Nucleon self-energy in the relativistic Brueckner theory
Energy Technology Data Exchange (ETDEWEB)
Waindzoch, T; Fuchs, C; Faessler, A [Inst. fuer Theoretische Physik, Univ. Tuebingen (Germany)
1998-06-01
The self-energy of the nucleon in nuclear matter is calculated in the relativistic Brueckner theory. We solve the Thompson equation for the two nucleon scattering in the medium using different Bonn potentials. The self-energy has a rather strong momentum dependence while the equation of state compares well with previous calculations. (orig.)
Nucleon self-energy in the relativistic Brueckner theory
International Nuclear Information System (INIS)
Waindzoch, T.; Fuchs, C.; Faessler, A.
1998-01-01
The self-energy of the nucleon in nuclear matter is calculated in the relativistic Brueckner theory. We solve the Thompson equation for the two nucleon scattering in the medium using different Bonn potentials. The self-energy has a rather strong momentum dependence while the equation of state compares well with previous calculations. (orig.)
Laser-assisted collisions: The Kroll-Watson formula and bremsstrahlung theory
International Nuclear Information System (INIS)
Geltman, S.
1996-01-01
Recent measurements on CO 2 -laser-assisted electron-atom collisions have shown large inconsistencies with the Kroll-Watson formula for small-angle scattering. We have carried out a detailed study to compare the predictions of Kroll-Watson theory (for both single and multimode fields) with those of conventional perturbation theory for stimulated free-free transitions. It is found that for E 0 /2ω 2 <1, where perturbation theory is valid, there are large differences with the Kroll-Watson theory. Comparisons of experimental variations with respect to scattering angle and electron energy show much better agreement with perturbation theory than with Kroll-Watson theory. A study of the angular variations in perturbation theory shows that use of the open-quote open-quote outgoing close-quote close-quote wave final state gives much better agreement with experiment than does the open-quote open-quote ingoing close-quote close-quote wave final state, which is different from the choice made in early bremsstrahlung theory. copyright 1996 The American Physical Society
[From humanism to nihilism: dialectics on Jean Watson's caring theory].
Krol, Pawel J; Lavoie, Mireille
2015-09-01
nursing today is heir to values that have developed over many years. In addition to the values of human care, present-day nursing embraces values that shape our modern world. This dialectical study first traces the evolution of a number of the traditional values associated with human care that nursing has retained. It goes on to show how some of the values of human care have been cast aside in favour of modern--neoliberal, technocratic and bureaucratic--values which have in turn given rise to disturbing problems of instrumentalization. Watson's theory of caring proposes two ways to remedy such instrumentalization: espousing a transcendental, metaphysical mode of thought and adopting an altruistic humanism. However, many critics have questioned the theoretical consistency and very legitimacy of the theory as a means of dealing with instrumentalization. this study analyses Watson's proposals, using a Nietzschean dialectic approach to test them and to suggest possible solutions. Significant problems in terms of both consistency and relevance are brought to light, tending to refute Watson's notions. the study findings suggest that the application of Watson's theory may paradoxically perpetuate dualism and nihilism and, rather than curb their invasive impact, lead inevitably to a conversion to instrumental values. it's suggested an alternative, ethics-of-life approach based on the synthesis of our dialectics that would foster a return to, and respect for, humanity's essential nature.
Fit for Practice: Analysis and Evaluation of Watson's Theory of Human Caring.
Pajnkihar, Majda; McKenna, Hugh P; Štiglic, Gregor; Vrbnjak, Dominika
2017-07-01
The aim of the authors of this paper is to analyze Watson's theory of human caring for its usefulness and worth in education, practice, and research. The reason for undertaking this analysis is to evaluate if Watson's theory would be useful for nursing in those countries where such theories were not an established part of the nursing curriculum. Furthermore, in some European countries, their political past or cultural influences led to an unquestioned adoption of the biomedical model. As their political culture changes, many social structures have had to be revisited, and for nursing, this has meant the introduction of theoretical reasoning, teaching, and practice.
Asymmetric nuclear matter and neutron star properties within the extended Brueckner theory
Energy Technology Data Exchange (ETDEWEB)
Hassaneen, Khaled S.A. [Sohag University, Physics Department, Faculty of Science, Sohag (Egypt); Taif University, Physics Department, Faculty of Science, Taif (Saudi Arabia)
2017-01-15
Microscopically, the equation of state (EOS) and other properties of asymmetric nuclear matter at zero temperature have been investigated extensively by adopting the non-relativistic Brueckner-Hartree-Fock (BHF) and the extended BHF approaches by using the self-consistent Green's function approach or by including a phenomenological three-body force. Once three-body forces are introduced, the phenomenological saturation point is reproduced and the theory is applied to the study of neutron star properties. We can calculate the total mass and radius for neutron stars using various equations of state at high densities in β-equilibrium without hyperons. A comparison with other microscopic predictions based on non-relativistic and density-dependent relativistic mean-field calculations has been done. It is found that relativistic EOS yields however larger mass and radius for neutron star than predictions based on non-relativistic approaches. Also the three-body force plays a crucial role to deduce the theoretical value of the maximum mass of neutron stars in agreement with recent measurements of the neutron star mass. (orig.)
Upper-bound nature of the Brueckner energy of nuclear matter
International Nuclear Information System (INIS)
Harada, M.
1993-01-01
A trial wavefunction is constructed for nuclear matter in terms of the reaction matrix. The trial function includes only two-particle excitations and the resulting energy expectation value for two-nucleon forces with a state-independent repulsive core of Yukawa shape approaches in the thermodynamic limit the energy given by the lowest order Brueckner theory with standard dispersion. Evaluation of the energy expectation value is carried out in a systematic way by use of an identity that holds between the Hamiltonians and reaction matrix. (Author)
Brueckner Rearrangement Effects in $^5_\\Lambda$He and $^6_{\\Lambda\\Lambda}$He
Kohno, M.; Fujiwara, Y.; Akaishi, Y.
2003-01-01
Rearrangement effects in light hypernuclei are investigated in the framework of the Brueckner theory. We can estimate without detailed numerical calculations that the energy of the $\\alpha$-core is reduced by more than 2.5 MeV when the $\\Lambda$ adheres to $^4$He to form $^5_\\Lambda$He. Similar assessment of rearrangement contributions is essential to deduce the strength of $\\Lambda\\Lambda$ interaction from experimentally observed $\\Delta B_{\\Lambda\\Lambda}$. The recently observed experimenta...
Distributional Watson transforms
Dijksma, A.; Snoo, H.S.V. de
1974-01-01
For all Watson transforms W in L2(R+) a triple of Hilbert space LG ⊂ L2(R+) ⊂ L'G is constructed such that W may be extended to L'G. These results allow the construction of a triple L ⊂ L2(R+) ⊂ L', where L is a Gelfand-Fréchet space. This leads to a theory of distributional Watson transforms.
International Nuclear Information System (INIS)
Grange, P.; Lejeune, A.
1979-01-01
Two, three- and four-body contributions to the binding energy of nuclear matter are evaluated in the framework of the Bethe-Brueckner expansion. Special attention is devoted to the choice of the auxillary single particle field and to the potential diagrams at the level of three- and four-hole lines present when such a field is different from zero. Two nucleon-nucleon interactions are used: a model interaction V 1 and the Reid soft-core interaction. For V 1 our results are compared with those obtained from variational calculations; this comparison supports the reliability of the perturbative expansion. (Auth.)
From theory to practice: caring science according to Watson and Brewer.
Clarke, Pamela N; Watson, Jean; Brewer, Barbara B
2009-10-01
Caring science is presented by Jean Watson and Barbara Brewer through an interview and dialogue format. Jean Watson presents caring science and its philosophy and evolution and the impact of her model on nursing and other disciplines. Barbara Brewer addresses the implementation of the model in a Magnet hospital setting and describes how her leadership facilitated implementation.
Watson's theorem and resonant pion photoproduction amplitude in the delta channel
International Nuclear Information System (INIS)
Wittman, R.; Davidson, R.; Mukhopadhyay, N.C.
1984-01-01
The CGLN and BL theories of the pion photoproduction on nucleons, used in nuclear calculations, are examined regarding their predictions of the resonant M 1 + and E 1 + multipoles. The nonunitary BL approach violates Watson's theorem, and predicts these multipoles porly. In the static limit, the CGLN multipoles satisfy Watson's theorem and are in fine agreement with data. The unitarized BL multipoles agree with those from the Olsson theory and data. (orig.)
Weighted Watson-Crick automata
Energy Technology Data Exchange (ETDEWEB)
Tamrin, Mohd Izzuddin Mohd [Department of Information System, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia); Turaev, Sherzod; Sembok, Tengku Mohd Tengku [Department of Computer Science, Kulliyyah of Information and Communication Technology, International Islamic University Malaysia, 50728 Gombak, Selangor (Malaysia)
2014-07-10
There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power.
Weighted Watson-Crick automata
International Nuclear Information System (INIS)
Tamrin, Mohd Izzuddin Mohd; Turaev, Sherzod; Sembok, Tengku Mohd Tengku
2014-01-01
There are tremendous works in biotechnology especially in area of DNA molecules. The computer society is attempting to develop smaller computing devices through computational models which are based on the operations performed on the DNA molecules. A Watson-Crick automaton, a theoretical model for DNA based computation, has two reading heads, and works on double-stranded sequences of the input related by a complementarity relation similar with the Watson-Crick complementarity of DNA nucleotides. Over the time, several variants of Watson-Crick automata have been introduced and investigated. However, they cannot be used as suitable DNA based computational models for molecular stochastic processes and fuzzy processes that are related to important practical problems such as molecular parsing, gene disease detection, and food authentication. In this paper we define new variants of Watson-Crick automata, called weighted Watson-Crick automata, developing theoretical models for molecular stochastic and fuzzy processes. We define weighted Watson-Crick automata adapting weight restriction mechanisms associated with formal grammars and automata. We also study the generative capacities of weighted Watson-Crick automata, including probabilistic and fuzzy variants. We show that weighted variants of Watson-Crick automata increase their generative power
Brovarets', O O
2013-01-01
At the MP2/6-311++G(2df,pd)//B3LYP/6-311++G(d,p) level of theory it was established for the first time, that the Löwdin's G*.C* DNA base pair formed by the mutagenic tautomers can acquire, as the A-T Watson-Crick DNA base pair, four biologically important configurations, namely: Watson-Crick, reverse Watson-Crick, Hoogsteen and reverse Hoogsteen. This fact demonstrates rather unexpected role of the tautomerisation of the one of the Watson-Crick DNA base pairs, in particular, via double proton transfer: exactly the G.C-->G*.C* tautomerisation allows to overcome steric hindrances for the implementation of the above mentioned configurations. Geometric, electron-topological and energetic properties of the H-bonds that stabilise the studied pairs, as well as the energetic characteristics of the latters are presented.
Closure properties of Watson-Crick grammars
Zulkufli, Nurul Liyana binti Mohamad; Turaev, Sherzod; Tamrin, Mohd Izzuddin Mohd; Azeddine, Messikh
2015-12-01
In this paper, we define Watson-Crick context-free grammars, as an extension of Watson-Crick regular grammars and Watson-Crick linear grammars with context-free grammar rules. We show the relation of Watson-Crick (regular and linear) grammars to the sticker systems, and study some of the important closure properties of the Watson-Crick grammars. We establish that the Watson-Crick regular grammars are closed under almost all of the main closure operations, while the differences between other Watson-Crick grammars with their corresponding Chomsky grammars depend on the computational power of the Watson-Crick grammars which still need to be studied.
Sternod, Latisha; French, Brian
2016-01-01
The Watson-Glaser™ II Critical Thinking Appraisal (Watson-Glaser II; Watson & Glaser, 2010) is a revised version of the "Watson-Glaser Critical Thinking Appraisal®" (Watson & Glaser, 1994). The Watson-Glaser II introduces a simplified model of critical thinking, consisting of three subdimensions: recognize assumptions, evaluate…
Data Discovery with IBM Watson
Fessler, J.
2016-12-01
BM Watson is a cognitive computing system that uses machine learning, statistical analysis, and natural language processing to find and understand the clues in questions posed to it. Watson was made famous when it bested two champions on TV's Jeopardy! show. Since then, Watson has evolved into a platform of cognitive services that can be trained on very granular fields up study. Watson is being used to support a number of subject domains, such as cancer research, public safety, engineering, and the intelligence community. IBM will be providing a presentation and demonstration on the Watson technology and will discuss its capabilities including Natural Language Processing, text analytics and enterprise search, as well as cognitive computing with deep Q&A. The team will also be giving examples of how IBM Watson technology is being used to support real-world problems across a number of public sector agencies
Rilling, M
2000-01-01
Before he invented behaviorism, John B. Watson considered learning one of the most important topics in psychology. Watson conducted excellent empirical research on animal learning. He developed behaviorism in part to promote research and elevate the status of learning in psychology. Watson was much less successful in the adequacy and originality of the mechanisms he proposed to explain learning. By assimilating the method of classical conditioning and adopting Pavlov's theory of stimulus substitution, Watson linked behaviorism with a new method that could compete with both Titchener's method of introspection and Freud's methods of psychoanalysis. Watson's interest in explaining psychopathology led to the discovery of conditioned emotional responses and a behavioristic explanation for the learning of phobic behavior. Watson established learning as a central topic for basic research and application in American psychology.
Multi-head Watson-Crick automata
Chatterjee, Kingshuk; Ray, Kumar Sankar
2015-01-01
Inspired by multi-head finite automata and Watson-Crick automata in this paper, we introduce new structure namely multi-head Watson-Crick automata where we replace the single tape of multi-head finite automaton by a DNA double strand. The content of the second tape is determined using a complementarity relation similar to Watson-Crick complementarity relation. We establish the superiority of our model over multi-head finite automata and also show that both the deterministic and non-determinis...
International Nuclear Information System (INIS)
Fargher, H.E.; Roberts, M.J.
1983-01-01
Simplified versions of the second-order Born and Faddeev-Watson approximations are applied to the excitation of the n=2 levels of atomic hydrogen by the impact of 54.4 eV electrons. The theories are compared with the measurements of differential cross sections and angular correlation parameters. The results indicate that the Born approximation is better at low angles of scattering but that the Faddeev-Watson approximation is better at high angles. The importance of the phases of the two-body T matrices in the Faddeev-Watson approximation is illustrated. (author)
Did John B. Watson Really "Found" Behaviorism?
Malone, John C
2014-05-01
Developments culminating in the nineteenth century, along with the predictable collapse of introspective psychology, meant that the rise of behavioral psychology was inevitable. In 1913, John B. Watson was an established scientist with impeccable credentials who acted as a strong and combative promoter of a natural science approach to psychology when just such an advocate was needed. He never claimed to have founded "behavior psychology" and, despite the acclaim and criticism attending his portrayal as the original behaviorist, he was more an exemplar of a movement than a founder. Many influential writers had already characterized psychology, including so-called mental activity, as behavior, offered many applications, and rejected metaphysical dualism. Among others, William Carpenter, Alexander Bain, and (early) Sigmund Freud held views compatible with twentieth-century behaviorism. Thus, though Watson was the first to argue specifically for psychology as a natural science, behaviorism in both theory and practice had clear roots long before 1913. If behaviorism really needs a "founder," Edward Thorndike might seem more deserving, because of his great influence and promotion of an objective psychology, but he was not a true behaviorist for several important reasons. Watson deserves the fame he has received, since he first made a strong case for a natural science (behaviorist) approach and, importantly, he made people pay attention to it.
Quasiparticle method in relativistic mean-field theories of nuclear structure
International Nuclear Information System (INIS)
Ai, H.
1988-01-01
In recent years, in order to understand the success of Dirac phenomenology, relativistic Brueckner-Hartree-Fock (RBHF) theory has been developed. This theory is a relativistic many-body theory of nuclear structure. Based upon the RBHF theory, which is characterized as having no free parameters other than those introduced in fitting free-space nucleon-nucleon scattering data, we construct an effective interaction. This interaction, when treated in a relativistic Hartree-Fock approximation, reproduces, rather accurately, the nucleon self-energy in nuclear matter, Migdal parameters obtained via relativistic Brueckner-Hartree-Fock calculations, and the saturation curves calculated with the full relativistic Brueckner-Hartree-Fock theory. This effective interaction is constructed by adding a number of pseudoparticles to the mesons used to construct one-boson-exchange (OBE) models of the nuclear force. The pseudoparticles have relatively large masses and either real or imaginary coupling constants. (For example, exchange of a pseudo-sigma with an imaginary coupling constant has the effect of reducing the scalar attraction arising from sigma exchange, while exchange of a pseudo-omega with an imaginary coupling constant has the effect of reducing the repulsion arising from omega exchange. The terms beyond the Born term in the case of pion exchange are well simulated by pseudo-sigma exchange with a real coupling constant.) The effective interaction constructed here may be used for calculations of the properties of finite nuclei in a relativistic Hartree-Fock approximation
Making IBM's Computer, Watson, Human
Rachlin, Howard
2012-01-01
This essay uses the recent victory of an IBM computer (Watson) in the TV game, "Jeopardy," to speculate on the abilities Watson would need, in addition to those it has, to be human. The essay's basic premise is that to be human is to behave as humans behave and to function in society as humans function. Alternatives to this premise are considered…
International Nuclear Information System (INIS)
Catalan, G.; Roberts, M.J.
1979-01-01
A form of the off-shell Coulomb T matrix, which has a well defined on-shell limit, is used in the Faddeev-Watson multiple-scattering expansion for a direct three-body collision process. Using the excitation of atomic hydrogen by electron impact as an example, approximations to the second-order terms, which are valid for high momentum transfers of the incident electron, are derived. It is shown how the resulting asymptotic behaviour of the second-order Faddeev-Watson approximation is related to the high momentum transfer limit of the second Born approximation. The results are generalised to the excitation of more complex atoms. The asymptotic forms of the Faddeev-Watson and Born approximations are compared with other theories and with measurements of differential cross sections and angular correlation parameters for the excitation of H(2p) and He(2 1 P). The results indicate that the Faddeev-Watson approximation converges more rapidly at high momentum transfers than does the Born approximation. (author)
How a low-fidelity DNA polymerase chooses non-Watson-Crick from Watson-Crick incorporation.
Wu, Wen-Jin; Su, Mei-I; Wu, Jian-Li; Kumar, Sandeep; Lim, Liang-Hin; Wang, Chun-Wei Eric; Nelissen, Frank H T; Chen, Ming-Chuan Chad; Doreleijers, Jurgen F; Wijmenga, Sybren S; Tsai, Ming-Daw
2014-04-02
A dogma for DNA polymerase catalysis is that the enzyme binds DNA first, followed by MgdNTP. This mechanism contributes to the selection of correct dNTP by Watson-Crick base pairing, but it cannot explain how low-fidelity DNA polymerases overcome Watson-Crick base pairing to catalyze non-Watson-Crick dNTP incorporation. DNA polymerase X from the deadly African swine fever virus (Pol X) is a half-sized repair polymerase that catalyzes efficient dG:dGTP incorporation in addition to correct repair. Here we report the use of solution structures of Pol X in the free, binary (Pol X:MgdGTP), and ternary (Pol X:DNA:MgdGTP with dG:dGTP non-Watson-Crick pairing) forms, along with functional analyses, to show that Pol X uses multiple unprecedented strategies to achieve the mutagenic dG:dGTP incorporation. Unlike high fidelity polymerases, Pol X can prebind purine MgdNTP tightly and undergo a specific conformational change in the absence of DNA. The prebound MgdGTP assumes an unusual syn conformation stabilized by partial ring stacking with His115. Upon binding of a gapped DNA, also with a unique mechanism involving primarily helix αE, the prebound syn-dGTP forms a Hoogsteen base pair with the template anti-dG. Interestingly, while Pol X prebinds MgdCTP weakly, the correct dG:dCTP ternary complex is readily formed in the presence of DNA. H115A mutation disrupted MgdGTP binding and dG:dGTP ternary complex formation but not dG:dCTP ternary complex formation. The results demonstrate the first solution structural view of DNA polymerase catalysis, a unique DNA binding mode, and a novel mechanism for non-Watson-Crick incorporation by a low-fidelity DNA polymerase.
78 FR 43198 - Watson Cogeneration Company; Notice of Filing
2013-07-19
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. TX13-1-000] Watson... Commission's (Commission) Regulations, 18 CFR 36.1, Watson Cogeneration Company filed an application... physical interconnection to the Watson facility; (2) direct SCE and California Independent System Operator...
Directory of Open Access Journals (Sweden)
Luciane Favero
2009-01-01
producciones referidas al tema de estudio, que ella puede ser aplicada en los niveles de atención primaria, secundaria y terciaria y que el 64,7% de las producciones utilizan los factores de cuidado propuestos por Jean Watson en 1979. Surge la necesidad de perfeccionamiento de las investigaciones respecto a la transformación ocurrida en la Teoría del Cuidado Transpersonal, con abordaje del Proceso Clinical Caritas, no obstante como son escasos los estudios referentes a esta temática, dificultan su utilización práctica.This systematic review aimed to describe and analyze the use of Jean Watson's Theory of Human Caring in Brazilian studies in the last ten years. A literature search using MEDLINE (MEDLARS - Medical Literature Analysis and Retrieval System, LILACS (Latin American and Caribbean Health Science Literature BDENF (Nursing Database, and SciELO (Scientific Electronic Library Online databases was conducted. A sample of 34 publications met the systematic review inclusion criteria. The results showed that 61.8% of the studies were conducted in the south of Brazil, and these studies suggested that the Theory of Human Caring could be used in the three levels of care: primary, secondary, and tertiary. The majority of publications (64.7% used the carative factors proposed by Jean Watson in 1979. There is a need for research approaches in respect to changes occurred in the Theory of Human Caring that evolved into the clinical caritas processes. Few studies have tested these new processes. This fact makes difficulty to use them in clinical practice.
The multiple personalities of Watson and Crick strands.
Cartwright, Reed A; Graur, Dan
2011-02-08
In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus) strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky), and William Martin.
The multiple personalities of Watson and Crick strands
Directory of Open Access Journals (Sweden)
Graur Dan
2011-02-01
Full Text Available Abstract Background In genetics it is customary to refer to double-stranded DNA as containing a "Watson strand" and a "Crick strand." However, there seems to be no consensus in the literature on the exact meaning of these two terms, and the many usages contradict one another as well as the original definition. Here, we review the history of the terminology and suggest retaining a single sense that is currently the most useful and consistent. Proposal The Saccharomyces Genome Database defines the Watson strand as the strand which has its 5'-end at the short-arm telomere and the Crick strand as its complement. The Watson strand is always used as the reference strand in their database. Using this as the basis of our standard, we recommend that Watson and Crick strand terminology only be used in the context of genomics. When possible, the centromere or other genomic feature should be used as a reference point, dividing the chromosome into two arms of unequal lengths. Under our proposal, the Watson strand is standardized as the strand whose 5'-end is on the short arm of the chromosome, and the Crick strand as the one whose 5'-end is on the long arm. Furthermore, the Watson strand should be retained as the reference (plus strand in a genomic database. This usage not only makes the determination of Watson and Crick unambiguous, but also allows unambiguous selection of reference stands for genomics. Reviewers This article was reviewed by John M. Logsdon, Igor B. Rogozin (nominated by Andrey Rzhetsky, and William Martin.
Durgun Ozan, Yeter; Okumuş, Hülya
2017-06-01
Introduction: The failure of infertility treatment leads to individual, familial, and social problems. The objective of this study was to evaluate the effectiveness of the nursing care program based on Watson's "Theory of Human Caring" on anxiety and distress caused by coping when the treatment fails. Methods: This study randomized controlled trial study was conducted from April to November 2012, with 86 Turkish women with infertility (intervention group: 45, control group: 41). Follow-up of 32 infertile women, who failed infertility treatment from intervention group, and 35 infertile women, who failed infertility treatment from control group, continued for another four weeks. Data were collected through Spiel Berger's State/Trait Anxiety Inventory, Distress Scale, and Ways of Coping Questionnaire. The analyses of data were conducted using SPSS ver 13. Results: The intervention and control groups significantly differed in terms of anxiety, distress, and coping levels. The intervention group's mean anxiety score decreased by thirteen points and distress by fourteen points (in a positive direction). The intervention group's mean positive coping style score increased. Whereas a negative increase was observed in the control group's values depending on the failure of the treatment. Conclusion: Watson's theory of human caring is recommended as a guide to nursing patients with infertility treatment to decrease levels of anxiety and distress, and to increase the positive coping style among infertile women.
Training IBM Watson using Automatically Generated Question-Answer Pairs
Lee, Jangho; Kim, Gyuwan; Yoo, Jaeyoon; Jung, Changwoo; Kim, Minseok; Yoon, Sungroh
2016-01-01
IBM Watson is a cognitive computing system capable of question answering in natural languages. It is believed that IBM Watson can understand large corpora and answer relevant questions more effectively than any other question-answering system currently available. To unleash the full power of Watson, however, we need to train its instance with a large number of well-prepared question-answer pairs. Obviously, manually generating such pairs in a large quantity is prohibitively time consuming and...
Poltev, V I; Anisimov, V M; Sanchez, C; Deriabina, A; Gonzalez, E; Garcia, D; Rivas, F; Polteva, N A
2016-01-01
It is generally accepted that the important characteristic features of the Watson-Crick duplex originate from the molecular structure of its subunits. However, it still remains to elucidate what properties of each subunit are responsible for the significant characteristic features of the DNA structure. The computations of desoxydinucleoside monophosphates complexes with Na-ions using density functional theory revealed a pivotal role of DNA conformational properties of single-chain minimal fragments in the development of unique features of the Watson-Crick duplex. We found that directionality of the sugar-phosphate backbone and the preferable ranges of its torsion angles, combined with the difference between purines and pyrimidines. in ring bases, define the dependence of three-dimensional structure of the Watson-Crick duplex on nucleotide base sequence. In this work, we extended these density functional theory computations to the minimal' fragments of DNA duplex, complementary desoxydinucleoside monophosphates complexes with Na-ions. Using several computational methods and various functionals, we performed a search for energy minima of BI-conformation for complementary desoxydinucleoside monophosphates complexes with different nucleoside sequences. Two sequences are optimized using ab initio method at the MP2/6-31++G** level of theory. The analysis of torsion angles, sugar ring puckering and mutual base positions of optimized structures demonstrates that the conformational characteristic features of complementary desoxydinucleoside monophosphates complexes with Na-ions remain within BI ranges and become closer to the corresponding characteristic features of the Watson-Crick duplex crystals. Qualitatively, the main characteristic features of each studied complementary desoxydinucleoside monophosphates complex remain invariant when different computational methods are used, although the quantitative values of some conformational parameters could vary lying within the
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
Uporaba orodja poslovne inteligence IBM Watson za predvidevanje prodaje
Stojić, Igor
2016-01-01
Diplomska naloga obravnava uporabo orodja IBM Watson in njegovo poslovno vrednost, ki jo ima v okviru oblikovanja napovedi prihodnje prodaje produktov. V teoretičnem delu podrobneje opredeljuje napovedovanje in smoter le-tega. V okviru empiričnega dela pa je bila izvedena primerjava uporabe ERP sistemov SAP in IBM Watson, pri čemer je bil dosledno prikazan postopek oblikovanja napovedi, tako s SAP kot tudi z IBM Watson, s slednjim pa tudi identificiran parameter, ki vpliva na prodajo nekateri...
Theoretical study of the Hoogsteen-Watson-Crick junctions in DNA.
Cubero, Elena; Luque, F Javier; Orozco, Modesto
2006-02-01
A series of d (AT)(n) oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation.
Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA
Cubero, Elena; Luque, F. Javier; Orozco, Modesto
2006-01-01
A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less stable than the canonical B-type Watson-Crick one. The junctions between the Watson-Crick and Hoogsteen structures introduces a priori a sharp discontinuity in the helix, because the properties of each type of conformation are very well preserved in the corresponding fragments. However, and quite counterintuitively, junctions do not largely distort the duplex in structural, dynamics or energetic terms. Our results strongly support the possibility that small fragments of antiparallel Hoogsteen duplex might be embedded into large fragments of B-type Watson-Crick helices, making possible protein-DNA interactions that are specific of the antiparallel Hoogsteen conformation. PMID:16287814
Substituent effif ects on hydrogen bonding in Watson-Crick base pairs. A theoretical study
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2005-01-01
We have theoretically analyzed Watson-Crick AT and GC base pairs in which purine C8 and/or pyrimidine C6 positions carry a substituent X = H, F, Cl or Br, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P. The purpose is to study the effects on structure
Introduction to quantum field theory
Chang, Shau-Jin
1990-01-01
This book presents in a short volume the basics of quantum field theory and many body physics. The first part introduces the perturbative techniques without sophisticated apparatus and applies them to numerous problems including quantum electrodynamics (renormalization), Fermi and Bose gases, the Brueckner theory of nuclear system, liquid Helium and classical systems with noise. The material is clear, illustrative and the important points are stressed to help the reader get the understanding of what is crucial without overwhelming him with unnecessary detours or comments. The material in the s
International Nuclear Information System (INIS)
Chen Baoqiu; Ma Zhongyu
1992-01-01
Relativistic microscopic optical potential of nucleon-nucleus is derived from the relativistic Brueckner-Bethe-Goldstone (RBBG) equation. The complex effective mass of a nucleon is determined by a fit to 200 MeV p- 40 Ca scattering data. The relativistic microscopic optical potentials with this effective mass are obtained from RBBG for p- 16O , 40 Ca, 90 Zr and 208 Pb scattering in energy range from 160 to 800 MeV. The microscopic optical potential is used to study the proton- 40 Ca scattering problem at 200 MeV. The results, such as differential cross section, analyzing power and spin rotation function are compared with those calculated from phenomenological relativistic optical potential
Watson-Crick base pairs with thiocarbonyl groups: How sulfur changes the hydrogen bonds in DNA
Fonseca Guerra, C.; Baerends, E.J.; Bickelhaupt, F.M.
2008-01-01
We have theoretically analyzed mimics of Watson-Crick AT and GC base pairs in which N-H•••O hydrogen bonds are replaced by N-H•••S, using the generalized gradient approximation (GGA) of density functional theory at BP86/TZ2P level. The general effect of the above substitutions is an elongation and a
Microscopic optical model potential based on Brueckner-Hartree-Fock theory
International Nuclear Information System (INIS)
Li Lulu; Zhao Enguang; Zhou Shangui; Li Zenghua; Zuo Wei; Bonaccorso, Angela; Lonbardo, Umberto
2010-01-01
The optical model is one of the most important models in the study of nuclear reactions. In the optical model, the elastic channel is considered to be dominant and the contributions of all other absorption channels are described by introducing an imaginary potential, Koning and Delaroche obtained empirically the so-called KDR optical potentials based on a best-fitting of massive experimental data on nucleon-nucleus scattering reactions. The volume part is found to be dominant in the real component of the OMP at low energies. Using the Bruckner-Hartree-Fock theory with Bonn B potential plus self consistent three body force, the nucleon-nucleus optical potential is studied in this thesis. In the Bruckner theory, the on-shell self energy, is corresponding to the depth of the volume part of the optical model potential (OMP) for nucleon-nucleus scattering. Using Bruckner-Hartree-Fock theory, the nucleon on-shell self energy is calculated based on Hughenoltz-Van Hove (HVH) theorem. The microscopic optical potentials thus obtained agree well with the volume part of the KDR potentials. Furthermore, the isospin splitting in the volume part of the OMP is also reproduced satisfactorily. The isospin effect in the volume part of the OMP is directly related to the isospin splitting of the effective mass of the nucleon. According to our results, the isospin splitting of neutron to proton effective mass is such that the neutron effective mass increases with isospin, whereas the proton effective mass decreases. The isovector potential U n (E) - U p (E) vanishes at energy E ≈ 200 MeV and then changes sign indicating a possible inversion in the effective mass isospin spitting. We also calculated from the Bruckner theory the imaginary part of the OMP, and the microscopic calculations predict that the isospin splitting exists also in the imaginary OMP whereas the empirical KDR potentials do not show this feature. The shape of the real component of the nucleon-nucleus OMP is
Replication infidelity via a mismatch with Watson-Crick geometry.
Bebenek, Katarzyna; Pedersen, Lars C; Kunkel, Thomas A
2011-02-01
In describing the DNA double helix, Watson and Crick suggested that "spontaneous mutation may be due to a base occasionally occurring in one of its less likely tautomeric forms." Indeed, among many mispairing possibilities, either tautomerization or ionization of bases might allow a DNA polymerase to insert a mismatch with correct Watson-Crick geometry. However, despite substantial progress in understanding the structural basis of error prevention during polymerization, no DNA polymerase has yet been shown to form a natural base-base mismatch with Watson-Crick-like geometry. Here we provide such evidence, in the form of a crystal structure of a human DNA polymerase λ variant poised to misinsert dGTP opposite a template T. All atoms needed for catalysis are present at the active site and in positions that overlay with those for a correct base pair. The mismatch has Watson-Crick geometry consistent with a tautomeric or ionized base pair, with the pH dependence of misinsertion consistent with the latter. The results support the original idea that a base substitution can originate from a mismatch having Watson-Crick geometry, and they suggest a common catalytic mechanism for inserting a correct and an incorrect nucleotide. A second structure indicates that after misinsertion, the now primer-terminal G • T mismatch is also poised for catalysis but in the wobble conformation seen in other studies, indicating the dynamic nature of the pathway required to create a mismatch in fully duplex DNA.
Detterman, Douglas K.
2011-01-01
Watson's Jeopardy victory raises the question of the similarity of artificial intelligence and human intelligence. Those of us who study human intelligence issue a challenge to the artificial intelligence community. We will construct a unique battery of tests for any computer that would provide an actual IQ score for the computer. This is the same…
2006-01-01
Ed Watson passed away suddenly on 1 August in Geneva, he was 66. He leaves his wife and two children. Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The...
The structure of nuclear matter; La structure de la matiere nucleaire
Energy Technology Data Exchange (ETDEWEB)
Bloch, [Commissariat a l' Energie Atomique, Saclay (France).Centre d' Etudes Nucleaires
1959-07-01
Report on the most recent developments in the theory of systems of interacting fermions. After having given the general form of the ground state energy in perturbation theory, one indicates the terms whose summation tends to the Brueckner approximation. The numerical results obtained with this theory are briefly mentioned. A discussion is given about the difficulty occurring in the case of potentials which are attractive near the Fermi surface due to the existence of the Cooper bound states. The main ideas of the proof of the Van Hove Hugenholtz theorem on the Fermi energy are indicated and its implications for the Brueckner theory are given. The extension of the methods described here to statistical mechanics are briefly mentioned. In the discussion, Professor Brueckner reports on the most recent results concerning the application of his theory to finite nuclei. Professor Migdal reviews the results which he has obtained with the method of Green's functions on the superconducting properties of finite nuclei. Professor Weisskopf gives a qualitative explanation of the success of the Brueckner theory. (author) [French] Rapport sur les recents travaux portant sur la theorie des systemes de fermions en interaction. Apres avoir donne la forme generale du developpement de l'energie de l'etat fondamental dans la theorie des perturbations, on indique les termes dont la sommation conduit a l'approximation de Brueckner. Les resultats numeriques obtenus a l'aide de cette theorie sont brievement mentionnes. Une discussion est donnee de la difficulte survenant dans le cas des potentiels attractifs au voisinage de la surface de Fermi par suite de l'existence des etats lies de Cooper. Les idees essentielles de la demonstration du theoreme de Van Hove et Hugenholtz sur l'energie de Fermi sont indiquees ainsi que ses consequences pour la theorie de Brueckner. L'extension des methodes decrites a la Mecanique Statistique est brievement mentionnee. Dans la discussion, le professeur
International Nuclear Information System (INIS)
Koehler, H.S.
1979-01-01
A short review of the early developments due largely to K. A Brueckner is given. Special emphasis is given to insertions in hole and particle lines, dispersion-effects and healings, and how the quantitative effects of these are related to the nature of the force. The importance of higher-order insertions in hole and particle lines and its relation to the force is also emphasized. This is important in a quantitative comparison of BBG theory with variational theory. The inceased healing-distance due to the tensor force is also pointed out. This gives convergence problems. Experiment may leave room for a nuclear force with weaker tensor force than mostly used. (Auth.)
Chuck Watson's ``differential psychoacoustics:'' Individual differences in auditory abilities
Kidd, Gary R.
2004-05-01
Chuck Watson was among the first in the psychoacoustic community to seriously address the topic of individual differences. At a time when there was little concern with variation among ``normal listeners'' in psychoacoustic research, Watson began a research program to document the range of human auditory abilities. The primary goals were to determine the number of distinct abilities, to specify the nature of each ability, and to document the distribution of these abilities in the general population. Thanks to Watson's talent for organizing and directing large-scale projects and his workmanlike approach to science, a large and valuable body of data on human individual differences has been collected. The research program began about 20 years ago with the study of basic auditory abilities, and it has expanded to include other modalities and cognitive/intellectual abilities in adults and children. A somewhat biased view of the importance of this work will be presented by one of Watson's many colleagues in this endeavor. The talk will provide an overview of this ongoing research program as well as a brief review of some related research by other investigators. New findings from recent extensions of this work will also be discussed.
78 FR 17231 - Importer of Controlled Substances, Notice of Registration, Watson Pharma, Inc.
2013-03-20
... Registration, Watson Pharma, Inc. By Notice dated November 5, 2012, and published in the Federal Register on November 13, 2012, 77 FR 67675, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made.... 823(a) and Sec. 952(a) and determined that the registration of Watson Pharma, Inc., to import the...
78 FR 64016 - Importer of Controlled Substances; Notice of Registration; Watson Pharma, Inc.
2013-10-25
... Registration; Watson Pharma, Inc. By Notice dated May 24, 2013, and published in the Federal Register on June 4, 2013, 78 FR 33440, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made... in 21 U.S.C. 823(a) and 952(a) and determined that the registration of Watson Pharma, Inc., to import...
Review of the theory of infinite nuclear matter
International Nuclear Information System (INIS)
Llano, M. de; Tolmachev, V.V.
1975-01-01
Given a two-body force, there seems to be two distinct starting points in the many-body perturbation-theoretic problem of computing the energy per nucleon of infinite (as well as finite) nuclear matter: ordinary Hartree-Fock theory and the Brueckner theory. The former theory, treated almost exclusively with plane-wave solutions, has long-ago fallen into disuse, to yield to the latter, apparently more sophisticated, theory. After a brief outline of many-fermion diagramatic techniques, the Brueckner-Bethe-Goldstone series expansion in terms of the density is discussed as a low density, non-ideal Fermi gas theory, whose convergence is analyzed. A calculation based on particle-hole Green's function techniques shows that a nucleon gas condenses to the liquid phase at about 3% of the empirical nuclear matter saturation density. The analogy between the BBG expansion and the virial expansion for a classical or quantum gas is studied with special emphasis on the apparent impossibility of analytical-continuing the latter gas theory to densities in the liquid regime, as first elucidated by Lee and Yang. It is finally argued that ordinary HF theory may provide a good starting point for the eventual understanding of nuclear matter as it gives (in the finite nuclear problem, at any rate) not only the basic liquid properties of a definite density and a surface but also provides independent-particle aspects, avoiding at the same time the idea of n-body clusters appropriate only for dilute gases. This program has to date not been carried out for infinite nuclear matter, mainly because of insufficient knowledge regarding low-energy, non-plane-wave solutions of the HF equations, in the thermodynamic limit [pt
On the scaling limits of Galton Watson processes in varying environment
Bansaye, V.; Simatos, F.
2011-01-01
Renormalized sequences of Galton Watson processes converge to Continuous State Branching Processes (CSBP), characterized by a L\\'evy triplet of two numbers and a measure. This paper investigates the case of Galton Watson processes in varying environment and provides an explicit sufficient condition
Sommerfeld-Watson transformation for nuclear fission
International Nuclear Information System (INIS)
Alexandru, G.
1978-01-01
It is proved that the fission matrix element can be written like a Sommerfeld-Watson relation. This leads to a dispersion relation for the fission process in which the substraction term is uniquely determined. (author)
Little Albert's alleged neurological impairment: Watson, Rayner, and historical revision.
Digdon, Nancy; Powell, Russell A; Harris, Ben
2014-11-01
In 2012, Fridlund, Beck, Goldie, and Irons (2012) announced that "Little Albert"-the infant that Watson and Rayner used in their 1920 study of conditioned fear (Watson & Rayner, 1920)-was not the healthy child the researchers described him to be, but was neurologically impaired almost from birth. Fridlund et al. also alleged that Watson had committed serious ethical breaches in regard to this research. Our article reexamines the evidentiary bases for these claims and arrives at an alternative interpretation of Albert as a normal infant. In order to set the stage for our interpretation, we first briefly describe the historical context for the Albert study, as well as how the study has been construed and revised since 1920. We then discuss the evidentiary issues in some detail, focusing on Fridlund et al.'s analysis of the film footage of Albert, and on the context within which Watson and Rayner conducted their study. In closing, we return to historical matters to speculate about why historiographical disputes matter and what the story of neurologically impaired Albert might be telling us about the discipline of psychology today.
Theoretical Study of the Hoogsteen–Watson-Crick Junctions in DNA
Cubero, Elena; Luque, F. Javier; Orozco, Modesto
2005-01-01
A series of d (AT)n oligonucleotides containing mixtures of normal B-type Watson-Crick and antiparallel Hoogsteen helices have been studied using molecular dynamics simulation techniques to analyze the structural and thermodynamic impact of the junction between Watson-Crick and antiparallel Hoogsteen structures. Analysis of molecular dynamics simulations strongly suggests that for all oligonucleotides studied the antiparallel Hoogsteen appears as a reasonable conformation, only slightly less ...
Quasiconfigurations and the theory of effective interactions
International Nuclear Information System (INIS)
Poves, A.; Zuker, A.
1980-01-01
Perturbation theory is reformulated. Schroedinger's equation is recast as a non linear integral equation which yields by Neumann expansion a linked cluster series for the degenerate, quasi degenerate or non degenerate problem. An effective interaction theory emerges that can be formulated in a biorthogonal basis leading to a non Hermitian secular problem. Hermiticity can be recovered in a clear and rigorous way. As the mathematical form of the theory is dictated by the request of physical clarity the latter is obtained naturally. When written in diagrammatic many body language, the integral equation produces a set of linked coupled equations for the degenerate case. The classic summations (Brueckner, Bethe-Faddeev and RPA) emerge naturally. Possible extensions of nuclear matter theory are suggested
Graham Watson: Eesti vajab enam riigi sekkumist majandusse
Watson, Graham
2009-01-01
18. aprillil pidasid keskerakondlased Tallinnas Euroopa Parlamendi valimiste konverentsi. Euroopa Parlamendi demokraatide ja liberaalide fraktsiooni juht Graham Watson saatis Keskerakonnale videotervituse
Seniority zero pair coupled cluster doubles theory
International Nuclear Information System (INIS)
Stein, Tamar; Henderson, Thomas M.; Scuseria, Gustavo E.
2014-01-01
Coupled cluster theory with single and double excitations accurately describes weak electron correlation but is known to fail in cases of strong static correlation. Fascinatingly, however, pair coupled cluster doubles (p-CCD), a simplified version of the theory limited to pair excitations that preserve the seniority of the reference determinant (i.e., the number of unpaired electrons), has mean field computational cost and is an excellent approximation to the full configuration interaction (FCI) of the paired space provided that the orbital basis defining the pairing scheme is adequately optimized. In previous work, we have shown that optimization of the pairing scheme in the seniority zero FCI leads to a very accurate description of static correlation. The same conclusion extends to p-CCD if the orbitals are optimized to make the p-CCD energy stationary. We here demonstrate these results with numerous examples. We also explore the contributions of different seniority sectors to the coupled cluster doubles (CCD) correlation energy using different orbital bases. We consider both Hartree-Fock and Brueckner orbitals, and the role of orbital localization. We show how one can pair the orbitals so that the role of the Brueckner orbitals at the CCD level is retained at the p-CCD level. Moreover, we explore ways of extending CCD to accurately describe strongly correlated systems
Oncologists partner with Watson on genomics.
2015-08-01
A new collaboration between IBM Watson Health and more than a dozen cancer centers uses the power of cognitive computing to dramatically reduce the time it takes to analyze data from patients' DNA and identify targeted treatment options. ©2015 American Association for Cancer Research.
John B. Watson's Alleged Sex Research: An Appraisal of the Evidence
Benjamin, Ludy T. Jr.; Whitaker, Jodi L.; Ramsey, Russell M.; Zeve, Daniel R.
2007-01-01
In 1974, a story was published about clandestine research done by John B. Watson that was judged to be so reprehensible that it was offered as the real reason he was fired from his faculty position at Johns Hopkins University in 1920, at perhaps the peak of his academic career. Watson's dismissal from Johns Hopkins may have been the most important…
International Nuclear Information System (INIS)
Brandow, B.H.
1977-01-01
The Brueckner--Goldstone form of linked-cluster perturbation theory is derived, together with its open-shell analog, by an elementary time-independent approach. This serves to focus attention on the physical interpretation of the results. The open-shell expansion is used to provide a straightforward justification for the effective π-electron Hamiltonians of planar organic molecules
Moore, Chad L; Zivkovic, Aleksandra; Engels, Joachim W; Kuchta, Robert D
2004-09-28
Human DNA primase synthesizes short RNA primers that DNA polymerase alpha further elongates. Primase readily misincorporates the natural NTPs and will generate a wide variety of mismatches. In contrast, primase exhibited a remarkable resistance to polymerizing NTPs containing unnatural bases. This included bases whose shape was almost identical to the natural bases (4-aminobenzimidazole and 4,6-difluorobenzimidazole), bases shaped very differently than a natural base [e.g., 5- and 6-(trifluoromethyl)benzimidazole], bases much more hydrophobic than a natural base [e.g., 4- and 7-(trifluoromethyl)benzimidazole], bases of similar hydrophobicity as a natural base but with the Watson-Crick hydrogen-bonding groups in unusual positions (7-beta-D-guanine), and bases capable of forming only one Watson-Crick hydrogen bond with the template base (purine and 4-aminobenzimidazole). Primase only polymerized NTP analogues containing bases capable of forming hydrogen bonds between the equivalent of both N-1 and the exocyclic group at C-6 of a purine NTP (2-fluoroadenine, 2-chloroadenine, 3-deazaadenine, and hypoxanthine) and N-3 and the exocyclic group at C-4 of a pyrimidine. These data indicate that human primase requires the formation of Watson-Crick hydrogen bonds in order to polymerize a NTP, a situation very different than what is observed with some DNA polymerases. The implications of these results with respect to current theories of how polymerases discriminate between right and wrong (d)NTPs are discussed.
Hyperons in nuclear matter from SU(3) chiral effective field theory
Energy Technology Data Exchange (ETDEWEB)
Petschauer, S.; Kaiser, N. [Technische Universitaet Muenchen, Physik Department, Garching (Germany); Haidenbauer, J. [Institut fuer Kernphysik, Forschungszentrum Juelich, Institute for Advanced Simulation, Juelich Center for Hadron Physics, Juelich (Germany); Meissner, Ulf G. [Institut fuer Kernphysik, Forschungszentrum Juelich, Institute for Advanced Simulation, Juelich Center for Hadron Physics, Juelich (Germany); Universitaet Bonn, Helmholtz-Institut fuer Strahlen- und Kernphysik and Bethe Center for Theoretical Physics, Bonn (Germany); Weise, W. [Technische Universitaet Muenchen, Physik Department, Garching (Germany); Villa Tambosi, ECT, Villazzano (Trento) (Italy)
2016-01-15
Brueckner theory is used to investigate the properties of hyperons in nuclear matter. The hyperon-nucleon interaction is taken from chiral effective field theory at next-to-leading order with SU(3) symmetric low-energy constants. Furthermore, the underlying nucleon-nucleon interaction is also derived within chiral effective field theory. We present the single-particle potentials of Λ and Σ hyperons in symmetric and asymmetric nuclear matter computed with the continuous choice for intermediate spectra. The results are in good agreement with the empirical information. In particular, our calculation gives a repulsive Σ-nuclear potential and a weak Λ-nuclear spin-orbit force. (orig.)
77 FR 67675 - Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc.
2012-11-13
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances; Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34(a), this is notice that on August 28, 2012, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
78 FR 33440 - Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc.
2013-06-04
... DEPARTMENT OF JUSTICE Drug Enforcement Administration Importer of Controlled Substances, Notice of Application; Watson Pharma, Inc. Pursuant to Title 21 Code of Federal Regulations 1301.34 (a), this is notice that on May 3, 2013, Watson Pharma, Inc., 2455 Wardlow Road, Corona, California 92880-2882, made...
A history of the term radical behaviorism: From Watson to Skinner
Schneider, Susan M.; Morris, Edward K.
1987-01-01
This paper describes the origins and evolution of the term radical behaviorism. John B. Watson's coining of behaviorism in 1913 is presented first, followed by a discussion of the uses of “radical” within psychology during these early years. When the term radical behaviorism first emerged in the early 1920s, its referent was Watson's behaviorism, most specifically his stance on consciousness. In the 1930s, B. F. Skinner described his own position with the term radical behaviorism in an unpublished manuscript, and then in 1945 first referred in print to his views as such. Today, radical behaviorism is generally applied to Skinner's views alone. The paper concludes with a brief discussion of a similarity in Watson's and Skinner's positions on consciousness, which seems a possible historical and philosophical connection between their respective radical behaviorisms. PMID:22477958
Flouting maxim by sherlock holmes and dr. Watson in tv series Of sherlock season
Directory of Open Access Journals (Sweden)
Lina Affifatusholihah
2017-04-01
In running daily activities, people will always meet and interact with other people, and language is a medium that is used by humans to interact with each other. In a conversation or discussion, everyone should pay attention to the four maxims in order that there are no errors in communication. However, it is not uncommon that the four rules above are breached by the speakers. This is called non-observance of the maxims, and one of a non-observance of the maxims that often occurs in is flouting maxim. The aims of this paper are to describe types of maxims that are flouted by Sherlock Holmes and dr. Watson as well as to describe how the maxims are flouted in Sherlock TV series season 1. This research used qualitative descriptive method. The researcher classifies the utterances to know what kind of maxim which are flouted, categorizes those into the category based on the Grice’s theory of Cooperative Principle, namely: maxim of quantity, quality, relation and manner. The research procedure begin by searching the script in the internet, matching the utterances in the script and in film and sorting the utterances between Sherlock Holmes and dr. Watson as well observing every word or sentence which are flouted by the main characters. The findings find that all kinds of maxims are flouted by Sherlock and dr. Watson. The result of analysis shows that the maxim flouted when the speakers say something irrelevant; something roguishness or lied to hide the truth in the form of rhetorical question; the information becomes more or too informative than what is required; and something obscurity of expression, ambiguity, or unnecessary prolixity.
Watson's behaviorism: a comparison of the two editions (1925 and 1930).
Carpintero, Helio
2004-05-01
J.B. Watson's Behaviorism, a complete presentation of the mature psychological points of view of its author, had 2 editions, in 1925 and 1930, which presented significant differences in their texts. Although Watson maximized such variations, to the point of considering the 2nd edition as nearly a brand-new book, both suppressions and additions reveal his feelings when presenting his ideas to a general audience. Such variations are here presented through an in-depth analysis.
Watson will see you now: a supercomputer to help clinicians make informed treatment decisions.
Doyle-Lindrud, Susan
2015-02-01
IBM has collaborated with several cancer care providers to develop and train the IBM supercomputer Watson to help clinicians make informed treatment decisions. When a patient is seen in clinic, the oncologist can input all of the clinical information into the computer system. Watson will then review all of the data and recommend treatment options based on the latest evidence and guidelines. Once the oncologist makes the treatment decision, this information can be sent directly to the insurance company for approval. Watson has the ability to standardize care and accelerate the approval process, a benefit to the healthcare provider and the patient.
A conversation with Geoff Watson
Beran, R. J.; Fisher, N. I.
1998-01-01
Geoffrey Stuart Watson, Professor Emeritus at Princeton University, celebrated his 75th birthday on December 3, 1996. A native Australian, his early education included Bendigo High School and Scotch College in Melbourne. After graduating with a B.A. (Hons.) from Melbourne University in December 1942, he spent the next few years, during and after World War II, doing research and teaching on applied mathematical topics. His wandering as a scholar began in 1947, when he became ...
