phosphorylation. As a result, Acm1 expression is limited to the cell cycle window in which Cdk is active. We provide evidence that failure to eliminate Acm1 impairs activation of APCCdh1 at mitotic exit, justifying its strict regulation by cell cycle-dependent transcription and proteolytic mechanisms. Importantly, our results reveal that strict cell

  6. Timely Activation of Budding Yeast APCCdh1 Involves Degradation of Its Inhibitor, Acm1, by an Unconventional Proteolytic Mechanism

    Science.gov (United States)

    Melesse, Michael; Choi, Eunyoung; Hall, Hana; Walsh, Michael J.; Geer, M. Ariel; Hall, Mark C.

    2014-01-01

    Regulated proteolysis mediated by the ubiquitin proteasome system is a fundamental and essential feature of the eukaryotic cell division cycle. Most proteins with cell cycle-regulated stability are targeted for degradation by one of two related ubiquitin ligases, the Skp1-cullin-F box protein (SCF) complex or the anaphase-promoting complex (APC). Here we describe an unconventional cell cycle-regulated proteolytic mechanism that acts on the Acm1 protein, an inhibitor of the APC activator Cdh1 in budding yeast. Although Acm1 can be recognized as a substrate by the Cdc20-activated APC (APCCdc20) in anaphase, APCCdc20 is neither necessary nor sufficient for complete Acm1 degradation at the end of mitosis. An APC-independent, but 26S proteasome-dependent, mechanism is sufficient for complete Acm1 clearance from late mitotic and G1 cells. Surprisingly, this mechanism appears distinct from the canonical ubiquitin targeting pathway, exhibiting several features of ubiquitin-independent proteasomal degradation. For example, Acm1 degradation in G1 requires neither lysine residues in Acm1 nor assembly of polyubiquitin chains. Acm1 was stabilized though by conditional inactivation of the ubiquitin activating enzyme Uba1, implying some requirement for the ubiquitin pathway, either direct or indirect. We identified an amino terminal predicted disordered region in Acm1 that contributes to its proteolysis in G1. Although ubiquitin-independent proteasome substrates have been described, Acm1 appears unique in that its sensitivity to this mechanism is strictly cell cycle-regulated via cyclin-dependent kinase (Cdk) phosphorylation. As a result, Acm1 expression is limited to the cell cycle window in which Cdk is active. We provide evidence that failure to eliminate Acm1 impairs activation of APCCdh1 at mitotic exit, justifying its strict regulation by cell cycle-dependent transcription and proteolytic mechanisms. Importantly, our results reveal that strict cell-cycle expression profiles

  7. The proline metabolism intermediate Δ1-pyrroline-5-carboxylate directly inhibits the mitochondrial respiration in budding yeast.

    Science.gov (United States)

    Nishimura, Akira; Nasuno, Ryo; Takagi, Hiroshi

    2012-07-30

    The proline metabolism intermediate Δ(1)-pyrroline-5-carboxylate (P5C) induces cell death in animals, plants and yeasts. To elucidate how P5C triggers cell death, we analyzed P5C metabolism, mitochondrial respiration and superoxide anion generation in the yeast Saccharomyces cerevisiae. Gene disruption analysis revealed that P5C-mediated cell death was not due to P5C metabolism. Interestingly, deficiency in mitochondrial respiration suppressed the sensitivity of yeast cells to P5C. In addition, we found that P5C inhibits the mitochondrial respiration and induces a burst of superoxide anions from the mitochondria. We propose that P5C regulates cell death via the inhibition of mitochondrial respiration. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  8. Delineating functional principles of the bow tie structure of a kinase-phosphatase network in the budding yeast.

    Science.gov (United States)

    Abd-Rabbo, Diala; Michnick, Stephen W

    2017-03-16

    Kinases and phosphatases (KP) form complex self-regulating networks essential for cellular signal processing. In spite of having a wealth of data about interactions among KPs and their substrates, we have very limited models of the structures of the directed networks they form and consequently our ability to formulate hypotheses about how their structure determines the flow of information in these networks is restricted. We assembled and studied the largest bona fide kinase-phosphatase network (KP-Net) known to date for the yeast Saccharomyces cerevisiae. Application of the vertex sort (VS) algorithm on the KP-Net allowed us to elucidate its hierarchical structure in which nodes are sorted into top, core and bottom layers, forming a bow tie structure with a strongly connected core layer. Surprisingly, phosphatases tend to sort into the top layer, implying they are less regulated by phosphorylation than kinases. Superposition of the widest range of KP biological properties over the KP-Net hierarchy shows that core layer KPs: (i), receive the largest number of inputs; (ii), form bottlenecks implicated in multiple pathways and in decision-making; (iii), and are among the most regulated KPs both temporally and spatially. Moreover, top layer KPs are more abundant and less noisy than those in the bottom layer. Finally, we showed that the VS algorithm depends on node degrees without biasing the biological results of the sorted network. The VS algorithm is available as an R package ( https://cran.r-project.org/web/packages/VertexSort/index.html ). The KP-Net model we propose possesses a bow tie hierarchical structure in which the top layer appears to ensure highest fidelity and the core layer appears to mediate signal integration and cell state-dependent signal interpretation. Our model of the yeast KP-Net provides both functional insight into its organization as we understand today and a framework for future investigation of information processing in yeast and eukaryotes

  9. High-yield expression in Escherichia coli, purification and application of budding yeast K2 killer protein.

    Science.gov (United States)

    Podoliankaitė, Monika; Lukša, Juliana; Vyšniauskis, Gintautas; Sereikaitė, Jolanta; Melvydas, Vytautas; Serva, Saulius; Servienė, Elena

    2014-07-01

    Saccharomyces cerevisiae K2 toxin is a highly active extracellular protein, important as a biocontrol agent for biotechnological applications in the wine industry. This protein is produced at negligible levels in yeast, making difficult to isolate it in amounts sufficient for investigation and generation of analysis tools. In this work, we demonstrate the use of a bacterial system for expression of the recombinant K2 protein, suitable for generation of antibodies specific for toxin of the yeast origin. Synthesis of the full-length S. cerevisiae K2 preprotoxin in Escherichia coli was found to be toxic to the host cell, resulting in diminished growth. Such effect was abolished by the introduction of the C-terminal truncation into K2 protein, directing it into non-toxic inclusion body fraction. The obtained protein is of limited solubility thus, facilitating the purification by simple and efficient chromatography-free procedure. The protein aggregates were successfully refolded into a soluble form yielding sufficient amounts of a tag-less truncated K2 protein suitable for polyclonal antibody production. Antibodies were raised in rabbit and found to be specific for detection of both antigen and native S. cerevisiae K2 toxin.

  10. Long-term tracking of budding yeast cells in brightfield microscopy: CellStar and the Evaluation Platform.

    Science.gov (United States)

    Versari, Cristian; Stoma, Szymon; Batmanov, Kirill; Llamosi, Artémis; Mroz, Filip; Kaczmarek, Adam; Deyell, Matt; Lhoussaine, Cédric; Hersen, Pascal; Batt, Gregory

    2017-02-01

    With the continuous expansion of single cell biology, the observation of the behaviour of individual cells over extended durations and with high accuracy has become a problem of central importance. Surprisingly, even for yeast cells that have relatively regular shapes, no solution has been proposed that reaches the high quality required for long-term experiments for segmentation and tracking (S&T) based on brightfield images. Here, we present CellStar , a tool chain designed to achieve good performance in long-term experiments. The key features are the use of a new variant of parametrized active rays for segmentation, a neighbourhood-preserving criterion for tracking, and the use of an iterative approach that incrementally improves S&T quality. A graphical user interface enables manual corrections of S&T errors and their use for the automated correction of other, related errors and for parameter learning. We created a benchmark dataset with manually analysed images and compared CellStar with six other tools, showing its high performance, notably in long-term tracking. As a community effort, we set up a website, the Yeast Image Toolkit, with the benchmark and the Evaluation Platform to gather this and additional information provided by others. © 2017 The Authors.

  11. Exposure of ELF-EMF and RF-EMF Increase the Rate of Glucose Transport and TCA Cycle in Budding Yeast.

    Science.gov (United States)

    Lin, Kang-Wei; Yang, Chuan-Jun; Lian, Hui-Yong; Cai, Peng

    2016-01-01

    In this study, we investigated the transcriptional response to 50 Hz extremely low frequency electromagnetic field (ELF-EMF) and 2.0 GHz radio frequency electromagnetic field (RF-EMF) exposure by Illumina sequencing technology using budding yeast as the model organism. The transcription levels of 28 genes were upregulated and those of four genes were downregulated under ELF-EMF exposure, while the transcription levels of 29 genes were upregulated and those of 24 genes were downregulated under RF-EMF exposure. After validation by reverse transcription quantitative polymerase chain reaction (RT-qPCR), a concordant direction of change both in differential gene expression (DGE) and RT-qPCR was demonstrated for nine genes under ELF-EMF exposure and for 10 genes under RF-EMF exposure. The RT-qPCR results revealed that ELF-EMF and RF-EMF exposure can upregulate the expression of genes involved in glucose transportation and the tricarboxylic acid (TCA) cycle, but not the glycolysis pathway. Energy metabolism is closely related with the cell response to environmental stress including EMF exposure. Our findings may throw light on the mechanism underlying the biological effects of EMF.

  12. H2B ubiquitylation is part of chromatin architecture that marks exon-intron structure in budding yeast

    Directory of Open Access Journals (Sweden)

    Shieh Grace S

    2011-12-01

    Full Text Available Abstract Background The packaging of DNA into chromatin regulates transcription from initiation through 3' end processing. One aspect of transcription in which chromatin plays a poorly understood role is the co-transcriptional splicing of pre-mRNA. Results Here we provide evidence that H2B monoubiquitylation (H2BK123ub1 marks introns in Saccharomyces cerevisiae. A genome-wide map of H2BK123ub1 in this organism reveals that this modification is enriched in coding regions and that its levels peak at the transcribed regions of two characteristic subgroups of genes. First, long genes are more likely to have higher levels of H2BK123ub1, correlating with the postulated role of this modification in preventing cryptic transcription initiation in ORFs. Second, genes that are highly transcribed also have high levels of H2BK123ub1, including the ribosomal protein genes, which comprise the majority of intron-containing genes in yeast. H2BK123ub1 is also a feature of introns in the yeast genome, and the disruption of this modification alters the intragenic distribution of H3 trimethylation on lysine 36 (H3K36me3, which functionally correlates with alternative RNA splicing in humans. In addition, the deletion of genes encoding the U2 snRNP subunits, Lea1 or Msl1, in combination with an htb-K123R mutation, leads to synthetic lethality. Conclusion These data suggest that H2BK123ub1 facilitates cross talk between chromatin and pre-mRNA splicing by modulating the distribution of intronic and exonic histone modifications.

  13. H2B ubiquitylation is part of chromatin architecture that marks exon-intron structure in budding yeast

    LENUS (Irish Health Repository)

    Shieh, Grace S.

    2011-12-22

    Abstract Background The packaging of DNA into chromatin regulates transcription from initiation through 3\\' end processing. One aspect of transcription in which chromatin plays a poorly understood role is the co-transcriptional splicing of pre-mRNA. Results Here we provide evidence that H2B monoubiquitylation (H2BK123ub1) marks introns in Saccharomyces cerevisiae. A genome-wide map of H2BK123ub1 in this organism reveals that this modification is enriched in coding regions and that its levels peak at the transcribed regions of two characteristic subgroups of genes. First, long genes are more likely to have higher levels of H2BK123ub1, correlating with the postulated role of this modification in preventing cryptic transcription initiation in ORFs. Second, genes that are highly transcribed also have high levels of H2BK123ub1, including the ribosomal protein genes, which comprise the majority of intron-containing genes in yeast. H2BK123ub1 is also a feature of introns in the yeast genome, and the disruption of this modification alters the intragenic distribution of H3 trimethylation on lysine 36 (H3K36me3), which functionally correlates with alternative RNA splicing in humans. In addition, the deletion of genes encoding the U2 snRNP subunits, Lea1 or Msl1, in combination with an htb-K123R mutation, leads to synthetic lethality. Conclusion These data suggest that H2BK123ub1 facilitates cross talk between chromatin and pre-mRNA splicing by modulating the distribution of intronic and exonic histone modifications.

  14. Divergent Evolution of the Transcriptional Network Controlled by Snf1-Interacting Protein Sip4 in Budding Yeasts.

    Directory of Open Access Journals (Sweden)

    Constance Mehlgarten

    Full Text Available Cellular responses to starvation are of ancient origin since nutrient limitation has always been a common challenge to the stability of living systems. Hence, signaling molecules involved in sensing or transducing information about limiting metabolites are highly conserved, whereas transcription factors and the genes they regulate have diverged. In eukaryotes the AMP-activated protein kinase (AMPK functions as a central regulator of cellular energy homeostasis. The yeast AMPK ortholog SNF1 controls the transcriptional network that counteracts carbon starvation conditions by regulating a set of transcription factors. Among those Cat8 and Sip4 have overlapping DNA-binding specificity for so-called carbon source responsive elements and induce target genes upon SNF1 activation. To analyze the evolution of the Cat8-Sip4 controlled transcriptional network we have compared the response to carbon limitation of Saccharomyces cerevisiae to that of Kluyveromyces lactis. In high glucose, S. cerevisiae displays tumor cell-like aerobic fermentation and repression of respiration (Crabtree-positive while K. lactis has a respiratory-fermentative life-style, respiration being regulated by oxygen availability (Crabtree-negative, which is typical for many yeasts and for differentiated higher cells. We demonstrate divergent evolution of the Cat8-Sip4 network and present evidence that a role of Sip4 in controlling anabolic metabolism has been lost in the Saccharomyces lineage. We find that in K. lactis, but not in S. cerevisiae, the Sip4 protein plays an essential role in C2 carbon assimilation including induction of the glyoxylate cycle and the carnitine shuttle genes. Induction of KlSIP4 gene expression by KlCat8 is essential under these growth conditions and a primary function of KlCat8. Both KlCat8 and KlSip4 are involved in the regulation of lactose metabolism in K. lactis. In chromatin-immunoprecipitation experiments we demonstrate binding of both, KlSip4 and

  15. DNA is structured as a linear "jigsaw puzzle" in the genomes of Arabidopsis, rice, and budding yeast.

    Science.gov (United States)

    Liu, Yun-Hua; Zhang, Meiping; Wu, Chengcang; Huang, James J; Zhang, Hong-Bin

    2014-01-01

    Knowledge of how a genome is structured and organized from its constituent elements is crucial to understanding its biology and evolution. Here, we report the genome structuring and organization pattern as revealed by systems analysis of the sequences of three model species, Arabidopsis, rice and yeast, at the whole-genome and chromosome levels. We found that all fundamental function elements (FFE) constituting the genomes, including genes (GEN), DNA transposable elements (DTE), retrotransposable elements (RTE), simple sequence repeats (SSR), and (or) low complexity repeats (LCR), are structured in a nonrandom and correlative manner, thus leading to a hypothesis that the DNA of the species is structured as a linear "jigsaw puzzle". Furthermore, we showed that different FFE differ in their importance in the formation and evolution of the DNA jigsaw puzzle structure between species. DTE and RTE play more important roles than GEN, LCR, and SSR in Arabidopsis, whereas GEN and RTE play more important roles than LCR, SSR, and DTE in rice. The genes having multiple recognized functions play more important roles than those having single functions. These results provide useful knowledge necessary for better understanding genome biology and evolution of the species and for effective molecular breeding of rice.

  16. A mechanism for the coordination of proliferation and differentiation by spatial regulation of Fus2p in budding yeast

    Science.gov (United States)

    Kim, Junwon; Rose, Mark D.

    2012-01-01

    Yeast cells induce the genes required for mating prior to the completion of mitosis. To ensure proper cell cycle progression prior to mating differentiation, a key cytoplasmic regulator of cell fusion, Fus2p, is sequestered in the nucleus by cyclin-dependent kinase (Cdk). In response to pheromone signaling, the mitogen-activated protein kinase Fus3p phosphorylates Ser 84 in Fus2p to drive nuclear export. We found that Fus3p becomes active and phosphorylates S84 as early as S phase, raising the question of how Cdk prevents inappropriate activation of Fus2p. Countering Fus3p, Cdk and a p21-activated kinase, Cla4p, maintain Fus2p's nuclear localization by phosphorylating Ser 67, which drives nuclear import and inhibits nuclear export. When Cdk and Cla4p activities drop after cell division, Fus3p promotes Fus2p export both via S84 phosphorylation and by down-regulating S67 phosphorylation. Thus, potential premature activation of Fus2p in mitosis is prevented by cell cycle-dependent phosphorylation that overrides the mating pheromone-induced phosphorylation that drives nuclear export. PMID:22588722

  17. Identification of Putative Mek1 Substrates during Meiosis in Saccharomyces cerevisiae Using Quantitative Phosphoproteomics.

    Directory of Open Access Journals (Sweden)

    Raymond T Suhandynata

    Full Text Available Meiotic recombination plays a key role in sexual reproduction as it generates crossovers that, in combination with sister chromatid cohesion, physically connect homologous chromosomes, thereby promoting their proper segregation at the first meiotic division. Meiotic recombination is initiated by programmed double strand breaks (DSBs catalyzed by the evolutionarily conserved, topoisomerase-like protein Spo11. Repair of these DSBs is highly regulated to create crossovers between homologs that are distributed throughout the genome. This repair requires the presence of the mitotic recombinase, Rad51, as well as the strand exchange activity of the meiosis-specific recombinase, Dmc1. A key regulator of meiotic DSB repair in Saccharomyces cerevisiae is the meiosis-specific kinase Mek1, which promotes interhomolog strand invasion and is required for the meiotic recombination checkpoint and the crossover/noncrossover decision. Understanding how Mek1 regulates meiotic recombination requires the identification of its substrates. Towards that end, an unbiased phosphoproteomic approach utilizing Stable Isotope Labeling by Amino Acids in Cells (SILAC was utilized to generate a list of potential Mek1 substrates, as well as proteins containing consensus phosphorylation sites for cyclin-dependent kinase, the checkpoint kinases, Mec1/Tel1, and the polo-like kinase, Cdc5. These experiments represent the first global phosphoproteomic dataset for proteins in meiotic budding yeast.

  18. Doing the Meiosis Shuffle.

    Science.gov (United States)

    Krauskopf, Sara

    1999-01-01

    Presents a game called the Meiosis Shuffle that helps students simulate the process of meiosis in which homologous cards representing chromosomes pair up, line up, and split apart. Students respond well to the simulation and are better able to conceptualize what chromosomes do and how independent assortment causes genetic variation. (CCM)

  19. Genes Important for Schizosaccharomyces pombe Meiosis Identified Through a Functional Genomics Screen

    Science.gov (United States)

    Blyth, Julie; Makrantoni, Vasso; Barton, Rachael E.; Spanos, Christos; Rappsilber, Juri; Marston, Adele L.

    2018-01-01

    Meiosis is a specialized cell division that generates gametes, such as eggs and sperm. Errors in meiosis result in miscarriages and are the leading cause of birth defects; however, the molecular origins of these defects remain unknown. Studies in model organisms are beginning to identify the genes and pathways important for meiosis, but the parts list is still poorly defined. Here we present a comprehensive catalog of genes important for meiosis in the fission yeast, Schizosaccharomyces pombe. Our genome-wide functional screen surveyed all nonessential genes for roles in chromosome segregation and spore formation. Novel genes important at distinct stages of the meiotic chromosome segregation and differentiation program were identified. Preliminary characterization implicated three of these genes in centrosome/spindle pole body, centromere, and cohesion function. Our findings represent a near-complete parts list of genes important for meiosis in fission yeast, providing a valuable resource to advance our molecular understanding of meiosis. PMID:29259000

  20. Transcript profiling to analyse gene expression during male meiosis in petunia hybrida

    NARCIS (Netherlands)

    Cnudde, F.

    2004-01-01

    Meiosis is a key feature of eukaryotic sexual reproduction. So far, the molecular and functional analysis of meiosis is relatively underdeveloped in plants, but the flood of genomics data from yeast research and the availability of large mutant collections cause a growing interest in molecular

  1. In germ cells of mouse embryonic ovaries, the decision to enter meiosis precedes premeiotic DNA replication

    NARCIS (Netherlands)

    Baltus, Andrew E.; Menke, Douglas B.; Hu, Yueh-Chiang; Goodheart, Mary L.; Carpenter, Anne E.; de Rooij, Dirk G.; Page, David C.

    2006-01-01

    The transition from mitosis to meiosis is a defining juncture in the life cycle of sexually reproducing organisms. In yeast, the decision to enter meiosis is made before the single round of DNA replication that precedes the two meiotic divisions. We present genetic evidence of an analogous decision

  2. Sociobiology of the budding yeast

    Indian Academy of Sciences (India)

    2014-03-15

    Mar 15, 2014 ... The organisms taking part in social behaviours can be divided into actors ... behaviour that have been classified as social. .... tory strains on solid agar media. ..... scenario, PCD is beneficial for the young cells where effective.

  3. Biotechnical Microbiology, yeast and bacteria

    DEFF Research Database (Denmark)

    Villadsen, Ingrid Stampe

    1999-01-01

    This section contains the following single lecture notes: Eukaryotic Cell Biology. Kingdom Fungi. Cell Division. Meiosis and Recombination. Genetics of Yeast. Organisation of the Chromosome. Organization and genetics of the mitochondrial Geneme. Regulatio of Gene Expression. Intracellular Compart...

  4. Arenavirus Budding

    Directory of Open Access Journals (Sweden)

    Shuzo Urata

    2011-01-01

    Full Text Available Several arenaviruses cause hemorrhagic fever disease in humans and pose a significant public health concern in their endemic regions. On the other hand, the prototypic arenavirus LCMV is a superb workhorse for the investigation of virus-host interactions and associated disease. The arenavirus small RING finger protein called Z has been shown to be the main driving force of virus budding. The budding activity of Z is mediated by late (L domain motifs, PT/SAP, and PPXY, located at the C-terminus of Z. This paper will present the current knowledge on arenavirus budding including the diversity of L domain motifs used by different arenaviruses. We will also discuss how improved knowledge of arenavirus budding may facilitate the development of novel antiviral strategies to combat human pathogenic arenaviruses.

  5. Microscopic Procedures for Plant Meiosis.

    Science.gov (United States)

    Braselton, James P.

    1997-01-01

    Describes laboratory techniques designed to familiarize students with meiosis and how microscopic preparations of meiosis are made. These techniques require the use of fresh or fixed flowers. Contains 18 references. (DDR)

  6. The Chromatin Protein DUET/MMD1 Controls Expression of the Meiotic Gene TDM1 during Male Meiosis in Arabidopsis.

    Science.gov (United States)

    Andreuzza, Sébastien; Nishal, Bindu; Singh, Aparna; Siddiqi, Imran

    2015-09-01

    Meiosis produces haploid cells essential for sexual reproduction. In yeast, entry into meiosis activates transcription factors which trigger a transcriptional cascade that results in sequential co-expression of early, middle and late meiotic genes. However, these factors are not conserved, and the factors and regulatory mechanisms that ensure proper meiotic gene expression in multicellular eukaryotes are poorly understood. Here, we report that DUET/MMD1, a PHD finger protein essential for Arabidopsis male meiosis, functions as a transcriptional regulator in plant meiosis. We find that DUET-PHD binds H3K4me2 in vitro, and show that this interaction is critical for function during meiosis. We also show that DUET is required for proper microtubule organization during meiosis II, independently of its function in meiosis I. Remarkably, DUET protein shows stage-specific expression, confined to diplotene. We identify two genes TDM1 and JAS with critical functions in cell cycle transitions and spindle organization in male meiosis, as DUET targets, with TDM1 being a direct target. Thus, DUET is required to regulate microtubule organization and cell cycle transitions during male meiosis, and functions as a direct transcription activator of the meiotic gene TDM1. Expression profiling showed reduced expression of a subset comprising about 12% of a known set of meiosis preferred genes in the duet mutant. Our results reveal the action of DUET as a transcriptional regulator during male meiosis in plants, and suggest that transcription of meiotic genes is under stagewise control in plants as in yeast.

  7. Arenavirus Budding

    OpenAIRE

    Urata, Shuzo; de la Torre, Juan Carlos

    2011-01-01

    Several arenaviruses cause hemorrhagic fever disease in humans and pose a significant public health concern in their endemic regions. On the other hand, the prototypic arenavirus LCMV is a superb workhorse for the investigation of virus-host interactions and associated disease. The arenavirus small RING finger protein called Z has been shown to be the main driving force of virus budding. The budding activity of Z is mediated by late (L) domain motifs, PT/SAP, and PPXY, located at the C-termin...

  8. Predicted RNA Binding Proteins Pes4 and Mip6 Regulate mRNA Levels, Translation, and Localization during Sporulation in Budding Yeast.

    Science.gov (United States)

    Jin, Liang; Zhang, Kai; Sternglanz, Rolf; Neiman, Aaron M

    2017-05-01

    In response to starvation, diploid cells of Saccharomyces cerevisiae undergo meiosis and form haploid spores, a process collectively referred to as sporulation. The differentiation into spores requires extensive changes in gene expression. The transcriptional activator Ndt80 is a central regulator of this process, which controls many genes essential for sporulation. Ndt80 induces ∼300 genes coordinately during meiotic prophase, but different mRNAs within the NDT80 regulon are translated at different times during sporulation. The protein kinase Ime2 and RNA binding protein Rim4 are general regulators of meiotic translational delay, but how differential timing of individual transcripts is achieved was not known. This report describes the characterization of two related NDT80 -induced genes, PES4 and MIP6 , encoding predicted RNA binding proteins. These genes are necessary to regulate the steady-state expression, translational timing, and localization of a set of mRNAs that are transcribed by NDT80 but not translated until the end of meiosis II. Mutations in the predicted RNA binding domains within PES4 alter the stability of target mRNAs. PES4 and MIP6 affect only a small portion of the NDT80 regulon, indicating that they act as modulators of the general Ime2/Rim4 pathway for specific transcripts. Copyright © 2017 American Society for Microbiology.

  9. Meiosis and speciation

    Indian Academy of Sciences (India)

    Meiotic analysis shows normal overall progression of meiosis in the heterozygotes, which is consistent with their normal gametogenesis. Nevertheless, both the inversion and fusion heterozygotes had undergone some alterations in the regular process of homologous synapsis, and it appeared that certain features of the ...

  10. Meiosis and SUMO

    DEFF Research Database (Denmark)

    Holm, Lærke Rebekka

    to target proteins can be catalyzed by the SUMO E3 ligase Pli1. In this study we investigate the role of Pli1 and Pmt3 during meiotic differentiation and at repetitive DNA during mitotic growth. Target proteins for Pmt3 are many; however, Pli1 has a meiosis-specic function regulating meiotic recombination...

  11. Evolutionary mysteries in meiosis.

    Science.gov (United States)

    Lenormand, Thomas; Engelstädter, Jan; Johnston, Susan E; Wijnker, Erik; Haag, Christoph R

    2016-10-19

    Meiosis is a key event of sexual life cycles in eukaryotes. Its mechanistic details have been uncovered in several model organisms, and most of its essential features have received various and often contradictory evolutionary interpretations. In this perspective, we present an overview of these often 'weird' features. We discuss the origin of meiosis (origin of ploidy reduction and recombination, two-step meiosis), its secondary modifications (in polyploids or asexuals, inverted meiosis), its importance in punctuating life cycles (meiotic arrests, epigenetic resetting, meiotic asymmetry, meiotic fairness) and features associated with recombination (disjunction constraints, heterochiasmy, crossover interference and hotspots). We present the various evolutionary scenarios and selective pressures that have been proposed to account for these features, and we highlight that their evolutionary significance often remains largely mysterious. Resolving these mysteries will likely provide decisive steps towards understanding why sex and recombination are found in the majority of eukaryotes.This article is part of the themed issue 'Weird sex: the underappreciated diversity of sexual reproduction'. © 2016 The Author(s).

  12. Evolutionary mysteries in meiosis

    NARCIS (Netherlands)

    Lenormand, Thomas; Engelstädter, Jan; Johnston, Susan E.; Wijnker, Erik; Haag, Christoph R.

    2016-01-01

    Meiosis is a key event of sexual life cycles in eukaryotes. Its mechanistic details have been uncovered in several model organisms, and most of its essential features have received various and often contradictory evolutionary interpretations. In this perspective, we present an overview of these

  13. Human female meiosis revised

    DEFF Research Database (Denmark)

    Capalbo, Antonio; Hoffmann, Eva R.; Cimadomo, Danilo

    2017-01-01

    to chromosome segregation in meiosis and mitosis. OUTCOMES Advances in genomic and imaging technologies are allowing unprecedented insight into chromosome segregation in human oocytes. This includes the identification of a novel chromosome segregation error, termed reverse segregation, as well as sister...

  14. SLC1 and SLC4 encode partially redundant acyl-coenzyme A 1-acylglycerol-3-phosphate O-acyltransferases of budding yeast

    DEFF Research Database (Denmark)

    Benghezal, Mohammed; Roubaty, Carole; Veepuri, Vijayanath

    2007-01-01

    Phosphatidic acid is the intermediate, from which all glycerophospholipids are synthesized. In yeast, it is generated from lysophosphatidic acid, which is acylated by Slc1p, an sn-2-specific, acyl-coenzyme A-dependent 1-acylglycerol-3-phosphate O-acyltransferase. Deletion of SLC1 is not lethal...

  15. Regulatory Control of the Resolution of DNA Recombination Intermediates during Meiosis and Mitosis

    OpenAIRE

    Matos, Joao; Blanco, Miguel G.; Maslen, Sarah; Skehel, J. Mark; West, Stephen C.

    2011-01-01

    The efficient and timely resolution of DNA recombination intermediates is essential for bipolar chromosome segregation. Here, we show that the specialized chromosome segregation patterns of meiosis and mitosis, which require the coordination of recombination with cell-cycle progression, are achieved by regulating the timing of activation of two crossover-promoting endonucleases. In yeast meiosis, Mus81-Mms4 and Yen1 are controlled by phosphorylation events that lead to their sequential activa...

  16. Unique geometry of sister kinetochores in human oocytes during meiosis I may explain maternal age-associated increases in chromosomal abnormalities

    Directory of Open Access Journals (Sweden)

    Jessica Patel

    2016-02-01

    Full Text Available The first meiotic division in human oocytes is highly error-prone and contributes to the uniquely high incidence of aneuploidy observed in human pregnancies. A successful meiosis I (MI division entails separation of homologous chromosome pairs and co-segregation of sister chromatids. For this to happen, sister kinetochores must form attachments to spindle kinetochore-fibres emanating from the same pole. In mouse and budding yeast, sister kinetochores remain closely associated with each other during MI, enabling them to act as a single unified structure. However, whether this arrangement also applies in human meiosis I oocytes was unclear. In this study, we perform high-resolution imaging of over 1900 kinetochores in human oocytes, to examine the geometry and architecture of the human meiotic kinetochore. We reveal that sister kinetochores in MI are not physically fused, and instead individual kinetochores within a pair are capable of forming independent attachments to spindle k-fibres. Notably, with increasing female age, the separation between kinetochores increases, suggesting a degradation of centromeric cohesion and/or changes in kinetochore architecture. Our data suggest that the differential arrangement of sister kinetochores and dual k-fibre attachments may explain the high proportion of unstable attachments that form in MI and thus indicate why human oocytes are prone to aneuploidy, particularly with increasing maternal age.

  17. Evolution of the hemiascomycete yeasts: on life styles and the importance of inbreeding.

    Science.gov (United States)

    Knop, Michael

    2006-07-01

    The term 'breeding system' is used to describe the morphological and behavioural aspects of the sexual life cycle of a species. The yeast breeding system provides three alternatives that enable hapoids to return to the diploid state that is necessary for meiosis: mating of unrelated haploids (amphimixis), mating between spores from the same tetrad (intratetrad mating, automixis) and mother daughter mating upon mating type switching (haplo-selfing). The frequency of specific mating events affects the level of heterozygosity present in individuals and the genetic diversity of populations. This review discusses the reproductive strategies of yeasts, in particular S. cerevisiae (Bakers' or budding yeast). Emphasis is put on intratetrad mating, its implication for diversity, and how the particular genome structure could have evolved to ensure the preservation of a high degree of heterozygosity in conjunction with frequent intratetrad matings. I also discuss how the ability of yeast to control the number of spores that are formed accounts for high intratetrad mating rates and for enhanced transmission of genomic variation. I extend the discussion to natural genetic variation and propose that a high level of plasticity is inherent in the yeast breeding system, which may allow variation of the breeding behaviour in accordance with the needs imposed by the environment. (c) 2006 Wiley Periodicals, Inc.

  18. Detection of Multiple Budding Yeast Cells and a Partial Sequence of 43-kDa Glycoprotein Coding Gene of Paracoccidioides brasiliensis from a Case of Lacaziosis in a Female Pacific White-Sided Dolphin (Lagenorhynchus obliquidens).

    Science.gov (United States)

    Minakawa, Tomoko; Ueda, Keiichi; Tanaka, Miyuu; Tanaka, Natsuki; Kuwamura, Mitsuru; Izawa, Takeshi; Konno, Toshihiro; Yamate, Jyoji; Itano, Eiko Nakagawa; Sano, Ayako; Wada, Shinpei

    2016-08-01

    Lacaziosis, formerly called as lobomycosis, is a zoonotic mycosis, caused by Lacazia loboi, found in humans and dolphins, and is endemic in the countries on the Atlantic Ocean, Indian Ocean and Pacific Ocean of Japanese coast. Susceptible Cetacean species include the bottlenose dolphin (Tursiops truncatus), the Indian Ocean bottlenose dolphin (T. aduncus), and the estuarine dolphin (Sotalia guianensis); however, no cases have been recorded in other Cetacean species. We diagnosed a case of Lacaziosis in a Pacific white-sided dolphin (Lagenorhynchus obliquidens) nursing in an aquarium in Japan. The dolphin was a female estimated to be more than 14 years old at the end of June 2015 and was captured in a coast of Japan Sea in 2001. Multiple, lobose, and solid granulomatous lesions with or without ulcers appeared on her jaw, back, flipper and fluke skin, in July 2014. The granulomatous skin lesions from the present case were similar to those of our previous cases. Multiple budding and chains of round yeast cells were detected in the biopsied samples. The partial sequence of 43-kDa glycoprotein coding gene confirmed by a nested PCR and sequencing, which revealed a different genotype from both Amazonian and Japanese lacaziosis in bottlenose dolphins, and was 99 % identical to those derived from Paracoccidioides brasiliensis; a sister fungal species to L. loboi. This is the first case of lacaziosis in Pacific white-sided dolphin.

  19. Phosphorylation of the Budding Yeast 9-1-1 Complex Is Required for Dpb11 Function in the Full Activation of the UV-Induced DNA Damage Checkpoint▿ †

    Science.gov (United States)

    Puddu, Fabio; Granata, Magda; Di Nola, Lisa; Balestrini, Alessia; Piergiovanni, Gabriele; Lazzaro, Federico; Giannattasio, Michele; Plevani, Paolo; Muzi-Falconi, Marco

    2008-01-01

    Following genotoxic insults, eukaryotic cells trigger a signal transduction cascade known as the DNA damage checkpoint response, which involves the loading onto DNA of an apical kinase and several downstream factors. Chromatin modifications play an important role in recruiting checkpoint proteins. In budding yeast, methylated H3-K79 is bound by the checkpoint factor Rad9. Loss of Dot1 prevents H3-K79 methylation, leading to a checkpoint defect in the G1 phase of the cell cycle and to a reduction of checkpoint activation in mitosis, suggesting that another pathway contributes to Rad9 recruitment in M phase. We found that the replication factor Dpb11 is the keystone of this second pathway. dot1Δ dpb11-1 mutant cells are sensitive to UV or Zeocin treatment and cannot activate Rad53 if irradiated in M phase. Our data suggest that Dpb11 is held in proximity to damaged DNA through an interaction with the phosphorylated 9-1-1 complex, leading to Mec1-dependent phosphorylation of Rad9. Dpb11 is also phosphorylated after DNA damage, and this modification is lost in a nonphosphorylatable ddc1-T602A mutant. Finally, we show that, in vivo, Dpb11 cooperates with Dot1 in promoting Rad9 phosphorylation but also contributes to the full activation of Mec1 kinase. PMID:18541674

  20. The histone codes for meiosis.

    Science.gov (United States)

    Wang, Lina; Xu, Zhiliang; Khawar, Muhammad Babar; Liu, Chao; Li, Wei

    2017-09-01

    Meiosis is a specialized process that produces haploid gametes from diploid cells by a single round of DNA replication followed by two successive cell divisions. It contains many special events, such as programmed DNA double-strand break (DSB) formation, homologous recombination, crossover formation and resolution. These events are associated with dynamically regulated chromosomal structures, the dynamic transcriptional regulation and chromatin remodeling are mainly modulated by histone modifications, termed 'histone codes'. The purpose of this review is to summarize the histone codes that are required for meiosis during spermatogenesis and oogenesis, involving meiosis resumption, meiotic asymmetric division and other cellular processes. We not only systematically review the functional roles of histone codes in meiosis but also discuss future trends and perspectives in this field. © 2017 Society for Reproduction and Fertility.

  1. Pch2 acts through Xrs2 and Tel1/ATM to modulate interhomolog bias and checkpoint function during meiosis.

    Directory of Open Access Journals (Sweden)

    Hsuan-Chung Ho

    2011-11-01

    Full Text Available Proper segregation of chromosomes during meiosis requires the formation and repair of double-strand breaks (DSBs to form crossovers. Repair is biased toward using the homolog as a substrate rather than the sister chromatid. Pch2 is a conserved member of the AAA(+-ATPase family of proteins and is implicated in a wide range of meiosis-specific processes including the recombination checkpoint, maturation of the chromosome axis, crossover control, and synapsis. We demonstrate a role for Pch2 in promoting and regulating interhomolog bias and the meiotic recombination checkpoint in response to unprocessed DSBs through the activation of axial proteins Hop1 and Mek1 in budding yeast. We show that Pch2 physically interacts with the putative BRCT repeats in the N-terminal region of Xrs2, a member of the MRX complex that acts at sites of unprocessed DSBs. Pch2, Xrs2, and the ATM ortholog Tel1 function in the same pathway leading to the phosphorylation of Hop1, independent of Rad17 and the ATR ortholog Mec1, which respond to the presence of single-stranded DNA. An N-terminal deletion of Xrs2 recapitulates the pch2Δ phenotypes for signaling unresected breaks. We propose that interaction with Xrs2 may enable Pch2 to remodel chromosome structure adjacent to the site of a DSB and thereby promote accessibility of Hop1 to the Tel1 kinase. In addition, Xrs2, like Pch2, is required for checkpoint-mediated delay conferred by the failure to synapse chromosomes.

  2. Oocyte Development, Meiosis and Aneuploidy

    OpenAIRE

    Maclennan, Marie; Crichton, James; Playfoot, Christopher J; Adams, Ian

    2015-01-01

    Meiosis is one of the defining events in gametogenesis. Male and female germ cells both undergo one round of meiotic cell division during their development in order to reduce the ploidy of the gametes, and thereby maintain the ploidy of the species after fertilisation. However, there are some aspects of meiosis in the female germline, such as the prolonged arrest in dictyate, that appear to predispose oocytes to missegregate their chromosomes and transmit aneuploidies to the next generation. ...

  3. The Gcn2 Regulator Yih1 Interacts with the Cyclin Dependent Kinase Cdc28 and Promotes Cell Cycle Progression through G2/M in Budding Yeast.

    Directory of Open Access Journals (Sweden)

    Richard C Silva

    Full Text Available The Saccharomyces cerevisiae protein Yih1, when overexpressed, inhibits the eIF2 alpha kinase Gcn2 by competing for Gcn1 binding. However, deletion of YIH1 has no detectable effect on Gcn2 activity, suggesting that Yih1 is not a general inhibitor of Gcn2, and has no phenotypic defect identified so far. Thus, its physiological role is largely unknown. Here, we show that Yih1 is involved in the cell cycle. Yeast lacking Yih1 displays morphological patterns and DNA content indicative of a delay in the G2/M phases of the cell cycle, and this phenotype is independent of Gcn1 and Gcn2. Accordingly, the levels of phosphorylated eIF2α, which show a cell cycle-dependent fluctuation, are not altered in cells devoid of Yih1. We present several lines of evidence indicating that Yih1 is in a complex with Cdc28. Yih1 pulls down endogenous Cdc28 in vivo and this interaction is enhanced when Cdc28 is active, suggesting that Yih1 modulates the function of Cdc28 in specific stages of the cell cycle. We also demonstrate, by Bimolecular Fluorescence Complementation, that endogenous Yih1 and Cdc28 interact with each other, confirming Yih1 as a bona fide Cdc28 binding partner. Amino acid substitutions within helix H2 of the RWD domain of Yih1 enhance Yih1-Cdc28 association. Overexpression of this mutant, but not of wild type Yih1, leads to a phenotype similar to that of YIH1 deletion, supporting the view that Yih1 is involved through Cdc28 in the regulation of the cell cycle. We further show that IMPACT, the mammalian homologue of Yih1, interacts with CDK1, the mammalian counterpart of Cdc28, indicating that the involvement with the cell cycle is conserved. Together, these data provide insights into the cellular function of Yih1/IMPACT, and provide the basis for future studies on the role of this protein in the cell cycle.

  4. Black hole meiosis

    Science.gov (United States)

    van Herck, Walter; Wyder, Thomas

    2010-04-01

    The enumeration of BPS bound states in string theory needs refinement. Studying partition functions of particles made from D-branes wrapped on algebraic Calabi-Yau 3-folds, and classifying states using split attractor flow trees, we extend the method for computing a refined BPS index, [1]. For certain D-particles, a finite number of microstates, namely polar states, exclusively realized as bound states, determine an entire partition function (elliptic genus). This underlines their crucial importance: one might call them the ‘chromosomes’ of a D-particle or a black hole. As polar states also can be affected by our refinement, previous predictions on elliptic genera are modified. This can be metaphorically interpreted as ‘crossing-over in the meiosis of a D-particle’. Our results improve on [2], provide non-trivial evidence for a strong split attractor flow tree conjecture, and thus suggest that we indeed exhaust the BPS spectrum. In the D-brane description of a bound state, the necessity for refinement results from the fact that tachyonic strings split up constituent states into ‘generic’ and ‘special’ states. These are enumerated separately by topological invariants, which turn out to be partitions of Donaldson-Thomas invariants. As modular predictions provide a check on many of our results, we have compelling evidence that our computations are correct.

  5. Multiple Duties for Spindle Assembly Checkpoint Kinases in Meiosis

    Science.gov (United States)

    Marston, Adele L.; Wassmann, Katja

    2017-01-01

    Cell division in mitosis and meiosis is governed by evolutionary highly conserved protein kinases and phosphatases, controlling the timely execution of key events such as nuclear envelope breakdown, spindle assembly, chromosome attachment to the spindle and chromosome segregation, and cell cycle exit. In mitosis, the spindle assembly checkpoint (SAC) controls the proper attachment to and alignment of chromosomes on the spindle. The SAC detects errors and induces a cell cycle arrest in metaphase, preventing chromatid separation. Once all chromosomes are properly attached, the SAC-dependent arrest is relieved and chromatids separate evenly into daughter cells. The signaling cascade leading to checkpoint arrest depends on several protein kinases that are conserved from yeast to man. In meiosis, haploid cells containing new genetic combinations are generated from a diploid cell through two specialized cell divisions. Though apparently less robust, SAC control also exists in meiosis. Recently, it has emerged that SAC kinases have additional roles in executing accurate chromosome segregation during the meiotic divisions. Here, we summarize the main differences between mitotic and meiotic cell divisions, and explain why meiotic divisions pose special challenges for correct chromosome segregation. The less-known meiotic roles of the SAC kinases are described, with a focus on two model systems: yeast and mouse oocytes. The meiotic roles of the canonical checkpoint kinases Bub1, Mps1, the pseudokinase BubR1 (Mad3), and Aurora B and C (Ipl1) will be discussed. Insights into the molecular signaling pathways that bring about the special chromosome segregation pattern during meiosis will help us understand why human oocytes are so frequently aneuploid. PMID:29322045

  6. Multiple Duties for Spindle Assembly Checkpoint Kinases in Meiosis

    Directory of Open Access Journals (Sweden)

    Adele L. Marston

    2017-12-01

    Full Text Available Cell division in mitosis and meiosis is governed by evolutionary highly conserved protein kinases and phosphatases, controlling the timely execution of key events such as nuclear envelope breakdown, spindle assembly, chromosome attachment to the spindle and chromosome segregation, and cell cycle exit. In mitosis, the spindle assembly checkpoint (SAC controls the proper attachment to and alignment of chromosomes on the spindle. The SAC detects errors and induces a cell cycle arrest in metaphase, preventing chromatid separation. Once all chromosomes are properly attached, the SAC-dependent arrest is relieved and chromatids separate evenly into daughter cells. The signaling cascade leading to checkpoint arrest depends on several protein kinases that are conserved from yeast to man. In meiosis, haploid cells containing new genetic combinations are generated from a diploid cell through two specialized cell divisions. Though apparently less robust, SAC control also exists in meiosis. Recently, it has emerged that SAC kinases have additional roles in executing accurate chromosome segregation during the meiotic divisions. Here, we summarize the main differences between mitotic and meiotic cell divisions, and explain why meiotic divisions pose special challenges for correct chromosome segregation. The less-known meiotic roles of the SAC kinases are described, with a focus on two model systems: yeast and mouse oocytes. The meiotic roles of the canonical checkpoint kinases Bub1, Mps1, the pseudokinase BubR1 (Mad3, and Aurora B and C (Ipl1 will be discussed. Insights into the molecular signaling pathways that bring about the special chromosome segregation pattern during meiosis will help us understand why human oocytes are so frequently aneuploid.

