WorldWideScience

Sample records for bryothamnion triquetrum red

  1. Antinociceptive and Anti-Inflammatory Activities of Crude Methanolic Extract of Red Alga Bryothamnion triquetrum

    Science.gov (United States)

    Cavalcante-Silva, Luiz Henrique Agra; da Matta, Carolina Barbosa Brito; de Araújo, Morgana Vital; Barbosa-Filho, José Maria; de Lira, Daysianne Pereira; de Oliveira Santos, Bárbara Viviana; de Miranda, George Emmanuel C.; Alexandre-Moreira, Magna Suzana

    2012-01-01

    The marine environment is an extraordinary reservoir of bioactive natural products, many of which exhibit chemical and structural features not found in terrestrial natural products. In this regard, the aim of this study was to investigate the possible antinociceptive and anti-inflammatory activities of a crude methanolic extract of the red alga Bryothamnion triquetrum (BT-MeOH) in murine models. Groups of Swiss mice of both sexes (25–30 g) were used throughout the experiments. The potential antinociceptive of BT-MeOH was evaluated by means of the following tests: acetic acid-induced writhing, hot-plate test and glutamate- and formalin-induced nociception. The anti-inflammatory activity of BT-MeOH was investigated using the zymosan A-induced peritonitis test. The tests were conducted using 100 mg/kg (p.o.) BT-MeOH, 33.3 mg/kg (p.o.) dipyrone, 35.7 mg/kg (p.o.) indomethacin and 5.7 mg/kg (s.c.) morphine. The extract and all standard drugs were administered 40 min before the nociceptive/inflammatory stimulus. In the acetic acid-induced writhing test, BT-MeOH and dipyrone inhibited the nociceptive response by 55.9% (22.2 ± 2.0 writhings; p < 0.01) and 80.9% (9.6 ± 2.1 writhings; p < 0.01). In the hot-plate test, BT-MeOH did not increase the latency time of the animals in the time evaluated. In addition, BT-MeOH inhibited glutamate-induced nociception by 50.1%. While BT-MeOH did not inhibit the neurogenic phase in formalin-induced nociception, the inflammatory phase was inhibited by 53.1% (66.8 ± 14.2 s; p < 0.01). Indomethacin inhibited the inflammatory phase by 60.2% (56.8 ± 8.7 s; p < 0.01). In the zymosan-induced peritonitis test, BT-MeOH inhibited 55.6% (6.6 ± 0.2 × 106 leukocytes/mL; p < 0.01) of leukocyte migration, while indomethacin inhibited 78.1% (3.2 ± 0.1 × 106 leukocytes/mL; p < 0.01). Based on the results obtained in this study, we conclude that BT-MeOH has peripheral antinociceptive and anti-inflammatory activities. However, more studies need

  2. Antinociceptive and Anti-Inflammatory Activities of Crude Methanolic Extract of Red Alga Bryothamnion triquetrum

    Directory of Open Access Journals (Sweden)

    Luiz Henrique Agra Cavalcante-Silva

    2012-09-01

    Full Text Available The marine environment is an extraordinary reservoir of bioactive natural products, many of which exhibit chemical and structural features not found in terrestrial natural products. In this regard, the aim of this study was to investigate the possible antinociceptive and anti-inflammatory activities of a crude methanolic extract of the red alga Bryothamnion triquetrum (BT-MeOH in murine models. Groups of Swiss mice of both sexes (25–30 g were used throughout the experiments. The potential antinociceptive of BT-MeOH was evaluated by means of the following tests: acetic acid-induced writhing, hot-plate test and glutamate- and formalin-induced nociception. The anti-inflammatory activity of BT-MeOH was investigated using the zymosan A-induced peritonitis test. The tests were conducted using 100 mg/kg (p.o. BT-MeOH, 33.3 mg/kg (p.o. dipyrone, 35.7 mg/kg (p.o. indomethacin and 5.7 mg/kg (s.c. morphine. The extract and all standard drugs were administered 40 min before the nociceptive/inflammatory stimulus. In the acetic acid-induced writhing test, BT-MeOH and dipyrone inhibited the nociceptive response by 55.9% (22.2 ± 2.0 writhings; p < 0.01 and 80.9% (9.6 ± 2.1 writhings; p < 0.01. In the hot-plate test, BT-MeOH did not increase the latency time of the animals in the time evaluated. In addition, BT-MeOH inhibited glutamate-induced nociception by 50.1%. While BT-MeOH did not inhibit the neurogenic phase in formalin-induced nociception, the inflammatory phase was inhibited by 53.1% (66.8 ± 14.2 s; p < 0.01. Indomethacin inhibited the inflammatory phase by 60.2% (56.8 ± 8.7 s; p < 0.01. In the zymosan-induced peritonitis test, BT-MeOH inhibited 55.6% (6.6 ± 0.2 × 106 leukocytes/mL; p < 0.01 of leukocyte migration, while indomethacin inhibited 78.1% (3.2 ± 0.1 × 106 leukocytes/mL; p < 0.01. Based on the results obtained in this study, we conclude that BT-MeOH has peripheral antinociceptive and anti-inflammatory activities. However, more

  3. Antinociceptive activity of sulfated carbohydrates from the red algae Bryothamnion seaforthii (Turner) Kütz. and B. triquetrum (S.G. Gmel.) M. Howe

    OpenAIRE

    Viana G.S.B.; Freitas A.L.P.; Lima M.M.L.; Vieira L.A.P.; Andrade M.C.H.; Benevides N.M.B.

    2002-01-01

    We report the antinociceptive activity, determined by the writhing, formalin and hot-plate tests in mice, of crude (F0/60), lectin and carbohydrate fractions isolated by ammonium sulfate precipitation (0 to 60%) from Bryothamnion seaforthii and B. triquetrum, species of red algae. Not only fraction F0/60 but also lectins from both species significantly inhibited acetic acid-induced abdominal contractions after intraperitoneal or oral administrations. In the formalin test, lectins (1 and 5 mg/...

  4. Antinociceptive activity of sulfated carbohydrates from the red algae Bryothamnion seaforthii (Turner Kütz. and B. triquetrum (S.G. Gmel. M. Howe

    Directory of Open Access Journals (Sweden)

    Viana G.S.B.

    2002-01-01

    Full Text Available We report the antinociceptive activity, determined by the writhing, formalin and hot-plate tests in mice, of crude (F0/60, lectin and carbohydrate fractions isolated by ammonium sulfate precipitation (0 to 60% from Bryothamnion seaforthii and B. triquetrum, species of red algae. Not only fraction F0/60 but also lectins from both species significantly inhibited acetic acid-induced abdominal contractions after intraperitoneal or oral administrations. In the formalin test, lectins (1 and 5 mg/kg, ip, and 5 to 20 mg/kg, po inhibited the 1st and 2nd phases (5 and 20 min, respectively, but the effect occurred predominantly on the 2nd phase. The effects of the lectins were totally or partially reversed by naloxone (2 mg/kg, sc in the 1st and 2nd phases, respectively. Experiments performed with lectins in the absence and presence of avidin (1 mg/kg, ip and D-mannose (1 mg/kg, ip showed that avidin did not interfere with the effect of B. seaforthii lectin but partially reversed the effect of B. triquetrum lectin. D-Mannose completely reversed the effects of both species. F0/60 fractions from both algae significantly increased the latency time in response to thermal stimuli, and naloxone reversed antinociception, indicating the involvement of the opioid system in both the peripheral and central effects of the fractions. In the writhing test, the carbohydrate fractions were the most active, inhibiting the contractions by 71 and 79% (B. triquetrum and by 46 and 69% (B. seaforthii at doses of 1 and 5 mg/kg, ip, respectively. Sulfated carbohydrate fractions of B. seaforthii and B. triquetrum, containing only about 5% protein as contaminants, are probably responsible for the antinociceptive effects of these red algae.

  5. Composición química y actividad antioxidante del alga marina roja Bryothamnion triquetrum (S.G.Gmelin Howe Chemical composition and antioxidant activity of the red marine algae Bryothamnion triquetrum (S.G.Gmelin Howe

    Directory of Open Access Journals (Sweden)

    Alexis Vidal

    2006-12-01

    Full Text Available En la actualidad existe un marcado interés por la búsqueda de antioxidantes de fuentes naturales, incluidas las algas marinas. El objetivo de este trabajo fue evaluar la composición química y propiedades antioxidantes del alga Bryothamnion triquetrum. Se estudió la composición centesimal y de minerales, identificación de ácidos grasos y sustancias antioxidantes. La composición centesimal es la siguiente: Proteínas (9,5%, Lípidos (1,3%, Carbohidratos (5,9%, Fibras (10,2% y Cenizas (43%. Los resultados de la actividad antioxidante para las diferentes metodologías empleadas fueron: atrapamiento de radicales DPPH• (38%, 4 mg de liofilizado, beta-Caroteno-Linoleico (12%, 4 mg de liofilizado, actividad atrapadora de radicales O2•- (CI50 0,36 mg/mL, de radicales OH• (CI50 2,11 mg/mL y unión al Fe (CI50 0,37 mg/mL. Las propiedades antioxidantes de esta alga parecen explicarse por la capacidad atrapadora de radicales libres, particularmente relacionada con mecanismos de dismutación de radicales O2•-, inactivación de radicales OH• y quelación de Fe. En trabajos previos se identificaron ácidos cinámicos y fenólicos como moléculas que pudieran explicar la actividad antioxidante, sin embargo adicionalmente se debe considerar un efecto sumatorio y/o sinérgico de otros componentes antioxidantes del extracto, como los descritos en este trabajo, incluidos minerales, carotenoides y vitamina C.An increasing interest has been growing during the past years for the search of natural origin antioxidants, particularly those from marine algae. In this context, the main objective of current research was to evaluate the chemical composition and some antioxidant properties of the aqueous extract of the seaweed Bryothamnion triquetrum. The extracts contains: Proteins (9.5%, Lipids (1.3%, Carbohydrates (5.9%, Fibers (10.2% and Ashes (43%. In current approach, the following results were obtained for the different procedures assessed: DPPH

  6. Modulation of the pharmacological effects of enzymatically-active PLA2 by BTL-2, an isolectin isolated from the Bryothamnion triquetrum red alga

    Directory of Open Access Journals (Sweden)

    Nagano Celso S

    2008-06-01

    Full Text Available Abstract Background An interaction between lectins from marine algae and PLA2 from rattlesnake was suggested some years ago. We, herein, studied the effects elicited by a small isolectin (BTL-2, isolated from Bryothamnion triquetrum, on the pharmacological and biological activities of a PLA2 isolated from rattlesnake venom (Crotalus durissus cascavella, to better understand the enzymatic and pharmacological mechanisms of the PLA2 and its complex. Results This PLA2 consisted of 122 amino acids (approximate molecular mass of 14 kDa, its pI was estimated to be 8.3, and its amino acid sequence shared a high degree of similarity with that of other neurotoxic and enzymatically-active PLA2s. BTL-2 had a molecular mass estimated in approximately 9 kDa and was characterized as a basic protein. In addition, BTL-2 did not exhibit any enzymatic activity. The PLA2 and BTL-2 formed a stable heterodimer with a molecular mass of approximately 24–26 kDa, estimated by molecular exclusion HPLC. In the presence of BTL-2, we observed a significant increase in PLA2 activity, 23% higher than that of PLA2 alone. BTL-2 demonstrated an inhibition of 98% in the growth of the Gram-positive bacterial strain, Clavibacter michiganensis michiganensis (Cmm, but only 9.8% inhibition of the Gram-negative bacterial strain, Xanthomonas axonopodis pv passiflorae (Xap. PLA2 decreased bacterial growth by 27.3% and 98.5% for Xap and Cmm, respectively, while incubating these two proteins with PLA2-BTL-2 inhibited their growths by 36.2% for Xap and 98.5% for Cmm. PLA2 significantly induced platelet aggregation in washed platelets, whereas BTL-2 did not induce significant platelet aggregation in any assay. However, BTL-2 significantly inhibited platelet aggregation induced by PLA2. In addition, PLA2 exhibited strong oedematogenic activity, which was decreased in the presence of BTL-2. BTL-2 alone did not induce oedema and did not decrease or abolish the oedema induced by the 48

  7. Actividad antioxidante y neuroprotectora in vitro del extracto acuoso del alga Bryothamnion triquetrum (Ceramiales, Rhodomelaceae)

    OpenAIRE

    Fallarero Linares, Adyary

    2005-01-01

    La presente investigación aborda el estudio de las propiedades antioxidantes y neuroprotectoras de un extracto acuoso del alga Bryothamnion triquetrum (S.G.Gmelin) Howe, así como la relación de tales propiedades con los compuestos fenólicos presentes en este producto natural, mediante el uso de modelos experimentales in vitro. Los resultados mostraron que el extracto acuoso de B. triquetrum contiene moléculas que pueden unir Fe, atrapar radicales O2•, OH•, DPPH•, e inhibir la peroxidación li...

  8. Evaluación de la toxicidad del extracto acuoso de Bryothamnion triquetrum en células humanas

    Directory of Open Access Journals (Sweden)

    Maribel González-Pumariega

    2010-01-01

    Full Text Available Las algas han sido extensamente investigadas por su uso en la cosmética y la biomedicina, además de sus propiedades nutritivas por las que han sido incorporadas en las dietas de varios países. El extracto acuoso total de la especie Bryothamnion triquetrum, ha sido informado como fuente de agentes antioxidantes. Sin embargo, constituye un requisito preclínico para su empleo con fines terapéuticos y/o nutricionales, el estudio de sus propiedades tóxicas. En este trabajo se evaluó la citotoxicidad de esta especie en células humanas. Se empleó como modelo experimental la línea celular MRC5. Las células fueron tratadas con dosis crecientes del extracto durante 49 horas. Se evaluó la capacidad de formación de colonia y la inducción de muerte celular programada por citometría de flujo. Los resultados de este estudio mostraron que en las células tratadas con el extracto de B. triquetrum no hubo inducción de apoptosis. Sin embargo, el extracto inhibió la capacidad de formar colonias, en los cultivos de células tratadas con dosis > 1000 mg/mL.

  9. Evaluaciones toxicol??gicas de un extracto acuoso del alga marina Bryothamnion triquetrum (Gmelin) M.A.Howe en estudios in vitro y modelos animales

    OpenAIRE

    A Vidal-Novoa; Fallarero-Linares, A.; Laba??ino, M.; S??nchez-Lamar, A.; Batista-Gonz??lez, A.E.; Silva, Amo; Mancini-Filho, J.

    2012-01-01

    Objetivo: El objetivo de este trabajo fue evaluar la toxicidad de un extracto acuoso del alga marina Bryothamnion triquetrum. M??todos: El ensayo de Ames se desarroll?? con las cepas de S. typhimurium TA 1535, TA 1537 y TA 1538 con y sin activaci??n metab??lica. El estudio de citotoxicidad se realiz?? con c??lulas intestinales Caco-2 durante 24 y 48 horas de exposici??n al extracto y la viabilidad fue evaluada con la t??cnica de yoduro de propidio. El Estudio de Toxicidad Aguda se realiz??...

  10. Characterization of Isoforms of the Lectin Isolated from the Red Algae Bryothamnion seaforthii and Its Pro-Healing Effect Characterization of Isoforms of the Lectin Isolated from the Red Algae Bryothamnion seaforthii and Its Pro-Healing Effect

    Directory of Open Access Journals (Sweden)

    Edson Holanda Teixeira

    2012-09-01

    Full Text Available Lectins are a structurally heterogeneous group of proteins that have specific binding sites for carbohydrates and glycoconjugates. Because of their biotechnological potential, lectins are widely used in biomedical research. The present study aimed to evaluate the healing potential of the lectin isolated from the marine red alga Bryothamnion seaforthii (BSL. The lectin was purified using ion exchange chromatography with DEAE cellulose and characterized using tandem mass spectrometry. For healing tests, skin wounds were induced in the dorsal thoracic region of mice. These animals were randomly divided into three groups and subjected to topical treatment for 12 days with BSL, bovine serum albumin and 150 mM NaCl. To evaluate the potential of each treatment, the animals were anesthetized and sacrificed on days 2, 7 and 12, respectively. The parameters evaluated included the wound area, the proportion of wound closure and the histological diagnosis. The wound closure was more effective with BSL (Postoperative Day 7 and 12 than controls. The luminal epithelium was completely restructured; the presence of collagen in the dermis and the strongly active presence of young skin annexes demonstrate the potential of treatment with BSL compared with controls. Our findings suggest that BSL has pro-healing properties and can be a potential medical process in the treatment of acute wounds.

  11. Introducing Triquetrum, A Possible Future for Kepler and Ptolemy II

    Energy Technology Data Exchange (ETDEWEB)

    Brooks, Christopher [University of California, Berkeley; Billings, Jay Jay [ORNL

    2016-01-01

    Triquetrum is an open platform for managing and executing scientific workflows that is under development as an Eclipse project. Both Triquetrum and Kepler use Ptolemy II as their execution engine. Triquetrum presents opportunities and risks for the Kepler community. The opportunities include a possibly larger community for interaction and a path for Kepler to move from Kepler's one-off ant-based build environment towards a more common OSGi-based environment and a way to maintain a stable Ptolemy II core. The risks include the fact that Triquetrum is a fork of Ptolemy II that would result in package name changes and other possible changes. In addition, Triquetrum is licensed under the Eclipse Public License v1.0, which includes a patent clause that could conflict with the University of California patent clause. This paper describes these opportunities and risks.

  12. A rare case of intraosseous ganglion of the triquetrum

    OpenAIRE

    Luben Stokov; Georgi P. Georgiev; Boris Matev

    2012-01-01

    Carpal intraosseous ganglia are one of the rarely seenpathologic conditions in the hand. In this report we presenta rare case of an intraosseous ganglion cyst in a16-year-old girl located in the triquetrum bone as an uncommoncause of wrist pain. Radiographic and magneticresonance imaging demonstrated the cystic lesion intothe triquetrum. The patient was successfully treated byexcision of the ganglion cyst and curettage of the bone.Clinical aspects, radiological findings and treatment modaliti...

  13. A rare case of intraosseous ganglion of the triquetrum

    OpenAIRE

    Matev, Boris; Georgi P. Georgiev; Stokov, Luben

    2012-01-01

    Carpal intraosseous ganglia are one of the rarely seen pathologic conditions in the hand. In this report we present a rare case of an intraosseous ganglion cyst in a 16-year-old girl located in the triquetrum bone as an uncommon cause of wrist pain. Radiographic and magnetic resonance imaging demonstrated the cystic lesion into the triquetrum. The patient was successfully treated by excision of the ganglion cyst and curettage of the bone. Clinical aspects, radiological findings and treatment ...

  14. A rare case of intraosseous ganglion of the triquetrum

    Directory of Open Access Journals (Sweden)

    Luben Stokov

    2012-03-01

    Full Text Available Carpal intraosseous ganglia are one of the rarely seenpathologic conditions in the hand. In this report we presenta rare case of an intraosseous ganglion cyst in a16-year-old girl located in the triquetrum bone as an uncommoncause of wrist pain. Radiographic and magneticresonance imaging demonstrated the cystic lesion intothe triquetrum. The patient was successfully treated byexcision of the ganglion cyst and curettage of the bone.Clinical aspects, radiological findings and treatment modalitiesof this condition were briefly reviewed. J Clin ExpInvest 2012; 3(1: 111-112

  15. Hepatoprotective and Antioxidant Activities of Desmodium Triquetrum DC

    OpenAIRE

    G A Kalyani; Ramesh, C.K.; V. Krishna

    2011-01-01

    The hepatoprotective and antioxidant activities of ethanol extract of Desmodium triquetrum DC leaf were investigated against carbon tetrachloride (1 ml/kg i.p) induced hepatic damage in rats at a dose of 200 mg/kg body weight p.o. The test extract significantly (P

  16. Hepatoprotective and Antioxidant Activities of Desmodium Triquetrum DC.

    Science.gov (United States)

    Kalyani, G A; Ramesh, C K; Krishna, V

    2011-07-01

    The hepatoprotective and antioxidant activities of ethanol extract of Desmodium triquetrum DC leaf were investigated against carbon tetrachloride (1 ml/kg i.p) induced hepatic damage in rats at a dose of 200 mg/kg body weight p.o. The test extract significantly (P<0.05) reduced the elevated levels of serum transaminases, alkaline phosphatase, bilirubin and reversed the antioxidant enzyme and non-enzyme levels. It dose dependently inhibited thiobarbuturic acid induced lipid peroxidation in vitro (IC(50)=59.9 μg/ml). Histopathological studies provided supportive evidence for biochemical analysis. Silymarin (25 mg/kg) is a known hepatoprotective drug used as a reference drug. The results indicated that D. triquetrum has potent hepatoprotective and antioxidant activity that may be due to the presence of flavonoids in the plant. PMID:22707836

  17. Hepatoprotective and antioxidant activities of Desmodium triquetrum DC

    Directory of Open Access Journals (Sweden)

    G A Kalyani

    2011-01-01

    Full Text Available The hepatoprotective and antioxidant activities of ethanol extract of Desmodium triquetrum DC leaf were investigated against carbon tetrachloride (1 ml/kg i.p induced hepatic damage in rats at a dose of 200 mg/kg body weight p.o. The test extract significantly (P<0.05 reduced the elevated levels of serum transaminases, alkaline phosphatase, bilirubin and reversed the antioxidant enzyme and non-enzyme levels. It dose dependently inhibited thiobarbuturic acid induced lipid peroxidation in vitro (IC 50 =59.9 μg/ml. Histopathological studies provided supportive evidence for biochemical analysis. Silymarin (25 mg/kg is a known hepatoprotective drug used as a reference drug. The results indicated that D. triquetrum has potent hepatoprotective and antioxidant activity that may be due to the presence of flavonoids in the plant.

  18. Morphological charaterization of accessions 144 of tadehagi triquetrum

    OpenAIRE

    Martínez Mamián, Carlos Augusto; Morales Velasco, Sandra; Vivas Quila, Nelson José

    2011-01-01

    Morphological characterization was performed of 114 accessions of Tadehagi triquetrum from Thailand, Vietnam, China, Indonesia and Papua New Guinea. The plant material is part of genebank fodder program of the International Center for Tropical Agriculture (CIAT). These accessions are used in animal feed and initially were sown in the greenhouse of CIAT forage program Palmira and after 8 weeks were transplanted to the final location on the grounds of the CIAT experimental substation Santander ...

  19. Avaliação do sequestro do óxido nítrico (NO) pelo extrato metanólico da alga Bryothamnion triquetrum (Gmelin) Howe Evaluation of nitric oxide (NO) scavenging for the metanol extract of the alga Bryothamnion triquetrum (Gmelin) Howe

    OpenAIRE

    Robinson M. Maia; Carlos W. N. Moura; Bispo, Vanderson S.; João L. A. Santos; Rafael S. Santana; Humberto R. Matos

    2010-01-01

    O excesso de óxido nítrico (NO) produzido por indução da enzima óxido nítrico sintase (iNOS) participa do desenvolvimento de inúmeras desordens que conduzem à perda da homeostasia. O estresse oxidativo gerado pelo aumento da produção endógena de NO pode levar a efeitos de toxidade induzida, tais como peroxidação lipídica, nitração de proteínas e danos ao DNA. Compostos que sejam capazes de sequestrar o radical NO podem diminuir a toxicidade das espécies reativas de nitrogênio (RNS), atuando n...

  20. [Intra-articular sub-periosteal osteoid osteoma of the triquetrum. Case report].

    Science.gov (United States)

    Herzberg, G; Baaklini, M; Al Saati, M; Izem, Y

    2010-10-01

    We report a case of subperiosteal osteoid osteoma of the triquetrum located into the piso-triquetral joint space. Such a variant at this particular location is very rare. The diagnosis was delayed for six years. A bloc resection of the tumour was followed by complete recovery. PMID:20724201

  1. Caracterización morfológica de 144 accesiones de Tadehagi triquetrum Morphological charaterization of accessions 144 of Tadehagi triquetrum

    OpenAIRE

    Carlos Augusto Martínez Mamián; Sandra Morales Velasco; Nelson José Vivas Quila

    2010-01-01

    Se realizó la caracterización morfológica de 114 accesiones de Tadehagi triquetrum provenientes de Tailandia, Vietnam, China, Indonesia y Papúa Nueva Guinea. Dicho material vegetal hace parte del banco de germoplasma del programa de forrajes del Centro Internacional de Agricultura Tropical (CIAT). Estas accesiones se utilizan en alimentación animal e inicialmente fueron sembradas en el invernadero del programa de forrajes del CIAT Palmira y después de 8 semanas se trasplantaron al sitio defin...

  2. EFEK DIURETIK Desmodium Triquetrum (L) DC (DAUN DUDUK) PADA HEWAN COBA

    OpenAIRE

    Sa'roni Sa'roni; Sediarso Sediarso; Yuyu Nur Azizah

    2012-01-01

    Secara empiris Desmodium triquetrum (L) DC (Daun duduk) digunakan sebagai pelancar air seni (diuretik). Untuk mendukung pemakaian empiris maka dilakukan penelitian efek diuretik pada tikus putih. Penelitian dilakukan dalam bentuk ekstrak dengan dosis 3,1 mg; 9,3 mg dan 31 mg/100 gram bobot badan. Sebagai blangko digunakan akuades 1ml/100 g bobot badan dan sebagai pembanding efek diuretik HCT dosis 0,16 mg/100 gram bobot badan. Perlakuan diberikan secara oral. Penelitian efek diuretik dilakuka...

  3. Caracterización morfológica de 144 accesiones de Tadehagi triquetrum

    OpenAIRE

    Martínez Mamián Carlos Augusto; Vivas Quila Nelson José; Morales Velasco Sandra

    2010-01-01

    Se realizó la caracterización morfológica de 114 accesiones de Tadehagi triquetrum provenientes de Tailandia, Vietnam, China, Indonesia y Papúa Nueva Guinea. Dicho material vegetal hace parte del banco de germoplasma del programa de forrajes del Centro Internacional de Agricultura Tropical (CIAT). Estas accesiones se utilizan en alimentación animal e inicialmente fueron sembradas en el invernadero del programa de forrajes del CIAT Palmira y después de 8 semanas s...

  4. EFEK DIURETIK Desmodium Triquetrum (L DC (DAUN DUDUK PADA HEWAN COBA

    Directory of Open Access Journals (Sweden)

    Sa'roni Sa'roni

    2012-10-01

    Full Text Available Secara empiris Desmodium triquetrum (L DC (Daun duduk digunakan sebagai pelancar air seni (diuretik. Untuk mendukung pemakaian empiris maka dilakukan penelitian efek diuretik pada tikus putih. Penelitian dilakukan dalam bentuk ekstrak dengan dosis 3,1 mg; 9,3 mg dan 31 mg/100 gram bobot badan. Sebagai blangko digunakan akuades 1ml/100 g bobot badan dan sebagai pembanding efek diuretik HCT dosis 0,16 mg/100 gram bobot badan. Perlakuan diberikan secara oral. Penelitian efek diuretik dilakukan menurut cara Lipschitz. Diuretik selain meningkatkan volume air, juga meningkatkan ekskresi Na dan K. Untuk mengukur kadar Na dan K dalam urine digunakan AAS. Hasil penelitian menunjukkan bahwa ekstrak daun duduk dosis 31 mg/100 g bobot badan mempunyai efek diuretik paling kuat dibandingkan dengan kontrol akuades, sedang kadar Na dan K dalam urine tidak berbeda dengan kadar Na dan K dalam urine tikus pembanding HCT dosis 0,16 mg/100 gram bobot badan.   Kata Kunci :  Diuretik; Desmodium triquetrum (L DC; Daun duduk

  5. Caracterización morfológica de 144 accesiones de Tadehagi triquetrum Morphological charaterization of accessions 144 of Tadehagi triquetrum

    Directory of Open Access Journals (Sweden)

    Carlos Augusto Martínez Mamián

    2010-10-01

    Full Text Available Se realizó la caracterización morfológica de 114 accesiones de Tadehagi triquetrum provenientes de Tailandia, Vietnam, China, Indonesia y Papúa Nueva Guinea. Dicho material vegetal hace parte del banco de germoplasma del programa de forrajes del Centro Internacional de Agricultura Tropical (CIAT. Estas accesiones se utilizan en alimentación animal e inicialmente fueron sembradas en el invernadero del programa de forrajes del CIAT Palmira y después de 8 semanas se trasplantaron al sitio definitivo en los terrenos de la subestación experimental del CIAT Santander de Quilichao. Cada accesión fue sembrada en una hilera de tres plantas, a las cuales se les realizó descripciones cualitativas y cuantitativas de cada uno de los órganos de la planta (hojas, tallo, inflorescencia, flor, fruto y semilla. Se observaron tres tipos de hojas según la forma; oblongas, ovadas y entre oblongas y ovadas. También se hallaron tres tipos de hábito de crecimiento; erecto, ascendente y postrado. Además se encontró que la especie presenta hojas compuestas, pinnadas con terminación aguda, y peciolo alado, tallos con ramas simpondiales no leñosas, de crecimiento herbáceo, con inflorescencias de tipo racimosas simples axiales y terminales, flores completas con los cuatro verticilos, hermafroditas, de estambres cognados diadelfos y con un promedio de diez estambres por flor, los frutos son legumbres dehiscentes con un promedio de 4 semillas por vaina que se caracterizan por ser tridimensionales con un peso promedio de 0,37 g por 100 semillas.Morphological characterization was performed of 114 accessions of Tadehagi triquetrum from Thailand, Vietnam, China, Indonesia and Papua New Guinea. The plant material is part of genebank fodder program of the International Center for Tropical Agriculture (CIAT. These accessions are used in animal feed and initially were sown in the greenhouse of CIAT forage program Palmira and after 8 weeks were transplanted to the

  6. Fingerprint Analysis of Desmodium Triquetrum L. Based on Ultra Performance Liquid Chromatography with Photodiode Array Detector Combined with Chemometrics Methods.

    Science.gov (United States)

    Zhang, Meiling; Zhao, Cui; Liang, Xianrui; Ying, Yin; Han, Bing; Yang, Bo; Jiang, Cheng

    2016-01-01

    A fingerprinting approach was developed by means of ultra high-performance liquid chromatography with photodiode array detector for the quality control of Desmodium triquetrum L., an herbal medicine widely used for clinical purposes. Ten batches of raw material samples of D. triquetrum were collected from different regions of China. All UPLC analyses were carried out on a Waters ACQUITY UPLC BEH shield RP18 column (2.1 × 50 mm, 1.7 µm particle size) at 60°C, with a gradient mobile phase composed of 0.1% aqueous formic acid and acetonitrile at a flow rate of 0.45 mL/min. The method validation results demonstrated the developed method possessing desirable reproducibility, efficiency, and allowing fingerprint analysis in one chromatographic run within 13 min. The quality assessment was achieved by using chemometrics methods including similarity analysis, hierarchical clustering analysis and principal component analysis. The developed method can be used for further quality control of D. triquetrum. PMID:26791345

  7. Caracterización morfológica de 144 accesiones de Tadehagi triquetrum

    Directory of Open Access Journals (Sweden)

    Martínez Mamián Carlos Augusto

    2010-12-01

    Full Text Available

    Se realizó la caracterización morfológica de 114 accesiones de Tadehagi triquetrum provenientes de Tailandia, Vietnam, China, Indonesia y Papúa Nueva Guinea. Dicho material vegetal hace parte del banco de germoplasma del programa de forrajes del Centro Internacional de Agricultura Tropical (CIAT. Estas accesiones se utilizan en alimentación animal e inicialmente fueron sembradas en el invernadero del programa de forrajes del CIAT Palmira y después de 8 semanas se trasplantaron al sitio definitivo en los terrenos de la subestación experimental del CIAT Santander de Quilichao. Cada accesión fue sembrada en una hilera de tres plantas, a las cuales se les realizó descripciones cualitativas y cuantitativas de cada uno de los órganos de la planta (hojas, tallo, inflorescencia, flor, fruto y semilla.

    Se observaron tres tipos de hojas según la forma; oblongas, ovadas y entre oblongas y ovadas. También se hallaron tres tipos de hábito de crecimiento; erecto, ascendente y postrado. Además se encontró que la especie presenta hojas compuestas, pinnadas con terminación aguda, y peciolo alado, tallos con ramas simpondiales no leñosas, de crecimiento herbáceo, con inflorescencias de tipo racimosas simples axiales y terminales, flores completas con los cuatro verticilos, hermafroditas, de estambres cognados diadelfos y con un promedio de diez estambres por flor, los frutos son legumbres dehiscentes con un promedio de 4 semillas por vaina que se caracterizan por ser tridimensionales con un peso promedio de 0,37 g por 100 semillas.

  8. Caracterización morfológica de 144 accesiones de Tadehagi triquetrum

    Directory of Open Access Journals (Sweden)

    Carlos Augusto Martínez Mamián

    2010-10-01

    Full Text Available Se realizó la caracterización morfológica de 114 accesiones de Tadehagi triquetrum provenientes de Tailandia, Vietnam, China, Indonesia y Papúa Nueva Guinea. Dicho material vegetal hace parte del banco de germoplasma del programa de forrajes del Centro Internacional de Agricultura Tropical (CIAT. Estas accesiones se utilizan en alimentación animal e inicialmente fueron sembradas en el invernadero del programa de forrajes del CIAT Palmira y después de 8 semanas se trasplantaron al sitio definitivo en los terrenos de la subestación experimental del CIAT Santander de Quilichao. Cada accesión fue sembrada en una hilera de tres plantas, a las cuales se les realizó descripciones cualitativas y cuantitativas de cada uno de los órganos de la planta (hojas, tallo, inflorescencia, flor, fruto y semilla. Se observaron tres tipos de hojas según la forma; oblongas, ovadas y entre oblongas y ovadas. También se hallaron tres tipos de hábito de crecimiento; erecto, ascendente y postrado. Además se encontró que la especie presenta hojas compuestas, pinnadas con terminación aguda, y peciolo alado, tallos con ramas simpondiales no leñosas, de crecimiento herbáceo, con inflorescencias de tipo racimosas simples axiales y terminales, flores completas con los cuatro verticilos, hermafroditas, de estambres cognados diadelfos y con un promedio de diez estambres por flor, los frutos son legumbres dehiscentes con un promedio de 4 semillas por vaina que se caracterizan por ser tridimensionales con un peso promedio de 0,37 g por 100 semillas.

  9. Fresh Body Fracture of Triquetrum Treated with A Hollow Titanium Bold Screw:A Case Report and Literature Review%中空钛质Bold螺钉治疗新鲜腕三角骨体部骨折一例报道并文献复习

    Institute of Scientific and Technical Information of China (English)

    董军峰; 李新志; 卢国强; 黄卫; 徐留海; 陈文瑶

    2014-01-01

    本院利用中空肽质Bold螺钉成功治疗1例新鲜左腕三角骨体部骨折患者,取得满意临床疗效,并结合相关文献对此病例进行分析报道。CT或MRI能提高腕三角骨骨折诊断准确率,利用Bold螺钉治疗新鲜腕三角骨体部骨折创伤小,有利于患者早期康复训练、功能锻炼及术后腕关节功能的恢复。对于新鲜腕三角骨体部骨折患者,Bold螺钉内固定术是一种安全有效的方法之一。%A patient with fresh wrist triquetrum body fracture was treated with a hollow titanium Bold screw in our hos-pital recently and achieved satisfactory results. The clinical case was analyzed and reported by reviewing the related litera-ture. Combining with the case,we hold that the CT or MRI could significantly improve diagnosis precision for wrist triquetrum fracture. It is propitious for early healing of the micro-trauma when treated with a hollow titanium Bold screw to the fresh body fracture of the wrist triquetrum case. It is also beneficial for early functional exercise,so this patient's wrist joint function recov-ered soon after operation. Internal fixation with hollow titanium Bold screw is a safe and effective treatment for the fresh wrist triquetrum body fracture patient.

  10. Eye redness

    Science.gov (United States)

    Bloodshot eyes; Red eyes; Scleral infection; Conjunctival infection ... There are many causes of a red eye or eyes. Some are medical emergencies and some are a cause for concern, but not an emergency. Others are nothing to worry about. ...

  11. 葫芦茶粉剂和浸膏对山羊体内寄生虫卵的影响%Effect of Desmodium triquetrum (L.) DC. Powder of its extract on the parasitic worm egg in goat

    Institute of Scientific and Technical Information of China (English)

    李树荣; 李琦华; 张军胤; 项伟; 毛云玲

    2002-01-01

    @@ 葫芦茶[Desmodium triquetrum(L.)DC.](俗名:剃刀柄、牛虫草、咸鱼草、百劳舌等),属亚灌木状草本或半灌木。是一种常见的植物杂草,全草含生物碱、黄酮甙等。民间每次用30~250g生药加水煮沸治小儿蛔虫和成人钩虫;在腌制咸鱼和肉类时放入本品可防止蝇蛆,也有将其割刈后用来杀死厕所内的蝇蛆。另据报道,本品还具有开胃健脾的功能。为了验证其杀虫效果,确定其有效剂量,观察其毒性反应,扩大它的使用范围,我们于2001年5月作以下试验。……

  12. Red Sirius

    International Nuclear Information System (INIS)

    A hypothesis is proposed explaining the assumption that Sirius changes its colour from red in the second century to pale blue in the tenth century A.D. The hypothesis is based on the possibility of transformation of a Sirius satellite (Sirius B) from a red giant in the past to a white dwarf in the present. Such a transformation would have been accompanied by an explosion of Sirius B, which is clearly visible from the Earth. The fact that the increase in Sirius brightness by 4-5 units is not reflected in historical chronicles is attributed to the degradation of sciences in Europe in 4-10 centuries

  13. Red Alive

    Directory of Open Access Journals (Sweden)

    Reynaldo Thompson Lopez

    2010-01-01

    Full Text Available Red Alive is an installation consisting of video, sound and an aquarium containing a beta fish in it. The idea came out by observing the peculiar behavior of the small creature that fights to death with other fishes of his kind that are in his proximity. Its character and physical appearance are good reasons to capture it in a video recording since its color and sensual movements contrast with its aggressive instinct. The conduct of such fish is similar in many aspects to those of humans.

  14. Red Alive

    OpenAIRE

    Reynaldo Thompson Lopez

    2010-01-01

    Red Alive is an installation consisting of video, sound and an aquarium containing a beta fish in it. The idea came out by observing the peculiar behavior of the small creature that fights to death with other fishes of his kind that are in his proximity. Its character and physical appearance are good reasons to capture it in a video recording since its color and sensual movements contrast with its aggressive instinct. The conduct of such fish is similar in many aspects to those of humans.

  15. Seeing Red

    Science.gov (United States)

    2008-01-01

    This New Horizons image of Jupiter's volcanic moon Io was taken at 13:05 Universal Time during the spacecraft's Jupiter flyby on February 28, 2007. It shows the reddish color of the deposits from the giant volcanic eruption at the volcano Tvashtar, near the top of the sunlit crescent, as well as the bluish plume itself and the orange glow of the hot lava at its source. The relatively unprocessed image on the left provides the best view of the volcanic glow and the plume deposits, while the version on the right has been brightened to show the much fainter plume, and the Jupiter-lit night side of Io. New Horizons' color imaging of Io's sunlit side was generally overexposed because the spacecraft's color camera, the super-sensitive Multispectral Visible Imaging Camera (MVIC), was designed for the much dimmer illumination at Pluto. However, two of MVIC's four color filters, the blue and 'methane' filter (a special filter designed to map methane frost on the surface of Pluto at an infrared wavelength of 0.89 microns), are less sensitive than the others, and thus obtained some well-exposed views of the surface when illumination conditions were favorable. Because only two color filters are used, rather than the usual three, and because one filter uses infrared light, the color is only a rough approximation to what the human eye would see. The red color of the Tvashtar plume fallout is typical of Io's largest volcanic plumes, including the previous eruption of Tvashtar seen by the Galileo and Cassini spacecraft in 2000, and the long-lived Pele plume on the opposite side of Io. The color likely results from the creation of reddish three-atom and four-atom sulfur molecules (S3 and S4) from plume gases rich in two-atom sulfur molecules (S2 After a few months or years, the S3 and S4 molecules recombine into the more stable and familiar yellowish form of sulfur consisting of eight-atom molecules (S8), so these red deposits are only seen around recently-active Io volcanos

  16. Red Bull Crisis

    Institute of Scientific and Technical Information of China (English)

    2009-01-01

    Additives make Red Bull the first company to test China’s new Food Safety Law "Drink Red Bull when you feel sleepy or tired" is a famous advertising slogan well-known to Chinese. But a recent German

  17. American Red Cross

    Science.gov (United States)

    ... to Help Sand Fire Evacuees » 90% of the Red Cross Workforce are Volunteers Learn More. Search for ... Volunteer» Digital Advocates» SEARCH FOR OPENINGS Shop the Red Cross Store Be Prepared and Ready to Respond ...

  18. Red Wine Over China

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The color red dominates Chinese life and now growing interest in red wine maintains that trend and ushers in a new fashionable addition to local culture There was a time when trying to find a good red wine in China was a difficult affair. But as with all

  19. α-, β-caroteno e α-tocoferol em algas marinhas in natura α- and β-carotene, and α-tocopherol in fresh seaweeds

    Directory of Open Access Journals (Sweden)

    Márcia Barbosa de Sousa

    2008-12-01

    Full Text Available O objetivo deste trabalho foi avaliar o potencial de 32 espécies de algas marinhas das divisões Chlorophyta, Rhodophyta e Phaeophyta como fontes de α- e β-caroteno e α-tocoferol. Todas as clorofíceas analisadas apresentaram α- e β-caroteno. Os teores máximo e mínimo de α-caroteno foram detectados nas espécies do gênero Caulerpa e em Codium decorticatum, respectivamente; e β-caroteno foi mais baixo em Caulerpa mexicana e mais elevado em Ulva fasciata. Dentre as rodofíceas, 11 espécies apresentaram α-caroteno, com máximo em Botryocladia occidentalis. β-caroteno foi encontrado em todas as algas vermelhas analisadas com teores mínimo e máximo em Gracilaria caudata e Bryothamnion triquetrum, respectivamente. As feofíceas apresentaram apenas β-caroteno, com mínimo e máximo em Dictyopteris delicatula e Padina gymnospora, respectivamente. Na divisão Chlorophyta, α-tocoferol, foi máximo em Codium decorticatum e mínimo em Caulerpa prolifera. Na Rhodophyta, 12 espécies apresentaram α-tocoferol com teor máximo em Enantiocladia duperreyi. Na Phaeophyta, α-tocoferol foi encontrado com valores mínimo e máximo em Lobophora variegata e Dictyota dichotoma, respectivamente.The aim of this work was to evaluate the potential of 32 marine macro algae species, members of Chlorophyta, Rhodophyta and Phaeophyta, as sources of a-carotene, b-carotene and a-tocopherol. Both b-carotene and a-carotene were found in all species of green macroalgae analyzed. The maximum content of a-carotene was detected in algae belonging to Caulerpa genus and the minimum in Codium decorticatum. The amount of b-carotene found was minimum in Caulerpa mexicana and maximum in Ulva fasciata. Among the Rhodophyta species, eleven contain a-carotene, the maximum content was found in Botryocladia occidentalis. b-Carotene was found in all red macroalgae analyzed presenting the lowest and highest values in Gracilaria caudata and Bryothamnion triquetrum, respectively

  20. Inquiring into Red/Red Inquiring

    Directory of Open Access Journals (Sweden)

    Ken Gale

    2013-05-01

    Full Text Available This layered account of an inquiry into ‘red’ emerged out of a collective biography workshop. In the middle of the Wiltshire countryside, an international and interdisciplinary group of scholars gathered together to write and make other things and marks on paper that asked questions of, and into, the spaces between words, people, things and their environments. We did not set out to workshop or write into or paint ‘red’ but, rather, it was red that slipped in, uninvited, and painted and wrote us. Red arose as a blush or a stain seeping amongst us that became referenced obliquely by material objects, metaphors and fairytales. The stain spread, became noticeable through our weekend together and beyond it, creating another (bright red artery vein of connection to write with.

