WorldWideScience

Sample records for brine shrimp artemia

  1. Potentials of converting microalgae into brine shrimp Artemia

    OpenAIRE

    Sorgeloos, P

    1985-01-01

    High densities of brine shrimp Artemia can be cultured in flow-through systems using the effluent of microalgae cultures as a combined source of culture medium and food. It has been proven at the "St. Croix Artificial Upwelling Mariculture Project" that in comparison with the fast growing clam Tapes japonica, brine shrimp assure a much more efficient conversion of plant into animal biomass. It appears from the given examples that microalgae conversion into brine shrimp Artemia offers efficien...

  2. Use of brine shrimp, Artemia spp., in larval crustacean nutrition: a review

    OpenAIRE

    Sorgeloos, P.; Coutteau, P.; Dhert, Ph.; Merchie, G.; Lavens, P.

    1998-01-01

    Because of convenience in production and their suitable biochemical composition, brine shrimp Artemia spp. nauplii have been adopted as a standard diet in the commercial larviculture of several crustacean species. The nutritional value of Artemia, however, is not constant, but varies both geographically and temporally. During the past decade both the causes of Artemia nutritional variability and methods to improve poor-quality Artemia have been identified. Enriching Artemia spp. with emulsifi...

  3. The Brine Shrimp Artemia: Adapted to Critical Life Conditions

    Science.gov (United States)

    Gajardo, Gonzalo M.; Beardmore, John A.

    2012-01-01

    The brine shrimp Artemia is a micro-crustacean, well adapted to the harsh conditions that severely hypersaline environments impose on survival and reproduction. Adaptation to these conditions has taken place at different functional levels or domains, from the individual (molecular-cellular-physiological) to the population level. Such conditions are experienced by very few equivalent macro-planktonic organisms; thus, Artemia can be considered a model animal extremophile offering a unique suite of adaptations that are the focus of this review. The most obvious is a highly efficient osmoregulation system to withstand up to 10 times the salt concentration of ordinary seawater. Under extremely critical environmental conditions, for example when seasonal lakes dry-out, Artemia takes refuge by producing a highly resistant encysted gastrula embryo (cyst) capable of severe dehydration enabling an escape from population extinction. Cysts can be viewed as gene banks that store a genetic memory of historical population conditions. Their occurrence is due to the evolved ability of females to “perceive” forthcoming unstable environmental conditions expressed by their ability to switch reproductive mode, producing either cysts (oviparity) when environmental conditions become deleterious or free-swimming nauplii (ovoviviparity) that are able to maintain the population under suitable conditions. At the population level the trend is for conspecific populations to be fragmented into locally adapted populations, whereas species are restricted to salty lakes in particular regions (regional endemism). The Artemia model depicts adaptation as a complex response to critical life conditions, integrating and refining past and present experiences at all levels of organization. Although we consider an invertebrate restricted to a unique environment, the processes to be discussed are of general biological interest. Finally, we highlight the benefits of understanding the stress response of

  4. The brine shrimp Artemia: adapted to critical life conditions

    Directory of Open Access Journals (Sweden)

    Gonzalo M Gajardo

    2012-06-01

    Full Text Available The brine shrimp Artemia is a micro-crustacean, well adapted to the harsh conditions that severely hypersaline environments impose on survival and reproduction. Adaptation to these conditions has taken place at different functional levels or domains, from the individual (molecular-cellular-physiological to the population level. Such conditions are experienced by very few equivalent macro-planktonic organisms; thus, Artemia can be considered a model animal extremophile offering a unique suite of adaptations that are the focus of this review. The most obvious is a highly efficient osmoregulation system to withstand up to 10 times the salt concentration of ordinary seawater. Under extremely critical environmental conditions, for example when seasonal lakes dry out, Artemia takes refuge by producing a highly resistant encysted gastrula embryo (cyst capable of severe dehydration enabling an escape from population extinction. Cysts can be viewed as gene banks that store a genetic memory of historical population conditions. Their occurrence is due to the evolved ability of females to perceive forthcoming unstable environmental conditions expressed by their ability to switch reproductive mode, producing either cysts (oviparity when environmental conditions become deleterious or free-swimming nauplii (ovoviviparity that are able to maintain the population under suitable conditions.At the population level the trend is for conspecific populations to be fragmented into locally adapted populations, whereas species are restricted to salty lakes in particular regions (regional endemism. The Artemia model depicts adaptation as a complex response to critical life conditions, integrating and refining past and present experiences at all levels of organization. Although we consider an invertebrate restricted to a unique environment, the processes to be discussed are of general biological interest. Finally, we highlight the benefits of understanding the stress

  5. THE BRINE SHRIMP (ARTEMIA SALINA) LETHALITY OF Brassica oleracea var. capitata

    OpenAIRE

    O. T. TÜZÜN, E. GÜRKAN, S. DOĞANCA, F. HIRLAK,

    2015-01-01

    This work covers up the bio-activities of the five fractions obtained from the ethanolic extract of Brassica oleracea var. capitata (Cruciferae).Key Words: Brassica oleracea var. capitata, Brine shrimp (Artemia salina)

  6. Production dynamics of Brine Shrimp (Artemia franciscana) in the San Francisco Bay National Wildlife Refuge

    Data.gov (United States)

    US Fish and Wildlife Service, Department of the Interior — Abundance, stage structure and population dynamics of brine shrimp Artemia franciscana in pond M4 of the San Francisco Bay National Wildlife Refuge were documented...

  7. Evaluation of the bioactivities of some Myanmar medicinal plants using brine shrimp (Artemia salina) toxicity test

    International Nuclear Information System (INIS)

    For a variety of toxic substances, brine shrimp larvae (Artemia salina) are usually used as a simple bioassay method and it is also applied for natural product research. The brine shrimp larvae (nauplii) are obtained by natural hatching method from Artemia cysts. By using the larvae, the results from these experiments lead to the lethal dose, LD50 values of extracts of selected medicinal plants. Activities of a broad range of plant extracts are manifested as toxicity to the brine shrimp. Screening results with six plant extracts are compared with pure caffeine. This method is rapid, reliable, inexpensive and convenient. (author)

  8. Bioencapsulation of Two Different Vibrio Species in Nauplii of the Brine Shrimp (Artemia franciscana)

    OpenAIRE

    Gomez-Gil, Bruno; Herrera-Vega, Maria A.; Abreu-Grobois, F. Alberto; Roque, Ana

    1998-01-01

    Two groups of nauplii from the brine shrimp (Artemia franciscana) were enriched with different bacteria, and the dynamics of bacterial uptake by the nauplii were observed. This study showed that the efficiency of Artemia nauplii in bioencapsulating bacteria strongly depends on the type of bacteria used, time of exposure, and status (live or dead) of the bacteria.

  9. Characterization of polymorphic microsatellite markers in the brine shrimp Artemia (Branchiopoda, Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Green, Andy J.; Figuerola, Jordi;

    2009-01-01

    The brine shrimp Artemia is a complex genus containing sexual species and parthenogenetic lineages. Artemia franciscana is native to America and its cysts (diapausing eggs) are used worldwide as a food source in aquaculture. As a consequence, this anostracan has become an invasive species in many...

  10. Development of the brine shrimp Artemia is accelerated during spaceflight

    Science.gov (United States)

    Spooner, B. S.; Metcalf, J.; DeBell, L.; Paulsen, A.; Noren, W.; Guikema, J. A.

    1994-01-01

    Developmentally arrested brine shrimp cysts have been reactivated during orbital spaceflight on two different Space Shuttle missions (STS-50 and STS-54), and their subsequent development has been compared with that of simultaneously reactivated ground controls. Flight and control brine shrimp do not significantly differ with respect to hatching rates or larval morphology at the scanning and transmission EM levels. A small percentage of the flight larvae had defective nauplier eye development, but the observation was not statistically significant. However, in three different experiments on two different flights, involving a total of 232 larvae that developed in space, a highly significant difference in degree of flight to control development was found. By as early as 2.25 days after reactivation of development, spaceflight brine shrimp were accelerated, by a full instar, over ground control brine shrimp. Although developing more rapidly, flight shrimp grew as long as control shrimp at each developmental instar or stage.

  11. Phylogeography and local endemism of the native Mediterranean brine shrimp Artemia salina (Branchiopoda: Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Gómez, Africa; Green, Andy J.;

    2008-01-01

    There has been a recent appreciation of the ecological impacts of zooplanktonic species invasions. The North American brine shrimp Artemia franciscana is one such alien invader in hyper-saline water ecosystems at a global scale. It has been shown to outcompete native Artemia species, leading to...... their local extinction. We used partial sequences of the mitochondrial Cytochrome c Oxidase Subunit 1 (COI or cox1) gene to investigate the genetic diversity and phylogeography of A. salina, an extreme halophilic sexual brine shrimp, over its known distribution range (Mediterranean Basin and South...

  12. INTERNATIONAL STUDY ON ARTEMIA XXII: NUTRITION IN AQUATIC TOXICOLOGY--DIET QUALITY OF GEOGRAPHICAL STRAINS OF THE BRINE SHRIMP, ARTEMIA

    Science.gov (United States)

    A reference and four geographical strains of brine shrimp (Artemia spp.) nauplii were evaluated as diets for the larvae of a marine fish, the Atlantic silverside (Menidia menidia). The survival of fish fed the various strains was significantly different and ranged from 82 to 57 p...

  13. Cyanobacterial cytotoxicity versus toxicity to brine shrimp Artemia salina

    Czech Academy of Sciences Publication Activity Database

    Hisem, D.; Hrouzek, Pavel; Tomek, P.; Tomšíčková, J.; Zapomělová, Eliška; Skácelová, K.; Lukešová, Alena; Kopecký, Jiří

    2011-01-01

    Roč. 57, č. 1 (2011), s. 76-83. ISSN 0041-0101 R&D Projects: GA ČR GAP504/10/1501 Institutional research plan: CEZ:AV0Z50200510; CEZ:AV0Z60170517; CEZ:AV0Z60660521 Keywords : Secondary metabolites * Brine shrimp bioassay * Health risk assessment Subject RIV: EE - Microbiology, Virology Impact factor: 2.508, year: 2011

  14. The brine shrimp ( Artemia parthenogenetica) as encapsulation organism for prophylactic chemotherapy of fish and prawn

    Science.gov (United States)

    Cao, Ji-Xiang; Bian, Bo-Zhong; Li, Ming-Ren

    1996-06-01

    Brine shrimp ( Artemia parthenogenetica) which had ingested three water-insoluble antibacterial drugs i.e. sulfadiazine(SD), oxytetracycline (OTC) and erythromycin estolate (ERY-Es) were fed to Tilapia and Mysis III of Penaeus orientalis K. The drug contents in the predators were then determined. After administration of drugs to Tilapia and Mysis III, through the bio-encapsulation of the brine shrimp, efficacious therapeutical concentration of OTC and ERY-Es (but not SD) in the predators could be reached and maintained for more than 8 hours.

  15. Bioencapsulation of the antibacterial drug sarafloxacin in nauplii of the brine shrimp Artemia franciscana

    OpenAIRE

    Dixon, B.A.; Van Poucke, S; Chair, M; Dehasque, M.; Nelis, H J; Sorgeloos, P.; De Leenheer, A P

    1995-01-01

    Nauplii of the brine shrimp Artemia franciscana were enriched with the antibacterial drug sarafloxacin hydrochloride to determine if levels effective against four pathogenetic strains of Vibrio spp. would accumulate in brine shrimp. Three vibrio strains were Vibrio anguillarum; the fourth was V. vulnificus. Concentrations of sarafloxacin ranging from 1 to 40% (weight: volume) were incorporated into the oil phase of Super Selco brine shrimp diets. Enriched nauplii and controls were sampled at ...

  16. Biological screening of selected Pacific Northwest forest plants using the brine shrimp (Artemia salina) toxicity bioassay.

    Science.gov (United States)

    Karchesy, Yvette M; Kelsey, Rick G; Constantine, George; Karchesy, Joseph J

    2016-01-01

    The brine shrimp (Artemia salina) bioassay was used to screen 211 methanol extracts from 128 species of Pacific Northwest plants in search of general cytotoxic activity. Strong toxicity (LC50  1000 µg/ml). Our subsequent studies of conifer heartwoods with strong activity confirm the assay's value for identifying new investigational leads for materials with insecticidal and fungicidal activity. PMID:27186474

  17. Toxicity Effect of Silver Nanoparticles in Brine Shrimp Artemia

    OpenAIRE

    Chinnasamy Arulvasu; Samou Michael Jennifer; Durai Prabhu; Devakumar Chandhirasekar

    2014-01-01

    The present study revealed the toxic effect of silver nanoparticles (AgNPs) in Artemia nauplii and evaluated the mortality rate, hatching percentage, and genotoxic effect in Artemia nauplii/cysts. The AgNPs were commercially purchased and characterized using field emission scanning electron microscope with energy dispersive X-ray spectroscopy. Nanoparticles were spherical in nature and with size range of 30–40 nm. Artemia cysts were collected from salt pan, processed, and hatched in sea water...

  18. Biological screening of chitosan derivatives using Artemia spp. (brine shrimp test)

    International Nuclear Information System (INIS)

    The present study reported on the screening of six selected chitosan derivatives using the brine shrimp lethality bioassay. In addition, the irradiation effects towards the compounds at 25 kGy were also studied. Chitosan is a natural polysaccharide derived from chitin, extracted from the exoskeletons of crustaceans and insects as well as walls of some bacteria and fungi. Brine shrimp test is employed for the screening of toxicity of chitosan derivatives. Toxicity test was carried out by adding different concentrations of tested samples to approximately 5 to 15 Artemia salina larvae. Biological activity using the brine shrimp bioassay was recorded as LC50 i.e. lethal concentration that kills 50% of the larvae within 24 hours of contact with the samples. Compounds are considered toxic when the LC50 value is lower than 1 mg/ml by brine shrimp bioassay and practically non-toxic when the value is larger. Of the samples tested, none were toxic to the brine shrimp (LC50 > 1 mg/ml). The LC50 values of all chitosan derivatives tested, control and irradiated at 25 kGy were above 1 mg/ml thus all tested samples are considered non-toxic. This study demonstrated that irradiation at 25 kGy showed no significant effects towards the toxicity of the chitosan derivatives. After irradiation, only NO-CMC exhibited marked decrease in LC50 value, reduced by 3-fold from 34.96 mg/ml to 11.07 mg/ml while O-CMC (5.45 mg/ml to 5 mg/ml) showed no clear differences based on rough estimation. This study suggested that brine shrimp bioassay is a simple, reliable and convenient method that could provide useful clues of the relative toxic potential of the sample tested. (Author)

  19. Stress tolerance during diapause and quiescence of the brine shrimp, Artemia.

    Science.gov (United States)

    MacRae, Thomas H

    2016-01-01

    Oviparously developing embryos of the brine shrimp, Artemia, arrest at gastrulation and are released from females as cysts before entering diapause, a state of dormancy and stress tolerance. Diapause is terminated by an external signal, and growth resumes if conditions are permissible. However, if circumstances are unfavorable, cysts enter quiescence, a dormant stage that continues as long as adverse conditions persist. Artemia embryos in diapause and quiescence are remarkably resistant to environmental and physiological stressors, withstanding desiccation, cold, heat, oxidation, ultraviolet radiation, and years of anoxia at ambient temperature when fully hydrated. Cysts have adapted to stress in several ways; they are surrounded by a rigid cell wall impermeable to most chemical compounds and which functions as a shield against ultraviolet radiation. Artemia cysts contain large amounts of trehalose, a non-reducing sugar thought to preserve membranes and proteins during desiccation by replacing water molecules and/or contributing to vitrification. Late embryogenesis abundant proteins similar to those in seeds and other anhydrobiotic organisms are found in cysts, and they safeguard cell organelles and proteins during desiccation. Artemia cysts contain abundant amounts of p26, a small heat shock protein, and artemin, a ferritin homologue, both ATP-independent molecular chaperones important in stress tolerance. The evidence provided in this review supports the conclusion that it is the interplay of these protective elements that make Artemia one of the most stress tolerant of all metazoan organisms. PMID:26334984

  20. The primary structure of elongation factor EF-1 alpha from the brine shrimp Artemia.

    OpenAIRE

    Hemert, F.J. van; Amons, R; Pluijms, W J; van Ormondt, H; Möller, W.

    1984-01-01

    cDNA as well as amino acid sequencing has revealed the complete primary structure of elongation factor EF-1 alpha from the brine shrimp Artemia. A comparison with the published sequences of bacterial EF-Tu, mitochondrial EF-Tu and chloroplastic EF-Tu shows that distinct areas of these polypeptide chains are conserved in evolution. The evolutionary distance between prokaryotic and eukaryotic types of EF-Tu is larger than among bacterial and organellar EF- Tus . A number of regions present in b...

  1. Phylogenetic Analysis of Brine Shrimp (Artemia) in China Using DNA Barcoding

    Institute of Scientific and Technical Information of China (English)

    Weiwei Wang; Jun Yu; Qibin Luo; Haiyan Guo; Peter Bossier; Gilbert Van Stappen; Patrick Sorgeloos; Naihong Xin; Qishi Sun; Songnian Hu

    2008-01-01

    DNA barcoding is a powerful approach for characterizing species of organisms,especially those with almost identical morphological features, thereby helping to to establish phylogenetic relationships and reveal evolutionary histories. In this study, we chose a 648-bp segment of the mitochondrial gene, cytochrome c oxidase subunit 1 (COI), as a standard barcode region to establish phylogenetic relationships among brine shrimp (Artemia) species from major habitats around the world and further focused on the biodiversity of Artemia species in China, especially in the Tibetan Plateau. Samples from five major salt lakes of the Tibetan Plateau located at altitudes over 4,000 m showed clear differences from other Artemia populations in China. We also observed two consistent amino acid changes, 153A/V and 183L/F, in the COI gene between the high and low altitude species in China.Moreover, indels in the COI sequence were identified in cyst and adult samples unique to the Co Qen population from the Tibetan Plateau, demonstrating the need for additional investigations of the mitochondrial genome among Tibetan Artemia populations.

  2. Purification and characterization of phenoloxidase from brine shrimp Artemia sinica

    Institute of Scientific and Technical Information of China (English)

    Tingjun Fan; Zhao Jing; Xianyuan Fan; Miaomiao Yu; Guojian Jiang

    2011-01-01

    Phenoloxidase from Artemia sinica (AsPO) was purified by Superdex 200 gel-filtration and Q Sepharose fast flow ionexchange chromatography,and its properties were characterized biochemically and enzymatically by using L-dihydroxyphenylalanine (L-DOPA) as the specific substrate.Results showed that AsPO was isolated as a monomeric protein of 125.5 kDa in molecular mass.The optimal pH value and temperature are 7.0 and 50℃,respectively,for its PO activity.The AsPO had an apparent Km value of 4.2 mM on L-DOPA,and 10.9 mM on catechol,respectively.Oxidase inhibitor on PO activity showed that the AsPO was extremely sensitive to ascorbic acid,sodium sulfite,and citric acid; and was very sensitive to cysteine,benzoic acid,and l-phenyl-2-thiourea.Combined with its specific enzyme activity on L-DOPA and catechol,it can be concluded that AsPO is most probably a typical catechol-type O-diphenoloxidase.Its PO activity was also sensitive to metal ions and chelators,and 20 mM DETC-inhibited PO activity was obviously recovered by 15 mM Cu2+,indicating that AsPO is most probably a copper-containing metalloenzyme.All these data about specific substrate,sensitivity to oxidase inhibitor metal ions and chelators indicate that the AsPO has the properties of a catechol-type copper-containing Odiphenoloxidase that functions as a vital humoral factor in host defense via melaninization as in other Crustaceans.

  3. Effect of salinity on the uptake of cadmium by the brine shrimp Artemia fransiscana

    OpenAIRE

    Blust, R.; Kockelbergh, E.; Baillieul, M.

    1992-01-01

    The effect of salinity on cadmium uptake by the brine shrimp Artemia fransiscana was studied in chemically defined saltwater solutions. Shrimp were acclimated to different salinities and exposed to the metal in solutions of differing salinity and composition. Within each acclimation group, the cadmium uptake decreased with increasing salinity of exposure. Most of this variation was explained by changes in the activity of the free metal ion. Among the acclimation groups, uptake increased by in...

  4. Detrimental effect of CO2-driven seawater acidification on a crustacean brine shrimp, Artemia sinica.

    Science.gov (United States)

    Zheng, Chao-qun; Jeswin, Joseph; Shen, Kai-li; Lablche, Meghan; Wang, Ke-jian; Liu, Hai-peng

    2015-03-01

    The effects of the decline in ocean pH, termed as ocean acidification due to the elevated carbon dioxide in the atmosphere, on calcifying organisms such as marine crustacean are unclear. To understand the possible effects of ocean acidification on the physiological responses of a marine model crustacean brine shrimp, Artemia sinica, three groups of the cysts or animals were raised at different pH levels (8.2 as control; 7.8 and 7.6 as acidification stress according to the predictions for the end of this century and next century accordingly) for 24 h or two weeks, respectively, followed by examination of their hatching success, morphological appearance such as deformity and microstructure of animal body, growth (i.e. body length), survival rate, expression of selected genes (involved in development, immunity and cellular activity etc), and biological activity of several key enzymes (participated in antioxidant responses and physiological reactions etc). Our results clearly demonstrated that the cysts hatching rate, growth at late stage of acidification stress, and animal survival rate of brine shrimp were all reduced due to lower pH level (7.6 & 7.8) on comparison to the control group (pH 8.2), but no obvious change in deformity or microstructure of brine shrimp was present under these acidification stress by microscopy observation and section analysis. In addition, the animals subjected to a lower pH level of seawater underwent changes on their gene expressions, including Spätzle, MyD88, Notch, Gram-negative bacteria binding protein, prophenoloxidase, Apoptosis inhibitor 5, Trachealess, Caveolin-1 and Cyclin K. Meanwhile, several key enzyme activities, including superoxide dismutase, catalase, peroxidase, alkaline phosphatase and acid phosphatase, were also affected by acidified seawater stress. Taken together, our findings supports the idea that CO2-driven seawater acidification indeed has a detrimental effect, in case of hatching success, growth and survival, on

  5. Some observations on the growth and cyst production characteristics of the brine shrimp Artemia sp. (Gujarat strain) in pond culture and its potential for import substitution

    OpenAIRE

    Gopalakrishnan, P.; Krishna Raju, V.; Thaker, S R

    1989-01-01

    Experimental culture of the brine shrimp Artemia sp. (Gujarat strain) and production of cyst is discussed. The qualitative and quantitative aspects of the cyst and its economic potential for import substitution are highlighted.

  6. Temperature-dose relationships with aflatoxin M1 in milk on the brine shrimp (Artemia salina) larvae

    OpenAIRE

    Lejla Duraković; Mihaela Blažinkov; Andrea Skelin; Sanja Sikora; Frane Delaš; Mirna Mrkonjić-Fuka; Katarina Huić-Babić; Sulejman Redžepović

    2011-01-01

    Temperature-dose relationships with aflatoxin M1 (AFM1) were studied using the brine shrimp Artemia salina larvae as an biological indicator in the temperature range from 20 °C to 40 °C. Increase in the incubation temperature resulted in sensitivity increase by the brine shrimp to AFM1. Optimum sensitivity occured at 30 °C. Positive results were obtained at 0.18 μg AFM1 x L-1 of whole pasteurized milk with a mortality of over 15%. Greater than 90 % mortality occurred at dose levels of 0.9 μg ...

  7. Growth, longevity, and reproduction capacity of the marine crustacean Mysidopsis bahia Molenock fed on brine shrimp Artemia produced in two salt farms in Kenya.

    OpenAIRE

    Rasowo, J.

    1986-01-01

    The standard culture test using the mysid Mysidopsis bahia (M.) juveniles as predators was used to determine the nutritional quality possessed by the first batch of brine shrimp Artemia cysts collected one month after innoculation of the brine shrimp in two salt farms north of Malindi Town, Kenya. Good growth and survival was observed in all the cases. There was no significant difference in survival and growth resulting from Artemia collected from the different ecological zones. Fatty acids p...

  8. Toxicity of Five Phenolic Compounds to Brine Shrimp Artemia sinica(Crustacea:Artemiidae)

    Institute of Scientific and Technical Information of China (English)

    Ali Shaukat; LIU Guangxing; LI Zhengyan; XU Donghui; HUANG Yousong; CHEN Hongju

    2014-01-01

    The acute toxicity of five phenolic compounds each to 15 d old Artemia sinica was determined in this study. The brine shrimp A. sinica was hatched from the encysted dry eggs (Bohai Bay Brand) produced by Dongying Ocean Artemia Co., Ltd., China at 27℃± 1℃in pre-filtered (through pores of 0.45 µm in diameter) and autoclaved seawater (salinity 31, pH 7.5-8.0) in a cilindroconical glass beaker (2000 mL in volume) under continuous illumination (provided by a side set 20 W fluorescent lamp) with slight aeration. Ten Artemia individuals from the same batch of the hatched were cultured in 10 mL toxicant solution prepared with seawater (salinity 31, pH 7.5-8.0) at room temperature (about 20℃) to determine 24 h, 48 h and 72 h medium lethal concentration (LC50) of 5 phenolic compounds each. It was found that the toxicity of n-heptylphenol was the highest followed by nonylphenol, t-butylphenol, 2,4-dichlorophenol and bisphenol A in order. The LC50 values of the 5 compounds were calculated with regression analysis. The real concentration (in µg L-1) of 5 phenolic compounds each in toxicant solutions was measured with GC/MS analysis. Significant loss of phenolic compounds caused by either adsorption or desorption was not found. The significant difference of LC50 values was found among the five compounds 3 exposure times each. The range between the highest no-observed-effect concentration (NOEC) and 100%death causing concentration of five phenolic compounds each was determined. The toxicity in term of 24 h LC50 value of n-HP was 9.10 times higher than that of BPA, 1.71 times higher than t-BP, 1.53 times higher than 2,4-DCP and 1.36 times higher than NP, respectively.

  9. Impact of enriching larval brine shrimp (Artemia sp.) with a supplement containing polyunsaturated fatty acids on their growth and mortality

    OpenAIRE

    Prusińska Maja; Kushniry Olga; Khudyi Oleksii; Khuda Lidiia; Kolman Ryszard

    2015-01-01

    The aim of the study was to determine the impact the commercial supplement S.presso (INVE Aquaculture, Belgium), a source of polyunsaturated fatty acids to enrich the proximate composition of brine shrimp (Artemia sp.), had on their growth and mortality. Four different enrichment protocols were investigated: the supplement was given in one or two doses at various time intervals. The results indicate that while S.presso increased nauplius mortality slightly, administering the appropriate dose ...

  10. Bird migratory flyways influence the phylogeography of the invasive brine shrimp Artemia franciscana in its native American range

    OpenAIRE

    Joaquín Muñoz; Francisco Amat; Green, Andy J.; Jordi Figuerola; Africa Gómez

    2013-01-01

    Since Darwin’s time, waterbirds have been considered an important vector for the dispersal of continental aquatic invertebrates. Bird movements have facilitated the worldwide invasion of the American brine shrimp Artemia franciscana, transporting cysts (diapausing eggs), and favouring rapid range expansions from introduction sites. Here we address the impact of bird migratory flyways on the population genetic structure and phylogeography of A. franciscana in its native range in the Americas. ...

  11. Feeding of the brine shrimp Artemia on yeast: effect of mechanical disturbance, animal density, water quality and light intensity

    OpenAIRE

    Coutteau, P.; Sorgeloos, P.

    1989-01-01

    Details are given of experiments conducted to determine the effects of tank culture conditions on the feeding of Artemia. Mechanical disturbance, animal density and water quality were found to affect the feeding rate of Artemia. The importance of culture conditions in maintaining a rate of food consumption which does not limit the growth of the brine shrimp is stressed.

  12. Nano-sized polystyrene affects feeding, behavior and physiology of brine shrimp Artemia franciscana larvae.

    Science.gov (United States)

    Bergami, Elisa; Bocci, Elena; Vannuccini, Maria Luisa; Monopoli, Marco; Salvati, Anna; Dawson, Kenneth A; Corsi, Ilaria

    2016-01-01

    Nano-sized polymers as polystyrene (PS) constitute one of the main challenges for marine ecosystems, since they can distribute along the whole water column affecting planktonic species and consequently disrupting the energy flow of marine ecosystems. Nowadays very little knowledge is available on the impact of nano-sized plastics on marine organisms. Therefore, the present study aims to evaluate the effects of 40nm anionic carboxylated (PS-COOH) and 50nm cationic amino (PS-NH2) polystyrene nanoparticles (PS NPs) on brine shrimp Artemia franciscana larvae. No signs of mortality were observed at 48h of exposure for both PS NPs at naplius stage but several sub-lethal effects were evident. PS-COOH (5-100μg/ml) resulted massively sequestered inside the gut lumen of larvae (48h) probably limiting food intake. Some of them were lately excreted as fecal pellets but not a full release was observed. Likewise, PS-NH2 (5-100µg/ml) accumulated in larvae (48h) but also adsorbed at the surface of sensorial antennules and appendages probably hampering larvae motility. In addition, larvae exposed to PS-NH2 undergo multiple molting events during 48h of exposure compared to controls. The activation of a defense mechanism based on a physiological process able to release toxic cationic NPs (PS-NH2) from the body can be hypothesized. The general observed accumulation of PS NPs within the gut during the 48h of exposure indicates a continuous bioavailability of nano-sized PS for planktonic species as well as a potential transfer along the trophic web. Therefore, nano-sized PS might be able to impair food uptake (feeding), behavior (motility) and physiology (multiple molting) of brine shrimp larvae with consequences not only at organism and population level but on the overall ecosystem based on the key role of zooplankton on marine food webs. PMID:26422775

  13. Maladaptive Sex Ratio Adjustment in the Invasive Brine Shrimp Artemia franciscana.

    Science.gov (United States)

    Lievens, Eva J P; Henriques, Gil J B; Michalakis, Yannis; Lenormand, Thomas

    2016-06-01

    Sex allocation theory is often hailed as the most successful area of evolutionary theory due to its striking success as a predictor of empirical observations [1]. Most naturally occurring sex ratios can be explained by the principle of equal investment in the sexes [2-4] or by cases of "extraordinary" sex allocation [5]. Deviations from the expected sex ratio are often correlated with weak selection or low environmental predictability (e.g., [6, 7]); true cases of aberrant sex allocation are surprisingly rare [8]. Here, we present a case of long-lasting maladaptive sex allocation, which we discovered in invasive populations of the exclusively sexual brine shrimp Artemia franciscana. A. franciscana was introduced to Southern France roughly 500 generations ago [9]; since then, it has coexisted with the native asexual species Artemia parthenogenetica [10]. Although we expect A. franciscana to produce balanced offspring sex ratios, we regularly observed extremely male-biased sex ratios in invasive A. franciscana, which were significantly correlated to the proportion of asexuals in the overall population. We experimentally proved that both invasive- and native-range A. franciscana overproduced sons when exposed to excess females, without distinguishing between conspecific and asexual females. We conclude that A. franciscana adjust their offspring sex ratio in function of the adult sex ratio but are information limited in the presence of asexual females. Their facultative adjustment trait, which is presumably adaptive in their native range, has thus become maladaptive in the invasive range where asexuals occur. Despite this, it has persisted unchanged for hundreds of generations. PMID:27185556

  14. Impacts of harvesting on brine shrimp (Artemia franciscana) in Great Salt Lake, Utah, USA.

    Science.gov (United States)

    Sura, Shayna A; Belovsky, Gary E

    2016-03-01

    Selective harvesting can cause evolutionary responses in populations via shifts in phenotypic characteristics, especially those affecting life history. Brine shrimp (Artemia franciscana) cysts in Great Salt Lake (GSL), Utah, USA are commercially harvested with techniques that select against floating cysts. This selective pressure could cause evolutionary changes over time. Our objectives are to (1) determine if there is a genetic basis to cyst buoyancy, (2) determine if cyst buoyancy and nauplii mortality have changed over time, and (3) to examine GSL environmental conditions over time to distinguish whether selective harvesting pressure or a trend in environmental conditions caused changes in cyst buoyancy and nauplii mortality. Mating crosses between floating and sinking parental phenotypes with two food concentrations (low and high) indicated there is a genetic basis to cyst buoyancy. Using cysts harvested from 1991-2011, we found cyst buoyancy decreased and nauplii mortality increased over time. Data on water temperature, salinity, and chlorophyll a concentration in GSL from 1994 to 2011 indicated that although water temperature has increased over time and chlorophyll a concentration has decreased over time, the selective harvesting pressure against floating cysts is a better predictor of changes in cyst buoyancy and nauplii mortality over time than trends in environmental conditions. Harvesting of GSL A. franciscana cysts is causing evolutionary changes, which has implications for the sustainable management and harvesting of these cysts. Monitoring phenotypic characteristics and life-history traits of the population should be implemented and appropriate responses taken to reduce the impacts of the selective harvesting. PMID:27209783

  15. Cytotoxicity of antimalarial plant extracts from Kenyan biodiversity to the brine shrimp, Artemia salina L. (Artemiidae

    Directory of Open Access Journals (Sweden)

    Joseph Mwanzia Nguta

    2012-07-01

    Full Text Available Artemia salina (Artemiidae, the brine shrimp larva, is an invertebrate used in the alternative test to determine toxicity of chemicals and natural products. In this study the medium lethal concentration fifty (LC50 values of 45 antimalarial plant extracts and positive controls, cyclophosphamide and etoposide were determined using Artemia salina (Artemiidae. Out of the 45 organic extracts screened for activity against Artemia salina larvae, 23 (51% of the crude extracts demonstrated activity at or below 100 μg/mL, and were categorized as having strong cytotoxic activity, 18 (40% of the crude extracts had LC50 values between 100 μg/mL and 500 μg/mL, and were categorized as having moderate cytotoxicity, 2 (4.5% of the crude extracts had LC50 values between 500 μg/mL and 1000 μg/mL, and were considered to have weak cytotoxic activity, while 2 (4.5% of the crude extracts had LC50 values greater than 1000 μg/mL and were considered to be non toxic. Approximately 20% (9 of the aqueous extracts demonstrated activity at or below 100 g/mL and were considered to have strong cytotoxic activity, 40% (18 of the screened aqueous crude extracts had LC50 values between 100 μg/mL and 500 μg/mL and were considered to be moderately cytotoxic, 16% (7 of the crude extracts had LC50 values between 500 μg/mL and 1000 μg/mL and were considered to have weak cytotoxic activity while 24% (11 of the aqueous extracts had LC50 values greater than 1000μg/mL and were categorized as non toxic The positive controls, cyclophosphamide and etoposide exhibited strong cytotoxicity with LC50 values of 95 μg/mL and 6 μg/mL respectively in a 24 hour lethality study, validating their use as anticancer agents. In the current study, 95.5% of all the screened organic extracts and 76% of the investigated aqueous extracts demonstrated LC50 values <1000 g/mL, indicating that these plants could not make safe anti-malarial treatments. This calls for dose adjustment amongst the

  16. Assessment of cyst production potential of a natural population of brine shrimp Artemia

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Sumitra-Vijayaraghavan; Krishnakumari, L.

    Studies on a natural population of Artemia in the salterns of Jamnagar indicated that the population is parthenogenetic. These shrimps reach a maximum size of 9 mm. Number of cysts per brood varies from 10-32. Adults form about 68% of the total...

  17. Naked eye instant reversible sensing of Cu(2+) and its in situ imaging in live brine shrimp Artemia.

    Science.gov (United States)

    Nair, Ratish R; Raju, M; Patel, Neha P; Raval, Ishan H; Suresh, E; Haldar, Soumya; Chatterjee, Pabitra B

    2015-08-21

    A Cu(2+)-specific colorimetric reversible fluorescent receptor was designed and synthesized which showed a naked eye observable colour change from colourless to pink on addition of an aqueous buffer (pH 7.4) solution of 30 ppb Cu(2+). Short response time (≤5 s) and low detection limit (nearly 3 ppb) make suitable as a reliable "dip-in" open eye sensor for Cu(2+). Bio-imaging application in live brine shrimp Artemia enabled to detect Cu(2+) at as low as 10 ppb exposure. PMID:26145434

  18. Effects of gamma radiation on the survival and growth of brine shrimp, Artemia salina

    International Nuclear Information System (INIS)

    To determine the effects of gamma radiation on the survival and growth of brine shrimp, nauplii and adults were exposed to different doses of radiation and maintained at different salinities and temperatures. The LD50 determination demonstrated that nauplii were thirty to forty times more sensitive than the adults and had a 25-day LD50 of 450 rads. Radiation and salinity reduced survival of adult female brine shrimp more than the males. The interaction of salinity, 5 and 50 ppt, temperature, 10, 20 and 300C, and radiation, 25 to 100 kilorads, decreased the survival of both male and female brine shrimp, with the males having the greater sensitivity. Brine shrimp nauplii irradiated with doses of 500 and 2,500 rads had accelerated growth and matured earlier than the controls. A test of the effect of crowding on growth showed that volume per individual was important, and a dose of 500 rads accelerated brine shrimp growth in all concentrations, with the greatest increase at 8 ml/nauplius

  19. Quorum Sensing-Disrupting Brominated Furanones Protect the Gnotobiotic Brine Shrimp Artemia franciscana from Pathogenic Vibrio harveyi, Vibrio campbellii, and Vibrio parahaemolyticus Isolates†

    OpenAIRE

    Defoirdt, Tom; Crab, Roselien; Wood, Thomas K.; Sorgeloos, Patrick; Verstraete, Willy; Bossier, Peter

    2006-01-01

    Autoinducer 2 (AI-2) quorum sensing was shown before to regulate the virulence of Vibrio harveyi towards the brine shrimp Artemia franciscana. In this study, several different pathogenic V. harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates were shown to produce AI-2. Furthermore, disruption of AI-2 quorum sensing by a natural and a synthetic brominated furanone protected gnotobiotic Artemia from the pathogenic isolates in in vivo challenge tests.

  20. Quorum Sensing-Disrupting Brominated Furanones Protect the Gnotobiotic Brine Shrimp Artemia franciscana from Pathogenic Vibrio harveyi, Vibrio campbellii, and Vibrio parahaemolyticus Isolates†

    Science.gov (United States)

    Defoirdt, Tom; Crab, Roselien; Wood, Thomas K.; Sorgeloos, Patrick; Verstraete, Willy; Bossier, Peter

    2006-01-01

    Autoinducer 2 (AI-2) quorum sensing was shown before to regulate the virulence of Vibrio harveyi towards the brine shrimp Artemia franciscana. In this study, several different pathogenic V. harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates were shown to produce AI-2. Furthermore, disruption of AI-2 quorum sensing by a natural and a synthetic brominated furanone protected gnotobiotic Artemia from the pathogenic isolates in in vivo challenge tests. PMID:16957276

  1. Habitat use and diet selection of northward migrating waders in the Sivash (Ukraine): the use of brine shrimp Artemia salina in a variably saline lagoon complex.

    NARCIS (Netherlands)

    Verkuil, Y.; Have, van der T.M.; Winden, van der J.; Chernichko, I.I.

    2003-01-01

    Wader species migrating through the Sivash (Ukraine) use hypersaline and brackish lagoons. We studied the use of the two habitat types, and focused on the profitability of Brine Shrimp Artemia salina, prey species in hypersaline lagoons for Dunlins Calidris alpina, Curlew Sandpipers Calidris ferrugi

  2. Habitat use and diet selection of northward migrating waders in the Sivash (Ukraine) : The use of Brine Shrimp Artemia salina in a variably saline lagoon complex

    NARCIS (Netherlands)

    Verkuil, Y; Van der Have, TM; Van der Winden, J; Chernichko, [No Value

    2003-01-01

    Wader species migrating through the Sivash (Ukraine) use hypersaline and brackish lagoons. We studied the use of the two habitat types, and focused on the profitability of Brine Shrimp Artemia salina, prey species in hypersaline lagoons for Dunlins Calidris alpina, Curlew Sandpipers Calidris ferrugi

  3. TOXICITY TESTING OF RESTORATIVE DENTAL MATERIALS USING BRINE SHRIMP LARVAE (ARTEMIA SALINA)

    OpenAIRE

    Milhem, Manar M.; Al-Hiyasat, Ahmad S.; Homa Darmani

    2008-01-01

    This study investigated the effect of extracts of different composites, glass ionomer cement (GIC)s and compomers on the viability of brine shrimp larvae. Ethanolic extracts of four dental composites (Z-100; Solitaire 2; Filtek P60 and Synergy), a conventional GIC (Ketac-Fil), a resin-modified glass ionomer cement (Vitremer), two compomers (F2000; Dyract AP), and a flowable compomer (Dyract Flow) were prepared from each material. Following evaporation of the ethanol, the extracts were resuspe...

  4. Toxicological investigations of Aloe ferox Mill. extracts using Brine shrimp (Artemia salina L.) assay.

    Science.gov (United States)

    Abosede, Wintola Olubunmi; Sunday, Arowosegbe; Jide, Afolayan Anthony

    2015-03-01

    Cytotoxicity of the extracts of Aloe ferox using brine shrimp was evaluated. Effects of the extracts on hatchability and lethality of brine shrimps were reported in terms of minimum inhibitory concentration and LD(50) respectively. The hatching success was in the order: aqueous root extract (39.8%) >aqueous leaf (26.5%) >acetone leaf (13.7%) > ethanol leaf extracts (2.5%). Hatchability in incubations of ethanol and acetone extracts was found to be dose - dependent, with hatching success decreasing as the concentration of the extracts increased. The lethality of extracts was in the order: aqueous leaf extract (4.7%) >aqueous root extract (4.2%) >acetone leaf extract (3.5%) >ethanol root extract (2.6%) > ethanol leaf extract (1.8%) >acetone root extract (0.7%). Mean mortality of nauplii in the control was higher (6.7%) than that of all the extracts. Based on Meyer's index of toxicity, the acetone leaf extract with LD(50) >1.0mg/mL could be considered as non toxic, while the ethanol root extract (LD(50) toxic to the brine shrimp. Since the extracts of A. ferox have consistently exhibited significant pharmaceutical properties in-vitro, the non-toxic extracts could further be exploited for the development of plant-based pharmaceuticals. PMID:25730795

  5. Toxicity Testing of Restorative Dental Materials Using Brine Shrimp Larvae (Artemia salina

    Directory of Open Access Journals (Sweden)

    Manar M. Milhem

    2008-08-01

    Full Text Available This study investigated the effect of extracts of different composites, glass ionomer cement (GICs and compomers on the viability of brine shrimp larvae. Ethanolic extracts of four dental composites (Z-100; Solitaire 2; Filtek P60 and Synergy, a conventional GIC (Ketac-Fil, a resin-modified glass ionomer cement (Vitremer, two compomers (F2000; Dyract AP, and a flowable compomer (Dyract Flow were prepared from each material. Following evaporation of the ethanol, the extracts were resuspended in distilled water, which was then used to test the effects on the viability of brine shrimp larvae. For the composites, the extract of Synergy was the least toxic (88% viability followed by the extracts of Solitaire 2, Z100 and P60 (75%, 67.5% and 50% viability, respectively. One-way ANOVA revealed highly significant differences between the resin composite materials (p<0.001. Follow-up comparison between the composite groups by Tukey's pairwise multiple-comparison test (α =0.05 showed that the extract of Synergy was significantly less toxic than the extracts of all the other materials except that of Solitaire 2. The compomers showed 100% lethality, while the percentage of viable larvae for the extracts of Ketac-Fil, and Vitremer were 32.3%, and 37.0%, respectively. One-way ANOVA revealed highly significant differences between the groups of materials (p<0.001. Follow-up comparison between the groups by Tukey's test (α = 0.05 showed that the toxic effect of the extracts of the compomers were significantly greater than that of Ketac-Fil, and Vitremer. The differences in the toxic effects of Vitremer and Ketac-Fil were not statistically significant. In conclusion, the toxicity of composite materials varied according to their chemical composition. Compomers were the most lethal materials to brine shrimp larvae followed by GICs and then composites.

  6. Effect of municipal waste water effluent upon the expression of Glutathione S-transferase isoenzymes of brine shrimp Artemia.

    Science.gov (United States)

    Grammou, Athina; Papadimitriou, Chrisa; Samaras, Peter; Vasara, Eleni; Papadopoulos, Athanasios I

    2011-06-01

    Multiple isoenzymes of the detoxification enzyme family Glutathione S-transferase are expressed in the brine shrimp Artemia. The number of the major ones detected in crude extract by means of chromatofocusing varied between three and four, depending on the age. Two isoenzymes, one alkaline and one neutral (with corresponding isoelectric points of 8.5 and 7.2) appear to be dominant in all three developmental stages studied, (24, 48, and 72 h after hatching). Culturing Artemia for 48 h after hatching, in artificial sea water prepared by municipal wastewater effluent resulted to significant alterations of the isoenzyme profile. In comparison to organisms cultured for the same period of time in artificial sea water prepared by filtered tap water, the expression of the alkaline isoenzyme decreased by 62% while that of the neutral isoenzyme increased by 58%. Furthermore, the enzyme activity of the major isoenzyme of the acidic area increased by more than two folds. It is worth mentioning that although the specific activity of the total enzyme in the whole body homogenate was elevated, no statistically significant alteration of the Km value was observed. These findings suggest that study of the isoenzyme profile of Glutathione S-transferase may offer high sensitivity in detecting environmental pollution and needs to be further investigated. PMID:21429555

  7. A note on the biogeographical origin of the brine shrimp Artemia urmiana Günther, 1899 from Urmia Lake, Iran.

    Science.gov (United States)

    Eimanifar, Amin; Asem, Alireza; Djamali, Morteza; Wink, Michael

    2016-01-01

    The brine shrimp Artemia urmiana, an abundant inhabitant of the hypersaline Urmia Lake in northwestern Iran, has recently been described from Lake Koyashskoe, also a shallow hypersaline lake that is located on the Black Sea coast of the Crimean Peninsula (Ukraine). This discovery has questioned the endemicity of A. urmiana in Urmia Lake and has also brought into question the biogeographical origin of this species. In the present study, we combined recent genetic divergence data (mtDNA-COI) with palaeoecological evidence to address the biogeographical origin of A. urmiana. Calibration of the molecular clock of the COI region was set by assigning the age of the micro-crustacean Daphnia pulex minimally at 145 Mya. The divergence age of A. urmiana in Urmia Lake dates back to 383,000 years, whereas Ukrainian Artemia reflects a very young populations that diverged about 196,000 years ago. Palaeoecological evidence suggests that the age of the major habitat of A. urmiana i.e. Urmia Lake goes back to the Tertiary Period while the Ukranian habitats of the species are very young, by virtue of geological features of the Holocene age. We conclude that the biogeographical origin of A. urmiana is outside of Europe and the current state of knowledge strongly suggests that Urmia Lake has been the major source of its expansion into its modern habitats in Europe. PMID:27394547

  8. Effect of temperature and viscosity on swimming velocity of the copepod Acartia tonsa, brine shrimp Artemia salina and rotifer Brachionus plicatilis

    DEFF Research Database (Denmark)

    Larsen, Poul Scheel; Madsen, C.V.; Riisgard, H.U.

    2008-01-01

    Beating cilia are important organelles for swimming in many zooplanktonic aquatic organisms, including many invertebrate larvae, rotifers and ciliates, but other planktonic organisms, such as copepods and brine shrimps, use muscle-powered swimming appendages. In recent studies we found that the...... of swimming velocity for a 10 degrees C temperature reduction) that is found to be largest for the brine shrimp Artemia salina nauplius (37 %) and the rotifer Brachionus plicatilis (26%), but negligible for the copepod Acartia tonsa (4%). We suggest that experimental data on change in swimming...... velocity (V) due to change in kinematic viscosity (v) be correlated in terms of a power law, V proportional to v(-m). The present data on swimming velocity of copepods, brine shrimps and rotifers show values of exponent m approximate to 1.5 to 3, with a trend of decreasing values for increasing size of...

  9. Effect of hydrogen ions and inorganic complexing on the uptake of copper by the brine shrimp Artemia franciscana

    OpenAIRE

    Blust, R.; Fontaine, A.; Decleir, W.

    1991-01-01

    The effect of hydrogen ions and inorganic complexing on copper uptake in the brine shrimp Artemia franciscana has been studied in chemically defined saltwater solutions. Uptake increases with decreasing hydrogen ion concentration and decreases with increasing carbonate complexation. A simple non-linear model that combines the effect of hydrogen ions on the transport of the metal across the solution-body interface and the effect of hydrogen ions and complexation on the speciation of the metal ...

  10. Bird migratory flyways influence the phylogeography of the invasive brine shrimp Artemia franciscana in its native American range

    Directory of Open Access Journals (Sweden)

    Joaquín Muñoz

    2013-11-01

    Full Text Available Since Darwin’s time, waterbirds have been considered an important vector for the dispersal of continental aquatic invertebrates. Bird movements have facilitated the worldwide invasion of the American brine shrimp Artemia franciscana, transporting cysts (diapausing eggs, and favouring rapid range expansions from introduction sites. Here we address the impact of bird migratory flyways on the population genetic structure and phylogeography of A. franciscana in its native range in the Americas. We examined sequence variation for two mitochondrial gene fragments (COI and 16S for a subset of the data in a large set of population samples representing the entire native range of A. franciscana. Furthermore, we performed Mantel tests and redundancy analyses (RDA to test the role of flyways, geography and human introductions on the phylogeography and population genetic structure at a continental scale. A. franciscana mitochondrial DNA was very diverse, with two main clades, largely corresponding to Pacific and Atlantic populations, mirroring American bird flyways. There was a high degree of regional endemism, with populations subdivided into at least 12 divergent, geographically restricted and largely allopatric mitochondrial lineages, and high levels of population structure (ΦST of 0.92, indicating low ongoing gene flow. We found evidence of human-mediated introductions in nine out of 39 populations analysed. Once these populations were removed, Mantel tests revealed a strong association between genetic variation and geographic distance (i.e., isolation-by-distance pattern. RDA showed that shared bird flyways explained around 20% of the variance in genetic distance between populations and this was highly significant, once geographic distance was controlled for. The variance explained increased to 30% when the factor human introduction was included in the model. Our findings suggest that bird-mediated transport of brine shrimp propagules does not result

  11. Characterization of the virulence of Harveyi clade vibrios isolated from a shrimp hatchery in vitro and in vivo, in a brine shrimp (Artemia franciscana) model system

    OpenAIRE

    Vanmaele, S.; Defoirdt, T; Cleenwerck, I; Vos, P; P. Bossier

    2015-01-01

    Vibrios belonging to the Harveyi clade are important pathogens of a large number of marine animals in the aquaculture industry. In this study, six isolates (H1 to H6) were obtained from a shrimp hatchery in Rio Grande do Norte (Natal-Area, Brazil), which had been confronted with disease outbreaks in 2009. The aim was to characterize the virulence of these isolates, both in vitro (virulence factor production) and in vivo (virulence towards gnotobiotic brine shrimp, Artemia franciscana, larvae)...

  12. Intracellular water in Artemia cysts (brine shrimp): Investigations by deuterium and oxygen-17 nuclear magnetic resonance

    OpenAIRE

    Kasturi, S. R.; Seitz, P. K.; Chang, D. C.; Hazlewood, C. F.

    1990-01-01

    The dormant cysts of Artemia undergo cycles of hydration-dehydration without losing viability. Therefore, Artemia cysts serve as an excellent intact cellular system for studying the dynamics of water-protein interactions as a function of hydration. Deuterium spin-lattice (T1) and spin-spin (T2) relaxation times of water in cysts hydrated with D2O have been measured for hydrations between 1.5 and 0.1 g of D2O per gram of dry solids. When the relaxation rates (I/T1, I/T2) of 2H and 17O are plot...

  13. The Cytotoxicity Study of Carboxymethyl Starch (CMS) of Sago Starch (Metro xylon sago) by Brine Shrimp Lethality Test (Artemia salina nauplii)

    International Nuclear Information System (INIS)

    CMS can be produced by substitution of the hydroxyl groups with sodium monochloroacetate in the presence of strong alkali. Carboxy methylation can be performed in water as a solvent or in a water-miscible organic solvent containing a small amount of water such as ethanol, isopropanol, methanol or toluene. The use of organic solvent will preserve the final product in the granular form and the side product can be washed out easily but some of them may be having potential toxicity and carcinogenic effect. In this study, CMS was investigated the level of toxicity by using brine shrimp lethality (BSLT). Brine shrimp test method was used to screen CMS for their biological activity. The screening results showed that the LC50, of CMS is more than 100 mg/ ml dose concentration. In conclusion, CMS is not cytotoxicity to Artemia salina nauplii and BSLT method is simple, inexpensive and convenient assay for the detection of cytotoxic compound. (author)

  14. Sharp Phylogeographic Breaks and Patterns of Genealogical Concordance in the Brine Shrimp Artemia franciscana

    OpenAIRE

    Theodora Farmaki; Abatzopoulos, Theodore J.; Baxevanis, Athanasios D.; Stefania Maniatsi; Ilias Kappas

    2009-01-01

    Genealogical concordance is a critical overlay of all phylogenetic analyses, irrespective of taxonomic level. To assess such patterns of congruence we have compiled and derived sequence data for two mitochondrial (16S rRNA, COI) and two nuclear (ITS1, p26) markers in 14 American populations of the hypersaline branchiopod Artemia franciscana. Cladistic analysis revealed three reciprocally monophyletic mitochondrial clades. For nuclear DNA, incomplete lineage sorting was evident presumably as a...

  15. Oxygen bioavailability and haemoglobins in the brine shrimp Artemia franciscana

    OpenAIRE

    Wachter, B; Blust, R.; Decleir, W.

    1992-01-01

    Bioavailability of oxygen for the saline-water invertebrate Artemia franciscana was studied, since both oxygen concentration and oxygen diffusion rate change with salinity. Total haemoglobin concentration and the relative contribution of each of three haemoglobins was measured in specimens acclimated to different salinities and oxygen concentrations. Both haemoglobin concentration and contribution were influenced by salinity and the group observed (males, females with and females without eggs...

  16. A first AFLP-Based Genetic Linkage Map for Brine Shrimp Artemia franciscana and Its Application in Mapping the Sex Locus

    OpenAIRE

    De Vos, Stephanie; Bossier, Peter; Van Stappen, Gilbert; Vercauteren, Ilse; Sorgeloos, Patrick; Vuylsteke, Marnik

    2013-01-01

    We report on the construction of sex-specific linkage maps, the identification of sex-linked markers and the genome size estimation for the brine shrimp Artemia franciscana. Overall, from the analysis of 433 AFLP markers segregating in a 112 full-sib family we identified 21 male and 22 female linkage groups (2n = 42), covering 1,041 and 1,313 cM respectively. Fifteen putatively homologous linkage groups, including the sex linkage groups, were identified between the female and male linkage map...

  17. Intracellular water in Artemia cysts (brine shrimp): Investigations by deuterium and oxygen-17 nuclear magnetic resonance.

    Science.gov (United States)

    Kasturi, S R; Seitz, P K; Chang, D C; Hazlewood, C F

    1990-08-01

    The dormant cysts of Artemia undergo cycles of hydration-dehydration without losing viability. Therefore, Artemia cysts serve as an excellent intact cellular system for studying the dynamics of water-protein interactions as a function of hydration. Deuterium spin-lattice (T(1)) and spin-spin (T(2)) relaxation times of water in cysts hydrated with D(2)O have been measured for hydrations between 1.5 and 0.1 g of D(2)O per gram of dry solids. When the relaxation rates (I/T(1), I/T(2)) of (2)H and (17)O are plotted as a function of the reciprocal of hydration (1/H), an abrupt change in slope is observed near 0.6 g of D(2)O (or H(2) (17)O)/gram of dry solids, the hydration at which conventional metabolism is activated in this system. The results have been discussed in terms of the two-site and multisite exchange models for the water-protein interaction as well as protein dynamics models. The (2)H and (17)O relaxation rates as a function of hydration show striking similarities to those observed for anisotropic motion of water molecules in protein crystals.It is suggested here that although the simple two-site exchange model or n-site exchange model could be used to explain our data at high hydration levels, such models are not adequate at low hydration levels (<0.6 g H(2)O/g) where several complex interactions between water and proteins play a predominant role in the relaxation of water nuclei. We further suggest that the abrupt change in the slope of I/T(1) as a function of hydration in the vicinity of 0.6 g H(2)O/g is due to a change in water-protein interactions resulting from a variation in the dynamics of protein motion. PMID:19431762

  18. Quorum sensing-disrupting brominated furanones protect the gnotobiotic brine shrimp Artemia franciscana from pathogenic Vibrio harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates

    OpenAIRE

    Defoirdt, T; Crab, R.; Wood, T. K.; Sorgeloos, P.; Verstraete, W; P. Bossier

    2006-01-01

    Autoinducer 2 (AI-2) quorum sensing was shown before to regulate the virulence of Vibrio harveyi towards the brine shrimp Artemia franciscana. In this study, several different pathogenic V. harveyi, Vibrio campbellii, and Vibrio parahaemolyticus isolates were shown to produce AI-2. Furthermore, disruption of AI-2 quorum sensing by a natural and a synthetic brominated furanone protected gnotobiotic Artemia from the pathogenic isolates in in vivo challenge tests.

  19. A case study to optimise and validate the brine shrimp Artemia franciscana immobilisation assay with silver nanoparticles: The role of harmonisation.

    Science.gov (United States)

    Kos, Monika; Kahru, Anne; Drobne, Damjana; Singh, Shashi; Kalčíková, Gabriela; Kühnel, Dana; Rohit, Rekulapelly; Gotvajn, Andreja Žgajnar; Jemec, Anita

    2016-06-01

    Brine shrimp Artemia sp. has been recognised as an important ecotoxicity and nanotoxicity test model organism for salt-rich aquatic environments, but currently there is still no harmonised testing protocol which would ensure the comparable results for hazard identification. In this paper we aimed to design the harmonised protocol for nanomaterial toxicity testing using Artemia franciscana and present a case study to validate the protocol with silver nanoparticles (AgNPs). We (i) revised the existing nanotoxicity test protocols with Artemia sp. (ii) optimised certain methodological steps based on the experiments with AgNPs and potassium dichromate (K2Cr2O7) as a soluble reference chemical and (iii) tested the optimised protocol in an international inter-laboratory exercise conducted within the EU FP7 NanoValid project. The intra- and inter-laboratory reproducibility of the proposed protocol with a soluble reference chemical K2Cr2O7 was good, which confirms the suitability of this assay for conventional chemicals. However, the variability of AgNPs toxicity results was very high showing again that nanomaterials are inherently challenging for toxicity studies, especially those which toxic effect is linked to shed metal ions. Among the identified sources for this variability were: the hatching conditions, the type of test plate incubation and the illumination regime. The latter induced variations assumingly due to the changes in bioavailable silver species concentrations. Up to our knowledge this is the first inter-laboratory comparison of the Artemia sp. toxicity study involving nanomaterials. Although the inter-laboratory exercise revealed poor repeatability of AgNPs toxicity results, this study provides valuable information regarding the importance of harmonisation of all steps in the test procedure. Also, the presented AgNPs toxicity case study may serve as a platform for further validation steps with other types of NMs. PMID:26895539

  20. A novel heparan sulphate with high degree of N-sulphation and high heparin cofactor-II activity from the brine shrimp Artemia franciscana.

    Science.gov (United States)

    Chavante, S F; Santos, E A; Oliveira, F W; Guerrini, M; Torri, G; Casu, B; Dietrich, C P; Nader, H B

    2000-03-16

    With the aid of heparinase and heparitinases from Flavobacterium heparinum and 13C and IH NMR spectroscopy it was shown that the heparan sulphate isolated from the brine shrimp Artemia franciscana exhibits structural features intermediate between those of mammalian heparins and heparan sulphates. These include an unusually high degree of N-sulphation (with corresponding very low degree of N-acetylation), a relatively high content of iduronic acid residues (both unsulphated and 2-O-sulphated) and a relatively low degree of 6-O-sulphation of the glucosamine residues. The major sequences (glucuronic acid-->N-sulphated glucosamine and glucuronic acid-->N, 6-disulphated glucosamine) are most probably arranged in blocks. Although exhibiting negligible anticlotting activity in the APTT and anti-factor Xa assays the A. franciscana heparan sulphate has a high heparin cofactor-II activity (about 1/3 that of heparin). PMID:10704986

  1. The gnotobiotic brine shrimp (Artemia franciscana) model system reveals that the phenolic compound pyrogallol protects against infection through its prooxidant activity.

    Science.gov (United States)

    Baruah, Kartik; Duy Phong, Ho Phuong Pham; Norouzitallab, Parisa; Defoirdt, Tom; Bossier, Peter

    2015-12-01

    The phenolic compound pyrogallol is the functional unit of many polyphenols and currently there has been a growing interest in using this compound in human and animal health owing to its health-promoting effects. The biological actions of pyrogallol moiety (and polyphenols) in inducing health benefitting effects have been studied; however, the mechanisms of action remain unclear yet. Here, we aimed at unravelling the underlying mechanism of action behind the protective effects of pyrogallol against bacterial infection by using the gnotobiotically-cultured brine shrimp Artemia franciscana and pathogenic bacteria Vibrio harveyi as host-pathogen model system. The gnotobiotic test system represents an exceptional system for carrying out such studies because it eliminates any possible interference of microbial communities (naturally present in the experimental system) in mechanistic studies and furthermore facilitates the interpretation of the results in terms of a cause effect relationship. We provided clear evidences suggesting that pyrogallol pretreament, at an optimum concentration, induced protective effects in the brine shrimp against V. harveyi infection. By pretreating brine shrimp with pyrogallol in the presence or absence of an antioxidant enzyme mixture (catalase and superoxide dismutase), we showed that the Vibrio-protective effect of the compound was caused by its prooxidant action (e.g. generation of hydrogen peroxide, H2O2). We showed further that generation of prooxidant is linked to the induction of heat shock protein Hsp70, which is involved in eliciting the prophenoloxidase and transglutaminase immune responses. The ability of pyrogallol to induce protective immunity makes it a potential natural protective agent that might be a potential preventive modality for different host-pathogen systems. PMID:26459033

  2. ASSESSMENT OF CYTOTOXIC ACTIVITY OF TWO MEDICINAL PLANTS USING BRINE SHRIMP ( ARTEMIA SALINA AS AN EXPERIMENTAL TOOL

    Directory of Open Access Journals (Sweden)

    Apurba Sarker Apu*, S. H. Bhuyan, F. Khatun, M. Sultana Liza, M. Matin, Md. Faruq Hossain

    2013-03-01

    Full Text Available ABSTRACT: Solanum sisymbriifolium (Solanaceae and Jatropha gossypifolia (Euphorbiaceae have long been used in folkloric medicine for the treatment of various ailments. The purpose of the present study was to evaluate the cytotoxic activity of the plants and to make available the process of data analysis of cytotoxic studies to the researchers. A general toxicity of the extracts was assessed by a simple and low cost assay using brine shrimp lethality as an indicator of toxicity. Ethanol crude extract and fractions of the extract of leaves of Solanum sisymbriifolium exhibited relatively mild cytotoxic activity compared to that of flowers and fruits against brine shrimp larvae with median lethal concentration, LC50 values ranging from 10.10 – 321.35 and 13.19 – 80.16 μg/ml, respectively. Methanol crude extract and fractions of the extract of leaves of Jatropha gossypifolia exhibited significant toxicity against the shrimps (LC50 values 17.19 – 98.19 μg/ml, while that of potassium permanganate, a positive control, was 11.27 μg/ml. Among the fractions of the crude extracts of both plants, non-polar fractions such as n-hexane, chloroform, dichloromethane were the most cytotoxic. These results warrant follow-up through bioassay directed isolation of the active principles.

  3. The use of a brine shrimp (Artemia salina) bioassay to assess the water quality in Hangzhou section of Beijing-Hangzhou Grand Canal.