  7. Development of a Meiosis Concept Inventory

    Science.gov (United States)

    Kalas, Pamela; O'Neill, Angie; Pollock, Carol; Birol, Gulnur

    2013-01-01

    We have designed, developed, and validated a 17-question Meiosis Concept Inventory (Meiosis CI) to diagnose student misconceptions on meiosis, which is a fundamental concept in genetics. We targeted large introductory biology and genetics courses and used published methodology for question development, which included the validation of questions by…

  8. New phenotypes generated by the G57R mutation of BUD23 in Saccharomyces cerevisiae.

    Science.gov (United States)

    Lin, Jyun-Liang; Yu, Hui-Chia; Chao, Ju-Lan; Wang, Chung; Cheng, Ming-Yuan

    2012-12-01

    BUD23 in Saccharomyces cerevisiae encodes for a class I methyltransferase, and deletion of the gene results in slow growth and random budding phenotypes. Herein, two BUD23 mutants defective in methyltransferase activity were generated to investigate whether the phenotypes of the null mutant might be correlated with a loss in enzymatic activity. Expression at the physiological level of both D77A and G57R mutants was able to rescue the phenotypes of the bud23-null mutant. The result implied that the methyltransferase activity of the protein was not necessary for supporting normal growth and bud site selection of the cells. High-level expression of Bud23 (G57R), but not Bud23 or Bud23 (D77A), in BUD23 deletion cells failed to complement these phenotypes. However, just like Bud23, Bud23 (G57R) was localized in a DAPI-poor region in the nucleus. Distinct behaviour in Bud23 (G57R) could not be originated from a mislocalization of the protein. Over-expression of Bud23 (G57R) in null cells also produced changes in actin organization and additional septin mutant-like phenotypes. Therefore, the absence of Bud23, Bud23 (G57R) at a high level might affect the cell division of yeast cells through an as yet unidentified mechanism. Copyright © 2012 John Wiley & Sons, Ltd.

  9. Sexual differentiation in fission yeast

    DEFF Research Database (Denmark)

    Egel, R; Nielsen, O; Weilguny, D

    1990-01-01

    The regulation of sexual reproduction in yeast constitutes the highest level of differentiation observed in these unicellular organisms. The various ramifications of this system involve DNA rearrangement, transcriptional control, post-translational modification (such as protein phosphorylation) a......) and receptor/signal processing. A few basic similarities are common to both fission and budding yeasts. The wiring of the regulatory circuitry, however, varies considerably between these divergent yeast groups....

  10. Mining meiosis and gametogenesis with DNA microarrays.

    Science.gov (United States)

    Schlecht, Ulrich; Primig, Michael

    2003-04-01

    Gametogenesis is a key developmental process that involves complex transcriptional regulation of numerous genes including many that are conserved between unicellular eukaryotes and mammals. Recent expression-profiling experiments using microarrays have provided insight into the co-ordinated transcription of several hundred genes during mitotic growth and meiotic development in budding and fission yeast. Furthermore, microarray-based studies have identified numerous loci that are regulated during the cell cycle or expressed in a germ-cell specific manner in eukaryotic model systems like Caenorhabditis elegans, Mus musculus as well as Homo sapiens. The unprecedented amount of information produced by post-genome biology has spawned novel approaches to organizing biological knowledge using currently available information technology. This review outlines experiments that contribute to an emerging comprehensive picture of the molecular machinery governing sexual reproduction in eukaryotes.

  11. Yeast for virus research

    Science.gov (United States)

    Zhao, Richard Yuqi

    2017-01-01

    Budding yeast (Saccharomyces cerevisiae) and fission yeast (Schizosaccharomyces pombe) are two popular model organisms for virus research. They are natural hosts for viruses as they carry their own indigenous viruses. Both yeasts have been used for studies of plant, animal and human viruses. Many positive sense (+) RNA viruses and some DNA viruses replicate with various levels in yeasts, thus allowing study of those viral activities during viral life cycle. Yeasts are single cell eukaryotic organisms. Hence, many of the fundamental cellular functions such as cell cycle regulation or programed cell death are highly conserved from yeasts to higher eukaryotes. Therefore, they are particularly suited to study the impact of those viral activities on related cellular activities during virus-host interactions. Yeasts present many unique advantages in virus research over high eukaryotes. Yeast cells are easy to maintain in the laboratory with relative short doubling time. They are non-biohazardous, genetically amendable with small genomes that permit genome-wide analysis of virologic and cellular functions. In this review, similarities and differences of these two yeasts are described. Studies of virologic activities such as viral translation, viral replication and genome-wide study of virus-cell interactions in yeasts are highlighted. Impacts of viral proteins on basic cellular functions such as cell cycle regulation and programed cell death are discussed. Potential applications of using yeasts as hosts to carry out functional analysis of small viral genome and to develop high throughput drug screening platform for the discovery of antiviral drugs are presented. PMID:29082230

  12. A Comparative Study of the Cell Wall Structure of Basidiomycetous and Related Yeasts

    NARCIS (Netherlands)

    Kreger-van Rij, N.J.W.; Veenhuis, M.

    1971-01-01

    The wall of basidiomycetous and related yeasts showed a lamellar structure in sections of both budding cells and hyphae fixed with potassium permanganate. The yeasts also had a typical way of bud formation and septation. These features differ from those recorded for ascomycetous yeasts. In the

  13. Propagation of Mammalian Prions in Yeast

    National Research Council Canada - National Science Library

    Harris, David A

    2006-01-01

    ...: the budding yeast Saccharomyces cerevisiae. This unicellular organism offers a number of potential advantages for the study of prion biology, including rapid generation time, ease of culturing, and facile genetics...

  14. Analysis of meiosis regulators in human gonads

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Nielsen, John E; Jensen, Martin Blomberg

    2012-01-01

    The mitosis-meiosis switch is a key event in the differentiation of germ cells. In humans, meiosis is initiated in fetal ovaries, whereas in testes meiotic entry is inhibited until puberty. The purpose of this study was to examine the expression pattern of meiosis regulators in human gonads...... with their role in initiation and progression of meiosis. The putative meiosis inhibitors, CYP26B1 and NANOS2, were primarily expressed in Leydig cells and spermatocytes, respectively. In conclusion, the expression pattern of the investigated meiotic regulators is largely conserved in the human gonads compared...... with rodents, but with some minor differences, such as a stable expression of CYP26B1 in human fetal ovaries. The sexually dimorphic expression pattern of DMRT1 indicates a similar role in the mitosis-meiosis switch in human gonads as previously demonstrated in mice. The biological importance of the changes...

  15. Sister chromatid segregation in meiosis II

    Science.gov (United States)

    Wassmann, Katja

    2013-01-01

    Meiotic divisions (meiosis I and II) are specialized cell divisions to generate haploid gametes. The first meiotic division with the separation of chromosomes is named reductional division. The second division, which takes place immediately after meiosis I without intervening S-phase, is equational, with the separation of sister chromatids, similar to mitosis. This meiotic segregation pattern requires the two-step removal of the cohesin complex holding sister chromatids together: cohesin is removed from chromosome arms that have been subjected to homologous recombination in meiosis I and from the centromere region in meiosis II. Cohesin in the centromere region is protected from removal in meiosis I, but this protection has to be removed—deprotected”—for sister chromatid segregation in meiosis II. Whereas the mechanisms of cohesin protection are quite well understood, the mechanisms of deprotection have been largely unknown until recently. In this review I summarize our current knowledge on cohesin deprotection. PMID:23574717

  16. Chromosome segregation in plant meiosis

    Directory of Open Access Journals (Sweden)

    Linda eZamariola

    2014-06-01

    Full Text Available Faithful chromosome segregation in meiosis is essential for ploidy stability over sexual life cycles. In plants, defective chromosome segregation caused by gene mutations or other factors leads to the formation of unbalanced or unreduced gametes creating aneuploid or polyploid progeny, respectively. Accurate segregation requires the coordinated execution of conserved processes occurring throughout the two meiotic cell divisions. Synapsis and recombination ensure the establishment of chiasmata that hold homologous chromosomes together allowing their correct segregation in the first meiotic division, which is also tightly regulated by cell-cycle dependent release of cohesin and monopolar attachment of sister kinetochores to microtubules. In meiosis II, bi-orientation of sister kinetochores and proper spindle orientation correctly segregate chromosomes in four haploid cells. Checkpoint mechanisms acting at kinetochores control the accuracy of kinetochore-microtubule attachment, thus ensuring the completion of segregation. Here we review the current knowledge on the processes taking place during chromosome segregation in plant meiosis, focusing on the characterization of the molecular factors involved.

  17. What Are Taste Buds?

    Science.gov (United States)

    ... Sexual Health Food & Fitness Diseases & Conditions Infections Drugs & Alcohol School & Jobs Sports Expert Answers (Q&A) Staying Safe Videos for Educators Search English Español What Are Taste Buds? KidsHealth / For Kids / What Are Taste Buds? ...

  18. Meiosis-Specific Loading of the Centromere-Specific Histone CENH3 in Arabidopsis thaliana

    Science.gov (United States)

    Ravi, Maruthachalam; Shibata, Fukashi; Ramahi, Joseph S.; Nagaki, Kiyotaka; Chen, Changbin; Murata, Minoru; Chan, Simon W. L.

    2011-01-01

    Centromere behavior is specialized in meiosis I, so that sister chromatids of homologous chromosomes are pulled toward the same side of the spindle (through kinetochore mono-orientation) and chromosome number is reduced. Factors required for mono-orientation have been identified in yeast. However, comparatively little is known about how meiotic centromere behavior is specialized in animals and plants that typically have large tandem repeat centromeres. Kinetochores are nucleated by the centromere-specific histone CENH3. Unlike conventional histone H3s, CENH3 is rapidly evolving, particularly in its N-terminal tail domain. Here we describe chimeric variants of CENH3 with alterations in the N-terminal tail that are specifically defective in meiosis. Arabidopsis thaliana cenh3 mutants expressing a GFP-tagged chimeric protein containing the H3 N-terminal tail and the CENH3 C-terminus (termed GFP-tailswap) are sterile because of random meiotic chromosome segregation. These defects result from the specific depletion of GFP-tailswap protein from meiotic kinetochores, which contrasts with its normal localization in mitotic cells. Loss of the GFP-tailswap CENH3 variant in meiosis affects recruitment of the essential kinetochore protein MIS12. Our findings suggest that CENH3 loading dynamics might be regulated differently in mitosis and meiosis. As further support for our hypothesis, we show that GFP-tailswap protein is recruited back to centromeres in a subset of pollen grains in GFP-tailswap once they resume haploid mitosis. Meiotic recruitment of the GFP-tailswap CENH3 variant is not restored by removal of the meiosis-specific cohesin subunit REC8. Our results reveal the existence of a specialized loading pathway for CENH3 during meiosis that is likely to involve the hypervariable N-terminal tail. Meiosis-specific CENH3 dynamics may play a role in modulating meiotic centromere behavior. PMID:21695238

  19. An essential role for trimethylguanosine RNA caps in Saccharomyces cerevisiae meiosis and their requirement for splicing of SAE3 and PCH2 meiotic pre-mRNAs.

    Science.gov (United States)

    Qiu, Zhicheng R; Shuman, Stewart; Schwer, Beate

    2011-07-01

    Tgs1 is the enzyme that converts m(7)G RNA caps to the 2,2,7-trimethylguanosine (TMG) caps characteristic of spliceosomal snRNAs. Fungi grow vegetatively without TMG caps, thereby raising the question of what cellular transactions, if any, are TMG cap-dependent. Here, we report that Saccharomyces cerevisiae Tgs1 methyltransferase activity is essential for meiosis. tgs1Δ cells are specifically defective in splicing PCH2 and SAE3 meiotic pre-mRNAs. The TMG requirement for SAE3 splicing is alleviated by two intron mutations: a UAUUAAC to UACUAAC change that restores a consensus branchpoint and disruption of a stem-loop encompassing the branchpoint. The TMG requirement for PCH2 splicing is alleviated by a CACUAAC to UACUAAC change restoring a consensus branchpoint and by shortening the PCH2 5' exon. Placing the SAE3 and PCH2 introns within a HIS3 reporter confers Tgs1-dependent histidine prototrophy, signifying that the respective introns are portable determinants of TMG-dependent gene expression. Analysis of in vitro splicing in extracts of TGS1 versus tgs1Δ cells showed that SAE3 intron removal was enfeebled without TMG caps, whereas splicing of ACT1 was unaffected. Our findings illuminate a new mode of tunable splicing, a reliance on TMG caps for an essential developmental RNA transaction, and three genetically distinct meiotic splicing regulons in budding yeast.

  20. Two-step activation of meiosis by the mat1 locus in Schizosaccharomyces pombe

    DEFF Research Database (Denmark)

    Willer, M; Hoffmann, Ulla-Lisbeth; Styrkársdóttir, U

    1995-01-01

    in which the mat1 locus plays two roles in controlling meiosis. In the first instance, the mat1-Pc and mat1-Mc functions are required to produce the mating pheromones and receptors that allow the generation of a pheromone signal. This signal is required to induce the expression of mat1-Pm and mat1-Mm......The mat1 locus is a key regulator of both conjugation and meiosis in the fission yeast Schizosaccharomyces pombe. Two alternative DNA segments of this locus, mat1-P and mat1-M, specify the haploid cell types (Plus and Minus). Each segment includes two genes: mat1-P includes mat1-Pc and mat1-Pm....... This appears to be the major pheromone-dependent step in controlling meiosis since ectopic expression of these genes allows meiosis in the absence of mat1-Pc and mat1-Mc. The mat1-Pm and mat1-Mm products complete the initiation of meiosis by activating transcription of the mei3 gene....

  1. Yeast replicative aging: a paradigm for defining conserved longevity interventions

    OpenAIRE

    Wasko, Brian M.; Kaeberlein, Matt

    2013-01-01

    The finite replicative life span of budding yeast mother cells was demonstrated as early as 1959, but the idea that budding yeast could be used to model aging of multicellular eukaryotes did not enter the scientific mainstream until relatively recently. Despite continued skepticism by some, there are now abundant data that several interventions capable of extending yeast replicative life span have a similar effect in multicellular eukaryotes including nematode worms, fruit flies, and rodents....

  2. Large-scale functional genomic analysis of sporulation and meiosis in Saccharomyces cerevisiae.

    OpenAIRE

    Enyenihi, Akon H; Saunders, William S

    2003-01-01

    We have used a single-gene deletion mutant bank to identify the genes required for meiosis and sporulation among 4323 nonessential Saccharomyces cerevisiae annotated open reading frames (ORFs). Three hundred thirty-four sporulation-essential genes were identified, including 78 novel ORFs and 115 known genes without previously described sporulation defects in the comprehensive Saccharomyces Genome (SGD) or Yeast Proteome (YPD) phenotype databases. We have further divided the uncharacterized sp...

  3. Meiosis.

    Science.gov (United States)

    Henderson, Paula

    This autoinstructional lesson deals with the study of cytology (or cells) with emphasis placed on cell reproduction. Knowledge of the structure of the DNA molecule and of the stages of mitotic cell division are considered prerequisites for this lesson. Approximately 15 minutes is the established time set for the activity. The behavioral objectives…

  4. Forskolin and the meiosis inducing substance synergistically initiate meiosis in fetal male germ cells

    DEFF Research Database (Denmark)

    Byskov, A G; Fenger, M; Westergaard, L

    1993-01-01

    We have shown that Meiosis Inducing Substance (MIS) and forskolin synergistically and dose dependently induce meiosis in germ cells of cultured fetal mouse testes. We used a bioassay which consists of fetal mouse testes and ovaries cultured for 6 days. In this study MIS media are spent culture...... are fixed, squashed, and DNA-stained. In these preparations germ cells and somatic cells can be distinguished, and the number of germ cells in the different stages of meiosis is counted as is the number of somatic cells in mitosis. MIS activity is defined to be present in a medium when meiosis is induced...... in male germ cells during culture. We found that MIS media as well as forskolin induced meiosis in fetal male germ cells in a dose-dependent manner. In addition, MIS media and forskolin acted synergistically by inducing meiosis. Female germ cells seem to be unaffected by the various culture media...

  5. Tradescantia: A Tool for Teaching Meiosis.

    Science.gov (United States)

    Hammersmith, Robert L.; Mertens, Thomas R.

    1997-01-01

    Describes a procedure for making slides of microsporogenesis in Tradescantia. Uses photographs to demonstrate that Tradescantia is an ideal organism for studying meiosis in the classroom. Contains 17 references. (JRH)

  6. The roles of the catalytic and noncatalytic activities of Rpd3L and Rpd3S in the regulation of gene transcription in yeast.

    Directory of Open Access Journals (Sweden)

    Daniella Yeheskely-Hayon

    Full Text Available In budding yeasts, the histone deacetylase Rpd3 resides in two different complexes called Rpd3L (large and Rpd3S (small that exert opposing effects on the transcription of meiosis-specific genes. By introducing mutations that disrupt the integrity and function of either Rpd3L or Rpd3S, we show here that Rpd3 function is determined by its association with either of these complexes. Specifically, the catalytic activity of Rpd3S activates the transcription of the two major positive regulators of meiosis, IME1 and IME2, under all growth conditions and activates the transcription of NDT80 only during vegetative growth. In contrast, the effects of Rpd3L depends on nutrients; it represses or activates transcription in the presence or absence of a nitrogen source, respectively. Further, we show that transcriptional activation does not correlate with histone H4 deacetylation, suggesting an effect on a nonhistone protein. Comparison of rpd3-null and catalytic-site point mutants revealed an inhibitory activity that is independent of either the catalytic activity of Rpd3 or the integrity of Rpd3L and Rpd3S.

  7. The Roles of the Catalytic and Noncatalytic Activities of Rpd3L and Rpd3S in the Regulation of Gene Transcription in Yeast

    Science.gov (United States)

    Yeheskely-Hayon, Daniella; Kotler, Anat; Stark, Michal; Hashimshony, Tamar; Sagee, Shira; Kassir, Yona

    2013-01-01

    In budding yeasts, the histone deacetylase Rpd3 resides in two different complexes called Rpd3L (large) and Rpd3S (small) that exert opposing effects on the transcription of meiosis-specific genes. By introducing mutations that disrupt the integrity and function of either Rpd3L or Rpd3S, we show here that Rpd3 function is determined by its association with either of these complexes. Specifically, the catalytic activity of Rpd3S activates the transcription of the two major positive regulators of meiosis, IME1 and IME2, under all growth conditions and activates the transcription of NDT80 only during vegetative growth. In contrast, the effects of Rpd3L depends on nutrients; it represses or activates transcription in the presence or absence of a nitrogen source, respectively. Further, we show that transcriptional activation does not correlate with histone H4 deacetylation, suggesting an effect on a nonhistone protein. Comparison of rpd3-null and catalytic-site point mutants revealed an inhibitory activity that is independent of either the catalytic activity of Rpd3 or the integrity of Rpd3L and Rpd3S. PMID:24358376

  8. Meikin-associated polo-like kinase specifies Bub1 distribution in meiosis I.

    Science.gov (United States)

    Miyazaki, Seira; Kim, Jihye; Yamagishi, Yuya; Ishiguro, Tadashi; Okada, Yuki; Tanno, Yuji; Sakuno, Takeshi; Watanabe, Yoshinori

    2017-06-01

    In meiosis I, sister chromatids are captured by microtubules emanating from the same pole (mono-orientation), and centromeric cohesion is protected throughout anaphase. Shugoshin, which is localized to centromeres depending on the phosphorylation of histone H2A by Bub1 kinase, plays a central role in protecting meiotic cohesin Rec8 from separase cleavage. Another key meiotic kinetochore factor, meikin, may regulate cohesion protection, although the underlying molecular mechanisms remain elusive. Here, we show that fission yeast Moa1 (meikin), which associates stably with CENP-C during meiosis I, recruits Plo1 (polo-like kinase) to the kinetochores and phosphorylates Spc7 (KNL1) to accumulate Bub1. Consequently, in contrast to the transient kinetochore localization of mitotic Bub1, meiotic Bub1 persists at kinetochores until anaphase I. The meiotic Bub1 pool ensures robust Sgo1 (shugoshin) localization and cohesion protection at centromeres by cooperating with heterochromatin protein Swi6, which binds and stabilizes Sgo1. Furthermore, molecular genetic analyses show a hierarchical regulation of centromeric cohesion protection by meikin and shugoshin that is important for establishing meiosis-specific chromosome segregation. We provide evidence that the meiosis-specific Bub1 regulation is conserved in mouse. © 2017 Molecular Biology Society of Japan and John Wiley & Sons Australia, Ltd.

  9. Axillary bud development in chrysanthemum

    NARCIS (Netherlands)

    Ruiter, de H.A.

    1996-01-01


    Each chrysanthemum cutting originates from an axillary bud. For an improvement of the cultivation of cuttings or more specific their quality, it is necessary that the development of an axillary bud can be controlled as good as possible. Axillary bud development can be distinguished into

  10. Inter-homolog crossing-over and synapsis in Arabidopsis meiosis are dependent on the chromosome axis protein AtASY3.

    Directory of Open Access Journals (Sweden)

    Maheen Ferdous

    2012-02-01

    Full Text Available In this study we have analysed AtASY3, a coiled-coil domain protein that is required for normal meiosis in Arabidopsis. Analysis of an Atasy3-1 mutant reveals that loss of the protein compromises chromosome axis formation and results in reduced numbers of meiotic crossovers (COs. Although the frequency of DNA double-strand breaks (DSBs appears moderately reduced in Atasy3-1, the main recombination defect is a reduction in the formation of COs. Immunolocalization studies in wild-type meiocytes indicate that the HORMA protein AtASY1, which is related to Hop1 in budding yeast, forms hyper-abundant domains along the chromosomes that are spatially associated with DSBs and early recombination pathway proteins. Loss of AtASY3 disrupts the axial organization of AtASY1. Furthermore we show that the AtASY3 and AtASY1 homologs BoASY3 and BoASY1, from the closely related species Brassica oleracea, are co-immunoprecipitated from meiocyte extracts and that AtASY3 interacts with AtASY1 via residues in its predicted coiled-coil domain. Together our results suggest that AtASY3 is a functional homolog of Red1. Since studies in budding yeast indicate that Red1 and Hop1 play a key role in establishing a bias to favor inter-homolog recombination (IHR, we propose that AtASY3 and AtASY1 may have a similar role in Arabidopsis. Loss of AtASY3 also disrupts synaptonemal complex (SC formation. In Atasy3-1 the transverse filament protein AtZYP1 forms small patches rather than a continuous SC. The few AtMLH1 foci that remain in Atasy3-1 are found in association with the AtZYP1 patches. This is sufficient to prevent the ectopic recombination observed in the absence of AtZYP1, thus emphasizing that in addition to its structural role the protein is important for CO formation.

  11. Assessing Understanding of Biological Processes: Elucidating Students' Models of Meiosis.

    Science.gov (United States)

    Kindfield, Ann C.

    1994-01-01

    Presents a meiosis reasoning problem that provides direct access to students' current models of chromosomes and meiosis. Also included in the article are tips for classroom implementation and a summary of the solution evaluation. (ZWH)

  12. Microarray expression analysis of meiosis and microsporogenesis in hexaploid bread wheat

    Directory of Open Access Journals (Sweden)

    Langridge Peter

    2006-10-01

    Full Text Available Abstract Background Our understanding of the mechanisms that govern the cellular process of meiosis is limited in higher plants with polyploid genomes. Bread wheat is an allohexaploid that behaves as a diploid during meiosis. Chromosome pairing is restricted to homologous chromosomes despite the presence of homoeologues in the nucleus. The importance of wheat as a crop and the extensive use of wild wheat relatives in breeding programs has prompted many years of cytogenetic and genetic research to develop an understanding of the control of chromosome pairing and recombination. The rapid advance of biochemical and molecular information on meiosis in model organisms such as yeast provides new opportunities to investigate the molecular basis of chromosome pairing control in wheat. However, building the link between the model and wheat requires points of data contact. Results We report here a large-scale transcriptomics study using the Affymetrix wheat GeneChip® aimed at providing this link between wheat and model systems and at identifying early meiotic genes. Analysis of the microarray data identified 1,350 transcripts temporally-regulated during the early stages of meiosis. Expression profiles with annotated transcript functions including chromatin condensation, synaptonemal complex formation, recombination and fertility were identified. From the 1,350 transcripts, 30 displayed at least an eight-fold expression change between and including pre-meiosis and telophase II, with more than 50% of these having no similarities to known sequences in NCBI and TIGR databases. Conclusion This resource is now available to support research into the molecular basis of pairing and recombination control in the complex polyploid, wheat.

  13. High School Students' Use of Meiosis When Solving Genetics Problems.

    Science.gov (United States)

    Wynne, Cynthia F.; Stewart, Jim; Passmore, Cindy

    2001-01-01

    Paints a different picture of students' reasoning with meiosis as they solved complex, computer-generated genetics problems, some of which required them to revise their understanding of meiosis in response to anomalous data. Students were able to develop a rich understanding of meiosis and can utilize that knowledge to solve genetics problems.…

  14. Cis-Acting Determinants Affecting Centromere Function, Sister-Chromatid Cohesion and Reciprocal Recombination during Meiosis in Saccharomyces Cerevisiae

    OpenAIRE

    Sears, D. D.; Hegemann, J. H.; Shero, J. H.; Hieter, P.

    1995-01-01

    We have employed a system that utilizes homologous pairs of human DNA-derived yeast artificial chromosomes (YACs) as marker chromosomes to assess the specific role (s) of conserved centromere DNA elements (CDEI, CDEII and CDEIII) in meiotic chromosome disjunction fidelity. Thirteen different centromere (CEN) mutations were tested for their effects on meiotic centromere function. YACs containing a wild-type CEN DNA sequence segregate with high fidelity in meiosis I (99% normal segregation) and...

  15. The final cut: cell polarity meets cytokinesis at the bud neck in S. cerevisiae.

    Science.gov (United States)

    Juanes, Maria Angeles; Piatti, Simonetta

    2016-08-01

    Cell division is a fundamental but complex process that gives rise to two daughter cells. It includes an ordered set of events, altogether called "the cell cycle", that culminate with cytokinesis, the final stage of mitosis leading to the physical separation of the two daughter cells. Symmetric cell division equally partitions cellular components between the two daughter cells, which are therefore identical to one another and often share the same fate. In many cases, however, cell division is asymmetrical and generates two daughter cells that differ in specific protein inheritance, cell size, or developmental potential. The budding yeast Saccharomyces cerevisiae has proven to be an excellent system to investigate the molecular mechanisms governing asymmetric cell division and cytokinesis. Budding yeast is highly polarized during the cell cycle and divides asymmetrically, producing two cells with distinct sizes and fates. Many components of the machinery establishing cell polarization during budding are relocalized to the division site (i.e., the bud neck) for cytokinesis. In this review we recapitulate how budding yeast cells undergo polarized processes at the bud neck for cell division.

  16. Meiosis: An Overview of Key Differences from Mitosis

    Science.gov (United States)

    Ohkura, Hiroyuki

    2015-01-01

    Meiosis is the specialized cell division that generates gametes. In contrast to mitosis, molecular mechanisms and regulation of meiosis are much less understood. Meiosis shares mechanisms and regulation with mitosis in many aspects, but also has critical differences from mitosis. This review highlights these differences between meiosis and mitosis. Recent studies using various model systems revealed differences in a surprisingly wide range of aspects, including cell-cycle regulation, recombination, postrecombination events, spindle assembly, chromosome–spindle interaction, and chromosome segregation. Although a great degree of diversity can be found among organisms, meiosis-specific processes, and regulation are generally conserved. PMID:25605710

  17. Preferential inclusion of extrachromosomal genetic elements in yeast meiotic spores.

    Science.gov (United States)

    Brewer, B J; Fangman, W L

    1980-09-01

    During meiosis and sporulation in the yeast Saccharomyces cerevisiae, extrachromosomal traits are efficiently transmitted to haploid spores. Although the pattern of inheritance of chromosomal traits reflects the mechanism of regular chromosomal segregation in meiosis, it is not known what processes are reflected by the efficient inheritance of extrachromosomal traits. Because extrachromosomal genetic elements in yeast are present in multiple copies, perpetuation of an extrachromosomal trait could occur by the passive envelopment of a subset of copies or by an active sequestering of all or a subset of copies within the four spores. We show that only subsets of the four extrachromosomal nucleic acids commonly found in yeast are transmitted through meiosis--55% of mitochondrial DNA copies, 82% of the 2-micron DNA plasmids, and about 70% of the L and M double-stranded RNAs. However, electron micrographs of serial sections through yeast asci indicate that the four spore enclose only 30% of the total ascus material. Thus these extrachromosomal elements are preferentially included within the spores, indicating that their inheritance is not a random process. Transmission of mitochondrial DNA can be accounted for by the observed enclosure of 52% of the mitochondrial volume within the spores. The high transmission frequencies of the double-stranded RNAs (which exist as virus-like particles in the cytoplasm) and 2-micron DNA must indicate that either these nucleic acids are actively recruited from the cytoplasm by some mechanism or they are associated in some way with the nucleus during meiosis.

  18. The transcriptome landscape of early maize meiosis

    Science.gov (United States)

    Meiosis, particularly meiotic recombination, is a major factor affecting yield and breeding of plants. To gain insight into the transcriptome landscape during early initiation steps of meiotic recombination, we profiled early prophase I meiocytes from maize using RNA-seq. Our analyses of genes prefe...

  19. Cuf2 Is a Novel Meiosis-Specific Regulatory Factor of Meiosis Maturation

    Science.gov (United States)

    Ioannoni, Raphael; Beaudoin, Jude; Lopez-Maury, Luis; Codlin, Sandra; Bahler, Jurg; Labbe, Simon

    2012-01-01

    Background Meiosis is the specialized form of the cell cycle by which diploid cells produce the haploid gametes required for sexual reproduction. Initiation and progression through meiosis requires that the expression of the meiotic genes is precisely controlled so as to provide the correct gene products at the correct times. During meiosis, four temporal gene clusters are either induced or repressed by a cascade of transcription factors. Principal Findings In this report a novel copper-fist-type regulator, Cuf2, is shown to be expressed exclusively during meiosis. The expression profile of the cuf2+ mRNA revealed that it was induced during middle-phase meiosis. Both cuf2+ mRNA and protein levels are unregulated by copper addition or starvation. The transcription of cuf2+ required the presence of a functional mei4+ gene encoding a key transcription factor that activates the expression of numerous middle meiotic genes. Microscopic analyses of cells expressing a functional Cuf2-GFP protein revealed that Cuf2 co-localized with both homologous chromosomes and sister chromatids during the meiotic divisions. Cells lacking Cuf2 showed an elevated and sustained expression of several of the middle meiotic genes that persisted even during late meiosis. Moreover, cells carrying disrupted cuf2Δ/cuf2Δ alleles displayed an abnormal morphology of the forespore membranes and a dramatic reduction of spore viability. Significance Collectively, the results revealed that Cuf2 functions in the timely repression of the middle-phase genes during meiotic differentiation. PMID:22558440

  20. Axillary bud development in rose

    NARCIS (Netherlands)

    Marcelis - van Acker, C.A.M.

    1994-01-01

    Axillary buds form the basis of flower production of a rose crop. Within a rose crop there exists an undesired large variation in shoot number and size, which affects flower yield. Part of this variation may be traced back to early variation in axillary buds. The aim of the research

  1. Fission yeast mating-type switching: programmed damage and repair

    DEFF Research Database (Denmark)

    Egel, Richard

    2005-01-01

    Mating-type switching in fission yeast follows similar rules as in budding yeast, but the underlying mechanisms are entirely different. Whilst the initiating double-strand cut in Saccharomyces cerevisiae requires recombinational repair for survival, the initial damage in Schizosaccharomyces pombe...

  2. Transcriptional Waves in the Yeast Cell Cycle

    OpenAIRE

    Oliva, Anna; Rosebrock, Adam; Ferrezuelo, Francisco; Pyne, Saumyadipta; Chen, Haiying; Skiena, Steve; Futcher, Bruce; Leatherwood, Janet

    2005-01-01

    Many genes are regulated as an innate part of the eukaryotic cell cycle, and a complex transcriptional network helps enable the cyclic behavior of dividing cells. This transcriptional network has been studied in Saccharomyces cerevisiae (budding yeast) and elsewhere. To provide more perspective on these regulatory mechanisms, we have used microarrays to measure gene expression through the cell cycle of Schizosaccharomyces pombe (fission yeast). The 750 genes with the most significant oscillat...

  3. Simultaneous production of buds on mother and daughter cells of Saccharomyces cerevisiae in the presence of hydroxyurea

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, K; Michio, I

    1979-12-01

    Individual budding yeast cells, Saccharomyces cerevisiae, enclosed in small culture chambers were observed through two budding cycles to examine their behavior during growth and division. In the nutrient medium (YHG medium), the duration of the budding cycles was 77 minutes for mother cells and 90 minutes for daughter cells. Continuous exposure of cells to 16 or 32 mm hydroxyurea extended the duration of the cycles and increased the volume of cells, resulting in the formation of abnormally large and equal-sized mother-daughter pairs. Each cell of these pairs subsequently produced buds simultaneously. Stained cell nuclei showed simultaneous nuclear division. This synchronous budding on mother-daughter pairs was repeated in the next budding cycle. The coordination of growth with division is discussed in relation to these results.

  4. Protein patterns of yeast during sporulation

    International Nuclear Information System (INIS)

    Litske Petersen, J.G.; Kielland-Brandt, M.C.; Nilsson-Tillgren, T.

    1979-01-01

    High resolution two-dimensional gel electrophoresis was used to study protein synthesis during synchronous meiosis and ascospore formation of Saccharomyces cerevisiae. The stained protein patterns of samples harvested at any stage between meiotic prophase and the four-spore stage in two sporulating strains showed the same approximately 250 polypeptides. Of these only a few seemed to increase or decrease in concentration during sporulation. The characteristic pattern of sporulating yeast was identical to the pattern of glucose-grown staitonary yeast cells adapted to respiration. The latter type of cells readily initiates meiosis when transferred to sporulation medium. This pattern differed from the protein patterns of exponentially growing cells in glucose or acetate presporulation medium. Five major proteins in stationary and sporulating yeast cells were not detected in either type of exponential culture. Two-dimensional autoradiograms of [ 35 S]methionine-labelled yeast proteins revealed that some proteins were preferentially labelled during sporulation, while other proteins were labelled at later stages. These patterns differed from the auroradiograms of exponentially growing yeast cells in glucose presporulation medium in a number of spots. No differences were observed when stained gels or autoradiograms of sporulating cultures and non-sporulating strains in sporulation medium were compared. (author)

  5. New vectors in fission yeast: application for cloning the his2 gene

    DEFF Research Database (Denmark)

    Weilguny, D; Praetorius, M; Carr, Alan

    1991-01-01

    of transforming Sc. pombe ura4 strains, as well as ura 3 strains of the distantly related budding yeast Saccharomyces cerevisiae. We have used pON163 for the construction of two fission yeast genomic libraries. From these gene banks clones were isolated that were able to complement fission yeast his2 mutants...

  6. ESCRT-independent budding of HIV-1 gag virus-like particles from Saccharomyces cerevisiae spheroplasts.

    Directory of Open Access Journals (Sweden)

    Andrew P Norgan

    Full Text Available Heterologous expression of HIV-1 Gag in a variety of host cells results in its packaging into virus-like particles (VLPs that are subsequently released into the extracellular milieu. This phenomenon represents a useful tool for probing cellular factors required for viral budding and has contributed to the discovery of roles for ubiquitin ligases and the endosomal sorting complexes required for transport (ESCRTs in viral budding. These factors are highly conserved throughout eukaryotes and have been studied extensively in the yeast Saccharomyces cerevisiae, a model eukaryote previously utilized as a host for the production of VLPs. We used heterologous expression of HIV Gag in yeast spheroplasts to examine the role of ESCRTs and associated factors (Rsp5, a HECT ubiquitin ligase of the Nedd4 family; Bro1, a homolog of Alix; and Vps4, the AAA-ATPase required for ESCRT function in all contexts/organisms investigated in the generation of VLPs. Our data reveal: 1 characterized Gag-ESCRT interaction motifs (late domains are not required for VLP budding, 2 loss of function alleles of the essential HECT ubiquitin ligase Rsp5 do not display defects in VLP formation, and 3 ESCRT function is not required for VLP formation from spheroplasts. These results suggest that the egress of HIV Gag from yeast cells is distinct from the most commonly described mode of exit from mammalian cells, instead mimicking ESCRT-independent VLP formation observed in a subset of mammalian cells. As such, budding of Gag from yeast cells appears to represent ESCRT-independent budding relevant to viral replication in at least some situations. Thus the myriad of genetic and biochemical tools available in the yeast system may be of utility in the study of this aspect of viral budding.

  7. Conservation and Variability of Meiosis Across the Eukaryotes.

    Science.gov (United States)

    Loidl, Josef

    2016-11-23

    Comparisons among a variety of eukaryotes have revealed considerable variability in the structures and processes involved in their meiosis. Nevertheless, conventional forms of meiosis occur in all major groups of eukaryotes, including early-branching protists. This finding confirms that meiosis originated in the common ancestor of all eukaryotes and suggests that primordial meiosis may have had many characteristics in common with conventional extant meiosis. However, it is possible that the synaptonemal complex and the delicate crossover control related to its presence were later acquisitions. Later still, modifications to meiotic processes occurred within different groups of eukaryotes. Better knowledge on the spectrum of derived and uncommon forms of meiosis will improve our understanding of many still mysterious aspects of the meiotic process and help to explain the evolutionary basis of functional adaptations to the meiotic program.

  8. True polyploid meiosis in the human male.

    Science.gov (United States)

    Pearson, Peter L; Madan, Kamlesh

    2018-05-21

    Polyploidy does not usually occur in germinal cells of mammals and other higher vertebrates. We describe a unique example of mosaic autotetraploidy in the meiosis of a human male. Although the original observations were made in the late 1960s, we did not publish them at that time, because we expected to detect further examples that could be described together. However, this did not occur and we have now decided to make the observations available to demonstrate that polyploidy in mammalian male meiosis can arise at a higher frequency than expected by random polyploidization of individual meiotic cells, by either DNA duplication or cell fusion prior to synapsis. This is the first description of a population of primary spermatocytes exhibiting multivalent formation at leptotene /diakinesis in human spermatogenesis, with ring, chain, frying pan and other types of quadrivalents, typical of autotetraploidy. As many of the polyploid configurations showed apoptotic breakdown, it is likely that diploid and/or aneuploid spermatozoa would have rarely or never resulted from this mosaic autotetraploid meiosis.

  9. Meiosis in hematological malignancies. In situ cytogenetic morphology

    OpenAIRE

    Logothetou-Rella, H.

    1996-01-01

    This is the first study on the in situ cytogenetic morphology and analysis of malignant bone marrow cells, growing attached on a culture vessel surface. It was documented that bone marrow cells, in different types of hematological malignancies, divide by meiosis giving rise to a non-repetitive aneuploidy. Male and female gametes are formed by meiosis and fertilization occurs in a life cycle of: Fertilization Meiosis Gametes - Embryo - Gametes Immature a...

  10. Taste bud cells and nerves

    OpenAIRE

    武田,正子/内田,暢彦/鈴木,裕子; タケダ,マサコ/ウチダ,ノブヒコ/スズキ,ユウコ; TAKEDA,Masako/UCHIDA,Nobuhiko/SUZUKI,Yuko

    2002-01-01

    Sectioning of glossopharyngeal nerves which innervate the taste buds in the circumvallate papillae caused apoptosis of taste buds, the numbers decreasing and the taste buds disappearing after 11 days. This indicates that gustatory nerves may release a trophic substance that induces and maintains taste buds. Taste bud cells contain neurotrophins, NCAM, NSE, PGP9.5, and NeuroD which are specific markers of neurons. The BDNF and GDNF of neurotrophins, and Trk B and GFRαl of their receptors were ...

  11. The yeast replicative aging model.

    Science.gov (United States)

    He, Chong; Zhou, Chuankai; Kennedy, Brian K

    2018-03-08

    It has been nearly three decades since the budding yeast Saccharomyces cerevisiae became a significant model organism for aging research and it has emerged as both simple and powerful. The replicative aging assay, which interrogates the number of times a "mother" cell can divide and produce "daughters", has been a stalwart in these studies, and genetic approaches have led to the identification of hundreds of genes impacting lifespan. More recently, cell biological and biochemical approaches have been developed to determine how cellular processes become altered with age. Together, the tools are in place to develop a holistic view of aging in this single-celled organism. Here, we summarize the current state of understanding of yeast replicative aging with a focus on the recent studies that shed new light on how aging pathways interact to modulate lifespan in yeast. Copyright © 2018. Published by Elsevier B.V.

  12. H2B ubiquitination: Conserved molecular mechanism, diverse physiologic functions of the E3 ligase during meiosis.

    Science.gov (United States)

    Wang, Liying; Cao, Chunwei; Wang, Fang; Zhao, Jianguo; Li, Wei

    2017-09-03

    RNF20/Bre1 mediated H2B ubiquitination (H2Bub) has various physiologic functions. Recently, we found that H2Bub participates in meiotic recombination by promoting chromatin relaxation during meiosis. We then analyzed the phylogenetic relationships among the E3 ligase for H2Bub, its E2 Rad6 and their partner WW domain-containing adaptor with a coiled-coil (WAC) or Lge1, and found that the molecular mechanism underlying H2Bub is evolutionarily conserved from yeast to mammals. However, RNF20 has diverse physiologic functions in different organisms, which might be caused by the evolutionary divergency of their domain/motif architectures. In the current extra view, we not only elucidate the evolutionarily conserved molecular mechanism underlying H2Bub, but also discuss the diverse physiologic functions of RNF20 during meiosis.

  13. Replication and meiotic transmission of yeast ribosomal RNA genes.

    Science.gov (United States)

    Brewer, B J; Zakian, V A; Fangman, W L

    1980-11-01

    The yeast Saccharomyces cerevisiae has approximately 120 genes for the ribosomal RNAs (rDNA) which are organized in tandem within chromosomal DNA. These multiple-copy genes are homogeneous in sequence but can undergo changes in copy number and topology. To determine if these changes reflect unusual features of rDNA metabolism, we have examined both the replication of rDNA in the mitotic cell cycle and the inheritance of rDNA during meiosis. The results indicate that rDNA behaves identically to chromosomal DNA: each rDNA unit is replicated once during the S phase of each cell cycle and each unit is conserved through meiosis. Therefore, the flexibility in copy number and topology of rDNA does not arise from the selective replication of units in each S phase nor by the selective inheritance of units in meiosis.

  14. Biotechnological Applications of Dimorphic Yeasts

    Science.gov (United States)

    Doiphode, N.; Joshi, C.; Ghormade, V.; Deshpande, M. V.

    The dimorphic yeasts have the equilibrium between spherical growth (budding) and polarized (hyphal or pseudohyphal tip elongation) which can be triggered by change in the environmental conditions. The reversible growth phenomenon has made dimorphic yeasts as an useful model to understand fungal evolution and fungal differentiation, in general. In nature dimorphism is clearly evident in plant and animal fungal pathogens, which survive and most importantly proliferate in the respective hosts. However, number of organisms with no known pathogenic behaviour also show such a transition, which can be exploited for the technological applications due to their different biochemical make up under different morphologies. For instance, chitin and chitosan production using dimorphic Saccharomyces, Mucor, Rhizopus and Benjaminiella, oil degradation and biotransformation with yeast-form of Yarrowia species, bioremediation of organic pollutants, exopolysac-charide production by yeast-phase of Aureobasidium pullulans, to name a few. Myrothecium verrucaria can be used for seed dressing in its yeast form and it produces a mycolytic enzyme complex in its hyphal-form for the biocontrol of fungal pathogens, while Beauveria bassiana and other entomopathogens kill the insect pest by producing yeast- like cells in the insect body. The form-specific expression of protease, chitinase, lipase, ornithine decarboxylase, glutamate dehydrogenases, etc. make Benjaminiella poitrasii, Basidiobolus sp., and Mucor rouxii strains important in bioremediation, nanobiotechnology, fungal evolution and other areas.