Quasiparticle pole strength in nuclear matter
International Nuclear Information System (INIS)
Poggioli, R.S.; Jackson, A.D.
1975-01-01
It is argued that single-particle-like behavior in nuclear matter is much less probable than Brueckner theory suggests. In particular, the quasiparticle pole strength is evaluated for nuclear matter and it is shown that, contrary to the spirit of Brueckner theory, low momentum states play a crucial role in determining the magnitude of z/sub k/sub F/. (auth)
Predicting the Mechanism and Kinetics of the Watson-Crick to Hoogsteen Base Pairing Transition
Vreede, J.; Bolhuis, P.G.; Swenson, D.W.H.
2016-01-01
DNA duplexes predominantly contain Watson-Crick (WC) base pairs. Yet, a non-negligible number of base pairs converts to the Hoogsteen (HG) hydrogen bonding pattern, involving a 180° rotation of the purine base relative to Watson-Crick. These WC to HG conversions alter the conformation of DNA, and
Conformational analysis of a covalently cross-linked Watson-Crick base pair model.
Jensen, Erik A; Allen, Benjamin D; Kishi, Yoshito; O'Leary, Daniel J
2008-11-15
Low-temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH(2)C(5') (psi) carbon-carbon bond, which is energetically preferred over the alternate CH(2)N(3) (phi) carbon-nitrogen bond rotation.
Elementary? Question Answering, IBM's Watson, and the Jeopardy ...
Indian Academy of Sciences (India)
IAS Admin
One of the most readable accounts of early AI systems, including. NLP systems, may be .... tions of these questions to annotations of information segments in ..... Watson as a decision-aide rather than as a decision-maker will be a safe step ...
Relativistic and non-relativistic studies of nuclear matter
Banerjee, MK; Tjon, JA
2002-01-01
We point out that the differences between the results of the non-relativistic lowest order Brueckner theory (LOBT) and the relativistic Dirac-Brueckner analysis predominantly arise from two sources. Besides effects from a nucleon mass modification M* in nuclear medium we have in a relativistic
Relativistic generalisation of the Kroll-Watson formula
International Nuclear Information System (INIS)
Kaminski, J.Z.
1985-01-01
The relativistic analogue of the space-translation method is derived. Using this method the generalisation of the Kroll-Watson formula [1973, Phys. Rev. A. 8 804] is obtained for the scattering of an arbitrary charged particle (e.g. mesons, hyperons, quarks, etc). The separation of the background and resonant parts of the scattering amplitude is predicted. (author)
Conformational Analysis of a Covalently Cross-Linked Watson-Crick Base Pair Model
Jensen, Erik A.; Allen, Benjamin D.; Kishi, Yoshito; O'Leary, Daniel J.
2008-01-01
Low temperature NMR experiments and molecular modeling have been used to characterize the conformational behavior of a covalently cross-linked DNA base pair model. The data suggest that Watson-Crick or reverse Watson-Crick hydrogen bonding geometries have similar energies and can interconvert at low temperatures. This low-temperature process involves rotation about the crosslink CH2–C(5′) (ψ) carbon-carbon bond, which is energetically preferred over the alternate CH2–N(3) (ϕ) carbon-nitrogen ...
Charlton, Bruce G
2008-01-01
In 2007 James D. Watson, perhaps the most famous living scientist, was forced to retire from his position and retreat from public life in the face of international mass media condemnation following remarks concerning genetically-caused racial differences in intelligence. Watson was punished for stating forthright views on topics that elite opinion has determined should be discussed only with elaborate caution, frequent disclaimers, and solemn deference to the currently-prevailing pieties. James Watson has always struck many people as brash; however this blunt, truth-telling quality was intrinsic to his role in one of the greatest scientific discoveries. Much more importantly than 'good manners', Watson has consistently exemplified the cardinal scientific virtue: he speaks what he understands to be the truth without regard for the opinion of others. The most chilling aspect of the Watson Affair was the way in which so many influential members of the scientific research community joined the media condemnation directed against Watson. Perhaps the most egregious betrayal of science was an article by editorialists of the premier UK scientific journal Nature. Instead of defending the freedom of discourse in pursuit of scientific truth, Nature instead blamed Watson for being 'crass' and lacking 'sensitivity' in discussing human genetic differences. But if asked to choose between the 'sensitive' editors of Nature or the 'crass' genius of James D. Watson, all serious scientists must take the side of Watson. Because when a premier researcher such as Watson is hounded from office by a vicious, arbitrary and untruthful mob; all lesser scientists are made vulnerable to analogous treatment at the whim of the media. A zealous and coercive brand of 'political correctness' is now making the biological truth of human genetic differences intolerably difficult to discover and discuss in US and UK. This needs to change. My hope is that truth will prevail over political correctness and
O pensamento em Watson: rompendo com o legado metafísico e buscando uma referência materializante
Directory of Open Access Journals (Sweden)
Cláudio Ivan de Oliveira
Full Text Available O trabalho de Watson sobre o pensamento foi tratado inadequadamente por muitos intérpretes, gerando uma lacuna na interpretação histórica visto que Watson exerceu ampla influência sobre a Psicologia. Nosso objetivo é sanar parte deste problema esclarecendo as principais posições de Watson sobre pensamento. Nossa hipótese é que a teoria watsoniana sobre o pensamento como hábito é uma forma de referencialização materializante influenciada pela desmetafisicização do pensamento Ocidental proveniente do Iluminismo. Admitimos que a teoria de Watson reproduziu premissas do erro de categoria cartesiano. Assumimos também que a prioritária associação entre pensamento e linguagem watsoniana denuncia influências indiretas da tradição filosófica grega clássica.
A comparative study of the second-order Born and Faddeev-Watson approximations: Pt. 3
International Nuclear Information System (INIS)
Roberts, M.J.
1988-01-01
Singularities which arise in the second-order Born and Faddeev-Watson approximations for ionisation processes are examined. A regularisation procedure for the latter is suggested. Comparison with He(e,2e)He + experimental data in symmetric coplanar energy-sharing kinematics shows that the second-order Faddeev-Watson approximation is inferior to the second Born results of Byron et al. (1985. J. Phys. B: At. Mol. Phys. 18, 3203). (author)
The Game is aFoot, Watson: DeepQA systems and the future of HCI
Keates, Simeon; Varker, Philip
2012-01-01
In February 2011, the IBM Watson DeepQA (deep question and answer) system took part in a special challenge, pitting its question and answer capability against former Jeopardy!TM grand champions in a televised match. Watson emerged victorious from the challenge, demonstrating that current question answering technology has advanced to the point where it can arguably be more dependable than human experts. This new system represents a significant breakthrough in humanity’s decades-long endeavour ...
Discrete state perturbation theory via Green's functions
International Nuclear Information System (INIS)
Rubinson, W.
1975-01-01
The exposition of stationary-state perturbation theory via the Green's function method in Goldberger and Watson's Collision Theory is reworked in a way that makes explicit its mathematical basis. It is stressed that the theory consists of the construction of, and manipulations on, a mathematical identity. The perturbation series fall out of the identity almost immediately. The logical status of the method is commented on
Meijer, Rob R.
I comment on two recent papers by Watson et al. (2007, 2008) who investigated whether personality items form a hierarchical scale. I discuss that the methods they used are inappropriate and discuss alternative methods presented in the literature. (C) 2009 Elsevier Ltd All rights reserved..
Czyznikowska, Z; Góra, R W; Zaleśny, R; Lipkowski, P; Jarzembska, K N; Dominiak, P M; Leszczynski, J
2010-07-29
A set of nearly 100 crystallographic structures was analyzed using ab initio methods in order to verify the effect of the conformational variability of Watson-Crick guanine-cytosine and adenine-thymine base pairs on the intermolecular interaction energy and its components. Furthermore, for the representative structures, a potential energy scan of the structural parameters describing mutual orientation of the base pairs was carried out. The results were obtained using the hybrid variational-perturbational interaction energy decomposition scheme. The electron correlation effects were estimated by means of the second-order Møller-Plesset perturbation theory and coupled clusters with singles and doubles method adopting AUG-cc-pVDZ basis set. Moreover, the characteristics of hydrogen bonds in complexes, mimicking those appearing in B-DNA, were evaluated using topological analysis of the electron density. Although the first-order electrostatic energy is usually the largest stabilizing component, it is canceled out by the associated exchange repulsion in majority of the studied crystallographic structures. Therefore, the analyzed complexes of the nucleic acid bases appeared to be stabilized mainly by the delocalization component of the intermolecular interaction energy which, in terms of symmetry adapted perturbation theory, encompasses the second- and higher-order induction and exchange-induction terms. Furthermore, it was found that the dispersion contribution, albeit much smaller in terms of magnitude, is also a vital stabilizing factor. It was also revealed that the intermolecular interaction energy and its components are strongly influenced by four (out of six) structural parameters describing mutual orientation of bases in Watson-Crick pairs, namely shear, stagger, stretch, and opening. Finally, as a part of a model study, much of the effort was devoted to an extensive testing of the UBDB databank. It was shown that the databank quite successfully reproduces the
Morari, Cristian; Muntean, Cristina M; Tripon, Carmen; Buimaga-Iarinca, Luiza; Calborean, Adrian
2014-04-01
The binding effects of Mg²⁺, Ca²⁺, and Cu²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. Both Watson-Crick and Hoogsteen configurations of the base pairs were investigated. In Watson-Crick configuration, the metal was coordinated at N7 atom of guanine, while in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the geometric properties of the metal-GC base pairs structure, as well as the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen GC structures. For the geometric models used by us, the vibrational amplitudes of metallic atoms were stronger for wavenumbers lower than 500 cm⁻¹. This suggests that in the experimental studies on DNA the presence of the three metallic atoms (Mg, Ca, and Cu) can be explicitly detected at low frequencies.
Relativistic mean-field theory for unstable nuclei with non-linear σ and ω terms
International Nuclear Information System (INIS)
Sugahara, Y.; Toki, H.
1994-01-01
We search for a new parameter set for the description of stable as well as unstable nuclei in the wide mass range within the relativistic mean-field theory. We include a non-linear ω self-coupling term in addition to the non-linear σ self-coupling terms, the necessity of which is suggested by the relativistic Brueckner-Hartree-Fock (RBHF) theory of nuclear matter. We find two parameter sets, one of which is for nuclei above Z=20 and the other for nuclei below that. The calculated results agree very well with the existing data for finite nuclei. The parameter set for the heavy nuclei provides the equation of state of nuclear matter similar to the one of the RBHF theory. ((orig.))
Watson-Crick hydrogen bonding of unlocked nucleic acids
DEFF Research Database (Denmark)
Langkjær, Niels; Wengel, Jesper; Pasternak, Anna
2015-01-01
We herein describe the synthesis of two new unlocked nucleic acid building blocks containing hypoxanthine and 2,6-diaminopurine as nucleobase moieties and their incorporation into oligonucleotides. The modified oligonucleotides were used to examine the thermodynamic properties of UNA against unmo...... unmodified oligonucleotides and the resulting thermodynamic data support that the hydrogen bonding face of UNA is Watson-Crick like....
Watson, Skinner y Algunas Disputas dentro del Conductismo
Directory of Open Access Journals (Sweden)
RICARDO PELLÓN SUÁREZ DE PUGA
2013-01-01
Full Text Available Con motivo del primer centenario de la publicación del manifiesto conductista, se revisa brevemente la concepción de Watson (1913 sobre el aprendizaje y la conducta, y se extiende dicho análisis al conductismo de B. F. Skinner y a las disputas entre enfoques molares y moleculares en el análisis de la conducta.
IBM Watson: How Cognitive Computing Can Be Applied to Big Data Challenges in Life Sciences Research.
Chen, Ying; Elenee Argentinis, J D; Weber, Griff
2016-04-01
Life sciences researchers are under pressure to innovate faster than ever. Big data offer the promise of unlocking novel insights and accelerating breakthroughs. Ironically, although more data are available than ever, only a fraction is being integrated, understood, and analyzed. The challenge lies in harnessing volumes of data, integrating the data from hundreds of sources, and understanding their various formats. New technologies such as cognitive computing offer promise for addressing this challenge because cognitive solutions are specifically designed to integrate and analyze big datasets. Cognitive solutions can understand different types of data such as lab values in a structured database or the text of a scientific publication. Cognitive solutions are trained to understand technical, industry-specific content and use advanced reasoning, predictive modeling, and machine learning techniques to advance research faster. Watson, a cognitive computing technology, has been configured to support life sciences research. This version of Watson includes medical literature, patents, genomics, and chemical and pharmacological data that researchers would typically use in their work. Watson has also been developed with specific comprehension of scientific terminology so it can make novel connections in millions of pages of text. Watson has been applied to a few pilot studies in the areas of drug target identification and drug repurposing. The pilot results suggest that Watson can accelerate identification of novel drug candidates and novel drug targets by harnessing the potential of big data. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor
Directory of Open Access Journals (Sweden)
FELIPE PARRADO CORREDOR
2013-01-01
Full Text Available La investigación del comportamiento de las personas frente a los productos y servicios se remonta a los inicios del siglo XX y J. B. Watson es uno de sus principales precursores. Watson ofreció un curso de psicología aplicada titulado Psicología de la Publicidad, introdujo en varias empresas las técnicas experimentales para el mercadeo de sus productos y, tras su retiro de la vida académica, se vinculó a la agencia de publicidad Walter Thompson, donde desarrolló campañas masivas con los mismos principios de las reacciones emocionales condicionadas. En este ensayo se expone la importancia del trabajo de Watson en la psicología de la publicidad, como precursor de los desarrollos científicos de la psicología del consumidor.
Hyperons in nuclear matter from SU(3) chiral effective field theory
Energy Technology Data Exchange (ETDEWEB)
Petschauer, Stefan; Kaiser, Norbert [Technische Universitaet Muenchen (Germany); Haidenbauer, Johann [Forschungszentrum Juelich (Germany); Meissner, Ulf G. [Forschungszentrum Juelich (Germany); Universitaet Bonn (Germany); Weise, Wolfram [Technische Universitaet Muenchen (Germany); ECT, Trento (Italy)
2016-07-01
Brueckner theory is used to investigate the properties of hyperons in nuclear matter. The hyperon-nucleon interaction is taken from chiral effective field theory at next-to-leading order with SU(3) symmetric low-energy constants. Furthermore, the underlying nucleon-nucleon interaction is also derived within chiral effective field theory. We present the single-particle potentials of Λ and Σ hyperons in symmetric and asymmetric nuclear matter computed with the continuous choice for intermediate spectra. The results are in good agreement with the empirical information. In particular, our calculation gives a repulsive Σ-nuclear potential and a weak Λ-nuclear spin-orbit force. The splittings among the Σ{sup +}, Σ{sup 0} and Σ{sup -} potentials have a non-linear dependence on the isospin asymmetry which goes beyond the usual parametrization in terms of an isovector Lane potential.
Annual Quality Assurance Conference Files by Nicola Watson and Rui Li
26th Annual Quality Assurance Conference. Abstract: An Innovative Water Management Device for Online and Canister-based Thermal Desorption of Trace-level VVOCs in High Humidity Ambient Air by Nicola Watson and Rui Li
Directory of Open Access Journals (Sweden)
Katy Shaw
2016-04-01
Full Text Available Mark Watson is a British comedian and novelist. His five novels to date – 'Bullet Points' (2004, 'A Light-Hearted Look At Murder' (2007, 'Eleven' (2010, 'The Knot' (2012 and 'Hotel Alpha' (2014 – explore human relationships and communities in contemporary society. His latest novel Hotel Alpha tells the story of an extraordinary hotel in London and two mysterious disappearances that raise questions no one seems willing to answer. External to the novel, readers can also discover more about the hotel and its inhabitants in one hundred extra stories that expand the world of the novel and can be found at http://www.hotelalphastories.com. In conversation here with Dr Katy Shaw, Mark offers some reflections on his writing process, the field of contemporary literature, and the vitality of the novel form in the twenty-first century.
Watson: A new link in the IIE iron chain
Olsen, Edward; Davis, Andrew; Clarke, Roy S., Jr.; Schultz, Ludolf; Weber, Hartwig W.; Clayton, Robert; Mayeda, Toshiko; Jarosewich, Eugene; Sylvester, Paul; Grossman, Lawrence
1994-01-01
Watson, which was found in 1972 in South Australia, contains the largest single silicate rock mass seen in any known iron meteorite. A comprehensive study has been completed on this unusual meteorite: petrography, metallography, analyses of the silicate inclusion (whole rock chemical analysis, INAA, RNAA, noble gases, and oxygen isotope analysis) and mineral compositions (by electron microprobe and ion microprobe). The whole rock has a composition of an H-chondrite minus the normal H-group metal and troilite content. The oxygen isotope composition is that of the silicates in the IIE iron meteorites and lies along an oxygen isotope fractionation line with the H-group chondrites. Trace elements in the metal confirm Watson is a new IIE iron. Whole rock Watson silicate shows an enrichment in K and P (each approximately 2X H-chondrites). The silicate inclusion has a highly equilibrated igneous (peridotite-like) texture with olivine largely poikilitic within low-Ca pyroxene: olivine (Fa20), opx (Fs17Wo3), capx (Fs9Wo14)(with very fine exsolution lamellae), antiperthite feldspar (An1-3Or5) with less than 1 micron exsolution lamellae (An1-3Or greater than 40), shocked feldspar with altered stoichiometry, minor whitlockite (also a poorly characterized interstitial phosphate-rich phase) and chromite, and only traces of metal and troilite. The individual silicate minerals have normal chondritic REE patterns, but whitlockite has a remarkable REE pattern. It is very enriched in light REE (La is 720X C1, and Lu is 90X C1, as opposed to usual chonditic values of approximately 300X and 100-150X, respectively) with a negative Eu anomaly. The enrichment of whole rock K is expressed both in an unusually high mean modal Or content of the feldspar, Or13, and in the presence of antiperthite.
Complexes of DNA bases and Watson-Crick base pairs with small neutral gold clusters.
Kryachko, E S; Remacle, F
2005-12-08
The nature of the DNA-gold interaction determines and differentiates the affinity of the nucleobases (adenine, thymine, guanine, and cytosine) to gold. Our preliminary computational study [Kryachko, E. S.; Remacle, F. Nano Lett. 2005, 5, 735] demonstrates that two major bonding factors govern this interaction: the anchoring, either of the Au-N or Au-O type, and the nonconventional N-H...Au hydrogen bonding. In this paper, we offer insight into the nature of nucleobase-gold interactions and provide a detailed characterization of their different facets, i.e., geometrical, energetic, and spectroscopic aspects; the gold cluster size and gold coordination effects; proton affinity; and deprotonation energy. We then investigate how the Watson-Crick DNA pairing patterns are modulated by the nucleobase-gold interaction. We do so in terms of the proton affinities and deprotonation energies of those proton acceptors and proton donors which are involved in the interbase hydrogen bondings. A variety of properties of the most stable Watson-Crick [A x T]-Au3 and [G x C]-Au3 hybridized complexes are described and compared with the isolated Watson-Crick A x T and G x C ones. It is shown that enlarging the gold cluster size to Au6 results in a rather short gold-gold bond in the Watson-Crick interbase region of the [G x C]-Au6 complex that bridges the G x C pair and thus leads to a significant strengthening of G x C pairing.
Historical trend of nuclear matter calculation and its recent developments
International Nuclear Information System (INIS)
Kohno, Michio
2006-01-01
He guide line to understand nuclear properties on the basis of nuclear force was started in the 1950's by the Brueckner theory. The theory established the fundamental framework to formulate the picture to consider both the two nucleon and tensor correlations as well as Pauli effect inside the nuclei. In the 1960's the theory was developed to obtain ground state energy on the perturbation many-body theory. The growth and refinement of the Brueckner theory in the 1970's and after are overviewed and the computer code developments in the 1980's are mentioned. Concerning the many-body correlation problem Italian group has calculated up to three-body correlations in the Brueckner theory. At present, effective interaction nuclear theory is coming into a new level and actively studied by the introduction of low momentum interaction based on the renormalization group theory, by full application of the coupled cluster method, by the application of Skyrme Hartree-Fock method in wide range and by the reconsideration of the energy density functional method in relation to the relativistic mean field method. Owing to the recent remarkable progress of computers, calculations which were impossible to be executed in old days are now done rather easily. (S. Funahashi)
Non-Watson Crick base pairs might stabilize RNA structural motifs in ...
Indian Academy of Sciences (India)
Watson Crick base pairs, internal loops and pseudoknots have been the highlighting feature of recent structural determination of RNAs. The recent crystal structure of group-I introns has demonstrated that these might constitute RNA structural ...
Eshelman, E.; Wanger, G.; Manatt, K.; Malaska, M.; Willis, M.; Abbey, W.; Doloboff, I.; Beegle, L. W.; DeFlores, L. P.; Priscu, J. C.; Lane, A. L.; Carrier, B. L.; Mellerowicz, B.; Kim, D.; Paulsen, G.; Zacny, K.; Bhartia, R.
2017-12-01
Future astrobiological missions to Europa and other ocean worlds may benefit from next-generation instrumentation capable of in situ organic and life detection in subsurface ice environments. WATSON (Wireline Analysis Tool for in Situ Observation of Northern ice sheets) is an instrument under development at NASA's Jet Propulsion Laboratory. WATSON contains high-TRL instrumentation developed for SHERLOC, the Mars 2020 deep-UV fluorescence and Raman spectrometer, including a 248.6 nm NeCu hollow cathode laser as an excitation source. In WATSON, these technologies provide spectroscopic capabilities highly sensitive to many organic compounds, including microbes, in an instrument package approximately 1.2 m long with a 101.6 mm diameter, designed to accommodate a 108 mm ice borehole. Interrogation into the ice wall with a laser allows for a non-destructive in situ measurement that preserves the spatial distribution of material within the ice. We report on a successful deployment of WATSON to Kangerlussuaq, Greenland, where the instrument was lowered to a 4.5 m depth in a hand-cored hole on the Kangerlussuaq sector of the Greenland ice sheet. Motorized stages within the instrument were used to raster a laser across cm-scale regions of the interior surface of the borehole, obtaining fluorescence spectral maps with a 200 µm spatial resolution and a spectral range from 265 nm to 440 nm. This region includes the UV emission bands of many aromatic compounds and microbes, and includes the water and ice Raman O-H stretching modes. We additionally report on experiments designed to inform an early-2018 deployment to Kangerlussuaq where WATSON will be incorporated into a Honeybee Robotics planetary deep drill, with a goal of drilling to a depth of 100 m and investigating the distribution of organic material within the ice sheet. These experiments include laboratory calibrations to determine the sensitivity to organic compounds embedded in ice at various depths, as well as
Portrait of a discovery. Watson, Crick, and the double helix.
de Chadarevian, Soraya
2003-03-01
This essay examines an iconic image of twentieth-century science: Antony Barrington Brown's photograph of James Watson, Francis Crick, and the double-helical model of DNA. The detailed reconstruction of the production, reception, and uses of the photograph reveals the central role of the image in making the discovery it portrays. Taken in May 1953, two full months after the scientists built the model, to accompany a report on the structure in Time magazine, the photograph (like the report) was never published. It came into circulation only fifteen years later, as an illustration in Watson's best-selling book The Double Helix. While the image served as a historical document and advertisement for the book, only the book provided the description that made the image as well as the people and the model it represented famous. The history of the image provides insights into the retrospective construction of the discovery, which has since been celebrated as the origin of a new science of life.
Watson-Crick base pairing controls excited-state decay in natural DNA.
Bucher, Dominik B; Schlueter, Alexander; Carell, Thomas; Zinth, Wolfgang
2014-10-13
Excited-state dynamics are essential to understanding the formation of DNA lesions induced by UV light. By using femtosecond IR spectroscopy, it was possible to determine the lifetimes of the excited states of all four bases in the double-stranded environment of natural DNA. After UV excitation of the DNA duplex, we detected a concerted decay of base pairs connected by Watson-Crick hydrogen bonds. A comparison of single- and double-stranded DNA showed that the reactive charge-transfer states formed in the single strands are suppressed by base pairing in the duplex. The strong influence of the Watson-Crick hydrogen bonds indicates that proton transfer opens an efficient decay path in the duplex that prohibits the formation or reduces the lifetime of reactive charge-transfer states. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Visualizing Transient Watson-Crick Like Mispairs in DNA and RNA Duplexes
Kimsey, Isaac J.; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W.; Al-Hashimi, Hashim M.
2015-01-01
Rare tautomeric and anionic nucleobases are believed to play fundamental biological roles but their prevalence and functional importance has remained elusive because they exist transiently, in low-abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10−3-10−5) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases. PMID:25762137
Visualizing transient Watson-Crick-like mispairs in DNA and RNA duplexes.
Kimsey, Isaac J; Petzold, Katja; Sathyamoorthy, Bharathwaj; Stein, Zachary W; Al-Hashimi, Hashim M
2015-03-19
Rare tautomeric and anionic nucleobases are believed to have fundamental biological roles, but their prevalence and functional importance has remained elusive because they exist transiently, in low abundance, and involve subtle movements of protons that are difficult to visualize. Using NMR relaxation dispersion, we show here that wobble dG•dT and rG•rU mispairs in DNA and RNA duplexes exist in dynamic equilibrium with short-lived, low-populated Watson-Crick-like mispairs that are stabilized by rare enolic or anionic bases. These mispairs can evade Watson-Crick fidelity checkpoints and form with probabilities (10(-3) to 10(-5)) that strongly imply a universal role in replication and translation errors. Our results indicate that rare tautomeric and anionic bases are widespread in nucleic acids, expanding their structural and functional complexity beyond that attainable with canonical bases.
Jokulhlaups and sediment transport in Watson River, Kangerlussuaq, West Greenland
DEFF Research Database (Denmark)
Mikkelsen, A. B.; Hasholt, Bent; Knudsen, N. T.
2013-01-01
For 3 years, during a 4-year observation period (2007-2010), jokulhlaups were observed from a lake at the northern margin of Russells Gletscher. At a gauging station located on a bedrock sill near the outlet of Watson River into Sdr Stromfjord, discharge and sediment transport was monitored during...
Tateishi-Karimata, Hisae; Nakano, Miki; Sugimoto, Naoki
2014-01-08
The instability of Hoogsteen base pairs relative to Watson-Crick base pairs has limited biological applications of triplex-forming oligonucleotides. Hydrated ionic liquids (ILs) provide favourable environments for a wide range of chemical reactions and are known to impact the stabilities of Watson-Crick base pairs. We found that DNA triplex formation was significantly stabilized in hydrated choline dihydrogen phosphate as compared with an aqueous buffer at neutral pH. Interestingly, the stability of Hoogsteen base pairs was found to be comparable with that of Watson-Crick base pairs in the hydrated IL. Molecular dynamics simulations of a DNA triplex in the presence of choline ions revealed that the DNA triplex was stabilized because of the binding of choline ion around the third strand in the grooves. Our finding will facilitate the development of new DNA materials. Our data also indicate that triplex formation may be stabilized inside cells where choline ions and their derivatives are abundant in vivo.
Using grounded theory as a method for rigorously reviewing literature
Wolfswinkel, J.; Furtmueller-Ettinger, Elfriede; Wilderom, Celeste P.M.
2013-01-01
This paper offers guidance to conducting a rigorous literature review. We present this in the form of a five-stage process in which we use Grounded Theory as a method. We first probe the guidelines explicated by Webster and Watson, and then we show the added value of Grounded Theory for rigorously
Coulomb interaction in multiple scattering theory
International Nuclear Information System (INIS)
Ray, L.; Hoffmann, G.W.; Thaler, R.M.
1980-01-01
The treatment of the Coulomb interaction in the multiple scattering theories of Kerman-McManus-Thaler and Watson is examined in detail. By neglecting virtual Coulomb excitations, the lowest order Coulomb term in the Watson optical potential is shown to be a convolution of the point Coulomb interaction with the distributed nuclear charge, while the equivalent Kerman-McManus-Thaler Coulomb potential is obtained from an averaged, single-particle Coulombic T matrix. The Kerman-McManus-Thaler Coulomb potential is expressed as the Watson Coulomb term plus additional Coulomb-nuclear and Coulomb-Coulomb cross terms, and the omission of the extra terms in usual Kerman-McManus-Thaler applications leads to negative infinite total reaction cross section predictions and incorrect pure Coulomb scattering limits. Approximations are presented which eliminate these anomalies. Using the two-potential formula, the full projectile-nucleus T matrix is separated into two terms, one resulting from the distributed nuclear charge and the other being a Coulomb distorted nuclear T matrix. It is shown that the error resulting from the omission of the Kerman-McManus-Thaler Coulomb terms is effectively removed when the pure Coulomb T matrix in Kerman-McManus-Thaler is replaced by the analogous quantity in the Watson approach. Using the various approximations, theoretical angular distributions are obtained for 800 MeV p+ 208 Pb elastic scattering and compared with experimental data
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-06-21
Here, we use MP2/DFT quantum-chemical methods combined with Quantum Theory of Atoms in Molecules to study the tautomeric transition between wobble A·C(w) mismatch and Watson-Crick-like A·C*(WC) base mispair, proceeding non-dissociatively via sequential proton transfer between bases through the planar, highly stable and zwitterionic TS(A∙C-)(A∙C(W)A∙C&(WC)) transition state joined by the participation of (A)N6(+)H∙∙∙N4(-)(C), (A)N1(+)H∙∙∙N4(-)(C) and (A)C2(+)H∙∙∙N3(-)(C) H-bonds. Notably, the A·C(w) ↔ A·C*(WC) tautomerization reaction is accompanied by 10 unique patterns of the specific intermolecular interactions that consistently replace each other. Our data suggest that biologically significant A·C(w) → A·C*(WC) tautomerization is a kinetically controlled pathway for formation of the enzymatically competent Watson-Crick-like A·C*(WC) DNA base mispair in the essentially hydrophobic recognition pocket of the high-fidelity DNA-polymerase, responsible for the occurrence of spontaneous point AC/CA incorporation errors during DNA biosynthesis.
IBM Watson Analytics: Automating Visualization, Descriptive, and Predictive Statistics.
Hoyt, Robert Eugene; Snider, Dallas; Thompson, Carla; Mantravadi, Sarita
2016-10-11
We live in an era of explosive data generation that will continue to grow and involve all industries. One of the results of this explosion is the need for newer and more efficient data analytics procedures. Traditionally, data analytics required a substantial background in statistics and computer science. In 2015, International Business Machines Corporation (IBM) released the IBM Watson Analytics (IBMWA) software that delivered advanced statistical procedures based on the Statistical Package for the Social Sciences (SPSS). The latest entry of Watson Analytics into the field of analytical software products provides users with enhanced functions that are not available in many existing programs. For example, Watson Analytics automatically analyzes datasets, examines data quality, and determines the optimal statistical approach. Users can request exploratory, predictive, and visual analytics. Using natural language processing (NLP), users are able to submit additional questions for analyses in a quick response format. This analytical package is available free to academic institutions (faculty and students) that plan to use the tools for noncommercial purposes. To report the features of IBMWA and discuss how this software subjectively and objectively compares to other data mining programs. The salient features of the IBMWA program were examined and compared with other common analytical platforms, using validated health datasets. Using a validated dataset, IBMWA delivered similar predictions compared with several commercial and open source data mining software applications. The visual analytics generated by IBMWA were similar to results from programs such as Microsoft Excel and Tableau Software. In addition, assistance with data preprocessing and data exploration was an inherent component of the IBMWA application. Sensitivity and specificity were not included in the IBMWA predictive analytics results, nor were odds ratios, confidence intervals, or a confusion matrix
Impact parameter representation from the Watson-Sommerfeld transform
International Nuclear Information System (INIS)
Islam, M.M.
1976-01-01
Using the Watson-Sommerfeld transform the elastic scattering amplitude of two spinless particles is shown to have an exact and unique impact parameter, or Fourier-Bessel (FB) representation. The representation is valid for all physical energies and scattering angles. Wallace's recent work is found to be an asymptotic expansion of the FB amplitude obtained from the partial-wave expansion. The way singularities of the partial-wave amplitude in the l-plane enter in the FB amplitude is also explicitly shown. (Auth.)
Some Econometric Results for the Blanchard-Watson Bubble Model
DEFF Research Database (Denmark)
Johansen, Soren; Lange, Theis
The purpose of the present paper is to analyse a simple bubble model suggested by Blanchard and Watson. The model is defined by y(t) =s(t)¿y(t-1)+e(t), t=1,…,n, where s(t) is an i.i.d. binary variable with p=P(s(t)=1), independent of e(t) i.i.d. with mean zero and finite variance. We take ¿>1 so...
Shankar, Akshaya; Jagota, Anand; Mittal, Jeetain
2012-10-11
Single- and double-stranded DNA are increasingly being paired with surfaces and nanoparticles for numerous applications, such as sensing, imaging, and drug delivery. Unlike the majority of DNA structures in bulk that are stabilized by canonical Watson-Crick pairing between Ade-Thy and Gua-Cyt, those adsorbed on surfaces are often stabilized by noncanonical base pairing, quartet formation, and base-surface stacking. Not much is known about these kinds of interactions. To build an understanding of the role of non-Watson-Crick pairing on DNA behavior near surfaces, one requires basic information on DNA base pair stacking and hydrogen-bonding interactions. All-atom molecular simulations of DNA bases in two cases--in bulk water and strongly adsorbed on a graphite surface--are conducted to study the relative strengths of stacking and hydrogen bond interactions for each of the 10 possible combinations of base pairs. The key information obtained from these simulations is the free energy as a function of distance between two bases in a pair. We find that stacking interactions exert the dominant influence on the stability of DNA base pairs in bulk water as expected. The strength of stability for these stacking interactions is found to decrease in the order Gua-Gua > Ade-Gua > Ade-Ade > Gua-Thy > Gua-Cyt > Ade-Thy > Ade-Cyt > Thy-Thy > Cyt-Thy > Cyt-Cyt. On the other hand, mutual interactions of surface-adsorbed base pairs are stabilized mostly by hydrogen-bonding interactions in the order Gua-Cyt > Ade-Gua > Ade-Thy > Ade-Ade > Cyt-Thy > Gua-Gua > Cyt-Cyt > Ade-Cyt > Thy-Thy > Gua-Thy. Interestingly, several non-Watson-Crick base pairings, which are commonly ignored, have similar stabilization free energies due to interbase hydrogen bonding as Watson-Crick pairs. This clearly highlights the importance of non-Watson-Crick base pairing in the development of secondary structures of oligonucleotides near surfaces.
The case of the missing fingerprints or Dr Watson's cosmology
International Nuclear Information System (INIS)
Longair, M.S.
1987-01-01
The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.)
Noori, Nazanin; Wald, Ron; Sharma Parpia, Arti; Goldstein, Marc B
2018-01-01
Accurate assessment of total body water (TBW) is essential for the evaluation of dialysis adequacy (Kt/V urea ). The Watson formula, which is recommended for the calculation of TBW, was derived in healthy volunteers thereby leading to potentially inaccurate TBW estimates in maintenance hemodialysis recipients. Bioimpedance spectroscopy (BIS) may be a robust alternative for the measurement of TBW in hemodialysis recipients. The primary objective of this study was to evaluate the accuracy of Watson formula-derived TBW estimates as compared with TBW measured with BIS. Second, we aimed to identify the anthropometric characteristics that are most likely to generate inaccuracy when using the Watson formula to calculate TBW. Finally, we derived novel anthropometric equations for the more accurate estimation of TBW. This was a cross-sectional study of prevalent in-center HD patients at St Michael's Hospital. One hundred eighty-four hemodialysis patients (109 men and 75 women) were evaluated in this study. Anthropometric measurements including weight, height, waist circumference, midarm circumference, and 4-site skinfold (biceps, triceps, subscapular, and suprailiac) thickness were measured; fat mass was measured using the formula by Durnin and Womersley. We measured TBW by BIS using the Body Composition Monitor (Fresenius Medical Care, Bad Homburg, Germany). We used the Bland-Altman method to calculate the difference between the TBW derived from the Watson method and the BIS. To derive new equations for TBW estimation, Pearson's correlation coefficients between BIS-TBW (the reference test) and other variables were examined. We used the least squares regression analysis to develop parsimonious equations to predict TBW. TBW values based on the Watson method had a high correlation with BIS-TBW (correlation coefficients = 0.87 and P Watson formula overestimated TBW by 5.1 (4.5-5.8) liters and 3.8 (3.0-4.5) liters, in men and women, respectively. Higher fat mass and waist
Directory of Open Access Journals (Sweden)
Thaís Schossler
2008-01-01
Full Text Available Este estudio tuvo como objetivo conocer la percepción del cuidador domiciliario del anciano acerca del cuidado de sí mismo, teniendo como base teórica a Jean Watson en su Teoría del Cuidado Humano. La investigación se caracterizó por un abordaje cualitativo, de tipo exploratorio-descriptivo, el cual fue desarrollado en la Unidad de la Vila Floresta con nueve cuidadores domiciliarios de ancianos, integrantes del Programa de Atención a Domicilio. La recolección de informaciones se realizó en el período de agosto a octubre de 2006, por medio de una entrevista parcialmente estructurada. Se utilizó el análisis de contenido de Bardin y emergieron las categorías: compartir el cuidado al anciano - una posibilidad para cuidar de sí mismo; descansar, pasear, dormir, uno no tiene más ese derecho; presencia de la familia: una necesidad sentida por el cuidador domiciliar; (desequilibrio del cuerpo físico y mental, una resultante percibida en el (descuidado de sí mismo. Se concluye que el cuidador domiciliario es el principal responsable por el cuidado del anciano y que el cuidado de sí mismo se hace presente en su realidad.
Rao, B J; Radding, C M
1994-01-01
Whereas complementary strands of DNA recognize one another by forming Watson-Crick base pairs, the way in which RecA protein enables a single strand to recognize homology in duplex DNA has remained unknown. Recent experiments, however, have shown that a single plus strand in the RecA filament can recognize an identical plus strand via bonds that, by definition, are non-Watson-Crick. In experiments reported here, base substitutions had the same qualitative and quantitative effects on the pairi...
Szymanski, Eric S; Kimsey, Isaac J; Al-Hashimi, Hashim M
2017-03-29
The replicative and translational machinery utilizes the unique geometry of canonical G·C and A·T/U Watson-Crick base pairs to discriminate against DNA and RNA mismatches in order to ensure high fidelity replication, transcription, and translation. There is growing evidence that spontaneous errors occur when mismatches adopt a Watson-Crick-like geometry through tautomerization and/or ionization of the bases. Studies employing NMR relaxation dispersion recently showed that wobble dG·dT and rG·rU mismatches in DNA and RNA duplexes transiently form tautomeric and anionic species with probabilities (≈0.01-0.40%) that are in concordance with replicative and translational errors. Although computational studies indicate that these exceptionally short-lived and low-abundance species form Watson-Crick-like base pairs, their conformation could not be directly deduced from the experimental data, and alternative pairing geometries could not be ruled out. Here, we report direct NMR evidence that the transient tautomeric and anionic species form hydrogen-bonded Watson-Crick-like base pairs. A guanine-to-inosine substitution, which selectively knocks out a Watson-Crick-type (G)N2H 2 ···O2(T) hydrogen bond, significantly destabilized the transient tautomeric and anionic species, as assessed by lack of any detectable chemical exchange by imino nitrogen rotating frame spin relaxation (R 1ρ ) experiments. An 15 N R 1ρ NMR experiment targeting the amino nitrogen of guanine (dG-N2) provides direct evidence for Watson-Crick (G)N2H 2 ···O2(T) hydrogen bonding in the transient tautomeric state. The strategy presented in this work can be generally applied to examine hydrogen-bonding patterns in nucleic acid transient states including in other tautomeric and anionic species that are postulated to play roles in replication and translational errors.
Probing the Watson-Crick, wobble, and sugar-edge hydrogen bond sites of uracil and thymine.
Müller, Andreas; Frey, Jann A; Leutwyler, Samuel
2005-06-16
The nucleobases uracil (U) and thymine (T) offer three hydrogen-bonding sites for double H-bond formation via neighboring N-H and C=O groups, giving rise to the Watson-Crick, wobble and sugar-edge hydrogen bond isomers. We probe the hydrogen bond properties of all three sites by forming hydrogen bonded dimers of U, 1-methyluracil (1MU), 3-methyluracil (3MU), and T with 2-pyridone (2PY). The mass- and isomer-specific S1 origins exhibit large spectral blue shifts relative to the 2PY monomer. Ab initio CIS calculations of the spectral shifts of the different hydrogen-bonded dimers show a linear correlation with experiment. This correlation allows us to identify the R2PI spectra of the weakly populated Watson-Crick and wobble isomers of both 2PY.U and 2PY.T. (3) PW91 density functional calculation of the ground-state binding and dissociation energies De and D0 are in agreement with the assignment of the dominant hydrogen bond isomers of 2PY.U, 2PY.3MU and 2PY.T as the sugar-edge form. For 2PY.U, 2PY.T and 2PY.1MU the measured wobble:Watson-Crick:sugar-edge isomer ratios are in good agreement with the calculated ratios, based on the ab initio dissociation energies and gas-phase statistical mechanics. The Watson-Crick and wobble isomers are thereby determined to be several kcal/mol less strongly bound than the sugar-edge isomers. The 36 observed intermolecular frequencies of the nine different H-bonded isomers give detailed insight into the intermolecular force field.
2006-01-01
Ed Watson arrived at CERN in March 1973 to work on digital electronics and CAMAC systems under Bob Dobinson, after many years at Rolls Royce in Scotland. He joined the European Muon Collaboration in 1976, where he played a major role in the design, deployment and running of its data acquisition system (DAQ) with David Botterill, Bob Dobinson, and Vicky White. The CAMAC-ROMULUS system was by far the largest and most advanced of its time, and it became a defining standard for DAQ systems for years to come. Ed was deeply involved in the detailed planning of the control rooms and the experiment cabling, as well as sharing the responsibility for the CAMAC readout system. He had a real talent for trouble shooting and played a vital part in supporting the experiment throughout its lifetime. He offered great moral support to the younger members of the collaboration and helped them a great deal with their work. The EMC had a wonderful social life to which Ed was a major contributor - who can forget its barbecues? In...
When a clear strong voice was needed: A retrospective review of Watson's (1924/1930) behaviorism.
Malone, John C; García-Penagos, Andrés
2014-07-25
Despite the attention given John B. Watson during the century since he introduced behaviorism, there remain questions about what he really contributed. He is still appropriately criticized for his arrogant self-promotion and especially for his perceived emphasis on a simple S-R reflexology. However, we argue that the former was necessary at the time and that criticism of Watson on the second count only diverts attention from the genuine contributions that he did make. In support of these contentions we examine several aspects of his contributions that warrant clarification, namely, his promotion of applied comparative psychology, his views on the nature of mind, his originality, criticism from and respect afforded by contemporaries, his relation to recent interest in "the embodiment of mind," his treatment of thinking, and his appreciation of Freud's work. We organize our discussion around specific chapters of the two editions of Behaviorism, but in support of our arguments we include publications of Watson that are less well known. Those works develop some important points that are only briefly treated in both editions of Behaviorism. © Society for the Experimental Analysis of Behavior.
Röttger, Katharina; Marroux, Hugo J B; Grubb, Michael P; Coulter, Philip M; Böhnke, Hendrik; Henderson, Alexander S; Galan, M Carmen; Temps, Friedrich; Orr-Ewing, Andrew J; Roberts, Gareth M
2015-12-01
Ultrafast deactivation pathways bestow photostability on nucleobases and hence preserve the structural integrity of DNA following absorption of ultraviolet (UV) radiation. One controversial recovery mechanism proposed to account for this photostability involves electron-driven proton transfer (EDPT) in Watson-Crick base pairs. The first direct observation is reported of the EDPT process after UV excitation of individual guanine-cytosine (G⋅C) Watson-Crick base pairs by ultrafast time-resolved UV/visible and mid-infrared spectroscopy. The formation of an intermediate biradical species (G[-H]⋅C[+H]) with a lifetime of 2.9 ps was tracked. The majority of these biradicals return to the original G⋅C Watson-Crick pairs, but up to 10% of the initially excited molecules instead form a stable photoproduct G*⋅C* that has undergone double hydrogen-atom transfer. The observation of these sequential EDPT mechanisms across intermolecular hydrogen bonds confirms an important and long debated pathway for the deactivation of photoexcited base pairs, with possible implications for the UV photochemistry of DNA. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
J. B. Watson y la Publicidad, los Inicios de la Psicología del Consumidor
Directory of Open Access Journals (Sweden)
FELIPE PARRADO CORREDOR
2013-12-01
Full Text Available Research regarding the behavior of individuals with respect to products and services dates back to the beginning of the 20th century, and J. B. Watson is one of its main precursors. Watson taught an applied psychology course called Psychology of Advertising, introduced many companies to experimental techniques for the marketing of their products, and, after retiring from academic life, joined the Walter Thompson advertising agency, where he developed massive campaigns using the principles of conditioned emotional responses. The article highlights the importance of Watson’s work in the psychology of advertising, as a forerunner of the scientific developments of consumer psychology.
On the extension of the Fermi-Watson Theorem to high energy diffraction
International Nuclear Information System (INIS)
Malecki, A.; Istituto Nazionale di Fisica Nucleare, Frascati
1995-12-01
The Fermi-Watson theorem, established for low energy reactions and then applied to high energy collision, is revisited. Its use for the processes of inelastic diffraction is discussed. The theorem turns out to be valid in the case inclusive cross-section of diffractive transition
Kadhi, T.; Palasota, A.; Holley, D.; Rudley, D.
2010-01-01
The following report gives the statistical findings of the 2009-2010 Watson-Glaser test. Data is pre-existing and was given to the Evaluator by email from the Director, Center for Legal Pedagogy. Statistical analyses were run using SPSS 17 to address the following questions: 1. What are the statistical descriptors of the Watson-Glaser results of…
"Elementary, my dear Watson". Per una falsa citazione
Directory of Open Access Journals (Sweden)
Irene Minella
2014-12-01
Full Text Available Nowhere, among Sir Arthur Conan Doyle's pages concerning one of the most celebrated characters of British literature, Sherlock Holmes, is to be found the interjection: "Elementary, my dear Watson!". Exploring the creation of the London investigator as well as Holmes' first appearance in theatre, cinema and literature, this essay will help to understand why he is still so popular and why the 'non-quotation' keeps haunting the collective imagination. Despite its philological inaccuracy, the interjection has become so famous that it has been used even outside its original context.
Charlton, Bruce G
2008-01-01
Crick and Watson gave complementary advice to the aspiring scientist based on the insight that to do your best work you need to make your greatest possible effort. Crick made the positive suggestion to work on the subject which most deeply interests you, the thing about which you spontaneously gossip - Crick termed this 'the gossip test'. Watson made the negative suggestion of avoiding topics and activities that bore you - which I have termed 'the boredom principle'. This is good advice because science is tough and the easy things have already been done. Solving the harder problems that remain requires a lot of effort. But in modern biomedical science individual effort does not necessarily correlate with career success as measured by salary, status, job security, etc. This is because Crick and Watson are talking about revolutionary science - using Thomas Kuhn's distinction between paradigm-shifting 'revolutionary' science and incremental 'normal' science. There are two main problems with pursuing a career in revolutionary science. The first is that revolutionary science is intrinsically riskier than normal science, the second that even revolutionary success in a scientific backwater may be less career-enhancing than mundane work in a trendy field. So, if you pick your scientific problem using the gossip test and the boredom principle, you might also be committing career suicide. This may explain why so few people follow Crick and Watson's advice. The best hope for future biomedical science is that it will evolve towards a greater convergence between individual effort and career success.
Finding Little Albert: A Journey to John B. Watson's Infant Laboratory
Beck, Hall P.; Levinson, Sharman; Irons, Gary
2009-01-01
In 1920, John Watson and Rosalie Rayner claimed to have conditioned a baby boy, Albert, to fear a laboratory rat. In subsequent tests, they reported that the child's fear generalized to other furry objects. After the last testing session, Albert disappeared, creating one of the greatest mysteries in the history of psychology. This article…
Lichstein, Paul M; Kleimeyer, John P; Githens, Michael; Vorhies, John S; Gardner, Michael J; Bellino, Michael; Bishop, Julius
2018-04-24
A well-reduced femoral neck fracture is more likely to heal than a poorly reduced one, and increasing the quality of the surgical exposure makes it easier to achieve anatomic fracture reduction. Two open approaches are in common use for femoral neck fractures, the modified Smith-Petersen and Watson-Jones; however, to our knowledge, the quality of exposure of the femoral neck exposure provided by each approach has not been investigated. (1) What is the respective area of exposed femoral neck afforded by the Watson-Jones and modified Smith-Petersen approaches? (2) Is there a difference in the ability to visualize and/or palpate important anatomic landmarks provided by the Watson-Jones and modified Smith-Petersen approaches? Ten fresh-frozen human pelvi underwent both modified Smith-Petersen (utilizing the caudal extent of the standard Smith-Petersen interval distal to the anterosuperior iliac spine and parallel to the palpable interval between the tensor fascia lata and the sartorius) and Watson-Jones approaches. Dissections were performed by three fellowship-trained orthopaedic traumatologists with extensive experience in both approaches. Exposure (in cm) was quantified with calibrated digital photographs and specialized software. Modified Smith-Petersen approaches were analyzed before and after rectus femoris tenotomy. The ability to visualize and palpate seven clinically relevant anatomic structures (the labrum, femoral head, subcapital femoral neck, basicervical femoral neck, greater trochanter, lesser trochanter, and medial femoral neck) was also recorded. The quantified area of the exposed proximal femur was utilized to compare which approach afforded the largest field of view of the femoral neck and articular surface for assessment of femoral neck fracture and associated femoral head injury. The ability to visualize and palpate surrounding structures was assessed so that we could better understand which approach afforded the ability to assess structures that
2011-01-01
On 6 September, Nobel laureate James Watson paid a visit to CERN. In this interview, he shares his views with CERN's Paola Catapano. var flash_video_player=get_video_player_path(); insert_player_for_external('Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0753-kbps-640x360-25-fps-audio-64-kbps-44-kHz-stereo', 'mms://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0480-kbps-512x288-25-fps-audio-128-kbps-48-kHz-stereo.wmv', 'false', 480, 360, 'https://mediastream.cern.ch/MediaArchive/Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-posterframe-640x360-at-10-percent.jpg', '1384418', true, 'Video/Public/Movies/2011/CERN-MOVIE-2011-144/CERN-MOVIE-2011-144-0600-kbps-maxH-360-25-fps-audio-128-kbps-48-kHz-stereo.mp4');
Case of the missing fingerprints or Dr. Watson's cosmology
Energy Technology Data Exchange (ETDEWEB)
Longair, M.S.
1987-01-01
The cosmological problem has four main areas of uncertainty -the origin of isotropy of the universe, the origin of the fluctuations from which galaxies form, the explanation of why we live in a matter universe rather than one composed of equal amounts of matter and antimatter and why the Universe seems to be within a factor of 10 of the critical, flat universe. These cannot be explained satisfactorily within the Hot Big Bang theory after a millisecond or so. The solutions are presumed, therefore, to lie in the very early universe when it was less than about a millisecond old. The clues which lead to this conclusion are set out in terms of a detective story with Sherlock Holmes explaining the facts about the universe to Dr Watson. Holmes first explains the size of the universe in terms of distances and sizes of stars, galaxies and galaxy clusters. Evidence from pictures of the universe at different temperatures, (X-ray pictures, gamma-ray pictures, far infra-red pictures and pictures at radio and millimetre wavelengths) is presented. Holmes then starts to build up a realistic model of the universe using two of the facts collected (the isotropy of the universe and the expansion of the universe), one assumption (the cosmological principle) and one theory of gravity (General Relativity). However the universe which emerges does not solve the four problems mentioned. Quasars, which provide information (illustrated) from earlier epochs of the universe may, therefore, help to solve the problems. (U.K.).
Hydrogen Bonding in DNA Base Pairs: Reconciliation of Theory and Experiment
Fonseca Guerra, C.; Bickelhaupt, F.M.; Snijders, J.G.; Baerends, E.J.