    Science.gov (United States)

    Lu, Yin; Xu, Xiaolu; Li, Tian; Xu, Yifei; Wu, Xu

    2012-03-01

    As physical and chemical tests alone are not sufficient enough for the assessment of potential effects on aquatic organisms, bioassays are required for the integrated evaluation of water pollution. In this study, invertebrate crustacean Artemia salina (brine shrimp) was applied as an indicator to assess the water quality of Hangzhou Section of Beijing-Hangzhou Grand Canal. The percentage mortality of brine shrimp was recorded after 24-h exposure to the Canal water. The water samples were collected from five typical sites during October 2008 and April 2009. It exhibited 11% ± 8.3%, 26.7% ± 17%, 31.7% ± 8.5%, 28.0% ± 11.7%, and 4% ± 4.3% percentage mortality for the sample from Tangxi Bridge, Yi Bridge, Gongchen Bridge, Maiyu Bridge, and Gujia Bridge in 2008, respectively. And it exhibited 5.7% ± 4.2%, 10.3% ± 8.2%, 24.3% ± 12.3%, 16.0% ± 12.3%, and 0%, percentage mortality in 2009, respectively. According to the results, a relative improvement in water quality was observed, although the results were not significantly different at the p water toxicity when alternative bioassays were unavailable. PMID:22187021

  4. A novel model of early development in the brine shrimp, Artemia franciscana, and its use in assessing the effects of environmental variables on development, emergence, and hatching.

    Science.gov (United States)

    Neumeyer, Courtney H; Gerlach, Jamie L; Ruggiero, Kristin M; Covi, Joseph A

    2015-03-01

    The brine shrimp, Artemia (Crustacea, Anostraca), is a zooplankton that is commonly used in both basic and applied research. Unfortunately, Artemia embryos are often cultured under conditions that alter early development, and reports based on these cultures oversimplify or fail to describe morphological phenotypes. This is due in part to the lack of a comprehensive developmental model that is applicable to observations of live specimens. The objective of this study was to build and test a descriptive model of post-diapause development in Artemia franciscana using observations made with a standard dissecting microscope. The working model presented is the first to comprehensively place all known "abnormal" embryonic and naupliar phenotypes within the context of a classic hatching profile. Contrary to previous reports, embryos and nauplii with aberrant phenotypes often recover and develop normally. Oval prenauplii may emerge as normal prenauplii (E2 stage). A delay of this transition leads to incomplete hatching or direct hatching of first instar larvae with a curved thoracoabdomen. When hatching is incomplete, retained cuticular remnants are shed during the next molt, and a "normal" second instar larva is produced. By differentiating between molting events and gross embryonic patterning in live embryos, this new model facilitates fine time-scale analyses of chemical and environmental impacts on early development. A small increase in salinity within what is commonly believed to be a permissive range (20‰-35‰) produced aberrant morphology by delaying emergence without slowing development. A similar effect was observed by decreasing culture density within a range commonly applied in toxicological studies. These findings clearly demonstrate that morphological data from end-point studies are highly dependent on the time points chosen. An alternate assessment method is proposed, and the potential impact of heavy metals, hexachlorobenzene, Mirex, and cis

  5. ANALYTICAL VARIATION IN THE DETERMINATION OF THE FATTY ACID COMPOSITION OF STANDARD PREPARATIONS OF BRINE SHRIMP ARTEMIA: AN INTERLABORATORY EXERCISE

    Science.gov (United States)

    An international interlaboratory exercise was conducted to investigate the variability associated with the preparation and analysis of samples and the reporting of fatty acid composition data for tvo samples of Artemia supplied to the laboratories by the Artemia Reference Center ...

  6. 镰刀菌Fusarium solani菌株对卤虫Artemia salina的毒性%Toxicity of Fusarium solani Strains on Brine Shrimp (Artemia salina)

    Institute of Scientific and Technical Information of China (English)

    Shagufia Hameed; Viqar Sultana; Jehan Ara; Syed Ehteshamul-Haque; Mohammad Athar4

    2009-01-01

    寻找能杀伤肿瘤细胞而对正常细胞无毒的抗癌药物极具挑战性.具有细胞毒性的植物或者真菌可能含有抗肿瘤的化合物.卤虫无节幼体的致死性可作为筛选抗肿瘤化合物的试验.本研究运用从不同农作物种子分离的8株镰刀菌(Fusarium solani)培养滤液来测试卤虫的细胞毒性效果.结果表明,5株菌株(TS、S-29、B-17、C-10和W-5)对卤虫显示高毒性;3株菌株(SR、T-9和L-25)显示低毒性,且毒性随着培养滤液的稀释而减弱.5株菌株(TS、B-17、SR、T-9和L-25)按照1:10稀释能导致30%以上的死亡率.NaOH中和后的滤液毒性略微降低,表明培养滤液的pH值可能影响毒性.这些菌株冻干的滤液相对于未冻干的滤液毒性较低.只在3株温和毒性的菌株中得到正己烷可溶萃取物;氯仿可溶萃取物的鼍极微而不能作进一步处理.各菌株的毒性效果各小相同.从镰刀菌(F.solani)分离的化合物可开发为毒性化合物.%Discovery of anticancer drugs that must kill or disable tumor cells in the presence of normal cells without undue toxicity is an extraordinary challenge. Cytotoxicity of plant or fungal materials is considered as the presence of antitumor compounds. Brine shrimp lethality for larvae (nauplii) is used as prescreening test for the antitumor compounds. In this study, culture filtrates of eight strains of Fusarium solani isolated from seeds of various crops were tested for the toxic effect on brine shrimp. Five of the strains (TS, S-29, B-17, C-10, W-5) showed highest toxic effect and three of the strains (SR, T-9, L-25) showed low toxic activity on brine shrimp. Toxic activity reduced when culture filtrates were diluted. However, F. solani strains TS, B-17, SR, T-9 and L-25 caused more than 30% mortality at 1:10 dilution. Toxic activity was slightly reduced when the filtrates were neutralized with sodium hydroxide indicating possible role of pH of culture filtrate on toxicity. Lyophilized

  7. Brine shrimp Artemia in coastal saltworks: inexpensive source of food for vertically integrated aquaculture

    OpenAIRE

    Sorgeloos, P.

    1983-01-01

    Proper Artemia introduction and management should lead not only to optimal salt production outputs but at the same time provide opportunities for the exploitation of valuable by-products, i.e. Artemia cysts and adult biomass as cheap sources of high quality food for intensive fish or crustacean farming.

  8. Global biodiversity and geographical distribution of diapausing aquatic invertebrates: the case of the cosmopolitan brine shrimp, Artemia (Branchiopoda, Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Pacios, Fernando

    2010-01-01

    The genus Artemia comprises passively dispersed anostracan species with a distribution all around the world, except in Antarctica. We used both published and personal data to assess and update existing knowledge on the diversity and distribution of Artemia, in particular compiling also genetic an...

  9. Survival of the probiotic bacteria Lactobacillus rhamnosus in seawater and its bioencapsulation in the brine shrimp Artemia

    Directory of Open Access Journals (Sweden)

    Claudia Ofelio

    2014-06-01

    The results obtained in the first test showed that the L. rhamnosus was able to survive in seawater during the whole experiment (30h, maintaining densities of 10e7 CFU/ml during the first 6h although decreasing progressively afterwards (10e3 CFU/ml at 30h. This allows adequate levels at sufficient time for Artemia to incorporate the probiotic. In fact, bioencapsulation test demonstrated that Artemia metanauplii were able to bioencapsulate the probiotic, reaching the highest concentration in Artemia after 30 min of bioencapsulation (10e4 CFU/Artemia. A slight further decrease (10e3 CFU/Artemia was observed after 24h. Interestingly, L. rhamnosus reduced in 1Log total Vibrionaceae bacteria in Artemia during the 3 first hours. Therefore, 3 hours was the time established for the bioencapsulation protocol and further studies are in progress to determine the ability of Artemia metanauplii to maintain bioencapsulated L. rhamnosus once transferred to rearing tanks. Also, the capability of the probiotic to inhibit potential pathogenic or opportunistic bacteria will be assessed.

  10. Investigating Brine Shrimp.

    Science.gov (United States)

    Duran, Lena Ballone

    2003-01-01

    Presents a brine shrimp activity designed for students in grades 5-12 to foster authentic scientific inquiry in addition to providing an engaging and exciting avenue for student exploration. Emphasizes that inquiry should be a critical component in the science classroom. (KHR)

  11. Comparing the potential for dispersal via waterbirds of a native and an invasive brine shrimp

    OpenAIRE

    Sánchez, Marta I.; Hortas, F.; Figuerola, Jordi; Green, Andy J.

    2012-01-01

    Migratory waterbirds are likely to have a major role in the spread of many exotic aquatic invertebrates by passive dispersal. However, in the field, this has so far only been confirmed in the case of the American brine shrimp Artemia franciscana, which is spreading quickly around the Mediterranean region. We compared experimentally the capacity of A. franciscana and the native brine shrimp Artemia parthenogenetica to disperse via migratory shorebirds. After Artemia resting eggs (cysts) were f...

  12. Coadaptation: lessons from the brine shrimp Artemia, "the aquatic Drosophila" (Crustacea; Anostraca Coadaptación: lecciones desde el camarón de salmuera Artemia, "la Drosophila acuática" (Crustacea; Anostraca

    Directory of Open Access Journals (Sweden)

    GONZALO GAJARDO

    2001-03-01

    Full Text Available During the fifties Brncic and the Dobzhansky's school, using the fruit fly Drosophila as a test organism, introduced the term integration of the genotype, or genetic coadaptation, which has had great impact on thinking in today's evolutionary biology. In this work we use the brine shrimp Artemia - in many respects a sort of aquatic Drosophila- as a model organism to evaluate the relationship between population structure, potential for divergence and the degree of morphological and/or genetic change. These aspects, tightly linked with the organization of the genotype, are important to understanding how recombination and adaptive release of genetic and phenotypic variation affect the speciation process in Artemia. Analysis of genetic (allozyme, diploid and chromocentre numbers, morphological (Mahalanobis distances and reproductive data (cross-fertility tests available for populations of the bisexual, endemic species of the Americas, Artemia franciscana and A. persimilis, indicate that: (i A. franciscana and A. persimilis are morphologically distinct in correspondence with observed genetic differences (D Nei > 1; 2n = 42 and 44; 12.5 and 1.5 mean chromocentre numbers, respectively; (ii populations from Chile and other South American localities (mainly A. franciscana display high levels of genetic variability and a trend to develop large genetic distances between populations; (iii the plasticity of Artemia gene pool is associated, at least in part, with ecological heterogeneity. Hence an adaptive divergence mode is thought to best define the speciation process in Artemia; (iv the succesful production of laboratory hybrids in the allopatric Artemia populations studied in the Americas, a feature seen in other anostracods, could be explained by the fact that formerly allopatric populations have not achieved later sympatry, as required by the allopatric speciation paradigmEn los años cincuenta Brncic y la escuela de Dobzhansky introdujeron el t

  13. Cloning and expression of retinoblastoma-binding protein 4 gene in embryo diapause termination and in response to salinity stress from brine shrimp Artemia sinica.

    Science.gov (United States)

    Wang, Xiaolu; Yao, Feng; Liang, Xiaoyu; Zhu, Xiaolin; Zheng, Ren; Jia, Baolin; Hou, Lin; Zou, Xiangyang

    2016-10-15

    Retinoblastoma binding protein 4 (RBBP4) is a nuclear protein with four WD-repeat sequences and thus belongs to a highly conserved subfamily of proteins with such domains. This retinoblastoma-binding protein plays an important role in nucleosome assembly and histone modification, which influences gene transcription and regulates cell cycle and proliferation. Artemia sinica (brine shrimp) undergoes an unusual diapause process under stress conditions of high salinity and low temperature. However, the role of RBBP4 in diapause termination of embryo development in A. sinica remains unknown. Here, the full-length cDNA of the As-rbbp4 gene was obtained from A. sinica and found to contain 1411 nucleotides, including a 1281 bp open reading frame (ORF), 63 bp 5'-untranslated region (UTR) and a 67-bp 3'-UTR, which encodes a 427 amino acid (48 kDa) protein. Bioinformatic analysis indicated As-RBBP4 to be mainly located in the nucleus, with a theoretical isoelectric point of 4.79. Protein sequence domain analysis showed that As-RBBP4 is a conserved protein, especially in the WD40 domain. No specificity in expression of this gene was observed in tissues or organs by in situ hybridization. Real-time quantitative PCR and Western blot analyses of As-RBBP4 gene and protein expression, respectively, showed notably high levels at 10 h and a subsequent downward trend. Obvious trends in upregulation of As-RBBP4 were observed under conditions of low temperature and high salinity stress. As-E2F1 and As-CyclinE also presented similar trends as that of As-RBBP4 in Western blots. Analysis of the RBBP4 expression in early embryonic development of A. sinica indicated that this protein plays an important role in diapause termination and cell cycle regulation. PMID:27267406

  14. Assessment of Cytotoxic Activity of Agave cantula Using Brine Shrimp (Artemia salina) Lethality Bioassay

    OpenAIRE

    M D Dhanaraju; B. Heera; K.V. Gowthami; M.VamsiKrishna; Ramachandran, S.

    2011-01-01

    The essence of the present study is to focus on the cytotoxicity of the aqueous and alcoholic extracts of the Indian medicinal plant Agave cantula belonging to the family Agavaceae. Brine shrimp lethality bioassay method was established for the present study and the cytotoxicity was reported in terms of lethality concentration (LC50). The shrimps were hatched and active shrimps were collected and used for the assay, 10 active shrimps were added to the 0.5 mL diluted test solution and the surv...

  15. Brine Shrimp Ecology In The Great Salt Lake, Utah

    OpenAIRE

    Wurtsbaugh, Wayne A.

    1995-01-01

    Hypersaline lakes are noted for their simple communities which facilitate understanding ecological interactions (Williams et al. 1990; Wurtsbaugh 1992; Jellison and Melack 1988). Nevertheless, we still cannot easily predict how environmental changes will effect the population dynamics in these lakes, at least in part because even these simple ecosystems may be more complex than we .realize. Many hypersaline lakes are dominated by the brine shrimp Artemia spp. The production of brine shrimp is...

  16. Proteomic analysis of acute responses to copper sulfate stress in larvae of the brine shrimp,Artemia sinica

    Institute of Scientific and Technical Information of China (English)

    周茜; 吴长功; 董波; 李富花; 刘凤岐; 相建海

    2010-01-01

    Proteomics was used to reveal the differential protein expression profiles of acute responses to copper sulfate exposure in larvae of Artemia sinica.Fourteen differentially displayed protein spots were detected and seven of them were identified.Three spots were up-expressed and identified:actin, heat shock protein 70,and chaperone subunit 1;three down-regulated proteins were identified:arginine kinase,elongation factor-2,and glycine-rich protein;and a newly expressed protein was identified as peroxiredoxin....

  17. Probing the phenomenon of trained immunity in invertebrates during a transgenerational study, using brine shrimp Artemia as a model system.

    Science.gov (United States)

    Norouzitallab, Parisa; Baruah, Kartik; Biswas, Priyanka; Vanrompay, Daisy; Bossier, Peter

    2016-01-01

    The invertebrate's innate immune system was reported to show some form of adaptive features, termed trained immunity. However, the memory characteristics of innate immune system and the mechanisms behind such phenomena remain unclear. Using the invertebrate model Artemia, we verified the possibility or impossibility of trained immunity, examining the presence or absence of enduring memory against homologous and heterologous antigens (Vibrio spp.) during a transgenerational study. We also determined the mechanisms behind such phenomenon. Our results showed the occurrence of memory and partial discrimination in Artemia's immune system, as manifested by increased resistance, for three successive generations, of the progenies of Vibrio-exposed ancestors towards a homologous bacterial strain, rather than to a heterologous strain. This increased resistance phenotype was associated with elevated levels of hsp70 and hmgb1 signaling molecules and alteration in the expression of key innate immunity-related genes. Our results also showed stochastic pattern in the acetylation and methylation levels of H4 and H3K4me3 histones, respectively, in the progenies whose ancestors were challenged. Overall results suggest that innate immune responses in invertebrates have the capacity to be trained, and epigenetic reprogramming of (selected) innate immune effectors is likely to have central place in the mechanisms leading to trained immunity. PMID:26876951

  18. Proteomic analysis of acute responses to copper sulfate stress in larvae of the brine shrimp, Artemia sinica

    Science.gov (United States)

    Zhou, Qian; Wu, Changgong; Dong, Bo; Li, Fuhua; Liu, Fengqi; Xiang, Jianhai

    2010-03-01

    Proteomics was used to reveal the differential protein expression profiles of acute responses to copper sulfate exposure in larvae of Artemia sinica. Fourteen differentially displayed protein spots were detected and seven of them were identified. Three spots were up-expressed and identified: actin, heat shock protein 70, and chaperone subunit 1; three down-regulated proteins were identified: arginine kinase, elongation factor-2, and glycine-rich protein; and a newly expressed protein was identified as peroxiredoxin. The study indicates the involvement of all the differentially expressed proteins in the early responses of protein expression, and in the survival of A. sinica in the presence of copper and other heavy metals; the findings improve understanding of the organism’s adaptive responses and resistance.

  19. Bacillus sp. LT3 improves the survival of gnotobiotic brine shrimp (Artemia franciscana) larvae challenged with Vibrio campbellii by enhancing the innate immune response and by decreasing the activity of shrimp-associated vibrios

    OpenAIRE

    Niu, Y.; Defoirdt, T; K. Baruah; Van de Wiele, T.; Dong, L.; P. Bossier

    2014-01-01

    Bacteria belonging to the genus Bacillus are amongst the most intensively studied group of bacteria for use as probiotics in aquaculture. However, the exact mechanism of action of these bacteria is often not well described, and the microbiota that are naturally present in cultures of test organisms often compromise the interpretation of the results. The present study aimed to evaluate the putative probiotic effect of Bacillus sp. LT3 in a model system with gnotobiotic brine shrimp Artemia fra...

  20. 高原盐湖盐藻和卤虫资源的开发和利用%Development and Utilization of Salt Algae (Dunaliella salina) and Brine Shrimp (Artemia spp.) in the Plateau Salt Lake of China

    Institute of Scientific and Technical Information of China (English)

    印象初; 印红; 周可新; 张道川; 施鉴屏

    2001-01-01

    叙述了我国高原盐湖的名称、地理位置、面积、水深、海拔和盐湖类型等基本情况;盐湖中盐藻和卤虫的种类、生物学和生态学特性。并对它们的经济价值和开发利用作了初步的讨论。%In the paper, the name, geographical position, area, depth ofwater, altitude, brine type of salt lake from Plateau; ecology, biology and economy of salt algae (Dunaliella salina) and brine shrimp (Artemia spp.) are described. The development and utilization of the sources of salt lake are preliminarily discussed.

  1. THE BRINE SHRIMP (ARTMA SALINA) LETHALITY OF SOME FERULAGO SPECIES

    OpenAIRE

    F. HIRLAK, S. DOĞANCA, E. GÜRKAN, O.T. TÜZÜN,

    2015-01-01

    In this work the bio-activities of the extracts obtained from F. asparagifoliaBoiss., F. humilis Boiss., F. aucheri Boiss. (Umbelliferae) are investigatedusing the Brine shrimp method.Key words: Ferulago aucheri, F. humilis, F. asparagifolia, Brineshrimp (Artemia salina).

  2. The American brine shrimp as an exotic invasive species in the western Mediterranean

    OpenAIRE

    Amat, Francisco; Hontoria, Francisco; Ruiz, Olga; Green, Andy J.; Sánchez, Marta I.; Figuerola, Jordi; Hortas, F.

    2005-01-01

    The hypersaline environments and salterns present in the western Mediterranean region (including Italy, southern France, the Iberian Peninsula and Morocco) contain autochthonous forms of the brine shrimp Artemia, with parthenogenetic diploid and tetraploid strains coexisting with the bisexual species A. sal- ina. Introduced populations of the American brine shrimp A. franciscana have also been recorded in these Mediterranean environments since the 1980s. Based on brine shrimp cyst samples...

  3. Sudden weaning of angel fish pterophyllum scalare (Lichtenstein) (Pisces; Cichlidae) larvae from brine shrimp (Artemia sp) nauplii to formulated larval feed

    OpenAIRE

    Herath, Sandamali Sakunthala; Atapaththu, Kerthi Sri Senarathna

    2013-01-01

    This study investigated the effects of sudden weaning of angel fish larvae (Pteraphylum scalari) from Artemia nauplii to commercial larval feed. Four days post hatch (DPH) larvae were reared in four different weaning protocols (TR1-TR4) with triplicates in a complete randomize design. Larvae in TR1 and TR4 were exclusively fed Artemia nauplii and dry feed respectively. In TR2 and TR3, larvae were initially fed Artemia nauplii and suddenly wean to formulated feed on 14 DPH and 7 DPH respective...

  4. The Brine Shrimp's Butterfly Stroke

    OpenAIRE

    Johnson, Brennan; Garrity, Deborah; Dasi, Lakshmi Prasad

    2011-01-01

    We investigate the fluid dynamics of brine shrimp larvae swimming in this gallery of fluid motion video. Time resolved particle image velocimetry was performed using nano-particles as seeding material to measure the time dependent velocity and vorticity fields. The Reynolds number of the flow was roughly 8 and the Womerseley number (ratio of periodic forcing to viscous forcing) was about 5. Vorticity dynamics reveals the formation of a vortex ring structure at the tip of each arm at the begin...

  5. Uji Sitotoksik Fraksi Etilasetat Daun Bangun-Bangun (Plectranthus amboinicus (Lour.) terhadap Larva Artemia salina Leach dengan Metode Brine Shrimp Lethality Test (BSLT)

    OpenAIRE

    Pardede, E. Roslina

    2016-01-01

    Background: Bangun-Bangun leaves (Plectranthus amboinicus (Lour.) Spreng is one of the plants that have the potential to be developed as a cancer chemopreventive agent. The Purpose: The aim of the study were to find out the cytotoxic effect of ethylacetate fraction bangun-bangun leaves (FEDBB) on Artemia salina Leach larvae. Methods: This experimental study using 800 Artemia salina Leach larvae were divided into one control group negative 1 and 5 positive control group concentration10 μ...

  6. A Brine Shrimp Bioassay for Measuring Toxicity and Remediation of Chemicals

    Science.gov (United States)

    Lieberman, Marya

    1999-12-01

    A bioassay using Artemia franciscana (brine shrimp) was adapted to measure the toxicity of household chemicals. One project is described in which students collect dose-response curves for seven commercial flea-killing products. Next, groups of students researched the insecticidal ingredients of the flea products. On the basis of the structures of the active ingredients, they chose remediation methods to make the flea product less toxic to brine shrimp; procedures included copper-catalyzed hydrolysis, adsorption onto activated charcoal, bleach treatment, and photodegradation. No special equipment or supplies are necessary for the bioassay other than the brine shrimp eggs, which can be obtained at any aquarium store.

  7. Multimeric hemoglobin of the Australian brine shrimp Parartemia.

    Science.gov (United States)

    Coleman, M; Matthews, C M; Trotman, C N

    2001-04-01

    The hemoglobin molecule of the commercially important brine shrimp Artemia sp. has been used extensively as a model for the study of molecular evolution. It consists of nine globin domains joined by short linker sequences, and these domains are believed to have originated through a series of duplications from an original globin gene. In addition, in Artemia, two different polymers of hemoglobin, called C and T, are found which differ by 11.7% at the amino acid level and are believed to have diverged about 60 MYA. This provides a set of data of 18 globin domain sequences that have evolved in the same organism. The pattern of amino acid substitution between these two polymers is unusual, with pairs of equivalent domains displaying differences of up to 2.7-fold in total amino acid substitution. Such differences would reflect a similar range of molecular-clock rates in what appear to be duplicate, structurally equivalent domains. In order to provide a reference outgroup, we sequenced the cDNA for a nine-domain hemoglobin (P) from another genus of brine shrimp, Parartemia zietziana, which differs morphologically and ecologically from Artemia and is endemic to Australia. Parartemia produces only one hundredth the amount of hemoglobin that Artemia produces and does not upregulate production in response to low oxygen partial pressure. Comparison of the globin domains at the amino acid and DNA levels suggests that the Artemia globin T gene has accumulated substitutions differently from the Parartemia P and Artemia C globin genes. We discuss the questions of accelerated evolution after duplication and possible functions for the Parartemia globin. PMID:11264409

  8. Sudden weaning of angel fish pterophyllum scalare (Lichtenstein) (Pisces; Cichlidae) larvae from brine shrimp (Artemia sp) nauplii to formulated larval feed.

    Science.gov (United States)

    Herath, Sandamali Sakunthala; Atapaththu, Kerthi Sri Senarathna

    2013-12-01

    This study investigated the effects of sudden weaning of angel fish larvae (Pteraphylum scalari) from Artemia nauplii to commercial larval feed. Four days post hatch (DPH) larvae were reared in four different weaning protocols (TR1-TR4) with triplicates in a complete randomize design. Larvae in TR1 and TR4 were exclusively fed Artemia nauplii and dry feed respectively. In TR2 and TR3, larvae were initially fed Artemia nauplii and suddenly wean to formulated feed on 14 DPH and 7 DPH respectively. The experiment was lasted for 28 days. At the end of the experiment, final mean weight (FW), total length (FL), height (FH), Daily Weight Gain (DWG), Specific Growth Rate (SGR), survival and stress index were compared. Significantly highest (P < 0.05) FW, DWG and SGR were observed in TR1 and TR2 while former values of TR3 were not significantly different from TR1. Highest FL observed in TR1 and TR2 while FL of TR2 was statistically similar to that of TR3. The poorest growth was observed in larvae solely fed formulated feed. Survival and the stress index were independent from weaning methods. Although sudden weaning is possible on 7 DPH, larvae showed comparatively higher growth when switch off to formulate feed on 14 DPH. PMID:23626927

  9. Avaliação de extratos de macroalgas bênticas do litoral catarinense utilizando o teste de letalidade para Artemia salina Evaluation of macroalgae from Santa Catarina’s coast with the brine shrimp assay

    Directory of Open Access Journals (Sweden)

    Cintia Lhullier

    2006-06-01

    Full Text Available Foram coletadas amostras de algas marinhas de 19 espécies (sendo 4 pertencentes ao filo Chlorophyta, 5 ao filo Phaeophyta e 10 ao filo Rhodophyta em dois locais do litoral catarinense. Os extratos etanólicos foram submetidos ao teste de letalidade para larvas de Artemia salina com objetivo de realizar uma triagem das espécies. Dos 26 extratos testados, 25 apresentaram toxicidade significativa em pelo menos uma das 3 concentrações testadas. O grupo de algas vermelhas (Rhodophyta foi o que obteve maior porcentagem de extratos com resultados estatisticamente significativos pelo método do qui-quadrado e também menores valores de CL50, com destaque para Acanthophora spicifera, Hypnea musciformis e Pterocladiella capillacea. Observaram-se diferenças entre as espécies de um mesmo gênero (Codium decorticatum e Codium isthmocladium e também a influência de fatores ambientais (Hypnea musciformis na toxicidade dos extratos.Samples of 19 macroalgae species (4 Chlorophyta, 5 Phaeophyta and 10 Rhodophyta have been collected from two points of Santa Catarina's coast. The ethanolic extracts were avaluated with the brine shrimp assay in order to perform a screening for potential toxicity. A total of 25 extracts presented significant results in one or more of the tested concentrations. The phylum Rhodophyta presented more statistically significant results with the chi-square test, as well as lower values of LC50. The extracts of Acanthophora spicifera (from Canasvieiras and Ilha do Francês, Hypnea musciformis and Pterocladiella capillacea (both from Ilha do Francês presented LC50 below 50 mg/mL. Differences between the species of same genus (Codium decorticatum and Codium isthmocladium and the influence of environmental factors (Hypnea musciformis were observed.

  10. Live preys in shrimp culture: nutritional and sanitary considerations on the use of Artemia in New Caledonia

    OpenAIRE

    Pham, Dominique; Wabete, Nelly; Maillez, Jean-rene; Broutoi, Francis; Chim, Liet

    2009-01-01

    In aquaculture, Artemia nauplii are commonly used as live prey; and represent 40 % of the total aquaculture feed demands in the early stages. However, the production of Brine shrimp is very unstable from one year to another and in the late 90’s, only 20 % of the world aquaculture need was covered. An insufficient offer leads to higher prices of the Artemia cysts and consequently, the price of shrimp juveniles from hatchery. In New Caledonia, marine aquaculture is mainly based on the blue s...

  11. The Brine Shrimp's Butterfly Stroke

    CERN Document Server

    Johnson, Brennan; Dasi, Lakshmi Prasad

    2011-01-01

    We investigate the fluid dynamics of brine shrimp larvae swimming in this gallery of fluid motion video. Time resolved particle image velocimetry was performed using nano-particles as seeding material to measure the time dependent velocity and vorticity fields. The Reynolds number of the flow was roughly 8 and the Womerseley number (ratio of periodic forcing to viscous forcing) was about 5. Vorticity dynamics reveals the formation of a vortex ring structure at the tip of each arm at the beginning of the power stroke. This two vortex system evolves dramatically with time as the stroke progresses. The outer circulation is noted to weaken while the inner circulation strengthens over the power stroke. The gaining strength of the inner vortex correlates with the acceleration and forward movement of the larvae.

  12. Estudo fitoquímico de Unonopsis lindmanii - Annonaceae, biomonitorado pelo ensaio de toxicidade sobre a Artemia salina leach Activity - guided isolation of constituents of Unonopsis lindmanii - Annonaceae, based on the brine shrimp lethality bioassay

    OpenAIRE

    João Máximo de Siqueira; Mauro Dionei Bomm; Núbia Fernanda Gomes Pereira; Walmir Silva Garcez; Maria Amélia Diamantino Boaventura

    1998-01-01

    Extracts obtained from leaves, seeds and bark of Unonopsis lindmanii were evaluated by means of Brine Shrimp Lethality test (BSL). Through bioassay-guided chromatographic fractionation, liriodenine, an oxoaporphine alkaloid, was isolated from the bark extracts as the bioactive compound. Two additional inactive known alkaloids, unonopsine and lysicamine were also isolated from the bark extracts.

  13. Accumulation of pesticide residues by shrimp, fish and brine shrimp during pond culture at Ghorabari (District Thatta)

    International Nuclear Information System (INIS)

    Residual level of persistent organo chlorines (OC) such as sigma-HCH (alpha-HCH, beta-HCH, gamma-HCH, delta-HCH, sigma-DDT (o,p'-DDD, op-DDE, p,p-DDE pp-DDD, pp'-DDT, o,p'-DDT), dieldrin and endrin were measured in a number of water samples from Ambro creek and their accumulation in shrimp (Penaeus merguiensis and P. penicillatus), fish (Otolithes ruber) and brine shrimp (Artemia sp.) reared in ponds for a period of four months. Samples were extracted with organic solvents, and quantified using gas chromatography-electron capture detection (GC/ECD). It has been found that results of animal tissue and water are not same however OCs, (mainly sigma DT and beta-HCH 4,4-DDT, Dieldrin + 2,4-DDT, and Methoxychlor were detected in all samples ). Heptachlor exo-epoxide were found in fish and Artemia sp. and absent in all shrimp samples. Heptachlor endo-epoxide was detected only in Artemia sp. and average residual concentration of OCs in Artemia sp. was 0.004-0.09 ppm. Methoxychlor was found in the highest quantity in all the samples whether it was fish, shrimp or Artemia. In fish average residual concentration of all (OCs) in individual sample was 0.03 - 0.180 ppm. (author)

  14. Diffusive properties of water in Artemia cysts as determined from quasi-elastic neutron scattering spectra. [Artemia shrimp

    Energy Technology Data Exchange (ETDEWEB)

    Trantham, E.C.; Rorschach, H.E.; Clegg, J.S.; Hazlewood, C.F.; Nicklow, R.M.; Wakabayashi, N.

    1984-05-01

    Results have been obtained on the quasi-elastic spectra of neutrons scattered from pure water, 20% agarose gel (hydration four grams H/sub 2/O per gram of dry solid) and cysts of the brine shrimp Artemia for hydrations between 0.10 and 1.2 grams H/sub 2/O per gram of dry solids. The spectra were interpreted using a two-component model that included contributions from the covalently bonded protons and the hydration water, and a mobile water fraction. The mobile fraction was described by a jump-diffusion correlation function for the translation motion and a simple diffusive orientational correlation function. The results for the line widths ..gamma..(Q/sup 2/) for pure water were in good agreement with previous measurements. The agarose results were consistent with NMR measurements that show a slightly reduced translational diffusion for the mobile water fraction. The Artemia results show that the translational diffusion coefficient of the mobile water fraction was greatly reduced from that of pure water. The line width was determined mainly by the rotational motion, which was also substantially reduced from the pure water value as determined from dielectric relaxation studies. The translational and rotational diffusion parameters were consistent with the NMR measurements of diffusion and relaxation. Values for the hydration fraction and the mean square thermal displacement as determined from the Q-dependence of line areas were also obtained.

  15. Comparison live adult Artemia and squid meat on the growth of Penaeid shrimp Metapenaeus dobsoni (Miers)

    Digital Repository Service at National Institute of Oceanography (India)

    Nair, S.R.S.; Achuthankutty, C.T.; Royan, J.P.

    An experiment lasting 14 weeks was conducted to compare the efficiency of live adult Artemia with fresh squid meat on growth of penaeid shrimp Metapenaeus dobsoni. The shrimps were found actively feeding on live Artemia and grew 84% more than those...

  16. The sequence of the 5S ribosomal RNA of the crustacean Artemia salina

    OpenAIRE

    Diels, Ludo; De Baere, Raymond; Vandenberghe, Antoon; De Wachter, Rupert

    1981-01-01

    The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU OH.

  17. Brine shrimp cytotoxic activities of Hippophae rhamnoides Linn leaves extracts

    OpenAIRE

    Javid Ali; Bashir Ahmad

    2015-01-01

    Objective: To evaluate brine shrimp lethality assay of solvent extracts (aqueous, methanol, ethanol, acetone, ethyl acetate, chloroform and n-hexane) of Hippophae rhamnoides (H. rhamnoides) leaves. Methods: Brine shrimp cytotoxicity assay was used to assess the cytotoxic potential of H. rhamnoides leaves extracts. Three vials for concentration of each extract were made and 10 shrimps per vial (30 shrimps per dilution) were transferred to specific concentration of each extrac...

  18. 不同日龄卤虫对钻井液生物毒性效应比较研究%The Biological Toxicity of Various Day Old Brine Shrimp Artemia salineto Drilling Effluent

    Institute of Scientific and Technical Information of China (English)

    尹翠玲; 张秋丰; 刘洋; 牛福新; 徐玉山

    2014-01-01

    The 96h biological toxicity of drilling effluent to two ,five ,ten ,twenty and thirty day old brine shrimp A rtemia saline was studied at water temperature from 23 ℃ to 25 ℃ .The results showed that the differences in mortality of the brine shrimp caused by different concentrations of drilling effluent were found to be increased with the test period elapse .There were significant differences in mortality between the second ,third ,fourth and fifth brime shrimp groups and the control group (P< 0 .05) ,except for between the first group and the control group in 96 h test .The 96 h LC50 was found to be 3464 mg/L in 2 day old A rtemia ,3488 mg/L in 5 day old A rtemia ,3452 mg/L in 10 day old A rtemia ,4811 mg/L in 20 day old A rtemia ,and 2592 mg/L in 30 day old A rtemia ,with the test time elapse ,the differences in mortality being decreased among all age A rtemia .%研究了23~25℃下2、5、10、20日和30日龄卤虫对钻井液的96 h毒性耐受力的差异。试验结果表明,随着试验时间的延长,不同质量浓度钻井液对卤虫死亡率的影响差异性逐渐增大,试验96 h时,除钻井液质量浓度为2000 mg/L组与对照组死亡率差异不显著外,4000、6000、8000、10000 mg/L质量浓度组均与对照组差异显著( P<0.05);2、5、10、20日和30日龄卤虫的96 h半致死质量浓度分别为3464、3488、3452、4811、2592 m g/L ,随着试验时间的延长,各日龄卤虫之间的死亡率差异逐渐降低。

  19. INTERNATIONAL STUDY ON 'ARTEMIA': 21. INVESTIGATIONS INTO WHY SOME STRAINS OF 'ARTEMIA' ARE BETTER FOOD SOURCES THAN OTHERS. FURTHER NUTRITIONAL WORK WITH LARVAE OF THE MUD CRAB, 'RHITHROPANOPEUS HARRISII'

    Science.gov (United States)

    In a series of studies conducted by members of the International Study on Artemia, differences in nutritional quality were documented between geographical strains of the brine shrimp Artemia. Concomitant with, and possibly related to nutritional effectiveness are differences in b...

  20. Nutritional value of brine shrimp cysts as a factitious food for Orius laevigatus (Heteroptera: Anthocoridae)

    OpenAIRE

    De Clercq, P.; Arijs, Y.; Van Meir, T.; G. Van Stappen; Sorgeloos, P.; K. DEWETTINCK; Rey, M; Grenier, S.; Febvay, G.

    2005-01-01

    Decapsulated cysts of the brine shrimp Artemia franciscana were assessed as a factitious food for rearing the anthocorid predator Orius laevigatus. Developmental and reproductive traits of O. laevigatus reared for a single generation on A. franciscana from three geographical locations or on gamma-irradiated eggs of the Mediterranean flour moth Ephestia kuehniella were compared. There was no effect of diet on nymphal survival but nymphal period on E. kuehniella eggs (12.2 days) was 0.7-1.6 day...

  1. Winter Waterbird Ecology on the Great Salt Lake, Utah, and Interactions with Commercial Harvest of Brine Shrimp Cysts

    OpenAIRE

    Roberts, Anthony J

    2013-01-01

    Interactions among commercial fisheries and birds have been studied in open ocean ecosystems and at aquaculture facilities. On the Great Salt Lake (GSL), Utah, USA, a commercial harvest of brine shrimp (Artemia franciscana) eggs (i.e. cysts) occurs annually during fall and winter. Coinciding with commercial harvest is the use of the GSL by millions of waterbirds which has the potential to result in conflict among industry and birds. The objectives of my research were to examine fall and winte...

  2. Prospects of Artemia culture in the coastal zone

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.

    The importance of the brine shrimp Artemia as live feed in shrimp hatcheries has been pointed out. The paper deals with the resource potential and status of cyst production in India. There is a need for setting up a Pilot Project for Artemia cyst...

  3. Composição química, atividade antibacteriana in vitro e toxicidade em Artemia salina do óleo essencial das inflorescências de Ocimum gratissimum L., Lamiaceae Chemical composition, antibacterial activity in vitro and brine-shrimp toxicity of the essential oil from inflorescences of Ocimum gratissimum L., Lamiaceae.

    Directory of Open Access Journals (Sweden)

    Lenise L. Silva

    2010-11-01

    Full Text Available O óleo essencial das inflorescências de Ocimum gratissimum L., Lamiaceae foi obtido por hidrodestilação e analisado por CG/EM. Os constituintes majoritários identificados foram eugenol (81,94% e γ-muuroleno (12,58%. O óleo essencial das inflorescências demonstrou atividade antibacteriana frente a todas as cepas bacterianas testadas pelo método de microdiluição em caldo. Merece destaque a atividade verificada frente às cepas resistentes de Enterococcus faecalis, Staphylococcus aureus e Escherichia coli. Os valores obtidos de concentração inibitória mínima (CIM e a concentração bactericida mínima (CBM variaram, respectivamente, entre 0,5-2 mg/mL e 1-4 mg/mL. Valores de CL50 de 233,8 (200,7-272,0 µg/mL para o óleo essencial e 186,1 (144,1-228,5 µg/mL para o eugenol, utilizado como controle positivo, foram observados frente à Artemia salina L.The essential oil obtained by hydrodistillation of the inflorescences of Ocimum gratissimum L. was analyzed by GC/MS. The main constituents were eugenol (81.94% and γ-muurolene (12.58%. Antibacterial activity was shown against all assayed strains by the broth microdilution method. It's worth noting the activity against resistant strains of Enterococcus faecalis, Staphylococcus aureus and Escherichia coli. Minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC values ranged between 0.5-2 mg/mL and 1-4 mg/mL, respectively. Preliminary toxicity assayed by the brine-shrimp (Artemia salina L. test showed LC50 values of 233.8 (200.7 - 272.0 µg/mL and 186.1 (144.1 - 228.5 µg/mL, respectively for the essential oil and eugenol (positive control.

  4. Antimicrobial, antityrosinase and brine shrimp lethality test of Bauhinia rufescens Lam (Fabaceae

    Directory of Open Access Journals (Sweden)

    Aminu Muhammad

    2013-09-01

    Full Text Available Objective: To evaluate leaves and stem bark extracts of Bauhinia rufescens for antimicrobial activities, tyrosinase enzyme inhibition potentials and lethality to brine shrimp larvae (Artemia salina. Methods: The plant materials were extracted based on polarity gradient of petroleum ether, ethyl acetate and methanol. The extracts were investigated for their antimicrobial, antityrosinase and cytotoxicity potentials. Results: The antimicrobial results indicated that the extracts inhibited the microbial growth in the range of 6.00-12.57 mm (450-1 800 µg/mL for bacterial strains and 7.33-14.03 mm (225-1 800 µg/mL for fungal strains. While the tyrosinase enzyme inhibition assay of the extracts showed that both the petroleum ether leaves and stem bark extracts exhibited a moderate inhibition (39.60% and 39.89% towards the action of mushroom tyrosinase enzyme on L-DOPA. In the brine shrimp lethality assay, ethyl acetate and methanol extracts of the leaves of the plant were found toxic to the Artemia salina with IC 50 values of 0.059 mg/mL and 0.389 mg/mL. However, both the petroleum ether and ethyl acetate extracts of the stem bark were nontoxic to the larvae. Conclusions: The result of the present study suggest the presence of phytochemicals possessing antimicrobial and antityrosinase activity as well as cytotoxic agents.

  5. Microbial changes and growth of Listeria monocytogenes during chilled storage of brined shrimp ( Pandalus borealis )

    DEFF Research Database (Denmark)

    Mejlholm, Ole; Kjeldgaard, J.; Modberg, A.;

    2008-01-01

    Thirteen storage trials and ten challenge tests were carried out to examine microbial changes, spoilage and the potential growth of Listeria monocytogenes in brined shrimp (Pandalus borealis). Shrimp in brine as well as brined and drained shrimp in modified atmosphere packaging (MAP) were produce...

  6. Estudo fitoquímico das cascas do caule de Duguetia glabriuscula - Annonaceae, biomonitorado pelo ensaio de toxicidade frente a Artemia salina leach Activity-guided isolation of the constituents from bark of stem of Duguetia glabriuscula - Annonaceae, using Brine Shrimp Lethality test (BSL)

    OpenAIRE

    João Máximo de Siqueira; Maria Graziela Ziminiani; Ubirazilda Maria Resende; Maria Amélia Diamantino Boaventura

    2001-01-01

    The extract obtained from stem bark of Duguetia glabriuscula - Annonaceae was evaluated by Brine Shrimp Lethality test (BSL). The bioactive compounds, oxobufoline and lanuginosine, two oxoaporphine alkaloids were isolated by activity-guided fractionation. In addition, the compounds asaraldehyde, (+)-allo-aromadendrane-10beta, 14-diol, and two aporphine alkaloids, polyalthine and oliveridine were also obtained.

  7. Talking about Brine Shrimps: Three Ways of Analysing Pupil Conversations.

    Science.gov (United States)

    Tunnicliffe, Sue Dale; Reiss, Michael J.

    1999-01-01

    Applies three distinct analyses to recorded and transcribed student conversations (n=240) about brine shrimps. The complementary analytic methods provide information on the content of pupils' conversations in terms of the observations made, the ways in which pupils make sense of their observations, and the ways in which students use conversation…

  8. Brine Shrimp and Their Habitat, An Environmental Investigation.

    Science.gov (United States)

    National Wildlife Federation, Washington, DC.

    This environmental unit is one of a series designed for integration within the existing curriculum. The unit is self-contained and students are encouraged to work at their own speed. The philosophy of the unit is based on an experience-oriented process that encourages independent student work. This unit explores the life cycle of brine shrimp and…

  9. Brine shrimp cytotoxic activities of Hippophae rhamnoides Linn leaves extracts

    Institute of Scientific and Technical Information of China (English)

    JavidAli; BashirAhmad

    2015-01-01

    Objective: To evaluate brine shrimp lethality assay of solvent extracts (aqueous, methanol, ethanol, acetone, ethyl acetate, chloroform and n-hexane) of Hippophae rhamnoides (H. rhamnoides) leaves. Methods: Brine shrimp cytotoxicity assay was used to assess the cytotoxic potential of H. rhamnoides leaves extracts. Three vials for concentration of each extract were made and 10 shrimps per vial (30 shrimps per dilution) were transferred to specific concentration of each extract. Results: The mortality of aqueous extract was 46.7%, methanol extract was 46.7%, ethanolic extract was 50.0%, ethyl acetate was 26.7%, acetone extract was 33.3%, chloroform extract was 40.0% and n-hexane extract was 33.3%. The lowest LD50 was found in methanol extracts (1199.97 µg/mL). Brine shrimp cytotoxicity of tested extracts of H. rhamnoides showed that mortality rate was concentration dependent. Conclusions: It is concluded that bioactive components are present in all leaves extracts of H. rhamnoides, which could be accounted for its pharmacological effects. Thus, the results support the uses of this plant species in traditional medicine.

  10. Brine shrimp development in space: ground-based data to shuttle flight results

    Science.gov (United States)

    Spooner, B. S.; DeBell, L.; Hawkins, L.; Metcalf, J.; Guikema, J. A.; Rosowski, J.

    1992-01-01

    The brine shrimp, Artemia salina, has been used as a model system to assess microgravity effects on developing organisms. Following fertilization and early development, the egg can arrest in early gastrula as a dehydrated cyst stage that is stable to harsh environments over long time periods. When salt water is added, the cysts can reactivate, with embryonic development and egg hatching occurring in about 24 h. A series of larval molts or instars, over about a 2 week period, results in the adult crustacean. We have assessed these developmental events in a closed syringe system, a bioprocessing module, in ground-based studies, and have conducted preliminary in-orbit experiments aboard the Space Shuttle Atlantis during the flights of STS-37 and STS-43. Although the in-flight data are limited, spectacular degrees of development have been achieved.

  11. Antimicrobial, antityrosinase and brine shrimp lethality test of Bauhinia rufescens Lam (Fabaceae)

    Institute of Scientific and Technical Information of China (English)

    Aminu Muhammad; Hasnah Mohd Sirat

    2013-01-01

    Objective: To evaluate leaves and stem bark extracts of Bauhinia rufescens for antimicrobial activities, tyrosinase enzyme inhibition potentials and lethality to brine shrimp larvae (Artemiasalina ). Methods: The plant materials were extracted based on polarity gradient of petroleum ether, ethyl acetate and methanol. The extracts were investigated for their antimicrobial, antityrosinase and cytotoxicity potentials.Results:The antimicrobial results indicated that the extracts inhibited the microbial growth in the range of 6.00-12.57 mm (450-1 800 µg/mL) for bacterial strains and 7.33-14.03 mm (225-1 800 µg/mL) for fungal strains. While the tyrosinase enzyme inhibition assay of the extracts showed that both the petroleum ether leaves and stem bark extracts exhibited a moderate inhibition (39.60%and 39.89%) towards the action of mushroom tyrosinase enzyme on L-DOPA. In the brine shrimp lethality assay, ethyl acetate and methanol extracts of the leaves of the plant were found toxic to the Artemia salina with IC50 values of 0.059 mg/mL and 0.389 mg/mL. However, both the petroleum ether and ethyl acetate extracts of the stem bark were nontoxic to the larvae.Conclusions:The result of the present study suggest the presence of phytochemicals possessing antimicrobial and antityrosinase activity as well as cytotoxic agents.

  12. When Parasites Are Good for Health: Cestode Parasitism Increases Resistance to Arsenic in Brine Shrimps

    Science.gov (United States)

    Martínez-Haro, Mónica; Taggart, Mark A.; Lenormand, Thomas; Green, Andy J.

    2016-01-01

    Parasites and pollutants can both affect any living organism, and their interactions can be very important. To date, repeated studies have found that parasites and heavy metals or metalloids both have important negative effects on the health of animals, often in a synergistic manner. Here, we show for the first time that parasites can increase host resistance to metalloid arsenic, focusing on a clonal population of brine shrimp from the contaminated Odiel and Tinto estuary in SW Spain. We studied the effect of cestodes on the response of Artemia to arsenic (acute toxicity tests, 24h LC50) and found that infection consistently reduced mortality across a range of arsenic concentrations. An increase from 25°C to 29°C, simulating the change in mean temperature expected under climate change, increased arsenic toxicity, but the benefits of infection persisted. Infected individuals showed higher levels of catalase and glutathione reductase activity, antioxidant enzymes with a very important role in the protection against oxidative stress. Levels of TBARS were unaffected by parasites, suggesting that infection is not associated with oxidative damage. Moreover, infected Artemia had a higher number of carotenoid-rich lipid droplets which may also protect the host through the “survival of the fattest” principle and the antioxidant potential of carotenoids. This study illustrates the need to consider the multi-stress context (contaminants and temperature increase) in which host-parasite interactions occur. PMID:26938743

  13. When Parasites Are Good for Health: Cestode Parasitism Increases Resistance to Arsenic in Brine Shrimps.

    Science.gov (United States)

    Sánchez, Marta I; Pons, Inès; Martínez-Haro, Mónica; Taggart, Mark A; Lenormand, Thomas; Green, Andy J

    2016-03-01

    Parasites and pollutants can both affect any living organism, and their interactions can be very important. To date, repeated studies have found that parasites and heavy metals or metalloids both have important negative effects on the health of animals, often in a synergistic manner. Here, we show for the first time that parasites can increase host resistance to metalloid arsenic, focusing on a clonal population of brine shrimp from the contaminated Odiel and Tinto estuary in SW Spain. We studied the effect of cestodes on the response of Artemia to arsenic (acute toxicity tests, 24h LC50) and found that infection consistently reduced mortality across a range of arsenic concentrations. An increase from 25°C to 29°C, simulating the change in mean temperature expected under climate change, increased arsenic toxicity, but the benefits of infection persisted. Infected individuals showed higher levels of catalase and glutathione reductase activity, antioxidant enzymes with a very important role in the protection against oxidative stress. Levels of TBARS were unaffected by parasites, suggesting that infection is not associated with oxidative damage. Moreover, infected Artemia had a higher number of carotenoid-rich lipid droplets which may also protect the host through the "survival of the fattest" principle and the antioxidant potential of carotenoids. This study illustrates the need to consider the multi-stress context (contaminants and temperature increase) in which host-parasite interactions occur. PMID:26938743

  14. Toxicity of heavy metals to brine shrimp Artemia

    Digital Repository Service at National Institute of Oceanography (India)

    Gajbhiye, S.N.; Hirota, R.

    stream_size 8 stream_content_type text/plain stream_name J_Indian_Fish_Assoc_20_43.pdf.txt stream_source_info J_Indian_Fish_Assoc_20_43.pdf.txt Content-Encoding ISO-8859-1 Content-Type text/plain; charset=ISO-8859-1 ...

  15. Brine shrimp lethality bioassay of selected Centaurea L. species (Asteraceae)

    OpenAIRE

    Janaćković P.; Tešević V.; Marin P.D.; Milosavljević S.; Duletić-Laušević Sonja; Janaćković Slavica; Veljić M.

    2008-01-01

    Ether extracts of 15 Centaurea L. species (Asteraceae) methanol extracts of 12species, and cnicin isolated from C. derventana were tested for general bioactivity using the brine shrimp lethality test. Cnicin showed the most potent activity with LC50 0.2. Also, ether extract of C. splendens showed significant activity with LC50 7.3, as did methanol extract of C. arenaria with LC50 12.4.

  16. Monitoring of Vibrio harveyi quorum sensing activity in real time during infection of brine shrimp larvae.

    Science.gov (United States)

    Defoirdt, Tom; Sorgeloos, Patrick

    2012-12-01

    Quorum sensing, bacterial cell-to-cell communication, has been linked to the virulence of pathogenic bacteria. Indeed, in vitro experiments have shown that many bacterial pathogens regulate the expression of virulence genes by this cell-to-cell communication process. Moreover, signal molecules have been detected in samples retrieved from infected hosts and quorum sensing disruption has been reported to result in reduced virulence in different host-pathogen systems. However, data on in vivo quorum sensing activity of pathogens during infection of a host are currently lacking. We previously reported that quorum sensing regulates the virulence of Vibrio harveyi in a standardised model system with gnotobiotic brine shrimp (Artemia franciscana) larvae. Here, we monitored quorum sensing activity in Vibrio harveyi during infection of the shrimp, using bioluminescence as a read-out. We found that wild-type Vibrio harveyi shows a strong increase in quorum sensing activity early during infection. In this respect, the bacteria behave remarkably similar in different larvae, despite the fact that only half of them survive the infection. Interestingly, when expressed per bacterial cell, Vibrio harveyi showed around 200-fold higher maximal quorum sensing-regulated bioluminescence when associated with larvae than in the culture water. Finally, the in vivo quorum sensing activity of mutants defective in the production of one of the three signal molecules is consistent with their virulence, with no detectable in vivo quorum sensing activity in AI-2- and CAI-1-deficient mutants. These results indicate that AI-2 and CAI-1 are the dominant signals during infection of brine shrimp. PMID:22673627

  17. SURVIVAL AND GROWTH OF A SHEEPSHEAD MINNOW LARVAE AND JUVENILES ON A DIET OF 'ARTEMIA' NAUPLII

    Science.gov (United States)

    Two geographic strains of brine shrimp (Artemia franciscana) nauplii were evaluated for nutritional quality as a food source for young sheepshead minnows (Cyprinodon variegatus). Although there was no mortality of fish fed either strain, fish reared on brine shrimp nauplii from S...

  18. SURVIVAL AND GROWTH OF SHEEPSHEAD MINNOW LARVAE AND JUVENILES ON A DIET OF 'ARTEMIA' NAUPLII

    Science.gov (United States)

    Two geographic strains of brine shrimp (Artemia franciscana) nauplii were evaluated for nutritional quality as a food source for young sheepshead minnows (Cyprinodon variegatus). Although there was no mortality of fish fed either strain, fish reared on brine shrimp nauplii from S...

  19. Microprobe analysis of brine shrimp grown on meteorite extracts

    International Nuclear Information System (INIS)

    Nuclear microprobe methods have been used to investigate the uptake and distribution of various elements by brine shrimps and their unhatched eggs when grown in extracts of the Murchison and Allende carbonaceous meteorites, which were selected as model space resources. Measurements were carried out using a focussed 2 MeV proton beam raster scanned over the samples in order to obtain the average elemental concentrations. Line scans across the egg and shrimp samples show uptake of elements such as Mg, Ni, S and P which are present in the meteorites. The results confirmed that carbonaceous chondrite materials can provide nutrients, including high levels of the essential nutrient phosphate. The concentrations of these elements varied significantly between shrimp and eggs grown in extracts of the two meteorite types, which can help in identifying optimal growth media. Our results illustrate that nuclear microprobe techniques can determine elemental concentrations in organisms exposed to meteorite derived media and thus help in identifying useful future resources

  20. Microprobe analysis of brine shrimp grown on meteorite extracts

    Energy Technology Data Exchange (ETDEWEB)

    Kennedy, J. [National Isotope Centre, GNS Science, 30 Gracefield Road, Lower Hutt (New Zealand)]. E-mail: j.kennedy@gns.cri.nz; Mautner, M.N. [Soil, Plant and Ecological Sciences Division, Lincoln University (New Zealand) and Department of Chemistry, University of Canterbury, Christchurch 8001 (New Zealand)]. E-mail: m.mautner@solis1.com; Barry, B. [National Isotope Centre, GNS Science, 30 Gracefield Road, Lower Hutt (New Zealand); Markwitz, A. [National Isotope Centre, GNS Science, 30 Gracefield Road, Lower Hutt (New Zealand)

    2007-07-15

    Nuclear microprobe methods have been used to investigate the uptake and distribution of various elements by brine shrimps and their unhatched eggs when grown in extracts of the Murchison and Allende carbonaceous meteorites, which were selected as model space resources. Measurements were carried out using a focussed 2 MeV proton beam raster scanned over the samples in order to obtain the average elemental concentrations. Line scans across the egg and shrimp samples show uptake of elements such as Mg, Ni, S and P which are present in the meteorites. The results confirmed that carbonaceous chondrite materials can provide nutrients, including high levels of the essential nutrient phosphate. The concentrations of these elements varied significantly between shrimp and eggs grown in extracts of the two meteorite types, which can help in identifying optimal growth media. Our results illustrate that nuclear microprobe techniques can determine elemental concentrations in organisms exposed to meteorite derived media and thus help in identifying useful future resources.

  1. Microprobe analysis of brine shrimp grown on meteorite extracts

    Science.gov (United States)

    Kennedy, J.; Mautner, M. N.; Barry, B.; Markwitz, A.

    2007-07-01

    Nuclear microprobe methods have been used to investigate the uptake and distribution of various elements by brine shrimps and their unhatched eggs when grown in extracts of the Murchison and Allende carbonaceous meteorites, which were selected as model space resources. Measurements were carried out using a focussed 2 MeV proton beam raster scanned over the samples in order to obtain the average elemental concentrations. Line scans across the egg and shrimp samples show uptake of elements such as Mg, Ni, S and P which are present in the meteorites. The results confirmed that carbonaceous chondrite materials can provide nutrients, including high levels of the essential nutrient phosphate. The concentrations of these elements varied significantly between shrimp and eggs grown in extracts of the two meteorite types, which can help in identifying optimal growth media. Our results illustrate that nuclear microprobe techniques can determine elemental concentrations in organisms exposed to meteorite derived media and thus help in identifying useful future resources.

  2. Baker's yeast as a potential substitute for live algae in aquaculture diets: Artemia as a case study

    OpenAIRE

    Coutteau, P.; Lavens, P.; Sorgeloos, P.

    1990-01-01

    In this study baker's yeast was evaluated as a substitute for live Dunaliella tertiolecta algae in the culture of the brine shrimp Artemia . Consumption of fresh baker's yeast resulted in poor growth and survival of brine shrimp. However, the nutritional value of the yeast significantly improved after complete removal of the yeast cell wall by enzymatic treatment. Baker's yeast was also made digestible for Artemia by simple chemical treatment which did not reduce rigidity of the yeast cell. T...

  3. Guiding brine shrimp through mazes by solving reaction diffusion equations

    Science.gov (United States)

    Singal, Krishma; Fenton, Flavio

    Excitable systems driven by reaction diffusion equations have been shown to not only find solutions to mazes but to also to find the shortest path between the beginning and the end of the maze. In this talk we describe how we can use the Fitzhugh-Nagumo model, a generic model for excitable media, to solve a maze by varying the basin of attraction of its two fixed points. We demonstrate how two dimensional mazes are solved numerically using a Java Applet and then accelerated to run in real time by using graphic processors (GPUs). An application of this work is shown by guiding phototactic brine shrimp through a maze solved by the algorithm. Once the path is obtained, an Arduino directs the shrimp through the maze using lights from LEDs placed at the floor of the Maze. This method running in real time could be eventually used for guiding robots and cars through traffic.

  4. Scanning electron microscope observations of brine shrimp larvae from space shuttle experiments

    Science.gov (United States)

    DeBell, L.; Paulsen, A.; Spooner, B.

    1992-01-01

    Brine shrimp are encysted as gastrula stage embryos, and may remain dehydrated and encysted for years without compromising their viability. This aspect of brine shrimp biology is desirable for studying development of animals during space shuttle flight, as cysts placed aboard a spacecraft may be rehydrated at the convenience of an astronaut, guaranteeing that subsequent brine shrimp development occurs only on orbit and not on the pad during launch delays. Brine shrimp cysts placed in 5 ml syringes were rehydrated with salt water and hatched during a 9 day space shuttle mission. Subsequent larvae developed to the 8th larval stage in the sealed syringes. We studied the morphogenesis of the brine shrimp larvae and found the larvae from the space shuttle experiments similar in rate of growth and extent of development, to larvae grown in sealed syringes on the ground. Extensive differentiation and development of embryos and larvae can occur in a microgravity environment.

  5. Comparison of the Artemia salina and Artemia fransiscana bioassays for toxicity of Indian medicinal plants

    Institute of Scientific and Technical Information of China (English)

    Thangapandi Veni; Thambusamy Pushpanathan

    2014-01-01

    Objective:To evaluate leaves extract of Azima tetracantha and Gmelina asiatica for lethality to brine shrimp larvae (Artemia salina and Artemia fransiscana). Methods: The plant materials were extracted based on polarity gradients of petroleum ether, benzene, chloroform, acetone, ethanol and methanol. The extracts were investigated for their cytotoxic potential. Results: In the brine shrimp lethality assay of all extracts, exception of acetone, ethanol and petroleum ether extracts Gmelina asiatica displayed 100%mortality at 1 000 μg/mL by Artemia salina and Artemia fransiscana. Chloroform extract was the most potent and presented the highest percentage of mortality with the lowest LC50 values by both assay too. Conclusions:The results of the present study suggest the presence of photochemical possessing cytotoxic agents.

  6. The Frequency-Dependence of the NMR Longitudinal Relaxation Rate, T(1)(-1), of Water in Cysts of the Brine Shrimp

    Science.gov (United States)

    Egan, Thomas F.

    The NMR spin-lattice relaxation rate, T(,1)(' -1), of water is independent of the Larmor frequency, (omega)/2(pi), in the normal rf range. However, T(,1)('-1) of intracellular water in biological systems, which accounts for as much as 80% of the cell mass, is frequency-dependent. This indicates that the NMR properties of water in the cellular environment are influenced by long-correlation time processes due to the interaction of water with proteins and other macromolecular constituents of the cell. In this research, the relaxation rate T(,1)(' -1) of water in the Artemia (brine shrimp) cyst is examined as a function of: (1) the proton NMR Larmor frequency for .01 brine shrimp cysts are influenced by additional relexation mechanisms; translational diffusion of hydration water is one possibility.

  7. Mass selection for small-sized cysts in Artemia franciscana produced in Vinh Chau salt ponds, Vietnam

    OpenAIRE

    Van, N.T.H.; Van Hoa, N.; Bossier, P.; Sorgeloos, P; Van Stappen, G.

    2014-01-01

    Unidirectional mass truncation selection for small-sized cysts was carried out on brine shrimp (Artemia franciscana Kellogg 1906), Vinh Chau strain, Vietnam, through cyst sieving and then culturing the selected individuals (

  8. Physiological strategies during animal diapause: lessons from brine shrimp and annual killifish.

    Science.gov (United States)

    Podrabsky, Jason E; Hand, Steven C

    2015-06-01

    Diapause is a programmed state of developmental arrest that typically occurs as part of the natural developmental progression of organisms that inhabit seasonal environments. The brine shrimp Artemia franciscana and annual killifish Austrofundulus limnaeus share strikingly similar life histories that include embryonic diapause as a means to synchronize the growth and reproduction phases of their life history to favorable environmental conditions. In both species, respiration rate is severely depressed during diapause and thus alterations in mitochondrial physiology are a key component of the suite of characters associated with cessation of development. Here, we use these two species to illustrate the basic principles of metabolic depression at the physiological and biochemical levels. It is clear that these two species use divergent molecular mechanisms to achieve the same physiological and ecological outcomes. This pattern of convergent physiological strategies supports the importance of biochemical and physiological adaptations to cope with extreme environmental stress and suggests that inferring mechanism from transcriptomics or proteomics or metabolomics alone, without rigorous follow-up at the biochemical and physiological levels, could lead to erroneous conclusions. PMID:26085666

  9. Antimicrobial Activity and Brine Shrimp Lethality Bioassay of the Leaves Extract of Dillenia indica Linn.

    Science.gov (United States)

    Apu, As; Muhit, Ma; Tareq, Sm; Pathan, Ah; Jamaluddin, Atm; Ahmed, M

    2010-01-01

    The crude methanolic extract of Dillenia indica Linn. (Dilleniaceae) leaves has been investigated for the evaluation of antimicrobial and cytotoxic activities. Organic solvent (n-hexane, carbon tetrachloride and chloroform) fractions of methanolic extract and methanolic fraction (aqueous) were screened for their antimicrobial activity by disc diffusion method. Besides, the fractions were screened for cytotoxic activity using brine shrimp (Artemia salina) lethality bioassay. Among the four fractions tested, n-hexane, carbon tetrachloride, and chloroform fractions showed moderate antibacterial and antifungal activity compared to standard antibiotic, kanamycin. The average zone of inhibition was ranged from 6 to 8 mm at a concentration of 400 µg/disc. But the aqueous fraction was found to be insensitive to microbial growth. Compared to vincristine sulfate (with LC(50) of 0.52 µg/ ml), n-hexane and chloroform fractions demonstrated a significant cytotoxic activity (having LC(50) of 1.94 µg/ml and 2.13 µg/ml, respectively). The LC(50) values of the carbon tetrachloride and aqueous fraction were 4.46 µg/ml and 5.13 µg/ ml, respectively. The study confirms the moderate antimicrobial and potent cytotoxic activities of Dillenia indica leaves extract and therefore demands the isolation of active principles and thorough bioassay. PMID:21331191

  10. Density and distribution of water boatmen and brine shrimp at a major shorebird wintering area in Puerto Rico

    Science.gov (United States)

    Tripp, K.J.; Collazo, J.A.