  15. The Retention of Meaningful Understanding of Meiosis and Genetics.

    Science.gov (United States)

    Cavallo, Ann Liberatore

    This study investigated the retention of meaningful understanding of the biological topics of meiosis, the Punnett square method and the relations between these two topics. This study also explored the predictive influence of students' general tendency to learn meaningfully or by rote (meaningful learning orientation), prior knowledge of meiosis,…

  16. Complex regulation of sister kinetochore orientation in meiosis-I.

    Science.gov (United States)

    Bardhan, Amit

    2010-09-01

    Kinetochores mediate chromosome movement during cell division by interacting with the spindle microtubules. Sexual reproduction necessitates the daunting task of reducing ploidy (number of chromosome sets) in the gametes, which depends upon the specialized properties of meiosis. Kinetochores have a central role in the reduction process. In this review, we discuss the complexity of this role of kinetochores in meiosis-I.

  17. Tapping into yeast diversity.

    Science.gov (United States)

    Fay, Justin C

    2012-11-01

    Domesticated organisms demonstrate our capacity to influence wild species but also provide us with the opportunity to understand rapid evolution in the context of substantially altered environments and novel selective pressures. Recent advances in genetics and genomics have brought unprecedented insights into the domestication of many organisms and have opened new avenues for further improvements to be made. Yet, our ability to engineer biological systems is not without limits; genetic manipulation is often quite difficult. The budding yeast, Saccharomyces cerevisiae, is not only one of the most powerful model organisms, but is also the premier producer of fermented foods and beverages around the globe. As a model system, it entertains a hefty workforce dedicated to deciphering its genome and the function it encodes at a rich mechanistic level. As a producer, it is used to make leavened bread, and dozens of different alcoholic beverages, such as beer and wine. Yet, applying the awesome power of yeast genetics to understanding its origins and evolution requires some knowledge of its wild ancestors and the environments from which they were derived. A number of surprisingly diverse lineages of S. cerevisiae from both primeval and secondary forests in China have been discovered by Wang and his colleagues. These lineages substantially expand our knowledge of wild yeast diversity and will be a boon to elucidating the ecology, evolution and domestication of this academic and industrial workhorse.

  18. History of genome editing in yeast.

    Science.gov (United States)

    Fraczek, Marcin G; Naseeb, Samina; Delneri, Daniela

    2018-05-01

    For thousands of years humans have used the budding yeast Saccharomyces cerevisiae for the production of bread and alcohol; however, in the last 30-40 years our understanding of the yeast biology has dramatically increased, enabling us to modify its genome. Although S. cerevisiae has been the main focus of many research groups, other non-conventional yeasts have also been studied and exploited for biotechnological purposes. Our experiments and knowledge have evolved from recombination to high-throughput PCR-based transformations to highly accurate CRISPR methods in order to alter yeast traits for either research or industrial purposes. Since the release of the genome sequence of S. cerevisiae in 1996, the precise and targeted genome editing has increased significantly. In this 'Budding topic' we discuss the significant developments of genome editing in yeast, mainly focusing on Cre-loxP mediated recombination, delitto perfetto and CRISPR/Cas. © 2018 The Authors. Yeast published by John Wiley & Sons, Ltd.

  19. Imaging of DNA Ultrafine Bridges in Budding Yeast

    DEFF Research Database (Denmark)

    Quevedo Rodriguez, Oliver; Lisby, Michael

    2018-01-01

    DNA ultrafine bridges (UFBs) are a type of chromatin-free DNA bridges that connect sister chromatids in anaphase and pose a threat to genome stability. However, little is known about the origin of these structures, and how they are sensed and resolved by the cell. In this chapter, we review tools...... and methods for studying UFBs by fluorescence microscopy including chemical and genetic approaches to induce UFBs in the model organism Saccharomyces cerevisiae....

  20. Imaging of DNA Ultrafine Bridges in Budding Yeast.

    Science.gov (United States)

    Quevedo, Oliver; Lisby, Michael

    2018-01-01

    DNA ultrafine bridges (UFBs) are a type of chromatin-free DNA bridges that connect sister chromatids in anaphase and pose a threat to genome stability. However, little is known about the origin of these structures, and how they are sensed and resolved by the cell. In this chapter, we review tools and methods for studying UFBs by fluorescence microscopy including chemical and genetic approaches to induce UFBs in the model organism Saccharomyces cerevisiae.

  1. Timing robustness in the budding and fission yeast cell cycles.

    KAUST Repository

    Mangla, Karan; Dill, David L; Horowitz, Mark A

    2010-01-01

    Robustness of biological models has emerged as an important principle in systems biology. Many past analyses of Boolean models update all pending changes in signals simultaneously (i.e., synchronously), making it impossible to consider robustness

  2. Development and growth potential of axillary buds in roses as affected by bud age.

    NARCIS (Netherlands)

    Marcelis-van Acker, C.A.M.

    1994-01-01

    The effect of axillary bud age on the development and potential for growth of the bud into a shoot was studied in roses. Age of the buds occupying a similar position on the plant varied from 'subtending leaf just unfolded' up to 1 year later. With increasing age of the axillary bud its dry mass,

  3. Budded baculovirus particle structure revisited

    NARCIS (Netherlands)

    Wang, Qiushi; Bosch, Berend-Jan; Vlak, Just M; van Oers, Monique M; Rottier, Peter J; van Lent, Jan W M

    2015-01-01

    Baculoviruses are a group of enveloped, double-stranded DNA insect viruses with budded (BV) and occlusion-derived (ODV) virions produced during their infection cycle. BVs are commonly described as rod shaped particles with a high apical density of protein extensions (spikes) on the lipid envelope

  4. Budded baculovirus particle structure revisited

    NARCIS (Netherlands)

    Wang, Qiushi; Bosch, Berend Jan; Vlak, J.M.; Oers, van M.M.; Rottier, P.J.; Lent, van J.W.M.

    2016-01-01

    Baculoviruses are a group of enveloped, double-stranded DNA insect viruses with budded (BV) and occlusion-derived (ODV) virions produced during their infection cycle. BVs are commonly described as rod shaped particles with a high apical density of protein extensions (spikes) on the lipid envelope

  5. Budding yeast cDNA sequencing project: S03036-05_I15 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available EST - Link to UCSC Genome Browser - Sequence >S03036-05_I15.phd NNNTNNTNNNNCNCTCACATANAAGACGGANNAGNNNGCTGGGC...CAATGCGTTCCATATGCG AAAATTCTTGGNCAATGTATTCTCTAGCAATCTNTNCTTTTGTACANTCGGAGGNTTNTC ATGNTCCTTTCATANATTATANAAANNG

  6. Budding yeast cDNA sequencing project: S03052-78_H01 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available GGTTCAGTC ACCCCAGCTTTAAACNATTGTTAATACAGAAGTGAATGCTTCCGTTTTCCAATTTTTCGC TTCCCTCCGCCGCNCCNNACCGNTTCTTCCGANCATTTAGATATNNATTCATANA...TGCTT ATTTNNGGGTCATANAGGAAANAATTTTCGATTGNAANGACTGAATATANATTGTTNTAT ANTTANATTGAANANGNTANNAN

  7. Budding yeast cDNA sequencing project: S03036-21_O21 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available NANAAGAGNATATGATATANNNNCATANATAN AGATAAATANANNAACAANCACNCACATANATNTAGACAANNANGANGNTNACTATANAN TTTATTCTATTAAA...CTTTTNNNNAAGAATANA AAAAANAAAAACCACCCCCCNTCCCCCTATGAGAGAGGAGGAGGAGANNNNNACNNTNTT TTTATTTANTANATANGNAAANGANAGC

  8. Budding yeast cDNA sequencing project: S03052-01_K20 [Budding yeast cDNA sequencing project

    Lifescience Database Archive (English)

    Full Text Available GTCTTTGCTTCTAAA GCTTAACCATANAGTCACGGACTTAAGACTGTACGACCTGAAGGGCGCAAAAGGTGTATG CG Quality >S03052-01_K20.phd 4...C ATATACAATGTTGTCANGAGTAGCTAAACGTGCGTTTTCCTCTACANTTGCCAACCCTTA TAAAGTGACTGTCTTGGGTGCAGGCGGTGGTATTGGACAACCATT

  9. From equator to pole: splitting chromosomes in mitosis and meiosis

    Science.gov (United States)

    Duro, Eris

    2015-01-01

    During eukaryotic cell division, chromosomes must be precisely partitioned to daughter cells. This relies on a mechanism to move chromosomes in defined directions within the parental cell. While sister chromatids are segregated from one another in mitosis and meiosis II, specific adaptations enable the segregation of homologous chromosomes during meiosis I to reduce ploidy for gamete production. Many of the factors that drive these directed chromosome movements are known, and their molecular mechanism has started to be uncovered. Here we review the mechanisms of eukaryotic chromosome segregation, with a particular emphasis on the modifications that ensure the segregation of homologous chromosomes during meiosis I. PMID:25593304

  10. Influence of the bud neck on nuclear envelope fission in Saccharomyces cerevisiae.

    Science.gov (United States)

    Melloy, Patricia G; Rose, Mark D

    2017-09-15

    Studies have shown that nuclear envelope fission (karyokinesis) in budding yeast depends on cytokinesis, but not distinguished whether this was a direct requirement, indirect, because of cell cycle arrest, or due to bud neck-localized proteins impacting both processes. To determine the requirements for karyokinesis, we examined mutants conditionally defective for bud emergence and/or nuclear migration. The common mutant phenotype was completion of the nuclear division cycle within the mother cell, but karyokinesis did not occur. In the cdc24 swe1 mutant, at the non-permissive temperature, multiple nuclei accumulated within the unbudded cell, with connected nuclear envelopes. Upon return to the permissive temperature, the cdc24 swe1 mutant initiated bud emergence, but only the nucleus spanning the neck underwent fission suggesting that the bud neck region is important for fission initiation. The neck may be critical for either mechanical reasons, as the contractile ring might facilitate fission, or for regulatory reasons, as the site of a protein network regulating nuclear envelope fission, mitotic exit, and cytokinesis. We also found that 77-85% of pairs of septin mutant nuclei completed nuclear envelope fission. In addition, 27% of myo1Δ mutant nuclei completed karyokinesis. These data suggested that fission is not dependent on mechanical contraction at the bud neck, but was instead controlled by regulatory proteins there. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Activation of Rab GTPase Sec4 by its GEF Sec2 is required for prospore membrane formation during sporulation in yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Suda, Yasuyuki; Tachikawa, Hiroyuki; Inoue, Ichiro; Kurita, Tomokazu; Saito, Chieko; Kurokawa, Kazuo; Nakano, Akihiko; Irie, Kenji

    2018-02-01

    Sec2 activates Sec4 Rab GTPase as a guanine nucleotide exchange factor for the recruitment of downstream effectors to facilitate tethering and fusion of post-Golgi vesicles at the plasma membrane. During the meiosis and sporulation of budding yeast, post-Golgi vesicles are transported to and fused at the spindle pole body (SPB) to form a de novo membrane, called the prospore membrane. Previous studies have revealed the role of the SPB outer surface called the meiotic outer plaque (MOP) in docking and fusion of post-Golgi vesicles. However, the upstream molecular machinery for post-Golgi vesicular fusion that facilitates prospore membrane formation remains enigmatic. Here, we demonstrate that the GTP exchange factor for Sec4, Sec2, participates in the formation of the prospore membrane. A conditional mutant in which the SEC2 expression is shut off during sporulation showed sporulation defects. Inactivation of Sec2 caused Sec4 targeting defects along the prospore membranes, thereby causing insufficient targeting of downstream effectors and cargo proteins to the prospore membrane. These results suggest that the activation of Sec4 by Sec2 is required for the efficient supply of post-Golgi vesicles to the prospore membrane and thus for prospore membrane formation/extension and subsequent deposition of spore wall materials. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  12. Induction of mutation and recombination following UV irradiation during meiosis in Saccharomyces cerevisiae

    Energy Technology Data Exchange (ETDEWEB)

    Kelly, S.L.; Parry, J.M. (University Coll. of Swansea (UK). Dept. of Genetics)

    1983-03-01

    Irradiation of yeast cultures with ultraviolet light at discrete stages during meiosis produces cyclic variations in sensitivity, i.e. cells are more sensitive to the lethal effects of UV light prior to entry into the meiotic DNA synthesis, and this corresponds to a peak of induction of point mutation. Cells become more resistant to both induced point mutation and lethality as they enter meiotic DNA synthesis, but become more sensitive again during spore formation. The induced level of intragenic recombination rises during the period of commitment ot recombination to a level indistinguishable from the full meiotic level of spontaneous intragenic recombination. Induced reciprocal recombination remains above the spontaneous level up to the point of commitment to sporulation.

  13. The induction of mutation and recombination following UV irradiation during meiosis in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Kelly, S.L.; Parry, J.M.

    1983-01-01

    Irradiation of yeast cultures with ultraviolet light at discrete stages during meiosis produces cyclic variations in sensitivity, i.e. cells are more sensitive to the lethal effects of UV light prior to entry into the meiotic DNA synthesis, and this corresponds to a peak of induction of point mutation. Cells become more resistant to both induced point mutation and lethality as they enter meiotic DNA synthesis, but become more sensitive again during spore formation. The induced level of intragenic recombination rises during the period of commitment ot recombination to a level indistinguishable from the full meiotic level of spontaneous intragenic recombination. Induced reciprocal recombination remains above the spontaneous level up to the point of commitment to sporulation. (orig.)

  14. The induction of mutation and recombination following UV irradiation during meiosis in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kelly, S L; Parry, J M

    1983-03-01

    Irradiation of yeast cultures with ultraviolet light at discrete stages during meiosis produces cyclic variations in sensitivity, i.e. cells are more sensitive to the lethal effects of UV light prior to entry into the meiotic DNA synthesis, and this corresponds to a peak of induction of point mutation. Cells become more resistant to both induced point mutation and lethality as they enter meiotic DNA synthesis, but become more sensitive again during spore formation. The induced level of intragenic recombination rises during the period of commitment to recombination to a level indistinguishable from the full meiotic level of spontaneous intragenic recombination. Induced reciprocal recombination remains above the spontaneous level up to the point of commitment to sporulation.

  15. Selection on meiosis genes in diploid and tetraploid Arabidopsis arenosa

    Czech Academy of Sciences Publication Activity Database

    Wright, K. M.; Arnold, B.; Xue, K.; Šurinová, Mária; O´Connell, J.; Bomblies, K.

    2015-01-01

    Roč. 32, č. 4 (2015), s. 944-955 ISSN 0737-4038 Institutional support: RVO:67985939 Keywords : meiosis * evolution * polyploidy Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 13.649, year: 2015

  16. Atypical ploidy cycles, Spo11, and the evolution of meiosis.

    Science.gov (United States)

    Bloomfield, Gareth

    2016-06-01

    The Spo11 protein induces DNA double strand breaks before the first division of meiosis, enabling the formation of the chiasmata that physically link homologous chromosomes as they align. Spo11 is an ancient and well conserved protein, related in sequence and structure to a DNA topoisomerase subunit found in Archaea as well as a subset of eukaryotes. However the origins of its meiotic function are unclear. This review examines some apparent exceptions to the rule that Spo11 activity is specific to, and required for meiosis. Spo11 appears to function in the context of unusual forms of ploidy reduction in some protists and fungi. One lineage of amoebae, the dictyostelids, is thought to undergo meiosis during its sexual cycle despite having lost Spo11 entirely. Further experimental characterisation of these and other non-canonical ploidy cycling mechanisms may cast light of the evolution of meiosis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  17. Localization of two mammalian cyclin dependent kinases during mammalian meiosis

    NARCIS (Netherlands)

    Ashley, T.; Walpita, D.; de rooij, D. G.

    2001-01-01

    Mammalian meiotic progression, like mitotic cell cycle progression, is regulated by cyclins and cyclin dependent kinases (CDKs). However, the unique requirements of meiosis (homologous synapsis, reciprocal recombination and the dual divisions that segregate first homologues, then sister chromatids)

  18. Wrestling with Chromosomes: The Roles of SUMO During Meiosis.

    Science.gov (United States)

    Nottke, Amanda C; Kim, Hyun-Min; Colaiácovo, Monica P

    2017-01-01

    Meiosis is a specialized form of cell division required for the formation of haploid gametes and therefore is essential for successful sexual reproduction. Various steps are exquisitely coordinated to ensure accurate chromosome segregation during meiosis, thereby promoting the formation of haploid gametes from diploid cells. Recent studies are demonstrating that an important form of regulation during meiosis is exerted by the post-translational protein modification known as sumoylation. Here, we review and discuss the various critical steps of meiosis in which SUMO-mediated regulation has been implicated thus far. These include the maintenance of meiotic centromeric heterochromatin , meiotic DNA double-strand break repair and homologous recombination, centromeric coupling, and the assembly of a proteinaceous scaffold between homologous chromosomes known as the synaptonemal complex.

  19. Chiasmatic and achiasmatic inverted meiosis of plants with holocentric chromosomes

    Science.gov (United States)

    Cabral, Gabriela; Marques, André; Schubert, Veit; Pedrosa-Harand, Andrea; Schlögelhofer, Peter

    2014-01-01

    Meiosis is a specialized cell division in sexually reproducing organisms before gamete formation. Following DNA replication, the canonical sequence in species with monocentric chromosomes is characterized by reductional segregation of homologous chromosomes during the first and equational segregation of sister chromatids during the second meiotic division. Species with holocentric chromosomes employ specific adaptations to ensure regular disjunction during meiosis. Here we present the analysis of two closely related plant species with holocentric chromosomes that display an inversion of the canonical meiotic sequence, with the equational division preceding the reductional. In-depth analysis of the meiotic divisions of Rhynchospora pubera and R. tenuis reveals that during meiosis I sister chromatids are bi-oriented, display amphitelic attachment to the spindle and are subsequently separated. During prophase II, chromatids are connected by thin chromatin threads that appear instrumental for the regular disjunction of homologous non-sister chromatids in meiosis II. PMID:25295686

  20. Cytomixis impairs meiosis and influences reproductive success in ...

    Indian Academy of Sciences (India)

    MADU

    evolved but complex process to produce gametes genetically and structurally different ... All the organisms, irrespective of ... Meiosis is highly coherent and genetically programmed ..... may be genetic in nature and modified by the environment.

  1. Increased genome instability is not accompanied by sensitivity to DNA damaging agents in aged yeast cells

    NARCIS (Netherlands)

    Novarina, Daniele; Mavrova, Sara N.; Janssens, Georges E.; Rempel, Irina L.; Veenhoff, Liesbeth M.; Chang, Michael

    The budding yeast Saccharomyces cerevisiae divides asymmetrically, producing a new daughter cell from the original mother cell. While daughter cells are born with a full lifespan, a mother cell ages with each cell division and can only generate on average 25 daughter cells before dying. Aged yeast

  2. Yeast cells contain a heterogeneous population of peroxisomes that segregate asymmetrically during cell division

    NARCIS (Netherlands)

    Kumar, Sanjeev; de Boer, Rinse; van der Klei, Ida J

    2018-01-01

    Here we used fluorescence microscopy and a peroxisome-targeted tandem fluorescent protein timer to determine the relative age of peroxisomes in yeast. Our data indicate that yeast cells contain a heterogeneous population of relatively old and younger peroxisomes. During budding the peroxisome

  3. Mutant allele of rna14 in fission yeast affects pre-mRNA splicing

    Indian Academy of Sciences (India)

    transcript. Rna14 protein in budding yeast has been implicated in cleavage and ... Subsequently, genetic interaction of Rna14 with prp1 and physical .... molecular yeast techniques as described by Moreno et al. ..... To elucidate the role of Rna14 in splicing, RT-PCR analysis ..... design principles of a dynamic RNP machine.

  4. Checkpoint independence of most DNA replication origins in fission yeast

    OpenAIRE

    Mickle, Katie L; Ramanathan, Sunita; Rosebrock, Adam; Oliva, Anna; Chaudari, Amna; Yompakdee, Chulee; Scott, Donna; Leatherwood, Janet; Huberman, Joel A

    2007-01-01

    Abstract Background In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU), which limits the pool of deoxyribonucleo...

  5. Quantitative analysis of taste bud cell numbers in fungiform and soft palate taste buds of mice.

    Science.gov (United States)

    Ohtubo, Yoshitaka; Yoshii, Kiyonori

    2011-01-07

    Mammalian taste bud cells (TBCs) consist of several cell types equipped with different taste receptor molecules, and hence the ratio of cell types in a taste bud constitutes the taste responses of the taste bud. Here we show that the population of immunohistochemically identified cell types per taste bud is proportional to the number of total TBCs in the taste bud or the area of the taste bud in fungiform papillae, and that the proportions differ among cell types. This result is applicable to soft palate taste buds. However, the density of almost all cell types, the population of cell types divided by the area of the respective taste buds, is significantly higher in soft palates. These results suggest that the turnover of TBCs is regulated to keep the ratio of each cell type constant, and that taste responsiveness is different between fungiform and soft palate taste buds. Copyright © 2010 Elsevier B.V. All rights reserved.

  6. The multiple roles of Bub1 in chromosome segregation during mitosis and meiosis

    Energy Technology Data Exchange (ETDEWEB)

    Marchetti, Francesco; Venkatachalam, Sundaresan

    2009-06-19

    Aneuploidy, any deviation from an exact multiple of the haploid number of chromosomes, is a common occurrence in cancer and represents the most frequent chromosomal disorder in newborns. Eukaryotes have evolved mechanisms to assure the fidelity of chromosome segregation during cell division that include a multiplicity of checks and controls. One of the main cell division control mechanisms is the spindle assembly checkpoint (SAC) that monitors the proper attachment of chromosomes to spindle fibers and prevents anaphase until all kinetochores are properly attached. The mammalian SAC is composed by at least 14 evolutionary-conserved proteins that work in a coordinated fashion to monitor the establishment of amphitelic attachment of all chromosomes before allowing cell division to occur. Among the SAC proteins, the budding uninhibited by benzimidazole protein 1 (Bub1), is a highly conserved protein of prominent importance for the proper functioning of the SAC. Studies have revealed many roles for Bub1 in both mitosis and meiosis, including the localization of other SAC proteins to the kinetochore, SAC signaling, metaphase congression and the protection of the sister chromatid cohesion. Recent data show striking sex specific differences in the response to alterations in Bub1 activity. Proper Bub1 functioning is particularly important during oogenesis in preventing the generation of aneuploid gametes that can have detrimental effects on the health status of the fetus and the newborn. These data suggest that Bub1 is a master regulator of SAC and chromosomal segregation in both mitosis and meiosis. Elucidating its many essential functions in regulating proper chromosome segregation can have important consequences for preventing tumorigenesis and developmental abnormalities.

  7. Testing of mitosis and meiosis in female and male gametes

    Directory of Open Access Journals (Sweden)

    L. F. Kurilo

    2016-01-01

    Full Text Available Method of quantitative evaluation of the immature germ cells, their pathology in mitosis and meiosis (in semen, embryo and fetal ovaries, of gonad biopsies or fragments of sectioned material is informative method and should be introduced into the clinical practice in andrology and gynecology and fundamental research. Quantitative analysis of mitosis and female meiosis development was initiated on experimental animals and fetal gonads from spontaneous or therapeutic abortions.

  8. Meiosis and Haploid Gametes in the Pathogen Trypanosoma brucei

    OpenAIRE

    Peacock, Lori; Bailey, Mick; Carrington, Mark; Gibson, Wendy

    2014-01-01

    Summary In eukaryote pathogens, sex is an important driving force in spreading genes for drug resistance, pathogenicity, and virulence [1]. For the parasitic trypanosomes that cause African sleeping sickness, mating occurs during transmission by the tsetse vector [2, 3] and involves meiosis [4], but haploid gametes have not yet been identified. Here, we show that meiosis is a normal part of development in the insect salivary glands for all subspecies of Trypanosoma brucei, including the human...

  9. Chiasmata promote monopolar attachment of sister chromatids and their co-segregation toward the proper pole during meiosis I.

    Directory of Open Access Journals (Sweden)

    Yukinobu Hirose

    2011-03-01

    Full Text Available The chiasma is a structure that forms between a pair of homologous chromosomes by crossover recombination and physically links the homologous chromosomes during meiosis. Chiasmata are essential for the attachment of the homologous chromosomes to opposite spindle poles (bipolar attachment and their subsequent segregation to the opposite poles during meiosis I. However, the overall function of chiasmata during meiosis is not fully understood. Here, we show that chiasmata also play a crucial role in the attachment of sister chromatids to the same spindle pole and in their co-segregation during meiosis I in fission yeast. Analysis of cells lacking chiasmata and the cohesin protector Sgo1 showed that loss of chiasmata causes frequent bipolar attachment of sister chromatids during anaphase. Furthermore, high time-resolution analysis of centromere dynamics in various types of chiasmate and achiasmate cells, including those lacking the DNA replication checkpoint factor Mrc1 or the meiotic centromere protein Moa1, showed the following three outcomes: (i during the pre-anaphase stage, the bipolar attachment of sister chromatids occurs irrespective of chiasma formation; (ii the chiasma contributes to the elimination of the pre-anaphase bipolar attachment; and (iii when the bipolar attachment remains during anaphase, the chiasmata generate a bias toward the proper pole during poleward chromosome pulling that results in appropriate chromosome segregation. Based on these results, we propose that chiasmata play a pivotal role in the selection of proper attachments and provide a backup mechanism that promotes correct chromosome segregation when improper attachments remain during anaphase I.

  10. Meiosis evolves: adaptation to external and internal environments.

    Science.gov (United States)

    Bomblies, Kirsten; Higgins, James D; Yant, Levi

    2015-10-01

    306 I. 306 II. 307 III. 312 IV. 317 V. 318 319 References 319 SUMMARY: Meiosis is essential for the fertility of most eukaryotes and its structures and progression are conserved across kingdoms. Yet many of its core proteins show evidence of rapid or adaptive evolution. What drives the evolution of meiosis proteins? How can constrained meiotic processes be modified in response to challenges without compromising their essential functions? In surveying the literature, we found evidence of two especially potent challenges to meiotic chromosome segregation that probably necessitate adaptive evolutionary responses: whole-genome duplication and abiotic environment, especially temperature. Evolutionary solutions to both kinds of challenge are likely to involve modification of homologous recombination and synapsis, probably via adjustments of core structural components important in meiosis I. Synthesizing these findings with broader patterns of meiosis gene evolution suggests that the structural components of meiosis coevolve as adaptive modules that may change in primary sequence and function while maintaining three-dimensional structures and protein interactions. The often sharp divergence of these genes among species probably reflects periodic modification of entire multiprotein complexes driven by genomic or environmental changes. We suggest that the pressures that cause meiosis to evolve to maintain fertility may cause pleiotropic alterations of global crossover rates. We highlight several important areas for future research. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  11. Polo kinase Cdc5 is a central regulator of meiosis I

    Science.gov (United States)

    Attner, Michelle A.; Miller, Matthew P.; Ee, Ly-sha; Elkin, Sheryl K.; Amon, Angelika

    2013-01-01

    During meiosis, two consecutive rounds of chromosome segregation yield four haploid gametes from one diploid cell. The Polo kinase Cdc5 is required for meiotic progression, but how Cdc5 coordinates multiple cell-cycle events during meiosis I is not understood. Here we show that CDC5-dependent phosphorylation of Rec8, a subunit of the cohesin complex that links sister chromatids, is required for efficient cohesin removal from chromosome arms, which is a prerequisite for meiosis I chromosome segregation. CDC5 also establishes conditions for centromeric cohesin removal during meiosis II by promoting the degradation of Spo13, a protein that protects centromeric cohesin during meiosis I. Despite CDC5’s central role in meiosis I, the protein kinase is dispensable during meiosis II and does not even phosphorylate its meiosis I targets during the second meiotic division. We conclude that Cdc5 has evolved into a master regulator of the unique meiosis I chromosome segregation pattern. PMID:23918381

  12. Coevolutionary patterning of teeth and taste buds

    Science.gov (United States)

    Bloomquist, Ryan F.; Parnell, Nicholas F.; Phillips, Kristine A.; Fowler, Teresa E.; Yu, Tian Y.; Sharpe, Paul T.; Streelman, J. Todd

    2015-01-01

    Teeth and taste buds are iteratively patterned structures that line the oro-pharynx of vertebrates. Biologists do not fully understand how teeth and taste buds develop from undifferentiated epithelium or how variation in organ density is regulated. These organs are typically studied independently because of their separate anatomical location in mammals: teeth on the jaw margin and taste buds on the tongue. However, in many aquatic animals like bony fishes, teeth and taste buds are colocalized one next to the other. Using genetic mapping in cichlid fishes, we identified shared loci controlling a positive correlation between tooth and taste bud densities. Genome intervals contained candidate genes expressed in tooth and taste bud fields. sfrp5 and bmper, notable for roles in Wingless (Wnt) and bone morphogenetic protein (BMP) signaling, were differentially expressed across cichlid species with divergent tooth and taste bud density, and were expressed in the development of both organs in mice. Synexpression analysis and chemical manipulation of Wnt, BMP, and Hedgehog (Hh) pathways suggest that a common cichlid oral lamina is competent to form teeth or taste buds. Wnt signaling couples tooth and taste bud density and BMP and Hh mediate distinct organ identity. Synthesizing data from fish and mouse, we suggest that the Wnt-BMP-Hh regulatory hierarchy that configures teeth and taste buds on mammalian jaws and tongues may be an evolutionary remnant inherited from ancestors wherein these organs were copatterned from common epithelium. PMID:26483492

  13. Coevolutionary patterning of teeth and taste buds.

    Science.gov (United States)

    Bloomquist, Ryan F; Parnell, Nicholas F; Phillips, Kristine A; Fowler, Teresa E; Yu, Tian Y; Sharpe, Paul T; Streelman, J Todd

    2015-11-03

    Teeth and taste buds are iteratively patterned structures that line the oro-pharynx of vertebrates. Biologists do not fully understand how teeth and taste buds develop from undifferentiated epithelium or how variation in organ density is regulated. These organs are typically studied independently because of their separate anatomical location in mammals: teeth on the jaw margin and taste buds on the tongue. However, in many aquatic animals like bony fishes, teeth and taste buds are colocalized one next to the other. Using genetic mapping in cichlid fishes, we identified shared loci controlling a positive correlation between tooth and taste bud densities. Genome intervals contained candidate genes expressed in tooth and taste bud fields. sfrp5 and bmper, notable for roles in Wingless (Wnt) and bone morphogenetic protein (BMP) signaling, were differentially expressed across cichlid species with divergent tooth and taste bud density, and were expressed in the development of both organs in mice. Synexpression analysis and chemical manipulation of Wnt, BMP, and Hedgehog (Hh) pathways suggest that a common cichlid oral lamina is competent to form teeth or taste buds. Wnt signaling couples tooth and taste bud density and BMP and Hh mediate distinct organ identity. Synthesizing data from fish and mouse, we suggest that the Wnt-BMP-Hh regulatory hierarchy that configures teeth and taste buds on mammalian jaws and tongues may be an evolutionary remnant inherited from ancestors wherein these organs were copatterned from common epithelium.

  14. GC-rich DNA elements enable replication origin activity in the methylotrophic yeast Pichia pastoris.

    Science.gov (United States)

    Liachko, Ivan; Youngblood, Rachel A; Tsui, Kyle; Bubb, Kerry L; Queitsch, Christine; Raghuraman, M K; Nislow, Corey; Brewer, Bonita J; Dunham, Maitreya J

    2014-03-01

    The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins--a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation.

  15. GC-rich DNA elements enable replication origin activity in the methylotrophic yeast Pichia pastoris.

    Directory of Open Access Journals (Sweden)

    Ivan Liachko

    2014-03-01

    Full Text Available The well-studied DNA replication origins of the model budding and fission yeasts are A/T-rich elements. However, unlike their yeast counterparts, both plant and metazoan origins are G/C-rich and are associated with transcription start sites. Here we show that an industrially important methylotrophic budding yeast, Pichia pastoris, simultaneously employs at least two types of replication origins--a G/C-rich type associated with transcription start sites and an A/T-rich type more reminiscent of typical budding and fission yeast origins. We used a suite of massively parallel sequencing tools to map and dissect P. pastoris origins comprehensively, to measure their replication dynamics, and to assay the global positioning of nucleosomes across the genome. Our results suggest that some functional overlap exists between promoter sequences and G/C-rich replication origins in P. pastoris and imply an evolutionary bifurcation of the modes of replication initiation.

  16. Meiosis in mice without a synaptonemal complex.

    Directory of Open Access Journals (Sweden)

    Anna Kouznetsova

    Full Text Available The synaptonemal complex (SC promotes fusion of the homologous chromosomes (synapsis and crossover recombination events during meiosis. The SC displays an extensive structural conservation between species; however, a few organisms lack SC and execute meiotic process in a SC-independent manner. To clarify the SC function in mammals, we have generated a mutant mouse strain (Sycp1(-/-Sycp3(-/-, here called SC-null in which all known SC proteins have been displaced from meiotic chromosomes. While transmission electron microscopy failed to identify any remnants of the SC in SC-null spermatocytes, neither formation of the cohesion axes nor attachment of the chromosomes to the nuclear membrane was perturbed. Furthermore, the meiotic chromosomes in SC-null meiocytes achieved pre-synaptic pairing, underwent early homologous recombination events and sustained a residual crossover formation. In contrast, in SC-null meiocytes synapsis and MLH1-MLH3-dependent crossovers maturation were abolished, whereas the structural integrity of chromosomes was drastically impaired. The variable consequences that SC inactivation has on the meiotic process in different organisms, together with the absence of SC in some unrelated species, imply that the SC could have originated independently in different taxonomic groups.

  17. Genome-wide identification of pheromone-targeted transcrption in fission yeast

    DEFF Research Database (Denmark)

    Xue-Franzen, Y.; Kjærulff, S.; Holmberg, C.

    2006-01-01

    Background Fission yeast cells undergo sexual differentiation in response to nitrogen starvation. In this process haploid M and P cells first mate to form diploid zygotes, which then enter meiosis and sporulate. Prior to mating, M and P cells communicate with diffusible mating pheromones that act......Background Fission yeast cells undergo sexual differentiation in response to nitrogen starvation. In this process haploid M and P cells first mate to form diploid zygotes, which then enter meiosis and sporulate. Prior to mating, M and P cells communicate with diffusible mating pheromones...... transcription factor is responsible for the majority of pheromone-induced transcription. Finally, most cell-type specific genes now appear to be identified in fission yeast....

  18. Assessment of pheromone production and response in fission yeast by a halo test of induced sporulation

    DEFF Research Database (Denmark)

    Egel, R; Willer, M; Kjaerulff, S

    1994-01-01

    We describe a rapid, sensitive and semi-quantitative plate assay for monitoring pheromone activity in the fission yeast Schizosaccharomyces pombe. It is based on the observation that meiosis requires stimulation by pheromone and exploits diploid strains that will only sporulate after addition...... of exogenous pheromone. The tester strains are heterozygous for mating type, are non-switching, and are mutated in one of the early subfunctions (either mat1-Mc or mat1-Pc), so that meiosis is only induced after exposure to exogenous pheromone (M-factor or P-factor, respectively). Pheromone activity...

  19. [Impact of TDZ and NAA on adventitious bud induction and cluster bud multiplication in Tulipa edulis].

    Science.gov (United States)

    Zhu, Li-Fang; Xu, Chao; Zhu, Zai-Biao; Yang, He-Tong; Guo, Qiao-Sheng; Xu, Hong-jian; Ma, Hong-Jian; Zhao, Gui-Hua

    2014-08-01

    To explore the method of explants directly induced bud and establish the tissue culture system of mutiple shoot by means of direct organogenesis, core bud and daughter bulbs (the top of bud stem expanded to form daughter bulb) of T. edulis were used as explants and treated with thidiazuron (TDZ) and 1-naphthlcetic acid (NAA). The results showed that the optimal medium for bud inducted form core bud and daughter bulb were MS + TDZ 2.0 mg x L(-1) + NAA 4.0 mg x L(-1) and MS +TDZ 2.0 mg x L(-1) + NAA 2.0 mg x L(-1) respectively, both of them had a bud induction rate of 72.92%, 79.22%. The optimal medium for cluster buds multiplication was MS + TDZ 0.2 mg x L(-1) + NAA 0.2 mg x L(-1), and proliferation coefficient was 2.23. After proliferation, cluster buds rooting occurred on MS medium with IBA 1.0 mg x L(-1) and the rooting rate was 52.6%, three to five seedlings in each plant. Using core bud and daughter bulb of T. edulis, the optimum medium for adventitious bud directly inducted from daughter bulb, core bud and cluster bud multiplication were screened out and the tissue culture system of multiple shoot by means of direct organogenesis was established.

  20. Repellence of the red bud borer (Resseliella oculiperda) to grafted apple trees by impregnation of budding tape with essential oils

    NARCIS (Netherlands)

    Tol, van R.W.H.M.; Linden, van der A.; Swarts, H.J.; Visser, J.H.

    2007-01-01

    The red bud borer Resseliella oculiperda (Rübs.) is a pest insect of apple trees when rootstocks are grafted with scion buds by shield budding. The female midges are attracted to the wounds of the grafted buds where they lay their eggs. The larvae feed on the cambium and destroy the buds completely

  1. Changes in gene expression during male meiosis in Petunia hybrida.

    Science.gov (United States)

    Cnudde, Filip; Hedatale, Veena; de Jong, Hans; Pierson, Elisabeth S; Rainey, Daphne Y; Zabeau, Marc; Weterings, Koen; Gerats, Tom; Peters, Janny L

    2006-01-01

    We analyzed changes in gene expression during male meiosis in Petunia by combining the meiotic staging of pollen mother cells from a single anther with cDNA-AFLP transcript profiling of mRNA from the synchronously developing sister anthers. The transcript profiling experiments focused on the identification of genes with a modulated expression profile during meiosis, while premeiotic archesporial cells and postmeiotic microspores served as a reference. About 8000 transcript tags, estimated at 30% of the total transcriptome, were generated, of which around 6% exhibited a modulated gene expression pattern at meiosis. Cluster analysis revealed a transcriptional cascade that coincides with the initiation and progression through all stages of the two meiotic divisions. Fragments that exhibited high expression specifically during meiosis I were characterized further by sequencing; 90 out of the 293 sequenced fragments showed homology with known genes, belonging to a wide range of gene classes, including previously characterized meiotic genes. In-situ hybridization experiments were performed to determine the spatial expression pattern for five selected transcript tags. Its concurrence with cDNA-AFLP transcript profiles indicates that this is an excellent approach to study genes involved in specialized processes such as meiosis. Our data set provides the potential to unravel unique meiotic genes that are as yet elusive to reverse genetics approaches.

  2. Development and Meiosis of Three Interspecific Hybrids with Cultivated Barley (Hordeum vulgare L.)

    DEFF Research Database (Denmark)

    Von Bothmer, R.; Flink, J.; Linde-Laursen, Ib

    1986-01-01

    The development and meiosis of three interspecific hybrids between cultivated barley (Hordeum vulgare L.) and H. secalinum Schreb., H. tetraploidum Covas, and H. parodii Covas, respectively, were studied. All three hybrid combinations developed very slowly vegetatively. Meiosis of the hybrids...

  3. Apoptosis-like yeast cell death in response to DNA damage and replication defects

    Energy Technology Data Exchange (ETDEWEB)

    Burhans, William C.; Weinberger, Martin; Marchetti, Maria A.; Ramachandran, Lakshmi; D' Urso, Gennaro; Huberman, Joel A

    2003-11-27

    In budding (Saccharomyces cerevisiae) and fission (Schizosaccharomyces pombe) yeast and other unicellular organisms, DNA damage and other stimuli can induce cell death resembling apoptosis in metazoans, including the activation of a recently discovered caspase-like molecule in budding yeast. Induction of apoptotic-like cell death in yeasts requires homologues of cell cycle checkpoint proteins that are often required for apoptosis in metazoan cells. Here, we summarize these findings and our unpublished results which show that an important component of metazoan apoptosis recently detected in budding yeast - reactive oxygen species (ROS) - can also be detected in fission yeast undergoing an apoptotic-like cell death. ROS were detected in fission and budding yeast cells bearing conditional mutations in genes encoding DNA replication initiation proteins and in fission yeast cells with mutations that deregulate cyclin-dependent kinases (CDKs). These mutations may cause DNA damage by permitting entry of cells into S phase with a reduced number of replication forks and/or passage through mitosis with incompletely replicated chromosomes. This may be relevant to the frequent requirement for elevated CDK activity in mammalian apoptosis, and to the recent discovery that the initiation protein Cdc6 is destroyed during apoptosis in mammals and in budding yeast cells exposed to lethal levels of DNA damage. Our data indicate that connections between apoptosis-like cell death and DNA replication or CDK activity are complex. Some apoptosis-like pathways require checkpoint proteins, others are inhibited by them, and others are independent of them. This complexity resembles that of apoptotic pathways in mammalian cells, which are frequently deregulated in cancer. The greater genetic tractability of yeasts should help to delineate these complex pathways and their relationships to cancer and to the effects of apoptosis-inducing drugs that inhibit DNA replication.

  4. Apoptosis-like yeast cell death in response to DNA damage and replication defects

    International Nuclear Information System (INIS)

    Burhans, William C.; Weinberger, Martin; Marchetti, Maria A.; Ramachandran, Lakshmi; D'Urso, Gennaro; Huberman, Joel A.

    2003-01-01

    In budding (Saccharomyces cerevisiae) and fission (Schizosaccharomyces pombe) yeast and other unicellular organisms, DNA damage and other stimuli can induce cell death resembling apoptosis in metazoans, including the activation of a recently discovered caspase-like molecule in budding yeast. Induction of apoptotic-like cell death in yeasts requires homologues of cell cycle checkpoint proteins that are often required for apoptosis in metazoan cells. Here, we summarize these findings and our unpublished results which show that an important component of metazoan apoptosis recently detected in budding yeast - reactive oxygen species (ROS) - can also be detected in fission yeast undergoing an apoptotic-like cell death. ROS were detected in fission and budding yeast cells bearing conditional mutations in genes encoding DNA replication initiation proteins and in fission yeast cells with mutations that deregulate cyclin-dependent kinases (CDKs). These mutations may cause DNA damage by permitting entry of cells into S phase with a reduced number of replication forks and/or passage through mitosis with incompletely replicated chromosomes. This may be relevant to the frequent requirement for elevated CDK activity in mammalian apoptosis, and to the recent discovery that the initiation protein Cdc6 is destroyed during apoptosis in mammals and in budding yeast cells exposed to lethal levels of DNA damage. Our data indicate that connections between apoptosis-like cell death and DNA replication or CDK activity are complex. Some apoptosis-like pathways require checkpoint proteins, others are inhibited by them, and others are independent of them. This complexity resembles that of apoptotic pathways in mammalian cells, which are frequently deregulated in cancer. The greater genetic tractability of yeasts should help to delineate these complex pathways and their relationships to cancer and to the effects of apoptosis-inducing drugs that inhibit DNA replication

  5. In vitro PROLIFERATION ABILITY OF AXILLARY BUDS IN Musa spp

    African Journals Online (AJOL)

    AISA

    The proliferation rate of Axillary and apical buds and other growth parameters ... types of buds after four to five sub cultures in all the varieties except for CRBP 39 where the axillary bud exhibits ..... propagation, conservation and exchange.

  6. Potential Role of Meiosis Proteins in Melanoma Chromosomal Instability

    International Nuclear Information System (INIS)

    Lindsey, S. F.; Byrnes, D. M.; Eller, M. S.; Rosa, A. M.; Dabas, N.; Escandon, J.; Grichnik, J. M.; Grichnik, J. M.; Grichnik, J. M.; Grichnik, J. M.

    2013-01-01

    Melanomas demonstrate chromosomal instability (CIN). In fact, CIN can be used to differentiate melanoma from benign nevi. The exact molecular mechanisms that drive CIN in melanoma have yet to be fully elucidated. Cancer/testis antigens are a unique group of germ cell proteins that are found to be primarily expressed in melanoma as compared to benign nevi. The abnormal expression of these germ cell proteins, normally expected only in the testis and ovaries, in somatic cells may lead to interference with normal cellular pathways. Germ cell proteins that may be particularly critical in CIN are meiosis proteins. Here, we review pathways unique to meiosis with a focus on how the aberrant expression of meiosis proteins in normal mitotic cells "meiomitosis"could impact chromosomal instability in melanoma and other cancers.

  7. Peculiarities of meiosis in radiomutants of the soft wheat

    Energy Technology Data Exchange (ETDEWEB)

    Shakaryan, Zh.O.; Avakyan, V.A. (Armyanskij Sel' skokhozyajstvennyj Inst.)

    1983-10-01

    The experiment is carried out using five constant mutant lines of soft wheat with a cylindrical ear. On the basis of the study of the dynamics and character of violations in 1 and 2 divisions of meiosis in the mutants and initial sorts a conclusion can be made that inspite of the morphological homogeneity in M/sub 8/, the mutants are characteristized by different degree of heterozygosis in translocations and micromutations. The presence of a comparatively large number of multivalents in MI of the meiosis did not cause violations in the final stage of meiosis. All the mutants have normal meiotic index and formed gametes, balanced as to genetic material, which points to the possibility of growing the economically-efficient wheat mutants with a high productivity and fertility using the method of radiation mutagenesis.