  1. Experimental information: 1096 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_24_4_3 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  2. Experimental information: 1083 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_22_6_5 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  3. Experimental information: 1079 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_21_12_11 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  4. Experimental information: 1101 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_24_14_13 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  5. Experimental information: 1091 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_23_8_7 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  6. Experimental information: 1092 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_23_10_9 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  7. Experimental information: 1077 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_21_8_7 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  8. Experimental information: 1082 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_22_4_3 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  9. Experimental information: 1097 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_24_6_5 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  10. Experimental information: 1100 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_24_12_11 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  11. Experimental information: 1085 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_22_10_9 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  12. Experimental information: 1088 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_23_2_1 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  13. Experimental information: 1090 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_23_6_5 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  14. Experimental information: 1076 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_21_6_5 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  15. Experimental information: 1099 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_24_10_9 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  16. Experimental information: 1084 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_22_8_7 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  17. Experimental information: 1087 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_22_14_13 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... d Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  18. Experimental information: 1094 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_23_14_13 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  19. Experimental information: 1089 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_23_4_3 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  20. Experimental information: 1075 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_21_4_3 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  1. Experimental information: 1080 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_21_14_13 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestr ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  2. Experimental information: 1098 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_24_8_7 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  3. Experimental information: 1095 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_24_2_1 RED Cy3 Cy5 Zenpei Shimatnai Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Jasmonic acid,JA two-dye methods 2 ...

  4. Experimental information: 1086 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_22_12_11 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... d Fisheries Hormonal Hormonal Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  5. Experimental information: 1078 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_21_10_9 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  6. Experimental information: 1081 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_22_2_1 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry and ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Gibberellin,GA3 two-dye methods 20 ...

  7. Experimental information: 1074 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_21_2_1 RED Cy3 Cy5 Zenpei Shimatani Society for Techno-Innovation of Agriculture, Forestry ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Abscisic acid,ABA two-dye methods ...

  8. Experimental information: 1093 [RED

    Lifescience Database Archive (English)

    Full Text Available 1000_23_12_11 RED Cy3 Cy5 Kanako Shinbo Society for Techno-innovation of Agriculture,Forestry an ... ries Hormonal Other Hormonal Other Rice Expression Database ,RED,Time course,Brassinosteroide,Br two-dye method ...

  9. Probe data: 5652 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED D41273 AU174297 ST3645 >AGU83687_1(U83687|pid:g1835701) Apium graveolens NADP ... H-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  10. Next generation red teaming

    CERN Document Server

    Dalziel, Henry

    2015-01-01

    Red Teaming is can be described as a type of wargaming.In private business, penetration testers audit and test organization security, often in a secretive setting. The entire point of the Red Team is to see how weak or otherwise the organization's security posture is. This course is particularly suited to CISO's and CTO's that need to learn how to build a successful Red Team, as well as budding cyber security professionals who would like to learn more about the world of information security. Teaches readers how to dentify systemic security issues based on the analysis of vulnerability and con

  11. Inteligencia de red

    OpenAIRE

    Barba Martí, Antonio; Hesselbach Serra, Xavier

    2002-01-01

    Bibliografia Actualmente existe una necesidad cada vez mayor de ofrecer servicios de red avanzados, que proporcionen un alto valor añadido al cliente. Eso es ya posible gracias a las nuevas capacidades de computación añadidas a los nodos de red, que proporcionan inteligencia y facilitan la gestión de red a los operadores y proveedores de servicios. En este texto, se presentan las nuevas redes inteligentes basadas en señalización número 7, los nuevos servicios sobre Internet (voz sobre IP, ...

  12. Experimental information: 225 [RED

    Lifescience Database Archive (English)

    Full Text Available 2202_21_1_2 RED Cy3 Cy3 Masaaki Umeda The University of Tokyo Cell ... cycle Transgenic Cell ... cycle T ... ransgenic cell ... division,cell ... cycle,cyclin,CDK,transgenic plant on ...

  13. Experimental information: 226 [RED

    Lifescience Database Archive (English)

    Full Text Available 2202_21_1_3 RED Cy3 Cy3 Masaaki Umeda The University of Tokyo Cell ... cycle Transgenic Cell ... cycle T ... ransgenic cell ... division,cell ... cycle,cyclin,CDK,transgenic plant on ...

  14. Probe data: 2827 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-035040-2AR RED C72992 AU101214 E02619 EB2619 >(P35339) EXOPOLYGALACTURONASE PRECURSOR (EC 3. ... 2.1.67) (EXOPG) (PECTINASE ) (GALACTURAN 1,4-ALPHA-GALACTURONIDASE). &S30067(S ...

  15. Probe data: 6229 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-061580-1AR RED AU108708 C96917 C50119 CG0119 >(P52424) PHOSPHORIBOSYLFORMYLGLYCINAMIDINE CYC ... LO-LIGASE PRECURSOR (EC 6.3.3.1) (AIR S) (PHOSPHORIBOSYL-AMINOIMIDAZOLE SYNTHETASE) (AIR ...

  16. Experimental information: 1043 [RED

    Lifescience Database Archive (English)

    Full Text Available 2112_21_11_12 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo ... Nutrient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  17. Experimental information: 1038 [RED

    Lifescience Database Archive (English)

    Full Text Available 2112_21_1_2 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  18. Experimental information: 1040 [RED

    Lifescience Database Archive (English)

    Full Text Available 2112_21_5_6 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  19. Experimental information: 1042 [RED

    Lifescience Database Archive (English)

    Full Text Available 2112_21_9_10 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo N ... utrient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  20. Experimental information: 1039 [RED

    Lifescience Database Archive (English)

    Full Text Available 2112_21_3_4 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  1. Experimental information: 1041 [RED

    Lifescience Database Archive (English)

    Full Text Available 2112_21_7_8 RED Cy3 Cy5 Toru Fujiwara Agricultural and Life Sciences, The University of Tokyo Nu ... trient Metabolism Nutrient Metabolism sulfur nutrition ,root,O-acetyl-L-serine,gluthatione,time course two ...

  2. Probe data: 3426 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED C26646 AU108627 C12762 CB2762 >AGU83687_1(U83687|pid:g1835701) Apium graveole ... ns NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  3. Probe data: 779 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED D48175 AU032804 S14252 SS4252 >AGU83687_1(U83687|pid:g1835701) Apium graveole ... ns NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  4. Probe data: 3773 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-002330-1AR RED AU163183 AU163184 S00625 ST0625 >AGU83687_1(U83687|pid:g1835701) Apium graveo ... lens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  5. Galaxy Zoo: Passive Red Spirals

    CERN Document Server

    Masters, Karen L; Romer, A Kathy; Nichol, Robert C; Bamford, Steven P; Schawinski, Kevin; Lintott, Chris J; Andreescu, Dan; Campbell, Heather C; Crowcroft, Ben; Doyle, Isabelle; Edmondson, Edward M; Murray, Phil; Raddick, M Jordan; Slosar, Anze; Szalay, Alexander S; Vandenberg, Jan

    2009-01-01

    We study the spectroscopic properties and environments of red spiral galaxies found by the Galaxy Zoo project. By carefully selecting face-on, disk dominated spirals we construct a sample of truly passive disks (not dust reddened, nor dominated by old stellar populations in a bulge). As such, our red spirals represent an interesting set of possible transition objects between normal blue spirals and red early types. We use SDSS data to investigate the physical processes which could have turned these objects red without disturbing their morphology. Red spirals prefer intermediate density regimes, however there are no obvious correlations between red spiral properties and environment - environment alone is not sufficient to determine if a galaxy will become a red spiral. Red spirals are a small fraction of spirals at low masses, but dominate at large stellar masses - massive galaxies are red independent of morphology. We confirm that red spirals have older stellar populations and less recent star formation than ...

  6. Red giant seismology: Observations

    Directory of Open Access Journals (Sweden)

    Mosser B.

    2013-03-01

    Full Text Available The CoRoT and Kepler missions provide us with thousands of red-giant light curves that allow a very precise asteroseismic study of these objects. Before CoRoT and Kepler, the red-giant oscillation patterns remained obscure. Now, these spectra are much more clear and unveil many crucial interior structure properties. For thousands of red giants, we can derive from seismic data precise estimates of the stellar mass and radius, the evolutionary status of the giants (with a clear difference between clump and RGB stars, the internal differential rotation, the mass loss, the distance of the stars... Analyzing this amount of information is made easy by the identification of the largely homologous red-giant oscillation patterns. For the first time, both pressure and mixed mode oscillation patterns can be precisely depicted. The mixed-mode analysis allows us, for instance, to probe directly the stellar core. Fine details completing the red-giant oscillation pattern then provide further information on the interior structure, including differential rotation.

  7. Little Red Riding Hood

    Institute of Scientific and Technical Information of China (English)

    胡蓉

    2011-01-01

    你一定看过并知道小红帽(Little Red Riding Hood)的故事吧!下面是英语版的小红帽,你看过吗? Once upon a time,people liked a little girl very much.Her red hood(头巾 ) fit her, so people called her Little Red Riding Hood. One day,her mother said, "Take a piece of cake and a bottle ofwine to your grandmother.She is ill and weak.These will do her good.Donot run off the road,or you may fall and break the bottle,and then yourgrandmother will get nothing.OK! Go at once."

  8. Probe data: 5037 [RED

    Lifescience Database Archive (English)

    Full Text Available R12-044780-1AR RED AU173063 AU173064 RA0155 >XLU37373_1(U37373|pid:g1234787) Xenopus laevis tail ... -specific thyroid ... hormone up-regulated (gene 5) mRNA, complete cds; ... up-regulated by thyroid ... hormone in tadpoles; expressed specifically in the ...

  9. Probe data: 5576 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-047910-1AR RED AU174190 AU174191 ST1070 >XLU37373_1(U37373|pid:g1234787) Xenopus laevis tail ... -specific thyroid ... hormone up-regulated (gene 5) mRNA, complete cds; ... up-regulated by thyroid ... hormone in tadpoles; expressed specifically in the ...

  10. Probe data: 6197 [RED

    Lifescience Database Archive (English)

    Full Text Available R07-048110-1AR RED D22267 C96749 C10642 CB0642 >TAU87163_1(U87163|pid:g2306768) Triticum aestivu ... eta subunit mRNA, complete cds; assignment of open reading ... frame based on alignment with other plant eIF2 sub ...

  11. Probe data: 2895 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-021800-1AR RED C19773 AU101326 E10917 EC0917 >TAU87163_1(U87163|pid:g2306768) Triticum aesti ... eta subunit mRNA, complete cds; assignment of open reading ... frame based on alignment with other plant eIF2 sub ...

  12. Probe data: 5564 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-057040-1AR RED D39512 AU174175 ST0896 >SPAC19A8_12(Z98974|pid:g2388911) S.pombe chromosome I ... ar eg. to YNL118C, PSU1_YEAST, P53550, involved in respiration , (970aa), fasta scores, opt:776, E():0, (29.1% ide ...

  13. Probe data: 5495 [RED

    Lifescience Database Archive (English)

    Full Text Available R09-031940-1R RED D48735 AU174075 SS5125 >SPBC215_13(AL033534|pid:g3873550) S.pombe chromosome I ... 932 aa), fasta scores: opt: 694, E():8e-27, (41.8% identity ... in 457 aa). ...

  14. Probe data: 2587 [RED

    Lifescience Database Archive (English)

    Full Text Available R11-011010-4R RED AU062718 AU100766 C30311 CE0311 >AE000959_10(AE000959|pid:g2648442) Archaeoglo ... similar to GB:X79560 SP:P46464 PID:517390 percent identity : 61.98; identified by sequence similarity; putativ ...

  15. Probe data: 3857 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-042830-1AR RED AU064223 AU164111 ED0143 >AE001019_19(AE001019|pid:g2649345) Archaeoglobus fu ... similar to GB:L77117 SP:Q60179 PID:1591690 percent identity : 39.38; identified by sequence similarity; putativ ...

  16. Probe data: 3925 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-019390-1AR RED AU164858 AU164859 EH1645 >AP000005_67(AP000005|pid:g3257577) Pyrococcus horik ... position (5/7); similar to owl:HPAE0006332 percent identity :27.451 in 212aa; Swiss_Prot:P44659 percent identit ...

  17. Probe data: 3184 [RED

    Lifescience Database Archive (English)

    Full Text Available R05-006300-1AR RED D48993 AU101824 S15595 SS5595 >AE001130_3(AE001130|pid:g2688094) Borrelia bur ... SP:P17580 GB:M24503 PID:290500 PID:551840 percent identity : 38.99; identified by sequence similarity; putativ ...

  18. Probe data: 5521 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-030160-1AR RED AU174105 AU174106 SS6038 >ATNAP16KD_1(Z96936|pid:g2765837) Arabidopsis thalia ... ociated protein NAP16kDa; pos. 112 to 116 sequence identity ... to nitrilase isoform 1 and 2. ...

  19. Probe data: 5482 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-017290-1AR RED AU174055 AU174056 SS4954 >AE000956_15(AE000956|pid:g2648379) Archaeoglobus fu ... e genome; similar to PID:1045016 SP:Q51790 percent identity : 31.21; identified by sequence similarity; putativ ...

  20. Probe data: 364 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-031580-1AR RED AU075434 AU031062 E60705 EH0705 >AF036618_1(AF036618|pid:g2708624) Arabidopsi ... thaliana acetyl-CoA synthetase mRNA, complete cds; identity ... based on similarity to known acetyl-CoA synthetase ...

  1. Probe data: 252 [RED

    Lifescience Database Archive (English)

    Full Text Available R09-033840-1AR RED AU162299 AU030444 E51070 EG1070 >AE000968_9(AE000968|pid:g2648586) Archaeoglo ... similar to GB:L77117 SP:Q57665 PID:1498988 percent identity : 60.92; identified by sequence similarity; putativ ...

  2. Probe data: 4505 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-017940-1AR RED AU166950 AU166951 CH0192 >AE001265_11(AE001265|pid:g3323304) Treponema pallid ... the complete genome; similar to GP:606359 percent identity : 29.47; identified by sequence similarity; putativ ...

  3. Probe data: 1244 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-038610-1AR RED AU057404 AU057405 S21415 SA1415 >SPAC57A7_5(Z95396|pid:g2104440) S.pombe chro ... 5 aa), fasta scores: opt: 199, E():0.00029, (20.5% identity ... in 366 aa). ...

  4. Probe data: 5087 [RED

    Lifescience Database Archive (English)

    Full Text Available R07-015750-1AR RED D24254 AU173174 RA1586 >AE001048_5(AE001048|pid:g2649798) Archaeoglobus fulgi ... e genome; similar to GB:L77117 PID:1591676 percent identity : 48.77; identified by sequence similarity; putativ ...

  5. Probe data: 1808 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-015680-1AR RED C72327 AU078752 EB1437 >AE000949_5(AE000949|pid:g2648274) Archaeoglobus fulgi ... of 172 of the complete genome; similar to percent identity : 28.02; identified by sequence similarity; putativ ...

  6. Probe data: 5456 [RED

    Lifescience Database Archive (English)

    Full Text Available R08-023200-1AR RED D47972 AU174021 SS3803 >AE001011_18(AE001011|pid:g2649239) Archaeoglobus fulg ... the complete genome; similar to SP:P24297 percent identity : 67.92; identified by sequence similarity; putativ ...

  7. Probe data: 4990 [RED

    Lifescience Database Archive (English)

    Full Text Available R12-008240-1AR RED AU064916 AU172911 EF0791 >AF052429_1(AF052429|pid:g2981214) Zea mays photosys ... tem I complex PsaN subunit precursor (psaN) mRNA, nuclear ... gene encoding chloroplast protein, partial cds; nu ...

  8. Probe data: 581 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-011070-2AR RED AU031849 AU031850 R02164 RA2164 >XLU69669_1(U69669|pid:g1850344) Xenopus laev ... is nuclear ... pore complex-associated protein TPR (tpr) mRNA, pa ... rtial cds; nuclear ... pore complex-associated protein; translocated prom ...

  9. Probe data: 6247 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-008440-1AR RED C26839 C96955 C50194 CG0194 >ATF19H22_3(AL035679|pid:g4539312) Arabidopsis th ... 778, T76313, H76773, T76734 are in 3' untranslated region ; EST T42894 covers intron in 5' untranslated regio ...

  10. Probe data: 5314 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-013800-1AR RED AU065355 AU173508 RA3452 >DOG01_1(D43756|pid:g1304047) Dog gene for fibrinoge ... n A-alpha-chain, partial cds (C-terminal region ); carboxy-terminal region . ...

  11. Probe data: 5984 [RED

    Lifescience Database Archive (English)

    Full Text Available RED AU174977 AU174976 FL0119 >OLRKLP2_1(U72725|pid:g2586083) Oryza longistaminata receptor kinas ... e-like protein gene, family ... member A1, complete cds; Xa21 gene family ... member A ... of microsatellite region; disease resistance gene family ... member. ...

  12. Probe data: 5952 [RED

    Lifescience Database Archive (English)

    Full Text Available RED AU174907 AU174908 FL0036 >OLRKLP2_1(U72725|pid:g2586083) Oryza longistaminata receptor kinas ... e-like protein gene, family ... member A1, complete cds; Xa21 gene family ... member A ... of microsatellite region; disease resistance gene family ... member. ...

  13. Probe data: 991 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-046410-1AR RED AU162658 AU056152 S20333 SA0333 >CAN012165_1(AJ012165|pid:g3808101) Capsicum ... for chloroplast protease (CACP)from the AAA atpase family ; AAA atpase family . ...

  14. Probe data: 2696 [RED

    Lifescience Database Archive (English)

    Full Text Available R07-042870-1AR RED AU101001 AU101000 C62681 CH2681 >AF078103_1(AF078103|pid:g4218945) Homo sapie ... ns developmentally regulated GTP-binding protein (DRG ) mRNA, complete cds. &HSA005940_1(AJ005940|pid:g41 ...

  15. Probe data: 2995 [RED

    Lifescience Database Archive (English)

    Full Text Available R11-007900-2AR RED AU030559 AU101484 E51237 EG1237 >AF020193_1(AF020193|pid:g2895198) Glycine ma ... x DNA ... polymerase delta (Pol delta) mRNA, complete cds; D ... NA-dependent DNA ... polymerase. ...

  16. Probe data: 3754 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-042000-1AR RED D48054 AU162984 SS3984 >CELZC13_4(U67953|pid:g1519683) Caenorhabditis elegans ... ity to EGF-like domain cysteine pattern signature (PS :PS 00022); coded for by C. elegans cDNA yk70d5.3; c ...

  17. Probe data: 4083 [RED

    Lifescience Database Archive (English)

    Full Text Available R08-045490-1AR RED AU077699 AU166249 E50587 EG0587 >MEU72662_12(U72662|pid:g2160684) Methylobact ... tative ABC transporter ATP-binding subunit (abcC), methanol ... dyhydrogenase large subunit homolog (mxaF'), cytoc ...

  18. Probe data: 4655 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-018670-1AR RED C72142 AU172460 EB1070 >TDU89271_1(U89271|pid:g1877482) Tripsacum dactyloides ... short-chain alcohol dehydrogenase (gynomonoecious sex ... form 1) gene, allele gsf1, complete cds; similar t ...

  19. Probe data: 5077 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-043650-1AR RED AU173162 AU173163 RA1507 >AF057183_1(AF057183|pid:g3264596) Zea mays putative ... nscript 1 (HIT1); induced by submergence, hypoxia, mechanical ... impedence, and 40% O2 conditions. ...

  20. Probe data: 487 [RED

    Lifescience Database Archive (English)

    Full Text Available R05-018490-1AR RED D23861 AU031673 R00448 RA0448 >OSU30479_1(U30479|pid:g1041712) Oryza sativa e ... 3 (Os-EXP3) mRNA, complete cds; induces extension (creep ) in plant cell walls; former gene name RiExD. ...

  1. Probe data: 3148 [RED

    Lifescience Database Archive (English)

    Full Text Available R12-043420-1AR RED D47342 AU101752 S12658 SS2658 >(P38076) CYSTEINE SYNTHASE (EC 4.2.99.8) (O -AC ... ETYLSERINE SULFHYDRYLASE) (O -ACETYLSERINE (THIO L)-LYASE) (CSASE). &JS0762(JS076 ...

  2. Probe data: 3928 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-053360-1AR RED AU164935 AU164936 E61827 EH1827 >(Q43317) CYSTEINE SYNTHASE (EC 4.2.99.8) (O - ... ACETYLSERINE SULFHYDRYLASE) (O -ACETYLSERINE (THIO L)-LYASE) (CSASE). &CNAPCCS7_1(D ...

  3. Probe data: 4200 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-028920-1AR RED AU062597 AU166443 CB2410 >EBV_10(V01555|pid:g1334843) Epstein-Barr virus (EBV ... stoid cell line immortalized with human EBV from a mononucleosis ... patient; BWRF1 reading frame 8; Protein sequence i ...

  4. Probe data: 4637 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-008940-1AR RED C71953 AU172434 EB0676 >ATF10M23_3(AL035440|pid:g4455192) Arabidopsis thalian ... weak similarity to hypothetical protein PFB0835c - malaria , PID:g3845289; contains EST gb:T42321, R65259, Aa7 ...

  5. Probe data: 6350 [RED

    Lifescience Database Archive (English)

    Full Text Available R11-026990-1AR RED C97557 C97558 C60385 CH0385 >HTU32872_1(U32872|pid:g1463038) Human T-cell lym ... photropic virus type 2 rex and tax ... genes, partial cds, clone SP2; putative. &HTU32875 ...

  6. Probe data: 2820 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-000280-1AR RED C72958 AU101205 E02550 EB2550 >S39445(S39445;A42119) DNA-directed RNA polymer ... ase (EC 2.7.7.6) II chain 9, 15K - fruit fly ... (Drosophila melanogaster) &S66940_1(S66940|pid:g45 ...

  7. Probe data: 3103 [RED

    Lifescience Database Archive (English)

    Full Text Available R09-032390-1AR RED D39322 AU101671 R03330 RA3330 >ATT5C23_17(AL049500|pid:g4539465) Arabidopsis ... e 4, BAC clone T5C23 (ESSA project); similarity to Fly ... Fas-associated factor (FFAF), Drosophila melanogas ...

  8. Probe data: 3422 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-049940-1AR RED C96862 AU108608 C12691 CB2691 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cyt ... oplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  9. Probe data: 1384 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-049940-1AR RED AU068083 AU068084 C11828 CB1828 >ZMU43082_1(U43082|pid:g1421730) Zea mays T c ... ytoplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  10. Probe data: 5862 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-016110-1AR RED AU174691 AU174690 FE0214 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cytoplas ... m male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  11. Probe data: 635 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-039520-1AR RED D39230 AU031992 R03072 RA3072 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cyt ... oplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  12. Probe data: 2296 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-049940-1AR RED C19367 AU094406 E10314 EC0314 >ZMU43082_1(U43082|pid:g1421730) Zea mays T cyt ... oplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  13. Probe data: 3192 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-016110-1AR RED AU101840 AU101841 S15881 SS5881 >ZMU43082_1(U43082|pid:g1421730) Zea mays T c ... ytoplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  14. Probe data: 1631 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-039510-1AR RED AU075853 AU075854 S20436 SA0436 >ZMU43082_1(U43082|pid:g1421730) Zea mays T c ... ytoplasm male ... sterility restorer factor 2 (rf2) mRNA, complete c ... +B73; putative aldehyde dehydrogenase; T cytoplasm male ... sterility. ...

  15. Probe data: 2872 [RED

    Lifescience Database Archive (English)

    Full Text Available R04-052870-1AR RED C73509 AU101290 E04274 EB4274 >AF023159_1(AF023159|pid:g3057120) Zea mays starch ... ULL1 (dull1) mRNA, complete cds; similar to potato starch ... synthase SSIII; likely to be the maize starch ... synt ...

  16. Probe data: 173 [RED

    Lifescience Database Archive (English)

    Full Text Available R04-032560-4R RED AU030096 AU030097 E50621 EG0621 >ZMU65948_1(U65948|pid:g2340108) Zea mays starch ... ch branching enzyme IIa (Sbe2a) mRNA, partial cds; starch ... branching enzyme isozyme SBEIIa. ...

  17. Probe data: 3220 [RED

    Lifescience Database Archive (English)

    Full Text Available R09-025420-1AR RED AU032971 AU101898 S00086 ST0086 >D88434_1(D88434|pid:g4519507) Malus domestic ... a mRNA for protein abundantly expressed during apple ... fruit development, complete cds; similar to Garden ...

  18. Probe data: 4872 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-007550-2AR RED AU172766 AU172767 EE0037 >F9D12_1(AF077407|pid:g3319342) Arabidopsis thaliana ... BAC F9D12; similar to mit ochondrial carrier proteins (Pfam: mit _carr.hmm, sc ...

  19. Probe data: 1918 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-001500-1AR RED AU031498 AU082419 E61744 EH1744 >ATU20347_1(U20347|pid:g790583) Arabidopsis t ... responding to this gene accumulates in response to ozone ... stress and pathogen (bacterial) infection; putativ ...

  20. Probe data: 1601 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-043000-1AR RED C26746 AU075577 C12957 CB2957 >HSU49082_1(U49082|pid:g1840045) Human transpor ... ter protein (g17) mRNA, complete cds; member of a new ... family of transporter protein genes; resides in th ...

  1. Probe data: 3050 [RED

    Lifescience Database Archive (English)

    Full Text Available R05-046640-1AR RED AU031556 AU101584 E61844 EH1844 >HS1119A7_2(AL022313|pid:g4200328) Human DNA ... iation factor EIF3-P66 subunit, EST, GSS, STS, CpG island , complete sequence; &HSU54558_1(U54558|pid:g235137 ...

  2. Probe data: 3094 [RED

    Lifescience Database Archive (English)

    Full Text Available R12-040640-1AR RED D24605 AU101660 R02241 RA2241 >AF099082_1(AF099082|pid:g4176766) Homo sapiens ... xenotropic and polytropic murine retrovirus ... receptor (XPR1) mRNA, complete cds; related to yea ...

  3. EST data: 8680 [RED

    Lifescience Database Archive (English)

    Full Text Available ST3645 D41273 AU174297 DPlate 090 H05 AAAAGCCCCCATTATTGTTC AGGAGGAGAGATTGCAGGAG >AGU83687_1(U836 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  4. EST data: 8002 [RED

    Lifescience Database Archive (English)

    Full Text Available SS4252 D48175 AU032804 S14252 4 G DPlate 083 B05 CGCAAATACACGAAATATAG TGCTTGATGAATTATGAGTC >AGU8 ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  5. EST data: 8329 [RED

    Lifescience Database Archive (English)

    Full Text Available ST0625 AU163183 AU163184 S00625 4 G DPlate 086 A10 ACTTGGCAGGCTGGTTGGTG GAGTGGTTTGGGTCCGTTTC >AG ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  6. Probe data: 66 [RED

    Lifescience Database Archive (English)

    Full Text Available R07-032820-1AR RED AU166075 AU029521 EE1034 >AF020814_1(AF020814|pid:g2997591) Pisum sativum glu ... cose-6-phosphate /phosphate -translocator precursor (GPT) mRNA, nucle ... n, complete cds; metabolite transporter; glucose-6-phosphate ... is the precursor for starch synthesis in many plas ...

  7. Probe data: 6267 [RED

    Lifescience Database Archive (English)

    Full Text Available R08-034590-1AR RED AU108817 C97061 C51323 CG1323 >(Q43272) NADP-DEPENDENT GLYCERALDEHYDE-3-PHOSPHATE ... (EC 1.2.1.9) (NON-PHOSPHORYLATING GLYCERALDEHYDE 3-PHOSPHATE ... DEHYDROGENASE) (GLYCERALDEHYDE-3-PHOSPHATE ... DEHYDRO ... GENASE (NADP+)) (TRIOSEPHOSPHATE ... DEHYDROGENASE). &S43833(S43833) &ZMRNAGAPN_1(X7532 ...

  8. Probe data: 783 [RED

    Lifescience Database Archive (English)

    Full Text Available R08-034590-1AR RED D48732 AU032835 S15122 SS5122 >(Q43272) NADP-DEPENDENT GLYCERALDEHYDE-3-PHOSPHATE ... (EC 1.2.1.9) (NON-PHOSPHORYLATING GLYCERALDEHYDE 3-PHOSPHATE ... DEHYDROGENASE) (GLYCERALDEHYDE-3-PHOSPHATE ... DEHYDRO ... GENASE (NADP+)) (TRIOSEPHOSPHATE ... DEHYDROGENASE). &S43833(S43833) &ZMRNAGAPN_1(X7532 ...

  9. Probe data: 3500 [RED

    Lifescience Database Archive (English)

    Full Text Available R04-059760-1AR RED C27462 AU160841 CG1937 >AF020814_1(AF020814|pid:g2997591) Pisum sativum gluco ... se-6-phosphate /phosphate -translocator precursor (GPT) mRNA, nucle ... n, complete cds; metabolite transporter; glucose-6-phosphate ... is the precursor for starch synthesis in many plas ...

  10. Canadian Red Cross.

    Science.gov (United States)

    Lavender, Colleen

    2008-01-01

    The Canadian Red Cross is guided by its Fundamental Principles--humanity, impartiality, neutrality, independence, voluntary service, unity, and universality--and organized in a traditional geographic hierarchical structure. Among the characteristics that have contributed to its success are a budgeting process that starts at the local level, measurement of program outcomes, and coordinated fundraising activities at the regional level. PMID:18551842

  11. Probe data: 1164 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-003380-1AR RED AU078263 AU056903 S20966 SA0966 >HVSCOAT_1(L37299|pid:g609504) Helicoverpa ar ... tics, makes tube-like structures when expressed in bacteria , unstable when expressed in baculovirus, start cod ...

  12. Probe data: 5088 [RED

    Lifescience Database Archive (English)

    Full Text Available R10-035910-1AR RED D24257 AU173175 RA1590 >ATF23E12_14(AL022604|pid:g3080420) Arabidopsis thalia ... lone F23E12 (ESSAII project); strong similarity to sugar ... transporter, Arabidopsis thaliana, db_xref=PID:g14 ... 95273; Contains Sugar ... transport proteins signatures [SGGVADWLGRRPMLILS] ...

  13. Probe data: 5473 [RED

    Lifescience Database Archive (English)

    Full Text Available R10-035910-1AR RED D48171 AU174043 SS4246 >ATF23E12_14(AL022604|pid:g3080420) Arabidopsis thalia ... lone F23E12 (ESSAII project); strong similarity to sugar ... transporter, Arabidopsis thaliana, db_xref=PID:g14 ... 95273; Contains Sugar ... transport proteins signatures [SGGVADWLGRRPMLILS] ...

  14. Probe data: 4686 [RED

    Lifescience Database Archive (English)

    Full Text Available R04-036560-1AR RED AU063886 AU172500 EB1608 >F9D12_15(AF077407|pid:g3319354) Arabidopsis thalian ... a BAC F9D12; contains similarity to sugar ... transporters (Pfam: sugar _tr.hmm, score: 395.39); ...

  15. Sample information: 2201 [RED

    Lifescience Database Archive (English)

    Full Text Available 2201 2 T Cell cycle Oryza sativa (rice) C5924 (Ghaiya) Rice cell (Oc cells from rice root) culture ... red in AA medium 0 Root t 30 min culture ... (cell cycle)|Rice Oc cells were transferred to a n ... ew culture ... medium and collected after 30min ...

  16. Probe data: 2199 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-053030-1AR RED C27281 AU092509 C51502 CG1502 >(P29677) MITOCHONDRIAL PROCESSING PEPTIDASE AL ... PHA SUBUNIT PREC URSOR (EC ... 3.4.24.64) (ALPHA-MPP) (UBIQUINOL-CYTOCHR ... OME C ... REDUCTASE SUBUNIT II) (EC ... 1.10.2.2). &S23558(S235 ...

  17. Probe data: 438 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-055920-1AR RED AU095379 AU031455 E61595 EH1595 >(Q42876) CHLOROPLAST AMINOPEPTIDASE 1 PREC UR ... SOR (EC ... 3.4.11.1) (LEUCINE AMINOPEPTIDASE) (LAP) (LEUCYL A ... MINOPEPTIDASE) (PROLINE AMINOPEPTIDASE) (EC ... 3.4.11.5) (PROLYL AMINOPEPTIDASE). &S57812(S57812) ...

  18. Probe data: 621 [RED

    Lifescience Database Archive (English)

    Full Text Available R11-008840-1AR RED D39164 AU031950 R02794 RA2794 >(P52588) PROTEIN DISULFIDE ISOMERASE PREC URSOR ... (PDI) (EC ... 5.3.4.1) / DOLICHYL- DIPHOSPHOOLIGOSACCHARIDE-PROT ... EIN GLYCOTRANSFERASE (EC ... 2.4.1.119) (GLYCOSYLATION SITE-BINDING CHAIN) (GSB ...

  19. Probe data: 4096 [RED

    Lifescience Database Archive (English)

    Full Text Available R12-025080-1AR RED AU166273 AU166274 CB0250 >(P07814) MULTIFUNCTIONAL AMINOACYL-TRNA SYNTHETASE ... (CONTAINS: GLUTAMYL-TRNA SYNTHETASE (EC ... 6.1.1.17) (GLUTAMATE--TRNA LIGASE), AND PROLYL-TRN ... A SYNTHETASE (EC ... 6.1.1.15) (PROLINE--TRNA LIGASE)). &HSGTS_1(X54326 ...

  20. Probe data: 6356 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-072960-1AR RED C28243 C97586 C60441 CH0441 >(Q42942) URIDINE 5'-MONOPHOSPHATE SYNTHASE (UMP ... SYNTHASE) (OROTATE PHOSPHORIBOSYLTRANSFERASE (EC ... 2.4.2.10) AND OROTIDINE 5'-PHOSPHATE DEC ARBOXYLASE ... (EC ... 4.1.1.23)) (FRAGMENT). &NTU22260_1(U22260|pid:g747 ...

  1. Probe data: 1484 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-005160-1AR RED AU068643 AU068642 C30624 CE0624 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsi ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  2. Probe data: 450 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-005160-1AR RED AU031552 AU031553 E61840 EH1840 >ATF28M20_6(AL031004|pid:g3281853) Arabidopsi ... icago sativa, PID:g2582800; Contains Mitochondrial energy ... transfer proteins signature [PEEGAKRLMM], Protein ...

  3. Probe data: 539 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-015880-1AR RED D24296 AU031777 R01679 RA1679 >ATF17M5_25(AL035678|pid:g4490316) Arabidopsis ... R:G2290202; Contains Eukaryotic and viral aspartyl proteases ... active site [LDLDTGSDLTWL]. ...

  4. Probe data: 67 [RED

    Lifescience Database Archive (English)

    Full Text Available R08-035600-3AR RED AU029523 AU029522 EE1035 >F6N15_22(AF069299|pid:g3193320) Arabidopsis thalian ... tains similarity to the subtilase family of serine proteases ... (Pfam: subtilase.hmm, score: 47.57); strong simila ...

  5. Probe data: 2573 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-050030-1AR RED C26608 AU100748 C12680 CB2680 >ATF17M5_25(AL035678|pid:g4490316) Arabidopsis ... R:G2290202; Contains Eukaryotic and viral aspartyl proteases ... active site [LDLDTGSDLTWL]. ...

  6. Probe data: 4726 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-005800-1AR RED C72916 AU172547 EB2461 >ATT25K17_14(AL049171|pid:g4539429) Arabidopsis thalia ... e, Arabidopsis thaliana, AF055848; Contains Serine proteases , subtilase family, active sites [GTSMSCPHVAG]. ...

  7. Probe data: 629 [RED

    Lifescience Database Archive (English)

    Full Text Available R05-000860-1AR RED D39203 AU031981 RA3021 >ATF23E12_9(AL022604|pid:g3080415) Arabidopsis thalian ... PIR2:S71773; Contains Eukaryotic thiol (cysteine) proteases ... active sites [QGQCGSCWAFST][LDHGVAAVGYG]; contains ...

  8. Probe data: 3935 [RED

    Lifescience Database Archive (English)

    Full Text Available R04-031750-1AR RED AU165241 AU165240 C62825 CH2825 >(P49727) UBIQUINOL-CYTOCHROME C REDUCTASE IRON ... ON-SULFUR SUBUNIT PRECURSOR (EC 1.10.2.2) (RIESKE IRON -SULFUR PROTEIN) (RISP). &A41607(A41607) &MZERFESPA ...

  9. Probe data: 1697 [RED

    Lifescience Database Archive (English)

    Full Text Available R10-029050-2AR RED AU077497 AU077496 C51971 CG1971 >(P48600) EUKARYOTIC TRANSLATION INITIATION F ... (EIF-4E) (EIF4E) (MRNA CAP-BINDING PROTEIN) (EIF-(ISO )4F 25 KD SUBUNIT) (EIF-(ISO )4F P28 SUBUNIT). &JC53 ...

  10. Probe data: 6548 [RED

    Lifescience Database Archive (English)

    Full Text Available R02-004920-4AR RED C73633 C99436 E20022 ED0022 >S72415_5(S72415|pid:g632873) putative protein ki ... sequence comes from Fig. 2. Protein sequence is in conflict ... with the conceptual translation; mismatches(518-52 ...

  11. Probe data: 5046 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-046030-1AR RED AU173086 AU173087 RA0369 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thali ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  12. Probe data: 4866 [RED

    Lifescience Database Archive (English)

    Full Text Available R07-030880-3AR RED C91611 AU172758 ED0945 >S62928_1(S62928|pid:g386431) PRB1M=PRB1 medium length ... equence comes from Fig. 3A. Protein sequence is in conflict ... with the conceptual translation; mismatch(177[R- & ...

  13. Probe data: 3457 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-022440-3AR RED C27097 AU108766 CG0974 >S58544_1(S58544|pid:g299703) 75 kda infertility-relat ... sequence comes from Fig. 4. Protein sequence is in conflict ... with the conceptual translation; mismatches(46[R- ...

  14. Probe data: 1379 [RED

    Lifescience Database Archive (English)

    Full Text Available R11-043720-4R RED AU166370 AU068062 C11732 CB1732 >AMTAM1TR_1(X57297|pid:g1345502) A. majus TAM1 ... gene for TNP1 and TNP2; Protein sequence is in conflict ... with the conceptual translation; no ATG start codo ...

  15. Probe data: 988 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-019390-1AR RED AU056143 AU056144 S20327 SA0327 >HSPM5_1(X57398|pid:g1335273) Human mRNA for ... pM5 protein; Protein sequence is in conflict ... with the conceptual translation.. &S21977(S21977) ...

  16. Probe data: 1072 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-066870-1AR RED AU162697 AU056522 S20655 SA0655 >ATATAF1_1(X74755|pid:g1345506) A.thaliana AT ... AF1 mRNA; Protein sequence is in conflict ... with the conceptual translation.. &S37101(S37101) ...

  17. Probe data: 4820 [RED

    Lifescience Database Archive (English)

    Full Text Available R05-004160-1AR RED C19333 AU172698 EC0269 >S72926_1(S72926|pid:g633890) Hordeum vulgare glucose ... sequence comes from Fig. 1. Protein sequence is in conflict ... with the conceptual translation.. ...

  18. Probe data: 5707 [RED

    Lifescience Database Archive (English)

    Full Text Available R09-000620-2R RED AU161807 AU174368 ST5674 >S81497_1(S81497|pid:g1336726) lysosomal acid lipase= ... sequence comes from Fig. 2. Protein sequence is in conflict ... with the conceptual translation; mismatches(82[G- ...

  19. Probe data: 2355 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-046030-1AR RED AU065261 AU095249 EH0928 >ATF18F4_17(AL021637|pid:g2827661) Arabidopsis thali ... one F18F4 (ESSAII project); Protein sequence is in conflict ... with the conceptual translation; 5-substituted hyd ...

  20. Probe data: 862 [RED

    Lifescience Database Archive (English)

    Full Text Available R03-008820-1AR RED AU055750 AU055751 S20035 SA0035 >S75487_1(S75487|pid:g913445) adh3a=alcohol d ... rom Fig. 2. Map location 4. Protein sequence is in conflict ... with the conceptual translation; mismatch(46[R- &V ...

  1. Probe data: 3193 [RED

    Lifescience Database Archive (English)

    Full Text Available R04-033600-2AR RED C24862 AU101846 S16003 SS6003 >IT U51741_1(U51741|pid:g1272351) Ipomoea trifid ... eceptor protein kinase 2 (IRK2) mRNA, partial cds; it ... is unknown whether kinase domain is translated; ge ...

  2. Probe data: 3966 [RED

    Lifescience Database Archive (English)

    Full Text Available R09-031370-1AR RED C72012 AU165393 EB0781 >AC002329_15(AC002329|pid:g2262170) DNA sequence of Ar ... 9); glycosyl hydrolase family I signature found at residues ... 329 to 337 [SLLLENGAA]. ...

  3. Probe data: 3897 [RED

    Lifescience Database Archive (English)

    Full Text Available R06-022230-4R RED D23831 AU164531 RA0286 >AC002329_18(AC002329|pid:g2262173) DNA sequence of Ara ... nucleotide-disulphide oxidoreductases located from residues ... 197 to 219 [CAVCD...IGGGD]. ...

  4. Infra-red material structures

    International Nuclear Information System (INIS)

    A process for modifying properties of infra-red materials in or for use in infra-red windows and other structures, in which the infra-red material is subjected to ion implantation whereby ions of an elemental dopant are implanted into the infra-red material under vacuum conditions. Heat diffusion may improve the depth of ion penetration. Specified materials are germanium, zinc sulphide, cadmium mercury telluride, calcium lanthanum sulphide and zinc selenide; specified dopants are boron, carbon and silicon. (author)

  5. Registration of 'Red Ruby' Wheat

    Science.gov (United States)

    Red Ruby’ soft red winter wheat (Triticum aestivum L.) was developed by the Michigan Agricultural Experiment Station and released in 2007 via an exclusive licensing agreement through Michigan State University (MSU) Technologies. Red Ruby was selected from the cross Pioneer ‘2552’/Pioneer ‘2737W’ ma...