    2003-01-01

    The Cabo Rojo salt flats are an important wintering area for migratory shorebirds. Their quality is intimately related to prey availability, as prey are needed to meet energetic requirements. Understanding prey dynamics is, therefore, a key element of shorebird conservation plans. To this end, we monitored the density and distribution of water-boatmen (Trichocorixa spp.) and brine shrimp (Artemia spp.) in relation to water salinity from September to November of 1994 and 1995. Salinity ranged from 4 to 292 ppt, and gradients were related to hydrological alterations (e.g., salt extraction) and connection to the ocean. Brine shrimp were restricted to areas of highest salinity (??? 106 ppt), whereas water-boatmen to areas of lowest salinity ( 100 ppt. Lowering water salinity did not result in osmolal related mortality. Results underscored the sensitivity of water boatmen to high salinity, particularly when the difference in salinity between the 'source' and 'destination' localities widened. Water boatmen density increased in one lagoon as salinity decreased from 65 to 47 ppt. On the basis of our experiments, local adult survivorship improved and immigration and subsequent survival of adults, if any, was not hindered. The density of nymphs also suggested that hatching occurred concurrently. The foraging value of the salt flats can be enhanced by maintaining salinity at < 65 ppt in selected management units and minimizing differences in salinity concentrations among them.

  11. BRINE SHRIMP LETHALITY TEST (BSLT DARI BERBAGAI FRAKSI EKSTRAK DAGING BUAH DAN KULIT BIJI MAHKOTA DEWA (Phaleria macrocarpa

    Directory of Open Access Journals (Sweden)

    Vivi Lisdawati

    2012-10-01

    Full Text Available Biological activity of a natural product involved in several certain characteristics will influence its pharmaceutical application. Secondary metabolites, considered as chemical compounds, are now thought to mediate plant defense mechanism by providing chemical barriers against animal and microbial predators. Brine Shrimp Lethality Test (BSLT method has been used as preliminary test for screening the activity of chemical compounds in n­ hexane, ethyl acetate, and methanol extracts from mesocarp and seeds of Phaleria macrocarpa, fam. Thymelaeaceae. BSLT method used shrimp larvas of Artemia salina L. to study the mortality effect that was caused by the sample extracts. All of crude extracts showed bioactivity with LC50 values from 0.16 to 11.83 µg/ml (baseline 1000 µg/ml. It means, at the concentration the crude extracts can cause 50% mortality of A. salina L. shrimp larvas, after 24 hours incubation. These results clearly indicate that crude extracts of P. macrocarpa showed high potential biological activity.

  12. Use of a Brine Shrimp Assay to Study Herbal Teas in the Classroom.

    Science.gov (United States)

    Opler, Annette; Mizell, Rebecca; Robert, Alexander; Cervantes-Cervantes, Miguel; Kincaid, Dwight; Kennelly, Edward J.

    2002-01-01

    Introduces a brine shrimp assay to demonstrate the effects of the biological activity of herbal remedies. Describes two protocols, one using aqueous extracts and the other using methanol extracts. (Contains 21 references.) (YDS)

  13. Brine shrimp lethality and antibacterial activity of extracts from the bark of Schleichera oleosa

    Institute of Scientific and Technical Information of China (English)

    Laxman Pokhrel; Bigyan Sharma; Gan B Bajracharya

    2015-01-01

    Objective: To determine the antibacterial efficacy and brine shrimp toxicity of extracts (hexane, dichloromethane, ethyl acetate, methanol and water) obtained from the bark of Schleichera oleosa. Methods: The powdered bark sample was Soxhlet extracted sequentially in hexanes, dichloromethane, ethyl acetate, methanol and water. Antibacterial evaluation was carried out by following the agar diffusion method and amoxicillin disc was used as a reference. Slightly modified Meyer’s method was used to determine the toxicity of the extracts in brine shrimps. Results: Among the nine bacterial strains tested, the methanolic and aqueous extracts showed promising antibacterial efficacy against Serratia marcescens, Escherarichia coli, Bacillus subtilis and Micrococcus luteus. None of the extracts were found significantly toxic to brine shrimps. Conclusions: Strong antibacterial activity and low brine shrimp toxicity of methanolic and aqueous extracts can provide new antibacterial compounds.

  14. Brine shrimp lethality and antibacterial activity of extracts from the bark of Schleichera oleosa

    Directory of Open Access Journals (Sweden)

    Laxman Pokhrel

    2015-08-01

    Full Text Available Objective: To determine the antibacterial efficacy and brine shrimp toxicity of extracts (hexane, dichloromethane, ethyl acetate, methanol and water obtained from the bark of Schleichera oleosa. Methods: The powdered bark sample was Soxhlet extracted sequentially in hexanes, dichloromethane, ethyl acetate, methanol and water. Antibacterial evaluation was carried out by following the agar diffusion method and amoxicillin disc was used as a reference. Slightly modified Meyer’s method was used to determine the toxicity of the extracts in brine shrimps. Results: Among the nine bacterial strains tested, the methanolic and aqueous extracts showed promising antibacterial efficacy against Serratia marcescens, Escherarichia coli, Bacillus subtilis and Micrococcus luteus. None of the extracts were found significantly toxic to brine shrimps. Conclusions: Strong antibacterial activity and low brine shrimp toxicity of methanolic and aqueous extracts can provide new antibacterial compounds.

  15. Brine shrimp lethality and acute oral toxicity studies on Swietenia mahagoni (Linn.) Jacq. seed methanolic extract

    OpenAIRE

    Geethaa Sahgal; Surash Ramanathan; Sreenivasan Sasidharan; Mohd. Nizam Mordi; Sabariah Ismail; Sharif Mahsufi Mansor

    2010-01-01

    Background: The seeds of Swietenia mahagoni have been applied in folk medicine for the treatment of hypertension, diabetes, malaria, amoebiasis, cough, chest pain, and intestinal parasitism. Here we are the first to report on the toxicity of the Swietenia mahagoni crude methanolic (SMCM) seed extract. Methods: SMCM seed extract has been studied for its brine shrimp lethality and acute oral toxicity, in mice. Results: The brine shrimp lethality bioassay shows a moderate cytotoxicity at high co...

  16. A comparison between two brine shrimp assays to detect in vitro cytotoxicity in marine natural products

    OpenAIRE

    Pérez Pilar; Hernández-Inda Zaira L; Carballo José; García-Grávalos María D

    2002-01-01

    Abstract Background The brine shrimp lethality assay is considered a useful tool for preliminary assessment of toxicity. It has also been suggested for screening pharmacological activities in plant extracts. However, we think that it is necessary to evaluate the suitability of the brine shrimp methods before they are used as a general bio-assay to test natural marine products for pharmacological activity. Material and Methods The bioactivity of the isopropanolic (2-PrOH) extracts of 14 specie...

  17. Acute toxicity, brine shrimp cytotoxicity, anthelmintic and relaxant potentials of fruits of Rubus fruticosus Agg

    OpenAIRE

    Ali, Niaz; Aleem, Umer; Ali Shah, Syed Wadood; Shah, Ismail; Junaid, Muhammad; Ahmed, Ghayour; Ali, Waqar; Ghias, Mehreen

    2013-01-01

    Background Rubus fruticosus is used in tribal medicine as anthelmintic and an antispasmodic. In the current work, we investigated the anthelmintic and antispasmodic activities of crude methanol extract of fruits of R. fruticosus on scientific grounds. Acute toxicity and brine shrimp cytotoxicity activity of the extract were also performed. Methods Acute toxicity study of crude methanol extract of R. fruticosus was performed on mice. In vitro Brine shrimp cytotoxicity assay was performed on sh...

  18. New aspects of the use of inert diets for high density culturing of brine shrimp

    OpenAIRE

    Dobbeleir, J.; Adam, N.(Princeton University, Princeton, U.S.A); Bossuyt, E.; Bruggeman, E.; Sorgeloos, P

    1980-01-01

    Brine shrimp being non-selective filter-feeders, cheap agricultural waste products should be evaluated as potential food sources for their controlled mass culturing. Preliminary results of screening tests performed with wheat bran, soybean meal , rice bran and whey powder in culturing systems of various size are reported. Wheat bran appears to be unsuitable as monodiet for brine shrimp. The other products tested support good growth although specific precautions have to be taken with some food...

  19. Studies on the antimicrobial activity and brine shrimp toxicity of Zeyheria tuberculosa (Vell. Bur. (Bignoniaceae extracts and their main constituents

    Directory of Open Access Journals (Sweden)

    Rocha Eliana MM

    2009-05-01

    Full Text Available Abstract Background Due to the indiscriminate use of antimicrobial drugs, the emergence of human pathogenic microorganisms resistant to major classes of antibiotics has been increased and has caused many clinical problems in the treatment of infectious diseases. Thus, the aim of this study was to evaluate for the first time the in vitro antimicrobial activity and brine shrimp lethality of extracts and isolated compounds from Zeyheria tuberculosa (Vell. Bur., a species used in Brazilian folk medicine for treatment of cancer and skin diseases. Methods Using the disc diffusion method, bioautography assay and brine shrimp toxicity test (Artemia salina Leach, we studied the antimicrobial activity and lethality of extracts and isolated compounds against three microorganisms strains, including Gram-positive (Staphylococcus aureus and Gram-negative (Pseudomonas aeruginosa bacteria and yeasts (Candida albicans. Results In this study, the extracts inhibited S. aureus (8.0 ± 0.0 to 14.0 ± 0.0 mm and C. albicans (15.3 ± 0.68 to 25.6 ± 0.4 mm growth. In the brine shrimp test, only two of them showed toxic effects (LC50 29.55 to 398.05 μg/mL and some extracts were non-toxic or showed weak lethality (LC50 705.02 to > 1000 μg/mL. From these extracts, four flavones [5,6,7,8-tetramethoxyflavone (1, 5,6,7-trimethoxyflavone (2, 4'-hydroxy-5,6,7,8-tetramethoxyflavone (3, and 4'-hydroxy-5,6,7-trimethoxyflavone (4] were isolated through bioassay-guided fractionation and identified based on the 1D and 2D NMR spectral data. By bioautography assays, compounds 1 [S. aureus (16.0 ± 0.0 mm and C. albicans (20.0 ± 0.0 mm] and 3 [S. aureus (10.3 ± 0.6 mm and C. albicans (19.7 ± 0.6 mm] inhibited both microorganisms while 2 inhibited only S. aureus (11.7 ± 0.6 mm. Compound 4 did not restrain the growth of any tested microorganism. Conclusion Our results showed that extracts and isolated flavones from Z. tuberculosa may be particularly useful against two pathogenic

  20. Artemia in aquatic toxicology: a review

    OpenAIRE

    Persoone, G.; Wells, P.G.

    1987-01-01

    Due to commercial availability of dried cysts from which live test material can be hatched at will, Artemia is used extensively in research and applied toxicology.Despite the extensive literature on dose-effect relationships of chemicals on brine shrimp, it was not until 1980 that an experimental protocol was developed for a simple acute toxicity test with Artemia nauplii, meeting the prerequisites for standardization.The reliability and accuracy of this short-term test were determined during...

  1. Hydrogen and oxygen in brine shrimp chitin reflect environmental water and dietary isotopic composition

    Science.gov (United States)

    Nielson, Kristine E.; Bowen, Gabriel J.

    2010-03-01

    Hydrogen and oxygen isotope ratios of the common structural biopolymer chitin are a potential recorder of ecological and environmental information, but our understanding of the mechanisms of incorporation of H and O from environmental substrates into chitin is limited. We report the results of a set of experiments in which the isotopic compositions of environmental water and diet were varied independently in order to assess the contribution of these variables to the H and O isotopic composition of Artemia franciscana chitin. Hydrogen isotope ratios of chitin were strongly linearly correlated with both food and water, with approximately 26% of the hydrogen signal reflecting food and approximately 38% reflecting water. Oxygen isotopes were also strongly correlated with the isotopic composition of water and food, but whereas 69% of oxygen in chitin exchanged with environmental water, only 10% was derived from food. We propose that these observations reflect the position-specific, partial exchange of H and O atoms with brine shrimp body water during the processes of digestion and chitin biosynthesis. Comparison of culture experiments with a set of natural samples collected from the Great Salt Lake, UT in 2006 shows that, with some exceptions, oxygen isotope compositions of chitin track those of water, whereas hydrogen isotopes vary inversely with those of lake water. The different behavior of the two isotopic systems can be explained in terms of a dietary shift from allochthonous particulate matter with relatively higher δ 2H values in the early spring to autochthonous particulate matter with significantly lower δ 2H values in the late summer to autumn. These results suggest oxygen in chitin may be a valuable proxy for the oxygen isotopic composition of environmental water, whereas hydrogen isotope values from the same molecule may reveal ecological and biogeochemical changes within lakes.

  2. Oxygen, pHi and arrest of biosynthesis in brine shrimp embryos.

    Science.gov (United States)

    Hand, S C

    1997-12-01

    Embryos of the brine shrimp Artemia franciscana are able to withstand bouts of environmental anoxia for several years by entering a quiescent state, during which time metabolism is greatly depressed. Within minutes of oxygen removal, intracellular pH (pHi) drops at least 1.0 unit. This acidification has been strongly implicated in the arrest of both catabolic and anabolic processes in the cytoplasm. A global arrest of cytoplasmic translation accompanies the transition into anoxia or into aerobic acidosis (artificial quiescence imposed by intracellular acidification with CO2 in the presence of oxygen). Similarly, protein synthesis in isolated mitochondria from these embryos is also reduced markedly in response to acidic pH (80% reduction) or anoxia (79% reduction). The constancy of mRNA levels during quiescence indicates that protein synthesis is likely to be controlled at the translational level. Mitochondrial matrix pH is 8.2 during protein synthesis assays performed at the extramitochondrial pH optimum of 7.5. When this proton gradient is abolished with the K+/H+ ionophore nigericin, the extramitochondrial pH optimum for protein synthesis displays an alkaline shift of approximately 0.7 pH unit. These data suggest the presence of proton-sensitive translational components within the mitochondrion. The oxygen dependency of mitochondrial protein synthesis is not explained simply by blockage of the electron transport chain or by the increased redox state. Whereas oxygen deprivation substantially depresses protein synthesis by 77% after 1 h, normoxic incubations with saturating concentrations of cyanide or antimycin A have only a modest effect (36% reduction, cyanide; 20%, antimycin A). This cyanide- and antimycin-insensitive, but hypoxia-sensitive, inhibitory signature for the arrest of protein synthesis suggests the presence of a molecular oxygen sensor within the mitochondrion. PMID:9429663

  3. Interference from ordinarily used solvents in the outcomes of Artemia salina lethality test

    OpenAIRE

    Geethaa, Sahgal; Thavamany, Priscilla Jayanthi; Chiew, Siah Poh; Thong, Ong Ming

    2013-01-01

    Methanol, ethanol, Tween 20 and dimethyl sulfoxide (DMSO) are widely used as dissolving agents in Artemia salina lethality test (aka brine shrimp lethality test [BSLT]) to screen the pharmaceutical properties of natural products. Nevertheless, there is lack of toxicity level of these solvents against brine shrimp. High concentration of these organic solvent might be toxic for this zoology invertebrate and interfere in the experimental outcomes. To avoid this, permissible concentration of the ...

  4. An investigation on the application of ohmic heating of cold water shrimp and brine mixtures

    DEFF Research Database (Denmark)

    Pedersen, Søren Juhl; Feyissa, Aberham Hailu; Brøkner Kavli, Sissel Therese;

    2016-01-01

    Cooking is an important unit-operation in the production of cooked and peeled shrimps. The present study explores the feasibility of using ohmic heating for cooking of shrimps. The focus is on investigating the effects of different process parameters on heating time and quality of ohmic cooked...... shrimps (Pandalus Borelias). The shrimps were heated to a core temperature of 72 °C in a brine solution using a small batch ohmic heater. Three experiments were performed: 1) a comparative analyses of the temperature development between different sizes of shrimps and thickness (head and tail region...... of the shrimp) over varying salt concentrations (10 kg m−3 to 20 kg m−3) and electric field strengths (1150 V m−1 to 1725 V m−1) with the heating time as the response; 2) a 2 level factorial experiment for screening the impact of processing conditions using electric field strengths of 1250 V m−1 and 1580 V m−1...

  5. Use of the genus Artemia in ecotoxicity testing

    International Nuclear Information System (INIS)

    Information related to varied uses of several species of the genus Artemia (commonly known as brine shrimp), is dispersed among literature from several scientific areas, such as Ecology, Physiology, Ecotoxicology, Aquaculture and Genetics. The present paper reviews information related to Artemia that may be considered relevant for ecotoxicity testing. Integration of different areas of scientific knowledge concerning biology, life cycle and environmental needs of Artemia is of crucial importance when considering the interpretation of results drawn from tests involving this genus. Furthermore, this paper provides suggestions to overcome problems related to toxicity assessment with the use of Artemia as test organism in bioassays, under the scope of estuarine, marine and hypersaline environments. Aspects related to variability in results, adoptable toxicity end-points, culture conditions, characteristics of species and strains, influence of geographical origins over physiological features and responses to exposure to chemical agents are considered. - The physiology, reproductive processes and general use of Artemia in modern ecotoxicological testing are reviewed

  6. Use of the genus Artemia in ecotoxicity testing

    Energy Technology Data Exchange (ETDEWEB)

    Nunes, Bruno S. [Instituto de Ciencias Biomedicas de Abel Salazar, Departamento de Estudos de Populacoes, Laboratorio de Ecotoxicologia, Universidade do Porto, Largo Prof. Abel Salazar 2, 4099-003 Porto (Portugal) and Centro Interdisciplinar de Investigacao Marinha e Ambiental, Rua dos Bragas 289, 4150-123 Porto (Portugal)]. E-mail: bruno@ufp.pt; Carvalho, Felix D. [REQUIMTE, Departamento de Toxicologia da Faculdade de Farmacia da Universidade do Porto, Rua Anibal Cunha, 164, 4050-047 Porto (Portugal); Guilhermino, Lucia M. [Instituto de Ciencias Biomedicas de Abel Salazar, Departamento de Estudos de Populacoes, Laboratorio de Ecotoxicologia, Universidade do Porto, Largo Prof. Abel Salazar 2, 4099-003 Porto (Portugal); Centro Interdisciplinar de Investigacao Marinha e Ambiental, Rua dos Bragas 289, 4150-123 Porto (Portugal); Van Stappen, Gilbert [Laboratory of Aquaculture and Artemia Reference Centre, Ghent University, Rozier 44, B-9000 Ghent (Belgium)

    2006-11-15

    Information related to varied uses of several species of the genus Artemia (commonly known as brine shrimp), is dispersed among literature from several scientific areas, such as Ecology, Physiology, Ecotoxicology, Aquaculture and Genetics. The present paper reviews information related to Artemia that may be considered relevant for ecotoxicity testing. Integration of different areas of scientific knowledge concerning biology, life cycle and environmental needs of Artemia is of crucial importance when considering the interpretation of results drawn from tests involving this genus. Furthermore, this paper provides suggestions to overcome problems related to toxicity assessment with the use of Artemia as test organism in bioassays, under the scope of estuarine, marine and hypersaline environments. Aspects related to variability in results, adoptable toxicity end-points, culture conditions, characteristics of species and strains, influence of geographical origins over physiological features and responses to exposure to chemical agents are considered. - The physiology, reproductive processes and general use of Artemia in modern ecotoxicological testing are reviewed.

  7. DISTINCTIVE LOCALIZATION OF GROUP 3 LATE EMBRYOGENESIS ABUNDANT SYNTHESIZING CELLS DURING BRINE SHRIMP DEVELOPMENT.

    Science.gov (United States)

    Kim, Bo Yong; Song, Hwa Young; Kim, Mi Young; Lee, Bong Hee; Kim, Kyung Joo; Jo, Kyung Jin; Kim, Suhng Wook; Lee, Seung Gwan; Lee, Boo Hyung

    2015-07-01

    Despite numerous studies on late embryogenesis abundant (LEA) proteins, their functions, roles, and localizations during developmental stages in arthropods remain unknown. LEA proteins protect crucial proteins against osmotic stress during the development and growth of various organisms. Thus, in this study, fluorescence in situ hybridization was used to determine the crucial regions protected against osmotic stress as well as the distinctive localization of group 3 (G3) LEA(+) cells during brine shrimp development. Several cell types were found to synthesize G3 LEA RNA, including neurons, muscular cells, APH-1(+) cells, and renal cells. The G3 LEA(+) neuronal cell bodies outside of the mushroom body projected their axonal bundles to the central body, but those inside the mushroom body projected their axonal bundles toward the deutocerebrum without innervating the central body. The cell bodies inside the mushroom body received axons of the G3 LEA(+) sensory cells at the medial ventral cup of the nauplius eye. Several glands were found to synthesize G3 LEA RNA during the nauplius stages of brine shrimp, including the sinus, antennal I and II, salt, and three ectodermal glands. This study provides the first demonstration of the formation of G3 LEA(+) sinus glands at the emergence stages of brine shrimp. These results suggest that G3 LEA protein is synthesized in several cell types. In particular, specific glands play crucial roles during the emergence and nauplius stages of brine shrimp. PMID:25781424

  8. Evaluation of mono- and mixed diets as food for intensive Artemia culture

    OpenAIRE

    Lavens, P.; De Meulemeester, A.; Sorgeloos, P.

    1987-01-01

    In order to alleviate the problems encountered when using live algae or rice bran as Artemia food in intensive culturing, different alternative types of brine shrimp diets have been evaluated. Using a high-density flow-through recirculation culture system, a Single Cell Protein yeast and mixed diets, consisting of this yeast and micronized waste products from agricultural corps, were selected as suitable Artemia feeds.Production yields after 2 weeks culturing varied from 2 to 5 kg live weight...

  9. Potential utilization of Artemia franciscana eggs as food for Coleomegilla maculata

    Science.gov (United States)

    We tested the hypothesis that Artemia franciscana Kellogg (brine shrimp, Anostraca: Artemiidae) eggs are suitable factitious, i.e., alternative, food to support the life history of a predatory ladybird beetle, Coleomegilla maculata DeGeer (Coleoptera: Coccinellidae). Using progeny from a stock colo...

  10. CYTOTOXIC (BRINE SHRIMP LETHALITY BIOASSAY AND ANTIOXIDANT INVESTIGATION OF BARRINGTONIA ACUTANGULA (L.”

    Directory of Open Access Journals (Sweden)

    Md. Asaduzzaman

    2015-08-01

    Full Text Available Barringtonia acutangula (L. gaertn. (Family: Barringtoniaceae, a medicinal small to medium evergreen tree known as ‘Hijal’, is used in diarrhoea, dysentery, colic, flatulence, cooling, aperients expectorant, stimulating emetic, astringents to the bowel, antihelminthic, bronchitis, lumber pain, hallucinations, seminal weakness, gonorrhoea and many other ailments in rural areas of Bangladesh It is also used as traditional medicine in other countries. But till to date, sporadic attempts have been made for the scientific and methodical validation of these traditional claims. In Brine Shrimp Lethality Bioassay, all the extracts produced dose dependent cytotoxicity effect to brine shrimp nauplii with methanol extract of leaf exhibiting highest toxicity having LC50 value 46.24 μg/ml where standard vincristine sulphate had the LC50 value of 0.69 μg/ml. & In antioxidant attempt by reducing power and CUPRAC assays, pet. ether extract of leaf were found to exhibit moderate but concentration dependent reducing power respectively.

  11. Acute Oral Toxicity and Brine Shrimp Lethality of Elaeis guineensis Jacq., (Oil Palm Leaf) Methanol Extract

    OpenAIRE

    Yeng Chen; Lai Ngit Shin; Yee Ling Lau; Sreenivasan Sasidharan; Yuet Ping Kwan; Lachimanan Yoga Latha; Soundararajan Vijayarathna; Abdul Rani Muhamad Syahmi

    2010-01-01

    Elaeis guineensis (Arecaceae) is widely used in West African traditional medicine for treating various ailments. An evaluation on the toxicity of extracts of this plant is crucial to support the therapeutic claims. The acute oral toxicity and brine shrimp lethality of a methanolic extract of this plant was tested. Oral administration of crude extract at the highest dose of 5,000 mg/kg resulted in no mortalities or evidence of adverse effects, implying that E. guineensis is nontoxic. Normal be...

  12. Brine shrimp lethality and antibacterial activity of extracts from the bark of Schleichera oleosa

    OpenAIRE

    Laxman Pokhrel; Bigyan Sharma; Bajracharya, Gan B.

    2015-01-01

    Objective: To determine the antibacterial efficacy and brine shrimp toxicity of extracts (hexane, dichloromethane, ethyl acetate, methanol and water) obtained from the bark of Schleichera oleosa. Methods: The powdered bark sample was Soxhlet extracted sequentially in hexanes, dichloromethane, ethyl acetate, methanol and water. Antibacterial evaluation was carried out by following the agar diffusion method and amoxicillin disc was used as a reference. Slightly modified Meyer’...

  13. Evaluation of larvicidal activity and brine shrimp toxicity of rhizome extracts of Zingiber zerumbet (L.) Smith

    OpenAIRE

    Augusto Bucker; Nadia Cristina Falcao-Bucker; Cecilia Veronica Nunez; Carlos Cleomir de Souza Pinheiro; Wanderli Pedro Tadei

    2013-01-01

    Introduction In this study, we used dichloromethane (DCM) and methanol (MeOH) extracts of the Zingiber zerumbet rhizome to evaluate brine shrimp lethality and larvicidal activity on Aedes aegypti and Anopheles nuneztovari mosquitoes. Methods Bioassays were performed by exposing third-instar larvae of each mosquito species to the DCM or MeOH extracts. Results Probit analysis with DCM and MeOH extracts demonstrated efficient larvicidal activity against A. aegypti and A. nuneztovari larvae. ...

  14. Uji Toksisitas Ekstrak Benalu Kopi (Loranthus ferrugineus Roxb.) dengan Metode Brine Shrimp Lethality Test (BSLT)

    OpenAIRE

    Bratisca, Sonya Citra

    2016-01-01

    Toxicity assaythe methanol extract of leaves parasite coffee (Loranthus ferrugineus Roxb.) Has been performed using Brine Shrimp Lethality Test (BSLT). Coffee parasite leaves that have been dried and crushed, extracted by using methanol for 2 days, and the methanol extract coffee parasite concentrated by rotary vacuum evaporator. The methanol extract coffee parasiteleavesderived phytochemical screening to identify secondary metabolite coumpounds. Extracts of leaves parasite coffee made in a c...

  15. Antimicrobial, antitumor and brine shrimp lethality assay of Ranunculus arvensis L. extracts.

    Science.gov (United States)

    Bhatti, Muhammad Zeeshan; Ali, Amjad; Saeed, Asma; Saeed, Ahmad; Malik, Salman Akbar

    2015-05-01

    To investigate the antitumor activity, brine shrimp lethality assay, antibacterial and antifungal activity of Methanol Extract (ME), Water Extract (WE), Acetone Extract (AE), Chloroform Extract (CE), Methanol-Water Extract (MWE), Methanol-Acetone Extract (MAE), Methanol-Chloroform Extract (MCE) of Ranunculus arvensis (L.). Antitumor activity was evaluated with Agrobacterium tumefaciens (At10) induced potato disc assay. Cytotoxicity was evaluated with brine shrimp lethality assay. Antibacterial activity was evaluated with six bacterial strains including Escherichia coli, Enterobacter aerogenes, Bordetella bronchiseptica, Klebsiella pneumoniae, Micrococcus luteus and Streptococcus anginosus and antifungal screening was done against five fungal strains including Aspergillus niger, A. flavus, A. fumigates, Fusarium solani and Mucor species by using disc diffusion method. Best antitumor activity was obtained with ME and WE, having highest IC50 values 20.27 ± 1.62 and 93.01 ± 1.33μg/disc. Brine shrimp lethality assay showed LC50 values of AE, MAE and ME were obtained as 384.66 ± 9.42μg/ml, 724.11 ± 8.01μg/ml and 978.7 ±8.01 μg/ml respectively. WE of R. arvensis revealed weak antimicrobial result against the tested microorganisms. On the other hand, the antifungal activity of the plant extracts was found to be insignificant. These findings demonstrate that extracts of R. arvensis possesses significant antitumor activity. Further extensive study is necessary to assess the therapeutic potential of the plant. PMID:26004705

  16. BRINE SHRIMP LETHALITY BIOASSAY OF GLAUCIUM GRANDIFLORUM VAR. GRANDIFLORUM

    OpenAIRE

    A. SARI, Ç. ÜNSAL, İ. SARIOĞLU, A. SARI, Ç. ÜNSAL, İ. SARIOĞLU

    2013-01-01

    Türkiye'nin 3 farklı bölgesinden toplanan Glaucium grandiflorum Boiss. et Huet var. grandiflorum örneklerinin toprak üstü kısımlarından elde edilen alkaloit ekstreleri ve bu ekstrelerden elde edilen majör alkaloitler allokriptopin, protopİn, (+)-izokoridin, (+)-korİdin üzerinde brİne shrimp lethality testi yapılarak sitotoksisiteleri İncelenmiştir. Glaucium grandiflorum var. grandiflorum türünün 3 örneği de önemli oranda sitotoksik aktİvite göstermiştir. Allokriptopin, protopin, (+)-izokoridi...

  17. Antimicrobial activity and brine shrimp toxicity of extracts of Terminalia brownii roots and stem

    Directory of Open Access Journals (Sweden)

    Kapingu Modest C

    2007-03-01

    Full Text Available Abstract Background Ternimalia brownii Fresen (Combretaceae is widely used in traditional medicine to treat bacterial, fungal and viral infections. There is a need to evaluate extracts of this plant in order to provide scientific proof for it's wide application in traditional medicine system. Methods Extraction of stem bark, wood and whole roots of T. brownii using solvents of increasing polarity, namely, Pet ether, dichloromethane, dichloromethane: methanol (1:1, methanol and aqua, respectively, afforded dry extracts. The extracts were tested for antifungal and antibacterial activity and for brine shrimp toxicity test. Results Extracts of the stem bark, wood and whole roots of T. brownii exhibited antibacterial activity against standard strains of Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Klebsiella pneumoniae, Salmonella typhi, and Bacillus anthracis and the fungi, Candida albicans and Cryptococcus neoformans. Aqueous extracts exhibited the strongest activity against both bacteria and fungi. Extracts of the roots and stem bark exhibited relatively mild cytotoxic activity against brine shrimp larvae with LC50 values ranging from 113.75–4356.76 and 36.12–1458.81 μg/ml, respectively. The stem wood extracts exhibited the highest toxicity against the shrimps (LC50 values 2.58–14.88 μg/ml, while that of cyclophosphamide, a standard anticancer drug, was 16.33 (10.60–25.15 μg/ml. Conclusion These test results support traditional medicinal use of, especially, aqueous extracts for the treatment of conditions such as diarrhea, and gonorrhea. The brine shrimp results depict the general trend among plants of the genus Terminalia, which are known to contain cytotoxic compounds such as hydrolysable tannins. These results warrant follow-up through bioassay-directed isolation of the active principles.

  18. Effect of brine marination on survival and growth of spoilage and pathogenic bacteria during processing and subsequent storage of ready-to-eat shrimp (Pandalus borealis)

    DEFF Research Database (Denmark)

    Mejlholm, Ole; Devitt, Tina D.; Dalgaard, Paw

    2012-01-01

    The effect of brine marination at chill temperatures on survival and growth of spoilage and pathogenic bacteria during processing and subsequent storage of ready-to-eat cold water shrimp was studied. Survival and growth of Lactobacillus sakei, Listeria monocytogenes, Salmonella, Staphylococcus...... aureus and Vibrio parahaemolyticus were examined. The effect of brine composition and pH was determined in 12 screening experiments without addition of shrimp. Sixteen challenge tests with shrimp were then carried out to examine the effect of brine composition and storage temperature on survival and...... growth during processing and subsequent storage of brined and drained shrimp in modified atmosphere packaging (MAP). Different brines with (i) acetic and lactic acids (AL) or (ii) benzoic, citric and sorbic acids (BCS) were studied. V. parahaemolyticus was inactivated in brine AL without shrimp whereas...

  19. The ARC-test: a standardized short-term routine toxicity test with Artemia nauplii: methodology and evaluation

    OpenAIRE

    Vanhaecke, P.; Persoone, G.

    1984-01-01

    Considering the need for reliable standardized routine toxicity tests for the marine environment, a short-term bioassay with Artemia nauplii has been developed for routine testing. The major reason for the selection of brine shrimp as test species is the continuous availability of Artemia under the form of dry cysts from which the larvae are hatched very easily. This unique advantage solves one of the major problems of aquatic ecotoxicological tests, namely stock recruitment and/or culturing;...

  20. Species-specific RFLP pattern in the Heat Shock Protein26 gene (Hsp26): a single-locus tool for species identification and experimental testing of habitat-induced isolation in the New World Artemia species.

    Science.gov (United States)

    Beristain, P; Gajardo, G; Bossier, P

    2010-01-01

    The brine shrimp Artemia (Crustacea, Branchiopoda), a paradigmatic inhabitant of hypersaline lakes, has molecular features to survive under stressful conditions, such as the p26 heat shock protein. We report the RFLP fingerprinting pattern (four restriction enzymes) of a 217 bp fragment of exon2 of the Hsp26 gene in six Artemia franciscana and four Artemia persimilis populations, the most genetically divergent Artemia species co-occurring in latitudinal extremes of Chile. The species-specific RFLP pattern observed is a simple and cost-effective single-locus tool for species delimitation and experimental testing the habitat-induced isolation barrier between them. PMID:21565017

  1. Brine Shrimp Toxicity Evaluation of Some Tanzanian Plants Used Traditionally for the Treatment of Fungal Infections.

    OpenAIRE

    Moshi, Mainen J.; van den Beukel, Carolien J P; Hamza, Omar J M; Mbwambo, Zakaria H; Nondo, Ramadhani O S; Masimba, Pax J; Matee, Mecky I N; Kapingu, Modest C; Mikx, Frans; Verweij, Paul E.; van der Ven, André J. A. M.

    2006-01-01

    Plants which are used by traditional healers in Tanzania have been evaluated to obtain preliminary data of their toxicity using the brine shrimps test. The results indicate that 9 out of 44 plant species whose extracts were tested exhibited high toxicity with LC(50) values below 20 microg/ml. These include Aloe lateritia Engl. (Aloaceae) [19.1 microg/ml], Cassia abbreviata Oliv. (Caesalpiniaceae) [12.7 microg/ml], Croton scheffleri Pax (Euphorbiaceae) [13.7 microg/ml], Hymenodactyon parvifoli...

  2. Long-term monitoring of arsenic, copper, selenium, and other elements in Great Salt Lake (Utah, USA) surface water, brine shrimp, and brine flies.

    Science.gov (United States)

    Adams, William J; DeForest, David K; Tear, Lucinda M; Payne, Kelly; Brix, Kevin V

    2015-03-01

    This paper presents long-term monitoring data for 19 elements with a focus on arsenic (As), copper (Cu), and selenium (Se), in surface water (2002-2011), brine shrimp (2001-2011), and brine flies (1995-1996) collected from Great Salt Lake (GSL, Utah, USA). In open surface waters, mean (±standard deviation [SD]; range; n) As concentrations were 112 (±22.1; 54.0-169; 47) and 112 μg/L (±35.6; 5.1-175; 68) in filtered and unfiltered surface water samples, respectively, and 16.3 μg/g (±5.6; 5.1-35.2; 62) dry weight (dw) in brine shrimp. Mean (±SD; range; n) Cu concentrations were 4.2 (±2.1; 1.3-12.5; 47) and 6.9 μg/L (±6.6; 1.9-38.1; 68) in filtered and unfiltered surface water samples, respectively, and 20.6 μg/g (±18.4; 5.4-126; 62) dw in brine shrimp. Finally, mean (±SD; range; n) dissolved and total recoverable Se concentrations were 0.6 (±0.1; 0.4-1.2; 61) and 0.9 μg/L (±0.7; 0.5-3.6; 89), respectively, and 3.6 μg/g (±2.2; 1.1-14.9; 98) dw in brine shrimp. Thus, Se in open lake surface waters was most often in the range of 0.5-1 μg/L, and concentrations in both surface water and brine shrimp were comparable to concentrations measured in other monitoring programs for the GSL. Temporally, the statistical significance of differences in mean dissolved or total recoverable As, Cu, and Se concentrations between years was highly variable depending which test statistic was used, and there was no clear evidence of increasing or decreasing trends. In brine shrimp, significant differences in annual mean concentrations of As, Cu, and Se were observed using both parametric and nonparametric statistical approaches, but, as for water, there did not appear to be a consistent increase or decrease in concentrations of these elements over time. PMID:25690606

  3. Nano-sized polystyrene affects feeding, behavior and physiology of brine shrimp Artemia franciscana larvae

    NARCIS (Netherlands)

    Bergami, Elisa; Bocci, Elena; Vannuccini, Maria Luisa; Monopoli, Marco; Salvati, Anna; Dawson, Kenneth A; Corsi, Ilaria

    2016-01-01

    Nano-sized polymers as polystyrene (PS) constitute one of the main challenges for marine ecosystems, since they can distribute along the whole water column affecting planktonic species and consequently disrupting the energy flow of marine ecosystems. Nowadays very little knowledge is available on th

  4. 卤虫的营养%Nutrition in Brine Shrimp Artemia

    Institute of Scientific and Technical Information of China (English)

    黄旭雄

    2007-01-01

    卤虫(Aremia)是水产经济动物苗种生产中重要的活饵料之一,卤虫营养价值的高低直接影响到苗种生产的成败与效益。笔者拟就卤虫的营养价值研究作—综述,供学者参考。

  5. Acute Oral Toxicity and Brine Shrimp Lethality of Elaeis guineensis Jacq., (Oil Palm Leaf Methanol Extract

    Directory of Open Access Journals (Sweden)

    Yeng Chen

    2010-11-01

    Full Text Available Elaeis guineensis (Arecaceae is widely used in West African traditional medicine for treating various ailments. An evaluation on the toxicity of extracts of this plant is crucial to support the therapeutic claims. The acute oral toxicity and brine shrimp lethality of a methanolic extract of this plant was tested. Oral administration of crude extract at the highest dose of 5,000 mg/kg resulted in no mortalities or evidence of adverse effects, implying that E. guineensis is nontoxic. Normal behavioral pattern, clinical signs and histology of vital organs confirm this evidence. The E. guineensis extracts screened for toxicity against brine shrimp had 50% lethal concentration (LC50 values of more than 1.0 mg/mL (9.00 and 3.87 mg/mL, at 6 and 24 h, respectively, confirming that the extract was not toxic. Maximum mortalities occurred at 100 mg/mL concentration while the least mortalities happened to be at 0.195 mg/mL concentration. The results of both tests confirm that E. guineensis is nontoxic and hence safe for commercial utilization.

  6. Estimation of cytotoxic potency by brine shrimp lethality bioassay application of Clerodendrum infortunatum Linn.

    Institute of Scientific and Technical Information of China (English)

    Talukdar Muhammad Waliullah; Akter MstYeasmin; Ashraful MdAlam; Wahedul Md Islam; Parvez Hassan

    2015-01-01

    Objective: To learn a scientific and systematic knowledge of anticancer, antimicrobial and pharmacological activities of natural products and estimate cytotoxic potency by using ethanol and chloroform extracts of root, leaf and stem of Clerodendrum infortunatum (Verbenaceae) due to its random use in customary and traditional medicine to cure common ailments such as intestinal disorder, diarrhea, tuberculosis and respiratory problems etc. Methods: The in vitro application was carried out with the bench-top bioassay method by using brine shrimp lethality bioassay. Results: All of the crude extracts were found to be lethal and effective. The LC50 value of ethyl alcohol fraction of root was 20.845 mg/L compared to the standard drug tetracycline of 14.675 mg/L to brine shrimp nauplii, indicating that the extracts were biologically active. Conclusions: The cytotoxic study of LC50 value showed that a good correlation with the antibiotic tetracycline. From the comparative correlation error bars and percentage, we understood that ethyl alcohol fraction of root extract was very effective. This study serves as a basis for further research to lead compounds to be isolated so that it may be as a template for the implications of these results for bioactivity and drug discovery potential of herbal products.

  7. Isolasi Dan Uji Bioaktivitas Kandungan Kimia Utama Puding Merah (Graptophyllum pictum L. Griff) Dengan Metode Uji Brine Shrimp

    OpenAIRE

    Sovia Lenny; Cut Fatimah Zuhra

    2009-01-01

    Telah diisolasi suatu senyawa flavonoid dari ekstrak etanol daun puding merah (Graptophyllum pictum L. Griff) dengan cara maserasi dan pemisahan dengan menggunakan kromatografi kolom. Struktur senyawa hasil isolasi dielusidasi berdasarkan data spektroskopi IR dan H-NMR. Senyawa hasil isolasi merupakan senyawa bioaktif dengan LC sebesar 124,08/ml pada uji brine shrimp lethality assay.

  8. Larval brine shrimp (Nauplii): a potentially useful model to study cystic fibrosis.

    Science.gov (United States)

    Bargman, G J

    1976-01-01

    One of the most consistent characteristics of cystic fibrosis is the abnormal handling of electrolytes by exocrine glands. The present study has examined the possibility that diminished respiratory energy formation is a primary biochemical error responsible for this abnormality. Using oxygen consumption of intact larval brine shrimp, quantitative differences have been observed from reaction of mixed mouth saliva between CF heterozygotes and CF homozygotes. In addition, information demonstrating a correlation between a biochemical abnormality and disease severity was observed. The differences observed in inhibition by saliva from both CF homozygotes and obligate heterozygotes may occur as the result of 1) interference with electron transfer from organic fuel molecules to molecular oxygen or 2) interference with the mechanism responsible for generating the biochemical reducing power necessary for multiple biosynthetic reactions. PMID:996791

  9. Chemical Compound Gynecology, ToxinTest (Brine Shrimp Lethality Test) and Antioxidants (1,1-Diphenyl-2-Pikrilhydrazyl) from Saga Leaf Extract (Abrus Precatorius L.)

    OpenAIRE

    Yuhernita; Delvi Osmeli; Juniarti

    2009-01-01

    Cytotoxicity effects and antioxidant activities of saga(Abrus precatorius L.) extract were studied by using Brine Shrimp Lethality Test and 1,1-diphenyl-2-pikrilhydrazylassays. Saga was extracted with different solvents i.e n-hexane, ethyl acetate and methanol. Result showed that themethanolic extract of saga had been potential to be cytotoxic againts Brine Shrimp with LC50 value of 606.736 ppm.However, all the extract of saga did not have antioxidant activities.

  10. Genetic characterization of Artemia tibetiana (Crustacea: Anostraca)

    OpenAIRE

    Abatzopoulos, T.J.; Kappas, I.; Bossier, P.; Sorgeloos, P.; Beardmore, J. A.

    2002-01-01

    The brine shrimp Artemia consists of a number of bisexual species and a large number of parthenogenetic forms, which collectively, inhabit a wide range of hypersaline habitats. A recently described species (A. tibetiana) from a carbonate lake (Lagkor Co) in Tibet at an altitude of 4490 m has been tested with New World (A. franciscana USA, and A. franciscana feral population Vietnam) and Old World species (A. salina, A. urmiana, A. sinica) for cross fertility. These tests show complete inferti...

  11. Morphological changes about Artemia Salina by the effect of gamma radiation

    International Nuclear Information System (INIS)

    Direction Council of Europe require restriction of laboratory vertebrae in biological experiments. Once by possibilities is using biological test II. generation among which belongs to and test for Artemia salina. Still this time published test however value only lethality in dependence on dose, exposition and time survival. This work document possibility watch of expressive morphological changes, which consist in retardation development brine shrimps stage in dependence on dose gamma radiation 60Co. (authors)

  12. A small heat shock/α-crystallin protein from encysted Artemia embryos suppresses tubulin denaturation

    OpenAIRE

    Day, Rossalyn M.; Gupta, Jagdish S.; MacRae, Thomas H.

    2003-01-01

    Small heat shock/α-crystallin proteins function as molecular chaperones, protecting other proteins from irreversible denaturation by an energy-independent process. The brine shrimp, Artemia franciscana, produces a small heat shock/α-crystallin protein termed p26, found in embryos undergoing encystment, diapause, and metabolic arrest. These embryos withstand long-term anoxia and other stresses normally expected to cause death, a property likely dependent on molecular chaperone activity. The as...

  13. Phytochemical and toxicity evaluation of Phaleria macrocarpa (Scheff. Boerl by MCF-7 cell line and brine shrimp lethality bioassay

    Directory of Open Access Journals (Sweden)

    Abul Kalam Azad

    2016-01-01

    Full Text Available Objective: To evaluate the cytotoxicity of Phaleria macrocarpa fruits extracts. Methods: The cytotoxicity test was carried out by in vitro MCF-7 cell line and in vivo brine shrimp lethality bioassay. Results: The preliminary phytochemical test showed the presence of alkaloids, carbohydrate, glycosides, saponin, terpene, steroids, phenols and flavonoids. The MTT-assay results showed that the highest percentage of cell viability was 106.23% at concentration of 1.25 µL and the lowest percentage was 13.04% at concentration of 10 µL. Conclusions: The MTT-assay and brine shrimp lethality bioassay results showed that the extract was non-toxic and it would be consumable as a herbal remedy.

  14. Phytochemical and toxicity evaluation ofPhaleria macrocarpa (Scheff.) Boerl by MCF-7 cell line and brine shrimp lethality bioassay

    Institute of Scientific and Technical Information of China (English)

    Abul Kalam Azad; Wan Mohd Azizi Wan Sulaiman; Nushrat Khan Sunzida

    2016-01-01

    Objective:To evaluate the cytotoxicity ofPhaleria macrocarpa fruits extracts. Methods: The cytotoxicity test was carried out byin vitroMCF-7 cell line andin vivo brine shrimp lethality bioassay. Results: The preliminary phytochemical test showed the presence of alkaloids, carbohydrate, glycosides, saponin, terpene, steroids, phenols and flavonoids. TheMTT-assay results showed that the highest percentage of cell viability was 106.23% at concentration of 1.25µL and the lowest percentage was 13.04% at concentration of 10µL. Conclusions:TheMTT-assay and brine shrimp lethality bioassay results showed that the extract was non-toxic and it would be consumable as a herbal remedy.

  15. Expression and Quorum Sensing Regulation of Type III Secretion System Genes of Vibrio harveyi during Infection of Gnotobiotic Brine Shrimp

    OpenAIRE

    Ruwandeepika, HA Darshanee; Karunasagar, Indrani; Bossier, Peter; Defoirdt, Tom

    2015-01-01

    Type III secretion systems enable pathogens to inject their virulence factors directly into the cytoplasm of the host cells. The type III secretion system of Vibrio harveyi, a major pathogen of aquatic organisms and a model species in quorum sensing studies, is repressed by the quorum sensing master regulator LuxR. In this study, we found that during infection of gnotobiotic brine shrimp larvae, the expression levels of three type III secretion operons in V. harveyi increased within the first...

  16. EVALUATION OF THROMBOLYTIC ACTIVITY AND BRINE SHRIMP LETHALITY BIOASSAY OF METHANOL EXTRACT OF STEMS OF TINOSPORA CRISPA

    OpenAIRE

    Md. Ariful Islam , Z. A. Mahmud*, S.M. Abdur Rahman , Md. Monirujjaman and Sajal K. Saha

    2013-01-01

    ABSTRACT: Tinospora crispa, a plant belonging to the family of Menispermaceae is a well-known traditional medicinal plant used in Bangladesh. The methanolic extracts of stems of the plant were evaluated for their thrombolytic and preliminary cytotoxic activities. The thrombolytic activity was evaluated using the in vitro clot lysis model while while the screening of cytotoxic activity was done using brine shrimp lethality bioassay. Different concentrations of stem extract were made in isotoni...

  17. Studies on antimicrobial activity and brine shrimp lethality of crude samples of six different species of puffer fishes

    Directory of Open Access Journals (Sweden)

    Masilamani Mohan Raj

    2015-07-01

    Full Text Available Objective: To evaluate the antimicrobial activity and brine shrimp lethality activity of six different species of puffer fishes, including Cyclichthys orbicularis, Diodon holocanthus, Canthigaster solandri, Arthron hispidus, A. inermis and Lagocephalua inermis (L. inermis. Methodology: The puffer fishes were collected from Annangkovil Fish Landing Centre (Lattitude 11°30.47' N; Longitude 79°47.02' E, Parangipettai, Southeast Coast of India during summer season because of availability. Fresh tissue samples were collected from the clearly washed specimens, extracted with methanol at 37 °C for 3 days and filtered through Whatman No. 1 filter paper. The solvents such as methanol and ethanol were concentrated by using rotary evaporator under reduced pressure. The dark brown gummy mass was stored at 4 °C for further analysis. Prepared crude samples were analysed with human pathogens to assess the antibacterial activity and this was carried out by using standard disc diffusion method. The brine shrimp lethality was calculated as the percentage of mortality which was firstly calculated by dividing the number of dead larvae by the total number and then multiplied to 100%. Results: The antibacterial activity of crude extract of puffer fishes were exhibited against 10 different human bacterial pathogens. Among the ten human pathogens, Arthron hispidus showed maximum zone of inhibition (8 mm against Staphylococcus aureus while L. inermis showed minimum activity (1 mm against Proteus mirabilis and no zone of inhibition was observed against Staphylococcus aureus. Brine shrimp lethality was examined with six puffer fish extracts. Cyclichthys orbicularis showed maximum mortalities as 100% and L. inermis showed minimum mortalities as 70% at a concentration of 500 µg/mL. Conclusion: In conclusion, the study showed the preliminary investigation of crude extracts of puffer fishes about the prominent activity against human bacterial pathogens. The extracts had

  18. Studies on antimicrobial activity and brine shrimp lethality of crude samples of six different species of puffer ifshes

    Institute of Scientific and Technical Information of China (English)

    Masilamani Mohan Raj; Subramanian Bragadeeswaran; Anbukkarasu Suguna; Muthuramalingam Uthaya Siva

    2015-01-01

    Objective:To evaluate the antimicrobial activity and brine shrimp lethality activity of six different species of puffer fishes, includingCyclichthys orbicularis, Diodon holocanthus, Canthigaster solandri, Arthron hispidus, A. inermis andLagocephalua inermis(L. inermis). Methodology:The puffer fishes were collected from Annangkovil Fish Landing Centre (Lattitude 11°30.47' N; Longitude 79°47.02' E), Parangipettai, Southeast Coast of India during summer season because of availability. Fresh tissue samples were collected from the clearly washed specimens, extracted with methanol at 37°C for 3 days and filtered through Whatman No. 1 filter paper. The solvents such as methanol and ethanol were concentrated by using rotary evaporator under reduced pressure. The dark brown gummy mass was stored at 4°C for further analysis. Prepared crude samples were analysed with human pathogens to assess the antibacterial activity and this was carried out by using standard disc diffusion method. The brine shrimp lethality was calculated as the percentage of mortality which was firstly calculated by dividing the number of dead larvae by the total number and then multiplied to 100%. Results:The antibacterial activity of crude extract of puffer fishes were exhibited against 10 different human bacterial pathogens. Among the ten human pathogens,Arthron hispidus showed maximum zone of inhibition (8 mm) againstStaphylococcus aureus whileL. inermis showed minimum activity (1 mm) againstProteus mirabilis and no zone of inhibition was observed againstStaphylococcus aureus. Brine shrimp lethality was examined with six puffer fish extracts.Cyclichthys orbicularis showed maximum mortalities as 100% andL. inermis showed minimum mortalities as 70% at a concentration of 500 µg/mL. Conclusion:In conclusion, the study showed the preliminary investigation of crude extracts of puffer fishes about the prominent activity against human bacterial pathogens. The extracts had a good cytotoxic potential

  19. The genus Artemia Leach, 1819 (Crustacea: Branchiopoda: I. True and false taxonomical descriptions El género Artemia Leach, 1819 (Crustacea: Branchiopoda: I. Descripciones taxonómicas verdaderas y falsas

    Directory of Open Access Journals (Sweden)

    Alireza Asem

    2010-01-01

    Full Text Available The brine shrimp Artemia is important for aquaculture since it is bighly nutritious. It is also used widely in biological studies because it is easy to culture. The aim of the present study is to review the literature on the taxonomical nomenclature of Artemia. The present study indicates the existence of seven species: three living in the Americas, one in Europe, and three in Asia.El camarón de salmuera Artemia es importante para la acuicultura por su alta calidad nutricional y es muy utilizado para estudios biológicos por ser de fácil cultivo. El objetivo del presente estudio es revisar la literatura sobre la nomenclatura taxonómica de Artemia. Se determina la existencia de siete especies; tres de ellas viven en América, una en Europa y tres en Asia.

  20. Variant subunit specificity in the quaternary structure of Artemia hemoglobin.

    Science.gov (United States)

    Vandenberg, Cassandra J; Matthews, Charles M; Trotman, Clive N A

    2002-08-01

    The brine shrimp Artemia has three extracellular hemoglobins (Hbs) that are developmentally expressed and exhibit distinct oxygen-binding characteristics (Heip, Moens, and Kondo 1978; Heip et al. 1978 ). These Hbs are composed of two polymers, each of which comprises nine covalently linked globin domains. Although the cDNA sequences of two nine-domain globins from Artemia have been published, there is evidence for the existence of further expressed globin genes (Manning, Trotman, and Tate 1990 ). In the present study extensive analysis at the cDNA and genomic levels was performed in order to determine the globin gene copy number in Artemia. Sequence and Southern analysis suggest that four Hb polymers (T1, T2, C1, and C2) are expressed in Artemia. In addition, there is also at least one globin pseudogene. Protein sequencing of the native Hbs revealed that there are limitations on which two polymers can associate. The composition of the Hbs has been determined to be: Hb I, C1C2; Hb II, C1T2; and Hb III, T1T2. These pairings allow the levels of the three Artemia Hbs to be regulated independently by polymer expression alone, therefore explaining the previously inconsistent developmental and hypoxia-induced expression patterns. PMID:12140240

  1. Identification of lactic acid bacteria from spoilage associations of cooked and brined shrimps stored under modified atmosphere between 0 degrees C and 25 degrees C

    DEFF Research Database (Denmark)

    Dalgaard, Paw; Vancanneyt, M.; Vilalta, N.E.;

    2003-01-01

    Aims: To evaluate spoilage and identify lactic acid bacteria (LAB) from spoilage associations of cooked and brined shrimps stored under modified atmosphere packaging (MAP) at 0, 5, 8, 15 and 25degreesC. Methods and Results: Bacterial isolates (102) from spoilage associations of cooked and brined...... dominant parts of spoilage associations of cooked and brined MAP shrimps stored at high and low temperatures, respectively. Significance and Impact of the Study: The SDS-PAGE technique and simple biochemical keys allowed the majority of LAB isolates from spoilage associations of cooked and brined MAP...... MAP shrimps were characterized by phenotypic tests and identified as lactic acid bacteria (78 isolates), other Gram-positive bacteria (13 isolates) and Gram-negative bacteria (11 isolates). A selection of 48 LAB isolates were further characterized and identified by phenotypic tests and SDS...

  2. Acute toxicity, brine shrimp cytotoxicity and relaxant activity of fruits of callistemon citrinus curtis

    Directory of Open Access Journals (Sweden)

    Shah Ismail

    2011-10-01

    Full Text Available Abstract Background Callistemon citrinus Curtis belongs to family Myrtaceae that has a great medicinal importance. In our previous work, fruits of Callistemon citrinus were reported to have relaxant (antispasmodic activity. The current work describes the screening of fractions of the crude methanol extract for tracing spasmolytic constituents so that it shall help us for isolation of bioactive compounds. Acute toxicity and brine shrimp cytotoxicity of crude methanol extract are also performed to standardize it. Methods The crude methanol extract was obtained by maceration with distilled water (500 ml three times and fractionated successively with n-hexane, chloroform, ethyl acetate and n-butanol (300 ml of each solvent. Phytochemical analysis for crude methanol extract was performed. Acute toxicity studies were performed in mice. Brine shrimp cytotoxicity studies were performed to determine its cytotoxicity and standardize it. In other series of experiments, rabbits' jejunum preparations were used in screening for possible relaxant activities of various fractions. They were applied in concentrations of 0.01, 0.03, 0.1, 0.3, 1.0, 3.0, 5.0 and 10.0 mg/ml on spontaneous rabbits' jejunum preparations. In similar fashion, fractions were also tested on KCl (80 mM -induced contractions. Calcium chloride curves were constructed in K-rich Tyrode's solution. The effects of various fractions were tested on calcium chloride curves at concentrations 1.0, 3.0, 5.0 and 10.0 mg/ml. Curves of verapamil used as reference drug at concentration 0.1 μM and 0.3 μM were also constructed. The curves were compared with their respective controls for possible right shift. Results Methanol extract tested strongly positive for saponins and tannins. However, it tested mild positive for presence of proteins, amino acids, carbohydrates and phenolic compounds. LD50 value for crude methanol extract is 476.25 ± 10.3 (470-481, n = 4 mg/ml. Similarly, EC50 value for brine shrimp

  3. ANTIMICROBIAL SCREENING AND BRINE SHRIMP LETHALITY BIOASSAY OF TINOSPORA CORDIFOLIA (FAM: MENISPERMACEAE

    Directory of Open Access Journals (Sweden)

    Mohammad Kaisarul Islam

    2011-12-01

    Full Text Available Tinospora cordifolia (Fam: Menispermaceae has been investigated for evaluation of the biological activities. The stem of Tinospora cordifolia were extracted with carbon tetrachloride, n-hexane and methanol were collected and afford 4.0 mg, 4.0 mg, and 4.0 mg, respectively for the test. The crude carbon tetrachloride, n-hexane, and methanol extract of the plant were subjected to antimicrobial screening against 15 microorganisms such as gram-positive, gram-negative, fungi by the disc diffusion method. But interestingly no fraction showed any inhibitory effect against all the microorganisms. In the brine shrimp lethality bioassay, carbon tetrachloride fraction showed high toxicity, where LC90 value was only 6.25 mg/ml. The methanol crude extract and n-hexane fraction showed LC50 of 1.563 and 6.05 mg/ml respectively with very narrow therapeutic index (LC90 of 43.0 mg/ml and 45.0 mg/ml respectively. This indicated that the cytotoxicity exhibited by the carbon tetra chloride, n-hexane, and methanol extract was very significant.

  4. IN VITRO ANTIOXIDANT, TOTAL PHENOLIC CONTENT AND BRINE SHRIMP LETHALITY STUDIES OF SYNEDRELLA NODIFLORA

    Directory of Open Access Journals (Sweden)

    Md. Hassan Kawsar et al.

    2012-05-01

    Full Text Available The antioxidant activity of methanol extract of whole plant of Synedrella nodiflora as well as its petroleum ether, carbon tetrachloride, dichloro-methane and aqueous soluble partitionates were evaluated by DPPH of (1, 1-diphenyl-2-picrylhydrazyl and phosphomolybdenum total antioxidant assay and compared with standard antioxidants butylated hydroxytoluene (BHT and ascorbic acid (ASA. The total phenolic content was also determined and expressed in gallic acid equivalent (mg of GAE/g of sample. A great variance was observed for polyphenol content as well as antioxidant activity (1.574-9.4136 mg GAE/g and DPPH IC50 10.52-31.25 μg/ml depending on the nature of solvent used to fractionate the crude extract. The result demonstrated that dichloromethane soluble fraction revealed the highest amount of phenolic compounds (9.4136 mg GAE/g and also had significant free radical scavenging activity (IC50 10.52 μg/ml. A positive correlation was observed between total phenolic content and total antioxidant activity of S. nodiflora having correlation coefficient (R2 of 0.9270. The general toxicity of the extractive was studied by brine shrimp lethality bioassay and from the results (LC50 0.023-0.122 μg/ml, it can be well predicted that the crude extract and the partitionate fractions contain cytotoxic principles and have considerable toxic potencies which supported the insecticidal uses of plant by the indigenous people.

  5. Non-lethal heat shock protects gnotobiotic Artemia franciscana larvae against virulent Vibrios

    OpenAIRE

    Yik Sung, Y.; Van Damme, E.J.M.; Sorgeloos, P.; Bossier, P

    2007-01-01

    Brine shrimp Artemia were exposed under gnotobiotic conditions to a non-lethal heat shock (NLHS) from 28 to 32, 37 and 40°C. Different recovery periods (2, 6, 12 and 24 h) and different heat-exposure times (15, 30, 45 and 60 min) were tested. After these NLHS, Artemia was subsequently challenged with Vibrio. Challenge tests were performed in stressed and unstressed nauplii at concentrations of 107 cells ml-1 of pathogenic bacteria, Vibrio campbellii and Vibrio proteolyticus. A NLHS with an op...

  6. Radiation Damage to Artemia Cysts:Effects of Water Vapor.

    Science.gov (United States)

    Snipes, W C; Gordy, W

    1963-10-25

    Water vapor altered the form and greatly increased the rate of decay of the electron-spin resonance pattern of long-lived free radicals obtained upon gamma irradiation of Artemia salina cysts ( brine shrimp eggs). These results, combined with data on radiation survival, indicate that the water vapor protects the cysts from radiation damage, or heals the damage. They also indicate that water protects the cysts from the effect of oxygen by neutralizing the radiation-induced free radicals before they can interact with oxygen to produce irreversible damage. PMID:17748168

  7. Design, operation, and potential of a culture system for the continuous production of Artemia nauplii

    OpenAIRE

    Lavens, P.; Sorgeloos, P

    1987-01-01

    A flow-through system is described for the controlled production of Artemia nauplii. High densities of adult brine shrimp are induced to ovoviviparity through diet manipulation, optimal culture water exchange, and high constant oxygen levels. The nauplii produced are separated from the culture tank effluents in a special recuperation filter system. The culture water is recirculated over a rotating biodisc, a cross-flow sieve, and a plate separator.The potential of this nauplii production syst...

  8. 鱼藤卤虫致死活性成分的分离和结构鉴定%Isolation and Identification of Brine Shrimp Lethal Activities from Derris trifoliata

    Institute of Scientific and Technical Information of China (English)

    蒋诚; 熊本强; 邱细敏; 刘胜姿; 张偲; 尹浩

    2012-01-01

    目的:研究鱼藤Derris trifoliata Lour.根和茎乙酸乙酯提取物的卤虫致死活性成分.方法:以卤虫2龄幼虫为试虫,采用活性跟踪指导,使用硅胶柱色谱、Sephadex LH-20和半制备液相色谱分离纯化,根据理化性质和光谱学数据进行结构鉴定.结果:分离鉴定了11个化合物,其中12a-羟基鱼藤酮、灰叶素、鱼藤酮和鱼藤素的卤虫致死活性LD50分别为0.365、0.236、0.060和0.734 μg/mL.结论:活性测试表明,12a-羟基鱼藤酮、灰叶素、鱼藤酮和鱼藤素均具有显著的卤虫致死活性.%Objective:To study the brine shrimp lethal activities of the roots and stems from Denis trifoliata. Methods:The biological activity of the athyl acetate extract was tested by the 2nd-inslar of Artemia franciscana by the method of Silica gel column chromatog-raphy,Sephadex LH-20 column chromatography,Semipreparative HPLC,and their structures were elucidated by spectral analysis. Results: Eleven compounds were isolated from the athyl acetate extract,and LD50s of 12a-hydroxyrotenone,tephrosin,rotenone and deguelin were 0. 365,0. 236,0.060 and 0.734 μg/mL, respectively. Conclusion: The results of bioassay show that 12a-hydroxyrotenone, tephrosin,rotenone and deguelin have strong brine shrimp lethal activity.