  8. The peculiarities of meiosis in radiomutants of the soft wheat

    International Nuclear Information System (INIS)

    Shakaryan, Zh.O.; Avakyan, V.A.

    1983-01-01

    The experiment is carried out using five constant mutant lines of soft wheat with a cylindrical ear. On the basis of the study of the dynamics and character of violations in 1 and 2 divisions of meiosis in the mutants and initial sorts a conclusion can be made that inspite of the morphological homogeneity in M 8 , the mutants are characteristized by different degree of heterozygosis in translocations and micromutations. The presence of a comparatively large number of multivalents in MI of the meiosis did not cause violations in the final stage of meiosis. All the mutants has a normal meiotic index and formed gametes, balanced as to genetic material, which points to the possibility of growing the economically-efficient wheat mutants with a high productivity and fertility using the method of radiation mutagenesis

  9. Identification of differentially expressed sequences in bud ...

    African Journals Online (AJOL)

    The developmental process of lily flower bud differentiation has been studied in morphology thoroughly, but the mechanism in molecular biology is still ambiguous and few studies on genetic expression have been carried out. Little is known about the physiological responses of flower bud differentiation in Oriental hybrid lily ...

  10. Understanding a Basic Biological Process: Expert and Novice Models of Meiosis.

    Science.gov (United States)

    Kindfield, Ann C. H.

    The results of a study of the meiosis models utilized by individuals at varying levels of expertise while reasoning about the process of meiosis are presented. Based on these results, the issues of sources of misconceptions/difficulties and the construction of a sound understanding of meiosis are discussed. Five individuals from each of three…

  11. Students as "Humans Chromosomes" in Role-Playing Mitosis and Meiosis

    Science.gov (United States)

    Chinnici, Joseph P.; Yue, Joyce W.; Torres, Kieron M.

    2004-01-01

    Students often find it challenging to understand mitosis and meiosis and determine their processes. To develop an easier way to understand these terms, students are asked to role-play mitosis and meiosis and students themselves act as human chromosomes, which help students to learn differences between mitosis and meiosis.

  12. Effect of guaianolides in the meiosis reinitiation of amphibian oocytes.

    Science.gov (United States)

    Zapata-Martínez, J; Sánchez-Toranzo, G; Chaín, F; Catalán, C A N; Bühler, M I

    2017-02-01

    Sesquiterpene lactones (STLs) are a large and structurally diverse group of plant metabolites generally found in the Asteraceae family. STLs exhibit a wide spectrum of biological activities and it is generally accepted that their major mechanism of action is the alkylation of the thiol groups of biological molecules. The guaianolides is one of various groups of STLs. Anti-tumour and anti-migraine effects, an allergenic agent, an inhibitor of smooth muscle cells and of meristematic cell proliferation are only a few of the most commonly reported activities of STLs. In amphibians, fully grown ovarian oocytes are arrested at the beginning of meiosis I. Under stimulus with progesterone, this meiotic arrest is released and meiosis progresses to metaphase II, a process known as oocyte maturation. There are previous records of the inhibitory effect of dehydroleucodin (DhL), a guaianolide lactone, on the progression of meiosis. It has been also shown that DhL and its 11,13-dihydroderivative (2H-DhL; a mixture of epimers at C-11) act as blockers of the resumption of meiosis in fully grown ovarian oocytes from the amphibian Rhinella arenarum (formerly classified as Bufo arenarum). The aim of this study was to analyze the effect of four closely related guaianolides, i.e., DhL, achillin, desacetoxymatricarin and estafietin as possible inhibitors of meiosis in oocytes of amphibians in vitro and discuss some structure-activity relationships. It was found that the inhibitory effect on meiosis resumption is greater when the lactone has two potentially reactive centres, either a α,β-α',β'-diunsaturated cyclopentanone moiety or an epoxide group plus an exo-methylene-γ-lactone function.

  13. Selection on meiosis genes in diploid and tetraploid Arabidopsis arenosa.

    Science.gov (United States)

    Wright, Kevin M; Arnold, Brian; Xue, Katherine; Šurinová, Maria; O'Connell, Jeremy; Bomblies, Kirsten

    2015-04-01

    Meiotic chromosome segregation is critical for fertility across eukaryotes, and core meiotic processes are well conserved even between kingdoms. Nevertheless, recent work in animals has shown that at least some meiosis genes are highly diverse or strongly differentiated among populations. What drives this remains largely unknown. We previously showed that autotetraploid Arabidopsis arenosa evolved stable meiosis, likely through reduced crossover rates, and that associated with this there is strong evidence for selection in a subset of meiosis genes known to affect axis formation, synapsis, and crossover frequency. Here, we use genome-wide data to study the molecular evolution of 70 meiosis genes in a much wider sample of A. arenosa. We sample the polyploid lineage, a diploid lineage from the Carpathian Mountains, and a more distantly related diploid lineage from the adjacent, but biogeographically distinct Pannonian Basin. We find that not only did selection act on meiosis genes in the polyploid lineage but also independently on a smaller subset of meiosis genes in Pannonian diploids. Functionally related genes are targeted by selection in these distinct contexts, and in two cases, independent sweeps occurred in the same loci. The tetraploid lineage has sustained selection on more genes, has more amino acid changes in each, and these more often affect conserved or potentially functional sites. We hypothesize that Pannonian diploid and tetraploid A. arenosa experienced selection on structural proteins that mediate sister chromatid cohesion, the formation of meiotic chromosome axes, and synapsis, likely for different underlying reasons. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Elevated mutation rate during meiosis in Saccharomyces cerevisiae.

    Science.gov (United States)

    Rattray, Alison; Santoyo, Gustavo; Shafer, Brenda; Strathern, Jeffrey N

    2015-01-01

    Mutations accumulate during all stages of growth, but only germ line mutations contribute to evolution. While meiosis contributes to evolution by reassortment of parental alleles, we show here that the process itself is inherently mutagenic. We have previously shown that the DNA synthesis associated with repair of a double-strand break is about 1000-fold less accurate than S-phase synthesis. Since the process of meiosis involves many programmed DSBs, we reasoned that this repair might also be mutagenic. Indeed, in the early 1960's Magni and Von Borstel observed elevated reversion of recessive alleles during meiosis, and found that the revertants were more likely to be associated with a crossover than non-revertants, a process that they called "the meiotic effect." Here we use a forward mutation reporter (CAN1 HIS3) placed at either a meiotic recombination coldspot or hotspot near the MAT locus on Chromosome III. We find that the increased mutation rate at CAN1 (6 to 21 -fold) correlates with the underlying recombination rate at the locus. Importantly, we show that the elevated mutation rate is fully dependent upon Spo11, the protein that introduces the meiosis specific DSBs. To examine associated recombination we selected for random spores with or without a mutation in CAN1. We find that the mutations isolated this way show an increased association with recombination (crossovers, loss of crossover interference and/or increased gene conversion tracts). Polζ appears to contribute about half of the mutations induced during meiosis, but is not the only source of mutations for the meiotic effect. We see no difference in either the spectrum or distribution of mutations between mitosis and meiosis. The correlation of hotspots with elevated mutagenesis provides a mechanism for organisms to control evolution rates in a gene specific manner.

  15. The colocalization transition of homologous chromosomes at meiosis

    Science.gov (United States)

    Nicodemi, Mario; Panning, Barbara; Prisco, Antonella

    2008-06-01

    Meiosis is the specialized cell division required in sexual reproduction. During its early stages, in the mother cell nucleus, homologous chromosomes recognize each other and colocalize in a crucial step that remains one of the most mysterious of meiosis. Starting from recent discoveries on the system molecular components and interactions, we discuss a statistical mechanics model of chromosome early pairing. Binding molecules mediate long-distance interaction of special DNA recognition sequences and, if their concentration exceeds a critical threshold, they induce a spontaneous colocalization transition of chromosomes, otherwise independently diffusing.

  16. Arabidopsis SMG7 protein is required for exit from meiosis

    Czech Academy of Sciences Publication Activity Database

    Riehs, N.; Akimcheva, S.; Puizina, J.; Bulánková, P.; Idol, R.A.; Široký, Jiří; Schleiffer, A.; Schweizer, D.; Shippen, D.E.; Říha, K.

    2008-01-01

    Roč. 121, č. 13 (2008), s. 2208-2216 ISSN 0021-9533 R&D Projects: GA ČR(CZ) GA522/06/0380 Institutional research plan: CEZ:AV0Z50040507; CEZ:AV0Z50040702 Keywords : anaphase * CDK * meiosis Subject RIV: BO - Biophysics Impact factor: 6.247, year: 2008

  17. Complex regulation of sister kinetochore orientation in meiosis-I

    Indian Academy of Sciences (India)

    Kinetochores mediate chromosome movement during cell division by interacting with the spindle microtubules. Sexual reproduction necessitates the daunting task of reducing ploidy (number of chromosome sets) in the gametes, which depends upon the specialized properties of meiosis. Kinetochores have a central role in ...

  18. Meiosis and haploid gametes in the pathogen Trypanosoma brucei.

    Science.gov (United States)

    Peacock, Lori; Bailey, Mick; Carrington, Mark; Gibson, Wendy

    2014-01-20

    In eukaryote pathogens, sex is an important driving force in spreading genes for drug resistance, pathogenicity, and virulence. For the parasitic trypanosomes that cause African sleeping sickness, mating occurs during transmission by the tsetse vector and involves meiosis, but haploid gametes have not yet been identified. Here, we show that meiosis is a normal part of development in the insect salivary glands for all subspecies of Trypanosoma brucei, including the human pathogens. By observing insect-derived trypanosomes during the window of peak expression of meiosis-specific genes, we identified promastigote-like (PL) cells that interacted with each other via their flagella and underwent fusion, as visualized by the mixing of cytoplasmic red and green fluorescent proteins. PL cells had a short, wide body, a very long anterior flagellum, and either one or two kinetoplasts, but only the anterior kinetoplast was associated with the flagellum. Measurement of nuclear DNA contents showed that PL cells were haploid relative to diploid metacyclics. Trypanosomes are among the earliest diverging eukaryotes, and our results support the hypothesis that meiosis and sexual reproduction are ubiquitous in eukaryotes and likely to have been early innovations. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  19. "Dropping Your Genes." A Genetics Simulation in Meiosis, Fertilization & Reproduction.

    Science.gov (United States)

    Atkins, Thomas; Roderick, Joyce MacFall

    1991-01-01

    An activity that introduces students to the concepts of independent assortment of alleles during meiosis and gametogenesis, the richness of the variation that occurs as a result of allele recombination, and the unique phenotypes of offspring. Reproducible handouts with the directions and model chromosomes are provided. (KR)

  20. Kif4 Is Essential for Mouse Oocyte Meiosis.

    Science.gov (United States)

    Camlin, Nicole J; McLaughlin, Eileen A; Holt, Janet E

    2017-01-01

    Progression through the meiotic cell cycle must be strictly regulated in oocytes to generate viable embryos and offspring. During mitosis, the kinesin motor protein Kif4 is indispensable for chromosome condensation and separation, midzone formation and cytokinesis. Additionally, the bioactivity of Kif4 is dependent on phosphorylation via Aurora Kinase B and Cdk1, which regulate Kif4 function throughout mitosis. Here, we examine the role of Kif4 in mammalian oocyte meiosis. Kif4 localized in the cytoplasm throughout meiosis I and II, but was also observed to have a dynamic subcellular distribution, associating with both microtubules and kinetochores at different stages of development. Co-localization and proximity ligation assays revealed that the kinetochore proteins, CENP-C and Ndc80, are potential Kif4 interacting proteins. Functional analysis of Kif4 in oocytes via antisense knock-down demonstrated that this protein was not essential for meiosis I completion. However, Kif4 depleted oocytes displayed enlarged polar bodies and abnormal metaphase II spindles, indicating an essential role for this protein for correct asymmetric cell division in meiosis I. Further investigation of the phosphoregulation of meiotic Kif4 revealed that Aurora Kinase and Cdk activity is critical for Kif4 kinetochore localization and interaction with Ndc80 and CENP-C. Finally, Kif4 protein but not gene expression was found to be upregulated with age, suggesting a role for this protein in the decline of oocyte quality with age.

  1. Sperm should evolve to make female meiosis fair.

    Science.gov (United States)

    Brandvain, Yaniv; Coop, Graham

    2015-04-01

    Genomic conflicts arise when an allele gains an evolutionary advantage at a cost to organismal fitness. Oögenesis is inherently susceptible to such conflicts because alleles compete for inclusion into the egg. Alleles that distort meiosis in their favor (i.e., meiotic drivers) often decrease organismal fitness, and therefore indirectly favor the evolution of mechanisms to suppress meiotic drive. In this light, many facets of oögenesis and gametogenesis have been interpreted as mechanisms of protection against genomic outlaws. That females of many animal species do not complete meiosis until after fertilization, appears to run counter to this interpretation, because this delay provides an opportunity for sperm-acting alleles to meddle with the outcome of female meiosis and help like alleles drive in heterozygous females. Contrary to this perceived danger, the population genetic theory presented herein suggests that, in fact, sperm nearly always evolve to increase the fairness of female meiosis in the face of genomic conflicts. These results are consistent with the apparent sperm dependence of the best characterized female meiotic driversin animals. Rather than providing an opportunity for sperm collaboration in female meiotic drive, the "fertilization requirement" indirectly protects females from meiotic drivers by providing sperm an opportunity to suppress drive. © 2015 The Author(s).

  2. Piwil1 mediates meiosis during spermatogenesis in chicken.

    Science.gov (United States)

    Xu, Lu; Chang, Guobin; Ma, Teng; Wang, Hongzhi; Chen, Jing; Li, Zhiteng; Guo, Xiaomin; Wan, Fang; Ren, Lichen; Lu, Wei; Chen, Guohong

    2016-03-01

    Piwil1 mediates spermatogenesis and ensures stable cell division rates in germline cells in mammals. However, the involvement of Piwil1 in poultry spermatogenesis and meiosis is poorly understood. In the present study, we used TaqMan RT-qPCR to characterize Piwil1 mRNA expression in different types of spermatogenic cells, including primordial germ cells (PGCs), spermatogonial stem cells (SSCs), spermatogonia cells (Sa), tetraploid cells (Tp), round sperm cells (Rs), mature sperm, and in PGCs treated with retinoic acid. Our results revealed that Piwil1 is differentially expressed during spermatogenesis in chicken. Compared to PGCs, SSCs, Tp, and Sa, Rs cells presented the highest Piwil1 mRNA expression levels. Retinoic acid significantly upregulated Piwil1 and Stra8 mRNA expression as well as Piwil1 levels in chicken PGCs. In addition, retinoic acid induced PGCs to progress through all the meiotic stages, eventually leading to haploid cell formation, which was determined using flow cytometry and western blot analysis. Taken together, our results showed that during spermatogenesis, Piwil1 was first expressed at low levels in germ stem cells, PGCs, and SSCs. Its expression levels increased during later meiosis stages. Finally, no expression was detected in mature sperm after meiosis. Treatment of PGCs with retinoic acid further demonstrated that Piwil1 plays a key role in meiosis during chicken spermatogenesis. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. The DNA Triangle and Its Application to Learning Meiosis

    Science.gov (United States)

    Wright, L. Kate; Catavero, Christina M.; Newman, Dina L.

    2017-01-01

    Although instruction on meiosis is repeated many times during the undergraduate curriculum, many students show poor comprehension even as upper-level biology majors. We propose that the difficulty lies in the complexity of understanding DNA, which we explain through a new model, the DNA triangle. The "DNA triangle" integrates three…

  4. Sperm should evolve to make female meiosis fair

    Science.gov (United States)

    Brandvain, Yaniv; Coop, Graham

    2017-01-01

    Genomic conflicts arise when an allele gains an evolutionary advantage at a cost to organismal fitness. Oögenesis is inherently susceptible to such conflicts because alleles compete for inclusion into the egg. Alleles that distort meiosis in their favor (i.e. meiotic drivers) often decrease organismal fitness, and therefore indirectly favor the evolution of mechanisms to suppress meiotic drive. In this light, many facets of oögenesis and gametogenesis have been interpreted as mechanisms of protection against genomic outlaws. That females of many animal species do not complete meiosis until after fertilization, appears to run counter to this interpretation, because this delay provides an opportunity for sperm-acting alleles to meddle with the outcome of female meiosis and help like alleles drive in heterozygous females. Contrary to this perceived danger, the population genetic theory presented herein suggests that, in fact, sperm nearly always evolve to increase the fairness of female meiosis in the face of genomic conflicts. These results are consistent with the apparent sperm dependence of the best characterized female meiotic drivers in animals. Rather than providing an opportunity for sperm collaboration in female meiotic drive, the ‘fertilization requirement’ indirectly protects females from meiotic drivers by providing sperm an opportunity to suppress drive. PMID:25662355

  5. Restructuring of Holocentric Centromeres During Meiosis in the Plant Rhynchospora pubera.

    Science.gov (United States)

    Marques, André; Schubert, Veit; Houben, Andreas; Pedrosa-Harand, Andrea

    2016-10-01

    Centromeres are responsible for the correct segregation of chromosomes during mitosis and meiosis. Holocentric chromosomes, characterized by multiple centromere units along each chromatid, have particular adaptations to ensure regular disjunction during meiosis. Here we show by detecting CENH3, CENP-C, tubulin, and centromeric repeats that holocentromeres may be organized differently in mitosis and meiosis of Rhynchospora pubera Contrasting to the mitotic linear holocentromere organization, meiotic centromeres show several clusters of centromere units (cluster-holocentromeres) during meiosis I. They accumulate along the poleward surface of bivalents where spindle fibers perpendicularly attach. During meiosis II, the cluster-holocentromeres are mostly present in the midregion of each chromatid. A linear holocentromere organization is restored after meiosis during pollen mitosis. Thus, a not yet described case of a cluster-holocentromere organization, showing a clear centromere restructuration between mitosis and meiosis, was identified in a holocentric organism. Copyright © 2016 by the Genetics Society of America.

  6. Recombination homeostasis of meiosis during spermatogenesis under nicotine treatment

    Directory of Open Access Journals (Sweden)

    Zhai Jingli

    2018-01-01

    Full Text Available Cigarette smoking can affect male fertility via the quality of semen. To explore the effects of nicotine, a major component of cigarettes, on meiotic recombination during spermatogenesis, C57BL/6J male mice were injected with nicotine at a dosage of 0.2 mg/100 g body weight daily for 35 days (nicotine-treated group; mice in the control group were injected with isopycnic normal saline. According to previous expression profiles of mouse sperm, a subset of meiosis-related genes was pooled using bioinformatic analysis. Protein expression was compared between the two groups using by Western blotting and immunohistochemistry. Recombination frequency during the meiosis phase of spermatogenesis was estimated by combined use of chromosome spread and immunofluorescence staining in mouse testes. Data mining analysis indicated that 4 genes that express meiotic topoisomerase-like protein SPO11, MutS protein homolog 4 (MSH4, strand exchange protein RAD51 and MutL protein homologue 1 (MLH1, were associated with the meiosis recombination process. The results of Western blotting and immunohistochemistry further showed that the protein expression of SPO11 (0.73-fold and MSH4 (0.73-fold was downregulated in murine testes after nicotine treatment, whereas the protein expression of both RAD51 (2.06-fold and MLH1 (1.40-fold was upregulated. Unexpectedly, we did not detect a significant difference in recombination frequency in meiosis during spermatogenesis in the nicotine-treated group as compared to the control. Taken together, these results indicate that nicotine can affect the expression profile of restructuring-related genes, but it does not significantly change the recombination frequency during male meiosis. These findings suggest there is a self-regulating mechanism during meiotic chromosome restructuring in male mice that responds to environmental stress.

  7. Fingerprinting taste buds: intermediate filaments and their implication for taste bud formation.

    OpenAIRE

    Witt, M; Reutter, K; Ganchrow, D; Ganchrow, J R

    2000-01-01

    Intermediate filaments in taste organs of terrestrial (human and chick) as well as aquatic (Xenopus laevis) species were detected using immunohistochemistry and electron microscopy. During development, the potential importance of the interface between the taste bud primordium and non-gustatory adjacent tissues is evidenced by the distinct immunoreactivity of a subpopulation of taste bud cells for cytokeratins and vimentin. In human foetuses, the selective molecular marker for taste bud primor...

  8. Shrinkage of ipsilateral taste buds and hyperplasia of contralateral taste buds following chorda tympani nerve transection

    OpenAIRE

    Li, Yi-ke; Yang, Juan-mei; Huang, Yi-bo; Ren, Dong-dong; Chi, Fang-lu

    2015-01-01

    The morphological changes that occur in the taste buds after denervation are not well understood in rats, especially in the contralateral tongue epithelium. In this study, we investigated the time course of morphological changes in the taste buds following unilateral nerve transection. The role of the trigeminal component of the lingual nerve in maintaining the structural integrity of the taste buds was also examined. Twenty-four Sprague-Dawley rats were randomly divided into three groups: co...

  9. Unique properties of multiple tandem copies of the M26 recombination hotspot in mitosis and meiosis in Schizosaccharomyces pombe.

    Science.gov (United States)

    Steiner, Walter W; Recor, Chelsea L; Zakrzewski, Bethany M

    2016-11-15

    The M26 hotspot of the fission yeast Schizosaccharomyces pombe is one of the best-characterized eukaryotic hotspots of recombination. The hotspot requires a seven bp sequence, ATGACGT, that serves as a binding site for the Atf1-Pcr1 transcription factor, which is also required for activity. The M26 hotspot is active in meiosis but not mitosis and is active in some but not all chromosomal contexts and not on a plasmid. A longer palindromic version of M26, ATGACGTCAT, shows significantly greater activity than the seven bp sequence. Here, we tested whether the properties of the seven bp sequence were also true of the longer sequence by placing one, two, or three copies of the sequence into the ade6 gene, where M26 was originally discovered. These constructs were tested for activity when located on a plasmid or on a chromosome in mitosis and meiosis. We found that two copies of the 10bp M26 motif on a chromosome were significantly more active for meiotic recombination than one, but no further increase was observed with three copies. However, three copies of M26 on a chromosome created an Atf1-dependent mitotic recombination hotspot. When located on a plasmid, M26 also appears to behave as a mitotic recombination hotspot; however, this behavior most likely results from Atf1-dependent inter-allelic complementation between the plasmid and chromosomal ade6 alleles. Copyright © 2016 Elsevier B.V. All rights reserved.

  10. Non-introgressive genome chimerisation by malsegregation in autodiploidised allotetraploids during meiosis of Saccharomyces kudriavzevii x Saccharomyces uvarum hybrids.

    Science.gov (United States)

    Karanyicz, Edina; Antunovics, Zsuzsa; Kallai, Z; Sipiczki, M

    2017-06-01

    Saccharomyces strains with chimerical genomes consisting of mosaics of the genomes of different species ("natural hybrids") occur quite frequently among industrial and wine strains. The most widely endorsed hypothesis is that the mosaics are introgressions acquired via hybridisation and repeated backcrosses of the hybrids with one of the parental species. However, the interspecies hybrids are sterile, unable to mate with their parents. Here, we show by analysing synthetic Saccharomyces kudriavzevii x Saccharomyces uvarum hybrids that mosaic (chimeric) genomes can arise without introgressive backcrosses. These species are biologically separated by a double sterility barrier (sterility of allodiploids and F1 sterility of allotetraploids). F1 sterility is due to the diploidisation of the tetraploid meiosis resulting in MAT a /MAT α heterozygosity which suppresses mating in the spores. This barrier can occasionally be broken down by malsegregation of autosyndetically paired chromosomes carrying the MAT loci (loss of MAT heterozygosity). Subsequent malsegregation of additional autosyndetically paired chromosomes and occasional allosyndetic interactions chimerise the hybrid genome. Chromosomes are preferentially lost from the S. kudriavzevii subgenome. The uniparental transmission of the mitochondrial DNA to the hybrids indicates that nucleo-mitochondrial interactions might affect the direction of the genomic changes. We propose the name GARMe (Genome AutoReduction in Meiosis) for this process of genome reduction and chimerisation which involves no introgressive backcrossings. It opens a way to transfer genetic information between species and thus to get one step ahead after hybridisation in the production of yeast strains with beneficial combinations of properties of different species.

  11. Un-“ESCRT”-ed Budding

    Directory of Open Access Journals (Sweden)

    Mark Yondola

    2011-01-01

    Full Text Available In their recent publication, Rossman et al. [1] describe how the inherent budding capability of its M2 protein allows influenza A virus to bypass recruitment of the cellular ESCRT machinery enlisted by several other enveloped RNA and DNA viruses, including HIV, Ebola, rabies, herpes simplex type 1 and hepatitis B. Studies from the same laboratory [2] and other laboratories [3–6] indicate that budding of plasmid-derived virus-like particles can be mediated by the influenza virus hemagglutinin and neuraminidase proteins in the absence of M2. These events are also independent of canonical ESCRT components [2,7]. Understanding how intrinsic properties of these influenza virus proteins permit ESCRT-independent budding expands our understanding of the budding process itself.

  12. Taste buds: cells, signals and synapses.

    Science.gov (United States)

    Roper, Stephen D; Chaudhari, Nirupa

    2017-08-01

    The past decade has witnessed a consolidation and refinement of the extraordinary progress made in taste research. This Review describes recent advances in our understanding of taste receptors, taste buds, and the connections between taste buds and sensory afferent fibres. The article discusses new findings regarding the cellular mechanisms for detecting tastes, new data on the transmitters involved in taste processing and new studies that address longstanding arguments about taste coding.

  13. Single-particle tracking of quantum dot-conjugated prion proteins inside yeast cells

    Energy Technology Data Exchange (ETDEWEB)

    Tsuji, Toshikazu; Kawai-Noma, Shigeko [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan); Pack, Chan-Gi [Cellular Informatics Laboratory, RIKEN Advanced Science Institute, Wako-shi, Saitama 351-0198 (Japan); Terajima, Hideki [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan); Yajima, Junichiro; Nishizaka, Takayuki [Department of Physics, Gakushuin University, 1-5-1 Mejiro, Toshima-ku, Tokyo 171-8588 (Japan); Kinjo, Masataka [Laboratory of Molecular Cell Dynamics, Graduate School of Life Sciences, Hokkaido University, Sapporo 001-0021 (Japan); Taguchi, Hideki, E-mail: taguchi@bio.titech.ac.jp [Department of Biomolecular Engineering, Graduate School of Biosciences and Biotechnology, Tokyo Institute of Technology, B56, 4259 Nagatsuta, Midori-ku, Yokohama 226-8501 (Japan)

    2011-02-25

    Research highlights: {yields} We develop a method to track a quantum dot-conjugated protein in yeast cells. {yields} We incorporate the conjugated quantum dot proteins into yeast spheroplasts. {yields} We track the motions by conventional or 3D tracking microscopy. -- Abstract: Yeast is a model eukaryote with a variety of biological resources. Here we developed a method to track a quantum dot (QD)-conjugated protein in the budding yeast Saccharomyces cerevisiae. We chemically conjugated QDs with the yeast prion Sup35, incorporated them into yeast spheroplasts, and tracked the motions by conventional two-dimensional or three-dimensional tracking microscopy. The method paves the way toward the individual tracking of proteins of interest inside living yeast cells.

  14. Single-particle tracking of quantum dot-conjugated prion proteins inside yeast cells

    International Nuclear Information System (INIS)

    Tsuji, Toshikazu; Kawai-Noma, Shigeko; Pack, Chan-Gi; Terajima, Hideki; Yajima, Junichiro; Nishizaka, Takayuki; Kinjo, Masataka; Taguchi, Hideki

    2011-01-01

    Research highlights: → We develop a method to track a quantum dot-conjugated protein in yeast cells. → We incorporate the conjugated quantum dot proteins into yeast spheroplasts. → We track the motions by conventional or 3D tracking microscopy. -- Abstract: Yeast is a model eukaryote with a variety of biological resources. Here we developed a method to track a quantum dot (QD)-conjugated protein in the budding yeast Saccharomyces cerevisiae. We chemically conjugated QDs with the yeast prion Sup35, incorporated them into yeast spheroplasts, and tracked the motions by conventional two-dimensional or three-dimensional tracking microscopy. The method paves the way toward the individual tracking of proteins of interest inside living yeast cells.

  15. Mismatch repair proteins, meiosis, and mice: understanding the complexities of mammalian meiosis.

    Science.gov (United States)

    Svetlanov, Anton; Cohen, Paula E

    2004-05-15

    Mammalian meiosis differs from that seen in lower eukaryotes in several respects, not least of which is the added complexity of dealing with chromosomal interactions across a much larger genome (12 MB over 16 chromosome pairs in Saccharomyces cerevisiae compared to 2500 MB over 19 autosome pairs in Mus musculus). Thus, the recombination machinery, while being highly conserved through eukaryotes, has evolved to accommodate such issues to preserve genome integrity and to ensure propagation of the species. One group of highly conserved meiotic regulators is the DNA mismatch repair protein family that, as their name implies, were first identified as proteins that act to repair DNA mismatches that arise primarily during DNA replication. Their function in ensuring chromosomal integrity has also translated into a critical role for this family in meiotic recombination in most sexually reproducing organisms. In mice, targeted deletion of certain family members results in severe consequences for meiotic progression and infertility. This review will focus on the studies involving these mutant mouse models, with occasional comparison to the function of these proteins in other organisms.

  16. Comparative live-cell imaging analyses of SPA-2, BUD-6 and BNI-1 in Neurospora crassa reveal novel features of the filamentous fungal polarisome.

    Directory of Open Access Journals (Sweden)

    Alexander Lichius

    Full Text Available A key multiprotein complex involved in regulating the actin cytoskeleton and secretory machinery required for polarized growth in fungi, is the polarisome. Recognized core constituents in budding yeast are the proteins Spa2, Pea2, Aip3/Bud6, and the key effector Bni1. Multicellular fungi display a more complex polarized morphogenesis than yeasts, suggesting that the filamentous fungal polarisome might fulfill additional functions. In this study, we compared the subcellular organization and dynamics of the putative polarisome components BUD-6 and BNI-1 with those of the bona fide polarisome marker SPA-2 at various developmental stages of Neurospora crassa. All three proteins exhibited a yeast-like polarisome configuration during polarized germ tube growth, cell fusion, septal pore plugging and tip repolarization. However, the localization patterns of all three proteins showed spatiotemporally distinct characteristics during the establishment of new polar axes, septum formation and cytokinesis, and maintained hyphal tip growth. Most notably, in vegetative hyphal tips BUD-6 accumulated as a subapical cloud excluded from the Spitzenkörper (Spk, whereas BNI-1 and SPA-2 partially colocalized with the Spk and the tip apex. Novel roles during septal plugging and cytokinesis, connected to the reinitiation of tip growth upon physical injury and conidial maturation, were identified for BUD-6 and BNI-1, respectively. Phenotypic analyses of gene deletion mutants revealed additional functions for BUD-6 and BNI-1 in cell fusion regulation, and the maintenance of Spk integrity. Considered together, our findings reveal novel polarisome-independent functions of BUD-6 and BNI-1 in Neurospora, but also suggest that all three proteins cooperate at plugged septal pores, and their complex arrangement within the apical dome of mature hypha might represent a novel aspect of filamentous fungal polarisome architecture.

  17. Rec8p, a meiotic recombination and sister chromatid cohesion phosphoprotein of the Rad21p family conserved from fision yeast to humans.

    NARCIS (Netherlands)

    S. Parisi; M.J. McKay (Michael); M. Molnar; M.A. Thompson (Anne); P.J. van der Spek (Peter); E. van Drunen-Schoenmaker; R. Kanaar (Roland); E. Lehmann; J.H.J. Hoeijmakers (Jan); J. Kohli

    1999-01-01

    textabstractOur work and that of others defined mitosis-specific (Rad21 subfamily) and meiosis-specific (Rec8 subfamily) proteins involved in sister chromatid cohesion in several eukaryotes, including humans. Mutation of the fission yeast Schizosaccharomyces pombe rec8 gene was previously shown to

  18. Checkpoint independence of most DNA replication origins in fission yeast.

    Science.gov (United States)

    Mickle, Katie L; Ramanathan, Sunita; Rosebrock, Adam; Oliva, Anna; Chaudari, Amna; Yompakdee, Chulee; Scott, Donna; Leatherwood, Janet; Huberman, Joel A

    2007-12-19

    In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU), which limits the pool of deoxyribonucleoside triphosphates (dNTPs) and activates the replication checkpoint. The checkpoint-mutant cells carried deletions either of rad3 (which encodes the fission yeast homologue of ATR) or cds1 (which encodes the fission yeast homologue of Chk2). Our microarray results proved to be largely consistent with those independently obtained and recently published by three other laboratories. However, we were able to reconcile differences between the previous studies regarding the extent to which fission yeast replication origins are affected by the replication checkpoint. We found (consistent with the three previous studies after appropriate interpretation) that, in surprising contrast to budding yeast, most fission yeast origins, including both early- and late-firing origins, are not significantly affected by checkpoint mutations during replication in the presence of HU. A few origins (approximately 3%) behaved like those in budding yeast: they replicated earlier in the checkpoint mutants than in wild type. These were located primarily in the heterochromatic subtelomeric regions of chromosomes 1 and 2. Indeed, the subtelomeric regions defined by the strongest checkpoint restraint correspond precisely to previously mapped subtelomeric heterochromatin. This observation implies that subtelomeric heterochromatin in fission yeast differs from heterochromatin at centromeres, in the mating type region, and in ribosomal DNA, since these regions replicated at least as efficiently in wild-type cells as in checkpoint

  19. Checkpoint independence of most DNA replication origins in fission yeast

    Science.gov (United States)

    Mickle, Katie L; Ramanathan, Sunita; Rosebrock, Adam; Oliva, Anna; Chaudari, Amna; Yompakdee, Chulee; Scott, Donna; Leatherwood, Janet; Huberman, Joel A

    2007-01-01

    Background In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU), which limits the pool of deoxyribonucleoside triphosphates (dNTPs) and activates the replication checkpoint. The checkpoint-mutant cells carried deletions either of rad3 (which encodes the fission yeast homologue of ATR) or cds1 (which encodes the fission yeast homologue of Chk2). Results Our microarray results proved to be largely consistent with those independently obtained and recently published by three other laboratories. However, we were able to reconcile differences between the previous studies regarding the extent to which fission yeast replication origins are affected by the replication checkpoint. We found (consistent with the three previous studies after appropriate interpretation) that, in surprising contrast to budding yeast, most fission yeast origins, including both early- and late-firing origins, are not significantly affected by checkpoint mutations during replication in the presence of HU. A few origins (~3%) behaved like those in budding yeast: they replicated earlier in the checkpoint mutants than in wild type. These were located primarily in the heterochromatic subtelomeric regions of chromosomes 1 and 2. Indeed, the subtelomeric regions defined by the strongest checkpoint restraint correspond precisely to previously mapped subtelomeric heterochromatin. This observation implies that subtelomeric heterochromatin in fission yeast differs from heterochromatin at centromeres, in the mating type region, and in ribosomal DNA, since these regions replicated at least as efficiently in wild-type cells as in

  20. Checkpoint independence of most DNA replication origins in fission yeast

    Directory of Open Access Journals (Sweden)

    Scott Donna

    2007-12-01

    Full Text Available Abstract Background In budding yeast, the replication checkpoint slows progress through S phase by inhibiting replication origin firing. In mammals, the replication checkpoint inhibits both origin firing and replication fork movement. To find out which strategy is employed in the fission yeast, Schizosaccharomyces pombe, we used microarrays to investigate the use of origins by wild-type and checkpoint-mutant strains in the presence of hydroxyurea (HU, which limits the pool of deoxyribonucleoside triphosphates (dNTPs and activates the replication checkpoint. The checkpoint-mutant cells carried deletions either of rad3 (which encodes the fission yeast homologue of ATR or cds1 (which encodes the fission yeast homologue of Chk2. Results Our microarray results proved to be largely consistent with those independently obtained and recently published by three other laboratories. However, we were able to reconcile differences between the previous studies regarding the extent to which fission yeast replication origins are affected by the replication checkpoint. We found (consistent with the three previous studies after appropriate interpretation that, in surprising contrast to budding yeast, most fission yeast origins, including both early- and late-firing origins, are not significantly affected by checkpoint mutations during replication in the presence of HU. A few origins (~3% behaved like those in budding yeast: they replicated earlier in the checkpoint mutants than in wild type. These were located primarily in the heterochromatic subtelomeric regions of chromosomes 1 and 2. Indeed, the subtelomeric regions defined by the strongest checkpoint restraint correspond precisely to previously mapped subtelomeric heterochromatin. This observation implies that subtelomeric heterochromatin in fission yeast differs from heterochromatin at centromeres, in the mating type region, and in ribosomal DNA, since these regions replicated at least as efficiently in wild

  1. Replication dynamics of the yeast genome.

    Science.gov (United States)

    Raghuraman, M K; Winzeler, E A; Collingwood, D; Hunt, S; Wodicka, L; Conway, A; Lockhart, D J; Davis, R W; Brewer, B J; Fangman, W L

    2001-10-05

    Oligonucleotide microarrays were used to map the detailed topography of chromosome replication in the budding yeast Saccharomyces cerevisiae. The times of replication of thousands of sites across the genome were determined by hybridizing replicated and unreplicated DNAs, isolated at different times in S phase, to the microarrays. Origin activations take place continuously throughout S phase but with most firings near mid-S phase. Rates of replication fork movement vary greatly from region to region in the genome. The two ends of each of the 16 chromosomes are highly correlated in their times of replication. This microarray approach is readily applicable to other organisms, including humans.

  2. Complex bud architecture and cell-specific chemical patterns enable supercooling of Picea abies bud primordial

    Science.gov (United States)

    Bud primordia of Picea abies, despite a frozen shoot, stay ice free down to -50 °C by a mechanism termed supercooling whose biophysical and biochemical requirements are poorly understood. Bud architecture was assessed by 3D-reconstruction, supercooling and freezing patterns by infrared video thermog...

  3. Shrinkage of ipsilateral taste buds and hyperplasia of contralateral taste buds following chorda tympani nerve transection.

    Science.gov (United States)

    Li, Yi-Ke; Yang, Juan-Mei; Huang, Yi-Bo; Ren, Dong-Dong; Chi, Fang-Lu

    2015-06-01

    The morphological changes that occur in the taste buds after denervation are not well understood in rats, especially in the contralateral tongue epithelium. In this study, we investigated the time course of morphological changes in the taste buds following unilateral nerve transection. The role of the trigeminal component of the lingual nerve in maintaining the structural integrity of the taste buds was also examined. Twenty-four Sprague-Dawley rats were randomly divided into three groups: control, unilateral chorda tympani nerve transection and unilateral chorda tympani nerve transection + lingual nerve transection. Rats were allowed up to 42 days of recovery before being euthanized. The taste buds were visualized using a cytokeratin 8 antibody. Taste bud counts, volumes and taste receptor cell numbers were quantified and compared among groups. No significant difference was detected between the chorda tympani nerve transection and chorda tympani nerve transection + lingual nerve transection groups. Taste bud counts, volumes and taste receptor cell numbers on the ipsilateral side all decreased significantly compared with control. On the contralateral side, the number of taste buds remained unchanged over time, but they were larger, and taste receptor cells were more numerous postoperatively. There was no evidence for a role of the trigeminal branch of the lingual nerve in maintaining the structural integrity of the anterior taste buds.

  4. Shrinkage of ipsilateral taste buds and hyperplasia of contralateral taste buds following chorda tympani nerve transection

    Directory of Open Access Journals (Sweden)

    Yi-ke Li

    2015-01-01

    Full Text Available The morphological changes that occur in the taste buds after denervation are not well understood in rats, especially in the contralateral tongue epithelium. In this study, we investigated the time course of morphological changes in the taste buds following unilateral nerve transection. The role of the trigeminal component of the lingual nerve in maintaining the structural integrity of the taste buds was also examined. Twenty-four Sprague-Dawley rats were randomly divided into three groups: control, unilateral chorda tympani nerve transection and unilateral chorda tympani nerve transection + lingual nerve transection. Rats were allowed up to 42 days of recovery before being euthanized. The taste buds were visualized using a cytokeratin 8 antibody. Taste bud counts, volumes and taste receptor cell numbers were quantified and compared among groups. No significant difference was detected between the chorda tympani nerve transection and chorda tympani nerve transection + lingual nerve transection groups. Taste bud counts, volumes and taste receptor cell numbers on the ipsilateral side all decreased significantly compared with control. On the contralateral side, the number of taste buds remained unchanged over time, but they were larger, and taste receptor cells were more numerous postoperatively. There was no evidence for a role of the trigeminal branch of the lingual nerve in maintaining the structural integrity of the anterior taste buds.

  5. Radiation-induced mitotic and meiotic aneuploidy in the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Parry, J M; Sharp, D; Tippins, R S; Parry, E M

    1979-06-01

    A number of genetic systems are described which in yeast may be used to monitor the induction of chromosome aneuploidy during both mitotic and meiotic cell division. Using these systems we have been able to demonstrate the induction of both monosomic and trisomic cells in mitotically dividing cells and disomic spores in meiotically dividing cells after both UV light and X-ray exposure. The frequency of UV-light-induced monosomic colonies were reduced by post-treatment with photoreactivity light and both UV-light- and X-ray-induced monosomic colonies were reduced by liquid holding post-treatment under non-nutrient conditions. Both responses indicate an involvement of DNA-repair mechanisms in the removal of lesions which may lead to monosomy in yeast. This was further confirmed by the response of an excision-defective yeast strain which showed considerably increased sensitivity to the induction of monosomic colonies by UV-light treatment at low doses. Yeast cultures irradiated at different stages of growth showed variation in their responses to both UV-light and X-rays, cells at the exponential phase of growth show maximum sensitivity to the induction of monosomic colonies at low doses whereas stationary phase cultures showed maximum induction of monosomic colonies at high does. The frequencies of X-ray-induced chromosome aneuploidy during meiosis leading to the production of disomic spores was shown to be dependent upon the stage of meiosis at which the yeast cells were exposed to radiation. Cells which had proceeded beyond the DNA synthetic stage of meiosis were shown to produce disomic spores at considerably lower radiation doses than those cells which had only recently been inoculated into sporulation medium. The results obtained suggest that the yeast sustem may be suitable for the study of sensitivities of the various stages of meiotic cell division to the induction of chromosome aneuploidy after radiation exposure.

  6. Heteromorphic Sex Chromosomes: Navigating Meiosis without a Homologous Partner

    OpenAIRE

    Checchi, Paula M.; Engebrecht, JoAnne

    2011-01-01

    Accurate chromosome segregation during meiosis relies on homology between the maternal and paternal chromosomes. Yet by definition, sex chromosomes of the heterogametic sex lack a homologous partner. Recent studies in a number of systems have shed light on the unique meiotic behavior of heteromorphic sex chromosomes, and highlight both the commonalities and differences in divergent species. During meiotic prophase, the homology-dependent processes of pairing, synapsis, and recombination have ...

  7. TGMS in Rapeseed (Brassica napus Resulted in Aberrant Transcriptional Regulation, Asynchronous Microsporocyte Meiosis, Defective Tapetum, and Fused Sexine

    Directory of Open Access Journals (Sweden)

    Xi-Qiong Liu

    2017-07-01

    Full Text Available The thermo-sensitive genic male sterility (TGMS line SP2S is a spontaneous rapeseed mutation with several traits that are favorable for the production of two-line hybrids. To uncover the key cellular events and genetic regulation associated with TGMS expression, a combined study using cytological observation, transcriptome profiling, and gene expression analysis was conducted for SP2S and its near-isogenic line SP2F grown under warm conditions. Asynchronous microsporocyte meiosis and abnormal tapetal plastids and elaioplasts were demonstrated in the anther of SP2S. The tetrad microspore did not undergo mitosis before the cytoplasm degenerated. Delayed degradation of the tetrad wall, which led to tetrad microspore aggregation, resulted in postponement of sexine (outer layer of pollen exine formation and sexine fusion in the tetrad. The nexine (foot layer of exine was also absent. The delay of tetrad wall degradation and abnormality of the exine structure suggested that the defective tapetum lost important functions. Based on transcriptomic comparisons between young flower buds of SP2S and SP2F plants, a total of 465 differentially expressed transcripts (DETs were identified, including 303 up-regulated DETs and 162 down-regulated DETs in SP2S. Several genes encoding small RNA degrading nuclease 2, small RNA 2′-O-methyltransferase, thioredoxin reductase 2, regulatory subunit A alpha isoform of serine/threonine-protein phosphatase 2A, glycine rich protein 1A, transcription factor bHLH25, leucine-rich repeat receptor kinase At3g14840 like, and fasciclin-like arabinogalactan proteins FLA19 and FLA20 were greatly depressed in SP2S. Interestingly, a POLLENLESS3-LIKE 2 gene encoding the Arabidopsis MS5 homologous protein, which is necessary for microsporocyte meiosis, was down-regulated in SP2S. Other genes that were up-regulated in SP2S encoded glucanase A6, ethylene-responsive transcription factor 1A-like, pollen-specific SF3, stress

  8. Functions of Aurora kinase C in meiosis and cancer

    Directory of Open Access Journals (Sweden)

    Suzanne M. Quartuccio

    2015-08-01

    Full Text Available The mammalian genome encodes three Aurora kinase protein family members: A, B, and C. While Aurora kinase A (AURKA and B (AURKB are found in cells throughout the body, significant protein levels of Aurora kinase C (AURKC are limited to cells that undergo meiosis (sperm and oocyte. Despite its discovery nearly 15 years ago, we know little about the function of AURKC compared to that of the other 2 Aurora kinases. This lack of understanding can be attributed to the high sequence homology between AURKB and AURKC preventing the use of standard approaches to understand non-overlapping and meiosis I (MI-specific functions of the two kinases. Recent evidence has revealed distinct functions of AURKC in meiosis and may aid in our understanding of why chromosome segregation during MI often goes awry in oocytes. Many cancers aberrantly express AURKC, but because we do not fully understand AURKC function in its normal cellular context, it is difficult to predict the biological significance of this expression on the disease. Here, we consolidate and update what is known about AURKC signaling in meiotic cells to better understand why it has oncogenic potential.