  6. Human red cell acetyltransferase

    International Nuclear Information System (INIS)

    Acetyltransferase was isolated by histone-Sepharose affinity chromatography from human cord blood red cells. The enzyme was detected only in very young red cells. The semipurified enzyme and [14C]acetyl-CoA were used to acetylate isolated Hb F tetramer and α and γ subunits. The in vitro acetylated products were characterized by globin chain separation by CM-cellulose chromatography and tryptic peptide analysis by reverse-phase HPLC. Acetylation of both the γ-chains and the α-chains could occur within the Hb F tetramer. Acetylation also could take place on intact subunits. It appears that some Hb F/sub Ic/ could be formed in the cells by utilizing Hb F or free γ-chains as acetylation substrate

  7. Probe data: 2561 [RED

    Lifescience Database Archive (English)

    Full Text Available R08-000680-1AR RED C26504 AU100736 CB2477 >SPAC4F8_3(Z98530|pid:g2330820) S.pombe chromosome I c ... orf, (250aa), fasta scores, opt:691, E():0, (47.2% identity ... in 246 aa overlap), also similar to C.elegans Q232 ... 6E11, (258aa), fasta scores, opt:632,E():0, (40.2% identity ... in 249 aa overlap). ...

  8. Probe data: 2942 [RED

    Lifescience Database Archive (English)

    Full Text Available R01-031330-1AR RED C74139 AU101397 E30485 EE0485 >SPBC3B9_12(AL022070|pid:g2950478) S.pombe chro ... (219aa), fasta scores, opt:182, E():1e-29, (29.8% identity ... in 215 aa overlap), also similar eg. to C. elegans ... 224aa), fasta scores, opt:303, E():1.2e-26, (41.4% identity ... in 111 aa overlap). ...

  9. Probe data: 5856 [RED

    Lifescience Database Archive (English)

    Full Text Available R10-024200-4R RED AU174678 AU174679 FE0202 >AP000002_62(AP000002|pid:g3256770) Pyrococcus horiko ... nt. position (2/7); similar to PIR:S44960 percent identity :40.645 in 320aa; PIR:S69807 percent identity :41.10 ... 0 in 319aa; owl:MTY13D1217 percent identity :39.171 in 224aa. &H71145(H71145) ...

  10. Probe data: 5450 [RED

    Lifescience Database Archive (English)

    Full Text Available R04-032550-1AR RED D47635 AU174014 SS3251 >AC002534_10(AC002534|pid:g2392772) Arabidopsis thalia ... products; the lack of similarity in the N-terminal region ... between T32N15.11 and bacterial PheA gene products ... re located from residue 279 to 301 [YNLQI..RFLML] (region ... includes a conserved threonine found to be essenti ...

  11. Probe data: 1459 [RED

    Lifescience Database Archive (English)

    Full Text Available R09-012590-1AR RED AU166582 AU068404 CE0184 >DMSEG0007_4(AL033125|pid:g4185888) Drosophila melan ... e.; 2-match_species=Drosophila melanogaster (fruit fly ); 2-method=blastn;1.4.9; 2-method_score=2580.00; 2 ... e.; 3-match_species=Drosophila melanogaster (fruit fly ); 3-method=blastn;1.4.9; 3-method_score=3101.00; 4 ...

  12. EST data: 731 [RED

    Lifescience Database Archive (English)

    Full Text Available CB2762 C26646 AU108627 C12762 4 G DPlate 008 C08 5' AAC AAT AAT GGG GGC TTT TC 3' 5' TTA TTG ATT ... 835701) Apium graveolens NADPH-dependent mannose 6-phosphate ... reductase (m6pr) mRNA, complete cds; aldo-keto red ... uctase; similar to aldose 6-phosphate ... reductase also known as NADP-sorbitol-6-phosphate ...

  13. Deep Red (Profondo Rosso)

    CERN Multimedia

    Cine Club

    2015-01-01

    Wednesday 29 April 2015 at 20:00 CERN Council Chamber    Deep Red (Profondo Rosso) Directed by Dario Argento (Italy, 1975) 126 minutes A psychic who can read minds picks up the thoughts of a murderer in the audience and soon becomes a victim. An English pianist gets involved in solving the murders, but finds many of his avenues of inquiry cut off by new murders, and he begins to wonder how the murderer can track his movements so closely. Original version Italian; English subtitles

  14. Red DirCom

    OpenAIRE

    Joan Costa

    2007-01-01

    Catorce países congregados de manera activa, a través de una plataforma de encuentro donde se comparten conocimiento y experiencias en la gestión estratégica de la comunicación en las organizaciones. La red reconoce en el DirCom una figura clave del desarrollo corporativo en el nuevo contexto de los negocios, impulsa la exigencia ética a través de la formación y consolida la proyección profesional para posicionar la gestión integral del DirCom en Iberoamérica.

  15. Red de sensores SIPIA

    OpenAIRE

    Mercado, Gustavo; Ortiz Uriburu, Gisela; Diedrichs, Ana; Borgo, Roberto; Gonzalez Antivilo, Francisco; Tromer, Sebastián; Ledezma, Nicolás; Aguirre, Matías; Panella, Cristian; Tabacchi, Germán; Martí, Juan; Grünwaldt, Guillermo; Rigoni, Ignacio; Antón, Gabriel; Chamorro, Fernando

    2012-01-01

    El proyecto consiste en el análisis, implementación y evaluación de una red de sensores inalámbricos basada en la norma IEEE 802.15.4, aplicada al entorno agropecuario en el ámbito de agricultura de precisión, con participación de tanto ingenieros electrónicos e informáticos como de ingenieros e investigadores agrónomos, Se propone entonces el estudio de estas tecnologías en el contexto de un grupo de investigaciones que permita: • La colaboración interinstitucional e interdisciplinaria en...

  16. Probe data: 305 [RED

    Lifescience Database Archive (English)

    Full Text Available R08-039710-1AR RED AU030739 AU030740 EH0171 >PTU27116_1(U27116|pid:g857578) Po pulus tremulo ides ... caffeo yl-Co A 3-O -methyltransferase mRNA, co mplete cds; S- ... adenyo syl-methio nine caffeo yl-Co A 3-O -methyltransferase; ... similar to ... Swiss-Pro t Accessio n Number P28034; similar to ... pro ... teins enco ded by GenBank accessio n Numbers U20736, U13151, an ...

  17. Big Red Telephone, Gone

    Institute of Scientific and Technical Information of China (English)

    Toni Piech

    2006-01-01

    @@ The Chinese big red telephones looked exactly as Iimagined the ones servicing the direct emergen line between the Kreml and the White House duing the cold-war era would have look like. But here in China, every kio seemed to have such a device in t1990s, and anyone could use it for ju 0.2 yuan. The government did not juinstall public phones on street corner but they let small-business owners pa ticipate in telecommunication. Supply and demand were juggled by a kind of Hutong capitalism.

  18. Red DirCom

    Directory of Open Access Journals (Sweden)

    Joan Costa

    2007-01-01

    Full Text Available Catorce países congregados de manera activa, a través de una plataforma de encuentro donde se comparten conocimiento y experiencias en la gestión estratégica de la comunicación en las organizaciones. La red reconoce en el DirCom una figura clave del desarrollo corporativo en el nuevo contexto de los negocios, impulsa la exigencia ética a través de la formación y consolida la proyección profesional para posicionar la gestión integral del DirCom en Iberoamérica.

  19. Alaistaitokartoitus, Red Events Oy

    OpenAIRE

    Latva, Mariikka

    2013-01-01

    Tämän tutkimuksellisen opinnäytetyön tarkoituksena oli kartoittaa tapahtuma-alan yrityksen Red Events Oy:n vuokratyöntekijöiden mielipiteitä heidän omista alaistaidoistaan. Työn tavoitteena oli saada kartoituksen tulosten pohjalta mahdollisia kehittämisehdotuksia. Opinnäytetyön tietoperusta muodostui alaistaidoista ja psykologisesta sopimuksesta. Psykologisen sopimuksen osa-alueista esiteltiin työn kannalta merkittävimmät, joita olivat vuorovaikutus, palautteen antaminen ja vastaanottam...

  20. Probe data: 5759 [RED

    Lifescience Database Archive (English)

    Full Text Available R10-026870-1AR RED AU174436 AU174437 EA0016 >C ELC 46G7_4(U97593|pid:g1946975) C aenorhabditis eleg ... ans c osmid C 46G7; weak similarity to human ataxin-1 X792 ... 04 (NID:g529662); c oded for by C . elegans c DNA yk153d2.5; c oded for by ... C . elegans c DNA yk95h11.5; c oded for by C . elegans c ... DNA yk5a4.5; c oded for by C . elegans c DNA yk11g5.5; c oded for by ...

  1. Probe data: 331 [RED

    Lifescience Database Archive (English)

    Full Text Available R04-032990-1AR RED AU030864 AU030865 E60359 EH0359 >C ELB0546_1(AF038604|pid:g2702370) C aenorhabd ... itis elegans c osmid B0546; c ontains similarity to Drosophila ovar ... ian tumor loc us protein (GB:X13693); c oded for by C . elegans c DN ... A yk389b1.5; c oded for by C . elegans c DNA yk332a1.5; c oded for by ... C . elegans c DNA yk314b10.5; c oded for by C . elegans ...

  2. Probe data: 739 [RED

    Lifescience Database Archive (English)

    Full Text Available R05-012910-1AR RED C 23575 AU032457 SS0091 >C ELH17B01_3(AF040646|pid:g2746826) C aenorhabditis ele ... gans c osmid H17B01; c oded for by C . elegans c DNA yk169c 10 ... .3; c oded for by C . elegans c DNA yk125b6.3; c oded for by ... C . elegans c DNA yk71e8.3; c oded for by C . elegans c D ... NA C EESD11FB; c oded for by C . elegans c DNA C EESD11F; c o ...

  3. Analysis of RED ONE Digital Cinema Camera and RED Workflow

    OpenAIRE

    Foroughi Mobarakeh, Taraneh

    2009-01-01

    RED Digital Cinema is a rather new company that has developed a camera that has shaken the world of the film industry, the RED One camera. RED One is a digital cinema camera with the characteristics of a 35mm film camera. With a custom made 12 megapixel CMOS sensor it offers images with a filmic look that cannot be achieved with many other digital cinema cameras. With a new camera comes a new set of media files to work with, which brings new software applications supporting them. RED Digital ...

  4. Red Tape, Corruption and Finance

    OpenAIRE

    Keith Blackburn; Rashmi Sarmah

    2006-01-01

    We study the effects of red tape and corruption in a model of occupational choice, entry regulation and imperfect capital markets. Red tape is the set of rules and regulations that private agents are obliged to comply with in order to engage in entrepreneurial activity. Corruption is the payment of bribes to public officials for the purpose of circumventing red tape. Capital market imperfections are the asymmetries of information between borrowers and lenders about the returns to entrepreneur...

  5. Probe data: 1422 [RED

    Lifescience Database Archive (English)

    Full Text Available R05-049390-1AR RED AU068280 AU068281 C 12919 C B2919 >C ELR148_1(AF025467|pid:g2429509) C aenorhabdi ... tis elegans c osmid R148; c ontains similarity to drosophila DNA-b ... inding protein K10 (NID:g8148); c oded for by C . elegans c DNA yk118e11.5; c oded for b ... y C . elegans c DNA yk64h11.5; c oded for by C . elegans c ... DNA yk172f2.5; c oded for by C . elegans c DNA yk79b6.5; c oded for by ...

  6. Probe data: 6469 [RED

    Lifescience Database Archive (English)

    Full Text Available R07-038020-1AR RED C 99062 C 99063 E04404 EB4404 >C ELC 35E7_7(AF067216|pid:g3158466) C aenorhabditis ... elegans c osmid C 35E7; c oded for by C . elegans c DNA yk109g4.5 ... ; c oded for by C . elegans c DNA yk399b8.5; c oded for by ... C . elegans c DNA yk394b7.5; c oded for by C . elegans c ... DNA yk476g9.5; c oded for by C . elegans c DNA yk290c 12.5; c oded for b ...

  7. The Red and the Yellow

    Institute of Scientific and Technical Information of China (English)

    QiuJianghong

    2004-01-01

    THE China film market is based on the so-called battle of the yellow, green and red.Yellow is American Kodak,green Japanese Fuji color, and red China's Lucky film, local counterweight to the two world-famous foreigners.

  8. Romantic red: red enhances men's attraction to women.

    Science.gov (United States)

    Elliot, Andrew J; Niesta, Daniela

    2008-11-01

    In many nonhuman primates, the color red enhances males' attraction to females. In 5 experiments, the authors demonstrate a parallel effect in humans: Red, relative to other achromatic and chromatic colors, leads men to view women as more attractive and more sexually desirable. Men seem unaware of this red effect, and red does not influence women's perceptions of the attractiveness of other women, nor men's perceptions of women's overall likeability, kindness, or intelligence. The findings have clear practical implications for men and women in the mating game and, perhaps, for fashion consultants, product designers, and marketers. Furthermore, the findings document the value of extending research on signal coloration to humans and of considering color as something of a common language, both within and across species. PMID:18954199

  9. Red meat and colorectal cancer

    Directory of Open Access Journals (Sweden)

    Nuri Faruk Aykan

    2015-12-01

    Full Text Available Colorectal cancer (CRC is the third most common cancer in men and the second in women worldwide. More than half of cases occur in more developed countries. The consumption of red meat (beef, pork, lamb, veal, mutton is high in developed countries and accumulated evidence until today demonstrated a convincing association between the intake of red meat and especially processed meat and CRC risk. In this review, meta-analyses of prospective epidemiological studies addressed to this association, observed link of some subtypes of red meat with CRC risk, potential carcinogenic compounds, their mechanisms and actual recommendations of international guidelines are presented.

  10. The Analysis of A Red,Red Rose

    Institute of Scientific and Technical Information of China (English)

    姬丽霞

    2009-01-01

    A Red, Red Rose was written by the great farmer poet of Scotland, Robert Burns. This love poem has been recited by people for more than two centuries. The poet praised his lover's beauty and expressed his love to her with enthusiasm. This paper will analyze this immortal love song from the points of phonological patterns, figure of speech and cohesion to help readers know it better.

  11. Red Blood Cell Antibody Identification

    Science.gov (United States)

    ... limited. Home Visit Global Sites Search Help? RBC Antibody Identification Share this page: Was this page helpful? Also known as: Alloantibody Identification; Antibody ID, RBC; RBC Ab ID Formal name: Red ...

  12. Less red tape; Weniger Bremskloetze

    Energy Technology Data Exchange (ETDEWEB)

    Ristau, Oliver

    2011-07-01

    Since July 2009, the PV Legal initiative funded by the European Commission has brought greater transparency and less red tape to photovoltaic projects in Europe. The remaining obstacles will be resolved by the new initiative, PV Grid.

  13. Proyecto de red para ONG

    OpenAIRE

    Ruiz López, David

    2013-01-01

    Proyecto de una red de comunicaciones para una ONG en la Comunidad de Madrid. Projecte d'una xarxa de comunicacions per a una ONG a la Comunidad de Madrid. Bachelor thesis for the Telecommunication Technologies program on Telematics.

  14. Red meat and colorectal cancer

    OpenAIRE

    Nuri Faruk Aykan

    2015-01-01

    Colorectal cancer (CRC) is the third most common cancer in men and the second in women worldwide. More than half of cases occur in more developed countries. The consumption of red meat (beef, pork, lamb, veal, mutton) is high in developed countries and accumulated evidence until today demonstrated a convincing association between the intake of red meat and especially processed meat and CRC risk. In this review, meta-analyses of prospective epidemiological studies addressed to this association...

  15. Red Tide off Texas Coast

    Science.gov (United States)

    2002-01-01

    Red tides (algae) bloomed late this summer along a 300-mile stretch of Texas' Gulf Coast, killing millions of fish and shellfish as well as making some people sick. State officials are calling this the worst red tide bloom in 14 years. The algae produces a poison that paralyzes fish and prevents them from breathing. There is concern that the deadly algae could impact or even wipe out this year's oyster harvest in Texas, which usually peaks during the Thanksgiving and Christmas holidays. The red tides were first observed off the Texas coast in mid-August and have been growing steadily in size ever since. Red tides tend to bloom and subside rapidly, depending upon changes in wind speed and direction, water temperature, salinity, and rainfall patterns (as the algae doesn't do as well in fresher water). This true-color image of the Texas Gulf Coast was acquired on September 29, 2000, by the Moderate-resolution Imaging Spectroradiometer (MODIS) flying aboard NASA's Terra spacecraft. The red tide can be seen as the dark reddish discoloration in the ocean running southwest to northeast along the coast. In this scene, the bloom appears to be concentrated north and east of Corpus Christi, just off Matagorda Island. The image was made at 500-meter resolution using a combination of MODIS' visible bands 1 (red), 4 (green), and 3 (blue). The city of Houston can be seen clearly as the large, greyish cluster of pixels to the north and west of Galveston Bay, which is about mid-way up the coastline in this image. Also visible in this image are plumes of smoke, perhaps wildfires, both to the north and northeast of Houston. For more information about red tides, refer to the Texas Red Tide Web site. Image courtesy Andrey Savtchenko, MODIS Data Support Team, and the MODIS Ocean Team, NASA's Goddard Space Flight Center

  16. Betelgeuse and the red supergiants

    CERN Document Server

    van Loon, Jacco Th

    2013-01-01

    Betelgeuse is one of the most magnificent stars in the sky, and one of the nearest red supergiants. Astronomers gathered in Paris in the Autumn of 2012 to decide what we know about its structure, behaviour, and past and future evolution, and how to place this in the general context of the class of red supergiants. Here I reflect on the discussions and propose a synthesis of the presented evidence. I believe that, in those four days, we have achieved to solve a few riddles.

  17. sujetos a Efectos de Red

    Directory of Open Access Journals (Sweden)

    José Luis Arroyo Barrigüete

    2005-01-01

    Full Text Available El objetivo del presente artículo es analizar una de las principales características de la Economía Digital: las Externalidades de Red. Dichas Externalidades inducen en los mercados una realimentación positiva que lleva en muchos casos a situaciones prácticamente monopolísticas. Se identificarán aquellas capacidades internas de las empresas que resultan críticas para lograr el éxito en presencia de Efectos de Red así como las principales estrategias que es posible desarrollar en este contexto.

  18. White Wedding and Red Wedding

    Institute of Scientific and Technical Information of China (English)

    李梦遥

    2010-01-01

    @@ The most obvious difference between western wedding and Chinese wedding tradition lies in the main color of the ceremony.Western wedding is known as the white wedding in some sense,for its main color is white from bride's gown(礼服)to the decoration of the wedding hall.While,traditional Chinese wedding ceremony is full of the color of red.

  19. The Temperatures of Red Supergiants

    NARCIS (Netherlands)

    Davies, Ben; Kudritzki, Rolf-Peter; Plez, Bertrand; Trager, Scott; Lançon, Ariane; Gazak, Zach; Bergemann, Maria; Evans, Chris; Chiavassa, Andrea

    2013-01-01

    We present a re-appraisal of the temperatures of red supergiants (RSGs) using their optical and near-infrared spectral energy distributions (SEDs). We have obtained data of a sample of RSGs in the Magellanic Clouds using VLT+XSHOOTER, and we fit MARCS model atmospheres to different regions of the sp

  20. The Temperatures of Red Supergiants

    NARCIS (Netherlands)

    Davies, Ben; Kudritzki, Rolf-Peter; Plez, Bertrand; Trager, Scott; Lancon, Ariane; Gazak, Zach; Bergemann, Maria; Evans, Chris; Chiavassa, Andrea

    2013-01-01

    We present a re-appraisal of the temperatures of Red Supergiants (RSGs) using their optical and near-infrared spectral energy distributions (SEDs). We have obtained data of a sample of RSGs in the Magellanic Clouds using VLT+XSHOOTER, and we fit MARCS model atmospheres to different regions of the sp

  1. Control of poultry red mites

    DEFF Research Database (Denmark)

    Kilpinen, Ole; Steenberg, Tove

    2008-01-01

    The poultry red mite (PRM), Dermanyssus gallinae, is the most important ectoparasite in European egg production. The mites hide in cracks and crevices in the near vicinity of the resting places of the birds, coming out to feed mainly during the night. Under favourable conditions the population can...

  2. Advances in Red VCSEL Technology

    Directory of Open Access Journals (Sweden)

    Klein Johnson

    2012-01-01

    Full Text Available Red VCSELs offer the benefits of improved performance and lower power consumption for medical and industrial sensing, faster printing and scanning, and lower cost, higher speed interconnects based upon plastic optical fiber (POF. However, materials challenges make it more difficult to achieve the desired performance than at the well-developed wavelength of 850 nm. This paper will describe the state of the art of red VCSEL performance and the results of development efforts to achieve improved output power and a broader temperature range of operation. It will also provide examples of the applications of red VCSELs and the benefits they offer. In addition, the packaging flexibility offered by VCSELs, and some examples of non-Hermetic package demonstrations will be discussed. Some of the red VCSEL performance demonstrations include output power of 14 mW CW at room temperature, a record maximum temperature of 115∘C for CW operation at an emission wavelength of 689 nm, time to 1% failure at room temperature of approximately 200,000 hours, lifetime in a 50∘C, 85% humidity environment in excess of 3500 hours, digital data rate of 3 Gbps, and peak pulsed array power of greater than 100 mW.

  3. Red blood cells, sickle cell (image)

    Science.gov (United States)

    Sickle cell anemia is an inherited blood disease in which the red blood cells produce abnormal pigment (hemoglobin). ... abnormal hemoglobin causes deformity of the red blood cells into crescent or sickle-shapes, as seen in this photomicrograph.

  4. 7 CFR 29.1053 - Red (R).

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Red (R). 29.1053 Section 29.1053 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Type 92) § 29.1053 Red (R). A brownish red....

  5. 27 CFR 9.167 - Red Mountain

    Science.gov (United States)

    2010-04-01

    ... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Red Mountain 9.167 Section... Mountain (a) Name. The name of the viticultural area described in this section is “Red Mountain.” (b) Approved maps. The appropriate map for determining the boundaries of the Red Mountain viticultural area...

  6. 21 CFR 184.1121 - Red algae.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 3 2010-04-01 2009-04-01 true Red algae. 184.1121 Section 184.1121 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) FOOD FOR HUMAN... Substances Affirmed as GRAS § 184.1121 Red algae. (a) Red algae are seaweeds of the species...

  7. “AmaRosa,” a red skinned, red fleshed fingerling with high phytonutrient value

    Science.gov (United States)

    AmaRosa is a mid season specialty potato with red skin and red flesh. This selection is unique among commercially available potato varieties in that plants set a large number of smooth, small, fingerling-shaped tubers with red skin and red flesh. AmaRosa tubers have higher total anthocyanin and hyd...

  8. 76 FR 22033 - Safety Zone; Red River Safety Zone, Red River, MN

    Science.gov (United States)

    2011-04-20

    ... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AAOO Safety Zone; Red River Safety Zone, Red River, MN AGENCY... Safety Unit Duluth, MN is establishing a temporary safety zone on the Red River, MN. This safety zone is... entering all navigable waters of the Red River in the State of Minnesota north of a line drawn...

  9. Red nodule on the breast

    Directory of Open Access Journals (Sweden)

    Roberta Colucci

    2012-01-01

    Full Text Available A 63-year-old woman living in the countryside referred to our department with a 2-month history of a red nodule localized on the right breast. Histological examination, immunohistochemical analyses and serologic evaluation conducted with ELISA and Western blot were performed. Clinical diagnosis of borrelial lymphocytoma was not possible solely on the clinical presentation of a classical nodular form without lymphoadenopathy. An absence of a referred prior tick bite and a previous or concomitant erythema migrans at clinical presentation rendered a more challenging diagnosis. The fact that the patient lived in the countryside, the appearance of the breast nodule in September, and serologic, histologic, and immunohistochemical analysis facilitated the diagnosis of borrelial lymphocytoma. We report this case to highlight the importance of an investigation of Lyme borreliosis when a patient living in the countryside presents with a red nodule of the nipple and areola.

  10. Right turn on red (RTOR)

    OpenAIRE

    Vovk, Žiga

    2013-01-01

    The subject of this thesis is introducing the principle of law permitting right turn on red (in further RTOR) and seeking procedures for better level of service in traffic intersections. In the first part, the work talks about history and usage of the RTOR around the world. Afterwards it focuses on research data from and about traffic accidents, benefits and disadvantages, and dangerous situations occurred because of the RTOR. Thesis concludes with principles of RTOR adjusted for Slovenia inc...

  11. The structure of the chromophore within DsRed, a red fluorescent protein from coral

    OpenAIRE

    Gross, Larry A.; Baird, Geoffrey S.; Hoffman, Ross C.; Baldridge, Kim K; Tsien, Roger Y.

    2000-01-01

    DsRed, a brilliantly red fluorescent protein, was recently cloned from Discosoma coral by homology to the green fluorescent protein (GFP) from the jellyfish Aequorea. A core question in the biochemistry of DsRed is the mechanism by which the GFP-like 475-nm excitation and 500-nm emission maxima of immature DsRed are red-shifted to the 558-nm excitation and 583-nm emission maxima of mature DsRed. After digestion of mature DsRed with lysyl endopeptidase, high-resolut...

  12. La red sobre trabajo infantil peligroso (Red Tip

    Directory of Open Access Journals (Sweden)

    Walter Varillas

    2003-01-01

    Full Text Available En el mundo, aproximadamente 351.7 millones de niños entre 5 y 17 años realizaban algún tipo de actividad económica, de ellos 170.5 millones (48.5% realizaban algún tipo de trabajo considerado peligroso. Un alto porcentaje se encuentra en la agricultura, otros en minas, manufacturas, ladrilleras, predominantemente en la economía informal. El Convenio 138 (cobre la edad mínima de admisión en el empleo de la OIT y el Convenio 182 (sobre las peores formas de trabajo infantil, definen como trabajo infantil peligroso el que puede afectar la salud, seguridad y moralidad de los menores. Estudios específicos sobre los menores muestran su susceptibilidad particular frente a los riesgos laborales, aumentando la peligrosidad para su normal desarrollo y crecimiento: "los niños no son adultos pequeños". Los profesionales de la seguridad y salud en el trabajo pueden colaborar con los profesionales y las organizaciones especializadas en el trabajo infantil, en la definición y caracterización de lo que significa el trabajo infantil peligroso. Para ello se ha conformado la Red sobre Trabajo Infantil Peligroso (Red TIP, con la finalidad de articular estos dos espacios, orientados a eliminar el trabajo infantil peligroso y rescatar al menor y devolverle la oportunidad de sonreír ahora y en el futuro.

  13. Red de Empresas: Empresas Virtuales

    OpenAIRE

    Romina Anahí Lucanera

    2010-01-01

    En este trabajo se resumen algunos aportes teóricos sobre el nuevo paradigma organizacional: Empresa-Red. La suma relevancia adquirida por el mismo, producto de los constantes y rápidos cambios del entorno, obliga a las organizaciones a obtener ventajas competitivas mediante estrategias de cooperación entre ellas. En este trabajo se explican brevemente el concepto, la fundamentación, el diseño, la clasifi cación, los componentes y el comportamiento de las empresas virtuales, por ser éstas las...

  14. Unripe red fruits may be aposematic

    OpenAIRE

    Lev-Yadun, Simcha; Ne'eman, Gidi; Izhaki, Ido

    2009-01-01

    The unripe fruits of certain species are red. Some of these species disperse their seeds by wind (Nerium oleander, Anabasis articulata), others by adhering to animals with their spines (Emex spinosa) or prickles (Hedysarum spinosissimum). Certainly neither type uses red coloration as advertisement to attract the seed dispersing agents. Fleshy-fruited species (Rhamnus alaternus, Rubus sanguineus and Pistacia sp.), which disperse their seeds via frugivores, change fruit color from green to red ...

  15. The Red-Blue Transportation Problem

    OpenAIRE

    Vancroonenburg, Wim; Della Croce, Federico; Goossens, Dries; Spieksma, Frits

    2014-01-01

    This paper considers the Red-Blue Transportation Problem (Red-Blue TP), a generalization of the transportation problem where supply nodes are partitioned into two sets and so-called exclusionary constraints are imposed. We encountered a special case of this problem in a hospital context, where patients need to be assigned to rooms. We establish the problem's complexity, and we compare two integer programming formulations. Furthermore, a maximization variant of Red-Blue TP is presented, for...

  16. European red list of vascular plants

    OpenAIRE

    Abeli, Th.; Acevedo Rodríguez, A.; Aguiar, Carlos

    2011-01-01

    The European Red List is a review of the conservation status of c. 6,000 European species (mammals, reptiles, amphibians, dragonflies, butterflies, freshwater fishes, and selected groups of beetles, molluscs, and vascular plants) according to IUCN regional Red Listing guidelines. It identifies those species that are threatened with extinction at the regional level – in order that appropriate conservation action can be taken to improve their status. This Red List public...

  17. Public Perceptions of Florida Red Tide Risks

    OpenAIRE

    Kuhar, Sara E.; Nierenberg, Kate; Kirkpatrick, Barbara; Tobin, Graham A.

    2009-01-01

    This research integrates theoretical frameworks of risk perception, social amplification of risk, and the role of place-specific contexts in order to explore the various perceptions surrounding Florida red tides. Florida red tides are naturally occurring events that are increasing in frequency, duration, and severity. This has implications for public health, the local economy, and ecosystem health. While many of the negative impacts of Florida red tides are not easily controlled, some of the ...

  18. Infra Red 3D Computer Mouse

    DEFF Research Database (Denmark)

    Harbo, Anders La-Cour; Stoustrup, Jakob

    2000-01-01

    The infra red 3D mouse is a three dimensional input device to a computer. It works by determining the position of an arbitrary object (like a hand) by emitting infra red signals from a number of locations and measuring the reflected intensities. To maximize stability, robustness, and use of bandw......The infra red 3D mouse is a three dimensional input device to a computer. It works by determining the position of an arbitrary object (like a hand) by emitting infra red signals from a number of locations and measuring the reflected intensities. To maximize stability, robustness, and use...

  19. Red Sesbania Distribution - lines [ds81

    Data.gov (United States)

    California Department of Resources — This layer conatains line data for the red sesbania (Sesbania punicea) database. The database represents historic and current observations by various individuals of...

  20. Red Sesbania Distribution - points [ds80

    Data.gov (United States)

    California Department of Resources — This layer contains point data for the red sesbania (Sesbania punicea) database. The database represents historic and current observations by various individuals of...

  1. Pure red cell aplasia and associated thymoma

    Directory of Open Access Journals (Sweden)

    Cristian Rosu

    2011-04-01

    Full Text Available Pure red cell aplasia is a rare cause of anemia, caused by an absence of red blood cell precursors in the bone marrow. It is usually a paraneoplastic syndrome, associated most commonly with large-cell granular lymphocyte leukemia but also thymoma. For patients who present both pure red cell aplasia and thymoma, thymectomy leads to an initial remission of the aplasia in 30% of cases. However, sustained remission may require the addition of medications such as corticosteroids, cyclospo­rine, or cyclophosphamide. We present a case of pure red cell aplasia associated with a thymoma in an otherwise healthy 80 year-old woman.

  2. La red sobre trabajo infantil peligroso (Red Tip The hazardous child labor network (Red Tip

    Directory of Open Access Journals (Sweden)

    Walter Varillas

    2003-01-01

    Full Text Available En el mundo, aproximadamente 351.7 millones de niños entre 5 y 17 años realizaban algún tipo de actividad económica, de ellos 170.5 millones (48.5% realizaban algún tipo de trabajo considerado peligroso. Un alto porcentaje se encuentra en la agricultura, otros en minas, manufacturas, ladrilleras, predominantemente en la economía informal. El Convenio 138 (cobre la edad mínima de admisión en el empleo de la OIT y el Convenio 182 (sobre las peores formas de trabajo infantil, definen como trabajo infantil peligroso el que puede afectar la salud, seguridad y moralidad de los menores. Estudios específicos sobre los menores muestran su susceptibilidad particular frente a los riesgos laborales, aumentando la peligrosidad para su normal desarrollo y crecimiento: "los niños no son adultos pequeños". Los profesionales de la seguridad y salud en el trabajo pueden colaborar con los profesionales y las organizaciones especializadas en el trabajo infantil, en la definición y caracterización de lo que significa el trabajo infantil peligroso. Para ello se ha conformado la Red sobre Trabajo Infantil Peligroso (Red TIP, con la finalidad de articular estos dos espacios, orientados a eliminar el trabajo infantil peligroso y rescatar al menor y devolverle la oportunidad de sonreír ahora y en el futuro.In the world, approximately 351.7 millions children between 5 and 17 years old work. Of them, 170,5 millions (48.5% work at the hazardous child labor forms. A high percentage is in agriculture, others in mines, manufactures, brick makers, predominantly in informal economy. The 138 Convention of ILO and the 182 Convention, define as hazardous child labor activities that can affect the health, safety and morality of the children. Studies on the children at work point out their particular susceptibility to some occupational risks, increasing the danger for their normal development and growth. "They are not little adults". The occupational health

  3. Cadmium uptake by rat red blood cells

    International Nuclear Information System (INIS)

    Rat red blood cells were employed to study the uptake of cadmium (109Cd). Suspensions of red blood cells were exposed to Cd concentrations (both bound and free) observed following in vivo Cd administration. Cd uptake was biphasic with an initial rapid phase (0C was one-fourth of that at 370C. The metabolic inhibitors: sodium fluoride (1mM), potassium cyanide (1mM) and carbonyl cyanide-m-chlorophenyl hydrazone (2μM) and the Na+-K+-ATPase inhibitor, ouabain (1mM) did not reduce Cd (50μM) uptake into red blood cells. This suggests that the uptake of Cd into red blood cells was not an active process. Incubation of Cd (10μM) with an equimolar concentration of Zn did not alter uptake of Cd into red blood cells, but at 5 and 10 times higher concentrations of Zn, Cd uptake was enhanced 5-fold. Mercury at one-tenth and equimolar concentrations of Cd increased Cd uptake by red blood cells 2-fold. N-Ethylmaleimide (0.5-5mM), which irreversibly inactivates membrane sulfhydryl groups, decreased Cd uptake. The data indicate that Cd uptake into rat red blood cells occurs by passive transport and that alterations of sulfhydryls of red blood cell membrane may modulate the process. (author)

  4. Red River Basin Mapping 2008-2010

    Data.gov (United States)

    Federal Emergency Management Agency, Department of Homeland Security — This LiDAR data covers the Red River Basin with portions of ND, MN, SD and flows into Canada. The US Red River Basin boudnary covers 40,860 sqmi,with the additional...

  5. Big Red: A Development Environment for Bigraphs

    DEFF Research Database (Denmark)

    Faithfull, Alexander John; Perrone, Gian David; Hildebrandt, Thomas

    2013-01-01

    We present Big Red, a visual editor for bigraphs and bigraphical reactive systems, based upon Eclipse. The editor integrates with several existing bigraph tools to permit simulation and model-checking of bigraphical models. We give a brief introduction to the bigraphs formalism, and show how these...... concepts manifest within the tool using a small motivating example bigraphical model developed in Big Red....

  6. Public perceptions of Florida red tide risks.

    Science.gov (United States)

    Kuhar, Sara E; Nierenberg, Kate; Kirkpatrick, Barbara; Tobin, Graham A

    2009-07-01

    This research integrates theoretical frameworks of risk perception, social amplification of risk, and the role of place-specific contexts in order to explore the various perceptions surrounding Florida red tides. Florida red tides are naturally occurring events that are increasing in frequency, duration, and severity. This has implications for public health, the local economy, and ecosystem health. While many of the negative impacts of Florida red tides are not easily controlled, some of the secondary impacts may be mitigated through individuals' responses. However, public perception and consequent reactions to Florida red tides have not been investigated. This research uses questionnaire surveys, and semi-structured interviews, to explore the various perceptions of the risk surrounding red tides. Surveys and interviews were conducted along two Florida west coast beaches. The results indicate that the underlying foundations of the social amplification of the risk framework are applicable to understanding how individuals form perceptions of risk relative to red tide events. There are key differences between the spatial locations of individuals and corresponding perceptions, indicating that place-specific contexts are essential to understanding how individuals receive and interpret risk information. The results also suggest that individuals may be lacking efficient and up-to-date information about Florida red tides and their impacts because of inconsistent public outreach. Overall, social and spatial factors appear to be influential as to whether individuals amplify or attenuate the risks associated with Florida red tides. PMID:19392675

  7. 33 CFR 117.135 - Red River.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Red River. 117.135 Section 117.135 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES DRAWBRIDGE OPERATION REGULATIONS Specific Requirements Arkansas § 117.135 Red River. The draws of the bridges...

  8. 33 CFR 117.491 - Red River.

    Science.gov (United States)

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Red River. 117.491 Section 117.491 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY BRIDGES DRAWBRIDGE OPERATION REGULATIONS Specific Requirements Louisiana § 117.491 Red River. (a) The draw of the Union...

  9. 76 FR 23485 - Safety Zone; Red River

    Science.gov (United States)

    2011-04-27

    ... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone; Red River AGENCY: Coast Guard, DHS. ACTION... Red River in the State of North Dakota, including those portions of the river bordered by Richland... across latitude 46 20'00'' N, extending the entire width of the river. This safety zone is needed...

  10. Internal rotation of red giants by asteroseismology

    Directory of Open Access Journals (Sweden)

    Christensen-Dalsgaard J.

    2013-03-01

    Full Text Available We present an asteroseismic approach to study the dynamics of the stellar interior in red giant stars by asteroseismic inversion of the splittings induced by the stellar rotation on the oscillation frequencies. We show preliminary results obtained for the red giant KIC4448777 observed by the space mission Kepler.

  11. 21 CFR 640.10 - Red Blood Cells.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Red Blood Cells. 640.10 Section 640.10 Food and... ADDITIONAL STANDARDS FOR HUMAN BLOOD AND BLOOD PRODUCTS Red Blood Cells § 640.10 Red Blood Cells. The proper name of this product shall be Red Blood Cells. The product is defined as red blood cells...

  12. White dwarf-red dwarf binaries in the Galaxy

    NARCIS (Netherlands)

    Besselaar, E.J.M. van den

    2007-01-01

    This PhD thesis shows several studies on white dwarf - red dwarf binaries. White dwarfs are the end products of most stars and red dwarfs are normal hydrogen burning low-mass stars. White dwarf - red dwarf binaries are both blue (white dwarf) and red (red dwarf). Together with the fact that they are

  13. Red, Rank, and Romance in Women Viewing Men

    Science.gov (United States)

    Elliot, Andrew J.; Niesta Kayser, Daniela; Greitemeyer, Tobias; Lichtenfeld, Stephanie; Gramzow, Richard H.; Maier, Markus A.; Liu, Huijun

    2010-01-01

    In many nonhuman species of vertebrates, females are attracted to red on male conspecifics. Red is also a signal of male status in many nonhuman vertebrate species, and females show a mating preference for high-status males. These red-attraction and red-status links have been found even when red is displayed on males artificially. In the present…

  14. Red algae and their use in papermaking.

    Science.gov (United States)

    Seo, Yung-Bum; Lee, Youn-Woo; Lee, Chun-Han; You, Hack-Chul

    2010-04-01

    Gelidialian red algae, that contain rhizoidal filaments, except the family Gelidiellaceae were processed to make bleached pulps, which can be used as raw materials for papermaking. Red algae consist of rhizoidal filaments, cortical cells usually reddish in color, and medullary cells filled with mucilaginous carbohydrates. Red algae pulp consists of mostly rhizoidal filaments. Red algae pulp of high brightness can be produced by extracting mucilaginous carbohydrates after heating the algae in an aqueous medium and subsequently treating the extracted with bleaching chemicals. In this study, we prepared paper samples from bleached pulps obtained from two red algae species (Gelidium amansii and Gelidium corneum) and compared their properties to those of bleached wood chemical pulps. PMID:20022488

  15. RED TACTON HUMAN AREA NETWORKING

    Directory of Open Access Journals (Sweden)

    Priyanka Kakade

    2013-04-01

    Full Text Available All the user-friendly services require technologies that enable communication between people and objects in close proximity. This paper describes a model of human area networking technology that enables communication by touching, a technology we call Red Tacton. Human area networking technology for communication between mobile terminals and between terminals that are embedded in the environment has become important. When cables are used for communication between terminals, the routing of the cables is clearly inconvenient. When very weak radio signals are used for the communication, data speeds are reduced by packet collision and other such problems in crowded places such as exhibition sites and security risk from unwanted signal interception is another problem. Technology for solving such problems includes the use of the person body as a signal path for communication. A transmission path is formed automatically when a person comes into contact with a device and communication between mobile terminals begins. Here, the human body acts as a transmission medium supporting IEEE 802.3 half duplex communication at 10Mbit/s.

  16. A red-letter day !

    CERN Multimedia

    2008-01-01

    Today is a red-letter day for the LHC and CERN as a beam of protons has travelled around the LHC ring for the very first time! The start of LHC operation marks the end of a long period in which you have given your all, and this first particle beam circulating in the accelerator now paves the way for discoveries that will open up a whole new field of knowledge. The history of the LHC began in 1984 with a debate on the possible objectives of a future accelerator, based on the state of our knowledge at that time. The CERN Council then approved the single-stage construction of the LHC in 1996, giving the go-ahead for the work that has now reached completion. For the past twelve years, physicists, engineers and technicians from CERN and its associated institutes have been engaged in constructing the three pillars of the LHC: the accelerator (including the upgrade of the existing accelerator chain), the four experiments, and the computing ...

  17. Red quasars not so dusty

    CERN Document Server

    Benn, C R; Carballo, R; González-Serrano, J I; Sánchez, S F

    1997-01-01

    Webster et al (1995) claimed that up to 80% of QSOs may be obscured by dust. They inferred the presence of this dust from the remarkably broad range of B-K optical-infrared colours of a sample of flat-spectrum PKS radio QSOs. If such dust is typical of QSOs, it will have rendered invisible most of those which would otherwise been have detected by optical surveys. We used the William Herschel Telescope on La Palma to obtain K infrared images of 54 B3 radio quasars selected at low frequency (mainly steep-spectrum), and we find that although several have very red optical-infrared colours, most of these can be attributed to an excess of light in K rather than a dust-induced deficit in B. We present evidence that some of the infrared excess comes from the light of stars in the host galaxy (some, as previously suggested, comes from synchrotron radiation associated with flat-spectrum radio sources). The B-K colours of the B3 QSOs provide no evidence for a large reddened population. Either the Webster et al QSOs are ...