  9. Effect of light and brine shrimp on skeletal δ 13C in the Hawaiian coral Porites compressa: a tank experiment

    Science.gov (United States)

    Grottoli, Andréa G.

    2002-06-01

    Previous experimental fieldwork showed that coral skeletal δ 13C values decreased when solar intensity was reduced, and increased in the absence of zooplankton. However, actual seasonal changes in solar irradiance levels are typically less pronounced than those used in the previous experiment and the effect of increases in the consumption of zooplankton in the coral diet on skeletal δ 13C remains relatively unknown. In the present study, the effects of four different light and heterotrophy regimes on coral skeletal δ 13C values were measured. Porites compressa corals were grown in outdoor flow-through tanks under 112%, 100%, 75%, and 50% light conditions at the Hawaii Institute of Marine Biology, Hawaii. In addition, corals were fed either zero, low, medium, or high concentrations of brine shrimp. Decreases in light from 100% resulted in significant decreases in δ 13C that is most likely due to a corresponding decrease in photosynthesis. Increases in light to 112% also resulted in a decrease in δ 13C values. This latter response may be a consequence of photoinhibition. The overall curved response in δ 13C values was described by a significant quadratic function. Increases in brine shrimp concentrations resulted in increased skeletal δ 13C levels. This unexpected outcome appears to be attributable to enhanced nitrogen supply associated with the brine shrimp diet which led to increased zooxanthellae concentrations, increased photosynthesis rates, and thus increased δ 13C values. This result highlights the potential influence of nutrients from heterotrophically acquired carbon in maintaining the zooxanthellae-host symbiosis in balance. In addition, evidence is presented that suggests that coral skeletal growth and δ 13C are decoupled. These results increase our knowledge of how light and heterotrophy affects the δ 13C of coral skeletons.

  10. Larvicidal, antimicrobial and brine shrimp activities of extracts from Cissampelos mucronata and Tephrosia villosa from coast region, Tanzania

    Directory of Open Access Journals (Sweden)

    Erasto Paul

    2011-04-01

    Full Text Available Abstract Background The leaves and roots of Cissampelos mucronata A. Rich (Menispermaceae are widely used in the tropics and subtropics to manage various ailments such as gastro-intestinal complaints, menstrual problems, venereal diseases and malaria. In the Coast region, Tanzania, roots are used to treat wounds due to extraction of jigger. Leaves of Tephrosia villosa (L Pers (Leguminosae are reported to be used in the treatment of diabetes mellitus in India. In this study, extracts from the roots and aerial parts of C. mucronata and extracts from leaves, fruits, twigs and roots of T. villosa were evaluated for larvicidal activity, brine shrimps toxicity and antimicrobial activity. Methods Powdered materials from C. mucronata were extracted sequentially by dichloromethane followed by ethanol while materials from T.villosa were extracted by ethanol only. The extracts obtained were evaluated for larvicidal activity using Culex quinquefasciatus Say larvae, cytotoxicity using brine shrimp larvae and antimicrobial activity using bacteria and fungi. Results Extracts from aerial parts of C. Mucronata exhibited antibacterial activity against Staphylococcus aureus, Escherichia coli, Pseudomonas aeruginosa, Salmonella typhi, Vibrio cholera, Bacillus anthracis, Streptococcus faecalis and antifungal activity against Candida albicans and Cryptococcus neoformans. They exhibited very low toxicity to brine shrimps and had no larvicidal activity. The root extracts exhibited good larvicidal activity but weak antimicrobial activity. The root dichloromethane extracts from C. mucronata was found to be more toxic with an LC50 value of 59.608 μg/mL while ethanolic extracts from root were not toxic with LC50>100 μg/mL. Ethanol extracts from fruits and roots of T. villosa were found to be very toxic with LC50 values of 9.690 μg/mL and 4.511 μg/mL, respectively, while, ethanol extracts from leaves and twigs of T. villosa were found to be non toxic (LC50>100

  11. Synthesis and Characterization of N1-Phenylhydrazine-1,2-bis(carbothioamide) and Its Evaluation for Antimicrobial, Antioxidant, and Brine Shrimp Lethality Bioassay

    OpenAIRE

    G. M. Golzar Hossain; Md. Mainul Abedin; Bachar, Sitesh C

    2012-01-01

    The compound N1-phenylhydrazine-1,2-bis(carbothioamide) was synthesised from phenylisothiocyanate reacting with thiosemicarbazide refluxing the mixture in ethanol. The new compound obtained was characterised by various spectral and elemental analyses. It was subjected to antibacterial, antioxidant and brine shrimp lethality bioassay. The compound showed brine shrimp lethality with LC50 value of 12.79 μg which was comparable to vincristine with LC50 value of 0.33 μg. The compound did not exhib...

  12. Identification of lactic acid bacteria from spoilage associations of cooked and brined shrimps stored under modified atmosphere between 0 degrees C and 25 degrees C

    DEFF Research Database (Denmark)

    Dalgaard, Paw; Vancanneyt, M.; Vilalta, N.E.; Swings, J.; Fruekilde, Palle; Leisner, J.J.

    2003-01-01

    MAP shrimps were characterized by phenotypic tests and identified as lactic acid bacteria (78 isolates), other Gram-positive bacteria (13 isolates) and Gram-negative bacteria (11 isolates). A selection of 48 LAB isolates were further characterized and identified by phenotypic tests and SDS-PAGE...... dominant parts of spoilage associations of cooked and brined MAP shrimps stored at high and low temperatures, respectively. Significance and Impact of the Study: The SDS-PAGE technique and simple biochemical keys allowed the majority of LAB isolates from spoilage associations of cooked and brined MAP...

  13. Specific anion effects in Artemia salina.

    Science.gov (United States)

    Lo Nostro, Pierandrea; Ninham, Barry W; Carretti, Emiliano; Dei, Luigi; Baglioni, Piero

    2015-09-01

    The specific anion effect on the vitality of Artemia salina was investigated by measuring the Lethal Time LT50 of the crustaceans in the presence of different sodium salts solutions at room temperature and at the same ionic strength as natural seawater. Fluoride, thiocyanate and perchlorate are the most toxic agents, while chloride, bromide and sulfate are well tolerated. The rates of oxygen consumption of brine shrimps were recorded in mixed NaCl+NaF or NaCl+NaSCN solutions as a function of time. The results are discussed in terms of the Hofmeister series, and suggest that, besides the biochemical processes that involve F(-), SCN(-) and ClO4(-), the different physico-chemical properties of the strong kosmotropic and chaotropic anions may contribute in determining their strong toxicity for A. salina. PMID:25978674

  14. Evaluation of Membrane Stabilizing Activity, Total Phenolic Content, Brine Shrimp Lethality Bioassay, Thrombolytic and Antimicrobial Activities of Tagetes patula L.

    Directory of Open Access Journals (Sweden)

    Md. Ruhul Kuddus

    2012-11-01

    Full Text Available The methanol extract of leaf of Tagetes patula L. as well as its n-hexane, carbon tetrachloride, chloroform and aqueous soluble partitionates were subjected to screening for total phenolic content, brine shrimp lethality, membrane stabilizing, thrombolytic and antimicrobial activity. The membrane stabilizing activity was assessed by hypotonic solution-and heat-induced methods and was compared with acetyl salicylic acid. In the present studies, the n-hexane soluble fraction demonstrated strong membrane stabilizing activity in both hypotonic solution-and heat-induced methods with 44.48% and 42.68% inhibition of haemolysis, respectively. The total phenolic content was also determined and expressed in gallic acid equivalent. In brine shrimp bioassay, the crude methanol extract of leaf showed strong cytotoxic activity with LC50 value of 8.58 μg/ml compared to that of 0.451 μg/ml exhibited by standard vincristine sulphate. During assay for thrombolytic activity, the n-hexane soluble fraction revealed 43.7% lysis of clot while standard streptokinase and water, used as positive and negative controls, demonstrated 65.8% and 3.62% lysis of clot, respectively. In antimicrobial assay by disc diffusion method, all the samples exhibited moderate to significant antimicrobial activity (zone of inhibition = 9.0-22.0 mm against all the test organisms. Among all the samples, the carbon tetrachloride soluble fraction displayed strong antimicrobial activity against Escherichia coli (22.0 mm.

  15. Anti-bacterial activity and brine shrimp lethality bioassay of methanolic extracts of fourteen different edible vegetables from Bangladesh

    Institute of Scientific and Technical Information of China (English)

    MObayedUllah; MahmudaHaque; KanizFatimaUrmi; AbuHasanatMdZulfiker; ElicheaSynthiAnita; MomtajBegum; KaiserHamid

    2013-01-01

    Objective: To investigate the antibacterial and cytotoxic activity of fourteen different edible vegetables methanolic extract from Bangladesh. Methods: The antibacterial activity was evaluated using disc diffusion assay method against 12 bacteria (both gram positive and gram negative). The plant extracts were also screened for cytotoxic activity using the brine shrimp lethality bioassay method and the lethal concentrations (LC50) were determined at 95% confidence intervals by analyzing the data on a computer loaded with “Finney Programme”. Results: All the vegetable extracts showed low to elevated levels of antibacterial activity against most of the tested strains (zone of inhibition=5-28 mm). The most active extract against all bacterial strains was from Xanthium indicum which showed remarkable antibacterial activity having the diameter of growth inhibition zone ranging from 12 to 28 mm followed by Alternanthera sessilis (zone of inhibition=6-21 mm). All extracts exhibited considerable general toxicity towards brine shrimps. The LC50 value of the tested extracts was within the range of 8.447 to 60.323 µg/mL with respect to the positive control (vincristine sulphate) which was 0.91 µg/mL. Among all studied extracts, Xanthium indicum displayed the highest cytotoxic effect with LC50 value of 8.447 µg/mL. Conclusions: The results of the present investigation suggest that most of the studied plants are potentially good source of antibacterial and anticancer agents.

  16. Anti-bacterial activity and brine shrimp lethality bioassay of methanolic extracts of fourteen different edible vegetables from Bangladesh

    Institute of Scientific and Technical Information of China (English)

    M.Obayed; Ullah; Mahmuda; Haque; Kaniz; Fatima; Urmi; Abu; Hasanat; Md.Zulfiker; Elichea; Synthi; Anita; Momtaj; Begum; Kaiser; Hamid

    2013-01-01

    Objective:To investigate the antibacterial and cytotoxic activity of fourteen different edible vegetables methanolic extract from Bangladesh.Methods:The antibacterial activity was evaluated using disc diffusion assay method against 12 bacteria(both gram positive and gram negative).The plant extracts were also screened for cytotoxic activity using the brine shrimp lethality bioassay method and the lethal concentrations(LC50)were determined at confidence intervals by analyzing the data on a computer loaded with"Finney Programme??Results:All the vegetable extracts showed low to elevated levels of antibacterial activity against most of the tested strains(zone of inhibition=5-28 mm).The most active extract against all bacterial strains was from Xanthium indicum which showed remarkable antibacterial activity having the diameter of growth inhibition zone ranging from 12 to 28 mm followed by Alternanthera sessilis(zone of inhibition=6-21 mm).All extracts exhibited considerable general toxicity towards brine shrimps.The LC50value of the tested extracts was within the range of 8.447 to 60.323μg/mL with respect to the positive control(vincristine sulphate)which was 0.91μg/mL.Among all studied extracts,Xanthium indicum displayed the highest cytotoxic effect with LC50value of 8.447μg/mL.Conclusions:The results of the present investigation suggest that most of the studied plants are potentially good source of antibacterial and anticancer agents.

  17. Stable isotope record of Holocene climate and ecological change from brine shrimp cyst chitin for the Great Salt Lake, UT

    Science.gov (United States)

    Nielson, K. E.; Bowen, G. J.

    2009-12-01

    We present a record of oxygen and hydrogen isotopes in brine shrimp cysts from the Great Salt Lake, a terminal lake in the Great Basin, US. Water balance for the region is influenced by strength of the El Niño in Pacific and by the strength of the summer monsoon. Brine shrimp cysts are a novel proxy for isotope reconstruction, and allow reconstruction of water isotopes (oxygen, hydrogen) and ecology (hydrogen). Oxygen isotopes in chitin respond to water, while both diet and growth water contribute to hydrogen isotopes, allowing reconstruction of both environmental and ecological information from a single molecule. Values of δ18O decrease from about +15‰ to about +11‰ over course of the 8000 year record. This may suggest the importance of snow melt increased over the Holocene, or it may suggest lake is larger today than it was in mid-Holocene. Hydrogen isotopes are relatively stable for most of record, fluctuating around -140‰. Modeled hydrogen isotopes in food, also stable in the beginning of the record at about -150‰, become much heavier, shifting toward about -75‰ starting about 5000 ybp. This may suggest a shift from a primarily aquatic diet in the Mid-Holocene to a diet with a greater contribution of terrestrial material later in the Holocene. These observations agree broadly with previous inferences of a warm Mid-Holocene and associated low terrestrial productivity, followed by a more moist, and consequently more productive Late Holocene.

  18. Niche Limits of Symbiotic Gut Microbiota Constrain the Salinity Tolerance of Brine Shrimp.

    Science.gov (United States)

    Nougué, Odrade; Gallet, Romain; Chevin, Luis-Miguel; Lenormand, Thomas

    2015-09-01

    Symbiosis generally causes an expansion of the niche of each partner along the axis for which a service is mutually provided. However, for other axes, the niche can be restricted to the intersection of each partner's niche and can thus be constrained rather than expanded by mutualism. We explore this phenomenon using Artemia as a model system. This crustacean is able to survive at very high salinities but not at low salinities, although its hemolymph's salinity is close to freshwater. We hypothesized that this low-salinity paradox results from poor performance of its associated microbiota at low salinity. We showed that, in sterile conditions, Artemia had low survival at all salinities when algae were the only source of carbon. In contrast, survival was high at all salinities when fed with yeast. We also demonstrated that bacteria isolated from Artemia's gut reached higher densities at high salinities than at low salinities, including when grown on algae. Taken together, our results show that Artemia can survive at low salinities, but their gut microbiota, which are required for algae digestion, have reduced fitness. Widespread facultative symbiosis may thus be an important determinant of niche limits along axes not specific to the mutualistic interaction. PMID:26655356

  19. Embryogenesis, hatching and larval development of Artemia during orbital spaceflight

    Science.gov (United States)

    Spooner, B. S.; Debell, L.; Armbrust, L.; Guikema, J. A.; Metcalf, J.; Paulsen, A.

    1994-08-01

    Developmental biology studies, using gastrula-arrested cysts of the brine shrimp Artemia franciscana, were conducted during two flights of the space shuttle Atlantis (missions STS-37 and STS-43) in 1991. Dehydrated cysts were activated, on orbit, by addition of salt water to the cysts, and then development was terminated by the addition of fixative. Development took place in 5 ml syringes, connected by tubing to activation syringes, containing salt water, and termination syringes, containing fixative. Comparison of space results with simultaneous ground control experiments showed that equivalent percentages of naupliar larvae hatched in the syringes (40%). Thus, reactivation of development, completion of embryogenesis, emergence and hatching took place, during spaceflight, without recognizable alteration in numbers of larvae produced. Post-hatching larval development was studied in experiments where development was terminated, by intrduction of fixative, 2 days, 4 days, and 8 days after reinitiation of development. During spaceflight, successive larval instars or stages, interrupted by molts, occurred, generating brine shrimp at appropriate larval instars. Naupliar larvae possessed the single naupliar eye, and development of the lateral pair of adult eyes also took place in space. Transmission electron microscopy revealed extensive differentiation, including skeletal muscle and gut endoderm, as well as the eye tissues. These studies demonstrate the potential value of Artemia for developmental biology studies during spaceflight, and show that extensive degress of development can take place in this microgravity environment.

  20. Cadmium and zinc reversibly arrest development of Artemia larvae

    Energy Technology Data Exchange (ETDEWEB)

    Bagshaw, J.C.; Rafiee, P.; Matthews, C.O.; MacRae, T.H.

    1986-08-01

    Despite the widespread distribution of heavy metals such as cadmium and zinc in the environment and their well-known cytotoxicity and embryotoxicity in mammals, comparatively little is known about their effect on aquatic organisms, particularly invertebrates. Post-gastrula and early larval development of the brine shrimp, Artemia, present some useful advantages for studies of developmental aspects of environmental toxicology. Dormant encysted gastrulae, erroneously called brine shrimp eggs, can be obtained commercially and raised in the laboratory under completely defined conditions. Following a period of post-gastrula development within the cyst, pre-nauplius larvae emerge through a crack in the cyst shell. A few hours later, free-swimming nauplius larvae hatch. Cadmium is acutely toxic to both adults and nauplius larvae of Artemia, but the reported LC50s are as high as 10 mM, depending on larval age. In this paper the authors show that pre-nauplius larvae prior to hatching are much more sensitive to cadmium than are hatched nauplius larvae. At 0.1 ..mu..m, cadmium retards development and hatching of larvae; higher concentrations block hatching almost completely and thus are lethal. However, the larvae arrested at the emergence stage survive for 24 hours or more before succumbing to the effects of cadmium, and during this period the potentially lethal effect is reversible if the larvae are placed in cadmium-free medium. The effects of zinc parallel those of cadmium, although zinc is somewhat less toxic than cadmium at equal concentrations.

  1. Opportunities for Sex Education and Personal and Social Education (PSE) through Science Lessons: The Comments of Primary Pupils When Observing Meal Worms and Brine Shrimp.

    Science.gov (United States)

    Tunnicliffe, Sue Dale; Reiss, Michael J.

    1999-01-01

    Presents a characterization of students' comments during observation of meal worms or brine shrimp. Finds that many student comments had to do with sex, reproduction, death, violence, and the life history of the organisms. Significant differences in conversations occurred across age and gender groups. Contains 32 references. (Author/WRM)

  2. Toxicity and Binding Profile of Lectins from the Genus Canavalia on Brine Shrimp

    OpenAIRE

    Francisco Vassiliepe Sousa Arruda; Arthur Alves Melo; Mayron Alves de Vasconcelos; Romulo Farias Carneiro; Ito Liberato Barroso-Neto; Suzete Roberta Silva; Francisco Nascimento Pereira-Junior; Celso Shiniti Nagano; Kyria Santiago Nascimento; Edson Holanda Teixeira; Silvana Saker-Sampaio; Benildo Sousa Cavada; Alexandre Holanda Sampaio

    2013-01-01

    Lectins are sugar-binding proteins widely distributed in nature with many biological functions. Although many lectins have a remarkable biotechnological potential, some of them can be cytotoxic. Thus, the aim of this study was to assess the toxicity of five lectins, purified from seeds of different species of Canavalia genus. In order to determine the toxicity, assays with Artemia nauplii were performed. In addition, a fluorescence assay was carried out to evaluate the binding of lectins to A...

  3. Bioactivity evaluation against Artemia salina Leach of medicinal plants used in Brazilian Northeastern folk medicine Avaliação da bioatividade frente à Artemia salina Leach de plantas medicinais utilizadas na medicina popular na Região Nordeste do Brasil

    OpenAIRE

    DDR. Arcanjo; ACM. Albuquerque; B. Melo-Neto; LCLR. Santana; MGF Medeiros; AMGL. Citó

    2012-01-01

    The brine shrimp (Artemia salina Leach) lethality bioassay offers an advantage in standardization and quality control of botanical products. This test is well correlated with antitumor activity (cytotoxicity) and can be used to monitor the activity of bioactive natural products. This paper reports the bioactivity of ethanol extracts from seven medicinal plants from the Northeast of Brazil (Acmella uliginosa, Ageratum conyzoides, Eugenia uniflora, Plectranthus neochilus, Moringa oleifera, Just...

  4. Larvicidal, insecticidal, brine shrimp cytotoxicity and anti-oxidant activities of Diospyros kaki (L.) reported from Pakistan.

    Science.gov (United States)

    Nisar, Mohammad; Shah, Syed Muhammad Mukarram; Khan, Imran; Sheema; Sadiq, Abdul; Khan, Shahzeb; Shah, Syed Muhammad Hassan

    2015-07-01

    Diospyros kaki is cultivated in different agro-ecological zones of Pakistan, especially in Malakand division. The current study was designed to investigate the hide potential of the vulnerable species of the plant. Aqueous extracts of Diospyros kaki leaves were screened for larvicidal, insecticidal cytotoxic and antioxidant activities. The extract exhibited moderate to outstanding larvicidal activity (100 to 28%) at 100, 80, 70, 50, 40, 30, 20 and 10% concentrations respectively after 24 hours, showing 42% LC₅₀. Permitrin displayed 100% lethality at 0.3%. The extract demonstrated outstanding cytotoxic action against brain shrimps nauplii (Artemia salina), showing 10 ppm LC50 which is closed to the LC50 (9.8μg/ml) of standard drug Etoposide. Similarly profound insecticidal potential (100%) was recorded after 15 min against Cimex lectularius. In DPPH scavenging activity the extract demonstrated moderate 30.22%, while Quercetin, Gallic acid and Acetic acid showed 98, 96 and 97% activity respectively at 100 ppm. Thus on the basis of our finding it could be concluded that the decoction of the leaves of D. kaki is a good natural alternative for the control of insects and neoplasia. PMID:26142513

  5. Brine shrimp lethality test active constituents and new highly oxygenated seco-prezizaane-type sesquiterpenes from Illicium merrillianum.

    Science.gov (United States)

    Huang, Jian-Mei; Nakade, Kousuke; Kondo, Mamiko; Yang, Chun-Shu; Fukuyama, Yoshiyasu

    2002-01-01

    In the study of bioactive substances in Illicium plants, the methanol extract of I. merrillianum showed brine shrimp lethality test (BST) activity at 200 microg/ml. Bioassay-guided fractionation of the BST active fractions resulted in the isolation of 4-O-methyleudesm-11-en-4alpha-ol, eudesmol-11-en-4alpha-ol and (-)-hinokinin as potent BST active compounds. On the other hand, four new highly oxygenated seco-prezizaane-type sesquiterpenes, merrilliortholactone (1), 2alpha-hydroxycycloparvifloralone (2), 2alpha-hydroxycycloparviflorolide (3), and 2alpha-hydroxyanisatin (4) were isolated from the BST-inactive polar fractions. The structures of new compounds were elucidated by extensive analyses of spectral data. Furthermore, the absolute configuration of 3 was established by the modified Mosher's method. Compounds 1--4 showed neither BST activity at 100 microg/ml nor neurite outgrowth-promoting activity. PMID:11824575

  6. Inland hypersaline lakes and the brine shrimp Artemia as simple models for biodiversity analysis at the population level

    OpenAIRE

    Gonzalo M Gajardo; Sorgeloos, Patrick; John A Beardmore

    2006-01-01

    Biodiversity can be measured at different hierarchical levels, from genetic diversity within species to diversity of ecosystems, though policy-makers tend to use species richness. The 2010 goal of reducing biodiversity loss, agreed by the subscribers to the Convention on Biological Diversity, requires simple and reliable protocols to evaluate biodiversity at any level in a given ecosystem. Stakeholders, particularly policy makers, need to understand how ecosystem components interact to produc...

  7. 卤虫等位酶的遗传控制%GENETIC CONTROL OF ALLOZYMES IN THE BRINE SHRIMP (ARTEMIA)

    Institute of Scientific and Technical Information of China (English)

    董树刚; 付成秋; 程继军; 高明君

    2000-01-01

    应用聚丙烯酰胺凝胶电泳技术分析了孤雌生殖卤虫产生的罕见雄体、两性卤虫及其杂交后代(F1)的酯酶(EST)、超氧物歧化酶(SOD)、过氧化物酶(PRX)、碱性磷酸酶( ALP)、四唑氧化酶(TO)和乳酸脱氢酶(LDH)的同工酶酶谱表型.对编码五种酶的19个位点、35个等位基因的表达进行了遗传分析.结果表明,在EST、PRX和TO酶谱中既有共显性等位基因,又有沉默等位基因的表达;卤虫PRX、ALP和SOD为单体酶,在EST和TO酶谱中还存在着二聚体同工酶;除LDH为单态外,其余五种同工酶为多态酶.

  8. Artemia parthenogenetica (Branchiopoda: Anostraca) from the Large Aral Sea: Abundance, distribution, population structure and cyst production

    Science.gov (United States)

    Arashkevich, Elena G.; Sapozhnikov, P. V.; Soloviov, K. A.; Kudyshkin, T. V.; Zavialov, P. O.

    2009-03-01

    The brine shrimp Artemia parthenogenetica appeared in the Large Aral Sea (Central Asia) in 1998 when mineralization reached 63 ppt. Data on Artemia abundance and biomass, along with temperature and salinity measurements were collected in the western basin during 2002-2006, primarily in the autumn. During the study period, population density grew progressively, both in terms of number, from 250 to 1260 individuals per m 3, and in terms of biomass, from 0.3 to 1.3 g per m 3. In 2005, the population density and spatial distribution in the different parts of the sea (western and eastern basins and strait) was assessed. The horizontal distribution of the Artemia population was uniform in the deep central part of the western basin, although the distribution was quite patchy in the shallow coastal zone. Depth habitat of Artemia was restricted to the upper 20-25 m of depth, as the oxygen depletion and formation of anoxic layer prevented distribution of Artemia to the deeper waters. In autumn, all females reproduced oviparously, with an average clutch size of 30-35 eggs per female. The number of eggs in a clutch was positively correlated with female body length ( r2 = 0.36-0.44).

  9. Origin and Genetic Diversity of Diploid Parthenogenetic Artemia in Eurasia

    Science.gov (United States)

    Maccari, Marta; Amat, Francisco; Gómez, Africa

    2013-01-01

    There is wide interest in understanding how genetic diversity is generated and maintained in parthenogenetic lineages, as it will help clarify the debate of the evolution and maintenance of sexual reproduction. There are three mechanisms that can be responsible for the generation of genetic diversity of parthenogenetic lineages: contagious parthenogenesis, repeated hybridization and microorganism infections (e.g. Wolbachia). Brine shrimps of the genus Artemia (Crustacea, Branchiopoda, Anostraca) are a good model system to investigate evolutionary transitions between reproductive systems as they include sexual species and lineages of obligate parthenogenetic populations of different ploidy level, which often co-occur. Diploid parthenogenetic lineages produce occasional fully functional rare males, interspecific hybridization is known to occur, but the mechanisms of origin of asexual lineages are not completely understood. Here we sequenced and analysed fragments of one mitochondrial and two nuclear genes from an extensive set of populations of diploid parthenogenetic Artemia and sexual species from Central and East Asia to investigate the evolutionary origin of diploid parthenogenetic Artemia, and geographic origin of the parental taxa. Our results indicate that there are at least two, possibly three independent and recent maternal origins of parthenogenetic lineages, related to A. urmiana and Artemia sp. from Kazakhstan, but that the nuclear genes are very closely related in all the sexual species and parthenogegetic lineages except for A. sinica, who presumable took no part on the origin of diploid parthenogenetic strains. Our data cannot rule out either hybridization between any of the very closely related Asiatic sexual species or rare events of contagious parthenogenesis via rare males as the contributing mechanisms to the generation of genetic diversity in diploid parthenogenetic Artemia lineages. PMID:24376692

  10. Reproduction path and effect factors of Brine Shrimp%卤虫的生殖途径和影响因素

    Institute of Scientific and Technical Information of China (English)

    鲍鹰; 逄少军

    2007-01-01

    有关卤虫的第一篇报道发表于1755年,标本采自英国的Lymington。1758年经林奈定名为Artemia salina。卤虫(Brine Shrimp)隶属节肢动物门(Arthropoda)、甲壳纲(Crustacea)、鳃足亚纲(Branehiopoda)、卤虫科(Artemiidae)。卤虫分布广泛,世界各地的许多自然盐湖和人工盐池中均有分布。

  11. Brine saturation technique for extracting light filth from canned crabmeat and shrimp: intralaboratory study.

    Science.gov (United States)

    Freeman, C C

    1983-11-01

    An intralaboratory study was made of a new technique for isolating light filth from canned shrimp and crabmeat. Recoveries of 93.8% for insect fragments and 89.4% for rodent hair plus the brevity and simplicity of the new technique make it superior to the 2 existing official methods for these products. PMID:6643364

  12. Synthesis and Characterization of N1-Phenylhydrazine-1,2-bis(carbothioamide and Its Evaluation for Antimicrobial, Antioxidant, and Brine Shrimp Lethality Bioassay

    Directory of Open Access Journals (Sweden)

    G. M. Golzar Hossain

    2012-01-01

    Full Text Available The compound N1-phenylhydrazine-1,2-bis(carbothioamide was synthesised from phenylisothiocyanate reacting with thiosemicarbazide refluxing the mixture in ethanol. The new compound obtained was characterised by various spectral and elemental analyses. It was subjected to antibacterial, antioxidant and brine shrimp lethality bioassay. The compound showed brine shrimp lethality with LC50 value of 12.79 μg which was comparable to vincristine with LC50 value of 0.33 μg. The compound did not exhibit any antimicrobial activity against Gram +ve and Gram −ve organisms, as well as against the tested fungal strains. But very good free radical scavenging activity was observed at concentration range of 0.185–100 μg with IC50 values of 1.43 μg in comparison to reference standard butylated hydroxytoluene (BHT with IC50 value 16.46 μg.

  13. Gut reaction by heartless shrimps: experimental evidence for the role of the gut in generating circulation before cardiac ontogeny

    OpenAIRE

    Spicer, John I

    2006-01-01

    Before the appearance of a functional heart in many invertebrate species, the assumption was that general body movements provide circulatory function. Consequently, I investigated the frequency of gut movements in the brine shrimp, Artemia franciscana, immediately post-hatch to the point when a functional heart appeared. Prior to cardiac ontogeny, movements of internal musculature and gut provided pre-cardiac circulatory currents with the rate of gut movements increasing when swimming limbs w...

  14. Parasiticidal and brine shrimp cytotoxicity potential of crude methanolic extract of rind of Punica granatum Linn against round worms and tape worms.

    Science.gov (United States)

    Ali, Niaz; Jamil, Ayesha; Shah, Syed Wadood Ali; Shah, Ismail; Ahmed, Ghayour; Junaid, Muhammad; Ahmed, Zahoor

    2015-05-01

    Rind of Punica granatum is traditionally used for anthelmintic purposes. The current work describes the possible anthelmintic activity of crude methanolic extract of Punica granatum (Pg. Cr) against round worms (Ascaridia galli) and the tape worms (Raillietina spiralis). Brine shrimp cytotoxicity is also performed. Brine shrimp cytotoxic activity was tested using different concentrations (1000 μg/mL, 100 μg/mL and 10 μg/mL) of Pg.Cr. In vitro anthelmintic activity of Pg. Cr was determined against the parasites using albendazole and piperazine citrate as standard anthelmintic drugs in concentration 10 mg/ml. LC50 value for Brine shrimp cytotoxicity was 189.44 ±28 μg/mL. In test concentration of 40mg/ml of the Pg. Cr, Raillietina spiralis was paralyzed in 23 minutes. However, for parasiticidal activity (death of the parasite), it took less time (40 minutes) as compared to standard Albendazole. Time taken for death of the parasite Raillietina spiralis, in concentration 40 mg /ml, is 40 min. While standard drugs took more time to kill the Raillietina spiralis. Pg. Cr took 19 minutes to paralyze the Ascaridia galli at concentration 40 mg/ml whereas; it took 48 minutes for to kill the parasite Ascaridia galli. The current work confirms the traditional use of rind of Punica granatum as anthelmintic against Raillietina spiralis and Ascaridia galli. Results of brine shrimp cytotoxicity assay warrant for the isolation of cytotoxic compounds. List of abbreviation- Pg. Cr = Crude methanolic extract of Punica granatum. PMID:26004729

  15. 腌制和干制对即食虾仁品质的影响%Effects of Brining and Drying on the Quality of Instant Shrimp

    Institute of Scientific and Technical Information of China (English)

    李丹丹; 李威; 李汴生; 杨朝雄

    2011-01-01

    The salt content, the moisture content, water activity, sensory evaluation and color of instant shrimp were determined during the brining and drying treatments, to investigate the effects of brining and drying on the quality of instant shrimp. The results showed that the moisture content and salt content of the shrimp were sigiificantly changed when the salt solution was over 2% by vacuum brining method. The best brining regents and time were determined as 6% salt solution and 1.5 h, respectively. And the best drying technology were found as follows:drying the pickled shrimp at 80℃ until no water was detected at the product surface and then re-drying it at 65℃ until the water content was down to 60%.%通过对产品的盐含量、水分含量、水分活度、感官评定以及色泽的测定,研究即食虾仁加工过程中的腌制和干制对其品质的影响.结果表明,腌制采用真空湿腌法,在腌制液中的盐浓度大于2%之后,可以显著改变腌制后虾仁的水分含量以及盐含量,最佳的腌制液盐浓度为6%,腌制时间为1.5 h,干制的最佳条件为:在80℃干燥到表面无复水,然后在65℃烘干至最终水分含量60%.

  16. Bioactivity evaluation against Artemia salina Leach of medicinal plants used in Brazilian Northeastern folk medicine.

    Science.gov (United States)

    Arcanjo, D D R; Albuquerque, A C M; Melo-Neto, B; Santana, L C L R; Medeiros, M G F; Citó, Amgl

    2012-08-01

    The brine shrimp (Artemia salina Leach) lethality bioassay offers an advantage in standardization and quality control of botanical products. This test is well correlated with antitumor activity (cytotoxicity) and can be used to monitor the activity of bioactive natural products. This paper reports the bioactivity of ethanol extracts from seven medicinal plants from the Northeast of Brazil (Acmella uliginosa, Ageratum conyzoides, Eugenia uniflora, Plectranthus neochilus, Moringa oleifera, Justicia pectoralis and Equisetum sp.) against Artemia salina. Biological activity was evaluated for extracts at 1, 10, 100, and 1000 µg/mL in triplicate, and the mean lethal concentration values (LC50) were obtained by probit analysis. The species Acmella uliginosa showed the highest bioactivity, and its flower extract was more active than its leaf extract. PMID:22990821

  17. Investigations of the effects of cosmic rays on Artemia cysts and tobacco seeds: results of Exobloc II experiment, flown aboard Biocosmos 1887

    International Nuclear Information System (INIS)

    Artemia (Brine shrimp) cysts and tobacco seeds, dormant biological material devoid of metabolic activity, were flown aboard the Soviet Biocosmos 1887 in order to investigate the effects of cosmic rays. Artemia cysts and tobacco seeds were used in bulk or in monolayers sandwiched with track detectors. Biological and physical units were located outside and inside the spacecraft. Stacks included lead shielding in order to expose the objects to different doses of radiation. Total dosimetry was performed using thermoluminescent detectors. In spite of low levels of doses, the space flight resulted in a decrease in developmental capacity of Artemia cysts, and in a higher mutation rate in tobacco seeds. The more obvious responses occurred, in both cases, in biological objects exposed to the highest doses. These results are compared to those of previous space experiments. (author)

  18. Expression and Quorum Sensing Regulation of Type III Secretion System Genes of Vibrio harveyi during Infection of Gnotobiotic Brine Shrimp

    Science.gov (United States)

    Ruwandeepika, H. A. Darshanee; Karunasagar, Indrani; Bossier, Peter; Defoirdt, Tom

    2015-01-01

    Type III secretion systems enable pathogens to inject their virulence factors directly into the cytoplasm of the host cells. The type III secretion system of Vibrio harveyi, a major pathogen of aquatic organisms and a model species in quorum sensing studies, is repressed by the quorum sensing master regulator LuxR. In this study, we found that during infection of gnotobiotic brine shrimp larvae, the expression levels of three type III secretion operons in V. harveyi increased within the first 12h after challenge and decreased again thereafter. The in vivo expression levels were highest in a mutant with a quorum sensing system that is locked in low cell density configuration (minimal LuxR levels) and lowest in a mutant with a quorum sensing system that is locked in the high cell density configuration (maximal LuxR levels), which is consistent with repression of type III secretion by LuxR. Remarkably, in vivo expression levels of the type III secretion system genes were much (> 1000 fold) higher than the in vitro expression levels, indicating that (currently unknown) host factors significantly induce the type III secretion system. Given the fact that type III secretion is energy-consuming, repression by the quorum sensing master regulators might be a mechanism to save energy under conditions where it does not provide an advantage to the cells. PMID:26636765

  19. Expression and Quorum Sensing Regulation of Type III Secretion System Genes of Vibrio harveyi during Infection of Gnotobiotic Brine Shrimp.

    Science.gov (United States)

    Ruwandeepika, H A Darshanee; Karunasagar, Indrani; Bossier, Peter; Defoirdt, Tom

    2015-01-01

    Type III secretion systems enable pathogens to inject their virulence factors directly into the cytoplasm of the host cells. The type III secretion system of Vibrio harveyi, a major pathogen of aquatic organisms and a model species in quorum sensing studies, is repressed by the quorum sensing master regulator LuxR. In this study, we found that during infection of gnotobiotic brine shrimp larvae, the expression levels of three type III secretion operons in V. harveyi increased within the first 12h after challenge and decreased again thereafter. The in vivo expression levels were highest in a mutant with a quorum sensing system that is locked in low cell density configuration (minimal LuxR levels) and lowest in a mutant with a quorum sensing system that is locked in the high cell density configuration (maximal LuxR levels), which is consistent with repression of type III secretion by LuxR. Remarkably, in vivo expression levels of the type III secretion system genes were much (> 1000 fold) higher than the in vitro expression levels, indicating that (currently unknown) host factors significantly induce the type III secretion system. Given the fact that type III secretion is energy-consuming, repression by the quorum sensing master regulators might be a mechanism to save energy under conditions where it does not provide an advantage to the cells. PMID:26636765

  20. Preliminary results of the Artemia salina experiments in biostack on LDEF

    International Nuclear Information System (INIS)

    The mosaic egg of the brine shrimp, Artemia salina, resting in blastula or gastrula state represents a system that during further development, proceeds without any further development to the larval stage, the free swimming nauplius. Therefore, injury to a single cell of the egg will be manifest in the larvae. In several experiments, it was shown that the passage of a single heavy ion through the shrimp egg damaged a cellular area large enough to disturb either embryogenesis or further development of the larvae, or the integrity of the adult individual. Emergence from the egg shell was heavily disturbed by the heavy ions as was hatching. Additional late effects, due to a hit by a heavy ion, are delayed of growth and of sexual maturity, and reduced fertility. Anomalies in the body and the extremities could be observed more frequently for the nauplii which had developed from eggs hit by heavy ions

  1. Anticipation of Artemia sp. supply in the larviculture of the barber goby Elacatinus figaro (Gobiidae: Teleostei influenced growth, metamorphosis and alkaline protease activity

    Directory of Open Access Journals (Sweden)

    Maria Fernanda da Silva-Souza

    2015-09-01

    Full Text Available The barber goby Elacatinus figaro is considered endangered due to overexploitation by the ornamental industry. Farming marine ornamental fishes, especially the threatened ones, can be one of the measures to minimize the pressure on the natural stocks. Among the priority issues for their production is the determination of the most appropriate feeding management. The feeding protocol commonly used in the larviculture of barber goby, when the start of Artemia sp. offer occurred at the 18th DAH (days after hatching (treatment T18, was modified, by anticipating brine shrimp supply in 6 days (treatment T12. Alkaline proteases activity, growth and metamorphosis of larvae were evaluated in both protocols. Juveniles at T12 showed higher weight (0.04 ± 0.001 g and lower activity of total alkaline proteases (1.3 ± 0.2 mU mg-1 protein compared to T18 (0.02 ± 0.001 g; 2.8 ± 0.4 mU mg-1 protein, respectively. With anticipation of brine shrimp, the commencing and end of larval transformation was observed earlier (at 24 and 34 DAH, respectively in comparison to those with the supply of Artemia sp. at 18 DAH (27 and 41 DAH, respectively. Thus, the Artemia sp. anticipation was beneficial during the larviculture of the barber goby, considering that larvae reached metamorphosis earlier.

  2. High prevalence of cestodes in Artemia spp. throughout the annual cycle: relationship with abundance of avian final hosts

    Science.gov (United States)

    Sánchez, Marta I.; Nikolov, Pavel N.; GEorgieva, Darina D.; Georgiev, Boyko B.; Vasileva, Gergana P.; Pankov, Plamen; Paracuellos, Mariano; Lafferty, Kevin D.; Green, Andy J.

    2013-01-01

    Brine shrimp, Artemia spp., act as intermediate hosts for a range of cestode species that use waterbirds as their final hosts. These parasites can have marked influences on shrimp behavior and fecundity, generating the potential for cascading effects in hypersaline food webs. We present the first comprehensive study of the temporal dynamics of cestode parasites in natural populations of brine shrimp throughout the annual cycle. Over a 12-month period, clonal Artemia parthenogenetica were sampled in the Odiel marshes in Huelva, and the sexual Artemia salina was sampled in the Salinas de Cerrillos in Almería. Throughout the year, 4–45 % of A. parthenogenetica were infected with cestodes (mean species richness = 0.26), compared to 27–72 % of A. salina (mean species richness = 0.64). Ten cestode species were recorded. Male and female A. salina showed similar levels of parasitism. The most prevalent and abundant cestodes were those infecting the most abundant final hosts, especially the Greater Flamingo Phoenicopterus ruber. In particular, the flamingo parasite Flamingolepis liguloides had a prevalence of up to 43 % in A. parthenogenetica and 63.5 % in A. salina in a given month. Although there was strong seasonal variation in prevalence, abundance, and intensity of cestode infections, seasonal changes in bird counts were weak predictors of the dynamics of cestode infections. However, infection levels of Confluaria podicipina in A. parthenogenetica were positively correlated with the number of their black-necked grebe Podiceps nigricollis hosts. Similarly, infection levels of Anomotaenia tringae and Anomotaenia microphallos in A. salina were correlated with the number of shorebird hosts present the month before. Correlated seasonal transmission structured the cestode community, leading to more multiple infections than expected by chance.

  3. Laboratory generation of new parthenogenetic lineages supports contagious parthenogenesis in Artemia

    Directory of Open Access Journals (Sweden)

    Marta Maccari

    2014-06-01

    Full Text Available Contagious parthenogenesis—a process involving rare functional males produced by a parthenogenetic lineage which mate with coexisting sexual females resulting in fertile parthenogenetic offspring—is one of the most striking mechanisms responsible for the generation of new parthenogenetic lineages. Populations of the parthenogenetic diploid brine shrimp Artemia produce fully functional males in low proportions. The evolutionary role of these so-called Artemia rare males is, however, unknown. Here we investigate whether new parthenogenetic clones could be obtained in the laboratory by mating these rare males with sexual females. We assessed the survival and sex ratio of the hybrid ovoviviparous offspring from previous crosses between rare males and females from all Asiatic sexual species, carried out cross-mating experiments between F1 hybrid individuals to assess their fertility, and estimated the viability and the reproductive mode of the resulting F2 offspring. Molecular analysis confirmed the parentage of hybrid parthenogenetic F2. Our study documents the first laboratory synthesis of new parthenogenetic lineages in Artemia and supports a model for the contagious spread of parthenogenesis. Our results suggest recessive inheritance but further experiments are required to confirm the likelihood of the contagious parthenogenesis model.

  4. FRAKSINASI EKSTRAK METANOL KULIT BATANG KETAPANG (Terminalia catappaLinn. DAN UJI TOKSISITASNYA DENGAN METODE BSLT (Brine Shrimp Lethality Test

    Directory of Open Access Journals (Sweden)

    Moch. Chasani

    2013-05-01

    Full Text Available Ketapang (Terminalia catappa Linn. merupakan salah satu tumbuhan anggota famili Combretaceae. Hasil uji senyawa metabolit sekunder pada kulit batang ketapang diketahui mengandung flavonoid, terpenoid, polifenol, steroid dan saponin. Penelitian ini dilakukan untuk menemukan fraksi ekstrak dari kulit batang ketapang yang memiliki toksisitas tertinggi terhadap larva udang Artemia salina Leach dengan menggunakan metode BSLT serta mengidentifikasi senyawa metabolit sekundernya. Kulit batang ketapang diekstraksi secara maserasi menggunakan pelarut metanol. Ekstrak metanol yang diperoleh diekstraksi cair-cair dengan pelarut n-heksana, dan etil asetat. Ekstrak metanol (EM, fraksi n-heksana ekstrak metanol (FH, fraksi etil asetat ekstrak metanol (FE, dan residu etil asetat ekstrak metanol (FR diuji toksisitasnya. Fraksi ekstrak dengan toksisitas tertinggi diuji kandungan senyawa metabolit sekundernya menggunakan pereaksi warna pada plat KLT. Hasil uji menunjukkan bahwa EM, FH, FE, dan FR bersifat toksik terhadap larva udang Artemia salina Leach dan FE bersifat paling toksik dengan nilai LC50 sebesar 61,675 ppm. Hasil uji metabolit sekunder menunjukkan FE mengandung senyawa golongan flavonoid, fenolat, terpenoid, dan saponin.

  5. CHARACTERIZATION OF REFERENCE ARTEMIA III FOR MARINE TOXICOLOGICAL STUDIES

    Science.gov (United States)

    ASTM Practice for Using Brine Shrimp Nauplii as Food for Test Animals in Aquatic Toxicology Tests (E 1203) suggests use of Reference Artemis as a reference standard for evaluating other batches of brine shrimp as food for organisms used in toxicology. in 1988, the U.S. EPA was ab...

  6. IDENTIFIKASI DAN UJI AKTIVITAS ANTIKANKER EKSTRAK SPONS Ianthella basta TERHADAP LARVA Artemia salina L.

    Directory of Open Access Journals (Sweden)

    Ni Wayan Sri Sukmarianti

    2013-05-01

    Full Text Available The main purpose of this research is to determine the toxicity of extracts sponge Ianthella basta against Artemia salina larvae and to identify the chemical compounds contained in those toxic isolates. The preliminary test of the anticancer activity has conducted by Brine Shrimp Letalithy (BST test. The results showed that the chloroform extract was the most toxic with LC50 value of 22,39 ppm. Futher, the cloroform extract was separated and purified by coloumn chromatography using eluent of solvent mixture of chloroform : ethyl acetate : n-hexane by 7 : 2 : 1 and 4 fractions were obtained. The most toxic fraction was the fraction C with LC50 value of 35,36 ppm. Based on the GC-MS results, the toxic isolate is allegedly containing chemicals compound of hexadecanoic methyl ester and hexadecanoic acid.

  7. Interference from ordinarily used solvents in the outcomes of Artemia salina lethality test

    Directory of Open Access Journals (Sweden)

    Sahgal Geethaa

    2013-01-01

    Full Text Available Methanol, ethanol, Tween 20 and dimethyl sulfoxide (DMSO are widely used as dissolving agents in Artemia salina lethality test (aka brine shrimp lethality test [BSLT] to screen the pharmaceutical properties of natural products. Nevertheless, there is lack of toxicity level of these solvents against brine shrimp. High concentration of these organic solvent might be toxic for this zoology invertebrate and interfere in the experimental outcomes. To avoid this, permissible concentration of the solvents used in BSLT was identified. BSLT was performed to evaluate the toxicity effect of Tween 20, methanol, ethanol and DMSO at 24 h post-treatment time point against A. salina. The suggested maximum working concentration (v/v for DMSO, methanol, ethanol was found to be 1.25% and that for Tween 20 was 0.16%. LC 50 for the solvents were 8.5% (DMSO, 6.4% (methanol, 3.4% (ethanol and 2.5% (Tween 20. The findings have shown a toxicity level among the solvents in descending order as Tween 20 > ethanol > methanol > DMSO. DMSO is a safer solvent to be used in BSLT compared with other tested solvents, whereas Tween 20 has been shown to be the most stringent solvent among the tested solvents. The findings are resourcefully useful to avoid interference of solvents in the assessment of natural products using BSLT.

  8. Multiple γ-glutamylation: A novel type of post-translational modification in a diapausing Artemia cyst protein

    International Nuclear Information System (INIS)

    A highly hydrophilic, glutamate-rich protein was identified in the aqueous phenol extract from the cytosolic fraction of brine shrimp (Artemia franciscana) diapausing cysts and termed Artemia phenol soluble protein (PSP). Mass spectrometric analysis revealed the presence of many protein peaks around m/z 11,000, separated by 129 atomic mass units; this value corresponds to that of glutamate, which is strongly suggestive of heterogeneous polyglutamylation. Polyglutamylation has long been known as the functionally important post-translational modification of tubulins, which carry poly(L-glutamic acid) chains of heterogeneous length branching off from the main chain at the γ-carboxy groups of a few specific glutamate residues. In Artemia PSP, however, Edman degradation of enzymatic peptides revealed that at least 13, and presumably 16, glutamate residues were modified by the attachment of a single L-glutamate, representing a hitherto undescribed type of post-translational modification: namely, multiple γ-glutamylation or the addition of a large number of glutamate residues along the polypeptide chain. Although biological significance of PSP and its modification is yet to be established, suppression of in vitro thermal aggregation of lactate dehydrogenase by glutamylated PSP was observed.

  9. Multiple {gamma}-glutamylation: A novel type of post-translational modification in a diapausing Artemia cyst protein

    Energy Technology Data Exchange (ETDEWEB)

    Hasegawa, Mai [Bioscience Course, Graduate School of Science and Technology, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Ikeda, Yuka [Institute of High Polymer Research, Faculty of Textile Science and Technology, Shinshu University, 3-15-1, Tokida, Ueda 386-8567 (Japan); Kanzawa, Hideaki [Department of Biology, Faculty of Science, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Sakamoto, Mika [Bioscience Course, Graduate School of Science and Technology, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Goto, Mina [Department of Biology, Faculty of Science, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Tsunasawa, Susumu [Analytical and Measuring Instruments Division, Shimadzu Corporation, Nishinokyo Kuwabaracho 1, Nakagyo-Ku, Kyoto 604-8511 (Japan); Uchiumi, Toshio, E-mail: uchiumi@bio.sc.niigata-u.ac.jp [Bioscience Course, Graduate School of Science and Technology, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Department of Biology, Faculty of Science, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Odani, Shoji [Bioscience Course, Graduate School of Science and Technology, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan); Department of Biology, Faculty of Science, Niigata University, 2-8050 Ikarashi, Nishi-Ku, Niigata 950-2181 (Japan)

    2010-03-26

    A highly hydrophilic, glutamate-rich protein was identified in the aqueous phenol extract from the cytosolic fraction of brine shrimp (Artemia franciscana) diapausing cysts and termed Artemia phenol soluble protein (PSP). Mass spectrometric analysis revealed the presence of many protein peaks around m/z 11,000, separated by 129 atomic mass units; this value corresponds to that of glutamate, which is strongly suggestive of heterogeneous polyglutamylation. Polyglutamylation has long been known as the functionally important post-translational modification of tubulins, which carry poly(L-glutamic acid) chains of heterogeneous length branching off from the main chain at the {gamma}-carboxy groups of a few specific glutamate residues. In Artemia PSP, however, Edman degradation of enzymatic peptides revealed that at least 13, and presumably 16, glutamate residues were modified by the attachment of a single L-glutamate, representing a hitherto undescribed type of post-translational modification: namely, multiple {gamma}-glutamylation or the addition of a large number of glutamate residues along the polypeptide chain. Although biological significance of PSP and its modification is yet to be established, suppression of in vitro thermal aggregation of lactate dehydrogenase by glutamylated PSP was observed.

  10. Inland hypersaline lakes and the brine shrimp Artemia as simple models for biodiversity analysis at the population level

    OpenAIRE

    Gajardo, G.M.; Sorgeloos, P; Beardmore, J.A.

    2006-01-01

    Biodiversity can be measured at different hierarchical levels, from genetic diversity within species to diversity of ecosystems, though policy-makers tend to use species richness. The 2010 goal of reducing biodiversity loss, agreed by the subscribers to the Convention on Biological Diversity, requires simple and reliable protocols to evaluate biodiversity at any level in a given ecosystem. Stakeholders, particularly policy makers, need to understand how ecosystem components interact to produc...

  11. Gynandromorphs of the brine shrimp Artemia parthenogenetica in Gahai Lake, Qingdao%孤雌生殖卤虫的雌雄嵌合体

    Institute of Scientific and Technical Information of China (English)

    刘凤岐; 相建海; 卜文俊; 纪炳纯; 刘安西

    2005-01-01

    在实验室条件下,培养了一个采自青海尕海湖的孤雌生殖卤虫(Artemiaparthenogenetica of Gahai)的克隆.该克隆包括3578个雌体和103个罕见雄体,在这些罕见雄体中发现二例雌雄嵌合体.其外部形态均表现为雄性,即具有正常的执握肢和外交接器,但在其体左侧出现了正常形态特征的卵细胞,表明在这两个外表为雄性的卤虫中有卵巢存在,为雌雄嵌合体.

  12. Survival of the probiotic bacteria Lactobacillus rhamnosus in seawater and its bioencapsulation in the brine shrimp Artemia

    OpenAIRE

    Claudia Ofelio; Alex Paltrinieri

    2014-01-01

    The probiotic Lactobacillus rhamnosus IMC 501® (Synbiotec Srl, Camerino, Italy) has demonstrated a positive effect in growth and early development of some fish species as clownfish (Amphiprion ocellaris, Cuvier 1830) and zebrafish (Danio rerio, Hamilton-Buchanan, 1822). The probiotic effects in A. ocellaris were an increase in body weight, a metamorphosis and skeletal head development acceleration and a reduction in the response to general stress (Avella et al. 2010). Besides this, an acceler...

  13. Diffusive properties of water in Artemia cysts as determined from quasi-elastic neutron scattering spectra

    International Nuclear Information System (INIS)

    Results have been obtained on the quasi-elastic spectra of neutrons scattered from pure water, 20% agarose gel (hydration four grams H2O per gram of dry solid) and cysts of the brine shrimp Artemia for hydrations between 0.10 and 1.2 grams H2O per gram of dry solids. The spectra were interpreted using a two-component model that included contributions from the covalently bonded protons and the hydration water, and a mobile water fraction. The mobile fraction was described by a jump-diffusion correlation function for the translation motion and a simple diffusive orientational correlation function. The results for the line widths γ(Q2) for pure water were in good agreement with previous measurements. The agarose results were consistent with NMR measurements that show a slightly reduced translational diffusion for the mobile water fraction. The Artemia results show that the translational diffusion coefficient of the mobile water fraction was greatly reduced from that of pure water. The line width was determined mainly by the rotational motion, which was also substantially reduced from the pure water value as determined from dielectric relaxation studies. The translational and rotational diffusion parameters were consistent with the NMR measurements of diffusion and relaxation. Values for the hydration fraction and the mean square thermal displacement 2> as determined from the Q-dependence of line areas were also obtained

  14. Habitat diversity and adaptation to environmental stress in encysted embryos of the crustacean Artemia

    Indian Academy of Sciences (India)

    Joshua A Tanguay; Reno C Reyes; James S Clegg

    2004-12-01

    Encysted embryos (cysts) of the brine shrimp, Artemia, provide excellent opportunities for the study of biochemical and biophysical adaptation to extremes of environmental stress in animals. Among other virtues, this organism is found in a wide variety of hypersaline habitats, ranging from deserts, to tropics, to mountains. One adaptation implicated in the ecological success of Artemia is p26, a small heat shock protein that previous evidence indicates plays the role of a molecular chaperone in these embryos. We add to that evidence here. We summarize recently published work on thermal tolerance and stress protein levels in embryos from the San Francisco Bay (SFB) of California inoculated into experimental ponds in southern Vietnam where water temperatures are much higher. New results on the relative contents of three stress proteins (hsp70, artemin and p26) will be presented along with data on cysts of A. tibetiana collected from the high plateau of Tibet about 4.5 km above sea level. Unpublished results on the stress protein artemin are discussed briefly in the context of this paper, and its potential role as an RNA chaperone. Interestingly, we show that the substantial tolerance of A. franciscana embryos to ultraviolet (UV) light does not seem to result from intracellular biochemistry but, rather, from their surrounding thick shell, a biophysical adaptation of considerable importance since these embryos receive heavy doses of UV in nature.

  15. Purification and characterization of a carboxymethyl cellulase from Artemia salina.

    Science.gov (United States)

    Zin, Hyun Woo; Park, Kwang-Hyun; Choi, Tae Jin

    2014-01-01

    Brine shrimp (Artemia salina) belong to a group of crustaceans that feed on microalgae and require a cellulase enzyme that can be used in ethanol production from marine algae. Protein with potential cellulase activity was purified and the activity analyzed under different conditions. After initial identification of cellulase activity by CMC cellulase, surface sterilization and PCR using 16s rRNA primers was conducted to confirm that the cellulase activity was not produced from contaminating bacteria. The enzyme was purified by ammonium sulfate fractionation, gel filtration, and ion exchange chromatography. After the final purification, a 70-fold increase in specific enzyme activity was observed. SDS-PAGE results revealed that the cellulase enzyme had a molecular mass of 96 kDa. Temperature, pH, and salinity values were found to be optimal at 55 °C, pH 8.0, and 600 mM NaCl, respectively. Specifically, the enzyme showed a fivefold increase in enzyme activity in seawater compared to 600 mM NaCl in phosphate buffer. Further analysis of the purified enzyme by molecular spectrometry showed no match to known cellulases, indicating this enzyme could be a novel halophilic cellulase that can be used for the production of bioethanol from marine macroalgae. PMID:24291747

  16. Study of model systems to test the potential function of Artemia group 1 late embryogenesis abundant (LEA) proteins.

    Science.gov (United States)

    Warner, Alden H; Guo, Zhi-hao; Moshi, Sandra; Hudson, John W; Kozarova, Anna

    2016-01-01

    Embryos of the brine shrimp, Artemia franciscana, are genetically programmed to develop either ovoviparously or oviparously depending on environmental conditions. Shortly upon their release from the female, oviparous embryos enter diapause during which time they undergo major metabolic rate depression while simultaneously synthesize proteins that permit them to tolerate a wide range of stressful environmental events including prolonged periods of desiccation, freezing, and anoxia. Among the known stress-related proteins that accumulate in embryos entering diapause are the late embryogenesis abundant (LEA) proteins. This large group of intrinsically disordered proteins has been proposed to act as molecular shields or chaperones of macromolecules which are otherwise intolerant to harsh conditions associated with diapause. In this research, we used two model systems to study the potential function of the group 1 LEA proteins from Artemia. Expression of the Artemia group 1 gene (AfrLEA-1) in Escherichia coli inhibited growth in proportion to the number of 20-mer amino acid motifs expressed. As well, clones of E. coli, transformed with the AfrLEA-1 gene, expressed multiple bands of LEA proteins, either intrinsically or upon induction with isopropyl-β-thiogalactoside (IPTG), in a vector-specific manner. Expression of AfrLEA-1 in E. coli did not overcome the inhibitory effects of high concentrations of NaCl and KCl but modulated growth inhibition resulting from high concentrations of sorbitol in the growth medium. In contrast, expression of the AfrLEA-1 gene in Saccharomyces cerevisiae did not alter the growth kinetics or permit yeast to tolerate high concentrations of NaCl, KCl, or sorbitol. However, expression of AfrLEA-1 in yeast improved its tolerance to drying (desiccation) and freezing. Under our experimental conditions, both E. coli and S. cerevisiae appear to be potentially suitable hosts to study the function of Artemia group 1 LEA proteins under environmentally

  17. Optimizing the co-feeding strategy of Persian sturgeon (Acipenser persicus larvae using Artemia nauplii and formulated diet

    Directory of Open Access Journals (Sweden)

    Naser Agh

    2013-07-01

    Full Text Available High mortality and labor costs are associated with first-feeding sturgeon culture, particularly during the period of dietary transition from live to formulated feed. Therefore we investigated the effects of various feeding treatments on the survival and growth of the Persian sturgeon (Acipenser persicus larvae during a 20-day culture period. Three replicate groups (250 fish/replicate of first-feeding larvae were fed according to four main feeding regimes: (1 live food (live nauplii of brine shrimp Artemia urmiana; (2 indirect transition (5 days live food followed by gradual transition to formulated diet; (3 direct transition (using different combinations of live and formulated diet from the start feeding onwards; (4 formulated feed (FD from the start feeding. Results indicated that growth and survival were higher in the indirect transition feeding regime than in other regimes. Based on our study, co-feeding of A. persicus should start five days after prior feeding with live food.

  18. May arsenic pollution contribute to limiting Artemia franciscana invasion in southern Spain?

    Science.gov (United States)

    Sánchez, Marta I; Petit, Cathleen; Martínez-Haro, Mónica; Taggart, Mark A; Green, Andy J

    2016-01-01

    Limited information exists regarding the complex interactions between biological invasions, pollution, and climate change. Most studies indicate that pollution tends to favor invasive species. Here, we provide evidence that arsenic (As) pollution may have a role in limiting the invasion of the exotic brine shrimp Artemia franciscana. We tested As toxicity in natural populations of Artemia parthenogenetica (a native taxon) and A. franciscana from localities in southern Spain with differing degrees of As contamination. Tests were conducted both under current mean temperature conditions (25 °C), and as per a future climate scenario (i.e., an increase in mean temperature of 4 °C). Acute toxicity was estimated on the basis of the median lethal concentration (at 24 h), and chronic toxicity was evaluated by measuring Artemia survival and growth under sublethal exposures (after 26 days). At 25 °C, native A. parthenogenetica from the highly polluted Odiel and Tinto estuary was much more resistant to acute As stress (LC50-24 h, 24.67 mg L(-1)) than A. franciscana (15.78 mg L(-1)) and A. parthenogenetica from unpolluted sites (12.04 mg L(-1))-suggesting that local adaptation to polluted conditions may occur. At 29 °C, resistance of A. parthenogenetica from Odiel decreased significantly, and there were no statistical differences in sensitivity between the three species/populations, suggesting that climate change may enhance the probability of invasion. Resistance increased with developmental stage from nauplii to adults, and was extremely high in cysts which still hatched at As concentrations of up to 6400 mg L(-1). Under sublethal chronic exposure A. franciscana performed better (survival and growth) than A. parthenogenetica, and both species experienced a faster growth when exposed to As, compared with unexposed (control) individuals, probably due to the hormesis. We discuss the ecological implications of our results. PMID:26925327

  19. Physical, biochemical and functional characterization of haemoglobin from three strains of Artemia.

    Science.gov (United States)

    Sugumar, Vasudevan; Munuswamy, Natesan

    2007-02-01

    The brine shrimp, Artemia, an inhabitant of coastal and inland salterns, encounter fluctuations in the salinity which in turn influences the oxygen availability of their habitat. Hence, experiments were performed to analyze variations in haemoglobin structure and patterns of three strains of Artemia from South India and also to reflect the effect of varying oxygen levels in their habitat. Haemoglobins were purified on a DEAE-Sephadex column and haemoglobin types were analyzed by comparing their relative mobility on a non-denaturing medium. Furthermore, their molecular masses were determined by gel filtration in Sepharose column and by dodecylsulfate polyacrylamide gel electrophoresis. Results clearly reveal the presence of three distinct extracellular haemoglobins Hb I, Hb II and Hb III in Tuticorin strain while the other strains displayed only trails or the complete absence of Hb III and Hb II. Estimated molecular masses of these haemoglobins are 235,000-250,000 Da. Denaturation of the reduced and alkylated haemoglobins revealed apparently one polypeptide chain with a molecular mass of 124,000 Da. Upon denaturing gel electrophoresis of native haemoglobin Hb II, it was found that the 124,000 Da, polypeptide was cleaved specifically into two unequally-sized fragments of 50,400 and 79,800 Da. With regard to oxygen affinity, Hb III has a very high affinity for oxygen, an almost negligible Bohr effect and a good physiological adaptation to temperature changes. By combining the three haemoglobins in different proportions Artemia strains must be able to withstand diverging environmental conditions. In particular, the absence of Hb III in Puthalam and its occurrence as a faint band in Thamaraikulam could be correlated to the oxygen levels of their habitats. PMID:17185017

  20. Efeito da oferta de náuplios de Artemia franciscana enriquecidos com ácidos graxos poliinsaturados sobre o desenvolvimento de pós-larvas do camarão marinho Farfantepenaeus paulensis Effect of poliunsaturated fatty acid enriched Artemia franciscana nauplii on development of Farfantepenaeus paulensis shrimp post-larvae

    Directory of Open Access Journals (Sweden)

    Cibele Soares Pontes

    2003-12-01

    Full Text Available O objetivo deste trabalho foi avaliar a eficácia da técnica de enriquecimento de náuplios de Artemia franciscana, em emulsões de ácidos graxos poliinsaturados (AGP para a alimentação de pós-larvas do camarão marinho Farfantepenaeus paulensis. Este procedimento visou o acréscimo dos ácidos eicosapentaenóico (EPA e docosahexaenóico (DHA, essenciais para organismos marinhos, mas deficientes na composição de náuplios provenientes de ecossistemas aquáticos continentais. Os náuplios foram divididos em cinco tratamentos: um grupo controle, composto por indivíduos recém-eclodidos, e quatro grupos enriquecidos cada um com as emulsões Selco, Super Selco, AlgaMac 2000 e emulsão formulada em laboratório à base de óleo de fígado de bacalhau, e então ofertados às pós-larvas. Foram comparados os efeitos das dietas quanto à taxa de sobrevivência, ao ganho de peso e à resistência ao estresse nos estádios de PL10 e de PL20. Observou-se que as emulsões Super Selco e Selco foram as que proporcionaram aumento mais destacado dos níveis de EPA e DHA nos náuplios. Entretanto, nenhuma das emulsões aplicadas induziu a diferenças significativas para os parâmetros estudados em comparação com as pós-larvas alimentadas com os náuplios do grupo de controle, indicando que o aumento nos níveis de EPA e DHA não exerceu influência na melhora do desenvolvimento de pós-larvas.The objective of this work was to evaluate the efficiency of Artemia franciscana nauplii, in poliunsturated fatty acid enriched emulsions, for marine shrimp (Farfantepenaeus paulensis postlarvae feeding. This proceeding aimed the addiction to their diets of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA, essential fatty acids for marine organisms, but scarce in nauplii originated in aquatic continental ecosystems. The nauplii were divided in five treatments: a control one with newly-hatched individuals and other four groups, each one enriched with the

  1. Nematicidal and Brine Shrimp Lethality of Secondary Metabolites from Marine-derived Fungi%海洋真菌杀虫活性的初步研究

    Institute of Scientific and Technical Information of China (English)

    肖永堂; 郑忠辉; 黄耀坚; 徐庆妍; 苏文金; 宋思扬

    2005-01-01

    对采集自浙江舟山海域底泥、福建省九龙江口红树林及福建省云霄县红树林共188株海洋真菌代谢产物的杀小杆线虫(Rhabditis sp.)和卤虫(brine shrimp)活性进行初步研究.筛选出#164菌株代谢产物对小杆线虫显示了较好的杀害活性,其LC90小于0.5 mg/mL.#122菌株代谢产物对卤虫显示了较强的麻痹效应.#305菌株代谢产物对卤虫的LC50仅为75 μg/mL.此外,对188株海洋真菌代谢产物的乙酰胆碱酯酶抑制活性进行研究,筛选出#229菌株代谢产物和#170菌株代谢产物具有较强的乙酰胆碱酯酶抑制活性.IC50分别为30μg/mL和25μg/mL,这些活性菌株具有产生杀线虫剂或乙酰胆碱酯酶抑制剂的特性.