  9. A Review of Fluorescent Proteins for Use in Yeast.

    Science.gov (United States)

    Bialecka-Fornal, Maja; Makushok, Tatyana; Rafelski, Susanne M

    2016-01-01

    The field of fluorescent proteins (FPs) is constantly developing. The use of FPs changed the field of life sciences completely, starting a new era of direct observation and quantification of cellular processes. The broad spectrum of FPs (see Fig. 1) with a wide range of characteristics allows their use in many different experiments. This review discusses the use of FPs for imaging in budding yeast (Saccharomyces cerevisiae) and fission yeast Schizosaccharomyces pombe). The information included in this review is relevant for both species unless stated otherwise.

  10. Oxytocin signaling in mouse taste buds.

    Directory of Open Access Journals (Sweden)

    Michael S Sinclair

    2010-08-01

    Full Text Available The neuropeptide, oxytocin (OXT, acts on brain circuits to inhibit food intake. Mutant mice lacking OXT (OXT knockout overconsume salty and sweet (i.e. sucrose, saccharin solutions. We asked if OXT might also act on taste buds via its receptor, OXTR.Using RT-PCR, we detected the expression of OXTR in taste buds throughout the oral cavity, but not in adjacent non-taste lingual epithelium. By immunostaining tissues from OXTR-YFP knock-in mice, we found that OXTR is expressed in a subset of Glial-like (Type I taste cells, and also in cells on the periphery of taste buds. Single-cell RT-PCR confirmed this cell-type assignment. Using Ca2+ imaging, we observed that physiologically appropriate concentrations of OXT evoked [Ca2+]i mobilization in a subset of taste cells (EC50 approximately 33 nM. OXT-evoked responses were significantly inhibited by the OXTR antagonist, L-371,257. Isolated OXT-responsive taste cells were neither Receptor (Type II nor Presynaptic (Type III cells, consistent with our immunofluorescence observations. We also investigated the source of OXT peptide that may act on taste cells. Both RT-PCR and immunostaining suggest that the OXT peptide is not produced in taste buds or in their associated nerves. Finally, we also examined the morphology of taste buds from mice that lack OXTR. Taste buds and their constituent cell types appeared very similar in mice with two, one or no copies of the OXTR gene.We conclude that OXT elicits Ca2+ signals via OXTR in murine taste buds. OXT-responsive cells are most likely a subset of Glial-like (Type I taste cells. OXT itself is not produced locally in taste tissue and is likely delivered through the circulation. Loss of OXTR does not grossly alter the morphology of any of the cell types contained in taste buds. Instead, we speculate that OXT-responsive Glial-like (Type I taste bud cells modulate taste signaling and afferent sensory output. Such modulation would complement central pathways of

  11. Oxytocin signaling in mouse taste buds.

    Science.gov (United States)

    Sinclair, Michael S; Perea-Martinez, Isabel; Dvoryanchikov, Gennady; Yoshida, Masahide; Nishimori, Katsuhiko; Roper, Stephen D; Chaudhari, Nirupa

    2010-08-05

    The neuropeptide, oxytocin (OXT), acts on brain circuits to inhibit food intake. Mutant mice lacking OXT (OXT knockout) overconsume salty and sweet (i.e. sucrose, saccharin) solutions. We asked if OXT might also act on taste buds via its receptor, OXTR. Using RT-PCR, we detected the expression of OXTR in taste buds throughout the oral cavity, but not in adjacent non-taste lingual epithelium. By immunostaining tissues from OXTR-YFP knock-in mice, we found that OXTR is expressed in a subset of Glial-like (Type I) taste cells, and also in cells on the periphery of taste buds. Single-cell RT-PCR confirmed this cell-type assignment. Using Ca2+ imaging, we observed that physiologically appropriate concentrations of OXT evoked [Ca2+]i mobilization in a subset of taste cells (EC50 approximately 33 nM). OXT-evoked responses were significantly inhibited by the OXTR antagonist, L-371,257. Isolated OXT-responsive taste cells were neither Receptor (Type II) nor Presynaptic (Type III) cells, consistent with our immunofluorescence observations. We also investigated the source of OXT peptide that may act on taste cells. Both RT-PCR and immunostaining suggest that the OXT peptide is not produced in taste buds or in their associated nerves. Finally, we also examined the morphology of taste buds from mice that lack OXTR. Taste buds and their constituent cell types appeared very similar in mice with two, one or no copies of the OXTR gene. We conclude that OXT elicits Ca2+ signals via OXTR in murine taste buds. OXT-responsive cells are most likely a subset of Glial-like (Type I) taste cells. OXT itself is not produced locally in taste tissue and is likely delivered through the circulation. Loss of OXTR does not grossly alter the morphology of any of the cell types contained in taste buds. Instead, we speculate that OXT-responsive Glial-like (Type I) taste bud cells modulate taste signaling and afferent sensory output. Such modulation would complement central pathways of appetite

  12. Taste buds as peripheral chemosensory processors.

    Science.gov (United States)

    Roper, Stephen D

    2013-01-01

    Taste buds are peripheral chemosensory organs situated in the oral cavity. Each taste bud consists of a community of 50-100 cells that interact synaptically during gustatory stimulation. At least three distinct cell types are found in mammalian taste buds - Type I cells, Receptor (Type II) cells, and Presynaptic (Type III) cells. Type I cells appear to be glial-like cells. Receptor cells express G protein-coupled taste receptors for sweet, bitter, or umami compounds. Presynaptic cells transduce acid stimuli (sour taste). Cells that sense salt (NaCl) taste have not yet been confidently identified in terms of these cell types. During gustatory stimulation, taste bud cells secrete synaptic, autocrine, and paracrine transmitters. These transmitters include ATP, acetylcholine (ACh), serotonin (5-HT), norepinephrine (NE), and GABA. Glutamate is an efferent transmitter that stimulates Presynaptic cells to release 5-HT. This chapter discusses these transmitters, which cells release them, the postsynaptic targets for the transmitters, and how cell-cell communication shapes taste bud signaling via these transmitters. Copyright © 2012 Elsevier Ltd. All rights reserved.

  13. Roles of Cohesin and Condensin in Chromosome Dynamics During Mammalian Meiosis

    OpenAIRE

    LEE, Jibak

    2013-01-01

    Meiosis is a key step for sexual reproduction in which chromosome number is halved by two successive meiotic divisions after a single round of DNA replication. In the first meiotic division (meiosis I), homologous chromosomes pair, synapse, and recombine with their partners in prophase I. As a result, homologous chromosomes are physically connected until metaphase I and then segregated from each other at the onset of anaphase I. In the subsequent second meiotic division (meiosis II), sister c...

  14. [Inverted meiosis and its place in the evolution of sexual reproduction pathways].

    Science.gov (United States)

    Bogdanov, Yu F

    2016-05-01

    Inverted meiosis is observed in plants (Cyperaceae and Juncaceae) and insects (Coccoidea, Aphididae) with holocentric chromosomes, the centromeres of which occupy from 70 to 90% of the metaphase chromosome length. In the first meiotic division (meiosis I), chiasmata are formed and rodlike bivalents orient equationally, and in anaphase I, sister chromatids segregate to the poles; the diploid chromosome number is maintained. Non-sister chromatids of homologous chromosomes remain in contact during interkinesis and prophase II and segregate in anaphase II, forming haploid chromosome sets. The segregation of sister chromatids in meiosis I was demonstrated by example of three plant species that were heterozygous for chromosomal rearrangements. In these species, sister chromatids, marked with rearrangement, segregated in anaphase I. Using fluorescent antibodies, it was demonstrated that meiotic recombination enzymes Spo11 and Rad5l, typical of canonical meiosis, functioned at the meiotic prophase I of pollen mother cells of Luzula elegance and Rhynchospora pubera. Moreover, antibodies to synaptonemal complexes proteins ASY1 and ZYP1 were visualized as filamentous structures, pointing to probable formation of synaptonemal complexes. In L. elegance, chiasmata are formed by means of chromatin threads containing satellite DNA. According to the hypothesis of the author of this review, equational division of sister chromatids at meiosis I in the organisms with inverted meiosis can be explained by the absence of specific meiotic proteins (shugoshins). These proteins are able to protect cohesins of holocentric centromeres from hydrolysis by separases at meiosis I, as occurs in the organisms with monocentric chromosomes and canonical meiosis. The basic type of inverted meiosis was described in Coccoidea and Aphididae males. In their females, the variants of parthenogenesis were also observed. Until now, the methods of molecular cytogenetics were not applied for the analysis of

  15. Engineering prokaryotic transcriptional activators as metabolite biosensors in yeast

    DEFF Research Database (Denmark)

    Skjødt, Mette Louise; Snoek, Tim; Kildegaard, Kanchana Rueksomtawin

    2016-01-01

    ,cis-muconic acid at different levels, and found that reporter gene output correlated with production. The transplantation of prokaryotic transcriptional activators into the eukaryotic chassis illustrates the potential of a hitherto untapped biosensor resource useful for biotechnological applications....... real-time monitoring of production has attracted attention. Here we applied systematic engineering of multiple parameters to search for a general biosensor design in the budding yeast Saccharomyces cerevisiae based on small-molecule binding transcriptional activators from the prokaryote superfamily...

  16. p53 Protein interacts specifically with the meiosis-specific mammalian RecA-like protein DMC1 in meiosis.

    Science.gov (United States)

    Habu, Toshiyuki; Wakabayashi, Nobunao; Yoshida, Kayo; Yomogida, Kenntaro; Nishimune, Yoshitake; Morita, Takashi

    2004-06-01

    The tumor suppressor protein p53 is specifically expressed during meiosis in spermatocytes. Subsets of p53 knockout mice exhibit testicular giant cell degenerative syndrome, which suggests p53 may be associated with meiotic cell cycle and/or DNA metabolism. Here, we show that p53 binds to the mouse meiosis-specific RecA-like protein Mus musculus DMC1 (MmDMC1). The C-terminal domain (amino acid 234-340) of MmDMC1 binds to DNA-binding domain of p53 protein. p53 might be involved in homologous recombination and/or checkpoint function by directly binding to DMC1 protein to repress genomic instability in meiotic germ cells.

  17. Evolution of cyclin-dependent kinases (CDKs) and CDK-activating kinases (CAKs): differential conservation of CAKs in yeast and metazoa.

    Science.gov (United States)

    Liu, J; Kipreos, E T

    2000-07-01

    Cyclin-dependent kinases (CDKs) function as central regulators of both the cell cycle and transcription. CDK activation depends on phosphorylation by a CDK-activating kinase (CAK). Different CAKs have been identified in budding yeast, fission yeast, and metazoans. All known CAKs belong to the extended CDK family. The sole budding yeast CAK, CAK1, and one of the two CAKs in fission yeast, csk1, have diverged considerably from other CDKs. Cell cycle regulatory components have been largely conserved in eukaryotes; however, orthologs of neither CAK1 nor csk1 have been identified in other species to date. To determine the evolutionary relationships of yeast and metazoan CAKs, we performed a phylogenetic analysis of the extended CDK family in budding yeast, fission yeast, humans, the fruit fly Drosophila melanogaster, and the nematode Caenorhabditis elegans. We observed that there were 10 clades for CDK-related genes, of which seven appeared ancestral, containing both yeast and metazoan genes. The four clades that contain CDKs that regulate transcription by phosphorylating the carboxyl-terminal domain (CTD) of RNA Polymerase II generally have only a single orthologous gene in each species of yeast and metazoans. In contrast, the ancestral cell cycle CDK (analogous to budding yeast CDC28) gave rise to a number of genes in metazoans, as did the ancestor of budding yeast PHO85. One ancestral clade is unique in that there are fission yeast and metazoan members, but there is no budding yeast ortholog, suggesting that it was lost subsequent to evolutionary divergence. Interestingly, CAK1 and csk1 branch together with high bootstrap support values. We used both the relative apparent synapomorphy analysis (RASA) method in combination with the S-F method of sampling reduced character sets and gamma-corrected distance methods to confirm that the CAK1/csk1 association was not an artifact of long-branch attraction. This result suggests that CAK1 and csk1 are orthologs and that a

  18. Identification and Quality Assessment of Chrysanthemum Buds by CE Fingerprinting

    Directory of Open Access Journals (Sweden)

    Xiaoping Xing

    2015-01-01

    Full Text Available A simple and efficient fingerprinting method for chrysanthemum buds was developed with the aim of establishing a quality control protocol based on biochemical makeup. Chrysanthemum bud samples were successively extracted by water and alcohol. The fingerprints of the chrysanthemum buds samples were obtained using capillary electrophoresis and electrochemical detection (CE-ED employing copper and carbon working electrodes to capture all of the chemical information. 10 batches of chrysanthemum buds were collected from different regions and various factories to establish the baseline fingerprint. The experimental data of 10 batches electropherogram buds by CE were analyzed by correlation coefficient and the included angle cosine methods. A standard chrysanthemum bud fingerprint including 24 common peaks was established, 12 from each electrode, which was successfully applied to identify and distinguish between chrysanthemum buds from 2 other chrysanthemum species. These results demonstrate that fingerprint analysis can be used as an important criterion for chrysanthemum buds quality control.

  19. Unraveling the proteomic profile of mice testis during the initiation of meiosis.

    Science.gov (United States)

    Shao, Binbin; Guo, Yueshuai; Wang, Lei; Zhou, Quan; Gao, Tingting; Zheng, Bo; Zheng, Haoyu; Zhou, Tao; Zhou, Zuomin; Guo, Xuejiang; Huang, Xiaoyan; Sha, Jiahao

    2015-04-29

    In mice, once primordial germ cells (PGCs) are generated, they continue to proliferate and migrate to eventually reach the future gonads. They initiate sexual differentiation after their colonization of the gonads. During this process, retinoic acid (RA) induces meiosis in the female germ cells, which proceeds to the diplotene stage of meiotic prophase I, whereas the male germ cells initiate growth arrest. After birth, meiosis is initiated in mice spermatogonia by their conversion to preleptotene spermatocytes. There are evidences showing the roles of RA in the regulation of spermatogonial differentiation and meiosis initiation. However, it is still not well known on what responds to RA and how RA signaling engages meiosis. Thus, we constructed a proteomic profile of proteins associated with meiosis onset during testis development in mouse and identified 104 differentially expressed proteins (≥1.5 folds). Bioinformatic analysis showed proteins functioning in specific cell processes. The expression patterns of five selected proteins were verified via Western blot, of which we found that Tfrc gene was RA responsive, with a RA responsive element, and could be up regulated by RA in spermatogonial stem cell (SSC) line. Taken together, the results provide an important reference profile for further functional study of meiosis initiation. Spermatogenesis involves mitosis of spermatogonia, meiosis of spermatocytes and spermiogenesis, in which meiosis is a unique event to germ cells, and not in the somatic cells. Till now, the detailed molecular mechanisms of the transition from mitosis to meiosis are still not elucidated. With high-throughput proteomic technology, it is now possible to systemically identify proteins possibly involved. With TMT-6plex based quantification, we identified 104 proteins differentially between testes without meiosis (day 8.5) and those that were meiosis initiated (day 10.5). And a well-known protein essential for meiosis initiation, stra8, was

  20. Quantitative analysis of developing epiglottal taste buds in sheep.

    OpenAIRE

    Bradley, R M; Cheal, M L; Kim, Y H

    1980-01-01

    Epiglottal taste buds of the sheep increase in number during development, and continue to increase until the epiglottis has reached its adult size. However, since the increase in taste bud numbers is paralleled by increase in the surface area of the epiglottis, the density of taste buds decreases progressively in the fetus and newborn. After birth the density remains relatively constant. From examination of the morphological stages of epiglottal taste bud development, we conclude that taste b...

  1. Prions in yeast

    OpenAIRE

    Bezdíčka, Martin

    2013-01-01

    The thesis describes yeast prions and their biological effects on yeast in general. It defines the basic characteristics of yeast prions, that distinguish prions from other proteins. The thesis introduces various possibilities of prion formation, and propagation as well as specific types of yeast prions, including various functions of most studied types of prions. The thesis also focuses on chaperones that affect the state of yeast prions in cells. Lastly, the thesis indicates similarities be...

  2. Genomewide identification of pheromone-targeted transcription in fission yeast

    Directory of Open Access Journals (Sweden)

    Wright Anthony

    2006-11-01

    Full Text Available Abstract Background Fission yeast cells undergo sexual differentiation in response to nitrogen starvation. In this process haploid M and P cells first mate to form diploid zygotes, which then enter meiosis and sporulate. Prior to mating, M and P cells communicate with diffusible mating pheromones that activate a signal transduction pathway in the opposite cell type. The pheromone signalling orchestrates mating and is also required for entry into meiosis. Results Here we use DNA microarrays to identify genes that are induced by M-factor in P cells and by P-factor in M-cells. The use of a cyr1 genetic background allowed us to study pheromone signalling independently of nitrogen starvation. We identified a total of 163 genes that were consistently induced more than two-fold by pheromone stimulation. Gene disruption experiments demonstrated the involvement of newly discovered pheromone-induced genes in the differentiation process. We have mapped Gene Ontology (GO categories specifically associated with pheromone induction. A direct comparison of the M- and P-factor induced expression pattern allowed us to identify cell-type specific transcripts, including three new M-specific genes and one new P-specific gene. Conclusion We found that the pheromone response was very similar in M and P cells. Surprisingly, pheromone control extended to genes fulfilling their function well beyond the point of entry into meiosis, including numerous genes required for meiotic recombination. Our results suggest that the Ste11 transcription factor is responsible for the majority of pheromone-induced transcription. Finally, most cell-type specific genes now appear to be identified in fission yeast.

  3. Overhead irrigation increased winter chilling and floral bud ...

    African Journals Online (AJOL)

    Eucalyptus nitens requires a sufficiently cold winter to produce flower buds. In areas in South Africa where E. nitens commercial plantations as well as breeding and production seed orchards are located, winter chilling is often insufficient for floral bud initiation. Hence, under such conditions, E. nitens floral bud and seed ...

  4. Taste buds in the palatal mucosa of snakes | Berkhoudt | African ...

    African Journals Online (AJOL)

    An examination of the oral mucosa of Crotalus and several Scolecophidia revealed the presence of taste buds. The taste buds in these two divergent groups of snakes are similar in appearance, and correspond to previous descriptions of gustatory organs in other reptiles. Few taste buds were present in any specimen, and ...

  5. Sprouting of dormant buds on border trees

    Science.gov (United States)

    G.R., Jr. Trimble; H. Clay Smith; H. Clay Smith

    1970-01-01

    As part of an evaluation of silvicultura1 systems used in managing Appalachian hardwoods, we are studying degrade of border trees surrounding harvest-cut openings made in the patch cutting and group selection systems. One facet of this research dealt with determining what portion of visually evident dormant buds on border tree boles sprouted when the openings were cut...

  6. thidiazuron improves adventitious bud and shoot regeneration

    African Journals Online (AJOL)

    Prof. Adipala Ekwamu

    Induction of adventitious buds and shoots from intact leaves and stem internode segments of two recalcitrant. Ugandan sweetpotato (Ipomoea batatas L.) cultivars was investigated in vitro on Murashige and Skoog (MS) medium, supplemented with 3 different levels (0.5, 2.0 and 4.0 µM) of Thidiazuron (TDZ). Shoots were.

  7. Immunohistochemical Analysis of Human Vallate Taste Buds.

    Science.gov (United States)

    Tizzano, Marco; Grigereit, Laura; Shultz, Nicole; Clary, Matthew S; Finger, Thomas E

    2015-11-01

    The morphology of the vallate papillae from postmortem human samples was investigated with immunohistochemistry. Microscopically, taste buds were present along the inner wall of the papilla, and in some cases in the outer wall as well. The typical taste cell markers PLCβ2, GNAT3 (gustducin) and the T1R3 receptor stain elongated cells in human taste buds consistent with the Type II cells in rodents. In the human tissue, taste bud cells that stain with Type II cell markers, PLCβ2 and GNAT3, also stain with villin antibody. Two typical immunochemical markers for Type III taste cells in rodents, PGP9.5 and SNAP25, fail to stain any taste bud cells in the human postmortem tissue, although these antibodies do stain numerous nerve fibers throughout the specimen. Car4, another Type III cell marker, reacted with only a few taste cells in our samples. Finally, human vallate papillae have a general network of innervation similar to rodents and antibodies directed against SNAP25, PGP9.5, acetylated tubulin and P2X3 all stain free perigemmal nerve endings as well as intragemmal taste fibers. We conclude that with the exception of certain molecular features of Type III cells, human vallate papillae share the structural, morphological, and molecular features observed in rodents. © The Author 2015. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Radiation effects on bovine taste bud membranes

    International Nuclear Information System (INIS)

    Shatzman, A.R.; Mossman, K.L.

    1982-01-01

    In order to investigate the mechanisms of radiation-induced taste loss, the effects of radiation on preparations of enriched bovine taste bud membranes were studied. Taste buds containing circumvallate papilae, and surrounding control epithelial tissues devoid of taste buds, were obtained from steers and given radiation doses of 0-7000 cGy (rad). Tissue fractions were isolated into membrane-enriched and heterogeneous components using differential and sucrose gradient centrifugation of tissue homogenates. The yield of membranes, as measured by protein content in the buoyant membrane-enriched fractions, was reduced in quantity with increasing radiation dose. The relation between radiation dose and membrane quantity in membrane-enriched fractions could be fit by a simple exponential model with taste bud-derived membranes twice as radiosensitive as membranes from control epithelial tissue. Binding of sucrose, sodium, and acetate and fluoride stimulation of adenylate cyclase were nearly identical in both irradiated and nonirradiated intact membranes. Radiation had no effect on fractions of heterogeneous components. While it is not clear what changes are occurring in enriched taste cell membranes, damage to membranes may play an important role in the taste loss observed in patients following radiotherapy

  9. Effect of temperature on development and growth potential of axillary buds in roses

    NARCIS (Netherlands)

    Marcelis-van Acker, C.A.M.

    1995-01-01

    The effect of temperature during axillary bud formation on axillary bud development and subsequent shoot growth was investigated. Growth potential of the axillary buds was studied either in situ, by pruning the parent shoot above the bud, or in isolation, by grafting the bud or by culturing the bud

  10. Ontogeny of axillary buds and shoots in roses: Leaf initiation and pith development.

    NARCIS (Netherlands)

    Marcelis-van Acker, C.A.M.

    1994-01-01

    The ontogeny of an axillary bud (in the middle region of a shoot) from initiation up to flowering of the subsequent shoot was studied. The first secondary buds appeared in the axillary bud (primary bud) when the leaf subtending the primary bud unfolded. By that time, the primary bud contained seven

  11. An Interactive Modeling Lesson Increases Students' Understanding of Ploidy during Meiosis

    Science.gov (United States)

    Wright, L. Kate; Newman, Dina L.

    2011-01-01

    Chromosome structure is confusing to students at all levels, and chromosome behavior during meiosis is a notoriously difficult topic. Undergraduate biology majors are exposed to the process of meiosis numerous times during their presecondary and postsecondary education, yet understanding of key concepts, such as the point at which haploidy is…

  12. First-Year Biology Students' Understandings of Meiosis: An Investigation Using a Structural Theoretical Framework

    Science.gov (United States)

    Quinn, Frances; Pegg, John; Panizzon, Debra

    2009-01-01

    Meiosis is a biological concept that is both complex and important for students to learn. This study aims to explore first-year biology students' explanations of the process of meiosis, using an explicit theoretical framework provided by the Structure of the Observed Learning Outcome (SOLO) model. The research was based on responses of 334…

  13. Meiosis I chromosome segregation is established through regulation of microtubule–kinetochore interactions

    Science.gov (United States)

    Miller, Matthew P; Ünal, Elçin; Brar, Gloria A; Amon, Angelika

    2012-01-01

    During meiosis, a single round of DNA replication is followed by two consecutive rounds of nuclear divisions called meiosis I and meiosis II. In meiosis I, homologous chromosomes segregate, while sister chromatids remain together. Determining how this unusual chromosome segregation behavior is established is central to understanding germ cell development. Here we show that preventing microtubule–kinetochore interactions during premeiotic S phase and prophase I is essential for establishing the meiosis I chromosome segregation pattern. Premature interactions of kinetochores with microtubules transform meiosis I into a mitosis-like division by disrupting two key meiosis I events: coorientation of sister kinetochores and protection of centromeric cohesin removal from chromosomes. Furthermore we find that restricting outer kinetochore assembly contributes to preventing premature engagement of microtubules with kinetochores. We propose that inhibition of microtubule–kinetochore interactions during premeiotic S phase and prophase I is central to establishing the unique meiosis I chromosome segregation pattern. DOI: http://dx.doi.org/10.7554/eLife.00117.001 PMID:23275833

  14. Meiosis in oocytes: predisposition to aneuploidy and its increased incidence with age.

    Science.gov (United States)

    Jones, Keith T

    2008-01-01

    Mammalian oocytes begin meiosis in the fetal ovary, but only complete it when fertilized in the adult reproductive tract. This review examines the cell biology of this protracted process: from entry of primordial germ cells into meiosis to conception. The defining feature of meiosis is two consecutive cell divisions (meiosis I and II) and two cell cycle arrests: at the germinal vesicle (GV), dictyate stage of prophase I and at metaphase II. These arrests are spanned by three key events, the focus of this review: (i) passage from mitosis to GV arrest during fetal life, regulated by retinoic acid; (ii) passage through meiosis I and (iii) completion of meiosis II following fertilization, both meiotic divisions being regulated by cyclin-dependent kinase (CDK1) activity. Meiosis I in human oocytes is associated with an age-related high rate of chromosomal mis-segregation, such as trisomy 21 (Down's syndrome), resulting in aneuploid conceptuses. Although aneuploidy is likely to be multifactorial, oocytes from older women may be predisposed to be becoming aneuploid as a consequence of an age-long decline in the cohesive ties holding chromosomes together. Such loss goes undetected by the oocyte during meiosis I either because its ability to respond and block division also deteriorates with age, or as a consequence of being inherently unable to respond to the types of segregation defects induced by cohesion loss.

  15. Dysregulation of the mitosis-meiosis switch in testicular carcinoma in situ

    DEFF Research Database (Denmark)

    Jørgensen, Anne; Nielsen, John E; Almstrup, Kristian

    2013-01-01

    , except in spermatocytic seminoma (not derived from CIS). In conclusion, this study indicates that meiosis signalling is dysregulated in CIS cells and that a key regulator of the mitosis-meiosis switch, DMRT1, is expressed in 'early-stage' CIS cells but is down-regulated with further invasive...

  16. TACC3 Is Important for Correct Progression of Meiosis in Bovine Oocytes

    NARCIS (Netherlands)

    Mahdipour, Mahdi; Leitoguinho, Ana Rita Canhoto; Zacarias Silva, Ricardo A; van Tol, Helena T A; Stout, Tom A E; Rodrigues, Gabriela; Roelen, Bernard A J

    2015-01-01

    Transforming acidic coiled-coil (TACC) proteins are key players during mitosis via stabilization of the spindle. The roles of TACCs during meiosis are however less clear. We used bovine oocytes to study the expression and function of TACC3 during meiosis. TACC3 mRNA was detected in bovine oocytes

  17. Characterisation of the nascent polypeptide-associated complex in fission yeast

    DEFF Research Database (Denmark)

    Andersen, Katrine M; Semple, Colin A; Hartmann-Petersen, Rasmus

    2007-01-01

    with other cell proteins, but has also been found to associate with DNA junctions, and to be involved in other processes including transcription regulation and mitochondrial protein import.Here, we characterize NAC in fission yeast. We find that NAC is associated with ribosomes, while a significant fraction...... defects in protein degradation. Accordingly, we find that the NAC UBA domain belongs to an ancient and distinct subgroup of the UBA family. In contrast to the situation with budding yeast, fission yeast cells devoid of NAC were not temperature sensitive. However, they displayed resistance to the amino...

  18. Mouse TRIP13/PCH2 Is Required for Recombination and Normal Higher-Order Chromosome Structure during Meiosis

    NARCIS (Netherlands)

    Roig, I.; Dowdle, J.A.; Toth, A.; de Rooij, D.G.; Jasin, M.; Keeney, S.

    2010-01-01

    Accurate chromosome segregation during meiosis requires that homologous chromosomes pair and become physically connected so that they can orient properly on the meiosis I spindle. These connections are formed by homologous recombination closely integrated with the development of meiosis-specific,

  19. Mps1 kinase-dependent Sgo2 centromere localisation mediates cohesin protection in mouse oocyte meiosis I

    NARCIS (Netherlands)

    Yakoubi, W. El; Buffin, E.; Cladiere, D.; Gryaznova, Y.; Berenguer, I.; Touati, S.A.; Gomez, R.; Suja, J.A.; Deursen, J.M.A. van; Wassmann, K.

    2017-01-01

    A key feature of meiosis is the step-wise removal of cohesin, the protein complex holding sister chromatids together, first from arms in meiosis I and then from the centromere region in meiosis II. Centromeric cohesin is protected by Sgo2 from Separase-mediated cleavage, in order to maintain sister

  20. Lipid raft involvement in yeast cell growth and death

    Energy Technology Data Exchange (ETDEWEB)

    Mollinedo, Faustino, E-mail: fmollin@usal.es [Instituto de Biología Molecular y Celular del Cáncer, Centro de Investigación del Cáncer, Consejo Superior de Investigaciones Científicas - Universidad de Salamanca, Salamanca (Spain)

    2012-10-10

    The notion that cellular membranes contain distinct microdomains, acting as scaffolds for signal transduction processes, has gained considerable momentum. In particular, a class of such domains that is rich in sphingolipids and cholesterol, termed as lipid rafts, is thought to compartmentalize the plasma membrane, and to have important roles in survival and cell death signaling in mammalian cells. Likewise, yeast lipid rafts are membrane domains enriched in sphingolipids and ergosterol, the yeast counterpart of mammalian cholesterol. Sterol-rich membrane domains have been identified in several fungal species, including the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe as well as the pathogens Candida albicans and Cryptococcus neoformans. Yeast rafts have been mainly involved in membrane trafficking, but increasing evidence implicates rafts in a wide range of additional cellular processes. Yeast lipid rafts house biologically important proteins involved in the proper function of yeast, such as proteins that control Na{sup +}, K{sup +}, and pH homeostasis, which influence many cellular processes, including cell growth and death. Membrane raft constituents affect drug susceptibility, and drugs interacting with sterols alter raft composition and membrane integrity, leading to yeast cell death. Because of the genetic tractability of yeast, analysis of yeast rafts could be an excellent model to approach unanswered questions of mammalian raft biology, and to understand the role of lipid rafts in the regulation of cell death and survival in human cells. A better insight in raft biology might lead to envisage new raft-mediated approaches to the treatment of human diseases where regulation of cell death and survival is critical, such as cancer and neurodegenerative diseases.

  1. Lipid raft involvement in yeast cell growth and death

    International Nuclear Information System (INIS)

    Mollinedo, Faustino

    2012-01-01

    The notion that cellular membranes contain distinct microdomains, acting as scaffolds for signal transduction processes, has gained considerable momentum. In particular, a class of such domains that is rich in sphingolipids and cholesterol, termed as lipid rafts, is thought to compartmentalize the plasma membrane, and to have important roles in survival and cell death signaling in mammalian cells. Likewise, yeast lipid rafts are membrane domains enriched in sphingolipids and ergosterol, the yeast counterpart of mammalian cholesterol. Sterol-rich membrane domains have been identified in several fungal species, including the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe as well as the pathogens Candida albicans and Cryptococcus neoformans. Yeast rafts have been mainly involved in membrane trafficking, but increasing evidence implicates rafts in a wide range of additional cellular processes. Yeast lipid rafts house biologically important proteins involved in the proper function of yeast, such as proteins that control Na + , K + , and pH homeostasis, which influence many cellular processes, including cell growth and death. Membrane raft constituents affect drug susceptibility, and drugs interacting with sterols alter raft composition and membrane integrity, leading to yeast cell death. Because of the genetic tractability of yeast, analysis of yeast rafts could be an excellent model to approach unanswered questions of mammalian raft biology, and to understand the role of lipid rafts in the regulation of cell death and survival in human cells. A better insight in raft biology might lead to envisage new raft-mediated approaches to the treatment of human diseases where regulation of cell death and survival is critical, such as cancer and neurodegenerative diseases.

  2. Taste Bud-Derived BDNF Is Required to Maintain Normal Amounts of Innervation to Adult Taste Buds123

    Science.gov (United States)

    Meng, Lingbin; Ohman-Gault, Lisa; Ma, Liqun

    2015-01-01

    Abstract Gustatory neurons transmit chemical information from taste receptor cells, which reside in taste buds in the oral cavity, to the brain. As adult taste receptor cells are renewed at a constant rate, nerve fibers must reconnect with new taste receptor cells as they arise. Therefore, the maintenance of gustatory innervation to the taste bud is an active process. Understanding how this process is regulated is a fundamental concern of gustatory system biology. We speculated that because brain-derived neurotrophic factor (BDNF) is required for taste bud innervation during development, it might function to maintain innervation during adulthood. If so, taste buds should lose innervation when Bdnf is deleted in adult mice. To test this idea, we first removed Bdnf from all cells in adulthood using transgenic mice with inducible CreERT2 under the control of the Ubiquitin promoter. When Bdnf was removed, approximately one-half of the innervation to taste buds was lost, and taste buds became smaller because of the loss of taste bud cells. Individual taste buds varied in the amount of innervation each lost, and those that lost the most innervation also lost the most taste bud cells. We then tested the idea that that the taste bud was the source of this BDNF by reducing Bdnf levels specifically in the lingual epithelium and taste buds. Taste buds were confirmed as the source of BDNF regulating innervation. We conclude that BDNF expressed in taste receptor cells is required to maintain normal levels of innervation in adulthood. PMID:26730405

  3. Taste Bud-Derived BDNF Is Required to Maintain Normal Amounts of Innervation to Adult Taste Buds.

    Science.gov (United States)

    Meng, Lingbin; Ohman-Gault, Lisa; Ma, Liqun; Krimm, Robin F

    2015-01-01

    Gustatory neurons transmit chemical information from taste receptor cells, which reside in taste buds in the oral cavity, to the brain. As adult taste receptor cells are renewed at a constant rate, nerve fibers must reconnect with new taste receptor cells as they arise. Therefore, the maintenance of gustatory innervation to the taste bud is an active process. Understanding how this process is regulated is a fundamental concern of gustatory system biology. We speculated that because brain-derived neurotrophic factor (BDNF) is required for taste bud innervation during development, it might function to maintain innervation during adulthood. If so, taste buds should lose innervation when Bdnf is deleted in adult mice. To test this idea, we first removed Bdnf from all cells in adulthood using transgenic mice with inducible CreERT2 under the control of the Ubiquitin promoter. When Bdnf was removed, approximately one-half of the innervation to taste buds was lost, and taste buds became smaller because of the loss of taste bud cells. Individual taste buds varied in the amount of innervation each lost, and those that lost the most innervation also lost the most taste bud cells. We then tested the idea that that the taste bud was the source of this BDNF by reducing Bdnf levels specifically in the lingual epithelium and taste buds. Taste buds were confirmed as the source of BDNF regulating innervation. We conclude that BDNF expressed in taste receptor cells is required to maintain normal levels of innervation in adulthood.

  4. Discrete innervation of murine taste buds by peripheral taste neurons.

    Science.gov (United States)

    Zaidi, Faisal N; Whitehead, Mark C

    2006-08-09

    The peripheral taste system likely maintains a specific relationship between ganglion cells that signal a particular taste quality and taste bud cells responsive to that quality. We have explored a measure of the receptoneural relationship in the mouse. By injecting single fungiform taste buds with lipophilic retrograde neuroanatomical markers, the number of labeled geniculate ganglion cells innervating single buds on the tongue were identified. We found that three to five ganglion cells innervate a single bud. Injecting neighboring buds with different color markers showed that the buds are primarily innervated by separate populations of geniculate cells (i.e., multiply labeled ganglion cells are rare). In other words, each taste bud is innervated by a population of neurons that only connects with that bud. Palate bud injections revealed a similar, relatively exclusive receptoneural relationship. Injecting buds in different regions of the tongue did not reveal a topographic representation of buds in the geniculate ganglion, despite a stereotyped patterned arrangement of fungiform buds as rows and columns on the tongue. However, ganglion cells innervating the tongue and palate were differentially concentrated in lateral and rostral regions of the ganglion, respectively. The principal finding that small groups of ganglion cells send sensory fibers that converge selectively on a single bud is a new-found measure of specific matching between the two principal cellular elements of the mouse peripheral taste system. Repetition of the experiments in the hamster showed a more divergent innervation of buds in this species. The results indicate that whatever taste quality is signaled by a murine geniculate ganglion neuron, that signal reflects the activity of cells in a single taste bud.

  5. Traits and meiosis in mutant of impatiens balsamina induced by space treatment

    International Nuclear Information System (INIS)

    Tang Zesheng; Yang Jun; Zhao Yan; Yuan Haiyun

    2004-01-01

    A mutant of Impatiens balsamina was obtained after space induction, and its traits and meiosis were investigated. Characters such as color and form of the mutant expressed great variation. Observation of meiosis showed that most of pollen mother cells were normal in meiosis phase I, except the disproportion of chromosomal segregation, lagging chromosome and dispersal chromosome in anaphase I. Most pollen mother cells developed into microspores tetrad after meiosis, but paraspores also appeared. The number of chromosome in microspore varied from 1 to 21, even more than 30. The shape and size of the microspores fluctuated apparently, and the size of the microspores was in positive correlation to chromosome number. When staining with iodic solution, most of the pollens showed sterility, which was in consistence with the low setting percentage of the mutant plant. It was thought that space induction caused the variation of size, fertility and the abnormal meiosis

  6. Processing umami and other tastes in mammalian taste buds.

    Science.gov (United States)

    Roper, Stephen D; Chaudhari, Nirupa

    2009-07-01

    Neuroscientists are now coming to appreciate that a significant degree of information processing occurs in the peripheral sensory organs of taste prior to signals propagating to the brain. Gustatory stimulation causes taste bud cells to secrete neurotransmitters that act on adjacent taste bud cells (paracrine transmitters) as well as on primary sensory afferent fibers (neurocrine transmitters). Paracrine transmission, representing cell-cell communication within the taste bud, has the potential to shape the final signal output that taste buds transmit to the brain. The following paragraphs summarize current thinking about how taste signals generally, and umami taste in particular, are processed in taste buds.

  7. Plk1 is essential for proper chromosome segregation during meiosis I/meiosis II transition in pig oocytes.

    Science.gov (United States)

    Zhang, Zixiao; Chen, Changchao; Ma, Liying; Yu, Qiuchen; Li, Shuai; Abbasi, Benazir; Yang, Jiayi; Rui, Rong; Ju, Shiqiang

    2017-08-29

    Polo-like kinase 1 (Plk1), as a characteristic regulator in meiosis, organizes multiple biological events of cell division. Although Plk1 has been implicated in various functions in somatic cell mitotic processes, considerably less is known regarding its function during the transition from metaphase I (MI) to metaphase II (MII) stage in oocyte meiotic progression. In this study, the possible role of Plk1 during the MI-to-MII stage transition in pig oocytes was addressed. Initially, the spatiotemporal expression and subcellular localization pattern of Plk1 were revealed in pig oocytes from MI to MII stage using indirect immunofluorescence and confocal microscopy imaging techniques combined with western blot analyses. Moreover, a highly selective Plk1 inhibitor, GSK461364, was used to determine the potential role of Plk1 during this MI-to-MII transition progression. Upon expression, Plk1 exhibited a specific dynamic intracellular localization, and co-localization of Plk1 with α-tubulin was revealed in the meiotic spindle of pig oocyte during the transition from MI to MII stage. GSK461364 treatment significantly blocked the first polar body (pbI) emission in a dose-dependent manner and resulted in a failure of meiotic maturation, with a larger percentage of the GSK461364-treated oocytes arresting in the anaphase-telophase I (ATI) stage. Further subcellular structure examination results showed that inhibition of Plk1 with GSK461364 had no visible effect on spindle assembly but caused a significantly higher proportion of the treated oocytes to have obvious defects in homologous chromosome segregation at ATI stage. Thus, these results indicate that Plk1 plays an essential role during the meiosis I/meiosis II transition in porcine oocytes, and the regulation is associated with Plk1's effects on homologous chromosome segregation in the ATI stage.

  8. Genome scale models of yeast: towards standardized evaluation and consistent omic integration

    DEFF Research Database (Denmark)

    Sanchez, Benjamin J.; Nielsen, Jens

    2015-01-01

    Genome scale models (GEMs) have enabled remarkable advances in systems biology, acting as functional databases of metabolism, and as scaffolds for the contextualization of high-throughput data. In the case of Saccharomyces cerevisiae (budding yeast), several GEMs have been published and are curre......Genome scale models (GEMs) have enabled remarkable advances in systems biology, acting as functional databases of metabolism, and as scaffolds for the contextualization of high-throughput data. In the case of Saccharomyces cerevisiae (budding yeast), several GEMs have been published...... in which all levels of omics data (from gene expression to flux) have been integrated in yeast GEMs. Relevant conclusions and current challenges for both GEM evaluation and omic integration are highlighted....

  9. Volumetry of human taste buds using laser scanning microscopy.

    Science.gov (United States)

    Just, T; Srur, E; Stachs, O; Pau, H W

    2009-10-01

    In vivo laser scanning confocal microscopy is a relatively new, non-invasive method for assessment of oral cavity epithelia. The penetration depth of approximately 200-400 microm allows visualisation of fungiform papillae and their taste buds. This paper describes the technique of in vivo volumetry of human taste buds. Confocal laser scanning microscopy used a diode laser at 670 nm for illumination. Digital laser scanning confocal microscopy equipment consisted of the Heidelberg Retina Tomograph HRTII and the Rostock Cornea Module. Volume scans of fungiform papillae were used for three-dimensional reconstruction of the taste bud. This technique supplied information on taste bud structure and enabled measurement and calculation of taste bud volume. Volumetric data from a 23-year-old man over a nine-day period showed only a small deviation in values. After three to four weeks, phenomenological changes in taste bud structures were found (i.e. a significant increase in volume, followed by disappearance of the taste bud and appearance of a new taste bud). The data obtained indicate the potential application of this non-invasive imaging modality: to evaluate variation of taste bud volume in human fungiform papillae with ageing; to study the effects of chorda tympani nerve transection on taste bud volume; and to demonstrate recovery of taste buds in patients with a severed chorda tympani nerve who show recovery of gustatory sensibility after surgery.

  10. Observing meiosis in filamentous fungi: Sordaria and Neurospora.

    Science.gov (United States)

    Zickler, Denise

    2009-01-01

    The filamentous fungi Neurospora crassa and Sordaria macrospora are materials of choice for recombination studies because each of the DNA strands involved in meiosis can be visually analyzed using spore-color mutants. Well-advanced molecular genetic methodologies have been developed for each of these fungi, and several mutants defective in recombination and/or pairing are available. Moreover, the complete genome sequence of N. crassa has made it possible to clone virtually any gene involved in their life cycle. Both fungi provide also a particularly attractive experimental system for cytological analysis of meiosis: stages can be determined independently of chromosomal morphology and their seven chromosomes are easily identified. The techniques for light, immunofluorescence and electron microscopy presented here have been used, with success, for monitoring of chromosome behavior during both meiotic and sporulation processes. They have also proved useful for the analysis of mitochondria and peroxisomes as well as cytoskeleton and spindle pole-body components. Moreover, all techniques of this chapter can be easily applied to other filamentous ascomycetes, including other Sordaria and Neurospora species as well as Podospora, Ascobolus, Ascophanus, Fusarium, Neotiella, and Aspergillus species.

  11. Retinoic acid activates two pathways required for meiosis in mice.

    Directory of Open Access Journals (Sweden)

    Jana Koubova

    2014-08-01

    Full Text Available In all sexually reproducing organisms, cells of the germ line must transition from mitosis to meiosis. In mice, retinoic acid (RA, the extrinsic signal for meiotic initiation, activates transcription of Stra8, which is required for meiotic DNA replication and the subsequent processes of meiotic prophase. Here we report that RA also activates transcription of Rec8, which encodes a component of the cohesin complex that accumulates during meiotic S phase, and which is essential for chromosome synapsis and segregation. This RA induction of Rec8 occurs in parallel with the induction of Stra8, and independently of Stra8 function, and it is conserved between the sexes. Further, RA induction of Rec8, like that of Stra8, requires the germ-cell-intrinsic competence factor Dazl. Our findings strengthen the importance of RA and Dazl in the meiotic transition, provide important details about the Stra8 pathway, and open avenues to investigate early meiosis through analysis of Rec8 induction and function.