  18. Uptake of carnitine by red blood cells

    Energy Technology Data Exchange (ETDEWEB)

    Campa, M.; Borum, P.

    1986-05-01

    A significant amount of blood carnitine (70% of cord blood and 40% of blood from healthy adults) is partitioned into the red blood cell compartment of whole blood. Data indicate that the plasma compartment and the red blood cell compartment of whole blood represent different metabolic pools of carnitine. There are no data to indicate that red blood cells synthesize carnitine, but our understanding of the uptake of carnitine by red blood cells is negligible. Red blood cells were obtained from healthy adults, washed twice with normal saline, and used for uptake experiments. When the cells were incubated at 37/sup 0/C in the presence of /sup 14/C-carnitine, radioactivity was found both in the soluble cytosolic and membrane fractions of the cells following lysis. The uptake was dependent upon the time of incubation, temperature of incubation, and carnitine concentration in the incubation medium. Washed red blood cell membranes incubated with /sup 14/C-carnitine showed specific binding of radioactivity. These data are consistent with the hypothesis that red blood cells have an uptake mechanism for L-carnitine.

  19. Uptake of carnitine by red blood cells

    International Nuclear Information System (INIS)

    A significant amount of blood carnitine (70% of cord blood and 40% of blood from healthy adults) is partitioned into the red blood cell compartment of whole blood. Data indicate that the plasma compartment and the red blood cell compartment of whole blood represent different metabolic pools of carnitine. There are no data to indicate that red blood cells synthesize carnitine, but our understanding of the uptake of carnitine by red blood cells is negligible. Red blood cells were obtained from healthy adults, washed twice with normal saline, and used for uptake experiments. When the cells were incubated at 370C in the presence of 14C-carnitine, radioactivity was found both in the soluble cytosolic and membrane fractions of the cells following lysis. The uptake was dependent upon the time of incubation, temperature of incubation, and carnitine concentration in the incubation medium. Washed red blood cell membranes incubated with 14C-carnitine showed specific binding of radioactivity. These data are consistent with the hypothesis that red blood cells have an uptake mechanism for L-carnitine

  20. Decadal stability of Red Sea mangroves

    Science.gov (United States)

    Almahasheer, Hanan; Aljowair, Abdulaziz; Duarte, Carlos M.; Irigoien, Xabier

    2016-02-01

    Across the Earth, mangroves play an important role in coastal protection, both as nurseries and carbon sinks. However, due to various human and environmental impacts, the coverage of mangroves is declining on a global scale. The Red Sea is in the northern-most area of the distribution range of mangroves. Little is known about the surface covered by mangroves at this northern limit or about the changes experienced by Red Sea mangroves. We sought to study changes in the coverage of Red Sea mangroves by using multi-temporal Landsat data (1972, 2000 and 2013). Interestingly, our results show that there has been no decline in mangrove stands in the Red Sea but rather a slight increase. The area covered by mangroves is about 69 Km2 along the African shore and 51 Km2 along the Arabian Peninsula shore. From 1972 to 2013, the area covered by mangroves increased by about 0.29% y-1. We conclude that the trend exhibited by Red Sea mangroves departs from the general global decline of mangroves. Along the Red Sea, mangroves expanded by 12% over the 41 years from 1972 to 2013. Losses to Red Sea mangroves, mostly due to coastal development, have been compensated by afforestation projects.

  1. Decadal Stability of Red Sea Mangroves

    KAUST Repository

    Almahasheer, Hanan

    2015-12-15

    Across the Earth, mangroves play an important role in coastal protection, both as nurseries and carbon sinks. However, due to various human and environmental impacts, the coverage of mangroves is declining on a global scale. The Red Sea is in the northern-most area of the distribution range of mangroves. Little is known about the surface covered by mangroves at this northern limit or about the changes experienced by Red Sea mangroves. We sought to study changes in the coverage of Red Sea mangroves by using multi-temporal Landsat data (1972, 2000 and 2013). Interestingly, our results show that there has been no decline in mangrove stands in the Red Sea but rather a slight increase. The area covered by mangroves is about 69 Km2 along the African shore and 51 Km2 along the Arabian Peninsula shore. From 1972 to 2013, the area covered by mangroves increased by about 0.29% y-1. We conclude that the trend exhibited by Red Sea mangroves departs from the general global decline of mangroves. Along the Red Sea, mangroves expanded by 12% over the 41 years from 1972 to 2013. Losses to Red Sea mangroves, mostly due to coastal development, have been compensated by afforestation projects.

  2. Florida Red Tide Perception: Residents versus Tourists.

    Science.gov (United States)

    Nierenberg, Kate; Byrne, Margaret; Fleming, Lora E; Stephan, Wendy; Reich, Andrew; Backer, Lorraine C; Tanga, Elvira; Dalpra, Dana R; Kirkpatrick, Barbara

    2010-09-01

    The west coast of Florida has annual blooms of the toxin-producing dinoflagellate, Karenia brevis with Sarasota, FL considered the epicenter for these blooms. Numerous outreach materials, including Frequently Asked Question (FAQ) cards, exhibits for local museums and aquaria, public beach signs, and numerous websites have been developed to disseminate information to the public about this natural hazard. In addition, during intense onshore blooms, a great deal of media attention, primarily via newspaper (print and web) and television, is focused on red tide. However to date, the only measure of effectiveness of these outreach methods has been counts of the number of people exposed to the information, e.g., visits to a website or number of FAQ cards distributed. No formal assessment has been conducted to determine if these materials meet their goal of informing the public about Florida red tide. Also, although local residents have the opinion that they are very knowledgeable about Florida red tide, this has not been verified empirically. This study addressed these issues by creating and administering an evaluation tool for the assessment of public knowledge about Florida red tide. A focus group of Florida red tide outreach developers assisted in the creation of the evaluation tool. The location of the evaluation was the west coast of Florida, in Sarasota County. The objective was to assess the knowledge of the general public about Florida red tide. This assessment identified gaps in public knowledge regarding Florida red tides and also identified what information sources people want to use to obtain information on Florida red tide. The results from this study can be used to develop more effective outreach materials on Florida red tide. PMID:20824108

  3. Gestión de red

    OpenAIRE

    Barba Martí, Antonio

    1999-01-01

    Esta obra pretende introducir al lector en el mundo de la gestión de red dando una visión general de las arquitecturas y entornos de gestión existentes. Últimamente, aspectos como el control, la gestión de red o la gestión de servicios están obteniendo una mayor importancia para los operadores de red. Una de las razones fundamentales estriba en que los clientes cada vez más exigen una mayor calidad de servicio a un menor precio. De esta forma, se ha desatado una competencia entre operadores p...

  4. Red cell transfusion and the immune system.

    Science.gov (United States)

    Hart, S; Cserti-Gazdewich, C M; McCluskey, S A

    2015-01-01

    Understanding the complex immunological consequences of red cell transfusion is essential if we are to use this valuable resource wisely and safely. The decision to transfuse red cells should be made after serious considerations of the associated risks and benefits. Immunological risks of transfusion include major incompatibility reactions and transfusion-related acute lung injury, while other immunological insults such as transfusion-related immunomodulation are relatively underappreciated. Red cell transfusions should be acknowledged as immunological exposures, with consequences weighed against expected benefits. This article reviews immunological consequences and the emerging evidence that may inform risk-benefit considerations in clinical practice. PMID:25440393

  5. THE TEMPERATURES OF RED SUPERGIANTS

    Energy Technology Data Exchange (ETDEWEB)

    Davies, Ben [Astrophysics Research Institute, Liverpool John Moores University, Egerton Wharf, Birkenhead CH41 1LD (United Kingdom); Kudritzki, Rolf-Peter; Gazak, Zach [Institute for Astronomy, University of Hawaii, 2680 Woodlawn Drive, Honolulu, HI 96822 (United States); Plez, Bertrand [Laboratoire Univers et Particules de Montpellier, Universite Montpellier 2, CNRS, F-34095 Montpellier (France); Trager, Scott [Kapteyn Institute, University of Groningen, P.O. Box 800, 9700-AV Groningen (Netherlands); Lancon, Ariane [Observatoire Astronomique and CNRS UMR 7550, Universite de Strasbourg, F-67000 Strasbourg (France); Bergemann, Maria [Max-Planck-Institute for Astrophysics, Karl-Schwarzschild-Str. 1, D-85741 Garching (Germany); Evans, Chris [UK Astronomy Technology Centre, Royal Observatory Edinburgh, Blackford Hill, Edinburgh EH9 3HJ (United Kingdom); Chiavassa, Andrea [CNRS Laboratoire Lagrange, Universite de Nice Sophia-Antipolis, Observatoire de la Cote d' Azur, BP 4229, F-06304 Nice Cedex 4 (France)

    2013-04-10

    We present a re-appraisal of the temperatures of red supergiants (RSGs) using their optical and near-infrared spectral energy distributions (SEDs). We have obtained data of a sample of RSGs in the Magellanic Clouds using VLT+XSHOOTER, and we fit MARCS model atmospheres to different regions of the spectra, deriving effective temperatures for each star from (1) the TiO bands, (2) line-free continuum regions of the SEDs, and (3) the integrated fluxes. We show that the temperatures derived from fits to the TiO bands are systematically lower than the other two methods by several hundred kelvin. The TiO fits also dramatically overpredict the flux in the near-IR, and imply extinctions which are anomalously low compared to neighboring stars. In contrast, the SED temperatures provide good fits to the fluxes at all wavelengths other than the TiO bands, are in agreement with the temperatures from the flux integration method, and imply extinctions consistent with nearby stars. After considering a number of ways to reconcile this discrepancy, we conclude that three-dimensional effects (i.e., granulation) are the most likely cause, as they affect the temperature structure in the upper layers where the TiO lines form. The continuum, however, which forms at much deeper layers, is apparently more robust to such effects. We therefore conclude that RSG temperatures are much warmer than previously thought. We discuss the implications of this result for stellar evolution and supernova progenitors, and provide relations to determine the bolometric luminosities of RSGs from single-band photometry.

  6. Dipeptides from the red alga Acanthopora spicifera

    Digital Repository Service at National Institute of Oceanography (India)

    Wahidullah, S.; DeSouza, L.; Kamat, S.Y.

    An investigation of red alga Acanthophora spicifera afforded the known peptide, aurantiamide acetate and a new diastereoisomer of this dipeptide (dia-aurantiamide acetate). This is a first report of aurantiamide acetate from a marine source...

  7. PUNGENT AND COLOUR COMPOUNDS OF RED PEPPERS

    Directory of Open Access Journals (Sweden)

    Çetin KADAKAL

    2001-03-01

    Full Text Available The capcaicinoid amount of red peppers from Solanacea family is used for the evaluation of quality and classification in many countries. Capsaicin is the major pungent principle (69 % of capsaicinoids. The others are dihidrocapsaicin (22 %, nordihidrocapsaicin (7 %, homocapsaicin (1 % and homodihidrocapsaicin (1 %. As in most foods, the carotenoids of red peppers are also important compounds. Carotenoids are typical colour pigments and some of them have vitamin A activity. Major carotenoids of ripe fruit of red peppers are capsanthin, capsorubin, ß-carotene and zeaxanthin. Capcaicinoid and carotenoid contents of red peppers grown in many different regions of the world, their properties and roles on the human health were given in this review.

  8. Red Wine Polyphenols for Cancer Prevention

    Directory of Open Access Journals (Sweden)

    Yuanjiang Pan

    2008-05-01

    Full Text Available Conventional cancer therapies, the second leading cause of death worldwide, result in serious side effects and, at best, merely extend the patient's lifespan by a few years. Searching for effective prevention is of high priority in both basic and clinical sciences. In recent decades natural products have been considered to be an important source of cancer chemopreventive agents. Red wine polyphenols, which consisted of various powerful antioxidants such as flavonoids and stilbenes, have been implicated in cancer prevention and that promote human health without recognizable side effects. Since resveratrol, a major component of red wine polyphenols, has been studied and reviewed extensively for its chemopreventive activity to interfere with the multi-stage carcinogenesis, this review focuses on recent progress in studies on cancer chemopreventive activities of red wine polyphenol extracts and fractions as well as other red wine polyphenols, like procyanidin B5 analogues and myricetin.

  9. Comparative metagenomics of the Red Sea

    KAUST Repository

    Mineta, Katsuhiko

    2016-01-26

    Metagenome produces a tremendous amount of data that comes from the organisms living in the environments. This big data enables us to examine not only microbial genes but also the community structure, interaction and adaptation mechanisms at the specific location and condition. The Red Sea has several unique characteristics such as high salinity, high temperature and low nutrition. These features must contribute to form the unique microbial community during the evolutionary process. Since 2014, we started monthly samplings of the metagenomes in the Red Sea under KAUST-CCF project. In collaboration with Kitasato University, we also collected the metagenome data from the ocean in Japan, which shows contrasting features to the Red Sea. Therefore, the comparative metagenomics of those data provides a comprehensive view of the Red Sea microbes, leading to identify key microbes, genes and networks related to those environmental differences.

  10. Raoul Kurvitz esitleb : "Armastusest" & "RED" / Heie Treier

    Index Scriptorium Estoniae

    Treier, Heie, 1963-

    2000-01-01

    Näitus "Armastusest" Vaal-galeriis, näituse avamine toimus kunstniku performance'iga. Sõnumina mainitakse Raoul Kurvitza kuraatoriprojekti "RED" Mustpeade Maja valges saalis, loetletud eksponeeritud kunstnikud

  11. Design of tailing dam using red mud

    Science.gov (United States)

    Rout, Subrat; Sahoo, Tapaswini; Das, Sarat

    2013-06-01

    Red mud, waste industrial product from aluminum industries produced approximately 75 million tonnes every year with less than half of this is used. Storage of this unutilized red mud takes vast tracts of usable land and pollutes, land, air and water. Construction of high embankments, under passes, flyovers, tailing dams uses vast tract of natural resources (top soil) is also matter of concern as its takes thousands of years to form the natural soil. This paper discusses use of red mud for construction of tailing dam based on laboratory findings and finite element analysis. The geotechnical properties such as plasticity, compaction, permeability, shear strength characteristics and dispersion of red mud are presented. Stability and seepage analysis of tailing dams as per finite element analysis using the above geotechnical parameters is presented.

  12. Avoiding Anemia: Boost Your Red Blood Cells

    Science.gov (United States)

    ... link, please review our exit disclaimer . Subscribe Avoiding Anemia Boost Your Red Blood Cells If you’re ... and sluggish, you might have a condition called anemia. Anemia is a common blood disorder that many ...

  13. Host compounds for red phosphorescent OLEDs

    Science.gov (United States)

    Xia, Chuanjun; Cheon, Kwang -Ohk

    2015-08-25

    Novel compounds containing a triphenylene moiety linked to an .alpha..beta. connected binaphthyl ring system are provided. These compounds have surprisingly good solubility in organic solvents and are useful as host compounds in red phosphorescent OLEDs.

  14. Red in the Face: Understanding Rosacea

    Science.gov (United States)

    ... exit disclaimer . Subscribe Red in the Face Understanding Rosacea Some people think of a rosy complexion as ... more troubling—a long-lasting skin disorder called rosacea. Rosacea (pronounced ro-ZAY-she-ah) may start ...

  15. NOAA NCCOS: New England Red Tide Research

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Alexandrium blooms are one of several algal bloom types often called "red tides," but more correctly referred to as Harmful Algal Blooms (HABs). Alexandrium...

  16. Red Rock Lakes Wildlife Refuge : Reports : 1939

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — This report for Red Rock Lakes National Wildlife Refuge during 1939 contains and inventory of migratory waterfowl, as well as weather reports, and general remarks...

  17. Metagenomic studies of the Red Sea.

    Science.gov (United States)

    Behzad, Hayedeh; Ibarra, Martin Augusto; Mineta, Katsuhiko; Gojobori, Takashi

    2016-02-01

    Metagenomics has significantly advanced the field of marine microbial ecology, revealing the vast diversity of previously unknown microbial life forms in different marine niches. The tremendous amount of data generated has enabled identification of a large number of microbial genes (metagenomes), their community interactions, adaptation mechanisms, and their potential applications in pharmaceutical and biotechnology-based industries. Comparative metagenomics reveals that microbial diversity is a function of the local environment, meaning that unique or unusual environments typically harbor novel microbial species with unique genes and metabolic pathways. The Red Sea has an abundance of unique characteristics; however, its microbiota is one of the least studied among marine environments. The Red Sea harbors approximately 25 hot anoxic brine pools, plus a vibrant coral reef ecosystem. Physiochemical studies describe the Red Sea as an oligotrophic environment that contains one of the warmest and saltiest waters in the world with year-round high UV radiations. These characteristics are believed to have shaped the evolution of microbial communities in the Red Sea. Over-representation of genes involved in DNA repair, high-intensity light responses, and osmoregulation were found in the Red Sea metagenomic databases suggesting acquisition of specific environmental adaptation by the Red Sea microbiota. The Red Sea brine pools harbor a diverse range of halophilic and thermophilic bacterial and archaeal communities, which are potential sources of enzymes for pharmaceutical and biotechnology-based application. Understanding the mechanisms of these adaptations and their function within the larger ecosystem could also prove useful in light of predicted global warming scenarios where global ocean temperatures are expected to rise by 1-3°C in the next few decades. In this review, we provide an overview of the published metagenomic studies that were conducted in the Red Sea, and

  18. Red and lateritic soils : world scenario

    OpenAIRE

    Volkoff, Boris

    1998-01-01

    Calcareous, neutral and acid red soils, red lateritic soils, latosols and lateritic soils sensu lato are defined on the basis of their mineralogical composition and profile development. Their geographical distribution is discussed. Their origin is interpreted, considering successively palaeoclimates and continental drifts, tectonic movements and land-form development since the Early Tertiary period and the soil transformation during the Quaternary period. Finally, it is shown that in the trop...

  19. Causes of Red Eye-Uveitis

    OpenAIRE

    Selçuk Sızmaz

    2012-01-01

    Uveitis, being an important cause of ocular morbidity, must be taken into consideration in the differential diagnosis and the management of patients with red eye. Uveitis entities can demonstrate variable clinical features. Patients presenting with uveitis must undergo careful systemic evaluation for exact diagnosis and treatment. Studies for standardization of uveitis with variable clinical pictures are emerging. Acute anterior uveitis and panuveitis can cause red eye. The purpose o...

  20. Red flags in prospective contractors' financial statements.

    OpenAIRE

    Lee, Man-ying, Nicole

    1992-01-01

    Approved for public release; distribution is unlimited. This thesis attempts to identify warning signals in the contractors financial statement, or 'red flags', which may be used to identify those prospective contractors who are likely to become delinquent in the performance of their contracts. A 'red flags' list compiled from the current literature was sent to financial analysts in the thirty-eight Financial Service Branches, Defense Contract Management Command Area Offices(FSDCMAOs) to d...

  1. Organic red meat development in Wales

    OpenAIRE

    Bassett, Anna

    2003-01-01

    Much of the recent expansion of organic farming in Wales in associated with red meat production. Of the 56,621 hectares that will be fully organic by 2004, probably 80% is permanent grassland (assumption from Soil Association OFFR, 2002), the majority of which will be associated with beef and lamb production. The following factors suggest that the development of a strategy (which may encompass several sub strategies) for the red meat sector in Wales, to include production, processing, retaili...

  2. Red Teaming of Advanced Information Assurance Concepts

    International Nuclear Information System (INIS)

    Red Teaming is an advanced form of assessment that can be used to identify weaknesses in a variety of cyber systems. it is especially beneficial when the target system is still in development when designers can readily affect improvements. This paper discusses the red team analysis process and the author's experiences applying this process to five selected Information Technology Office (ITO) projects. Some detail of the overall methodology, summary results from the five projects, and lessons learned are contained within this paper

  3. Red de Bibliotecas y Archivos del CSIC

    OpenAIRE

    CSIC - Unidad de Recursos de Información Científica para la Investigación (URICI); Álvarez Díez, Luis Raúl; Pérez, Carmen

    2015-01-01

    Documento extraído de la entrada en Wikipedia. Contiene datos básicos de la Red de Bibliotecas y Archivos del CSIC, la historia de la Red, la Unidad de Recursos de Información Científica para la Investigación (URICI), las Bibliotecas del CSIC, los Archivos CSIC, Digital.CSIC (repositorio institucional del CSIC), estadísticas y enlaces externos.

  4. Multiple ways to become red: Pigment identification in red feathers using spectrometry

    OpenAIRE

    Toral, G.M.; Figuerola, Jordi; Negro, Juan J.

    2008-01-01

    Red hues are a challenge in studies on the evolution of bird coloration, as multiple pigments such as carotenoids, pheomelanin, psittacofulvins, porphyrins, turacin, haemoglobin and even exogenous iron-oxides, may confer red colors. Determining the pigment type is paramount and here we investigate the differences in spectrum reflectance for six pigments resulting in red colorations in feathers of different species, with a focus on discriminating among melanins and carotenoids. Pig...

  5. A note on the largest number of red nodes in red-black trees

    OpenAIRE

    Wu, Yingjie; Zhu, Daxin; Wang, Lei; Wang, Xiaodong

    2014-01-01

    In this paper, we are interested in the number of red nodes in red-black trees. We first present an $O(n^2\\log n)$ time dynamic programming solution for computing $r(n)$, the largest number of red internal nodes in a red-black tree on $n$ keys. Then the algorithm is improved to some $O(\\log n)$ time recursive and nonrecursive algorithms. Based on these improved algorithms we finally find a closed-form solution of $r(n)$.

  6. The Red Sea Modeling and Forecasting System

    KAUST Repository

    Hoteit, Ibrahim

    2015-04-01

    Despite its importance for a variety of socio-economical and political reasons and the presence of extensive coral reef gardens along its shores, the Red Sea remains one of the most under-studied large marine physical and biological systems in the global ocean. This contribution will present our efforts to build advanced modeling and forecasting capabilities for the Red Sea, which is part of the newly established Saudi ARAMCO Marine Environmental Research Center at KAUST (SAMERCK). Our Red Sea modeling system compromises both regional and nested costal MIT general circulation models (MITgcm) with resolutions varying between 8 km and 250 m to simulate the general circulation and mesoscale dynamics at various spatial scales, a 10-km resolution Weather Research Forecasting (WRF) model to simulate the atmospheric conditions, a 4-km resolution European Regional Seas Ecosystem Model (ERSEM) to simulate the Red Sea ecosystem, and a 1-km resolution WAVEWATCH-III model to simulate the wind driven surface waves conditions. We have also implemented an oil spill model, and a probabilistic dispersion and larval connectivity modeling system (CMS) based on a stochastic Lagrangian framework and incorporating biological attributes. We are using the models outputs together with available observational data to study all aspects of the Red Sea circulations. Advanced monitoring capabilities are being deployed in the Red Sea as part of the SAMERCK, comprising multiple gliders equipped with hydrographical and biological sensors, high frequency (HF) surface current/wave mapping, buoys/ moorings, etc, complementing the available satellite ocean and atmospheric observations and Automatic Weather Stations (AWS). The Red Sea models have also been equipped with advanced data assimilation capabilities. Fully parallel ensemble-based Kalman filtering (EnKF) algorithms have been implemented with the MITgcm and ERSEM for assimilating all available multivariate satellite and in-situ data sets. We

  7. Red Tide Frequency Analysis Using the Extreme Value Theory

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    In recent years, the red tide erupted frequently, and caused a great economic loss. At present, most literatures emphasize the academic research on the growth mechanism of red tide alga. In order to find out the characters of red tide in detail and improve the precision of forecast, this paper gives some new approaches to dealing with the red tide. By the extreme values, we deal with the red tide frequency analysis and get the estimation of T-times red tide level U(T), which is the level once the consistence of red tide alga exceeds on the average in a period of T times.

  8. 7X performance results - final report : ASCI Red vs Red Storm.

    Energy Technology Data Exchange (ETDEWEB)

    Dinge, Dennis C. (Cray Inc., Albuquerque, NM); Davis, Michael E. (Cray Inc., Albuquerque, NM); Haskell, Karen H.; Ballance, Robert A.; Gardiner, Thomas Anthony; Stevenson, Joel O.; Noe, John P.

    2011-04-01

    The goal of the 7X performance testing was to assure Sandia National Laboratories, Cray Inc., and the Department of Energy that Red Storm would achieve its performance requirements which were defined as a comparison between ASCI Red and Red Storm. Our approach was to identify one or more problems for each application in the 7X suite, run those problems at multiple processor sizes in the capability computing range, and compare the results between ASCI Red and Red Storm. The first part of this report describes the two computer systems, the applications in the 7X suite, the test problems, and the results of the performance tests on ASCI Red and Red Storm. During the course of the testing on Red Storm, we had the opportunity to run the test problems in both single-core mode and dual-core mode and the second part of this report describes those results. Finally, we reflect on lessons learned in undertaking a major head-to-head benchmark comparison.

  9. Red mud characterization using nuclear analytical techniques

    International Nuclear Information System (INIS)

    Red mud is a toxic waste left as a byproduct in aluminum production Bayer process. Since it contains significant concentrations of other chemical elements interesting for industry, including REE, it is also potential secondary ore source. Recent events in some countries have shown that red mud presents a serious environmental hazard if not properly stored. The subject of our study is the red mud from an ex-aluminum plant in Obrovac, Croatia, left from processing of bauxite mined during late 70's and early 80's at the eastern Adriatic coast and since than stored in open concrete basins for more than 30 years. We have used energy dispersive x-ray fluorescence analysis (both tube and radioactive source excitation), fast neutron activation analysis and passive gamma spectrometry to identify a number of elements present in the red mud, their concentration levels and radioactivity in the red mud. The high concentrations of Al, Si, Ca, Ti and Fe have been measured. Chemical elements Sc, Cr, Mn, Co, Ni, Cu, Zn, Ga, As, Se, Br, Y, La, Ce, Pr, Nd, Sm, Eu, Gd, Tb, Dy, Ho, Er, Tm, Pb, Th and U were found in lower concentrations. No significant levels of radioactivity have been measured. (authors)

  10. Features of Red Sea Water Masses

    KAUST Repository

    Kartadikaria, Aditya

    2015-04-01

    Features of Red Sea water mass can be divided into three types but best to be grouped into two different classes that are split at the potential density line σθ=27.4. The surface water (0-50 m) and the intermediate water (50-200 m) have nearly identical types of water mass. They appear as a maxima salinity layer for the water mass that has σθ > 26.0, and as a minimum salinity layer for water mass that has σθ < 26.0. These types of water masses are strongly affected by mixing that is controlled by seasonal variability, fresh water intrusion of the Gulf of Aden Intermediate Water (GAIW), and eddies variability. Two types of mixing; isopycnal and diapycnal mixing are part of important physical phenomena that explain the change of water mass in the Red Sea. The isopycnal mixing occurs at the neutral potential density line, connecting the Red Sea with its adjacent channel, the Gulf of Aden. Diapycnal mixing is found as a dominant mixing mode in the surface of the Red Sea Water and mainly due to energetic eddy activity. Density gradients, across which diapycnal mixing occurs, in the Red Sea are mainly due to large variations in salinity. The isolation of an extreme haline water mass below the thermocline contributes to the generation of the latitudinal shift and low diapycnal mixing. This finding further explains the difference of spatial kinetic mixing between the RSW and the Indian Ocean basin.

  11. Chlorine-Free Red-Burning Pyrotechnics.

    Science.gov (United States)

    Sabatini, Jesse J; Koch, Ernst-Christian; Poret, Jay C; Moretti, Jared D; Harbol, Seth M

    2015-09-01

    The development of a red, chlorine-free pyrotechnic illuminant of high luminosity and spectral purity was investigated. Red-light emission based solely on transient SrOH(g) has been achieved by using either 5-amino-1H-tetrazole or hexamine to deoxidize the combustion flame of a Mg/Sr(NO3 )2 /Epon-binder composition and reduce the amount of both condensed and gaseous SrO, which emits undesirable orange-red light. The new formulations were found to possess high thermal onset temperatures. Avoiding chlorine in these formulations eliminates the risk of the formation of PCBs, PCDDs, and PCDFs. This finding, hence, will have a great impact on both military pyrotechnics and commercial firework sectors. PMID:26333055

  12. Genome of the red alga Porphyridium purpureum.

    Science.gov (United States)

    Bhattacharya, Debashish; Price, Dana C; Chan, Cheong Xin; Qiu, Huan; Rose, Nicholas; Ball, Steven; Weber, Andreas P M; Arias, Maria Cecilia; Henrissat, Bernard; Coutinho, Pedro M; Krishnan, Anagha; Zäuner, Simone; Morath, Shannon; Hilliou, Frédérique; Egizi, Andrea; Perrineau, Marie-Mathilde; Yoon, Hwan Su

    2013-01-01

    The limited knowledge we have about red algal genomes comes from the highly specialized extremophiles, Cyanidiophyceae. Here, we describe the first genome sequence from a mesophilic, unicellular red alga, Porphyridium purpureum. The 8,355 predicted genes in P. purpureum, hundreds of which are likely to be implicated in a history of horizontal gene transfer, reside in a genome of 19.7 Mbp with 235 spliceosomal introns. Analysis of light-harvesting complex proteins reveals a nuclear-encoded phycobiliprotein in the alga. We uncover a complex set of carbohydrate-active enzymes, identify the genes required for the methylerythritol phosphate pathway of isoprenoid biosynthesis, and find evidence of sexual reproduction. Analysis of the compact, function-rich genome of P. purpureum suggests that ancestral lineages of red algae acted as mediators of horizontal gene transfer between prokaryotes and photosynthetic eukaryotes, thereby significantly enriching genomes across the tree of photosynthetic life. PMID:23770768

  13. Red-giant stars in eccentric binaries

    Directory of Open Access Journals (Sweden)

    Beck P. G.

    2015-01-01

    Full Text Available The unparalleled photometric data obtained by NASA’s Kepler Space Telescope has led to improved understanding of red-giant stars and binary stars. We discuss the characterization of known eccentric system, containing a solar-like oscillating red-giant primary component. We also report several new binary systems that are candidates for hosting an oscillating companion. A powerful approach to study binary stars is to combine asteroseimic techniques with light curve fitting. Seismology allows us to deduce the properties of red giants. In addition, by modeling the ellipsoidal modulations we can constrain the parameters of the binary system. An valuable independent source are ground-bases, high-resolution spectrographs.

  14. Recovery of rare earths from red mud

    International Nuclear Information System (INIS)

    The prospect for the recovery of rare earths from red mud, the bauxite tailings from the production of alumina is examined. The Jamaican red mud by far has the higher trace concentrations of lanthanum, cerium, neodymium, and yttrium. Scandium is also present. The dissolution of the rare earth is a major extraction problem because of the large volume of other materials. The recovery processes that have been proposed include the production of co-products such as iron, alumina, and titanium concentrates, with the rare earths going with the titanium. In this paper a critical examination of the possible processes are presented with the recommended research projects to be carried out

  15. Red cell hemolysis during processing and storage

    OpenAIRE

    Sawant R; Jathar S; Rajadhyaksha S; Kadam P

    2007-01-01

    Introduction: Apart from the visual assessment, measurement of plasma hemoglobin in the supernatant from red cell units provides an objective measure of the extent of hemolysis during storage. Study Design and Methods: Packed red cells (N=50), 25 units each in triple (CPD-A1 and SAGM) and quadruple (CPD-A1 and ADSOL) blood bags were evaluated for plasma hemoglobin by the tetramethylbenzidiene (TMB) method on day 1, 7, 14, 21 and 28 of collection. The hemoglobin, hematocrit, MCV, LDH and po...

  16. Causes of Red Eye-Uveitis

    Directory of Open Access Journals (Sweden)

    Selçuk Sızmaz

    2012-12-01

    Full Text Available Uveitis, being an important cause of ocular morbidity, must be taken into consideration in the differential diagnosis and the management of patients with red eye. Uveitis entities can demonstrate variable clinical features. Patients presenting with uveitis must undergo careful systemic evaluation for exact diagnosis and treatment. Studies for standardization of uveitis with variable clinical pictures are emerging. Acute anterior uveitis and panuveitis can cause red eye. The purpose of this current study is to summarize the clinical features and laboratory investigations that could help the differential diagnosis of acute anterior uveitis and panuveitis cases. (Turk J Ophthalmol 2012; 42: Supplement 57-62

  17. Pseudoepitheliomatous Hyperplasia in a Red Pigment Tattoo

    Science.gov (United States)

    Kazlouskaya, Viktoryia

    2015-01-01

    Red pigment tattoos are known to cause pseudoepitheliomatous hyperplasia in the skin, frequently simulating squamous cell carcinoma or keratoacanthoma. Herein, the authors present two additional cases of red pigment tattoo pseudoepitheliomatous hyperplasia in which they noted a lichenoid tissue reaction. They reviewed the previously published cases and observed a lichenoid reaction in the histopathological images similar to hypertrophic lichen planus. The authors suggest that these reactions might best be referred to as “lichenoid reaction with pseudoepitheliomatous hyperplasia” or “hypertrophic lichen planus-like reaction.” Accordingly, recognition of an inflammatory component may allow additional treatment options. PMID:26705448

  18. Kepler Asteroseismology of Red-giant Stars

    DEFF Research Database (Denmark)

    Christensen-Dalsgaard, J.

    2012-01-01

    The Kepler mission, launched in March 2009, has revolutionized asteroseismology, providing detailed observations of thousands of stars. This has allowed in-depth analyses of stars ranging from compact hot subdwarfs to red giants, and including the detection of solar-like oscillations in hundreds of...... stars on or near the main sequence. Here I mainly consider solar-like oscillations in red giants, where Kepler observations are yielding results of a perhaps unexpected richness. In addition to giving a brief overview of the observational and numerical results for these stars, I present a simple...

  19. Biotreatment of red water with fungal systems

    Energy Technology Data Exchange (ETDEWEB)

    Tsai, TenLin S.; Turner, R.J.; Sanville, C.J.

    1990-01-01

    Red water generated during the manufacture of trinitrotoluene (TNT) is an environmental concern because it contaminates ground surfaces and groundwaters. Past methods for the management of this hazardous waste stream did not meet pollution compliance or were not cost effective. Biodegradation of TNT by bacteria has been reported, but no conclusive evidence supports its biotransformation to harmless products or its complete mineralization. The lignin peroxidase (ligninase) secreted by the white rot fungus (Phanerochaete chrysosporium) has been shown to degrade a broad spectrum of organic pollutants. In this study, the efficacy of treating red water with the P. chrysosporium system was investigated.

  20. Brand image and identity of Red Bull

    OpenAIRE

    Kubátová, Karolína

    2009-01-01

    The thesis is focused on a comparison of the image perception and brand identity of Red Bull. The theoretical part explains the difference between the concepts of identity and brand image, how the brand sees itself and how it is perceived from the perspective of consumers. Further information is also given in the context of the topic. This analysis yields a comparison between the brand's identity and the inaccuracies in the perceptions of the brand image, and reveals the real image of Red Bull.

  1. Late Devonian red tide and mass extinction

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Molecular stratigraphical, carbonate carbon isotopic, stratigraphical and paleontological data show that algal booming, eutrophication, anoxia, hypersalinity, positive ( 13C excursion and biomass decreasing occurred in the offshore carbonate environments of the Frasnian-Famennian (F-F) transition, which hints that red tide might frequently take place in the F-F transition of Guangxi, South China. We suggest that the mass extinction of the reef ecosystems and the shallow-water marine organisms in the F-F transition of the lower-middle latitudes may be related to the frequent occurrence of red tide in that time.

  2. Computer Assisted Diagnoses for Red Eye (CADRE)

    OpenAIRE

    Muhammad Zubair Asghar; Abdur Rashid Khan; Muhammad Junaid Asghar

    2009-01-01

    This paper introduces an expert System (ES) named as “CADRE-Computer Assisted Diagnoses for Red Eye. Mostly the remote areas of the population are deprived of the facilities of having experts in eye disease. So it is the need of the day to store the expertise of Eye specialists in computers through using ES technology. This ES is a rule-based Expert System that assists in red-eye diagnosis and treatment. The knowledge acquired from literature review and human experts of the specific domain wa...

  3. ESR analysis of irradiated red peppers and commercial red peppers in Japan

    International Nuclear Information System (INIS)

    ESR analysis of γ-ray irradiated and being treated with different processing red pepper was studied. All the red peppers were commercial expect irradiated one. Processing treatment of red pepper was sun drying, mechanical processing (heating sterilization and powdering treatment). All the samples were weighted and analyzed. The ESR spectrum of the red pepper is composed of a singlet at g=2.00. This signal was originated from organic free radical. It is suggested the effect of heating treatment on the radical formation is not so large and powdering treatment will promote the radical formation of red pepper. ESR singlet signal of the irradiated red pepper showed the large signal intensity and the dose-dependence. The singlet signal intensity of irradiated powder sample showed the almost same value as compared with that of the powder sample with heating treatment. Relaxation times (T1 and T2) of the singlet signal were calculated. The relaxation behavior and relaxation times of the irradiated sample were different from that of the non-irradiated sample. The value of T1, the spin lattice relaxation time, of irradiated sample was increased and T2, the spin-spin relaxation time, of irradiated sample was decreased. We concluded that the radical formation of the red pepper is mainly depended on the powdering treatment and irradiation. (author)

  4. RED Alert – Early warning or detection of global re-emerging infectious disease (RED)

    Energy Technology Data Exchange (ETDEWEB)

    Deshpande, Alina [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-07-13

    This is the PDF of a presentation for a webinar given by Los Alamos National Laboratory (LANL) on the early warning or detection of global re-emerging infectious disease (RED). First, there is an overview of LANL biosurveillance tools. Then, information is given about RED Alert. Next, a demonstration is given of a component prototype. RED Alert is an analysis tool that can provide early warning or detection of the re-emergence of an infectious disease at the global level, but through a local lens.

  5. Infra-red fixed points in supersymmetry

    Indian Academy of Sciences (India)

    B Ananthanarayan

    2000-07-01

    Model independent constraints on supersymmetric models emerge when certain couplings are drawn towards their infra-red (quasi) fixed points in the course of their renormalization group evolution. The general principles are first reviewed and the conclusions for some recent studies of theories with -parity and baryon and lepton number violations are summarized.

  6. Aspergillosis in a red-crowned crane

    Science.gov (United States)

    Stroud, R.K.; Duncan, R.M.

    1983-01-01

    An unusual form of pulmonary aspergillosis in a red-crowned crane (Grus japonensis) is described in this report. The major lesion is unique because it closely resembles a lesion referred to as an aspergilloma. An aspergilloma is a single large granulomatous lesion that resembles a tumor and is caused by fungi of the genus Aspergillus.

  7. Optical Data Storage in Acid Red Dyes

    Science.gov (United States)

    Sankar, Deepa; Palanisamy, P. K.

    High-density optical data storage is a current field gaining importance where research work is done in abundance to bring about holographic CDs to light. Dye-doped gelatin films are promising candidates as recording materials for holographic data storage because of the ease of preparation and low cost. In this report we suggest some acid red dyes as useful recording materials for optical data storage. Acid red dyes namely Acid Red 73 and Acid Red 114 that are completely water-soluble are used to sensitize gelatin thin films for data storage. These dyes have their absorption peak around 514 nm. Two coherent beams of Argon ion laser (514.5 nm) are used to form the grating in the dye-sensitized gelatin films. The grating formed is found to be permanent. The diffraction efficiency of each material as a function of different parameters like dye concentration, writing beam intensities and their ratios and spatial frequency has been studied and presented. An attempt to store data in the sample has been made.

  8. Red blood cell transfusion in septic shock

    DEFF Research Database (Denmark)

    Rosland, Ragnhild G; Hagen, Marte U; Haase, Nicolai;

    2014-01-01

    BACKGROUND: Treating anaemia with red blood cell (RBC) transfusion is frequent, but controversial, in patients with septic shock. Therefore we assessed characteristics and outcome associated with RBC transfusion in this group of high risk patients. METHODS: We did a prospective cohort study at 7...

  9. Infra-red fixed points in supersymmetry

    International Nuclear Information System (INIS)

    Model independent constraints on supersymmetric models emerge when certain couplings are drawn towards their infra-red (quasi) fixed points in the course of their renormalization group evolution. The general principles are first reviewed and the conclusions for some recent studies of theories with R-parity and baryon and lepton number violations are summarized. (author)

  10. The FIRST-2MASS Red Quasar Survey

    Energy Technology Data Exchange (ETDEWEB)

    Glikman, E; Helfand, D J; White, R L; Becker, R H; Gregg, M D; Lacy, M

    2007-06-28

    Combining radio observations with optical and infrared color selection--demonstrated in our pilot study to be an efficient selection algorithm for finding red quasars--we have obtained optical and infrared spectroscopy for 120 objects in a complete sample of 156 candidates from a sky area of 2716 square degrees. Consistent with our initial results, we find our selection criteria--J-K > 1.7,R-K > 4.0--yield a {approx} 50% success rate for discovering quasars substantially redder than those found in optical surveys. Comparison with UVX- and optical color-selected samples shows that {approx}> 10% of the quasars are missed in a magnitude-limited survey. Simultaneous two-frequency radio observations for part of the sample indicate that a synchrotron continuum component is ruled out as a significant contributor to reddening the quasars spectra. We go on to estimate extinctions for our objects assuming their red colors are caused by dust. Continuum fits and Balmer decrements suggest E(B-V) values ranging from near zero to 2.5 magnitudes. Correcting the K-band magnitudes for these extinctions, we find that for K {le} 14.0, red quasars make up between 25% and 60% of the underlying quasar population; owing to the incompleteness of the 2MASS survey at fainter K-band magnitudes, we can only set a lower limit to the radio-detected red quasar population of > 20-30%.

  11. Red Cooperativa de Tejido Humano del NCI

    Science.gov (United States)

    Bioespecímenes de calidad son un recurso de investigación oncológica. Uno de los programas de bioespecímenes que han operado por más tiempo es la Red Cooperativa de Tejido Humano, ara descubrimientos básicos e investigación inicial de transferencia.

  12. Recounting "Red Star over China"

    Institute of Scientific and Technical Information of China (English)

    2011-01-01

    Dear readers, When Itake to writing this editor's letter, a classic book name flashes into my mind while the whole country is exploded with rising heat and jubilant dances, and red songs that rippled .to schools, factories, government departments and n

  13. Sherry Red Owl, Stands at Dawn Woman

    Science.gov (United States)

    Crazy Bull, Cheryl

    2014-01-01

    This article introduces Sherry Red Owl, also known as "Stands at Dawn Woman," because she greets each day as a new opportunity and has spent her life working at new things. She worked at Sinte Gleska University (SGU) during its founding years, taught at an elementary school when few Native teachers were employed in the school systems,…

  14. Film Guide for "The Red Kite".

    Science.gov (United States)

    Hughes, A. O.