2000-01-01
Up till now, there has been a significant disagreement between theory and experiment regarding hydrogen bond lengths in Watson - Crick base pairs. To investigate the possible sources of this discrepancy, we have studied numerous model systems for adenine - thymine (AT) and guanine - cytosine (GC)
Building Watson: An Overview of the DeepQA Project
Ferrucci, David; Brown, Eric; Chu-Carroll, Jennifer; Fan, James; Gondek, David; Kalyanpur, Aditya A.; Lally, Adam; Murdock, J. William; Nyberg, Eric; Prager, John; Schlaefer, Nico; Welty, Chris
2010-01-01
IBM Research undertook a challenge to build a computer system that could compete at the human champion level in real time on the American TV Quiz show, Jeopardy! The extent of the challenge includes fielding a real-time automatic contestant on the show, not merely a laboratory exercise. The Jeopardy! Challenge helped us address requirements that led to the design of the DeepQA architecture and the implementation of Watson. After 3 years of intense research and development by a core team of ab...
DEFF Research Database (Denmark)
Yde, Jacob C.; Knudsen, N. Tvis; Hasholt, Bent
2014-01-01
–2010 for the Watson River sector of the GrIS that drains into the fjord Kangerlussuaq. The hydrochemistry is dominated by Ca2+ and HCO3− with a relatively high molar K+/Na+ ratio of 0.6 ± 0.1, typical for meltwaters draining a gneissic lithology. Low molar Ca2+/Na+ and Mg2+/Na+ ratios indicate that weathering....... However, when normalized by discharge the denudation rates are comparable to other Arctic sites. When extrapolating the results from the Watson River catchment to the entire Greenland for 2007–2010, the solute export from Greenland meltwater varied between 7.1 × 106 and 7.8 × 106 tons, whilst the major...
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone
DEFF Research Database (Denmark)
Kumar, P.; Sharma, P. K.; Madsen, Charlotte S.
2013-01-01
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand.......Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand....
AVE bond index in the H-bond of the Watson-Crick pairs
International Nuclear Information System (INIS)
Giambiagi, M.; Giambiagi, M.S. de; Barroso Filho, W.
1981-01-01
The normal Watson-Crick base pairs are treated as super-molecules. The properties of the electronic distribution along the N-H...Y bonds are studied in an all-valence-electrons calculation, through a bond index formula devised for non-orthogonal basis. Eletronic density diagrams of the adenine-uracil base pair are analysed. (Auhor) [pt
Bakkar, Nadine; Kovalik, Tina; Lorenzini, Ileana; Spangler, Scott; Lacoste, Alix; Sponaugle, Kyle; Ferrante, Philip; Argentinis, Elenee; Sattler, Rita; Bowser, Robert
2018-02-01
Amyotrophic lateral sclerosis (ALS) is a devastating neurodegenerative disease with no effective treatments. Numerous RNA-binding proteins (RBPs) have been shown to be altered in ALS, with mutations in 11 RBPs causing familial forms of the disease, and 6 more RBPs showing abnormal expression/distribution in ALS albeit without any known mutations. RBP dysregulation is widely accepted as a contributing factor in ALS pathobiology. There are at least 1542 RBPs in the human genome; therefore, other unidentified RBPs may also be linked to the pathogenesis of ALS. We used IBM Watson ® to sieve through all RBPs in the genome and identify new RBPs linked to ALS (ALS-RBPs). IBM Watson extracted features from published literature to create semantic similarities and identify new connections between entities of interest. IBM Watson analyzed all published abstracts of previously known ALS-RBPs, and applied that text-based knowledge to all RBPs in the genome, ranking them by semantic similarity to the known set. We then validated the Watson top-ten-ranked RBPs at the protein and RNA levels in tissues from ALS and non-neurological disease controls, as well as in patient-derived induced pluripotent stem cells. 5 RBPs previously unlinked to ALS, hnRNPU, Syncrip, RBMS3, Caprin-1 and NUPL2, showed significant alterations in ALS compared to controls. Overall, we successfully used IBM Watson to help identify additional RBPs altered in ALS, highlighting the use of artificial intelligence tools to accelerate scientific discovery in ALS and possibly other complex neurological disorders.
Hazardous Waste Cleanup: IBM Corporation-TJ Watson Research Center in Yorktown Heights, New York
IBM Corporation -TJ Watson Research Center is located in southern Yorktown near the boundary separating the Town of Yorktown from the Town of New Castle. The site occupies an area of approximately 217 acres and adjoins land uses are predominantly residenti
Caplan, R M
1982-06-01
The author provides arguments to explain why four of Arthur Conan Doyle's sixty stories about Sherlock Holmes were not narrated by Dr. Watson. The arguments relate to logical demands of the plot in the cases of the two stories told by an unidentified narrator. The two told by Holmes seem to demand Watson's absence because the final elucidation requires skill in cutaneous diagnosis; the presence of a medical man would have, or should have, relieved the dramatic tension of the mystery too soon. The Sherlock Holmes stories can provide delightful diversion as well as serve constantly to enhance our appreciation for highly alert and careful physical examination.
Miyoshi, Daisuke; Nakamura, Kaori; Tateishi-Karimata, Hisae; Ohmichi, Tatsuo; Sugimoto, Naoki
2009-03-18
It has been revealed recently that molecular crowding, which is one of the largest differences between in vivo and in vitro conditions, is a critical factor determining the structure, stability, and function of nucleic acids. However, the effects of molecular crowding on Watson-Crick and Hoogsteen base pairs remain unclear. In order to investigate directly and quantitatively the molecular crowding effects on base pair types in nucleic acids, we designed intramolecular parallel- and antiparallel-stranded DNA duplexes consisting of Hoogsteen and Watson-Crick base pairs, respectively, as well as an intramolecular parallel-stranded triplex containing both types of base pairs. Thermodynamic analyses demonstrated that the values of free energy change at 25 degrees C for Hoogsteen base-pair formations decreased from +1.45 +/- 0.15 to +1.09 +/- 0.13 kcal mol(-1), and from -1.89 +/- 0.13 to -2.71 +/- 0.11 kcal mol(-1) in the intramolecular duplex and triplex, respectively, when the concentration of PEG 200 (polyethylene glycol with average molecular weight 200) increased from 0 to 20 wt %. However, corresponding values for Watson-Crick formation in the duplex and triplex increased from -10.2 +/- 0.2 to -8.7 +/- 0.1 kcal mol(-1), and from -10.8 +/- 0.2 to -9.2 +/- 0.2 kcal mol(-1), respectively. Furthermore, it was revealed that the opposing effects of molecular crowding on the Hoogsteen and Watson-Crick base pairs were due to different behaviors of water molecules binding to the DNA strands.
Méndez-Arriaga, José M; Maldonado, Carmen R; Dobado, José A; Galindo, Miguel A
2018-03-26
DNA sequences comprising noncanonical 7-deazaguanine ( 7C G) and canonical cytosine (C) are capable of forming Watson-Crick base pairs via hydrogen bonds as well as silver(I)-mediated base pairs by coordination to central silver(I) ions. Duplexes I and II containing 7C G and C have been synthesized and characterized. The incorporation of silver(I) ions into these duplexes has been studied by means of temperature-dependent UV spectroscopy, circular dichroism, and DFT calculations. The results suggest the formation of DNA molecules comprising contiguous metallated 7C G-Ag I -C Watson-Crick base pairs that preserve the original B-type conformation. Furthermore, additional studies performed on duplex III indicated that, in the presence of Ag I ions, 7C G-C and 7C A-T Watson-Crick base pairs ( 7C A, 7-deazadenine; T, thymine) can be converted to metallated 7C G-Ag I -C and 7C A-Ag I -T base pairs inside the same DNA molecule whilst maintaining its initial double helix conformation. These findings are very important for the development of customized silver-DNA nanostructures based on a Watson-Crick complementarity pattern. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Brovarets', O O; Hovorun, D M
2010-01-01
A novel physico-chemical mechanism of the Watson-Crick DNA base pair Gua.Cyt tautomerization Gua.Cyt*Gua.CytGua*.Cyt (mutagenic tautomers of bases are marked by asterisks) have been revealed and realized in a pathway of single proton transfer through two mutual isoenergetic transition states with Gibbs free energy of activation 30.4 and 30.6 kcal/mol and they are ion pairs stabilized by three (N2H...N3, N1H...N4- and O6+H...N4-) and five (N2H...O2, N1H...O2, N1H...N3, O6+H...N4- and 06+H...N4-) H-bonds accordingly. Stable base pairs Gua-Cyt* and Gua*.Cyt which dissociate comparably easy into monomers have acceptable relative Gibbs energies--12.9 and 14.3 kcal/mol--for the explanation of the nature of the spontaneous transitions of DNA replication. Results are obtained at the MP2/6-311++G(2df,pd)//B3LYP/6-31 1++G(d,p) level of theory in vacuum approach.
The Watson-Glaser Critical Thinking Appraisal and the Performance of Business Management Students.
Hicks, R. E.; Southey, G. N.
1990-01-01
The 80-item Watson-Glaser Critical Thinking Appraisal-Form A was administered to 415 business management students in Australia as a step toward adapting the test for Australian use. The results correspond reasonably closely to the U.S. data. Analysis of group results and item statistics provided information about necessary modifications. (SLD)
Das, Shubhajit
2015-09-17
We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.
Das, Shubhajit; Samanta, Pralok Kumar; Pati, Swapan
2015-01-01
We employ first-principles Density Functional Theory (DFT) and time-dependent DFT (TDDFT) to elucidate structural, electronic and optical properties of a few recently reported triazole adenine nucleobase analogues. The results are compared against the findings obtained for both natural adenine nucleobase and available experimental data. The optical absorption of these adenine analogues are calculated both in gas-phase and in solvent (methanol) using Polarized Continuum Model (PCM). We find that all the analogues show a red-shifted absorption profile as compared to adenine. Our simulated emission spectra in solvent compare fairly well with experimentally observed results. We investigate base paring ability of these adenine analogues with thymine. The calculations on the intrinsic stability of these base pairs ascertain that all the adenine analogues form the hydrogen bonded Watson-Crick base pair with similar H-bonding energy as obtained for natural adenine-thymine base pair. In our study, we provide a microscopic origin of the low-energy absorption and emission peaks, observed experimentally.
Quasi-four-particle first-order Faddeev-Watson-Lovelace terms in proton-helium scattering
Safarzade, Zohre; Akbarabadi, Farideh Shojaei; Fathi, Reza; Brunger, Michael J.; Bolorizadeh, Mohammad A.
2017-06-01
The Faddeev-Watson-Lovelace equations, which are typically used for solving three-particle scattering problems, are based on the assumption of target having one active electron while the other electrons remain passive during the collision process. So, in the case of protons scattering from helium or helium-like targets, in which there are two bound-state electrons, the passive electron has a static role in the collision channel to be studied. In this work, we intend to assign a dynamic role to all the target electrons, as they are physically active in the collision. By including an active role for the second electron in proton-helium-like collisions, a new form of the Faddeev-Watson-Lovelace integral equations is needed, in which there is no disconnected kernel. We consider the operators and the wave functions associated with the electrons to obey the Pauli exclusion principle, as the electrons are indistinguishable. In addition, a quasi-three-particle collision is assumed in the initial channel, where the electronic cloud is represented as a single identity in the collision.
Brovarets, Ol'ha O; Hovorun, Dmytro M
2014-01-01
Trying to answer the question posed in the title, we have carried out a detailed theoretical investigation of the biologically important mechanism of the tautomerization of the A·T Watson-Crick DNA base pair, information that is hard to establish experimentally. By combining theoretical investigations at the MP2 and density functional theory levels of QM theory with quantum theory of atoms in molecules analysis, the tautomerization of the A·T Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4) corresponding to a hydrophobic interfaces of protein-nucleic acid interactions. Based on the sweeps of the electron-topological, geometric, and energetic parameters, which describe the course of the tautomerization along its intrinsic reaction coordinate (IRC), it was proved that the A·T → A(∗)·T(∗) tautomerization through the DPT is a concerted (i.e. the pathway without an intermediate) and asynchronous (i.e. protons move with a time gap) process. The limiting stage of this phenomenon is the final PT along the N6H⋯O4 hydrogen bond (H-bond). The continuum with ϵ = 4 does not affect qualitatively the course of the tautomerization reaction: similar to that observed in vacuo, it proceeds via a concerted asynchronous process with the same structure of the transition state (TS). For the first time, the nine key points along the IRC of the A·T base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These nine key points have been used to define the reactant, TS, and product regions of the DPT in the A·T base pair. Considering the energy dependence of each of the three H-bonds, which stabilize the Watson-Crick and Löwdin's base pairs, along the IRC of the tautomerization, it was found that all these H
Directory of Open Access Journals (Sweden)
Mei-Yu LEE
2014-11-01
Full Text Available This paper investigates the effect of the nonzero autocorrelation coefficients on the sampling distributions of the Durbin-Watson test estimator in three time-series models that have different variance-covariance matrix assumption, separately. We show that the expected values and variances of the Durbin-Watson test estimator are slightly different, but the skewed and kurtosis coefficients are considerably different among three models. The shapes of four coefficients are similar between the Durbin-Watson model and our benchmark model, but are not the same with the autoregressive model cut by one-lagged period. Second, the large sample case shows that the three models have the same expected values, however, the autoregressive model cut by one-lagged period explores different shapes of variance, skewed and kurtosis coefficients from the other two models. This implies that the large samples lead to the same expected values, 2(1 – ρ0, whatever the variance-covariance matrix of the errors is assumed. Finally, comparing with the two sample cases, the shape of each coefficient is almost the same, moreover, the autocorrelation coefficients are negatively related with expected values, are inverted-U related with variances, are cubic related with skewed coefficients, and are U related with kurtosis coefficients.
Stability of non-Watson-Crick G-A/A-G base pair in synthetic DNA and RNA oligonucleotides.
Ito, Yuko; Sone, Yumiko; Mizutani, Takaharu
2004-03-01
A non-Watson-Crick G-A/A-G base pair is found in SECIS (selenocysteine-insertion sequence) element in the 3'-untranslated region of Se-protein mRNAs and in the functional site of the hammerhead ribozyme. We studied the stability of G-A/A-G base pair (bold) in 17mer GT(U)GACGGAAACCGGAAC synthetic DNA and RNA oligonucleotides by thermal melting experiments and gel electrophoresis. The measured Tm value of DNA oligonucleotide having G-A/A-G pair showed an intermediate value (58 degrees C) between that of Watson-Crick G-C/C-G base pair (75 degrees C) and that of G-G/A-A of non-base-pair (40 degrees C). Similar thermal melting patterns were obtained with RNA oligonucleotides. This result indicates that the secondary structure of oligonucleotide having G-A/A-G base pair is looser than that of the G-C type Watson-Crick base pair. In the comparison between RNA and DNA having G-A/A-G base pair, the Tm value of the RNA oligonucleotide was 11 degrees C lower than that of DNA, indicating that DNA has a more rigid structure than RNA. The stained pattern of oligonucleotide on polyacrylamide gel clarified that the mobility of the DNA oligonucleotide G-A/A-G base pair changed according to the urea concentration from the rigid state (near the mobility of G-C/C-G oligonucleotide) in the absence of urea to the random state (near the mobility of G-G/A-A oligonucleotide) in 7 M urea. However, the RNA oligonucleotide with G-A/A-G pair moved at an intermediate mobility between that of oligonucleotide with G-C/C-G and of the oligonucleotide with G-G/A-A, and the mobility pattern did not depend on urea concentration. Thus, DNA and RNA oligonucleotides with the G-A/A-G base pair showed a pattern indicating an intermediate structure between the rigid Watson-Crick base pair and the random structure of non-base pair. RNA with G-A/A-G base pair has the intermediate structure not influenced by urea concentration. Finally, this study indicated that the intermediate rigidity imparted by Non-Watson
The McLean-Watson line strength formula and its implementation
International Nuclear Information System (INIS)
Hey, J D
2009-01-01
We consider the application of the line strength formula recently derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions between states of high principal quantum number in hydrogenic atoms and ions (Rydberg-Rydberg transitions). Apparent difficulties in the implementation of this formula are overcome by the use of recurrence relations derived by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), and set out in an earlier paper by the present author (2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641). The use of the McLean-Watson formula for such cases is illustrated by the determination of the radiative lifetimes for levels with n ∼ 1000 and comparison of present results with approximate formulae. Interest in this work on the radial matrix elements for large n and n' is related both to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852) and to the calculation of Stark broadening for such spectra, e.g. Gigosos et al (2007 Astron. Astrophys. 466 1189), Stambulchik et al (2007 Phys. Rev. E 75 016401) and Stambulchik and Maron (2008 J. Phys. B: At. Mol. Opt. Phys. 41 095703). In addition, we discuss the question of inaccuracy caused by the omission of fine structure in such calculations, and the numerical stability of the recurrence relations used to implement the line strength formulae.
James Watson's most inconvenient truth: race realism and the moralistic fallacy.
Rushton, J Philippe; Jensen, Arthur R
2008-11-01
Recent editorials in this journal have defended the right of eminent biologist James Watson to raise the unpopular hypothesis that people of sub-Saharan African descent score lower, on average, than people of European or East Asian descent on tests of general intelligence. As those editorials imply, the scientific evidence is substantial in showing a genetic contribution to these differences. The unjustified ill treatment meted out to Watson therefore requires setting the record straight about the current state of the evidence on intelligence, race, and genetics. In this paper, we summarize our own previous reviews based on 10 categories of evidence: The worldwide distribution of test scores; the g factor of mental ability; heritability differences; brain size differences; trans-racial adoption studies; racial admixture studies; regression-to-the-mean effects; related life-history traits; human origins research; and the poverty of predictions from culture-only explanations. The preponderance of evidence demonstrates that in intelligence, brain size, and other life-history variables, East Asians average a higher IQ and larger brain than Europeans who average a higher IQ and larger brain than Africans. Further, these group differences are 50-80% heritable. These are facts, not opinions and science must be governed by data. There is no place for the "moralistic fallacy" that reality must conform to our social, political, or ethical desires.
Chandrasekhar, Sosale; Naik, Tangali R Ravikumar; Nayak, Susanta K; Row, Tayur N Guru
2010-06-15
The titled complex, obtained by co-crystallization (EtOH/25 degrees C), is apparently the only known complex of the free bases. Its crystal structure, as determined by X-ray diffraction at both 90 K and 313 K, showed that one A-T pair involves a Hoogsteen interaction, and the other a Watson-Crick interaction but only with respect to the adenine unit. The absence of a clear-cut Watson-Crick base pair raises intriguing questions about the basis of the DNA double helix. Copyright 2010 Elsevier Ltd. All rights reserved.
The ϱ-ππ coupling constant in lattice gauge theory
Gottlieb, Steven; MacKenzie, Paul B.; Thacker, H. B.; Weingarten, Don
1984-01-01
We present a method for studying hadronic transitions in lattice gauge theory which requires computer time comparable to that required by recent hadron spectrum calculations. This method is applied to a calculation of the decay ϱ-->ππ. On leave from the Department of Physics, Indiana University, Bloomington, IN 47405, USA. Address after September 1, 1983: IBM, T.J. Watson Research Center, Yorktown Heights, NY 10598, USA.
Density dependent hadron field theory
International Nuclear Information System (INIS)
Fuchs, C.; Lenske, H.; Wolter, H.H.
1995-01-01
A fully covariant approach to a density dependent hadron field theory is presented. The relation between in-medium NN interactions and field-theoretical meson-nucleon vertices is discussed. The medium dependence of nuclear interactions is described by a functional dependence of the meson-nucleon vertices on the baryon field operators. As a consequence, the Euler-Lagrange equations lead to baryon rearrangement self-energies which are not obtained when only a parametric dependence of the vertices on the density is assumed. It is shown that the approach is energy-momentum conserving and thermodynamically consistent. Solutions of the field equations are studied in the mean-field approximation. Descriptions of the medium dependence in terms of the baryon scalar and vector density are investigated. Applications to infinite nuclear matter and finite nuclei are discussed. Density dependent coupling constants obtained from Dirac-Brueckner calculations with the Bonn NN potentials are used. Results from Hartree calculations for energy spectra, binding energies, and charge density distributions of 16 O, 40,48 Ca, and 208 Pb are presented. Comparisons to data strongly support the importance of rearrangement in a relativistic density dependent field theory. Most striking is the simultaneous improvement of charge radii, charge densities, and binding energies. The results indicate the appearance of a new ''Coester line'' in the nuclear matter equation of state
D'Souza, Francis; Gadde, Suresh; Islam, D-M Shafiqul; Pang, Siew-Cheng; Schumacher, Amy Lea; Zandler, Melvin E; Horie, Rumiko; Araki, Yasuyaki; Ito, Osamu
2007-02-07
A fluorescent reporter molecule, 2-aminopurine was self-assembled via Watson-Crick base-pairing to a uracil appended fullerene to form a donor-acceptor conjugate; efficient photoinduced charge separation was confirmed by time-resolved emission and transient absorption spectral studies.
Xia, Shuangluo; Konigsberg, William H
2014-04-01
Recent structures of DNA polymerase complexes with dGMPCPP/dT and dCTP/dA mispairs at the insertion site have shown that they adopt Watson-Crick geometry in the presence of Mn(2+) indicating that the tautomeric or ionization state of the base has changed. To see whether the tautomeric or ionization state of base-pair could be affected by its microenvironment, we determined 10 structures of an RB69 DNA polymerase quadruple mutant with dG/dT or dT/dG mispairs at position n-1 to n-5 of the Primer/Template duplex. Different shapes of the mispairs, including Watson-Crick geometry, have been observed, strongly suggesting that the local environment of base-pairs plays an important role in their tautomeric or ionization states. © 2014 The Protein Society.
Pipe, Teresa Britt
2008-01-01
Sustained, high-performance nursing leadership can be effectively guided by caring theory. While much of leadership performance is manifested by external behaviors, highly effective leaders are also grounded by internal work of self-reflection and growth. This article focuses primarily on the inward journey of leadership as guided by Jean Watson's Theory of Human Caring. Key elements of the theory are interpreted within the context of the emerging, urgent, high-stakes challenges of the current healthcare environment. The links between self-nurturance and caring-healing leadership of others are explored.
DNA polymerase catalysis in the absence of Watson-Crick hydrogen bonds
Potapova, Olga; Chan, Chikio; DeLucia, Angela M.; Helquist, Sandra A.; Kool, Eric T.; Grindley, Nigel D. F.; Joyce, Catherine M.
2008-01-01
We report the first pre-steady-state kinetic studies of DNA replication in the absence of hydrogen bonds. We have used nonpolar nucleotide analogues that mimic the shape of a Watson-Crick base pair in order to investigate the kinetic consequences of a lack of hydrogen bonds in the polymerase reaction catalyzed by the Klenow fragment of DNA Polymerase I from Escherichia coli. With a thymine isostere lacking hydrogen bonding ability in the nascent pair, the efficiency (kpol/Kd) of the polymerase reaction is decreased by 30-fold, affecting ground state (Kd) and transition state (kpol) approximately equally. When both thymine and adenine analogues in the nascent pair lack hydrogen bonding ability, the efficiency of the polymerase reaction is decreased by about 1000-fold, with most the decrease attributable to the transition state. Reactions using nonpolar analogues at the primer terminal base pair demonstrated the requirement for a hydrogen bond between the polymerase and the minor groove of the primer-terminal base. The R668A mutation of Klenow fragment abolished this requirement, identifying R668 as the probable hydrogen bond donor. Detailed examination of the kinetic data suggested that Klenow fragment has an extremely low tolerance of even minor deviations of the analogue base pairs from ideal Watson-Crick geometry. Consistent with this idea, some analogue pairings were better tolerated by Klenow fragment mutants having more spacious active sites. By contrast, the Y-family polymerase Dbh was much less sensitive to changes in base pair dimensions, and more dependent on hydrogen bonding between base-paired partners. PMID:16411765
Cai, Hong; Li, Mian; Lin, Xiao-Rong; Chen, Wei; Chen, Guang-Hui; Huang, Xiao-Chun; Li, Dan
2015-09-01
Biological and artificial molecules and assemblies capable of supramolecular recognition, especially those with nucleobase pairing, usually rely on autonomous or collective binding to function. Advanced site-specific recognition takes advantage of cooperative spatial effects, as in local folding in protein-DNA binding. Herein, we report a new nucleobase-tagged metal-organic framework (MOF), namely ZnBTCA (BTC=benzene-1,3,5-tricarboxyl, A=adenine), in which the exposed Watson-Crick faces of adenine residues are immobilized periodically on the interior crystalline surface. Systematic control experiments demonstrated the cooperation of the open Watson-Crick sites and spatial effects within the nanopores, and thermodynamic and kinetic studies revealed a hysteretic host-guest interaction attributed to mild chemisorption. We further exploited this behavior for adenine-thymine binding within the constrained pores, and a globally adaptive response of the MOF host was observed. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Fanconi anaemia and the repair of Watson and Crick DNA crosslinks.
Kottemann, Molly C; Smogorzewska, Agata
2013-01-17
The function of Fanconi anaemia proteins is to maintain genomic stability. Their main role is in the repair of DNA interstrand crosslinks, which, by covalently binding the Watson and the Crick strands of DNA, impede replication and transcription. Inappropriate repair of interstrand crosslinks causes genomic instability, leading to cancer; conversely, the toxicity of crosslinking agents makes them a powerful chemotherapeutic. Fanconi anaemia proteins can promote stem-cell function, prevent tumorigenesis, stabilize replication forks and inhibit inaccurate repair. Recent advances have identified endogenous aldehydes as possible culprits of DNA damage that may induce the phenotypes seen in patients with Fanconi anaemia.
Assistência em Enfermagem e Jean Watson: Uma reflexão sobre a empatia
Directory of Open Access Journals (Sweden)
Roberta Maria Savieto
2016-03-01
Full Text Available Resumo Objetivo: Relacionar a empatia com a Teoria do Cuidado Humano, de Jean Watson, no contexto atual da Enfermagem. Métodos: Trata-se de um ensaio teórico-reflexivo que propõe uma discussão acerca da empatia e sua relação com a Teoria do Cuidado Humano, de Jean Watson, na prática contemporânea da Enfermagem. Resultado: É apresentado o processo Clinical Caritas e cada elemento de cuidado que o compõe visando propor e discutir as conexões com a empatia na assistência em Enfermagem. Torna-se imperioso aliar aspectos técnicos e humanísticos na oferta do cuidado de Enfermagem, além de resgatar a valorização da abordagem da empatia na formação de profissionais da saúde, bem como na continuidade dos estudos após a graduação. Conclusão: Entende-se que essa reflexão pode contribuir para a reorganização de ideias e conceitos sobre aprimoramentos essenciais que se mostram necessários à prática atual da Enfermagem, além de reforçar seu crescimento enquanto ciência.
Pramanik, Smritimoy; Nakamura, Kaori; Usui, Kenji; Nakano, Shu-ichi; Saxena, Sarika; Matsui, Jun; Miyoshi, Daisuke; Sugimoto, Naoki
2011-03-14
We found that Hoogsteen base pairs were stabilized by molecular crowding and a histone H3-mimicking peptide, which was not observed for Watson-Crick base pairs. Our findings demonstrate that the type of DNA base pair is critical for the interaction between DNA and histones.
Extension of Hartree-Fock theory including tensor correlation in nuclear matter
Hu, Jinniu; Toki, Hiroshi; Ogawa, Yoko
2013-10-01
We study the properties of nuclear matter in the extension of Hartree-Fock theory including tensor correlation using a realistic nucleon-nucleon (NN) interaction. The nuclear wave function consists of the Hartree-Fock and two-particle-two-hole (2p-2h) states, following the concept of the tensor-optimized shell model (TOSM) for light nuclei. The short range repulsion and strong tensor force of realistic NN interaction provide high momentum components, which are taken into account in a many-body framework by introducing 2p-2h states. Single particle states are determined by the variational principle of the total energy with respect to 2p-2h amplitudes and Hartree-Fock (HF) single-particle states. The resulting differential equation is almost identical with that of Brueckner-Hartree-Fock (BHF) theory by taking two-body scattering terms only. We calculate the equation of state (EOS) of nuclear matter in this framework with the Bonn potential as a realistic NN interaction. We found similar results to BHF theory with slightly repulsive effects in the total energy. The relativistic effect is discussed for the EOSs of nuclear matter in both non-relativistic and relativistic frameworks. The momentum distribution has large components at high momenta due to 2p-2h excitations. We also obtain the EOSs of pure neutron matter, where the tensor effect is small in the iso-vector channel.
International Nuclear Information System (INIS)
Mount, Brianna J.; Redshaw, Matthew; Myers, Edmund G.; Mueller, Holger S. P.
2010-01-01
By fitting the Dunham-Watson model to extensive rotational and vibrational spectroscopic data of isotopic variants of CO, and by using existing precise masses of 13 C, 16 O, and 18 O from Penning-trap mass spectrometry, we determine the atomic mass of 17 O to be M[ 17 O]=16.999 131 644(30) u, where the uncertainty is purely statistical. Using Penning-trap mass spectrometry, we have also directly determined the atomic mass of 17 O with the more precise result M[ 17 O]=16.999 131 756 6(9) u. The Dunham-Watson model applied to the molecular spectroscopic data hence predicts the mass of 17 O to better than 1 part in 10 8 .
Hagemann, Rudolf
2007-01-01
At the beginning, the two fundamental papers by Watson and Crick published in 1953 are presented. Subsequently, the main phases of protein and nucleic acids research, starting in the middle of the 19th century, are shortly reviewed. It is outlined, how the 'protein-paradigm' was gradually developed and ultimately became widely accepted. It is then described how Caspersson in 1936 newly raised the question what the chemical nature of genes was: proteins or nucleic acids ? In the main part of this report six lines of research are reviewed, the results of which led to the demise of the 'protein paradigm', the creation of the Watson-Crick model of the DNA and the elaboration of the mechanism of DNA replication: (a) mutation experiments with UV and determination of the UV action spectrum, (b) determination of the chemical identity of the transforming agent in bacteria, (c) detailed chemical analysis of the DNA of different organisms, (d) molecular investigation of the infection of bacteria by bacteriophages, (e) X-ray analysis of DNA fibers, (f) model building and theoretical treatment of all data obtained. In this article, the factors promoting and inhibiting scientific progress in this field are described (and, above all, the relations between scientists with fixated concepts). The results from these lines of research led to the recognition of the decisive role of nucleic acids as the carriers of genetic information and, in this way, formally established the 'nucleic acid paradigm'. Finally the question is discussed why Watson and Crick found the right solution for the DNA structure (and not one of their competitors).
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-13
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase iota (poliota) is a bypass polymerase of the Y family. Crystal structures of poliota suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that poliota is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetylaminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in poliota for bypass of dG-AAF. In poliota with Hoogsteen-paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick-paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that poliota would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for poliota in lesion bypass.
Bhattacharyya, Dhananjay; Halder, Sukanya; Basu, Sankar; Mukherjee, Debasish; Kumar, Prasun; Bansal, Manju
2017-02-01
Comprehensive analyses of structural features of non-canonical base pairs within a nucleic acid double helix are limited by the availability of a small number of three dimensional structures. Therefore, a procedure for model building of double helices containing any given nucleotide sequence and base pairing information, either canonical or non-canonical, is seriously needed. Here we describe a program RNAHelix, which is an updated version of our widely used software, NUCGEN. The program can regenerate duplexes using the dinucleotide step and base pair orientation parameters for a given double helical DNA or RNA sequence with defined Watson-Crick or non-Watson-Crick base pairs. The original structure and the corresponding regenerated structure of double helices were found to be very close, as indicated by the small RMSD values between positions of the corresponding atoms. Structures of several usual and unusual double helices have been regenerated and compared with their original structures in terms of base pair RMSD, torsion angles and electrostatic potentials and very high agreements have been noted. RNAHelix can also be used to generate a structure with a sequence completely different from an experimentally determined one or to introduce single to multiple mutation, but with the same set of parameters and hence can also be an important tool in homology modeling and study of mutation induced structural changes.
The extension of a DNA double helix by an additional Watson-Crick base pair on the same backbone.
Kumar, Pawan; Sharma, Pawan K; Madsen, Charlotte S; Petersen, Michael; Nielsen, Poul
2013-06-17
Additional base pair: The DNA duplex can be extended with an additional Watson-Crick base pair on the same backbone by the use of double-headed nucleotides. These also work as compressed dinucleotides and form two base pairs with cognate nucleobases on the opposite strand. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Covariant density functional theory for nuclear matter
Energy Technology Data Exchange (ETDEWEB)
Badarch, U.
2007-07-01
The present thesis is organized as follows. In Chapter 2 we study the Nucleon-Nucleon (NN) interaction in Dirac-Brueckner (DB) approach. We start by considering the NN interaction in free-space in terms of the Bethe-Salpeter (BS) equation to the meson exchange potential model. Then we present the DB approach for nuclear matter by extending the BS equation for the in-medium NN interaction. From the solution of the three-dimensional in-medium BS equation, we derive the DB self-energies and total binding energy which are the main results of the DB approach, which we later incorporate in the field theoretical calculation of the nuclear equation of state. In Chapter 3, we introduce the basic concepts of density functional theory in the context of Quantum Hadrodynamics (QHD-I). We reach the main point of this work in Chapter 4 where we introduce the DDRH approach. In the DDRH theory, the medium dependence of the meson-nucleon vertices is expressed as functionals of the baryon field operators. Because of the complexities of the operator-valued functionals we decide to use the mean-field approximation. In Chapter 5, we contrast microscopic and phenomenological approaches to extracting density dependent meson-baryon vertices. Chapter 6 gives the results of our studies of the EOS of infinite nuclear matter in detail. Using formulas derived in Chapters 4 and 5 we calculate the properties of symmetric and asymmetric nuclear matter and pure neutron matter. (orig.)
Covariant density functional theory for nuclear matter
International Nuclear Information System (INIS)
Badarch, U.
2007-01-01
The present thesis is organized as follows. In Chapter 2 we study the Nucleon-Nucleon (NN) interaction in Dirac-Brueckner (DB) approach. We start by considering the NN interaction in free-space in terms of the Bethe-Salpeter (BS) equation to the meson exchange potential model. Then we present the DB approach for nuclear matter by extending the BS equation for the in-medium NN interaction. From the solution of the three-dimensional in-medium BS equation, we derive the DB self-energies and total binding energy which are the main results of the DB approach, which we later incorporate in the field theoretical calculation of the nuclear equation of state. In Chapter 3, we introduce the basic concepts of density functional theory in the context of Quantum Hadrodynamics (QHD-I). We reach the main point of this work in Chapter 4 where we introduce the DDRH approach. In the DDRH theory, the medium dependence of the meson-nucleon vertices is expressed as functionals of the baryon field operators. Because of the complexities of the operator-valued functionals we decide to use the mean-field approximation. In Chapter 5, we contrast microscopic and phenomenological approaches to extracting density dependent meson-baryon vertices. Chapter 6 gives the results of our studies of the EOS of infinite nuclear matter in detail. Using formulas derived in Chapters 4 and 5 we calculate the properties of symmetric and asymmetric nuclear matter and pure neutron matter. (orig.)
Worthington, Debra L.; Keaton, Shaughan; Cook, John; Fitch-Hauser, Margaret; Powers, William G.
2014-01-01
The Watson-Barker Listening Test (WBLT) is one of the most popular measures of listening comprehension. However, participants in studies utilizing this scale have been almost exclusively Anglo-American. At the same time, previous research questions the psychometric properties of the test. This study addressed both of these issues by testing the…
Many body calculations in atomic physics
International Nuclear Information System (INIS)
Kelly, H.P.
1985-01-01
The use of the many-body perturbation theory for atomic calculations are reviewed. The major emphasis is on the use of the linked-cluster many-body perturbation theory derived by Brueckner and Goldstone. Applications of many-body theory to calculations of hyperfine structure are examined. Auger rates and parity violation are discussed. Photoionization is reviewed, and the authors show how many-body perturbation theory can be applied to problems ranging from structural properties such as correlation energies and hyperfine structure to dynamical properties such as transitions induced by weak neutral currents and photoionization cross sections
Jung, Seungwon; Cha, Misun; Park, Jiyong; Jeong, Namjo; Kim, Gunn; Park, Changwon; Ihm, Jisoon; Lee, Junghoon
2010-08-18
It has been known that single-strand DNA wraps around a single-walled carbon nanotube (SWNT) by pi-stacking. In this paper it is demonstrated that such DNA is dissociated from the SWNT by Watson-Crick base-pairing with a complementary sequence. Measurement of field effect transistor characteristics indicates a shift of the electrical properties as a result of this "unwrapping" event. We further confirm the suggested process through Raman spectroscopy and gel electrophoresis. Experimental results are verified in view of atomistic mechanisms with molecular dynamics simulations and binding energy analyses.
Enol tautomers of Watson-Crick base pair models are metastable because of nuclear quantum effects.
Pérez, Alejandro; Tuckerman, Mark E; Hjalmarson, Harold P; von Lilienfeld, O Anatole
2010-08-25
Intermolecular enol tautomers of Watson-Crick base pairs could emerge spontaneously via interbase double proton transfer. It has been hypothesized that their formation could be facilitated by thermal fluctuations and proton tunneling, and possibly be relevant to DNA damage. Theoretical and computational studies, assuming classical nuclei, have confirmed the dynamic stability of these rare tautomers. However, by accounting for nuclear quantum effects explicitly through Car-Parrinello path integral molecular dynamics calculations, we find the tautomeric enol form to be dynamically metastable, with lifetimes too insignificant to be implicated in DNA damage.
Bende, Attila; Muntean, Cristina M
2014-03-01
The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.
A complex angular momentum theory of modified Coulomb scattering
International Nuclear Information System (INIS)
Thylwe, K.E.; Connor, J.N.L.
1985-01-01
The paper develops an exact complex angular momentum (CAM) theory of elastic scattering for a complex optical potential with a Coulombic tail. The present CAM theory avoids complications due to the long range nature of the Coulombic potential in a straightforward way. The Sommerfeld-Watson transformation together with a travelling wave (near-side far-side) decomposition, is used to obtain an exact representation for the scattering amplitude f(theta) in terms of a background integral fsub(B)(theta) and a series of subamplitudes fsup((+-))sub(n)(theta). New exact representations are derived for fsub(B)(theta) when the scattering matrix element S(lambda) possesses local symmetries of the type S(-lambda)=S(lambda)exp(+-2iπlambda) and S(-lambda)=S(lambda). The exact results obtained in this paper unify the CAM theory of scattering for Coulombic and short range potentials and are especially suitable for the introduction of semiclassical approximations. (author)
Donny-Clark, Kerry; Shapiro, Robert; Broyde, Suse
2009-01-01
Bypass across DNA lesions by specialized polymerases is essential for maintenance of genomic stability. Human DNA polymerase ι (polι) is a bypass polymerase of the Y family. Crystal structures of polι suggest that Hoogsteen base pairing is employed to bypass minor groove DNA lesions, placing them on the spacious major groove side of the enzyme. Primer extension studies have shown that polι is also capable of error-free nucleotide incorporation opposite the bulky major groove adduct N-(deoxyguanosin-8-yl)-2-acetyl-aminofluorene (dG-AAF). We present molecular dynamics simulations and free energy calculations suggesting that Watson-Crick base pairing could be employed in polι for bypass of dG-AAF. In polι with Hoogsteen paired dG-AAF the bulky AAF moiety would reside on the cramped minor groove side of the template. The Hoogsteen-capable conformation distorts the active site, disrupting interactions necessary for error-free incorporation of dC opposite the lesion. Watson-Crick pairing places the AAF rings on the spacious major groove side, similar to the position of minor groove adducts observed with Hoogsteen pairing. Watson-Crick paired structures show a well-ordered active site, with a near reaction-ready ternary complex. Thus our results suggest that polι would utilize the same spacious region for lesion bypass of both major and minor groove adducts. Therefore, purine adducts with bulk on the minor groove side would use Hoogsteen pairing, while adducts with the bulky lesion on the major groove side would utilize Watson-Crick base pairing as indicated by our MD simulations for dG-AAF. This suggests the possibility of an expanded role for polι in lesion bypass. PMID:19072536
Extended low-frequency approximation for laser-modified electron scattering: Coulomb effects
International Nuclear Information System (INIS)
Mittleman, M.H.
1988-01-01
The Kroll-Watson [N.M. Kroll and K. M. Watson, Phys. Rev. A 8, 804 (1973)] theory for electron scattering in the field of a low-frequency laser has been extended by L. Rosenberg [Phys. Rev. A 23, 2283 (1981); 28, 2727 (1983)] to apply to higher intensities. That result is rederived in another way so as to make the correction second order. The correction terms are obtained and shown to be small in the high-intensity low-energy regime in which the original theory is weakest. The special case of a Coulomb potential is analyzed and shown to present special peculiarities in the extended theory just as in the original Kroll-Watson theory
Non-Watson-Crick basepairing and hydration in RNA motifs: molecular dynamics of 5S rRNA loop E
Czech Academy of Sciences Publication Activity Database
Réblová, K.; Špačková, Naďa; Štefl, R.; Csaszar, K.; Koča, J.; Leontis, N. B.; Šponer, Jiří
2003-01-01
Roč. 84, č. 6 (2003), s. 3564-3582 ISSN 0006-3495 R&D Projects: GA MŠk LN00A016 Grant - others:National Institutes of Health(US) 2R15 GM55898; National Science Foundation(US) CHE-9732563 Institutional research plan: CEZ:AV0Z5004920 Keywords : non-Watson-Crick base pairs * ribosomal RNA * Loop E Subject RIV: BO - Biophysics Impact factor: 4.463, year: 2003
Roseboro, Donyell; Lewis, Somer; Buchanan, Lisa; Higgins, Heidi; Schlichting, Katie; Brinkley, Brian
2014-01-01
In 1989, the Watson College of Education at the University of North Carolina Wilmington started the Model Clinical Teaching Project and the Consortium for the Advancement of Public Education's School Reform Initiative (CAPE). Since that time, the partnership system has grown to include 146 schools across twelve traditional school districts and…
Narrow coherent effects in πNN-dynamics
International Nuclear Information System (INIS)
Kudryavtsev, A.E.; Obrant, G.Z.
1990-01-01
Coherent effect production is considered in πNN-dynamics with resonant pion-nucleon interaction via Brueckner theory and Faddev equations. It is shown that the narrow energy and final momentum dependence can arise in the inelastic S-wave πd-scattering. The energy dependence peculiarities can have a width an order magnitude less than πN-resonance one
Isaksson, J; Zamaratski, E; Maltseva, T V; Agback, P; Kumar, A; Chattopadhyaya, J
2001-06-01
A single-point substitution of the O4' oxygen by a CH2 group at the sugar residue of A6 (i.e. 2'-deoxyaristeromycin moiety) in a self-complementary DNA duplex, 5'-d(C1G2C3G4A5A6T7T8C9G10C11G12)2(-3), has been shown to steer the fully Watson-Crick basepaired DNA duplex (1A), akin to the native counterpart, to a doubly A6:T7 Hoogsteen basepaired (1B) B-type DNA duplex, resulting in a dynamic equilibrium of (1A)(1B): Keq = k1/k(-1) = 0.56+/-0.08. The dynamic conversion of the fully Watson-Crick basepaired (1A) to the partly Hoogsteen basepaired (1B) structure is marginally kinetically and thermodynamically disfavoured [k1 (298K) = 3.9 0.8 sec(-1); deltaHdegrees++ = 164+/-14 kJ/mol; -TdeltaS degrees++ (298K) = -92 kJ/mol giving a deltaG degrees++ 298 of 72 kJ/mol. Ea (k1) = 167 14 kJ/mol] compared to the reverse conversion of the Hoogsteen (1B) to the Watson-Crick (1A) structure [k-1 (298K) = 7.0 0.6 sec-1, deltaH degrees++ = 153 13 kJ/mol; -TdeltaSdegrees++ (298K) = -82 kJ/mol giving a deltaGdegrees++(298) of 71 kJ/mol. Ea (k-1) = 155 13 kJ/mol]. Acomparison of deltaGdegrees++(298) of the forward (k1) and backward (k-1) conversions, (1A)(1B), shows that there is ca 1 kJ/mol preference for the Watson-Crick (1A) over the double Hoogsteen basepaired (1B) DNA duplex, thus giving an equilibrium ratio of almost 2:1 in favour of the fully Watson-Crick basepaired duplex. The chemical environments of the two interconverting DNA duplexes are very different as evident from their widely separated sets of chemical shifts connected by temperature-dependent exchange peaks in the NOESY and ROESY spectra. The fully Watson-Crick basepaired structure (1A) is based on a total of 127 intra, 97 inter and 17 cross-strand distance constraints per strand, whereas the double A6:T7 Hoogsteen basepaired (1B) structure is based on 114 intra, 92 inter and 15 cross-strand distance constraints, giving an average of 22 and 20 NOE distance constraints per residue and strand, respectively. In addition
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
The intrinsic capability of the homo-purine DNA base mispairs to perform wobble↔Watson-Crick/Topal-Fresco tautomeric transitions via the sequential intrapair double proton transfer was discovered for the first time using QM (MP2/DFT) and QTAIM methodologies that are crucial for understanding the microstructural mechanisms of the spontaneous transversions.
Czech Academy of Sciences Publication Activity Database
Šponer, Judit E.; Leszczynski, J.; Šponer, Jiří
2005-01-01
Roč. 22, č. 6 (2005), s. 826 ISSN 0739-1102. [Albany 2005. Conversation /14./. 14.06.2005-18.06.2005, Albany] Institutional research plan: CEZ:AV0Z50040507 Keywords : RNA base pairing * DNA * Watson-Crick/Sugar Edge Subject RIV: BO - Biophysics
Calculation of the hyperfine interaction using an effective-operator form of many-body theory
International Nuclear Information System (INIS)
Garpman, S.; Lindgren, I.; Lindgren, J.; Morrison, J.
1975-01-01
The effective-operator form of many-body theory is reviewed and applied to the calculation of the hyperfine structure. Numerical results are given for the 2p, 3p, and 4p excited states of Li and the 3p state of Na. This is the first complete calculation of the hyperfine structure using an effective-operator form of perturbation theory. As in the Brueckner-Goldstone form of many-body theory, the various terms in the perturbation expansion are represented by Feynman diagrams which correspond to basic physical processes. The angular part of the perturbation diagrams are evaluated by taking advantage of the formal analogy between the Feynman diagrams and the angular-momentum diagrams, introduced by Jucys et al. The radial part of the diagrams is calculated by solving one- and two-particle equations for the particular linear combination of excited states that contribute to the Feynman diagrams. In this way all second- and third-order effects are accurately evaluated without explicitly constructing the excited orbitals. For the 2p state of Li our results are in agreement with the calculations of Nesbet and of Hameed and Foley. However, our quadrupole calculation disagrees with the work of Das and co-workers. The many-body results for Li and Na are compared with semiempirical methods for evaluating the quadrupole moment from the hyperfine interaction, and a new quadrupole moment of 23 Na is given
Hwang, Hanshin; Taylor, John-Stephen
2005-03-29
We have recently reported that pyrene nucleotide is preferentially inserted opposite an abasic site, the 3'-T of a thymine dimer, and most undamaged bases by yeast DNA polymerase eta (pol eta). Because pyrene is a nonpolar molecule with no H-bonding ability, the unusually high efficiencies of dPMP insertion are ascribed to its superior base stacking ability, and underscore the importance of base stacking in the selection of nucleotides by pol eta. To investigate the role of H-bonding and base pair geometry in the selection of nucleotides by pol eta, we determined the insertion efficiencies of the base-modified nucleotides 2,6-diaminopurine, 2-aminopurine, 6-chloropurine, and inosine which would make a different number of H-bonds with the template base depending on base pair geometry. Watson-Crick base pairing appears to play an important role in the selection of nucleotide analogues for insertion opposite C and T as evidenced by the decrease in the relative insertion efficiencies with a decrease in the number of Watson-Crick H-bonds and an increase in the number of donor-donor and acceptor-acceptor interactions. The selectivity of nucleotide insertion is greater opposite the 5'-T than the 3'-T of the thymine dimer, in accord with previous work suggesting that the 5'-T is held more rigidly than the 3'-T. Furthermore, insertion of A opposite both Ts of the dimer appears to be mediated by Watson-Crick base pairing and not by Hoogsteen base pairing based on the almost identical insertion efficiencies of A and 7-deaza-A, the latter of which lacks H-bonding capability at N7. The relative efficiencies for insertion of nucleotides that can form Watson-Crick base pairs parallel those for the Klenow fragment, whereas the Klenow fragment more strongly discriminates against mismatches, in accord with its greater shape selectivity. These results underscore the importance of H-bonding and Watson-Crick base pair geometry in the selection of nucleotides by both pol eta and the
Directory of Open Access Journals (Sweden)
Carme Ferré-Grau
2008-03-01
Full Text Available La elevada frecuencia de personas con trastornos depresivos en todos los niveles de atención y la complejidad de los cuidados, conlleva la necesidad, para la enfermera, de desarrollar nuevas habilidades y competencias en el abordaje integral de los pacientes y su familia. Para la comprensión de una persona con depresión es útil una mirada etnográfica que nos permita conocer la expresión subjetiva de la vivencia de la enfermedad. Un marco adecuado de referencia para ayudar en el cuidado de estos procesos es la teoría de Jean Watson sobre la Filosofía y Ciencia de los Cuidados Humanos, que a través de sus diez factores cuidativos enmarca el rol de la enfermera en "cómo tener cuidado de...". Este artículo trata de analizar, a través de los factores cuidativos de Watson, las vivencias subjetivas relacionadas con la transformación del cuerpo y la mente de las personas con depresión: el sufrimiento y el dolor, la autoimagen y el reconocimiento, la falta de energía, la pérdida de la esperanza. Se concluye que no es posible controlar el cuerpo sin controlar la mente y para ello nos puede ayudar el análisis subjetivo de la experiencia y la aplicación de los factores cuidativos.The high frequency of people with depressive disorders in Primary Health Care as well as in Hospital and the complexity of care, carry for nurses the need to develop new skills and competences to deal with complete care of patiens and families. To understand a person suffering depressive disorders may be useful an ethnographic look that let us know the subjective expression of the experience of being ill. An appropriate framework to help care is Jean Watson’s Philosophy and Science of Human Caring, trough 10 caring factors that frame the nursing role "to take care of…". This paper tries to analyze the subjective experience related to body and mind changes: suffering and pain, self-image and acceptance, lack of energy, loss of hope… in patients with
The Towers Watson Approach to Improving Corporate Wellness.
Wootton, Adam
2012-06-01
Encouraging employees to take care of their health is in the interests of everyone. Employees benefit from being healthier and happier, employers benefit from having an engaged workforce, lower absenteeism, and lower medical costs, and society as a whole benefits from using less medical resources. Employers have been trying to push healthy messages to employees for a long time and have had some good success. For example, an increased emphasis on the dangers of tobacco use in employer and government communications has helped bring about a significant decrease in smoking. However, overall population health in key risk areas (such as obesity and diabetes) continues to decline. These areas are where employers can really make a difference in health outcomes-and effective communications are critical to success. Towers Watson helps many companies educate employees about health and wellness and encourage more effective use of healthcare. The challenge is to find new and engaging ways to deliver this information so that employees take notice-and take action. After all, the amount of material employees receive on a daily basis from marketers, employers, and each other across the wide range of available media makes it extremely difficult to be heard. This is where gaming comes in-and why we think it's the tool to be incorporating into communication and engagement plans.
Guidi, Gabriele; Miniati, Roberto; Mazzola, Matteo; Iadanza, Ernesto
2016-01-01
In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS) using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detect...
Covariant density functional theory: predictive power and first attempts of a microscopic derivation
Ring, Peter
2018-05-01
We discuss systematic global investigations with modern covariant density functionals. The number of their phenomenological parameters can be reduced considerable by using microscopic input from ab-initio calculations in nuclear matter. The size of the tensor force is still an open problem. Therefore we use the first full relativistic Brueckner-Hartree-Fock calculations in finite nuclear systems in order to study properties of such functionals, which cannot be obtained from nuclear matter calculations.
Pereira Poza, A
1998-01-01
We use texts by preeminent figures in Victorian surgery at the end of the nineteenth century and information about their role in disseminating the germ theory to analyse the impact of this new etiologic element in the genesis of cancer. We trace the career of William Watson Cheyne (1852-1932), a disciple of Lister, and of many other surgeons of his generation, to outline the changes in the approach to treatment for cancer, the theoretical basis for these changes, and the role of a new conceptualization of cancer in the light of the microbial theory. This theory, among many other better-known factors, helped establish the foundation for radical surgery which became widespread in oncological treatment during the final decade of the nineteenth century.