  2. THE SCREENING ACTIVITY PARTS OF ACER TRUNCATUM BUNGE.AND OTHER PLANTS OF THE SAME GENUS BY THE BRINE SHRIMP LETAITY BIOASSAY%采用BSLB(Brine Shrimp Letality Bioassay)法对元宝枫(Acer truncatum Bunge.)及同属植物活性部位的筛选

    Institute of Scientific and Technical Information of China (English)

    魏希颖; 吕居娴; 李映丽; 贺浪冲

    2004-01-01

    本文通过BSLB法对元宝枫及同属植物不同部位的水提物进行了活性试验,得知:元宝枫的幼技、种皮的水提物具一定的生物致死活性;同属植物青榨槭叶和种子,秦岭槭、杈叶槭果翅的水提物也具一定的生物致死活性.本实验为元宝枫及同属植物进行进一步肿瘤细胞的体外培养试验及动物模型试验提供了科学依据.%By means of the brine shrimp lethality bioassay the authors study the watering abstracts activity of the A. truncatum Bunge. and the other plants of the same genus. The results indicate that the tender bark and seed skin of A. truncatum Bunge have the bioactivity. The leaves and seeds of A. dervidii Fr, the seed skin of A. robustum pax. have the same activity. The test offers some scientific basis for the further researches of anticancer experiments and animal model test outside the body of cell.

  3. Artemia (Crustacea, Anostraca in Chile: a review of basic and applied biology Artemia Crustacea, Anostraca en Chile: revisión de la biología básica y aplicada

    Directory of Open Access Journals (Sweden)

    Patricio De los Rios-Escalante

    2012-09-01

    Full Text Available The brine shrimp Artemia in Chile has been studied since the 1980s, initially on populations inhabiting shallow coastal and inland mountain ponds, and saltworks in northern and central Chile. Based on morphometric and molecular evidence, these populations were identified as A. franciscana. In the 1990s, A. persimilis was recorded from southern Patagonia, a species previously considered endemic to Argentina. Recently, two new populations of A.franciscana have been recorded, from one saline coastal pond in northern Chile and from a saltwork in central Chile. The scope for further research to increase both understanding of the strain characterization and basic population ecology descriptions of the Chilean brine shrimps and improve their conservation status is discussed. It is suggested that future studies should investigate first the management of local brine shrimp population for local aquaculture or conservation resources, other direction would be the effects of ultraviolet radiation (UVR exposition that is notoriously high in brine shrimp habitats. This last factor is very important because the UVR is an important mutagen on the genetic structure of the populations. In this scenario, it is suggest a carefully management for introduced brine shrimp populations for local aquaculture for avoid alterations in native populations that due their genetic isolation would need conservation procedures for avoid local extinctions.El camarón de salmuera o Artemia ha sido estudiado en Chile desde la década de 1980, las primeras descripciones de poblaciones fueron para lagunas someras en zonas costeras y de montana, y en salinas artificiales en la zona central y norte de Chile. Sobre la base de evidencias morfométricas y moleculares estas poblaciones fueron descritas como A. franciscana. En la década de 1990, se describió la presencia de A. persimilis en la zona sur de la Patagonia, lo cual fue una ampliación del rango de distribución significativa

  4. Trophic transfer of lead through a model marine four-level food chain: Tetraselmis suecica, Artemia franciscana, Litopenaeus vannamei, and Haemulon scudderi.

    Science.gov (United States)

    Soto-Jiménez, M F; Arellano-Fiore, C; Rocha-Velarde, R; Jara-Marini, M E; Ruelas-Inzunza, J; Páez-Osuna, F

    2011-08-01

    The objective of this investigation was to assess the transfer of lead (Pb) along an experimental, four-level food chain: Tetraselmis suecica (phytoplankton) → Artemia franciscana (crustacean, brine shrimp) → Litopenaeus vannamei (crustacean, white shrimp) → Haemulon scudderi (fish, grunt). T. suecica was exposed to a sublethal dose of Pb in solution and then used as the base of a marine food chain. Significant differences in Pb concentrations were found between exposed organisms of the different trophic levels and the control. Particularly, Pb concentrations in fish of the simulated trophic chain were two-to three times higher in the exposed specimens than in the control. Levels of Pb in phytoplankton showed a substantial increase with respect to the solution (level I), with bioconcentration factors averaging from 930 to 3630. In contrast, a strong decrease in Pb concentration from phytoplankton to zooplankton (level II) and from zooplankton to shrimp tissues (level III) was evidenced by bioaccumulation factors metal transfer observed in these two predators, Pb concentration in the grunt fish (level IV) was higher than in the shrimp (level III) (bioaccumulation factor >1.0). Some of the added Pb is transferred from the phytoplankton along the food chain, thus producing a net accumulation of Pb mainly in fish and, to a lesser extent, in shrimp tissues. Because Pb is one of the most pervasive contaminants in coastal ecosystems, its transference by way of diet and potential net accumulation in higher predators is of ecologic importance for marine life. In addition, because shrimp and adult Haemulon scudderi are commercially important resources, this issue is of particular relevance to the safety of marine products. PMID:21082317

  5. 40 CFR 799.2475 - 2-Mercaptobenzothiazole.

    Science.gov (United States)

    2010-07-01

    ... newly-hatched brine shrimp nauplii (Artemia salina) three times a day ad libitum, with excess food siphoned off daily. The minnow fry shall be fed live newly-hatched brine shrimp nauplii (Artemia salina)...

  6. Quaternary structure of Artemia haemoglobin II: analysis of T and C polymer alignment and interpolymer interface

    Directory of Open Access Journals (Sweden)

    Rawle Vincent L

    2007-04-01

    Full Text Available Abstract Background The brine shrimp Artemia expresses four different types of haemoglobin subunits namely C1, C2, T1 and T2. Two of these four subunits dimerize in different combinations to produce the three isoforms of the heterodimeric Artemia haemoglobin: HbI (C1 and C2, HbII (C1 and T2 and HbIII (T1 and T2. Previous biochemical, biophysical and computational analyses demonstrate that the T and C polymers are rings of nine concatenated globin domains, which are covalently joined by interdomain linkers. Two such rings stacked coaxially give the functional molecule. This research aimed to construct a quaternary structural model of Artemia HbII that shows the interpolymer interface and domain-domain alignment, using the MS3D (mass spectrometry for three dimensional analysis approach. This involved introducing chemical crosslinks between the two polymers, cleaving with trypsin and analyzing the resulting products by mass spectrometry. This was followed by computational analysis of the mass spectrometry data using the program SearchXlinks to identify putatively crosslinked peptides. Results Six putative EGS (ethylene glycol bis [succinimidylsuccinate] crosslinked tryptic peptides were identified. All of them support a model in which the EF helices of all domains are in contact along the interpolymer surface, and Domain 1 of the T-polymer aligns with Domain 1 of the C-polymer. Any two adjacent interpolymer domain pairs contact through the early Helix H and early Helix A. The orientation of domains is different from the subunit proposed model proposed previously by this group. Crosslinking with GMBS (N- [γ-maleimidobutyryloxy]succinimide ester was also performed, and the results show good agreement with this model. Conclusion The interpolymer EF-contact allows the hydrophobic E and F helices to be buried in the interface and therefore allow the complex to solubilize readily to facilitate efficient oxygen transport. Furthermore the EF-contact is a

  7. Avaliação da bioatividade dos extratos de cúrcuma (Curcuma longa L., Zingiberaceae em Artemia salina e Biomphalaria glabrata Bioactivity evaluation of the turmeric (Curcuma longa L., Zingiberaceae extracts in Artemia salina and Biomphalaria glabrata

    Directory of Open Access Journals (Sweden)

    Carlos R. M. da Silva Filho

    2009-12-01

    Full Text Available A cúrcuma é o rizoma limpo, em boas condições, seco e moído da Curcuma longa L., uma planta herbácea da família Zingiberaceae. Visando novas alternativas para o controle da esquistossomose, os extratos de Curcuma longa L. foram testados para a avaliação da atividade moluscicida contra caramujos adultos da espécie Biomphalaria glabrata, e toxicidade (ensaio de letalidade com Artemia salina. A oleoresina e o óleo essencial de cúrcuma foram ativos contra Artemia salina (CL50 = 80,43 e CL50 = 319,82 μg/mL, respectivamente e também ativos contra os indivíduos adultos de Biomphalaria glabrata (CL50 = 58,3 e CL50 = 46,73 μg/mL, respectivamente. A partir dos resultados obtidos pôde ser concluído que ambos os extratos podem constituir uma alternativa no controle da população desses caramujos e na redução da esquistossomose.The turmeric is the clean rhizome at good conditions, dried and powdered of Curcuma longa L., an herbaceous plant of Zingiberaceae family. Aiming new alternatives for Schistosomiasis control, the Curcuma longa L. extracts were tested for molluscicidal activity evaluation against adult snails of Biomphalaria glabrata specie, and the toxicity (Brine Shrimp Lethality-BSL-bioassay. The oleoresin and the essential oil of turmeric were active against Artemia salina (CL50 = 80.43 and CL50 = 319.82 μg.mL-1, respectively and also active against the adult snails of Biomphalaria glabrata (CL50 = 58.3 and CL50 = 46.73 μg.mL-1, respectively. From the obtained results it was concluded that both extracts can constitute an alternative to population control of these snails and in the reduction of Schistosomiasis.

  8. Identification of the glycerol kinase gene and its role in diapause embryo restart and early embryo development of Artemia sinica.

    Science.gov (United States)

    Cheng, Cheng; Yao, Feng; Chu, Bing; Li, Xuejie; Liu, Yan; Wu, Yang; Mei, Yanli; Wang, Peisheng; Hou, Lin; Zou, Xiangyang

    2014-03-01

    Glycerol kinase (GK) catalyzes the rate-limiting step in glycerol utilization by transferring a phosphate from ATP to glycerol, yielding glycerol 3-phosphate, which is an important intermediate for both energy metabolism and glycerolipid production. Artemia sinica has an unusual diapause process under stress conditions of high salinity, low temperature and lack of food. In the process, diapause embryos of A. sinica (brine shrimp) accumulate high concentrations of glycerol as a cryoprotectant to prevent low temperature damage to embryos. Upon embryo restart, glycerol is converted into glucose and other carbohydrates. Therefore, GK plays an important role in the diapause embryo restart process. However, the role of GK in diapause termination of embryo development in A. sinica remains unknown. In the present study, a 2096 bp full-length cDNA of gk from A. sinica (As-gk) was obtained, encoding putative 551 amino acids, 60.6 kDa protein. As a crucial enzyme in glycerol uptake and metabolism, GK has been conserved structurally and functionally during evolution. The expression pattern of As-gk was investigated by quantitative real-time PCR and Western blotting. Expression locations of As-gk were analyzed using in situ hybridization. As-gk was widely distributed in the early embryo and several main parts of Artemia after differentiation. The expression of As-GK was also induced by stresses such as cold exposure and high salinity. This initial research into the expression pattern and stress response of GK in Artemia provides a sound basis for further understanding of the function and regulation of genes in early embryonic development in A. sinica and the stress response. PMID:24365596

  9. Reactive oxygen species generated by a heat shock protein (Hsp) inducing product contributes to Hsp70 production and Hsp70-mediated protective immunity in Artemia franciscana against pathogenic vibrios.

    Science.gov (United States)

    Baruah, Kartik; Norouzitallab, Parisa; Linayati, Linayati; Sorgeloos, Patrick; Bossier, Peter

    2014-10-01

    The cytoprotective role of heat shock protein (Hsp70) described in a variety of animal disease models, including vibriosis in farmed aquatic animals, suggests that new protective strategies relying upon the use of compounds that selectively turn on Hsp genes could be developed. The product Tex-OE® (hereafter referred to as Hspi), an extract from the skin of the prickly pear fruit, Opuntia ficus indica, was previously shown to trigger Hsp70 synthesis in a non-stressful situation in a variety of animals, including in a gnotobiotically (germ-free) cultured brine shrimp Artemia franciscana model system. This model system offers great potential for carrying out high-throughput, live-animal screens of compounds that have health benefit effects. By using this model system, we aimed to disclose the underlying cause behind the induction of Hsp70 by Hspi in the shrimp host, and to determine whether the product affects the shrimp in inducing resistance towards pathogenic vibrios. We provide unequivocal evidences indicating that during the pretreatment period with Hspi, there is an initial release of reactive oxygen species (hydrogen peroxide and/or superoxide anion), generated by the added product, in the rearing water and associated with the host. The reactive molecules generated are the triggering factors responsible for causing Hsp70 induction within Artemia. We have also shown that Hspi acts prophylactically at an optimum dose regimen to confer protection against pathogenic vibrios. This salutary effect was associated with upregulation of two important immune genes, prophenoloxidase and transglutaminase of the innate immune system. These findings suggest that inducers of stress protein (e.g. Hsp70) are potentially important modulator of immune responses and might be exploited to confer protection to cultured shrimp against Vibrio infection. PMID:24950414

  10. Experimental taphonomy of Artemia reveals the role of endogenous microbes in mediating decay and fossilization.

    Science.gov (United States)

    Butler, Aodhán D; Cunningham, John A; Budd, Graham E; Donoghue, Philip C J

    2015-06-01

    Exceptionally preserved fossils provide major insights into the evolutionary history of life. Microbial activity is thought to play a pivotal role in both the decay of organisms and the preservation of soft tissue in the fossil record, though this has been the subject of very little experimental investigation. To remedy this, we undertook an experimental study of the decay of the brine shrimp Artemia, examining the roles of autolysis, microbial activity, oxygen diffusion and reducing conditions. Our findings indicate that endogenous gut bacteria are the main factor controlling decay. Following gut wall rupture, but prior to cuticle failure, gut-derived microbes spread into the body cavity, consuming tissues and forming biofilms capable of mediating authigenic mineralization, that pseudomorph tissues and structures such as limbs and the haemocoel. These observations explain patterns observed in exceptionally preserved fossil arthropods. For example, guts are preserved relatively frequently, while preservation of other internal anatomy is rare. They also suggest that gut-derived microbes play a key role in the preservation of internal anatomy and that differential preservation between exceptional deposits might be because of factors that control autolysis and microbial activity. The findings also suggest that the evolution of a through gut and its bacterial microflora increased the potential for exceptional fossil preservation in bilaterians, providing one explanation for the extreme rarity of internal preservation in those animals that lack a through gut. PMID:25972468

  11. Gut reaction by heartless shrimps: experimental evidence for the role of the gut in generating circulation before cardiac ontogeny.

    Science.gov (United States)

    Spicer, John I

    2006-12-22

    Before the appearance of a functional heart in many invertebrate species, the assumption was that general body movements provide circulatory function. Consequently, I investigated the frequency of gut movements in the brine shrimp, Artemia franciscana, immediately post-hatch to the point when a functional heart appeared. Prior to cardiac ontogeny, movements of internal musculature and gut provided pre-cardiac circulatory currents with the rate of gut movements increasing when swimming limbs were impeded. There was also some evidence that gut movements were responsive to low oxygen, indicating a possible regulatory function for the gut in early circulation. Overall, this suggests that general body movements are not always adequate to provide internal circulation in small, heartless individuals. PMID:17148293

  12. Kinetic properties and heme pocket structure of two domains of the polymeric hemoglobin of Artemia in comparison with the native molecule.

    Science.gov (United States)

    Borhani, Heshmat Akbari; Berghmans, Herald; Trashin, Stanislav; De Wael, Karolien; Fago, Angela; Moens, Luc; Habibi-Rezaei, Mehran; Dewilde, Sylvia

    2015-10-01

    In this project, we studied some physicochemical properties of two different globin domains of the polymeric hemoglobin of the brine shrimp Artemia salina and compared them with those of the native molecule. Two domains (AsHbC1D1 and AsHbC1D5) were cloned and expressed in BL21(DE3)pLysS strain of Escherichia coli. The recombinant proteins as well as the native hemoglobin (AfHb) were purified from bacteria and frozen Artemia, respectively by standard chromatographic methods and assessed by SDS-PAGE. The heme environment of these proteins was studied by optical spectroscopy and ligand-binding kinetics (e.g. CO association and O2 binding affinity) were measured for the two recombinant proteins and the native hemoglobin. This indicates that the CO association rate for AsHbC1D1 is higher than that of AsHbC1D5 and AfHb, while the calculated P50 value for AsHbC1D1 is lower than that of AsHbC1D5 and AfHb. The geminate and bimolecular rebinding parameters indicate a significant difference between both domains. Moreover, EPR results showed that the heme pocket in AfHb is in a more closed conformation than the heme pocket in myoglobin. Finally, the reduction potential of -0.13V versus the standard hydrogen electrode was determined for AfHb by direct electrochemical measurements. It is about 0.06V higher than the potential of the single domain AsHbC1D5. This work shows that each domain in the hemoglobin of Artemia has different characteristics of ligand binding. PMID:26004089

  13. Research on the acute toxicity of imidazolium ionic liquids on the brine shrimp%咪唑类离子液体系列对卤虫的急性毒性研究

    Institute of Scientific and Technical Information of China (English)

    卢珩俊; 陆胤; 徐冬梅; 魏超; 陈梅兰

    2011-01-01

    In this paper, the effects of three imidazolium ionic liquids, 1-butyl-, 1-octyl- and 1-dodecyl-3-methylimidazolium chloride on the inhibiting concentration to the growth of brine shrimp in artificial sea water were carefully studied.At the same time, toxic organics such as methanol and acetonitrile and toxic inorganics like potassium dichromate were selected as positive control for the investigation of the effect of ILs on the brine shrimp.Dose-response curve fittings were established for the ionic liquids and the positive control toxins.The experimental results showed that with increasing the alkyl chain length of the ionic liquids, their toxicity to brine shrimp accordingly increased (LC50-24h values were 171.1, 133.6, 17.76μg/mL for the three ionic liquids, respectively).The LC50-24h values of the three imidazolium ionic liquids were found to be 10-2 to 10-3 of the values of methanol and acetonitrile while being much close to that of potassium dichromate.%选取卤虫作为实验生物,研究了1-丁基,1-辛基,1-十二烷基-3甲基咪唑盐酸盐([Cnmim][C1](n=4,8,12))3种离子液体的暴露对卤虫个体存活率的影响.同时,选取了实验室常用的有机试剂甲醇和乙腈,无机化学品重铬酸钾作为阳性对照.根据剂量效应曲线的拟合结果发现.受试离子液体系列随着咪唑环上烃基侧链碳原子数的增加,对卤虫的毒性效应也相应增强,3种离子液体对卤虫的LC50-24h依次为171.1,133.6,17.76μg/mL.离子液体对卤虫的LC50-24h比甲醇(LC50-24h=84.83mg/mL)和乙腈(LC50-24h=52.84mg/mL)低了2~3个数量级,重铬酸钾对卤虫的(LC50-24h=16.87μg/mL)与离子液体对卤虫的LC50-24h处于同一水平.

  14. Predicted sub-populations in a marine shrimp proteome as revealed by combined EST and cDNA data from multiple Penaeus species

    Directory of Open Access Journals (Sweden)

    Kotewong Rattanawadee

    2010-11-01

    Full Text Available Abstract Background Many species of marine shrimp in the Family Penaeidae, viz. Penaeus (Litopenaeus vannamei, Penaeus monodon, Penaeus (Fenneropenaeus chinensis, and Penaeus (Marsupenaeus japonicus, are animals of economic importance in the aquaculture industry. Yet information about their DNA and protein sequences is lacking. In order to predict their collective proteome, we combined over 270,000 available EST and cDNA sequences from the 4 shrimp species with all protein sequences of Drosophila melanogaster and Caenorhabditis elegans. EST data from 4 other crustaceans, the crab Carcinus maenas, the lobster Homarus americanus (Decapoda, the water flea Daphnia pulex, and the brine shrimp Artemia franciscana were also used. Findings Similarity searches from EST collections of the 4 shrimp species matched 64% of the protein sequences of the fruit fly, but only 45% of nematode proteins, indicating that the shrimp proteome content is more similar to that of an insect than a nematode. Combined results with 4 additional non-shrimp crustaceans increased matching to 78% of fruit fly and 56% of nematode proteins, suggesting that present shrimp EST collections still lack sequences for many conserved crustacean proteins. Analysis of matching data revealed the presence of 4 EST groups from shrimp, namely sequences for proteins that are both fruit fly-like and nematode-like, fruit fly-like only, nematode-like only, and non-matching. Gene ontology profiles of proteins for the 3 matching EST groups were analyzed. For non-matching ESTs, a small fraction matched protein sequences from other species in the UniProt database, including other crustacean-specific proteins. Conclusions Shrimp ESTs indicated that the shrimp proteome is comprised of sub-populations of proteins similar to those common to both insect and nematode models, those present specifically in either model, or neither. Combining small EST collections from related species to compensate for their

  15. Click one pot synthesis, spectral analyses, crystal structures, DFT studies and brine shrimp cytotoxicity assay of two newly synthesized 1,4,5-trisubstituted 1,2,3-triazoles

    Science.gov (United States)

    Ahmed, Muhammad Naeem; Yasin, Khawaja Ansar; Ayub, Khurshid; Mahmood, Tariq; Tahir, M. Nawaz; Khan, Bilal Ahmad; Hafeez, Muhammad; Ahmed, Madiha; ul-Haq, Ihsan

    2016-02-01

    Methyl-2-(1-benzyl-4-phenyl-1H-1,2,3-triazol-5-yl)-2-oxoacetate (1) and ethyl-2-(1-benzyl-4-phenyl-1H-1,2,3-triazol-5-yl)-2-oxoacetate (2) were synthesized by one pot three component strategy, and characterized by FT-IR, NMR (1H and 13C) spectroscopy and TOF-MS spectrometry. Finally, the structures were unequivocally confirmed by single crystal X-ray diffraction analyses. Both compounds, 1 and 2 exist in monoclinic crystal packing having space group P21/n and P21/c, respectively. Crystal structures investigations revealed that the molecular structures of the title compounds are stabilized by weak intermolecular hydrogen bonding interactions to form dimers. Density functional theory (DFT) calculations were performed not only to compare with the experimental spectroscopic results but also to probe structural properties. The molecular electrostatic potential (MEP) mapped over the entire stabilized geometries of the molecules delivered information about the electrophilic and nucleophilic sites. Furthermore, frontier molecular orbital analysis gave the idea about stability and reactivity of compounds. Both compounds were also screened for brine shrimp cytotoxicity assay.

  16. Oxygen-binding characteristics of three extracellular haemoglobins of Artemia salina.

    Science.gov (United States)

    D'Hondt, J; Moens, L; Heip, J; D'Hondt, A; Kondo, M

    1978-06-01

    The oxygen-binding characteristics of the three extracellular haemoglobins of brine shrimp (Artemia salina) were studied in vitro by using highly purified preparations. Haemoglobin I is induced last in the development of brine shrimps when functional gills are formed. It has the lowest oxygen affinity (p(50) 5.34mmHg), an intermediate Bohr effect (ø -0.09 at 20 degrees C) above pH8 and a temperature-sensitivity (DeltaH -44.8 to -45.6kJ/mol at pH8-9) comparable with those observed with other invertebrate haemoglobins [Weber & Heidemann (1977) Comp. Biochem. Physiol. A57, 151-155]. Haemoglobin II, which is the first to be induced, soon after hatching of nauplius larvae, persists generally throughout the whole adult life. It has an intermediate oxygen affinity (p(50) 3.7mmHg), the highest Bohr effect (ø -0.21 at 20 degrees C) above pH8 and a similar temperature-sensitivity (DeltaH -46.0 to -54.8kJ/mol at pH8-9) as haemoglobin I. However, haemoglobin III, which is induced second several hours after the induction of haemoglobin II but disappearing from the haemolymph in the middle of adult life, has the highest oxygen affinity (p(50) 1.8mmHg), the lowest Bohr effect (ø -0.03 at 20 degrees C) above pH8.5 and a high resistance against temperature variation between 10 and 25 degrees C at pH8.5-9 (DeltaH -22.6 to -23.0kJ/mol). At pH7.5-8, haemoglobin III exhibits a similar temperature-sensitivity under 30 degrees C as do other haemoglobins. All three haemoglobins have a rather low co-operativity, with Hill coefficients (h 1.6-1.9 at pH8.5), which are dependent on both pH and temperature. The highest co-operativity was observed at 20 degrees C and pH9 for haemoglobins I and II, whereas it was at 27 degrees C and pH8.5 for haemoglobin III. Thus the oxygen-binding behaviour of haemoglobin III in vitro is significantly different from those of haemoglobins I and II and indicates possibly its specific physiological role in vivo in the adaptive process in the natural

  17. Comparative study of the assay of Artemia salina L. and the estimate of the medium lethal dose (LD50 value) in mice, to determine oral acute toxicity of plant extracts.

    Science.gov (United States)

    Logarto Parra, A; Silva Yhebra, R; Guerra Sardiñas, I; Iglesias Buela, L

    2001-09-01

    Artemia salina L. (Artemiidae), the brine shrimp larva, is an invertebrate used in the alternative test to determine toxicity of chemical and natural products. In this study the Medium Lethal Concentrations (LC50 value) of 20 plant extracts, Aloe vera (L.) Burm. F. (Aloeaceae), Artemisia absinthium L. (Asteraceae); Citrus aurantium L. (Rutaceae); Cymbopogon citratus (DC. Ex Nees) Stapf (Poaceae); Datura stramonium L. (Solanaceae); Justicia pectoralis Jacq. (Acanthaceae); Musa x paradisiaca L. (Musaceae); Ocimum basilicum L.; O. gratissimum L.; O. tenuiflorum L. (Lamiaceae); Pimenta dioica (L.) Merr. (Myrtaceae); Piper auritum Kunth (Piperaceae); Plantago major L. (Plantaginaceae); Plectranthus amboinicus (Lour.) Spreng. (Lamiaceae); Ruta graveolens L. (Rutaceae); Senna alata (L.) Roxb. (Fabaceae); Stachytarpheta jamaicensis (L.) Vahl (Verbenaceae); and Thuja occidentalis L. (Cupressaceae), were determined using Artemia salina L. (Artemiidae), with the objective of relating the results to the LD50 values reported in mice (tested at three concentrations: 10, 100, and 1000 microg/mL, for each extract). We found good correlation between the in vivo and the in vitro tests (r = 0.85 p < 0.05), and this method is a useful tool for predicting oral acute toxicity in plant extracts. PMID:11695884

  18. Does a Change from Whole to Powdered Food (Artemia franciscana eggs Increase Oviposition in the Ladybird Coleomegilla maculata?

    Directory of Open Access Journals (Sweden)

    Eric W. Riddick

    2015-09-01

    Full Text Available The limited availability of alternative foods to replace natural prey hinders cost-effective mass production of ladybird beetles for augmentative biological control. We compared the effects of powdered vs. whole Artemia franciscana (A. franciscana (brine shrimp eggs with or without a dietary supplement on development and reproduction of Coleomegilla maculata (C. maculata (Coleoptera: Coccinellidae. We tested the hypotheses that (1 powdered A. franciscana eggs are more suitable than whole eggs; and (2 palmitic acid, a common fatty acid in natural prey, i.e., aphids, is an effective dietary supplement. Development time, pre-imaginal survival, sex ratio, and body weight of adults did not differ significantly amongst individuals fed powdered vs. whole eggs, with or without 5% palmitic acid. Significantly more oviposition occurred when females were fed powdered eggs than whole eggs and powdered eggs with 5% palmitic acid than whole eggs with or without 5% palmitic acid. A weak functional relationship was found between pre-oviposition time and total oviposition by females fed powdered eggs with 5% palmitic acid; pre-oviposition time decreased as oviposition increased. Food treatments had no significant differential effect on progeny (egg hatch rate. In conclusion, a simple change in A. franciscana egg texture and particle size (i.e., blending whole eggs into a dust-like powder increases oviposition in C. maculata. Supplementing powdered eggs with 5% palmitic acid might accelerate oogenesis (egg maturation in some females.

  19. Primary Screening of the Bioactivity of Brackishwater Cyanobacteria: Toxicity of Crude Extracts to Artemia salina Larvae and Paracentrotus lividus Embryos

    Directory of Open Access Journals (Sweden)

    Viviana R. Lopes

    2010-03-01

    Full Text Available Cyanobacteria are a diverse group of Gram-negative bacteria that produce an array of secondary compounds with selective bioactivity against vertebrates, invertebrates, plants, microalgae, fungi, bacteria, viruses and cell lines. The aim of this study was to assess the toxic effects of aqueous, methanolic and hexane crude extracts of benthic and picoplanktonic cyanobacteria isolated from estuarine environments, towards the nauplii of the brine shrimp Artemia salina and embryos of the sea urchin Paracentrotus lividus. The A. salina lethality test was used as a frontline screen and then complemented by the more specific sea urchin embryo-larval assay. Eighteen cyanobacterial isolates, belonging to the genera Cyanobium, Leptolyngbya, Microcoleus, Phormidium, Nodularia, Nostoc and Synechocystis, were tested. Aqueous extracts of cyanobacteria strains showed potent toxicity against A. salina, whereas in P. lividus, methanolic and aqueous extracts showed embryo toxicity, with clear effects on development during early stages. The results suggest that the brackishwater cyanobacteria are producers of bioactive compounds with toxicological effects that may interfere with the dynamics of invertebrate populations.

  20. Reporting a new siderophore based Ca(2+) selective chemosensor that works as a staining agent in the live organism Artemia.

    Science.gov (United States)

    Raju, M; Nair, Ratish R; Raval, Ishan H; Haldar, Soumya; Chatterjee, Pabitra B

    2015-11-21

    A Ca(2+)-specific chemosensor involving acyclic non-ether and non-carboxylato-type metal chelating ligands is rare. The tetradentate OONO artificial receptor, HL, possessing a sulfur-containing intermediate siderophore aeruginic acid, tethered to a rhodamine 6G based signalling unit in a single molecule has been synthesized. The fluoroionophore required excitation in the visible wavelength (510 nm) and showed highly selective and sensitive detection of Ca(2+) ions in 100% water solution in HEPES buffer at physiological pH (7.4). The probe HL, with LOD as low as 70 nM, behaves reversibly and showed nearly 17-fold enhanced selectivity for Ca(2+) over other cell abundant alkali and alkaline metal ions such as Na(+), K(+), Li(+), and Mg(2+) without any intervention. Job's plot, (1)H NMR titration and ESI-MS data provided corroborative evidence in support of 1 : 1 association between HL and Ca(2+). From a wide range of transition and heavy metal ions series, HL also binds Cu(2+). However, the use of l-cysteine removes the interference from Cu(2+) and results in highly selective detection specificity of HL for Ca(2+). As a reversible "off-on-off" fluorescent chemosensor, it is possible to detect Ca(2+) at as low as 5 μM in the midgut region of the gastrointestinal tract of the live animal Artemia, a brine shrimp. PMID:26460620

  1. Depression of nuclear transcription and extension of mRNA half-life under anoxia in Artemia franciscana embryos.

    Science.gov (United States)

    van Breukelen, F; Maier, R; Hand, S C

    2000-04-01

    Transcriptional activity, as assessed by nuclear run-on assays, was constant during 10 h of normoxic development for embryos of the brine shrimp Artemia franciscana. Exposure of embryos to only 4 h of anoxia resulted in a 79.3+/-1 % decrease in levels of in-vivo-initiated transcripts, and transcription was depressed by 88. 2+/-0.7 % compared with normoxic controls after 24 h of anoxia (means +/- s.e.m., N=3). Initiation of transcription was fully restored after 1 h of normoxic recovery. Artificially lowering the intracellular pH of aerobic embryos to the value reflective of anoxia (pH 6.7) showed that acidification alone explained over half the transcriptional arrest. Initiation of transcription was not rescued by application of 80 % carbon monoxide under anoxia, which suggests that heme-based oxygen sensing is not involved in this global arrest. When these transcriptional data are combined with the finding that mRNA levels are unchanged for at least 6 h of anoxia, it is clear that the half-life of mRNA is extended at least 8.5-fold compared with that in aerobic embryos. In contrast to the activation of compensatory mechanisms to cope with anoxia that occurs in mammalian cells, A. franciscana embryos enter a metabolically depressed state in which gene expression and mRNA turnover are cellular costs apparently not compatible with survival and in which extended tolerance supercedes the requirement for continued metabolic function. PMID:10708633

  2. Assessment of Euphorbia hirta L. Leaf, Flower, Stem and Root Extracts for Their Antibacterial and Antifungal Activity and Brine Shrimp Lethality

    Directory of Open Access Journals (Sweden)

    Santhanam Amutha

    2010-08-01

    zones ranged between 16–29 mm. Leaves extract inhibited the growth of all tested microorganisms with large zones of inhibition, followed by that of flowers, which also inhibited all the bacteria except C. albicans. The most susceptible microbes to all extracts were S. aureus and Micrococcus sp. Root extract displayed larger inhibition zones against Gram positive bacteria than Gram negative bacteria and had larger inhibition zones compared to stem extract. The lowest MIC values were obtained with E. coli and C. albicans (3.12 mg/mL, followed by S. aureus (12.50 mg/mL and P. mirabilis (50.00 mg/mL. All the other bacteria had MIC values of 100.00 mg/mL. Scanning Electron Microscopic (SEM studies revealed that the cells exposed to leaf extract displayed a rough surface with multiple blends and invaginations which increased with increasing time of treatment, and cells exposed to leaf extract for 36 h showed the most damage, with abundant surface cracks which may be related to final cell collpase and loss of function. Time-kill assay of C. albicans indicated a primarily fungicidal effect at 1- and 2-fold MIC. E. hirta extracts had LC50 values of 0.71, 0.66, 0.41 and 0.03 mg/mL for stems, leaves, roots and flowers, respectively against Artemia salina. Hence, these plants can be used to discover new bioactive natural products that may serve as leads in the development of new pharmaceuticals.

  3. STUDY OF A DNA SEQUENCE FROM BRINE SHRIMP ARTEMIA CONTAINING A NOVEL DM DOMAIN%卤虫中编码DM结构域的DNA序列的克隆和初步研究(简报)

    Institute of Scientific and Technical Information of China (English)

    曾辉; 宋文芹; 陈瑞阳

    2004-01-01

    性别决定的分子机制复杂多样,但是处于动物性别决定的基因调控网络底部的一些调控基因具有相当高的保守性。doublesex(dsx)基因和male abnomal-3(mab-3)基因分别是果蝇(Drosophila melanogaster)和线虫(Caenorhabditis elegans)性别决定调控途径末端的重要基因,对这两个基因序列的比较导致了DM结构域的发现,它是已知在性别发育过程中最为保守的DNA结合结构域。目前,已

  4. Liposomes with diverse compositions are protected during desiccation by LEA proteins from Artemia franciscana and trehalose.

    Science.gov (United States)

    Moore, Daniel S; Hansen, Richard; Hand, Steven C

    2016-01-01

    Intracellular accumulation of Late Embryogenesis Abundant (LEA) proteins and the disaccharide trehalose is associated with cellular desiccation tolerance in a number of animal species. Two LEA proteins from anhydrobiotic embryos of the brine shrimp Artemia franciscana were tested for the ability to protect liposomes of various compositions against desiccation-induced damage in the presence and absence of trehalose. Damage was assessed by carboxyfluorescein leakage after drying and rehydration. Further, using a cytoplasmic-localized (AfrLEA2) and a mitochondrial-targeted (AfrLEA3m) LEA protein allowed us to evaluate whether each may preferentially stabilize membranes of a particular lipid composition based on the protein's subcellular location. Both LEA proteins were able to offset damage during drying of liposomes that mimicked the lipid compositions of the inner mitochondrial membrane (with cardiolipin), outer mitochondrial membrane, and the inner leaflet of the plasma membrane. Thus liposome stabilization by AfrLEA3m or AfrLEA2 was not dependent on lipid composition, provided physiological amounts of bilayer and non-bilayer-forming lipids were present (liposomes with a non-biological composition of 100% phosphatidylcholine were not protected by either protein). Additive protection by LEA proteins plus trehalose was dependent on the lipid composition of the target membrane. Minimal additional damage occurred to liposomes stored at room temperature in the dried state for one week compared to liposomes rehydrated after 24h. Consistent with the ability to stabilize lipid bilayers, molecular modeling of the secondary structures for AfrLEA2 and AfrLEA3m revealed bands of charged amino acids similar to other amphipathic proteins that interact directly with membranes. PMID:26518519

  5. 78 FR 50385 - Certain Frozen Warmwater Shrimp from India: Final Affirmative Countervailing Duty Determination

    Science.gov (United States)

    2013-08-19

    ... Warmwater Shrimp From India: Preliminary Countervailing Duty Determination, 78 FR 33344 (June 4, 2013... scope of this investigation does not include brine-frozen shrimp.\\4\\ We have ] addressed this request..., Thailand, and Socialist Republic of Vietnam--Final Scope Memorandum Regarding Onboard Brine-Frozen...

  6. 78 FR 50389 - Certain Frozen Warmwater Shrimp From Ecuador: Final Affirmative Countervailing Duty Determination

    Science.gov (United States)

    2013-08-19

    ...: Preliminary Negative Countervailing Duty Determination, 78 FR 33347 (June 4, 2013) (Preliminary Determination... investigation does not include ] brine-frozen shrimp.\\4\\ We have addressed this request and comments thereon in... Socialist Republic of Vietnam--Final Scope Memorandum Regarding Onboard Brine-Frozen Shrimp,'' which...

  7. Little Shrimp, Big Results: A Model of an Integrative, Cross-Curricular Activity

    Science.gov (United States)

    Ackerson, Nicole; Piser, Carol; Walka, Keith

    2010-01-01

    This integrative, cross-curricular lab engages middle school biology students in an exercise involving ecology, arthropod biology, and mathematics. Students research the anatomy and behavioral patterns of a species of brine shrimp, compare the anatomy of adult and juvenile brine shrimp, and graph and interpret results. In this article, the authors…

  8. 78 FR 50387 - Certain Frozen Warmwater Shrimp From the Socialist Republic of Vietnam: Final Affirmative...

    Science.gov (United States)

    2013-08-19

    ...: Preliminary Countervailing Duty Determination, 78 FR 33342 (June 4, 2013) (Preliminary Determination). This... investigation does not include brine-frozen shrimp.\\4\\ We have addressed this request and comments thereon in... Socialist Republic of Vietnam--Final Scope Memorandum Regarding Onboard Brine-Frozen Shrimp,'' which...

  9. Isolation of TDA-producing Phaeobacter strains from sea bass larval rearing units and their probiotic effect against pathogenic Vibrio spp. in Artemia cultures.

    Science.gov (United States)

    Grotkjær, Torben; Bentzon-Tilia, Mikkel; D'Alvise, Paul; Dourala, Nancy; Nielsen, Kristian Fog; Gram, Lone

    2016-05-01

    Fish-pathogenic Vibrio can cause large-scale crashes in marine larval rearing units and, since the use of antibiotics can result in bacterial antibiotic resistance, new strategies for disease prevention are needed. Roseobacter-clade bacteria from turbot larval rearing facilities can antagonize Vibrio anguillarum and reduce mortality in V. anguillarum-infected cod and turbot larvae. In this study, it was demonstrated that antagonistic Roseobacter-clade bacteria could be isolated from sea bass larval rearing units. In addition, it was shown that they not only antagonized V. anguillarum but also V. harveyi, which is the major bacterial pathogen in crustaceans and Mediterranean sea bass larvae cultures. Concomitantly, they significantly improved survival of V. harveyi-infected brine shrimp. 16S rRNA gene sequence homology identified the antagonists as Phaeobacter sp., and in silico DNA-DNA hybridization indicated that they could belong to a new species. The genomes contained genes involved in synthesis of the antibacterial compound tropodithietic acid (TDA), and its production was confirmed by UHPLC-TOFMS. The new Phaeobacter colonized live feed (Artemia) cultures and reduced Vibrio counts significantly, since they reached only 10(4)CFUmL(-1), as opposed to 10(8)CFUmL(-1) in non-Phaeobacter treated controls. Survival of V. anguillarum-challenged Artemia nauplii was enhanced by the presence of wild type Phaeobacter compared to challenged control cultures (89±1.0% vs 8±3.2%). In conclusion, TDA-producing Phaeobacter isolated from Mediterranean marine larviculture are promising probiotic bacteria against pathogenic Vibrio in crustacean live-feed cultures for marine fish larvae. PMID:26922490

  10. Motion control of a population of Artemias

    Directory of Open Access Journals (Sweden)

    L. Fortuna

    2010-06-01

    Full Text Available In this work, the collective behavior of Artemia Salina is studied both experimentally and theoretically. Several experiments have been designed to investigate the Artemia motion under different environment conditions. From the results of such experiments, a strategy to control the direction of motion of an Artemia population, by exploiting their sensitivity to light, has been derived and then implemented.

  11. The effects of dietary administration with chemical treated Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates in Artemia

    Directory of Open Access Journals (Sweden)

    Behnam Shekarchi

    2016-02-01

    Full Text Available Objective: To investigate the biological effects of β-glucans in cell wall of new identified strain Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates, in Artemia as model organism. Methods: All yeasts used in the present study were isolated from Rainbow trout intestine and then cultured in yeast extract-peptone-glycerol medium. Activation of β-glucan in yeasts was performed by chemical treatment with 2-mercaptoethanol (2ME (3.5% v/v. Then nauplii and larvae individuals of Artemia urmiana and Artemia franciscana (two different species of Artemia as test organisms were fed with 2ME-treated yeasts during the culture. At the end of experiment, after feeding individual length (total length and growth rate in adult individuals of Artemia was measured. Results: Following this administration, growth in both species of Artemia was improved (P < 0.05. So, the results showed that Artemia urmiana adults individuals that fed with 2MEtreated yeasts had the highest growth and total length. These results were confirmed with growth measurement in adult individuals of Artemia. Conclusions: This study suggested that 2ME-treated Saccharomyces cerevisiae strain YG3-1 yeasts can be used for enhancing the growth of other aquatic invertebrates like shrimps as probiotic supplement and growth promoter.

  12. High surface adsorption properties of carbon-based nanomaterials are responsible for mortality, swimming inhibition, and biochemical responses in Artemia salina larvae.

    Science.gov (United States)

    Mesarič, Tina; Gambardella, Chiara; Milivojević, Tamara; Faimali, Marco; Drobne, Damjana; Falugi, Carla; Makovec, Darko; Jemec, Anita; Sepčić, Kristina

    2015-06-01

    We investigated the effects of three different carbon-based nanomaterials on brine shrimp (Artemia salina) larvae. The larvae were exposed to different concentrations of carbon black, graphene oxide, and multiwall carbon nanotubes for 48 h, and observed using phase contrast and scanning electron microscopy. Acute (mortality) and behavioural (swimming speed alteration) responses and cholinesterase, glutathione-S-transferase and catalase enzyme activities were evaluated. These nanomaterials were ingested and concentrated in the gut, and attached onto the body surface of the A. salina larvae. This attachment was responsible for concentration-dependent inhibition of larval swimming, and partly for alterations in the enzyme activities, that differed according to the type of tested nanomaterials. No lethal effects were observed up to 0.5mg/mL carbon black and 0.1mg/mL multiwall carbon nanotubes, while graphene oxide showed a threshold whereby it had no effects at 0.6 mg/mL, and more than 90% mortality at 0.7 mg/mL. Risk quotients calculated on the basis of predicted environmental concentrations indicate that carbon black and multiwall carbon nanotubes currently do not pose a serious risk to the marine environment, however if uncontrolled release of nanomaterials continues, this scenario can rapidly change. PMID:25889088

  13. High surface adsorption properties of carbon-based nanomaterials are responsible for mortality, swimming inhibition, and biochemical responses in Artemia salina larvae

    Energy Technology Data Exchange (ETDEWEB)

    Mesarič, Tina, E-mail: tina.mesaric84@gmail.com [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Gambardella, Chiara, E-mail: chiara.gambardella@ge.ismar.cnr.it [Institute of Marine Sciences, National Research Council, Genova (Italy); Milivojević, Tamara, E-mail: milivojevictamara@gmail.com [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Faimali, Marco, E-mail: marco.faimali@ismar.cnr.it [Institute of Marine Sciences, National Research Council, Genova (Italy); Drobne, Damjana, E-mail: damjana.drobne@bf.uni-lj.si [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Centre of Excellence in Nanoscience and Nanotechnology (CO Nanocentre), Ljubljana (Slovenia); Centre of Excellence in Advanced Materials and Technologies for the Future (CO NAMASTE), Ljubljana (Slovenia); Falugi, Carla, E-mail: carlafalugi@hotmail.it [Department of Earth, Environment and Life Sciences, University of Genova, Genova (Italy); Makovec, Darko, E-mail: darko.makovec@ijs.si [Jožef Stefan Institute, Jamova 39, 1000 Ljubljana (Slovenia); Jemec, Anita, E-mail: anita.jemec@bf.uni-lj.si [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia); Sepčić, Kristina, E-mail: kristina.sepcic@bf.uni-lj.si [Department of Biology, Biotechnical Faculty, University of Ljubljana (Slovenia)

    2015-06-15

    Highlights: • Carbon-based nanomaterials adsorb onto the body surface of A. salina larvae. • Surface adsorption results in concentration–dependent inhibition of larval swimming. • Carbon-based nanomaterials induce no significant mortality of A. salina larvae. - Abstract: We investigated the effects of three different carbon-based nanomaterials on brine shrimp (Artemia salina) larvae. The larvae were exposed to different concentrations of carbon black, graphene oxide, and multiwall carbon nanotubes for 48 h, and observed using phase contrast and scanning electron microscopy. Acute (mortality) and behavioural (swimming speed alteration) responses and cholinesterase, glutathione-S-transferase and catalase enzyme activities were evaluated. These nanomaterials were ingested and concentrated in the gut, and attached onto the body surface of the A. salina larvae. This attachment was responsible for concentration–dependent inhibition of larval swimming, and partly for alterations in the enzyme activities, that differed according to the type of tested nanomaterials. No lethal effects were observed up to 0.5 mg/mL carbon black and 0.1 mg/mL multiwall carbon nanotubes, while graphene oxide showed a threshold whereby it had no effects at 0.6 mg/mL, and more than 90% mortality at 0.7 mg/mL. Risk quotients calculated on the basis of predicted environmental concentrations indicate that carbon black and multiwall carbon nanotubes currently do not pose a serious risk to the marine environment, however if uncontrolled release of nanomaterials continues, this scenario can rapidly change.

  14. High surface adsorption properties of carbon-based nanomaterials are responsible for mortality, swimming inhibition, and biochemical responses in Artemia salina larvae

    International Nuclear Information System (INIS)

    Highlights: • Carbon-based nanomaterials adsorb onto the body surface of A. salina larvae. • Surface adsorption results in concentration–dependent inhibition of larval swimming. • Carbon-based nanomaterials induce no significant mortality of A. salina larvae. - Abstract: We investigated the effects of three different carbon-based nanomaterials on brine shrimp (Artemia salina) larvae. The larvae were exposed to different concentrations of carbon black, graphene oxide, and multiwall carbon nanotubes for 48 h, and observed using phase contrast and scanning electron microscopy. Acute (mortality) and behavioural (swimming speed alteration) responses and cholinesterase, glutathione-S-transferase and catalase enzyme activities were evaluated. These nanomaterials were ingested and concentrated in the gut, and attached onto the body surface of the A. salina larvae. This attachment was responsible for concentration–dependent inhibition of larval swimming, and partly for alterations in the enzyme activities, that differed according to the type of tested nanomaterials. No lethal effects were observed up to 0.5 mg/mL carbon black and 0.1 mg/mL multiwall carbon nanotubes, while graphene oxide showed a threshold whereby it had no effects at 0.6 mg/mL, and more than 90% mortality at 0.7 mg/mL. Risk quotients calculated on the basis of predicted environmental concentrations indicate that carbon black and multiwall carbon nanotubes currently do not pose a serious risk to the marine environment, however if uncontrolled release of nanomaterials continues, this scenario can rapidly change

  15. 卤虫(Artemia salina)孵化腺细胞分化时相的免疫细胞化学研究(简报)%IMMUNOCYTOCHEMICAL STUDIES ON THE PHASE OF DIFFERENTIATION OF HATCHING GLAND CELLS IN BRINE SHRIMP, ARTEMIA SALINA

    Institute of Scientific and Technical Information of China (English)

    李凌; 樊廷俊; 汪小锋; 丛日山; 于秋涛; 钟其旺

    2004-01-01

    动物孵化酶(hatching enzyme HE)是早期胚胎在特定发育阶段由孵化腺细胞产生和分泌的,在动物早期胚胎孵化中具有关键性作用[4]。孵化腺细胞(hatching gland cell,HGC)一般为单细胞腺体,是从胚胎发育到特定阶段(孵化前)出现、至胚胎孵出后的特定时期消失的一时性细胞(transient type of

  16. Profiles of nuclear and mitochondrial encoded mRNAs in developing and quiescent embryos of Artemia franciscana.

    Science.gov (United States)

    Hardewig, I; Anchordoguy, T J; Crawford, D L; Hand, S C

    1996-05-24

    Embryos of the brine shrimp Artemia franciscana are able to withstand long bouts of environmental anoxia by entering a quiescent state during which metabolism is greatly depressed. Recent evidence supports a global arrest of protein synthesis during quiescence. In this study we measured the amounts of mRNA for a mitochondrial-encoded subunit of cytochrome c oxidase (COX I) and for nuclear-encoded actin during aerobic development, anaerobiosis, and aerobic acidosis (artificial quiescence imposed by intracellular acidification under aerobic conditions). The levels of both COX I and actin transcripts increased significantly during aerobic development. COX I mRNA levels were tightly correlated with previous measures of COX catalytic activity, which suggests that COX synthesis could be regulated by message concentration during aerobic development. The ontogenetic increase for these mRNAs was blocked by anoxia and aerobic acidosis. Importantly, the levels of COX I and actin mRNA did not decline appreciably during the 6 h bouts of quiescence, even though protein synthesis is acutely arrested by these same treatments. Thus, the constancy of mRNA levels during quiescence indicate that reduced protein synthesis is not caused by message limitation, but rather, is likely controlled at the translational level. One advantage of this regulatory mechanism is the conservation of mRNA molecules during quiescence, which would potentially favor a quick resumption of translation as soon as oxygen is returned to the embryos. Finally, because anoxia and aerobic acidosis are both characterized by acidic intracellular pH, the reduction in pH may serve, directly or indirectly, as one signal regulating levels of mRNA in this embryo during quiescence. PMID:8817476

  17. Complexity in a population of Artemia

    International Nuclear Information System (INIS)

    Highlights: → Experiments on collective motion of populations of animals (Artemia salina). → Design of low-cost experimental setup for complex systems. → Control of collective motion of populations of Artemia. → Models of collective motion of populations of Artemia. - Abstract: Artemia salina belongs to a genus of very primordial crustaceans, whose behavior is not widely investigated in literature. Their collective behavior is studied in this paper both experimentally and theoretically. Different experiments have been designed to control the direction of motion of an Artemia population by exploiting their sensitivity to light and to measure the response of the population to light at different wavelengths. Mathematical models have been also derived, explaining the mechanisms underlying Artemia flocking formation when a light spot is applied to the system. The results obtained allow to develop new strategies for distributed control of agents and to test them in a simple and low cost experimental setup.

  18. Complexity in a population of Artemia

    Energy Technology Data Exchange (ETDEWEB)

    Ali, A.A., E-mail: abduladem1@yahoo.co [Electrical Engineering Department, University of Basrah (Iraq); Fortuna, L., E-mail: lfortuna@diees.unict.i [DIEEI, Faculty of Engineering, University of Catania (Italy); Frasca, M., E-mail: mfrasca@diees.unict.i [DIEEI, Faculty of Engineering, University of Catania (Italy); Rashid, M.T., E-mail: mofid76@yahoo.co [Electrical Engineering Department, University of Basrah (Iraq); Xibilia, M.G., E-mail: mxibilia@ingegneria.unime.i [DiSIA, Faculty of Engineering, University of Messina (Italy)

    2011-04-15

    Highlights: Experiments on collective motion of populations of animals (Artemia salina). Design of low-cost experimental setup for complex systems. Control of collective motion of populations of Artemia. Models of collective motion of populations of Artemia. - Abstract: Artemia salina belongs to a genus of very primordial crustaceans, whose behavior is not widely investigated in literature. Their collective behavior is studied in this paper both experimentally and theoretically. Different experiments have been designed to control the direction of motion of an Artemia population by exploiting their sensitivity to light and to measure the response of the population to light at different wavelengths. Mathematical models have been also derived, explaining the mechanisms underlying Artemia flocking formation when a light spot is applied to the system. The results obtained allow to develop new strategies for distributed control of agents and to test them in a simple and low cost experimental setup.

  19. BRINE SHRIM LETHALITY BIOASSAY OF METHANOLIC CRUDE EXTRACTS OF TERMINALIA ARJUNA

    OpenAIRE

    Maruf Anayet and Mohammad Musarraf Hussain

    2012-01-01

    The aim of this work is to determine the cytotoxic activities of Terminalia arjuna (Family: Combretaceae) by brine shrimp lethality bioassay. The leaves of Terminalia arjuna were extracted with methanol and the methanolic extract was fractionated into three fractions by using organic solvents like n-hexane, ethyl acetate and chloroform. The n-hexane, ethyl acetate and chloroform soluble fractions of methanolic crude extract were screened for antitumor properties using brine shrimp lethality b...

  20. Phytochemistry study from bark of stem of Duguetia Glabriuscula - Annonaceae, using toxicity assays for Artemia salina

    International Nuclear Information System (INIS)

    The extract obtained from stem bark of Duguetia glabriuscula - Annonaceae was evaluated by Brine Shrimp Lethality test (BSL). The bioactive compounds, oxobufoline and lanuginosine, two oxoaporphine alkaloids were isolated by activity-guided fractionation. In addition, the compounds asaraldehyde, (+)-allo-aromadendrane-10 β, 14-diol, and two aporphine alkaloids, polyalthine and oliveridine were also obtained. (author)

  1. Toxicite de Detergents et d'un Dispersant sur Artemia salina Leach.

    OpenAIRE

    1980-01-01

    The authors study the toxic influence of 3 detergents (Tween 20 or Polysorbate 20, laurylsulfate of sodium, Secosyl or N-Lauroyl sarcosinate of sodium) and of a dispersent (Finasol OSR sub(2) or Dodecyl Sodium sulfate) on the hatching and the survival of the brine shrimp, (A. salina)). The determination of the DL sub(50) was effected after 24 h.

  2. Quiescence in Artemia franciscana embryos: reversible arrest of metabolism and gene expression at low oxygen levels.

    Science.gov (United States)

    Hand, S C

    1998-04-01

    Depression of the production and consumption of cellular energy appears to be a prerequisite for the survival of prolonged bouts of anoxia. A correlation exists between the degree of metabolic depression under anoxia and the duration of anoxia tolerance. In the case of brine shrimp (Artemia franciscana) embryos, oxygen deprivation induces a reversible quiescent state that can be tolerated for several years with substantial survivorship. A global arrest of cytoplasmic translation accompanies the transition into anoxia, and rates of protein synthesis in mitochondria from these embryos appears to be markedly reduced in response to anoxia. Previous evidence suggests that the acute acidification of intracellular pH (pHi) by over 1.0 unit during the transition into anoxia contributes to the depression of biosynthesis, but message limitation does not appear to play a role in the down-regulation in either cellular compartment. The ontogenetic increase in mRNA levels for a mitochondrial-encoded subunit of cytochrome c oxidase (COX I) and for nuclear-encoded actin is blocked by anoxia and aerobic acidosis (artificial quiescence imposed by intracellular acidification under aerobic conditions). Further, the levels of COX I and actin mRNA do not decline appreciably during 6 h bouts of quiescence, even though protein synthesis is acutely arrested across this same period. Thus, the constancy of mRNA levels during quiescence indicates that reduced protein synthesis is not caused by message limitation but, instead, is probably controlled at the translational level. This apparent stabilization of mRNA under anoxia is mirrored in an extension of protein half-life. The ubiquitin-dependent pathway for protein degradation is depressed under anoxia and aerobic acidosis, as judged by the acute drop in levels of ubiquitin-conjugated proteins. Mitochondrial protein synthesis is responsive to both acidification of pHi and removal of oxygen per se. Matrix pH declines in parallel with pHi, and

  3. 78 FR 50383 - Certain Frozen Warmwater Shrimp From the Republic of Indonesia: Final Negative Countervailing...

    Science.gov (United States)

    2013-08-19

    ...: Negative Preliminary Countervailing Duty Determination, 78 FR 33349 (June 4, 2013) (Preliminary... Memorandum Regarding Onboard Brine-Frozen Shrimp'' (Scope Memorandum), which is dated concurrently with and... suspend liquidation of entries of subject merchandise. \\4\\ See Preliminary Determination, 78 FR...

  4. Biomass production of Artemia in air-water-lift raceway system

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Vijayaraghavan, S.; Krishnakumari, L.

    is in great demand as a source of high quality food in fish and crustacean fanning (Persoone and Sorgeloos, 1982). Recent studies have proved that adult Artemia have higher nutritive value, contain 60% protein and rich in all essential amino and fatty acids... sources for Arternia and this can 164 ROYANetal be converted to nutritive animal protein. It was found that the shrimp Met)ipenaeus monoceros was able to,convert maximum of the food into body tissue "Vhen..fed aciult Artemiil inpelleted form (Sumi...

  5. The effects of dietary administration with chemical treated Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates in Artemia

    Institute of Scientific and Technical Information of China (English)

    Behnam Shekarchi; Ali Nekuiefard; Ramin Manaffar

    2016-01-01

    Objective: To investigate the biological effects of β-glucans in cell wall of new identified strain Saccharomyces cerevisiae strain YG3-1 on the growth of aquatic invertebrates, in Artemia as model organism. Methods: All yeasts used in the present study were isolated from Rainbow trout intestine and then cultured in yeast extract-peptone-glycerol medium. Activation of β-glucan in yeasts was performed by chemical treatment with 2-mercaptoethanol (2ME) (3.5% v/v). Then nauplii and larvae individuals of Artemia urmiana and Artemia franciscana (two different species of Artemia as test organisms) were fed with 2ME-treated yeasts during the culture. At the end of experiment, after feeding individual length (total length and growth rate) in adult individuals of Artemia was measured. Results: Following this administration, growth in both species of Artemia was improved (P Conclusions: This study suggested that 2ME-treated Saccharomyces cerevisiae strain YG3-1 yeasts can be used for enhancing the growth of other aquatic invertebrates like shrimps as probiotic supplement and growth promoter.

  6. Phytochemistry study from bark of stem of Duguetia Glabriuscula - Annonaceae, using toxicity assays for Artemia salina; Estudo fitoquimico das cascas do caule de Duguetia Glabriuscula - Annonaceae, biomonitorado pelo ensaio de toxicidade frente a Artemia salina leach

    Energy Technology Data Exchange (ETDEWEB)

    Siqueira, Joao Maximo de; Ziminiani, Maria Graziela [Mato Grosso do Sul Univ., Campo Grande, MS (Brazil). Dept. de Farmacia Bioquimica]. E-mail: jmaximo@nin.ufms.br; Resende, Ubirazilda Maria [Mato Grosso do Sul Univ., Campo Grande, MS (Brazil). Dept. de Biologia; Boaventura, Maria Amelia Diamantino [Minas Gerais Univ., Belo Horizonte, MG (Brazil). Dept. de Quimica

    2001-04-01

    The extract obtained from stem bark of Duguetia glabriuscula - Annonaceae was evaluated by Brine Shrimp Lethality test (BSL). The bioactive compounds, oxobufoline and lanuginosine, two oxoaporphine alkaloids were isolated by activity-guided fractionation. In addition, the compounds asaraldehyde, (+)-allo-aromadendrane-10 {beta}, 14-diol, and two aporphine alkaloids, polyalthine and oliveridine were also obtained. (author)

  7. Biological screening of araripe basin medicinal plants using Artemia salina Leach and pathogenic bacteria

    OpenAIRE

    da Costa, José Galberto M.; Campos, Adriana R.; Brito, Samara A.; Carla Karine B Pereira; Souza, Erlânio O.; Fabíola Fernandes G Rodrigues

    2010-01-01

    Background: Many medicinal plant species from the Araripe Basin are widely known and used in folk medicine and for commercial manufacturing of phytotherapeutic products. Few ethnobotanical and pharmacological studies have been undertaken in this region, however, in spite of the great cultural and biological diversity found there. Materials and Methods : Extracts of 11 plant species collected from Cearα state, Brazil, were subjected to the brine shrimp lethality test in order to detect potenti...