    1969-01-01

    Aspects to consider in studying the film "The Red Kite" are (1) a synopsis of the story, which concerns a young father's musings about life and death; (2) the film's structure, which focuses on the father's encounters in a store, on a bus, in his home, at a party, and finally on a hill while flying the kite; (3) possible themes, such as "human…

  15. in the red fox () in Slovenia

    OpenAIRE

    Rataj, Aleksandra Vergles; Bidovec, Andrej; Žele, Diana; Vengušt, Gorazd

    2010-01-01

    Using the parasitological washing out method, we examined the intestines of 428 red foxes () for the presence of (Leuckart 1863) and found that the overall prevalence was 2.6% (confidence interval 95% 1.3-4.5%). This is the first extended research reporting on the presence of in the Slovenian fox population.

  16. Observations of the summer Red Sea circulation

    Science.gov (United States)

    Sofianos, Sarantis S.; Johns, William E.

    2007-06-01

    Aiming at exploring and understanding the summer circulation in the Red Sea, a cruise was conducted in the basin during the summer of 2001 involving hydrographic, meteorological, and direct current observations. The most prominent feature, characteristic of the summer circulation and exchange with the Indian Ocean, is a temperature, salinity, and oxygen minimum located around a depth of 75 m at the southern end of the basin, associated with Gulf of Aden Intermediate Water inflowing from the Gulf of Aden during the summer season as an intruding subsurface layer. Stirring and mixing with ambient waters lead to marked increases in temperature (from 16.5 to almost 33°C) and salinity (from 35.7 to more than 38 psu) in this layer by the time it reaches midbasin. The observed circulation presents a very vigorous pattern with strong variability and intense features that extend the width of the basin. A permanent cyclone, detected in the northern Red Sea, verifies previous observations and modeling studies, while in the central sector of the basin a series of very strong anticyclones were observed with maximum velocities exceeding 1 m/s. The three-layer flow pattern, representative of the summer exchange between the Red Sea and the Gulf of Aden, is observed in the strait of Bab el Mandeb. In the southern part of the basin the layer flow is characterized by strong banking of the inflows and outflows against the coasts. Both surface and intermediate water masses involved in the summer Red Sea circulation present prominent spatial variability in their characteristics, indicating that the eddy field and mixing processes play an important role in the summer Red Sea circulation.

  17. Red salmon investigations: Kodiak red salmon studies, plan of operations, April 1966 to April 1967

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — The broad objective of the Karluk research program is to study those aspects of the life cycle and ecology of red salmon pertinent to explaining the long-term...

  18. A COMPLEX IDENTITY: RED COLOR-CODING IN ALAI'S RED POPPIES

    Directory of Open Access Journals (Sweden)

    Alexandra Draggeim

    2015-03-01

    Full Text Available Alai's Red Poppies presents a complex depiction of Tibetan identity that is at odds with the romanticized portrayal of the Tibetan minority in Chinese government media as well as with the standard historical positioning of Old Tibet as feudal and primitive. The color red is an ongoing theme that recurs throughout the novel, from the original introduction of the red poppies, to their spread throughout the area surrounding the Maichi chiefdom and, finally, to the chiefdom's downfall, offering insight not only into the complexity of Sino-Tibetan relations, but also into tension between Tibetan self-perception and popular image. Using a color frequently associated with Red China to highlight diverse cultural themes, Alai's work provides us a valuable window into marginal Tibetan realms outside of Central Tibet.

  19. Red and far red sun-induced chlorophyll fluorescence as a measure of plant photosynthesis

    OpenAIRE

    M. Rossini; L. Nedbal; Luis Guanter; A. Ač; L. Alonso; A. Burkart; S. Cogliati; R. Colombo; A. Damm; M. Drusch; J. Hanus; R. Janoutova; T. Julitta; P. Kokkalis; J. Moreno

    2015-01-01

    Remote estimation of Sun-induced chlorophyll fluorescence emitted by terrestrial vegetation can provide an unparalleled opportunity to track spatiotemporal variations of photosynthetic efficiency. Here we provide the first direct experimental evidence that the two peaks of the chlorophyll fluorescence spectrum can be accurately mapped from high-resolution radiance spectra and that the signal is linked to variations in actual photosynthetic efficiency. Red and far red fluorescence measured usi...

  20. A Preliminary Exploration of the Metrical Musicality in Robert Burns’s A Red, Red Rose

    Institute of Scientific and Technical Information of China (English)

    罗军; 刘芹

    2013-01-01

    The musicality of poetry is a project that has been in great need of scholars’attentions and studies due to its charming typicality, which has been a rarely-visited for a long time. To get away with this intellectual sterility and poverty, and highlight the aesthetic universality of the musicality in poetic texts, this paper aims to give a preliminary exploration of the metrical musical-ity in A Red, Red Rose.

  1. Growth and replication of red rain cells at 121°C and their red fluorescence

    Science.gov (United States)

    Gangappa, Rajkumar; Wickramasinghe, Chandra; Wainwright, Milton; Kumar, A. Santhosh; Louis, Godfrey

    2010-09-01

    We have shown that the red cells found in the Red Rain (which fell on Kerala, India, in 2001) survive and grow after incubation for periods of up to two hours at 121°C . Under these conditions daughter cells appear within the original mother cells and the number of cells in the samples increases with length of exposure to 121°C. No such increase in cells occurs at room temperature, suggesting that the increase in daughter cells is brought about by exposure of the Red Rain cells to high temperatures. This is an independent confirmation of results reported earlier by two of the present authors, claiming that the cells can replicate under high pressure at temperatures upto 300°C. The flourescence behaviour of the red cells is shown to be in remarkable correspondence with the extended red emission observed in the Red Rectagle planetary nebula and other galactic and extragalactic dust clouds, suggesting, though not proving an extraterrestrial origin.

  2. Growth and replication of red rain cells at 121 oC and their red fluorescence

    CERN Document Server

    Gangappa, Rajkumar; Wainwright, Milton; Kumar, A Santhosh; Louis, Godfrey

    2010-01-01

    We have shown that the red cells found in the Red Rain (which fell on Kerala, India, in 2001) survive and grow after incubation for periods of up to two hours at 121 oC . Under these conditions daughter cells appear within the original mother cells and the number of cells in the samples increases with length of exposure to 121 oC. No such increase in cells occurs at room temperature, suggesting that the increase in daughter cells is brought about by exposure of the Red Rain cells to high temperatures. This is an independent confirmation of results reported earlier by two of the present authors, claiming that the cells can replicate under high pressure at temperatures up to 300 oC. The flourescence behaviour of the red cells is shown to be in remarkable correspondence with the extended red emission observed in the Red Rectangle planetary nebula and other galactic and extragalactic dust clouds, suggesting, though not proving, an extraterrestrial origin.

  3. Red, Itchy Rash? Get the Skinny on Dermatitis

    Science.gov (United States)

    ... External link, please review our exit disclaimer . Subscribe Red, Itchy Rash? Get the Skinny on Dermatitis You’ ... unusual. Why does your skin break out in red blotches like that? More important, is there anything ...

  4. Study on red rice%赤米考

    Institute of Scientific and Technical Information of China (English)

    俞为洁

    2005-01-01

    'The red rice grain' recorded in the Chinese ancient books is neither a kind of good rice variety nor old rice grain or rotten rice grain, they are some rice varieties which have red-color grains and poor taste.

  5. Physical and Chemical Properties of Sintering Red Mud and Bayer Red Mud and the Implications for Beneficial Utilization

    Directory of Open Access Journals (Sweden)

    Ping Wang

    2012-10-01

    Full Text Available Performances of two common types of red mud, Bayer red mud and Sintering red mud, were investigated in this research. Their compositions, mechanical properties and microstructure characterization were measured through XRD, TG and SEM analysis. Their shear strength, particle size, density and hydraulic characteristics also had been performed. Huge differences between the basic mineral types of these two kinds of red mud also can be found. The comparison of compositions shows that CaCO3 content in Sintering red mud is higher, Bayer red mud has more hazardous elements such as As, Pb and Hg and both have a high concentration of radioactivity. The micro particle of Bayer red mud is finer and more disperse, but the Sintering red mud has higher shear strength. Combining the TG and hydraulic characteristics analysis, it can be shown that Bayer red mud has higher value of water content and Sintering red mud has higher hydraulic conductivity. The paper then illustrates that Sintering red mud can become the main filling material of supporting structure of red mud stocking yard. Bayer red mud has a high reuse value and also can be used as a mixing material of masonry mortar.

  6. Red Dwarfs and the End of the Main Sequence

    Science.gov (United States)

    Adams, F. C.; Graves, G. J. M.; Laughlin, G.

    2004-12-01

    This paper celebrates the contributions of Peter Bodenheimer to our understanding of stellar evolution by focusing on the long term development of red dwarf stars. We show that these diminutive stellar objects remain convective over most of their lives, they continue to burn hydrogen for trillions of years, and they do not experience red giant phases in their old age. Instead, red dwarfs turn into blue dwarfs and finally white dwarfs. This work shows (in part) why larger stars do become red giants.

  7. 7 CFR 29.3052 - Red color (R).

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Red color (R). 29.3052 Section 29.3052 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Red color (R). A brownish red....

  8. 21 CFR 864.7100 - Red blood cell enzyme assay.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Red blood cell enzyme assay. 864.7100 Section 864... enzyme assay. (a) Identification. Red blood cell enzyme assay is a device used to measure the activity in... kinase or 2,3-diphosphoglycerate. A red blood cell enzyme assay is used to determine the enzyme...

  9. 21 CFR 660.30 - Reagent Red Blood Cells.

    Science.gov (United States)

    2010-04-01

    ... identify human blood-group antibodies. (b) Source. Reagent Red Blood Cells shall be prepared from human... 21 Food and Drugs 7 2010-04-01 2010-04-01 false Reagent Red Blood Cells. 660.30 Section 660.30...) BIOLOGICS ADDITIONAL STANDARDS FOR DIAGNOSTIC SUBSTANCES FOR LABORATORY TESTS Reagent Red Blood Cells §...

  10. 7 CFR 29.1080 - Variegated dark red (KD).

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Variegated dark red (KD). 29.1080 Section 29.1080..., 13, 14 and Foreign Type 92) § 29.1080 Variegated dark red (KD). A dark brownish-red discoloration... over extended periods of time. Any leaf of which 20 percent or more of its surface is dark...

  11. Hidden values in bauxite residue (red mud): Recovery of metals

    Energy Technology Data Exchange (ETDEWEB)

    Liu, Yanju; Naidu, Ravi, E-mail: ravi.naidu@unisa.edu.au

    2014-12-15

    Highlights: • Current iron recovery techniques using red mud are depicted. • Advantages and disadvantages exist in different recovering processes. • Economic and environmental friendly integrated usage of red mud is promising. - Abstract: Bauxite residue (red mud) is a hazardous waste generated from alumina refining industries. Unless managed properly, red mud poses significant risks to the local environment due to its extreme alkalinity and its potential impacts on surface and ground water quality. The ever-increasing generation of red mud poses significant challenges to the aluminium industries from management perspectives given the low proportion that are currently being utilized beneficially. Red mud, in most cases, contains elevated concentrations of iron in addition to aluminium, titanium, sodium and valuable rare earth elements. Given the scarcity of iron supply globally, the iron content of red mud has attracted increasing research interest. This paper presents a critical overview of the current techniques employed for iron recovery from red mud. Information on the recovery of other valuable metals is also reviewed to provide an insight into the full potential usage of red mud as an economic resource rather than a waste. Traditional hydrometallurgy and pyrometallurgy are being investigated continuously. However, in this review several new techniques are introduced that consider the process of iron recovery from red mud. An integrated process which can achieve multiple additional values from red mud is much preferred over the single process methods. The information provided here should help to improve the future management and utilization of red mud.

  12. 7 CFR 29.3068 - Tannish-red color (FR).

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Tannish-red color (FR). 29.3068 Section 29.3068 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards... Type 93) § 29.3068 Tannish-red color (FR). A light red shaded toward tan....

  13. 7 CFR 29.1044 - Orange Red (FR).

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Orange Red (FR). 29.1044 Section 29.1044 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... Type 92) § 29.1044 Orange Red (FR). A yellowish red....

  14. Hidden values in bauxite residue (red mud): Recovery of metals

    International Nuclear Information System (INIS)

    Highlights: • Current iron recovery techniques using red mud are depicted. • Advantages and disadvantages exist in different recovering processes. • Economic and environmental friendly integrated usage of red mud is promising. - Abstract: Bauxite residue (red mud) is a hazardous waste generated from alumina refining industries. Unless managed properly, red mud poses significant risks to the local environment due to its extreme alkalinity and its potential impacts on surface and ground water quality. The ever-increasing generation of red mud poses significant challenges to the aluminium industries from management perspectives given the low proportion that are currently being utilized beneficially. Red mud, in most cases, contains elevated concentrations of iron in addition to aluminium, titanium, sodium and valuable rare earth elements. Given the scarcity of iron supply globally, the iron content of red mud has attracted increasing research interest. This paper presents a critical overview of the current techniques employed for iron recovery from red mud. Information on the recovery of other valuable metals is also reviewed to provide an insight into the full potential usage of red mud as an economic resource rather than a waste. Traditional hydrometallurgy and pyrometallurgy are being investigated continuously. However, in this review several new techniques are introduced that consider the process of iron recovery from red mud. An integrated process which can achieve multiple additional values from red mud is much preferred over the single process methods. The information provided here should help to improve the future management and utilization of red mud

  15. The Red River Valley archeological project

    Science.gov (United States)

    Bennett, Jack; Smith, Lawson; Laustrup, Mark

    1986-01-01

    The Red River Valley Archeology Project is a long-term effort involving numerous individuals and institutions engaged in archeological investigations in the Texas and Oklahoma portions of the Red River Valley. To date the focus of the project was on site location. The project acquired both Thermal Infrared Multispectral Scanner (TIMS), TMS, and color infrared photographs over a significant portion of the project area in an effort to define signatures for archeological sites and to assist in the detailed geomorphological mapping of the flood plain. Preliminary analysis of acquired data indicates that both the TIMS and TMS can make a substantial contribution to landform definition, the identification of cultural resources, and to the clarification of site-landform correlations in this riverine environment.

  16. Molecular biodiversity of Red Sea demosponges

    KAUST Repository

    Erpenbeck, Dirk

    2016-01-07

    Sponges are important constituents of coral reef ecosystems, including those around the Arabian Peninsula. Despite their importance, our knowledge on demosponge diversity in this area is insufficient to recognize, for example, faunal changes caused by anthropogenic disturbances. We here report the first assessment of demosponge molecular biodiversity from Arabia, with focus on the Saudi Arabian Red Sea, based on mitochondrial and nuclear ribosomal molecular markers gathered in the framework of the Sponge Barcoding Project. We use a rapid molecular screening approach on Arabian demosponge collections and analyze results in comparison against published material in terms of biodiversity. We use a variable region of 28S rDNA, applied for the first time in the assessment of demosponge molecular diversity. Our data constitutes a solid foundation for a future more comprehensive understanding of sponge biodiversity of the Red Sea and adjacent waters.

  17. Improvements to the Red List Index.

    Directory of Open Access Journals (Sweden)

    Stuart H M Butchart

    Full Text Available The Red List Index uses information from the IUCN Red List to track trends in the projected overall extinction risk of sets of species. It has been widely recognised as an important component of the suite of indicators needed to measure progress towards the international target of significantly reducing the rate of biodiversity loss by 2010. However, further application of the RLI (to non-avian taxa in particular has revealed some shortcomings in the original formula and approach: It performs inappropriately when a value of zero is reached; RLI values are affected by the frequency of assessments; and newly evaluated species may introduce bias. Here we propose a revision to the formula, and recommend how it should be applied in order to overcome these shortcomings. Two additional advantages of the revisions are that assessment errors are not propagated through time, and the overall level extinction risk can be determined as well as trends in this over time.

  18. Molecular biodiversity of Red Sea demosponges.

    Science.gov (United States)

    Erpenbeck, Dirk; Voigt, Oliver; Al-Aidaroos, Ali M; Berumen, Michael L; Büttner, Gabriele; Catania, Daniela; Guirguis, Adel Naguib; Paulay, Gustav; Schätzle, Simone; Wörheide, Gert

    2016-04-30

    Sponges are important constituents of coral reef ecosystems, including those around the Arabian Peninsula. Despite their importance, our knowledge on demosponge diversity in this area is insufficient to recognize, for example, faunal changes caused by anthropogenic disturbances. We here report the first assessment of demosponge molecular biodiversity from Arabia, with focus on the Saudi Arabian Red Sea, based on mitochondrial and nuclear ribosomal molecular markers gathered in the framework of the Sponge Barcoding Project. We use a rapid molecular screening approach on Arabian demosponge collections and analyze results in comparison against published material in terms of biodiversity. We use a variable region of 28S rDNA, applied for the first time in the assessment of demosponge molecular diversity. Our data constitutes a solid foundation for a future more comprehensive understanding of sponge biodiversity of the Red Sea and adjacent waters. PMID:26776057

  19. Lower Red River Meadow Stream Restoration Project

    International Nuclear Information System (INIS)

    As part of a continuing effort to restore anadromous fish populations in the South Fork Clearwater River basin of Idaho, Bonneville Power Administration (BPA) proposes to fund the Lower Red River Meadow Restoration Project (Project). The Project is a cooperative effort with the Idaho Soil and Water Conservation District, Nez Perce National Forest, Idaho Department of Fish and Game (IDFG), and the Nez Perce Tribe of Idaho. The proposed action would allow the sponsors to perform stream bank stabilization, aquatic and riparian habitat improvement activities on IDFG's Red River Management Area and to secure long-term conservation contracts or agreements for conducting streambank and habitat improvement activities with participating private landowners located in the Idaho County, Idaho, study area. This preliminary Environmental Assessment (EA) examines the potential environmental effects of stabilizing the stream channel, restoring juvenile fish rearing habitat and reestablishing a riparian shrub community along the stream

  20. Responder individuality in red blood cell alloimmunization.

    Science.gov (United States)

    Körmöczi, Günther F; Mayr, Wolfgang R

    2014-11-01

    Many different factors influence the propensity of transfusion recipients and pregnant women to form red blood cell alloantibodies (RBCA). RBCA may cause hemolytic transfusion reactions, hemolytic disease of the fetus and newborn and may be a complication in transplantation medicine. Antigenic differences between responder and foreign erythrocytes may lead to such an immune answer, in part with suspected specific HLA class II associations. Biochemical and conformational characteristics of red blood cell (RBC) antigens, their dose (number of transfusions and pregnancies, absolute number of antigens per RBC) and the mode of exposure impact on RBCA rates. In addition, individual circumstances determine the risk to form RBCA. Responder individuality in terms of age, sex, severity of underlying disease, disease- or therapy-induced immunosuppression and inflammation are discussed with respect to influencing RBC alloimmunization. For particular high-risk patients, extended phenotype matching of transfusion and recipient efficiently decreases RBCA induction and associated clinical risks. PMID:25670932

  1. Quantitative Adaptive RED in Differentiated Service Networks

    Institute of Scientific and Technical Information of China (English)

    LONG KePing(隆克平); WANG Qian(王茜); CHENG ShiDuan(程时端); CHEN JunLiang(陈俊亮)

    2003-01-01

    This paper derives a quantitative model between RED (Random Early Detection)maxp and committed traffic rate for token-based marking schemes in DiffServ IP networks. Then,a DiffServ Quantitative RED (DQRED) is presented, which can adapt its dropping probabilityto marking probability of the edge router to reflect not only the sharing bandwidth but also therequirement of performance of these services. Hence, DQRED can cooperate with marking schemesto guarantee fairness between different DiffServ AF class services. A new marking probabilitymetering algorithm is also proposed to cooperate with DQRED. Simulation results verify thatDQRED mechanism can not only control congestion of DiffServ network very well, but also satisfydifferent quality requirements of AF class service. The performance of DQRED is better than thatof WRED.

  2. Population dynamics of red tide dinoflagellates

    Science.gov (United States)

    Wyatt, Timothy; Zingone, Adriana

    2014-03-01

    Sea-surface discolorations due to high concentrations of phytoplankton are called red tides. Their ecological significance is a long standing puzzle, and they are sometimes considered pathological. Here we propose that many red tides, particularly but not exclusively those composed of certain autotrophic dinoflagellates, are presexual/sexual swarms, essential links in their complex life cycles. This view provides a rationale for the appearance of these organisms in thin surface layers, and helps explain their ephemeral nature. We suggest that further understanding of this phenomenon, and of phytoplankton ecology in general, would benefit from attention to the 'net reproductive value‧ (r) over the whole life cycle as well as to the division rate (μ) of the vegetative phase. It is argued that r is strategically adapted to seasonal cycles and long term environmental variability, while μ reflects tactical needs (timing) and constraints (grazers, parasites) on vegetative growth.

  3. Adsorption of ruthenium red to phospholipid membranes.

    OpenAIRE

    Voelker, D; Smejtek, P

    1996-01-01

    We have measured the distribution of the hexavalent ruthenium red cation (RuR) between water and phospholipid membranes, have shown the critical importance of membrane negative surface charge for RuR binding, and determined the association constant of RuR for different phospholipid bilayers. The studies were performed with liposomes made of mixtures of zwitterionic L-alpha-phosphatidylcholine (PC), and one of the negatively charged phospholipids: L-alpha-phosphatidylserine (PS), L-alpha-phosp...

  4. Multigrid with red black SOR revisited

    Energy Technology Data Exchange (ETDEWEB)

    Yavneh, I. [Technion-Israel Institute of Technology, Haifa (Israel)

    1994-12-31

    Optimal relaxation parameters are obtained for red-black point Gauss-Seidel relaxation in multigrid solvers of a family of elliptic equations. The resulting relaxation schemes are found to retain high efficiency over an appreciable range of coefficients of the elliptic operator, yielding simple, inexpensive and fully parallelizable smoothers in many situations where more complicated and less cost-effective block-relaxation and/or partial coarsening are commonly used.

  5. Flavonoids from the Red Alga Acanthophora spicifera

    Institute of Scientific and Technical Information of China (English)

    ZENG Long-Mei(曾陇梅); 曾陇梅; WANG Chao-Jie(王超杰); 王超杰; SU Jing-Yu(苏镜娱); 苏镜娱; LI Du(李笃); 李笃; OWEN Noel L.; OWEN Noel L; LU Yang(吕扬); 吕扬; LU Nan(鲁南); 鲁南; ZHENG Qi-Tai(郑启泰); 郑启泰

    2001-01-01

    Two new flavonoids, acanthophorin A (1) and acanthophorin B (2), along with three known compounds tiliroside (3),( - )-catechin (4) and quercetin (5) were isolated from the red alga Acanthophora spicifera. The structures of 1 and 2were determined to be kaempferol 3-O-α-L-fucopyranoside (1) and quercetin 3-O-α-L-fucopyranoside (2) by spectroscopic methods. Both 1 and 2 showed significant anfioxidant activity.

  6. CAPITAL GAINS: BLUE MACHINES AND RED MACHINES

    OpenAIRE

    LUÍS AGUIAR-CONRARIA; KARL SHELL

    2005-01-01

    Capital gains play an essential role in the intertemporal allocation of resources, but they can also fuel self-fulfilling bubbles. The simple case of 2 "identical" capitals is analyzed in an overlapping generations model. The only trajectory in which expectations are realized at every date is the one in which blue machines and red machines have the same price. If ever their prices differ, then there is a "bubble" which must burst in finite time.

  7. Red Wine Polyphenols for Cancer Prevention

    OpenAIRE

    Yuanjiang Pan; Cuirong Sun; Shan He

    2008-01-01

    Conventional cancer therapies, the second leading cause of death worldwide, result in serious side effects and, at best, merely extend the patient's lifespan by a few years. Searching for effective prevention is of high priority in both basic and clinical sciences. In recent decades natural products have been considered to be an important source of cancer chemopreventive agents. Red wine polyphenols, which consisted of various powerful antioxidants such as flavonoids and stilbenes, have been ...

  8. Red wine: A drink to your heart

    OpenAIRE

    Saleem, T. S. Mohamed; Basha, S. Darbar

    2010-01-01

    Mortality and morbidity are still high in cardiovascular disease (CVD). Myocardial ischemia reperfusion injury leading to myocardial infarction is one of the most frequent causes of the death in humans. Atherosclerosis and generation of reactive oxygen species through oxidative stress is the major risk factor for CVD. From the literature collection, it has been identified that moderate consumption of red wine helps in preventing CVD through several mechanisms, including increasing the high-de...

  9. Redox alters yellow dragonflies into red

    OpenAIRE

    Futahashi, Ryo; Kurita, Ryoji; Mano, Hiroaki; Fukatsu, Takema

    2012-01-01

    Body color change associated with sexual maturation—so-called nuptial coloration—is commonly found in diverse vertebrates and invertebrates, and plays important roles for their reproductive success. In some dragonflies, whereas females and young males are yellowish in color, aged males turn vivid red upon sexual maturation. The male-specific coloration plays pivotal roles in, for example, mating and territoriality, but molecular basis of the sex-related transition in body coloration of the dr...

  10. Red de microcines - Perú

    OpenAIRE

    Kaspar, Stefan

    2015-01-01

    El Grupo Chaski aprovecha nuevas tecnologías digitales para crear un modelo de organización cultural que permite desarrollar el cine y lo audiovisual desde la comunidad. En el Perú hay 32 grupos en 8 regiones del país que manejan un microcine y trabajan con este concepto. En el siguiente artículo Stefan Kaspar, director ejecutivo del Grupo Chaski, nos habla del proyecto y describe el funcionamiento de la red de microcines.

  11. Microstructure of Black, Green and Red Gram

    OpenAIRE

    Joseph, Enamuthu; Crites, Shelly G.; Swanson, Barry G.

    1993-01-01

    The three most commonly consumed legumes (grams or pulses) in India, black gram (Vigna mungo (L.) Hepper), or urd , green gram (Vigna radiata (L.) Wilczek) or mung, and red gram (Cajanus cajan (L.) Millsp.) or tur, were examined by scanning electron microscopy . Seed coat and internal features were examined to differentiate these legumes from common beans (Phaseolus vulgaris) , adzuki beans (Vigna angu/aris) and lentils (Lens culinaris). Cross-sections of the seed coats of black, green and re...

  12. Red refinements of simplices into congruent subsimplices

    Czech Academy of Sciences Publication Activity Database

    Korotov, S.; Křížek, Michal

    2014-01-01

    Roč. 67, č. 12 (2014), s. 2199-2204. ISSN 0898-1221 R&D Projects: GA ČR GA14-02067S Institutional support: RVO:67985840 Keywords : sommerville tetrahedron * red refinement * higher-dimensional simplex Subject RIV: BA - General Mathematics Impact factor: 1.697, year: 2014 http://www. science direct.com/ science /article/pii/S0898122114000662

  13. Human Connections in Red Badge of Courage

    OpenAIRE

    Syed Afroz Ashrafi

    2016-01-01

    The paper Human connection in Red badge of Courage sought to reestablish the notion that humanity survives the ravages of war, the war that kills and alienates a good chunk of human populace. The sounds of bullets cannot soften the tissues of heart, rather it only appalls humanity. Crane’s human connection is stressed as the succor for the tormented and oppressed nations mainly through wars.Keywords: war, nations, death, savagery

  14. Formation and spreading of Red Sea Outflow Water in the Red Sea

    Science.gov (United States)

    Zhai, Ping; Bower, Amy S.; Smethie, William M.; Pratt, Larry J.

    2015-09-01

    Hydrographic data, chlorofluorocarbon-12 (CFC-12) and sulfur hexafluoride (SF6) measurements collected in March 2010 and September-October 2011 in the Red Sea, as well as an idealized numerical experiment are used to study the formation and spreading of Red Sea Outflow Water (RSOW) in the Red Sea. Analysis of inert tracers, potential vorticity distributions, and model results confirm that RSOW is formed through mixed-layer deepening caused by sea surface buoyancy loss in winter in the northern Red Sea and reveal more details on RSOW spreading rates, pathways, and vertical structure. The southward spreading of RSOW after its formation is identified as a layer with minimum potential vorticity and maximum CFC-12 and SF6. Ventilation ages of seawater within the RSOW layer, calculated from the partial pressure of SF6 (pSF6), range from 2 years in the northern Red Sea to 15 years at 17°N. The distribution of the tracer ages is in agreement with the model circulation field which shows a rapid transport of RSOW from its formation region to the southern Red Sea where there are longer circulation pathways and hence longer residence time due to basin wide eddies. The mean residence time of RSOW within the Red Sea estimated from the pSF6 age is 4.7 years. This time scale is very close to the mean transit time (4.8 years) for particles from the RSOW formation region to reach the exit at the Strait of Bab el Mandeb in the numerical experiment.

  15. The "Living with a Red Dwarf" Program

    CERN Document Server

    Guinan, Edward F

    2009-01-01

    Red Dwarfs (main-sequence / dwarf M or dM) stars are the most common stars in the Galaxy. These cool, faint, low mass stars comprise over 75% of all stars. Because of their low luminosities (~0.0008-0.06 of the Sun's luminosity), the circumstellar habitable zones (HZs) of dM stars are located within ~0.05-0.4 AU of the host star. Nevertheless, the prospect of life on a planet located within the HZ of a red dwarf is moderately high, based on the longevity of these stars (>50 Gyr), their constant luminosities and high space densities. Here we describe the aims and early results of the "Living with a Red Dwarf" Program - a study of dM stars that we have been carrying out over the last few years. The primary focus of our research on dM stars is the study of their magnetic dynamos and resulting star spots & coronal X-ray and chromospheric UV emissions as a function of age, rotation and spectral type. This program will provide datasets that can be used as inputs for the study of all aspects of dM stars, along w...

  16. Abrupt warming of the Red Sea

    KAUST Repository

    Raitsos, D. E.

    2011-07-19

    Coral reef ecosystems, often referred to as “marine rainforests,” concentrate the most diverse life in the oceans. Red Sea reef dwellers are adapted in a very warm environment, fact that makes them vulnerable to further and rapid warming. The detection and understanding of abrupt temperature changes is an important task, as ecosystems have more chances to adapt in a slowly rather than in a rapid changing environment. Using satellite derived sea surface and ground based air temperatures, it is shown that the Red Sea is going through an intense warming initiated in the mid-90s, with evidence for an abrupt increase after 1994 (0.7°C difference pre and post the shift). The air temperature is found to be a key parameter that influences the Red Sea marine temperature. The comparisons with Northern Hemisphere temperatures revealed that the observed warming is part of global climate change trends. The hitherto results also raise additional questions regarding other broader climatic impacts over the area.

  17. Red Sea as a source for bioprospecting

    KAUST Repository

    Kodzius, Rimantas

    2015-12-12

    King-Abdullah University of Science and Technology (KAUST) is located on the shores of the Red Sea in Saudi Arabia. The Red Sea is well known for its unique environment, harboring various microbes capable of surviving in salty brines. We collected sediment samples from brine pool adjacent to the Thuwal cold seeps in the Red Sea. The taxonomic analysis showed the diversity and abundance of bacterial and archaeal operational taxonomic units (OUT). Recently we established in the laboratory a microdroplet technology to encapsulate single cells. This technology enables us to analyze single-cell genomes and perform the high-throughput screening. The genomes of both cultivable and uncultivable organisms can be analyzed. We envision the collection of complimentary data, obtained by various techniques, such as single-cell genomics, metagenomics, and transcriptomics. That will enable us not only to understand the environment and microorganism communities but also will allow to discover the previously unknown genes, pathways, and whole genomes. These data will facilitate the enhancement of biological and chemical producers, and pave the way for bioprospecting.

  18. PPR Great Red Spot Temperature Map

    Science.gov (United States)

    1996-01-01

    This map shows temperature for the region around Jupiter's Great Red Spot and an area to the northwest. It corresponds to a level in Jupiter's atmosphere where the pressure is 1/2 of the of the Earth's at sea level (500 millibars), the same as it is near 6000 meters (20,000 feet) above sea level on Earth. The center of Great Red Spot appears colder than the surrounding areas, where air from below is being brought up. The 'panhandle' to the northwest is warmer and drier, and the gases there are descending, so it is much clearer of clouds. Compare this map to one released earlier at a higher place in the atmosphere (250 millibars or 12000 meters). The center of the Great Red Spot is warmer lower in the atmosphere, and a white 'hot spot' appears in this image that is not present at the higher place. This map was made from data taken by the Photopolarimeter/Radiometer (PPR) instrument on June 26, 1996.Launched in October 1989, Galileo entered orbit around Jupiter on December 7, 1995. The spacecraft's mission is to conduct detailed studies of the giant planet, its largest moons and the Jovian magnetic environment.JPL manages the Galileo mission for NASA's Office of Space Science, Washington, D.C.This image and other images and data received from Galileo are posted on the World Wide Web, on the Galileo mission home page at URL http://galileo.jpl.nasa.gov.

  19. Computer Assisted Diagnoses for Red Eye (CADRE

    Directory of Open Access Journals (Sweden)

    Muhammad Zubair Asghar

    2009-11-01

    Full Text Available This paper introduces an expert System (ES named as “CADRE-Computer Assisted Diagnoses for Red Eye. Mostly the remote areas of the population are deprived of the facilities of having experts in eye disease. So it is the need of the day to store the expertise of Eye specialists in computers through using ES technology. This ES is a rule-based Expert System that assists in red-eye diagnosis and treatment. The knowledge acquired from literature review and human experts of the specific domain was used as a base for analysis, diagnosis and recommendations. CADRE evaluates the risk factors of 20 eye diseases and works just like an ophthalmologist, which will be useful for students, doctors and researchers as well as to patients. This expert system (ES was developed through using ESTA, VISUAL BASIC, MS-EXCEL, Seagate Crystal Reports and Image Styler. This ES is not limited to the Red-eye diseases but can be extended to all types of eye-diseases.

  20. Chandra Observations of 12 Luminous Red Quasars

    Energy Technology Data Exchange (ETDEWEB)

    Urrutia, T; Lacy, M; Gregg, M D; Becker, R H

    2005-03-11

    The authors present results of a study of 12 dust-reddened quasars with 0.4 < z < 2.65 and reddenings in the range 0.15 < E(B-V) < 1.7. They obtained ACIS-S X-ray spectra of these quasars, estimated the column densities towards them, and hence obtained the gas:dust ratios in the material obscuring the quasar. They detect all but one of the red quasars in the X-rays. Even though there is no obvious correlation between the X-ray determined column densities of the sources and their optical color or reddening, all of the sources show absorbed X-ray spectra. When they correct the luminosity for absorption, they can be placed among luminous quasars; therefore their objects belong to the group of high luminosity analogues of the sources contributing to the X-ray background seen in deep X-ray observations. Such sources are also found in serendipitous shallow X-ray surveys. There is a hint that the mean spectral slope of the red quasar is higher than that of normal, unobscured quasars, which could be an indication for higher accretion rates and/or an evolutionary effect. They investigate the number density of these sources compared to type 2 AGN based on the X-ray background and estimate how many moderate luminosity red quasars may be found in deep X-ray fields.

  1. Energetic Efficiency of red palm oil

    Directory of Open Access Journals (Sweden)

    Byron Jiménez

    2013-11-01

    Full Text Available The main goal of this paper is to determine the energy efficiency in the production of red palm oil (Elaeis guineensis by using the biophysical indicator EROI, postulated by the Ecological Economics. This indicator is applied to compare the energy used in the preparation of synthetic fertilizers (to fill its nutritional demands versus the energy contained in the oil. In 2009, there were 195.550 hectares of land planted with African palm in Ecuador (INEC, 2011. In addition, between 2002 and 2009, there were 2,7 million tons of red oil (FEDEPAL, 2010. It is determined that for each unit of energy consumed, 4.82 units of energy are contained in the red oil. The energy used in making pesticides for cultivation, consumed in transportation, refining, and post harvest is excluded because this other energy would drastically reduce the absolute data of the indicator, which is already inefficient for the high energy consumption it requires to generate the energy contained in the oil. On the other hand, agroecology has proven to be more efficient in the generation of energy per unit of invested energy (Altieri et. al., 2010; Moore, 2004.

  2. Modelling ion flux in red cells

    International Nuclear Information System (INIS)

    The volume of a circulating red blood cell is a primary function of its water content; this being determined by the cellular amounts of ions such as K+ and Na+. Improper function of transport pathways of these can lead to reduced cell deformability, as occurs in Sickle-cell Anaemia and other disease states. Work in our laboratory has focussed on the kinetics of the calcium-activated potassium (Gardos) channel in the human red cell, and the role this transporter plays in regulation of cell volume. Whole cell 39K, 87Rb, 31P NMR spectroscopy was employed to monitor changes in cellular ion and water content. 19F NMR enabled prediction of the available free calcium using 5,5'-difluoro-l,2-bis(o-aminophenoxy)-ethane-N,N,N'N'-tetraacetic acid (5-F-BAPTA) as a calcium 'probe'. Concurrently a model of red cell ion flux has been written in Mathematica. This model numerically solves a system of time-dependent differential equations with rate constants and other parameters based on experimental evidence

  3. Suitability of tuna red meat for preparation of wafers

    OpenAIRE

    Thankamma, R.; Lekshmy Nair, A.; Shenoy, A.V.; Gopakumar, K.

    1985-01-01

    Studies to find out the suitability of tuna red meat for preparation of wafers have indicated that the red meat as such is not a good raw material for the production of wafers. The wafers obtained had poor organoleptic quality and characteristic tuna red meat flavour unacceptable to consumers. Attempts to prepare the wafers with the red meat mixed with the meat of barracuda in varying proportions showed that the mixture of red meat and barracuda meat in the ratio 1:3 gives a product having ex...

  4. Actividad antibacteriana y antifúngica de extractos de algas marinas venezolanas

    Directory of Open Access Journals (Sweden)

    Nurby Ríos

    2011-07-01

    Full Text Available En este trabajo se evaluaron las propiedades bioactivas antibacterianas y antimicóticas de 33 extractos (etanol, diclorometano, hexano obtenidos de 11 especies de algas marinas recolectadas en las localidades de San Juan de Los Cayos y Chichiriviche, Estado Falcón, Venezuela. La actividad antibiótica y antimicótica de los extractos se evaluó mediante la aparición de halos de inhibición contra bacterias Gram positivas (Staphylococ- cus aureus, Gram negativas (Pseudomona aeruginosa, Klebsiella pneumoniae, Escherichia coli y el hongo Candida albicans. De los 33 extractos ensayados sólo 17 presentaron actividad antibacteriana (5 con etanol, 6 con diclorometano y 6 con hexano, resultando activos 14 frente a las especies Gram(- y 4 contra la especie Gram(+. Las especies algales que mostraron actividad antibacteriana fueron: Acanthophora sp., Bryothamnion triquetrum, Gracilaria sp., Gelidium sp., Caulerpa mexicana, Caulerpa sp., Caulerpa spp., Halimeda incras- sata, Ulva sp., Codium decorticatum, Sargassum sp. Ninguno de los extractos de algas ensayados presentó actividad antimicótica sobre Cándida albicans. Los resultados obtenidos permiten concluir que las algas de la costa occidental de Venezuela, presentan compuestos bioactivos con actividad antibacteriana.

  5. Biological oceanography of the red oceanic system

    Science.gov (United States)

    Theil, Hjalmar; Weikert, Horst

    1. In 1977, 1979 and 1980-81, investigations were carried out which aimed at evaluating the potential risks from mining metalliferous muds precipating in the Atlantis II Deep of the central Red Sea. This environmental research was initiated by the Saudi Sudanese Red Sea Joint Commission in order to avoid any danger for the Red Sea ecosystem. The broad environmental research programme coherent studies in physical, chemical, biological, and geological oceanography as well as toxicological investigations in the oceanic and in reef zones. We summarise the results from our biological fiels studies in the open sea. 2. The biological investigations were concentrated on the area of the Atlantis II Deep. Benthos was sampled between 700-2000m. For comparison a few samples were also taken further north in the central Red Sea, and to east and west along the flanking deep terraces (500-1000m). Plankton studies covered the total water column above the Deep, and were extended along the axial through to north and south. 3. Benthos sampling was carried out using a heavy closing trawl, a large box grab (box size 50 × 50 cm), Van Veen grabs and traps; photographic surveys were made a phototrap and a photosled. Community respiration was measured with a ship-board method using grab subsamples. Nutrient concentrations, seston and phytoplankton standing stocks as well as in situ primary production were determined from hydrocast samples. Data on zooplankton and micronekton composition and standing stock were obtained from samples collected using different multiple opening-and-closing nets equipped with 100 μm, 300 μm, and 1000 μm mesh sizes. Daily and ontogenetical vertical migration patterns were studied by comparisons of data from midday and midnight tows. 4. Throughout the whole area the sediment is a pteropod ooze containing low contentrations of organic matter; measured organic carbon and nitrogen contents were 0.5 and 0.05% respectively, and chloroplastic pigment equivalents

  6. Nutritional profile of edible red marine seaweeds

    Directory of Open Access Journals (Sweden)

    Catarina Guedes Costa

    2014-06-01

    Full Text Available Marine biodiversity represents an exceptional source of natural resources. Their use in a sustainable way may ensure alternative food sources for human consumption, which scarcity is anticipated. Macroalgae, also known as seaweed, are an outstanding example of this biodiversity and are considered an excellent source of a wide number of chemical compounds with beneficial health effects [1]. According to their pigmentation, they can be distinguished in green (Chlorophytaea, brown (Phaeophytaea and red (Rhodophytaea, showing differences in nutritional and chemical compositions [1]. Some macroalgae are widely used as food ingredients in oriental countries as a good source of fiber and protein. Alternatively, they are also considered a source of nutraceuticals, providing health benefits such as anti-inflamatory, anti-allergic, antimutagenic, antitumor, antidiabetic, antioxidant, antihyperthensive and neuroprotective properties [2]. Indeed, macroalgae are a very attractive material for the food, pharmaceutical and cosmetic industries. According to some studies red seaweeds seem to be the most suitable source of proteins for human nutrition [3]. The aim of this study was to evaluate the nutritional profile of the most consumed species of red seaweed that are commercially available in the market. Red species as Palmaria palmata (Dulse, Porphyra tenera (Nori and Eisenia bicyclis (Arame, were analyzed. Moisture determination was performed using a Scaltec SMO01 moisture analyzer. The ashes were obtained by incineration at 500ºC. The protein content was determined using the Kjeldahl procedure and total fat was measured through Soxhlet method. The carbohydrates were calculated indirectly by difference. In addition, chlorides were volumetrically determined and vitamin E profile was analysed by HPLC/DAD/FLD. The algae samples are commercialized dry, so the moisture content was very low, around 10%. The ash content was around 10-17%. Protein levels ranged from

  7. redMaGiC: Selecting Luminous Red Galaxies from the DES Science Verification Data

    CERN Document Server

    Rozo, E; Abate, A; Bonnett, C; Crocce, M; Davis, C; Hoyle, B; Leistedt, B; Peiris, H V; Wechsler, R H; Abbott, T; Abdalla, F B; Banerji, M; Bauer, A H; Benoit-Lévy, A; Bernstein, G M; Bertin, E; Brooks, D; Buckley-Geer, E; Burke, D L; Capozzi, D; Rosell, A Carnero; Carollo, D; Kind, M Carrasco; Carretero, J; Castander, F J; Childress, M J; Cunha, C E; D'Andrea, C B; Davis, T; DePoy, D L; Desai, S; Diehl, H T; Dietrich, J P; Doel, P; Eifler, T F; Evrard, A E; Neto, A Fausti; Flaugher, B; Fosalba, P; Frieman, J; Gaztanaga, E; Gerdes, D W; Glazebrook, K; Gruen, D; Gruendl, R A; Honscheid, K; James, D J; Jarvis, M; Kim, A G; Kuehn, K; Kuropatkin, N; Lahav, O; Lidman, C; Lima, M; Maia, M A G; March, M; Martini, P; Melchior, P; Miller, C J; Miquel, R; Mohr, J J; Nichol, R C; Nord, B; O'Neill, C R; Ogando, R; Plazas, A A; Romer, A K; Roodman, A; Sako, M; Sanchez, E; Santiago, B; Schubnell, M; Sevilla-Noarbe, I; Smith, R C; Soares-Santos, M; Sobreira, F; Suchyta, E; Swanson, M E C; Thaler, J; Thomas, D; Uddin, S; Vikram, V; Walker, A R; Wester, W; Zhang, Y; da Costa, L N

    2015-01-01

    We introduce redMaGiC, an automated algorithm for selecting Luminous Red Galaxies (LRGs). The algorithm was specifically developed to minimize photometric redshift uncertainties in photometric large-scale structure studies. redMaGiC achieves this by self-training the color-cuts necessary to produce a luminosity-thresholded LRG sample of constant comoving density. We demonstrate that redMaGiC photozs are very nearly as accurate as the best machine-learning based methods, yet they require minimal spectroscopic training, do not suffer from extrapolation biases, and are very nearly Gaussian. We apply our algorithm to Dark Energy Survey (DES) Science Verification (SV) data to produce a redMaGiC catalog sampling the redshift range $z\\in[0.2,0.8]$. Our fiducial sample has a comoving space density of $10^{-3}\\ (h^{-1} Mpc)^{-3}$, and a median photoz bias ($z_{spec}-z_{photo}$) and scatter $(\\sigma_z/(1+z))$ of 0.005 and 0.017 respectively. The corresponding $5\\sigma$ outlier fraction is 1.4%. We also test our algorit...