Directory of Open Access Journals (Sweden)
Ingrid Meireles Gomes
2013-09-01
Full Text Available Trata-se de um ensaio reflexivo sobre o potencial de utilização da Teoria do Cuidado Transpessoal de Jean Watson, na realização do cuidado domiciliar de enfermagem direcionado à criança, desenvolvido à luz dos 10 elementos do Processo Clinical Caritas. Este referencial teórico permite desenvolver a transpessoalidade no cuidado domiciliar da criança, momento em que o enfermeiro precisa desenvolver autoconhecimento, ter suporte teórico-filosófico e valer-se deste conhecimento, a fim de ultrapassar o paradigma da objetividade e do biologicismo.
Robonaut 2 and Watson: Cognitive Dexterity for Future Exploration
Badger, Julia M.; Strawser, Philip; Farrell, Logan; Goza, S. Michael; Claunch, Charles A.; Chancey, Raphael; Potapinski, Russell
2018-01-01
Future exploration missions will dictate a level of autonomy never before experienced in human spaceflight. Mission plans involving the uncrewed phases of complex human spacecraft in deep space will require a coordinated autonomous capability to be able to maintain the spacecraft when ground control is not available. One promising direction involves embedding intelligence into the system design both through the employment of state-of-the-art system engineering principles as well as through the creation of a cognitive network between a smart spacecraft or habitat and embodiments of cognitive agents. The work described here details efforts to integrate IBM's Watson and other cognitive computing services into NASA Johnson Space Center (JSC)'s Robonaut 2 (R2) anthropomorphic robot. This paper also discusses future directions this work will take. A cognitive spacecraft management system that is able to seamlessly collect data from subsystems, determine corrective actions, and provide commands to enable those actions is the end goal. These commands could be to embedded spacecraft systems or to a set of robotic assets that are tied into the cognitive system. An exciting collaboration with Woodside provides a promising Earth-bound testing analog, as controlling and maintaining not normally manned off-shore platforms have similar constraints to the space missions described.
Covariant density functional theory: predictive power and first attempts of a microscopic derivation
Directory of Open Access Journals (Sweden)
Ring Peter
2018-01-01
Full Text Available We discuss systematic global investigations with modern covariant density functionals. The number of their phenomenological parameters can be reduced considerable by using microscopic input from ab-initio calculations in nuclear matter. The size of the tensor force is still an open problem. Therefore we use the first full relativistic Brueckner-Hartree-Fock calculations in finite nuclear systems in order to study properties of such functionals, which cannot be obtained from nuclear matter calculations.
Trivedi, Hari; Mesterhazy, Joseph; Laguna, Benjamin; Vu, Thienkhai; Sohn, Jae Ho
2018-04-01
Magnetic resonance imaging (MRI) protocoling can be time- and resource-intensive, and protocols can often be suboptimal dependent upon the expertise or preferences of the protocoling radiologist. Providing a best-practice recommendation for an MRI protocol has the potential to improve efficiency and decrease the likelihood of a suboptimal or erroneous study. The goal of this study was to develop and validate a machine learning-based natural language classifier that can automatically assign the use of intravenous contrast for musculoskeletal MRI protocols based upon the free-text clinical indication of the study, thereby improving efficiency of the protocoling radiologist and potentially decreasing errors. We utilized a deep learning-based natural language classification system from IBM Watson, a question-answering supercomputer that gained fame after challenging the best human players on Jeopardy! in 2011. We compared this solution to a series of traditional machine learning-based natural language processing techniques that utilize a term-document frequency matrix. Each classifier was trained with 1240 MRI protocols plus their respective clinical indications and validated with a test set of 280. Ground truth of contrast assignment was obtained from the clinical record. For evaluation of inter-reader agreement, a blinded second reader radiologist analyzed all cases and determined contrast assignment based on only the free-text clinical indication. In the test set, Watson demonstrated overall accuracy of 83.2% when compared to the original protocol. This was similar to the overall accuracy of 80.2% achieved by an ensemble of eight traditional machine learning algorithms based on a term-document matrix. When compared to the second reader's contrast assignment, Watson achieved 88.6% agreement. When evaluating only the subset of cases where the original protocol and second reader were concordant (n = 251), agreement climbed further to 90.0%. The classifier was
Applications of the Galton-Watson process to human DNA evolution and demography
Neves, A G M
2005-01-01
We show that the problem of existence of a mitochondrial Eve can be understood as an application of the Galton--Watson process and presents interesting analogies with critical phenomena in Statistical Mechanics. In the approximation of small survival probability, and assuming limited progeny, we are able to find for a genealogic tree the maximum and minimum survival probabilities over all probability distributions for the number of children per woman constrained to a given mean. As a consequence, we can relate existence of a mitochondrial Eve to quantitative demographic data of early mankind. In particular, we show that a mitochondrial Eve may exist even in an exponentially growing population, provided that the mean number of children per woman $\\overline N$ is constrained to a small range depending on the probability $p$ that a child is a female. Assuming that the value $p \\approx 0.488$ valid nowadays has remained fixed for thousands of generations, the range where a mitochondrial Eve occurs with sizeable p...
Analytic multi-Regge theory and the pomeron in QCD. 1
International Nuclear Information System (INIS)
White, A.R.
1991-01-01
This paper reports on the formalism of analytic multi-Regge theory developed as a basis for the study of abstract critical and super-critical pomeron high-energy behavior and for related studies of the Regge behavior of spontaneously broken gauge theories and the pomeron in QCD. Asymptotic domains of analyticity for multiparticle amplitudes are shown to follow from properties of field theory and S-matrix theory. General asymptotic dispersion relations are then derived for such amplitudes in which the spectral components are described by the graphical formalism of hexagraphs. Further consequences are distinct Sommerfeld-Watson representations for each hexagraph spectral component, together with a complete set of angular momentum plane unitarity equations which control the form of all multi-Regge amplitudes. Because of this constraint of reggeon unitarity the critical pomeron solution of the reggeon field theory gives the only known non-trivial unitary high-energy S-matrix. By exploiting the full structure of multi-Regge amplitudes as the pomeron becomes super-critical, one can study the simultaneous modification of hadrons and the pomeron. The result is a completely consistent description of the super-critical pomeron appearing in hadron scattering. Reggeon unitarity is satisfied in the super-critical phase by the appearance of a massive gluon (Reggeized vector particle) coupling pair-wise to the pomeron
International Nuclear Information System (INIS)
Curtiss, L.A.; Raghavachari, K.; Pople, J.A.
1995-01-01
The performance of Gaussian-2 theory is investigated when higher level theoretical methods are included for correlation effects, geometries, and zero-point energies. A higher level of correlation treatment is examined using Brueckner doubles [BD(T)] and coupled cluster [CCSD(T)] methods rather than quadratic configuration interaction [QCISD(T)]. The use of geometries optimized at the QCISD level rather than the second-order Moller--Plesset level (MP2) and the use of scaled MP2 zero-point energies rather than scaled Hartree--Fock (HF) zero-point energies have also been examined. The set of 125 energies used for validation of G2 theory [J. Chem. Phys. 94, 7221 (1991)] is used to test out these variations of G2 theory. Inclusion of higher levels of correlation treatment has little effect except in the cases of multiply-bonded systems. In these cases better agreement is obtained in some cases and poorer agreement in others so that there is no improvement in overall performance. The use of QCISD geometries yields significantly better agreement with experiment for several cases including the ionization potentials of CS and O 2 , electron affinity of CN, and dissociation energies of N 2 , O 2 , CN, and SO 2 . This leads to a slightly better agreement with experiment overall. The MP2 zero-point energies gives no overall improvement. These methods may be useful for specific systems
Watson, Caroline C; Griessenauer, Christoph J; Loukas, Marios; Blount, Jeffrey P; Tubbs, R Shane
2013-11-01
William Watson Cheyne lived and trained during a period of great advances in medical knowledge and surgical techniques. Despite his various contributions to the fields of bacteriology and surgery, little is known about his career or his life apart from his affiliations with Joseph Lister. This article aims to identify Cheyne as a pioneer in the treatment of congenital hydrocephalus and sheds light on the man who existed in Lister's shadow for most of his life. Cheyne's technique for surgical intervention of hydrocephalus was a great turning point and contributes to the current treatment strategy utilized today for hydrocephalus.
Srivastava, Ruby
2018-03-01
We study the binding of the neutral Ag n (n = 8, 10, 12) to the DNA base-adenine (A), guanine (G) and Watson-Crick -adenine-thymine, guanine-cytosine pairs. Geometries of complexes were optimized at the DFT level using the hybrid B3LYP functional. LANL2DZ effective core potential was used for silver and 6-31 + G ** was used for all other atoms. NBO charges were analyzed using the Natural population analysis. The absorption properties of Ag n -A,G/WC complexes were also studied using time-dependent density functional theory. The absorption spectra for these complexes show wavelength in the visible region. It was revealed that silver clusters interact more strongly with WC pairs than with isolated DNA complexes. Furthermore, it was found that the electronic charge transferred from silver to isolated DNA clusters are less than the electronic charge transferred from silver to the Ag n -WC complexes. The vertical ionization potential, vertical electron affinity, hardness, and electrophilicity index of Ag n -DNA/WC complexes have also been discussed.
Lignocellulosic composite (LC) panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS), pennycress (Thlaspi arvense L.) press cake (PPC) or lesquerella (Lesquerella fendleri A. Gary (S. Watson) press cake (L...
PENGEMBANGAN TES BERPIKIR KRITIS DENGAN PENDEKATAN ITEM RESPONSE THEORY
Directory of Open Access Journals (Sweden)
Fajrianthi Fajrianthi
2016-06-01
Full Text Available Penelitian ini bertujuan untuk menghasilkan sebuah alat ukur (tes berpikir kritis yang valid dan reliabel untuk digunakan, baik dalam lingkup pendidikan maupun kerja di Indonesia. Tahapan penelitian dilakukan berdasarkan tahap pengembangan tes menurut Hambleton dan Jones (1993. Kisi-kisi dan pembuatan butir didasarkan pada konsep dalam tes Watson-Glaser Critical Thinking Appraisal (WGCTA. Pada WGCTA, berpikir kritis terdiri dari lima dimensi yaitu Inference, Recognition Assumption, Deduction, Interpretation dan Evaluation of arguments. Uji coba tes dilakukan pada 1.453 peserta tes seleksi karyawan di Surabaya, Gresik, Tuban, Bojonegoro, Rembang. Data dikotomi dianalisis dengan menggunakan model IRT dengan dua parameter yaitu daya beda dan tingkat kesulitan butir. Analisis dilakukan dengan menggunakan program statistik Mplus versi 6.11 Sebelum melakukan analisis dengan IRT, dilakukan pengujian asumsi yaitu uji unidimensionalitas, independensi lokal dan Item Characteristic Curve (ICC. Hasil analisis terhadap 68 butir menghasilkan 15 butir dengan daya beda yang cukup baik dan tingkat kesulitan butir yang berkisar antara –4 sampai dengan 2.448. Sedikitnya jumlah butir yang berkualitas baik disebabkan oleh kelemahan dalam menentukan subject matter experts di bidang berpikir kritis dan pemilihan metode skoring. Kata kunci: Pengembangan tes, berpikir kritis, item response theory DEVELOPING CRITICAL THINKING TEST UTILISING ITEM RESPONSE THEORY Abstract The present study was aimed to develop a valid and reliable instrument in assesing critical thinking which can be implemented both in educational and work settings in Indonesia. Following the Hambleton and Jones’s (1993 procedures on test development, the study developed the instrument by employing the concept of critical thinking from Watson-Glaser Critical Thinking Appraisal (WGCTA. The study included five dimensions of critical thinking as adopted from the WGCTA: Inference, Recognition
Binding energies of sd-shell nuclei with a realistic effective Hamiltonian
International Nuclear Information System (INIS)
Dalton, B.J.; Vary, J.P.; Baldridge, W.J.
1977-01-01
The nuclear shell model with a second-order effective Hamiltonian derived within Brueckner theory from the free nucleon-nucleon interaction is shown to yield accurate binding energies of nuclei with 16 < A < 40. This agreement is obtained by choosing the spectrum of low-lying unoccupied orbitals in a justified manner and, when necessary, by employing a statistical method to approximate the lowest eigenvalue of very large shell-model diagonalizations
Directory of Open Access Journals (Sweden)
Kevin Possin
2014-12-01
Full Text Available The Watson-Glaser Critical Thinking Appraisal Test is one of the oldest, most frequently used, multiple-choice critical-thinking tests on the market in business, government, and legal settings for purposes of hiring and promotion. I demonstrate, however, that the test has serious construct-validity issues, stemming primarily from its ambiguous, unclear, misleading, and sometimes mysterious instructions, which have remained unaltered for decades. Erroneously scored items further diminish the test’s validity. As a result, having enhanced knowledge of formal and informal logic could well result in test subjects receiving lower scores on the test. That’s not how things should work for a CT assessment test.
Nuclear physics brought about by the π-mesons studied from field theory and experiments
International Nuclear Information System (INIS)
Toki, Hiroshi
2012-01-01
In nuclei π-mesons are playing key role. At first the important interactions of π-mesons in light nuclei is explained mentioning that the π-meson exchange force is tensor force. It is pointed out that the importance of π-meson is observed even in the deuterons. By the progress of computations it is possible at present to calculate nuclei up to the mass number of twelve. It is explained then how to handle the π-mesons in heavy nuclei referring to the discovery of the halo of 11 Li and its analysis. Due to the pseudo scalar properties of the π-mesons, tensor force is the strong nucleon-nucleon interaction. It has been necessary to go through numbers of trials and errors to arrive at the discovery of the proper tensor force analysis. It is shown to be possible to handle them in the Tensor-Optimized Shell Model (TOSM) based on the variation method. The explanation of the Extended Brueckner Hartree-Fock (EBHF) method obtained by combining the TOSM with the mean field theory used in the heavy nuclei is given. EBHF theory has the structure including high momentum components in the 2p2h wave functions. Calculated equation of state of symmetric nuclear matter is shown as a function of density in which important contribution of the tensor force is observed. Properties of nuclear matter are discussed. (S. Funahashi)
Brovarets', Ol'ha O; Hovorun, Dmytro M
2014-01-01
The ground-state tautomerization of the G·C Watson-Crick base pair by the double proton transfer (DPT) was comprehensively studied in vacuo and in the continuum with a low dielectric constant (ϵ = 4), corresponding to a hydrophobic interface of protein-nucleic acid interactions, using DFT and MP2 levels of quantum-mechanical (QM) theory and quantum theory "Atoms in molecules" (QTAIM). Based on the sweeps of the electron-topological, geometric, polar, and energetic parameters, which describe the course of the G·C ↔ G*·C* tautomerization (mutagenic tautomers of the G and C bases are marked with an asterisk) through the DPT along the intrinsic reaction coordinate (IRC), it was proved that it is, strictly speaking, a concerted asynchronous process both at the DFT and MP2 levels of theory, in which protons move with a small time gap in vacuum, while this time delay noticeably increases in the continuum with ϵ = 4. It was demonstrated using the conductor-like polarizable continuum model (CPCM) that the continuum with ϵ = 4 does not qualitatively affect the course of the tautomerization reaction. The DPT in the G·C Watson-Crick base pair occurs without any intermediates both in vacuum and in the continuum with ϵ = 4 at the DFT/MP2 levels of theory. The nine key points along the IRC of the G·C base pair tautomerization, which could be considered as electron-topological "fingerprints" of a concerted asynchronous process of the tautomerization via the DPT, have been identified and fully characterized. These key points have been used to define the reactant, transition state, and product regions of the DPT reaction in the G·C base pair. Analysis of the energetic characteristics of the H-bonds allows us to arrive at a definite conclusion that the middle N1H⋯N3/N3H⋯N1 and the lower N2H⋯O2/N2H⋯O2 parallel H-bonds in the G·C/G*·C* base pairs, respectively, are anticooperative, that is, the strengthening of the middle H-bond is accompanied
Fingerprints of Both Watson-Crick and Hoogsteen Isomers of the Isolated (Cytosine-Guanine)H+ Pair.
Cruz-Ortiz, Andrés F; Rossa, Maximiliano; Berthias, Francis; Berdakin, Matías; Maitre, Philippe; Pino, Gustavo A
2017-11-16
Gas phase protonated guanine-cytosine (CGH + ) pair was generated using an electrospray ionization source from solutions at two different pH (5.8 and 3.2). Consistent evidence from MS/MS fragmentation patterns and differential ion mobility spectra (DIMS) point toward the presence of two isomers of the CGH + pair, whose relative populations depend strongly on the pH of the solution. Gas phase infrared multiphoton dissociation (IRMPD) spectroscopy in the 900-1900 cm -1 spectral range further confirms that the Watson-Crick isomer is preferentially produced (91%) at pH = 5.8, while the Hoogsteen isomer predominates (66%) at pH = 3.2). These fingerprint signatures are expected to be useful for the development of new analytical methodologies and to trigger isomer selective photochemical studies of protonated DNA base pairs.
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
In this study, we have theoretically demonstrated the intrinsic ability of the wobble G·T(w)/G*·T*(w)/G·T(w1)/G·T(w2) and Watson-Crick-like G*·T(WC) DNA base mispairs to interconvert into each other via the DPT tautomerization. We have established that among all these transitions, only one single G·T(w) ↔ G*·T(WC) pathway is eligible from a biological perspective. It involves short-lived intermediate - the G·T*(WC) base mispair - and is governed by the planar, highly stable, and zwitterionic [Formula: see text] transition state stabilized by the participation of the unique pattern of the five intermolecular O6(+)H⋯O4(-), O6(+)H⋯N3(-), N1(+)H⋯N3(-), N1(+)H⋯O2(-), and N2(+)H⋯O2(-) H-bonds. This non-dissociative G·T(w) ↔ G*·T(WC) tautomerization occurs without opening of the pair: Bases within mispair remain connected by 14 different patterns of the specific intermolecular interactions that successively change each other along the IRC. Novel kinetically controlled mechanism of the thermodynamically non-equilibrium spontaneous point GT/TG incorporation errors has been suggested. The mutagenic effect of the analogues of the nucleotide bases, in particular 5-bromouracil, can be attributed to the decreasing of the barrier of the acquisition by the wobble pair containing these compounds of the enzymatically competent Watson-Crick's geometry via the intrapair mutagenic tautomerization directly in the essentially hydrophobic recognition pocket of the replication DNA-polymerase machinery. Proposed approaches are able to explain experimental data, namely growth of the rate of the spontaneous point incorporation errors during DNA biosynthesis with increasing temperature.
Directory of Open Access Journals (Sweden)
Susilawati Susilawati
2016-06-01
Full Text Available Studi ini bertujuan untuk menganalisa dan mengklasifikasi kesalahan siswa dalam menyelesaikan permasalahan peluang. Subjek studi ini adalah 38 siswa dari kelas X MIA 3 di SMA Negeri 1 Tanjungpinang. Instrumen yang digunakan adalah tes tertulis yang memuat 5 butir soal uraian yang disusun dan divalidasi bersama oleh peneliti dan guru matematika kelas X MIA 3. Kesalahan yang dianalisis dikategorikan dengan menggunakan kategori kesalahan Watson diantaranya data tidak tepat (inappropriate data/id, prosedur tidak tepat (inappropriate procedure/ip, data hilang (ommited data/od, kesimpulan hilang (ommited conclusion/oc, konflik level respon (response level conflict/rlc, manipulasi tidak langsung (undirected manipulation/um, masalah hierarki keterampilan (skills hierarchy problem/shp, dan jenis kesalahan lain dalam kategori terakhir. Hasil analisis kesalahan menunjukkan persentase data tidak tepat sebesar 14,43 %, prosedur tidak tepat sebesar 12,08 %, data hilang sebesar 19,13%, kesimpulan hilang sebesar 21,14%, konflik level respon sebesar 1,34 %, manipulasi tidak langsung sebesar 12,75 %, serta persentase masalah hirarki keterampilan sebesar 19,13 %. Kata Kunci: Peluang, Kesalahan Siswa, Kategori Kesalahan Menurut Watson DOI: http://dx.doi.org/10.22342/jpm.10.2.3630.39-52
STRUCTURES OF THE VELA PULSAR AND THE GLITCH CRISIS FROM THE BRUECKNER THEORY
International Nuclear Information System (INIS)
Li, A.; Dong, J. M.; Wang, J. B.; Xu, R. X.
2016-01-01
Detailed structures of the Vela pulsar (PSR B0833-45, with a period of 89.33 ms) are predicted by adopting a recently constructed unified treatment of all parts of neutron stars: the outer crust, the inner crust, and the core based on modern microscopic Brueckner–Hartree–Fock calculations. Taking a pulsar mass in the range from 1.0 to 2.0 M ⊙ , we calculate the central density, the core/crust radii, the core/crustal mass, the core/crustal thickness, the moment of inertia, and the crustal moment of inertia. Among them, the crustal moment of inertia could be effectively constrained from the accumulated glitch observations, which has been a great debate recently, known as the “glitch crisis.” Namely, superfluid neutrons contained in the inner crust, which are regarded as the origin of the glitch in the standard two-component model, could be largely entrained in the nuclei lattices, and then there may not be enough superfluid neutrons (∼4/5 less than the previous value) to trigger the large glitches (Δν/ν 0 ∼ 10 −6 ) in the Vela pulsar. By confronting the glitch observations with the theoretical calculations for the crustal moment of inertia, we find that despite some recent opposition to the crisis argument, the glitch crisis is still present, which means that besides the crustal superfluid neutrons, core neutrons might be necessary for explaining the large glitches of the Vela pulsar
STRUCTURES OF THE VELA PULSAR AND THE GLITCH CRISIS FROM THE BRUECKNER THEORY
Energy Technology Data Exchange (ETDEWEB)
Li, A. [Department of Astronomy, Xiamen University, Xiamen, Fujian 361005 (China); Dong, J. M. [Institute of Modern Physics, Chinese Academy of Sciences, Lanzhou 730000 (China); Wang, J. B. [Xinjiang Astronomical Observatory, Chinese Academy of Sciences, Urumqi, Xinjiang 830011 (China); Xu, R. X., E-mail: liang@xmu.edu.cn [School of Physics and State Key Laboratory of Nuclear Physics and Technology, Peking University, Beijing 100871 (China)
2016-03-15
Detailed structures of the Vela pulsar (PSR B0833-45, with a period of 89.33 ms) are predicted by adopting a recently constructed unified treatment of all parts of neutron stars: the outer crust, the inner crust, and the core based on modern microscopic Brueckner–Hartree–Fock calculations. Taking a pulsar mass in the range from 1.0 to 2.0 M{sub ⊙}, we calculate the central density, the core/crust radii, the core/crustal mass, the core/crustal thickness, the moment of inertia, and the crustal moment of inertia. Among them, the crustal moment of inertia could be effectively constrained from the accumulated glitch observations, which has been a great debate recently, known as the “glitch crisis.” Namely, superfluid neutrons contained in the inner crust, which are regarded as the origin of the glitch in the standard two-component model, could be largely entrained in the nuclei lattices, and then there may not be enough superfluid neutrons (∼4/5 less than the previous value) to trigger the large glitches (Δν/ν{sub 0} ∼ 10{sup −6}) in the Vela pulsar. By confronting the glitch observations with the theoretical calculations for the crustal moment of inertia, we find that despite some recent opposition to the crisis argument, the glitch crisis is still present, which means that besides the crustal superfluid neutrons, core neutrons might be necessary for explaining the large glitches of the Vela pulsar.
Principle-based concept analysis: intentionality in holistic nursing theories.
Aghebati, Nahid; Mohammadi, Eesa; Ahmadi, Fazlollah; Noaparast, Khosrow Bagheri
2015-03-01
This is a report of a principle-based concept analysis of intentionality in holistic nursing theories. A principle-based concept analysis method was used to analyze seven holistic theories. The data included eight books and 31 articles (1998-2011), which were retrieved through MEDLINE and CINAHL. Erickson, Kriger, Parse, Watson, and Zahourek define intentionality as a capacity, a focused consciousness, and a pattern of human being. Rogers and Newman do not explicitly mention intentionality; however, they do explain pattern and consciousness (epistemology). Intentionality has been operationalized as a core concept of nurse-client relationships (pragmatic). The theories are consistent on intentionality as a noun and as an attribute of the person-intentionality is different from intent and intention (linguistic). There is ambiguity concerning the boundaries between intentionality and consciousness (logic). Theoretically, intentionality is an evolutionary capacity to integrate human awareness and experience. Because intentionality is an individualized concept, we introduced it as "a matrix of continuous known changes" that emerges in two forms: as a capacity of human being and as a capacity of transpersonal caring. This study has produced a theoretical definition of intentionality and provides a foundation for future research to further investigate intentionality to better delineate its boundaries. © The Author(s) 2014.
Battersby, Thomas R; Albalos, Maria; Friesenhahn, Michel J
2007-05-01
Nucleic acid duplexes associating through purine-purine base pairing have been constructed and characterized in a remarkable demonstration of nucleic acids with mixed sequence and a natural backbone in an alternative duplex structure. The antiparallel deoxyribose all-purine duplexes associate specifically through Watson-Crick pairing, violating the nucleobase size-complementarity pairing convention found in Nature. Sequence-specific recognition displayed by these structures makes the duplexes suitable, in principle, for information storage and replication fundamental to molecular evolution in all living organisms. All-purine duplexes can be formed through association of purines found in natural ribonucleosides. Key to the formation of these duplexes is the N(3)-H tautomer of isoguanine, preferred in the duplex, but not in aqueous solution. The duplexes have relevance to evolution of the modern genetic code and can be used for molecular recognition of natural nucleic acids.
End of the Line? Paul Watson and the Future of the Sea Shepherd Conservation Society
Directory of Open Access Journals (Sweden)
Gerry Joseph Nagtzaam
2014-03-01
Full Text Available This paper critically examines the Sea Shepherd Conservation Society (‘SSCS’ and the legal challenges they are currently facing to continue its self-appointed role to protect oceanic life through direct action. In Part One, the article examines the history of this radical environmental group and; the role performed by its charismatic leader Paul Watson; it’s organisational structure and its strategies and tactics; its governing philosophy and its attitudes to violence. Part Two provides a history of the various direct actions carried out by the group; it further examines the organisation’s ongoing confrontations with the Japanese whaling fleet; documents the current legal travails the group and its leader are experiencing; and lastly asks what impact these issues will have on the group’s viability as a direct action group going forward.
LEOPARD syndrome is not linked to the Marfan syndrome and the Watson syndrome loci
Energy Technology Data Exchange (ETDEWEB)
Rass-Rothchild, A.: Abeliovitch, D.; Kornstein, A. [Tel Aviv Univ. (Israel)]|[Hebrew Univ., Jerusalem (Israel)
1994-09-01
The acronym LEOPARD stands for a syndromic association of Lentigines, Eletrocardiographic changes, Ocular hypertelorism, Pulmonic stenosis, Abnormal genitalia, Retardation of growth and sensorineural Deafness. Inheritance is autosomal dominant with high penetrance and variable expressivity. In 1990 Torok et al. reported on the association of LEOPARD and Marfan syndrome. In addition a clinical similarity (cardiac and cutaneous involvement) exists with the Watson syndrome (neurofibromatosis and pulmonic stenosis) which is linked to the marker D17S33 on chromosome 17. We studied possible linkage of LEOPARD syndrome to the Marfan syndrome locus on chromosome 15 (D15S1, MF13, and (TAAAA)n repeats) and to the NF-1 locus on chromosome 17 in a family with 9 cases of LEOPARD syndrome. Close linkage between LEOPARD syndrome and both the Marfan locus on chromosome 15 and the NF-1 locus on chromosome 17 was excluded (lod score <-2.0 through {theta} = 0.1).
Proton tunneling in the A∙T Watson-Crick DNA base pair: myth or reality?
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
The results and conclusions reached by Godbeer et al. in their recent work, that proton tunneling in the A∙T(WC) Watson-Crick (WC) DNA base pair occurs according to the Löwdin's (L) model, but with a small (~10(-9)) probability were critically analyzed. Here, it was shown that this finding overestimates the possibility of the proton tunneling at the A∙T(WC)↔A*∙T*(L) tautomerization, because this process cannot be implemented as a chemical reaction. Furthermore, it was outlined those biologically important nucleobase mispairs (A∙A*↔A*∙A, G∙G*↔G*∙G, T∙T*↔T*∙T, C∙C*↔C*∙C, H∙H*↔H*∙H (H - hypoxanthine)) - the players in the field of the spontaneous point mutagenesis - where the tunneling of protons is expected and for which the application of the model proposed by Godbeer et al. can be productive.
Watson-Crick Base Pair Radical Cation as a Model for Oxidative Damage in DNA.
Feketeová, Linda; Chan, Bun; Khairallah, George N; Steinmetz, Vincent; Maitre, Philippe; Radom, Leo; O'Hair, Richard A J
2017-07-06
The deleterious cellular effects of ionizing radiation are well-known, but the mechanisms causing DNA damage are poorly understood. The accepted molecular events involve initial oxidation and deprotonation at guanine sites, triggering hydrogen atom abstraction reactions from the sugar moieties, causing DNA strand breaks. Probing the chemistry of the initially formed radical cation has been challenging. Here, we generate, spectroscopically characterize, and examine the reactivity of the Watson-Crick nucleobase pair radical cation in the gas phase. We observe rich chemistry, including proton transfer between the bases and propagation of the radical site in deoxyguanosine from the base to the sugar, thus rupturing the sugar. This first example of a gas-phase model system providing molecular-level details on the chemistry of an ionized DNA base pair paves the way toward a more complete understanding of molecular processes induced by radiation. It also highlights the role of radical propagation in chemistry, biology, and nanotechnology.
Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules
Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David
2003-01-01
We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778
Patahuddin, Sitti Maesuri; Puteri, Indira; Lowrie, Tom; Logan, Tracy; Rika, Baiq
2018-04-01
This study examined student mathematical engagement through the intended and enacted lessons taught by two teachers in two different middle schools in Indonesia. The intended lesson was developed using the ELPSA learning design to promote mathematical engagement. Based on the premise that students will react to the mathematical tasks in the forms of words and actions, the analysis focused on identifying the types of mathematical engagement promoted through the intended lesson and performed by students during the lesson. Using modified Watson's analytical tool (2007), students' engagement was captured from what the participants' did or said mathematically. We found that teachers' enacted practices had an influence on student mathematical engagement. The teacher who demonstrated content in explicit ways tended to limit the richness of the engagement; whereas the teacher who presented activities in an open-ended manner fostered engagement.
Brovarets', Ol'ha O; Voiteshenko, Ivan S; Hovorun, Dmytro M
2017-12-20
This study is intended to clarify in detail the tautomeric transformations of the wobble (w) G*·2AP(w) and A·2AP(w) nucleobase mispairs involving 2-aminopurine (2AP) into the Watson-Crick (WC) G·2AP(WC) and A*·2AP(WC) base mispairs (asterisks denote mutagenic tautomers of the DNA bases), respectively, by quantum-mechanical methods and Bader's Quantum Theory of Atoms in Molecules. Our previously reported methodology has been used, which allows the evolution of the physico-chemical parameters to be tracked along the entire internal reaction coordinate (IRC), not exclusively in the stationary states of these reactions. These biologically important G*·2AP(w) ↔ G·2AP(WC) and A·2AP(w) ↔ A*·2AP(WC) w ↔ WC tautomerisations, which are involved in mutagenic tautomerically-conformational pathways, determine the origin of the transitions and transversions induced by 2AP. In addition, it is established that they proceed through planar, highly stable, zwitterionic transition states and they exhibit similar physico-chemical profiles and stages of sequential intrapair proton transfer, followed by spatial rearrangement of the nucleobases relative to each other within the base pairs. These w ↔ WC tautomerisations occur non-dissociatively and are accompanied by a significant alteration in geometry (from wobble to Watson-Crick and vice versa) and redistribution of the specific intermolecular interactions, which can be divided into 10 patterns including AHB H-bonds and loosened A-H-B covalent bridges along the IRC of tautomerisation. Based on the redistribution of the geometrical and electron-topological parameters of the intrapair hydrogen bonds, exactly 9 key points have been allocated to characterize the evolution of these reactions.
Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints
Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.
2015-01-01
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536
Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G
2015-05-14
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.
Chakraborty, Debayan; Wales, David J
2018-01-04
The recent discovery that Hoogsteen (HG) base pairs are widespread in DNA across diverse sequences and positional contexts could have important implications for understanding DNA replication and DNA-protein recognition. While evidence is emerging that the Hoogsteen conformation could be a thermodynamically accessible conformation of the DNA duplex and provide a means to expand its functionality, relatively little is known about the molecular mechanism underlying the Watson-Crick (WC) to HG transition. In this Perspective, we describe pathways and kinetics for this transition at an atomic level of detail, using the energy landscape perspective. We show that competition between the duplex conformations results in a double funnel landscape, which explains some recent experimental observations. The interconversion pathways feature a number of intermediates, with a variable number of WC and HG base pairs. The relatively slow kinetics, with possible deviations from two-state behavior, suggest that this conformational switch is likely to be a challenging target for both simulation and experiment.
Single-stranded γPNAs for in vivo site-specific genome editing via Watson-Crick recognition.
Bahal, Raman; Quijano, Elias; McNeer, Nicole A; Liu, Yanfeng; Bhunia, Dinesh C; Lopez-Giraldez, Francesco; Fields, Rachel J; Saltzman, William M; Ly, Danith H; Glazer, Peter M
2014-01-01
Triplex-forming peptide nucleic acids (PNAs) facilitate gene editing by stimulating recombination of donor DNAs within genomic DNA via site-specific formation of altered helical structures that further stimulate DNA repair. However, PNAs designed for triplex formation are sequence restricted to homopurine sites. Herein we describe a novel strategy where next generation single-stranded gamma PNAs (γPNAs) containing miniPEG substitutions at the gamma position can target genomic DNA in mouse bone marrow at mixed-sequence sites to induce targeted gene editing. In addition to enhanced binding, γPNAs confer increased solubility and improved formulation into poly(lactic-co-glycolic acid) (PLGA) nanoparticles for efficient intracellular delivery. Single-stranded γPNAs induce targeted gene editing at frequencies of 0.8% in mouse bone marrow cells treated ex vivo and 0.1% in vivo via IV injection, without detectable toxicity. These results suggest that γPNAs may provide a new tool for induced gene editing based on Watson-Crick recognition without sequence restriction.
Benchmark studies on the building blocks of DNA. 3. Watson-Crick and stacked base pairs.
Szalay, Péter G; Watson, Thomas; Perera, Ajith; Lotrich, Victor; Bartlett, Rodney J
2013-04-18
Excited states of stacked adenine-thymine and guanine-cytosine pairs as well as the Watson-Crick pair of guanine-thymine have been investigated using the equation of motion coupled-cluster (EOM-CC) method with single and double as well as approximate triple excitations. Transitions have been assigned, and the form of the excitations has been analyzed. The majority of the excitations could be classified as localized on the nucleobases, but for all three studied systems, charge-transfer (CT) transitions could also be identified. The main aim of this study was to compare the performance of lower-level methods (ADC(2) and TDDFT) to the high-level EOM-CC ones. It was shown that both ADC(2) and TDDFT with long-range correction have nonsystematic error in excitation energies, causing alternation of the energetic ordering of the excitations. Considering the high costs of the EOM-CC calculations, there is a need for reliable new approximate methods.
Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints
Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.
2015-05-01
Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.
International Nuclear Information System (INIS)
Topping, R.J.; Stone, M.P.; Brush, C.K.; Harris, T.M.
1988-01-01
The 1 H NMR spectrum of the tetradeoxynucleotide d(TpCpGpA) was examined as a function of temperature, pH, and concentration. At pH 7 and above the solution conformation for this oligodeoxynucleotide appears to be a mixture of random coil and Watson-Crick duplex. At 25 degree C, a pH titration of d(TpCpGaA) shown that distinct conformational changes occur as the pH is lowered below 7.0. These conformational changes are reversible upon readjusting the pH to neutrality, indicating the presence of a pH-dependent set of conformational equilibria. At 25 degree C, the various conformational state in the mixture are in rapid exchange on the NMR time scale. Examination of the titration curve shown the presence of distinct conformational states at pH greater than 7, and between pH 4 and pH 5. When the pH titration is repeated at 5 degree C, the conformational equilibria are in slow exchange on the NMR time scale; distinct signals from each conformational state are observable. The stable conformational state present between pH 4 and pH 5 represents an ordered conformation of d(TpCpGpA) which dissociates to a less ordered structure upon raising the temperature. The ordered conformation differs from the Watson-Crick helix, as is shown from nuclear Overhauser enhancement experiments, as well as chemical shift data. These results indicate that their ordered conformation is similar to the conformation of d(TpCpGpA) observed between pH 4 and pH 5. In the present case it is likely that stabilization of an ordered duplex conformation for d(TpCpGpA) is achieved by protonation of cytosine. A possible model which could explain the data involves formation of Hoogsteen C + :G base pairs
International Nuclear Information System (INIS)
Mazurkiewicz, Kamil; Haranczyk, Maciej; Gutowski, Maciej S.; Rak, Janusz
2007-01-01
The electron affinity and the propensity to electron-induced proton transfer (PT) of hydrogen-bonded complexes between the Watson-Crick adenine-thymine pair (AT) and simple organic acid (HX), attached to adenine in the Hoogsteen-type configuration, were studied at the B3LYP/6-31+G** level. Although the carboxyl group is deprotonated at physiological pH, its neutral form, COOH, resembles the peptide bond or the amide fragment in the side chain of asparagine (Asn) or glutamine (Gln). Thus, these complexes mimic the interaction between the DNA environment (e.g., proteins) and nucleobase pairs incorporated in the biopolymer. Electron attachment is thermodynamically feasible and adiabatic electron affinities range from 0.41 to 1.28 eV, while the vertical detachment energies of the resulting anions span the range of 0.39-2.88 eV. Low-energy activation barriers separate the anionic minima: aHX(AT) from the more stable single-PT anionic geometry, aHX(AT)-SPT, and aHX(AT)-SPT from the double-PT anionic geometry, aHX(AT)-DPT. Interaction between the adenine of the Watson-Crick AT base pair with an acidic proton donor probably counterbalances the larger EA of isolated thymine, as SOMO is almost evenly delocalized over both types of nucleic bases in the aHX(AT) anions. Moreover, as a result of PT the excess electron localizes entirely on adenine. Thus, in DNA interacting with its physiological environment, damage induced by low-energy electrons could begin, contrary to the current view, with the formation of purine anions, which are not formed in isolated DNA because of the greater stability of anionic pyrimidines.
Observation of H-bond mediated 3hJH2H3coupling constants across Watson-Crick AU base pairs in RNA
International Nuclear Information System (INIS)
Luy, Burkhard; Richter, Uwe; DeJong, Eric S.; Sorensen, Ole W.; Marino, John P.
2002-01-01
3h J H2H3 trans-hydrogen bond scalar coupling constants have been observed for the first time in Watson-Crick AU base pairs in uniformly 15 N-labeled RNA oligonucleotides using a new 2h J NN -HNN-E. COSY experiment. The experiment utilizes adenosine H2 (AH2) for original polarization and detection, while employing 2h J NN couplings for coherence transfer across the hydrogen bonds (H-bonds). The H3 protons of uracil bases are unperturbed throughout the experiment so that these protons appear as passive spins in E. COSY patterns. 3h J H2H3 coupling constants can therefore be accurately measured in the acquisition dimension from the displacement of the E. COSY multiplet components, which are separated by the relatively large 1 J H3N3 coupling constants in the indirect dimension of the two-dimensional experiment. The 3h J H2H3 scalar coupling constants determined for AU base pairs in the two RNA hairpins examined here have been found to be positive and range in magnitude up to 1.8 Hz. Using a molecular fragment representation of an AU base pair, density functional theory/finite field perturbation theory (DFT/FPT) methods have been applied to attempt to predict the relative contributions of H-bond length and angular geometry to the magnitude of 3h J H2H3 coupling constants. Although the DFT/FPT calculations did not reproduce the full range of magnitude observed experimentally for the 3h J H2H3 coupling constants, the calculations do predict the correct sign and general trends in variation in size of these coupling constants. The calculations suggest that the magnitude of the coupling constants depends largely on H-bond length, but can also vary with differences in base pair geometry. The dependency of the 3h J H2H3 coupling constant on H-bond strength and geometry makes it a new probe for defining base pairs in NMR studies of nucleic acids
Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo
2009-11-23
Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.
Long-Range Vibrational Dynamics Are Directed by Watson-Crick Base Pairing in Duplex DNA.
Hithell, Gordon; Shaw, Daniel J; Donaldson, Paul M; Greetham, Gregory M; Towrie, Michael; Burley, Glenn A; Parker, Anthony W; Hunt, Neil T
2016-05-05
Ultrafast two-dimensional infrared (2D-IR) spectroscopy of a 15-mer A-T DNA duplex in solution has revealed structure-dependent vibrational coupling and energy transfer processes linking bases with the sugar-phosphate backbone. Duplex melting induces significant changes in the positions of off-diagonal peaks linking carbonyl and ring-stretching vibrational modes of the adenine and thymine bases with vibrations of the phosphate group and phosphodiester linkage. These indicate that Watson-Crick hydrogen bonding and helix formation lead to a unique vibrational coupling arrangement of base vibrational modes with those of the phosphate unit. On the basis of observations from time-resolved 2D-IR data, we conclude that rapid energy transfer processes occur between base and backbone, mediated by additional modes located on the deoxyribose moiety within the same nucleotide. These relaxation dynamics are insensitive to duplex melting, showing that efficient intramolecular energy relaxation to the solvent via the phosphate groups is the key to excess energy dissipation in both single- and double-stranded DNA.
Determining the Walker exponent and developing a modified Smith-Watson-Topper parameter model
Energy Technology Data Exchange (ETDEWEB)
Lv, Zhiqiang; Huang, Hong Zhong; Wang, Hai Kun; Gao, Huiying; Zuo, Fang Jun [University of Electronic Science and Technology of China, Chengdu (China)
2016-03-15
Mean stress effects significantly influence the fatigue life of components. In general, tensile mean stresses are known to reduce the fatigue life of components, whereas compressive mean stresses are known to increase it. To date, various methods that account for mean stress effects have been studied. In this research, considering the high accuracy of mean stress correction and the difficulty in obtaining the material parameter of the Walker method, a practical method is proposed to describe the material parameter of this method. The test data of various materials are then used to verify the proposed practical method. Furthermore, by applying the Walker material parameter and the Smith-Watson-Topper (SWT) parameter, a modified strain-life model is developed to consider sensitivity to mean stress of materials. In addition, three sets of experimental fatigue data from super alloy GH4133, aluminum alloy 7075-T651, and carbon steel are used to estimate the accuracy of the proposed model. A comparison is also made between the SWT parameter method and the proposed strainlife model. The proposed strain-life model provides more accurate life prediction results than the SWT parameter method.
Large-angle theory for pion-nucleus scattering at high energies
International Nuclear Information System (INIS)
Hoock, D.W. Jr.
1978-01-01
An approximate solution for high-energy, projectile-nucleus, multiple scattering is developed from the exact Watson series and applied to pion scattering for 12 C and 4 He. Agreement with measured differential cross sections available from the literature for the range 150 to 260 MeV pion laboratory energies is surprisingly good. The approximation method expands the propagators of the Watson series about the transverse component of the momentum transfer. Contributions of each of the first two terms to double scattering from a Gaussian potential are compared to the exact solution. The purely plane-wave propagation produces a scattering amplitude that agrees to order (k 0 a) -1 with the exact solution at the forward and backward directions at high energies. The second (off-axis) propagation term produces an amplitude that is one order smaller at forward angles and two orders smaller at 180 0 than the exact amplitude. At intermediate angles it is of the same order. The general multiple-scattering series is approximated with selection of plane-wave propagation as the fundamental process at large and small angles. This model suggests that a single nucleon accepts most of the momentum transfer for backward scattering. The resulting multiple-scattering formula agrees with the well-known high-energy eikonal theory at small angles and the backward-angle scattering formula of Chen at exactly 180 0 . A lowest-order formula that includes off-axis propagation is also derived. Predicted differential cross sections are found to be sensitive to nucleon motion and binding. For 4 He the effect of the nuclear potential on the pion kinetic energy is also examined and found to produce significant changes in the predicted cross sections
Comparison of approximate methods for multiple scattering in high-energy collisions. II
International Nuclear Information System (INIS)
Nolan, A.M.; Tobocman, W.; Werby, M.F.
1976-01-01
The scattering in one dimension of a particle by a target of N like particles in a bound state has been studied. The exact result for the transmission probability has been compared with the predictions of the Glauber theory, the Watson optical potential model, and the adiabatic (or fixed scatterer) approximation. The approximate methods optical potential model is second best. The Watson method is found to work better when the kinematics suggested by Foldy and Walecka are used rather than that suggested by Watson, that is to say, when the two-body of the nucleon-nucleon reduced mass
Directory of Open Access Journals (Sweden)
Gonzalo Martínez Fernández
2016-01-01
Conclusiones: Existen diferencias en el V de los pacientes de una unidad de DP según sea calculado por fórmula de Watson o por BIS. La presencia de hipertensión, diabetes, hipoalbuminemia, obesidad, malnutrición, inflamación, E/I ratio ≥1 y la ausencia de diuresis residual se asocia con la aparición de estas diferencias.
Quasiparticle interaction in nuclear matter
International Nuclear Information System (INIS)
Poggioli, R.S.; Jackson, A.D.
1975-07-01
A microscopic calculation of the quasiparticle interaction in nuclear matter is detailed. In order to take especial care of the contributions from the low momentum states, a model space is introduced. Excluded from the model space, the high momentum states are absorbed into the model interaction. Brueckner theory suggests the choice of a truncated G-matrix as a good approximation for this model interaction. A simple perturbative approach is attempted within the model space. The calculated quasiparticle interaction is consistent with experimental results. (11 tables, 14 figures)
Millen, Andrea L; Churchill, Cassandra D M; Manderville, Richard A; Wetmore, Stacey D
2010-10-14
Bulky DNA addition products (adducts) formed through attack at the C8 site of guanine can adopt the syn orientation about the glycosidic bond due to changes in conformational stability or hydrogen-bonding preferences directly arising from the bulky group. Indeed, the bulky substituent may improve the stability of (non-native) Hoogsteen pairs. Therefore, such adducts often result in mutations upon DNA replication. This work examines the hydrogen-bonded pairs between the Watson-Crick and Hoogsteen faces of the ortho or para C8-phenoxyl-2'-deoxyguanosine adduct and each natural (undamaged) nucleobase with the goal to clarify the conformational preference of this type of damage, as well as provide insight into the likelihood of subsequent mutation events. B3LYP/6-311+G(2df,p)//B3LYP/6-31G(d) hydrogen-bond strengths were determined using both nucleobase and nucleoside models for adduct pairs, as well as the corresponding complexes involving natural 2'-deoxyguanosine. In addition to the magnitude of the binding strengths, the R(C1'···C1') distances and ∠(N9C1'C1') angles, as well as the degree of propeller-twist and buckle distortions, were carefully compared to the values observed in natural DNA strands. Due to structural changes in the adduct monomer upon inclusion of the sugar moiety, the monomer deformation energy significantly affects the relative hydrogen-bond strengths calculated with the nucleobase and nucleoside models. Therefore, we recommend the use of at least a nucleoside model to accurately evaluate hydrogen-bond strengths of base pairs involving flexible, bulky nucleobase adducts. Our results also emphasize the importance of considering both the magnitude of the hydrogen-bond strength and the structure of the base pair when predicting the preferential binding patterns of nucleobases. Using our best models, we conclude that the Watson-Crick face of the ortho phenoxyl adduct forms significantly more stable complexes than the Hoogsteen face, which
Effect of electronic coupling of Watson-Crick hopping in DNA poly(dA)-poly(dT)
Risqi, A. M.; Yudiarsah, E.
2017-07-01
Charge transport properties of poly(dA)-poly(dT) DNA has been studied by using thigh binding Hamiltonian approach. Molecule DNA that we use consist of 32 base pair of adenine (A) and thymine (T) and backbone is consist of phosphate and sugar. The molecule DNA is contacted electrode at both ends. Charge transport in molecule DNA depend on the environment, we studied the effect of electronic coupling of Watson-Crick hopping in poly(dA)-poly(dT) DNA to transmission probability and characteristic I-V. The electronic coupling constant influence charge transport between adenine-thymine base pairs at the same site. Transmission probability is studied by using transfer matrix and scattering matrix method, and the result of transmission probability is used to calculate the characteristic I-V by using formula Landauer Buttiker. The result shows that when the electronic coupling increase then transmission probability and characteristic I-V increase slightly.
Magnetized plasma kinetic theory
International Nuclear Information System (INIS)
Hassan, M.H.A.; Watson, C.J.H.
1977-01-01
The magnetized Balescu-Lenard Collision integral for a multi-species plasma in the form derived by Hassan and Watson (1976) is approximated by ignoring wave effects. The resulting collision integral is put in Fokker-Planck form and most of the integrals occurring in the coefficients are performed analytically. The remaining integral is evaluated approximately in various limits for ion-electron, electron-electron and electron-ion interactions. (author)
Yang, Haozhe; Mei, Hui; Seela, Frank
2015-07-06
Reverse Watson-Crick DNA with parallel-strand orientation (ps DNA) has been constructed. Pyrrolo-dC (PyrdC) nucleosides with phenyl and pyridinyl residues linked to the 6 position of the pyrrolo[2,3-d]pyrimidine base have been incorporated in 12- and 25-mer oligonucleotide duplexes and utilized as silver-ion binding sites. Thermal-stability studies on the parallel DNA strands demonstrated extremely strong silver-ion binding and strongly enhanced duplex stability. Stoichiometric UV and fluorescence titration experiments verified that a single (2py) PyrdC-(2py) PyrdC pair captures two silver ions in ps DNA. A structure for the PyrdC silver-ion base pair that aligns 7-deazapurine bases head-to-tail instead of head-to-head, as suggested for canonical DNA, is proposed. The silver DNA double helix represents the first example of a ps DNA structure built up of bidentate and tridentate reverse Watson-Crick base pairs stabilized by a dinuclear silver-mediated PyrdC pair. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Santamaría-Díaz, Noelia; Méndez-Arriaga, José M; Salas, Juan M; Galindo, Miguel A
2016-05-17
The oligonucleotide d(TX)9 , which consists of an octadecamer sequence with alternating non-canonical 7-deazaadenine (X) and canonical thymine (T) as the nucleobases, was synthesized and shown to hybridize into double-stranded DNA through the formation of hydrogen-bonded Watson-Crick base pairs. dsDNA with metal-mediated base pairs was then obtained by selectively replacing W-C hydrogen bonds by coordination bonds to central silver(I) ions. The oligonucleotide I adopts a duplex structure in the absence of Ag(+) ions, and its stability is significantly enhanced in the presence of Ag(+) ions while its double-helix structure is retained. Temperature-dependent UV spectroscopy, circular dichroism spectroscopy, and ESI mass spectrometry were used to confirm the selective formation of the silver(I)-mediated base pairs. This strategy could become useful for preparing stable metallo-DNA-based nanostructures. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Short history of nuclear many-body problem
International Nuclear Information System (INIS)
Köhler, H.S.
2014-01-01
This is a very short presentation regarding developments in the theory of nuclear many-body problems, as seen and experienced by the author during the past 60 years with particular emphasis on the contributions of Gerry Brown and his research-group. Much of his work was based on Brueckner's formulation of the nuclear many-body problem. It is reviewed briefly together with the Moszkowski–Scott separation method that was an important part of his early work. The core polarisation and his work related to effective interactions in general are also addressed
Shternin, P. S.; Baldo, M.; Schulze, H.-J.
2017-12-01
Thermal conductivity and shear viscosity of npeµ matter in non-superfluid neutron star cores are considered in the framework of Brueckner-Hartree-Fock many-body theory. We extend our previous work (Shternin et al 2013 PRC 88 065803) by analysing different nucleon-nucleon potentials and different three-body forces. We find that the use of different potentials leads up to one order of magnitude variations in the values of the nucleon contribution to transport coefficients. The nucleon contribution dominates the thermal conductivity, but for all considered models the shear viscosity is dominated by leptons.
Neutron Star masses from the Field Correlator Method Equation of State
Directory of Open Access Journals (Sweden)
Zappalà D.