  12. Expression and functional analysis of TaASY1 during meiosis of bread wheat (Triticum aestivum

    Directory of Open Access Journals (Sweden)

    Langridge Peter

    2007-08-01

    Full Text Available Abstract Background Pairing and synapsis of homologous chromosomes is required for normal chromosome segregation and the exchange of genetic material via recombination during meiosis. Synapsis is complete at pachytene following the formation of a tri-partite proteinaceous structure known as the synaptonemal complex (SC. In yeast, HOP1 is essential for formation of the SC, and localises along chromosome axes during prophase I. Homologues in Arabidopsis (AtASY1, Brassica (BoASY1 and rice (OsPAIR2 have been isolated through analysis of mutants that display decreased fertility due to severely reduced synapsis of homologous chromosomes. Analysis of these genes has indicated that they play a similar role to HOP1 in pairing and formation of the SC through localisation to axial/lateral elements of the SC. Results The full length wheat cDNA and genomic clone, TaASY1, has been isolated, sequenced and characterised. TaASY1 is located on chromosome Group 5 and the open reading frame displays significant nucleotide sequence identity to OsPAIR2 (84% and AtASY1 (63%. Transcript and protein analysis showed that expression is largely restricted to meiotic tissue, with elevated levels during the stages of prophase I when pairing and synapsis of homologous chromosomes occur. Immunolocalisation using transmission electron microscopy showed TaASY1 interacts with chromatin that is associated with both axial elements before SC formation as well as lateral elements of formed SCs. Conclusion TaASY1 is a homologue of ScHOP1, AtASY1 and OsPAIR2 and is the first gene to be isolated from bread wheat that is involved in pairing and synapsis of homologous chromosomes.

  13. Hormad1 mutation disrupts synaptonemal complex formation, recombination, and chromosome segregation in mammalian meiosis.

    Directory of Open Access Journals (Sweden)

    Yong-Hyun Shin

    2010-11-01

    Full Text Available Meiosis is unique to germ cells and essential for reproduction. During the first meiotic division, homologous chromosomes pair, recombine, and form chiasmata. The homologues connect via axial elements and numerous transverse filaments to form the synaptonemal complex. The synaptonemal complex is a critical component for chromosome pairing, segregation, and recombination. We previously identified a novel germ cell-specific HORMA domain encoding gene, Hormad1, a member of the synaptonemal complex and a mammalian counterpart to the yeast meiotic HORMA domain protein Hop1. Hormad1 is essential for mammalian gametogenesis as knockout male and female mice are infertile. Hormad1 deficient (Hormad1(-/ (- testes exhibit meiotic arrest in the early pachytene stage, and synaptonemal complexes cannot be visualized by electron microscopy. Hormad1 deficiency does not affect localization of other synaptonemal complex proteins, SYCP2 and SYCP3, but disrupts homologous chromosome pairing. Double stranded break formation and early recombination events are disrupted in Hormad1(-/ (- testes and ovaries as shown by the drastic decrease in the γH2AX, DMC1, RAD51, and RPA foci. HORMAD1 co-localizes with γH2AX to the sex body during pachytene. BRCA1, ATR, and γH2AX co-localize to the sex body and participate in meiotic sex chromosome inactivation and transcriptional silencing. Hormad1 deficiency abolishes γH2AX, ATR, and BRCA1 localization to the sex chromosomes and causes transcriptional de-repression on the X chromosome. Unlike testes, Hormad1(-/ (- ovaries have seemingly normal ovarian folliculogenesis after puberty. However, embryos generated from Hormad1(-/ (- oocytes are hyper- and hypodiploid at the 2 cell and 8 cell stage, and they arrest at the blastocyst stage. HORMAD1 is therefore a critical component of the synaptonemal complex that affects synapsis, recombination, and meiotic sex chromosome inactivation and transcriptional silencing.

  14. Vaginal yeast infection

    Science.gov (United States)

    Yeast infection - vagina; Vaginal candidiasis; Monilial vaginitis ... Most women have a vaginal yeast infection at some time. Candida albicans is a common type of fungus. It is often found in small amounts ...

  15. Yeast signaling pathways in the oxidative stress response

    Energy Technology Data Exchange (ETDEWEB)

    Ikner, Aminah [Section of Microbiology, Division of Biological Sciences, University of California, Davis, CA 95616 (United States); Shiozaki, Kazuhiro [Section of Microbiology, Division of Biological Sciences, University of California, Davis, CA 95616 (United States)]. E-mail: kshiozaki@ucdavis.edu

    2005-01-06

    Oxidative stress that generates the reactive oxygen species (ROS) is one of the major causes of DNA damage and mutations. The 'DNA damage checkpoint' that arrests cell cycle and repairs damaged DNA has been a focus of recent studies, and the genetically amenable model systems provided by yeasts have been playing a leading role in the eukaryotic checkpoint research. However, means to eliminate ROS are likely to be as important as the DNA repair mechanisms in order to suppress mutations in the chromosomal DNA, and yeasts also serve as excellent models to understand how eukaryotes combat oxidative stress. In this article, we present an overview of the signaling pathways that sense oxidative stress and induce expression of various anti-oxidant genes in the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe and the pathogenic yeast Candida albicans. Three conserved signaling modules have been identified in the oxidative stress response of these diverse yeast species: the stress-responsive MAP kinase cascade, the multistep phosphorelay and the AP-1-like transcription factor. The structure and function of these signaling modules are discussed.

  16. Yeast signaling pathways in the oxidative stress response

    International Nuclear Information System (INIS)

    Ikner, Aminah; Shiozaki, Kazuhiro

    2005-01-01

    Oxidative stress that generates the reactive oxygen species (ROS) is one of the major causes of DNA damage and mutations. The 'DNA damage checkpoint' that arrests cell cycle and repairs damaged DNA has been a focus of recent studies, and the genetically amenable model systems provided by yeasts have been playing a leading role in the eukaryotic checkpoint research. However, means to eliminate ROS are likely to be as important as the DNA repair mechanisms in order to suppress mutations in the chromosomal DNA, and yeasts also serve as excellent models to understand how eukaryotes combat oxidative stress. In this article, we present an overview of the signaling pathways that sense oxidative stress and induce expression of various anti-oxidant genes in the budding yeast Saccharomyces cerevisiae, the fission yeast Schizosaccharomyces pombe and the pathogenic yeast Candida albicans. Three conserved signaling modules have been identified in the oxidative stress response of these diverse yeast species: the stress-responsive MAP kinase cascade, the multistep phosphorelay and the AP-1-like transcription factor. The structure and function of these signaling modules are discussed

  17. Dma1-dependent degradation of SIN proteins during meiosis in Schizosaccharomyces pombe.

    Science.gov (United States)

    Krapp, Andrea; Simanis, Viesturs

    2014-07-15

    The Schizosaccharomyces pombe septation initiation network (SIN) is required for cytokinesis during vegetative growth and for spore formation during meiosis. Regulation of the SIN during mitosis has been studied extensively, but less is known about its meiotic regulation. Here, we show that several aspects of SIN regulation differ between mitosis and meiosis. First, the presence of GTP-bound Spg1p is not the main determinant of the timing of Cdc7p and Sid1p association with the spindle pole body (SPB) during meiosis. Second, the localisation dependencies of SIN proteins differ from those in mitotic cells, suggesting a modified functional organisation of the SIN during meiosis. Third, there is stage-specific degradation of SIN components in meiosis; Byr4p is degraded after meiosis I, whereas the degradation of Cdc7p, Cdc11p and Sid4p occurs after the second meiotic division and depends upon the ubiquitin ligase Dma1p. Finally, Dma1p-dependent degradation is not restricted to the SIN, as we show that Dma1p is needed for the degradation of Mcp6p (also known as Hrs1p) during meiosis I. Taken together, these data suggest that stage-specific targeted proteolysis plays an important role in regulating meiotic progression. © 2014. Published by The Company of Biologists Ltd.

  18. Exposure to Brefeldin A promotes initiation of meiosis in murine female germ cells.

    Science.gov (United States)

    Zhang, Lian-Jun; Chen, Bo; Feng, Xin-Lei; Ma, Hua-Gang; Sun, Li-Lan; Feng, Yan-Min; Liang, Gui-Jin; Cheng, Shun-Feng; Li, Lan; Shen, Wei

    2015-01-01

    In mammals, ontogenesis starts from a fusion of spermatozoon and oocyte, which are produced by reductive nuclear division of a diploid germ cell in a specialised but complex biological process known as meiosis. However, little is known about the mechanism of meiotic initiation in germ cells, although many factors may be responsible for meiosis both in male and female gonads. In this study, 11.5 days post coitum (dpc) female fetal mouse genital ridges were cultured in vitro with exposure to Brefeldin A (BFA) for 6h, and the changes in meiosis were detected. Synaptonemal-complex analysis implied that BFA played a positive role in meiosis initiation and this hypothesis was confirmed by quantitative PCR of meiosis-specific genes: stimulated by retinoic acid gene 8 (Stra8) and deleted in a zoospermia-like (DAZL). At the same time, mRNA expression of retinoic acid synthetase (Raldh2) and retinoic acid (RA) receptors increased in female gonads with in vitro exposure to BFA. Transplanting genital ridges treated with BFA into the kidney capsule of immunodeficient mice demonstrated that the development capacity of female germ cells was normal, while formation of primordial follicles was seen to be a result of accelerated meiosis after exposure to BFA. In conclusion, the study indicated that BFA stimulated meiosis initiation partly by RA signalling and then promoted the development of follicles.

  19. A sphingolipid-dependent diffusion barrier confines ER stress to the yeast mother cell

    Science.gov (United States)

    Clay, Lori; Caudron, Fabrice; Denoth-Lippuner, Annina; Boettcher, Barbara; Buvelot Frei, Stéphanie; Snapp, Erik Lee; Barral, Yves

    2014-01-01

    In many cell types, lateral diffusion barriers compartmentalize the plasma membrane and, at least in budding yeast, the endoplasmic reticulum (ER). However, the molecular nature of these barriers, their mode of action and their cellular functions are unclear. Here, we show that misfolded proteins of the ER remain confined into the mother compartment of budding yeast cells. Confinement required the formation of a lateral diffusion barrier in the form of a distinct domain of the ER-membrane at the bud neck, in a septin-, Bud1 GTPase- and sphingolipid-dependent manner. The sphingolipids, but not Bud1, also contributed to barrier formation in the outer membrane of the dividing nucleus. Barrier-dependent confinement of ER stress into the mother cell promoted aging. Together, our data clarify the physical nature of lateral diffusion barriers in the ER and establish the role of such barriers in the asymmetric segregation of proteotoxic misfolded proteins during cell division and aging. DOI: http://dx.doi.org/10.7554/eLife.01883.001 PMID:24843009

  20. The pat1 protein kinase controls transcription of the mating-type genes in fission yeast

    DEFF Research Database (Denmark)

    Nielsen, O; Egel, R; Nielsen, Olaf

    1990-01-01

    . This differentiation process is characterized by a transcriptional induction of the mating-type genes. Conjugation can also be induced in pat1-ts mutants by a shift to a semi-permissive temperature. The pat1 gene encodes a protein kinase, which also functions further downstream in the developmental pathway controlling...... of the mating-type genes in the zygote leads to complete loss of pat1 protein kinase activity causing entry into meiosis. Thus, pat1 can promote its own inactivation. We suggest a model according to which a stepwise inactivation of pat1 leads to sequential derepression of the processes of conjugation......The developmental programme of fission yeast brings about a transition from mitotic cell division to the dormant state of ascospores. In response to nitrogen starvation, two cells of opposite mating type conjugate to form a diploid zygote, which then undergoes meiosis and sporulation...

  1. 5'-end sequences of budding yeast full-length cDNA clones - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available search(/contents-en/) != -1 || url.search(/index-e.html/) != -1 ) { document.getElementById(lang).innerHTML=.../) != -1 ) { url = url.replace(-e.html,.html); document.getElementById(lang).innerHTML=[ Japanese |...en/,/jp/); document.getElementById(lang).innerHTML=[ Japanese | English ]; } else if ( url.search(//contents...//) != -1 ) { url = url.replace(/contents/,/contents-en/); document.getElementById(lang).innerHTML=[ Japanes...e(/contents-en/,/contents/); document.getElementById(lang).innerHTML=[ Japanese | English ]; } else if( url.

  2. Meiosis in gamma-ray induced tomato mutants of line XXIV-a

    International Nuclear Information System (INIS)

    Zagorcheva, L.; Jordanov, M.

    1976-01-01

    Results are reported of investigations on meiosis in tomato mutants obtained by gamma-irradiation ( 60 Co) of seeds from line XXIV-a with doses of 20 and 30 krad. Two genome mutants (one a triploid and the other a tetraploid form) as well as a chromosome aberration of the translocation type, were selected in the course of the investigations and their meiosis is described. Meiosis in the initial form (line XXIV-a) was also studied. About 16% of the initial line XXIV-a plants proved to be trisomic forms. (author)

  3. The role of cohesin genes in the meiosis of male house mouse

    OpenAIRE

    Šebestová, Lenka

    2015-01-01

    Cohesin genes play an important role in cell division. They ensure proper chromosome segregation during mitosis and meiosis. This study is focused on the role of cohesin genes during meiosis in male house mouse (Mus musculus). At first, this study introduces key processes of mammalian meiosis. Next, the structure of cohesin complex is described; it consists of a heterodimer SMC proteins - SMC3 and SMC1α or SMC1β, which are enclosed to the ring by cleavable subunit RAD21, RAD21L or REC8. Fourt...

  4. Meiosis in untreated and irradiated cyperus eragrostis vahl

    International Nuclear Information System (INIS)

    Bokhari, F.S.

    1976-01-01

    A cytological investigation of meiosis is seed irradiated Cyperus eragrostis has shown that the diffuse centromeric type of chromosome organisation leads to the formation of inviable chromosome complements, in which complex configurations resulting from stickiness as well as pairing of homologous regions, and numerous fragments, persist to the formation of pollen grains. At the higher doses, however, there is complete sterility, and low fertility even at the lower doses. The small numbers of M 2 and M 3 plants produced at lower doses show much reduced chromosomal abnormalities, indicating severe selection among the gametes and zygotes formed. There is little advantage in terms of survival from radiation damage, resulting from the possession of the diffuse centromere. (auth.)

  5. Functional conservation between Schizosaccharomyces pombe ste8 and Saccharomyces cerevisiae STE11 protein kinases in yeast signal transduction

    DEFF Research Database (Denmark)

    Styrkársdóttir, U; Egel, R; Nielsen, O

    1992-01-01

    in signal transduction in budding yeast. Expression of the S. cerevisiae STE11 gene in S. pombe ste8 mutants restores the ability to transcribe mat1-Pm in response to pheromone. Also, such cells become capable of conjugation and sporulation. When mat1-Pm is artifically expressed from a heterologous promoter...

  6. Breadth of Tuning and Taste Coding in Mammalian Taste Buds

    OpenAIRE

    Tomchik, Seth M.; Berg, Stephanie; Kim, Joung Woul; Chaudhari, Nirupa; Roper, Stephen D.

    2007-01-01

    A longstanding question in taste research concerns taste coding and, in particular, how broadly are individual taste bud cells tuned to taste qualities (sweet, bitter, umami, salty, and sour). Taste bud cells express G-protein-coupled receptors for sweet, bitter, or umami tastes but not in combination. However, responses to multiple taste qualities have been recorded in individual taste cells. We and others have shown previously there are two classes of taste bud cells directly involved in gu...

  7. Processing Umami and Other Tastes in Mammalian Taste Buds

    OpenAIRE

    Roper, Stephen D.; Chaudhari, Nirupa

    2009-01-01

    Neuroscientists are now coming to appreciate that a significant degree of information processing occurs in the peripheral sensory organs of taste prior to signals propagating to the brain. Gustatory stimulation causes taste bud cells to secrete neurotransmitters that act on adjacent taste bud cells (paracrine transmitters) as well as on primary sensory afferent fibers (neurocrine transmitters). Paracrine transmission, representing cell-cell communication within the taste bud, has the potentia...

  8. Principles of mRNA transport in yeast.

    Science.gov (United States)

    Heym, Roland Gerhard; Niessing, Dierk

    2012-06-01

    mRNA localization and localized translation is a common mechanism by which cellular asymmetry is achieved. In higher eukaryotes the mRNA transport machinery is required for such diverse processes as stem cell division and neuronal plasticity. Because mRNA localization in metazoans is highly complex, studies at the molecular level have proven to be cumbersome. However, active mRNA transport has also been reported in fungi including Saccharomyces cerevisiae, Ustilago maydis and Candida albicans, in which these events are less difficult to study. Amongst them, budding yeast S. cerevisiae has yielded mechanistic insights that exceed our understanding of other mRNA localization events to date. In contrast to most reviews, we refrain here from summarizing mRNA localization events from different organisms. Instead we give an in-depth account of ASH1 mRNA localization in budding yeast. This approach is particularly suited to providing a more holistic view of the interconnection between the individual steps of mRNA localization, from transcriptional events to cytoplasmic mRNA transport and localized translation. Because of our advanced mechanistic understanding of mRNA localization in yeast, the present review may also be informative for scientists working, for example, on mRNA localization in embryogenesis or in neurons.

  9. A Predictive Model for Yeast Cell Polarization in Pheromone Gradients.

    Science.gov (United States)

    Muller, Nicolas; Piel, Matthieu; Calvez, Vincent; Voituriez, Raphaël; Gonçalves-Sá, Joana; Guo, Chin-Lin; Jiang, Xingyu; Murray, Andrew; Meunier, Nicolas

    2016-04-01

    Budding yeast cells exist in two mating types, a and α, which use peptide pheromones to communicate with each other during mating. Mating depends on the ability of cells to polarize up pheromone gradients, but cells also respond to spatially uniform fields of pheromone by polarizing along a single axis. We used quantitative measurements of the response of a cells to α-factor to produce a predictive model of yeast polarization towards a pheromone gradient. We found that cells make a sharp transition between budding cycles and mating induced polarization and that they detect pheromone gradients accurately only over a narrow range of pheromone concentrations corresponding to this transition. We fit all the parameters of the mathematical model by using quantitative data on spontaneous polarization in uniform pheromone concentration. Once these parameters have been computed, and without any further fit, our model quantitatively predicts the yeast cell response to pheromone gradient providing an important step toward understanding how cells communicate with each other.

  10. Yeast Interacting Proteins Database: YDR439W, YCR086W [Yeast Interacting Proteins Database

    Lifescience Database Archive (English)

    Full Text Available inetochores during meiosis I to mediate accurate homolog segregation; required for condensin recruitment to ...and then Mam1p at kinetochores during meiosis I to mediate accurate homolog segregation; required for condensin recruitment...p, and then Mam1p at kinetochores during meiosis I to mediate accurate homolog segregation; required for condensin recruitment...with Lrs4p and then Mam1p at kinetochores during meiosis I to mediate accurate homolog segregation; required for condensin recruitmen

  11. Induction of spontaneous and UV-induced mutations during commitment to meiosis in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Machida, I.; Nakai, S.

    1980-01-01

    Inductions of reversions of nonsense, missense and frameshift-type mutations were investigated in a diploid cell population of Saccharomyces cerevisiae during commitment to meiosis, by using the medium-transfer technique from sporulation medium to vegetative medium. The yields of spontaneous reverse mutations obtained from the cells that were committed to different stages during meiosis were rather constant irrespective of the alleles tested, although the yields of both intergenic and intragenic recombinations markedly increased. The susceptibilities to UV-induced reverse mutations examined during commitment to meiosis were not changed appreciably. It is concluded that induction of base-change-type mutations in meiosis is not essentially different from that in mitosis. (orig.)

  12. Recent advances in the genome-wide study of DNA replication origins in yeast

    Science.gov (United States)

    Peng, Chong; Luo, Hao; Zhang, Xi; Gao, Feng

    2015-01-01

    DNA replication, one of the central events in the cell cycle, is the basis of biological inheritance. In order to be duplicated, a DNA double helix must be opened at defined sites, which are called DNA replication origins (ORIs). Unlike in bacteria, where replication initiates from a single replication origin, multiple origins are utilized in the eukaryotic genomes. Among them, the ORIs in budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe have been best characterized. In recent years, advances in DNA microarray and next-generation sequencing technologies have increased the number of yeast species involved in ORIs research dramatically. The ORIs in some non-conventional yeast species such as Kluyveromyces lactis and Pichia pastoris have also been genome-widely identified. Relevant databases of replication origins in yeast were constructed, then the comparative genomic analysis can be carried out. Here, we review several experimental approaches that have been used to map replication origins in yeast and some of the available web resources related to yeast ORIs. We also discuss the sequence characteristics and chromosome structures of ORIs in the four yeast species, which can be utilized to improve yeast replication origins prediction. PMID:25745419

  13. Primers-4-Yeast: a comprehensive web tool for planning primers for Saccharomyces cerevisiae.

    Science.gov (United States)

    Yofe, Ido; Schuldiner, Maya

    2014-02-01

    The budding yeast Saccharomyces cerevisiae is a key model organism of functional genomics, due to its ease and speed of genetic manipulations. In fact, in this yeast, the requirement for homologous sequences for recombination purposes is so small that 40 base pairs (bp) are sufficient. Hence, an enormous variety of genetic manipulations can be performed by simply planning primers with the correct homology, using a defined set of transformation plasmids. Although designing primers for yeast transformations and for the verification of their correct insertion is a common task in all yeast laboratories, primer planning is usually done manually and a tool that would enable easy, automated primer planning for the yeast research community is still lacking. Here we introduce Primers-4-Yeast, a web tool that allows primers to be designed in batches for S. cerevisiae gene-targeting transformations, and for the validation of correct insertions. This novel tool enables fast, automated, accurate primer planning for large sets of genes, introduces consistency in primer planning and is therefore suggested to serve as a standard in yeast research. Primers-4-Yeast is available at: http://www.weizmann.ac.il/Primers-4-Yeast Copyright © 2013 John Wiley & Sons, Ltd.

  14. Mutant induction through adventitious buds of Kohleria

    International Nuclear Information System (INIS)

    Parliman, B.J.; Stushnoff, C.

    1979-01-01

    Freshly cut leaves of Kohleria eriantha and K. x 'Longwood' were exposed in a wide range of gamma irradiation doses and allowed to root and form adventitious buds. K. Eriantha could not be successfully propagated from leaf half cuttings. 'Longwood' produced a small number of adventitious plantlets as compared to other Gesneriads. Colchicine treatments reduced leaf half survival in 'Longwood' by more than 50%. Leaf halves exposed to low and moderate doses of gamma irradiation showed increased overall plantlet production compared to nonirradiated leaf halves. (Auth.)

  15. Epicormic buds in trees: a review of bud establishment, development and dormancy release

    Science.gov (United States)

    Andrew R. ​Meier; Michael R. Saunders; Charles H. Michler

    2012-01-01

    The formation of epicormic sprouts on the boles of trees is a phenomenon that has, until recently, been poorly understood. Renewed interest in the topic in the last two decades has led to significant advances in our knowledge of the subject, especially in regard to bud anatomy, morphology and ontogeny. There exists, however, no comprehensive synthesis of results from...

  16. Motoring through: the role of kinesin superfamily proteins in female meiosis.

    Science.gov (United States)

    Camlin, Nicole J; McLaughlin, Eileen A; Holt, Janet E

    2017-07-01

    The kinesin motor protein family consists of 14 distinct subclasses and 45 kinesin proteins in humans. A large number of these proteins, or their orthologues, have been shown to possess essential function(s) in both the mitotic and the meiotic cell cycle. Kinesins have important roles in chromosome separation, microtubule dynamics, spindle formation, cytokinesis and cell cycle progression. This article contains a review of the literature with respect to the role of kinesin motor proteins in female meiosis in model species. Throughout, we discuss the function of each class of kinesin proteins during oocyte meiosis, and where such data are not available their role in mitosis is considered. Finally, the review highlights the potential clinical importance of this family of proteins for human oocyte quality. To examine the role of kinesin motor proteins in oocyte meiosis. A search was performed on the Pubmed database for journal articles published between January 1970 and February 2017. Search terms included 'oocyte kinesin' and 'meiosis kinesin' in addition to individual kinesin names with the terms oocyte or meiosis. Within human cells 45 kinesin motor proteins have been discovered, with the role of only 13 of these proteins, or their orthologues, investigated in female meiosis. Furthermore, of these kinesins only half have been examined in mammalian oocytes, despite alterations occurring in gene transcripts or protein expression with maternal ageing, cryopreservation or behavioral conditions, such as binge drinking, for many of them. Kinesin motor proteins have distinct and important roles throughout oocyte meiosis in many non-mammalian model species. However, the functions these proteins have in mammalian meiosis, particularly in humans, are less clear owing to lack of research. This review brings to light the need for more experimental investigation of kinesin motor proteins, particularly those associated with maternal ageing, cryopreservation or exposure to

  17. Hydra meiosis reveals unexpected conservation of structural synaptonemal complex proteins across metazoans

    OpenAIRE

    Fraune, Johanna; Alsheimer, Manfred; Volff, Jean-Nicolas; Busch, Karoline; Fraune, Sebastian; Bosch, Thomas C. G.; Benavente, Ricardo

    2012-01-01

    The synaptonemal complex (SC) is a key structure of meiosis, mediating the stable pairing (synapsis) of homologous chromosomes during prophase I. Its remarkable tripartite structure is evolutionarily well conserved and can be found in almost all sexually reproducing organisms. However, comparison of the different SC protein components in the common meiosis model organisms Saccharomyces cerevisiae, Arabidopsis thaliana, Caenorhabditis elegans, Drosophila melanogaster, and Mus musculus revealed...

  18. Mitochondrial localization of fission yeast manganese superoxide dismutase is required for its lysine acetylation and for cellular stress resistance and respiratory growth

    International Nuclear Information System (INIS)

    Takahashi, Hidekazu; Suzuki, Takehiro; Shirai, Atsuko; Matsuyama, Akihisa; Dohmae, Naoshi; Yoshida, Minoru

    2011-01-01

    Research highlights: → Fission yeast manganese superoxide dismutase (MnSOD) is acetylated. → The mitochondrial targeting sequence (MTS) is required for the acetylation of MnSOD. → The MTS is not crucial for MnSOD activity, but is important for respiratory growth. → Posttranslational regulation of MnSOD differs between budding and fission yeast. -- Abstract: Manganese-dependent superoxide dismutase (MnSOD) is localized in the mitochondria and is important for oxidative stress resistance. Although transcriptional regulation of MnSOD has been relatively well studied, much less is known about the protein's posttranslational regulation. In budding yeast, MnSOD is activated after mitochondrial import by manganese ion incorporation. Here we characterize posttranslational modification of MnSOD in the fission yeast Schizosaccharomyces pombe. Fission yeast MnSOD is acetylated at the 25th lysine residue. This acetylation was diminished by deletion of N-terminal mitochondrial targeting sequence, suggesting that MnSOD is acetylated after import into mitochondria. Mitochondrial localization of MnSOD is not essential for the enzyme activity, but is crucial for oxidative stress resistance and growth under respiratory conditions of fission yeast. These results suggest that, unlike the situation in budding yeast, S. pombe MnSOD is already active even before mitochondrial localization; nonetheless, mitochondrial localization is critical to allow the cell to cope with reactive oxygen species generated inside or outside of mitochondria.

  19. Transcription factors SOHLH1 and SOHLH2 coordinate oocyte differentiation without affecting meiosis I.

    Science.gov (United States)

    Shin, Yong-Hyun; Ren, Yu; Suzuki, Hitomi; Golnoski, Kayla J; Ahn, Hyo Won; Mico, Vasil; Rajkovic, Aleksandar

    2017-06-01

    Following migration of primordial germ cells to the genital ridge, oogonia undergo several rounds of mitotic division and enter meiosis at approximately E13.5. Most oocytes arrest in the dictyate (diplotene) stage of meiosis circa E18.5. The genes necessary to drive oocyte differentiation in parallel with meiosis are unknown. Here, we have investigated whether expression of spermatogenesis and oogenesis bHLH transcription factor 1 (Sohlh1) and Sohlh2 coordinates oocyte differentiation within the embryonic ovary. We found that SOHLH2 protein was expressed in the mouse germline as early as E12.5 and preceded SOHLH1 protein expression, which occurred circa E15.5. SOHLH1 protein appearance at E15.5 correlated with SOHLH2 translocation from the cytoplasm into the nucleus and was dependent on SOHLH1 expression. NOBOX oogenesis homeobox (NOBOX) and LIM homeobox protein 8 (LHX8), two important regulators of postnatal oogenesis, were coexpressed with SOHLH1. Single deficiency of Sohlh1 or Sohlh2 disrupted the expression of LHX8 and NOBOX in the embryonic gonad without affecting meiosis. Sohlh1-KO infertility was rescued by conditional expression of the Sohlh1 transgene after the onset of meiosis. However, Sohlh1 or Sohlh2 transgene expression could not rescue Sohlh2-KO infertility due to a lack of Sohlh1 or Sohlh2 expression in rescued mice. Our results indicate that Sohlh1 and Sohlh2 are essential regulators of oocyte differentiation but do not affect meiosis I.

  20. Dynamics of DNA replication during premeiosis and early meiosis in wheat.

    Science.gov (United States)

    Rey, María-Dolores; Prieto, Pilar

    2014-01-01

    Meiosis is a specialised cell division that involves chromosome replication, two rounds of chromosome segregation and results in the formation of the gametes. Meiotic DNA replication generally precedes chromosome pairing, recombination and synapsis in sexually developing eukaryotes. In this work, replication has been studied during premeiosis and early meiosis in wheat using flow cytometry, which has allowed the quantification of the amount of DNA in wheat anther in each phase of the cell cycle during premeiosis and each stage of early meiosis. Flow cytometry has been revealed as a suitable and user-friendly tool to detect and quantify DNA replication during early meiosis in wheat. Chromosome replication was detected in wheat during premeiosis and early meiosis until the stage of pachytene, when chromosomes are associated in pairs to further recombine and correctly segregate in the gametes. In addition, the effect of the Ph1 locus, which controls chromosome pairing and affects replication in wheat, was also studied by flow cytometry. Here we showed that the Ph1 locus plays an important role on the length of meiotic DNA replication in wheat, particularly affecting the rate of replication during early meiosis in wheat.

  1. Sequential steps in DNA replication are inhibited to ensure reduction of ploidy in meiosis

    Science.gov (United States)

    Hua, Hui; Namdar, Mandana; Ganier, Olivier; Gregan, Juraj; Méchali, Marcel; Kearsey, Stephen E.

    2013-01-01

    Meiosis involves two successive rounds of chromosome segregation without an intervening S phase. Exit from meiosis I is distinct from mitotic exit, in that replication origins are not licensed by Mcm2-7 chromatin binding, but spindle disassembly occurs during a transient interphase-like state before meiosis II. The absence of licensing is assumed to explain the block to DNA replication, but this has not been formally tested. Here we attempt to subvert this block by expressing the licensing control factors Cdc18 and Cdt1 during the interval between meiotic nuclear divisions. Surprisingly, this leads only to a partial round of DNA replication, even when these factors are overexpressed and effect clear Mcm2-7 chromatin binding. Combining Cdc18 and Cdt1 expression with modulation of cyclin-dependent kinase activity, activation of Dbf4-dependent kinase, or deletion of the Spd1 inhibitor of ribonucleotide reductase has little additional effect on the extent of DNA replication. Single-molecule analysis indicates this partial round of replication results from inefficient progression of replication forks, and thus both initiation and elongation replication steps may be inhibited in late meiosis. In addition, DNA replication or damage during the meiosis I–II interval fails to arrest meiotic progress, suggesting absence of checkpoint regulation of meiosis II entry. PMID:23303250

  2. Coordination of cellular differentiation, polarity, mitosis and meiosis - New findings from early vertebrate oogenesis.

    Science.gov (United States)

    Elkouby, Yaniv M; Mullins, Mary C

    2017-10-15

    A mechanistic dissection of early oocyte differentiation in vertebrates is key to advancing our knowledge of germline development, reproductive biology, the regulation of meiosis, and all of their associated disorders. Recent advances in the field include breakthroughs in the identification of germline stem cells in Medaka, in the cellular architecture of the germline cyst in mice, in a mechanistic dissection of chromosomal pairing and bouquet formation in meiosis in mice, in tracing oocyte symmetry breaking to the chromosomal bouquet of meiosis in zebrafish, and in the biology of the Balbiani body, a universal oocyte granule. Many of the major events in early oogenesis are universally conserved, and some are co-opted for species-specific needs. The chromosomal events of meiosis are of tremendous consequence to gamete formation and have been extensively studied. New light is now being shed on other aspects of early oocyte differentiation, which were traditionally considered outside the scope of meiosis, and their coordination with meiotic events. The emerging theme is of meiosis as a common groundwork for coordinating multifaceted processes of oocyte differentiation. In an accompanying manuscript we describe methods that allowed for investigations in the zebrafish ovary to contribute to these breakthroughs. Here, we review these advances mostly from the zebrafish and mouse. We discuss oogenesis concepts across established model organisms, and construct an inclusive paradigm for early oocyte differentiation in vertebrates. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Molecular Mechanism of Arenavirus Assembly and Budding

    Directory of Open Access Journals (Sweden)

    Shuzo Urata

    2012-10-01

    Full Text Available Arenaviruses have a bisegmented negative-strand RNA genome, which encodes four viral proteins: GP and NP by the S segment and L and Z by the L segment. These four viral proteins possess multiple functions in infection, replication and release of progeny viruses from infected cells. The small RING finger protein, Z protein is a matrix protein that plays a central role in viral assembly and budding. Although all arenaviruses encode Z protein, amino acid sequence alignment showed a huge variety among the species, especially at the C-terminus where the L-domain is located. Recent publications have demonstrated the interactions between viral protein and viral protein, and viral protein and host cellular protein, which facilitate transportation and assembly of viral components to sites of virus egress. This review presents a summary of current knowledge regarding arenavirus assembly and budding, in comparison with other enveloped viruses. We also refer to the restriction of arenavirus production by the antiviral cellular factor, Tetherin/BST-2.

  4. Whole transcriptome profiling of taste bud cells.

    Science.gov (United States)

    Sukumaran, Sunil K; Lewandowski, Brian C; Qin, Yumei; Kotha, Ramana; Bachmanov, Alexander A; Margolskee, Robert F

    2017-08-08

    Analysis of single-cell RNA-Seq data can provide insights into the specific functions of individual cell types that compose complex tissues. Here, we examined gene expression in two distinct subpopulations of mouse taste cells: Tas1r3-expressing type II cells and physiologically identified type III cells. Our RNA-Seq libraries met high quality control standards and accurately captured differential expression of marker genes for type II (e.g. the Tas1r genes, Plcb2, Trpm5) and type III (e.g. Pkd2l1, Ncam, Snap25) taste cells. Bioinformatics analysis showed that genes regulating responses to stimuli were up-regulated in type II cells, while pathways related to neuronal function were up-regulated in type III cells. We also identified highly expressed genes and pathways associated with chemotaxis and axon guidance, providing new insights into the mechanisms underlying integration of new taste cells into the taste bud. We validated our results by immunohistochemically confirming expression of selected genes encoding synaptic (Cplx2 and Pclo) and semaphorin signalling pathway (Crmp2, PlexinB1, Fes and Sema4a) components. The approach described here could provide a comprehensive map of gene expression for all taste cell subpopulations and will be particularly relevant for cell types in taste buds and other tissues that can be identified only by physiological methods.

  5. Tumor budding in upper gastrointestinal carcinomas

    Directory of Open Access Journals (Sweden)

    Viktor Hendrik Koelzer

    2014-08-01

    Full Text Available The basis of personalized medicine in oncology is the prediction of an individual’s risk of relapse and death from disease. The presence of tumor budding (TB at the tumor-host interface of gastrointestinal cancers has been recognized as a hallmark of unfavorable disease biology. TB is defined as the presence of dedifferentiated cells or small clusters of up to five cells at the tumor invasive front and can be observed in aggressive carcinomas of the esophagus, stomach, pancreas, ampulla, colon and rectum. Presence of TB reproducibly correlates with advanced tumor stage, frequent lymphovascular invasion, nodal and distant metastasis. The UICC has officially recognized TB as additional independent prognostic factor in cancers of the colon and rectum. Recent studies have also characterized TB as a promising prognostic indicator for clinical management of esophageal squamous cell carcinoma, adenocarcinoma of the gastro-esophageal junction and gastric adenocarcinoma. However, several important issues have to be addressed for application in daily diagnostic practice: 1 Validation of prognostic scoring systems for tumor budding in large, multi-center studies 2 Consensus on the optimal assessment method 3 Inter-observer reproducibility. This review provides a comprehensive analysis of TB in cancers of the upper gastrointestinal tract including critical appraisal of perspectives for further study.

  6. Glutamate: Tastant and Neuromodulator in Taste Buds.

    Science.gov (United States)

    Vandenbeuch, Aurelie; Kinnamon, Sue C

    2016-07-01

    In taste buds, glutamate plays a double role as a gustatory stimulus and neuromodulator. The detection of glutamate as a tastant involves several G protein-coupled receptors, including the heterodimer taste receptor type 1, member 1 and 3 as well as metabotropic glutamate receptors (mGluR1 and mGluR4). Both receptor types participate in the detection of glutamate as shown with knockout animals and selective antagonists. At the basal part of taste buds, ionotropic glutamate receptors [N-methyl-d-aspartate (NMDA) and non-NMDA] are expressed and participate in the modulation of the taste signal before its transmission to the brain. Evidence suggests that glutamate has an efferent function on taste cells and modulates the release of other neurotransmitters such as serotonin and ATP. This short article reviews the recent developments in the field with regard to glutamate receptors involved in both functions as well as the influence of glutamate on the taste signal. © 2016 American Society for Nutrition.

  7. Signal transduction during mating and meiosis in S. pombe

    DEFF Research Database (Denmark)

    Nielsen, O; Nielsen, Olaf

    1993-01-01

    When starved, the fission yeast Schizosaccharomyces pombe responds by producing mating factors or pheromones that signal to cells of the opposite sex to initiate mating. Like its distant relative Saccharomyces cerevisiae, cells of the two mating types of S. pombe each produce a distinct pheromone...

  8. Radiosensitivity of continuous cultures: experiments with diploid yeast

    International Nuclear Information System (INIS)

    Kiefer, J.; Wagner, E.

    1975-01-01

    To study the influence of systems parameters on the radiosensitivity of cell populations, stationary chemostat cultures of diploid yeast with different dilution rates were γ-irradiated. Proliferation and budding kinetics were investigated and the doses necessary to eliminate the entire population determined as a function of dilution rate. It was found that this killing dose decreases with dilution rate in a linear manner. The radiosensitivity of the cells was shown to depend on the dilution rate which is presumably due to differing compositions of the population. (U.S.)

  9. Nutrient sensing and TOR signaling in yeast and mammals.

    Science.gov (United States)

    González, Asier; Hall, Michael N

    2017-02-15

    Coordinating cell growth with nutrient availability is critical for cell survival. The evolutionarily conserved TOR (target of rapamycin) controls cell growth in response to nutrients, in particular amino acids. As a central controller of cell growth, mTOR (mammalian TOR) is implicated in several disorders, including cancer, obesity, and diabetes. Here, we review how nutrient availability is sensed and transduced to TOR in budding yeast and mammals. A better understanding of how nutrient availability is transduced to TOR may allow novel strategies in the treatment for mTOR-related diseases. © 2017 The Authors.

  10. Unearthing belowground bud banks in fire-prone ecosystems.

    Science.gov (United States)

    Pausas, Juli G; Lamont, Byron B; Paula, Susana; Appezzato-da-Glória, Beatriz; Fidelis, Alessandra

    2018-03-01

    Despite long-time awareness of the importance of the location of buds in plant biology, research on belowground bud banks has been scant. Terms such as lignotuber, xylopodium and sobole, all referring to belowground bud-bearing structures, are used inconsistently in the literature. Because soil efficiently insulates meristems from the heat of fire, concealing buds below ground provides fitness benefits in fire-prone ecosystems. Thus, in these ecosystems, there is a remarkable diversity of bud-bearing structures. There are at least six locations where belowground buds are stored: roots, root crown, rhizomes, woody burls, fleshy swellings and belowground caudexes. These support many morphologically distinct organs. Given their history and function, these organs may be divided into three groups: those that originated in the early history of plants and that currently are widespread (bud-bearing roots and root crowns); those that also originated early and have spread mainly among ferns and monocots (nonwoody rhizomes and a wide range of fleshy underground swellings); and those that originated later in history and are strictly tied to fire-prone ecosystems (woody rhizomes, lignotubers and xylopodia). Recognizing the diversity of belowground bud banks is the starting point for understanding the many evolutionary pathways available for responding to severe recurrent disturbances. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.

  11. Cell to cell signalling during vertebrate limb bud development

    NARCIS (Netherlands)

    Panman, Lia

    2004-01-01

    Communication between cells is essential during embryonic development. The vertebrate limb bud provides us a model to study signalling interactions between cells during patterning of embryonic tissues and organogenesis. In chapter 1 I give an introduction about limb bud development that is focussed

  12. Bud initiation and optimum harvest date in Brussels sprouts

    NARCIS (Netherlands)

    Everaarts, A.P.; Sukkel, W.

    1999-01-01

    For six cultivars of Brussels sprouts (Brassica oleracea var. gemmifera) with a decreasing degree of earliness, or optimum harvest date, the time of bud initiation was determined during two seasons. Fifty percent of the plants had initiated buds between 60 and 75 days after planting (DAP) in 1994

  13. Bud abortion in tulip bulbs studied by magnetic resonance imaging

    NARCIS (Netherlands)

    Kilsdonk, van M.G.; Nicolaij, K.; Franssen, J.M.; Kollöffel, C.

    2002-01-01

    After storage and subsequent planting of flower bulbs, the flower bud frequently appears to be aborted. This physiological aberration is probably caused by a change in the water status of the bulb and may be initiated during storage. The development of bud abortion in tulip bulbs was studied during

  14. Separase Is Required for Homolog and Sister Disjunction during Drosophila melanogaster Male Meiosis, but Not for Biorientation of Sister Centromeres.

    Science.gov (United States)

    Blattner, Ariane C; Chaurasia, Soumya; McKee, Bruce D; Lehner, Christian F

    2016-04-01

    Spatially controlled release of sister chromatid cohesion during progression through the meiotic divisions is of paramount importance for error-free chromosome segregation during meiosis. Cohesion is mediated by the cohesin protein complex and cleavage of one of its subunits by the endoprotease separase removes cohesin first from chromosome arms during exit from meiosis I and later from the pericentromeric region during exit from meiosis II. At the onset of the meiotic divisions, cohesin has also been proposed to be present within the centromeric region for the unification of sister centromeres into a single functional entity, allowing bipolar orientation of paired homologs within the meiosis I spindle. Separase-mediated removal of centromeric cohesin during exit from meiosis I might explain sister centromere individualization which is essential for subsequent biorientation of sister centromeres during meiosis II. To characterize a potential involvement of separase in sister centromere individualization before meiosis II, we have studied meiosis in Drosophila melanogaster males where homologs are not paired in the canonical manner. Meiosis does not include meiotic recombination and synaptonemal complex formation in these males. Instead, an alternative homolog conjunction system keeps homologous chromosomes in pairs. Using independent strategies for spermatocyte-specific depletion of separase complex subunits in combination with time-lapse imaging, we demonstrate that separase is required for the inactivation of this alternative conjunction at anaphase I onset. Mutations that abolish alternative homolog conjunction therefore result in random segregation of univalents during meiosis I also after separase depletion. Interestingly, these univalents become bioriented during meiosis II, suggesting that sister centromere individualization before meiosis II does not require separase.

  15. The detection of chromosome non-disjunction in the yeast Saccharomyces Cerevisiae

    International Nuclear Information System (INIS)

    Parry, J.M.

    1977-01-01

    A number of strains of yeast are described which are capable of detecting the induction of monosomic cells (2n-1) during mitosis and disomic spores (n+1) during meiosis by the plating of treated cells upon selective media. Amongst the chemicals tested for their possible effects upon chromosome loss we have detected significant activity after treatment with folic acid antagonists such as sulphacetamide as well as with the synthetic oestrogen stilboestrol diproprionate. Increases in the frequency of disomic spores were demonstrated after meiotic division following treatment of cells with both UV light and the amino acid analogue p-fluorophenyl-alanine. (Auth.)