  8. redMaGiC: selecting luminous red galaxies from the DES Science Verification data

    Science.gov (United States)

    Rozo, E.; Rykoff, E. S.; Abate, A.; Bonnett, C.; Crocce, M.; Davis, C.; Hoyle, B.; Leistedt, B.; Peiris, H. V.; Wechsler, R. H.; Abbott, T.; Abdalla, F. B.; Banerji, M.; Bauer, A. H.; Benoit-Lévy, A.; Bernstein, G. M.; Bertin, E.; Brooks, D.; Buckley-Geer, E.; Burke, D. L.; Capozzi, D.; Rosell, A. Carnero; Carollo, D.; Kind, M. Carrasco; Carretero, J.; Castander, F. J.; Childress, M. J.; Cunha, C. E.; D'Andrea, C. B.; Davis, T.; DePoy, D. L.; Desai, S.; Diehl, H. T.; Dietrich, J. P.; Doel, P.; Eifler, T. F.; Evrard, A. E.; Neto, A. Fausti; Flaugher, B.; Fosalba, P.; Frieman, J.; Gaztanaga, E.; Gerdes, D. W.; Glazebrook, K.; Gruen, D.; Gruendl, R. A.; Honscheid, K.; James, D. J.; Jarvis, M.; Kim, A. G.; Kuehn, K.; Kuropatkin, N.; Lahav, O.; Lidman, C.; Lima, M.; Maia, M. A. G.; March, M.; Martini, P.; Melchior, P.; Miller, C. J.; Miquel, R.; Mohr, J. J.; Nichol, R. C.; Nord, B.; O'Neill, C. R.; Ogando, R.; Plazas, A. A.; Romer, A. K.; Roodman, A.; Sako, M.; Sanchez, E.; Santiago, B.; Schubnell, M.; Sevilla-Noarbe, I.; Smith, R. C.; Soares-Santos, M.; Sobreira, F.; Suchyta, E.; Swanson, M. E. C.; Thaler, J.; Thomas, D.; Uddin, S.; Vikram, V.; Walker, A. R.; Wester, W.; Zhang, Y.; da Costa, L. N.

    2016-09-01

    We introduce redMaGiC, an automated algorithm for selecting luminous red galaxies (LRGs). The algorithm was specifically developed to minimize photometric redshift uncertainties in photometric large-scale structure studies. redMaGiC achieves this by self-training the colour cuts necessary to produce a luminosity-thresholded LRG sample of constant comoving density. We demonstrate that redMaGiC photo-zs are very nearly as accurate as the best machine learning-based methods, yet they require minimal spectroscopic training, do not suffer from extrapolation biases, and are very nearly Gaussian. We apply our algorithm to Dark Energy Survey (DES) Science Verification (SV) data to produce a redMaGiC catalogue sampling the redshift range z ∈ [0.2, 0.8]. Our fiducial sample has a comoving space density of 10-3 (h-1 Mpc)-3, and a median photo-z bias (zspec - zphoto) and scatter (σz/(1 + z)) of 0.005 and 0.017, respectively. The corresponding 5σ outlier fraction is 1.4 per cent. We also test our algorithm with Sloan Digital Sky Survey Data Release 8 and Stripe 82 data, and discuss how spectroscopic training can be used to control photo-z biases at the 0.1 per cent level.

  9. redMaGiC: Selecting Luminous Red Galaxies from the DES Science Verification Data

    Science.gov (United States)

    Rozo, E.; Rykoff, E. S.; Abate, A.; Bonnett, C.; Crocce, M.; Davis, C.; Hoyle, B.; Leistedt, B.; Peiris, H. V.; Wechsler, R. H.; Abbott, T.; Abdalla, F. B.; Banerji, M.; Bauer, A. H.; Benoit-Lévy, A.; Bernstein, G. M.; Bertin, E.; Brooks, D.; Buckley-Geer, E.; Burke, D. L.; Capozzi, D.; Rosell, A. Carnero; Carollo, D.; Kind, M. Carrasco; Carretero, J.; Castander, F. J.; Childress, M. J.; Cunha, C. E.; D'Andrea, C. B.; Davis, T.; DePoy, D. L.; Desai, S.; Diehl, H. T.; Dietrich, J. P.; Doel, P.; Eifler, T. F.; Evrard, A. E.; Neto, A. Fausti; Flaugher, B.; Fosalba, P.; Frieman, J.; Gaztanaga, E.; Gerdes, D. W.; Glazebrook, K.; Gruen, D.; Gruendl, R. A.; Honscheid, K.; James, D. J.; Jarvis, M.; Kim, A. G.; Kuehn, K.; Kuropatkin, N.; Lahav, O.; Lidman, C.; Lima, M.; Maia, M. A. G.; March, M.; Martini, P.; Melchior, P.; Miller, C. J.; Miquel, R.; Mohr, J. J.; Nichol, R. C.; Nord, B.; O'Neill, C. R.; Ogando, R.; Plazas, A. A.; Romer, A. K.; Roodman, A.; Sako, M.; Sanchez, E.; Santiago, B.; Schubnell, M.; Sevilla-Noarbe, I.; Smith, R. C.; Soares-Santos, M.; Sobreira, F.; Suchyta, E.; Swanson, M. E. C.; Thaler, J.; Thomas, D.; Uddin, S.; Vikram, V.; Walker, A. R.; Wester, W.; Zhang, Y.; da Costa, L. N.

    2016-05-01

    We introduce redMaGiC, an automated algorithm for selecting Luminous Red Galaxies (LRGs). The algorithm was specifically developed to minimize photometric redshift uncertainties in photometric large-scale structure studies. redMaGiC achieves this by self-training the color-cuts necessary to produce a luminosity-thresholded LRG sample of constant comoving density. We demonstrate that redMaGiC photo-zs are very nearly as accurate as the best machine-learning based methods, yet they require minimal spectroscopic training, do not suffer from extrapolation biases, and are very nearly Gaussian. We apply our algorithm to Dark Energy Survey (DES) Science Verification (SV) data to produce a redMaGiC catalog sampling the redshift range z ∈ [0.2, 0.8]. Our fiducial sample has a comoving space density of 10-3 (h-1Mpc)-3, and a median photo-z bias (zspec - zphoto) and scatter (σz/(1 + z)) of 0.005 and 0.017 respectively. The corresponding 5σ outlier fraction is 1.4%. We also test our algorithm with Sloan Digital Sky Survey (SDSS) Data Release 8 (DR8) and Stripe 82 data, and discuss how spectroscopic training can be used to control photo-z biases at the 0.1% level.

  10. redMaGiC: selecting luminous red galaxies from the DES Science Verification data

    Energy Technology Data Exchange (ETDEWEB)

    Rozo, E. [Univ. of Arizona, Tucson, AZ (United States). et al.

    2016-05-30

    We introduce redMaGiC, an automated algorithm for selecting Luminous Red Galaxies (LRGs). The algorithm was developed to minimize photometric redshift uncertainties in photometric large-scale structure studies. redMaGiC achieves this by self-training the color-cuts necessary to produce a luminosity-thresholded LRG sam- ple of constant comoving density. Additionally, we demonstrate that redMaGiC photo-zs are very nearly as accurate as the best machine-learning based methods, yet they require minimal spectroscopic training, do not suffer from extrapolation biases, and are very nearly Gaussian. We apply our algorithm to Dark Energy Survey (DES) Science Verification (SV) data to produce a redMaGiC catalog sampling the redshift range z ϵ [0.2,0.8]. Our fiducial sample has a comoving space density of 10-3 (h-1Mpc)-3, and a median photo-z bias (zspec zphoto) and scatter (σz=(1 + z)) of 0.005 and 0.017 respectively.The corresponding 5σ outlier fraction is 1.4%. We also test our algorithm with Sloan Digital Sky Survey (SDSS) Data Release 8 (DR8) and Stripe 82 data, and discuss how spectroscopic training can be used to control photo-z biases at the 0.1% level.

  11. Cancer chemopreventive and therapeutic activities of red ginseng.

    Science.gov (United States)

    Xiaoguang, C; Hongyan, L; Xiaohong, L; Zhaodi, F; Yan, L; Lihua, T; Rui, H

    1998-02-01

    Red ginseng extract A and B are the active components of Panax ginseng. Red ginseng is a classical traditional Chinese medicine. Among Chinese herbs, red ginseng has been considered as one of the tonics. Many studies indicated that red ginseng could enhance immune function of the human body. The effects of red ginseng extracts on transplantable tumors, proliferation of lymphocyte, two-stage model and rat liver lipid peroxidation were studied. In a two-stage model, red ginseng extracts had a significant cancer chemoprevention. At 50-400 mg/kg, they could inhibit DMBA/Croton oil-induced skin papilloma in mice, decrease the incidence of papilloma, prolong the latent period of tumor occurrence and reduce tumor number per mouse in a dose-dependent manner. Red ginseng extract B could effectively inhibit the Fe2+/cysteine-induced lipid peroxidation of rat liver microsome, suggesting that red ginseng extract B has a stronger antioxidative effect than that of extract A. The results indicated that red ginseng extracts (50 approximately 400 mg/kg) could significantly inhibit the growth of transplantable mouse sarcoma S180 and melanoma B16. Red ginseng extracts A (0.5 mg/ml) and B (0.1 and 0.25 mg/ml) might effectively promote the transformation of T lymphocyte, but there was no influence on lymphocyte proliferation stimulated by concanavalin A. This suggests that red ginseng extracts have potent tumor therapeutic activity and improve the cell immune system. PMID:9533434

  12. Evaluar el funcionamiento de una red. La red de apoyo a la gestión educativa, RedAGE

    OpenAIRE

    Gairín Sallán, Joaquín; Rodríguez-Gómez, David; Muñoz Moreno, José Luís

    2012-01-01

    La creación de redes interinstitucionales se vislumbra como una estrategia excelente para impulsar la investigación y la práctica de la gestión educativa en el contexto iberoamericano, como una de las disciplinas claves para la mejora educativa, ante la tendencia descentralizadora de los sistemas educativos, la extensión de la participación en los centros educativos y la complejidad inherente al fenómeno educativo. La presente aportación presenta el diseño de evaluación de la Red de Apoyo a l...

  13. Red-Enhanced White-Light-Emitting Diode Using a New Red Phosphor

    Science.gov (United States)

    Yamada, Motokazu; Naitou, Takahiro; Izuno, Kunihiro; Tamaki, Hiroto; Murazaki, Yoshinori; Kameshima, Masatoshi; Mukai, Takashi

    2003-01-01

    We fabricated a high-color-rendering, red-enhanced white-light-emitting diode (LED) using a new red phosphor and a short-wavelength YAG phosphor. When the new white-LED was operated at a forward-bias current of 20 mA at room temperature (RT), color temperature (Tcp), the general color rendering index (Ra) and luminous efficiency were 4670 K, 87.7 and 25.5 lm/W, respectively. Most of the color-rendering indexes (CRIs) of the new white-LED were larger than those of current white-LEDs, in which only YAG is used. In particular, the CRI-No.9 value, which shows the color reproduction in the red region, is improved from -2.5 to 62.6.

  14. Can Lutjanus purpureus (South red snapper be "legally" considered a red snapper (Lutjanus campechanus?

    Directory of Open Access Journals (Sweden)

    Grazielle Gomes

    2008-01-01

    Full Text Available Red snappers (Lutjanus purpureus in Brazil and Lutjanus campechanus in USA and Gulf of Mexico are both under clear effect of overfishing. Because of their high morphological similarity it has already been suggested that they could possibly be considered as a single species. To investigate the degree of similarity and the genetic structure of red snapper populations we constructed a common dataset of partial D-loop mtDNA sequences of L. purpureus from Brazil (Amapá, Pará and Maranhão and L. campechanus from the Atlantic coast of the USA (Florida, Louisiana and Mississippi. Phylogenetic and population genetic analyses surprisingly depicted high similarity between L. campechanus and L. purpureus, compatible with the hypothesis of a single species of red snapper for the Western Atlantic Ocean. These preliminary but very curious findings open an important discussion regarding the legislation involved on the capture of this overexploited fish resources as well as regarding their taxonomy.

  15. NMR water-proton spin-lattice relaxation time of human red blood cells and red blood cell suspensions

    International Nuclear Information System (INIS)

    NMR water-proton spin-lattice relaxation times were studied as probes of water structure in human red blood cells and red blood cell suspensions. Normal saline had a relaxation time of about 3000 ms while packed red blood cells had a relaxation time of about 500 ms. The relaxation time of a red blood cell suspension at 50% hematocrit was about 750 ms showing that surface charges and polar groups of the red cell membrane effectively structure extracellular water. Incubation of red cells in hypotonic saline increases relaxation time whereas hypertonic saline decreases relaxation time. Relaxation times varied independently of mean corpuscular volume and mean corpuscular hemoglobin concentration in a sample population. Studies with lysates and resealed membrane ghosts show that hemoglobin is very effective in lowering water-proton relaxation time whereas resealed membrane ghosts in the absence of hemoglobin are less effective than intact red cells. 9 refs.; 3 figs.; 1 table

  16. Sizing Up Red-Giant Twins

    Science.gov (United States)

    Kohler, Susanna

    2016-02-01

    In KIC 9246715, two red-giant stars twins in nearly every way circle each other in a 171-day orbit. This binary pair may be a key to learning about masses and radii of stars with asteroseismology, the study of oscillations in the interiors of stars.Two Ways to MeasureIn order to understand a stars evolution, it is critical that we know its mass and radius. Unfortunately, these quantities are often difficult to pin down!One of the few cases in which we can directly measure stars masses and radii is in eclipsing binaries, wherein two stars eclipse each other as they orbit. If we have a well-sampled light curve for the binary, as well as radial velocities for both stars, then we can determine the stars complete orbital information, including their masses and radii.But there may be another way to obtain stellar mass and radius: asteroseismology. In asteroseismology, oscillations inside stars are used to characterize the stellar interiors. Conveniently, if a star with a convective envelope exhibits solar-like oscillations, these oscillations can be directly compared to those of the Sun. Mass and radius scaling relations which use the Sun as a benchmark and scale based on the stars temperature can then be used to derive the mass and radius of the star.Test Subjects from KeplerSolar-like oscillations from KIC 9246715 are shown in red across different resonant frequencies. The oscillations of a single red-giant star with similar properties are shown upside down in grey for reference. [Rawls et al. 2016]Of course, scaling relations are only useful if we can test them! A team of scientists including Meredith Rawls (New Mexico State University) has identified 18 red-giant eclipsing binaries in the Kepler field of view that also exhibit solar-like oscillations perfect for testing the scaling relations.In a recent study led by Rawls, the team analyzed the first of these binaries, KIC 9246715. Using the Kepler light curves in addition to radial velocity measurements from high

  17. On the clustering of faint red galaxies

    Science.gov (United States)

    Xu, Haojie; Zheng, Zheng; Guo, Hong; Zhu, Ju; Zehavi, Idit

    2016-08-01

    Faint red galaxies in the Sloan Digital Sky Survey show a puzzling clustering pattern in previous measurements. In the two-point correlation function (2PCF), they appear to be strongly clustered on small-scales, indicating a tendency to reside in massive haloes as satellite galaxies. However, their weak clustering on large scales suggests that they are more likely to be found in low mass haloes. The interpretation of the clustering pattern suffers from the large sample variance in the 2PCF measurements, given the small volume of the volume-limited sample of such faint galaxies. We introduce a method to improve the clustering measurements of faint galaxies by making a full use of a flux-limited sample to obtain volume-limited measurements with an increased effective volume. In the improved 2PCF measurements, the fractional uncertainties on large-scales drop by more than 40 per cent, and the strong contrast between small-scale and large-scale clustering amplitudes seen in previous work is no longer prominent. From halo occupation distribution modelling of the measurements, we find that a considerable fraction of faint red galaxies to be satellites in massive haloes, a senario supported by the strong covariance of small-scale 2PCF measurements and the relative spatial distribution of faint red galaxies and luminous galaxies. However, the satellite fraction is found to be degenerate with the slope of the distribution profile of satellites in inner haloes. We compare the modelling results with semi-analytic model predictions and discuss the implications.

  18. Spectroscopy of red dravite from northern Tanzania

    Science.gov (United States)

    Taran, Michail N.; Dyar, M. Darby; Naumenko, Ievgen V.; Vyshnevsky, Olexij A.

    2015-07-01

    Low-Fe dravite with a formula of Na0.66Ca0.16Mg2.62Fe0.33Mn0.02Ti0.02Al5.95B3Si6.04O27(OH)4 is described from Engusero Sambu, northern Tanzania (On maps, Engusero Sambu may be found to be marked as belonging to Kenya, but in reality, it is located near the border in northern Tanzania). The sample has an unusual red color that is distinctly different from the red dravite from the Osarara, Narok district, in Kenya that was formerly studied by Mattson and Rossman (Phys Chem Miner 14:225-234, 1984) and Taran and Rossman (Am Mineral 87:1148-1153, 2002). This unique sample has been characterized by optical and Mössbauer spectral measurements to investigate underlying cause of the intense bands in absorption spectra that give rise to the red color. These features are shown to be caused by exchange-coupled Fe3+-Fe3+ interactions. Thermal annealing of the samples causes an increase in Fe3+ contents due to oxidation of [Y]Fe2+. However, heat treatment does not change the high-energy absorption edge, which is probably caused by intense ligand-to-Fe3+ charge-transfer UV bands. In fact, Mössbauer results show that high-temperature annealing initiates breakdown of the tourmaline into an Fe oxide and causes accompanying redistribution of Fe3+ within the structure. Because of the popularity of tourmaline as a gemstone, this work has implications for understanding the causes of color in tourmaline, facilitating recognition of the distinctions between naturally occurring and treated tourmalines in the gem industry and enabling heat treatments for color enhancement.

  19. Categorical perception for red and brown.

    Science.gov (United States)

    Witzel, Christoph; Gegenfurtner, Karl R

    2016-04-01

    Recent studies suggest that the widely accepted evidence in support of categorical perception of color may be a confound of effects due to low-level sensory mechanisms that are unrelated to color categories. To reveal genuine category effects, we investigated the category boundary least prone to spurious effects of low-level mechanisms: the boundary between red and brown. We tested for low-level sensory and high-level cognitive effects of categories on color discrimination, while carefully controlling potential factors of color vision that are not related to color categories. First, we established the red-brown boundary through a naming task and measured just-noticeable differences (JNDs) for colors across the boundary. If low-level sensitivity to color differences was categorical, JNDs should decrease toward the boundary. However, this was not the case. Second, we measured performance in terms of response times and error rates in a speeded discrimination task with color pairs that were equalized in discriminability based on the empirical JNDs. There was a boost of performance (lower response times and error rates) for identifying color differences in equally discriminable color pairs, when the colors crossed the boundary. Given the particularity of the red-brown boundary, these results prove that the observed effects were due to color categories rather than low-level visual mechanisms. These findings support the idea that category effects are due to a shift of attention to the linguistic distinction between categories, rather than being a pure product of perception. These category effects do not depend on the hemispheric lateralization of language. (PsycINFO Database Record PMID:26569337

  20. Red wines good, white wines bad?

    International Nuclear Information System (INIS)

    Full text: In 1994, free radicals were discovered in red wines, but only in whites exposed to skins and seeds, and/or oak. The radicals are on the phenolics, and therefore a measure of phenolic content. In 1995, Fuhrman, Levy and Aviram published a study showing antioxidant effects of red wine in the standard Israeli diet, but pro-oxidant effects of the white wine used. No phenolic analysis was done, but low or no phenolics were suspected. Letters to the winery used by Aviram proved fruitless. In 2001, Aviram admits that to see a significant antioxidant effect from white wine, he must make his own, giving it skin and seed contact, and adding alcohol to the fermenting stage, to leach out more tannin from the seeds. This would be unsaleable as a table wine, but not as a 'fortified' or 'dessert' wine. A completely independent study by van Velden in South Africa, with phenol analysis of wines, shows pro- oxidant behaviour of white wines low or lacking in phenolic content. This will be summarised. A Japanese study of the antioxidant properties of some wines shows none for wines low or lacking in catechin content. In the 1950's, two similar but independent studies on different laboratory animals showed no ill effects from 10% alcohol red wine in their diet, but serious effects from 10% pure alcohol - water mix. Conclusion. Drinking only of white wines lacking in phenols, either due to 'fining', or to deliberate avoidance in making, at the recommended 'moderate' drinking level, may be deleterious to cardiovascular health, because of their pro-oxidant action, now established

  1. Hidden values in bauxite residue (red mud): recovery of metals.

    Science.gov (United States)

    Liu, Yanju; Naidu, Ravi

    2014-12-01

    Bauxite residue (red mud) is a hazardous waste generated from alumina refining industries. Unless managed properly, red mud poses significant risks to the local environment due to its extreme alkalinity and its potential impacts on surface and ground water quality. The ever-increasing generation of red mud poses significant challenges to the aluminium industries from management perspectives given the low proportion that are currently being utilized beneficially. Red mud, in most cases, contains elevated concentrations of iron in addition to aluminium, titanium, sodium and valuable rare earth elements. Given the scarcity of iron supply globally, the iron content of red mud has attracted increasing research interest. This paper presents a critical overview of the current techniques employed for iron recovery from red mud. Information on the recovery of other valuable metals is also reviewed to provide an insight into the full potential usage of red mud as an economic resource rather than a waste. Traditional hydrometallurgy and pyrometallurgy are being investigated continuously. However, in this review several new techniques are introduced that consider the process of iron recovery from red mud. An integrated process which can achieve multiple additional values from red mud is much preferred over the single process methods. The information provided here should help to improve the future management and utilization of red mud. PMID:25269817

  2. Red clothing increases perceived dominance, aggression and anger.

    Science.gov (United States)

    Wiedemann, Diana; Burt, D Michael; Hill, Russell A; Barton, Robert A

    2015-05-01

    The presence and intensity of red coloration correlate with male dominance and testosterone in a variety of animal species, and even artificial red stimuli can influence dominance interactions. In humans, red stimuli are perceived as more threatening and dominant than other colours, and wearing red increases the probability of winning sporting contests. We investigated whether red clothing biases the perception of aggression and dominance outside of competitive settings, and whether red influences decoding of emotional expressions. Participants rated digitally manipulated images of men for aggression and dominance and categorized the emotional state of these stimuli. Men were rated as more aggressive and more dominant when presented in red than when presented in either blue or grey. The effect on perceived aggression was found for male and female raters, but only male raters were sensitive to red as a signal of dominance. In a categorization test, images were significantly more often categorized as 'angry' when presented in the red condition, demonstrating that colour stimuli affect perceptions of emotions. This suggests that the colour red may be a cue used to predict propensity for dominance and aggression in human males. PMID:25972401

  3. Effect of Light on Flavonoids Biosynthesis in Red Rice Rdh

    Institute of Scientific and Technical Information of China (English)

    HAN Lei; DONG Bao-cheng; YANG Xiao-ji; HUANG Cheng-bin; WANG Xu-dong; WU Xian-jun

    2009-01-01

    The effect of light on flavonoids biosynthesis in red rice Rdh was studied.The panicles of red rice Rdh produced colorless caryopses after darkness treatment;and these colorless caryopses displayed bright-red after vanillin treatment,but did not display red color after light inducing for 15 days,suggesting that red rice Rdh could produce leucoanthocyanidin,but could not produce polyproanthocyanidins in darkness.Histological study revealed that the aleurone layers of Rdh colorless caryopses displayed bright-red after vanillin assay,but the pericarp and seed coat layers did not display color change,which indicated that the aleurone layers could accumulate precursors of polyproanthocyanidins in darkness,but the pericarp and seed coat could not.Additionally,color ofRdh caryopses changed from green in immaturity to red in maturity,and the green caryopses changed color from green to red gradually indoor for 7 days after harvest,suggesting that leucoanthocyanidins could synthesize polyproanthocyanidins.It was concluded that light was necessary for red pigment biosynthesis in red rice Rdh,leucoanthocyanidins biosyntheses in the aleurone layers did not need light,leucoanthocyanidins biosynthesis in pericarp and seed coat needed light inducing,the effect of leucoanthocyanidin biosynthesis in Rdh to light had tissue specificity.

  4. "mbigoo!", la red social para foodies.

    OpenAIRE

    García Pumar, Javier

    2016-01-01

    Este trabajo fin de grado consiste en la elaboración de la web de una red social para aficionados a la gastronomía, englobando todo el ciclo de procesos de creación y siguiendo los principios del diseño centrado en el usuario (DCU), para obtener un primer prototipo con unas funcionalidades mínimas, que sea flexible y ampliable en el futuro, y que represente una opción de negocio. A partir de analizar las tendencias actuales, surge la gastronomía como un campo en plena ebullición, ...

  5. Bicentenarios digitales: celebraciones en la red

    OpenAIRE

    Alvar De la Llosa

    2011-01-01

    Si  la celebración del primer centenario de las independencias de los países americanos se valió de las innovaciones de los medios de comunicación de su época, en particular del cine, hoy en día los gobiernos han asaltado la Red y se han apoderado del media para difundir una versión oficial. Conviene por lo tanto ver cómo los diferentes países latinoamericanos construyen este Bicentenario siempre de modo nacional y unilateral y nunca transnacional, en el marco de unas fronteras modernas a pes...

  6. China’s Red-Canned Beverage

    Institute of Scientific and Technical Information of China (English)

    2010-01-01

    Herbal tea brand Wong Lo Kat gets global recognition for its product quality and embracing the traditional Chinese culture of health c oca Cola isn’t the only company with an iconic red can anymore-Wong Lo Kat herbal tea is gaining recognition worldwide. At the 15th World Congress of Food Science and Technology held on August 23 in Cape Town,South Africa,the canned Wong Lo Kat herbal tea,produced by The JDB Group,won the Global Food Industry Award.It is the first Chinese beverage brand to win this award.

  7. The red tree. Fictionality improves our heahth.

    OpenAIRE

    Mart??n Castilla, Cristina

    2014-01-01

    The theoretical basis for the present work is reader response criticism, a school of literary theory that focuses on the reader and his or her experience of a literary work. According to this school of thought, the reader of a particular text is an active agent who completes the meaning of the work through interpretation. So, meaning is created by the interaction of the reader and the text. I have chosen to work with the picture book The Red Tree by Shaun Tan because its interpretation dep...

  8. Energetic Efficiency of red palm oil

    OpenAIRE

    Byron Jiménez

    2013-01-01

    The main goal of this paper is to determine the energy efficiency in the production of red palm oil (Elaeis guineensis) by using the biophysical indicator EROI, postulated by the Ecological Economics. This indicator is applied to compare the energy used in the preparation of synthetic fertilizers (to fill its nutritional demands) versus the energy contained in the oil. In 2009, there were 195.550 hectares of land planted with African palm in Ecuador (INEC, 2011). In addition, between 2002 and...

  9. Zooplankton at deep Red Sea brine pools

    KAUST Repository

    Kaartvedt, Stein

    2016-03-02

    The deep-sea anoxic brines of the Red Sea comprise unique, complex and extreme habitats. These environments are too harsh for metazoans, while the brine–seawater interface harbors dense microbial populations. We investigated the adjacent pelagic fauna at two brine pools using net tows, video records from a remotely operated vehicle and submerged echosounders. Waters just above the brine pool of Atlantis II Deep (2000 m depth) appeared depleted of macrofauna. In contrast, the fauna appeared to be enriched at the Kebrit Deep brine–seawater interface (1466 m).

  10. 12CO emission from the Red Rectangle

    International Nuclear Information System (INIS)

    Observations of an unprecedented quality made by ALMA on the Red Rectangle of CO(3–2) and CO(6–5) emissions are analysed jointly with the aim of obtaining as simple as possible a description of the gas morphology and kinematics. Evidence is found for polar conical outflows and for a broad equatorial torus in rotation and expansion. Simple models of both are proposed. Comparing CO(6–5) and CO(3–2) emissions provides evidence for a strong temperature enhancement over the polar outflows. Continuum emission (dust) is seen to be enhanced in the equatorial region. Observed asymmetries are briefly discussed. (paper)

  11. Portal de compraventa con red social

    OpenAIRE

    Montero Vegas, Toni

    2010-01-01

    Este proyecto ha sido diseñado con la intención de añadir una aplicación a la red en la que un usuario que disponga de una necesidad, ya sea de compra o de venta, de un articulo pueda disponer de un medio más para vender en el que además, pueda hacer amistad con otros usuarios y que pueda interaccionar con todos estos usuarios, tanto amigo como simples usuarios bajo su punto de vista. Para poder realizar el proyecto, se han utilizado frameworks existentes como por ejemplo Ibatis, para la c...

  12. Red Tide Strands South African Rock Lobsters

    Science.gov (United States)

    2002-01-01

    Although some red tides form a healthy part of phytoplankton production, recurrent harmful or toxic blooms also occur, with results depending upon the type of plankton and on atmospheric and oceanic conditions. At Elands Bay in South Africa's Western Cape province, about 1000 tons of rock lobsters beached themselves during February 2002, when the decay of dense blooms of phytoplankton caused a rapid reduction in the oxygen concentration of nearshore waters. The lobsters (or crayfish, as they are known locally) moved toward the breaking surf in search of oxygen, but were stranded by the retreating tide. The Multi-angle Imaging SpectroRadiometer's nadir camera acquired these red, green, blue composites on February 2 and 18, 2002, during Terra orbits 11315 and 11548. The colors have been accentuated to highlight the bloom, and land and water have been enhanced separately. The two views show the shoreward migration of the algal bloom. Each image represents an area of about 205 kilometers x 330 kilometers. Elands Bay is situated near the mouth of the Doring River, about 75 kilometers northeast of the jutting Cape Columbine. The term 'red tide' is used to refer to a number of different types of phytoplankton blooms of various hues. The wine color of certain parts of this bloom are consistent with the ciliate species Mesodinium rubrum, which has been associated with recurring harmful algal blooms along the Western Cape coast. Under these conditions, the lobsters are not poisoned. During the recent event, government and military staff transported as many of the living lobsters as possible to areas that were less affected by the red tide. At the same time, people came from across South Africa to gather the undersized creatures for food. The effects of the losses on the maritime economy are expected to be felt over the next few years. MISR was built and is managed by NASA's Jet Propulsion Laboratory, Pasadena, CA, for NASA's Office of Earth Science, Washington, DC. The Terra

  13. Wide reflected angle DBR red light LED

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    The coupled DBR LED with one DBR for reflecting normal incidence light and the other for reflecting inclined incidence light has been grown by MOCVD. For improving the conventional DBR which was used to increase light extraction efficiency in A1GaInP red light LED is analyzed. At 20 mA Dc injection current, the LED peak wave length is 630 nm, and the light intensity of on axis is 137 mcd. The output light power is 2.32 mW. The light intensity and output light power have been improved compared with the conventional LEDs.

  14. Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein

    NARCIS (Netherlands)

    Shaner, Nathan C; Campbell, Robert E; Steinbach, Paul A; Giepmans, Ben N G; Palmer, Amy E; Tsien, Roger Y

    2004-01-01

    Fluorescent proteins are genetically encoded, easily imaged reporters crucial in biology and biotechnology. When a protein is tagged by fusion to a fluorescent protein, interactions between fluorescent proteins can undesirably disturb targeting or function. Unfortunately, all wild-type yellow-to-red

  15. Comparison of Bloat Potential Between Soft-Red and Hard-Red Winter Wheat Forages

    Science.gov (United States)

    Some aspects of wheat pasture bloat have been researched extensively, but few studies have evaluated the effect of wheat type on bloat. Eight Gelbvieh ' Angus ruminally cannulated heifers (1,135 ± 108 lb BW) and 48 Angus heifers (525 ± 26 lb BW) grazed 2.5-acre pastures of either hard-red or soft-re...

  16. Comparison of Bloat Potential Between Hard Red and Soft Red Winter Wheat

    Science.gov (United States)

    Some aspects of wheat pasture bloat have been researched extensively, but little research has evaluated the effects of wheat type on bloat. Forty-eight Angus stocker calves (238 ± 12 kg BW) and 8 Angus ruminally cannulated heifers (515 ± 49 kg BW) grazed 1-ha pastures of either hard red (HR) or sof...

  17. RED-PD算法的仿真研究%Simulation Study of RED with Preferential Dropping

    Institute of Scientific and Technical Information of China (English)

    宋欣; 康健; 杨晓萍; 陈虹

    2006-01-01

    随机早期检测(RED:Random Early Detection)是IETF推荐的一种基于路由器有效的主动队列管理算法,但是在某些情况下,一些数据量很大的数据流会大量占用带宽,从而导致了各流量之间带宽分配的不公平性,甚至产生拥塞崩溃.对Mahajan提出的一种基于RED分组丢弃历史的AQM(Active Queue Management)算法RED-PD(RED with Preferential Dropping)进行了深入研究.该算法通过对被检测出的高带宽流的数据包采用提前丢弃的策略,实现带宽分配的公平性.通过仿真发现了RED-PD算法的自适应性,表明此算法有更高的理论和实用价值.

  18. Red gaming in support of the war on terrorism : Sandia Red Game report.

    Energy Technology Data Exchange (ETDEWEB)

    Moore, Judy Hennessey; Whitley, John B.; Craft, Richard Layne, II

    2004-02-01

    The Advanced Concepts Group (ACG) at Sandia National Laboratories is exploring the use of Red Teaming to help intelligence analysts with two key processes: determining what a piece or pieces of information might imply and deciding what other pieces of information need to be found to support or refute hypotheses about what actions a suspected terrorist organization might be pursuing. In support of this effort, the ACG hosted a terrorism red gaming event in Albuquerque on July 22-24, 2003. The game involved two 'red teams' playing the roles of two terrorist cells - one focused on implementing an RDD attack on the DC subway system and one focused on a bio attack against the same target - and two 'black teams' playing the role of the intelligence collection system and of intelligence analysts trying to decide what plans the red teams might be pursuing. This exercise successfully engaged human experts to seed a proposed compute engine with detailed operational plans for hypothetical terrorist scenarios.

  19. Dynamics of ryegrass P in red soils

    Institute of Scientific and Technical Information of China (English)

    XiHai-Fu; ZhangQin-Zheng; 等

    1998-01-01

    An investigation on the dynamics of transformation of P from 32P-labelled ryegrass in red soils was conducted in laboratory.The results showed thast the rapid increase in flush 32P related with biomass P was accompanied with the decrease in extractable 32P on the first 3d of incubation in both sandy and clayey soils,and afterwards,itdisplayed great fluctuation in sandy soil,but hadlittle fluctuaston in clayey soil during 3-20d of incubation.At the later stage of incubation,the increase in extractable 32P was accompanied with decrease in flush 32P.The opposite changes in content of extractable 32P and flush 32P suggested transformation of ryegrass P was clkosely related to its utilization and its release from microorganisms in red soils.It can be concluded that addition of organic matter accelerated the release of soil native P according to the changes in the extractable soil P during incubation.

  20. Mechanosensing Dynamics of Red blood Cells

    Science.gov (United States)

    Wan, Jiandi

    2015-11-01

    Mechanical stress-induced deformation of human red blood cells (RBCs) plays important physiopathological roles in oxygen delivery, blood rheology, transfusion, and malaria. Recent studies demonstrate that, in response to mechanical deformation, RBCs release adenosine-5'-triphosphate (ATP), suggesting the existence of mechanotransductive pathways in RBCs. Most importantly, the released ATP from RBCs regulates vascular tone and impaired release of ATP from RBCs has been linked to diseases such as type II diabetes and cystic fibrosis. To date, however, the mechanisms of mechanotransductive release of ATP from RBCs remain unclear. Given that RBCs experience shear stresses continuously during the circulation cycle and the released ATP plays a central role in vascular physiopathology, understanding the mechanotransductive release of ATP from RBCs will provide not only fundamental insights to the role of RBCs in vascular homeostasis but also novel therapeutic strategies for red cell dysfunction and vascular disease. This talk describes the main research in my group on integrating microfluidic-based approaches to study the mechanosensing dynamics of RBCs. Specifically, I will introduce a micro?uidic approach that can probe the dynamics of shear-induced ATP release from RBCs with millisecond resolution and provide quantitative understandings of the mechanosensitive ATP release processes in RBCs. Furthermore, I will also describe our recent findings about the roles of the Piezo1 channel, a newly discovered mechanosensitive cation channel in the mechanotransductive ATP release in RBCs. Last, possible functions of RBCs in the regulation of cerebral blood flow will be discussed.

  1. XMM-NEWTON Observations of Red AGN

    CERN Document Server

    Wilkes, B J; Schmidt, G D; Smith, P S; Cutri, R M; Ghosh, H; Nelson, B; Hines, D C

    2005-01-01

    XMM-Newton spectra of five red, 2MASS AGN, selected from a sample observed by Chandra to be relatively X-ray bright and to cover a range of hardness ratios, confirm the presence of substantial absorbing material in three sources with optical classifications ranging from Type 1 to Type 2. A flat (hard), power law continuum is observed in the other two. The combination of X-ray absorption and broad optical emission lines suggests either a small (nuclear) absorber or a favored viewing angle so as to cover the X-ray source but not the broad emission line region (BELR). A soft excess is detected in all three Type 1 sources. We speculate that this may arise in an extended region of ionised gas, perhaps linked with the polarised (scattered) optical light present in these sources. The spectral complexity revealed by XMM-Newton emphasizes the limitations of the low S/N \\chandra data. The new results strengthen our earlier conclusions that the observed X-ray continua of red AGN are unusually hard at energies >2 keV. Th...

  2. The ERE of the "Red Rectangle" revisited

    CERN Document Server

    Van Winckel, H; Gull, T R; Winckel, Hans Van; Cohen, Martin; Gull, Ted R.

    2002-01-01

    We present in this paper high signal-to-noise long-slit optical spectra of the Extended Red Emission (ERE) in the "Red Rectangle" (RR) nebula. These spectra, obtained at different positions in the nebula, reveal an extremely complex emission pattern on top of the broad ERE continuum. It is well known that three features converge at large distance from the central object, in wavelength and profile to the diffuse interstellar bands (DIBs) at 5797, 5849.8 and 6614 ang., (e.g. Sarre et al., 1995). In this paper we give a detailed inventory of all spectral subfeatures observed in the 5550--6850 ang. spectral range. Thanks to our high S/N spectra, we propose 5 new features in the RR that can be associated with DIBs. For the 5550--6200 ang. spectral range our slit position was on top of the NE spike of the X shaped nebula. A detailed description of the spatial profile-changes is given of the strongest features revealing that even far out in the nebula at 24 arcsec from the central star, there remains a small shift i...

  3. Modifying alumina red mud to support a revegetation cover

    Science.gov (United States)

    Xenidis, A.; Harokopou, A. D.; Mylona, E.; Brofas, G.

    2005-02-01

    Alumina red mud, a fine-textured, iron-rich, alkaline residue, is the major waste product of bauxite digestion with caustic soda to remove alumina. The high alkalinity and salinity as well as the poor nutrient status are considered to be the major constraints of red mud revegetation. This research was conducted to evaluate the ameliorating effect of gypsum, sewage sludge, ferrous sulfate, ammonium sulfate, ammonium nitrate, and calcium phosphate on alumina red mud. The effectiveness of the mixtures was evaluated by applying extraction tests and performing experiments using six plant species. Gypsum amendment significantly reduced the pH, electrical conductivity, and sodium and aluminum content of red mud. Sewage sludge application had an extended effect in improving both the soil structure and the nutrient status of the gypsum-amended red mud. Together with the gypsum and sewage sludge, calcium phosphate application into red mud enhanced plant growth and gave the most promising results.

  4. Calcification-carbonation method for red mud processing.

    Science.gov (United States)

    Li, Ruibing; Zhang, Tingan; Liu, Yan; Lv, Guozhi; Xie, Liqun

    2016-10-01

    Red mud, the Bayer process residue, is generated from alumina industry and causes environmental problem. In this paper, a novel calcification-carbonation method that utilized a large amount of the Bayer process residue is proposed. Using this method, the red mud was calcified with lime to transform the silicon phase into hydrogarnet, and the alkali in red mud was recovered. Then, the resulting hydrogarnet was decomposed by CO2 carbonation, affording calcium silicate, calcium carbonate, and aluminum hydroxide. Alumina was recovered using an alkaline solution at a low temperature. The effects of the new process were analyzed by thermodynamics analysis and experiments. The extraction efficiency of the alumina and soda obtained from the red mud reached 49.4% and 96.8%, respectively. The new red mud with <0.3% alkali can be used in cement production. Using a combination of this method and cement production, the Bayer process red mud can be completely utilized. PMID:27214002

  5. Winter habitat selection of red-crowned crane (Grus japonensis)

    Institute of Scientific and Technical Information of China (English)

    张洪海; 杨月伟

    2000-01-01

    This paper studied the winter habitat selection of red-crowned cranes (Grus japonensis) in Yancheng National Natural Reserve, Jiangsu Province. There were six types of habitat used by red-crowned cranes, i.e. salt-works, aquiculture ponds, reed lands, grassy tidal lands, salting wormwood lands and wheat fields. The wheat field was a new type of habitat used by red-crowned cranes. More than 70 percent of red-crowned cranes chose grassy tidal lands, salting wormwood lands, and reed lands as their most important habitats. In recent years, the distribution of red-crowned cranes moved southward gradually. Red-crowned cranes prefer artificial or semi-artificial wetlands rather than original wetlands, successive distribution was broken into fragments.