2014-04-01
Full Text Available We analyse the hadron-quark phase transition in neutron stars by confronting the hadronic Equation of State (EoS obtained according to the microscopic Brueckner-Hartree-Fock many body theory, with the quark matter EoS derived within the Field Correlator Method. In particular, the latter EoS is only parametrized in terms of the gluon condensate and the large distance quark-antiquark potential, so that the comparison of the results of this analysis with the most recent measurements of heavy neutron star masses provides some physical constraints on these two parameters.
Directory of Open Access Journals (Sweden)
Gabriele Guidi
2016-07-01
Full Text Available In the recent years the progress in technology and the increasing availability of fast connections have produced a migration of functionalities in Information Technologies services, from static servers to distributed technologies. This article describes the main tools available on the market to perform Analytics as a Service (AaaS using a cloud platform. It is also described a use case of IBM Watson Analytics, a cloud system for data analytics, applied to the following research scope: detecting the presence or absence of Heart Failure disease using nothing more than the electrocardiographic signal, in particular through the analysis of Heart Rate Variability. The obtained results are comparable with those coming from the literature, in terms of accuracy and predictive power. Advantages and drawbacks of cloud versus static approaches are discussed in the last sections.
Portin, Petter
2014-04-01
The development of the DNA theory of inheritance culminated in the publication of the molecular structure of DNA 60 years ago. This paper describes this development, beginning with the discovery of DNA as a chemical substance by Friedrich Miescher in 1869, followed by its basic chemical analysis and demonstration of its participation in the structure of chromosomes. Subsequently it was discovered by Oswald Avery in 1944 that DNA was the genetic material, and then Erwin Chargaff showed that the proportions of the bases included in the structure of DNA followed a certain law. These findings, in association with the biophysical studies of Maurice Wilkins and Rosalind Franklin with Raymond Gosling, led James Watson and Francis Crick to the discovery of the double-helical structure of DNA in 1953. The paper ends with a short description of the development of the DNA theory of inheritance after the discovery of the double helix.
International Nuclear Information System (INIS)
Koehler, H.S.
1983-01-01
The Time-Dependent Hartree-Fock theory provides a microscopic approach to the scattering of heavy ions. Fundamental in this theory is a mean-(one-body) field. The calculation of this field from a two-body effective interaction makes the theory microscopic. Many-body effects are included by the Brueckner definition of this interaction; the reaction-matrix. In excited media it is in general complex allowing for decays. The imaginary part relates directly to the collision-term in a transport equation. We treat this term by the time-relaxation-method. This implies an extension of the TDHF-equation to include two-body collisions. Hydrodynamic equations are derived from this new equation. The solution of the two equations agree quantitatively for short-relaxation-times. Relaxation-times are calculated as a function of temperature. (orig.)
Thomas, Michael L
2012-03-01
There is growing evidence that psychiatric disorders maintain hierarchical associations where general and domain-specific factors play prominent roles (see D. Watson, 2005). Standard, unidimensional measurement models can fail to capture the meaningful nuances of such complex latent variable structures. The present study examined the ability of the multidimensional item response theory bifactor model (see R. D. Gibbons & D. R. Hedeker, 1992) to improve construct validity by serving as a bridge between measurement and clinical theories. Archival data consisting of 688 outpatients' psychiatric diagnoses and item-level responses to the Brief Symptom Inventory (BSI; L. R. Derogatis, 1993) were extracted from files at a university mental health clinic. The bifactor model demonstrated superior fit for the internal structure of the BSI and improved overall diagnostic accuracy in the sample (73%) compared with unidimensional (61%) and oblique simple structure (65%) models. Consistent with clinical theory, multiple sources of item variance were drawn from individual test items. Test developers and clinical researchers are encouraged to consider model-based measurement in the assessment of psychiatric distress.
International Nuclear Information System (INIS)
Hey, J D
2014-01-01
As a sequel to an earlier study (Hey 2009 J. Phys. B: At. Mol. Opt. Phys. 42 125701), we consider further the application of the line strength formula derived by Watson (2006 J. Phys. B: At. Mol. Opt. Phys. 39 L291) to transitions arising from states of very high principal quantum number in hydrogenic atoms and ions (Rydberg–Rydberg transitions, n > 1000). It is shown how apparent difficulties associated with the use of recurrence relations, derived (Hey 2006 J. Phys. B: At. Mol. Opt. Phys. 39 2641) by the ladder operator technique of Infeld and Hull (1951 Rev. Mod. Phys. 23 21), may be eliminated by a very simple numerical device, whereby this method may readily be applied up to n ≈ 10 000. Beyond this range, programming of the method may entail greater care and complexity. The use of the numerically efficient McLean–Watson formula for such cases is again illustrated by the determination of radiative lifetimes and comparison of present results with those from an asymptotic formula. The question of the influence on the results of the omission or inclusion of fine structure is considered by comparison with calculations based on the standard Condon–Shortley line strength formula. Interest in this work on the radial matrix elements for large n and n′ is related to measurements of radio recombination lines from tenuous space plasmas, e.g. Stepkin et al (2007 Mon. Not. R. Astron. Soc. 374 852), Bell et al (2011 Astrophys. Space Sci. 333 377), to the calculation of electron impact broadening parameters for such spectra (Watson 2006 J. Phys. B: At. Mol. Opt. Phys. 39 1889) and comparison with other theoretical methods (Peach 2014 Adv. Space Res. in press), to the modelling of physical processes in H II regions (Roshi et al 2012 Astrophys. J. 749 49), and the evaluation bound–bound transitions from states of high n during primordial cosmological recombination (Grin and Hirata 2010 Phys. Rev. D 81 083005, Ali-Haïmoud and Hirata 2010 Phys. Rev. D 82 063521
Static and Covariant Meson-Exchange Interactions in Nuclear Matter
International Nuclear Information System (INIS)
Carlson, B.V.; Hirata, D.
2011-01-01
The Dirac version of static meson exchange interactions provides a good description of low-energy NN scattering as well as very reasonable saturation properties in Dirac-Brueckner calculations of nuclear matter. We include retardation terms to make these interactions covariant and readjust the coupling constants so as to maintain a reasonable description of NN scattering. In this case, we find the Dirac-Brueckner approximation to nuclear matter to be extremely overbound. The Bonn meson-exchange interactions provide a good fit to low-energy nucleon-nucleon scattering and the deuteron binding energy using a static interaction and the Thompson form of the reduced two-nucleon interaction. We have readjusted the coupling constants of the these interactions to obtain almost equivalent fits to the scattering data and deuteron binding energy with a static interaction and the Blankenbecler-Sugar form of the reduced two-nucleon propagator and using both forms of the propagator with a covariant interaction. Dirac-Brueckner calculations using the static interactions furnish saturation properties similar to those found for the Bonn interactions. The covariant interactions, on the contrary, yield extreme overbinding and do not show signs of saturation before our calculations diverge. One of the advantages claimed for Dirac mean field calculations over nonrelativistic ones has been the fact that they yield reasonable saturation properties without the necessity of a three-body interaction. This is usually credited to the three-body effects introduced by virtual scattering through the Dirac sea states. These are included, in part, through the Dirac form of the self-energy in our calculations. However, we have explicitly excluded their contribution to the Brueckner scattering kernel. Dirac-Brueckner calculations in which both the positive and negative energy states are included in the scattering kernel result in less binding than those that include only the positive-energy ones
Thompson, Richard F.
1994-01-01
The influence of behaviorism's methods and theories on theory and research in the neurosciences is examined, partly in light of John B. Watson's 1913 essay. An attempt is made to reconcile classical behaviorism and modern cognitive psychology and neuroscience. (SLD)
Detection of protonated non-Watson-Crick base pairs using electrospray ionization mass spectrometry.
Ishida, Riyoko; Iwahashi, Hideo
2018-03-01
Many studies have shown that protonated nucleic acid base pairs are involved in a wide variety of nucleic acid structures. However, little information is available on relative stability of hemiprotonated self- and non-self-dimers at monomer level. We used electrospray ionization mass spectrometry (ESI-MS) to evaluate the relative stability under various concentrations of hydrogen ion. These enable conjecture of the formation of protonated non-Watson-Crick base pairs based on DNA and RNA base sequence. In the present study, we observed that ESI-MS peaks corresponded to respective self-dimers for all examined nucleosides except for adenosine. Peak heights depended on the concentration of hydrogen ion. The ESI-MS peak heights of the hemiprotonated cytidine dimers and the hemiprotonated thymidine dimer sharply increased with increased concentration of hydrogen ion, suggesting direct participation of hydrogen ion in dimer formations. In ESI-MS measurements of the solutions containing adenosine, cytidine, thymidine and guanosine, we observed protonated cytidine-guanosine dimer (CH+-G) and protonated cytidine-thymidine dimer (CH+-T) in addition to hemiprotonated cytidine-cytidine dimer (CH+-C) with following relative peak height, (CH+-C) > (CH+-G) ≈ (CH+-T) > (CH+-A). Additionally, in the ESI-MS measurements of solutions containing adenosine, thymidine and guanosine, we observed a considerable amount of protonated adenosine-guanosine (AH+-G) and protonated adenosine-thymidine (AH+-T).
Berger, Or; Adler-Abramovich, Lihi; Levy-Sakin, Michal; Grunwald, Assaf; Liebes-Peer, Yael; Bachar, Mor; Buzhansky, Ludmila; Mossou, Estelle; Forsyth, V Trevor; Schwartz, Tal; Ebenstein, Yuval; Frolow, Felix; Shimon, Linda J W; Patolsky, Fernando; Gazit, Ehud
2015-04-01
The two main branches of bionanotechnology involve the self-assembly of either peptides or DNA. Peptide scaffolds offer chemical versatility, architectural flexibility and structural complexity, but they lack the precise base pairing and molecular recognition available with nucleic acid assemblies. Here, inspired by the ability of aromatic dipeptides to form ordered nanostructures with unique physical properties, we explore the assembly of peptide nucleic acids (PNAs), which are short DNA mimics that have an amide backbone. All 16 combinations of the very short di-PNA building blocks were synthesized and assayed for their ability to self-associate. Only three guanine-containing di-PNAs-CG, GC and GG-could form ordered assemblies, as observed by electron microscopy, and these di-PNAs efficiently assembled into discrete architectures within a few minutes. The X-ray crystal structure of the GC di-PNA showed the occurrence of both stacking interactions and Watson-Crick base pairing. The assemblies were also found to exhibit optical properties including voltage-dependent electroluminescence and wide-range excitation-dependent fluorescence in the visible region.
Patrice Loiez
1999-01-01
UK Institute of Physics (IOP) President Sir Gareth Roberts (right) at CERN on 9 July with (right to left) IOP council vice-president and distinguished physicist Peter Kalmus, CERN engineer Tim Watson and IOP director of science Peter Cooper
Czech Academy of Sciences Publication Activity Database
Burda, J. V.; Šponer, Jiří; Hrabáková, J.; Zeizinger, M.; Leszczynski, J.
2003-01-01
Roč. 107, č. 22 (2003), s. 5349-5356 ISSN 1520-6106 R&D Projects: GA MŠk ME 517; GA MŠk LN00A016 Grant - others:Wellcome Trust(GB) GR067507MF; ONR(US) N00034-03-1-0116; National Science Foundation(US) CREST 9805465 Institutional research plan: CEZ:AV0Z5004920 Keywords : Watson-Crick base pairing * guanines * gas-phase and condensed-phase trends Subject RIV: BO - Biophysics Impact factor: 3.679, year: 2003
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
This study provides the first accurate investigation of the tautomerization of the biologically important guanine*·thymine (G*·T) DNA base mispair with Watson-Crick geometry, involving the enol mutagenic tautomer of the G and the keto tautomer of the T, into the G·T* mispair (∆G = .99 kcal mol(-1), population = 15.8% obtained at the MP2 level of quantum-mechanical theory in the continuum with ε = 4), formed by the keto tautomer of the G and the enol mutagenic tautomer of the T base, using DFT and MP2 methods in vacuum and in the weakly polar medium (ε = 4), characteristic for the hydrophobic interfaces of specific protein-nucleic acid interactions. We were first able to show that the G*·T↔G·T* tautomerization occurs through the asynchronous concerted double proton transfer along two antiparallel O6H···O4 and N1···HN3 H-bonds and is assisted by the third N2H···O2 H-bond, that exists along the entire reaction pathway. The obtained results indicate that the G·T* base mispair is stable from the thermodynamic point of view complex, while it is dynamically unstable structure in vacuum and dynamically stable structure in the continuum with ε = 4 with lifetime of 6.4·10(-12) s, that, on the one side, makes it possible to develop all six low-frequency intermolecular vibrations, but, on the other side, it is by three orders less than the time (several ns) required for the replication machinery to forcibly dissociate a base pair into the monomers during DNA replication. One of the more significant findings to emerge from this study is that the short-lived G·T* base mispair, which electronic interaction energy between the bases (-23.76 kcal mol(-1)) exceeds the analogical value for the G·C Watson-Crick nucleobase pair (-20.38 kcal mol(-1)), "escapes from the hands" of the DNA replication machinery by fast transforming into the G*·T mismatch playing an indirect role of its supplier during the DNA replication. So
Towards an unified microscopic approach of the description of the nuclear structure and reaction
International Nuclear Information System (INIS)
Hoang, Sy Than
2009-09-01
This thesis contains 3 main parts. The first one: nuclear matter. The motivation of the study is to establish a link between the bare nucleon-nucleon interaction and nuclear matter properties. The properties of nuclear matter are examined using finite range effective interactions either derived from the Brueckner theory or determined in a purely phenomenological way. Skyrme-type interactions are also used for comparison. We have focused our discussion on several main aspects: the pressure ins symmetric nuclear matter and in neutron matter, the density dependence of the symmetric energy S and the nuclear matter incompressibility. The second part: the structure of finite nuclei and of the inner crust of neutrons stars. We present the non-relativistic HF and HF-BCS approaches in coordinate representation using finite-range density-dependent interactions in both the mean field and pairing channels. An iterative scheme is used for solving the integral-differential HF equations. We have studied the doubly magic nuclei, the Sn isotopes and the possible occurrence of bubble structures in the nuclei O 22 , Si 34 , Ar 46 and Ar 68 . We have also examined the different zones of the inner crust of neutron stars. The third part: nuclear reactions. Using the same effective interactions derived from the Brueckner theory we have performed a coupled channel analysis of (p,n) charge exchange reactions at 35 and 45 MeV incident energies on Ca 48 , Zr 90 , Sn 120 and Pb 208 targets leading to isobaric analog states. (A.C.)
Bombaci, Ignazio; Logoteta, Domenico
2018-02-01
Aims: We report a new microscopic equation of state (EOS) of dense symmetric nuclear matter, pure neutron matter, and asymmetric and β-stable nuclear matter at zero temperature using recent realistic two-body and three-body nuclear interactions derived in the framework of chiral perturbation theory (ChPT) and including the Δ(1232) isobar intermediate state. This EOS is provided in tabular form and in parametrized form ready for use in numerical general relativity simulations of binary neutron star merging. Here we use our new EOS for β-stable nuclear matter to compute various structural properties of non-rotating neutron stars. Methods: The EOS is derived using the Brueckner-Bethe-Goldstone quantum many-body theory in the Brueckner-Hartree-Fock approximation. Neutron star properties are next computed solving numerically the Tolman-Oppenheimer-Volkov structure equations. Results: Our EOS models are able to reproduce the empirical saturation point of symmetric nuclear matter, the symmetry energy Esym, and its slope parameter L at the empirical saturation density n0. In addition, our EOS models are compatible with experimental data from collisions between heavy nuclei at energies ranging from a few tens of MeV up to several hundreds of MeV per nucleon. These experiments provide a selective test for constraining the nuclear EOS up to 4n0. Our EOS models are consistent with present measured neutron star masses and particularly with the mass M = 2.01 ± 0.04 M⊙ of the neutron stars in PSR J0348+0432.
Kinetics and Thermodynamics of Watson-Crick Base Pairing Driven DNA Origami Dimerization.
Zenk, John; Tuntivate, Chanon; Schulman, Rebecca
2016-03-16
We investigate the kinetics and thermodynamics of DNA origami dimerization using flat rectangle origami components and different architectures of Watson-Crick complementary single-stranded DNA ("sticky end") linking strategies. We systematically vary the number of linkers, the length of the sticky ends on the linker, and linker architecture and measure the corresponding yields as well as forward and reverse reaction rate constants through fluorescence quenching assays. Yields were further verified using atomic force microscopy. We calculate values of H° and ΔS° for various interface designs and find nonlinear van't Hoff behavior, best described by two linear equations, suggesting distinct regimes of dimerization between those with and those without well-formed interfaces. We find that self-assembly reactions can be tuned by manipulating the interface architecture without suffering a loss in yield, even when yield is high, ∼75-80%. We show that the second-order forward reaction rate constant (k(on)) depends on both linker architecture and number of linkers used, with typical values on the order of 10(5)-10(6) (M·s)(-1), values that are similar to those of bimolecular association of small, complementary DNA strands. The k(on) values are generally non-Arrhenius, tending to increase with decreasing temperature. Finally, we use kinetic and thermodynamic information about the optimal linking architecture to extend the system to an infinite, two-component repeating lattice system and show that we can form micron-sized lattices, with well-formed structures up to 8 μm(2).
Role modeling excellence in clinical nursing practice.
Perry, R N Beth
2009-01-01
Role modeling excellence in clinical nursing practice is the focus of this paper. The phenomenological research study reported involved a group of 8 nurses identified by their colleagues as exemplary. The major theme revealed in this study was that these exemplary nurses were also excellent role models in the clinical setting. This paper details approaches used by these nurses that made them excellent role models. Specifically, the themes of attending to the little things, making connections, maintaining a light-hearted attitude, modeling, and affirming others are presented. These themes are discussed within the framework of Watson [Watson, J., 1989. Human caring and suffering: a subjective model for health services. In: Watson, J., Taylor, R. (Eds.), They Shall Not Hurt: Human Suffering and Human Caring. Colorado University, Boulder, CO] "transpersonal caring" and [Bandura, A., 1997. Social Learning Theory. Prentice Hall, Englewood Cliffs, NJ] "Social Learning Theory." Particular emphasis in the discussion is on how positive role modeling by exemplary practitioners can contribute to the education of clinical nurses in the practice setting.
Onset of superfluidity in hot asymmetric nuclear matter
International Nuclear Information System (INIS)
Alm, T.; Roepke, G.; Friman, B.L.
1991-05-01
The onset of superfluidity in hot asymmetric nuclear matter is studied within a generalized Beth-Uhlenbeck approach. The finite tempeature t-matrix is of the Bethe-Goldstone type and contains hole-hole propagation not considered in the Brueckner G-matrix approach. It is shown that the phase contour for the onset of superfluidity in this approach is identical to that obtained within Gorkov's approach to BCS theory. Results for the realistic Paris potential imply that the critical temperature in the neutron-proton triplet channel is on the order of 6-8 MeV and thus much larger than that for singlet pairing. (orig.)
Off-shell effects and consistency of many-body treatments of dense matter
International Nuclear Information System (INIS)
Krippa, Boris; Birse, Michael C.; McGovern, Judith A.; Walet, Niels R.
2003-01-01
Effective field theory requires all observables to be independent of the representation used for the quantum field operators. It means that off-shell properties of the interactions should not lead to any observable effects. We analyze this issue in the context of many-body approaches to nuclear matter, where it should be possible to shift the contributions of lowest order in purely off-shell two-body interactions into three-body forces. We show that none of the commonly used truncations of the two-body scattering amplitude such as the ladder, Brueckner-Hartree-Fock, or parquet approximations respect this requirement
Krasnoshchekov, Sergey V; Isayeva, Elena V; Stepanov, Nikolay F
2012-04-12
Anharmonic vibrational states of semirigid polyatomic molecules are often studied using the second-order vibrational perturbation theory (VPT2). For efficient higher-order analysis, an approach based on the canonical Van Vleck perturbation theory (CVPT), the Watson Hamiltonian and operators of creation and annihilation of vibrational quanta is employed. This method allows analysis of the convergence of perturbation theory and solves a number of theoretical problems of VPT2, e.g., yields anharmonic constants y(ijk), z(ijkl), and allows the reliable evaluation of vibrational IR and Raman anharmonic intensities in the presence of resonances. Darling-Dennison and higher-order resonance coupling coefficients can be reliably evaluated as well. The method is illustrated on classic molecules: water and formaldehyde. A number of theoretical conclusions results, including the necessity of using sextic force field in the fourth order (CVPT4) and the nearly vanishing CVPT4 contributions for bending and wagging modes. The coefficients of perturbative Dunham-type Hamiltonians in high-orders of CVPT are found to conform to the rules of equality at different orders as earlier proven analytically for diatomic molecules. The method can serve as a good substitution of the more traditional VPT2.
International Nuclear Information System (INIS)
Pervushin, Konstantin; Fernandez, Cesar; Riek, Roland; Ono, Akira; Kainosho, Masatsune; Wuethrich, Kurt
2000-01-01
This paper describes NMR measurements of 15 N- 15 N and 1 H- 15 N scalar couplings across hydrogen bonds in Watson-Crick base pairs, h2 J NN and h1 J HN , in a 17 kDa Antennapedia homeodomain-DNA complex. A new NMR experiment is introduced which relies on zero-quantum coherence-based transverse relaxation-optimized spectroscopy (ZQ-TROSY) and enables measurements of h1 J HN couplings in larger molecules. The h2 J NN and h1 J HN couplings open a new avenue for comparative studies of DNA duplexes and other forms of nucleic acids free in solution and in complexes with proteins, drugs or possibly other classes of compounds
From the crust to the core of neutron stars on a microscopic basis
Baldo, M.; Burgio, G. F.; Centelles, M.; Sharma, B. K.; Viñas, X.
2014-09-01
Within a microscopic approach the structure of Neutron Stars is usually studied by modelling the homogeneous nuclear matter of the core by a suitable Equation of State, based on a many-body theory, and the crust by a functional based on a more phenomenological approach. We present the first calculation of Neutron Star overall structure by adopting for the core an Equation of State derived from the Brueckner-Hartree-Fock theory and for the crust, including the pasta phase, an Energy Density Functional based on the same Equation of State, and which is able to describe accurately the binding energy of nuclei throughout the mass table. Comparison with other approaches is discussed. The relevance of the crust Equation of State for the Neutron Star radius is particularly emphasised.
Brice, Maximilien
2014-01-01
Ms Wendy Watson-Wright Assistant Director General and Executive Secretary UNESCO Intergovernmental Oceanographic Commission Assistant Director-General for the Natural Sciences Sector ad interim UNESCO
Effective interaction for relativistic mean-field theories of nuclear structure
International Nuclear Information System (INIS)
Ai, H.B.; Celenza, L.S.; Harindranath, A.; Shakin, C.M.
1987-01-01
We construct an effective interaction, which when treated in a relativistic Hartree-Fock approximation, reproduces rather accurately the nucleon self-energy in nuclear matter and the Migdal parameters obtained via relativistic Brueckner-Hartree-Fock calculations. This effective interaction is constructed by adding Born terms, describing the exchange of pseudoparticles, to the Born terms of the Dirac-Hartree-Fock analysis. The pseudoparticles have relatively large masses and either real or imaginary coupling constants. (For example, exchange of a pseudo-sigma with an imaginary coupling constant has the effect of reducing the scalar attraction arising from sigma exchange while exchange of a pseudo-omega with an imaginary coupling constant has the effect of reducing the repulsion arising from omega exchange. The terms beyond the Born term in the case of pion exchange are well simulated by pseudo-sigma exchange with a real coupling constant.) The effective interaction constructed here may be used for calculations of the properties of finite nuclei in a relativistic Hartree-Fock approximation
Yang, Changwon; Kim, Eunae; Pak, Youngshang
2015-09-18
Houghton (HG) base pairing plays a central role in the DNA binding of proteins and small ligands. Probing detailed transition mechanism from Watson-Crick (WC) to HG base pair (bp) formation in duplex DNAs is of fundamental importance in terms of revealing intrinsic functions of double helical DNAs beyond their sequence determined functions. We investigated a free energy landscape of a free B-DNA with an adenosine-thymine (A-T) rich sequence to probe its conformational transition pathways from WC to HG base pairing. The free energy landscape was computed with a state-of-art two-dimensional umbrella molecular dynamics simulation at the all-atom level. The present simulation showed that in an isolated duplex DNA, the spontaneous transition from WC to HG bp takes place via multiple pathways. Notably, base flipping into the major and minor grooves was found to play an important role in forming these multiple transition pathways. This finding suggests that naked B-DNA under normal conditions has an inherent ability to form HG bps via spontaneous base opening events. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
International Nuclear Information System (INIS)
de Prunele, E.
1983-01-01
The Faddeev-Watson expansion (FWE) for the T operator is applied to the study of thermal collisions between Rydberg atom and neutral atom. These collisions are considered as a three-body problem (the perturber, the Rydberg electron, and its parent core) and it is assumed, as already done in most theoretical works dealing with Rydberg-atom--atom collisions, that the core-perturber interaction can be neglected. Then the evaluation of the FWE first- and second-order terms is made tractable by using an appropriate separable potential for the Rydberg-electron--perturber interaction. The evaluation of the second-order term allows us to estimate the importance of taking into account explicitly the Rydberg-electron--core interaction in the expression of the (three-body) T operator for the thermal collisions considered. Detailed calculations for the process Rb(n, l = 0)+He →Rb(n',l')+He are presented and discussed. The FWE second-order term has been evaluated for the first time by taking the (two-body) t operator associated with the Rydberg atom (valence electron plus parent core) as the Coulomb potential. The contribution of the FWE second-order term to the scattering amplitude decreases as n increases and is found especially significant when both the momentum transfers involved in the collision are large and the values of l and l' are small
Chawla, Mohit
2013-10-10
The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. 2013 The Author(s).
Spin symmetry in the Dirac sea derived from the bare nucleon-nucleon interaction
Shen, Shihang; Liang, Haozhao; Meng, Jie; Ring, Peter; Zhang, Shuangquan
2018-06-01
The spin symmetry in the Dirac sea has been investigated with relativistic Brueckner-Hartree-Fock theory using the bare nucleon-nucleon interaction. Taking the nucleus 16O as an example and comparing the theoretical results with the data, the definition of the single-particle potential in the Dirac sea is studied in detail. It is found that if the single-particle states in the Dirac sea are treated as occupied states, the ground state properties are in better agreement with experimental data. Moreover, in this case, the spin symmetry in the Dirac sea is better conserved and it is more consistent with the findings using phenomenological relativistic density functionals.
[Considering body ethics in the healthcare profession].
Wang, Shin-Yun
2014-10-01
This article uses the theory of body phenomenology and Watson's caring theory to develop and apply body ethics to the clinical healthcare profession. This attempt is meant to facilitate deep, humanistic experiences for healthcare personnel. The analysis of body phenomenology reveals that the soul is banished from her familiar and comfortable "at-home" status when illness and pain invade the body. In such situations, the body becomes an external object that is self-alienated. This experience induces experiences such as solitude and violence. However, it also holds the potential to expose the original morality of the body. Additionally, this article discusses popular tools used in clinical ethics such as principalism and virtual-based ethics, which are based on moral reasoning and moral feeling. In contrast to these, body ethics seek a more profound and humble level of sensibility that is able to implant authenticity into the ethics. Finally, we offer some suggestions related to Watson's caring theory.
Minimal coupling schemes in N-body reaction theory
International Nuclear Information System (INIS)
Picklesimer, A.; Tandy, P.C.; Thaler, R.M.
1982-01-01
A new derivation of the N-body equations of Bencze, Redish, and Sloan is obtained through the use of Watson-type multiple scattering techniques. The derivation establishes an intimate connection between these partition-labeled N-body equations and the particle-labeled Rosenberg equations. This result yields new insight into the implicit role of channel coupling in, and the minimal dimensionality of, the partition-labeled equations
Λ, Σ, and Ξ hyperons in neutron matter
International Nuclear Information System (INIS)
Kohno, M.
2013-01-01
Hyperon single-particle potentials are calculated in pure neutron matter in the framework of the lowest-order Brueckner theory, using two recent baryon–baryon interactions, the SU 6 quark-model potential and the potential derived from the chiral effective field theory. These properties are important for understanding neutron star matter on the basis of underlying baryon–baryon interactions. Because the calculated potential of Σ − is strongly repulsive and that of Ξ − is also repulsive, these hyperons are unlikely to appear in neutron star matter. The Λ potential is attractive enough to appear in high neutron matter as has been commonly expected in microscopic calculations. After showing important contributions of three-nucleon forces in neutron matter, analogous repulsive contributions to the Λ potential from the Σ ⁎ excitation are estimated by evaluating second-order diagrams
DEFF Research Database (Denmark)
Omerzu, Heike
2014-01-01
, for instance, the extent to which Luke made use of Matthew or the existence of a Christian ‘Sayings Collection’ genre. It is argued that an explanation of the Synoptic Problem demands a more complex theory than the one sketched by Watson and that the question of manuscript transmission also needs...... to be integrated into that theory....
Bandyopadhyay, D; Bhattacharyya, D
2006-10-15
It was shown earlier, from database analysis, model building studies, and molecular dynamics simulations that formation of cross-strand bifurcated or Extra Watson-Crick hydrogen (EWC) bonds between successive base pairs may lead to extra rigidity to DNA double helices of certain sequences. The strengths of these hydrogen bonds are debatable, however, as they do not have standard linear geometry criterion. We have therefore carried out detailed ab initio quantum chemical studies using RHF/6-31G(2d,2p) and B3LYP/6-31G(2p,2d) basis sets to determine strengths of several bent hydrogen bonds with different donor and acceptors. Interaction energy calculations, corrected for the basis set superposition errors, suggest that N-H...O type bent EWC hydrogen bonds are possible along same strands or across the strands between successive base pairs, leading to significant stability (ca. 4-9 kcal/mol). The N-H...N and C-H...O type interactions, however, are not so stabilizing. Hence, consideration of EWC N-H...O H-bonds can lead to a better understanding of DNA sequence directed structural features. Copyright (c) 2006 Wiley Periodicals, Inc.
Directory of Open Access Journals (Sweden)
Siddharth Jain
Full Text Available The performance of Watson & Ahumada's model of human visual motion sensing is compared against human psychophysical performance. The stimulus consists of random dots undergoing rotary motion, displayed in a circular annulus. The model matches psychophysical observer performance with respect to most parameters. It is able to replicate some key psychophysical findings such as invariance of observer performance to dot density in the display, and decrease of observer performance with frame duration of the display.Associated with the concept of rotary motion is the notion of a center about which rotation occurs. One might think that for accurate estimation of rotary motion in the display, this center must be accurately known. A simple vector analysis reveals that this need not be the case. Numerical simulations confirm this result, and may explain the position invariance of MST(d cells. Position invariance is the experimental finding that rotary motion sensitive cells are insensitive to where in their receptive field rotation occurs.When all the dots in the display are randomly drawn from a uniform distribution, illusory rotary motion is perceived. This case was investigated by Rose & Blake previously, who termed the illusory rotary motion the omega effect. Two important experimental findings are reported concerning this effect. First, although the display of random dots evokes perception of rotary motion, the direction of motion perceived does not depend on what dot pattern is shown. Second, the time interval between spontaneous flips in perceived direction is lognormally distributed (mode approximately 2 s. These findings suggest the omega effect fits in the category of a typical bistable illusion, and therefore the processes that give rise to this illusion may be the same processes that underlie much of other bistable phenomenon.
Effect of liquid surface tension on circular and linear hydraulic jumps; theory and experiments
Bhagat, Rajesh Kumar; Jha, Narsing Kumar; Linden, Paul F.; Wilson, David Ian
2017-11-01
The hydraulic jump has attracted considerable attention since Rayleigh published his account in 1914. Watson (1964) proposed the first satisfactory explanation of the circular hydraulic jump by balancing the momentum and hydrostatic pressure across the jump, but this solution did not explain what actually causes the jump to form. Bohr et al. (1992) showed that the hydraulic jump happens close to the point where the local Froude number equals to one, suggesting a balance between inertial and hydrostatic contributions. Bush & Aristoff (2003) subsequently incorporated the effect of surface tension and showed that this is important when the jump radius is small. In this study, we propose a new account to explain the formation and evolution of hydraulic jumps under conditions where the jump radius is strongly influenced by the liquid surface tension. The theory is compared with experiments employing liquids of different surface tension and different viscosity, in circular and linear configurations. The model predictions and the experimental results show excellent agreement. Commonwealth Scholarship Commission, St. John's college, University of Cambridge.
Lambda-nuclear interactions and hyperon puzzle in neutron stars
Energy Technology Data Exchange (ETDEWEB)
Haidenbauer, J. [Forschungszentrum Juelich, Institute for Advanced Simulation, Institut fuer Kernphysik and Juelich Center for Hadron Physics, Juelich (Germany); Universitaet Bonn, Helmholtz Institut fuer Strahlen- und Kernphysik and Bethe Center for Theoretical Physics, Bonn (Germany); Meissner, U.G. [Universitaet Bonn, Helmholtz Institut fuer Strahlen- und Kernphysik and Bethe Center for Theoretical Physics, Bonn (Germany); Forschungszentrum Juelich, Institute for Advanced Simulation, Institut fuer Kernphysik and Juelich Center for Hadron Physics, Juelich (Germany); Kaiser, N.; Weise, W. [Technische Universitaet Muenchen, Physik Department, Garching (Germany)
2017-06-15
Brueckner theory is used to investigate the in-medium properties of a Λ-hyperon in nuclear and neutron matter, based on hyperon-nucleon interactions derived within SU(3) chiral effective field theory (EFT). It is shown that the resulting Λ single-particle potential U{sub Λ}(p{sub Λ} = 0, ρ) becomes strongly repulsive for densities ρ of two-to-three times that of normal nuclear matter. Adding a density-dependent effective ΛN-interaction constructed from chiral ΛNN three-body forces increases the repulsion further. Consequences of these findings for neutron stars are discussed. It is argued that for hyperon-nuclear interactions with properties such as those deduced from the SU(3) EFT potentials, the onset for hyperon formation in the core of neutron stars could be shifted to much higher density which, in turn, could pave the way for resolving the so-called hyperon puzzle. (orig.)
Hamlin, Trevor A.; Poater, Jordi; Fonseca Guerra, Célia; Bickelhaupt, F. Matthias
2017-01-01
We have computationally analyzed a comprehensive series of Watson-Crick and mismatched B-DNA base pairs, in the gas phase and in several solvents, including toluene, chloroform, ammonia, methanol and water, using dispersion-corrected density functional theory and implicit solvation. Our analyses
Macromolecules Vis-a-Vis the Traditions of Chemistry
Flory, Paul J.
1973-01-01
Summarizes the history of concepts concerning the molecular nature of polymers, involving the carbon chain theory, graphic formula, polycondensation, colloidal properties, polypeptide hypothesis, secondary aggregation, and Watson-Crick model. Indicates that macromolecular science should be accommodated within the discipline of molecular science…
Two-body and three-body correlations in Os-shell nuclei
International Nuclear Information System (INIS)
Halderson, D.W.
1974-01-01
It is well known that conventional Brueckner calculations with modern nucleon-nucleon potentials have failed to reproduce experimental saturation properties of finite nuclei. The intent was to determine whether the discrepancies are due to the methods of calculation or the nucleon-nucleon potentials. Brueckner procedures which include only two-body correlations were applied to Os-shell nuclei. Calculations were performed with and without the Hartree-Fock condition, with and without partial occupation probabilities, and with various propagators and Pauli correction techniques. Then the entire class of three-body correlations was calculated by matrix solution of the Bethe-Faddeev equations. The convergence necessary to validate this technique was achieved by constructing a set of basic functions which contain no center of mass excitations and yet are still properly antisymmetrized. The two-body calculations yielded typical Brueckner results. The nuclei were underbound or the radii were too small. However, the three-body calculations yielded reasonable radii and moderate overbinding for the Reid soft core and Hamada-Johnston potentials. Therefore, the Bethe-Faddeev formalism has been shown to be a reasonable approach to calculation of the three-body correlations in finite nuclei; and the results of []these calculations demonstrate that the underbinding and collapsed radii of two-body calculations were largely due to the uncalculated correlations. (auth)
Toward an effective field theory approach to reheating
Özsoy, Ogan; Giblin, John T.; Nesbit, Eva; Şengör, Gizem; Watson, Scott
2017-12-01
We investigate whether effective field theory (EFT) approaches, which have been useful in examining inflation and dark energy, can also be used to establish a systematic approach to inflationary reheating. We consider two methods. First, we extend Weinberg's background EFT to the end of inflation and reheating. We establish when parametric resonance and decay of the inflaton occurs, but also find intrinsic theoretical limitations, which make it difficult to capture some reheating models. This motivates us to next consider Cheung et al.'s EFT approach, which instead focuses on perturbations and the symmetry breaking induced by the cosmological background. Adapting the latter approach to reheating implies some new and important differences compared to the EFT of inflation. In particular, there are new hierarchical scales, and we must account for inflaton oscillations during reheating, which lead to discrete symmetry breaking. Guided by the fundamental symmetries, we construct the EFT of reheating, and as an example of its usefulness we establish a new class of reheating models and the corresponding predictions for gravity wave observations. In this paper we primarily focus on the first stages of preheating. We conclude by discussing challenges for the approach and future directions. This paper builds on ideas first proposed in the paper [O. Ozsoy, G. Sengor, K. Sinha, and S. Watson, arXiv:1507.06651.].
Van Inwagen on the Cosmological Argument | Brueckner ...
African Journals Online (AJOL)
In his book Metaphysics, Peter van Inwagen constructs a version of the Cosmological Argument which does not depend on the Principle of Sufficient Reason. He goes on to reject the argument. In this paper, I construct an alternative version of the Cosmological Argument that uses some of van Inwagen's insights and yet is ...
Coaxing an intimate public : Life narrative in digital storytelling
Poletti, Anna
2011-01-01
This article considers the practice of digital storytelling in light of contemporary theories of autobiography and affect. Using the concept of coaxed life narrative developed by Sidonie Smith and Julia Watson, I analyse the role of digital storytelling in diversifying the voices in the public
Alternative Watson-Crick Synthetic Genetic Systems.
Benner, Steven A; Karalkar, Nilesh B; Hoshika, Shuichi; Laos, Roberto; Shaw, Ryan W; Matsuura, Mariko; Fajardo, Diego; Moussatche, Patricia
2016-11-01
In its "grand challenge" format in chemistry, "synthesis" as an activity sets out a goal that is substantially beyond current theoretical and technological capabilities. In pursuit of this goal, scientists are forced across uncharted territory, where they must answer unscripted questions and solve unscripted problems, creating new theories and new technologies in ways that would not be created by hypothesis-directed research. Thus, synthesis drives discovery and paradigm changes in ways that analysis cannot. Described here are the products that have arisen so far through the pursuit of one grand challenge in synthetic biology: Recreate the genetics, catalysis, evolution, and adaptation that we value in life, but using genetic and catalytic biopolymers different from those that have been delivered to us by natural history on Earth. The outcomes in technology include new diagnostic tools that have helped personalize the care of hundreds of thousands of patients worldwide. In science, the effort has generated a fundamentally different view of DNA, RNA, and how they work. Copyright © 2016 Cold Spring Harbor Laboratory Press; all rights reserved.
Computational Methods for Inviscid and Viscous Two-and-Three-Dimensional Flow Fields.
1975-01-01
Difference Equations Over a Network, Watson Sei. Comput. Lab. Report, 19U9. 173- Isaacson, E. and Keller, H. B., Analaysis of Numerical Methods...element method has given a new impulse to the old mathematical theory of multivariate interpolation. We first study the one-dimensional case, which
Directory of Open Access Journals (Sweden)
María L. Román-Miranda
2013-01-01
Full Text Available La utilización de especies forestales en los sistemas de producción agropecuaria contribuye a reducir la presión en los bosques naturales y se pueden incorporar en áreas no arboladas. El objetivo de este estudio fue evaluar la calidad nutritiva, germinación, desarrollo de plántula en vivero y diversidad de usos de Leucaena lanceolata S. Watson ssp. lanceolata. El material comestible y las semillas se colectaron en Tomatlán, Jalisco. Se realizaron análisis bromatológicos, pruebas de escarificación y evaluación de plántula en vivero sobre tres suelos con diferente pH. El experimento se analizó en un diseño completamente al azar con comparación de medias de Tukey (P ≤ 0.05. Además, se hicieron entrevistas a productores, una revisión bibliográfica y consulta de ejemplares en los herbarios para conocer los usos locales y potenciales de la especie. Los resultados indican alto contenido de materia seca (97.40 % y proteína cruda (29.05 %, mayor germinación en los tratamientos térmicos, mejor desarrollo de la plántula en el suelo ligeramente ácido (6.57 y la diversidad de usos incluye leña, forraje y madera, entre otros. Por el alto valor nutritivo y diversidad de usos en el medio rural, L. lanceolata representa una opción viable para utilizarse en sistemas silvopastoriles del trópico seco.
Multivariate and semiparametric kernel regression
Härdle, Wolfgang; Müller, Marlene
1997-01-01
The paper gives an introduction to theory and application of multivariate and semiparametric kernel smoothing. Multivariate nonparametric density estimation is an often used pilot tool for examining the structure of data. Regression smoothing helps in investigating the association between covariates and responses. We concentrate on kernel smoothing using local polynomial fitting which includes the Nadaraya-Watson estimator. Some theory on the asymptotic behavior and bandwidth selection is pro...
Isobar excitations and low energy spectra of light nuclei
International Nuclear Information System (INIS)
Czerski, P.
1984-01-01
The aim of this investigation is to study the possible influence of inner excitations of nucleons into the Δ(3,3)-resonance on the low lying spectra of light nuclei like 12 C and 16 O. Before we can study the effect of such exotic configurations one has to perform a reliable investigation within the normal nuclear model, which is based on a microscopic theory. This is achieved by performing RPA (Random Phase Approximation) calculations using a realistic residual interaction derived from the Brueckner G-matrix. An efficient parametrisation of the residual interaction is introduced and the reliability of the more phenomenological parametrisations which are generally used is discussed. Within such realistic calculations, the isobar effects are small. (orig.) [de
Kondo, Jiro; Tada, Yoshinari; Dairaku, Takenori; Saneyoshi, Hisao; Okamoto, Itaru; Tanaka, Yoshiyuki; Ono, Akira
2015-11-02
Metallo-base pairs have been extensively studied for applications in nucleic acid-based nanodevices and genetic code expansion. Metallo-base pairs composed of natural nucleobases are attractive because nanodevices containing natural metallo-base pairs can be easily prepared from commercially available sources. Previously, we have reported a crystal structure of a DNA duplex containing T-Hg(II)-T base pairs. Herein, we have determined a high-resolution crystal structure of the second natural metallo-base pair between pyrimidine bases C-Ag(I)-C formed in an RNA duplex. One Ag(I) occupies the center between two cytosines and forms a C-Ag(I)-C base pair through N3-Ag(I)-N3 linear coordination. The C-Ag(I)-C base pair formation does not disturb the standard A-form conformation of RNA. Since the C-Ag(I)-C base pair is structurally similar to the canonical Watson-Crick base pairs, it can be a useful building block for structure-based design and fabrication of nucleic acid-based nanodevices. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Mori, Miki
2014-01-01
This study looks at how language ideologies affect and are revealed in language socialization practices in a majority-L1 adult ESL classroom, particularly looking at language use and policy. It draws on recent theories and critiques of language socialization (Bayley & Langman, 2011; Bronson & Watson-Gegeo, 2008; Garrett &…
Yurenko, Yevgen P; Zhurakivsky, Roman O; Samijlenko, Svitlana P; Hovorun, Dmytro M
2011-08-01
The aim of this work is to cast some light on the H-bonds in double-stranded DNA in its AI and BI forms. For this purpose, we have performed the MP2 and DFT quantum chemical calculations of the canonical nucleoside conformers, relative to the AI and BI DNA forms, and their Watson-Crick pairs, which were regarded as the simplest models of the double-stranded DNA. Based on the atoms-in-molecules analysis (AIM), five types of the CH···O hydrogen bonds, involving bases and sugar, were detected numerically from 1 to 3 per a conformer: C2'H···O5', C1'H···O2, C6H···O5', C8H···O5', and C6H···O4'. The energy values of H-bonds occupy the range of 2.3-5.6 kcal/mol, surely exceeding the kT value (0.62 kcal/mol). The nucleoside CH···O hydrogen bonds appeared to "survive" turns of bases against the sugar, sometimes in rather large ranges of the angle values, pertinent to certain conformations, which points out to the source of the DNA lability, necessary for the conformational adaptation in processes of its functioning. The calculation of the interactions in the dA·T nucleoside pair gives evidence, that additionally to the N6H···O4 and N1···N3H canonical H-bonds, between the bases adenine and thymine the third one (C2H···O2) is formed, which, though being rather weak (about 1 kcal/mol), satisfies the AIM criteria of H-bonding and may be classified as a true H-bond. The total energy of all the CH···O nontraditional intramolecular H-bonds in DNA nucleoside pairs appeared to be commensurable with the energy of H-bonds between the bases in Watson-Crick pairs, which implies their possible important role in the DNA shaping.
Crespo-Hernandez, Carlos E; Close, David M; Gorb, Leonid; Leszczynski, Jerzy
2007-05-17
Redox potentials for the DNA nucleobases and nucleosides, various relevant nucleoside analogues, Watson-Crick base pairs, and seven organic dyes are presented based on DFT/B3LYP/6-31++G(d,p) and B3YLP/6-311+G(2df,p)//B3LYP/6-31+G* levels of calculations. The values are determined from an experimentally calibrated set of equations that correlate the vertical ionization (electron affinity) energy of 20 organic molecules with their experimental reversible oxidation (reduction) potential. Our results are in good agreement with those estimated experimentally for the DNA nucleosides in acetonitrile solutions (Seidel et al. J. Phys. Chem. 1996, 100, 5541). We have found that nucleosides with anti conformation exhibit lower oxidation potentials than the corresponding syn conformers. The lowering in the oxidation potential is due to the formation of an intramolecular hydrogen bonding interaction between the 5'-OH group of the sugar and the N3 of the purine bases or C2=O of the pyrimidine bases in the syn conformation. Pairing of adenine or guanine with its complementary pyrimidine base decreases its oxidation potential by 0.15 or 0.28 V, respectively. The calculated energy difference between the oxidation potential for the G.C base pair and that of the guanine base is in good agreement with the experimental value estimated recently (0.34 V: Caruso, T.; et al. J. Am. Chem. Soc. 2005, 127, 15040). The complete and consistent set of reversible redox values determined in this work for the DNA constituents is expected to be of considerable value to those studying charge and electronic energy transfer in DNA.
Metal-mediated DNA base pairing: alternatives to hydrogen-bonded Watson-Crick base pairs.
Takezawa, Yusuke; Shionoya, Mitsuhiko
2012-12-18
With its capacity to store and transfer the genetic information within a sequence of monomers, DNA forms its central role in chemical evolution through replication and amplification. This elegant behavior is largely based on highly specific molecular recognition between nucleobases through the specific hydrogen bonds in the Watson-Crick base pairing system. While the native base pairs have been amazingly sophisticated through the long history of evolution, synthetic chemists have devoted considerable efforts to create alternative base pairing systems in recent decades. Most of these new systems were designed based on the shape complementarity of the pairs or the rearrangement of hydrogen-bonding patterns. We wondered whether metal coordination could serve as an alternative driving force for DNA base pairing and why hydrogen bonding was selected on Earth in the course of molecular evolution. Therefore, we envisioned an alternative design strategy: we replaced hydrogen bonding with another important scheme in biological systems, metal-coordination bonding. In this Account, we provide an overview of the chemistry of metal-mediated base pairing including basic concepts, molecular design, characteristic structures and properties, and possible applications of DNA-based molecular systems. We describe several examples of artificial metal-mediated base pairs, such as Cu(2+)-mediated hydroxypyridone base pair, H-Cu(2+)-H (where H denotes a hydroxypyridone-bearing nucleoside), developed by us and other researchers. To design the metallo-base pairs we carefully chose appropriate combinations of ligand-bearing nucleosides and metal ions. As expected from their stronger bonding through metal coordination, DNA duplexes possessing metallo-base pairs exhibited higher thermal stability than natural hydrogen-bonded DNAs. Furthermore, we could also use metal-mediated base pairs to construct or induce other high-order structures. These features could lead to metal-responsive functional
Writing Assessment's "Debilitating Inheritance": Behaviorism's Dismissal of Experience
Wilson, Maja Joiwind
2013-01-01
In this project, I examine the legacy of behaviorism's dismissal of experience on contemporary writing assessment theory and practice within the field of composition studies. I use an archival study of John B. Watson's letters to Robert Mearns Yerkes to establish behaviorism's systematic denial of experience and its related constructs: mind,…
Novosjolova, Irina; Kennedy, Scott D; Rozners, Eriks
2017-11-02
The development of nucleic acid base-pair analogues that use new modes of molecular recognition is important both for fundamental research and practical applications. The goal of this study was to evaluate 2-methoxypyridine as a cationic thymidine mimic in the A-T base pair. The hypothesis was that including protonation in the Watson-Crick base pairing scheme would enhance the thermal stability of the DNA double helix without compromising the sequence selectivity. DNA and peptide nucleic acid (PNA) sequences containing the new 2-methoxypyridine nucleobase (P) were synthesized and studied by using UV thermal melting and NMR spectroscopy. Introduction of P nucleobase caused a loss of thermal stability of ≈10 °C in DNA-DNA duplexes and ≈20 °C in PNA-DNA duplexes over a range of mildly acidic to neutral pH. Despite the decrease in thermal stability, the NMR structural studies showed that P-A formed the expected protonated base pair at pH 4.3. Our study demonstrates the feasibility of cationic unnatural base pairs; however, future optimization of such analogues will be required. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H.; Cai, Yuqin; Rodriguez, Fabian A.; Sayer, Jane M.; Jerina, Donald M.; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E.
2012-01-01
The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the non-planar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely-studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14-position with the exocyclic amino group of guanine. Here, we present the first NMR solution structure of a DB[a,l]P-derived adduct, the 14R (+)-trans-anti-DB[a,l]P–N2-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N2-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3’-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3’-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE - DNA adduct conformation differs from: (1) the classical intercalation motif where Watson-Crick base-pairing is intact at the lesion site, and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix . The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed. PMID:23121427
Choice of single-particle potential and the convergence of the effective interaction
International Nuclear Information System (INIS)
Hjorth-Jensen, M.; Osnes, E.; Muether, H.; Schmid, K.W.
1990-02-01
The convergence of the expansion for the effective interaction is studied considering as example the shell model for the nuclei 18 O and 18 F. In this work the effective interaction is computed through third order in the Brueckner G matrix, using both a harmonic-oscillator (HO) basis and a Brueckner-Hartree-Fock (BHF) basis. The significant differences in the convergence behavior of the effective interaction in these two cases are reported. The results indicate that the choice of the BHF single-particle potential facilitates the convergence of the effective interaction in low-orders of the expansion, whereas the HO results exhibit a non-convergent behavior. The implications for the HO approach are discussed. All calculations have been performed considering a modern version of the Bonn one-boson-exchange potential for the nucleon-nucleon interaction. 23 refs., 4 figs., 2 tabs
Yazdi, Amir Amin; German, Tim P.; Defeyter, Margaret Anne; Siegal, Michael
2006-01-01
There is a change in false belief task performance across the 3-5 year age range, as confirmed in a recent meta-analysis [Wellman, H. M., Cross, D., & Watson, J. (2001). Meta-analysis of theory mind development: The truth about false-belief. "Child Development," 72, 655-684]. This meta-analysis identified several performance factors influencing…
On conjectures of Minkowski and Woods for n = 9
Indian Academy of Sciences (India)
Here we shall prove Conjecture II for n = 9, thereby proving Minkowski's Conjecture for n = 9. Woods [20 ... result that if hypothesis of Conjecture III holds, then any closed sphere in R9 of radius. √ ...... tures of Minkowski and Watson, Number Theory, Trends in Mathematics (2000) (Basel: ... Journal of the Indian Math. Soc.