  16. Plantlets from encapsulated shoot buds of Catalpa ovata G. Don

    Directory of Open Access Journals (Sweden)

    Halina Wysokińska

    2014-01-01

    Full Text Available Shoot buds isolated from in vitro shoot cultures of Catalpa ovata G. Don were encapsulated using 3% sodium alginate with sucrose (3% and 50 mM calcium chloride. The morphogenic response of encapsulated buds was affected by such factors, like composition of the media and the presence of growth regulators. The highest frequency of plantlet germination from encapsulated buds (70% within 4 weeks was obtained on Woody Plant medium (WP (Lloyd and McCown 1980 containing indole-3-butyric acid (IBA (1 mg/l. The process was substantially inhibited by cold-storage (4oC of encapsulated buds. In this case, the frequency response ranged from 3% to 22% dependent on storage period (28 or 42 days and the presence of the paraffin coat covering the alginate capsules. The plantlets developed from both unstored and stored encapsulated buds of C. ovata were transplanted to soil and grew in pots to phenotypically normal plants.

  17. Assembly of fission yeast eisosomes in the plasma membrane of budding yeast: Import of foreign membrane microdomains

    Czech Academy of Sciences Publication Activity Database

    Vaškovičová, Katarína; Strádalová, Vendula; Efenberk, Aleš; Opekarová, Miroslava; Malínský, Jan

    2015-01-01

    Roč. 94, č. 1 (2015), s. 1-11 ISSN 0171-9335 R&D Projects: GA ČR(CZ) GAP302/11/0146 Institutional support: RVO:68378041 Keywords : plasma membrane * membrane microdomain * MCC Subject RIV: EA - Cell Biology Impact factor: 4.011, year: 2015

  18. Cytokinins and polar transport of auxin in axillary pea buds

    Directory of Open Access Journals (Sweden)

    Petr Kalousek

    2010-01-01

    Full Text Available The influence of cytokinin on auxin transport during release of axillary buds from apical dominance was studied. Expression of auxin-carrier coding genes PsAUX1 (AUXIN RESISTANT 1 and PsPIN1 (PIN-FORMED 1 was explored in axillary buds of the 2nd node of 7-day pea plants (Pisum sativum L. cv. Vladan after decapitation or after exogenous application of benzyladenine (6-benzylaminopurine onto axillary buds of intact plants. Localization of the PsPIN1 protein, the key factor for polar transport of auxin in axillary buds, was visualised by immunohistochemistry. After exogenous application of cytokinin the expression of PsAUX1 and PsPIN1 rapidly increased with a simultaneous rapid decrease in PsDRM1 and PsAD1 expression – genes related to bud dormancy. The same changes in expression were observed after decapitation, however they were markedly slower. The PsPIN1 auxin efflux carrier in the inhibited axillary buds of intact plants was localised in a non-polar manner. After exogenous application of cytokinin gradual polarisation of the PsPIN1 protein occurred on the basal pole of polar auxin transport competent cells. Despite the fact that direct auxin application to buds of intact plants led to an increase in PsAUX1 and PsPIN1 expression, the buds remained dormant (non-growing what was accompanied by persistent expression of the dormancy markers PsDRM1 and PsAD1. The results indicate a possible effect of cytokinins on biosynthesis, and/or transport of auxin in axillary buds and they highlight the importance of auxin-cytokinin crosstalk in the regulation of bud outgrowth after breaking of apical dominance.

  19. The Consequences of Chromosome Segregation Errors in Mitosis and Meiosis

    Directory of Open Access Journals (Sweden)

    Tamara Potapova

    2017-02-01

    Full Text Available Mistakes during cell division frequently generate changes in chromosome content, producing aneuploid or polyploid progeny cells. Polyploid cells may then undergo abnormal division to generate aneuploid cells. Chromosome segregation errors may also involve fragments of whole chromosomes. A major consequence of segregation defects is change in the relative dosage of products from genes located on the missegregated chromosomes. Abnormal expression of transcriptional regulators can also impact genes on the properly segregated chromosomes. The consequences of these perturbations in gene expression depend on the specific chromosomes affected and on the interplay of the aneuploid phenotype with the environment. Most often, these novel chromosome distributions are detrimental to the health and survival of the organism. However, in a changed environment, alterations in gene copy number may generate a more highly adapted phenotype. Chromosome segregation errors also have important implications in human health. They may promote drug resistance in pathogenic microorganisms. In cancer cells, they are a source for genetic and phenotypic variability that may select for populations with increased malignance and resistance to therapy. Lastly, chromosome segregation errors during gamete formation in meiosis are a primary cause of human birth defects and infertility. This review describes the consequences of mitotic and meiotic errors focusing on novel concepts and human health.

  20. Meiosis of anther culture regenerants in asparagus (Asparagus officinalis L.

    Directory of Open Access Journals (Sweden)

    Leonardo Galli

    1998-03-01

    Full Text Available Pollen mother cells obtained from regenerated plants of asparagus (Asparagus officinalis L., in a population composed exclusively of male plants, through the process of anther culture from the hybrid G27 X 22-8, were analyzed during meiosis. It was observed that, during theprocess of anther culture by organogenesis, the pollen mother cells of the regenerants had great genomic instability, as evidenced by disturbances in all the meiotic phases of the first and second division. Furthermore, structural chromosomal abnormalities, in addition to aneuploidy and polyploidy, were observed.Foi analisada a meiose em células mãe de pólen de plantas de aspargo (Asparagus officinalis L. de uma população composta exclusivamente de plantas masculinas, obtidas através do processo de cultura de anteras do híbrido G27 X 22-8. Foi observado que, durante o processo de cultura de anteras, via calogênese, as células mãe de pólen dos regenerantes apresentaram grande instabilidade genômica, evidenciada por irregularidades nas fases de diacinese, assim como de metáfase, anáfase, telófase da primeira e segunda divisão meiótica. Além disto, o processo originou anormalidades cromossômicas estruturais em adição às aneuploidias e poliploidias.

  1. Speciation driven by hybridization and chromosomal plasticity in a wild yeast.

    Science.gov (United States)

    Leducq, Jean-Baptiste; Nielly-Thibault, Lou; Charron, Guillaume; Eberlein, Chris; Verta, Jukka-Pekka; Samani, Pedram; Sylvester, Kayla; Hittinger, Chris Todd; Bell, Graham; Landry, Christian R

    2016-01-11

    Hybridization is recognized as a powerful mechanism of speciation and a driving force in generating biodiversity. However, only few multicellular species, limited to a handful of plants and animals, have been shown to fulfil all the criteria of homoploid hybrid speciation. This lack of evidence could lead to the interpretation that speciation by hybridization has a limited role in eukaryotes, particularly in single-celled organisms. Laboratory experiments have revealed that fungi such as budding yeasts can rapidly develop reproductive isolation and novel phenotypes through hybridization, showing that in principle homoploid speciation could occur in nature. Here, we report a case of homoploid hybrid speciation in natural populations of the budding yeast Saccharomyces paradoxus inhabiting the North American forests. We show that the rapid evolution of chromosome architecture and an ecological context that led to secondary contact between nascent species drove the formation of an incipient hybrid species with a potentially unique ecological niche.

  2. Recent advances in the genome-wide study of DNA replication origins in yeast

    Directory of Open Access Journals (Sweden)

    Chong ePeng

    2015-02-01

    Full Text Available DNA replication, one of the central events in the cell cycle, is the basis of biological inheritance. In order to be duplicated, a DNA double helix must be opened at defined sites, which are called DNA replication origins (ORIs. Unlike in bacteria, where replication initiates from a single replication origin, multiple origins are utilized in the eukaryotic genome. Among them, the ORIs in budding yeast Saccharomyces cerevisiae and the fission yeast Schizosaccharomyces pombe have been best characterized. In recent years, advances in DNA microarray and next-generation sequencing technologies have increased the number of yeast species involved in ORIs research dramatically. The ORIs in some nonconventional yeast species such as Kluyveromyces lactis and Pichia pastoris have also been genome-widely identified. Relevant databases of replication origins in yeast were constructed, then the comparative genomic analysis can be carried out. Here, we review several experimental approaches that have been used to map replication origins in yeast and some of the available web resources related to yeast ORIs. We also discuss the sequence characteristics and chromosome structures of ORIs in the four yeast species, which can be utilized to improve the replication origins prediction.

  3. Recommendations for reporting tumor budding in colorectal cancer based on the International Tumor Budding Consensus Conference (ITBCC) 2016

    DEFF Research Database (Denmark)

    Lugli, Alessandro; Kirsch, Richard; Ajioka, Yoichi

    2017-01-01

    to determine the strength of recommendations and quality of evidence. The following 10 statements achieved consensus: Tumor budding is defined as a single tumor cell or a cell cluster consisting of four tumor cells or less (22/22, 100%). Tumor budding is an independent predictor of lymph node metastases in pT1......%). Intratumoral budding exists in colorectal cancer and has been shown to be related to lymph node metastasis (22/22, 100%). Tumor budding is assessed in one hotspot (in a field measuring 0.785 mm 2) at the invasive front (22/22, 100%). A three-tier system should be used along with the budding count in order...

  4. Engineering 1-Alkene Biosynthesis and Secretion by Dynamic Regulation in Yeast

    DEFF Research Database (Denmark)

    Zhou, Yongjin J.; Hu, Yating; Zhu, Zhiwei

    2018-01-01

    strategy to control the expression of membrane enzyme and 1-alkene production and cell growth by relieving the possible toxicity of overexpressed membrane proteins. With these efforts, the engineered yeast cell factory produced 35.3 mg/L 1-alkenes with more than 80% being secreted. This represents a 10...... product secretion. Here, we engineered the budding yeast Saccharomyces cerevisiae to produce and secrete 1-alkenes by manipulation of the fatty acid metabolism, enzyme selection, engineering the electron transfer system and expressing a transporter. Furthermore, we implemented a dynamic regulation...

  5. Heterotrimeric G Protein-coupled Receptor Signaling in Yeast Mating Pheromone Response.

    Science.gov (United States)

    Alvaro, Christopher G; Thorner, Jeremy

    2016-04-08

    The DNAs encoding the receptors that respond to the peptide mating pheromones of the budding yeastSaccharomyces cerevisiaewere isolated in 1985, and were the very first genes for agonist-binding heterotrimeric G protein-coupled receptors (GPCRs) to be cloned in any organism. Now, over 30 years later, this yeast and its receptors continue to provide a pathfinding experimental paradigm for investigating GPCR-initiated signaling and its regulation, as described in this retrospective overview. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. An Algorithm to Automate Yeast Segmentation and Tracking

    Science.gov (United States)

    Doncic, Andreas; Eser, Umut; Atay, Oguzhan; Skotheim, Jan M.

    2013-01-01

    Our understanding of dynamic cellular processes has been greatly enhanced by rapid advances in quantitative fluorescence microscopy. Imaging single cells has emphasized the prevalence of phenomena that can be difficult to infer from population measurements, such as all-or-none cellular decisions, cell-to-cell variability, and oscillations. Examination of these phenomena requires segmenting and tracking individual cells over long periods of time. However, accurate segmentation and tracking of cells is difficult and is often the rate-limiting step in an experimental pipeline. Here, we present an algorithm that accomplishes fully automated segmentation and tracking of budding yeast cells within growing colonies. The algorithm incorporates prior information of yeast-specific traits, such as immobility and growth rate, to segment an image using a set of threshold values rather than one specific optimized threshold. Results from the entire set of thresholds are then used to perform a robust final segmentation. PMID:23520484

  7. An algorithm to automate yeast segmentation and tracking.

    Directory of Open Access Journals (Sweden)

    Andreas Doncic

    Full Text Available Our understanding of dynamic cellular processes has been greatly enhanced by rapid advances in quantitative fluorescence microscopy. Imaging single cells has emphasized the prevalence of phenomena that can be difficult to infer from population measurements, such as all-or-none cellular decisions, cell-to-cell variability, and oscillations. Examination of these phenomena requires segmenting and tracking individual cells over long periods of time. However, accurate segmentation and tracking of cells is difficult and is often the rate-limiting step in an experimental pipeline. Here, we present an algorithm that accomplishes fully automated segmentation and tracking of budding yeast cells within growing colonies. The algorithm incorporates prior information of yeast-specific traits, such as immobility and growth rate, to segment an image using a set of threshold values rather than one specific optimized threshold. Results from the entire set of thresholds are then used to perform a robust final segmentation.

  8. Estimating the Per-Base-Pair Mutation Rate in the Yeast Saccharomyces cerevisiae

    OpenAIRE

    Lang, Gregory I.; Murray, Andrew W.

    2008-01-01

    Although mutation rates are a key determinant of the rate of evolution they are difficult to measure precisely and global mutations rates (mutations per genome per generation) are often extrapolated from the per-base-pair mutation rate assuming that mutation rate is uniform across the genome. Using budding yeast, we describe an improved method for the accurate calculation of mutation rates based on the fluctuation assay. Our analysis suggests that the per-base-pair mutation rates at two genes...

  9. Analysis of the Yeast Kinome Reveals a Network of Regulated Protein Localization during Filamentous Growth

    OpenAIRE

    Bharucha, Nikë; Ma, Jun; Dobry, Craig J.; Lawson, Sarah K.; Yang, Zhifen; Kumar, Anuj

    2008-01-01

    The subcellular distribution of kinases and other signaling proteins is regulated in response to cellular cues; however, the extent of this regulation has not been investigated for any gene set in any organism. Here, we present a systematic analysis of protein kinases in the budding yeast, screening for differential localization during filamentous growth. Filamentous growth is an important stress response involving mitogen-activated protein kinase and cAMP-dependent protein kinase signaling m...

  10. Live longer on MARS: a yeast paradigm of mitochondrial adaptive ROS signaling in aging

    Directory of Open Access Journals (Sweden)

    Gerald S. Shadel

    2014-04-01

    Full Text Available Adaptive responses to stress, including hormesis, have been implicated in longevity, but their mechanisms and out comes are not fully understood. Here, I briefly summarize a longevity mechanism elucidated in the budding yeast chronological lifespan model by which Mitochondrial Adaptive ROS Signaling (MARS promotes beneficial epigenetic and metabolic remodeling. The potential relevance of MARS to the human disease Ataxia-Telangiectasia and as a potential anti-aging target is discussed.

  11. The subcellular localization of yeast glycogen synthase is dependent upon glycogen content

    OpenAIRE

    Wilson, Wayne A.; Boyer, Michael P.; Davis, Keri D.; Burke, Michael; Roach, Peter J.

    2010-01-01

    The budding yeast, Saccharomyces cerevisiae, accumulates the storage polysaccharide glycogen in response to nutrient limitation. Glycogen synthase, the major form of which is encoded by the GSY2 gene, catalyzes the key regulated step in glycogen storage. Here, we utilize Gsy2p fusions to green fluorescent protein (GFP) to determine where glycogen synthase is located within cells. We demonstrate that the localization pattern of Gsy2-GFP depends upon the glycogen content of the cell. When glyco...

  12. Identification of candidate new cancer susceptibility genes using yeast genomics

    International Nuclear Information System (INIS)

    Brown, M.; Brown, J.A.; Game, J.C.

    2003-01-01

    A large proportion of cancer susceptibility syndromes are the result of mutations in genes in DNA repair or in cell-cycle checkpoints in response to DNA damage, such as ataxia telangiectasia (AT), Fanconi's anemia (FA), Bloom's syndrome (BS), Nijmegen breakage syndrome (NBS), and xeroderma pigmentosum (XP). Mutations in these genes often cause gross chromosomal instability leading to an increased mutation rate of all genes including those directly responsible for cancer. We have proposed that because the orthologs of these genes in budding yeast, S. cerevisiae, confer protection against killing by DNA damaging agents it should be possible to identify new cancer susceptibility genes by identifying yeast genes whose deletion causes sensitivity to DNA damage. We therefore screened the recently completed collection of individual gene deletion mutants to identify genes that affect sensitivity to DNA-damaging agents. Screening for sensitivity in this obtained up to now with the F98 glioma model othe fact that each deleted gene is replaced by a cassette containing two molecular 'barcodes', or 20-mers, that uniquely identify the strain when DNA from a pool of strains is hybridized to an oligonucleotide array containing the complementary sequences of the barcodes. We performed the screen with UV, IR, H 2 0 2 and other DNA damaging agents. In addition to identifying genes already known to confer resistance to DNA damaging agents we have identified, and individually confirmed, several genes not previously associated with resistance. Several of these are of unknown function. We have also examined the chromosomal stability of selected strains and found that IR sensitive strains often but not always exhibit genomic instability. We are presently constructing a yeast artificial chromosome to globally interrogate all the genes in the deletion pool for their involvement in genomic stability. This work shows that budding yeast is a valuable eukaryotic model organism to identify

  13. Transcriptomic Analysis of Flower Bud Differentiation in Magnolia sinostellata

    Directory of Open Access Journals (Sweden)

    Lijie Fan

    2018-04-01

    Full Text Available Magnolias are widely cultivated for their beautiful flowers, but despite their popularity, the molecular mechanisms regulating flower bud differentiation have not been elucidated. Here, we used paraffin sections and RNA-seq to study the process of flower bud differentiation in Magnolia sinostellata. Flower bud development occurred between 28 April and 30 May 2017 and was divided into five stages: undifferentiated, early flower bud differentiation, petal primordium differentiation, stamen primordium differentiation, and pistil primordium differentiation. A total of 52,441 expressed genes were identified, of which 11,592 were significantly differentially expressed in the five bud development stages. Of these, 82 genes were involved in the flowering. In addition, MADS-box and AP2 family genes play critical roles in the formation of flower organs and 20 differentially expressed genes associated with flower bud differentiation were identified in M. sinostellata. A qRT-PCR analysis verified that the MADS-box and AP2 family genes were expressed at high levels during flower bud differentiation. Consequently, this study provides a theoretical basis for the genetic regulation of flowering in M. sinostellata, which lays a foundation for further research into flowering genes and may facilitate the development of new cultivars.

  14. Taste bud homeostasis in health, disease, and aging.

    Science.gov (United States)

    Feng, Pu; Huang, Liquan; Wang, Hong

    2014-01-01

    The mammalian taste bud is an onion-shaped epithelial structure with 50-100 tightly packed cells, including taste receptor cells, supporting cells, and basal cells. Taste receptor cells detect nutrients and toxins in the oral cavity and transmit the sensory information to gustatory nerve endings in the buds. Supporting cells may play a role in the clearance of excess neurotransmitters after their release from taste receptor cells. Basal cells are precursor cells that differentiate into mature taste cells. Similar to other epithelial cells, taste cells turn over continuously, with an average life span of about 8-12 days. To maintain structural homeostasis in taste buds, new cells are generated to replace dying cells. Several recent studies using genetic lineage tracing methods have identified populations of progenitor/stem cells for taste buds, although contributions of these progenitor/stem cell populations to taste bud homeostasis have yet to be fully determined. Some regulatory factors of taste cell differentiation and degeneration have been identified, but our understanding of these aspects of taste bud homoeostasis remains limited. Many patients with various diseases develop taste disorders, including taste loss and taste distortion. Decline in taste function also occurs during aging. Recent studies suggest that disruption or alteration of taste bud homeostasis may contribute to taste dysfunction associated with disease and aging.

  15. A permeability barrier surrounds taste buds in lingual epithelia

    Science.gov (United States)

    Dando, Robin; Pereira, Elizabeth; Kurian, Mani; Barro-Soria, Rene; Chaudhari, Nirupa

    2014-01-01

    Epithelial tissues are characterized by specialized cell-cell junctions, typically localized to the apical regions of cells. These junctions are formed by interacting membrane proteins and by cytoskeletal and extracellular matrix components. Within the lingual epithelium, tight junctions join the apical tips of the gustatory sensory cells in taste buds. These junctions constitute a selective barrier that limits penetration of chemosensory stimuli into taste buds (Michlig et al. J Comp Neurol 502: 1003–1011, 2007). We tested the ability of chemical compounds to permeate into sensory end organs in the lingual epithelium. Our findings reveal a robust barrier that surrounds the entire body of taste buds, not limited to the apical tight junctions. This barrier prevents penetration of many, but not all, compounds, whether they are applied topically, injected into the parenchyma of the tongue, or circulating in the blood supply, into taste buds. Enzymatic treatments indicate that this barrier likely includes glycosaminoglycans, as it was disrupted by chondroitinase but, less effectively, by proteases. The barrier surrounding taste buds could also be disrupted by brief treatment of lingual tissue samples with DMSO. Brief exposure of lingual slices to DMSO did not affect the ability of taste buds within the slice to respond to chemical stimulation. The existence of a highly impermeable barrier surrounding taste buds and methods to break through this barrier may be relevant to basic research and to clinical treatments of taste. PMID:25209263

  16. A permeability barrier surrounds taste buds in lingual epithelia.

    Science.gov (United States)

    Dando, Robin; Pereira, Elizabeth; Kurian, Mani; Barro-Soria, Rene; Chaudhari, Nirupa; Roper, Stephen D

    2015-01-01

    Epithelial tissues are characterized by specialized cell-cell junctions, typically localized to the apical regions of cells. These junctions are formed by interacting membrane proteins and by cytoskeletal and extracellular matrix components. Within the lingual epithelium, tight junctions join the apical tips of the gustatory sensory cells in taste buds. These junctions constitute a selective barrier that limits penetration of chemosensory stimuli into taste buds (Michlig et al. J Comp Neurol 502: 1003-1011, 2007). We tested the ability of chemical compounds to permeate into sensory end organs in the lingual epithelium. Our findings reveal a robust barrier that surrounds the entire body of taste buds, not limited to the apical tight junctions. This barrier prevents penetration of many, but not all, compounds, whether they are applied topically, injected into the parenchyma of the tongue, or circulating in the blood supply, into taste buds. Enzymatic treatments indicate that this barrier likely includes glycosaminoglycans, as it was disrupted by chondroitinase but, less effectively, by proteases. The barrier surrounding taste buds could also be disrupted by brief treatment of lingual tissue samples with DMSO. Brief exposure of lingual slices to DMSO did not affect the ability of taste buds within the slice to respond to chemical stimulation. The existence of a highly impermeable barrier surrounding taste buds and methods to break through this barrier may be relevant to basic research and to clinical treatments of taste. Copyright © 2015 the American Physiological Society.

  17. Taste Bud Homeostasis in Health, Disease, and Aging

    Science.gov (United States)

    2014-01-01

    The mammalian taste bud is an onion-shaped epithelial structure with 50–100 tightly packed cells, including taste receptor cells, supporting cells, and basal cells. Taste receptor cells detect nutrients and toxins in the oral cavity and transmit the sensory information to gustatory nerve endings in the buds. Supporting cells may play a role in the clearance of excess neurotransmitters after their release from taste receptor cells. Basal cells are precursor cells that differentiate into mature taste cells. Similar to other epithelial cells, taste cells turn over continuously, with an average life span of about 8–12 days. To maintain structural homeostasis in taste buds, new cells are generated to replace dying cells. Several recent studies using genetic lineage tracing methods have identified populations of progenitor/stem cells for taste buds, although contributions of these progenitor/stem cell populations to taste bud homeostasis have yet to be fully determined. Some regulatory factors of taste cell differentiation and degeneration have been identified, but our understanding of these aspects of taste bud homoeostasis remains limited. Many patients with various diseases develop taste disorders, including taste loss and taste distortion. Decline in taste function also occurs during aging. Recent studies suggest that disruption or alteration of taste bud homeostasis may contribute to taste dysfunction associated with disease and aging. PMID:24287552

  18. Comparative expression profiling reveals gene functions in female meiosis and gametophyte development in Arabidopsis.

    Science.gov (United States)

    Zhao, Lihua; He, Jiangman; Cai, Hanyang; Lin, Haiyan; Li, Yanqiang; Liu, Renyi; Yang, Zhenbiao; Qin, Yuan

    2014-11-01

    Megasporogenesis is essential for female fertility, and requires the accomplishment of meiosis and the formation of functional megaspores. The inaccessibility and low abundance of female meiocytes make it particularly difficult to elucidate the molecular basis underlying megasporogenesis. We used high-throughput tag-sequencing analysis to identify genes expressed in female meiocytes (FMs) by comparing gene expression profiles from wild-type ovules undergoing megasporogenesis with those from the spl mutant ovules, which lack megasporogenesis. A total of 862 genes were identified as FMs, with levels that are consistently reduced in spl ovules in two biological replicates. Fluorescence-assisted cell sorting followed by RNA-seq analysis of DMC1:GFP-labeled female meiocytes confirmed that 90% of the FMs are indeed detected in the female meiocyte protoplast profiling. We performed reverse genetic analysis of 120 candidate genes and identified four FM genes with a function in female meiosis progression in Arabidopsis. We further revealed that KLU, a putative cytochrome P450 monooxygenase, is involved in chromosome pairing during female meiosis, most likely by affecting the normal expression pattern of DMC1 in ovules during female meiosis. Our studies provide valuable information for functional genomic analyses of plant germline development as well as insights into meiosis. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  19. miR-31 Regulates Spermatogonial Stem Cells Meiosis via Targeting Stra8.

    Science.gov (United States)

    Wang, Yingjie; Zuo, Qisheng; Bi, Yulin; Zhang, Wenhui; Jin, Jing; Zhang, Liangliang; Zhang, Ya-Ni; Li, Bichun

    2017-12-01

    Stra8 (stimulated by retinoic acid gene 8) is a specific gene that is expressed in mammalian germ cells during transition from mitosis to meiosis and plays a key role in the initiation of meiosis in mammals and birds. So, the evaluation of the Stra8 pathway in cSSCs may provide a deeper insight into mammalian spermatogenesis. miRNA was also an important regulating factor for meiosis of SSCs. However, there is currently no data indicating that miRNA regulate the meiosis of SSCs via Stra8. Here, we predicted the prospective miRNA targeting to Stra8 using the online Bioinformatics database-Targetscan, and performed an analysis of the dual-luciferase recombinant vector, pGL3-CMV-LUC-MCS-Stra8-3'UTR. miR-31 mimics (miR-31m), miR-31 inhibitors (miR-31i), Control (NC, scrambled oligonucleotides transfection) were transfected into cSSCs; Stra8 and miRNA were analyzed by RT-qPCR, immunofluorescence, and Western blot. The detection of haploid was conducted by flow cytometry. The results showed that miR-31 regulates meiosis of cSSCs via targeting Stra8 in vitro and in vivo. Our study identifies a new regulatory pathway that miR-31 targets Stra8 and inhibits spermatogenesis. J. Cell. Biochem. 118: 4844-4853, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  20. Role of Securin, Separase and Cohesins in female meiosis and polar body formation in Drosophila.

    Science.gov (United States)

    Guo, Zhihao; Batiha, Osamah; Bourouh, Mohammed; Fifield, Eric; Swan, Andrew

    2016-02-01

    Chromosome segregation in meiosis is controlled by a conserved pathway that culminates in Separase-mediated cleavage of the α-kleisin Rec8, leading to dissolution of cohesin rings. Drosophila has no gene encoding Rec8, and the absence of a known Separase target raises the question of whether Separase and its regulator Securin (Pim in Drosophila) are important in Drosophila meiosis. Here, we investigate the role of Securin, Separase and the cohesin complex in female meiosis using fluorescence in situ hybridization against centromeric and arm-specific sequences to monitor cohesion. We show that Securin destruction and Separase activity are required for timely release of arm cohesion in anaphase I and centromere-proximal cohesion in anaphase II. They are also required for release of arm cohesion on polar body chromosomes. Cohesion on polar body chromosomes depends on the cohesin components SMC3 and the mitotic α-kleisin Rad21 (also called Vtd in Drosophila). We provide cytological evidence that SMC3 is required for arm cohesion in female meiosis, whereas Rad21, in agreement with recent findings, is not. We conclude that in Drosophila meiosis, cohesion is regulated by a conserved Securin-Separase pathway that targets a diverged Separase target, possibly within the cohesin complex. © 2016. Published by The Company of Biologists Ltd.

  1. Apospory appears to accelerate onset of meiosis and sexual embryo sac formation in sorghum ovules

    Directory of Open Access Journals (Sweden)

    Elliott Estella

    2011-01-01

    Full Text Available Abstract Background Genetically unreduced (2n embryo sacs (ES form in ovules of gametophytic apomicts, the 2n eggs of which develop into embryos parthenogenetically. In many apomicts, 2n ES form precociously during ovule development. Whether meiosis and sexual ES formation also occur precociously in facultative apomicts (capable of apomictic and sexual reproduction has not been studied. We determined onset timing of meiosis and sexual ES formation for 569 Sorghum bicolor genotypes, many of which produced 2n ES facultatively. Results Genotype differences for onset timing of meiosis and sexual ES formation, relative to ovule development, were highly significant. A major source of variation in timing of sexual germline development was presence or absence of apomictic ES, which formed from nucellar cells (apospory in some genotypes. Genotypes that produced these aposporous ES underwent meiosis and sexual ES formation precociously. Aposporous ES formation was most prevalent in subsp. verticilliflorum and in breeding lines of subsp. bicolor. It was uncommon in land races. Conclusions The present study adds meiosis and sexual ES formation to floral induction, apomictic ES formation, and parthenogenesis as processes observed to occur precociously in apomictic plants. The temporally diverse nature of these events suggests that an epigenetic memory of the plants' apomixis status exists throughout its life cycle, which triggers, during multiple life cycle phases, temporally distinct processes that accelerate reproduction.

  2. Phylogenomic detection and functional prediction of genes potentially important for plant meiosis.

    Science.gov (United States)

    Zhang, Luoyan; Kong, Hongzhi; Ma, Hong; Yang, Ji

    2018-02-15

    Meiosis is a specialized type of cell division necessary for sexual reproduction in eukaryotes. A better understanding of the cytological procedures of meiosis has been achieved by comprehensive cytogenetic studies in plants, while the genetic mechanisms regulating meiotic progression remain incompletely understood. The increasing accumulation of complete genome sequences and large-scale gene expression datasets has provided a powerful resource for phylogenomic inference and unsupervised identification of genes involved in plant meiosis. By integrating sequence homology and expression data, 164, 131, 124 and 162 genes potentially important for meiosis were identified in the genomes of Arabidopsis thaliana, Oryza sativa, Selaginella moellendorffii and Pogonatum aloides, respectively. The predicted genes were assigned to 45 meiotic GO terms, and their functions were related to different processes occurring during meiosis in various organisms. Most of the predicted meiotic genes underwent lineage-specific duplication events during plant evolution, with about 30% of the predicted genes retaining only a single copy in higher plant genomes. The results of this study provided clues to design experiments for better functional characterization of meiotic genes in plants, promoting the phylogenomic approach to the evolutionary dynamics of the plant meiotic machineries. Copyright © 2017 Elsevier B.V. All rights reserved.

  3. Inflammation activates the interferon signaling pathways in taste bud cells.

    Science.gov (United States)

    Wang, Hong; Zhou, Minliang; Brand, Joseph; Huang, Liquan

    2007-10-03

    Patients with viral and bacterial infections or other inflammatory illnesses often experience taste dysfunctions. The agents responsible for these taste disorders are thought to be related to infection-induced inflammation, but the mechanisms are not known. As a first step in characterizing the possible role of inflammation in taste disorders, we report here evidence for the presence of interferon (IFN)-mediated signaling pathways in taste bud cells. IFN receptors, particularly the IFN-gamma receptor IFNGR1, are coexpressed with the taste cell-type markers neuronal cell adhesion molecule and alpha-gustducin, suggesting that both the taste receptor cells and synapse-forming cells in the taste bud can be stimulated by IFN. Incubation of taste bud-containing lingual epithelia with recombinant IFN-alpha and IFN-gamma triggered the IFN-mediated signaling cascades, resulting in the phosphorylation of the downstream STAT1 (signal transducer and activator of transcription protein 1) transcription factor. Intraperitoneal injection of lipopolysaccharide or polyinosinic:polycytidylic acid into mice, mimicking bacterial and viral infections, respectively, altered gene expression patterns in taste bud cells. Furthermore, the systemic administration of either IFN-alpha or IFN-gamma significantly increased the number of taste bud cells undergoing programmed cell death. These findings suggest that bacterial and viral infection-induced IFNs can act directly on taste bud cells, affecting their cellular function in taste transduction, and that IFN-induced apoptosis in taste buds may cause abnormal cell turnover and skew the representation of different taste bud cell types, leading to the development of taste disorders. To our knowledge, this is the first study providing direct evidence that inflammation can affect taste buds through cytokine signaling pathways.

  4. Norepinephrine is coreleased with serotonin in mouse taste buds.

    Science.gov (United States)

    Huang, Yijen A; Maruyama, Yutaka; Roper, Stephen D

    2008-12-03

    ATP and serotonin (5-HT) are neurotransmitters secreted from taste bud receptor (type II) and presynaptic (type III) cells, respectively. Norepinephrine (NE) has also been proposed to be a neurotransmitter or paracrine hormone in taste buds. Yet, to date, the specific stimulus for NE release in taste buds is not well understood, and the identity of the taste cells that secrete NE is not known. Chinese hamster ovary cells were transfected with alpha(1A) adrenoceptors and loaded with fura-2 ("biosensors") to detect NE secreted from isolated mouse taste buds and taste cells. Biosensors responded to low concentrations of NE (>or=10 nm) with a reliable fura-2 signal. NE biosensors did not respond to stimulation with KCl or taste compounds. However, we recorded robust responses from NE biosensors when they were positioned against mouse circumvallate taste buds and the taste buds were stimulated with KCl (50 mm) or a mixture of taste compounds (cycloheximide, 10 microm; saccharin, 2 mm; denatonium, 1 mm; SC45647, 100 microm). NE biosensor responses evoked by stimulating taste buds were reversibly blocked by prazosin, an alpha(1A) receptor antagonist. Together, these findings indicate that taste bud cells secrete NE when they are stimulated. We isolated individual taste bud cells to identify the origin of NE release. NE was secreted only from presynaptic (type III) taste cells and not receptor (type II) cells. Stimulus-evoked NE release depended on Ca(2+) in the bathing medium. Using dual biosensors (sensitive to 5-HT and NE), we found all presynaptic cells secrete 5-HT and 33% corelease NE with 5-HT.

  5. Pleiotropic functions of the yeast Greatwall-family protein kinase Rim15p: a novel target for the control of alcoholic fermentation.

    Science.gov (United States)

    Watanabe, Daisuke; Takagi, Hiroshi

    2017-06-01

    Rim15p, a Greatwall-family protein kinase in yeast Saccharomyces cerevisiae, is required for cellular nutrient responses, such as the entry into quiescence and the induction of meiosis and sporulation. In higher eukaryotes, the orthologous gene products are commonly involved in the cell cycle G 2 /M transition. How are these pleiotropic functions generated from a single family of protein kinases? Recent advances in both research fields have identified the conserved Greatwall-mediated signaling pathway and a variety of downstream target molecules. In addition, our studies of S. cerevisiae sake yeast strains revealed that Rim15p also plays a significant role in the control of alcoholic fermentation. Despite an extensive history of research on glycolysis and alcoholic fermentation, there has been no critical clue to artificial modification of fermentation performance of yeast cells. Our finding of an in vivo metabolic regulatory mechanism is expected to provide a major breakthrough in yeast breeding technologies for fermentation applications.

  6. Nuclear vlimata and aneuploidy in embryonic cells is caused by meiosis. Behaviour and properties of meiotic cells

    OpenAIRE

    Logothetou-Rella, H.

    1995-01-01

    This study demonstrates that human embryonic cells divide by meiosis. The use of trophoblastic tissue cells (early embryo) and amniotic cells (late embryo) exhibited the following characteristic events of meiosis: nuclear (NVs) and nucleolar (NuVs) vlimata formation; NV invasion in host cells; extrusion of chromosomes; nuclear fusion; metaphase fusion; hybrid cell formation; nuclear, nucleolar and cytoplasmic bridges, chromosomal transfer, variablesized nuc...

  7. Meiosis peculiarities featured by first-generation spring wheat (Triticum aestivum L.) under the influence of gamma-radiation

    International Nuclear Information System (INIS)

    Sen', L.A.; Volodin, V.G.; Elef, A.V.; Mikhalenko, N.A.

    2003-01-01

    The study of meiosis of spring wheat represented by three varieties revealed intervarietal differences according to the frequency and types of disturbances. Gamma-irradiation with 10 kCi dose increased the disturbance frequency during meiosis in all varieties. However, there were substantial differences in the variety response to the irradiation. (authors)

  8. "Chromoseratops Meiosus": A Simple, Two-Phase Exercise to Represent the Connection between Meiosis & Increased Genetic Diversity

    Science.gov (United States)

    Eliyahu, Dorit

    2014-01-01

    I present an activity to help students make the connection between meiosis and genetic variation. The students model meiosis in the first phase of the activity, and by that process they produce gametes of a fictitious reptilobird species, "Chromoseratops meiosus." Later on, they will "mate" their gametes and produce a zygote…

  9. A Paper-and-Pencil Strategy for Teaching Mitosis and Meiosis, Diagnosing Learning Problems and Predicting Examination Performance.

    Science.gov (United States)

    Mertens, Thomas R.; Walker, Julie O.

    1992-01-01

    Describes the Bajema strategy for teaching meiosis and how it is used in the general genetics course at Ball State University and can be used to identify students who have misconceptions of meiosis that can interfere with their learning the basics of Mendelian inheritance. (Contains 11 references.) (MDH)

  10. Comprehensive Cloning of Prunus mume Dormancy Associated MADS-Box Genes and Their Response in Flower Bud Development and Dormancy

    Directory of Open Access Journals (Sweden)

    Kai Zhao

    2018-02-01

    Full Text Available Dormancy Associated MADS-box genes are SVP/MADs-box members and supposed to play crucial roles in plant dormancy of perennial species. In Prunus mume, PmDAM6 has been previously identified to induce plant dormancy. In the current study, six PmDAMs were cloned in P. mume and functionally analyzed in yeast and tobacco to detect the roles of the genes paralogous to PmDAM6. The expression patterns together with sequence similarities indicate that PmDAMs are divided into two sub-clades within SVP group. Moreover, PmDAMs are verified to take part in the development of different plant organs, specifically the flower buds, in some intricate patterns. Furthermore, the PmDAM proteins are found to have special functions by forming corresponding protein complex during the development of flower bud and induction of dormancy. In particular, when PmDAM1 dominating in flower bud in the warm months, the protein complexes are consisted of PmDAM1 itself or with PmDAM2. With the decrease temperatures in the following months, PmDAM6 was found to be highly expressed and gradually changed the complex structure to PmDAM6-protein complex due to strong binding tendencies with PmDAM1 and PmDAM3. Finally, the homodimers of PmDAM6 prevailed to induce the dormancy. The results obtained in the current study highlight the functions of PmDAMs in the tissue development and dormancy, which provide available suggestions for further explorations of protein-complex functions in association with bud growth and dormancy.

  11. Male meiosis in Crustacea: synapsis, recombination, epigenetics and fertility in Daphnia magna.

    Science.gov (United States)

    Gómez, Rocío; Van Damme, Kay; Gosálvez, Jaime; Morán, Eugenio Sánchez; Colbourne, John K

    2016-09-01

    We present the first detailed cytological study of male meiosis in Daphnia (Crustacea: Branchiopoda: Cladocera)-an aquatic microcrustacean with a cyclical parthenogenetic life cycle. Using immunostaining of the testes in Daphnia magna for baseline knowledge, we characterized the different stages of meiotic division and spermiogenesis in relation to the distribution of proteins involved in synapsis, early recombination events and sister chromatid cohesion. We also studied post-translational histone modifications in male spermatocytes, in relation to the dynamic chromatin progression of meiosis. Finally, we applied a DNA fragmentation test to measure sperm quality of D. magna, with respect to levels of inbreeding. As a proxy for fertility, this technique may be used to assess the reproductive health of a sentinel species of aquatic ecosystems. Daphnia proves to be a model species for comparative studies of meiosis that is poised to improve our understanding of the cytological basis of sexual and asexual reproduction.

  12. CENP-A regulates chromosome segregation during the first meiosis of mouse oocytes.

    Science.gov (United States)

    Li, Li; Qi, Shu-Tao; Sun, Qing-Yuan; Chen, Shi-Ling

    2017-06-01

    Proper chromosome separation in both mitosis and meiosis depends on the correct connection between kinetochores of chromosomes and spindle microtubules. Kinetochore dysfunction can lead to unequal distribution of chromosomes during cell division and result in aneuploidy, thus kinetochores are critical for faithful segregation of chromosomes. Centromere protein A (CENP-A) is an important component of the inner kinetochore plate. Multiple studies in mitosis have found that deficiencies in CENP-A could result in structural and functional changes of kinetochores, leading to abnormal chromosome segregation, aneuploidy and apoptosis in cells. Here we report the expression and function of CENP-A during mouse oocyte meiosis. Our study found that microinjection of CENP-A blocking antibody resulted in errors of homologous chromosome segregation and caused aneuploidy in eggs. Thus, our findings provide evidence that CENP-A is critical for the faithful chromosome segregation during mammalian oocyte meiosis.

  13. Cytochemical and autoradiographic studies of meiosis and microsporanogenesis in tradescantia paludosa

    International Nuclear Information System (INIS)

    Dryanovska, O.

    1981-01-01

    Labelling experiments with H 3 -thymidine, H 3 -uridine and H 3 -leucine have been carried out with Tradescantia paludosa. The results of this study showed that from pre-meiosis to the pollen grain the chromatin, the nucleoli and the cytoplasm undergo alternative structural, cytochemical and functional changes connected with the differential functioning of the genes and the differentiation of the cells. Chromatin condensation is connected with DNA synthesis only in the pre-meiosis and in the microspore. Decondensation is connected with despiralization and with slight heterochromatization of the chromatin, with development and functioning of the nucleoli, slight DNA synthesis and intense synthesis of RNAs and proteins. Probably the nucleolus in meiosis is playing a certain role. (author)

  14. Cytochemical and autoradiographic studies of meiosis and microsporanogenesis in tradescantia paludosa

    Energy Technology Data Exchange (ETDEWEB)

    Dryanovska, O. (Bylgarska Akademiya na Naukite, Sofia. Inst. po Genetika)

    1981-01-01

    Labelling experiments with H/sup 3/-thymidine, H/sup 3/-uridine and H/sup 3/-leucine have been carried out with Tradescantia paludosa. The results of this study showed that from pre-meiosis to the pollen grain the chromatin, the nucleoli and the cytoplasm undergo alternative structural, cytochemical and functional changes connected with the differential functioning of the genes and the differentiation of the cells. Chromatin condensation is connected with DNA synthesis only in the pre-meiosis and in the microspore. Decondensation is connected with despiralization and with slight heterochromatization of the chromatin, with development and functioning of the nucleoli, slight DNA synthesis and intense synthesis of RNAs and proteins. Probably the nucleolus in meiosis is playing a certain role.

  15. Download - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available search(/contents-en/) != -1 || url.search(/index-e.html/) != -1 ) { document.getElementById(lang).innerHTML=.../) != -1 ) { url = url.replace(-e.html,.html); document.getElementById(lang).innerHTML=[ Japanese |...en/,/jp/); document.getElementById(lang).innerHTML=[ Japanese | English ]; } else if ( url.search(//contents...//) != -1 ) { url = url.replace(/contents/,/contents-en/); document.getElementById(lang).innerHTML=[ Japanes...e(/contents-en/,/contents/); document.getElementById(lang).innerHTML=[ Japanese | English ]; } else if( url.

  16. High-resolution transcription atlas of the mitotic cell cycle in budding yeast

    DEFF Research Database (Denmark)

    Granovskaia, Marina V; Jensen, Lars J; Ritchie, Matthew E

    2010-01-01

    Extensive transcription of non-coding RNAs has been detected in eukaryotic genomes and is thought to constitute an additional layer in the regulation of gene expression. Despite this role, their transcription through the cell cycle has not been studied; genome-wide approaches have only focused on...

  17. Cell mass and cell cycle dynamics of an asynchronous budding yeast population

    DEFF Research Database (Denmark)

    Lencastre Fernandes, Rita; Carlquist, Magnus; Lundin, Luisa

    2013-01-01

    of model predictions for cell property distributions against experimental data is scarce. This study focuses on the experimental and mathematical description of the dynamics of cell size and cell cycle position distributions, of a population of Saccharomyces cerevisiae, in response to the substrate...

  18. Database Description - Budding yeast cDNA sequencing project | LSDB Archive [Life Science Database Archive metadata

    Lifescience Database Archive (English)

    Full Text Available Frontier Sciences, The University of Tokyo(when creating) Creator Name: Takashi ...ating) Contact address GSFS - CB-06, Transdisciplinary Sciences, The University of ...Ito* Creator Affiliation: Department of Computational Biology, Graduate School of Frontier Sciences, The University of Tokyo(when cre

  19. Analysis of aging in lager brewing yeast during serial repitching.

    Science.gov (United States)

    Bühligen, Franziska; Lindner, Patrick; Fetzer, Ingo; Stahl, Frank; Scheper, Thomas; Harms, Hauke; Müller, Susann

    2014-10-10

    Serial repitching of brewing yeast inoculates is an important economic factor in the brewing industry, as their propagation is time and resource intensive. Here, we investigated whether replicative aging and/or the population distribution status changed during serial repitching in three different breweries with the same brewing yeast strain but different abiotic backgrounds and repitching regimes with varying numbers of reuses. Next to bud scar numbers the DNA content of the Saccharomyces pastorianus HEBRU cells was analyzed. Gene expression patterns were investigated using low-density microarrays with genes for aging, stress, storage compound metabolism and cell cycle. Two breweries showed a stable rejuvenation rate during serial repitching. In a third brewery the fraction of virgin cells varied, which could be explained with differing wort aeration rates. Furthermore, the number of bud scars per cell and cell size correlated in all 3 breweries throughout all runs. Transcriptome analyses revealed that from the 6th run on, mainly for the cells positive gene expression could be seen, for example up-regulation of trehalose and glycogen metabolism genes. Additionally, the cells' settling in the cone was dependent on cell size, with the lowest and the uppermost cone layers showing the highest amount of dead cells. In general, cells do not progressively age during extended serial repitching. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Brewing characteristics of haploid strains isolated from sake yeast Kyokai No. 7.