  6. Range-wide success of red-cockaded woodpecker translocations.

    Energy Technology Data Exchange (ETDEWEB)

    Edwards, John W.; Costa, Ralph

    2004-12-31

    Edwards, John W.; Costa, Ralph. 2004. Range-wide success of red-cockaded woodpecker translocations. In: Red-cockaded woodpecker; Road to Recovery. Proceedings of the 4th Red-cockaded woodpecker Symposium. Ralph Costa and Susan J. Daniels, eds. Savannah, Georgia. January, 2003. Chapter 6. Translocation. Pp 307-311. Abstract: Red-cockaded woodpeckers (Picoides borealis) have declined range-wide during the past century, suffering from habitat loss and the effects of fire exclusion in older southern pine forests. Red-cockaded woodpecker translocations are a potentially important tool in conservation efforts to reestablish red-cockaded woodpeckers in areas from which they have been extirpated. Currently, translocations are critical in ongoing efforts to save and restore the many existing small populations. We examined the effects of demographic and environmental factors on the range-wide success of translocations between 1989 and 1995.

  7. Red fluorescent biofilm: the thick, the old, and the cariogenic

    OpenAIRE

    Volgenant, Catherine M.C.; Hoogenkamp, Michel A.; Mark J. Buijs; Zaura, Egija; ten Cate, Jacob (Bob) M.; Monique H. van der Veen

    2016-01-01

    Background: Some dental plaque fluoresces red. The factors involved in this fluorescence are yet unknown.Objective: The aim of this study was to assess systematically the effect of age, thickness, and cariogenicity on the extent of red fluorescence produced by in vitro microcosm biofilms.Design: The effects of biofilm age and thickness on red fluorescence were tested in a constant depth film fermentor (CDFF) by growing biofilms of variable thicknesses that received a constant supply of define...

  8. Red fluorescent biofilm: the thick, the old, and the cariogenic

    OpenAIRE

    Volgenant, Catherine M.C.; Hoogenkamp, Michel A.; Mark J. Buijs; Egija Zaura; ten Cate, Jacob (Bob) M.; Monique H. van der Veen

    2016-01-01

    Background: Some dental plaque fluoresces red. The factors involved in this fluorescence are yet unknown. Objective: The aim of this study was to assess systematically the effect of age, thickness, and cariogenicity on the extent of red fluorescence produced by in vitro microcosm biofilms. Design: The effects of biofilm age and thickness on red fluorescence were tested in a constant depth film fermentor (CDFF) by growing biofilms of variable thicknesses that received a constant supply of defi...

  9. Debunking the Effects of Taurine in Red Bull Energy Drink

    OpenAIRE

    Kim, Woojae

    2003-01-01

    Red Bull is a carbonated beverage that initially gained wide popularity in the U.S. during the late nineties. Taking root amongst college campuses, it appeared throughout underground clubs and eventually entered mainstream pop-culture. The manufactures claim that drinking Red Bull enhances physical endurance, concentration and reaction speed (1,6). The main ingredients of Red Bull include sugar, taurine, glucuronolactone and caffeine. It is hypothesized that the combinatorial influences o...

  10. RED AND PROCESSED MEAT AND CARDIOVASCULAR RISK FACTOR

    OpenAIRE

    Atalić, Bruno; TOTH, JURICA; ATALIĆ, VLASTA; RADANOVIĆ, DANIJELA; Miškulin, Maja; LUČIN, ANA

    2014-01-01

    Aims: The British National Diet and Nutrition 2000/1 Survey data set records on 1,724 respondents (766 males and 958 females) were analyzed in order to assess the potential influences of red and processed meat intakes on cardiovascular risk factors. Methods: Linear regression of the associations of the red, processed, combination of red and processed, and total meat intakes with body mass index (BMI), systolic blood pressure and plasma total cholesterol as cardiovascular risk factors was cond...

  11. Traceability in Red Meat: Market Opportunity or Threat?

    OpenAIRE

    Liddell, Sterling; Bailey, DeeVon

    2001-01-01

    Traceability poses market opportunities and threats for U.S. red meat producers for at least two reasons. First, consumers are becoming more concerned about the inputs and practices used to produce food and the ability to trace red meat to its source is an essential step in providing information to consumers about inputs and practices. Second, our principal competitors and customers in international red meat trade have been developing traceability systems. If our competitors are successful in...

  12. Prediction Research of Red Tide Based on Improved FCM

    OpenAIRE

    Xiaomei Hu; Dong Wang; Hewei Qu; Xinran Shi

    2016-01-01

    Red tides are caused by the combination effects of many marine elements. The complexity of the marine ecosystem makes it hard to find the relationship between marine elements and red tides. The algorithm of fuzzy c-means (FCM) can get clear classification of things and expresses the fuzzy state among different things. Therefore, a prediction algorithm of red tide based on improved FCM is proposed. In order to overcome the defect of FCM which is overdependent on the initial cluster centers and...

  13. Vibrios associated with red tides caused by Mesodinium rubrum.

    OpenAIRE

    Romalde, J L; Barja, J L; Toranzo, A E

    1990-01-01

    Vibrios were isolated from red tides caused by Mesodinium rubrum and also throughout the year in the Ria de Pontevedra, Spain. The isolates were grouped into 14 phena by numerical toxonomy. Strains associated with red tides were restricted to four phena: phena I and II were Vibrio alginolyticus, and phena III and IV were Vibrio tubiashii and Vibrio anguillarum, respectively. V. anguillarum-like strains (phena V through XI) predominated throughout the year outside the red tide areas. Cytotoxic...

  14. High Mortality of Red Sea Zooplankton under Ambient Solar Radiation

    OpenAIRE

    Al-Aidaroos, Ali M.; El-Sherbiny, Mohsen M. O.; Sathianeson Satheesh; Gopikrishna Mantha; Susana Agustī; Beatriz Carreja; Duarte, Carlos M.

    2014-01-01

    High solar radiation along with extreme transparency leads to high penetration of solar radiation in the Red Sea, potentially harmful to biota inhabiting the upper water column, including zooplankton. Here we show, based on experimental assessments of solar radiation dose-mortality curves on eight common taxa, the mortality of zooplankton in the oligotrophic waters of the Red Sea to increase steeply with ambient levels of solar radiation in the Red Sea. Responses curves linking solar radiatio...

  15. Adenovirus: an emerging factor in red squirrel Sciurus vulgaris conservation

    OpenAIRE

    Everest, David J; Shuttleworth, Craig M.; Stidworthy, Mark F.; Grierson, Sylvia S.; Duff, J. Paul; Kenward, Robert E.

    2014-01-01

    1. Adenovirus is an emerging threat to red squirrel Sciurus vulgaris conservation, but confirming clinically significant adenovirus infections in red squirrels is challenging. Rapid intestinal autolysis after death in wild animals frequently obscures pathology characteristic of the disease in animals found dead. 2. We review the available literature to determine current understanding of both subclinical and clinically significant adenovirus infections in free-living wild and captive red sq...

  16. Suitability of commercial product for Cyber Red Team operations

    OpenAIRE

    Kuusela, Jukka

    2016-01-01

    The purpose of this thesis was to study, evaluate and estimate how well commercial penetration and Advanced Persistent Threat (ATP) simulation applications suit Cyber Red Team operations. The beginning of the study clarifies the needs, ways of acting and the history of Red Teaming: what it is and why and when it is needed. Later on, more focus is set on the characteristics of Cyber Red Teaming. What are the typical steps in Cyber Red Team operations and what requirements these set to the ...

  17. A review of elasmobranch research in the Red Sea

    KAUST Repository

    Spaet, Julia L.

    2012-01-30

    Given the global concern about the status of elasmobranch fishes, the paucity of information on elasmobranchs in the Red Sea is worrisome. Management of elasmobranchs in areas other than the Red Sea has been helped by research on population ecology, reproductive biology and resource partitioning, subjects that are virtually absent in the Red Sea elasmobranch literature. This review provides the first comprehensive summary of elasmobranch biology in the Red Sea with the aim of facilitating research in a region that remains remarkably under-studied. © 2012 The Authors. Journal of Fish Biology © 2012 The Fisheries Society of the British Isles.

  18. Experience reverses the red effect among Chinese stockbrokers.

    Science.gov (United States)

    Zhang, Tengxiao; Han, Buxin

    2014-01-01

    Recent research has shown that the color red influences psychological functioning. Red is hypothesized to be linked to aggression and danger in evolution, and these links are enhanced by culture-specific uses of red. Thus, color meanings are thought to be grounded in biologically based proclivities and learned associations. However, to date, there has been no direct evidence for the influence of experience on the red effect. This study focused on whether experience could change the psychological effects of the color red. In the context of the Chinese stock market, contrary to the meaning generally associated with red as negative and green as positive, red represents a rise in stock price and green stands for a decrease. An experiment using a 2×2 between subjects factorial design demonstrated that red (compared with green) impaired Chinese college students' performance on an IQ test (in accordance with the red effect), but the opposite effect was found among stockbrokers. These results provide direct evidence of learned color meanings, in support of the general model of color effect. PMID:24586587

  19. Experience reverses the red effect among Chinese stockbrokers.

    Directory of Open Access Journals (Sweden)

    Tengxiao Zhang

    Full Text Available Recent research has shown that the color red influences psychological functioning. Red is hypothesized to be linked to aggression and danger in evolution, and these links are enhanced by culture-specific uses of red. Thus, color meanings are thought to be grounded in biologically based proclivities and learned associations. However, to date, there has been no direct evidence for the influence of experience on the red effect. This study focused on whether experience could change the psychological effects of the color red. In the context of the Chinese stock market, contrary to the meaning generally associated with red as negative and green as positive, red represents a rise in stock price and green stands for a decrease. An experiment using a 2×2 between subjects factorial design demonstrated that red (compared with green impaired Chinese college students' performance on an IQ test (in accordance with the red effect, but the opposite effect was found among stockbrokers. These results provide direct evidence of learned color meanings, in support of the general model of color effect.

  20. Fault tree analysis for red oil explosion in reprocessing facility

    International Nuclear Information System (INIS)

    Almost all spent fuel reprocessing facilities have adopted Purex process. The red oil explosion is a great concern in safety study of spent fuel reprocessing facilities adopting Purex process. The event tree and fault tree analysis was performed for the red oil explosion of a medium level radioactive waste liquid evaporator for the collective decontamination and separation cycle segment in a representative reprocessing facility in this paper. The results show that the occurrence frequency of a red oil explosion is extremely low, and human errors and common cause failures are major causes to a red oil explosion. Therefore, some relevant measures should be taken to prevent such accidents. (authors)

  1. Red Tides in Nagasaki Bay during Summer Season of 1979

    OpenAIRE

    Dahril, Tengku; Iizuka, Shoji

    1981-01-01

    Almost every year during the summer season, red tides have occurred in Nagasaki Bay. Red tides are caused by various kind of phytoplankton and bay waters discolor like coffee by the exclusive growth of a single organism or mixed growth of two or three organisms. However, very little is known about red tide in this bay. In this paper the authors dealt with red tides in Nagasaki Bay during the summer season of 1979. The innermost part of this bay was divided into 3 areas. Five water sampling st...

  2. Comparative study of stability in different TCP/RED models

    International Nuclear Information System (INIS)

    This paper studies the stability issue of the average queue length of a Transmission Control Protocol (TCP) model when interacting with Random Early Detection (RED). The model used for the study has shown period doubling bifurcation (PDB) and border collision bifurcation (BCB) in the average queue size at certain values of parameters when original RED is deployed. In this paper, we adopt a gentle version of RED and a newly derived RED algorithm into the model to study the improvement in stability of average queue size of the system

  3. Assessment of the exposure to Allura red colour from the consumption of red juice-based and red soft drinks in Italy

    OpenAIRE

    Fallico, Biagio; Chiappara, Elena; Elena, Arena; Gabriele, Ballistreri

    2011-01-01

    Abstract This paper reports on a survey and an exposure study, based on a probabilistic approach, concerning red juice-based and red soft drink products in Italy. This study highlighted that the estimations, both of consumption rates and colorant intakes, are related to the hypotheses of scenarios. In fact, the study estimated that, on the average, consumers of red soft drinks consume 53.1 litres per year, ranging from 39.1 litres to 70.7 litres of soft drink products under a scena...

  4. Noncytotoxic orange and red/green derivatives of DsRed-Express2 for whole-cell labeling

    Directory of Open Access Journals (Sweden)

    Glick Benjamin S

    2009-04-01

    Full Text Available Abstract Background Whole-cell labeling is a common application of fluorescent proteins (FPs, but many red and orange FPs exhibit cytotoxicity that limits their use as whole-cell labels. Recently, a tetrameric red FP called DsRed-Express2 was engineered for enhanced solubility and was shown to be noncytotoxic in bacterial and mammalian cells. Our goal was to create derivatives of this protein with different spectral properties. Results Building on previous studies of DsRed mutants, we created two DsRed-Express2 derivatives: E2-Orange, an orange FP, and E2-Red/Green, a dual-color FP with both red and green emission. We show that these new FPs retain the low cytotoxicity of DsRed-Express2. In addition, we show that these new FPs are useful as second or third colors for flow cytometry and fluorescence microscopy. Conclusion E2-Orange and E2-Red/Green will facilitate the production of healthy, stably fluorescent cell lines and transgenic organisms for multi-color labeling studies.

  5. Combined Heavy Metal Pollution in Red Soil

    Institute of Scientific and Technical Information of China (English)

    CHENHUAIMAN; ZHENGCHNURONG

    1996-01-01

    The effects of combined heavy metal pollution of red soil on the growth of wetland rice and the transfer of Pb,Cd,Cu and Zn from soil into plants were sudied by greenhouse pot experiment,The results showed that the plantyields were markedly affected by heavy metals,with the exception of Pb,in soils under the experimental conditions,without taking into consideration all the interactions among the elements.The concentrations of the elemets in plants were mainly affected by the specific element added to the soil.The effect of interactions among the heavy metals was very significant either on plant yields or on the concentration of the elements in plants.The risk assessment of a combined pollution by heavy metals in the soil is discussed preliminarily in terms of the relative pollution equivalent.

  6. Optical Spectroscopy of Distant Red Galaxies

    CERN Document Server

    Wuyts, Stijn; Franx, Marijn; Schreiber, Natascha M Forster; Illingworth, Garth D; Labbe, Ivo; Rudnick, Gregory

    2009-01-01

    We present optical spectroscopic follow-up of a sample of Distant Red Galaxies (DRGs) with K 2.3, in the Hubble Deep Field South, the MS 1054-03 field, and the Chandra Deep Field South. Spectroscopic redshifts were obtained for 15 DRGs. Only 2 out of 15 DRGs are located at z 2. The combined spectroscopic and photometric sample is used to analyze the distinct intrinsic and observed properties of DRGs at z 2. In our photometric sample to K < 22.5, low-redshift DRGs are brighter in K than high-redshift DRGs by 0.7 mag, and more extincted by 1.2 mag in Av. Our analysis shows that the DRG criterion selects galaxies with different properties at different redshifts. Such biases can be largely avoided by selecting galaxies based on their rest-frame properties, which requires very good multi-band photometry and high q uality photometric redshifts.

  7. IRAC Snapshot Imaging of Red Herschel Galaxies

    Science.gov (United States)

    Cooray, Asantha; Nayyeri, Hooshang; Wardlow, Julie; Ivison, Rob; Perez-Fournon, Ismael; Riechers, Dominik; Clements, David; Oliver, Seb; Oteo, Ivan

    2016-08-01

    Wide-field submillimeter surveys with Herschel have produced large samples of rare populations, which provide some of the most stringent constraints on galaxy formation theories. In this proposal we request IRAC observations of 'red' Herschel sources, which are the most extreme DSFGs at z>4. The proposed snapshot IRAC 3.6 and 4.5um data will probe the stellar emission from these systems - complementary data to the far-infrared dust emission that led to their identification. We will use these data to extend the SEDs into the near-IR regime and measure more reliable stellar masses than otherwise available. They will be combined with existing survey data and dedicated follow-up programs to map the evolution of DSFGs as a function of redshift, stellar mass and far-IR luminosity.

  8. Sunspot temperatures from red and blue photometry

    Science.gov (United States)

    Chapman, G. A.; Cookson, A. M.; Preminger, D. G.

    2011-08-01

    Photometric images are used to measure the temperature of sunspots at different wavelengths. Images at 672.3 nm and 472.3 nm are obtained at the San Fernando Observatory using the CFDT2 (2.5'' x 2.5'' pixels). Images at 607.1 nm and 409.4 nm are obtained by the PSPT at Mauna Loa Observatory. Monochromatic intensities are converted to temperatures as in Steinegger et al (1990). The pixel by pixel temperature for a sunspot is converted into a bolometric contrast for that sunspot according to Chapman et al (1994). Sunspot temperatures, i.e., their bolometric contrasts, are calculated from both red (672.3 nm) and blue wavelengths (472.3 nm) and compared.

  9. Metabolism of radiocaesium in red grouse

    International Nuclear Information System (INIS)

    Red grouse eat a natural diet mostly of heather, a dwarf shrub which accumulates radiocaesium. Captive grouse were fed a diet, comprising 60% heather contaminated with Chernobyl radiocaesium, containing about 1500 Bq kg-1 of radiocaesium. Intake and excretion of radiocaesium reached equilibrium after 20-23 days and its biological half-life was 10-11 days, with about 23% of the radiocaesium in the diet being absorbed by the bird. Transfer coefficients for both captives and wild birds were about 10 days kg-1. Radiocaesium activity concentrations in wild birds reflected those in their diet and it is suggested that the sampling of birds shot for sport could form an efficient means of monitoring radiocaesium levels in heather-dominated uplands in the UK. (Author)

  10. Brevetoxicosis: red tides and marine mammal mortalities.

    Science.gov (United States)

    Flewelling, Leanne J; Naar, Jerome P; Abbott, Jay P; Baden, Daniel G; Barros, Nélio B; Bossart, Gregory D; Bottein, Marie-Yasmine D; Hammond, Daniel G; Haubold, Elsa M; Heil, Cynthia A; Henry, Michael S; Jacocks, Henry M; Leighfield, Tod A; Pierce, Richard H; Pitchford, Thomas D; Rommel, Sentiel A; Scott, Paula S; Steidinger, Karen A; Truby, Earnest W; Van Dolah, Frances M; Landsberg, Jan H

    2005-06-01

    Potent marine neurotoxins known as brevetoxins are produced by the 'red tide' dinoflagellate Karenia brevis. They kill large numbers of fish and cause illness in humans who ingest toxic filter-feeding shellfish or inhale toxic aerosols. The toxins are also suspected of having been involved in events in which many manatees and dolphins died, but this has usually not been verified owing to limited confirmation of toxin exposure, unexplained intoxication mechanisms and complicating pathologies. Here we show that fish and seagrass can accumulate high concentrations of brevetoxins and that these have acted as toxin vectors during recent deaths of dolphins and manatees, respectively. Our results challenge claims that the deleterious effects of a brevetoxin on fish (ichthyotoxicity) preclude its accumulation in live fish, and they reveal a new vector mechanism for brevetoxin spread through food webs that poses a threat to upper trophic levels. PMID:15944690

  11. Supernova Shock Breakout from a Red Supergiant

    CERN Document Server

    Schawinski, Kevin; Wolf, Christian; Podsiadlowski, Philipp; Sullivan, Mark; Steenbrugge, Katrien C; Bell, Tony; Roeser, Hermann-Josef; Walker, Emma; Astier, Pierre; Balam, Dave; Balland, Christophe; Basa, Stephane; Carlberg, Ray; Conley, Alex; Fouchez, Dominque; Guy, Julien; Hardin, Delphine; Hook, Isobel; Howell, Andy; Pain, Reynald; Perrett, Kathy; Pritchet, Chris; Regnault, Nicolas; Yi, Sukyoung K

    2008-01-01

    Massive stars undergo a violent death when the supply of nuclear fuel in their cores is exhausted, resulting in a catastrophic `core-collapse' supernova. Such events are usually detected long after the star has exploded. Here we report the first detection of the radiative precursor from a supernova shock before it has reached the surface of a star followed by the initial expansion of the star at the beginning of the explosion. Theoretical models of the ultraviolet light curve show that the progenitor was a red supergiant, as expected for this type of supernova. These observations provide a promising and novel way to probe the physics of core-collapse supernovae and the internal structures of their progenitors.

  12. Silicon Nanoparticles Source of Extended Red Emission?

    CERN Document Server

    Witt, A N; Furton, D G

    1998-01-01

    We have reviewed the characteristics of the extended red emission (ERE) as observed in many dusty astronomical environments, in particular, the diffuse interstellar medium of the Galaxy. The spectral nature and the photon conversion efficiency of the ERE identify the underlying process as highly efficient photoluminescence by an abundant component of interstellar dust. We have compared the photoluminescence properties of a variety of carbon- and silicon-based materials proposed as sources for the ERE with the observationally established constraints. We found that silicon nanoparticles provide the best match to the spectrum and the efficiency requirement of the ERE. If present in interstellar space with an abundance sufficient to explain the intensity of the ERE, silicon nanoparticles will also contribute to the interstellar 9.7 micron Si-O stretch feature in absorption, to the near- and mid-IR nonequilibrium thermal background radiation, and to the continuum extinction in the near- and far-UV. About 36% of th...

  13. Optical analysis of red blood cell suspension

    Science.gov (United States)

    Szołna, Alicja A.; Grzegorzewski, Bronisław

    2008-12-01

    The optical properties of suspensions of red blood cells (RBCs) were studied. Fresh human venues blood was obtained from adult healthy donors. RBCs were suspended in isotonic salt solution, and in autologous plasma. Suspensions with haematocrit 0.25 - 3% were investigated. Novel technique was proposed to determine the scattering coefficient μs for the suspensions. The intensity of He-Ne laser light transmitted through a wedge-shape container filled with a suspension was recorded. To find the dependence of the intensity on the thickness of the sample the container was moved horizontally. The dependence of μs on the haematocrit was determined for RBCs suspended in the isotonic salt solution. RBCs suspended in plasma tend to form rouleaux. For the RBCs suspended in plasma, the scattering coefficient as a function of time was obtained. It is shown that this technique can be useful in the study of rouleaux formation.

  14. Transcriptional regulation of anthocyanin biosynthesis in red cabbage.

    Science.gov (United States)

    Yuan, Youxi; Chiu, Li-Wei; Li, Li

    2009-11-01

    The color of red cabbage (Brassica oleracea var. capitata) is due to anthocyanin accumulation. To investigate the regulatory control of anthocyanin production in red cabbage, the expression of anthocyanin biosynthetic and regulatory genes from eight commercial cultivars was examined. While the four green varieties had negligible amount of anthocyanins under normal growth condition, the four red cultivars contained up to 1.60 mg g(-1) fresh weight. HPLC analysis of the four red cultivars revealed that they produced similar composition of various forms of cyanidin glucosides but at different concentrations. Molecular analysis indicated that all the red cabbage shared common mechanism of regulatory control for anthocyanin biosynthesis. Except CHI which showed similar expression levels between green and red cultivars, the other structural genes, CHS, F3H, F3'H, DFR, LDOX, and GST, were constitutively up-regulated during all stages of vegetative growth in red varieties. The expression of these structural genes was also dramatically increased in green and red cabbage under nutrient stresses. The increased expression of the structural genes coincided with a coordinated increase in transcript levels of a bHLH gene, BoTT8, and a MYB transcription factor, BoMYB2. These results indicate that activation of these two regulatory factors by unknown mechanisms constitutively up-regulates nearly the entire pathway genes for the onset of anthocyanin biosynthesis in red cabbage. Moreover, the amount of total anthocyanins in red cabbage was found to be positively correlated with total antioxidant power, implicating the potential health benefit of red cabbage to human health. PMID:19756724

  15. Automated red blood cell analysis compared with routine red blood cell morphology by smear review

    OpenAIRE

    Dr.Poonam Radadiya; Dr.Nandita Mehta; Dr.Hansa Goswami; Dr.R.N.Gonsai

    2015-01-01

    The RBC histogram is an integral part of automated haematology analysis and is now routinely available on all automated cell counters. This histogram and other associated complete blood count (CBC) parameters have been found abnormal in various haematological conditions and may provide major clues in the diagnosis and management of significant red cell disorders. Performing manual blood smears is important to ensure the quality of blood count results an...

  16. 7 CFR 29.3018 - Dark red color (D).

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Dark red color (D). 29.3018 Section 29.3018 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards... Type 93) § 29.3018 Dark red color (D). A dark reddish brown....

  17. 21 CFR 74.302 - Citrus Red No. 2.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Citrus Red No. 2. 74.302 Section 74.302 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES SUBJECT TO CERTIFICATION Foods § 74.302 Citrus Red No. 2. (a) Identity. (1) The color...

  18. Lichenoid reactions in red tattoo: report of 2 cases

    OpenAIRE

    César Bimbi

    2014-01-01

    Complications of cosmetic decorative tattoos were uncommon some decades ago. The practice is increasing and more cases are being reported. Red pigments are by far the commonest cause in tattoo reactions. We report two cases of lichenoid reactions limited to red tattoo pigment and review the literature on the subject.

  19. Lichenoid reactions in red tattoo: report of 2 cases

    Directory of Open Access Journals (Sweden)

    César Bimbi

    2014-01-01

    Full Text Available Complications of cosmetic decorative tattoos were uncommon some decades ago. The practice is increasing and more cases are being reported. Red pigments are by far the commonest cause in tattoo reactions. We report two cases of lichenoid reactions limited to red tattoo pigment and review the literature on the subject.

  20. Red Deer College Fact Book, 1999/2000.

    Science.gov (United States)

    Red Deer Coll. (Alberta).

    This report is a compilation of 1999-2000 student data at Red Deer College (Canada). It also includes data from 1997/98 through 1999/2000 for the purpose of three-year comparisons. Programs offered at Red Deer College include university transfer, career certificates, diploma, high school equivalency (academic upgrading), job readiness training,…

  1. FIRE! A Red Flag Tap in Reclaiming Intervention

    Science.gov (United States)

    Bodnar, Brian

    2007-01-01

    "Red Flag Interventions" address problems which are imported from elsewhere and acted out towards persons who are in effect innocent bystanders. This is commonly seen as students "carry in" problems from the home or street to school, or they "carry over" conflicts from one class to the next. A third variation of Red Flag intervention is when a…

  2. Structures and colour properties of new red wine pigments

    DEFF Research Database (Denmark)

    Håkansson, Anders Eckart; Pardon, K.; Hayasaka, Y.;

    2003-01-01

    colour properties of the pigments were characterized; it could be demonstrated that the pyranoanthocyanins retained their red colour at pH 3.6 in model wine and were resistant to bisulfite-mediated bleaching. Finally, HPLC-MS analysis confirmed the presence of both anthocyanin-derived pigments in red...

  3. Red meat and colon cancer : how dietary heme initiates hyperproliferation

    NARCIS (Netherlands)

    IJssennagger, N.

    2012-01-01

    Colorectal cancer is a leading cause of cancer deaths in Western countries. The risk to develop colorectal cancer is associated with the intake of red meat. Red meat contains the porphyrin pigment heme. Heme is an irritant for the colonic wall and it is previously shown that the addition of heme to

  4. Concentrating radioactive liquid with infra-red-heated evaporator

    International Nuclear Information System (INIS)

    The phenomena of Infra-Red-Heated Heater evaporation liquid and the test results of concentrating evaporating remain (salt content, without radioactivity) are presented. The advantages and prospects with Infra-Red-Heated evaporator system to treat radioactive liquid are also discussed

  5. Pioneering the red planet; adventures on Martian soil

    NARCIS (Netherlands)

    Van der Peijl, I.; Veraart, M.

    2013-01-01

    Mars has always obsessed humankind - the Red planet, the ‘New Earth’. And with the recent successful landing of NASA’s Curiosity rover, Mars is closer than ever. Ever since 1960, we have actively been sending probes and rovers to observe the planet, but not without defeat. The road to the red planet

  6. Internal solitary waves in the Red Sea: An unfolding mystery

    NARCIS (Netherlands)

    da Silva, J.C.B.; Magalhães, J.M.; Gerkema, T.; Maas, L.R.M.

    2012-01-01

    The off-shelf region between 16.0 degrees and 16.5 degrees N in the southern Red Sea is identified as a new hotspot for the occurrence of oceanic internal solitary waves. Satellite observations reveal trains of solitons that, surprisingly, appear to propagate from the center of the Red Sea, where it

  7. Cellulitis in a Red Kandhari Bull : A Case Report

    Directory of Open Access Journals (Sweden)

    M M Pathan

    2012-06-01

    Full Text Available A case of cellulitis caused by mixed infection of Staphylococcus spp. and Corynebacterium spp in a Red Kandhari bull leading to death of animal was autopsied at the department. It is being a case of cellulitis in a Red Kandhari bull and placed on record. [Vet. World 2012; 5(3.000: 183-184

  8. Radiation retinopathy treated with the krypton red laser

    Energy Technology Data Exchange (ETDEWEB)

    Axer-Siegel, R.; Kremer, I.; Ben-Sira, I.; Weiss, J. (Beilinson Medical Center, Petah Tiqva (Israel))

    1989-07-01

    We present two cases of radiation retinopathy treated with the krypton red laser (647 nm). The macular edema and exudates resolved completely after treatment, but visual acuity improved only partially due to the development of a lamellar macular hole. The rationale for laser therapy and the selection of the red wavelength are discussed.

  9. CHARACTERISTICS OF POLYPHENOL OXIDASES FROM RED CLOVER (TRIFOLIUM PRATENSE)

    Science.gov (United States)

    Polyphenol oxidase (PPO, EC 1.14.18.1 or EC 1.10.3.1) catalyzes the oxidation of o-diphenols to o-quinones which cause browning reactions in many wounded fruits, vegetables, and plants including the forage crop red clover (Trifolium pratense). Production of o-quinones in red clover inhibits post-har...

  10. Better to be red than blue in virtual competition

    DEFF Research Database (Denmark)

    Ilie, Andrei; Ioan, Silvia; Zagrean, Leon;

    2008-01-01

    In the 2004 Olympic Games, opponents wearing red athletic uniforms were more likely to win against opponents wearing blue uniforms. To investigate whether this color bias extends to the world of virtual competition, we compared the performance of red and blue teams in a popular multiplayer first......-person-shooter (FPS) computer game. For 3 consecutive months, we collected data from a publicly available global statistics server. Outcomes from 1,347 matches played by the top 10 players on the same virtual arena were included. Red teams won 54.9% of matches, and this effect was highly significant. Our data suggest...... that joining the red team may offer a slight advantage over the blue team in virtual competition, and this should be accounted for when designing FPS games. It is likely that "seeing red" may trigger a powerful psychological distractor signal in human aggressive competition that can affect the outcome...

  11. Red-Cell Trace Minerals in Children with Autism

    Directory of Open Access Journals (Sweden)

    Joan Jory

    2008-01-01

    Full Text Available Abnormalities in mineral-dependent antioxidant enzymes in children with autism raise interest in the determination of trace mineral status in this population. A cross sectional investigation of red cell mineral levels was carried out among 20 children with autism and 15 controls. Children with autism demonstrated significantly lower red cell selenium (p<0.0006 and higher molybdenum (p<0.01 than the controls. There was a trend toward lower red cell zinc and higher cobalt and vanadium, among the children with autism. There were no differences in red cell levels of chromium, copper, manganese, or magnesium. These findings confirm an earlier report of low red cell selenium in autism and support a role for decreased trace mineral status in oxidative stress in autism through alteration of selenium-dependent antioxidant enzymes and increased lipid peroxidation.

  12. Better to be red than blue in virtual competition.

    Science.gov (United States)

    Ilie, Andrei; Ioan, Silvia; Zagrean, Leon; Moldovan, Mihai

    2008-06-01

    In the 2004 Olympic Games, opponents wearing red athletic uniforms were more likely to win against opponents wearing blue uniforms. To investigate whether this color bias extends to the world of virtual competition, we compared the performance of red and blue teams in a popular multiplayer first-person-shooter (FPS) computer game. For 3 consecutive months, we collected data from a publicly available global statistics server. Outcomes from 1,347 matches played by the top 10 players on the same virtual arena were included. Red teams won 54.9% of matches, and this effect was highly significant. Our data suggest that joining the red team may offer a slight advantage over the blue team in virtual competition, and this should be accounted for when designing FPS games. It is likely that "seeing red" may trigger a powerful psychological distractor signal in human aggressive competition that can affect the outcome of sports and virtual contests alike. PMID:18537513

  13. Cometary panspermia explains the red rain of Kerala

    CERN Document Server

    Louis, G; Louis, Godfrey

    2003-01-01

    Red coloured rain occurred in many places of Kerala in India during July to September 2001 due to the mixing of huge quantity of microscopic red cells in the rainwater. Considering its correlation with a meteor airbust event, this phenomenon raised an extraordinary question whether the cells are extraterrestrial. Here we show how the observed features of the red rain phenomenon can be explained by considering the fragmentation and atmospheric disintegration of a fragile cometary body that presumably contains a dense collection of red cells. Slow settling of cells in the stratosphere explains the continuation of the phenomenon for two months. The red cells under study appear to be the resting spores of an extremophilic microorganism. Possible presence of these cells in the interstellar clouds is speculated from its similarity in UV absorption with the 217.5 nm UV extinction feature of interstellar clouds.

  14. New biology of red rain extremophiles prove cometary panspermia

    CERN Document Server

    Louis, G; Louis, Godfrey

    2003-01-01

    This paper reports the extraordinary biology of the microorganisms from the mysterious red rain of Kerala, India. These chemosynthetic organisms grow optimally at an extreme high temperature of 300 degrees C in hydrothermal conditions and can metabolize inorganic and organic compounds including hydrocarbons. Stages found in their life cycle show reproduction by a special multiple fission process and the red cells found in the red rain are identified as the resting spores of these microbes. While these extreme hyperthermophiles contain proteins, our study shows the absence of DNA in these organisms, indicating a new primitive domain of life with alternate thermostable genetics. This new biology proves our earlier hypothesis that these microbes are of extraterrestrial origin and also supports our earlier argument that the mysterious red rain of Kerala is due to the cometary delivery of the red spores into the stratosphere above Kerala.

  15. Use of red mud as addition for portland cement mortars

    International Nuclear Information System (INIS)

    The aim of the present research work was to investigate the possibility of adding red mud, an alkaline leaching waste that is obtained from bauxite during the Bayer process for alumina production, in the raw meal of Portland cement mortars. The red mud is classified as dangerous, according to NBR 10004/2004, and world while generation reached over 117 million tons/year. This huge production requires high consuming products to be used as incorporation matrix and we studied the influence of red mud addition on the characteristics of cement mortars and concrete. In this paper the properties of Portland cement mortars incorporating high amounts of red mud was evaluated: pH variation, fresh (setting time, workability or normal consistency and water retention), and hardened state (mechanical strength, capillary water absorption, density and apparent porosity). Results seem promising for red mud additions up to 20 wt%. (author)

  16. Prediction Research of Red Tide Based on Improved FCM

    Directory of Open Access Journals (Sweden)

    Xiaomei Hu

    2016-01-01

    Full Text Available Red tides are caused by the combination effects of many marine elements. The complexity of the marine ecosystem makes it hard to find the relationship between marine elements and red tides. The algorithm of fuzzy c-means (FCM can get clear classification of things and expresses the fuzzy state among different things. Therefore, a prediction algorithm of red tide based on improved FCM is proposed. In order to overcome the defect of FCM which is overdependent on the initial cluster centers and the objective function, this paper gains the initial cluster centers through the principle of regional minimum data density and the minimum mean distance. The feature weighted cluster center is added to the objective function. Finally, the improved FCM algorithm is applied in the prediction research of red tide, and the results show that the improved FCM algorithm has good denoising ability and high accuracy in the prediction of red tides.

  17. Improvement of Tagliatelle Quality by Addition of Red Quinoa Flour

    Directory of Open Access Journals (Sweden)

    Anamaria Pop

    2014-11-01

    Full Text Available In order to diversification of tagliatelle pasta and increasing segment of consumers it was intended to improvement of tagliatelle pasta quality by addition of red quinoa flour. The products obtained at Bakery Pilot Station of University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca was the result of original recipe. To optimize the recipe were made four experimental variants, white flour and red quinoa flour is used in different proportions: Variant 1 – plain tagliatelle pasta (control sample who used white flour WF in 100%, Variant 2 consisting of 15% red quinoa flour (15 QF, Variant 3 consisting of 30 % red quinoa flour (30 QF and Variant 4 consisting of 50 % red quinoa flour (50 RQF. The experimental variants was analyzed for physico-chemical: moisture content, protein content and acidity. The sensory attributes, were evaluated by using a 9-point Hedonic scale. Present study indicated that the variant 3 were most accepted by consumers.

  18. Research and Development of Cadmium Sulphoselenide Red Pigment

    Institute of Scientific and Technical Information of China (English)

    WU Jianfeng; LI Kun; XU Xiaohong; ZHANG Yaxiang; XU Xiaoyang; LAO Xinbin

    2015-01-01

    Cadmium sulphoselenide was synthesized continuous substitution solid solution and the only known pigment to yield bright red color on ceramic decoration. Encapsulated cadmium sulphoselenide pigments could yield abundant hues from yellow to red with high opacity at high temperature. The color generation has a linear function relation with the substitution rate. The encapsulation formation process of zirconium silicate encapsulated cadmium sulphoselenide was shown. Insufifcient encapsulation efifciency and potential hazard to human and environment had limited the industrial application of cadmium sulphoselenide red pigment. Ink-jet printing decoration required ifne size cadmium sulphoselenide red pigment on ceramic decoration. The review mainly focused on the synthesis techniques and industrial application of cadmium sulphoselenide red pigment.

  19. Red maca (Lepidium meyenii reduced prostate size in rats

    Directory of Open Access Journals (Sweden)

    Rubio Julio

    2005-01-01

    Full Text Available Abstract Background Epidemiological studies have found that consumption of cruciferous vegetables is associated with a reduced risk of prostate cancer. This effect seems to be due to aromatic glucosinolate content. Glucosinolates are known for have both antiproliferative and proapoptotic actions. Maca is a cruciferous cultivated in the highlands of Peru. The absolute content of glucosinolates in Maca hypocotyls is relatively higher than that reported in other cruciferous crops. Therefore, Maca may have proapoptotic and anti-proliferative effects in the prostate. Methods Male rats treated with or without aqueous extracts of three ecotypes of Maca (Yellow, Black and Red were analyzed to determine the effect on ventral prostate weight, epithelial height and duct luminal area. Effects on serum testosterone (T and estradiol (E2 levels were also assessed. Besides, the effect of Red Maca on prostate was analyzed in rats treated with testosterone enanthate (TE. Results Red Maca but neither Yellow nor Black Maca reduced significantly ventral prostate size in rats. Serum T or E2 levels were not affected by any of the ecotypes of Maca assessed. Red Maca also prevented the prostate weight increase induced by TE treatment. Red Maca administered for 42 days reduced ventral prostatic epithelial height. TE increased ventral prostatic epithelial height and duct luminal area. These increases by TE were reduced after treatment with Red Maca for 42 days. Histology pictures in rats treated with Red Maca plus TE were similar to controls. Phytochemical screening showed that aqueous extract of Red Maca has alkaloids, steroids, tannins, saponins, and cardiotonic glycosides. The IR spectra of the three ecotypes of Maca in 3800-650 cm (-1 region had 7 peaks representing 7 functional chemical groups. Highest peak values were observed for Red Maca, intermediate values for Yellow Maca and low values for Black Maca. These functional groups correspond among others to benzyl

  20. 77 FR 55693 - D&C Red No. 6 and D&C Red No. 7; Change in Specification; Confirmation of Effective Date

    Science.gov (United States)

    2012-09-11

    ... FR 39921) and that revised the requirements for D&C Red No. 6 and D&C Red No. 7 by replacing the... From the Federal Register Online via the Government Publishing Office DEPARTMENT OF HEALTH AND HUMAN SERVICES Food and Drug Administration 21 CFR Part 74 D&C Red No. 6 and D&C Red No. 7; Change...

  1. Training Course on the Marine Ecology of the Red Sea. Red Sea & Gulf of Aden Programme (PERSGA).

    Science.gov (United States)

    Arab Organization for Education and Science, Cairo (Egypt).

    This document presents a training course on the marine ecology of the Red Sea designed by the Arab League Educational, Cultural and Scientific Organization (ALECSO) in collaboration with the Marine Science Department of UNESCO for the Program for Environmental Studies, Red Sea and Gulf of Aden (PERSGA). It was hosted by the Marine Science Station,…

  2. Starch granule size distribution of hard red winter and hard red spring wheat: Its effects on mixing and breadmaking quality.

    Science.gov (United States)

    Starch was isolated from 98 hard red winter (HRW) wheat and 99 hard red spring (HRS) wheat. Granule size/volume distributions of the isolated starches were analyzed using a laser diffraction particle size analyzer. There were significant differences in the size distribution between HRW and HRS whe...

  3. Effect of red wine and red grape extract on blood lipids, haemostatic factors, and other risk factors for cardiovascular disease

    DEFF Research Database (Denmark)

    Hansen, Alice Schmidt; Marckmann, P.; Dragsted, L.O.;

    2005-01-01

    ( males: 300 ml/day, 38.3 g alcohol/day, female subjects: 200 ml/ day, 25.5 g alcohol/day), 2: water+red grape extract tablets ( wine-equivalent dose), 3: water+red grape extract tablets ( half dose), or 4: water+placebo tablets for a period of 4 weeks. No other sources of alcohol or anthocyanin were...