Resilient Communication: A New Crisis Communication Strategy for Homeland Security
2012-03-01
communication theory. Author, Timothy Coombs , in Ongoing Crisis Communication , discusses the need for a crisis management 10 plan to prepare for potential... COMMUNICATION : A NEW CRISIS COMMUNICATION STRATEGY FOR HOMELAND SECURITY by Sharon L. Watson March 2012 Thesis Advisor: Christopher Bellavita...REPORT TYPE AND DATES COVERED Master’s Thesis 4. TITLE AND SUBTITLE Resilient Communication : A New Crisis Communication
African Journals Online (AJOL)
NICO
James Moir (1874–1929) played an important role in the field of chemistry in South ... into the colour of organic compounds and the relationship be- tween colour ...... theory put forward by E.R.Watson,34 the depth of colour, or the displacement .... cover-glass, such as used in microscopy, to photograph absorp- tion bands ...
Alcolea Palafox, M.; Rastogi, V. K.; Singh, S. P.
2018-01-01
The laser Raman and IR spectra of 5-chlorocytosine have been recorded and accurately assigned in the solid state using Density functional calculations (DFT) together with the linear scaling equation procedure (LSE) and the solid state simulation of the crystal unit cell through a tetramer form. These results remarkably improve those reported previously by other authors. Several new scaling equations were proposed to be used in related molecules. The six main tautomers of the biomolecule 5-chlorocytosine were determined and optimized at the MP2 and CCSD levels, using different basis sets. The relative stabilities were compared with those obtained in cytosine and their 5-halo derivatives. Several relationships between energies, geometric parameters and NBO atomic charges were established. The effect of the chlorine substitution in the fifth position was evaluated through the stability of the Watson-Crick (WC) base pair of 5-chlorodeoxycytidine with deoxyguanosine, and through their vibrational spectra.
Gilligan's different voice: a perspective for nursing.
Cooper, M C
1989-01-01
This article proposes that Carol Gilligan's ethic of care provides for nursing a paradigm for moral deliberation that demonstrates compatibility with nursing's historical and philosophical traditions of relational caring and furnishes empirical support for the value of caring as a moral activity. The appropriateness of Gilligan's theory for nursing is further illustrated by an elucidation of the similarities between Gilligan's theory and nurse theorist Jean Watson's claims that caring constitutes both a necessary and a fundamental component of nursing. It is argued that Gilligan's theory of moral deliberation more faithfully reflects the nursing experience than Kohlberg's contractual, Kantian theory, which currently dominates the nursing literature.
Three-Dimensional Evolution of Erupted Flux Ropes from the Sun (2-20 Solar Radii) to 1 AU
2012-12-01
public release; distribution unlimited 13. SUPPLEMENTARY NOTES Preprint, Solar Phys., 2013 14. ABSTRACT 15. SUBJECT TERMS 16. SECURITY ...NASA GSFC (USA), RAL and University of Birmingham (UK), MPS(Germany), CSL (Belgium), IOTA and IAS (France). References Brueckner, G.E., Howard, R.A
Recent developments in liquid helium 3
International Nuclear Information System (INIS)
Ramarao, I.
1977-01-01
The current status of the theories for the ground state of liquid helium 3, are reviewed. To begin with, a brief summary of the experimental results on the thermodynamic properties of liquid helium 3 including its recently discovered superfulid phases is given. The basic ideas of the Landau theory of a normal Fermi liquid are then introduced. A qualitative discussion of the current understanding of the anisotropic phases of superfluid helium 3 is given, the microscopic calculaations for the binding energy of liquid helium 3 are reviewed and the results obtained for the two-body contributions to the binding energy using the Brueckner-Goldstone formulation and that of Mohling and his collaborators are summarized and discussed. The importance of a proper estimate of the three-body contributions to the binding energy is stressed. The results obtained in the literature using variational methods and constrained variational methods are discussed. A critical analysis of the results by various methods is given. Despite much effort the basic problem of the ground state of liquid helium 3, remains unresolved. (author)
Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E
2012-12-04
The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.
Isobar degrees of freedom in nuclei
International Nuclear Information System (INIS)
Muether, H.
1979-01-01
A report is given on some recent investigations of the influence of isobar degrees of freedom on the ground state properties of finite nuclei like e.g. 16 O. The nucleon-nucleon (NN) interaction is constructed in the freamework of an extended one-boson-exchange (OBE) model using non-covariant, time-dependent perturbation theory. The explicit consideration of fourth-order iterative diagrams involving NΔ and ΔΔ intermediate states gives an effective NN interaction in the nuclear many-body system which is less attractive than those which are obtained treating these terms phenomenologically. Therefore the binding energy calculated in the Brueckner-Hartree-Fock approximation is smaller if these effects of isobar degrees of freedom are taken into account. This repulsive effect of isobar configurations is partly counterbalanced by the attraction obtained for three-nucleon terms with intermediate NNΔ states. (Auth.)
Improving the Knowledge Base in Teacher Education.
Rockler, Michael J.
Education in the United States for most of the last 50 years has built its knowledge base on a single dominating foundation--behavioral psychology. This paper analyzes the history of behaviorism. Syntheses are presented of the theories of Ivan P. Pavlov, J. B. Watson, and B. F. Skinner, all of whom contributed to the body of works on behaviorism.…
A proposal for re-defining the way the aetiology of schizophrenia ...
Indian Academy of Sciences (India)
2010-02-03
Feb 3, 2010 ... ``The two big problems – the nature of development and the nature of the mind – are being subdued. I don't know whether there will be beautiful, general theories to come out of this – something really nice like Watson and Crick's double helix – or whether there will be an accumulation of more and more ...
Luna Acosta, German Aurelio
The masses of observed hadrons are fitted according to the kinematic predictions of Conformal Relativity. The hypothesis gives a remarkably good fit. The isospin SU(2) gauge invariant Lagrangian L(,(pi)NN)(x,(lamda)) is used in the calculation of d(sigma)/d(OMEGA) to 2nd-order Feynman graphs for simplified models of (pi)N(--->)(pi)N. The resulting infinite mass sums over the nucleon (Conformal) families are done via the Generalized-Sommerfeld-Watson Transform Theorem. Even though the models are too simple to be realistic, they indicate that if (DELTA)-internal lines were to be included, 2nd-order Feynman graphs may reproduce the experimental data qualitatively. The energy -dependence of the propagator and couplings in Conformal QFT is different from that of ordinary QFT. Suggestions for further work are made in the areas of ultra-violet divergences and OPEC calculations.
International Nuclear Information System (INIS)
Gao, X.; Patel, D.J.
1988-01-01
The authors report on two-dimensional proton NMR studies of echinomycin complexes with the self-complementary d(A1-C2-G3-Tr) and d(T1-C2-G3-A4) duplexes in aqueous solution. The exchangeable and nonexchangeable antibiotic and nucleic acid protons in the 1 echinomycin per tetranucleotide duplex complexes have been assigned from analyses of scalar coupling and distance connectivities in two-dimensional data sets records in H 2 O and D 2 O solution. An analysis of the intermolecular NOE patterns for both complexes combined with large upfield imino proton and large downfield phosphorus complexation chemical shift changes demonstrates that the two quinoxaline chromophores of echinomycin bisintercalate into the minor groove surrounding the dC-dG step of each tetranucleotide duplex. Further, the quinoxaline rings selectively stack between A1 and C2 bases in the d(ACGT) complex and between T1 and C2 bases in the d(TCGA) complex. The intermolecular NOE patterns and the base and sugar proton chemical shifts for residues C2 and G3 are virtually identical for the d(ACGT) and d(TCGA) complexes. A large set of intermolecular contacts established from nuclear Overhauser effects (NOEs) between antibiotic and nucleic acid protons in the echinomycin-tetranucleotide complexes in solution are consistent with corresponding contacts reported for echinomycin-oligonucleotide complexes in the crystalline state. The authors demonstrate that the G x G base pairs adopt Watson-Crick pairing in both d(ACGT) and d(TCGA) complexes in solution. By contrast, the A1 x T4 base pairs adopt Hoogsteen pairing for the echinomycin-d(A1-C2-G3-Tr) complex while the T1 x A4 base pairs adopt Watson-Crick pairing for the echinomycin-d(T1-C2-G3-A4) complex in aqueous solution. These results emphasize the role of sequence in discriminating between Watson-Crick and Hoogsteen pairs at base pairs flanking the echinomycin bisintercalation site in solution
DEFF Research Database (Denmark)
Pedersen, Michael Haldrup
Numerous are the signs and markers at museums and heritage sites instructing bodies to “stop, look and listen” (Ingold 2000: 243). Screens to be watched, gadgets and touch sensitive switches to be activated, films to be gazed at in silent concentration or interactive spectacles to participate in...... in tourism. Drawing in particular on performance based readings of heritage consumption and tourism (Haldrup and Larsen 2010; Waterton and Watson 2014; Haldrup and Bærenholdt 2015) as well as developments in non-representational theory and affect theory (Anderson and Harrison 2010; Massumi 2014; Timm Knudsen...
1989-10-01
Aires, and Philips Laboratory at Briarcliff, NY. B. Cernuschi-Frias is with Facultad de Ingenieria , Universidad de Buenos Aires, Buenos Aires... Ingenieria , Universidad de Buenos Aires, and from IBM (Thomas J. Watson Research Center). David B. Cooper (S’53-M’64) received the B.Sc. and Sc.M
Sathyamoorthy, Bharathwaj; Shi, Honglue; Zhou, Huiqing; Xue, Yi; Rangadurai, Atul; Merriman, Dawn K; Al-Hashimi, Hashim M
2017-05-19
In the canonical DNA double helix, Watson-Crick (WC) base pairs (bps) exist in dynamic equilibrium with sparsely populated (∼0.02-0.4%) and short-lived (lifetimes ∼0.2-2.5 ms) Hoogsteen (HG) bps. To gain insights into transient HG bps, we used solution-state nuclear magnetic resonance spectroscopy, including measurements of residual dipolar couplings and molecular dynamics simulations, to examine how a single HG bp trapped using the N1-methylated adenine (m1A) lesion affects the structural and dynamic properties of two duplexes. The solution structure and dynamic ensembles of the duplexes reveals that in both cases, m1A forms a m1A•T HG bp, which is accompanied by local and global structural and dynamic perturbations in the double helix. These include a bias toward the BI backbone conformation; sugar repuckering, major-groove directed kinking (∼9°); and local melting of neighboring WC bps. These results provide atomic insights into WC/HG breathing dynamics in unmodified DNA duplexes as well as identify structural and dynamic signatures that could play roles in m1A recognition and repair. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Javad Azarhoosh, Mohammad; Halladj, Rouein; Askari, Sima
2017-10-01
In this study, a new kinetic model for methanol to light olefins (MTO) reactions over a hierarchical SAPO-34 catalyst using the Langmuir-Hinshelwood-Hougen-Watson (LHHW) mechanism was presented and the kinetic parameters was obtained using a genetic algorithm (GA) and genetic programming (GP). Several kinetic models for the MTO reactions have been presented. However, due to the complexity of the reactions, most reactions are considered lumped and elementary, which cannot be deemed a completely accurate kinetic model of the process. Therefore, in this study, the LHHW mechanism is presented as kinetic models of MTO reactions. Because of the non-linearity of the kinetic models and existence of many local optimal points, evolutionary algorithms (GA and GP) are used in this study to estimate the kinetic parameters in the rate equations. Via the simultaneous connection of the code related to modelling the reactor and the GA and GP codes in the MATLAB R2013a software, optimization of the kinetic models parameters was performed such that the least difference between the results from the kinetic models and experiential results was obtained and the best kinetic parameters of MTO process reactions were achieved. A comparison of the results from the model with experiential results showed that the present model possesses good accuracy.
What happened to the Kuo-Brown interaction?
International Nuclear Information System (INIS)
Osnes, E.
1987-01-01
Twenty years of efforts to calculate the shell-model effective interaction, starting from the free nucleon-nucleon (NN) interaction and using many-body perturbation theory, are briefly reviewed. A description is given of the pioneering work of Kuo and Brown, in which the effective interaction was approximated by the Bethe-Brueckner-Goldstone G-matrix and the lowest order core-polarization correction. Subsequent developments which cast doubt upon the simple Kuo-Brown approximation are reviewed. Some of these problems have been shown to arise from inadequate treatment of various higher order contributions, whereas other problems are related to the strong tensor component of the NN interaction used. In fact, modern meson-exchange potentials have much weaker tensor forces and give rise to effective interactions which are similar to the original Kuo-Brown interaction. Applications of these new effective forces to shell-model calculations in the sd-shell are discussed
Effective mass of a #betta#-particle in nuclear matter and OBE #betta#-n interactions
International Nuclear Information System (INIS)
Bando, Hiroharu; Nagata, Sinobu.
1982-01-01
The effective mass of a lambda particle (M sub( lambda )*) in nuclear matter is investigated within the framework of the lowest-order Brueckner theory by employing the Nijmegen OBE lambda -N interaction model D and F. The non-locality mass (M tilde sub( lamda )) and the energy mass (anti M sub( lambda )) are evaluated and discussed in the light of the characteristics of the two models. In comparison with the model D, the model F yields smaller anti M sub( lambda ) and larger anti M sub( lamb da ) reflecting the stronger Majorana exchange force and the stronger lambda N- sigma N coupling tensor force. Final results of M sub( lambda )*/M sub( lambda ) are 0.85 for D and 0.79 for F. In view of the effective lambda mass inferred from observed properties of the single particle potential for lambda , the model D interaction seems to be more adequate. (author)
Wright, Ian; Bevin, William
2017-11-25
An inspirational equine veterinary surgeon with a keen interest in racing, to whom horses were a way of life. He took much pride in the success of his homebred racehorses. British Veterinary Association.
The practice of nurses caring for families of pediatric inpatients in light of Jean Watson
Directory of Open Access Journals (Sweden)
Maiara Rodrigues dos Santos
2014-08-01
Full Text Available Objective To know the facilities and the difficulties of nurses in caring practice of hospitalized children’s families in the light of Jean Watson’s Theory of Human Caring. Method It was used the descriptive qualitative approach. The data collection was conducted in three stages: presentation of theoretical content; engagement with families in the light of Watson’s theory; and semi-structured interview with 12 pediatric nurses. The interviews were analysed using inductive thematic analysis, being possible to form three themes: Recognizing a framework for care; Considering the institutional context; and Challenges in family’s relationship. Results The theory favored reflections about self, about the institutions and about nurses’ relationship with the family of the child, normalized by a consciousness toward caring attitudes. Conclusion In this process, it is imperative that nurses recognize the philosophical-theoretical foundations of care to attend the child’s family in hospital.
International Nuclear Information System (INIS)
Zuo Wei; Lu Guangcheng; Li Zenghua; Luo Peiyan; Chinese Academy of Sciences, Beijing
2005-01-01
The finite temperature Brueckner-Hartree-Fock (FTBHF) approach is extended by introducing a microscopic three-body force. Within the extended approach, the three-body force effects on the equation of state of hot nuclear matter and its temperature dependence have been investigated. The critical properties of the liquid-gas phase transition of hot nuclear matter have been calculated. It is shown that the three-body force provides a repulsive contribution to the equation of state of hot nuclear matter. The repulsive effect of the three-body force becomes more pronounced as the density and temperature increase and consequently inclusion of the three-body force contribution in the calculation reduces the predicted critical temperature from about 16 MeV to about 13 MeV. By separating the contribution originated from the 2σ-exchange process coupled to the virtual excitation of a nucleon-antinucleon pair from the full three-body force, the connection between the three-body force effect and the relativistic correction from the Dirac-Brueckner-Hartree-Fock has been explored. It turns out that the contribution of the 2σ-N(N-bar) part is more repulsive than that of the full three-body force and the calculated critical temperature is about 11 MeV if only the 2σ-N(N-bar) component of the three-body force is included which is lower than the value obtained in the case of including the full three-body force and is close to the value predicted by the Dirac-Brueckner-Hartree-Fock (DBHF) approach. Our result provides a reasonable explanation for the discrepancy between the values of critical temperature predicted from the FTBHF approach including the three-body force and the DBHF approach. (authors)
Zirkel, Jack
Sherlock Holmes and Dr. Watson went on a camping trip. As they lay down for the night, Holmes said, “Watson, look up at the sky and tell me what you see.”Watson:“! see millions and millions of stars.”
Relativistic approach to nuclear structure
International Nuclear Information System (INIS)
Nguyen Van Giai; Bouyssy, A.
1987-03-01
Some recent works related with relativistic models of nuclear structure are briefly reviewed. The Dirac-Hartree-Fock and Dirac-Brueckner-Hartree-Fock are recalled and illustrated by some examples. The problem of isoscalar current and magnetic moments of odd nuclei is discussed. The application of the relativistic model to the nuclear response function is examined
A quantum theoretical study of reactions of methyldiazonium ion with DNA base pairs
International Nuclear Information System (INIS)
Shukla, P.K.; Ganapathy, Vinay; Mishra, P.C.
2011-01-01
Graphical abstract: Reactions of methyldiazonium ion at the different sites of the DNA bases in the Watson-Crick GC and AT base pairs were investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Display Omitted Highlights: → Methylation of the DNA bases is important as it can cause mutation and cancer. → Methylation reactions of the GC and AT base pairs with CH 3 N 2 + were not studied earlier theoretically. → Experimental observations have been explained using theoretical methods. - Abstract: Methylation of the DNA bases in the Watson-Crick GC and AT base pairs by the methyldiazonium ion was investigated employing density functional and second order Moller-Plesset (MP2) perturbation theories. Methylation at the N3, N7 and O6 sites of guanine, N1, N3 and N7 sites of adenine, O2 and N3 sites of cytosine and the O2 and O4 sites of thymine were considered. The computed reactivities for methylation follow the order N7(guanine) > N3(adenine) > O6(guanine) which is in agreement with experiment. The base pairing in DNA is found to play a significant role with regard to reactivities of the different sites.
International Nuclear Information System (INIS)
Becker, R.L.; Svenne, J.P.
1975-12-01
Energy levels of states connected by a symmetry of the Hamiltonian normally should be degenerate. In self-consistent field theories, when only one of a pair of single-particle levels connected by a symmetry of the full Hamiltonian is occupied, the degeneracy is split and the unoccupied level often lies below the occupied one. Inversions of neutron-proton (charge) and time-reversal doublets in odd nuclei, charge doublets in even nuclei with a neutron excess, and spin-orbit doublets in spherical configurations with spin-unsaturated shells are examined. The origin of the level inversion is investigated, and the following explanation offered. Unoccupied single-particle levels, from a calculation in an A-particle system, should be interpreted as levels of the (A + 1)-particle system. When the symmetry-related level, occupied in the A-particle system, is also calculated in the (A + 1)-particle system it is degenerate with or lies lower than the other. That is, when both levels are calculated in the (A + 1)-particle system, they are not inverted. It is demonstrated that the usual prescription to occupy the lowest-lying orbitals should be modified to refer to the single-particle energies calculated in the (A + 1)- or the (A - 1)-particle system. This observation is shown to provide a justification for avoiding an oscillation of occupancy between symmetry-related partners in successive iterations leading to a self-consistency. It is pointed out that two degenerate determinants arise from occupying one or the other partner of an initially degenerate pair of levels and then iterating to self-consistency. The existence of the degenerate determinants indicates the need for introducing correlations, either by mixing the two configurations or by allowing additional symmetry-breaking (resulting in a more highly deformed non-degenerate configuration). 2 figures, 3 tables, 43 references
MACCIA, ELIZABETH S.; AND OTHERS
AN ANNOTATED BIBLIOGRAPHY OF 20 ITEMS AND A DISCUSSION OF ITS SIGNIFICANCE WAS PRESENTED TO DESCRIBE CURRENT UTILIZATION OF SUBJECT THEORIES IN THE CONSTRUCTION OF AN EDUCATIONAL THEORY. ALSO, A THEORY MODEL WAS USED TO DEMONSTRATE CONSTRUCTION OF A SCIENTIFIC EDUCATIONAL THEORY. THE THEORY MODEL INCORPORATED SET THEORY (S), INFORMATION THEORY…
Burgio, G. F.
2018-03-01
We discuss the structure of Neutron Stars by modelling the homogeneous nuclear matter of the core by a suitable microscopic Equation of State, based on the Brueckner-Hartree-Fock many-body theory, and the crust, including the pasta phase, by the BCPM energy density functional which is based on the same Equation of State. This allows for a uni ed description of the Neutron Star matter over a wide density range. A comparison with other uni ed approaches is discussed. With the same Equation of State, which features strong direct Urca processes and using consistent nuclear pairing gaps as well as effective masses, we model neutron star cooling, in particular the current rapid cooldown of the neutron star Cas A. We nd that several scenarios are possible to explain the features of Cas A, but only large and extended proton 1 S 0 gaps and small neutron 3 PF 2 gaps can accommodate also the major part of the complete current cooling data.
Effects of self-consistency in a Green's function description of saturation in nuclear matter
International Nuclear Information System (INIS)
Dewulf, Y.; Neck, D. van; Waroquier, M.
2002-01-01
The binding energy in nuclear matter is evaluated within the framework of self-consistent Green's function theory, using a realistic nucleon-nucleon interaction. The two-body dynamics is solved at the level of summing particle-particle and hole-hole ladders. We go beyond the on-shell approximation and use intermediary propagators with a discrete-pole structure. A three-pole approximation is used, which provides a good representation of the quasiparticle excitations, as well as reproducing the zeroth- and first-order energy-weighted moments in both the nucleon removal and addition domains of the spectral function. Results for the binding energy are practically independent of the details of the discretization scheme. The main effect of the increased self-consistency is to introduce an additional density dependence, which causes a shift towards lower densities and smaller binding energies, as compared to a (continuous choice) Brueckner calculation with the same interaction. Particle number conservation and the Hugenholz-Van Hove theorem are satisfied with reasonable accuracy
Halo nuclei studied by relativistic mean-field approach
International Nuclear Information System (INIS)
Gmuca, S.
1997-01-01
Density distributions of light neutron-rich nuclei are studied by using the relativistic mean-field approach. The effective interaction which parameterizes the recent Dirac-Brueckner-Hartree-Fock calculations of nuclear matter is used. The results are discussed and compared with the experimental observations with special reference to the neutron halo in the drip-line nuclei. (author)
String theory or field theory?
International Nuclear Information System (INIS)
Marshakov, Andrei V
2002-01-01
The status of string theory is reviewed, and major recent developments - especially those in going beyond perturbation theory in the string theory and quantum field theory frameworks - are analyzed. This analysis helps better understand the role and place of string theory in the modern picture of the physical world. Even though quantum field theory describes a wide range of experimental phenomena, it is emphasized that there are some insurmountable problems inherent in it - notably the impossibility to formulate the quantum theory of gravity on its basis - which prevent it from being a fundamental physical theory of the world of microscopic distances. It is this task, the creation of such a theory, which string theory, currently far from completion, is expected to solve. In spite of its somewhat vague current form, string theory has already led to a number of serious results and greatly contributed to progress in the understanding of quantum field theory. It is these developments which are our concern in this review. (reviews of topical problems)
Becker, Katrin; Becker, Melanie; Schwarz, John H.
String theory is one of the most exciting and challenging areas of modern theoretical physics. This book guides the reader from the basics of string theory to recent developments. It introduces the basics of perturbative string theory, world-sheet supersymmetry, space-time supersymmetry, conformal field theory and the heterotic string, before describing modern developments, including D-branes, string dualities and M-theory. It then covers string geometry and flux compactifications, applications to cosmology and particle physics, black holes in string theory and M-theory, and the microscopic origin of black-hole entropy. It concludes with Matrix theory, the AdS/CFT duality and its generalizations. This book is ideal for graduate students and researchers in modern string theory, and will make an excellent textbook for a one-year course on string theory. It contains over 120 exercises with solutions, and over 200 homework problems with solutions available on a password protected website for lecturers at www.cambridge.org/9780521860697. Comprehensive coverage of topics from basics of string theory to recent developments Ideal textbook for a one-year course in string theory Includes over 100 exercises with solutions Contains over 200 homework problems with solutions available to lecturers on-line
String theory or field theory?
International Nuclear Information System (INIS)
Marshakov, A.V.
2002-01-01
The status of string theory is reviewed, and major recent developments - especially those in going beyond perturbation theory in the string theory and quantum field theory frameworks - are analyzed. This analysis helps better understand the role and place of experimental phenomena, it is emphasized that there are some insurmountable problems inherent in it - notably the impossibility to formulate the quantum theory of gravity on its basis - which prevent it from being a fundamental physical theory of the world of microscopic distances. It is this task, the creation of such a theory, which string theory, currently far from completion, is expected to solve. In spite of its somewhat vague current form, string theory has already led to a number of serious results and greatly contributed to progress in the understanding of quantum field theory. It is these developments, which are our concern in this review [ru
George Gamow: a most talented and creative scientist
International Nuclear Information System (INIS)
Yang Qingyu
2002-01-01
As one of the most prominent scientists of the 20th century, George Gamow made notable contributions to many fields of science in his life time. In nuclear physics he proposed the well known 'nuclear potential barrier channel effect' and the Gamow-Teller transition probability of beta decay. In cosmology he did his almost to advocate the 'big bang' theory. Through extraordinary intuition he proposed a theory about how genetic codes work in molecular biology, which was later verified by Watson, Crick and Nirenbery. Gamow's unique style of research and his spirit of bringing forth new ideas in interdisciplinary subjects has greatly benefited scientific research
International Nuclear Information System (INIS)
Watson, Stephen R.
1995-01-01
In their comment on a recent contribution of mine, [Watson, S., The meaning of probability in probabilistic safety analysis. Reliab. Engng and System Safety, 45 (1994) 261-269.] Yellman and Murray assert that (1) I argue in favour of a realistic interpretation of probability for PSAs; (2) that the only satisfactory philosophical theory of probability is the relative frequency theory; (3) that I mean the same thing by the words 'uncertainty' and 'probability'; (4) that my argument can easily lead to the belief that the output of PSAs are meaningless. I take issue with all these points, and in this response I set out my arguments
STONE, PETER
2008-01-01
PUBLISHED When James Watson and Francis Crick submitted to Nature their groundbreaking paper relating DNA structure to protein synthesis, they faced a choice. In what order were their names to be listed? Would it be ?Watson and Crick,? or ?Crick and Watson?? They resolved the matter by tossing a coin (Crick, 1988, p. 66)
The Brueckner-Goldstone method and its application in light nuclei
International Nuclear Information System (INIS)
Ulehla, I.; Nguyen, N.T.
1976-01-01
A new method for solving the reaction matrix equation is described. In this method the Pauli operator is treated exactly and the reaction matrix is found straightforwardly from systems of differential and algebraic equations. The three-body cluster contribution is discussed. The low truncation used in computation of it in other papers is shown to be unsatisfactory. A dependence of computed binding energy on the formally introduced parameter lambda, corresponding to the shift of the single-particle spectrum of unoccupied states, is studied. In principle, the exact results should not depend on lambda and therefore in an approximate calculation one must achieve a weak dependence on this parameter. It is shown that in this case the consideration of the third order in the Goldstone series is necessary. Various conditions are suggested for choosing the parameter lambda. As an example of light nuclei, the 4 He nucleus is chosen. Its binding energy is found to be about 20 MeV, both for the Reid potential and the RHEL potential. (Auth.)
Isospin-dependent term in the relativistic microscopic optical potential
International Nuclear Information System (INIS)
Rong Jian; Ma Zhongyu; National Laboratory of Heavy Ion Accelerator of Lanzhou, Lanzhou; Chinese Academy of Sciences, Beijing
2005-01-01
The isospin-dependence of the relativistic microscopic optical potential is investigated in the Dirac Brueckner-Hartree-Fock approach. The isospin part of the microscopic optical potential is emphasized. A local density approximation is adopted for finite nuclei. Taking 208 Pb as example, the difference between proton and neutron optical potentials is studied and compared with the phenomenological Lane Model potential. (authors)
Intelligence: Pre-Theory and Post-Theory
Directory of Open Access Journals (Sweden)
James R. Flynn
2014-02-01
Full Text Available Defining “intelligence” exemplifies a mistake that has historical precedent: confusing the role of pre-theory and post-theory definitions. In every area, pre-theory concepts give broad directions for investigation: are the movements of heavenly bodies affected by the existence of other heavenly bodies? Post-theory concepts add precision and predictability. The mistake occurs when a successful theory like Newton’s demands that its peculiar and precise theory-imbedded concept forbids competing theories: Einstein was impossible (warping of space so long as it was assumed that all theories must be in accord with Newton’s concept (attraction across space. In psychology, Arthur Jensen made the same mistake. He gave his theory-embedded concept of g the role of executioner: the significance of every phenomenon had to be interpreted by its compatibility with g; and thus trivialized the significance of IQ gains over time. This is only one instance of a perennial demand: give us a precise definition of “intelligence” to guide our research. However, precision comes after research has generated a theory and its very precision stifles competing research. Be happy with a broad definition on the pre-theory level that lets many competing theories bloom: pre-theory precision equals post-theory poverty.
Superconducting Qubit with Integrated Single Flux Quantum Controller Part I: Theory and Fabrication
Beck, Matthew; Leonard, Edward, Jr.; Thorbeck, Ted; Zhu, Shaojiang; Howington, Caleb; Nelson, Jj; Plourde, Britton; McDermott, Robert
As the size of quantum processors grow, so do the classical control requirements. The single flux quantum (SFQ) Josephson digital logic family offers an attractive route to proximal classical control of multi-qubit processors. Here we describe coherent control of qubits via trains of SFQ pulses. We discuss the fabrication of an SFQ-based pulse generator and a superconducting transmon qubit on a single chip. Sources of excess microwave loss stemming from the complex multilayer fabrication of the SFQ circuit are discussed. We show how to mitigate this loss through judicious choice of process workflow and appropriate use of sacrificial protection layers. Present address: IBM T.J. Watson Research Center.
M-Theory and Maximally Supersymmetric Gauge Theories
Lambert, Neil
2012-01-01
In this informal review for non-specalists we discuss the construction of maximally supersymmetric gauge theories that arise on the worldvolumes branes in String Theory and M-Theory. Particular focus is made on the relatively recent construction of M2-brane worldvolume theories. In a formal sense, the existence of these quantum field theories can be viewed as predictions of M-Theory. Their construction is therefore a reinforcement of the ideas underlying String Theory and M-Theory. We also briefly discuss the six-dimensional conformal field theory that is expected to arise on M5-branes. The construction of this theory is not only an important open problem for M-Theory but also a significant challenge to our current understanding of quantum field theory more generally.
Report of seminar on relativistic approach to nuclear reaction and nuclear structure
International Nuclear Information System (INIS)
1986-05-01
A seminar on 'Relativistic Approach to Nuclear Reaction and Nuclear Structure' was held in 1985 at Osaka University. This booklet includes twenty-four reports given at the seminar, which deal with: Conventional Nonrelativistic Description of Nuclear Matter and Nuclear Spin-Orbit Interactions; Relativistic Approach to Nuclear Structure; Atomic and Molecular Structure Calculations; Electromagnetic Interaction in Nucleus and Relativistic Effect; Nuclear Magnetic Moment in the Relativistic Mean Field Theory, Effective Mass and Particle-Vibration Coupling in the Relativistic σ-ω Model; Gauge Invariance in Relativistic Many-Body Theory; Relativistic Description of Nucleon-Nucleon Interaction in Review; σ-Particle in NN Interaction; Nuclear Optical Potentials Based on the Brueckner-Hartree-Fock Approach; Elastic Backscattering and Optical Potential; Description of Intermediate-Energy Nuclear Reactions; Dirac Phenomenology at E(p) = 65 MeV; Relativistic Impulse Approximation; Reaction Studies with Intermediate Energy Deuterons at SATURNE; Folding Model for Intermediate-Energy Deutron Scattering; Folding Model for Polarized Deutron Scattering at 700 MeV; Dirac Approach Problems and a Different Viewpoint; Relativistic Approach and EMC Effect; Quasielastic Electron Scattering; Response Function of Quasielastic Electron Scattering; Relativistic Hartree Response Function for Quasielastic Electron Scattering on 12 C and 40 Ca; Backflow-, Retardation- and Relativistic Effects on the Longitudinal Response Function of Nuclear Matter; Pion-Photoproduction in the σ-ω Model. (Nogami, K.)
Superimposed Code Theorectic Analysis of DNA Codes and DNA Computing
2010-03-01
that the hybridization that occurs between a DNA strand and its Watson - Crick complement can be used to perform mathematical computation. This research...ssDNA single stranded DNA WC Watson – Crick A Adenine C Cytosine G Guanine T Thymine ... Watson - Crick (WC) duplex, e.g., TCGCA TCGCA . Note that non-WC duplexes can form and such a formation is called a cross-hybridization. Cross
Panczyk, Tomasz; Wolski, Pawel
2018-06-01
This work deals with a molecular dynamics analysis of the protonated and deprotonated states of the natural sequence d[(CCCTAA) 3 CCCT] of the telomeric DNA forming the intercalated i-motif or paired with the sequence d[(CCCTAA) 3 CCCT] and forming the Watson-Crick (WC) duplex. By utilizing the amber force field for nucleic acids we built the i-motif and the WC duplex either with native cytosines or using their protonated forms. We studied, by applying molecular dynamics simulations, the role of hydrogen bonds between cytosines or in cytosine-guanine pairs in the stabilization of both structures in the physiological fluid. We found that hydrogen bonds exist in the case of protonated i-motif and in the standard form of the WC duplex. They, however, vanish in the case of the deprotonated i-motif and protonated form of the WC duplex. By determining potentials of mean force in the enforced unwrapping of these structures we found that the protonated i-motif is thermodynamically the most stable. Its deprotonation leads to spontaneous and observed directly in the unbiased calculations unfolding of the i-motif to the hairpin structure at normal temperature. The WC duplex is stable in its standard form and its slight destabilization is observed at the acidic pH. However, the protonated WC duplex unwraps very slowly at 310 K and its decomposition was not observed in the unbiased calculations. At higher temperatures (ca. 400 K or more) the WC duplex unwraps spontaneously. Copyright © 2018. Published by Elsevier B.V.
Towards a theory of spacetime theories
Schiemann, Gregor; Scholz, Erhard
2017-01-01
This contributed volume is the result of a July 2010 workshop at the University of Wuppertal Interdisciplinary Centre for Science and Technology Studies which brought together world-wide experts from physics, philosophy and history, in order to address a set of questions first posed in the 1950s: How do we compare spacetime theories? How do we judge, objectively, which is the “best” theory? Is there even a unique answer to this question? The goal of the workshop, and of this book, is to contribute to the development of a meta-theory of spacetime theories. Such a meta-theory would reveal insights about specific spacetime theories by distilling their essential similarities and differences, deliver a framework for a class of theories that could be helpful as a blueprint to build other meta-theories, and provide a higher level viewpoint for judging which theory most accurately describes nature. But rather than drawing a map in broad strokes, the focus is on particularly rich regions in the “space of spaceti...
Brovarets', Ol'ha O; Hovorun, Dmytro M
2015-01-01
It was established for the first time by DFT and MP2 quantum-mechanical (QM) methods either in vacuum, so in the continuum with a low dielectric constant (ε = 4), typical for hydrophobic interfaces of specific protein-nucleic acid interactions, that the repertoire for the tautomerisation of the biologically important adenine · cytosine* (A · C*) mismatched DNA base pair, formed by the amino tautomer of the A and the imino mutagenic tautomer of the C, into the A*·C base mispair (∆G = 2.72 kcal mol(-1) obtained at the MP2 level of QM theory in the continuum with ε = 4), formed by the imino mutagenic tautomer of the A and the amino tautomer of the C, proceeds via the asynchronous concerted double proton transfer along two antiparallel H-bonds through the transition state (TSA · C* ↔ A* · C). The limiting stage of the A · C* → A* · C tautomerisation is the final proton transfer along the intermolecular N6H · · · N4 H-bond. It was found that the A · C*/A* · C DNA base mispairs with Watson-Crick geometry are associated by the N6H · · · N4/N4H · · · N6, N3H · · · N1/N1H · · · N3 and C2H · · · O2 H-bonds, respectively, while the TSA · C*↔ A* · C is joined by the N6-H-N4 covalent bridge and the N1H · · · N3 and C2H · · · O2 H-bonds. It was revealed that the A · C* ↔ A* · C tautomerisation is assisted by the true C2H · · · O2 H-bond, that in contrast to the two others conventional H-bonds exists along the entire intrinsic reaction coordinate (IRC) range herewith becoming stronger at the transition from vacuum to the continuum with ε = 4. To better understand the behavior of the intermolecular H-bonds and base mispairs along the IRC of the A · C* ↔ A* · C tautomerisation, the profiles of their electron-topological, energetical, geometrical, polar and charge characteristics are reported in this study. It was established based on the profiles of the H-bond energies that all three H-bonds are cooperative, mutually
Theoretical and computational studies in intermediate energy nuclear physics
International Nuclear Information System (INIS)
Elster, C.
1993-08-01
The research includes applications of many-body scattering theory to nuclear systems and studies of few-body systems described by effective hadronic field theories. Progress was made in bringing all first-order effects into the nonrelativistic elastic nucleon-nucleus scattering in a consistent fashion. This work is directed towards completely and reliably calculating the first-order term in a Watson expansion including a modification through the nulear medium. The research effort in few-body physics was concentrated on nucleon-nucleon (NN) scattering below pion production threshold, where recent measurements indicated that the backward-angle neutron-proton (np) differential cross section may show sensitivity to the size of the pion-nucleon coupling constant
Widespread Transient Hoogsteen Base-Pairs in Canonical Duplex DNA with Variable Energetics
Alvey, Heidi S.; Gottardo, Federico L.; Nikolova, Evgenia N.; Al-Hashimi, Hashim M.
2015-01-01
Hoogsteen base-pairing involves a 180 degree rotation of the purine base relative to Watson-Crick base-pairing within DNA duplexes, creating alternative DNA conformations that can play roles in recognition, damage induction, and replication. Here, using Nuclear Magnetic Resonance R1ρ relaxation dispersion, we show that transient Hoogsteen base-pairs occur across more diverse sequence and positional contexts than previously anticipated. We observe sequence-specific variations in Hoogsteen base-pair energetic stabilities that are comparable to variations in Watson-Crick base-pair stability, with Hoogsteen base-pairs being more abundant for energetically less favorable Watson-Crick base-pairs. Our results suggest that the variations in Hoogsteen stabilities and rates of formation are dominated by variations in Watson-Crick base pair stability, suggesting a late transition state for the Watson-Crick to Hoogsteen conformational switch. The occurrence of sequence and position-dependent Hoogsteen base-pairs provide a new potential mechanism for achieving sequence-dependent DNA transactions. PMID:25185517
Dependence theory via game theory
Grossi, D.; Turrini, P.
2011-01-01
In the multi-agent systems community, dependence theory and game theory are often presented as two alternative perspectives on the analysis of social interaction. Up till now no research has been done relating these two approaches. The unification presented provides dependence theory with the sort
Rationality, Theory Acceptance and Decision Theory
Directory of Open Access Journals (Sweden)
J. Nicolas Kaufmann
1998-06-01
Full Text Available Following Kuhn's main thesis according to which theory revision and acceptance is always paradigm relative, I propose to outline some possible consequences of such a view. First, asking the question in what sense Bayesian decision theory could serve as the appropriate (normative theory of rationality examined from the point of view of the epistemology of theory acceptance, I argue that Bayesianism leads to a narrow conception of theory acceptance. Second, regarding the different types of theory revision, i.e. expansion, contraction, replacement and residuals shifts, I extract from Kuhn's view a series of indications showing that theory replacement cannot be rationalized within the framework of Bayesian decision theory, not even within a more sophisticated version of that model. Third, and finally, I will point to the need for a more comprehensive model of rationality than the Bayesian expected utility maximization model, the need for a model which could better deal with the different aspects of theory replacement. I will show that Kuhn's distinction between normal and revolutionary science gives us several hints for a more adequate theory of rationality in science. I will also show that Kuhn is not in a position to fully articulate his main ideas and that he well be confronted with a serious problem concerning collective choice of a paradigm.
Deuerling, K. M.; Martin, J. B.; Martin, E. E.; Scribner, C. A.
2013-12-01
Chemical weathering of silicate rocks in glacial forelands is a potential sink for atmospheric CO2 and therefore may impact long-term climate variability. Physical weathering in glacial environments enhances the rate of chemical weathering, particularly through subglacial production of rock flour with a high surface area to volume ratio. This reactive material is transported to and chemically weathered within the proglacial system, increasing concentrations of solutes as water flows downstream. Water from proglacial rivers may also acquire solutes and draw down atmospheric CO2 through reactions driven by hyporheic zone (HZ) exchange in the broad, braided reaches of the river channel. However, few studies have addressed this process and none to date have directly examined porewater contributions. We address these questions in the Watson River/Akuliarusiarsuup Kuua (WR), which flows approximately 40 km from its headwaters, through the town of Kangerlussuaq, and into Søndre Strømfjord. We have collected river water samples five times from six sites over the 2012 and 2013 summer melt seasons and three transects of PW from sand flats located along the river. Specific conductivity (SpC), pH, and dissolved ion concentrations increase downstream, consistent with ongoing chemical weathering reactions along the flow path. Relative abundances of Na+, K+, and SiO2 increase downstream relative to Ca2+ and Mg2+ concentrations. These signals indicate preferential dissolution of biotite and/or alkali feldspar. Additionally, 206Pb/204Pb ratios become more nonradiogenic downstream, lending further evidence to dissolution of readily weathered minerals. Over the course of the melt season, SpC, pH, and dissolved ion concentrations decrease, consistent with the increase in discharge due to supraglacial melting. The greatest downstream SpC increase (~2x) occurs where the river exits largely bedrock channeled flow and enters the braided portion at the Sandflugtdalen. In general, PW
Non-relativistic and relativistic quantum kinetic equations in nuclear physics
International Nuclear Information System (INIS)
Botermans, W.M.M.
1989-01-01
In this thesis an attempt is made to draw up a quantummechanical tranport equation for the explicit calculation oof collision processes between two (heavy) ions, by making proper approaches of the exact equations (non-rel.: N-particles Schroedinger equation; rel.: Euler-Lagrange field equations.). An important starting point in the drag-up of the theory is the behaviour of nuclear matter in equilibrium which is determined by individual as well as collective effects. The central point in this theory is the effective interaction between two nucleons both surrounded by other nucleons. In the derivation of the tranport equations use is made of the green's function formalism as developed by Schwinger and Keldys. For the Green's function kinematic equations are drawn up and are solved by choosing a proper factorization of three- and four-particle Green's functions in terms of one- and two-particle Green's functions. The necessary boundary condition is obtained by explicitly making use of Boltzmann's assumption that colliding particles are statistically uncorrelated. Finally a transport equation is obtained in which the mean field as well as the nucleon-nucleon collisions are given by the same (medium dependent) interaction. This interaction is the non-equilibrium extension of the interaction as given in the Brueckner theory of nuclear matter. Together, kinetic equation and interaction, form a self-consistent set of equations for the case of a non-relativistic as well as for the case of a relativistic starting point. (H.W.) 148 refs.; 6 figs.; 411 schemes
Towards an unified microscopic approach of the description of the nuclear structure and reaction
International Nuclear Information System (INIS)
Hoang, Sy-Than
2009-01-01
This thesis contains 3 main parts: 1. Nuclear matter: The properties of nuclear matter are examined using finite range effective interactions, either derived from the Brueckner theory (M3Y-type interactions) or determined in a purely phenomenological way (Gogny-type interactions). Skyrme-type interactions are also used for comparison. The motivation of the study is to establish a link between the bare NN interaction and nuclear matter properties via the effective Brueckner G-matrix parameterized in the M3Y form. We have concentrated our discussion on several main aspects: the pressure in symmetric nuclear matter and in neutron matter, the density dependence of the symmetry energy S, the neutron star cooling, and the nuclear matter incompressibility for the symmetric and asymmetric nuclear matter. 2. Structure of finite nuclei and of the inner crust of neutron stars: We present the non-relativistic HF and HF-BCS approaches in coordinate representation using finite-range density-dependent interactions in both the mean field and pairing channels. The method for solving the HF equations in coordinate space is presented. We limit the study to the spherical symmetry case. An iterative scheme is used for solving the integro-differential HF equations. We adopt the method of Brueckner-Gammel-Weizner which is free of poles in the local equivalent potentials, in contrast to the usually used Vautherin-Veneroni method. Alternatively, we have developed a method using a basis of spherical Bessel functions. The latter method is useful for treating systems containing many nucleons in large boxes like the Wigner-Seitz (WS) cells of the neutron star inner crust. We have thus studied, using the effective interactions mentioned above, the doubly magic nuclei, the Sn isotopes, and the possible occurrence of bubble structures in the nuclei 22 O, 34 Si, 46 Ar and 68 Ar. We also present for the first time a study of Wigner-Seitz cells in the inner crust of neutron stars using finite range
Bullying in a caring profession: reasons, results, and recommendations.
Broome, Barbara S; Williams-Evans, Shiphrah
2011-10-01
The theories of Florence Nightingale and Jean Watson provide a framework for the caring work of nurses. Ironically, this caring profession struggles with bullying. Bullying has both physiological and psychological ramifications for the person being bullied and a negative impact on the organization and patient care. Strategies to address bullying include education, developing codes of acceptable conduct for the workplace, and a zero-tolerance policy. Mental health nurses have a vital role in helping nurses return to roles of caring. Copyright 2011, SLACK Incorporated.
International business theory and marketing theory
Soldner, Helmut
1984-01-01
International business theory and marketing theory : elements for internat. marketing theory building. - In: Marketing aspects of international business / Gerald M. Hampton ... (eds.). - Boston u.a. : Kluwer, 1984. - S. 25-57
N=1 field theory duality from M theory
International Nuclear Information System (INIS)
Schmaltz, M.; Sundrum, R.
1998-01-01
We investigate Seiberg close-quote s N=1 field theory duality for four-dimensional supersymmetric QCD with the M-theory 5-brane. We find that the M-theory configuration for the magnetic dual theory arises via a smooth deformation of the M-theory configuration for the electric theory. The creation of Dirichlet 4-branes as Neveu-Schwarz 5-branes are passed through each other in type IIA string theory is given an elegant derivation from M theory. copyright 1998 The American Physical Society
Targeting Micrornas With Small Molecules: A Novel Approach to Treating Breast Cancer
2010-10-01
DNAzyme, or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target...conserved antiparallel RNA A-helix fold among the selected pre- miRNA targets (Fig. 1a). Furthermore, 3D characteristics including Watson - Crick base pairs... Watson – Crick binding, leading to RNAse-H- mediated cleavage of the mRNA of the target gene. The ASOs also inhibit transcription, splicing, and
Targeting MicroRNAs with Small Molecules a Novel Approach to Treating Breast Cancer
2011-10-01
or deoxyribozyme, is a catalytic DNA that site-specifically cleaves the target RNA Watson – Crick base pairing to a complementary target sequence...RNA A-helix fold among the selected pre- miRNA targets. Furthermore, 3D characteristics including Watson - Crick base pairs and wobble base pairs...phosphorothioate backbone in addition to 2′-O-methoxyethyl AMOs are ASOs against miRNAs and therefore produce ASO–miRNA duplexes through Watson – Crick binding
2012-07-01
like saying Cambridge University, not Watson and Crick , deciphered the double helix structure of DNA . Consequently, I have endeavored to attribute...were reflected off the ionosphere to the earth’s surface, then back to the ionosphere, and so on. During the late 1940s the Army Air Forces’ Watson ...NM, Proving Grounds (The Army Signal Corps transferred Watson Laboratories to the Army Air Forces in 1945). A critical observation that enabled OTH
From chaos to unification: U theory vs. M theory
International Nuclear Information System (INIS)
Ye, Fred Y.
2009-01-01
A unified physical theory called U theory, that is different from M theory, is defined and characterized. U theory, which includes spinor and twistor theory, loop quantum gravity, causal dynamical triangulations, E-infinity unification theory, and Clifford-Finslerian unifications, is based on physical tradition and experimental foundations. In contrast, M theory pays more attention to mathematical forms. While M theory is characterized by supersymmetry string theory, U theory is characterized by non-supersymmetry unified field theory.
Temperature dependence of single-particle properties in nuclear matter
International Nuclear Information System (INIS)
Zuo, W.; Lu, G.C.; Li, Z.H.; Lombardo, U.; Schulze, H.-J.
2006-01-01
The single-nucleon potential in hot nuclear matter is investigated in the framework of the Brueckner theory by adopting the realistic Argonne V 18 or Nijmegen 93 two-body nucleon-nucleon interaction supplemented by a microscopic three-body force. The rearrangement contribution to the single-particle potential induced by the ground state correlations is calculated in terms of the hole-line expansion of the mass operator and provides a significant repulsive contribution in the low-momentum region around and below the Fermi surface. Increasing temperature leads to a reduction of the effect, while increasing density makes it become stronger. The three-body force suppresses somewhat the ground state correlations due to its strong short-range repulsion, increasing with density. Inclusion of the three-body force contribution results in a quite different temperature dependence of the single-particle potential at high enough densities as compared to that adopting the pure two-body force. The effects of three-body force and ground state correlations on the nucleon effective mass are also discussed
Mesonic and isobar degrees of freedom in nuclei
International Nuclear Information System (INIS)
Muether, H.
1978-01-01
A study is made in 16 O of the effects of mesonic and isobar degrees of freedom. Taking these degrees of freedom explicitly into account causes a change of the bare nucleon-nucleon (NN) interaction going from the description of the two-nucleon system (NN-scattering, deuteron) to the many-body system of complex nuclei. Three main effects are discussed: First, the mesonic degrees of freedom, taken into account in a noncovariant perturbation theory, introduce and additional density dependence into the NN interaction. In a Brueckner-Hartree-Fock calculation for 16 O this leads to an improvement of the radius with a small change of the energy. Second, fourth-order iterative diagrams involving NΔ-and ΔΔ-intermediate states give less medium range attraction in complex nuclei than a NN-potential which is also fitted to the NN-data but does not treat these terms explicitly. Third, effective three-N forces, caused by excitation of isobars, give rise to a small amount of attraction only. For 16 O the additional binding energy is only about 0.5 MeV per particle. (author)
Acquiring Procedural Skills from Lesson Sequences.
1985-08-13
Teachers of Mathematics . Washington, D)C: NCTM . Brueckner, I..J. (1930) Diagnostic aund remedial teaching in arithmetic. Philadelphia. PA: Winston. Burton...arithmetic and algebra, fr-m multi-lesson curricula. The central hypothesis is that students and teachers obey cc: :-.entions that cause the goal hierarchy...students and • . teachers obey conventions that cause the goal hierarchy of the acquired procedure to be a particular structural function of the sequential
Directory of Open Access Journals (Sweden)
M. R. Barrón-Yánez
2009-01-01
(Brassica napus L. y amaranto (Amaranthus leucocarpus S. Watson syn. hypochondriacus L.. Se realizó un análisis proximal y la cuantificación de saponinas en semillas y germinados de las cuatro especies. El contenido de proteína fue más alto en los germinados de canola que en las semillas, pero en huauzontle, calabacita y amaranto no varió. El contenido de lípidos en las semillas de canola, huauzontle y amaranto disminuyó en sus germinados, pero se incrementó en calabacita. El contenido de saponinas en los germinados fue de 2,873.23 en huauzontle, 155.40 en calabacita, 429.81 en canola, y 491.45 mg 100·g-1 de peso seco en amaranto. El contenido de saponinas en semillas fue de 5280.57, 0.00, 35.77 y 42.84 mg 100·g-1 en peso seco, respectivamente. Los niveles del contenido de saponinas en semillas y germinados para las cuatro especies estudiadas no representan toxicidad para humanos. El valor nutricio fue mejor en el germinado de canola que en el de huauzontle, calabaza y amaranto. El sabor de los germinados de huauzontle y amaranto fue mejor que en los de canola y calabacita.
Generalizability theory and item response theory
Glas, Cornelis A.W.; Eggen, T.J.H.M.; Veldkamp, B.P.
2012-01-01
Item response theory is usually applied to items with a selected-response format, such as multiple choice items, whereas generalizability theory is usually applied to constructed-response tasks assessed by raters. However, in many situations, raters may use rating scales consisting of items with a selected-response format. This chapter presents a short overview of how item response theory and generalizability theory were integrated to model such assessments. Further, the precision of the esti...