  8. Molecularly Characterized Solvent Extracts and Saponins from Polygonum hydropiper L. Show High Anti-Angiogenic, Anti-Tumor, Brine Shrimp, and Fibroblast NIH/3T3 Cell Line Cytotoxicity

    Science.gov (United States)

    Ayaz, Muhammad; Junaid, Muhammad; Ullah, Farhat; Sadiq, Abdul; Subhan, Fazal; Khan, Mir Azam; Ahmad, Waqar; Ali, Gowhar; Imran, Muhammad; Ahmad, Sajjad

    2016-01-01

    Polygonum hydropiper is used as anti-cancer and anti-rheumatic agent in folk medicine. This study was designed to investigate the anti-angiogenic, anti-tumor, and cytotoxic potentials of different solvent extracts and isolated saponins. Samples were analyzed using GC, Gas Chromatography–Mass Spectrometry (GC–MS) to identify major and bioactive compounds. Quantitation of antiangiogenesis for the plant's samples including methanolic extract (Ph.Cr), its subsequent fractions; n-hexane (Ph.Hex), chloroform (Ph.Chf), ethyl acetate (Ph.EtAc), n-Butanol (Ph.Bt), aqueous (Ph.Aq), saponins (Ph.Sp) were performed using the chick embryo chorioallantoic membrane (CAM) assay. Potato disc anti-tumor assay was performed on Agrobacterium tumefaciens containing tumor inducing plasmid. Cytotoxicity was performed against Artemia salina and mouse embryonic fibroblast NIH/3T3 cell line following contact toxicity and MTT cells viability assays, respectively. The GC–MS analysis of Ph.Cr, Ph.Hex, Ph.Chf, Ph.Bt, and Ph.EtAc identified 126, 124, 153, 131, and 164 compounds, respectively. In anti-angiogenic assay, Ph.Chf, Ph.Sp, Ph.EtAc, and Ph.Cr exhibited highest activity with IC50 of 28.65, 19.21, 88.75, and 461.53 μg/ml, respectively. In anti-tumor assay, Ph.Sp, Ph.Chf, Ph.EtAc, and Ph.Cr were most potent with IC50 of 18.39, 73.81, 217.19, and 342.53 μg/ml, respectively. In MTT cells viability assay, Ph.Chf, Ph.EtAc, Ph.Sp were most active causing 79.00, 72.50, and 71.50% cytotoxicity, respectively, at 1000 μg/ml with the LD50 of 140, 160, and 175 μg/ml, respectively. In overall study, Ph.Chf and Ph.Sp have shown overwhelming results which signifies their potentials as sources of therapeutic agents against cancer. PMID:27065865

  9. Molecularly Characterized Solvent Extracts and Saponins from Polygonum hydropiper L. Show High Anti-Angiogenic, Anti-Tumor, Brine Shrimp, and Fibroblast NIH/3T3 Cell Line Cytotoxicity.

    Science.gov (United States)

    Ayaz, Muhammad; Junaid, Muhammad; Ullah, Farhat; Sadiq, Abdul; Subhan, Fazal; Khan, Mir Azam; Ahmad, Waqar; Ali, Gowhar; Imran, Muhammad; Ahmad, Sajjad

    2016-01-01

    Polygonum hydropiper is used as anti-cancer and anti-rheumatic agent in folk medicine. This study was designed to investigate the anti-angiogenic, anti-tumor, and cytotoxic potentials of different solvent extracts and isolated saponins. Samples were analyzed using GC, Gas Chromatography-Mass Spectrometry (GC-MS) to identify major and bioactive compounds. Quantitation of antiangiogenesis for the plant's samples including methanolic extract (Ph.Cr), its subsequent fractions; n-hexane (Ph.Hex), chloroform (Ph.Chf), ethyl acetate (Ph.EtAc), n-Butanol (Ph.Bt), aqueous (Ph.Aq), saponins (Ph.Sp) were performed using the chick embryo chorioallantoic membrane (CAM) assay. Potato disc anti-tumor assay was performed on Agrobacterium tumefaciens containing tumor inducing plasmid. Cytotoxicity was performed against Artemia salina and mouse embryonic fibroblast NIH/3T3 cell line following contact toxicity and MTT cells viability assays, respectively. The GC-MS analysis of Ph.Cr, Ph.Hex, Ph.Chf, Ph.Bt, and Ph.EtAc identified 126, 124, 153, 131, and 164 compounds, respectively. In anti-angiogenic assay, Ph.Chf, Ph.Sp, Ph.EtAc, and Ph.Cr exhibited highest activity with IC50 of 28.65, 19.21, 88.75, and 461.53 μg/ml, respectively. In anti-tumor assay, Ph.Sp, Ph.Chf, Ph.EtAc, and Ph.Cr were most potent with IC50 of 18.39, 73.81, 217.19, and 342.53 μg/ml, respectively. In MTT cells viability assay, Ph.Chf, Ph.EtAc, Ph.Sp were most active causing 79.00, 72.50, and 71.50% cytotoxicity, respectively, at 1000 μg/ml with the LD50 of 140, 160, and 175 μg/ml, respectively. In overall study, Ph.Chf and Ph.Sp have shown overwhelming results which signifies their potentials as sources of therapeutic agents against cancer. PMID:27065865

  10. Development and validation of an extensive growth and growth boundary model for Listeria monocytogenes in lightly preserved and ready-to-eat shrimp

    DEFF Research Database (Denmark)

    Mejlholm, Ole; Dalgaard, Paw

    2009-01-01

    and their interactive effects. The new model predicted growth rates (mu(max) values) of L. monocytogenes accurately with bias and accuracy factors of 1.0 and 1.5, respectively, for 16 batches of brined shrimp with benzoic, citric, and sorbic acids. Corresponding values of 0.9 and 1.2, respectively......, were obtained for five batches of brined shrimp with acetic and lactic acids. Growth and no-growth responses of L. monocytogenes were also appropriately predicted with 88% correct prediction for 26 experiments with brined shrimp. The new model performed better than existing L. monocytogenes models with...

  11. Nonhatching Decapsulated Artemia Cysts As a Replacement to Artemia Nauplii in Juvenile and Adult Zebrafish Culture.

    Science.gov (United States)

    Tye, Marc; Rider, Dana; Duffy, Elizabeth A; Seubert, Adam; Lothert, Brogen; Schimmenti, Lisa A

    2015-12-01

    Feeding Artemia nauplii as the main nutrition source for zebrafish is a common practice for many research facilities. Culturing live feed can be time-consuming and requires additional equipment to be purchased, maintained, and cleaned. Nonhatching decapsulated Artemia cysts (decaps) are a commercially available product that can be fed directly to fish. Several other ornamental fish species have been successfully cultured using decaps. Replacing Artemia nauplii with decaps could reduce the overall time and costs associated with the operation of a zebrafish facility. The objective of this study was to determine if decaps could be a suitable replacement to Artemia nauplii in juvenile and adult zebrafish culture. Wild-type zebrafish were fed one of three dietary treatments: decaps only, nauplii only, or a standard consisting of nauplii plus a commercially prepared pellet food. Survival, growth (length and weight), and embryo production were analyzed between the treatments. Fish receiving the decap diet demonstrated a significantly higher growth and embryo production when compared to the fish receiving the nauplii-only diet. When comparing the decap fish to the standard fish, no significant difference was found in mean survival, mean weight at 90 days postfertilization, or mean embryo production. It was determined that nonhatching decapsulated Artemia cysts can be used as a suitable replacement to Artemia nauplii in juvenile and adult zebrafish culture. PMID:25495227

  12. Shrimp Survey Data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The Northern Shrimp Survey was initiated in 1983 by the Atlantic States Marine Fisheries Commission (ASMFC) and monitors the relative abundance (number of shrimp),...

  13. Physiochemical Changes and Optimization of Phosphate-Treated Shrimp (Litopenaeus vannamei ) Using Response Surface Methodology

    OpenAIRE

    Omar, Saiah Djebbour; Yang, Je-Eun; Oh, Sang-Cheol; Kim, Dae-Wook; Lee, Yang-Bong

    2016-01-01

    The objective of this study was to determine the factors responsible for the changed physiochemical properties of unpeeled shrimp treated in cold phosphate solution (2~4°C) with the intervention of 4 factors: phosphate concentration, dipping time, rotation speed, and volume of brine solution. Response surface analysis was used to characterize the effect of the phosphate treatment on shrimps by running 33 treatments for optimizing the experiment. For each treatment, phosphate amount, moisture ...

  14. Actualities and prospect of studies on the brine shrimp Artemia as biocapsule in prevention and treatment of diseases of aquatic animals%卤虫生物包囊在水产动物疾病防治中的研究现状及展望

    Institute of Scientific and Technical Information of China (English)

    曹立民; 李健; 王群; 刘淇

    2005-01-01

    在水产养殖中,"生物包囊"就是指以饵料生物作为载体包裹营养物质或药物,鱼虾通过摄食这种饵料生物达到营养强化、防治疾病等目的.本文以卤虫为代表,介绍了国内外利用生物包囊防治水产动物疾病方面的研究现状:包囊的优点、强化研究、药代学分析、防治效果等.并对研究中存在的问题和今后的研究方向进行了分析探讨.

  15. Shrimp Farming in the Classroom.

    Science.gov (United States)

    Ruggiero, Lovelle

    2000-01-01

    Describes a project on culturing shrimp. Presents observational labs and the experimentation procedure. Provides general information about shrimp, their life span, optimum temperatures, and other important information. (YDS)

  16. Brine Shrimp Bioassays: A Useful Technique in Biological Investigations

    Science.gov (United States)

    Rice, Stanley A.; Maness, Ian B.

    2004-01-01

    A technique to measure the potency of leaf compounds against herbivores with the use of a bioassay is described. Bioassays are useful in classes where students have career plans like medicine in which bioassays can be used as tools for screening plants for possible medicinal potency.

  17. Brine Distribution after Vacuum Saturation

    DEFF Research Database (Denmark)

    Hedegaard, Kathrine; Andersen, Bertel Lohmann

    1999-01-01

    Experiments with the vacuum saturation method for brine in plugs of chalk showed that a homogeneous distribution of brine cannot be ensured at saturations below 20% volume. Instead of a homogeneous volume distribution the brine becomes concentrated close to the surfaces of the plugs......Experiments with the vacuum saturation method for brine in plugs of chalk showed that a homogeneous distribution of brine cannot be ensured at saturations below 20% volume. Instead of a homogeneous volume distribution the brine becomes concentrated close to the surfaces of the plugs...

  18. Evaluation of the molluscicidal and Schistosoma mansoni cercariae activity of Croton floribundus extracts and kaurenoic acid

    OpenAIRE

    Janaina M. Medina; Juliana L. B. Peixoto; Silva, Adriano A.; Shirani K. Haraguchi; Dina L. M. Falavigna; Maria L. M. Zamuner; Maria H. Sarragiotto; Vidotti, Gentil J.

    2009-01-01

    Lethality of the extracts of Croton floribundus (Euphorbiaceae), a medicinal plant from south Brazil, and of the kaurenoic acid, an isolated compound, and two of its derivatives against adult Biomphalaria glabrata snails, Schistosoma mansoni cercariae and Artemia salina Leach. brine shrimp larvae are reported. Both extracts and the isolated compound showed significant molluscicidal and cercaricidal activities and reduced toxicity in brine shrimp assays.

  19. Silica in alkaline brines

    Science.gov (United States)

    Jones, B.F.; Rettig, S.L.; Eugster, H.P.

    1967-01-01

    Analysis of sodium carbonate-bicarbonate brines from closed basins in volcanic terranes of Oregon and Kenya reveals silica contents of up to 2700 parts per million at pH's higher than 10. These high concentrations of SiO 2 can be attributed to reaction of waters with silicates, and subsequent evaporative concentration accompanied by a rise in pH. Supersaturation with respect to amorphous silica may occur and persist for brines that are out of contact with silicate muds and undersaturated with respect to trona; correlation of SiO2 with concentration of Na and total CO2 support this interpretation. Addition of moredilute waters to alkaline brines may lower the pH and cause inorganic precipitation of substantial amounts of silica.

  20. Larvicidal activity of some marine macrophytes against Artemia salina

    Digital Repository Service at National Institute of Oceanography (India)

    PrabhaDevi; Wahidullah, S.; DeSouza, L.; Kamat, S.Y.

    and Microdictyon pseudohapteron, seagrasses (Halophila ovalis and Syringodium isoetifolium and lichens (Umbilicaria arpina) were tested for larvicidal activity using Artemia salina nauplii. The LC50 values for the PE-fraction of M. pseudohapteron and A. muscoides...

  1. Strong environmental tolerance of Artemia under very high pressure

    International Nuclear Information System (INIS)

    It was shown by the present authors group that a tardigrade in its tun-state can survive after exposed to 7.5 GPa for 13 hours. We have extended this experiment to other tiny animals searching for lives under extreme conditions of high hydrostatic pressure. Artemia, a kind of planktons, in its dried egg-state have strong environmental tolerance. Dozens of Artemia eggs were sealed in a small Teflon capsule together with a liquid pressure medium, and exposed to the high hydrostatic pressure of 7.5 GPa. After the pressure was released, they were soaked in seawater to observe hatching rate. It was proved that 80-90% of the Artemia eggs were alive and hatched into Nauplii after exposed to the maximum pressure of 7.5 GPa for up to 48 hours. Comparing with Tardigrades, Artemia are four-times stronger against high pressure.

  2. 40 CFR Appendix 2 to Subpart A of... - Drilling Fluids Toxicity Test

    Science.gov (United States)

    2010-07-01

    ..., mysids shall be fed daily with approximately 50 Artemia (brine shrimp) nauplii per mysid. This will... Acute Toxicity of Eight Drilling Fluids to Mysid Shrimp (Mysidopsis bahia), May 1984 EPA-600/3-84-067... Drilling Fluids and Mysid Shrimp Percent concentration Number exposed Number dead (96 hours) Number...

  3. 卤虫生物肥料对二种植物生长及叶绿素含量影响的研究%STUDY ON THE EFFECT OF BRINE SHRIMP BIOLOGICAL FERTILIZER ON THE GROWTH OF TWO VARIETIES OF PLANTS

    Institute of Scientific and Technical Information of China (English)

    姜国良; 李立德; 王翔宇; 刘云; 张广华

    2002-01-01

    @@ 卤虫 (Artemia)又叫卤虾,卤虫子或丰年虫,是一种世界性分布的耐高盐的小型低等甲壳类动物,全长 1.2~ 1.5cm,卤虫天然栖息的环境是多种多样的,按水中的离子成分来分有氯化钠型、硫酸盐型、碳酸盐型和钾盐型[1].

  4. South Atlantic Shrimp System

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — The SEFSC, in cooperation with the South Atlantic states, collects South Atlantic shrimp data from dealers and fishermen. These data are collected to provide catch,...

  5. Gulf Shrimp System

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Gulf of Mexico Shrimp Landings - This data set contains catch (landed catch) and effort for fishing trips made by the larger vessels that fish near and offshore for...

  6. Effects of different levels of live food replacement with microdiet on growth factors, survival and resistance to salinity stress of Indian white shrimp post-larvae (Fenneropenaeus indicus)

    OpenAIRE

    Seyed Hossein Hoseinifar; Parviz Zare

    2013-01-01

    In this study, partial and complete replacement of live food (Artemia nauplii) with a microdiet was investigated in post-larval Indian white shrimp, Fenneropenaeus indicus. Post-larvae (PL1) were stocked into nine 20-L vessels (5-L water volume) at a density of 50 L-1. Shrimp were fed six times a day over 10 days. At the end of the feeding period, there was no significant difference in quality index (stress-test survival) among treatments. Statistical analysis of results showed that partial o...

  7. Soil washing for brine removal

    International Nuclear Information System (INIS)

    During the exploration for oil and thereafter, brine transfer lines get ruptured releasing the brine which contaminates the surrounding soil. The salinity level in brine is very high, sometimes approaching or exceeding that of sea water. Soils contaminated with brine are unproductive and unsuitable for plant growth. Several investigators have documented the pollution of surface water and groundwater due to brine disposal from oil and needed to clean up such sites. The objective of this study is to develop a soil washing technique that can be used to remove brine sites were collected and used in the study. This paper reports on results which indicate that soil washing using various surface active agents is effective in removing the brine

  8. Development of shrimp in small ponds

    Directory of Open Access Journals (Sweden)

    Armando Adolfo Ortega Salas

    2014-06-01

    Full Text Available Development of white shrimp Litopenaeus vannamei in small ponds ( 6 m3 in fresh water (2-3‰ and seawater; ponds 3.66 x 1.65 x 1.0 m; availability of fresh water, sea water, aeration and drainage. Two cycles of three months each were made. The postlarvae were acclimated to seawater fresh water in four days. Four hundred postlarvas/m3 were seeded in freshwater pond and 500 in the pool of seawater. First, a culture of Daphnia magna in the freshwater pond, also appeared chyronomid larvae; Artemia cysts were seeded in sea water as a dietary supplement. The shrimp were fed Camaronina (25% protein at libitum, daily; is offered on a tray of food; the temperature ranged between 27 and 30° C, oxygen 4.26 ± 1.43 mg / L , pH between 7 and 8 . Detritus siphoned every third day. Water changes between 10 and 20% are often performed. The feed conversion rate (FCR was 1:1.3 . The shrimp were measured in length and weight to calculate weekly growth by Bertalanffy model. Survival in the first cycle was 95.8 , and 97.9% for the second cycle. In seawater parameters of the population of the first cycle were k = 0.0301, L ∞ = 322.16 and t0 = -0.8852, the second cycle of k = 0.0203, L ∞ = 294.42 and t0 = -5.3771. The biomass of 27 kg was obtained for the first cycle and 16 kg for the second cycle. Freshwater population parameters of the first cycle were k = 0.0957, L ∞ = 146.98 and t0 = - 0.93; in the second cycle of k = 0.0172 , L ∞ = 367.82 and t0 = - 4.60. The biomass of 26 kg was obtained for the first cycle and 16 kg for the second cycle. The results indicate a rapid growth during the first 10 weeks. In small ponds can be handled well aseptic conditions without disease problems, good crop was obtained.

  9. Burrowing behavior of penaeid shrimps

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Brown shrimp, Farfantepenaeus aztecus, and white shrimp, Litopenaeus setiferus, were held were held under natural light conditions before experiments. Experiments...

  10. Isolation of TDA-producing Phaeobacter strains from sea bass larval rearing units and their probiotic effect against pathogenic Vibrio spp. in Artemia cultures

    DEFF Research Database (Denmark)

    Grotkjær, Torben; Bentzon-Tilia, Mikkel; D'Alvise, Paul;

    2016-01-01

    V. harveyi, which is the major bacterial pathogen in crustaceans and Mediterranean sea bass larvae cultures. Concomitantly, they significantly improved survival of V. harveyi-infected brine shrimp. 16S rRNA gene sequence homology identified the antagonists as Phaeobacter sp., and in silico DNA...

  11. A Study on the Contribution of Different Food Sources to Shrimp Growth in an Intensive Fenneropenaeus chinensis Pond

    Institute of Scientific and Technical Information of China (English)

    SU Yuepeng; MA Shen; TIAN Xiangli; DONG Shuanglin

    2008-01-01

    Stable isotope methods can be used to determine the food sources and prey items of aquatic organisms accurately andreliably.This study examined the relative contribution of artificial foods (the formulated feed and Artemia) and natural foods toshrimp growth in an intensive Fenneropenaeus chinensis pond by using carbon and nitrogen stable isotopes.The results showed that the nutrition utilization efficiency of the harvested shrimp was low,only 33.18% of feed nitrogen and 21.73% of feed carbon beingconverted to shrimp flesh.Our stable isotope results showed that the shrimp obtained nutrition for maximum growth from artificialfoods,whose contribution was 93.5%,with the remaining attributed to the natural foods.However,there was 0.94 t harvested shrimpderived from natural foods (the rest of 13.56t harvested shrimp derived from artificial foods) in lha intensive pond with a shrimpproduction of 14.50 tha-1.Therefore,unit area shrimp production can be increased by increasing the contribution proportion of natu-ral foods in intensive shrimp farming.

  12. Brine Sampling and Evaluation Program

    International Nuclear Information System (INIS)

    The Brine Sampling and Evaluation Program (BSEP) Phase II Report is an interim report which updates the data released in the BSEP Phase I Report. Direct measurements and observations of the brine that seeps into the WIPP repository excavations were continued through the period between August 1986 and July 1987. That data is included in Appendix A, which extends the observation period for some locations to approximately 900 days. Brine observations at 87 locations are presented in this report. Although WIPP underground workings are considered ''dry,'' small amounts of brine are present. Part of that brine migrates into the repository in response to pressure gradients at essentially isothermal conditions. The data presented in this report is a continuation of moisture content studies of the WIPP facility horizon that were initiated in 1982, as soon as underground drifts began to be excavated. Brine seepages are manifested by salt efflorescences, moist areas, and fluid accumulations in drillholes. 35 refs., 6 figs., 11 tabs

  13. Development and validation of an extensive growth and growth boundary model for Listeria monocytogenes in lightly preserved and ready-to-eat shrimp

    DEFF Research Database (Denmark)

    Mejlholm, Ole; Dalgaard, Paw

    2009-01-01

    and their interactive effects. The new model predicted growth rates (mu(max) values) of L. monocytogenes accurately with bias and accuracy factors of 1.0 and 1.5, respectively, for 16 batches of brined shrimp with benzoic, citric, and sorbic acids. Corresponding values of 0.9 and 1.2, respectively......, were obtained for five batches of brined shrimp with acetic and lactic acids. Growth and no-growth responses of L. monocytogenes were also appropriately predicted with 88% correct prediction for 26 experiments with brined shrimp. The new model performed better than existing L. monocytogenes models with....... The new model also allowed the distance between the growth boundary and specific product characteristics to be quantified by a psi value. This can be of practical importance in the development or reformulation of seafood with preserving parameters that prevent growth of L. monocytogenes and take...

  14. Physiochemical Changes and Optimization of Phosphate-Treated Shrimp (Litopenaeus vannamei ) Using Response Surface Methodology.

    Science.gov (United States)

    Omar, Saiah Djebbour; Yang, Je-Eun; Oh, Sang-Cheol; Kim, Dae-Wook; Lee, Yang-Bong

    2016-03-01

    The objective of this study was to determine the factors responsible for the changed physiochemical properties of unpeeled shrimp treated in cold phosphate solution (2~4°C) with the intervention of 4 factors: phosphate concentration, dipping time, rotation speed, and volume of brine solution. Response surface analysis was used to characterize the effect of the phosphate treatment on shrimps by running 33 treatments for optimizing the experiment. For each treatment, phosphate amount, moisture content, and weight gain were measured. The results showed that phosphate concentration is the most important factor than other factors for facilitating phosphate penetration in the meat of the shrimp and for getting the best result. The optimum condition of phosphate-treated shrimp in this study was 110 to 120 min dipping time, 500 to 550 mL brine solution for 100 g shrimp sample, and 190 to 210 rpm agitation speed. The studied conditions can be applied in fisheries and other food industries for good phosphate treatments. PMID:27069905

  15. Effects of Artemia enriched with unsaturated fatty acids and vitamin C on growth, survival and resistance Salmo trutta caspius larvae

    OpenAIRE

    Javaheri baboli, Mehran

    2006-01-01

    This experiment was conducted to investigate the effect of using n-3 HUFA and Vitamin C enriched Artemia urmiana Nauplii Five difference treament were tested: for Caspian salmon (Salmo trutta caspius) larvae compare with artificial food in five treatment: (1) Artificial food, (2) Newly hatched Artemia (3) n-3 HUFA enriched Artemia (4) n-3 HUFA + 10% Ascorbyl Palmitate enriched Artemia (5) n-3 HUFA+20% Ascorbyl palmitate enriched Artemia during 15 days then all treatment were fe...

  16. Shrimp Ball Soup

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    Press the spring onion and ginger, add 25 grams water, soak for ten minutes, filter and remove the residue.Mince the shrimp meat and add pork fat. Add Shaoxing wine, egg white, spring onion and ginger juice, salt, MSG, and cornstarch, and blend. Slice the ham, and clean the bean sprouts. Put clear stock in a wok and heat.

  17. Field culture of American strain of Artemia in India

    Digital Repository Service at National Institute of Oceanography (India)

    Royan, J.P.; Sumitra-Vijayaraghavan; Krishnakumari, L.

    Pilot scale culture of Artemia was carried out in a 0.22 ha condenser unit of salt pans. Pond was fertilized with inorganic salts. The nauplii of San Francisco Bay, USA strain were inoculated. Within a period of 5 months a production of 20.6 kg dry...

  18. Enhanced Brine Dewatering System Project

    Data.gov (United States)

    National Aeronautics and Space Administration — The purpose of the Enhanced Brine Dewatering System (EBDS) is to provide an easily scalable means of completely recovering usable water from byproducts created by...

  19. Enhanced Brine Dewatering System Project

    Data.gov (United States)

    National Aeronautics and Space Administration — The purpose of the Enhanced Brine Dewatering System (EBDS) is to provide a scalable means of completely recovering usable water from byproducts created by reverse...

  20. SURFACE CONTAINMENT FOR GEOTHERMAL BRINES

    Science.gov (United States)

    This report examines the probability of significant releases of geothermal brine to the surface environment through unplanned or accidental events. It then evaluates the containment measures that may be used to prevent environmental damage. The results indicate that major spills ...

  1. Nutritional aspects of irradiated shrimp

    International Nuclear Information System (INIS)

    Data available in the literature on the nutritional aspects of irradiated shrimp are reviewed and the indication is that irradiation of shrimp at doses up to about 3.2 kGy does not significantly affect the levels of its protein, fat, carbohydrate and ash. There are no reports on the effect of irradiation of shrimp above 3.2 kGy on these components. Limited information available indicates that there are some minor changes in the fatty acid composition of shrimp as a result of irradiation. Irradiation also causes some changes in the amino acid composition of shrimp; similar changes occur due to canning and hot-air drying. Some of the vitamins in shrimp, such as thiamine, are lost as a result of irradiation but the loss is less extensive than in thermally processed shrimp. Protein quality of shrimp, based on the growth of rats as well as that of Tetrahymena pyriformis, is not affected by irradiation. No adverse effects attributed to irradiation were found either in short-term or long-term animal feeding tests

  2. Energy storage in evaporated brine

    Energy Technology Data Exchange (ETDEWEB)

    MacDonald, R. Ian

    2010-09-15

    We propose storage of electrical energy in brine solutions by using the energy to enhance natural evaporation. Using properties of existing industrial evaporation technologies and estimates of power regeneration from brine by pressure retarded osmosis, efficiency near 100% is calculated. Modelling indicates that systems ranging from 50kW to 50MW output may be practical, with storage capacities of hours to days. The method appears to have potential to be economically competitive with other technologies over a wide range of capacity. It may present a large new application area that could aid the development of salinity-based power generation technology.

  3. Brine Sampling and Evaluation Program, 1991 report

    Energy Technology Data Exchange (ETDEWEB)

    Deal, D.E.; Abitz, R.J.; Myers, J.; Martin, M.L.; Milligan, D.J.; Sobocinski, R.W.; Lipponer, P.P.J. [International Technology Corp., Albuquerque, NM (United States); Belski, D.S. [Westinghouse Electric Corp., Carlsbad, NM (United States). Waste Isolation Div.

    1993-09-01

    The data presented in this report are the result of Brine Sampling and Evaluation Program (BSEP) activities at the Waste Isolation Pilot Plan (WIPP) during 1991. These BSEP activities document and investigate the origins, hydraulic characteristics, extent, and composition of brine occurrences in the Permian Salado Formation and seepage of that brine into the excavations at the WIPP. When excavations began at the WIPP in 1982, small brine seepages (weeps) were observed on the walls. Brine studies began as part of the Site Validation Program and were formalized as a program in its own right in 1985. During nine years of observations (1982--1991), evidence has mounted that the amount of brine seeping into the WIPP excavations is limited, local, and only a small fraction of that required to produce hydrogen gas by corroding the metal in the waste drums and waste inventory. The data through 1990 is discussed in detail and summarized by Deal and others (1991). The data presented in this report describes progress made during the calendar year 1991 and focuses on four major areas: (1) quantification of the amount of brine seeping across vertical surfaces in the WIPP excavations (brine ``weeps); (2) monitoring of brine inflow, e.g., measuring brines recovered from holes drilled downward from the underground drifts (downholes), upward from the underground drifts (upholes), and from subhorizontal holes; (3) further characterization of brine geochemistry; and (4) preliminary quantification of the amount of brine that might be released by squeezing the underconsolidated clays present in the Salado Formation.

  4. Brine Sampling and Evaluation Program, 1990 report

    International Nuclear Information System (INIS)

    The data presented in this report are the result of Brine Sampling and Evaluation Program (BSEP) activities at the Waste Isolation Pilot Plant (WIPP) during 1990. When excavations began in 1982, small brine seepages (weeps) were observed on the walls. These brine occurrences were initially described as part of the Site Validation Program. Brine studies were formalized in 1985. The BSEP activities document and investigate the origins, hydraulic characteristics, extent, and composition of brine occurrences in the Permian Salado Formation and seepage of that brine into the excavations at the WIPP. The brine chemistry is important because it assists in understanding the origin of the brine and because it may affect possible chemical reactions in the buried waste after sealing the repository. The volume of brine and the hydrologic system that drives the brine seepage also need to be understood to assess the long-term performance of the repository. After more than eight years of observations (1982--1990), no credible evidence exists to indicate that enough naturally occurring brine will seep into the WIPP excavations to be of practical concern. The detailed observations and analyses summarized herein and in previous BSEP reports confirm the evidence apparent during casual visits to the underground workings -- that the excavations are remarkably dry

  5. Brine Sampling and Evaluation Program, 1990 report

    Energy Technology Data Exchange (ETDEWEB)

    Deal, D.E.; Abitz, R.J.; Myers, J.; Case, J.B.; Martin, M.L.; Roggenthen, W.M. [International Technology Corp., Albuquerque, NM (United States); Belski, D.S. [Westinghouse Electric Corp., Carlsbad, NM (United States). Waste Isolation Div.

    1991-08-01

    The data presented in this report are the result of Brine Sampling and Evaluation Program (BSEP) activities at the Waste Isolation Pilot Plant (WIPP) during 1990. When excavations began in 1982, small brine seepages (weeps) were observed on the walls. These brine occurrences were initially described as part of the Site Validation Program. Brine studies were formalized in 1985. The BSEP activities document and investigate the origins, hydraulic characteristics, extent, and composition of brine occurrences in the Permian Salado Formation and seepage of that brine into the excavations at the WIPP. The brine chemistry is important because it assists in understanding the origin of the brine and because it may affect possible chemical reactions in the buried waste after sealing the repository. The volume of brine and the hydrologic system that drives the brine seepage also need to be understood to assess the long-term performance of the repository. After more than eight years of observations (1982--1990), no credible evidence exists to indicate that enough naturally occurring brine will seep into the WIPP excavations to be of practical concern. The detailed observations and analyses summarized herein and in previous BSEP reports confirm the evidence apparent during casual visits to the underground workings -- that the excavations are remarkably dry.

  6. Biological screening of araripe basin medicinal plants using Artemia salina Leach and pathogenic bacteria

    Directory of Open Access Journals (Sweden)

    José Galberto M da Costa

    2010-01-01

    Full Text Available Background: Many medicinal plant species from the Araripe Basin are widely known and used in folk medicine and for commercial manufacturing of phytotherapeutic products. Few ethnobotanical and pharmacological studies have been undertaken in this region, however, in spite of the great cultural and biological diversity found there. Materials and Methods : Extracts of 11 plant species collected from Cearα state, Brazil, were subjected to the brine shrimp lethality test in order to detect potential sources of novel cytotoxic, antitumor compounds. The larvicidal activity, based on the percentage of larval mortality, was evaluated after 24 h exposure to the treatments. Results: All species tested showed good larvicidal activity as compared to a reference compound and literature data. The extract from Vanillosmopsis arborea was the most active with an LC 50 of 3.9 μg/ml. Best results were shown by Lantana montevidensis against Pseudomonas aeruginosa [minimum inhibitory concentration (MIC 8μg/ml] and Escherichia coli (MIC 32 μg/ml, Zanthoxylum rhoifolium against E. coli (MIC, 256 μg/ml and Staphylococcus aureus (MIC 64 μg/ml and Croton zenhtneri against S. aureus (MIC 64 μg/ml. Conclusion: Chemical tests indicated that a wide variety of natural product classes was present in those extracts that showed significant activities in the bioassays.

  7. Development of in situ hybridization and PCR assays for the detection of Enterocytozoon hepatopenaei (EHP), a microsporidian parasite infecting penaeid shrimp.

    Science.gov (United States)

    Tang, Kathy F J; Pantoja, Carlos R; Redman, Rita M; Han, Jee Eun; Tran, Loc H; Lightner, Donald V

    2015-09-01

    A microsporidian parasite, Enterocytozoon hepatopenaei (abbreviated as EHP), is an emerging pathogen for penaeid shrimp. EHP has been found in several shrimp farming countries in Asia including Vietnam, Thailand, Malaysia, Indonesia and China, and is reported to be associated with growth retardation in farmed shrimp. We examined the histological features from infected shrimp collected from Vietnam and Brunei, these include the presence of basophilic inclusions in the hepatopancreas tubule epithelial cells, in which EHP is found at various developmental stages, ranging from plasmodia to mature spores. By a PCR targeting the 18S rRNA gene, a 1.1kb 18S rRNA gene fragment of EHP was amplified, and this sequence showed a 100% identity to EHP found in Thailand and China. This fragment was cloned and labeled with digoxigenin-11-dUTP, and in situ hybridized to tissue sections of infected Penaeus vannamei (from Vietnam) and P. stylirostris (Brunei). The results of in situ hybridization were specific, the probe only reacted to the EHP within the cytoplasmic inclusions, not to a Pleistophora-like microsporidium that is associated with cotton shrimp disease. Subsequently, we developed a PCR assay from this 18S rRNA gene region, this PCR is shown to be specific to EHP, did not react to 2 other parasitic pathogens, an amoeba and the cotton shrimp disease microsporidium, nor to genomic DNA of various crustaceans including polychaetes, squids, crabs and krill. EHP was detected, through PCR, in hepatopancreatic tissue, feces and water sampled from infected shrimp tanks, and in some samples of Artemia biomass. PMID:26146228

  8. Growth and survival of Hippocampus erectus (Perry, 1810 juveniles fed on Artemia with different HUFA levels

    Directory of Open Access Journals (Sweden)

    Nicolás Vite-Garcia

    2014-03-01

    Full Text Available Survival during first months after birth is one of the bottlenecks for consolidating the seahorse farming industry. In this work, Artemia metanauplii enriched with two highly unsaturated fatty acids (HUFA rich commercial emulsions with different docosahexaenoic acid (DHA levels (63% and 14% of total lipids, a vegetable oil with no DHA, and non-enriched Artemia as control, were used to feed 5-day-old juvenile Hippocampus erectus for 60 days. Enriched Artemia had similar levels of DHA (13% and 9%, despite great differences of DHA in the emulsions, with traces of DHA in non-enriched and vegetable oil enriched Artemia. More than 20% of DHA was found in 24 h starved juveniles fed both DHA-enriched treatments, similar to values in newly born juveniles, but those fed vegetable oil enriched Artemia or non-enriched Artemia had 5% of DHA. Total lipid and protein levels were similar in juveniles from the four treatments. The n-3/n-6 ratio was almost four-fold higher in seahorses fed DHA-enriched treatments compared to juveniles fed the non-enriched treatments. Survival of seahorses only partially reflected the DHA levels: it was lower in the vegetable oil treatment, similar in the seahorses fed Artemia with higher DHA and in the control treatment, and higher in seahorses fed the HUFA-enriched Artemia with lower DHA levels, although growth was similar in the two DHA-enriched Artemia treatments. Juvenile H. erectus seahorses perform better when they have at least 20% of DHA in their tissues, and these levels can be attained with no more than 14% of DHA in emulsions, eliminating the need for more expensive emulsions with higher DHA levels.

  9. Comparación biométrica del lóbulo frontal en poblaciones americanas de Artemia (Anostraca, Artemiidae Biometric comparision of the frontal knob in american populations of Artemia (Anostraca, Artemiidae

    Directory of Open Access Journals (Sweden)

    PATRICIO R DE LOS RIOS

    2000-03-01

    Full Text Available Se compararon el diámetro del lóbulo frontal y su relación con la longitud corporal, en poblaciones de Artemia franciscana (Chile y Estados Unidos, A. persimilis (Argentina y Artemia sp. (Chile, cultivadas en laboratorio bajo condiciones controladas. Se encontraron diferencias significativas en ambos parámetros entre las poblaciones de A. franciscana y Artemia sp., de Salina El Convento (Chile y entre A. persimilis y Artemia sp. de Torres del Paine (Chile. Se discuten en el presente trabajo los factores geográficos, ecológicos y genéticos que determinaron la especiación de Artemia en Chile y Argentina, y como ésta se manifiesta en distintos patrones morfométricosThe frontal knob diameter and its relationship with the total body lenght among populations of Artemia franciscana (Chile and U.S.A, A. persimilis (Argentina, and Artemia sp. (Chile, were asessed. All populations were cultured under laboratory conditions. Significant differences in both parameters between A. franciscana and Artemia sp. from Salina el Convento (Chile, and between A. persimilis and Artemia sp. from Amarga Lagoon (Chile were recorded.Geographical, ecological and genetic aspects which affected the speciation of Artemia populations in Chile and Argentina, and their expression in morphometric characters are discussed

  10. Evaluación de la actividad enzimática y contenido de proteína en larvas de camarón blanco Litopenaeus vannamei alimentadas con diferentes dietas (Evaluation of the enzymatic activity and protein content in larvae of white shrimp Litopenaeus vannamei fed with different diets

    Directory of Open Access Journals (Sweden)

    Isiordia-Pérez E

    2007-08-01

    Full Text Available El alimento vivo para el cultivo de camarón requiere especial atención. Los alimentos comúnmente empleados en esta industria, se han seleccionado principalmente por la facilidad de su cultivo más que por sus propiedades nutricionales. El presente trabajo compara el uso de copépodos (Tisbe monozota vivos y muertos y una dieta microligada y microparticulada como alternativa alimenticia de nauplios de Artemia para larvas de camarón evaluando la actividad enzimática y contenido de proteínas de las misma. El estudio se realizó en estadios larvales de camarón blanco Litopenaeus vannamei bajo condiciones controladas de temperatura (28°C, salinidad (35‰ y fotoperiodo (12 h luz / 12h oscuridad. En ambos experimentos el mayor contenido proteico se obtuvo en larvas alimentadas con la dieta experimental y con Artemia viva. a diferencia de la actividad enzimática que fue mayor al utilizar copépodos tanto vivos como muertos. Los resultados demostraron que no hay diferencia significativa en contenido proteico y en actividad de tripsina al usar copépodos (vivos o muertos y nauplios de Artemia , y sugieren a la dieta experimental como buena fuente alternativa en los primeros estadios larvales de camarón blanco L. vannamei The live food for the shrimp culture requires special attention. The food commonly used in this industry, have been selected mainly for the feasibility of their culture rather than their nutritional properties. This present work include alive and dead copepods (Tisbe monozota and a microparticulate microbound diet as alternative live food to Artemia nauplii for shrimp larvae, evaluating their enzymatic activity and protein content. The study was made with larval stages of white shrimp Litopenaeus vannamei under control culture conditions: temperature (28°C, salinity (35% and photoperiodo (12 h light/12h dark. In both experiments the higher protein content was obtained in larvae fed with the microdiet and Artemia nauplii

  11. SHRIMP II analysis of minerals

    International Nuclear Information System (INIS)

    Full text: Ion microprobes are specialised mass spectrometers that allow in situ isotopic and abundance measurements of chemically complex materials with a spatial resolution of 5 to 20 micrometers. The Sensitive High mass Resolution Ion Micro-Probe (SHRIMP II), an Australian built instrument, is designed to achieve high mass resolution (>5000 MRP at the 1% level) and great sensitivity, with detection limits in the ppb range for most elements in the Periodic Table. The SHRIMP ion microprobes have revolutionised geochronology and they are primarily used for U-Th-Pb dating of zircons from geological samples. The in situ analysis capability of the SHRIMP is now recognised as the best method for obtaining highly precise ages for zircons and other accessory minerals in ancient rocks with complex geological histories. The Western Australian SHRIMP II, which is located at Curtin University, provides rapid, precise measurements of isotope ratios in minerals and glasses and has been applied to a wide variety of geological problems and to a few applied physics problems. During the last three years we have expanded the number of minerals that can be used for U-Th-Pb age dating to include titanite, rutile, apatite, badellyite, perovskite and monazite. In addition to age dating the SHRIMP can be used for isotopic tracing. SHRIMP analysis provides the spatial resolution required to study S isotopes in very complex ores from many of Australia's largest ore deposits (Mt Isa, Broken Hill, Olympic Dam). Sulphur isotope ratios can be measured with a precision of 1-2 ppm in both sulphides and sulphates. In situ S isotopic compositions of galena (PbS), sphalerite (ZnS), chalcopyrite (CuS) and pyrite (FeS) has been crucial in the development of models of ore deposition. The in situ analytical capability and the high sensitivity of the SHRIMP II has allowed measurement of, diffusion profiles of REE and other trace element in melt couples, the mineral-melt partition coefficients of these

  12. Denitrification of Spent Regenerated Brine Using Molasses

    OpenAIRE

    Tepuš, Brigita; Simonič, Marjana; Petrovič, Aleksandra; Filipič, Jasmina

    2014-01-01

    Spent BRINE from the regeneration of exhausted resins has to be properly treated before its disposal. The heterotrophic denitrification of regenerated brine was studied in present work. Molasses which served as a carbon source has until now not been applied during brine denitrification. The nitrate and nitrite consumptions were observed according to different ratios between total organic carbon and nitrate (TOC / NO3 ratios) and the influence of NaCl was studied during batch experiments. ...

  13. Distillation Brine Purification for Resource Recovery Applications

    Science.gov (United States)

    Wheeler, Raymond M.

    2014-01-01

    Wastewater processing systems for space generate residual brine that contains water and salts that could be recovered to life support consumables. The project assessed the use of ion-exchange resins to selectively remove salts from wastewater treatment brines. The resins were then regenerated for additional use. The intention would be to generate a Na/K and CI rich or purified brine that would then be processed into high value chemicals, such as acids, bases, and/or bleach.

  14. Brine disposal process for Morcinek coal mine

    Energy Technology Data Exchange (ETDEWEB)

    Tait, J.H. [Aquatech Services, Inc., Citrus Heights, CA (United States)

    1995-04-01

    This paper describes the work to develop a commercial brine disposal process for the Morcinek mine, located 45 km south of the city of Katowice in Poland. Currently, brine is discharged into the Odra river and methane from the mine is released into the atmosphere. The process would use the released methane and convert a large percentage of the brine into potable water for commercial use. Thus, the proposed process has two environmental benefits. The brine salinity is about 31,100 ppm. Major brine components are Na (10,300 ppm), Ca (1,170 ppm), Mg (460 ppm), Cl (18,500 ppm) and SO{sub 4}{sup 2-} (252 ppm). Present in smaller amounts are K, S, Sr, B, Ba and NO{sub 3}. The process integrates a reverse osmosis (RO) unit and a submerged combustion evaporator. Extensive studies made at the Lawrence Livermore National Laboratory established the pretreatment method of the brine before it enters the RO unit. Without adequate pretreatment, mineral phases in the brine would become super-saturated and would precipitate in the RO unit. The pretreatment consists of first adding sodium carbonate to increase both the pH and the carbonate concentration of the brine. This addition causes precipitation of carbonate solids containing Ca, Mg, Sr, and Ba. After filtration of these precipitates, the fluid is acidified with HCl to prevent precipitation in the RO unit as the brine increases in salinity.

  15. Origin of the yellow brine and the black brine in Sichuan Basin

    International Nuclear Information System (INIS)

    The spring water, geothermal water and Cretaceous brine in the outer zone of the Sichuan Basin has the Craig relationship, and they are cycling waters. The brine in the inner zone is mainly metasedimentary water. A basic feature of them is poor in 2H, but rich in 18O. The δD-values of the yellow brine in Jurassic and Upper Triassic aquifer of continental facies varies from -62.25 to -22.4, and the δ18O-values are -6.72 - +6.02. The δD-values of the black brine in marine aquifer (T2,T1,P,C,O and so on) varies from -49 to -25.1, and the 18O values are +3.89 - +6.14. The δD of yellow brine is similar to that of meteoric water, and the δD of the black brine is around that of crystallization water expelled from gypsum by anhydritization. Increases of salinity in Jurassic yellow brine result primarily from the evapotranspiration process. The salinity in Upper Triassic yellow brine in Aa sub-area originated from underlying rock salt which was leached by paleometeoric water. Triassic black brine derived from the mixing of the crystallization water leached from rock salt with the residual sea water after salt crystallization. In Zhigong, the composition of yellow brine has mainly been changed by the mixing of the yellow brine with the black brine. (author). 2 refs, 2 figs, 2 tabs

  16. Toxic Assessment of Triclosan and Triclocarban on Artemia salina.

    Science.gov (United States)

    Xu, Xiaolu; Lu, Yin; Zhang, Deyong; Wang, Yinyin; Zhou, Xianshan; Xu, Huiying; Mei, Yu

    2015-12-01

    In this study, we investigated the possible acute toxic and genotoxic effects of triclosan (TCS) and triclocarban (TCC) on Artemia salina. Genotoxicity was evaluated using single-cell gel electrophoresis and apoptotic frequency assays (Annexin V-FITC/PI assay). Acute toxicity test results showed that TCC (LC50-24 h = 17.8 µg/L) was more toxic than TCS (LC50-24 h = 171.1 µg/L). Significant increases in both genotoxic biomarkers were observed at 24 h after initial exposure, indicating that these two chemicals are potentially dangerous for this aquatic biological model. Although further studies are required, a comparison of data both in vitro and in vivo allowed us to suggest possible mechanisms of action for TCS and TCC in this sentinel organism. PMID:26310128

  17. On the physico-chemical characteristics of brines

    Digital Repository Service at National Institute of Oceanography (India)

    Shirodkar, P.V.; Rao, P.V.S.S.D.P.; Singbal, S.Y.S.

    Analyses of the natural brines form the salt lakes, salt pans and the artificial brines obtained after the solar desalination of seawater respectively, showed wide differences in their physico-chemical characteristics. The natural brines are markEd...

  18. REFUSE OF FERMENTATION BRINES IN THE CUCUMBER PICKLING INDUSTRY

    Science.gov (United States)

    The project evaluated on a commercial scale the technological and economic feasibility of recycling spent cucumber fermentation brine. Two brine treatment procedures, heat treatment and chemical treatment, were used. The results showed that brine recycling was practical on a comm...

  19. Polarization signals in mantis shrimps

    Science.gov (United States)

    Cronin, Thomas W.; Chiou, Tsyr-Huei; Caldwell, Roy L.; Roberts, Nicholas; Marshall, Justin

    2009-08-01

    While color signals are well known as a form of animal communication, a number of animals communicate using signals based on patterns of polarized light reflected from specialized body parts or structures. Mantis shrimps, a group of marine crustaceans, have evolved a great diversity of such signals, several of which are based on photonic structures. These include resonant scattering devices, structures based on layered dichroic molecules, and structures that use birefringent layers to produce circular polarization. Such biological polarizers operate in different spectral regions ranging from the near-UV to medium wavelengths of visible light. In addition to the structures that are specialized for signal production, the eyes of many species of mantis shrimp are adapted to detect linearly polarized light in the ultraviolet and in the green, using specialized sets of photoreceptors with oriented, dichroic visual pigments. Finally, a few mantis shrimp species produce biophotonic retarders within their photoreceptors that permit the detection of circularly polarized light and are thus the only animals known to sense this form of polarization. Mantis shrimps use polarized light in species-specific signals related to mating and territorial defense, and their means of manipulating light's polarization can inspire designs for artificial polarizers and achromatic retarders.

  20. Reducing Vibrio load in Artemia nauplii using antimicrobial photodynamic therapy: a promising strategy to reduce antibiotic application in shrimp larviculture

    Digital Repository Service at National Institute of Oceanography (India)

    Aparna, A.; Arshad, E.; Jasmin, C.; Pai, S.S.; BrightSingh, I.S.; Mohandas, A.; Anas, A.

    propitious alternative to antibiotics in recent years (Wainwright, 1998; Lee et al., 2004; Konopka and Goslinski, 2007; Donnelly et al., 2008; Almeida et al., 2009; Garland et al., 2009; Wainwright, 2009; Nakonechny et al., 2010; Wainwright, 2010). a...., 2000b; Defoirdt et al., 2007; Anas et al., 2009). Despite in vitro successes with these strategies, their wide spread application is limited by their inconsistency in the field and more importantly their handicap to provide protection during...

  1. Nutritional Content of Artemia sp. Fed with Chaetoceros calcitrans and Skeletonema costatum

    Directory of Open Access Journals (Sweden)

    VIVI ENDAR HERAWATI

    2014-12-01

    Full Text Available Artemia sp. is a natural food with high protein content, especially amino acid. Nowadays, Indonesia still relies on import for its supply. Hence, the utilization of local Artemia sp. as an alternative to the imported product is recommended as it contains more protein and less expensive. The advantages of local Artemia sp. is its better crystal quality as it is still fresh. It also provides better income for salt farmers because waste water from salt farm can be used to culture Artemia sp.. This research is aimed at determining the quality of locally-produced Artemia sp., by evaluation of its essential amino acid and fatty acid profiles after treatments. Our results indicated that Artemia sp. cysts with good quality were produced after 8 hours and Artemia sp. reaches a hatching rate of 1,320,000 cysts (95% after 27 hours. We also found an indication that the best feed concentration was a mix of 60% Chaetoceros calcitrans with 40% Skeletonema costatum. Fatty acid profile analyses showed that the highest SAFA (12.86% and PUFA (29.91% were gained after feeding with Chaetoceros calcitrans, whereas the highest HUFA (4.93% was gained after feeding with Skeletonemacostatum. Essential amino acid profile analyses revealed the highest content of amino acid (18912.62 ppm was after feeding with a combination of Chaetoceros calcitrans and Skeletonema costatum. Finally, the proper water quality during research was at 25-30 oC of temperature, 30-31 ppt of salinity, pH 7.8-8.9, and DO was at 3.0-4.4 mg/L.

  2. Effect of Brine Solution Containing Ginger Extracts on the Properties of Egyptian White Brined Cheese

    Directory of Open Access Journals (Sweden)

    M. Abd El-Aziz

    2015-01-01

    Full Text Available The present study aims to investigate the physico-chemicals properties of white cheese pickled in brine solution containing ginger extracts. After cows milk coagulation and whey drained, fresh white cheese block was cut and divided into 3 equal portions. The first portion covered with 16.0% brine aqueous ginger extract and the second portion was covered with 16.0% brine ethanol ginger extract. The later was covered with 16.0% plain brine serves as a control. All white brined cheese treatments were stored at 5±2°C for the ripening period of 60 days. The results revealed that brine solution containing aqueous ginger extract or ethanol ginger extract enhances the growth of starter culture, protein proteolysis (WSN/TN, total volatile fatty acids (TVFAs, oxidative stability (reduced TBA and sensory properties of white brined cheese compared with control cheese. In addition, brine solution containing aqueous ginger extract or ethanol ginger extract caused an increase in reddish and yellowish color degree and decrease in hardness of white cheese. However, most of these observations were more pronounced in white cheese pickled in brine aqueous ginger extract compared with that pickled in brine ethanol ginger extract; the differences were not significant.

  3. The link between shrimp farm runoff and blooms of toxic Heterosigma akashiwo in Red Sea coastal waters

    Directory of Open Access Journals (Sweden)

    Zakaria A. Mohamed

    2012-04-01

    Full Text Available In May 2010 a copious bloom of the raphidophyte Heterosigma akashiwo was observed for the first time in Red Sea waters off the coasts of Saudi Arabia.This bloom was confined to an area where water and phytoplankton flow freely between the sea and a shrimp farm. The phytoplankton density and physico-chemical characteristics of the sea water were therefore investigated weekly at bloom and non-bloom sites in order to gain insightinto the environmental factors prevailing at the bloom site and their link with the shrimp farm runoff. The bloom site showed higher nutrient concentrations than the non-bloom site, indicating the possible role of the shrimp farm in flushing nutrients into this site. The bloom appeared on 27 May, coinciding with a decrease in salinity (19°C. The results of toxicological assays showed that both bloom samples and batch cultures of H. akashiwo were toxic toArtemia salina and exhibited haemolytic activity with respectto rabbit erythrocytes.Bloom samples showed a higher toxicity (LC50=8.9 ×10^4 cells ml-1 and haemolytic activity (EC50=3.64 × 104cells ml-1 than the batch cultures (LC50=11.6 × 104 cells ml-1, EC50=5.1 imes 104 cells ml-1. In the light ofthe results of this study, the link between H. akashiwoblooms and shrimp farm runoff should be considered during the monitoring of Red Sea coastal waters for the presence of harmful algal blooms.

  4. Zooplankton at deep Red Sea brine pools

    KAUST Repository

    Kaartvedt, Stein

    2016-03-02

    The deep-sea anoxic brines of the Red Sea comprise unique, complex and extreme habitats. These environments are too harsh for metazoans, while the brine–seawater interface harbors dense microbial populations. We investigated the adjacent pelagic fauna at two brine pools using net tows, video records from a remotely operated vehicle and submerged echosounders. Waters just above the brine pool of Atlantis II Deep (2000 m depth) appeared depleted of macrofauna. In contrast, the fauna appeared to be enriched at the Kebrit Deep brine–seawater interface (1466 m).

  5. Ice Control with Brine on Highways

    DEFF Research Database (Denmark)

    Bolet, Lars

    of interpreting this information. The improvements gained by the county of Funen were mainly due to the use of technologies (brine spreading with nozzles) giving a more precise spread pattern than the traditional gritting of pre-wetted salt. Major challenges in the process have been to verify the higher quality...... of the nozzles spread pattern, to ensure maximum utilization of volume of brine carried by the spreading vehicles and to control the mixing of brine without getting stratification in the mixture. Moreover, of course, to ensure political approval of abandoning a well-served technology and to organize...

  6. Coiled Brine Recovery Assembly (CoBRA): A New Approach to Recovering Water from Wastewater Brines

    Science.gov (United States)

    Pensinger, Stuart J.

    2015-01-01

    Brine water recovery represents a current technology gap in water recycling for human spaceflight. The role of a brine processor is to take the concentrated discharge from a primary wastewater processor, called brine, and recover most of the remaining water from it. The current state-of-the-art primary processor is the ISS Urine Processor Assembly (UPA) that currently achieves 70% water recovery. Recent advancements in chemical pretreatments are expected to increase this to 85% in the near future. This is a welcome improvement, yet is still not high enough for deep space transit. Mission architecture studies indicate that at least 95% is necessary for a Mars mission, as an example. Brine water recovery is the technology that bridges the gap between 85% and 95%, and moves life support systems one step closer to full closure of the water loop. Several brine water recovery systems have been proposed for human spaceflight, most of them focused on solving two major problems: operation in a weightless environment, and management and containment of brine residual. Brine residual is the leftover byproduct of the brine recovery process, and is often a viscous, sticky paste, laden with crystallized solid particles. Due to the chemical pretreatments added to wastewater prior to distillation in a primary processor, these residuals are typically toxic, which further complicates matters. Isolation of crewmembers from these hazardous materials is paramount. The Coiled Brine Recovery Assembly (CoBRA) is a recently developed concept from the Johnson Space Center that offers solutions to these challenges. CoBRA is centered on a softgoods evaporator that enables a passive fill with brine, and regeneration by discharging liquid brine residual to a collection bag. This evaporator is meant to be lightweight, which allows it to be discarded along with the accumulated brine solids contained within it. This paper discusses design and development of a first CoBRA prototype, and reports

  7. Brine Dewatering Using Ultrasonic Nebulization Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Recovery of water from brine is critically important for future manned space exploration. Resupply of water is prohibitively costly for such extended missions....

  8. Brine Dewatering Using Ultrasonic Nebulization Project

    Data.gov (United States)

    National Aeronautics and Space Administration — Recovery of water from brine is critically important for manned space exploration. Resupply of water is prohibitively costly for extended missions. It is...

  9. Echinoderms as indicators of brine discharge impacts

    OpenAIRE

    Fernández-Torquemada, Yolanda; González-Correa, José Miguel; Sánchez-Lizaso, José Luis

    2013-01-01

    Echinoderms are osmoconformer organisms and are expected to be very sensitive to brine discharges. The objective of this study is to examine the use of echinoderms as early warning indicators of the impact of brine discharges and its application in the management of desalination discharges. We sampled using visual census along transect lines, for nine consecutive years and in three different stations, i.e. before the seawater reverse osmosis desalination plant began operating and thereafter. ...

  10. Phaeobacter inhibens as Probiotic Bacteria in Non-Axenic Artemia and Algae Cultures

    DEFF Research Database (Denmark)

    Grotkjær, Torben; D'Alvise, Paul; Bentzon-Tilia, Mikkel;

    2015-01-01

    Bacterial diseases are a major constraint in aquaculture, especially in larviculture. Antibiotics that can control pathogens should be avoided due to risk of antibiotic resistance. We have shown in axenic systems of live larval feed that marine Roseobacter clade bacteria can antagonize fish...... (Phaeobacter inhibens) were studied in an Artemia and a Dunaliella tertiolecta challenge setup, and a controlled microbiota of four bacteria isolated from aquaculture was added. P. inhibens grew well in Artemia and D. tertiolecta cultures, also with a background microbiota. V. anguillarum was decreased...... demonstrates that probiotic bacteria can be introduced at the stage of live feed and have a pathogen reducing effect in both an Artemia and a D. tertiolecta challenge setup. This can potentially limit the subsequent use of antibiotics for control of pathogenic bacteria....

  11. ANTIMICROBIAL SCREENING AND BRINE SHRIMP LETHALITY BIOASSAY OF TINOSPORA CORDIFOLIA (FAM: MENISPERMACEAE)

    OpenAIRE

    Mohammad Kaisarul Islam

    2011-01-01

    Tinospora cordifolia (Fam: Menispermaceae) has been investigated for evaluation of the biological activities. The stem of Tinospora cordifolia were extracted with carbon tetrachloride, n-hexane and methanol were collected and afford 4.0 mg, 4.0 mg, and 4.0 mg, respectively for the test. The crude carbon tetrachloride, n-hexane, and methanol extract of the plant were subjected to antimicrobial screening against 15 microorganisms such as gram-positive, gram-negative, fungi by the disc diffusion...

  12. CYTOTOXIC (BRINE SHRIMP LETHALITY BIOASSAY ) AND ANTIOXIDANT INVESTIGATION OF BARRINGTONIA ACUTANGULA (L.)”

    OpenAIRE

    Md. Asaduzzaman; Dr. Md. Sohel Rana; S.M. Raqibul Hasan; Md. Monir Hossain; Nittananda Das

    2015-01-01

    Barringtonia acutangula (L.) gaertn. (Family: Barringtoniaceae), a medicinal small to medium evergreen tree known as ‘Hijal’, is used in diarrhoea, dysentery, colic, flatulence, cooling, aperients expectorant, stimulating emetic, astringents to the bowel, antihelminthic, bronchitis, lumber pain, hallucinations, seminal weakness, gonorrhoea and many other ailments in rural areas of Bangladesh It is also used as traditional medicine in other countries. But till to date, sporadic attempts have b...

  13. Isolasi dan Uji Bioaktivitas Kandungan Kimia Utama Puding Merah dengan Metoda Uji Brine Shrimp

    OpenAIRE

    Sovia Lenny

    2006-01-01

    Puding merah (Graptophyllum pictum L Griff) merupakan tumbuhan perdu atau pohon kecil yang banyak dimanfaatkan oleh masyarakat untuk berbagai keperluan seperti untuk obat berbagai penyakit dan pelembut kulit, oleh Sovia Lenny

  14. Antimicrobial Activity and Brine shrimp Toxicity of Extracts of Terminalia Brownii Roots and Stem.

    OpenAIRE

    Mbwambo, Zakaria H; Moshi, Mainen J.; Masimba, Pax J; Kapingu, Modest C; Nondo, Ramadhani S.O.

    2007-01-01

    Background Ternimalia brownii Fresen (Combretaceae) is widely used in traditional medicine to treat bacterial, fungal and viral infections. There is a need to evaluate extracts of this plant in order to provide scientific proof for it's wide application in traditional medicine system. Methods Extraction of stem bark, wood and whole roots of T. brownii using solvents of increasing polarity, namely, Pet ether, dichloromethane, dichloromethane: methanol (1:1), methanol and aqua, respectively, af...

  15. Two New Coumarins from Micromelum falcatum with Cytotoxicity and Brine Shrimp Larvae Toxicity

    OpenAIRE

    Si Zhang; Yongzhong Huang; Qiao Liu; Qingxin Li; Hao Yin; Xiongming Luo; Weihong He

    2012-01-01

    Two new coumarins, 7-methoxy-8-(2-hydroxmethyl-1-O-isovaleryl-4-butenyl)-coumarin (1) and 7-methoxy-8-(1-hydroxy-2-O-b-glucopyranosyl-3-methyl-4-butene-1-yl)coumarin (2), and twelve known coumarins 3–14 were isolated from the stem bark of Micromelum falcatum. The structures of compounds 1–14 were elucidated by extensive spectrosc...

  16. Antimicrobial activity and brine shrimp toxicity of extracts of Terminalia brownii roots and stem

    OpenAIRE

    Mbwambo, Zakaria H.; Moshi, Mainen J; Masimba, Pax J; Kapingu, Modest C; Nondo, Ramadhani SO

    2007-01-01

    Background Ternimalia brownii Fresen (Combretaceae) is widely used in traditional medicine to treat bacterial, fungal and viral infections. There is a need to evaluate extracts of this plant in order to provide scientific proof for it's wide application in traditional medicine system. Methods Extraction of stem bark, wood and whole roots of T. brownii using solvents of increasing polarity, namely, Pet ether, dichloromethane, dichloromethane: methanol (1:1), methanol and aqua, respectively, af...

  17. Antimicrobial Activity and Brine shrimp Toxicity of Extracts of Terminalia Brownii Roots and Stem.

    OpenAIRE

    Mbwambo, Zakaria H.; Moshi, Mainen J; Masimba, Pax J; Kapingu, Modest C; Nondo, Ramadhani S O

    2007-01-01

    Ternimalia brownii Fresen (Combretaceae) is widely used in traditional medicine to treat bacterial, fungal and viral infections. There is a need to evaluate extracts of this plant in order to provide scientific proof for it's wide application in traditional medicine system. Extraction of stem bark, wood and whole roots of T. brownii using solvents of increasing polarity, namely, Pet ether, dichloromethane, dichloromethane: methanol (1:1), methanol and aqua, respectively, afforded dry extracts...

  18. Toxicity of Nanoparticles to Brine Shrimp: An Introduction to Nanotoxicity and Interdisciplinary Science

    Science.gov (United States)

    Maurer-Jones, Melissa A.; Love, Sara A.; Meierhofer, Sharon; Marquis, Bryce J.; Liu, Zhen; Haynes, Christy L.

    2013-01-01

    Nanotoxicity is an area of intense research, stimulated by increased use of nanoparticles in commercially available products. Herein, using nanotoxicity as a platform, we describe an experiment that emphasizes interdisciplinary science in a collaborative work setting while expanding the traditional realm of chemistry and chemistry research.…

  19. [Environmental Education Units.] Succession in a Micro-Aquarium. Minnows and Models. Brine Shrimp.

    Science.gov (United States)

    Minneapolis Independent School District 275, Minn.

    These three booklets are outlines of teaching procedures, using living material, designed for elementary school children. While emphasizing science, many opportunities are provided for exercises in mathematics, art, and writing, thus integrating the curriculum. All booklets contain exercises on data collection and organization; two have exercises…

  20. CONSUMPTIONS RATES OF SUMMER FLOUNDER LARVAE ON ROTIFER AND BRINE SHRIMP PREY DURING LARVAL REARING

    Science.gov (United States)

    Larval summer flounder Paralichthys dentatus were hatched and reared through metamorphosis in the laboratory. At several points in the rearing cycle, larvae were removed from their rearing chambers and placed in small bowls, where they were fed known quantities of the rotifer Bra...

  1. A cost-effectiveness analysis of live feeds in juvenile turbot Scophthalmus maximus (Linnaeus, 1758) farming

    DEFF Research Database (Denmark)

    Gedefaw Abate, Tenaw; Nielsen, Rasmus; Nielsen, Max;

    2016-01-01

    current usage is quite limited. One of the reasons has been lack of economic knowledge concerning the cost-effectiveness of copepod application compared to other commonly used feed items such as the brine shrimp Artemia. In this study, a cost-effectiveness analysis is made on two alternative live feed...