  4. Physicochemical and Sensory Properties of Red Ginseng Extracts or Red Ginseng Hydrolyzates-added Asiago Cheese during Ripening

    OpenAIRE

    Choi, Kyung-Hoon; Min, Ji-Young; Ganesan, Palanivel; Bae, In-Hyu; Kwak, Hae-Soo

    2015-01-01

    This study was carried out to investigate physicochemical properties of different concentrations (0.1%, 0.3%, and 0.5%) of red ginseng hydrolyzates (RGH)- or red ginseng extract (RGE)-added Asiago cheeses (AC) during ripening at 14°C for 4 months. The moisture content significantly increased with increasing concentrations of both RGH- and RGE- added AC (p

  5. On the origin of endemic species in the Red Sea

    KAUST Repository

    DiBattista, Joseph

    2015-10-19

    Aim The geological and palaeo-climatic forces that produced the unique biodiversity in the Red Sea are a subject of vigorous debate. Here, we review evidence for and against the hypotheses that: (1) Red Sea fauna was extirpated during glacial cycles of the Pleistocene and (2) coral reef fauna found refuge within or just outside the Red Sea during low sea level stands when conditions were inhospitable. Location Red Sea and Western Indian Ocean. Methods We review the literature on palaeontological, geological, biological and genetic evidence that allow us to explore competing hypotheses on the origins and maintenance of shallow-water reef fauna in the Red Sea. Results Palaeontological (microfossil) evidence indicates that some areas of the central Red Sea were devoid of most plankton during low sea level stands due to hypersaline conditions caused by almost complete isolation from the Indian Ocean. However, two areas may have retained conditions adequate for survival: the Gulf of Aqaba and the southern Red Sea. In addition to isolation within the Red Sea, which separated the northern and southern faunas, a strong barrier may also operate in the region: the cold, nutrient-rich water upwelling at the boundary of the Gulf of Aden and the Arabian Sea. Biological data are either inconclusive or support these putative barriers and refugia, but no data set, that we know of rejects them. Genetic evidence suggests that many endemic lineages diverged from their Indian Ocean counterparts long before the most recent glaciations and/or are restricted to narrow areas, especially in the northern Red Sea. Main conclusions High endemism observed in the Red Sea and Gulf of Aden appears to have multiple origins. A cold, nutrient-rich water barrier separates the Gulf of Aden from the rest of the Arabian Sea, whereas a narrow strait separates the Red Sea from the Gulf of Aden, each providing potential isolating barriers. Additional barriers may arise from environmental gradients

  6. Best Color Image of Jupiter's Little Red Spot

    Science.gov (United States)

    2007-01-01

    This amazing color portrait of Jupiter's 'Little Red Spot' (LRS) combines high-resolution images from the New Horizons Long Range Reconnaissance Imager (LORRI), taken at 03:12 UT on February 27, 2007, with color images taken nearly simultaneously by the Wide Field Planetary Camera 2 (WFPC2) on the Hubble Space Telescope. The LORRI images provide details as fine as 9 miles across (15 kilometers), which is approximately 10 times better than Hubble can provide on its own. The improved resolution is possible because New Horizons was only 1.9 million miles (3 million kilometers) away from Jupiter when LORRI snapped its pictures, while Hubble was more than 500 million miles (800 million kilometers) away from the Gas Giant planet. The Little Red Spot is the second largest storm on Jupiter, roughly 70% the size of the Earth, and it started turning red in late-2005. The clouds in the Little Red Spot rotate counterclockwise, or in the anticyclonic direction, because it is a high-pressure region. In that sense, the Little Red Spot is the opposite of a hurricane on Earth, which is a low-pressure region - and, of course, the Little Red Spot is far larger than any hurricane on Earth. Scientists don't know exactly how or why the Little Red Spot turned red, though they speculate that the change could stem from a surge of exotic compounds from deep within Jupiter, caused by an intensification of the storm system. In particular, sulfur-bearing cloud droplets might have been propelled about 50 kilometers into the upper level of ammonia clouds, where brighter sunlight bathing the cloud tops released the red-hued sulfur embedded in the droplets, causing the storm to turn red. A similar mechanism has been proposed for the Little Red Spot's 'older brother,' the Great Red Spot, a massive energetic storm system that has persisted for over a century. New Horizons is providing an opportunity to examine an 'infant' red storm system in detail, which may help scientists understand better how

  7. EFSA NDA Panel (EFSA Panel on Dietetic Products, Nutrition and Allergies), 2013. Scientific Opinion on the substantiation of a health claim related to a combination of red spinach, green spinach, red chicory, green chicory, green leaf chard, red leaf chard, red Swiss chard, golden Swiss chard and

    DEFF Research Database (Denmark)

    Tetens, Inge

    related to a combination of red spinach, green spinach, red chicory, green chicory, green leaf chard, red leaf chard, red Swiss chard, golden Swiss chard and white Swiss chard and maintenance of normal blood cholesterol concentration. The food that is the subject of the health claim, a combination of red...... spinach (Spinacia oleracea L.), green spinach (Spinacia oleracea L.), red chicory (Cichorium intybus L.), green chicory (Cichorium intybus L.), green leaf chard (Beta vulgaris L. var. cicla), red leaf chard (Beta vulgaris L. var. cicla), red Swiss chard (Beta vulgaris L. var. cicla), golden Swiss chard...... the scientific substantiation of the claim were provided by the applicant. The Panel concludes that a cause and effect relationship has not been established between consumption of a combination of red spinach, green spinach, red chicory, green chicory, green leaf chard, red leaf chard, red Swiss chard...

  8. Radioassay for serum and red cell folate

    International Nuclear Information System (INIS)

    A simple, reliable assay for serum and red cell folate is described. It uses plain untreated liquid or powdered milk, requiring no special handling or purification, as binder. Such milk makes it possible to ignore endogenous serum folate binder, since crude (but not purified) milk contains a factor which releases folate from serum binder. It simplifies counting radioactivity by employing a gamma emitting isotope of pteroylglutamic acid (PGA), namely the 125I-tyramide of PGA. Like the 3H-PGA assay of Givas and Gutcho, it permits the use of stable PGA rather than unstable methyltetrahydrofolic acid (MeTHFA) standards, because it is carried out at pH 9.3, a pH at which milk folate binder is unable to distinguish PGA from MeTHFA, which is the predominant folate in human tissues. The equipment required to do the radioassay is present in most diagnostic chemistry laboratories. Results are essentially identical to the generally accepted Lactobacillus casei microbiologic method of folate assay, except that false low results are not produced in the radioassay by antibiotics, tranquilizers, and chemotherapeutic agents. Three caveats in its use are the relative instability of 125I-PGA as compared to 3H-PGA, the fact that various powdered milks differ widely in folate-binding capacity, and that only about 60 percent of commercially obtained skim or powdered milk preparations appear to contain the substance which splits folate from serum binder

  9. Bicentenarios digitales: celebraciones en la red

    Directory of Open Access Journals (Sweden)

    Alvar de la Llosa

    2011-06-01

    Full Text Available Si  la celebración del primer centenario de las independencias de los países americanos se valió de las innovaciones de los medios de comunicación de su época, en particular del cine, hoy en día los gobiernos han asaltado la Red y se han apoderado del media para difundir una versión oficial. Conviene por lo tanto ver cómo los diferentes países latinoamericanos construyen este Bicentenario siempre de modo nacional y unilateral y nunca transnacional, en el marco de unas fronteras modernas a pesar de un pasado común entre varias naciones.Palabras clave: Internet, bicentenario, Latinoamérica.___________________________Abstract:The celebration of the first centenary of independence of american countries used the innovations of the mass media of it time, particulary the movie world. Today, the governements stormed Internet and taked possession of the media to spread an official version. It´s necesary, consequently, to analyse how the different latin american countries build this Centenary, always national, never like a transnational perspective, in the context of the modern frontiers and the common past.Keywords: Internet, bicentenary, Latin America

  10. Colorimetric evaluation of irradiated red beet roots

    Energy Technology Data Exchange (ETDEWEB)

    Nunes, Thaise C.F.; Rogovschi, Vladimir D.; Fabbri, Adriana D.T.; Sagretti, Juliana M.A.; Hirashima, Fabiana K.; Sabato, Susy F., E-mail: thaisecfnunes@hotmail.com [Instituto de Pesquisas Energeticas e Nucleares (IPEN/CNEN-SP), Sao Paulo, SP (Brazil)

    2013-07-01

    The red beetroot contain antioxidant and anticancer activity and have been consumed all over the world. In order to increase the consumption of beetroot the food industry has created a practical alternative, a beetroot shaped like a small ball, minimally processed with the convenience in meal preparation. Food irradiation is in consonance with the proposal to increase the consumption of beetroot whilst maintaining quality and product safety. The aim of this study was to analyze changes in colorimetric properties in beetroot after the irradiation process. Samples of minimally processed beetroot were purchased at a local supermarket. The samples were exposed to gamma rays with doses of 1.0kG{sub y}, 2.0kG{sub y}, 3.0kG{sub y} and 4.0 kG{sub y} and were stored at 5 deg C. Colorimetric characteristics were analyzed such as L{sup *}, a{sup *}, b{sup *}, C{sup *}, h{sup *}, δE and WI. The results of the colorimetric evaluation showed no significant difference among the samples. The authors concluded that the treatment with low doses of gamma radiation keeps the quality of beetroot. (author)

  11. Colorimetric evaluation of irradiated red beet roots

    International Nuclear Information System (INIS)

    The red beetroot contain antioxidant and anticancer activity and have been consumed all over the world. In order to increase the consumption of beetroot the food industry has created a practical alternative, a beetroot shaped like a small ball, minimally processed with the convenience in meal preparation. Food irradiation is in consonance with the proposal to increase the consumption of beetroot whilst maintaining quality and product safety. The aim of this study was to analyze changes in colorimetric properties in beetroot after the irradiation process. Samples of minimally processed beetroot were purchased at a local supermarket. The samples were exposed to gamma rays with doses of 1.0kGy, 2.0kGy, 3.0kGy and 4.0 kGy and were stored at 5 deg C. Colorimetric characteristics were analyzed such as L*, a*, b*, C*, h*, δE and WI. The results of the colorimetric evaluation showed no significant difference among the samples. The authors concluded that the treatment with low doses of gamma radiation keeps the quality of beetroot. (author)

  12. Properties of Red Sea coastal currents

    KAUST Repository

    Churchill, J.H.

    2014-02-14

    Properties of coastal flows of the central Red Sea are examined using 2 years of velocity data acquired off the coast of Saudi Arabia near 22 °N. The tidal flow is found to be very weak. The strongest tidal constituent, the M2 tide, has a magnitude of order 4 cm s−1. Energetic near-inertial and diurnal period motions are observed. These are surface-intensified currents, reaching magnitudes of >10 cm s−1. Although the diurnal currents appear to be principally wind-driven, their relationship with the surface wind stress record is complex. Less than 50% of the diurnal current variance is related to the diurnal wind stress through linear correlation. Correlation analysis reveals a classical upwelling/downwelling response to the alongshore wind stress. However, less than 30% of the overall sub-inertial variance can be accounted for by this response. The action of basin-scale eddies, impinging on the coastal zone, is implicated as a primary mechanism for driving coastal flows.

  13. Interpreting the Clustering of Distant Red Galaxies

    CERN Document Server

    Tinker, Jeremy L; Zheng, Zheng

    2009-01-01

    We analyze the angular clustering of z~2.3 distant red galaxies (DRGs) measured by Quadri et al 2008. We find that, with robust estimates of the measurement errors and realistic halo occupation distribution modeling, the measured clustering can be well fit within standard halo occupation models, in contrast to previous results. However, in order to fit the strong break in w(theta) at theta=10 arcsec, nearly all satellite galaxies in the DRG luminosity range are required to be DRGs. Within this luminosity-threshold sample, the fraction of galaxies that are DRGs is ~44%, implying that the formation of DRGs is more efficient for satellite galaxies than for central galaxies. Despite the evolved stellar populations contained within DRGs at z=2.3, 90% of satellite galaxies in the DRG luminosity range have been accreted within 500 Myr. Thus, satellite DRGs must have known they would become satellites well before the time of their accretion. This implies that the formation of DRGs correlates with large-scale environm...

  14. The morphology of extremely red objects

    CERN Document Server

    Moriondo, G; Daddi, E

    2000-01-01

    We present a quantitative study of the morphology of 41 Extremely Red Objects (EROs). The analysis is based on deep otical and near-infrared images from the Hubble Space Telescope public archive, and performed by fitting to each galaxy image a PSF-convolved bi-dimensional model brightness distribution. Relying both on the visual inspection of the data and on the results of the fitting procedure, we are able to determine the fraction of irregular and/or interacting EROs, and to identify those that more closely resemble local ellipticals. To the former class, whose members are probably high-redshift dusty starburst, belongs about 15% of the whole sample, whereas the elliptical-like objects are between 50 and 80% of the total. A few galaxies, although characterized by a compact morphology, are best fitted by an exponential distribution, more typical of local spirals. Our data also suggest that irregular EROs are found predominantly in the field, and that - on average - they tend to be characterized by the reddes...

  15. Removal of cesium from red deer meat

    International Nuclear Information System (INIS)

    The effect was studied of marinading on the reduction of cesium radionuclide activity in red deer meat contaminated by ingestion of feed containing 134Cs+137Cs from radioactive fallout following the Chernobyl accident. Two types of marinade were studied, viz., a vinegar infusion and a vinegar infusion with an addition of vegetables and spices. The meat was chopped to cubes of about 1.5 cm in size and the marinading process took place at temperatures of 5 and 11 degC. The drop of cesium content in the meat was determined by gamma spectrometry at given time intervals. The replacement of the marinade and the duration of the process were found to maximally affect efficiency. If the solution was not replaced, about 80% of cesium radionuclides were removed after seven hours of marinading. With one replacement of the infusion the drop in 134Cs+137Cs radioactivity amounted to up to 90% after seven hours of marinading. No effects were shown of vegetable additions to the vinegar infusion and of the change in temperature from 5 to 11 degC on the efficiency of the process. (author). 3 tabs., 6 refs

  16. Gradual Ordering in Red Abalone Nacre

    Energy Technology Data Exchange (ETDEWEB)

    Gilbert, P. U. P. A.; Metzler, Rebecca A.; Zhou, Dong; Scholl, Andreas; Doran, Andrew; Young, Anthony; Kunz, Martin; Tamura, Nobumichi; Coppersmith, Susan N.

    2008-09-03

    Red abalone (Haliotis rufescens) nacre is a layered composite biomineral that contains crystalline aragonite tablets confined by organic layers. Nacre is intensely studied because its biologically controlled microarchitecture gives rise to remarkable strength and toughness, but the mechanisms leading to its formation are not well understood. Here we present synchrotron spectromicroscopy experiments revealing that stacks of aragonite tablet crystals in nacre are misoriented with respect to each other. Quantitative measurements of crystal orientation, tablet size, and tablet stacking direction show that orientational ordering occurs not abruptly but gradually over a distance of 50 {micro}m. Several lines of evidence indicate that different crystal orientations imply different tablet growth rates during nacre formation. A theoretical model based on kinetic and gradual selection of the fastest growth rates produces results in qualitative and quantitative agreement with the experimental data and therefore demonstrates that ordering in nacre is a result of crystal growth kinetics and competition either in addition or to the exclusion of templation by acidic proteins as previously assumed. As in other natural evolving kinetic systems, selection of the fastest-growing stacks of tablets occurs gradually in space and time. These results suggest that the self-ordering of the mineral phase, which may occur completely independently of biological or organic-molecule control, is fundamental in nacre formation.

  17. The Red Supergiant Content of M31

    CERN Document Server

    Massey, Philip

    2016-01-01

    We investigate the red supergiant (RSG) population of M31, obtaining radial velocities of 255 stars. These data substantiate membership of our photometrically-selected sample, demonstrating that Galactic foreground stars and extragalactic RSGs can be distinguished on the basis of B-V, V-R two-color diagrams. In addition, we use these spectra to measure effective temperatures and assign spectral types, deriving physical properties for 192 RSGs. Comparison with the solar-metallicity Geneva evolutionary tracks indicates astonishingly good agreement. The most luminous RSGs in M31 are likely evolved from 25-30 Mo stars, while the vast majority evolved from stars with initial masses of 20 Mo or less. There is an interesting bifurcation in the distribution of RSGs with effective temperatures that increases with higher luminosities, with one sequence consisting of early K-type supergiants, and with the other consisting of M-type supergiants that become later (cooler) with increasing luminosities. This separation is o...

  18. Red blood cell in simple shear flow

    Science.gov (United States)

    Chien, Wei; Hew, Yayu; Chen, Yeng-Long

    2013-03-01

    The dynamics of red blood cells (RBC) in blood flow is critical for oxygen transport, and it also influences inflammation (white blood cells), thrombosis (platelets), and circulatory tumor migration. The physical properties of a RBC can be captured by modeling RBC as lipid membrane linked to a cytoskeletal spectrin network that encapsulates cytoplasm rich in hemoglobin, with bi-concave equilibrium shape. Depending on the shear force, RBC elasticity, membrane viscosity, and cytoplasm viscosity, RBC can undergo tumbling, tank-treading, or oscillatory motion. We investigate the dynamic state diagram of RBC in shear and pressure-driven flow using a combined immersed boundary-lattice Boltzmann method with a multi-scale RBC model that accurately captures the experimentally established RBC force-deformation relation. It is found that the tumbling (TU) to tank-treading (TT) transition occurs as shear rate increases for cytoplasm/outer fluid viscosity ratio smaller than 0.67. The TU frequency is found to be half of the TT frequency, in agreement with experiment observations. Larger viscosity ratios lead to the disappearance of stable TT phase and unstable complex dynamics, including the oscillation of the symmetry axis of the bi-concave shape perpendicular to the flow direction. The dependence on RBC bending rigidity, shear modulus, the order of membrane spectrin network and fluid field in the unstable region will also be discussed.

  19. Manganese abundances in Galactic bulge red giants

    CERN Document Server

    Barbuy, B; Zoccali, M; Minniti, D; Renzini, A; Ortolani, S; Gomez, A; Trevisan, M; Dutra, N

    2013-01-01

    Manganese is mainly produced in type II SNe during explosive silicon burning, in incomplete Si-burning regions, and depends on several nucleosynthesis environment conditions, such as mass cut beween the matter ejected and falling back onto the remnant, electron and neutron excesses, mixing fallback, and explosion energy. Manganese is also produced in type Ia SNe. The aim of this work is the study of abundances of the iron-peak element Mn in 56 bulge giants, among which 13 are red clump stars. Four bulge fields along the minor axis are inspected. The study of abundances of Mn-over-Fe as a function of metallicity in the Galactic bulge may shed light on its production mechanisms. High-resolution spectra were obtained using the FLAMES+UVES spectrograph on the Very Large Telescope. The spectra were obtained within a program to observe 800 stars using the GIRAFFE spectrograph, together with the present UVES spectra. We aim at identifying the chemical evolution of manganese, as a function of metallicity, in the Gala...

  20. Primary production in the northern Red Sea

    Science.gov (United States)

    Qurban, Mohammed Ali; Balala, Arvin C.; Kumar, Sanjeev; Bhavya, P. S.; Wafar, Mohideen

    2014-04-01

    Rates of uptake of carbon and nitrogen (ammonium, nitrate and urea) by phytoplankton, along with concentrations of nutrients and chlorophyll a, in the Saudi Arabian waters of the northern Red Sea (23 °N-28 °N) were measured in autumn, 2012. Concentrations of nitrate, nitrite and phosphate within the euphotic zone were in trace amounts while those of silicon were in excess of 0.5 μmol L- 1. Concentrations of chlorophyll (Chl a) were very low within the euphotic zone (0.01-0.6 μg L- 1 at discrete depths and 1.53-21.5 mg m- 2 as column-integrated values). A deep chlorophyll maximum and a nitrite maximum were present between 60 and 80 m at almost all of the stations occupied. Rates of carbon uptake at discrete depths ranged from 0.02 to 3 μg C L- 1 h- 1. Chl-normalized carbon uptake rates related with ambient light in a Michaelis-Menten kinetic pattern. About 80% of the carbon uptake was attributable to the export of carbon to deep sea could be lesser than that indicated by f-ratios.

  1. The red optical afterglow of GRB 030725

    CERN Document Server

    Pugliese, G; Gorosabel, J; Jensen, B L; Fynbo, J P U; Hjorth, J; Jorgensen, S F; Monard, B; Vinter, C

    2005-01-01

    We present a photometric study of the optical counterpart of the long-duration Gamma Ray Burst (GRB) 030725, which triggered the HETE FREGATE and WXM instruments on July 25th, 2003, and lasted more than 160s. An optical counterpart was identified at the Bronberg Observatory in South Africa about 7 hours after the burst occurred. The optical afterglow (OA) was observed between 4 and 15 days after the burst with the 1.54m Danish telescope at La Silla in the V, Rc, and Ic bands. We fit a broken power law to the data and determine a break time in the light curve between 16 hours and 4.7 days after the first detection of the burst. The decay slope is alpha1 = -0.59 +0.59/-0.44 before and alpha2 = -1.43 +/- 0.06 after the break. A bump may be present in the light curve, only significant at the 2-sigma level, 13.9 days after the main burst. The spectral slope of the OA, measured 12 days after the burst, is -2.9 +/- 0.6 , i.e. it falls in the extreme red end of the distribution of previous OA spectral slopes. Observa...

  2. Light scattering by aggregated red blood cells

    Science.gov (United States)

    Tsinopoulos, Stephanos V.; Sellountos, Euripides J.; Polyzos, Demosthenes

    2002-03-01

    In low flow rates, red blood cells (RBCs) fasten together along their axis of symmetry and form a so-called rouleaux. The scattering of He-Ne laser light by a rouleau consisting of n (2 less-than-or-equal n less-than-or-equal 8) average-sized RBCs is investigated. The interaction problem is treated numerically by means of an advanced axisymmetric boundary element--fast Fourier transform methodology. The scattering problem of one RBC was solved first, and the results showed that the influence of the RBC's membrane on the scattering patterns is negligible. Thus the rouleau is modeled as an axisymmetric, homogeneous, low-contrast dielectric cylinder, on the surface of which appears, owing to aggregated RBCs, a periodic roughness along the direction of symmetry. The direction of the incident laser light is considered to be perpendicular to the scatterer's axis of symmetry. The differential scattering cross sections in both perpendicular and parallel scattering planes and for all the scattering angles are calculated and presented in detail.

  3. Factors governing the deep ventilation of the Red Sea

    KAUST Repository

    Papadopoulos, Vassilis P.

    2015-11-19

    A variety of data based on hydrographic measurements, satellite observations, reanalysis databases, and meteorological observations are used to explore the interannual variability and factors governing the deep water formation in the northern Red Sea. Historical and recent hydrographic data consistently indicate that the ventilation of the near-bottom layer in the Red Sea is a robust feature of the thermohaline circulation. Dense water capable to reach the bottom layers of the Red Sea can be regularly produced mostly inside the Gulfs of Aqaba and Suez. Occasionally, during colder than usual winters, deep water formation may also take place over coastal areas in the northernmost end of the open Red Sea just outside the Gulfs of Aqaba and Suez. However, the origin as well as the amount of deep waters exhibit considerable interannual variability depending not only on atmospheric forcing but also on the water circulation over the northern Red Sea. Analysis of several recent winters shows that the strength of the cyclonic gyre prevailing in the northernmost part of the basin can effectively influence the sea surface temperature (SST) and intensify or moderate the winter surface cooling. Upwelling associated with periods of persistent gyre circulation lowers the SST over the northernmost part of the Red Sea and can produce colder than normal winter SST even without extreme heat loss by the sea surface. In addition, the occasional persistence of the cyclonic gyre feeds the surface layers of the northern Red Sea with nutrients, considerably increasing the phytoplankton biomass.

  4. The homeostasis of Plasmodium falciparum-infected red blood cells.

    Directory of Open Access Journals (Sweden)

    Jakob M A Mauritz

    2009-04-01

    Full Text Available The asexual reproduction cycle of Plasmodium falciparum, the parasite responsible for severe malaria, occurs within red blood cells. A merozoite invades a red cell in the circulation, develops and multiplies, and after about 48 hours ruptures the host cell, releasing 15-32 merozoites ready to invade new red blood cells. During this cycle, the parasite increases the host cell permeability so much that when similar permeabilization was simulated on uninfected red cells, lysis occurred before approximately 48 h. So how could infected cells, with a growing parasite inside, prevent lysis before the parasite has completed its developmental cycle? A mathematical model of the homeostasis of infected red cells suggested that it is the wasteful consumption of host cell hemoglobin that prevents early lysis by the progressive reduction in the colloid-osmotic pressure within the host (the colloid-osmotic hypothesis. However, two critical model predictions, that infected cells would swell to near prelytic sphericity and that the hemoglobin concentration would become progressively reduced, remained controversial. In this paper, we are able for the first time to correlate model predictions with recent experimental data in the literature and explore the fine details of the homeostasis of infected red blood cells during five model-defined periods of parasite development. The conclusions suggest that infected red cells do reach proximity to lytic rupture regardless of their actual volume, thus requiring a progressive reduction in their hemoglobin concentration to prevent premature lysis.

  5. Red spruce dynamics in an old southern Appalachian forest

    Science.gov (United States)

    Busing, R.T.

    2004-01-01

    By the late 1980s the composition and structure of forest stands in the southern Appalachian spruce-fir zone were altered by insect infestations to Fraser fir. The response of red spruce, the sole remaining coniferous forest dominant, to this disturbance was followed over twenty years (1983-2003) in an old spruce-fir forest at Mt. Collins, Great Smoky Mountains National Park. Although diameter growth of canopy red spruce (>30 cm dbh) at six plot sites was considerable (mean 10-yr increment 2.1 cm; 1993-2003), red spruce mortality increased sharply (mean 4% yr-1; 1993-2003). Wind-related mortality of canopy red spruce was substantial after the loss of Fraser fir from the canopy circa 1985 (>70% of the dead spruce had broken or uprooted boles; 1983-2003). Wind damage to red spruce was observed at most plot sites, but it was most pronounced on exposed topographic positions, where canopy gap expansion was extensive. The elevated mortality of red spruce at Mt. Collins was not associated with reduced diameter growth. Altered canopy structure has left large red spruce vulnerable to high winds. With the loss of canopy fir and the subsequent increase in mortality of canopy spruce, total live basal area has declined to about half of its pre-disturbance level.

  6. Sequestration of carbon dioxide (CO2) using red mud.

    Science.gov (United States)

    Yadav, Vishwajeet S; Prasad, Murari; Khan, Jeeshan; Amritphale, S S; Singh, M; Raju, C B

    2010-04-15

    Red mud, an aluminium industry hazardous waste, has been reported to be an inexpensive and effective adsorbent. In the present work applicability of red mud for the sequestration of green house gases with reference to carbon dioxide has been studied. Red mud sample was separated into three different size fractions (RM I, RM II, RM III) of varying densities (1.5-2.2 g cm(-3)). Carbonation of each fraction of red mud was carried out separately at room temperature using a stainless steel reaction chamber at a fixed pressure of 3.5 bar. Effects of reaction time (0.5-12 h) and liquid to solid ratio (0.2-0.6) were studied for carbonation of red mud. Different instrumental techniques such as X-ray diffraction, FTIR and scanning electron microscope (SEM) were used to ascertain the different mineral phases before and after carbonation of each fraction of red mud. Characterization studies revealed the presence of boehmite, cancrinite, chantalite, hematite, gibbsite, anatase, rutile and quartz. Calcium bearing mineral phases (cancrinite and chantalite) were found responsible for carbonation of red mud. Maximum carbonation was observed for the fraction RM II having higher concentration of cancrinite. The carbonation capacity is evaluated to be 5.3 g of CO(2)/100 g of RM II. PMID:20036053

  7. Sequestration of carbon dioxide (CO2) using red mud

    International Nuclear Information System (INIS)

    Red mud, an aluminium industry hazardous waste, has been reported to be an inexpensive and effective adsorbent. In the present work applicability of red mud for the sequestration of green house gases with reference to carbon dioxide has been studied. Red mud sample was separated into three different size fractions (RM I, RM II, RM III) of varying densities (1.5-2.2 g cm-3). Carbonation of each fraction of red mud was carried out separately at room temperature using a stainless steel reaction chamber at a fixed pressure of 3.5 bar. Effects of reaction time (0.5-12 h) and liquid to solid ratio (0.2-0.6) were studied for carbonation of red mud. Different instrumental techniques such as X-ray diffraction, FTIR and scanning electron microscope (SEM) were used to ascertain the different mineral phases before and after carbonation of each fraction of red mud. Characterization studies revealed the presence of boehmite, cancrinite, chantalite, hematite, gibbsite, anatase, rutile and quartz. Calcium bearing mineral phases (cancrinite and chantalite) were found responsible for carbonation of red mud. Maximum carbonation was observed for the fraction RM II having higher concentration of cancrinite. The carbonation capacity is evaluated to be 5.3 g of CO2/100 g of RM II.

  8. The effect of red on avoidance behavior in achievement contexts.

    Science.gov (United States)

    Elliot, Andrew J; Maier, Markus A; Binser, Martin J; Friedman, Ron; Pekrun, Reinhard

    2009-03-01

    This research tests whether the perception of red in an achievement context evokes avoidance behavior without conscious awareness and also examines the context specificity of the hypothesized red effect. In Experiment 1, participants were briefly shown red or green on the cover of an analogies test that they would ostensibly take (an achievement context) or rate on likability of (a nonachievement context) in an adjacent lab. Those shown red, relative to those shown green, knocked fewer times on the door of the adjacent lab in the achievement context; no red-green difference in knocking was observed in the nonachievement context. In Experiment 2, participants were briefly shown red, green, or gray on the cover of an IQ test that they would ostensibly take. Those shown red moved their body away from the test cover to a greater degree than did those shown green or gray. This research contributes to incipient work on color psychology and to the more established literature on the automatic link between evaluation and behavior. PMID:19223458

  9. Red cell ferritin and iron stores in chronic granulocytic leukemia

    International Nuclear Information System (INIS)

    Basic red cell ferritin was investigated in 28 patients with different phases of chronic granulocytic leukemia (GCL). Red cell ferritin was significantly decreased in remission after busulphan treatment and significantly elevated in the blast crisis as compared to healthy controls. Bone marrow stainable iron was decreased or absent in 86% of patients in the initial phase at the time of diagnosis and in 92% of those in remission. Red cell ferritin correlated with serum ferritin, however, serum ferritin level remained above normal range during all phases of the disease. A negative correlation between red cell ferritin and hemoglobin (Hb) (r = -0.605, p < 0.001) suggested that red cell ferritin level reflected the rate of iron utilization for heme synthesis. Decrease red cell iron observed in the remission may be explained by regression of dyserythropoiesis and by restoration of normal Hb synthesis after busulphan treatment. A progressive dyserythropoiesis in the blast crisis may lead to an increased red cell ferritin level. (author)

  10. The Red Edge Problem in asteroid band parameter analysis

    Science.gov (United States)

    Lindsay, Sean S.; Dunn, Tasha L.; Emery, Joshua P.; Bowles, Neil E.

    2016-04-01

    Near-infrared reflectance spectra of S-type asteroids contain two absorptions at 1 and 2 μm (band I and II) that are diagnostic of mineralogy. A parameterization of these two bands is frequently employed to determine the mineralogy of S(IV) asteroids through the use of ordinary chondrite calibration equations that link the mineralogy to band parameters. The most widely used calibration study uses a Band II terminal wavelength point (red edge) at 2.50 μm. However, due to the limitations of the NIR detectors on prominent telescopes used in asteroid research, spectral data for asteroids are typically only reliable out to 2.45 μm. We refer to this discrepancy as "The Red Edge Problem." In this report, we evaluate the associated errors for measured band area ratios (BAR = Area BII/BI) and calculated relative abundance measurements. We find that the Red Edge Problem is often not the dominant source of error for the observationally limited red edge set at 2.45 μm, but it frequently is for a red edge set at 2.40 μm. The error, however, is one sided and therefore systematic. As such, we provide equations to adjust measured BARs to values with a different red edge definition. We also provide new ol/(ol+px) calibration equations for red edges set at 2.40 and 2.45 μm.

  11. Abnormal red cell structure and function in neuroacanthocytosis.

    Directory of Open Access Journals (Sweden)

    Judith C A Cluitmans

    Full Text Available Panthothenate kinase-associated neurodegeneration (PKAN belongs to a group of hereditary neurodegenerative disorders known as neuroacanthocytosis (NA. This genetically heterogeneous group of diseases is characterized by degeneration of neurons in the basal ganglia and by the presence of deformed red blood cells with thorny protrusions, acanthocytes, in the circulation.The goal of our study is to elucidate the molecular mechanisms underlying this aberrant red cell morphology and the corresponding functional consequences. This could shed light on the etiology of the neurodegeneration.We performed a qualitative and semi-quantitative morphological, immunofluorescent, biochemical and functional analysis of the red cells of several patients with PKAN and, for the first time, of the red cells of their family members.We show that the blood of patients with PKAN contains not only variable numbers of acanthocytes, but also a wide range of other misshapen red cells. Immunofluorescent and immunoblot analyses suggest an altered membrane organization, rather than quantitative changes in protein expression. Strikingly, these changes are not limited to the red blood cells of PKAN patients, but are also present in the red cells of heterozygous carriers without neurological problems. Furthermore, changes are not only present in acanthocytes, but also in other red cells, including discocytes. The patients' cells, however, are more fragile, as observed in a spleen-mimicking device.These morphological, molecular and functional characteristics of red cells in patients with PKAN and their family members offer new tools for diagnosis and present a window into the pathophysiology of neuroacanthocytosis.

  12. OBSERVATIONAL CONSTRAINTS ON RED AND BLUE HELIUM BURNING SEQUENCES

    International Nuclear Information System (INIS)

    We derive the optical luminosity, colors, and ratios of the blue and red helium burning (HeB) stellar populations from archival Hubble Space Telescope observations of nineteen starburst dwarf galaxies and compare them with theoretical isochrones from Padova stellar evolution models across metallicities from Z = 0.001 to 0.009. We find that the observational data and the theoretical isochrones for both blue and red HeB populations overlap in optical luminosities and colors and the observed and predicted blue to red HeB ratios agree for stars older than 50 Myr over the time bins studied. These findings confirm the usefulness of applying isochrones to interpret observations of HeB populations. However, there are significant differences, especially for the red HeB population. Specifically, we find (1) offsets in color between the observations and theoretical isochrones of order 0.15 mag (0.5 mag) for the blue (red) HeB populations brighter than MV ∼ -4 mag, which cannot be solely due to differential extinction; (2) blue HeB stars fainter than MV ∼ -3 mag are bluer than predicted; (3) the slope of the red HeB sequence is shallower than predicted by a factor of ∼3; and (4) the models overpredict the ratio of the most luminous blue to red HeB stars corresponding to ages ∼ 0.5 Zsun), the red HeB stars overlap with the red giant branch stars in the color-magnitude diagrams, thus reducing their usefulness as indicators of star formation for ages ∼> 100 Myr.

  13. Passivity of iron in red mud's water solutions

    International Nuclear Information System (INIS)

    Red mud suspensions are studied as passivating agents for iron in alkaline chloride media. Red mud particles in alkaline media are negatively charged, and can absorb considerable amounts of protons without significant changes in pH. These particles adhere easily to an iron surface forming aggregates of heterogeneous shape, smaller than 10 μmx10 μm. These adhered particles recrystallise on potential cycling, and hinder metal dissolution and magnetite formation. Carbon steel samples passivated in red mud suspensions become resistant to corrosion in alkaline chloride media. Corrosion potential versus time records and impedance spectroscopy measurements allow formulating some hypotheses about the inhibiting mechanism

  14. Administration of red ginseng ameliorates memory decline in aged mice

    OpenAIRE

    Lee, Yeonju; Oh, Seikwan

    2015-01-01

    Background It has been known that ginseng can be applied as a potential nutraceutical for memory impairment; however, experiments with animals of old age are few. Methods To determine the memory enhancing effect of red ginseng, C57BL/6 mice (21 mo old) were given experimental diet pellets containing 0.12% red ginseng extract (approximately 200 mg/kg/d) for 3 mo. Young and old mice (4 mo and 21 mo old, respectively) were used as the control group. The effect of red ginseng, which ameliorated m...

  15. Holocaust and WWII: Jews in the Red Army

    OpenAIRE

    2015-01-01

    This paper focuses on the role of Jews in the Red Army in general and during WWII in particular. Historians estimate that a relatively high number of Jews (1.5 to 1.7 million) fought in the combined Allied Forces during WWII. At the same time, the fact that about 500,000 Jews enlisted or were conscripted into the Red Army has been largely ignored. After the demise of Communist regimes in the 1990s, however, the role of Jews serving in the Red Army began to be mentioned in cultural narratives....

  16. Red fluorescence in reef fish: A novel signalling mechanism?

    Directory of Open Access Journals (Sweden)

    Siebeck Ulrike E

    2008-09-01

    Full Text Available Abstract Background At depths below 10 m, reefs are dominated by blue-green light because seawater selectively absorbs the longer, 'red' wavelengths beyond 600 nm from the downwelling sunlight. Consequently, the visual pigments of many reef fish are matched to shorter wavelengths, which are transmitted better by water. Combining the typically poor long-wavelength sensitivity of fish eyes with the presumed lack of ambient red light, red light is currently considered irrelevant for reef fish. However, previous studies ignore the fact that several marine organisms, including deep sea fish, produce their own red luminescence and are capable of seeing it. Results We here report that at least 32 reef fishes from 16 genera and 5 families show pronounced red fluorescence under natural, daytime conditions at depths where downwelling red light is virtually absent. Fluorescence was confirmed by extensive spectrometry in the laboratory. In most cases peak emission was around 600 nm and fluorescence was associated with guanine crystals, which thus far were known for their light reflecting properties only. Our data indicate that red fluorescence may function in a context of intraspecific communication. Fluorescence patterns were typically associated with the eyes or the head, varying substantially even between species of the same genus. Moreover red fluorescence was particularly strong in fins that are involved in intraspecific signalling. Finally, microspectrometry in one fluorescent goby, Eviota pellucida, showed a long-wave sensitivity that overlapped with its own red fluorescence, indicating that this species is capable of seeing its own fluorescence. Conclusion We show that red fluorescence is widespread among marine fishes. Many features indicate that it is used as a private communication mechanism in small, benthic, pair- or group-living fishes. Many of these species show quite cryptic colouration in other parts of the visible spectrum. High inter

  17. Pressure-induced crystallization of amorphous red phosphorus

    Science.gov (United States)

    Rissi, Erin N.; Soignard, Emmanuel; McKiernan, Keri A.; Benmore, Chris. J.; Yarger, Jeffery L.

    2012-03-01

    Structural transitions in amorphous red phosphorus were studied at ambient temperature and pressures up to 12 GPa. Amorphous (red) phosphorus was observed to transform into crystalline black phosphorus at 7.5 ± 0.5 GPa using diamond anvil cell Raman spectroscopy, x-ray diffraction and a direct equation of state (EoS) measurement. The transition was found to be irreversible and the material recovered upon pressure cycling to 10 to 12 GPa was crystalline orthorhombic black phosphorus. A third order Birch-Murnaghan EoS was fit to the data and a bulk modulus (B0) of 11.2 GPa was measured for amorphous red phosphorus.

  18. Asteroseismology of red giant stars: The potential of dipole modes

    Directory of Open Access Journals (Sweden)

    Montalbán J.

    2013-03-01

    Full Text Available Since the detection of non-radial solar-like oscillation modes in red giants with the CoRoT satellite, the interest in the asteroseismic properties of red giants and the link with their global properties and internal structure is increasing. Moreover, more and more precise data are being collected with the space-based telescopes CoRoT and Kepler. Particularly relevant has been the detection of mixed modes in a large number of G-K red giants. In this contribution we discuss the potential of these dipole mixed modes to provide information on core extra-mixing and transport of angular momentum.

  19. Deep coverage mouse red blood cell proteome: a first comparison with the human red blood cell

    DEFF Research Database (Denmark)

    Pasini, Erica M; Kirkegaard, Morten; Salerno, Doris;

    2008-01-01

    Mice have close genetic/physiological relationships to humans, breed rapidly, and can be genetically modified, making them the most used mammal in biomedical research. Because the red blood cell (RBC) is the sole gas transporter in vertebrates, diseases of the RBC are frequently severe; much...... identified, and polypeptides migrating with anomalous apparent molecular weights were grouped into putatively ubiquitinated or partially degraded complexes. Overall there was close concordance between mouse and human proteomes, confirming the unexpected RBC complexity. Several novel findings in the human...

  20. THE CLUSTERING OF EXTREMELY RED OBJECTS

    Energy Technology Data Exchange (ETDEWEB)

    Palamara, David P.; Brown, Michael J. I.; Pimbblet, Kevin A. [School of Physics, Monash University, Clayton, Victoria 3800 (Australia); Jannuzi, Buell T.; Dey, Arjun [National Optical Astronomy Observatory, 950 North Cherry Avenue, Tucson, AZ 85719 (United States); Stern, Daniel [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States); Weiner, Benjamin J.; Rieke, Marcia [Steward Observatory, University of Arizona, 933 North Cherry Avenue, Tucson, AZ, 85721 (United States); Ashby, Matthew L. N. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Kochanek, C. S. [Department of Astronomy, The Ohio State University, 140, West 18th Avenue, Columbus, OH 43210 (United States); Gonzalez, Anthony [Department of Astronomy, University of Florida, Gainesville, FL 32611-2055 (United States); Brodwin, Mark [Department of Physics and Astronomy, University of Missouri, 5110 Rockhill Road, Kansas City, MO 64110 (United States); Le Floc' h, Emeric [Laboratoire AIM, CEA-Saclay-CNRS-Universite Paris Diderot, Service d' Astrophysique, Orme des Merisiers, F-91191 Gif-sur-Yvette (France)

    2013-02-10

    We measure the clustering of extremely red objects (EROs) in Almost-Equal-To 8 deg{sup 2} of the NOAO Deep Wide Field Survey Booetes field in order to establish robust links between ERO (z Almost-Equal-To 1.2) and local galaxy (z < 0.1) populations. Three different color selection criteria from the literature are analyzed to assess the consequences of using different criteria for selecting EROs. Specifically, our samples are (R - K{sub s} ) > 5.0 (28, 724 galaxies), (I - K{sub s} ) > 4.0 (22, 451 galaxies), and (I - [3.6]) > 5.0 (64, 370 galaxies). Magnitude-limited samples show the correlation length (r {sub 0}) to increase for more luminous EROs, implying a correlation with stellar mass. We can separate star-forming and passive ERO populations using the (K{sub s} - [24]) and ([3.6] - [24]) colors to K{sub s} = 18.4 and [3.6] = 17.5, respectively. Star-forming and passive EROs in magnitude-limited samples have different clustering properties and host dark halo masses and cannot be simply understood as a single population. Based on the clustering, we find that bright passive EROs are the likely progenitors of {approx}> 4L* elliptical galaxies. Bright EROs with ongoing star formation were found to occupy denser environments than star-forming galaxies in the local universe, making these the likely progenitors of {approx}> L* local ellipticals. This suggests that the progenitors of massive {approx}> 4L* local ellipticals had stopped forming stars by z {approx}> 1.2, but that the progenitors of less massive ellipticals (down to L*) can still show significant star formation at this epoch.