Studies of Single Biomolecules, DNA Conformational Dynamics, and Protein Binding
2008-07-11
Nucleotide Base pairs Hydrogen bonds FIG. 1: Ladder structure of DNA showing the Watson - Crick bonding of the bases A, T, G, and C which are suspended by a...protected against unwanted action of chemicals and proteins. The three-dimensional structure of DNA is the famed Watson - Crick double-helix, the equilibrium...quantitative analysis [88]. [1] A. Kornberg and T. A. Baker, DNA Replication (W. H. Freeman, New York, 1992). [2] J. D. Watson and F. H. C. Crick
Teaching Theory X and Theory Y in Organizational Communication
Noland, Carey
2014-01-01
The purpose of the activity described here is to integrate McGregor's Theory X and Theory Y into a group application: design a syllabus that embodies either Theory X or Theory Y tenets. Students should be able to differentiate between Theory X and Theory Y, create a syllabus based on Theory X or Theory Y tenets, evaluate the different syllabi…
Massive IIA string theory and Matrix theory compactification
International Nuclear Information System (INIS)
Lowe, David A.; Nastase, Horatiu; Ramgoolam, Sanjaye
2003-01-01
We propose a Matrix theory approach to Romans' massive Type IIA supergravity. It is obtained by applying the procedure of Matrix theory compactifications to Hull's proposal of the massive Type IIA string theory as M-theory on a twisted torus. The resulting Matrix theory is a super-Yang-Mills theory on large N three-branes with a space-dependent noncommutativity parameter, which is also independently derived by a T-duality approach. We give evidence showing that the energies of a class of physical excitations of the super-Yang-Mills theory show the correct symmetry expected from massive Type IIA string theory in a lightcone quantization
Theories of Career Development. A Comparison of the Theories.
Osipow, Samuel H.
These seven theories of career development are examined in previous chapters: (1) Roe's personality theory, (2) Holland's career typology theory, (3) the Ginzberg, Ginsburg, Axelrod, and Herma Theory, (4) psychoanalytic conceptions, (5) Super's developmental self-concept theory, (6) other personality theories, and (7) social systems theories.…
Energy Technology Data Exchange (ETDEWEB)
Metzger, St
2005-12-15
This thesis presents various ways to construct four-dimensional quantum field theories from string theory. In a first part we study the generation of a supersymmetric Yang-Mills theory, coupled to an adjoint chiral superfield, from type IIB string theory on non-compact Calabi-Yau manifolds, with D-branes wrapping certain sub-cycles. Properties of the gauge theory are then mapped to the geometric structure of the Calabi-Yau space. Even if the Calabi-Yau geometry is too complicated to evaluate the geometric integrals explicitly, one can then always use matrix model perturbation theory to calculate the effective superpotential. The second part of this work covers the generation of four-dimensional super-symmetric gauge theories, carrying several important characteristic features of the standard model, from compactifications of eleven-dimensional supergravity on G{sub 2}-manifolds. If the latter contain conical singularities, chiral fermions are present in the four-dimensional gauge theory, which potentially lead to anomalies. We show that, locally at each singularity, these anomalies are cancelled by the non-invariance of the classical action through a mechanism called 'anomaly inflow'. Unfortunately, no explicit metric of a compact G{sub 2}-manifold is known. Here we construct families of metrics on compact weak G{sub 2}-manifolds, which contain two conical singularities. Weak G{sub 2}-manifolds have properties that are similar to the ones of proper G{sub 2}-manifolds, and hence the explicit examples might be useful to better understand the generic situation. Finally, we reconsider the relation between eleven-dimensional supergravity and the E{sub 8} x E{sub 8}-heterotic string. This is done by carefully studying the anomalies that appear if the supergravity theory is formulated on a ten-manifold times the interval. Again we find that the anomalies cancel locally at the boundaries of the interval through anomaly inflow, provided one suitably modifies the
A Future of Communication Theory: Systems Theory.
Lindsey, Georg N.
Concepts of general systems theory, cybernetics and the like may provide the methodology for communication theory to move from a level of technology to a level of pure science. It was the purpose of this paper to (1) demonstrate the necessity of applying systems theory to the construction of communication theory, (2) review relevant systems…
Gauge theory loop operators and Liouville theory
International Nuclear Information System (INIS)
Drukker, Nadav; Teschner, Joerg
2009-10-01
We propose a correspondence between loop operators in a family of four dimensional N=2 gauge theories on S 4 - including Wilson, 't Hooft and dyonic operators - and Liouville theory loop operators on a Riemann surface. This extends the beautiful relation between the partition function of these N=2 gauge theories and Liouville correlators found by Alday, Gaiotto and Tachikawa. We show that the computation of these Liouville correlators with the insertion of a Liouville loop operator reproduces Pestun's formula capturing the expectation value of a Wilson loop operator in the corresponding gauge theory. We prove that our definition of Liouville loop operators is invariant under modular transformations, which given our correspondence, implies the conjectured action of S-duality on the gauge theory loop operators. Our computations in Liouville theory make an explicit prediction for the exact expectation value of 't Hooft and dyonic loop operators in these N=2 gauge theories. The Liouville loop operators are also found to admit a simple geometric interpretation within quantum Teichmueller theory as the quantum operators representing the length of geodesics. We study the algebra of Liouville loop operators and show that it gives evidence for our proposal as well as providing definite predictions for the operator product expansion of loop operators in gauge theory. (orig.)
Fidelity Mechanisms of DNA Polymerase Alpha
2008-07-23
between right and wrong dNTPs. With purine dNTPs, the enzyme uses a combination of positive and negative selectivity. The Watson - Crick hydrogen...dNTP as a dCTP analogue despite the lack of a Watson - Crick hydrogen bond. We specifically examined the role of O2 of a pyrimidine by synthesizing 4...cases the compounds could form 2 Watson - Crick hydrogen bonds. The lack of polymerization resulted from very weak binding of the dNTPs to pol α
Situation-specific theories from the middle-range transitions theory.
Im, Eun-Ok
2014-01-01
The purpose of this article was to analyze the theory development process of the situation-specific theories that were derived from the middle-range transitions theory. This analysis aims to provide directions for future development of situation-specific theories. First, transitions theory is concisely described with its history, goal, and major concepts. Then, the approach that was used to retrieve the situation-specific theories derived from transitions theory is described. Next, an analysis of 6 situation-specific theories is presented. Finally, 4 themes reflecting commonalities and variances in the theory development process are discussed with implications for future theoretical development.
Gauge theories as string theories: the first results
International Nuclear Information System (INIS)
Gorsky, Aleksandr S
2005-01-01
The gauge/string theory duality in curved space is discussed mainly using a non-Abelian conformal N = 4 supersymmetric gauge theory and the theory of a closed superstring in the AdS 5 x S 5 metric as an example. It is shown that in the supergravity approximation, string duality yields the characteristics of a strong-coupling gauge theory. For a special shape of the contour, a Wilson loop expression is derived in the classical superstring approximation. The role of the hidden integrability in lower-loop calculations in gauge theory and in different approximations of string theory is discussed. It is demonstrated that in the large quantum-number limit, gauge theory operators can be described in terms of the dual string picture. Examples of metrics providing the dual description of gauge theories with broken conformal symmetry are presented, and formulations of the vacuum structure of such theories in terms of gravity are discussed. (reviews of topical problems)
Dualities in M-theory and Born-Infeld Theory
International Nuclear Information System (INIS)
Brace, Daniel M.
2001-01-01
We discuss two examples of duality. The first arises in the context of toroidal compactification of the discrete light cone quantization of M-theory. In the presence of nontrivial moduli coming from the M-theory three form, it has been conjectured that the system is described by supersymmetric Yang-Mills gauge theory on a noncommutative torus. We are able to provide evidence for this conjecture, by showing that the dualities of this M-theory compactification, which correspond to T-duality in Type IIA string theory, are also dualities of the noncommutative supersymmetric Yang-Mills description. One can also consider this as evidence for the accuracy of the Matrix Theory description of M-theory in this background. The second type of duality is the self-duality of theories with U(1) gauge fields. After discussing the general theory of duality invariance for theories with complex gauge fields, we are able to find a generalization of the well known U(1) Born-Infeld theory that contains any number of gauge fields and which is invariant under the maximal duality group. We then find a supersymmetric extension of our results, and also show that our results can be extended to find Born-Infeld type actions in any even dimensional spacetime
Self-energy dispersion effects on neutron matter superfluidity
International Nuclear Information System (INIS)
Zuo Wei
2001-01-01
The effects of the dispersion and ground state correlation of the single particle self-energy on neutron matter superfluidity have been investigated in the framework of the Extended Brueckner-Hartree-Fock and the generalized BCS approaches. A sizable reduction of the energy gap is found due to the energy dependence of the self-energy. And the inclusion of the ground state correlations in the self-energy suppresses further the neutron matter superfluidity
M(atrix) theory: matrix quantum mechanics as a fundamental theory
International Nuclear Information System (INIS)
Taylor, Washington
2001-01-01
This article reviews the matrix model of M theory. M theory is an 11-dimensional quantum theory of gravity that is believed to underlie all superstring theories. M theory is currently the most plausible candidate for a theory of fundamental physics which reconciles gravity and quantum field theory in a realistic fashion. Evidence for M theory is still only circumstantial -- no complete background-independent formulation of the theory exists as yet. Matrix theory was first developed as a regularized theory of a supersymmetric quantum membrane. More recently, it has appeared in a different guise as the discrete light-cone quantization of M theory in flat space. These two approaches to matrix theory are described in detail and compared. It is shown that matrix theory is a well-defined quantum theory that reduces to a supersymmetric theory of gravity at low energies. Although its fundamental degrees of freedom are essentially pointlike, higher-dimensional fluctuating objects (branes) arise through the non-Abelian structure of the matrix degrees of freedom. The problem of formulating matrix theory in a general space-time background is discussed, and the connections between matrix theory and other related models are reviewed
Gauge theory loop operators and Liouville theory
Energy Technology Data Exchange (ETDEWEB)
Drukker, Nadav [Humboldt Univ. Berlin (Germany). Inst. fuer Physik; Gomis, Jaume; Okuda, Takuda [Perimeter Inst. for Theoretical Physics, Waterloo, ON (Canada); Teschner, Joerg [Deutsches Elektronen-Synchrotron (DESY), Hamburg (Germany)
2009-10-15
We propose a correspondence between loop operators in a family of four dimensional N=2 gauge theories on S{sup 4} - including Wilson, 't Hooft and dyonic operators - and Liouville theory loop operators on a Riemann surface. This extends the beautiful relation between the partition function of these N=2 gauge theories and Liouville correlators found by Alday, Gaiotto and Tachikawa. We show that the computation of these Liouville correlators with the insertion of a Liouville loop operator reproduces Pestun's formula capturing the expectation value of a Wilson loop operator in the corresponding gauge theory. We prove that our definition of Liouville loop operators is invariant under modular transformations, which given our correspondence, implies the conjectured action of S-duality on the gauge theory loop operators. Our computations in Liouville theory make an explicit prediction for the exact expectation value of 't Hooft and dyonic loop operators in these N=2 gauge theories. The Liouville loop operators are also found to admit a simple geometric interpretation within quantum Teichmueller theory as the quantum operators representing the length of geodesics. We study the algebra of Liouville loop operators and show that it gives evidence for our proposal as well as providing definite predictions for the operator product expansion of loop operators in gauge theory. (orig.)
Supersymmetric gauge theories from string theory
International Nuclear Information System (INIS)
Metzger, St.
2005-12-01
This thesis presents various ways to construct four-dimensional quantum field theories from string theory. In a first part we study the generation of a supersymmetric Yang-Mills theory, coupled to an adjoint chiral superfield, from type IIB string theory on non-compact Calabi-Yau manifolds, with D-branes wrapping certain sub-cycles. Properties of the gauge theory are then mapped to the geometric structure of the Calabi-Yau space. Even if the Calabi-Yau geometry is too complicated to evaluate the geometric integrals explicitly, one can then always use matrix model perturbation theory to calculate the effective superpotential. The second part of this work covers the generation of four-dimensional super-symmetric gauge theories, carrying several important characteristic features of the standard model, from compactifications of eleven-dimensional supergravity on G 2 -manifolds. If the latter contain conical singularities, chiral fermions are present in the four-dimensional gauge theory, which potentially lead to anomalies. We show that, locally at each singularity, these anomalies are cancelled by the non-invariance of the classical action through a mechanism called 'anomaly inflow'. Unfortunately, no explicit metric of a compact G 2 -manifold is known. Here we construct families of metrics on compact weak G 2 -manifolds, which contain two conical singularities. Weak G 2 -manifolds have properties that are similar to the ones of proper G 2 -manifolds, and hence the explicit examples might be useful to better understand the generic situation. Finally, we reconsider the relation between eleven-dimensional supergravity and the E 8 x E 8 -heterotic string. This is done by carefully studying the anomalies that appear if the supergravity theory is formulated on a ten-manifold times the interval. Again we find that the anomalies cancel locally at the boundaries of the interval through anomaly inflow, provided one suitably modifies the classical action. (author)
Group theory for chemists fundamental theory and applications
Molloy, K C
2010-01-01
The basics of group theory and its applications to themes such as the analysis of vibrational spectra and molecular orbital theory are essential knowledge for the undergraduate student of inorganic chemistry. The second edition of Group Theory for Chemists uses diagrams and problem-solving to help students test and improve their understanding, including a new section on the application of group theory to electronic spectroscopy.Part one covers the essentials of symmetry and group theory, including symmetry, point groups and representations. Part two deals with the application of group theory t
String theory as a quantum theory of gravity
International Nuclear Information System (INIS)
Horowitz, G.T.
1990-01-01
First, the connection between string theory and gravity is discussed - at first sight the theory of strings seem to have nothing to do with gravity but an intimate connection is shown. Then the quantum perturbation expansion is discussed. Thirdly, string theory is considered as a classical theory of gravity and finally recent speculation about a phase of string theory which is independent of a spacetime metric is discussed. (author)
Number theory via Representation theory
Indian Academy of Sciences (India)
2014-11-09
Number theory via Representation theory. Eknath Ghate. November 9, 2014. Eightieth Annual Meeting, Chennai. Indian Academy of Sciences1. 1. This is a non-technical 20 minute talk intended for a general Academy audience.
K-theory and representation theory
International Nuclear Information System (INIS)
Kuku, A.O.
2003-01-01
This contribution includes K-theory of orders, group-rings and modules over EI categories, equivariant higher algebraic K-theory for finite, profinite and compact Lie group actions together with their relative generalisations and applications
Kolker, Evelyne; Özdemir, Vural; Kolker, Eugene
2016-06-01
Healthcare is transforming with data-intensive omics technologies and Big Data. The "revolution" has already happened in technology, but the bottlenecks have shifted to the social domain: Who can be empowered by Big Data? Who are the users and customers? In this review and innovation field analysis, we introduce the idea of a "super-customer" versus "customer" and relate both to 21st century healthcare. A "super-customer" in healthcare is the patient, sample size of n = 1, while "customers" are the providers of healthcare (e.g., doctors and nurses). The super-customers have been patients, enabled by unprecedented social practices, such as the ability to track one's physical activities, personal genomics, patient advocacy for greater autonomy, and self-governance, to name but a few. In contrast, the originally intended customers-providers, doctors, and nurses-have relatively lagged behind. With patients as super-customers, there are valuable lessons to be learned from industry examples, such as Amazon and Uber. To offer superior quality service, healthcare organizations have to refocus on the needs, pains, and aspirations of their super-customers by enabling the customers. We propose a strategic solution to this end: the PPT-DAM (People-Process-Technology empowered by Data, Analytics, and Metrics) approach. When applied together with the classic Experiment-Execute-Evaluate iterative methodology, we suggest PPT-DAM is an extremely powerful approach to deliver quality health services to super-customers and customers. As an example, we describe the PPT-DAM implementation by the Benchmarking Improvement Program at the Seattle Children's Hospital. Finally, we forecast that cognitive systems in general and IBM Watson in particular, if properly implemented, can bring transformative and sustainable capabilities in healthcare far beyond the current ones.
Large N field theories, string theory and gravity
Energy Technology Data Exchange (ETDEWEB)
Maldacena, J [Lyman Laboratory of Physics, Harvard University, Cambridge (United States)
2002-05-15
We describe the holographic correspondence between field theories and string/M theory, focusing on the relation between compactifications of string/ M theory on Anti-de Sitter spaces and conformal field theories. We review the background for this correspondence and discuss its motivations and the evidence for its correctness. We describe the main results that have been derived from the correspondence in the regime that the field theory is approximated by classical or semiclassical gravity. We focus on the case of the N = 4 supersymmetric gauge theory in four dimensions. These lecture notes are based on the Review written by O. Aharony, S. Gubser, J. Maldacena, H. Ooguri and Y. Oz. (author)
Morse theory interpretation of topological quantum field theories
International Nuclear Information System (INIS)
Labastida, J.M.F.
1989-01-01
Topological quantum field theories are interpreted as a generalized form of Morse theory. This interpretation is applied to formulate the simplest topological quantum field theory: Topological quantum mechanics. The only non-trivial topological invariant corresponding to this theory is computed and identified with the Euler characteristic. Using field theoretical methods this topological invariant is calculated in different ways and in the process a proof of the Gauss-Bonnet-Chern-Avez formula as well as some results of degenerate Morse theory are obtained. (orig.)
International Nuclear Information System (INIS)
Chan Hongmo.
1987-10-01
The paper traces the development of the String Theory, and was presented at Professor Sir Rudolf Peierls' 80sup(th) Birthday Symposium. The String theory is discussed with respect to the interaction of strings, the inclusion of both gauge theory and gravitation, inconsistencies in the theory, and the role of space-time. The physical principles underlying string theory are also outlined. (U.K.)
Gravity, general relativity theory and alternative theories
International Nuclear Information System (INIS)
Zel'dovich, Ya.B.; Grishchuk, L.P.; Moskovskij Gosudarstvennyj Univ.
1986-01-01
The main steps in plotting the current gravitation theory and some prospects of its subsequent development are reviewed. The attention is concentrated on a comparison of the relativistic gravitational field with other physical fields. Two equivalent formulations of the general relativity (GR) - geometrical and field-theoretical - are considered in detail. It is shown that some theories of gravity constructed as the field theories at a flat background space-time are in fact just different formulations of GR and not alternative theories
Theory X and Theory Y in the Organizational Structure.
Barry, Thomas J.
This document defines contrasting assumptions about the labor force--theory X and theory Y--and shows how they apply to the pyramid organizational structure, examines the assumptions of the two theories, and finally, based on a survey and individual interviews, proposes a merger of theories X and Y to produce theory Z. Organizational structures…
International Nuclear Information System (INIS)
Uehara, S.
1985-01-01
Of all supergravity theories, the maximal, i.e., N = 8 in 4-dimension or N = 1 in 11-dimension, theory should perform the unification since it owns the highest degree of symmetry. As to the N = 1 in d = 11 theory, it has been investigated how to compactify to the d = 4 theories. From the phenomenological point of view, local SUSY GUTs, i.e., N = 1 SUSY GUTs with soft breaking terms, have been studied from various angles. The structures of extended supergravity theories are less understood than those of N = 1 supergravity theories, and matter couplings in N = 2 extended supergravity theories are under investigation. The harmonic superspace was recently proposed which may be useful to investigate the quantum effects of extended supersymmetry and supergravity theories. As to the so-called Kaluza-Klein supergravity, there is another possibility. (Mori, K.)
On the interplay between string theory and field theory
International Nuclear Information System (INIS)
Brunner, I.
1998-01-01
In this thesis, we have discussed various aspects of branes in string theory and M-theory. In chapter 2 we were able to construct six-dimensional chiral interacting eld theories from Hanany-Witten like brane setups. The field theory requirement that the anomalies cancel was reproduced by RR-charge conservation in the brane setup. The data of the Hanany-Witten setup, which consists of brane positions, was mapped to instanton data. The orbifold construction can be extended to D and E type singularities. In chapter 3 we discussed a matrix conjecture, which claims that M-theory in the light cone gauge is described by the quantum mechanics of D0 branes. Toroidal compactifications of M-theory have a description in terms of super Yang-Mills theory an the dual torus. For more than three compactified dimensions, more degrees of freedom have to be added. In some sense, the philosophy in this chapter is orthogonal to the previous chapter: Here, we want to get M-theory results from eld theory considerations, whereas in the previous chapter we obtained eld theory results by embedding the theories in string theory. Our main focus was on the compactification on T 6 , which leads to complications. Here, the Matrix model is again given by an eleven dimensional theory, not by a lower dimensional field theory. Other problems and possible resolutions of Matrix theory are discussed at the end of chapter 3. In the last chapter we considered M- and F-theory compactifications on Calabi-Yau fourfolds. After explaining some basics of fourfolds, we showed that the web of fourfolds is connected by singular transitions. The two manifolds which are connected by the transition are different resolutions of the same singular manifold. The resolution of the singularities can lead to a certain type of divisors, which lead to non-perturbative superpotentials, when branes wrap them. The vacua connected by the transitions can be physically very different. (orig.)
On the interplay between string theory and field theory
Energy Technology Data Exchange (ETDEWEB)
Brunner, I.
1998-07-08
In this thesis, we have discussed various aspects of branes in string theory and M-theory. In chapter 2 we were able to construct six-dimensional chiral interacting eld theories from Hanany-Witten like brane setups. The field theory requirement that the anomalies cancel was reproduced by RR-charge conservation in the brane setup. The data of the Hanany-Witten setup, which consists of brane positions, was mapped to instanton data. The orbifold construction can be extended to D and E type singularities. In chapter 3 we discussed a matrix conjecture, which claims that M-theory in the light cone gauge is described by the quantum mechanics of D0 branes. Toroidal compactifications of M-theory have a description in terms of super Yang-Mills theory an the dual torus. For more than three compactified dimensions, more degrees of freedom have to be added. In some sense, the philosophy in this chapter is orthogonal to the previous chapter: Here, we want to get M-theory results from eld theory considerations, whereas in the previous chapter we obtained eld theory results by embedding the theories in string theory. Our main focus was on the compactification on T{sup 6}, which leads to complications. Here, the Matrix model is again given by an eleven dimensional theory, not by a lower dimensional field theory. Other problems and possible resolutions of Matrix theory are discussed at the end of chapter 3. In the last chapter we considered M- and F-theory compactifications on Calabi-Yau fourfolds. After explaining some basics of fourfolds, we showed that the web of fourfolds is connected by singular transitions. The two manifolds which are connected by the transition are different resolutions of the same singular manifold. The resolution of the singularities can lead to a certain type of divisors, which lead to non-perturbative superpotentials, when branes wrap them. The vacua connected by the transitions can be physically very different. (orig.)
DEFF Research Database (Denmark)
Larsen, Poul Steen
the Metropolitan Museum of Art, Thomas J. Watson Library, Helge Ernst, illustrator, Poul Kristensen, printer, Ole Olsen, bookbinder, exhibition catalog......the Metropolitan Museum of Art, Thomas J. Watson Library, Helge Ernst, illustrator, Poul Kristensen, printer, Ole Olsen, bookbinder, exhibition catalog...
When is a theory a theory? A case example.
Alkin, Marvin C
2017-08-01
This discussion comments on the approximately 20years history of writings on the prescriptive theory called Empowerment Evaluation. To do so, involves examining how "Empowerment Evaluation Theory" has been defined at various points of time (particularly 1996 and now in 2015). Defining a theory is different from judging the success of a theory. This latter topic has been addressed elsewhere by Michael Scriven, Michael Patton, and Brad Cousins. I am initially guided by the work of Robin Miller (2010) who has written on the issue of how to judge the success of a theory. In doing so, she provided potential standards for judging the adequacy of theories. My task is not judging the adequacy or success of the Empowerment Evaluation prescriptive theory in practice, but determining how well the theory is delineated. That is, to what extent do the writings qualify as a prescriptive theory. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Schwarz, J.H.
1985-01-01
Dual string theories, initially developed as phenomenological models of hadrons, now appear more promising as candidates for a unified theory of fundamental interactions. Type I superstring theory (SST I), is a ten-dimensional theory of interacting open and closed strings, with one supersymmetry, that is free from ghosts and tachyons. It requires that an SO(eta) or Sp(2eta) gauge group be used. A light-cone-gauge string action with space-time supersymmetry automatically incorporates the superstring restrictions and leads to the discovery of type II superstring theory (SST II). SST II is an interacting theory of closed strings only, with two D=10 supersymmetries, that is also free from ghosts and tachyons. By taking six of the spatial dimensions to form a compact space, it becomes possible to reconcile the models with our four-dimensional perception of spacetime and to define low-energy limits in which SST I reduces to N=4, D=4 super Yang-Mills theory and SST II reduces to N=8, D=4 supergravity theory. The superstring theories can be described by a light-cone-gauge action principle based on fields that are functionals of string coordinates. With this formalism any physical quantity should be calculable. There is some evidence that, unlike any conventional field theory, the superstring theories provide perturbatively renormalizable (SST I) or finite (SST II) unifications of gravity with other interactions
Abelian gauge symmetries in F-theory and dual theories
Song, Peng
In this dissertation, we focus on important physical and mathematical aspects, especially abelian gauge symmetries, of F-theory compactifications and its dual formulations within type IIB and heterotic string theory. F-theory is a non-perturbative formulation of type IIB string theory which enjoys important dualities with other string theories such as M-theory and E8 x E8 heterotic string theory. One of the main strengths of F-theory is its geometrization of many physical problems in the dual string theories. In particular, its study requires a lot of mathematical tools such as advanced techniques in algebraic geometry. Thus, it has also received a lot of interests among mathematicians, and is a vivid area of research within both the physics and the mathematics community. Although F-theory has been a long-standing theory, abelian gauge symmetry in Ftheory has been rarely studied, until recently. Within the mathematics community, in 2009, Grassi and Perduca first discovered the possibility of constructing elliptically fibered varieties with non-trivial toric Mordell-Weil group. In the physics community, in 2012, Morrison and Park first made a major advancement by constructing general F-theory compactifications with U(1) abelian gauge symmetry. They found that in such cases, the elliptically-fibered Calabi-Yau manifold that F-theory needs to be compactified on has its fiber being a generic elliptic curve in the blow-up of the weighted projective space P(1;1;2) at one point. Subsequent developments have been made by Cvetic, Klevers and Piragua extended the works of Morrison and Park and constructed general F-theory compactifications with U(1) x U(1) abelian gauge symmetry. They found that in the U(1) x U(1) abelian gauge symmetry case, the elliptically-fibered Calabi-Yau manifold that F-theory needs to be compactified on has its fiber being a generic elliptic curve in the del Pezzo surface dP2. In chapter 2 of this dissertation, I bring this a step further by
Crack formation and crack propagation under multiaxial mechanical and thermal stresses. Proceedings
International Nuclear Information System (INIS)
1993-01-01
The 25th meeting of the DV Fracture Group was held on 16/17 February 1993 at Karlsruhe Technical University. The main topic, ''Crack formation and crack propagation under multiaxial mechanical and thermal stresses'', was discussed by five invited papers (by K.J. Miller, D. Loehe, H.A. Richard, W. Brocks, A. Brueckner-Foit) and 23 short papers. The other 21 papers were devoted to various domains of fracture mechanics, with emphasis on elastoplastic fracture mechanics. (orig./MM) [de
F-theory and 2d (0,2) theories
Energy Technology Data Exchange (ETDEWEB)
Schäfer-Nameki, Sakura [Department of Mathematics, King’s College London, The Strand, London WC2R 2LS (United Kingdom); Weigand, Timo [Institut für Theoretische Physik, Ruprecht-Karls-Universität,Philosophenweg 19, 69120 Heidelberg (Germany)
2016-05-11
F-theory compactified on singular, elliptically fibered Calabi-Yau five-folds gives rise to two-dimensional gauge theories preserving N=(0,2) supersymmetry. In this paper we initiate the study of such compactifications and determine the dictionary between the geometric data of the elliptic fibration and the 2d gauge theory such as the matter content in terms of (0,2) superfields and their supersymmetric couplings. We study this setup both from a gauge-theoretic point of view, in terms of the partially twisted 7-brane theory, and provide a global geometric description based on the structure of the elliptic fibration and its singularities. Global consistency conditions are determined and checked against the dual M-theory compactification to one dimension. This includes a discussion of gauge anomalies, the structure of the Green-Schwarz terms and the Chern-Simons couplings in the dual M-theory supersymmetric quantum mechanics. Furthermore, by interpreting the resulting 2d (0,2) theories as heterotic worldsheet theories, we propose a correspondence between the geometric data of elliptically fibered Calabi-Yau five-folds and the target space of a heterotic gauged linear sigma-model (GLSM). In particular the correspondence between the Landau-Ginsburg and sigma-model phase of a 2d (0,2) GLSM is realized via different T-branes or gluing data in F-theory.
Strings - Links between conformal field theory, gauge theory and gravity
International Nuclear Information System (INIS)
Troost, J.
2009-05-01
String theory is a candidate framework for unifying the gauge theories of interacting elementary particles with a quantum theory of gravity. The last years we have made considerable progress in understanding non-perturbative aspects of string theory, and in bringing string theory closer to experiment, via the search for the Standard Model within string theory, but also via phenomenological models inspired by the physics of strings. Despite these advances, many deep problems remain, amongst which a non-perturbative definition of string theory, a better understanding of holography, and the cosmological constant problem. My research has concentrated on various theoretical aspects of quantum theories of gravity, including holography, black holes physics and cosmology. In this Habilitation thesis I have laid bare many more links between conformal field theory, gauge theory and gravity. Most contributions were motivated by string theory, like the analysis of supersymmetry preserving states in compactified gauge theories and their relation to affine algebras, time-dependent aspects of the holographic map between quantum gravity in anti-de-Sitter space and conformal field theories in the bulk, the direct quantization of strings on black hole backgrounds, the embedding of the no-boundary proposal for a wave-function of the universe in string theory, a non-rational Verlinde formula and the construction of non-geometric solutions to supergravity
78 FR 6805 - Information Collection: Arctic National Wildlife Refuge Recreation Visitor Study-2013
2013-01-31
.... ADDRESSES: Comments concerning this notice should be addressed to Alan E. Watson, Aldo Leopold Wilderness... . The public may inspect comments received at the Aldo Leopold Wilderness Research Institute, USDA... FURTHER INFORMATION CONTACT: Alan E. Watson, Aldo Leopold Wilderness Research Institute, (406) 542-4197...
Investigations in gauge theories, topological solitons and string theories
International Nuclear Information System (INIS)
1993-01-01
This is the Final Report on a supported research project on theoretical particle physics entitled ''Investigations in Gauge Theories, Topological Solitons and String Theories.'' The major theme of particle theory pursued has been within the rubric of the standard model, particularly on the interplay between symmetries and dynamics. Thus, the research has been carried out primarily in the context of gauge with or without chiral fermions and in effective chiral lagrangian field theories. The topics studied include the physical implications of abelian and non-abelian anomalies on the spectrum and possible dynamical symmetry breaking in a wide range of theories. A wide range of techniques of group theory, differential geometry and function theory have been applied to probe topological and conformal properties of quantum field theories in two and higher dimensions, the breaking of global chiral symmetries by vector-like gauge theories such as QCD,the phenomenology of a possibly strongly interacting Higgs sector within the minimal standard model, and the relevance of solitonic ideas to non-perturbative phenomena at SSC energies
International Nuclear Information System (INIS)
Kaku, M.
1987-01-01
In this article, the authors summarize the rapid progress in constructing string field theory actions, such as the development of the covariant BRST theory. They also present the newer geometric formulation of string field theory, from which the BRST theory and the older light cone theory can be derived from first principles. This geometric formulation allows us to derive the complete field theory of strings from two geometric principles, in the same way that general relativity and Yang-Mills theory can be derived from two principles based on global and local symmetry. The geometric formalism therefore reduces string field theory to a problem of finding an invariant under a new local gauge group they call the universal string group (USG). Thus, string field theory is the gauge theory of the universal string group in much the same way that Yang-Mills theory is the gauge theory of SU(N). The geometric formulation places superstring theory on the same rigorous group theoretical level as general relativity and gauge theory
Yang-Mills theory - a string theory in disguise
International Nuclear Information System (INIS)
Foerster, D.
1979-01-01
An examination of the Schwinger-Dyson equations of U(N) lattice Yang-Mills theory shows that this theory is exactly equivalent to a theory of strings that interact with one another only through their topology. (Auth.)
Singularity theory and N = 2 superconformal field theories
International Nuclear Information System (INIS)
Warner, N.P.
1989-01-01
The N = 2 superconformal field theories that appear at the fixed points of the renormalization group flows of Landau-Ginsburg models are discussed. Some of the techniques of singularity theory are employed to deduce properties of these superconformal theories. These ideas are then used to deduce the relationship between Calabi-Yau compactifications and tensored discrete series models. The chiral rings of general N = 2 superconformal theories are also described. 14 refs
DEFF Research Database (Denmark)
Hendricks, Vincent F.
Game Theory is a collection of short interviews based on 5 questions presented to some of the most influential and prominent scholars in game theory. We hear their views on game theory, its aim, scope, use, the future direction of game theory and how their work fits in these respects....
Identity theory and personality theory: mutual relevance.
Stryker, Sheldon
2007-12-01
Some personality psychologists have found a structural symbolic interactionist frame and identity theory relevant to their work. This frame and theory, developed in sociology, are first reviewed. Emphasized in the review are a multiple identity conception of self, identities as internalized expectations derived from roles embedded in organized networks of social interaction, and a view of social structures as facilitators in bringing people into networks or constraints in keeping them out, subsequently, attention turns to a discussion of the mutual relevance of structural symbolic interactionism/identity theory and personality theory, looking to extensions of the current literature on these topics.
Jara, Pascual; Torrecillas, Blas
1988-01-01
The papers in this proceedings volume are selected research papers in different areas of ring theory, including graded rings, differential operator rings, K-theory of noetherian rings, torsion theory, regular rings, cohomology of algebras, local cohomology of noncommutative rings. The book will be important for mathematicians active in research in ring theory.
Cirafici, M.; Sinkovics, A.; Szabo, R.J.
2009-01-01
We study the relation between Donaldson–Thomas theory of Calabi–Yau threefolds and a six-dimensional topological Yang–Mills theory. Our main example is the topological U(N) gauge theory on flat space in its Coulomb branch. To evaluate its partition function we use equivariant localization techniques
String field theory-inspired algebraic structures in gauge theories
International Nuclear Information System (INIS)
Zeitlin, Anton M.
2009-01-01
We consider gauge theories in a string field theory-inspired formalism. The constructed algebraic operations lead, in particular, to homotopy algebras of the related Batalin-Vilkovisky theories. We discuss an invariant description of the gauge fixing procedure and special algebraic features of gauge theories coupled to matter fields.
GROUNDED THEORY METHODOLOGY and GROUNDED THEORY RESEARCH in TURKEY
ARIK, Ferhat; ARIK, Işıl Avşar
2016-01-01
This research discusses the historical development of the Grounded Theory Methodology, which is one of the qualitative research method, its transformation over time and how it is used as a methodology in Turkey. The Grounded Theory which was founded by Strauss and Glaser, is a qualitative methodology based on inductive logic to discover theories in contrast with the deductive understanding which is based on testing an existing theory in sociology. It is possible to examine the Grounded Theory...
Nanoswitches based on DNA base pairs: why adenine-thymine is less suitable than guanine-cytosine
Fonseca Guerra, C.; van der Wijst, T.; Bickelhaupt, F.M.
2006-01-01
Substituted Watson-Crick guanine-cytosine (GC) base pairs were recently shown to yield robust three-state nanoswitches. Here, we address the question: Can such supramolecular switches also be based on Watson-Crick adenine-thymine (AT) base pairs? We have theoretically analyzed AT pairs in which
Psychological behaviorism and behaviorizing psychology
Staats, Arthur W.
1994-01-01
Paradigmatic or psychological behaviorism (PB), in a four-decade history of development, has been shaped by its goal, the establishment of a behaviorism that can also serve as the approach in psychology (Watson's original goal). In the process, PB has become a new generation of behaviorism with abundant heuristic avenues for development in theory, philosophy, methodology, and research. Psychology has resources, purview and problem areas, and nascent developments of many kinds, gathered in chaotic diversity, needing unification (and other things) that cognitivism cannot provide. Behaviorism can, within PB's multilevel framework for connecting and advancing both psychology and behaviorism. PMID:22478175
On novel string theories from 4d gauge theories
Directory of Open Access Journals (Sweden)
Kiritsis Elias
2014-04-01
Full Text Available We investigate strings theories as defined from four dimensional gauge theories. It is argued that novel (superstring theories exist up to 26 dimensions. Some of them may support weakly curved geometries. A proposal is outlined to link their local conformal invariance to the dynamics of the bulk string theory.
Loring, FH
2014-01-01
Summarising the most novel facts and theories which were coming into prominence at the time, particularly those which had not yet been incorporated into standard textbooks, this important work was first published in 1921. The subjects treated cover a wide range of research that was being conducted into the atom, and include Quantum Theory, the Bohr Theory, the Sommerfield extension of Bohr's work, the Octet Theory and Isotopes, as well as Ionisation Potentials and Solar Phenomena. Because much of the material of Atomic Theories lies on the boundary between experimentally verified fact and spec
Theory and context / Theory in context
DEFF Research Database (Denmark)
Glaveanu, Vlad Petre
2014-01-01
trans-disciplinary manner. Consideration needs to be given as well to connected scholarship focusing on imagination, innova-tion, and improvisation. Last but not least, an expanded the-ory of context cannot ignore the institutional context of doing research on creativity. Creativity scholars are facing......It is debatable whether the psychology of creativity is a field in crisis or not. There are clear signs of increased fragmenta-tion and a scarcity of integrative efforts, but is this necessari-ly bad? Do we need more comprehensive theories of creativ-ity and a return to old epistemological...... questions? This de-pends on how one understands theory. Against a view of theoretical work as aiming towards generality, universality, uniformity, completeness, and singularity, I advocate for a dynamic perspective in which theory is plural, multifaceted, and contextual. Far from ‘waiting for the Messiah...
The rotor theories by Professor Joukowsky: Vortex theories
DEFF Research Database (Denmark)
Okulov, Valery L.; Sørensen, Jens Nørkær; Wood, David H.
2015-01-01
This is the second of two articles with the main, and largely self-explanatory, title "Rotor theories by Professor Joukowsky". This article considers rotors with finite number of blades and is subtitled "Vortex theories". The first article with subtitle "Momentum theories", assessed the starring...
Consumer culture theory (re)visits actor-network theory
DEFF Research Database (Denmark)
Bajde, Domen
2013-01-01
The vocabulary and tactics developed by actor-network theory (ANT) can shed light on several ontological and epistemological challenges faced by consumer culture theory. Rather than providing ready-made theories or methods, our translation of ANT puts forward a series of questions and propositions...
'Theory of Mind' I: a theory of knowledge?
Plastow, Michael
2012-06-01
'Theory of mind' is a cognitive notion introduced by Simon Baron-Cohen and colleagues to explain certain deficits in autistic disorders. It has, however, been extended beyond this, and applied more broadly. It proposes a means of knowing the mind of others, and suggests that this means fails in autism. The epistemological basis of 'theory of mind' will be examined critically, not just in terms of its endeavour as a theory of knowledge, but also in regard to the principles that underlie it. The proponents of 'theory of mind' eschew the rich field of psychological and phenomenological research, privileging only the biological sciences into which they endeavour to place their theorizations. In doing this, they fail to recognize the epistemological problems involved. This leads to the theory remaining hamstrung by the very Cartesian ontological problems that it seeks to avoid. For some, 'theory of mind' is but an artefact of the cognitive approach that it employs. It is argued that these difficulties are compounded by the failure of 'theory of mind' to take account of the place of language in the interpersonal encounters it attempts to describe.
Building International Business Theory: A Grounded Theory Approach
Gligor, David; Esmark, Carol; Golgeci, Ismail
2016-01-01
The field of international business (IB) is in need of more theory development (Morck & Yeung, 2007). As such, the main focus of our manuscript was to provide guidance on how to build IB specific theory using grounded theory (GT). Moreover, we contribute to future theory development by identifying areas within IB where GT can be applied and the type of research issues that can be addressed using this methodology. Finally, we make a noteworthy contribution by discussing some of GT’s caveats an...
Jardine, John F
2015-01-01
This monograph on the homotopy theory of topologized diagrams of spaces and spectra gives an expert account of a subject at the foundation of motivic homotopy theory and the theory of topological modular forms in stable homotopy theory. Beginning with an introduction to the homotopy theory of simplicial sets and topos theory, the book covers core topics such as the unstable homotopy theory of simplicial presheaves and sheaves, localized theories, cocycles, descent theory, non-abelian cohomology, stacks, and local stable homotopy theory. A detailed treatment of the formalism of the subject is interwoven with explanations of the motivation, development, and nuances of ideas and results. The coherence of the abstract theory is elucidated through the use of widely applicable tools, such as Barr's theorem on Boolean localization, model structures on the category of simplicial presheaves on a site, and cocycle categories. A wealth of concrete examples convey the vitality and importance of the subject in topology, n...
International Nuclear Information System (INIS)
Bergmann, P.G.
1980-01-01
A problem of construction of the unitary field theory is discussed. The preconditions of the theory are briefly described. The main attention is paid to the geometrical interpretation of physical fields. The meaning of the conceptions of diversity and exfoliation is elucidated. Two unitary field theories are described: the Weyl conformic geometry and Calitzy five-dimensioned theory. It is proposed to consider supersymmetrical theories as a new approach to the problem of a unitary field theory. It is noted that the supergravitational theories are really unitary theories, since the fields figuring there do not assume invariant expansion
Dynamical systems V bifurcation theory and catastrophe theory
1994-01-01
Bifurcation theory and catastrophe theory are two of the best known areas within the field of dynamical systems. Both are studies of smooth systems, focusing on properties that seem to be manifestly non-smooth. Bifurcation theory is concerned with the sudden changes that occur in a system when one or more parameters are varied. Examples of such are familiar to students of differential equations, from phase portraits. Moreover, understanding the bifurcations of the differential equations that describe real physical systems provides important information about the behavior of the systems. Catastrophe theory became quite famous during the 1970's, mostly because of the sensation caused by the usually less than rigorous applications of its principal ideas to "hot topics", such as the characterization of personalities and the difference between a "genius" and a "maniac". Catastrophe theory is accurately described as singularity theory and its (genuine) applications. The authors of this book, the first printing of w...
A succession of theories: purging redundancy from disturbance theory.
Pulsford, Stephanie A; Lindenmayer, David B; Driscoll, Don A
2016-02-01
The topics of succession and post-disturbance ecosystem recovery have a long and convoluted history. There is extensive redundancy within this body of theory, which has resulted in confusion, and the links among theories have not been adequately drawn. This review aims to distil the unique ideas from the array of theory related to ecosystem change in response to disturbance. This will help to reduce redundancy, and improve communication and understanding between researchers. We first outline the broad range of concepts that have developed over the past century to describe community change in response to disturbance. The body of work spans overlapping succession concepts presented by Clements in 1916, Egler in 1954, and Connell and Slatyer in 1977. Other theories describing community change include state and transition models, biological legacy theory, and the application of functional traits to predict responses to disturbance. Second, we identify areas of overlap of these theories, in addition to highlighting the conceptual and taxonomic limitations of each. In aligning each of these theories with one another, the limited scope and relative inflexibility of some theories becomes apparent, and redundancy becomes explicit. We identify a set of unique concepts to describe the range of mechanisms driving ecosystem responses to disturbance. We present a schematic model of our proposed synthesis which brings together the range of unique mechanisms that were identified in our review. The model describes five main mechanisms of transition away from a post-disturbance community: (i) pulse events with rapid state shifts; (ii) stochastic community drift; (iii) facilitation; (iv) competition; and (v) the influence of the initial composition of a post-disturbance community. In addition, stabilising processes such as biological legacies, inhibition or continuing disturbance may prevent a transition between community types. Integrating these six mechanisms with the functional
Effective actions for F-theory compactifications and tensor theories
International Nuclear Information System (INIS)
Bonetti, Federico
2014-01-01
In this thesis we study the low-energy effective dynamics emerging from a class of F-theory compactifications in four and six dimensions. We also investigate six-dimensional supersymmetric quantum field theories with self-dual tensors, motivated by the problem of describing the long-wavelength regime of a stack of M5-branes in M-theory. These setups share interesting common features. They both constitute examples of intrinsically non-perturbative physics. On the one hand, in the context of F-theory the non-perturbative character is encoded in the geometric formulation of this class of string vacua, which allows the complexified string coupling to vary in space. On the other hand, the dynamics of a stack of multiple M5-branes flows in the infrared to a novel kind of superconformal field theories in six dimensions - commonly referred to as (2,0) theories - that are expected to possess no perturbative weakly coupled regime and have resisted a complete understanding so far. In particular, no Lagrangian description is known for these models. The strategy we employ to address these two problems is also analogous. A recurring Leitmotif of our work is a transdimensional treatment of the system under examination: in order to extract information about dynamics in d dimensions we consider a (d-1)-dimensional setup. As far as F-theory compactifications are concerned, this is a consequence of the duality between M-theory and F-theory, which constitutes our main tool in the derivation of the effective action of F-theory compactifications. We apply it to six-dimensional F-theory vacua, obtained by taking the internal space to be an elliptically fibered Calabi-Yau threefold, but we also employ it to explore a novel kind of F-theory constructions in four dimensions based on manifolds with Spin(7) holonomy. With reference to six-dimensional (2,0) theories, the transdimensional character of our approach relies in the idea of studying these theories in five dimensions. Indeed, we
2010-09-07
... notice should be addressed to Alan E. Watson, Aldo Leopold Wilderness Research Institute, USDA Forest... submitted by e-mail to: [email protected] . The public may inspect comments received at the Aldo Leopold... to the building. FOR FURTHER INFORMATION CONTACT: Alan E. Watson, Aldo Leopold Wilderness Research...
Kadyshevich, E. A.; Dzyabchenko, A. V.; Ostrovskii, V. E.
2014-04-01
Size compatibility of the CH4-hydrate structure II and multi-component DNA fragments is confirmed by three-dimensional simulation; it is validation of the Life Origination Hydrate Theory (LOH-Theory).
International Nuclear Information System (INIS)
Lee, B.W.
1976-01-01
Some introductory remarks to Yang-Mills fields are given and the problem of the Coulomb gauge is considered. The perturbation expansion for quantized gauge theories is discussed and a survey of renormalization schemes is made. The role of Ward-Takahashi identities in gauge theories is discussed. The author then discusses the renormalization of pure gauge theories and theories with spontaneously broken symmetry. (B.R.H.)
General Theory versus ENA Theory: Comparing Their Predictive Accuracy and Scope.
Ellis, Lee; Hoskin, Anthony; Hartley, Richard; Walsh, Anthony; Widmayer, Alan; Ratnasingam, Malini
2015-12-01
General theory attributes criminal behavior primarily to low self-control, whereas evolutionary neuroandrogenic (ENA) theory envisions criminality as being a crude form of status-striving promoted by high brain exposure to androgens. General theory predicts that self-control will be negatively correlated with risk-taking, while ENA theory implies that these two variables should actually be positively correlated. According to ENA theory, traits such as pain tolerance and muscularity will be positively associated with risk-taking and criminality while general theory makes no predictions concerning these relationships. Data from Malaysia and the United States are used to test 10 hypotheses derived from one or both of these theories. As predicted by both theories, risk-taking was positively correlated with criminality in both countries. However, contrary to general theory and consistent with ENA theory, the correlation between self-control and risk-taking was positive in both countries. General theory's prediction of an inverse correlation between low self-control and criminality was largely supported by the U.S. data but only weakly supported by the Malaysian data. ENA theory's predictions of positive correlations between pain tolerance, muscularity, and offending were largely confirmed. For the 10 hypotheses tested, ENA theory surpassed general theory in predictive scope and accuracy. © The Author(s) 2014.
Quantum Yang-Mills theory of Riemann surfaces and conformal field theory
International Nuclear Information System (INIS)
Killingback, T.P.
1989-01-01
It is shown that Yang-Mills theory on a smooth surface, when suitably quantized, is a topological quantum field theory. This topological gauge theory is intimately related to two-dimensional conformal field theory. It is conjectured that all conformal field theories may be obtained from Yang-Mills theory on smooth surfaces. (orig.)
Harris, Tina
2015-04-29
Grounded theory is a popular research approach in health care and the social sciences. This article provides a description of grounded theory methodology and its key components, using examples from published studies to demonstrate practical application. It aims to demystify grounded theory for novice nurse researchers, by explaining what it is, when to use it, why they would want to use it and how to use it. It should enable nurse researchers to decide if grounded theory is an appropriate approach for their research, and to determine the quality of any grounded theory research they read.
Commentary on Malone: Who Founded Behaviorism?
Reese, Hayne W
2015-05-01
Malone (The Behavior Analyst, 37, 1-12 2014) argued that the emergence of behaviorism was inevitable with or without Watson's participation, mainly because protobehavioral ideas and dissatisfaction with classical structuralism were already widespread. However, the first premise is questionable because many of the ideas Malone cited were consistent with structuralism rather than behaviorism, and even if both premises were true they would not make the emergence of behaviorism-or anything else-inevitable. Historical evidence for inevitability is always retrospective and therefore always allows the logical fallacy of "after this, therefore because of this." In the relevant real world Watson existed, he was a psychologist, he was the first to publish an article that described a "behaviorism," and he promoted his behaviorism in later works. Stories about what would have happened without Watson's participation are therefore counterfactual and this lack of historicity makes the stories fictional rather than scientific. In the real world, Watson founded behaviorism.
Comparison of Attachment theory and Cognitive-Motivational Structure theory.
Malerstein, A J
2005-01-01
Attachment theory and Cognitive-Motivational Structure (CMS) are similar in most respects. They differ primarily in their proposal of when, during development, one's sense of the self and of the outside world are formed. I propose that the theories supplement each other after about age seven years--when Attachment theory's predictions of social function become unreliable, CMS theory comes into play.
Garza, Alejandro J.; Bulik, Ireneusz W.; Alencar, Ana G. Sousa; Sun, Jianwei; Perdew, John P.; Scuseria, Gustavo E.
2016-04-01
Contrary to standard coupled cluster doubles (CCD) and Brueckner doubles (BD), singlet-paired analogues of CCD and BD (denoted here as CCD0 and BD0) do not break down when static correlation is present, but neglect substantial amounts of dynamic correlation. In fact, CCD0 and BD0 do not account for any contributions from multielectron excitations involving only same-spin electrons at all. We exploit this feature to add - without introducing double counting, self-interaction, or increase in cost - the missing correlation to these methods via meta-GGA (generalised gradient approximation) density functionals (Tao-Perdew-Staroverov-Scuseria and strongly constrained and appropriately normed). Furthermore, we improve upon these CCD0+DFT blends by invoking range separation: the short- and long-range correlations absent in CCD0/BD0 are evaluated with density functional theory and the direct random phase approximation, respectively. This corrects the description of long-range van der Waals forces. Comprehensive benchmarking shows that the combinations presented here are very accurate for weakly correlated systems, while also providing a reasonable description of strongly correlated problems without resorting to symmetry breaking.
Generalized isobaric multiplet mass equation and its application to the Nolen-Schiffer anomaly
Dong, J. M.; Zhang, Y. H.; Zuo, W.; Gu, J. Z.; Wang, L. J.; Sun, Y.
2018-02-01
The Wigner isobaric multiplet mass equation (IMME) is the most fundamental prediction in nuclear physics with the concept of isospin. However, it was deduced based on the Wigner-Eckart theorem with the assumption that all charge-violating interactions can be written as tensors of rank two. In the present work, the charge-symmetry breaking (CSB) and charge-independent breaking (CIB) components of the nucleon-nucleon force, which contribute to the effective interaction in nuclear medium, are established in the framework of Brueckner theory with AV18 and AV14 bare interactions. Because such charge-violating components can no longer be expressed as an irreducible tensor due to density dependence, its matrix element cannot be analytically reduced by the Wigner-Eckart theorem. With an alternative approach, we derive a generalized IMME (GIMME) that modifies the coefficients of the original IMME. As the first application of GIMME, we study the long-standing question of the origin of the Nolen-Schiffer anomaly (NSA) found in the Coulomb displacement energy of mirror nuclei. We find that the naturally emerged CSB term in GIMME is largely responsible for explaining the NSA.
Benchmarking nuclear models for Gamow–Teller response
International Nuclear Information System (INIS)
Litvinova, E.; Brown, B.A.; Fang, D.-L.; Marketin, T.; Zegers, R.G.T.