  2. A convenient synthesis of pseudoceratidine and three analogs for biological evaluation

    DEFF Research Database (Denmark)

    Behrens, C.; Christoffersen, M.W.; Gram, Lone;

    1997-01-01

    be adopted to the preparation of other derivatives. This was demonstrated by the synthesis of a 5,5'-didebromo derivative (2) and two analogs (3-4). The compounds 1-4 have been tested for antibacterial activity and the results compared to a previous study. Also activity against the marine brine...... shrimp Artemia salina is reported....

  3. [Artemia sp. (Crustacea, Anostracea) as intermediate host of Eurycestus avoceti Clark, 1954 (Cestoda, Cyclophyllidea) (author's transl)].

    Science.gov (United States)

    Gabrion, C; MacDonald, G

    1980-01-01

    Examination of Artemia sp. (Crustacé, Anostracé) for natural infection by cysticercoids of Flamingolepis liguloides, Cestode of the Flamingo (Phoenicopterus ruber) shows the presence of three other cysticercoids of cestode parasites of the Flamingo in the hemocoele of the Branchiopode. A fourth one is reported as the cysticercoid of Eurycestus avoceti, Clark, 1954, which parasitizes the Avocet (Recurvirostra avosetta). The systematic position of this Cestode is always unknown. This report shows the importance of Artemia in the life cycle of Cestodes of Anseriforms and Charadriiforms birds in saline lagoons. PMID:7406422

  4. Bacteria contribute to Artemia nutrition in algae-limited conditions: A laboratory study

    OpenAIRE

    Toi, H.T.; P. Boeckx; Sorgeloos, P.; Bossier, P; Van Stappen, G.

    2013-01-01

    We investigated the effect of the stimulation of bacterial growth on Artemia performance in combination with a standard and with a low algal feeding regime. In both regimes, organic carbon (supplied as sucrose or soluble potato starch) and 15N labeled inorganic nitrogen (supplied as NaNO3) were used to stimulate bacterial growth in the Artemia cultures at C/N ratio 10 and 50. After a culture period of 15 days, significantly improved biomass production was obtained in all treatments with the l...

  5. Radiation-pathological examinations of Artemia Salina L. after exposure to heavy nuclei of cosmic radiation

    International Nuclear Information System (INIS)

    The radiation damage incurring in the development of Artemia salina (L) are investigated for the case when the eggs of this salt crab are not by a heavy nucleus of cosmic radiation. These are atom nuclei heavier than helium which possess relatively high energy. The investigations belong to the series of biostack experiments in which very intensively explored standard objects, embedded in water-soluble plastics (PVH), are exposed to space conditions. Artemia salina (L.) proved esp. suitable because of its extraordinary resistance against chemical and physical damaging factors. (orig./AJ)

  6. Comparison of brines relevant to nuclear waste experimentation

    International Nuclear Information System (INIS)

    The ionic compositions of 18 brines used in nuclear waste-related laboratory tests or obtained from field tests are described and compared. Also described are the origin of each brine, its predominant use for laboratory testing, and its relavancy for future testing. The brines include Brines A and B (Waste Isolation Pilot Plant (WIPP)/generic), Office of Nuclear Waste Isolation (ONWI) Composite Permian Brine P and Equilibrated Permian P No. 2, Battelle Pacific Northwest Laboratory (PNL)-Sandia High-Level Waste (HLW) package interactions test brines (flow and downhole), ERDA-6 brines (flow and downhole), WIPP Inclusions No. 1 and No. 2, Materials Characterization Center (MCC) brine, German quinare Brine Q, US Geological Survey bittern NBT-6a, saturated NaCl (200 and 1000C), and standard seawater

  7. Progress in live food production and use in fish and shellfish hatcheries

    OpenAIRE

    Sorgeloos, P.

    1998-01-01

    Different species of microalgae, the rotifer, Brachionus spp., and the brine shrimp, Artemia spp., are essential live food in the farming of several species of molluscs (e.g. oyster, clam, scallop), crustaceans (e.g. marine shrimp, freshwater prawn, crabs) and fish (e.g. bass, bream, grouper, turbot, flounder, halibut, ayu). A brief overview is given of the latest developments in their production and use in industrial hatcheries.

  8. Monitoring Change in Great Salt Lake

    Science.gov (United States)

    Naftz, David; Angeroth, Cory; Freeman, Michael; Rowland, Ryan; Carling, Gregory

    2013-08-01

    Great Salt Lake is the largest hypersaline lake in the Western Hemisphere and the fourth largest terminal lake in the world (Figure 1). The open water and adjacent wetlands of the Great Salt Lake ecosystem support millions of migratory waterfowl and shorebirds from throughout the Western Hemisphere [Aldrich and Paul, 2002]. In addition, the area is of important economic value: Brine shrimp (Artemia franciscana) residing in Great Salt Lake support an aquaculture shrimp cyst industry with annual revenues as high as $60 million.

  9. The Effects of Shrimp Gut Probiotic Bacteria on the Shrimp Larvae (Penaeus Chinensis)

    Institute of Scientific and Technical Information of China (English)

    2002-01-01

    The survival rates of shrimp larvae in different stage are higher than those of control groups when probiotic bacteria strains X4B-1 and X1B-1 which are isolated from gut of adult shrimp are added into the little volume rearing sea water of shrimp larvae. The effects of probiotic bacteria are evaluated by challenge test (pathogenic bacteria Z3G2 isolated from disease shrimp larvae in the hatchery of Jimo town) and low salinity stress resistance tests on shrimp larvae, the survival rate and lengths of the shrimp larvae in the experiment are determined. Results indicate that 1. The survival rate, ability of resistant to low salinity, lengths of the delivered shrimp larvae are improved after the strains of probiotic bacteria, X4B-1 or X1B-1, are added into the rearing sea water of hatchery. 2. The addition of the probiotic bacteria could not influence the change of the bacteria number, NH3-N and COD value in the rearing sea water. 3. The probiotic bacteria used in the experiment have many enzymes such as Lipase, Amylase, Gelatinase and Lecithinase. These enzymes may help the probiotic bacteria to digest the food components fed to shrimp larvae and increase the digestive efficiency of post larvae. This may be one of the reasons why these probiotic bacteria are beneficial to the shrimp larvae.

  10. Morphometric characterization of thalassohaline Artemia franciscana populations from the Colombian Caribbean

    OpenAIRE

    Camargo, W.N.; Ely, J.S.; Sorgeloos, P.

    2003-01-01

    Aim: To establish possible interpopulation relationships among Colombian Artemia franciscana (Crustacea, Anostraca) populations.Location: Colombian Caribbean coast (Manaure, Galerazamba, Salina Cero and Tayrona) and a similar thalassohaline reference population from San Francisco Bay (SFB-USA). Methods: Morphometric characters of male and female cultured individuals of A. franciscana were measured. The populations were grouped according to: (1) population type (populations grouped according t...

  11. Effect of artificial regulations of Artemia n-3 HUFA content on growth and survival of black seabream ( Sparus macrocephalus) larvae

    Science.gov (United States)

    Liu, Jing-Ke

    1998-06-01

    The requirement for dietary n-3 HUFA (highly unsaturated fatty acid) for growth and survival of black seabream ( Sparus macrocephalus) larvae was tested using Artemia with various levels of n-3 HUFA. Four treatments with Artemia differing in their n-3 HUFA were prepared by feeding them various oil emulsions. The results indicated that dietary n-3 HUFA significantly influences fish n-3 HUFA levels and are necessary for good growth and survival of black seabream larvae. The proper value of n-3 HUFA level and DHA, EPA level in Artemia should be 4.273% and 0.873% (wet weight) for good growth and survival in black seabream larvae respectively.

  12. Successful inoculation of Artemia and production of cysts in man-made salterns in the Philippines

    OpenAIRE

    de los Santos, C. Jr.; Sorgeloos, P.; Laviña, E.; Bernardino, A.

    1980-01-01

    The objective of the inoculation described in this paper was to test the feasibility of culturing Artemia in man-made earthen salterns and of producing adults and cysts for use in aquaculture projects in the Philippines. San Francisco Bay (California, USA) Artemia were inoculated in two concrete tanks and in four earthen ponds which are part of a small local salt factory. It was found that Artemia can be grown (with continuous production of nauplii and cysts) year-round in covered concrete ta...

  13. Feeding adult of Artemia salina (Crustacea-Branchiopoda) on the dinoflagellate Gyrodinium corsicum (Gymnodiniales) and the Chryptophyta Rhodomonas baltica

    OpenAIRE

    Rauquírio André Albuquerque Marinho da Costa; Maria Luise Koening; Luci Cajueiro Carneiro Pereira

    2005-01-01

    Experiments were carried out on feeding performance and survival rates of adult Artemia salina exposed to no axenic strains of the dinoflagellate Gyrodinium corsicum and of the Chryptophyta Rhodomonas baltica. Filtration rates on R. baltica and G. corsicum varied from 3.35 to 7.14 ml.artemia-1.h-1 and from 2.97 to 15.86 ml.artemia-1.h-1, respectively. The ingestion rates observed for A. salina did not indicate any digestive dysfunction or physiological impairment for organisms fed on G. corsi...

  14. Brine flow in heated geologic salt.

    Energy Technology Data Exchange (ETDEWEB)

    Kuhlman, Kristopher L.; Malama, Bwalya

    2013-03-01

    This report is a summary of the physical processes, primary governing equations, solution approaches, and historic testing related to brine migration in geologic salt. Although most information presented in this report is not new, we synthesize a large amount of material scattered across dozens of laboratory reports, journal papers, conference proceedings, and textbooks. We present a mathematical description of the governing brine flow mechanisms in geologic salt. We outline the general coupled thermal, multi-phase hydrologic, and mechanical processes. We derive these processes' governing equations, which can be used to predict brine flow. These equations are valid under a wide variety of conditions applicable to radioactive waste disposal in rooms and boreholes excavated into geologic salt.

  15. Marine Lactobacillus pentosus H16 protects Artemia franciscana from Vibrio alginolyticus pathogenic effects.

    Science.gov (United States)

    Garcés, M E; Sequeiros, C; Olivera, N L

    2015-02-10

    Vibrio alginolyticus is an opportunistic pathogen which may affect different aquatic organisms. The aim of this study was to assess the probiotic properties and the protective mode of action of Lactobacillus pentosus H16 against V. alginolyticus 03/8525, through in vitro and in vivo studies using Artemia franciscana (hereafter Artemia). This strain showed antimicrobial activity against V. alginolyticus 03/8525 and Aeromonas salmonicida subsp. salmonicida ATCC33658 possibly related to lactobacilli organic acid production. It was able to survive at high rainbow trout bile concentrations and showed high selective adhesion to rainbow trout mucus (1.2×10(5)±8.0×10(3) cells cm(-2)). H16 outcompeted V. alginolyticus 03/8525 and A. salmonicida subsp. salmonicida ATCC33658, greatly reducing their adherence to rainbow trout mucus (64.8 and 74.1%, respectively). Moreover, H16 produced a cell-bound biosurfactant which caused an important decrease in the surface tension. H16 also protected Artemia nauplii against mortality when it was administered previous to V. alginolyticus 03/8525 inoculation. Furthermore, H16 bioencapsulated in Artemia, suggesting that it is possible to use live carriers in its administration. We conclude that the ability of L. pentosus H16 to selectively adhere to mucosal surfaces and produce cell-bound biosurfactants, displacing pathogenic strains, in addition to its antimicrobial activity, confer H16 competitive advantages against pathogens as demonstrated in in vivo challenge experiments. Thus, L. pentosus H16, a marine bacterium from the intestinal tract of hake, is an interesting probiotic for Artemia culture and also has the potential to prevent vibriosis in other aquaculture activities such as larvae culture and fish farming. PMID:25667335

  16. Function of shrimp STAT during WSSV infection.

    Science.gov (United States)

    Wen, Rong; Li, Fuhua; Li, Shihao; Xiang, Jianhai

    2014-06-01

    JAK/STAT signaling pathway plays key roles in the antiviral immunity of mammals, fish and insect. However, limited knowledge is known about the function of JAK/STAT signaling pathway in the antiviral immunity of shrimp although virus disease has caused severe mortality in shrimp aquaculture. In order to understand the function of JAK/STAT signaling pathway in the antiviral immunity of shrimp, dsRNA interfering technique was used to silence the expression of STAT gene in Litopenaeus vannamei, and the mortality of shrimp was detected after WSSV infection. Furthermore, the expressions of some potential target genes regulated by STAT or genes related to RNA interfering pathway were detected in STAT silenced shrimp during WSSV infection. The WSSV copy number in STAT silenced shrimp was 10(2)-10(3) copies/ng DNA which was much lower than that in the control. The mortality in STAT silenced shrimp caused by WSSV infection decreased very significantly compared to their controls. The function of STAT was verified in vitro cultured cells of hematopoietic tissue of crayfish Cherax quadricarinatus by adding specific inhibitor of STAT3(S3I-201), and the cultured cells treated with S3I-201 showed much less WSSV copy number than their controls, which further suggested that STAT might be helpful for the replication of WSSV. Expression analysis on the potential STAT target genes and genes in RNA interfering pathway provide important information for understanding the functional mechanism of STAT in antiviral immunity of shrimp. PMID:24727196

  17. Signalling by the cleaner shrimp Periclimenes longicarpus

    OpenAIRE

    Chapuis L.; Bshary R.

    2010-01-01

    Signals increase the fitness of a sender by altering the behaviour of receivers. For cooperative interactions biological market theory proposes that signalling strength may be linked to supply and demand. In this context, a recent laboratory experiment demonstrated that cleaner shrimps may advertise their service to client reef fish and that the advertisement is linked to hunger levels. We investigated signalling by the cleaner shrimp Periclimenes longicarpus in the field to test more detaile...

  18. Sensory quality of frozen shrimp Litopenaeus vannamei

    Directory of Open Access Journals (Sweden)

    Inês Maria Barbosa Nunes Queiroga

    2014-09-01

    Full Text Available The objective of this research was to evaluate the sensory quality of the marine shrimp Litopenaeus vannamei grown and stored in a freezer. A sensory analysis consisted of the Quality Index Method (MIQ to review the raw shrimp and Descriptive Analysis (AD in cooked shrimp in samples stored for a period of 90 days, using eight previously trained panelists. Accommodation comprising shrimp filet (100-120 pieces / kg samples were subjected to freezing in liquid nitrogen (- 86 °C, Freezing Tunnel (- 35 °C and Domestic Freezer (- 18 °C. At 0, 30, 60 and 90 days of storage in these freezing systems, determination of pH, water holding capacity (WHC, weight loss during cooking (WLC, shearing force, color, total volatile bases (TVB and thiobarbituric acid reactive substances (TBARS were performed. The attributes manual firmness and softness showed better results in rapid freezing. The color parameters (a *, b * and L *, WHC and WCL were higher at 90 days of storage, no significant losses were observed. Highlighted the strength of greater shear in slowly frozen samples at 90 days, confirming the results reported by the sensory panel. At 90 days of storage, the frozen shrimp showed good sensory quality and physical and chemistry characteristics. The shelf life of this shrimp could be set at about 90 days.

  19. Effect of high intensity ultrasound on the allergenicity of shrimp

    Institute of Scientific and Technical Information of China (English)

    2006-01-01

    The tropomyosin fraction of shrimp proteins is potentially responsible for allergic reaction in individuals with genetic predisposition to allergy. However, there are no efficient and safe methods to reduce its allergenicity. High intensity ultrasound is known to change the structure of proteins. This study is aimed at assessing high intensity ultrasound's effect on the allergenicity of shrimp allergen. Shrimp and purified shrimp allergen were treated with high intensity ultrasound for 30~180 min. Extracts of treated samples were analyzed by enzyme-linked immunosorbent assay (ELISA) with pool serum of shrimp allergy patients and polyclonal anti-allergen antibodies and by immunoblotting after polyacrylamide gel electrophoresis. Shrimp treated with high intensity ultrasound showed a decrease in allergenicity measured with ELISA. A linear relationship between the immune response induced by treated shrimp allergen and the applied treatment time was observed. The decrease in allergenicity was confirmed by immunoblot assays with shrimp allergic patients serum. Allergenicity of shrimp allergen extracted from treated shrimp was higher than that of purified shrimp allergen with the same treatment time. Gel-filtration HPLC was applied for analysis of shrimp allergen after treatment with high intensity ultrasound. Some fractions were appeared with increasing treatment time. The results suggested that high intensity ultrasound could be used to reduce the allergenicity of shrimp.

  20. BIOCHEMICAL PROCESSES FOR GEOTHERMAL BRINE TREATMENT

    Energy Technology Data Exchange (ETDEWEB)

    PREMUZIC,E.T.; LIN,M.S.; BOHENEK,M.; JOSHI-TOPE,G.; ZHOU,W.; SHELENKOVA,L.; WILKE,R.

    1998-09-20

    As part of the DOE Geothermal Energy Program, BNL's Advanced Biochemical Processes for Geothermal Brines (ABPGB) project is aimed at the development of cost-efficient and environmentally acceptable technologies for the disposal of geothermal wastes. Extensive chemical studies of high and low salinity brines and precipitates have indicated that in addition to trace quantities of regulated substances, e.g., toxic metals such as arsenic and mercury, there are significant concentrations of valuable metals, including gold, silver and platinum. Further chemical and physical studies of the silica product have also shown that the produced silica is a valuable material with commercial potential. A combined biochemical and chemical technology is being developed which (1) solubilizes, separates, and removes environmentally regulated constituents in geothermal precipitates and brines (2) generates an amorphous silica product which may be used as feedstock for the production of revenue generating materials, (3) recover economically valuable trace metals and salts. Geothermal power resources which utilize low salinity brines and use the Stretford process for hydrogen sulfide abatement generate a contaminated sulfur cake. Combined technology converts such sulfur to a commercial grade sulfur, suitable for agricultural use. The R and D activities at BNL are conducted jointly with industrial parties in an effort focused on field applications.

  1. Biochemical processes for geothermal brine treatment

    Energy Technology Data Exchange (ETDEWEB)

    Premuzic, E.T.; Lin, M.S.; Bohenek, M.; Joshi-Tope, G.; Zhou, W.; Shelenkova, L.; Wilke, R.

    1998-08-01

    As part of the DOE Geothermal Energy Program, BNL`s Advanced Biochemical Processes for Geothermal Brines (ABPGB) project is aimed at the development of cost-efficient and environmentally acceptable technologies for the disposal of geothermal wastes. Extensive chemical studies of high and low salinity brines and precipitates have indicated that in addition to trace quantities of regulated substances, e.g., toxic metals such as arsenic and mercury, there are significant concentrations of valuable metals, including gold, silver and platinum. Further chemical and physical studies of the silica product have also shown that the produced silica is a valuable material with commercial potential. A combined biochemical and chemical technology is being developed which (1) solubilizes, separates, and removes environmentally regulated constituents in geothermal precipitates and brines, (2) generates an amorphous silica product which may be used as feedstock for the production of revenue generating materials, (3) recover economically valuable trace metals and salts. Geothermal power resources which utilize low salinity brines and use the Stretford process for hydrogen sulfide abatement generate a contaminated sulfur cake. Combined technology converts such sulfur to a commercial grade sulfur, suitable for agricultural use. The R and D activities at BNL are conducted jointly with industrial parties in an effort focused on field applications.

  2. Calcite solubility in simulated geothermal brines

    Energy Technology Data Exchange (ETDEWEB)

    Pool, K.H.; Raney, P.J.; Shannon, D.W.

    1987-02-01

    The deposition of scale on geothermal piping surfaces has been recognized as a cause of increased pressure drop and diminished fluid flow. The two most common scales encountered in the geothermal energy field are silica and calcite. The main purpose of this study was to obtain accurate, reliable calcite solubility data in brines similar to natural geothermal brines over the temperature range of most known exploitable geothermal resources. In addition, geothermal fluid equilibrium modeling efforts and data bases can be refined and fine-turned with respect to the commercially important calcite-geothermal fluid stability problem with these data. The effect of sodium chloride and sodium bicarbonate on the solubility of CaCO/sub 3/ (calcite) in high temperature solutions was measured over the 100 to 300/sup 0/C temperature range. The brines studied contained 0 to 5 wt % NaCl, 0 to 5 mM NaHCO/sub 3/, and 0.003 to 0.1 M CO/sub 2/. The data detailing calcite solubility at various temperatures are presented in tabular, graphical, and regression-equation form for each brine composition tested.

  3. Rheological Properties of Silica Nanoparticles in Brine and Brine-Surfactant Systems

    Science.gov (United States)

    Pales, Ashley; Kinsey, Erin; Li, Chunyan; Mu, Linlin; Bai, Lingyun; Clifford, Heather; Darnault, Christophe

    2016-04-01

    Rheological Properties of Silica Nanoparticles in Brine and Brine-Surfactant Systems Ashley R. Pales, Erin Kinsey, Chunyan Li, Linlin Mu, Lingyun Bai, Heather Clifford, and Christophe J. G. Darnault Department of Environmental Engineering and Earth Sciences, Laboratory of Hydrogeoscience and Biological Engineering, L.G. Rich Environmental Laboratory, Clemson University, Clemson, SC, USA Nanofluids are suspensions of nanometer sized particles in any fluid base, where the nanoparticles effect the properties of the fluid base. Commonly, nanofluids are water based, however, other bases such as ethylene-glycol, glycerol, and propylene-glycol, have been researched to understand the rheological properties of the nanofluids. This work aims to understand the fundamental rheological properties of silica nanoparticles in brine based and brine-surfactant based nanofluids with temperature variations. This was done by using variable weight percent of silica nanoparticles from 0.001% to 0.1%. Five percent brine was used to create the brine based nanofluids; and 5% brine with 2CMC of Tween 20 nonionic surfactant (Sigma-Aldrich) was used to create the brine-surfactant nanofluid. Rheological behaviors, such as shear rate, shear stress, and viscosity, were compared between these nanofluids at 20C and at 60C across the varied nanoparticle wt%. The goal of this work is to provide a fundamental basis for future applied testing for enhanced oil recovery. It is hypothesized that the addition of surfactant will have a positive impact on nanofluid properties that will be useful for enhance oil recovery. Differences have been observed in preliminary data analysis of the rheological properties between these two nanofluids indicating that the surfactant is having the hypothesized effect.

  4. Mirabilite solubility in equilibrium sea ice brines

    Science.gov (United States)

    Butler, Benjamin Miles; Papadimitriou, Stathys; Santoro, Anna; Kennedy, Hilary

    2016-06-01

    The sea ice microstructure is permeated by brine channels and pockets that contain concentrated seawater-derived brine. Cooling the sea ice results in further formation of pure ice within these pockets as thermal equilibrium is attained, resulting in a smaller volume of increasingly concentrated residual brine. The coupled changes in temperature and ionic composition result in supersaturation of the brine with respect to mirabilite (Na2SO4·10H2O) at temperatures below -6.38 °C, which consequently precipitates within the sea ice microstructure. Here, mirabilite solubility in natural and synthetic seawater derived brines, representative of sea ice at thermal equilibrium, has been measured in laboratory experiments between 0.2 and -20.6 °C, and hence we present a detailed examination of mirabilite dynamics within the sea ice system. Below -6.38 °C mirabilite displays particularly large changes in solubility as the temperature decreases, and by -20.6 °C its precipitation results in 12.90% and 91.97% reductions in the total dissolved Na+ and SO42- concentrations respectively, compared to that of conservative seawater concentration. Such large non-conservative changes in brine composition could potentially impact upon the measurement of sea ice brine salinity and pH, whilst the altered osmotic conditions may create additional challenges for the sympagic organisms that inhabit the sea ice system. At temperatures above -6.38 °C, mirabilite again displays large changes in solubility that likely aid in impeding its identification in field samples of sea ice. Our solubility measurements display excellent agreement with that of the FREZCHEM model, which was therefore used to supplement our measurements to colder temperatures. Measured and modelled solubility data were incorporated into a 1D model for the growth of first-year Arctic sea ice. Model results ultimately suggest that mirabilite has a near ubiquitous presence in much of the sea ice on Earth, and illustrate the

  5. Incidence and inactivation of Listeria spp. on frozen shrimp

    Science.gov (United States)

    Foodborne illness outbreaks occasionally occur as a result of microbiologically contaminated crustaceans, including shrimp. Foodborne pathogens occasionally found on shrimp include Listeria monocytogenes, Salmonella spp., Staphylococcus aureus, and Vibrios. In this study the microbiological qualit...

  6. 2012 Economic Survey of Gulf State Shrimp License Holders

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This mail survey collected economic data on inshore commercial shrimp fishermen who held licenses to commercially harvest shrimp in state waters of the U.S. Gulf of...

  7. Development of Researches on Preservation and Storage Technology of Shrimps

    Institute of Scientific and Technical Information of China (English)

    刘海玲; 杨春莉; 杨春瑜

    2015-01-01

    With the rapid development of the world’s fisheries, shrimp consumption and trade are occupying an increasingly important position in the international aquatic products market. China is the world’s largest producer of shrimp and is also the main exporter of shrimp, however, compared with developed countries, technology level of shrimp production and processing in our country is still low at present, especially in aspect of shrimp preservation and storage techniques. So it is necessary to study various technologies and applications of sterilization and conclude the effective methods of shrimp preservation and storage. Traditional storage, chemical and biological technology, low temperature preservation, heat treatment, gas preservation and physical sterilization technology are reviewed in this paper based on shrimp preservation aiming to provide certain theoretical reference and practical basis for shelf life extension of shrimp.

  8. Shrimp Farms and Mangroves, Gulf of Fonseca

    Science.gov (United States)

    2002-01-01

    For decades, astronauts on space missions have documented land use changes around the world. In this pair of images, astronauts track the development of shrimp farming along the Honduran coastline of the Gulf of Fonseca between 1989 and 2001. Mariculture, primarily shrimp farming, has become a leading agricultural effort in Honduras. The regional transformation of large tracts of coastal swamps into shrimp farms blossomed throughout the 1990s. The top image was taken with color infrared film in 1989. Dense vegetation, like the coastal mangrove swamps and the forested slopes of Volcan Cosiguina show up as dark red. The bottom image, taken with color visible film by the crew of the most recent Space Shuttle mission in December 2001 shows that hundreds of square kilometers of coastal swamp, primarily in Honduras, have been converted to shrimp ponds. These appear as the light-colored, rectilinear land use pattern. The Honduras shrimp farms were hit hard by flooding after Hurricane Mitch in 1998, and a devastating virus in 1999-2000. It is not known how many of the ponds in this view are still functional. A vigorous debate continues about the sustainability of the shrimp farms and the impacts to the environment and coastal ecosystem due to mangrove clearing and mariculture waste production. Apart from the shrimp farms, the other prominent feature on these images is the impressive volcano Cosiguina, which erupted explosively in 1859 (the largest recorded eruption in the Western Hemisphere). Photograph STS-108-717-85 was taken in the December 2001 by the crew of Space Shuttle mission 108 using a Hasselblad camera with 250-mm lens. Photograph STS030-93-15 was taken in May 1989 using a Hasselblad camera and color infrared film. Both images are provided by the Earth Sciences and Image Analysis Laboratory at Johnson Space Center. Additional images taken by astronauts and cosmonauts can be viewed at the NASA-JSC Gateway to Astronaut Photography of Earth.

  9. Expected brine movement at potential nuclear waste repository salt sites

    Energy Technology Data Exchange (ETDEWEB)

    McCauley, V.S.; Raines, G.E.

    1987-08-01

    The BRINEMIG brine migration code predicts rates and quantities of brine migration to a waste package emplaced in a high-level nuclear waste repository in salt. The BRINEMIG code is an explicit time-marching finite-difference code that solves a mass balance equation and uses the Jenks equation to predict velocities of brine migration. Predictions were made for the seven potentially acceptable salt sites under consideration as locations for the first US high-level nuclear waste repository. Predicted total quantities of accumulated brine were on the order of 1 m/sup 3/ brine per waste package or less. Less brine accumulation is expected at domal salt sites because of the lower initial moisture contents relative to bedded salt sites. Less total accumulation of brine is predicted for spent fuel than for commercial high-level waste because of the lower temperatures generated by spent fuel. 11 refs., 36 figs., 29 tabs.

  10. Geophysical and geochemical signatures of Gulf of Mexico seafloor brines

    Directory of Open Access Journals (Sweden)

    S. B. Joye

    2005-05-01

    Full Text Available Geophysical, temperature, and discrete depth-stratified geochemical data illustrate differences between an actively venting mud volcano and a relatively quiescent brine pool in the Gulf of Mexico along the continental slope. Geophysical data, including laser-line scan mosaics and sub-bottom profiles, document the dynamic nature of both environments. Temperature profiles, obtained by lowering a CTD into the brine fluid, show that the venting brine was at least 10°C warmer than the bottom water. At the brine pool, two thermoclines were observed, one directly below the brine-seawater interface and a second about one meter below the first. At the mud volcano, substantial temperature variability was observed, with the core brine temperature being either slightly (~2°C in 1997 or substantially (19°C in 1998 elevated above bottom water temperature. Geochemical samples were obtained using a device called the "brine trapper" and concentrations of dissolved gases, major ions and nutrients were determined using standard techniques. Both brines contained about four times as much salt as seawater and steep concentration gradients of dissolved ions and nutrients versus brine depth were apparent. Differences in the concentrations of calcium, magnesium and potassium between the two brine fluids suggests that the fluids are derived from different sources or that brine-sediment reactions are more important at the mud volcano than the brine pool. Substantial concentrations of methane and ammonium were observed in both brines, suggesting that fluids expelled from deep ocean brines are important sources of methane and dissolved inorganic nitrogen to the surrounding environment.

  11. Gamma Irradiation for the Inhibition of Shrimp (Penaeus aztecus) Allergy

    International Nuclear Information System (INIS)

    Food irradiation technology was conducted to reduce shrimp allergy. The experiment was designated in 3 portions as follows; A, the irradiation of raw shrimp; B the irradiation of shrimp and then cooking; and C, cooking the shrimp and then irradiation. Gamma irradiation was done with doses of 1, 3, 5, 7, 10 kGy. A shrimp sarcoplasmic protein solution (SSPS) and a myofibrillar protein solution (SMPS) were prepared from A portion. Cooked shrimp protein solutions were also prepared from B and C portions. The binding abilities of the shrimp allergic patients' IgE and mouse monoclonal Ab 4.9.5 (mAb 4.9.5), produced to the shrimp heat-stable protein, to each sample solution were determined by ELISA. Binding abilities of patients' IgE and mAb 4.9.5 to irradiated shrimp fractions were dose-dependently reduced. The cooking treatment after irradiation was more effective than the irradiation treatment after cooking in the reduction of the binding abilities of IgE and IgG. SDS-PAGE was performed to compare irradiated shrimp proteins with non-irradiated shrimp proteins. SDS-PAGE showed that no bands were changed by gamma irradiation. The results indicated that food irradiation with an adequate dose can be reduce allergenicity of shrimp

  12. Evolutionary Origin and Phylogeography of the Diploid Obligate Parthenogen Artemia parthenogenetica (Branchiopoda: Anostraca)

    DEFF Research Database (Denmark)

    Muñoz, Joaquin; Gómez, Africa; Green, Andy J.;

    2010-01-01

    Background: Understanding the evolutionary origin and the phylogeographic patterns of asexual taxa can shed light on the origin and maintenance of sexual reproduction. We assessed the geographic origin, genetic diversity, and phylogeographic history of obligate parthenogen diploid Artemia...... the phylogenetic relationships of diploid A. parthenogenetica and its closest sexual relatives. Populations displayed an extremely low level of mitochondrial genetic diversity, with one widespread haplotype shared by over 79% of individuals analysed. Phylogenetic and phylogeographic analyses indicated......, and probably to the rest of its current geographic distribution. This contrasts with the restricted geographic distribution, strong genetic structure, and regional endemism of sexual Artemia lineages and other passively dispersed sexual continental aquatic invertebrates. We hypothesize that diploid...

  13. Poly-beta-hydroxybutyrate-accumulating bacteria protect gnotobiotic Artemia franciscana from pathogenic Vibrio campbellii.

    Science.gov (United States)

    Halet, Dirk; Defoirdt, Tom; Van Damme, Petra; Vervaeren, Han; Forrez, Ilse; Van de Wiele, Tom; Boon, Nico; Sorgeloos, Patrick; Bossier, Peter; Verstraete, Willy

    2007-06-01

    A poly-beta-hydroxybutyrate (PHB)-accumulating enrichment culture was obtained using activated sludge from a polyphosphate-accumulating reactor as inoculum. PHB accumulated by the enrichment culture significantly enhanced the survival of Artemia nauplii, infected with the virulent pathogen Vibrio campbellii LMG 21363. A strain was isolated from the enrichment culture, based on its ability to accumulate PHB, and 16S rRNA gene sequencing of the isolate revealed 99% sequence similarity to Brachymonas denitrificans AS-P1. The isolate, named PHB2, showed good PHB-accumulating activity (up to 32% of the cell dry weight). PHB accumulated by isolate PHB2 was able to protect Artemia completely from the V. campbellii strain. Our data indicate that PHB-accumulating bacteria, such as B. denitrificans PHB2, could be used as an an effective and economically interesting alternative strategy to control infections in aquaculture. PMID:17391334

  14. Effect of ultra-high pressure on small animals, tardigrades and Artemia

    Directory of Open Access Journals (Sweden)

    Fumihisa Ono

    2016-12-01

    Full Text Available This research shows that small animals, tardigrades (Milnesium tardigradum in tun (dehydrated state and Artemia salina cists (dried eggs can tolerate the very high hydrostatic pressure of 7.5 GPa. It was really surprising that living organisms can survive after exposure to such a high pressure. We extended these studies to the extremely high pressure of 20 GPa by using a Kawai-type octahedral anvil press. After exposure to this pressure for 30 min, the tardigrades were soaked in pure water and investigated under a microscope. Their bodies regained metabolic state and no serious injury could be seen. But they were not alive. A few of Artemia eggs went part of the way to hatching after soaked in sea water, but they never grew any further. Comparing with the case of blue-green alga, these animals are weaker under ultra-high pressure.

  15. The efficacy testing of irradiated shrimp paste

    International Nuclear Information System (INIS)

    Two lots of shrimp paste from commercial source in Samutsakhon were irradiated at a recommended minimum dose of 6 kGy using a J S 8900 cobalt-60 carrier gamma irradiator of Thai Irradiation Center in Patum Thani. Red Perspex dosimeter were used to measure the absorbed dose throughout the product with emphasis on the region of minimum and maximum absorbed dose. This way, it was aimed to compare the dose effects of gamma irradiation on the microbiological, chemical and sensory quality of shrimp paste. The results indicated that the shrimp paste received minimum and maximum absorbed dose of 6.85 and 12.83 kGy with dose uniformity ratio of 1.87 . Throughput rate is 468 kilogram per hour. The microbiological load of shrimp paste was rather high resulting in not compliance with Thai industrial standard 1080-2535. Irradiation at 6.8 kGy reduced total viable bacterial count by one log cycle. Although the irradiated product was organoleptic ally acceptable and could be kept for 16 months at room temperature, mold and Clostridium perfringens were still present in some samples after irradiation and during prolonged storage in amount that exceeds the limitation of Thai industrial standard. Chemical properties such as p H, moisture and sodium chloride content of irradiated shrimp paste were not significantly changed after irradiation

  16. Biological treatment of shrimp production wastewater.

    Science.gov (United States)

    Boopathy, Raj

    2009-07-01

    Over the last few decades, there has been an increase in consumer demand for shrimp, which has resulted in its worldwide aquaculture production. In the United States, the stringent enforcement of environmental regulations encourages shrimp farmers to develop new technologies, such as recirculating raceway systems. This is a zero-water exchange system capable of producing high-density shrimp yields. The system also produces wastewater characterized by high levels of ammonia, nitrate, nitrite, and organic carbon, which make waste management costs prohibitive. Shrimp farmers have a great need for a waste management method that is effective and economical. One such method is the sequencing batch reactor (SBR). A SBR is a variation of the activated sludge biological treatment process. This process uses multiple steps in the same reactor to take the place of multiple reactors in a conventional treatment system. The SBR accomplishes equalization, aeration, and clarification in a timed sequence in a single reactor system. This is achieved through reactor operation in sequences, which includes fill, react, settle, decant, and idle. A laboratory scale SBR was successfully operated using shrimp aquaculture wastewater. The wastewater contained high concentrations of carbon and nitrogen. By operating the reactors sequentially, namely, aerobic and anoxic modes, nitrification and denitrification were achieved as well as removal of carbon. Ammonia in the waste was nitrified within 4 days. The denitrification of nitrate was achieved by the anoxic process, and 100% removal of nitrate was observed within 15 days of reactor operation. PMID:19396482

  17. Vaccination of European sea bass fry through bioencapsulation of Artemia nauplii

    OpenAIRE

    Chair, M.; Gapasin, R.S.J.; Dehasque, M.; Sorgeloos, P.

    1994-01-01

    European sea bass (Dicentrarchus labrax) fry vaccinated orally by bioencapsulation in Artemia nauplii or by bath method exhibited better performance than control fish in terms of growth, food conversion and resistance to stress. The comparable survival between vaccinated and non-vaccinated animals suggests that vaccination methods are stressful. The present study shows that oral vaccination can be used to enhance growth in fish fry.

  18. Monitoring the Effect of Metal Ions on the Mobility of Artemia salina Nauplii

    OpenAIRE

    Varvara Kokkali; Ioannis Katramados; Newman, Jeffrey D.

    2011-01-01

    This study aims to measure the effect of toxic aqueous solutions of metals on the mobility of Artemia salina nauplii by using digital image processing. The instrument consists of a camera with a macro lens, a dark chamber, a light source and a laptop computer. Four nauplii were inserted into a macro cuvette, which contained copper, cadmium, iron and zinc ions at various concentrations. The nauplii were then filmed inside the dark chamber for two minutes and the video sequence was processed by...

  19. AKTIVITAS ANTIKANKER EKSTRAK ETANOL DAUN Rhizopora mucronata TERHADAP LARVA UDANG Artemia salina Leach DAN SEL RAJI

    OpenAIRE

    Hartiwi Diastuti; Warsinah; Purwati

    2009-01-01

    The mangrove plant have been long used the people for traditional medicine to cure various diseases, one of them to cancer therapy. Investigation the anticancer potent of R. mucronata has not been carried yet. This research was aimed to toxicity test of R. mucronta leaf extracts againts Artemia salina Leach, then cytotoxicity test of R. mucronata leave extracts againts Raji cancer cells. The extraction of R. mucronata leaf was peformed by maseration with ethanol. The ethanol extracts was part...

  20. Elimination of negative effects of cadmium after addition ionizing radiation in Artemia franciscan

    International Nuclear Information System (INIS)

    Nuclear reactor failures present a risk of global contamination which can be affected by other environmental factors, such as chemical elements. The present study investigated the effect of low doses of gamma radiation in relation to the presence of low of Cd. We used an alternative biotest of 2nd generation - Artemia franciscan a. Interaction between irradiation and the action of cadmium chloride could result in a protective effect of ionizing radiation at some concentration of cadmium chloride. (authors)

  1. Automatic Estimation of Artemia Hatching Rate Using an Object Discrimination Method

    Directory of Open Access Journals (Sweden)

    Sung Kim

    2013-09-01

    Full Text Available Digital image processing is a process to analyze a large volume of information on digital images. In this study, Artemia hatching rate was measured by automatically classifying and counting cysts and larvae based on color imaging data from cyst hatching experiments using an image processing technique. The Artemia hatching rate estimation consists of a series of processes; a step to convert the scanned image data to a binary image data, a process to detect objects and to extract their shape information in the converted image data, an analysis step to choose an optimal discriminant function, and a step to recognize and classify the objects using the function. The function to classify Artemia cysts and larvae is optimally estimated based on the classification performance using the areas and the plan-form factors of the detected objects. The hatching rate using the image data obtained under the different experimental conditions was estimated in the range of 34-48%. It was shown that the maximum difference is about 19.7% and the average root-mean squared difference is about 10.9% as the difference between the results using an automatic counting (this study and a manual counting were compared. This technique can be applied to biological specimen analysis using similar imaging information.

  2. Essential oils of Nigella sativa protects Artemia from the pathogenic effect of Vibrio parahaemolyticus Dahv2.

    Science.gov (United States)

    Manju, Sivalingam; Malaikozhundan, Balasubramanian; Withyachumnarnkul, Boonsirm; Vaseeharan, Baskaralingam

    2016-05-01

    The anti-Vibrio activity of essential oils (EOs) of nine medicinal plants was tested against 28 Vibrio spp. isolated from diseased Fenneropenaeus indicus. EO of Nigella sativa exhibited anti-Vibrio activity against all Vibrio spp. and greater inhibition was noted for the isolate V2 which was identified as Vibrio parahaemolyticus Dahv2. Further, EO of N. sativa effectively inhibited V. parahaemolyticus Dahv2 with an inhibition zone of 23.9mm at 101.2μgml(-1). Moreover, EO of N. sativa revealed anti-biofilm activity at 101.2μgml(-1) against V. parahaemolyticus Dahv2 and inhibited the growth of V. parahaemolyticus Dahv2 at 100μgml(-1).In vivo experimental infection studies showed that the survival of Artemia spp. infected with V. parahaemolyticus Dahv2 at 1×10(3)cfuml(-1) was only 40%. However, the survival of Artemia spp. was significantly increased after challenge with 100μgml(-1) of EO of N. sativa. EO of N. sativa showed higher anti-oxidant potential and total phenol content than other EOs tested. The anti-oxidant activity of EO of N. sativa was highly correlated to their total phenolic contents (r=0.836, P<0.05). This observation suggests that EO of N. sativa protected the Artemia spp. after experimental infection of V. parahaemolyticus Dahv2. PMID:26945773

  3. Assessment of toxic potential of Cerrado fruit seeds using Artemia salina bioassay

    Directory of Open Access Journals (Sweden)

    Raíza Cavalcante Fonseca

    2013-06-01

    Full Text Available Artemia salina bioassay was used to assess toxicity of seeds and kernels of Brazilian fruits from cerrado (central high plains region and other inner regions of the country. Water extracts of the kernels were filtered and added to Artemia cultures containing ten individuals per mL. Dose - response curves were constructed, and LD50 values were calculated. Pure potassium cyanide standard was used to draw a calibration curve for comparison to detect the presence of cyanide in the samples tested. Extracts of the seeds of araticum, mangaba, cagaita, jatobá, and tucumã were found toxic to Artemia salina, and some of the dose - response curves were very similar in shape to those obtained with pure potassium cyanide standards, while the samples of baru, cajá-manga, siriguela, trauma, and veludo showed no toxicity at all. The Guignard test, specific for cyanide detection, showed negative results in all toxic samples, suggesting the presence of other toxic compounds rather than cyanide. The comparison of araticum dose - response curve with those of other annonaceous fruits suggests the presence acetogenins as the main toxic compounds in the seeds. These results could be useful to prevent poisoning by industrial derivatives of the fruits studied.

  4. Artemia hemoglobins. Increase in net synthesis of the beta-polypeptide (relative to the alpha-polypeptide) in hypoxia.

    Science.gov (United States)

    Ferry, J A; Nichols, R C; Condon, S J; Stubbs, J D; Bowen, S T

    1983-04-15

    Previous studies have shown that in the brine shrimp there are three dimeric hemoglobins with polypeptide composition alpha 2, alpha beta, beta 2. Concentrations of the alpha- and beta-polypeptides increase in hypoxia. We now report a two-dimensional electrophoretic method for assay of radiolabelled polypeptides in each hemoglobin. Net synthesis (synthesis minus degradation) of the beta-chain, relative to that of the alpha-chain, increases more than 3-fold (in male and female adults) within 3 days following a downshift in oxygen concentration from 0.2 to 0.1 mM in the culture medium. 3 days after downshift (2 days after in vivo incorporation of radiolabelled leucine), the beta-homodimer contained 10-20% of the radiolabel in the three hemoglobins although beta 2 was usually not detectable in the protein stain of an overloaded gel. The amount of radioactive leucine incorporated per unit amount of protein was more than 300-times greater in the beta 2 homodimer than in the beta-subunit of the heterodimer, suggesting that beta 2 does not dissociate rapidly during electrophoresis on the first dimension non-denaturing gel. This evidence for stable association of the two beta-monomers and the 5-8 heme-binding domains within each monomer (in vivo and during electrophoresis on non-denaturing gels) allows us to exclude one of two alternative interpretations of genetic data published previously. We present an independent line of evidence for the dimer model of the native hemoglobins (which states that each polypeptide has many heme-binding domains). PMID:6830806

  5. Determination of Biogenic Amines in Different Shrimp Species for Export

    International Nuclear Information System (INIS)

    This study is part of the project on the ''Quality Assurance of Different Shrimp Species for Export''. Local shrimp samples were collected from Ministry of Livestock and Fisheries and various private enterprises. Contents of biogenic amines were determined by using benzoyl chloride derivatization method with HPLC (reverse phase high performance liquid chromatography). Based on the biogenic amines, quality index of shrimps were correlated with freshness index so that the grade of shrimp samples can be classified as excellent, good, and acceptable. All sizes of shrimps such as extra large, large, medium were found to excceptable respectively

  6. Improvement of bacteriological quality of frozen shrimp by gamma radiation

    International Nuclear Information System (INIS)

    The possible use of gamma irradiation at doses of 2 and 3 kGy to improve bacteriological quality of frozen shrimp was investigated. The effects of gamma irradiation on salmonella viability in frozen shrimp and on sensory quality of frozen shrimp were also evaluated. Treatment of frozen shrimp at 3 kGy reduced bacterial load by 2 log cycles and eliminated Enterobacteriaceae, E. coli, V. parahaemolyticus, and S. aureus. Coliform was still present in a 3 kGy treated samples but in a very small percentage and the count was less than 10 cell/g. Salmonella was not detected in either irradiated or non-irradiated frozen shrimp. A difference in radiation resistance was noted among five salmonella serotypes tested. S. lexington was the most resistant and S. anatum was the least resistant. Salmonella resistance was higher in frozen inoculated shrimp than in refrigerated inoculated shrimp. A dose of at least 4.2 kGy is required for a seven log cycle reduction of salmonella contamination in frozen shrimp. Off-flavors were produced in frozen shrimp irradiated at 4.2 kGy but diminished during subsequent frozen storage. However, irradiated frozen shrimp was of acceptable quality for at least four months. Dosage at 3 kGy appeared to be sufficient for improving bacteriological quality of frozen shrimp

  7. Evolution of hydrologic systems and brine geochemistry in a deforming salt medium: Data from WIPP brine seeps

    Energy Technology Data Exchange (ETDEWEB)

    Deal, D.E. (I. T. Corp., Carlsbad, NM (USA)); Roggenthen, W.M. (South Dakota School of Mines and Technology, Rapid City, SD (USA). Dept. of Geology and Geological Engineering)

    1991-01-01

    The Brine Sampling and Evaluation Program (BSEP) is a formalized continuation of studies that began in 1982 as part of the Site Validation Program. The program was established in 1985. The mission was to document and investigate the origins, hydraulic characteristics, extent, and composition of brine occurrences in the Permian Salado Formation and the seepage of that brine into the WIPP excavations. This document focuses on the cumulative data obtained from the BSEP. The overall activities of the BSEP described and quantified the brine. It includes documentation and study of brine inflow into boreholes in the facility. The BSEP investigated the occurrence and development of brine weeps, crusts, and brine geochemistry. The presence of salt-tolerant bacteria in the workings was recorded and their possible interactions with experiments and operations, was assessed. The formation properties associated with the occurrence of brine was characterized. The determination of formation properties included the water content of various geologic units, direct examination of these units in boreholes using a video camera system, and measurement of electrical properties relatable to the brine contents. Modeling examined the interaction of salt deformation near the workings and the flow of brine through the deforming rocks. 34 refs.

  8. Evolution of hydrologic systems and brine geochemistry in a deforming salt medium: Data from WIPP brine seeps

    International Nuclear Information System (INIS)

    The Brine Sampling and Evaluation Program (BSEP) is a formalized continuation of studies that began in 1982 as part of the Site Validation Program. The program was established in 1985. The mission was to document and investigate the origins, hydraulic characteristics, extent, and composition of brine occurrences in the Permian Salado Formation and the seepage of that brine into the WIPP excavations. This document focuses on the cumulative data obtained from the BSEP. The overall activities of the BSEP described and quantified the brine. It includes documentation and study of brine inflow into boreholes in the facility. The BSEP investigated the occurrence and development of brine weeps, crusts, and brine geochemistry. The presence of salt-tolerant bacteria in the workings was recorded and their possible interactions with experiments and operations, was assessed. The formation properties associated with the occurrence of brine was characterized. The determination of formation properties included the water content of various geologic units, direct examination of these units in boreholes using a video camera system, and measurement of electrical properties relatable to the brine contents. Modeling examined the interaction of salt deformation near the workings and the flow of brine through the deforming rocks. 34 refs

  9. In vivo toxicity study of Lantana camara

    Institute of Scientific and Technical Information of China (English)

    Badakhshan Mahdi Pour; Sreenivasan Sasidharan

    2011-01-01

    Objective: To investigate the toxicity of methanol extract of various parts (Root, Stem, Leaf, Flower and Fruit) of Lantana camara(L. Camara) in Artemia salina. Methods: The methanol extracts of L. camara were tested for in vivo brine shrimp lethality assay. Results: All the tested extract exhibited very low toxicity on brine shrimp larva. The results showed that the root extract was the most toxic part of L. camara and may have potential as anticancer agent. Conclusions:Methanolic extract of L. camara is relatively safe on short-term exposure.

  10. OUT Success Stories: Chemical Treatments for Geothermal Brines

    International Nuclear Information System (INIS)

    DOE research helped develop the large, untapped geothermal resource beneath the Salton Sea in California's Imperial Valley. The very hot brines under high pressure make them excellent for electric power production. The brines are very corrosive and contain high concentrations of dissolved silica. DOE worked with San Diego Gas and Electric Company to find a solution to the silica-scaling problem. This innovative brine treatment eliminated scaling and made possible the development of the Salton Sea geothermal resource

  11. Geophysical and geochemical signatures of Gulf of Mexico seafloor brines

    OpenAIRE

    Joye, S. B.; Macdonald, I. R.; Montoya, J. P.; Peccini, M.

    2005-01-01

    Geophysical, temperature, and discrete depth-stratified geochemical data illustrate differences between an actively venting mud volcano and a relatively quiescent brine pool in the Gulf of Mexico along the continental slope. Geophysical data, including laser-line scan mosaics and sub-bottom profiles, document the dynamic nature of both environments. Temperature profiles, obtained by lowering a CTD into the brine fluid, show that the venting brine was at least 10°C warmer than the bottom w...

  12. Geophysical and geochemical signatures of Gulf of Mexico seafloor brines

    Directory of Open Access Journals (Sweden)

    S. B. Joye

    2005-01-01

    Full Text Available Geophysical, temperature, and discrete depth-stratified geochemical data illustrate differences between an actively venting mud volcano and a relatively quiescent brine pool in the Gulf of Mexico along the continental slope. Geophysical data, including laser-line scan mosaics and sub-bottom profiles, document the dynamic nature of both environments. Temperature profiles, obtained by lowering a CTD into the brine fluid, show that the venting brine was at least 10°C warmer than the bottom water. At the brine pool, thermal stratification was observed and only small differences in stratification were documented between three sampling times (1991, 1997 and 1998. In contrast, at the mud volcano, substantial temperature variability was observed, with the core brine temperature being slightly higher than bottom water (by 2°C in 1997 but substantially higher than bottom water (by 19°C in 1998. Detailed geochemical samples were obtained in 2002 using a device called the 'brine trapper' and concentrations of dissolved gases, major ions and nutrients were determined. Both brines contained about four times as much salt as seawater and steep concentration gradients of dissolved ions and nutrients versus brine depth were apparent. Differences in the concentrations of calcium, magnesium and potassium between the two brine fluids suggest that the fluids are derived from different sources, have different dilution/mixing histories, or that brine-sediment reactions are more important at the mud volcano. Substantial concentrations of methane, ammonium, and silicate were observed in both brines, suggesting that fluids expelled from deep ocean brines are important sources of these constituents to the surrounding environment.

  13. CO₂ efflux from shrimp ponds in Indonesia.

    Directory of Open Access Journals (Sweden)

    Frida Sidik

    Full Text Available The conversion of mangrove forest to aquaculture ponds has been increasing in recent decades. One of major concerns of this habitat loss is the release of stored 'blue' carbon from mangrove soils to the atmosphere. In this study, we assessed carbon dioxide (CO₂ efflux from soil in intensive shrimp ponds in Bali, Indonesia. We measured CO₂ efflux from the floors and walls of shrimp ponds. Rates of CO₂ efflux within shrimp ponds were 4.37 kg CO₂ m⁻² y⁻¹ from the walls and 1.60 kg CO₂ m⁻² y⁻¹ from the floors. Combining our findings with published data of aquaculture land use in Indonesia, we estimated that shrimp ponds in this region result in CO₂ emissions to the atmosphere between 5.76 and 13.95 Tg y⁻¹. The results indicate that conversion of mangrove forests to aquaculture ponds contributes to greenhouse gas emissions that are comparable to peat forest conversion to other land uses in Indonesia. Higher magnitudes of CO₂ emission may be released to atmosphere where ponds are constructed in newly cleared mangrove forests. This study indicates the need for incentives that can meet the target of aquaculture industry without expanding the converted mangrove areas, which will lead to increased CO₂ released to atmosphere.

  14. Neoliberalism and shrimp industry in Ecuador

    Directory of Open Access Journals (Sweden)

    Nadia Romero Salgado

    2014-04-01

    Full Text Available Analysis of the effects of the shrimp industry development in the mangrove ecosystem, the socio-environmental conflicts generated and its relationship with neoliberalism and the financial crisis of 1999 in Ecuador. After a review of the importance of the mangrove ecosystem, the stages of the shrimp expansion, its promoters, the mangrove deforestation and the socio-environmental effects caused, I will analyze the shrimp crisis, its parallels with the financial crisis of 1999 and its subsequent recovery. I will show that the shrimp industry expanded in mangrove areas in order to reduce costs, even breaking the law and creating environmental degradation, vulnerability of the costs and loss of natural resources, based on the exploitation and privatization of a public good. This created unemployment, migration and impoverishment to local populations and costs that the State will have to assume. Therefore, it is a process of “accumulation by dispossession” characteristic of neoliberalism.

  15. How snapping shrimp snap: through cavitating bubbles

    NARCIS (Netherlands)

    Versluis, Michel; Schmitz, Barbara; Heydt, von der Anna; Lohse, Detlef

    2000-01-01

    The snapping shrimp (Alpheus heterochaelis) produces a loud snapping sound by an extremely rapid closure of its snapper claw. One of the effects of the snapping is to stun or kill prey animals. During the rapid snapper claw closure, a high-velocity water jet is emitted from the claw with a speed exc

  16. On the Sound of Snapping Shrimp

    NARCIS (Netherlands)

    Versluis, Michel; Heydt, von der Anna; Lohse, Detlef; Schmitz, Barbara

    2001-01-01

    Snapping shrimp produce a snapping sound by an extremely rapid closure of their snapper claw. Source levels reported for Alpheus heterochaelis are as high as 220 dB (peak-to-peak) re. 1 µPa at 1 m distance. The loud snap has been attributed to the mechanical contact made when the snapper claw contra

  17. Is the Dutch shrimp fishery sustainable?

    NARCIS (Netherlands)

    Welleman, H.C.; Daan, N.

    2001-01-01

    The fishery of the brown shrimp (Crangon crangon LINNEAUS 1758) is a widespread human activity in the coastal zone. Yet management of this fishery has never been implemented. The question is raised whether an uncontrolled fishery is sustainable or the conceivable ecological stress results in recruit

  18. Solar Powered Automatic Shrimp Feeding System

    Directory of Open Access Journals (Sweden)

    Dindo T. Ani

    2015-12-01

    Full Text Available - Automatic system has brought many revolutions in the existing technologies. One among the technologies, which has greater developments, is the solar powered automatic shrimp feeding system. For instance, the solar power which is a renewable energy can be an alternative solution to energy crisis and basically reducing man power by using it in an automatic manner. The researchers believe an automatic shrimp feeding system may help solve problems on manual feeding operations. The project study aimed to design and develop a solar powered automatic shrimp feeding system. It specifically sought to prepare the design specifications of the project, to determine the methods of fabrication and assembly, and to test the response time of the automatic shrimp feeding system. The researchers designed and developed an automatic system which utilizes a 10 hour timer to be set in intervals preferred by the user and will undergo a continuous process. The magnetic contactor acts as a switch connected to the 10 hour timer which controls the activation or termination of electrical loads and powered by means of a solar panel outputting electrical power, and a rechargeable battery in electrical communication with the solar panel for storing the power. By undergoing through series of testing, the components of the modified system were proven functional and were operating within the desired output. It was recommended that the timer to be used should be tested to avoid malfunction and achieve the fully automatic system and that the system may be improved to handle changes in scope of the project.

  19. Evaluation of Brine Processing Technologies for Spacecraft Wastewater

    Science.gov (United States)

    Shaw, Hali L.; Flynn, Michael; Wisniewski, Richard; Lee, Jeffery; Jones, Harry; Delzeit, Lance; Shull, Sarah; Sargusingh, Miriam; Beeler, David; Howard, Jeanie; Howard, Kevin; Harris, Linden; Parodi, Jurek; Kawashima, Brian

    2015-01-01

    Brine drying systems may be used in spaceflight. There are several advantages to using brine processing technologies for long-duration human missions including a reduction in resupply requirements and achieving high water recovery ratios. The objective of this project was to evaluate four technologies for the drying of spacecraft water recycling system brine byproducts. The technologies tested were NASA's Forward Osmosis Brine Drying (FOBD), Paragon's Ionomer Water Processor (IWP), NASA's Brine Evaporation Bag (BEB) System, and UMPQUA's Ultrasonic Brine Dewatering System (UBDS). The purpose of this work was to evaluate the hardware using feed streams composed of brines similar to those generated on board the International Space Station (ISS) and future exploration missions. The brine formulations used for testing were the ISS Alternate Pretreatment and Solution 2 (Alt Pretreat). The brines were generated using the Wiped-film Rotating-disk (WFRD) evaporator, which is a vapor compression distillation system that is used to simulate the function of the ISS Urine Processor Assembly (UPA). Each system was evaluated based on the results from testing and Equivalent System Mass (ESM) calculations. A Quality Function Deployment (QFD) matrix was also developed as a method to compare the different technologies based on customer and engineering requirements.

  20. Key Performance Characteristics of Organic Shrimp Aquaculture in Southwest Bangladesh

    Directory of Open Access Journals (Sweden)

    Christian Reinhard Vogl

    2012-05-01

    Full Text Available In Bangladesh, black tiger shrimp (Penaeus monodon; Fabricius, 1798 aquaculture has come to be one of the most important sectors in both the rural and national economies. Likewise, organic shrimp aquaculture has emerged as an alternative farming enterprise for farmers especially in the southwestern districts of Bangladesh. The present study aims to show key performance characteristics of organic shrimp farmers and farming in a prototypical shrimp farming area in Bangladesh. Data was collected in 2009 from organic shrimp farmers in the Kaligonj and Shyamnagar sub-districts through questionnaire interviews, transect walks and focus group discussions. The mean productivity of organic shrimp farming in the area is 320 kg ha−1 yr−1 (ranging from 120 to 711 kg ha−1year−1. Organic farmers are more likely to have a higher monthly income and less aquaculture experience. Moreover, suitable landholdings and classified labor distribution have been found to play an important role in the development of organic shrimp aquaculture. The most common assets of organic shrimp aquaculture are high yield, low production cost, available post larvae and high market prices. Small business farmers are likely to earn more income benefits from organic shrimp aquaculture than their larger-scale counterparts. Finally, the paper suggests that more research is needed to stimulate the success of organic shrimp aquaculture.

  1. The influence of different rotifer and Artemia enrichment diets on growth, survival and pigmentation in turbot (Scophthalmus maximus L.) larvae

    DEFF Research Database (Denmark)

    Støttrup, Josianne; Attramadal, Y.

    1992-01-01

    An experiment was carried out on turbot larvae fed three different rotifer enrichment diets: Dry Selco, Protein Selco and ICES low-HUFA (an enrichment emulsion containing low amounts of highly unsaturated fatty acids-HUFA). Seven tanks were set up for each diet. After the rotifer stage, approxima......An experiment was carried out on turbot larvae fed three different rotifer enrichment diets: Dry Selco, Protein Selco and ICES low-HUFA (an enrichment emulsion containing low amounts of highly unsaturated fatty acids-HUFA). Seven tanks were set up for each diet. After the rotifer stage......, approximately seven days after hatching, the larvae were fed newly-hatched Artemia salina nauplii (AT-1; Brazil strain). From day 10, enriched Great Salt Lake Artemia nauplii were introduced. Each set of seven tansk was further subdivided and the larvae fed Artemia nauplii enriched with one of four enrichment...

  2. Modeling of brine migration in halite

    International Nuclear Information System (INIS)

    Four different models of the migration process have been reviewed to determine their suitability as a working model. While there are several common factors in the models additional factors are included to account for several possible effects. The detail of each model leads to a certain degree of difficulty in applying the model to the problem at hand. One model predicts that inclusions smaller than 0.1 mm dimension probably will not migrate. The other models do not consider size as a factor. Thermal diffusion (Soret effect) is considered insignificant in three models, while in the fourth model it is added to the concentration diffusion term. The following conclusions are made: (1) Temperature is the most significant parameter in all models and must be known as a function of time, and distance from the canister. (2) All four models predict about the same migration velocity for a given set of conditions. For 1000C and 10C/cm thermal gradient, the individual values are 3.0, 4.8, 5.6 and 6.4 mm/y. (3) The diffusion of ions through the brine inclusions is the rate controlling mechanism. (4) The difference between the thermal gradients in the liquid and in the solid should always be considered, and is a function of droplet shape. (5) The model based upon work by Nernst is easiest to use since all necessary parameters are readily available in the literature. However, of the four models is predicts the lowest migration rate. (6) The maximum volume of pure brine accumulated at the canister surface would be less than 20-40 liters in 50 years, for a canister initial thermal power of 3.5 kW. Bitterns would migrate proportionately less volume. A compuber code, BRINE, was developed to make these calculations by means of any of the four models

  3. Power production via North Sea Hot Brines

    International Nuclear Information System (INIS)

    Traditionally the power demand of offshore oil platforms is delivered by on-platform gas turbines. Natural gas to fuel these turbines is usually separated from the produced oil. However, in ageing fields as oil production declines so does the associated gas. Ultimately gas supply becomes insufficient; in order to continue producing fuel is imported at great expense. This study proposes the power demand of a platform could be met or supplemented by an on-platform ORC (organic Rankine cycle ) fuelled by coproduced hot brines. This could extend the operating life of oil platforms and reduce both cost and emissions. The potential power output of an ORC is modelled for fields in the North Sea's Brent Province. Results show 6 fields have the potential to generate more than 10 MW via an organic Rankine cycle fuelled by hot brines, with a maximum of 31 MW predicted for the Ninian field. Analysis of simulations for the Eider field shows that ORC plants can scale to size constraints. The cost of a 10 MW ORC is compared to cost of continued use of gas turbines. Payback times of between 3.09 and 4.53 years are predicted for an ORC, without accounting for greenhouse gas emissions levies. - Highlights: • We model organic Rankine cycles fuelled by hot brines produced in the North Sea. • Organic Rankine cycles could provide all an off-shore platform's power demand. • 6 fields in the Brent province have the potential to produce >10 MW via an ORC system. • Payback time calculated for a 10 MW organic Rankine cycle is 3.09–4.53 years

  4. Consolidation and permeability of salt in brine

    Energy Technology Data Exchange (ETDEWEB)

    Shor, A.J.; Baes, C.F. Jr.; Canonico, C.M.

    1981-07-01

    The consolidation and loss of permeability of salt crystal aggregates, important in assessing the effects of water in salt repositories, has been studied as a function of several variables. The kinetic behavior was similar to that often observed in sintering and suggested the following expression for the time dependence of the void fraction: phi(t) = phi(0) - (A/B)ln(1 + Bt/z(0)/sup 3/), where A and B are rate constants and z(0) is initial average particle size. With brine present, A and phi(0) varied linearly with stress. The initial void fraction was also dependent to some extent on the particle size distribution. The rate of consolidation was most rapid in brine and least rapid in the presence of only air as the fluid. A brine containing 5 m MgCl/sub 2/ showed an intermediate rate, presumably because of the greatly reduced solubility of NaCl. A substantial wall effect was indicated by an observed increase in the void fraction of consolidated columns with distance from the top where the stress was applied and by a dependence of consolidation rate on the column height and radius. The distance through which the stress fell by a factor of phi was estimated to change inversely as the fourth power of the column diameter. With increasing temperature (to 85/sup 0/C), consolidation proceeded somewhat more rapidly and the wall effect was reduced. The permeability of the columns dropped rapidly with consolidation, decreasing with about the sixth power of the void fraction. In general, extrapolation of the results to repository conditions confirms the self-sealing properties of bedded salt as a storage medium for radioactive waste.