    Science.gov (United States)

    Katou, Taku; Kitagaki, Hiroshi; Akao, Takeshi; Shimoi, Hitoshi

    2008-11-01

    Sake yeast exhibit various characteristics that make them more suitable for sake brewing compared to other yeast strains. Since sake yeast strains are Saccharomyces cerevisiae heterothallic diploid strains, it is likely that they have heterozygous alleles on homologous chromosomes (heterozygosity) due to spontaneous mutations. If this is the case, segregation of phenotypic traits in haploid strains after sporulation and concomitant meiosis of sake yeast strains would be expected to occur. To examine this hypothesis, we isolated 100 haploid strains from Kyokai No. 7 (K7), a typical sake yeast strain in Japan, and compared their brewing characteristics in small-scale sake-brewing tests. Analyses of the resultant sake samples showed a smooth and continuous distribution of analytical values for brewing characteristics, suggesting that K7 has multiple heterozygosities that affect brewing characteristics and that these heterozygous alleles do segregate after sporulation. Correlation and principal component analyses suggested that the analytical parameters could be classified into two groups, indicating fermentation ability and sake flavour. (c) 2008 John Wiley & Sons, Ltd.

  1. Inducing somatic meiosis-like reduction at high frequency by caffeine in root-tip cells of Vicia faba.

    Science.gov (United States)

    Chen, Y; Zhang, L; Zhou, Y; Geng, Y; Chen, Z

    2000-07-20

    Germinated seeds of Vicia faba were treated in caffeine solutions of different concentration for different durations to establish the inducing system of somatic meiosis-like reduction. The highest frequency of somatic meiosis-like reduction could reach up to 54.0% by treating the root tips in 70 mmol/l caffeine solution for 2 h and restoring for 24 h. Two types of somatic meiosis-like reduction were observed. One was reductional grouping, in which the chromosomes in a cell usually separated into two groups, and the role of spindle fibers did not show. The other type was somatic meiosis, which was analogous to meiosis presenting in gametogenesis, and chromosome pairing and chiasmata were visualized.

  2. Yeast identification in floral nectar of Mimulus aurantiacus (Invited)

    Science.gov (United States)

    Kyauk, C.; Belisle, M.; Fukami, T.

    2009-12-01

    Nectar is such a sugar-rich resource that serves as a natural habitat in which microbes thrive. As a result, yeasts arrive to nectar on the bodies of pollinators such as hummingbirds and bees. Yeasts use the sugar in nectar for their own needs when introduced. This research focuses on the identification of different types of yeast that are found in the nectar of Mimulus aurantiacus (commonly known as sticky monkey-flower). Unopened Mimulus aurantiacus flower buds were tagged at Jasper Ridge and bagged three days later. Floral nectar was then extracted and plated on potato dextrose agar. Colonies on the plates were isolated and DNA was extracted from each sample using QIAGEN DNeasy Plant Mini Kit. The DNA was amplified through PCR and ran through gel electrophoresis. The PCR product was used to clone the nectar samples into an E.coli vector. Finally, a phylogenetic tree was created by BLAST searching sequences in GenBank using the Internal Transcribed Space (ITS) locus. It was found that 18 of the 50 identified species were Candida magnifica, 14 was Candida rancensis, 6 were Crytococcus albidus and there were 3 or less of the following: Starmella bombicola, Candida floricola, Aureobasidium pullulans, Pichia kluyvera, Metschnikowa cibodaserisis, Rhodotorua colostri, and Malassezia globosa. The low diversity of the yeast could have been due to several factors: time of collection, demographics of Jasper Ridge, low variety of pollinators, and sugar concentration of the nectar. The results of this study serve as a necessary first step for a recently started research project on ecological interactions between plants, pollinators, and nectar-living yeast. More generally, this research studies the use of the nectar-living yeast community as a natural microcosm for addressing basic questions about the role of dispersal and competitive and facilitative interactions in ecological succession.

  3. Meiosis in desynaptic-chromosomal restitution mutants in Rhoeo spathacea (Commelinaceae)

    OpenAIRE

    García-Velázquez, Armando

    2008-01-01

    El estudio se llevó a cabo en recolectas de Rhoeo spathacea realizadas en Veracruz, Chiapas, Tabasco, Yucatán, Quintana Roo y Michoacán, México. Las plantas presentaron número diploide de cromosomas (2n=12) en mitosis. En meiosis los individuos formaron anillo y/o cadenas en metafase I, con excepción de varios mutantes desinápticos-RSD (separación de cromosomas apareados). En meiosis de Rhoeo no se observan bivalentes ni hay posibilidades de entrecruzamiento, y consecuentemente no habrá quias...

  4. Mouse CCDC79 (TERB1) is a meiosis-specific telomere associated protein.

    Science.gov (United States)

    Daniel, Katrin; Tränkner, Daniel; Wojtasz, Lukasz; Shibuya, Hiroki; Watanabe, Yoshinori; Alsheimer, Manfred; Tóth, Attila

    2014-05-22

    Telomeres have crucial meiosis-specific roles in the orderly reduction of chromosome numbers and in ensuring the integrity of the genome during meiosis. One such role is the attachment of telomeres to trans-nuclear envelope protein complexes that connect telomeres to motor proteins in the cytoplasm. These trans-nuclear envelope connections between telomeres and cytoplasmic motor proteins permit the active movement of telomeres and chromosomes during the first meiotic prophase. Movements of chromosomes/telomeres facilitate the meiotic recombination process, and allow high fidelity pairing of homologous chromosomes. Pairing of homologous chromosomes is a prerequisite for their correct segregation during the first meiotic division. Although inner-nuclear envelope proteins, such as SUN1 and potentially SUN2, are known to bind and recruit meiotic telomeres, these proteins are not meiosis-specific, therefore cannot solely account for telomere-nuclear envelope attachment and/or for other meiosis-specific characteristics of telomeres in mammals. We identify CCDC79, alternatively named TERB1, as a meiosis-specific protein that localizes to telomeres from leptotene to diplotene stages of the first meiotic prophase. CCDC79 and SUN1 associate with telomeres almost concurrently at the onset of prophase, indicating a possible role for CCDC79 in telomere-nuclear envelope interactions and/or telomere movements. Consistent with this scenario, CCDC79 is missing from most telomeres that fail to connect to SUN1 protein in spermatocytes lacking the meiosis-specific cohesin SMC1B. SMC1B-deficient spermatocytes display both reduced efficiency in telomere-nuclear envelope attachment and reduced stability of telomeres specifically during meiotic prophase. Importantly, CCDC79 associates with telomeres in SUN1-deficient spermatocytes, which strongly indicates that localization of CCDC79 to telomeres does not require telomere-nuclear envelope attachment. CCDC79 is a meiosis-specific telomere

  5. Functional cell types in taste buds have distinct longevities.

    Directory of Open Access Journals (Sweden)

    Isabel Perea-Martinez

    Full Text Available Taste buds are clusters of polarized sensory cells embedded in stratified oral epithelium. In adult mammals, taste buds turn over continuously and are replenished through the birth of new cells in the basal layer of the surrounding non-sensory epithelium. The half-life of cells in mammalian taste buds has been estimated as 8-12 days on average. Yet, earlier studies did not address whether the now well-defined functional taste bud cell types all exhibit the same lifetime. We employed a recently developed thymidine analog, 5-ethynil-2'-deoxyuridine (EdU to re-evaluate the incorporation of newly born cells into circumvallate taste buds of adult mice. By combining EdU-labeling with immunostaining for selected markers, we tracked the differentiation and lifespan of the constituent cell types of taste buds. EdU was primarily incorporated into basal extragemmal cells, the principal source for replenishing taste bud cells. Undifferentiated EdU-labeled cells began migrating into circumvallate taste buds within 1 day of their birth. Type II (Receptor taste cells began to differentiate from EdU-labeled precursors beginning 2 days after birth and then were eliminated with a half-life of 8 days. Type III (Presynaptic taste cells began differentiating after a delay of 3 days after EdU-labeling, and they survived much longer, with a half-life of 22 days. We also scored taste bud cells that belong to neither Type II nor Type III, a heterogeneous group that includes mostly Type I cells, and also undifferentiated or immature cells. A non-linear decay fit described these cells as two sub-populations with half-lives of 8 and 24 days respectively. Our data suggest that many post-mitotic cells may remain quiescent within taste buds before differentiating into mature taste cells. A small number of slow-cycling cells may also exist within the perimeter of the taste bud. Based on their incidence, we hypothesize that these may be progenitors for Type III cells.

  6. Functional cell types in taste buds have distinct longevities.

    Science.gov (United States)

    Perea-Martinez, Isabel; Nagai, Takatoshi; Chaudhari, Nirupa

    2013-01-01

    Taste buds are clusters of polarized sensory cells embedded in stratified oral epithelium. In adult mammals, taste buds turn over continuously and are replenished through the birth of new cells in the basal layer of the surrounding non-sensory epithelium. The half-life of cells in mammalian taste buds has been estimated as 8-12 days on average. Yet, earlier studies did not address whether the now well-defined functional taste bud cell types all exhibit the same lifetime. We employed a recently developed thymidine analog, 5-ethynil-2'-deoxyuridine (EdU) to re-evaluate the incorporation of newly born cells into circumvallate taste buds of adult mice. By combining EdU-labeling with immunostaining for selected markers, we tracked the differentiation and lifespan of the constituent cell types of taste buds. EdU was primarily incorporated into basal extragemmal cells, the principal source for replenishing taste bud cells. Undifferentiated EdU-labeled cells began migrating into circumvallate taste buds within 1 day of their birth. Type II (Receptor) taste cells began to differentiate from EdU-labeled precursors beginning 2 days after birth and then were eliminated with a half-life of 8 days. Type III (Presynaptic) taste cells began differentiating after a delay of 3 days after EdU-labeling, and they survived much longer, with a half-life of 22 days. We also scored taste bud cells that belong to neither Type II nor Type III, a heterogeneous group that includes mostly Type I cells, and also undifferentiated or immature cells. A non-linear decay fit described these cells as two sub-populations with half-lives of 8 and 24 days respectively. Our data suggest that many post-mitotic cells may remain quiescent within taste buds before differentiating into mature taste cells. A small number of slow-cycling cells may also exist within the perimeter of the taste bud. Based on their incidence, we hypothesize that these may be progenitors for Type III cells.

  7. Yeast genome sequencing:

    DEFF Research Database (Denmark)

    Piskur, Jure; Langkjær, Rikke Breinhold

    2004-01-01

    For decades, unicellular yeasts have been general models to help understand the eukaryotic cell and also our own biology. Recently, over a dozen yeast genomes have been sequenced, providing the basis to resolve several complex biological questions. Analysis of the novel sequence data has shown...... of closely related species helps in gene annotation and to answer how many genes there really are within the genomes. Analysis of non-coding regions among closely related species has provided an example of how to determine novel gene regulatory sequences, which were previously difficult to analyse because...... they are short and degenerate and occupy different positions. Comparative genomics helps to understand the origin of yeasts and points out crucial molecular events in yeast evolutionary history, such as whole-genome duplication and horizontal gene transfer(s). In addition, the accumulating sequence data provide...

  8. Real Life Science with Dandelions and Project BudBurst

    Directory of Open Access Journals (Sweden)

    Katherine A. Johnson

    2015-12-01

    Full Text Available Project BudBurst is a national citizen-science project that tracks bloom times and other phenological data for plants across the country. Data from Project BudBurst are being used to measure the effects of climate change. Students can participate in this project by watching any of the plants on the list, including the common dandelion, which makes the program easy and accessible to everyone.

  9. Real Life Science with Dandelions and Project BudBurst.

    Science.gov (United States)

    Johnson, Katherine A

    2016-03-01

    Project BudBurst is a national citizen-science project that tracks bloom times and other phenological data for plants across the country. Data from Project BudBurst are being used to measure the effects of climate change. Students can participate in this project by watching any of the plants on the list, including the common dandelion, which makes the program easy and accessible to everyone. Journal of Microbiology & Biology Education.

  10. Taste Bud Homeostasis in Health, Disease, and Aging

    OpenAIRE

    Feng, Pu; Huang, Liquan; Wang, Hong

    2013-01-01

    The mammalian taste bud is an onion-shaped epithelial structure with 50–100 tightly packed cells, including taste receptor cells, supporting cells, and basal cells. Taste receptor cells detect nutrients and toxins in the oral cavity and transmit the sensory information to gustatory nerve endings in the buds. Supporting cells may play a role in the clearance of excess neurotransmitters after their release from taste receptor cells. Basal cells are precursor cells that differentiate into mature...

  11. Longleaf pine bud development: influence of seedling nutrition

    Science.gov (United States)

    J. P. Barnett; D. P. Jackson; R. K. Dumroese

    2010-01-01

    A subset of seedlings from a larger study (Jackson and others 2006, 2007) were selected and evaluated for two growing seasons to relate bud development, and root-collar diameter (RCD), and height growth with three nursery fertilization rates. We chose seedlings in the 0.5 (lowest), 2.0 (mid-range), and 4.0 (highest) mg of nitrogen per seedling treatments. Buds moved...

  12. Nitrile Metabolizing Yeasts

    Science.gov (United States)

    Bhalla, Tek Chand; Sharma, Monica; Sharma, Nitya Nand

    Nitriles and amides are widely distributed in the biotic and abiotic components of our ecosystem. Nitrile form an important group of organic compounds which find their applications in the synthesis of a large number of compounds used as/in pharmaceutical, cosmetics, plastics, dyes, etc>. Nitriles are mainly hydro-lyzed to corresponding amide/acid in organic chemistry. Industrial and agricultural activities have also lead to release of nitriles and amides into the environment and some of them pose threat to human health. Biocatalysis and biotransformations are increasingly replacing chemical routes of synthesis in organic chemistry as a part of ‘green chemistry’. Nitrile metabolizing organisms or enzymes thus has assumed greater significance in all these years to convert nitriles to amides/ acids. The nitrile metabolizing enzymes are widely present in bacteria, fungi and yeasts. Yeasts metabolize nitriles through nitrilase and/or nitrile hydratase and amidase enzymes. Only few yeasts have been reported to possess aldoxime dehydratase. More than sixty nitrile metabolizing yeast strains have been hither to isolated from cyanide treatment bioreactor, fermented foods and soil. Most of the yeasts contain nitrile hydratase-amidase system for metabolizing nitriles. Transformations of nitriles to amides/acids have been carried out with free and immobilized yeast cells. The nitrilases of Torulopsis candida>and Exophiala oligosperma>R1 are enantioselec-tive and regiospecific respectively. Geotrichum>sp. JR1 grows in the presence of 2M acetonitrile and may have potential for application in bioremediation of nitrile contaminated soil/water. The nitrilase of E. oligosperma>R1 being active at low pH (3-6) has shown promise for the hydroxy acids. Immobilized yeast cells hydrolyze some additional nitriles in comparison to free cells. It is expected that more focus in future will be on purification, characterization, cloning, expression and immobilization of nitrile metabolizing

  13. Micropropagation of Helleborus through axillary budding.

    Science.gov (United States)

    Beruto, Margherita; Viglione, Serena; Bisignano, Alessandro

    2013-01-01

    Helleborus genus, belonging to the Ranunculaceae family, has 20 species of herbaceous perennial flowering plants. The commercial exploitation of this plant is dependent on the selection and propagation of appropriate lines. High propagation rate could be accomplished by using a suitable tissue culture method enabling the rapid introduction of valuable selections in the market. However, in vitro cultivation of Helleborus is still very difficult. Thereby the development of reliable in vitro propagation procedures is crucial for future production systems. Axillary buds cultured on agar-solidified Murashige and Skoog medium supplemented with 1 mg/L benzyladenine, 0.1 mg/L β-naphthoxyacetic acid, and 2 mg/L isopentenyl adenine develop shoots after 16 weeks of culture under 16 h light regime, 50-60 μmol/s/m(2), and 19 ± 1°C. The multiplication rate ranges from 1.4 to 2.1. However, the genotype and the number of subcultures affect the efficiency of the micropropagation process. The rooting of shoots is about 80% in solidified MS medium containing 1 mg/L 1-naphthaleneacetic acid and 3 mg/L indole-3-butyric acid. The described protocol provides information which can contribute to the commercial production of Helleborus plants.

  14. Histological and Molecular Characterization of Grape Early Ripening Bud Mutant

    Directory of Open Access Journals (Sweden)

    Da-Long Guo

    2016-01-01

    Full Text Available An early ripening bud mutant was analyzed based on the histological, SSR, and methylation-sensitive amplified polymorphism (MSAP analysis and a layer-specific approach was used to investigate the differentiation between the bud mutant and its parent. The results showed that the thickness of leaf spongy tissue of mutant (MT is larger than that of wild type (WT and the differences are significant. The mean size of cell layer L2 was increased in the mutant and the difference is significant. The genetic background of bud mutant revealed by SSR analysis is highly uniform to its parent; just the variations from VVS2 SSR marker were detected in MT. The total methylation ratio of MT is lower than that of the corresponding WT. The outside methylation ratio in MT is much less than that in WT; the average inner methylation ratio in MT is larger than that in WT. The early ripening bud mutant has certain proportion demethylation in cell layer L2. All the results suggested that cell layer L2 of the early ripening bud mutant has changed from the WT. This study provided the basis for a better understanding of the characteristic features of the early ripening bud mutant in grape.

  15. Change of the human taste bud volume over time.

    Science.gov (United States)

    Srur, Ehab; Stachs, Oliver; Guthoff, Rudolf; Witt, Martin; Pau, Hans Wilhelm; Just, Tino

    2010-08-01

    The specific aim of this study is to measure the taste volume in healthy human subjects over a 2.5-month period and to demonstrate morphological changes of the peripheral taste organs. Eighteen human taste buds in four fungiform papillae (fPap) were examined over a 10-week period. The fungiform papillae investigated were selected based on the form of the papillae or the arrangement of surface taste pores. Measurements were performed over 10 consecutive weeks, with five scans in a day once a week. The following parameters were measured: height and diameter of the taste bud, diameter of the fungiform papilla and diameter of the taste pore. The findings of this exploratory study indicated that (1) taste bud volumes changed over a 10-week period, (2) the interval between two volume maxima within the 10-week period was 3-5 weeks, and (3) the diameter of the fPap did not correlate with the volume of a single taste bud or with the volume of all taste buds in the fPap within the 10-week period. This exploratory in vivo study revealed changes in taste bud volumes in healthy humans with age-related gustatory sensitivity. These findings need to be considered when studying the effect of denervation of fungiform papillae in vivo using confocal microscopy. Crown Copyright 2009. Published by Elsevier Ireland Ltd. All rights reserved.

  16. Expression of sulfonylurea receptors in rat taste buds.

    Science.gov (United States)

    Liu, Dian-Xin; Liu, Xiao-Min; Zhou, Li-Hong; Feng, Xiao-Hong; Zhang, Xiao-Juan

    2011-07-01

    To test the possibility that a fast-onset promoting agent repaglinide may initiate prandial insulin secretion through the mechanism of cephalic-phase insulin release, we explored the expression and distribution character of sulfonylurea receptors in rat taste buds. Twenty male Wistar rats aged 10 weeks old were killed after general anesthesia. The circumvallate papillae, fungiform papillae and pancreas tissues were separately collected. Immunohistochemical staining was used to detect the expression and distribution of sulfonylurea receptor 1 (SUR1) or sulfonylurea receptor 2 (SUR2) in rat taste buds. Reverse transcriptase polymerase chain reaction (RT-PCR) was used to analyze the expression of SUR1 or SUR2 mRNA. The pancreatic tissues from the same rat were used as positive control. This is the first study to report that SUR1 is uniquely expressed in the taste buds of fungiform papillae of each rat tongue, while the expression of SUR1 or SUR2 was not detected in the taste buds of circumvallate papillae. SUR1 is selectively expressed in rat taste buds, and its distribution pattern may be functionally relevant, suggesting that the rapid insulin secretion-promoting effect of repaglinide may be exerted through the cephalic-phase secretion pathway mediated by taste buds. Copyright © 2010 Elsevier GmbH. All rights reserved.

  17. Yeast as a Heterologous Model System to Uncover Type III Effector Function.

    Directory of Open Access Journals (Sweden)

    Crina Popa

    2016-02-01

    Full Text Available Type III effectors (T3E are key virulence proteins that are injected by bacterial pathogens inside the cells of their host to subvert cellular processes and contribute to disease. The budding yeast Saccharomyces cerevisiae represents an important heterologous system for the functional characterisation of T3E proteins in a eukaryotic environment. Importantly, yeast contains eukaryotic processes with low redundancy and are devoid of immunity mechanisms that counteract T3Es and mask their function. Expression in yeast of effectors from both plant and animal pathogens that perturb conserved cellular processes often resulted in robust phenotypes that were exploited to elucidate effector functions, biochemical properties, and host targets. The genetic tractability of yeast and its amenability for high-throughput functional studies contributed to the success of this system that, in recent years, has been used to study over 100 effectors. Here, we provide a critical view on this body of work and describe advantages and limitations inherent to the use of yeast in T3E research. "Favourite" targets of T3Es in yeast are cytoskeleton components and small GTPases of the Rho family. We describe how mitogen-activated protein kinase (MAPK signalling, vesicle trafficking, membrane structures, and programmed cell death are also often altered by T3Es in yeast and how this reflects their function in the natural host. We describe how effector structure-function studies and analysis of candidate targeted processes or pathways can be carried out in yeast. We critically analyse technologies that have been used in yeast to assign biochemical functions to T3Es, including transcriptomics and proteomics, as well as suppressor, gain-of-function, or synthetic lethality screens. We also describe how yeast can be used to select for molecules that block T3E function in search of new antibacterial drugs with medical applications. Finally, we provide our opinion on the limitations

  18. Evidence consistent with human L1 retrotransposition in maternal meiosis I

    NARCIS (Netherlands)

    Brouha, Brook; Meischl, Christof; Ostertag, Eric; de Boer, Martin; Zhang, Yue; Neijens, Herman; Roos, Dirk; Kazazian, Haig H.

    2002-01-01

    We have used a unique polymorphic 3' transduction to show that a human L1, or LINE-1 ((l) under bar ong (i) under bar nterspersed (n) under bar ucleotide (e) under bar lement-1), retrotransposition event most likely occurred in the maternal primary oocyte during meiosis I. We characterized a

  19. Kinetics of meiosis in azoospermic males: a joint histological and cytological approach

    NARCIS (Netherlands)

    Boer, de P.; Giele, M.; Lock, M.T.W.T.; Rooij, de D.G.; Giltay, J.; Hochstenbach, R.; Velde, ter E.R.

    2004-01-01

    We have developed a protocol for the identification of aberrant chromosome behavior during human male meiosis up to metaphase of the secondary spermatocyte. Histological evaluation by the Johnsen score of a testicular biopsy was combined with immunofluorescence of first meiotic prophase

  20. Dissecting the telomere–inner nuclear membrane interface formed in meiosis

    Energy Technology Data Exchange (ETDEWEB)

    Pendlebury, Devon F.; Fujiwara, Yasuhiro; Tesmer, Valerie M.; Smith, Eric M.; Shibuya, Hiroki; Watanabe, Yoshinori; Nandakumar, Jayakrishnan

    2017-10-30

    Tethering telomeres to the inner nuclear membrane (INM) allows homologous chromosome pairing during meiosis. The meiosis-specific protein TERB1 binds the telomeric protein TRF1 to establish telomere–INM connectivity and is essential for mouse fertility. Here we solve the structure of the human TRF1–TERB1 interface to reveal the structural basis for telomere–INM linkage. Disruption of this interface abrogates binding and compromises telomere–INM attachment in mice. An embedded CDK-phosphorylation site within the TRF1-binding region of TERB1 provides a mechanism for cap exchange, a late-pachytene phenomenon involving the dissociation of the TRF1–TERB1 complex. Indeed, further strengthening this interaction interferes with cap exchange. Finally, our biochemical analysis implicates distinct complexes for telomere–INM tethering and chromosome-end protection during meiosis. Our studies unravel the structure, stoichiometry, and physiological implications underlying telomere–INM tethering, thereby providing unprecedented insights into the unique function of telomeres in meiosis.

  1. Regulation of mitogen-activated protein kinase 3/1 activity during meiosis resumption in mammals

    Czech Academy of Sciences Publication Activity Database

    Procházka, Radek; Blaha, Milan

    2015-01-01

    Roč. 61, č. 6 (2015), s. 495-502 ISSN 0916-8818 R&D Projects: GA MZe(CZ) QJ1510138 Institutional support: RVO:67985904 Keywords : cumulus oocyte complexes * meiosis resumption * mitogen-activated protein kinase 3/1 (MAPK3/1) Subject RIV: GI - Animal Husbandry ; Breeding Impact factor: 1.453, year: 2015

  2. Inhibition of CDK7 bypasses spindle assembly checkpoint via premature cyclin B degradation during oocyte meiosis.

    Science.gov (United States)

    Wang, HaiYang; Jo, Yu-Jin; Sun, Tian-Yi; Namgoong, Suk; Cui, Xiang-Shun; Oh, Jeong Su; Kim, Nam-Hyung

    2016-12-01

    To ensure accurate chromosome segregation, the spindle assembly checkpoint (SAC) delays anaphase onset by preventing the premature activation of anaphase-promoting complex/cyclosome (APC/C) until all kinetochores are attached to the spindle. Although an escape from mitosis in the presence of unsatisfied SAC has been shown in several cancer cells, it has not been reported in oocyte meiosis. Here, we show that CDK7 activity is required to prevent a bypass of SAC during meiosis I in mouse oocytes. Inhibition of CDK7 using THZ1 accelerated the first meiosis, leading to chromosome misalignment, lag of chromosomes during chromosome segregation, and a high incidence of aneuploidy. Notably, this acceleration occurred in the presence of SAC proteins including Mad2 and Bub3 at the kinetochores. However, inhibition of APC/C-mediated cyclin B degradation blocked the THZ1-induced premature polar body extrusion. Moreover, chromosomal defects mediated by THZ1 were rescued when anaphase onset was delayed. Collectively, our results show that CDK7 activity is required to prevent premature anaphase onset by suppressing the bypass of SAC, thus ensuring chromosome alignment and proper segregation. These findings reveal new roles of CDK7 in the regulation of meiosis in mammalian oocytes. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Dissecting the telomere-inner nuclear membrane interface formed in meiosis.

    Science.gov (United States)

    Pendlebury, Devon F; Fujiwara, Yasuhiro; Tesmer, Valerie M; Smith, Eric M; Shibuya, Hiroki; Watanabe, Yoshinori; Nandakumar, Jayakrishnan

    2017-12-01

    Tethering telomeres to the inner nuclear membrane (INM) allows homologous chromosome pairing during meiosis. The meiosis-specific protein TERB1 binds the telomeric protein TRF1 to establish telomere-INM connectivity and is essential for mouse fertility. Here we solve the structure of the human TRF1-TERB1 interface to reveal the structural basis for telomere-INM linkage. Disruption of this interface abrogates binding and compromises telomere-INM attachment in mice. An embedded CDK-phosphorylation site within the TRF1-binding region of TERB1 provides a mechanism for cap exchange, a late-pachytene phenomenon involving the dissociation of the TRF1-TERB1 complex. Indeed, further strengthening this interaction interferes with cap exchange. Finally, our biochemical analysis implicates distinct complexes for telomere-INM tethering and chromosome-end protection during meiosis. Our studies unravel the structure, stoichiometry, and physiological implications underlying telomere-INM tethering, thereby providing unprecedented insights into the unique function of telomeres in meiosis.

  4. Meiosis Drives Extraordinary Genome Plasticity in the Haploid Fungal Plant Pathogen Mycosphaerella Graminicola

    Science.gov (United States)

    Meiosis in the plant-pathogenic fungus Mycosphaerella graminicola results in eight ascospores due to a mitotic division following the two meiotic divisions. The transient diploid phase allows for recombination among homologous chromosomes. However, some chromosomes of M. graminicola lack homologs an...

  5. Cell type-specific translational repression of Cyclin B during meiosis in males.

    Science.gov (United States)

    Baker, Catherine Craig; Gim, Byung Soo; Fuller, Margaret T

    2015-10-01

    The unique cell cycle dynamics of meiosis are controlled by layers of regulation imposed on core mitotic cell cycle machinery components by the program of germ cell development. Although the mechanisms that regulate Cdk1/Cyclin B activity in meiosis in oocytes have been well studied, little is known about the trans-acting factors responsible for developmental control of these factors in male gametogenesis. During meiotic prophase in Drosophila males, transcript for the core cell cycle protein Cyclin B1 (CycB) is expressed in spermatocytes, but the protein does not accumulate in spermatocytes until just before the meiotic divisions. Here, we show that two interacting proteins, Rbp4 and Fest, expressed at the onset of spermatocyte differentiation under control of the developmental program of male gametogenesis, function to direct cell type- and stage-specific repression of translation of the core G2/M cell cycle component cycB during the specialized cell cycle of male meiosis. Binding of Fest to Rbp4 requires a 31-amino acid region within Rbp4. Rbp4 and Fest are required for translational repression of cycB in immature spermatocytes, with Rbp4 binding sequences in a cell type-specific shortened form of the cycB 3' UTR. Finally, we show that Fest is required for proper execution of meiosis I. © 2015. Published by The Company of Biologists Ltd.

  6. Students' Meaningful Learning Orientation and Their Meaningful Understandings of Meiosis and Genetics.

    Science.gov (United States)

    Cavallo, Ann Liberatore

    This 1-week study explored the extent to which high school students (n=140) acquired meaningful understanding of selected biological topics (meiosis and the Punnett square method) and the relationship between these topics. This study: (1) examined "mental modeling" as a technique for measuring students' meaningful understanding of the…

  7. Smc1β is required for activation of SAC during mouse oocyte meiosis.

    Science.gov (United States)

    Miao, Yilong; Zhou, Changyin; Cui, Zhaokang; Dai, Xiaoxin; Zhang, Mianqun; Lu, Yajuan; Xiong, Bo

    2017-03-19

    Smc1β is a meiosis-specific cohesin subunit that is essential for sister chromatid cohesion and DNA recombination. Previous studies have shown that Smc1β-deficient mice in both sexes are sterile. Ablation of Smc1β during male meiosis leads to the blockage of spermatogenesis in pachytene stage, and ablation of Smc1β during female meiosis generates a highly error-prone oocyte although it could develop to metaphase II stage. However, the underlying mechanisms regarding how Smc1β maintains the correct meiotic progression in mouse oocytes have not been clearly defined. Here, we find that GFP-fused Smc1β is expressed and localized to the chromosomes from GV to MII stages during mouse oocyte meiotic maturation. Knockdown of Smc1β by microinjection of gene-specific morpholino causes the impaired spindle apparatus and chromosome alignment which are highly correlated with the defective kinetochore-microtubule attachments, consequently resulting in a prominently higher incidence of aneuploid eggs. In addition, the premature extrusion of polar bodies and escape of metaphase I arrest induced by low dose of nocodazole treatment in Smc1β-depleted oocytes indicates that Smc1β is essential for activation of spindle assembly checkpoint (SAC) activity. Collectively, we identify a novel function of Smc1β as a SAC participant beyond its role in chromosome cohesion during mouse oocyte meiosis.

  8. Bovine ovarian cells have (pro)renin receptors and prorenin induces resumption of meiosis in vitro.

    Science.gov (United States)

    Dau, Andressa Minussi Pereira; da Silva, Eduardo Pradebon; da Rosa, Paulo Roberto Antunes; Bastiani, Felipe Tusi; Gutierrez, Karina; Ilha, Gustavo Freitas; Comim, Fabio Vasconcellos; Gonçalves, Paulo Bayard Dias

    2016-07-01

    The discovery of a receptor that binds prorenin and renin in human endothelial and mesangial cells highlights the possible effect of renin-independent prorenin in the resumption of meiosis in oocytes that was postulated in the 1980s.This study aimed to identify the (pro)renin receptor in the ovary and to assess the effect of prorenin on meiotic resumption. The (pro)renin receptor protein was detected in bovine cumulus-oocyte complexes, theca cells, granulosa cells, and in the corpus luteum. Abundant (pro)renin receptor messenger ribonucleic acid (mRNA) was detected in the oocytes and cumulus cells, while prorenin mRNA was identified in the cumulus cells only. Prorenin at concentrations of 10(-10), 10(-9), and 10(-8)M incubated with oocytes co-cultured with follicular hemisections for 15h caused the resumption of oocyte meiosis. Aliskiren, which inhibits free renin and receptor-bound renin/prorenin, at concentrations of 10(-7), 10(-5), and 10(-3)M blocked this effect (Pmeiosis resumption, cumulus-oocyte complexes and follicular hemisections were treated with prorenin and with angiotensin II or saralasin (angiotensin II antagonist). Prorenin induced the resumption of meiosis independently of angiotensin II. Furthermore, cumulus-oocyte complexes cultured with forskolin (200μM) and treated with prorenin and aliskiren did not exhibit a prorenin-induced resumption of meiosis (Pmeiosis in cattle. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Silencing of meiosis-critical genes for engineering male sterility in plants

    Science.gov (United States)

    Engineering sterile traits in plants through the tissue-specific expression of a cytotoxic gene provides an effective way for containing transgene flow; however, the microbial origin of cytotoxic genes has raised concerns. In an attempt to develop a safe alternative, we have chosen the meiosis-crit...

  10. E-type cyclins modulate telomere integrity in mammalian male meiosis.

    Science.gov (United States)

    Manterola, Marcia; Sicinski, Piotr; Wolgemuth, Debra J

    2016-06-01

    We have shown that E-type cyclins are key regulators of mammalian male meiosis. Depletion of cyclin E2 reduced fertility in male mice due to meiotic defects, involving abnormal pairing and synapsis, unrepaired DNA, and loss of telomere structure. These defects were exacerbated by additional loss of cyclin E1, and complete absence of both E-type cyclins produces a meiotic catastrophe. Here, we investigated the involvement of E-type cyclins in maintaining telomere integrity in male meiosis. Spermatocytes lacking cyclin E2 and one E1 allele (E1+/-E2-/-) displayed a high rate of telomere abnormalities but can progress to pachytene and diplotene stages. We show that their telomeres exhibited an aberrant DNA damage repair response during pachynema and that the shelterin complex proteins TRF2 and RAP2 were significantly decreased in the proximal telomeres. Moreover, the insufficient level of these proteins correlated with an increase of γ-H2AX foci in the affected telomeres and resulted in telomere associations involving TRF1 and telomere detachment in later prophase-I stages. These results suggest that E-type cyclins are key modulators of telomere integrity during meiosis by, at least in part, maintaining the balance of shelterin complex proteins, and uncover a novel role of E-type cyclins in regulating chromosome structure during male meiosis.

  11. Merotelic kinetochore attachment in oocyte meiosis II causes sister chromatids segregation errors in aged mice.

    Science.gov (United States)

    Cheng, Jin-Mei; Li, Jian; Tang, Ji-Xin; Hao, Xiao-Xia; Wang, Zhi-Peng; Sun, Tie-Cheng; Wang, Xiu-Xia; Zhang, Yan; Chen, Su-Ren; Liu, Yi-Xun

    2017-08-03

    Mammalian oocyte chromosomes undergo 2 meiotic divisions to generate haploid gametes. The frequency of chromosome segregation errors during meiosis I increase with age. However, little attention has been paid to the question of how aging affects sister chromatid segregation during oocyte meiosis II. More importantly, how aneuploid metaphase II (MII) oocytes from aged mice evade the spindle assembly checkpoint (SAC) mechanism to complete later meiosis II to form aneuploid embryos remains unknown. Here, we report that MII oocytes from naturally aged mice exhibited substantial errors in chromosome arrangement and configuration compared with young MII oocytes. Interestingly, these errors in aged oocytes had no impact on anaphase II onset and completion as well as 2-cell formation after parthenogenetic activation. Further study found that merotelic kinetochore attachment occurred more frequently and could stabilize the kinetochore-microtubule interaction to ensure SAC inactivation and anaphase II onset in aged MII oocytes. This orientation could persist largely during anaphase II in aged oocytes, leading to severe chromosome lagging and trailing as well as delay of anaphase II completion. Therefore, merotelic kinetochore attachment in oocyte meiosis II exacerbates age-related genetic instability and is a key source of age-dependent embryo aneuploidy and dysplasia.

  12. Live Imaging of Meiosis I in Late-Stage Drosophila melanogaster Oocytes.

    Science.gov (United States)

    Hughes, Stacie E; Hawley, R Scott

    2017-01-01

    Drosophila melanogaster has been studied for a century as a genetic model to understand recombination, chromosome segregation, and the basic rules of inheritance. However, it has only been about 25 years since the events that occur during nuclear envelope breakdown, spindle assembly, and chromosome orientation during D. melanogaster female meiosis I were first visualized by fixed cytological methods (Theurkauf and Hawley, J Cell Biol 116:1167-1180, 1992). Although these fixed cytological studies revealed many important details about the events that occur during meiosis I, they failed to elucidate the timing or order of these events. The development of protocols for live imaging of meiotic events within the oocyte has enabled collection of real-time information on the kinetics and dynamics of spindle assembly, as well as the behavior of chromosomes during prometaphase I. Here, we describe a method to visualize spindle assembly and chromosome movement during meiosis I by injecting fluorescent dyes to label microtubules and DNA into stage 12-14 oocytes. This method enables the events during Drosophila female meiosis I, such as spindle assembly and chromosome movement, to be observed in vivo, regardless of genetic background, with exceptional spatial and temporal resolution.

  13. Vesicular transport protein Arf6 modulates cytoskeleton dynamics for polar body extrusion in mouse oocyte meiosis.

    Science.gov (United States)

    Duan, Xing; Zhang, Hao-Lin; Pan, Meng-Hao; Zhang, Yu; Sun, Shao-Chen

    2018-02-01

    Arf6 (ADP-ribosylation factor 6) is known to play important roles in membrane dynamics through the regulation of actin filament reorganization for multiple cellular processes such as cytokinesis, phagocytosis, cell migration and tumor cell invasion. However, the functions of Arf6 in mammalian oocyte meiosis have not been clarified. In present study we showed that Arf6 expressed in mouse oocytes and was mainly distributed around the spindle during meiosis. Depletion of Arf6 by morpholino microinjection caused oocytes failing to extrude first polar body. Further analysis indicated that Arf6 knock down caused the aberrant actin distribution, which further induced the failure of meiotic spindle movement. And the loss of oocyte polarity also confirmed this. The regulation of Arf6 on actin filaments in mouse oocytes might be due to its effects on the phosphorylation level of cofilin and the expression of Arp2/3 complex. Moreover, we found that the decrease of Arf6 caused the disruption of spindle formation, indicating the multiple roles of Arf6 on cytoskeleton dynamics in meiosis. In summary, our results indicated that Arf6 was involved in mouse oocyte meiosis through its functional roles in actin-mediated spindle movement and spindle organization. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. Is meiosis a fundamental cause of inviability among sexual and asexual plants and animals?

    Science.gov (United States)

    Levitis, Daniel A; Zimmerman, Kolea; Pringle, Anne

    2017-08-16

    Differences in viability between asexually and sexually generated offspring strongly influence the selective advantage and therefore the prevalence of sexual reproduction (sex). However, no general principle predicts when sexual offspring will be more viable than asexual offspring. We hypothesize that when any kind of reproduction is based on a more complex cellular process, it will encompass more potential failure points, and therefore lower offspring viability. Asexual reproduction (asex) can be simpler than sex, when offspring are generated using only mitosis. However, when asex includes meiosis and meiotic restitution, gamete production is more complex than in sex. We test our hypothesis by comparing the viability of asexual and closely related sexual offspring across a wide range of plants and animals, and demonstrate that meiotic asex does result in lower viability than sex; without meiosis, asex is mechanistically simple and provides higher viability than sex. This phylogenetically robust pattern is supported in 42 of 44 comparisons drawn from diverse plants and animals, and is not explained by the other variables included in our model. Other mechanisms may impact viability, such as effects of reproductive mode on heterozygosity and subsequent viability, but we propose the complexity of cellular processes of reproduction, particularly meiosis, as a fundamental cause of early developmental failure and mortality. Meiosis, the leading cause of inviability in humans, emerges as a likely explanation of offspring inviability among diverse eukaryotes. © 2017 The Author(s).

  15. Non-homologous chromosome synapsis during mouse meiosis : consequences for male fertility and survival of progeny

    NARCIS (Netherlands)

    Peters, A.H.F.M.

    1997-01-01

    In the mouse, heterozygosity for several reciprocal and Robertsonian translocations is associated with impairment of chromosome synapsis and suppression of crossover formation in segments near the points of exchange during prophase of meiosis. This thesis describes the analysis of the consequences

  16. Dance of the Chromosomes: A Kinetic Learning Approach to Mitosis and Meiosis

    Science.gov (United States)

    Kreiser, Brian; Hairston, Rosalina

    2007-01-01

    Understanding mitosis and meiosis is fundamental to understanding the basics of Mendelian inheritance, yet many students find these concepts challenging or confusing. Here we present a visually and physically stimulating activity using minimal supplies to supplement traditional instruction in order to engage the students and facilitate…

  17. Creating a Double-Spring Model to Teach Chromosome Movement during Mitosis & Meiosis

    Science.gov (United States)

    Luo, Peigao

    2012-01-01

    The comprehension of chromosome movement during mitosis and meiosis is essential for understanding genetic transmission, but students often find this process difficult to grasp in a classroom setting. I propose a "double-spring model" that incorporates a physical demonstration and can be used as a teaching tool to help students understand this…

  18. Homologous recombination, sister chromatid cohesion, and chromosome condensation in mammalian meiosis

    NARCIS (Netherlands)

    Eijpe, M.

    2002-01-01

    In the life cycle of sexually reproducing eukaryotes, haploid and diploid generations of cells alternate. Two types of cell division occur in such a life cycle: mitosis and meiosis. They are compared in chapter 1 . Haploid and

  19. Centromeres cluster de novo at the beginning of meiosis in Brachypodium distachyon.

    Directory of Open Access Journals (Sweden)

    Ruoyu Wen

    Full Text Available In most eukaryotes that have been studied, the telomeres cluster into a bouquet early in meiosis, and in wheat and its relatives and in Arabidopsis the centromeres pair at the same time. In Arabidopsis, the telomeres do not cluster as a typical telomere bouquet on the nuclear membrane but are associated with the nucleolus both somatically and at the onset of meiosis. We therefore assessed whether Brachypodium distachyon, a monocot species related to cereals and whose genome is approximately twice the size of Arabidopsis thaliana, also exhibited an atypical telomere bouquet and centromere pairing. In order to investigate the occurrence of a bouquet and centromere pairing in B distachyon, we first had to establish protocols for studying meiosis in this species. This enabled us to visualize chromosome behaviour in meiocytes derived from young B distachyon spikelets in three-dimensions by fluorescent in situ hybridization (FISH, and accurately to stage meiosis based on chromatin morphology in relation to spikelet size and the timing of sample collection. Surprisingly, this study revealed that the centromeres clustered as a single site at the same time as the telomeres also formed a bouquet or single cluster.

  20. Transcriptome analysis of poplar rust telia reveals overwintering adaptation and tightly coordinated karyogamy and meiosis processes

    Directory of Open Access Journals (Sweden)

    Stéphane eHACQUARD

    2013-11-01

    Full Text Available Most rust fungi have a complex life cycle involving up to five different spore-producing stages. The telial stage that produces melanised overwintering teliospores is one of these and plays a fundamental role for generating genetic diversity as karyogamy and meiosis occur at that stage. Despite the importance of telia for the rust life cycle, almost nothing is known about the fungal genetic programs that are activated in this overwintering structure. In the present study, the transcriptome of telia produced by the poplar rust fungus M. larici-populina has been investigated using whole genome exon oligoarrays and RT-qPCR. Comparative expression profiling at the telial and uredinial stages identifies genes specifically expressed or up-regulated in telia including osmotins/thaumatin-like proteins and aquaporins that may reflect specific adaptation to overwintering as well numerous lytic enzymes acting on plant cell wall, reflecting extensive cell wall remodelling at that stage. The temporal dynamics of karyogamy was followed using combined RT-qPCR and DAPI-staining approaches. This reveals that fusion of nuclei and induction of karyogamy-related genes occur simultaneously between the 25-39 days post inoculation time frame. Transcript profiling of conserved meiosis genes indicate a preferential induction right after karyogamy and corroborate that meiosis begins prior to overwintering and is interrupted in Meiosis I (prophase I, diplonema stage until teliospore germination in early spring.