2014-01-01
A comparative study of the nuclear Gamow–Teller response (GTR) within conceptually different state-of-the-art approaches is presented. Three nuclear microscopic models are considered: (i) the recently developed charge-exchange relativistic time blocking approximation (RTBA) based on the covariant density functional theory, (ii) the shell model (SM) with an extended “jj77” model space and (iii) the non-relativistic quasiparticle random-phase approximation (QRPA) with a Brueckner G-matrix effective interaction. We study the physics cases where two or all three of these models can be applied. The Gamow–Teller response functions are calculated for 208 Pb, 132 Sn and 78 Ni within both RTBA and QRPA. The strengths obtained for 208 Pb are compared to data that enable a firm model benchmarking. For the nucleus 132 Sn, also SM calculations are performed within the model space truncated at the level of a particle–hole (ph) coupled to vibration configurations. This allows a consistent comparison to the RTBA where ph⊗phonon coupling is responsible for the spreading width and considerable quenching of the GTR. Differences between the models and perspectives of their future developments are discussed.
Benchmarking nuclear models for Gamow–Teller response
Energy Technology Data Exchange (ETDEWEB)
Litvinova, E., E-mail: elena.litvinova@wmich.edu [Department of Physics, Western Michigan University, Kalamazoo, MI 49008-5252 (United States); National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, MI 48824-1321 (United States); Brown, B.A. [Department of Physics and Astronomy, Michigan State University, East Lansing, MI 48824-1321 (United States); National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, MI 48824-1321 (United States); Fang, D.-L. [National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, MI 48824-1321 (United States); Joint Institute for Nuclear Astrophysics, Michigan State University, East Lansing, MI 48824-1321 (United States); Marketin, T. [Physics Department, Faculty of Science, University of Zagreb (Croatia); Zegers, R.G.T. [Department of Physics and Astronomy, Michigan State University, East Lansing, MI 48824-1321 (United States); National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, MI 48824-1321 (United States); Joint Institute for Nuclear Astrophysics, Michigan State University, East Lansing, MI 48824-1321 (United States)
2014-03-07
A comparative study of the nuclear Gamow–Teller response (GTR) within conceptually different state-of-the-art approaches is presented. Three nuclear microscopic models are considered: (i) the recently developed charge-exchange relativistic time blocking approximation (RTBA) based on the covariant density functional theory, (ii) the shell model (SM) with an extended “jj77” model space and (iii) the non-relativistic quasiparticle random-phase approximation (QRPA) with a Brueckner G-matrix effective interaction. We study the physics cases where two or all three of these models can be applied. The Gamow–Teller response functions are calculated for {sup 208}Pb, {sup 132}Sn and {sup 78}Ni within both RTBA and QRPA. The strengths obtained for {sup 208}Pb are compared to data that enable a firm model benchmarking. For the nucleus {sup 132}Sn, also SM calculations are performed within the model space truncated at the level of a particle–hole (ph) coupled to vibration configurations. This allows a consistent comparison to the RTBA where ph⊗phonon coupling is responsible for the spreading width and considerable quenching of the GTR. Differences between the models and perspectives of their future developments are discussed.
Generalizability theory and item response theory
Glas, Cornelis A.W.; Eggen, T.J.H.M.; Veldkamp, B.P.
2012-01-01
Item response theory is usually applied to items with a selected-response format, such as multiple choice items, whereas generalizability theory is usually applied to constructed-response tasks assessed by raters. However, in many situations, raters may use rating scales consisting of items with a
Nonrelativistic superstring theories
International Nuclear Information System (INIS)
Kim, Bom Soo
2007-01-01
We construct a supersymmetric version of the critical nonrelativistic bosonic string theory [B. S. Kim, Phys. Rev. D 76, 106007 (2007).] with its manifest global symmetry. We introduce the anticommuting bc conformal field theory (CFT) which is the super partner of the βγ CFT. The conformal weights of the b and c fields are both 1/2. The action of the fermionic sector can be transformed into that of the relativistic superstring theory. We explicitly quantize the theory with manifest SO(8) symmetry and find that the spectrum is similar to that of type IIB superstring theory. There is one notable difference: the fermions are nonchiral. We further consider noncritical generalizations of the supersymmetric theory using the superspace formulation. There is an infinite range of possible string theories similar to the supercritical string theories. We comment on the connection between the critical nonrelativistic string theory and the lightlike linear dilaton theory
The motivational peculiarities of bribe-takers
Directory of Open Access Journals (Sweden)
Krivins A.
2018-01-01
Full Text Available Criminology (as the scientific study of criminal behaviour on the individual and social level and psychology (as the science, which seeks to understand individuals and groups pay special attention to motivation – a theoretical construction, used to explain behaviour. In this article the motivation of recipients of bribery is widely investigated. In addition to such well-established motives as greediness, selfishness, prevalence of personal interest, the author analyzes also other criminal behaviour determinants. The works, which are used in this research are of the following authors: John Broadus Watson, Edward Lee Thorndike (Behavioural; Sigmund Freud, Erich Fromm (Psychoanalysis; Carl Rogers, Abraham Maslow (Existential-humanistic theories; William Isaac Thomas (Thomas theorem; Florian Witold Znaniecki (sociological theory; Erik Homburger Erikson (theory on psychosocial development of human beings; Jean William Fritz Piaget (theory of cognitive development; Herbert Lefcourt, Ronald Smith (Locus of Control etc. As the result of this research the author has concluded that bribe-takers’ behaviour is determined by such psychological constructs as the desire for power, fear, envy, mental deflections, mania, feeling of exclusion, the need for extreme, oppressed creativity.
Müller, Gert; Sacks, Gerald
1990-01-01
These proceedings contain research and survey papers from many subfields of recursion theory, with emphasis on degree theory, in particular the development of frameworks for current techniques in this field. Other topics covered include computational complexity theory, generalized recursion theory, proof theoretic questions in recursion theory, and recursive mathematics.
A Boyer-Moore (or Watson-Watson) type algorithm for regular tree pattern matching
Watson, B.W.; Aarts, E.H.L.; Eikelder, ten H.M.M.; Hemerik, C.; Rem, M.
1995-01-01
In this chapter, I outline a new algorithm for regular tree pattern matching. The existence of this algorithm was first mentioned in the statements accompanying my dissertation, [2]. In order to avoid repeating the material in my dissertation, it is assumed that the reader is familiar with Chapters
Analyzing the Teaching of Advanced Mathematics Courses via the Enacted Example Space
Fukawa-Connelly, Timothy Patrick; Newton, Charlene
2014-01-01
Examples are believed to be very important in developing conceptual understanding of mathematical ideas, useful both in mathematics research and instruction (Bills & Watson in "Educational Studies in Mathematics" 69:77-79, 2008; Mason & Watson, 2008; Bills & Tall, 1998; Tall & Vinner, 1981). In this study, we draw on the…
the use of research in protected area management in Madagascar
African Journals Online (AJOL)
they are also expected to contribute to social objectives (Watson et al. 2014). ...... . Chapman, J. M., Algera ... Fuller, R. A., Lee, J. R. and Watson, J. E. M. 2014. Achieving open ... Kremen, C., Cameron, A., Moilanen, A., Phillips, S. J., Thomas, C. D., et al. 2008. Aligning ...
Gilio, Mattia; Clos, Frediano; Van Roermund, Herman L. M.
2013-04-01
The Scandinavian Caledonides (SC) are a deeply eroded Alpine-type orogenic belt formed by closure of the Iapetus ocean and collision between Baltica and Laurentia (500-380 Ma). The SC consists of a stack of Nappe Complexes (from bottom to top called Lower, Middle, Upper and Uppermost Allochthons) thrusted to the east over the Baltic Shield (Brueckner and Van Roermund, 2004; Gee et al., 2008). Fossil lithospheric mantle fragments, called orogenic peridotites, have been found within the (upper part of) middle, upper and uppermost Allochthons, as well as in the reworked basement gneisses (a.o Western Gneiss Complex (WGC)) along the Norwegian west coast. They occur as isolated lenses that contain diverse mineral parageneses and/or bulk rock compositions. Crustal incorporation of orogenic peridotite is classically interpreted to be the result of plate collisional processes related to orogeny (Brueckner and Medaris, 2000). The WGC and parts of the upper part of the Middle Allochthon (a.o. Seve Nappe Complex (SNC) in N Jämtland/S Västerbotten, central Sweden), are well known for the occurrence of high (HP) and ultrahigh pressure (UHP) metamorphic terranes (of Caledonian age). The (U)HPM evidence clearly demonstrates the deep metamorphic origin of these rocks interpreted to be caused by continental subduction and/or collision. Other metamorphic rocks (of Caledonian age) exposed in allochthonous nappes are solely characterised by greenschist-, amphibolite- and/or MP granulite "facies" mineral assemblages that can be interpreted, in the absence of retrogression, to have formed in less deeply subducted (and/or metamorphic) environments. This duality in metamorphic "facies" allows for a discrimination (at least theoretically) between "deep" versus "shallow" rooted nappes (in central parts of the Scandinavian Caledonides). Conform this reasoning, this duality should also be present within the Caledonian mineral assemblages (= metamorphic overprint) of orogenic peridotites (in
Dorogovtsev, A Ya; Skorokhod, A V; Silvestrov, D S; Skorokhod, A V
1997-01-01
This book of problems is intended for students in pure and applied mathematics. There are problems in traditional areas of probability theory and problems in the theory of stochastic processes, which has wide applications in the theory of automatic control, queuing and reliability theories, and in many other modern science and engineering fields. Answers to most of the problems are given, and the book provides hints and solutions for more complicated problems.
How to Map Theory: Reliable Methods Are Fruitless Without Rigorous Theory.
Gray, Kurt
2017-09-01
Good science requires both reliable methods and rigorous theory. Theory allows us to build a unified structure of knowledge, to connect the dots of individual studies and reveal the bigger picture. Some have criticized the proliferation of pet "Theories," but generic "theory" is essential to healthy science, because questions of theory are ultimately those of validity. Although reliable methods and rigorous theory are synergistic, Action Identification suggests psychological tension between them: The more we focus on methodological details, the less we notice the broader connections. Therefore, psychology needs to supplement training in methods (how to design studies and analyze data) with training in theory (how to connect studies and synthesize ideas). This article provides a technique for visually outlining theory: theory mapping. Theory mapping contains five elements, which are illustrated with moral judgment and with cars. Also included are 15 additional theory maps provided by experts in emotion, culture, priming, power, stress, ideology, morality, marketing, decision-making, and more (see all at theorymaps.org ). Theory mapping provides both precision and synthesis, which helps to resolve arguments, prevent redundancies, assess the theoretical contribution of papers, and evaluate the likelihood of surprising effects.
Little string theory from double-scaling limits of field theories
International Nuclear Information System (INIS)
Ling, Henry; Shieh, H.-H.; Anders, Greg van
2007-01-01
We show that little string theory on S 5 can be obtained as double-scaling limits of the maximally supersymmetric Yang-Mills theories on R x S 2 and R x S 3 /Z k . By matching the gauge theory parameters with those in the dual supergravity solutions found by Lin and Maldacena, we determine the limits in the gauge theories that correspond to decoupling of NS5-brane degrees of freedom. We find that for the theory on R x S 2 , the 't Hooft coupling must be scaled like ln 3 N, and on R x S 3 /Z k , like ln 2 N. Accordingly, taking these limits in these field theories gives Lagrangian definitions of little string theory on S 5
Perturbation theory and coupling constant analyticity in two-dimensional field theories
International Nuclear Information System (INIS)
Simon, B.
1973-01-01
Conjectural material and results over a year old are presented in the discussion of perturbation theory and coupling constant analyticity in two-dimensional field theories. General properties of perturbation series are discussed rather than questions of field theory. The question is interesting for two reasons: First, one would like to understand why perturbation theory is such a good guide (to show that perturbation theory determines the theory in some way). Secondly, one hopes to prove that some or all of the theories are nontrivial. (U.S.)
New Pathways between Group Theory and Model Theory
Fuchs, László; Goldsmith, Brendan; Strüngmann, Lutz
2017-01-01
This volume focuses on group theory and model theory with a particular emphasis on the interplay of the two areas. The survey papers provide an overview of the developments across group, module, and model theory while the research papers present the most recent study in those same areas. With introductory sections that make the topics easily accessible to students, the papers in this volume will appeal to beginning graduate students and experienced researchers alike. As a whole, this book offers a cross-section view of the areas in group, module, and model theory, covering topics such as DP-minimal groups, Abelian groups, countable 1-transitive trees, and module approximations. The papers in this book are the proceedings of the conference “New Pathways between Group Theory and Model Theory,” which took place February 1-4, 2016, in Mülheim an der Ruhr, Germany, in honor of the editors’ colleague Rüdiger Göbel. This publication is dedicated to Professor Göbel, who passed away in 2014. He was one of th...
Quantum decision theory as quantum theory of measurement
International Nuclear Information System (INIS)
Yukalov, V.I.; Sornette, D.
2008-01-01
We present a general theory of quantum information processing devices, that can be applied to human decision makers, to atomic multimode registers, or to molecular high-spin registers. Our quantum decision theory is a generalization of the quantum theory of measurement, endowed with an action ring, a prospect lattice and a probability operator measure. The algebra of probability operators plays the role of the algebra of local observables. Because of the composite nature of prospects and of the entangling properties of the probability operators, quantum interference terms appear, which make actions noncommutative and the prospect probabilities nonadditive. The theory provides the basis for explaining a variety of paradoxes typical of the application of classical utility theory to real human decision making. The principal advantage of our approach is that it is formulated as a self-consistent mathematical theory, which allows us to explain not just one effect but actually all known paradoxes in human decision making. Being general, the approach can serve as a tool for characterizing quantum information processing by means of atomic, molecular, and condensed-matter systems
Changing theories of change: strategic shifting in implicit theory endorsement.
Leith, Scott A; Ward, Cindy L P; Giacomin, Miranda; Landau, Enoch S; Ehrlinger, Joyce; Wilson, Anne E
2014-10-01
People differ in their implicit theories about the malleability of characteristics such as intelligence and personality. These relatively chronic theories can be experimentally altered, and can be affected by parent or teacher feedback. Little is known about whether people might selectively shift their implicit beliefs in response to salient situational goals. We predicted that, when motivated to reach a desired conclusion, people might subtly shift their implicit theories of change and stability to garner supporting evidence for their desired position. Any motivated context in which a particular lay theory would help people to reach a preferred directional conclusion could elicit shifts in theory endorsement. We examine a variety of motivated situational contexts across 7 studies, finding that people's theories of change shifted in line with goals to protect self and liked others and to cast aspersions on disliked others. Studies 1-3 demonstrate how people regulate their implicit theories to manage self-view by more strongly endorsing an incremental theory after threatening performance feedback or memories of failure. Studies 4-6 revealed that people regulate the implicit theories they hold about favored and reviled political candidates, endorsing an incremental theory to forgive preferred candidates for past gaffes but leaning toward an entity theory to ensure past failings "stick" to opponents. Finally, in Study 7, people who were most threatened by a previously convicted child sex offender (i.e., parents reading about the offender moving to their neighborhood) gravitated most to the entity view that others do not change. Although chronic implicit theories are undoubtedly meaningful, this research reveals a previously unexplored source of fluidity by highlighting the active role people play in managing their implicit theories in response to goals. 2014 APA, all rights reserved
Generalizability Theory and Classical Test Theory
Brennan, Robert L.
2011-01-01
Broadly conceived, reliability involves quantifying the consistencies and inconsistencies in observed scores. Generalizability theory, or G theory, is particularly well suited to addressing such matters in that it enables an investigator to quantify and distinguish the sources of inconsistencies in observed scores that arise, or could arise, over…
Szulik, Marta W; Pallan, Pradeep S; Nocek, Boguslaw; Voehler, Markus; Banerjee, Surajit; Brooks, Sonja; Joachimiak, Andrzej; Egli, Martin; Eichman, Brandt F; Stone, Michael P
2015-02-10
5-Hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxylcytosine (5caC) form during active demethylation of 5-methylcytosine (5mC) and are implicated in epigenetic regulation of the genome. They are differentially processed by thymine DNA glycosylase (TDG), an enzyme involved in active demethylation of 5mC. Three modified Dickerson-Drew dodecamer (DDD) sequences, amenable to crystallographic and spectroscopic analyses and containing the 5'-CG-3' sequence associated with genomic cytosine methylation, containing 5hmC, 5fC, or 5caC placed site-specifically into the 5'-T(8)X(9)G(10)-3' sequence of the DDD, were compared. The presence of 5caC at the X(9) base increased the stability of the DDD, whereas 5hmC or 5fC did not. Both 5hmC and 5fC increased imino proton exchange rates and calculated rate constants for base pair opening at the neighboring base pair A(5):T(8), whereas 5caC did not. At the oxidized base pair G(4):X(9), 5fC exhibited an increase in the imino proton exchange rate and the calculated kop. In all cases, minimal effects to imino proton exchange rates occurred at the neighboring base pair C(3):G(10). No evidence was observed for imino tautomerization, accompanied by wobble base pairing, for 5hmC, 5fC, or 5caC when positioned at base pair G(4):X(9); each favored Watson-Crick base pairing. However, both 5fC and 5caC exhibited intranucleobase hydrogen bonding between their formyl or carboxyl oxygens, respectively, and the adjacent cytosine N(4) exocyclic amines. The lesion-specific differences observed in the DDD may be implicated in recognition of 5hmC, 5fC, or 5caC in DNA by TDG. However, they do not correlate with differential excision of 5hmC, 5fC, or 5caC by TDG, which may be mediated by differences in transition states of the enzyme-bound complexes.
Grounded theory: building a middle-range theory in nursing
Directory of Open Access Journals (Sweden)
Maria João Fernandes
2015-03-01
Full Text Available The development of nursing as a discipline results from a boom of investigations underway for nearly a century, and of the construction of theories that have arisen during the 1950’s, with greater relevance since the 1960’s. Giving continuation to the production of knowledge in nursing and seeking to contribute to the increase in the number of explanatory theories of the functional content of nurses, there is interest in answering the question: how can a middle-range theory in nursing be built that explains the nurse-elderly interaction in a successful aging process? As well, we address the goal of describing the process of building a middle-range theory in nursing. Middle-range theory refers to a qualitative paradigm study of inductive thinking, developed in the context of primary health care. The information was collected through participant observation and interviews. Method of analysis grounded theory by Corbin and Strauss(1 was followed, utilizing the triangulation of data and theoretical sampling. Grounded theory has become a method of analysis which facilitates the understanding and explanation of the phenomenon under study. By making clear the nature and process of the nurse-elderly interaction in the selected context and within the context of successful aging, a middle-range theory proposal emerged.
String theory duals of Lifshitz–Chern–Simons gauge theories
International Nuclear Information System (INIS)
Balasubramanian, Koushik; McGreevy, John
2012-01-01
We propose candidate gravity duals for a class of non-Abelian z = 2 Lifshitz Chern–Simons (LCS) gauge theories studied by Mulligan, Kachru and Nayak. These are nonrelativistic gauge theories in 2+1 dimensions in which parity and time-reversal symmetries are explicitly broken by the presence of a Chern–Simons term. We show that these field theories can be realized as deformations of DLCQ N=4 super Yang–Mills theory. Using the holographic dictionary, we identify the bulk fields of type IIB supergravity that are dual to these deformations. The geometries describing the groundstates of the non-Abelian LCS gauge theories realized here exhibit a mass gap. (paper)
Introduction to conformal field theory. With applications to string theory
International Nuclear Information System (INIS)
Blumenhagen, Ralph; Plauschinn, Erik
2009-01-01
Based on class-tested notes, this text offers an introduction to Conformal Field Theory with a special emphasis on computational techniques of relevance for String Theory. It introduces Conformal Field Theory at a basic level, Kac-Moody algebras, one-loop partition functions, Superconformal Field Theories, Gepner Models and Boundary Conformal Field Theory. Eventually, the concept of orientifold constructions is explained in detail for the example of the bosonic string. In providing many detailed CFT calculations, this book is ideal for students and scientists intending to become acquainted with CFT techniques relevant for string theory but also for students and non-specialists from related fields. (orig.)
... t understand how. All that changed when James Watson and Francis Crick showed that DNA is shaped like a spiral staircase that can ... split, copied and passed on to future generations. Watson and Crick received a Nobel Prize in 1962 for ... National DNA Day This Inside Life Science article also appears ...
G-theory: The generator of M-theory and supersymmetry
Sepehri, Alireza; Pincak, Richard
2018-04-01
In string theory with ten dimensions, all Dp-branes are constructed from D0-branes whose action has two-dimensional brackets of Lie 2-algebra. Also, in M-theory, with 11 dimensions, all Mp-branes are built from M0-branes whose action contains three-dimensional brackets of Lie 3-algebra. In these theories, the reason for difference between bosons and fermions is unclear and especially in M-theory there is not any stable object like stable M3-branes on which our universe would be formed on it and for this reason it cannot help us to explain cosmological events. For this reason, we construct G-theory with M dimensions whose branes are formed from G0-branes with N-dimensional brackets. In this theory, we assume that at the beginning there is nothing. Then, two energies, which differ in their signs only, emerge and produce 2M degrees of freedom. Each two degrees of freedom create a new dimension and then M dimensions emerge. M-N of these degrees of freedom are removed by symmetrically compacting half of M-N dimensions to produce Lie-N-algebra. In fact, each dimension produces a degree of freedom. Consequently, by compacting M-N dimensions from M dimensions, N dimensions and N degrees of freedom is emerged. These N degrees of freedoms produce Lie-N-algebra. During this compactification, some dimensions take extra i and are different from other dimensions, which are known as time coordinates. By this compactification, two types of branes, Gp and anti-Gp-branes, are produced and rank of tensor fields which live on them changes from zero to dimension of brane. The number of time coordinates, which are produced by negative energy in anti-Gp-branes, is more sensible to number of times in Gp-branes. These branes are compactified anti-symmetrically and then fermionic superpartners of bosonic fields emerge and supersymmetry is born. Some of gauge fields play the role of graviton and gravitino and produce the supergravity. The question may arise that what is the physical reason
From F/M-theory to K-theory and back
International Nuclear Information System (INIS)
Garcia-Etxebarria, Inaki; Uranga, Angel M.
2006-01-01
We consider discrete K-theory tadpole cancellation conditions in type IIB orientifolds with magnetised 7-branes. Cancellation of K-theory charge constrains the choices of world-volume magnetic fluxes on the latter. We describe the F-/M-theory lift of these configurations, where 7-branes are encoded in the geometry of an elliptic fibration, and their magnetic quanta correspond to supergravity 4-form field strength fluxes. In a K3 compactification example, we show that standard quantization of 4-form fluxes as integer cohomology classes in K3 automatically implies the K-theory charge cancellation constraints on the 7-brane worldvolume magnetic fluxes in string theory (as well as new previously unnoticed discrete constraints, which we also interpret). Finally, we show that flux quantization in F-/M-theory implies that 7-brane world-volume flux quantization conditions are modified in the presence of 3-form fluxes
From F/M-theory to K-theory and back
Garcia-Etxebarria, I; Garcia-Etxebarria, Inaki; Uranga, Angel M.
2006-01-01
We consider discrete K-theory tadpole cancellation conditions in type IIB orientifolds with magnetised 7-branes. Cancellation of K-theory charge constrains the choices of world-volume magnetic fluxes on the latter. We describe the F-/M-theory lift of these configurations, where 7-branes are encoded in the geometry of an elliptic fibration, and their magnetic quanta correspond to supergravity 4-form field strength fluxes. In a K3 compactification example, we show that standard quantization of 4-form fluxes as integer cohomology classes in K3 automatically implies the K-theory charge cancellation constraints on the 7-brane worldvolume magnetic fluxes in string theory (as well as new previously unnoticed discrete constraints, which we also interpret). Finally, we show that flux quantization in F-/M-theory implies that 7-brane world-volume flux quantization conditions are modified in the presence of 3-form fluxes.
Cox, David A
2012-01-01
Praise for the First Edition ". . .will certainly fascinate anyone interested in abstract algebra: a remarkable book!"—Monatshefte fur Mathematik Galois theory is one of the most established topics in mathematics, with historical roots that led to the development of many central concepts in modern algebra, including groups and fields. Covering classic applications of the theory, such as solvability by radicals, geometric constructions, and finite fields, Galois Theory, Second Edition delves into novel topics like Abel’s theory of Abelian equations, casus irreducibili, and the Galo
1999-11-08
In these lectures I will build up the concept of field theory using the language of Feynman diagrams. As a starting point, field theory in zero spacetime dimensions is used as a vehicle to develop all the necessary techniques: path integral, Feynman diagrams, Schwinger-Dyson equations, asymptotic series, effective action, renormalization etc. The theory is then extended to more dimensions, with emphasis on the combinatorial aspects of the diagrams rather than their particular mathematical structure. The concept of unitarity is used to, finally, arrive at the various Feynman rules in an actual, four-dimensional theory. The concept of gauge-invariance is developed, and the structure of a non-abelian gauge theory is discussed, again on the level of Feynman diagrams and Feynman rules.
DEFF Research Database (Denmark)
Hjørland, Birger
2009-01-01
Concept theory is an extremely broad, interdisciplinary and complex field of research related to many deep fields with very long historical traditions without much consensus. However, information science and knowledge organization cannot avoid relating to theories of concepts. Knowledge...... organizing systems (e.g. classification systems, thesauri and ontologies) should be understood as systems basically organizing concepts and their semantic relations. The same is the case with information retrieval systems. Different theories of concepts have different implications for how to construe......, evaluate and use such systems. Based on "a post-Kuhnian view" of paradigms this paper put forward arguments that the best understanding and classification of theories of concepts is to view and classify them in accordance with epistemological theories (empiricism, rationalism, historicism and pragmatism...
International Nuclear Information System (INIS)
Eloranta, E.
2003-11-01
The geophysical field theory includes the basic principles of electromagnetism, continuum mechanics, and potential theory upon which the computational modelling of geophysical phenomena is based on. Vector analysis is the main mathematical tool in the field analyses. Electrostatics, stationary electric current, magnetostatics, and electrodynamics form a central part of electromagnetism in geophysical field theory. Potential theory concerns especially gravity, but also electrostatics and magnetostatics. Solid state mechanics and fluid mechanics are central parts in continuum mechanics. Also the theories of elastic waves and rock mechanics belong to geophysical solid state mechanics. The theories of geohydrology and mass transport form one central field theory in geophysical fluid mechanics. Also heat transfer is included in continuum mechanics. (orig.)
Generalized string theory mapping relations between gravity and gauge theory
International Nuclear Information System (INIS)
Bjerrum-Bohr, N.E.J.
2003-01-01
A previous study of the Kawai, Lewellen and Tye (KLT) relations between gravity and gauge theories, imposed by the relationship of closed and open strings, are here extended in the light of general relativity and Yang-Mills theory as effective field theories. We discuss the possibility of generalizing the traditional KLT mapping in this effective setting. A generalized mapping between the effective Lagrangians of gravity and Yang-Mills theory is presented, and the corresponding operator relations between gauge and gravity theories at the tree level are further explored. From this generalized mapping remarkable diagrammatic relations are found, linking diagrams in gravity and Yang-Mills theory, as well as diagrams in pure effective Yang-Mills theory. Also the possibility of a gravitational coupling to an antisymmetric field in the gravity scattering amplitude is considered, and shown to allow for mixed open-closed string solutions, i.e., closed heterotic strings
Game theory and power theory : a critical comparison
Balzer, Wolfgang
1992-01-01
Social actions can be formulated in the frame of game theory or in a frame using, and foccussing on, the notion of power. The two frames are described and clarified. The comparison of theories from these two branches are evaluated from the point of theory of science.
Dufwenberg, Martin
2011-03-01
Game theory is a toolkit for examining situations where decision makers influence each other. I discuss the nature of game-theoretic analysis, the history of game theory, why game theory is useful for understanding human psychology, and why game theory has played a key role in the recent explosion of interest in the field of behavioral economics. WIREs Cogni Sci 2011 2 167-173 DOI: 10.1002/wcs.119 For further resources related to this article, please visit the WIREs website. Copyright © 2010 John Wiley & Sons, Ltd.
Watson, David
2014-01-01
In this article, David Watson debates the pros and cons of leadership skills in both a small and large university. Watson relates his own experiences regarding the changing atmosphere of leadership. He states that his experiences have caused him to reflect on what is genuinely generic about individual capacities for institutional leadership: that…
Educational Technologists: Leading Change for a New Paradigm of Education
Aslan, Sinem; Reigeluth, Charles M.
2013-01-01
The transition from the industrial age to the information age has happened and is still happening in our society (Duffy, 2009). However, our current educational systems still operate based on the needs of the industrial-age society (Watson, Watson, & Reigeluth, n.d), making them among the least impacted organizations (Reigeluth & Joseph,…
Systemic Thinking in Career Development Theory: Contributions of the Systems Theory Framework
McMahon, Mary; Patton, Wendy
2018-01-01
This article considers systemic thinking in relation to the Systems Theory Framework (STF) and to career theory. An overview of systems theory and its applications is followed by a discussion of career theory to provide a context for the subsequent description of STF. The contributions of STF to career theory and to theory integration are…
Sources of political violence, political and psychological analysis
Directory of Open Access Journals (Sweden)
O. B. Balatska
2015-05-01
We also consider the following approaches to determining the nature and sources of aggression and violence such as instinktyvizm (K. Lorenz and behaviorism (J. B. Watson and B. F. Skinner et al.. Special attention is paid to theories of frustration aggression (J. Dollard, N. E. Miller, L. Berkowitz et al., according to which the causes of aggression and violence are hidden in a particular mental state – frustration. The particular importance of the theory of T. R. Gurr, in which the source of aggression and political violence are defined through the concept of relative deprivation, is underlined. Another approach is described in the article the concept of aggression as a learned reaction (A. Bandura, G. Levin, B. Fleischmann et al.. Supporters of this approach believe that aggressive behavior is formed in the process of social training.
Critical Theory: Implications for School Leadership Theory and Practice.
Peca, Kathy
The school leader's behaviors are inspired by theories, and theories are intrinsic to practice. This paper provides an overview of an emerging perspective in educational administration, critical theory. The paper first highlights the philosophies of Immanuel Kant, Fichte, Hegel, Marx, and the Frankfurt School. It then discusses critical theory…
DEFF Research Database (Denmark)
Bjerg, Ole; Presskorn-Thygesen, Thomas
2017-01-01
The paper is a contribution to current debates about conspiracy theories within philosophy and cultural studies. Wittgenstein’s understanding of language is invoked to analyse the epistemological effects of designating particular questions and explanations as a ‘conspiracy theory......’. It is demonstrated how such a designation relegates these questions and explanations beyond the realm of meaningful discourse. In addition, Agamben’s concept of sovereignty is applied to explore the political effects of using the concept of conspiracy theory. The exceptional epistemological status assigned...... to alleged conspiracy theories within our prevalent paradigms of knowledge and truth is compared to the exceptional legal status assigned to individuals accused of terrorism under the War on Terror. The paper concludes by discussing the relation between conspiracy theory and ‘the paranoid style...
Putting a Realistic Theory of Mind into Agency Theory
DEFF Research Database (Denmark)
Foss, Nicolai Juul; Stea, Diego
2014-01-01
Agency theory is one of the most important foundational theories in management research, but it rests on contestable cognitive assumptions. Specifically, the principal is assumed to hold a perfect (correct) theory regarding some of the content of the agent's mind, while he is entirely ignorant...... concerning other such content. More realistically, individuals have some limited access to the minds of others. We explore the implications for classical agency theory of realistic assumptions regarding the human potential for interpersonal sensemaking. We discuss implications for the design and management...
Schürmann, Michael
2008-01-01
This volume contains the revised and completed notes of lectures given at the school "Quantum Potential Theory: Structure and Applications to Physics," held at the Alfried-Krupp-Wissenschaftskolleg in Greifswald from February 26 to March 10, 2007. Quantum potential theory studies noncommutative (or quantum) analogs of classical potential theory. These lectures provide an introduction to this theory, concentrating on probabilistic potential theory and it quantum analogs, i.e. quantum Markov processes and semigroups, quantum random walks, Dirichlet forms on C* and von Neumann algebras, and boundary theory. Applications to quantum physics, in particular the filtering problem in quantum optics, are also presented.
Historicizing affordance theory
DEFF Research Database (Denmark)
Pedersen, Sofie; Bang, Jytte Susanne
2017-01-01
The aim of this article is to discuss how mutually enriching points from both affordance theory and cultural-historical activity theory can promote theoretical ideas which may prove useful as analytical tools for the study of human life and human development. There are two issues that need...... to be overcome in order to explore the potentials of James Gibson’s affordance theory: it does not sufficiently theorize (a) development and (b) society. We claim that Gibson’s affordance theory still needs to be brought beyond “the axiom of immediacy.” Ambivalences in Gibson’s affordance theory...... societal character of affordance theory....
DEFF Research Database (Denmark)
Wæver, Ole
2009-01-01
-empiricism and anti-positivism of his position. Followers and critics alike have treated Waltzian neorealism as if it was at bottom a formal proposition about cause-effect relations. The extreme case of Waltz being so victorious in the discipline, and yet being consistently mis-interpreted on the question of theory......, shows the power of a dominant philosophy of science in US IR, and thus the challenge facing any ambitious theorising. The article suggests a possible movement of fronts away from the ‘fourth debate' between rationalism and reflectivism towards one of theory against empiricism. To help this new agenda...
International Nuclear Information System (INIS)
Buettgen, R.; Holinde, K.; Holzenkamp, B.; Speth, J.
1986-01-01
We present further results of our general program, which is to construct meson-exchange potentials for hadronic systems involving strange particles. In this contribution we investigate the relationship between the free ΛN-interaction and the effective interactions inside of a nucleus. These polarization effects are taken into account within a generalized Brueckner G-matrix. Within this approximation we calculate the binding energy and effective mass of a Λ-particle in nuclear matter as well as the Landau-parameters of the ΛN-system
Supersymmetric gauge theories with classical groups via M theory fivebrane
International Nuclear Information System (INIS)
Terashima, S.
1998-01-01
We study the moduli space of vacua of four-dimensional N=1 and N=2 supersymmetric gauge theories with the gauge groups Sp(2N c ), SO(2N c ) and SO(2N c +1) using the M theory fivebrane. Higgs branches of the N=2 supersymmetric gauge theories are interpreted in terms of the M theory fivebrane and the type IIA s-rule is realized in it. In particular, we construct the fivebrane configuration which corresponds to a special Higgs branch root. This root is analogous to the baryonic branch root in the SU(N c ) theory which remains as a vacuum after the adjoint mass perturbation to break N=2 to N=1. Furthermore, we obtain the monopole condensations and the meson vacuum expectation values in the confining phase of N=1 supersymmetric gauge theories using the fivebrane technique. These are in complete agreement with the field theory results for the vacua in the phase with a single confined photon. (orig.)
Moschovakis, YN
1987-01-01
Now available in paperback, this monograph is a self-contained exposition of the main results and methods of descriptive set theory. It develops all the necessary background material from logic and recursion theory, and treats both classical descriptive set theory and the effective theory developed by logicians.
Orbifolds of M-theory and type II string theories in two dimensions
International Nuclear Information System (INIS)
Roy, S.
1997-01-01
We consider several orbifold compactifications of M-theory and theircorresponding type II duals in two space-time dimensions. In particular, we show that while the orbifold compactification of M-theory on T 9 /J 9 is dual to the orbifold compactification of type IIB string theory on T 8 /I 8 , the same orbifold T 8 /I 8 of type IIA string theory is dual to M-theory compactified on a smooth product manifold K3 x T 5 . Similarly, while the orbifold compactification of M-theory on (K3 x T 5 )/σ. J 5 is dual to the orbifold compactification of type IIB string theory on (K3 x T 4 )/σ.I 4 , the same orbifold of type IIA string theory is dual to the orbifold T 4 x (K3 x S 1 )/σ.J 1 of M-theory. The spectrum of various orbifold compactifications of M-theory and type II string theories on both sides are compared giving evidence in favor of these duality conjectures. We also comment on a connection between the Dasgupta-Mukhi-Witten conjecture and the Dabholkar-Park-Sen conjecture for the six-dimensional orbifold models of type IIB string theory and M-theory. (orig.)
Super-Chern-Simons Theory as Superstring Theory
Grassi, P A
2004-01-01
Superstrings and topological strings with supermanifolds as target space play a central role in the recent developments in string theory. Nevertheless the rules for higher-genus computations are still unclear or guessed in analogy with bosonic and fermionic strings. Here we present a common geometrical setting to develop systematically the prescription for amplitude computations. The geometrical origin of these difficulties is the theory of integration of superforms. We provide a translation between the theory of supermanifolds and topological strings with supertarget space. We show how in this formulation one can naturally construct picture changing operators to be inserted in the correlation functions to soak up the zero modes of commuting ghost and we derive the amplitude prescriptions from the coupling with an extended topological gravity on the worldsheet. As an application we consider a simple model on R^(3|2) leading to super-Chern-Simons theory.
The use of perturbation theory in density-functional theory
International Nuclear Information System (INIS)
Goerling, A.
1996-01-01
Perturbation theory with respect to the electron-electron interaction leads to expressions for the exchange and correlation energies and potentials in terms of Kohn-Sham orbitals and Kohn-Sham eigenvalues. An exact open-quote exchange-only close-quote procedure for solids is introduced. Results for several semiconductors are presented. Perturbation theory expansions for the hardness of molecules and the bad gap of solids are given. Density-functional exchange and correlation energies for excited states are defined and a perturbation theory based Kohn-Sham formalism to treat excited states within density-functional theory is introduced
International Nuclear Information System (INIS)
Crisan, M.
1988-01-01
This book discusses the most important aspects of the theory. The phenomenological model is followed by the microscopic theory of superconductivity, in which modern formalism of the many-body theory is used to treat most important problems such as superconducting alloys, coexistence of superconductivity with the magnetic order, and superconductivity in quasi-one-dimensional systems. It concludes with a discussion on models for exotic and high temperature superconductivity. Its main aim is to review, as complete as possible, the theory of superconductivity from classical models and methods up to the 1987 results on high temperature superconductivity. Contents: Phenomenological Theory of Superconductivity; Microscopic Theory of Superconductivity; Theory of Superconducting Alloys; Superconductors in a Magnetic Field; Superconductivity and Magnetic Order; Superconductivity in Quasi-One-Dimensional Systems; and Non-Conventional Superconductivity
DEFF Research Database (Denmark)
Wæver, Ole
2011-01-01
theory is found to ‘act politically’ through three structural features that systematically shape the political effects of using the theory. The article further discusses – on the basis of the preceding articles in the special issue – three emerging debates around securitization theory: ethics......This article outlines three ways of analysing the ‘politics of securitization’, emphasizing an often-overlooked form of politics practised through theory design. The structure and nature of a theory can have systematic political implications. Analysis of this ‘politics of securitization......’ is distinct from both the study of political practices of securitization and explorations of competing concepts of politics among security theories. It means tracking what kinds of analysis the theory can produce and whether such analysis systematically impacts real-life political struggles. Securitization...
Some relations between twisted K-theory and E8 gauge theory
International Nuclear Information System (INIS)
Mathai, Varghese; Sati, Hisham
2004-01-01
Recently, Diaconescu, Moore and Witten provided a nontrivial link between K-theory and M-theory, by deriving the partition function of the Ramond-Ramond fields of Type IIA string theory from an E8 gauge theory in eleven dimensions. We give some relations between twisted K-theory and M-theory by adapting the method of Diaconescu-Moore-Witten and Moore-Saulina. In particular, we construct the twisted K-theory torus which defines the partition function, and also discuss the problem from the E8 loop group picture, in which the Dixmier-Douady class is the Neveu-Schwarz field. In the process of doing this, we encounter some mathematics that is new to the physics literature. In particular, the eta differential form, which is the generalization of the eta invariant, arises naturally in this context. We conclude with several open problems in mathematics and string theory. (author)
Conformal techniques in string theory and string field theory
International Nuclear Information System (INIS)
Giddings, S.B.
1987-01-01
The application of some conformal and Riemann surface techniques to string theory and string field theory is described. First a brief review of Riemann surface techniques and of the Polyakov approach to string theory is presented. This is followed by a discussion of some features of string field theory and of its Feynman rules. Specifically, it is shown that the Feynman diagrams for Witten's string field theory respect modular invariance, and in particular give a triangulation of moduli space. The Polyakov formalism is then used to derive the Feynman rules that should follow from this theory upon gauge-fixing. It should also be possible to apply this derivation to deduce the Feynman rules for other gauge-fixed string field theories. Following this, Riemann surface techniques are turned to the problem of proving the equivalence of the Polyakov and light-cone formalisms. It is first shown that the light-cone diagrams triangulate moduli space. Then the Polyakov measure is worked out for these diagrams, and shown to equal that deduced from the light-cone gauge fixed formalism. Also presented is a short description of the comparison of physical states in the two formalisms. The equivalence of the two formalisms in particular constitutes a proof of the unitarity of the Polyakov framework for the closed bosonic string
Informal Theory: The Ignored Link in Theory-to-Practice
Love, Patrick
2012-01-01
Applying theory to practice in student affairs is dominated by the assumption that formal theory is directly applied to practice. Among the problems with this assumption is that many practitioners believe they must choose between their lived experiences and formal theory, and that graduate students are taught that their experience "does not…
Theories of the firm as a foundation for formulating accounting theories
Directory of Open Access Journals (Sweden)
José Glauber Cavalcante dos Santos
2015-03-01
Full Text Available This paper develops an essay concerning the conceptual extension derived from the theory of the firm and its relationship to prevailing accounting theories, summarizes the main currents that try to explain the firm and seeks to establish a relationship with changes of direction in the object and purpose of accounting, as expressed in current accounting research. It is argued that the actual concept of “firm” ends up guiding an informational logic that is deep-rooted in accounting by means of the interpretations absorbed by accounting theory. The discussion centers on the object of accounting theory (registration and disclosure of economic aggregates as intended for accounting information users. The neoclassical theory of the firm, the contractual theory of the firm and the New Institutional Economics (NIE are used for support, focused on transactional costs, property rights and measurement costs. The concepts of business economics direct the actual conceptual logic of accounting theory, with the main intention being to provide efficient information to stakeholders. It has been observed that accounting theory has its roots in the neoclassical theory of the firm; and, by means of the contractual theory of the firm, where the monitoring of agents and of contracts is discussed, it goes beyond the limited vision of the assets control function (stewardship, expands the focus of providing information, in addition to the restricted function of accountability. And, finally, although not all elements of the new NIE are comprehended by accounting theory, the NIE withholds elements of instrumental importance for the consolidation of accounting theories concerning its institutionalization.
International Nuclear Information System (INIS)
Deshpande, N.G.
1980-01-01
By electro-weak theory is meant the unified field theory that describes both weak and electro-magnetic interactions. The development of a unified electro-weak theory is certainly the most dramatic achievement in theoretical physics to occur in the second half of this century. It puts weak interactions on the same sound theoretical footing as quantum elecrodynamics. Many theorists have contributed to this development, which culminated in the works of Glashow, Weinberg and Salam, who were jointly awarded the 1979 Nobel Prize in physics. Some of the important ideas that contributed to this development are the theory of beta decay formulated by Fermi, Parity violation suggested by Lee and Yang, and incorporated into immensely successful V-A theory of weak interactions by Sudarshan and Marshak. At the same time ideas of gauge invariance were applied to weak interaction by Schwinger, Bludman and Glashow. Weinberg and Salam then went one step further and wrote a theory that is renormalizable, i.e., all higher order corrections are finite, no mean feat for a quantum field theory. The theory had to await the development of the quark model of hadrons for its completion. A description of the electro-weak theory is given
Music Technology and Musical Creativity: Making Connections
Thompson, Douglas Earl
2012-01-01
This article is a preview of Scott Watson's new book, "Using Technology to Unlock Musical Creativity" (Oxford University Press, 2011). The book's main contents are summarized and one of the volume's 29 lessons is provided to assist readers in evaluating the book for their use. Particular attention is given to Watson's success in making the…
Bringing Precision Medicine to Community Oncologists.
2017-01-01
Quest Diagnostics has teamed up with Memorial Sloan Kettering Cancer Center and IBM Watson Health to offer IBM Watson Genomics to its network of community cancer centers and hospitals. This new service aims to advance precision medicine by combining genomic tumor sequencing with the power of cognitive computing. ©2017 American Association for Cancer Research.
Moore, J.
2011-01-01
Early forms of psychology assumed that mental life was the appropriate subject matter for psychology, and introspection was an appropriate method to engage that subject matter. In 1913, John B. Watson proposed an alternative: classical S-R behaviorism. According to Watson, behavior was a subject matter in its own right, to be studied by the…
Liu, Baoding
2015-01-01
When no samples are available to estimate a probability distribution, we have to invite some domain experts to evaluate the belief degree that each event will happen. Perhaps some people think that the belief degree should be modeled by subjective probability or fuzzy set theory. However, it is usually inappropriate because both of them may lead to counterintuitive results in this case. In order to rationally deal with belief degrees, uncertainty theory was founded in 2007 and subsequently studied by many researchers. Nowadays, uncertainty theory has become a branch of axiomatic mathematics for modeling belief degrees. This is an introductory textbook on uncertainty theory, uncertain programming, uncertain statistics, uncertain risk analysis, uncertain reliability analysis, uncertain set, uncertain logic, uncertain inference, uncertain process, uncertain calculus, and uncertain differential equation. This textbook also shows applications of uncertainty theory to scheduling, logistics, networks, data mining, c...
DEFF Research Database (Denmark)
Kosbar, Tamer R.; Sofan, Mamdouh A.; Waly, Mohamed A.
2015-01-01
about 6.1 °C when the TFO strand was modified with Z and the Watson-Crick strand with adenine-LNA (AL). The molecular modeling results showed that, in case of nucleobases Y and Z a hydrogen bond (1.69 and 1.72 Å, respectively) was formed between the protonated 3-aminopropyn-1-yl chain and one...... of the phosphate groups in Watson-Crick strand. Also, it was shown that the nucleobase Y made a good stacking and binding with the other nucleobases in the TFO and Watson-Crick duplex, respectively. In contrast, the nucleobase Z with LNA moiety was forced to twist out of plane of Watson-Crick base pair which......The phosphoramidites of DNA monomers of 7-(3-aminopropyn-1-yl)-8-aza-7-deazaadenine (Y) and 7-(3-aminopropyn-1-yl)-8-aza-7-deazaadenine LNA (Z) are synthesized, and the thermal stability at pH 7.2 and 8.2 of anti-parallel triplexes modified with these two monomers is determined. When, the anti...
Noncommutative Geometry in M-Theory and Conformal Field Theory
International Nuclear Information System (INIS)
Morariu, Bogdan
1999-01-01
In the first part of the thesis I will investigate in the Matrix theory framework, the subgroup of dualities of the Discrete Light Cone Quantization of M-theory compactified on tori, which corresponds to T-duality in the auxiliary Type II string theory. After a review of matrix theory compactification leading to noncommutative supersymmetric Yang-Mills gauge theory, I will present solutions for the fundamental and adjoint sections on a two-dimensional twisted quantum torus and generalize to three-dimensional twisted quantum tori. After showing how M-theory T-duality is realized in supersymmetric Yang-Mills gauge theories on dual noncommutative tori I will relate this to the mathematical concept of Morita equivalence of C*-algebras. As a further generalization, I consider arbitrary Ramond-Ramond backgrounds. I will also discuss the spectrum of the toroidally compactified Matrix theory corresponding to quantized electric fluxes on two and three tori. In the second part of the thesis I will present an application to conformal field theory involving quantum groups, another important example of a noncommutative space. First, I will give an introduction to Poisson-Lie groups and arrive at quantum groups using the Feynman path integral. I will quantize the symplectic leaves of the Poisson-Lie group SU(2)*. In this way we obtain the unitary representations of U q (SU(2)). I discuss the X-structure of SU(2)* and give a detailed description of its leaves using various parametrizations. Then, I will introduce a new reality structure on the Heisenberg double of Fun q (SL(N,C)) for q phase, which can be interpreted as the quantum phase space of a particle on the q-deformed mass-hyperboloid. I also present evidence that the above real form describes zero modes of certain non-compact WZNW-models
Noncommutative Geometry in M-Theory and Conformal Field Theory
Energy Technology Data Exchange (ETDEWEB)
Morariu, Bogdan [Univ. of California, Berkeley, CA (United States)
1999-05-01
In the first part of the thesis I will investigate in the Matrix theory framework, the subgroup of dualities of the Discrete Light Cone Quantization of M-theory compactified on tori, which corresponds to T-duality in the auxiliary Type II string theory. After a review of matrix theory compactification leading to noncommutative supersymmetric Yang-Mills gauge theory, I will present solutions for the fundamental and adjoint sections on a two-dimensional twisted quantum torus and generalize to three-dimensional twisted quantum tori. After showing how M-theory T-duality is realized in supersymmetric Yang-Mills gauge theories on dual noncommutative tori I will relate this to the mathematical concept of Morita equivalence of C*-algebras. As a further generalization, I consider arbitrary Ramond-Ramond backgrounds. I will also discuss the spectrum of the toroidally compactified Matrix theory corresponding to quantized electric fluxes on two and three tori. In the second part of the thesis I will present an application to conformal field theory involving quantum groups, another important example of a noncommutative space. First, I will give an introduction to Poisson-Lie groups and arrive at quantum groups using the Feynman path integral. I will quantize the symplectic leaves of the Poisson-Lie group SU(2)*. In this way we obtain the unitary representations of Uq(SU(2)). I discuss the X-structure of SU(2)* and give a detailed description of its leaves using various parametrizations. Then, I will introduce a new reality structure on the Heisenberg double of Funq (SL(N,C)) for q phase, which can be interpreted as the quantum phase space of a particle on the q-deformed mass-hyperboloid. I also present evidence that the above real form describes zero modes of certain non-compact WZNW-models.
Drawing Out Theory: Art and the Teaching of Political Theory.
Miller, Char R.
2000-01-01
Discusses how to use art in introductory political theory courses. Provides examples of incorporating art to teach political theory, such as examining Machiavelli's "The Prince" and Michelangelo's "David" to understand Florentine (Florence, Italy) political theory. (CMK)
Conlon, Joseph
2016-01-01
Is string theory a fraud or one of the great scientific advances? Why do so many physicists work on string theory if it cannot be tested? This book provides insight into why such a theory, with little direct experimental support, plays such a prominent role in theoretical physics. The book gives a modern and accurate account of string theory and science, explaining what string theory is, why it is regarded as so promising, and why it is hard to test.
Possible role of double scattering in electron-atom scattering in a laser field
International Nuclear Information System (INIS)
Rabadan, I.; Mendez, L.; Dickinson, A.S.
1996-01-01
By considering observations of double-scattering effects in the excitation of the 2 1 P level of He, gas density values estimated for the laser-assisted elastic scattering experiments of Wallbank and Holmes (1993, 1994a,b) for which the Kroll-Watson approximation appears to fail. Using comparable densities for He and lower densities for Ar, and assuming the Kroll-Watson approximation for single-scattering events, differential cross sections are calculated including double scattering for laser-assisted scattering for a range of energies and scattering angles. Comparison with the observed values shows that double-scattering effects can give a semi-quantitative explanation of the apparent breakdown of the Kroll-Watson approximation in both He and Ar. (author)
Directory of Open Access Journals (Sweden)
Brent Tisserat
2018-04-01
Full Text Available Lignocellulosic composite (LC panels were fabricated using an adhesive matrix prepared from three different agricultural by-products: dried distillers grains with solubles (DDGS, pennycress (Thlaspi arvense L. press cake (PPC, or lesquerella [Lesquerella fendleri (A. Gary S. Watson] press cake (LPC reinforced with Paulownia elongata L. wood (PW particles. The goal in this study was to assess the mechanical properties of composites utilizing these low-cost matrix materials, which were subjected to various oil extraction methods. Three types of oil extraction methods were utilized: ethanol, supercritical CO2, and hexane, in order to generate matrix materials. These matrix materials were mixed with equal proportions of PW and hot pressed to generate panels. Overall, hexane extraction was the best method to enhance the mechanical properties of the matrices used to fabricate lignocellulosic composites. LPC’s produced a matrix that gave the resulting composite superior flexural properties compared to composites generated from DDGS and PPC matrices. The mechanical properties of composites generated from soy products (soybean meal flour or soy protein isolate were similar to those derived from DDGS, PPC, or LPC. The dimensional stability properties of LCs were improved when the hexane extraction method was employed, unlike with the other extraction methods that were used to generate matrices.