  5. Brine Transport Experiments in Granular Salt

    Energy Technology Data Exchange (ETDEWEB)

    Jordan, Amy B. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Boukhalfa, Hakim [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Caporuscio, Florie Andre [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Stauffer, Philip H. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2016-06-06

    To gain confidence in the predictive capability of numerical models, experimental validation must be performed to ensure that parameters and processes are correctly simulated. The laboratory investigations presented herein aim to address knowledge gaps for heat-generating nuclear waste (HGNW) disposal in bedded salt that remain after examination of prior field and laboratory test data. Primarily, we are interested in better constraining the thermal, hydrological, and physicochemical behavior of brine, water vapor, and salt when moist salt is heated. The target of this work is to use run-of-mine (RoM) salt; however during FY2015 progress was made using high-purity, granular sodium chloride.

  6. Pressure-driven brine migration in a salt repository

    International Nuclear Information System (INIS)

    The traditional view is that salt is the ideal rock for isolation of nuclear waste because it is ''dry'' and probably ''impermeable.'' The existence of salt through geologic time is prima facie evidence of such properties. Experiments and experience at potential salt sites for geologic repositories have indicated that while porosity and permeability of salt are low, the salt may be saturated with brine. If this hypothesis is correct, then it is possible to have brine flow due to pressure differences within the salt. If there is pressure-driven brine migration in salt repositories then it is paramount to know the magnitude of such flow because inward brine flow would affect the corrosion rate of nuclear waste containers and outward brine flow might affect radionuclide transport rates. Brine exists in natural salt as inclusions in salt crystals and in grain boundaries. Brine inclusions in crystals move to nearby grain boundaries when subjected to a temperature gradient, because of temperature-dependent solubility of salt. Brine in grain boundaries moves under the influence of a pressure gradient. When salt is mined to create a waste repository, brine from grain boundaries will migrate into the rooms, tunnels and boreholes because these cavities are at atmospheric pressure. After a heat-emitting waste package is emplaced and backfilled, the heat will impose a temperature gradient in the surrounding salt that will cause inclusions in the nearby salt to migrate to grain boundaries within a few years, adding to the brine that was already present in the grain boundaries. The formulation of brine movement with salt as a thermoelastic porous medium, in the context of the continuum theory of mixtures, has been described. In this report we show the mathematical details and discuss the results predicted by this analysis

  7. Photocatalytic reduction of nitrate using titanium dioxide for regeneration of ion exchange brine

    OpenAIRE

    Yang, Ting; Doudrick, Kyle; Westerhoff, Paul

    2012-01-01

    Nitrate is often removed from groundwater by ion exchange (IX) before its use as drinking water. Accumulation of nitrate in IX brine reduces the efficiency of IX regeneration and the useful life of the regeneration brine. For the first time, we present a strategy to photocatalytically reduce nitrate in IX brine, thereby extending the use of the brine. Titanium dioxide (Evonik P90), acting as photocatalyst, reduced nitrate effectively in both synthetic brines and sulfate-removed IX brine when ...

  8. Toxicidad de nauplios de Artemia franciscana a dos piretroides de uso comercial

    OpenAIRE

    Arencibia Carballo, G.; Tizol Correa, R. A.; Rodríguez, R. O.

    2010-01-01

    Se presentan los resultados de la determinación de la LC50 para 24 h de exposición mediante una prueba de toxicidad aguda en Artemia franciscana. Se caracterizó una cepa, la cual según los resultados se evaluó de primera calidad y se aplicaron criterios importantes para el empleo de sus nauplios en dichas pruebas. Se determinó la toxicidad de los insecticidas piretroides, cipermetrina y permetrina reportándose los valores de 4,72 y 26,7 μg/mL de CL50 para 24 h respectivame...

  9. Shrimp aquaculture in low salinity water feeded with worm flavor

    Directory of Open Access Journals (Sweden)

    Wenceslao Valenzuela Quiñónez

    2012-09-01

    Full Text Available Shrimp aquaculture in Sinaloa is one of the top economic enterprises, generating many jobs and earns significant incomes every year. Shrimp feed is an essential part of maintaining healthy production. In this initial approach of shrimp growth in low salinity water, were tested two formulas of animal protein composed of 40% (APL1 and 20% (APL2 worm protein, a commercial diet, and no supplementary feed. Physicochemical parameters did not have a direct influence in shrimpbehavior. After six weeks of experimentation, shrimp fed with commercial diet had a weight gain 20% higher than those feed with worm protein. There were no significantly differences between sizes with respect to 40% animal protein and 20% animal protein with the commercial diet (P  0.05. However, shrimp fed worm protein had lower mortality. The use of worm protein could be an option to maintain a high quantity of shrimp reared in low salinity waters.

  10. The impact of shrimp farming on mangrove ecosystems

    DEFF Research Database (Denmark)

    Ashton, Elizabeth Clare

    2008-01-01

    . Policy to position shrimp farms behind mangroves can be effective but also requires good institutional capacity and coordination, effective enforcement, incentives, land tenure and participation of all stakeholders for success. Better management practices have been identified which reduce impacts......Farmed shrimp production and value continue to increase with Asia producing the global majority of shrimp and the USA, Japan and Europe being the main importers. Shrimp farming systems are very diverse in their management, size and impacts. There are many causes for mangrove loss but the conversion...... of mangroves to shrimp farms has caused considerable attention. The major issues of shrimp farming include the loss of important ecological and socio-economic functions of mangrove ecosystems, changes in hydrology, salinization, introduction of non-native species and diseases, pollution from effluents...

  11. A Successful Microbound Diet for the Larval Culture of Chinese Shrimp Fenneropenaeus chinensis

    Institute of Scientific and Technical Information of China (English)

    WANG Xinxia; MAI Kangsen

    2005-01-01

    A 13-day feeding trial was carried out to evaluate the effectiveness of a microbound diet for rearing the larvae of Chinese shrimp Fenneropenaeus chinensis in comparison with the live foods that consist of Isochrysis galbana, Chlorella vulgaris, Tetraselmis chuii, rotifer (Brachionus plicatilis) and Artemia sp. Larvae of 0 to 13d post-hatch (dph) were reared in a temperature-controlled semi-open culture system and stocked at a density of 100 larvae L-1 in tanks, each containing 50 L sterilized seawater with salinity 30-32. Larvae were manually fed either the live foods or the microbound diet 6 times per day. At 13 dph, the growth of the larvae fed on the microbound diet was approximately 84% of that fed on the live foods.The survival rate of the larvae fed on the microbound diet was 44.29% at 13 dph, which was not significantly different from that of larvae fed on live foods (63.55%). The body length and development index (DI) of the larvae fed on the microbound diet were always lower than those of larvae fed on live foods. However, the differences reached significant levels only at 11and 13dph (P<0.05). The mean dry weight loss of the microbound diet was 9.2% after 90min immersion in seawater, indicating that this diet has a good water stability. The microbound diet contains 52.23% crude protein and 10.27% lipid and is easy to prepare. These characteristics of the diet suggest good potentials for its successful use in the larviculture of other penaeid and fish species.

  12. A successful microbound diet for the larval culture of Chinese shrimp Fenneropenaeus chinensis

    Science.gov (United States)

    Wang, Xinxia; Mai, Kangsen

    2005-07-01

    A 13-day feeding trial was carried out to evaluate the effectiveness of a microbound diet for rearing the larvae of Chinese shrimp Fenneropenaeus chinensis in comparison with the live foods that consist of Isochrysis galbana, Chlorella vulgaris, Tetraselmis chuii, rotifer (Brachionus plicatilis) and Artemia sp. Larvae of 0 to 13d post-hatch (dph) were reared in a temperature-controlled semi-open culture system and stocked at a density of 100 larvae L-1 in tanks, each containing 50 L sterilized seawater with salinity 30 32. Larvae were manually fed either the live foods or the microbound diet 6 times per day. At 13dph, the growth of the larvae fed on the microbound diet was approximately 84% of that fed on the live foods. The survival rate of the larvae fed on the microbound diet was 44.29% at 13 dph, which was not significantly different from that of larvae fed on live foods (63.55% ). The body length and development index (DI) of the larvae fed on the microbound diet were always lower than those of larvae fed on live foods. However, the differences reached significant levels only at 11 and 13dph (P<0.05). The mean dry weight loss of the microbound diet was 9.2% after 90min immersion in seawater, indicating that this diet has a good water stability. The microbound diet contains 5223% crude protein and 10.27% lipid and is easy to prepare. These characteristics of the diet suggest good potentials for its successful use in the larviculture of other penaeid and fish species.

  13. Moisture variations in brine-salted pasta filata cheese.

    Science.gov (United States)

    Kindstedt, P S

    2001-01-01

    A study was made of the moisture distribution in brine-salted pasta filata cheese. Brine-salted cheeses usually develop reasonably smooth and predictable gradients of decreasing moisture from center to surface, resulting from outward diffusion of moisture in response to inward diffusion of salt. However, patterns of moisture variation within brine-salted pasta filata cheeses, notably pizza cheese, are more variable and less predictable because of the peculiar conditions that occur when warm cheese is immersed in cold brine. In this study, cold brining resulted in less moisture loss from the cheese surface to the brine. Also it created substantial temperature gradients within the cheese, which persisted after brining and influenced the movement of moisture within the cheese independently of that caused by the inward diffusion of salt. Depending on brining conditions and age, pizza cheese may contain decreasing, increasing, or irregular gradients of moisture from center to surface, which may vary considerably at different locations within a single block. This complicates efforts to obtain representative samples for moisture and composition testing. Dicing the entire block into small (e.g., 1.5 cm) cubes and collecting a composite sample after thorough mixing may serve as a practical sampling approach for manufacturers and users of pizza cheese that have ready access to dicing equipment. PMID:11324629

  14. Quantitative role of shrimp fecal bacteria in organic matter fluxes in a recirculating shrimp aquaculture system.

    Science.gov (United States)

    Beardsley, Christine; Moss, Shaun; Malfatti, Francesca; Azam, Farooq

    2011-07-01

    Microorganisms play integral roles in the cycling of carbon (C) and nitrogen (N) in recirculating aquaculture systems (RAS) for fish and shellfish production. We quantified the pathways of shrimp fecal bacterial activities and their role in C- and N-flux partitioning relevant to culturing Pacific white shrimp, Penaeus (Litopenaeus) vannamei, in RAS. Freshly produced feces from P. vannamei contained 0.6-7 × 10(10) bacteria g(-1) dry wt belonging to Bacteroidetes (7%), Alphaproteobacteria (4%), and, within the Gammaproteobacteria, almost exclusively to the genus Vibrio (61%). Because of partial disintegration of the feces (up to 27% within 12 h), the experimental seawater became inoculated with fecal bacteria. Bacteria grew rapidly in the feces and in the seawater, and exhibited high levels of aminopeptidase, chitinase, chitobiase, alkaline phosphatase, α- and β-glucosidase, and lipase activities. Moreover, fecal bacteria enriched the protein content of the feces within 12 h, potentially enriching the feces for the coprophagous shrimp. The bacterial turnover time was much faster in feces (1-10 h) than in mature RAS water (350 h). Thus, shrimp fecal bacteria not only inoculate RAS water but also contribute to bacterial abundance and productivity, and regulate system processes important for shrimp health. PMID:21426366

  15. Shrimp aquaculture in low salinity water feeded with worm flavor

    OpenAIRE

    Wenceslao Valenzuela Quiñónez; Gerardo Rodríguez-Quiroz; Héctor Manuel Esparza Leal; Eusebio Nava Pérez

    2012-01-01

    Shrimp aquaculture in Sinaloa is one of the top economic enterprises, generating many jobs and earns significant incomes every year. Shrimp feed is an essential part of maintaining healthy production. In this initial approach of shrimp growth in low salinity water, were tested two formulas of animal protein composed of 40% (APL1) and 20% (APL2) worm protein, a commercial diet, and no supplementary feed. Physicochemical parameters did not have a direct influence in shrimpbehavior. After six we...

  16. Immunological-based assays for specific detection of shrimp viruses

    OpenAIRE

    Chaivisuthangkura, Parin; Longyant, Siwaporn; Sithigorngul, Paisarn

    2014-01-01

    Among shrimp viral pathogens, white spot syndrome virus (WSSV) and yellow head virus (YHV) are the most lethal agents, causing serious problems for both the whiteleg shrimp, Penaeus (Litopenaeus) vannamei, and the black tiger shrimp, Penaeus (Penaeus) monodon. Another important virus that infects P. vannamei is infectious myonecrosis virus (IMNV), which induces the white discoloration of affected muscle. In the cases of taura syndrome virus and Penaeus stylirostris densovirus (PstDNV; formerl...

  17. Optimization of carotenoids extraction from Penaeus semisulcatus shrimp wastes

    OpenAIRE

    Gholamreza jahed Khaniki; Parisa Sadighara; Ramin Nabizadeh Nodehi; Mahmood Alimohammadi; Naiema Vakili Saatloo

    2013-01-01

    Objective: To find effective method for carotenoids extraction from shrimp waste which is one of the important sources of natural carotenoids and produced in large quantities in Iran. Methods: Two methods of carotenoids extraction, enzymatic and alkaline (NaOH 1 normal) treatment, were assayed. About 5 g of gritted shrimp wastes were used at each stage. For alkaline treatment, sodium hydroxide were added to shrimp waste. After 48 h, the mixture was filtered and centrifuged. ...

  18. Immune defence White Spot Syndrome Virus infected shrimp, Penaeus monodon

    OpenAIRE

    Arts, J.A.J.

    2006-01-01

    White spot syndrome virus (WSSV) is the most important viral pathogen of cultured penaeid shrimp worldwide. Since the initial discovery of the virus inTaiwanin 1992, it has spread to shrimp farming regions in Southeast Asia, theAmericas, Europe and theMiddle Eastcausing major economic losses. The virus has a wide host range among crustaceans and induces distinctive clinical signs (white spots)on the inner surface of the exoskeletonof penaeid shrimps.Limited data is available about the immune ...

  19. Feed palatability and the alternative protein sources in shrimp feed

    OpenAIRE

    Chutima Tantikitti

    2014-01-01

    Feed palatability in carnivorous aquaculture species, shrimps in particular, has been crucially related to the presence of compounds acting as attractants that are commonly associated with the prey components under wild conditions. Thus a nutritionally adequate and organoleptically-pleasing diet is essential to achieve satisfactory intake and growth in shrimps. Historically, fishmeal has been an essential dietary component of intensive shrimp cultures because of its nutrient composit...

  20. STRATEGIES FOR DEVELOPING SUSTAINABLE AND COMPETITIVE CLUSTER FOR SHRIMP INDUSTRY

    OpenAIRE

    Anas M. Fauzi; R.Dikky Indrawan; Alim Setiawan Slamet; Farida Ratna Dewi; Lindawati Kartika; Firmansjah S

    2012-01-01

    Kampung Vannamei as shrimp cluster is being developed since 2004 by PT CP Prima, tbk Surabaya through Shrimp Culture Health Management transformation technology to several traditional farmers in Gresik, Lamongan, Tuban, and Madura areas. The research objectives aims to identify and mapping of stakeholder, to analyze interaction of stakeholders, to formulate strategy from internal and external environment factors and to set priority on strategy to develop sustainable and competitive shrimp clu...

  1. A review of the chemical aspects of irradiated shrimp

    International Nuclear Information System (INIS)

    The literature was reviewed for information on the chemical aspects of irradiated shrimp. Low-dose irradiation can effectively control spoilage and pathogenic organisms and extend the refrigerated shelf life of shrimp. Radiation-induced increases in black discoloration occur in some species during storage, but can be minimized by proper blanching. Some loss of the characteristic pink color occurs at doses above 2.5 kGy, and irradiation off-odors occur above 1.5 kGy. These changes can be minimized by irradiating the shrimp when they are frozen. No significant change in protein, fat, carbohydrate, and ash content occurs as a result of low-dose irradiation. Low-dose irradiation does not produce any detectable change in the levels of volatile carbonyl compounds; irradiation at 8 kGy results in a transient increase in the total volatile compounds during subsequent storage in ice, but the increase is higher in the unirradiated shrimp. Radiation-induced changes in the fatty acid composition of shrimp are small. Some minor changes in the amino acid composition occur in irradiated shrimp; similar changes occur due to other processes such as canning and drying in hot air. Some vitamins in shrimp such as thiamine are affected by irradiation. But the loss is less extensive than in thermally processed shrimp. The protein efficiency ratio is not affected by irradiation of shrimp, and no adverse effects attributed to irradiation were found in animal feeding studies

  2. Evaluation of the toxicity of the methanolic extract of Caesalpinia Pyramidalis, subjected to gamma radiation, compared to saline artemias; Avaliacao da toxicidade do extrato metanolico de Caesalpinia Pyramidalis, submetido a radiacao gama, frente a artemias salinas

    Energy Technology Data Exchange (ETDEWEB)

    Pessoa, Juanna G.; Santos, Mariana L.O.; Costa, Michelle C.A.; Siqueira, Williams N.; Silva, Luanna R.S.; Cabral, Daniela L.V.; Amancio, Francisco F.; Melo, Ana M.M.A., E-mail: marianasantos_ufpe@hotmail.com [Universidade Federal de Pernambuco (UFPE), Recife, PE (Brazil)

    2013-07-01

    The present study aimed to investigate the possible effect of irradiation of 60 Co in methanol extract of Caesalpinia pyramidalis (catingueira) with function of reducing the toxicity of the extract at concentrations of 1000, 500, 250 and 125 ppm irradiating them with doses of 5 kGy 7 kGy and 10 kGy, using lethality tests with saline Artemias.

  3. Vitamin requirements of juvenile penaeid shrimp

    OpenAIRE

    Conklin, D.

    1989-01-01

    The results of supplementing crustacean feeds with vitamins are examined specifically from the standpoint of shrimp culture. Micro-nutrients selected for discussion include: water-soluble vitamins of the B-complex, choline and inositol, vitamin C and the fat-soluble group of vitamins: A, D, E and K. Ways in which utilization of vitamins and ultimately dietary demand are altered by physiological state, conditions of culture, as well as factors which impact on feed levels, are explored.

  4. Dead shrimp blues: a global assessment of extinction risk in freshwater shrimps (Crustacea: Decapoda: Caridea).

    Science.gov (United States)

    De Grave, Sammy; Smith, Kevin G; Adeler, Nils A; Allen, Dave J; Alvarez, Fernando; Anker, Arthur; Cai, Yixiong; Carrizo, Savrina F; Klotz, Werner; Mantelatto, Fernando L; Page, Timothy J; Shy, Jhy-Yun; Villalobos, José Luis; Wowor, Daisy

    2015-01-01

    We present the first global assessment of extinction risk for a major group of freshwater invertebrates, caridean shrimps. The risk of extinction for all 763 species was assessed using the IUCN Red List criteria that include geographic ranges, habitats, ecology and past and present threats. The Indo-Malayan region holds over half of global species diversity, with a peak in Indo-China and southern China. Shrimps primarily inhabit flowing water; however, a significant subterranean component is present, which is more threatened than the surface fauna. Two species are extinct with a further 10 possibly extinct, and almost one third of species are either threatened or Near Threatened (NT). Threats to freshwater shrimps include agricultural and urban pollution impact over two-thirds of threatened and NT species. Invasive species and climate change have the greatest overall impact of all threats (based on combined timing, scope and severity of threats). PMID:25807292

  5. Dead shrimp blues: a global assessment of extinction risk in freshwater shrimps (Crustacea: Decapoda: Caridea.

    Directory of Open Access Journals (Sweden)

    Sammy De Grave

    Full Text Available We present the first global assessment of extinction risk for a major group of freshwater invertebrates, caridean shrimps. The risk of extinction for all 763 species was assessed using the IUCN Red List criteria that include geographic ranges, habitats, ecology and past and present threats. The Indo-Malayan region holds over half of global species diversity, with a peak in Indo-China and southern China. Shrimps primarily inhabit flowing water; however, a significant subterranean component is present, which is more threatened than the surface fauna. Two species are extinct with a further 10 possibly extinct, and almost one third of species are either threatened or Near Threatened (NT. Threats to freshwater shrimps include agricultural and urban pollution impact over two-thirds of threatened and NT species. Invasive species and climate change have the greatest overall impact of all threats (based on combined timing, scope and severity of threats.

  6. Assessment of endemic microalgae as potential food for Artemia franciscana culture

    Directory of Open Access Journals (Sweden)

    Juan M Pacheco-Vega

    2015-03-01

    Full Text Available In this study, five microalgal strains were isolated from Bahía de La Paz, Baja California Sur, Mexico and identified as Grammatophora sp., Navícula sp., Rhabdonema sp., Schizochytrium sp., and Nitzschia sp., and their evaluation as potential food for Artemia franciscana. The isolated strains were cultured outdoors and harvested after four days. Chaetoceros muelleri was cultured under laboratory conditions and used as control. The protein, lipid, and carbohydrate composition and the fatty acid profiles of the strains were determined by gas chromatography. To assess the effect of microalgal strains on A. franciscana, decapsulated cysts were cultured at outdoor conditions in 15 L containers. The experiment was conducted for twelve days. Samples from the five different feeding treatments were taken at the beginning and end of the experiment to assess number, size, and weight of Artemia larvae. Treatment with Rhabdonema sp. showed larvae with a lower percentage of polyunsaturated fatty acids (PUFAs while Grammatophora sp. showed those with the greatest PUFA proportion, even more than those fed Chaetoceros muelleri (control. Larvae consuming Schizochytrium sp. had no docosahexanoic (DHA nor eicosapentaenoic (EPA fatty acid content. Growth and survival of A. franciscana did not show significant differences among feed treatments, except when it was fed Nitzschia sp., showing lower survival and dry weight. Treatment based on Schizochytrium sp. and Rhabdonema sp. had a greater A. franciscana size but reduced dry weight; additional tests including two or more algal species for every treatment should be carried out to determine the best yield.

  7. Risk associated with toxic blooms of marine phytoplankton functional groups on Artemia franciscana

    Directory of Open Access Journals (Sweden)

    Ana D’ors

    2014-08-01

    Full Text Available Objective: To study mortality of copepod Artemia franciscana against the occurrence of harmful marine algae and possible toxicological changes exhibited by binary and tertiary combinations of these harmful algae toxins. Methods: Tweenty four hours acute toxicity assays were performed with selected concentrations of Alexandrium minutum, Prorocentrum lima and Nitzschia N1c1 living cells. Additionally, the results were analyzed using the median-effect/combination index (CI-isobologram equation to assess possible changes in the toxic effect induced by phytoplankton functional groups. Results: Biotoxin equivalent values obtained by immunodetection were (2.12±0.10, (8.60±1.30 and (4.32±1.67 pg/cell for saxitoxin, okadaic acid and domoic acid, respectively. The 24-h LC50 values estimated to saxitoxin and okadaic acid equivalents were 4.06 and 6.27 µg/L, significantly below the value obtained for Nitzschia N1c1, which was established at 467.33 µg/L. CI analysis applied on phytoplankton assemblages showed that both ternary mixture as the binary combinations exhibited antagonic action on toxic effects in Artemia nauplii, which were significantly lower than the toxic effect exhibited by each species studied. Conclusions: These results show that, although these harmful algae represent a serious risk to estuarine zooplankton community, the presence of phytoplankton functional groups within the same bloom can reduce the potential risk compared to the expected risk when each of the phytoplankton groups are evaluated individually.

  8. A gene catalogue for post-diapause development of an anhydrobiotic arthropod Artemia franciscana

    Directory of Open Access Journals (Sweden)

    Yu Jun

    2009-01-01

    Full Text Available Abstract Background Diapause is a reversible state of developmental suspension and found among diverse taxa, from plants to animals, including marsupials and some other mammals. Although previous work has accumulated ample data, the molecular mechanism underlying diapause and reactivation from it remain elusive. Results Using Artemia franciscana, a model organism to study the development of post-diapause embryos in Arthropod, we sequenced random clones up to a total of 28,039 ESTs from four cDNA libraries made from dehydrated cysts and three time points after rehydration/reactivation, which were assembled into 8,018 unigene clusters. We identified 324 differentially-expressed genes (DEGs, P Conclusion We found that the first 5-hour period after rehydration is most important for embryonic reactivation of Artemia. As the total number of expressed genes increases significantly, the majority of DEGs were also identified in this period, including a group of water-deficient-induced genes. A group of genes with similar functions have been described in plant seeds; for instance, one of the novel LEA members shares ~70% amino-acid identity with an Arabidopsis EM (embryonic abundant protein, the closest animal relative to plant LEA families identified thus far. Our findings also suggested that not only nutrition, but also mRNAs are produced and stored during cyst formation to support rapid development after reactivation.

  9. Cloning and Expression Analysis of p26 Gene in Artemia sinica

    Institute of Scientific and Technical Information of China (English)

    Lijuan JIANG; Lin HOU; Xiangyang ZOU; Ruifeng ZHANG; Jiaqing WANG; Wenjing SUN; Xintao ZHAO; Jialu AN

    2007-01-01

    The protein p26 is a small heat shock protein that functions as a molecular chaperone to protect embryos by preventing irreversible protein damage during embryonic development. A 542 bp fragment of the p26 gene was cloned and sequenced. The fragment encoded 174 amino acid residues and the amino acid sequence contained the α-crystallin domain. Phylogenetic analysis showed that eight Artemia populations were divided into four major groups. Artemia sinica (YC) belonged to the East Asia bisexual group. Expression of the p26 gene at different developmental stages of A. sinica was quantified using real-time quantitative polymerase chain reaction followed by cloning and sequencing. The relationship between the quantity of p26 gene expression and embryonic development was analyzed. The results indicated that massive amounts of p26 were expressed during the development of A. sinica. At the developmental stage of 0 h, A. sinica expressed the highest level of p26. As development proceeded, expression levels of the p26 gene reduced significantly. There was a small quantity of p26 gene expression at the developmental stages of 16 h and 24 h. We concluded that p26 might be involved in protecting the embryo from physiological stress during embryonic development.

  10. Peningkatan Kuantitas dan Kualitas Kista Artemia franciscana setelah Pemberian Silase Ikan

    Directory of Open Access Journals (Sweden)

    ENDAH BUDI SULISTYOWATI

    2007-11-01

    Full Text Available Artemia is one of live feed needed in aquaculture as fishes and crustacean. Commercially, Artemia usually sold in dry cysts which can kept for years. The aim of this research were to know increasing quantity and quality A. franciscana cysts after exposing various concentration of fish silage as artificial food and to know optimal concentration of fish silage that can increase quantity and quality A. franciscana cysts. This research was done in Laboratory of Live Feed BBPBAP Jepara Central Java. This research was conducted by 5 treatments. Treatments were grouped based on amount of concentration given, i.e: control (coconut cake with concentrate 10 g/m3, fish silage concentrate 10, 20, 30, and 40 g/m3. Parameter investigated were number of cysts produced by individual female A. franciscana, diameter of A. franciscana cysts, hatching percentage, and hatching rate of A. franciscana cysts. Data were analyzed using ANOVA and continued using Tukeys test at significant level 5%. The result of this research showed that exposing fish silage can increase quantity and quality A. franciscana cysts. They were increase number of cysts production by individual females, decrease cysts diameter, increase hatching percentage and hatching rate. Optimal concentration of fish silage on increase quantity and quality of A. franciscana cysts was 20 g/m3.

  11. Intentional introduction of Artemia sinica (Anostraca) in the high-altitude Tibetan lake Dangxiong Co: the new population and consequences for the environment and for humans

    Science.gov (United States)

    Jia, Qinxian; Anufriieva, Elena; Liu, Xifang; Kong, Fanjing; Shadrin, Nickolai

    2015-11-01

    The imbalance between supply and demand of Artemia cysts in China and around the world is increasing now. Salt lakes in Tibet may contribute to the solution of the problem. In Northern Tibet there are 26 saline lakes whose salinity and temperature may support Artemia survival at an altitude of 4 000-5 100 m. We found Artemia in 15 of these lakes. The saline lakes with Artemia populations mainly belong to the shallow basin lakes, and the majority of these lakes are small in area. The total area of lakes without Artemia is more than 1 000 km2. Lake Dangxiong Co (Co means lake in Tibet) was chosen for the intentional introduction of Artemia sinica. In 2004, 850 g of A. sinica cysts, originating from Qinghai, were introduced in the lake. Surveys in 2006-2014 showed that the average abundance of Artemia adults in the lake gradually increased from 20 ind./m3 in 2006 to 1950 ind./m3 in 2013. We assume that two subpopulations of A. sinica, separated by depth, may exist in the lake. The new Artemia population caused an increase in the number of species of phytoplankton and heterotrophic protozoa with a decrease of their total abundance. Water transparency also increased. Dominance in phytoplankton passed from cyanobacteria to diatoms. Changes occurred not only in the lake ecosystem; the number of water birds using the lakes also dramatically increased. Preliminary calculations showed that is it possible to harvest at least about 150 t cysts per year from the lake as well as 3.2 thousand tons of frozen or 350 t of dried biomass of adult Artemia.

  12. The complete mitochondrial genomes of the yellowleg shrimp Farfantepenaeus californiensis and the blue shrimp Litopenaeus stylirostris (Crustacea: Decapoda).

    Science.gov (United States)

    Peregrino-Uriarte, Alma B; Varela-Romero, Alejandro; Muhlia-Almazán, Adriana; Anduro-Corona, Iván; Vega-Heredia, Sarahí; Gutiérrez-Millán, Luis E; De la Rosa-Vélez, Jorge; Yepiz-Plascencia, Gloria

    2009-03-01

    Mitochondria play key roles in many cellular processes. Description of penaeid shrimp genes, including mitochondrial genomes are fairly recent and some are focusing on commercially important shrimp as the Pacific shrimp Litopenaeus vannamei that is being used for aquaculture not only in America, but also in Asia. Much less is known about other Pacific shrimp such as the yellowleg shrimp Farfantepenaeus californiensis and the blue shrimp Litopenaeus stylirostris. We report the complete mitogenomes from these last two Pacific shrimp species. Long DNA fragments were obtained by PCR and then used to get internal fragments for sequencing. The complete F. californiensis and L. stylirostris mtDNAs are 15,975 and 15,988 bp long, containing the 37 common sequences and a control region of 990 and 999 bp, respectively. The gene order is identical to that of the tiger shrimp Penaeus monodon. Secondary structures for the 22 tRNAs are proposed and phylogenetic relationships for selected complete crustacean mitogenomes are included. Phylogenomic relationships among five shrimp show strong statistical support for the monophyly of the genus across the analysis. Litopenaeus species define a clade, with close relationship to Farfantepenaeus, and both clade with the sister group of Penaeus and Fenneropenaeus. PMID:20403743

  13. Radionuclide transport in sandstones with WIPP brine

    International Nuclear Information System (INIS)

    Retardation factors (R) have been measured for the transport of 3H, /sup 95m/Tc, and 85Sr in WIPP brine using St. Peter, Berea, Kayenta, and San Felipe sandstone cores. If tritium is assumed to have R=1, /sup 95m/Tc has R=1.0 to 1.3 and therefore is essentially not retarded. Strontium-85 has R = 1.0 to 1.3 on St. Peter, Berea, and Kayenta, but R=3 on San Felipe. This is attributed to sorption on the matrix material of San Felipe, which has 45 volume % matrix compared with 1 to 10 volume % for the others. Retardation factors (R/sub s/) for 85Sr calculated from static sorption measurements are unity for all the sandstones. Therefore, the static and transport results for 85Sr disagree in the case of San Felipe, but agree for St. Peter, Berea, and Kayenta

  14. Closed recirculating system for shrimp-mollusk polyculture

    Institute of Scientific and Technical Information of China (English)

    2005-01-01

    This paper deals with a new system of aquaculture, i.e., a closed recirculating system for shrimp-mollusk polyculture. The culture system consisted of several shrimp ponds, a mollusk water-purifying pond and a reservoir. During the production cycle, water circulated between the shrimp and mollusk ponds, and the reservoir compensated for water loss from seepage and evaporation. Constricted tagelus, Sinonovacula constricta, was selected as the cultured mollusk, and Pacific white shrimp, Litopenaeus vannamei, as the cultured shrimp. The main managing measures during the production cycle were: setting and using the aerators; introducing the probiotic products timely into the shrimp ponds; adopting a "pen-closing" method for controlling shrimp viral epidemics; setting the flow diversion barriers in the mollusk pond to keep the circulating water flowing through the pond along a sine-like curve and serve as substrate for biofilm; no direct feeding was necessary for the cultured mollusk until the co-cultured shrimp was harvested; natural foods in the water from the shrimp ponds was used for their foods. Two sets of the system were used in the experiment in 2002 and satisfactory results were achieved. The average yield of the shrimp was 11 943.5 kg/hm2, and that of the mollusk was 16 965kg/hm2. After converting the mollusk yield into shrimp yield at their market price ratio, the food coefficient of the entire system averaged at as low as 0.81. The water quality in the ponds was maintained at a desirable level and no viral epidemics were discovered during the production cycle.

  15. Closed recirculating system for shrimp-mollusk polyculture

    Science.gov (United States)

    Wu, Xiongfei; Zhao, Zhidong; Li, Deshang; Chang, Kangmei; Tong, Zhuanshang; Si, Liegang; Xu, Kaichong; Ge, Bailin

    2005-12-01

    This paper deals with a new system of aquaculture, i.e., a closed recirculating system for shrimp-mollusk polyculture. The culture system consisted of several shrimp ponds, a mollusk water-purifying pond and a reservoir. During the production cycle, water circulated between the shrimp and mollusk ponds, and the reservoir compensated for water loss from seepage and evaporation. Constricted tagelus, Sinonovacula constricta, was selected as the cultured mollusk, and Pacific white shrimp, Litopenaeus vannamei, as the cultured shrimp. The main managing measures during the production cycle were: setting and using the aerators; introducting the probiotic products timely into the shrimp ponds; adopting a “pen-closing” method for controlling shrimp viral epidemics; setting the flow diversion barriers in the mollusk pond to keep the circulating water flowing through the pond along a sine-like curve and serve as substrate for biofilm; no direct feeding was necessary for the cultured mollusk until the co-cultured shrimp was harvested; natural foods in the water from the shrimp ponds was used for their foods. Two sets of the system were used in the experiment in 2002 and satisfactory results were achieved. The average yield of the shrimp was 11 943.5 kg/hm2, and that of the mollusk was 16 965 kg/hm2. After converting the mollusk yield into shrimp yield at their market price ratio, the food coefficient of the entire system averaged at as low as 0.81. The water quality in the ponds was maintained at a desirable level and no viral epidemics were discovered during the production cycle.

  16. Improved brine recycling during nitrate removal using ion exchange.

    Science.gov (United States)

    Bae, Byung-Uk; Jung, Yoo-Hoon; Han, Woon-Woo; Shin, Hang-Sik

    2002-07-01

    Ion exchange technology is currently the best for removing nitrate from drinking water. However, problems related to the disposal of spent brine from regeneration of exhausted resins must be overcome so that ion exchange can be applied more widely and economically, especially in small communities. For this purpose, a novel spent brine recycling system using combined biological denitrification and sulfate reduction processes was developed for more efficient reuse of brine. A granular activated carbon (GAC) adsorption column was introduced as an additional step to prevent contamination of resins by bio-polymers and dissolved organics present in the bio-reactor effluent. Two upflow sludge blanket reactors (USBRs) were operated in series for 166 days to provide denitrification and sulfate reduction. The denitrification reactor provided a nitrate removal efficiency of 96% at a nitrate-N loading rate of 5.4 g NO3(-)-N/l d. The sulfate reduction efficiency of the sulfate reduction reactor remained approximately 62% at a sulfate loading rate of 1.8 g SO4(2-)/l d. Five ion exchange columns containing A520E resins were repeatedly operated in up to 25 cycles of service and regeneration using five kinds of brine: one virgin 3% NaCl and four differently recycled spent brines. Throughput decreased remarkably when the biologically recycled brine was not treated with the GAC column, probably due to the presence of bio-polymers and dissolved organic compounds. The sulfate reduction reactor placed after the denitrification step increased the bicarbonate concentration, which could be used as a co-regenerant with chloride. The inclusion of the sulfate reduction reactor into the conventional brine recycling system allowed more efficient reuse of brine, resulting in both reduced salt consumption and brine discharge. PMID:12188132

  17. Brine migration in hot-pressed polycrystalline sodium chloride

    International Nuclear Information System (INIS)

    This report describes experiments designed to provide data on brine migration in polycrystalline salt. Polycrystalling samples of various grain sizes, density, and purity were prepared from several commercial-grade salts by hot-pressing. Three distinct experimental set-ups were used to place salt billets in an induced thermal gradient in contact with brine source. The test designs varied primarily in the way in which the thermal gradient was applied and monitored and the way in which brine migration was determined. All migration was in enclosed vessels which precluded visual observation of brine movement through the microstructure. Migration velocities were estimated either by the timed appearance of brine at the hot face of the sample, or by determination of the penetration distance of migration artifacts in the microstructure after tests of fixed duration. For various reasons both of these methods were subject to a large degree of error. Our results suggest, however, that the migration velocity in dense polycrystalline salt may be at least an order of magnitude greater than that suggested by single-crystal experiments. Microstructural analysis shows that brine prefers to migrate along paths of high crystalline activity such as grain and subgrain boundaries and is dispersed rather quickly in the microstructure. A series of tests were performed using various types of tracers in brine in order to flag migration paths and locate brine in the microstructure more decisively. These attempts failed and it appears that only the aqueous portion of the brine moves through the microstructure with the dissolved ions being lost and replaced rather quickly. This suggests the use of deuterium as a tracer in future work

  18. Bacterial dynamics in intestines of the black tiger shrimp and the Pacific white shrimp during Vibrio harveyi exposure.

    Science.gov (United States)

    Rungrassamee, Wanilada; Klanchui, Amornpan; Maibunkaew, Sawarot; Karoonuthaisiri, Nitsara

    2016-01-01

    The intestinal microbiota play important roles in health of their host, contributing to maintaining the balance and resilience against pathogen. To investigate effects of pathogen to intestinal microbiota, the bacterial dynamics upon a shrimp pathogen, Vibrio harveyi, exposures were determined in two economically important shrimp species; the black tiger shrimp (BT) and the Pacific white shrimp (PW). Both shrimp species were reared under the same diet and environmental conditions. Shrimp survival rates after the V. harveyi exposure revealed that the PW shrimp had a higher resistance to the pathogen than the BT shrimp. The intestinal bacterial profiles were determined by denaturing gradient gel electrophoresis (DGGE) and barcoded pyrosequencing of the 16S rRNA sequences under no pathogen challenge control and under pathogenic V. harveyi challenge. The DGGE profiles showed that the presence of V. harveyi altered the intestinal bacterial patterns in comparison to the control in BT and PW intestines. This implies that bacterial balance in shrimp intestines was disrupted in the presence of V. harveyi. The barcoded pyrosequencing analysis showed the similar bacterial community structures in intestines of BT and PW shrimp under a normal condition. However, during the time course exposure to V. harveyi, the relative abundance of bacteria belong to Vibrio genus was higher in the BT intestines at 12h after the exposure, whereas relative abundance of vibrios was more stable in PW intestines. The principle coordinates analysis based on weighted-UniFrac analysis showed that intestinal bacterial population in the BT shrimp lost their ability to restore their bacterial balance during the 72-h period of exposure to the pathogen, while the PW shrimp were able to reestablish their bacterial population to resemble those seen in the unexposed control group. This observation of bacterial disruption might correlate to different mortality rates observed between the two shrimp species

  19. Empirical formula for the refractive index of freezing brine

    DEFF Research Database (Denmark)

    Frisvad, Jeppe Revall

    2009-01-01

    The refractive index of freezing brine is important for example in order to estimate oceanic scattering as sea ice develops. Previously, no simple continuous expression was available for estimating the refractive index of brine at subzero temperatures. I show that extrapolation of the empirical f...... formula for the refractive index of seawater by Quan and Fry [Appl. Opt. 34(18), 3477-3480 (1995)] provides a good fit to the refractive index of freezing brine for temperatures above -24 degrees celsius and salinities below 180 parts per thousand....

  20. Electromagnetic mapping of brine contamination in petroleum producing areas

    International Nuclear Information System (INIS)

    Geophysical electromagnetic devices are well suited to mapping soil and groundwater contamination by oilfield brines. Frequency domain devices such as ground conductivity meters are used for quick assessment of the lateral extent of contamination in the near surface. Time domain devices can accurately define the depth and thickness of the contaminated horizons. Three cases are reviewed which involve the use of geophysical electromagnetic mapping to evaluate brine contamination around a disused drilling pit and an evaporation pond, and to investigate the occurrence of brine relative to local geology in the Michigan Basin. 11 refs., 8 figs

  1. Biology, genome organization and evolution of parvoviruses in marine shrimp

    Science.gov (United States)

    A number of parvoviruses are now know to infect marine shrimp, and these viruses alone or in combination with other viruses have the potential to cause major losses in shrimp aquaculture globally. This review provides a comprehensive overview of the biology, genome organization, gene expression, and...

  2. Accumulation and retention of 241Am in marine plankton

    International Nuclear Information System (INIS)

    Two samples of sea water spiked with 241Am were prepared, one containing a rich suspension of phytoplankton cells and the other not. Adult Artemia brine shrimp were placed in each sample and the accumulation, uptake and concentration factors were obtained. Results from the Artemia uptake show that 241Am is far more effectively accumulated from the water pathway than from the combined food and water pathway. The experiments indicate that 241Am is relatively non-assimilatable when digested and thus most, if not all, of the isotope is rapidly voided in fecal pellets

  3. COMPARATIVE STUDIES ON NITROGEN BUDGETS OF CLOSED SHRIMP POLYCULTURE SYSTEMS"

    Institute of Scientific and Technical Information of China (English)

    齐振雄; 李德尚; 张曼平; 董双林

    2001-01-01

    April to October, 1997 comparative studios on the nitrogen budgets of closed shrimp polyculture systems showed that, in all the studied polyculture systems, nitrogen from feeds and fertilizers were the main input items, which comprised 70.7% - 83.9% of the total input nitrogen, 3.2% - 7.4% of which was provided by nitrogen fixation. It was in monoculture enclosures (Y-4, Y-11 and Y-12) that the percentage reached the maximum value. The output nitrogen in harvested products comprised 10.8% - 24.6% of total input nitrogen, and the highest percentage, 24.6%, was found in shrimp-fish-tagelus polyculture systems. In shrimp monoculture and shrimp-fish polyculture systems, they were 19.1% and 21.9%, respectively. The nitrogen utilization efficiency was different and varied from 12.2% to 20.1%. The highest, 20.1%, was found in shrimp-fish-tagelus polycultttre systems, and the average of 20.0% was found in shrimp-tagelus polyculture systems. The lowest, 12.2%, was found in shrimp monoculture systems.All the nitrogen utilization efficiencies in shrimp-fish systems or shrimp-scallop systems seemed to be higher than that of the monoculture system, but they showed little statistical difference. The main outputs of nitrngen were found in sediment mud, and comprised 48.2% -60.8% of the total input, the lowest percentage was found in shrimp-fish-tagelus polyculture systems, and the highost percentage in shrimp-scallop systems.During the experiment, nitrogen lost through denitrification and ammonia volatilization comprised 1.9% - 6.2%, averaged 2.8%, of the total input, and the loss through seepage comprised 5.9% - 8.9% of the total.The estimated nitrogen attached to the enclosure wall comprised 3.7% - 13.3% of the total, and was highest in shrimp monoculture systems. Compared with the classic shrimp farming industry, the closed shrimp polycul-ture systems may improve the nitrogen utilization efficiency, and hence reduce the environmental impacts on coastal waters. The nitrogen

  4. COMPARATIVE STUDIES ON NITROGEN BUDGETS OF CLOSED SHRIMP POLYCULTURE SYSTEMS

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    April to October, 1997 comparative studies on the nitrogen budgets of closed shrimp polyculture systems showed that, in all the studied polyculture systems, nitrogen from feeds and fertilizers were the main input items, which comprised 70.7%-83.9% of the total input nitrogen, 3.2%-7.4% of which was provided by nitrogen fixation. It was in monoculture enclosures (Y-4, Y-11 and Y-12) that the percentage reached the maximum value. The output nitrogen in harvested products comprised 10.8%-24.6% of total input nitrogen, and the highest percentage, 24.6%, was found in shrimp-fish-tagelus polyculture systems. In shrimp monoculture and shrimp-fish polyculture systems, they were 19.1% and 21.9%, respectively. The nitrogen utilization efficiency was different and varied from 12.2% to 20.1%. The highest, 20.1%, was found in shrimp-fish-tagelus polyculture systems, and the average of 20.0% was found in shrimp-tagelus polyculture systems. The lowest, 12.2%, was found in shrimp monoculture systems. All the nitrogen utilization efficiencies in shrimp-fish systems or shrimp-scallop systems seemed to be higher than that of the monoculture system, but they showed little statistical difference. The main outputs of nitrogen were found in sediment mud, and comprised 48.2%-60.8% of the total input, the lowest percentage was found in shrimp-fish-tagelus polyculture systems, and the highest percentage in shrimp-scallop systems. During the experiment, nitrogen lost through denitrification and ammonia volatilization comprised 1.9%-6.2%, averaged 2.8%, of the total input, and the loss through seepage comprised 5.9%-8.9% of the total. The estimated nitrogen attached to the enclosure wall comprised 3.7%-13.3% of the total, and was highest in shrimp monoculture systems. Compared with the classic shrimp farming industry, the closed shrimp polyculture systems may improve the nitrogen utilization efficiency, and hence reduce the environmental impacts on coastal waters. The nitrogen discharging

  5. Shelf life extension of dried shrimps by irradiation

    International Nuclear Information System (INIS)

    By reducing the number of bacteria, irradiation with a dose of 3 kGy increased the shelf life of dried and salted shrimp. Combining radiation with low-temperature storage further increased shelf life. Vacuum packaging the shrimp in polyethylene-laminated polyethylene bags resulted in extension of the shelf life by more than 15 weeks. Packing in tupperware and polyethylene bags was less effective. Most of the bacteria in the dried and salted shrimps were halophiles. Salmonellae and coliforms were not detected in the samples studied. During storage, ammonia was formed in the shrimps. Irradiation caused less ammonia to be formed. Low-temperature storage also reduced ammonia formation. The sensory quality of the shrimps decreased with increasing amounts of ammonia. (author). 9 refs, 25 figs

  6. Marine shrimp aquaculture and natural resource degradation in Thailand

    Science.gov (United States)

    Flaherty, Mark; Karnjanakesorn, Choomjet

    1995-01-01

    Rising demand for shrimp in the developed nations has helped to foster a dramatic growth in marine shrimp aquaculture, particularly in South America and South Asia. In Thailand, Marine shrimp aquaculture is now an important earmer of foreign exchange. The growth in Production has been achieved through the expansion of the culture area and the adoption of intensive production methods. The conversion of near-shore areas to shrimp culture, however, is proving to have many consequences that impinge on the environmental integrity of coastal areas. This paper reviews the development of Thailand's marine shrimp culture industry and examines the nature of the environmental impacts that are emerging. It then discusses the implications these have for rural poor and the long-term viability of the culture industry.

  7. Occurrence of aspartyl proteases in brine after herring marinating.

    Science.gov (United States)

    Szymczak, Mariusz; Lepczyński, Adam

    2016-03-01

    Herrings are marinated in a brine consisting of salt and acetic acid. During marinating, various nitrogen fractions diffuse from fish flesh to the brine, causing significant nutritional quality losses of the raw material. In this study, it has been demonstrated for the first time that proteases diffuse from the fish to the marinating brine. Using ammonium sulphate precipitation and affinity chromatography on pepstatin-A agarose bed the aspartyl proteases were purified and concentrated over 2600-fold from a marinating brine. Pepstatin-A completely inhibited the activity of the purified preparation. The preparation was active against fluorogenic substrates specific for cathepsin D and E and inactive against substrates specific for cysteine cathepsins. Depending on incubation time, the preparation showed pH-optimum at 2.0 or 4.5. The 2D SDS-PAGE separation demonstrated the presence of a few proteins with molecular weights and pI values typical of cathepsin D, E and pepsin. PMID:26471581

  8. Migration of brine and nitrogen in creeping salt

    International Nuclear Information System (INIS)

    Although the excavations in bedded salt at the Waste Isolation Pilot Plant (WIPP) are, for all practical purposes, dry, small amounts of brine have been observed to weep from exposed surfaces in the repository horizon and seep into drill holes in the underground excavations. As part of the Brine Sampling and Evaluation Program (BSEP) at the WIPP, this study has been made to formulate the complex problem of brine and nitrogen flow through deforming salt as completely as possible. The derived equations are coupled where appropriate in order to closely describe the natural phenomena. The main objective of this paper is to suggest a method by which the formulation might be solved in order to estimate the brine inflow rate into the excavated rooms at the WIPP repository level. The suggested solution method requires the modification and combination of two finite element codes which may necessitate a large amount of computer memory for data storage

  9. Coiled Brine Recovery Assembly (CoBRA) Project

    Data.gov (United States)

    National Aeronautics and Space Administration — The Coiled Brine Recovery Assembly (CoBRA) project will result in a proof-of-concept demonstration for a lightweight, compact, affordable, regenerable and...

  10. Uji Sitotoksik Ekstrak Metanol Kulit Kayu Tumbuhan Cep-Cepen (Castanopsis Costata Bl) Dengan Metode Brine Shrimp Lethality Assays

    OpenAIRE

    Kelana, Tata Bintara

    2010-01-01

    Telah dilakukan penelitian terhadap ekstrak kulit kayu tumbuhan Cep-cepen (Castanopsis Costata BL) yang pemeriksaannya dilaksanakan dengan cara 100 g kulit batang tumbuhan Cep-cepen (Castanopsis Costata BL) yang dimaserasi dengan methanol sebanyak 1200 ml dan diulang 5 kali maserasi dengan waktu maserasi 5 hari. Maserat dipekatkan dengan vacum dan diperoleh berat ekstrak pekat metanol = 5,7 g. Uji pendahuluan fitokimia memperlihatkan adanya senyawa kelompok flavonoida. Uji toksisitas ekst...

  11. Antimicrobial activity and brine shrimp toxicity of extracts of Terminalia brownii roots and stem

    OpenAIRE

    Kapingu Modest C; Masimba Pax J; Moshi Mainen J; Mbwambo Zakaria H; Nondo Ramadhani SO

    2007-01-01

    Abstract Background Ternimalia brownii Fresen (Combretaceae) is widely used in traditional medicine to treat bacterial, fungal and viral infections. There is a need to evaluate extracts of this plant in order to provide scientific proof for it's wide application in traditional medicine system. Methods Extraction of stem bark, wood and whole roots of T. brownii using solvents of increasing polarity, namely, Pet ether, dichloromethane, dichloromethane: methanol (1:1), methanol and aqua, respect...

  12. Antimicrobial and Cytotoxic Activity of Three Bitter Plants Enhydra Fluctuans, Andrographis Peniculata and Clerodendrum Viscosum.

    OpenAIRE

    Ruhul Amin, M.; Ripon Mondol; M. Rowshanul Habib; M. Tofazzal Hossain

    2012-01-01

    Purpose: In this study, three important medicinal plants (Enhydra fluctuans Lour, Clerodendrum viscosum Vent and Andrographis peniculata Wall) of Bangladesh were investigated to analyze their antimicrobial and cytotoxic activities against some pathogenic microorganisms and Artemia salina (brine shrimp nauplii). Methods: The coarse powder material of leaves of each plant was extracted separately with methanol and acetone to yield methanol extracts of leaves of Enhydra fluctuans (MLE), Cleroden...

  13. Ekstrak Daun Sambiloto (Andrographis paniculata) Dalam Mengendalikan Pertumbuhan Bakteri Aeromonas hydrophila, Edwarsiella tarda dan Jamur Saprolegnia sp. Secara In Vitro

    OpenAIRE

    Sinaga, Lihardo

    2016-01-01

    This study was aimed to know antimicrobial potential of extract of sambiloto’s Leaf (Andrographis paniculata) against bacteria Aeromonas hydrophila, Edwardsiella tarda and Saprolegnia sp. and to know the extract toxicity to brine shrimp (Artemia salina). Sambiloto’s leaf was extracted using methanol, ethyl acetate and n-Hexane. Antimicrobial activity test was done using diffusion discs method to know the compunds contained in the extract phytochemical test was conducted. The chemical compound...

  14. SOME BIOLOGICAL ACTIVITY INVESTIGATIONS ON BALLOT A ACETAB ULOSA

    OpenAIRE

    M. U. DUMLU, G. E. BULUT, M. U. DUMLU, G. E. BULUT

    2013-01-01

    Bu çalışmada Ballota acetabitlosa bitkisinin topraküstü kısımlarının potansiyel sitotoksik ve antioksidan aktiviteleri sırasıyla Brine Shrimp (Artemia salina), DPPH (1,1- difenil-2-pikrilhidrazil), indirgeme metodlan kullanılarak araştırılmıştı]-. Bitkinin etanol ekstresi bahsedilen tüm yöntemlerde aktif bulunmuştur.

  15. Biological and chemical study of paico (Chenopodium chilense, Chenopodiaceae).

    Science.gov (United States)

    García, R; Lemus, I; Rivera, P; Erazo, S

    1997-07-01

    The methanolic extract of the aerial portion of Chenopodium chilense Schrad., used in Chilean traditional medicine as a remedy for stomach-ache, has been found to exert the major spasmolytic activity in acetylcholine contracted rat ileum. This extract, with a complex flavonoid patterns on thin layer chromatography (TLC) analysis, is practically non-toxic both for rats and brine shrimp Artemia salina in acute toxicity test. PMID:9254110

  16. Cytotoxicity screening of some South American Solanaceae.

    Science.gov (United States)

    Moreno-Murillo, B; Fajardo, V M; Suárez, M

    2001-08-01

    Alcoholic extracts of seven plants belonging to the Solanaceae family were phytochemically screened and evaluated for their cytotoxic activity by Brine Shrimp Test (BST) with Artemia salina larvae, Inhibition of Cell Division Test (ICDT) on sea urchin Loxechinus albus fertilized eggs and inhibition of crown gall tumors on Potato Disk Bioassay (PDB). From Salpichroa diffusa, bioassay-guided chromatographic separation afforded some active fractions from which epi-katonic acid was identified. PMID:11543969

  17. In vivo and in vitro antiplasmodial activities of some plants traditionally used in Guatemala against malaria.

    OpenAIRE

    Franssen, F F; Smeijsters, L J; Berger, I; Medinilla Aldana, B E

    1997-01-01

    We present an evaluation of the antiplasmodial and cytotoxic effects of four plants commonly used in Guatemalan folk medicine against malaria. Methanol extracts of Simarouba glauca D. C., Sansevieria guineensis Willd, Croton guatemalensis Lotsy, and Neurolaena lobata (L.)R.Br. significantly reduced parasitemias in Plasmodium berghei-infected mice. Dichloromethane fractions were screened for their cytotoxicities on Artemia salina (brine shrimp) larvae, and 50% inhibitory concentrations were de...

  18. Potential Activity And Toxicity Of Methanol Extract Stem Bark Banyuru (Pterospermum Celebicum Miq.)

    OpenAIRE

    Marzuki, Agus

    2015-01-01

    Banyuru (Pterospermum celebicum, Miq.) is one of the specific plant, a stem bark that has the potential to be developed as a source of antibacterial drugs. Research of antibacterial activity and toxicity of methanol extract Banyuru aims to determine the antibacterial activity and the level of toxicity to Artemia Salina. The method used to test the antibacterial activity is the agar diffusion method and the method used to test the toxicity Brine Shrimp Lethaly Test (BSLT). Banyuru stem bark (...

  19. Dense, viscous brine behavior in heterogeneous porous medium systems.

    Science.gov (United States)

    Wright, D Johnson; Pedit, J A; Gasda, S E; Farthing, M W; Murphy, L L; Knight, S R; Brubaker, G R; Miller, C T

    2010-06-25

    The behavior of dense, viscous calcium bromide brine solutions used to remediate systems contaminated with dense nonaqueous phase liquids (DNAPLs) is considered in laboratory and field porous medium systems. The density and viscosity of brine solutions are experimentally investigated and functional forms fit over a wide range of mass fractions. A density of 1.7 times, and a corresponding viscosity of 6.3 times, that of water is obtained at a calcium bromide mass fraction of 0.53. A three-dimensional laboratory cell is used to investigate the establishment, persistence, and rate of removal of a stratified dense brine layer in a controlled system. Results from a field-scale experiment performed at the Dover National Test Site are used to investigate the ability to establish and maintain a dense brine layer as a component of a DNAPL recovery strategy, and to recover the brine at sufficiently high mass fractions to support the economical reuse of the brine. The results of both laboratory and field experiments show that a dense brine layer can be established, maintained, and recovered to a significant extent. Regions of unstable density profiles are shown to develop and persist in the field-scale experiment, which we attribute to regions of low hydraulic conductivity. The saturated-unsaturated, variable-density groundwater flow simulation code SUTRA is modified to describe the system of interest, and used to compare simulations to experimental observations and to investigate certain unobserved aspects of these complex systems. The model results show that the standard model formulation is not appropriate for capturing the behavior of sharp density gradients observed during the dense brine experiments. PMID:20444520

  20. Intracellular localization of group 3 LEA proteins in embryos of Artemia franciscana.

    Science.gov (United States)

    Boswell, Leaf C; Hand, Steven C

    2014-12-01

    Late embryogenesis abundant (LEA) proteins are accumulated by anhydrobiotic organisms in response to desiccation and improve survivorship during water stress. In this study we provide the first direct evidence for the subcellular localizations of AfrLEA2 and AfrLEA3m (and its subforms) in anhydrobiotic embryos of Artemia franciscana. Immunohistochemistry shows AfrLEA2 to reside in the cytoplasm and nucleus, and the four AfrLEA3m proteins to be localized to the mitochondrion. Cellular locations are supported by Western blots of mitochondrial, nuclear and cytoplasmic fractions. The presence of LEA proteins in multiple subcellular compartments of A. franciscana embryos suggests the need to protect biological structures in many areas of a cell in order for an organism to survive desiccation stress, and may explain in part why a multitude of different LEA proteins are expressed by a single organism. PMID:25311474

  1. First secondary metabolites from Herissantia crispa L (Brizicky) and the toxicity activity against Artemia salina Leach

    International Nuclear Information System (INIS)

    The phytochemical investigation of Herissantia crispa led to the isolation of seven compounds, identified as: sitosterol 3-O-β-D-glucopyranoside, stigmasterol 3-O-β-D-glucopyranoside, 3,5,7,4'-tetrahydroxyflavone (kaempferol), 3,5,7,3',4'-pentahydroxyflavone (quercetin), unpublished in the genus Herissantia, besides β-sitosterol, kaempferol 3-O-β-D-(6''-E-p-coumaroil) (tiliroside) glucopyranoside and kaempferol 3,7-di-O-α-L-ramnopyranoside (lespedin), described for the first time in the species. The structural determination of the compounds was made by means of spectroscopy methods such as Infrared Spectroscopy, 1H and 13C Nuclear Magnetic Resonance, with the aid of two dimensional techniques, and by comparison with literature data. The toxicity activity of the MeOH extract and lespedin on Artemia salina Leach. was also carried out. (author)

  2. Genetic variation in parthenogenetic Artemia from the Shandong Peninsula, P.R.C.

    Science.gov (United States)

    King, Charles E.; Zhao, Yuqi; Liu, Xin; Li, Mingren

    1988-06-01

    Results are presented of a survey of isozyme frequencies in parthenogenetic Artimia from six salterns in the Shandong Peninsula, P.R.C. Three of the eleven enzymes we scored using polyacryamide gel electrophoresis proved to be useful for analysis of electromorph frequency variation. These enzymes are tetrazolium oxidase (TO), lactate dehydrogenase (LDH), and malate dehydrogenase (MDH). Each of these systems showed extensive isozyme variation both within and between salterns. In addition, we have examined the possibility that electromorph frequencies may vary as the result of natural selection for adaptation to specific salinity, or salinity-associated environmental conditions. An indication of clinal variation was found in two series of ponds differing in salinity, however more extensive data are needed before it is possible to conclude that these patterns are the result of natural selection. Finally, the use of isozyme analyses such as ours, for unraveling taxonomic problems in Artemia is discussed.

  3. Characterization of brines and evaporites of Lake Katwe, Uganda

    Science.gov (United States)

    Kasedde, Hillary; Kirabira, John Baptist; Bäbler, Matthäus U.; Tilliander, Anders; Jonsson, Stefan

    2014-03-01

    Lake Katwe brines and evaporites were investigated to determine their chemical, mineralogical and morphological composition. 30 brine samples and 3 solid salt samples (evaporites) were collected from different locations of the lake deposit. Several analytical techniques were used to determine the chemical composition of the samples including Inductively Coupled Plasma-Atomic Emission Spectrometry (ICP-AES), Inductively Coupled Plasma-Sector Field Mass Spectrometry (ICP-SFMS), ion chromatography, and potentiometric titration. The mineralogical composition and morphology of the evaporites was determined using X-ray diffraction (XRD) and scanning electron microscopy (SEM), respectively. Physical parameters of the lake brines such as density, electrical conductivity, pH, and salinity were also studied. The results show that the lake brines are highly alkaline and rich in Na+, Cl-, CO32-, SO42-, and HCO3- with lesser amounts of K+, Mg2+, Ca2+, Br-, and F- ions. The brines show an intermediate transition between Na-Cl and Na-HCO3 water types. Among the trace metals, the lake brines were found to be enriched in B, I, Sr, Fe, Mo, Ba, and Mn. The solid salts are composed of halite mixed with other salts such as hanksite, burkeite and trona. It was also observed that the composition of the salts varies considerably even within the same grades.

  4. Consumer method to control Salmonella and Listeria species in shrimp.

    Science.gov (United States)

    Edwards, Genevieve; Janes, Marlene; Lampila, Lucina; Supan, John

    2013-01-01

    The purpose of this study was to determine whether the current consumer method of boiling shrimp until floating and pink in color is adequate for destroying Listeria and Salmonella. Shrimp samples were submerged in bacterial suspensions of Listeria and Salmonella for 30 min and allowed to air dry for 1 h under a biosafety cabinet. Color parameters were then measured with a spectrophotometer programmed with the CIELAB system. Twenty-four shrimp samples were divided into groups (days 0, 1, or 2) and stored at 4°C. The samples were treated by placing them in boiling water (100°C) on days 0, 1, and 2. The shrimp were immediately removed from the boiling water once they floated to the surface, and color parameters were measured. Bacterial counts were determined, and the log CFU per gram was calculated. The effect of sodium tripolyphosphate on the color change of cooked shrimp also was determined. Initial bacterial counts on shrimp after air drying were 5.31 ± 0.14 log CFU/g for Salmonella Enteritidis, 5.24 ± 0.31 log CFU/g for Salmonella Infantis, 5.40 ± 0.16 log CFU/g for Salmonella Typhimurium, 3.91 + 0.11 log CFU/g for Listeria innocua, 4.45 ± 0.11 log CFU/g for Listeria monocytogenes (1/2a), and 3.70 ± 0.22 log CFU/g for Listeria welshimeri. On days 0, 1, and 2, all bacterial counts were reduced to nondetectable levels for shrimp samples that floated. The average time for shrimp to float was 96 ± 8 s. The bacterial counts remained at nondetectable levels (<10 log CFU/g) during refrigerated (4°C) storage of cooked shrimp for 2 days. The redness, yellowness, and lightness were significantly higher (P < 0.0001) for the cooked shrimp than for the uncooked shrimp on all days tested. The standard deviation for redness in the cooked shrimp was large, indicating a wide range of pink coloration on all days tested. The results suggest that boiling shrimp until they float will significantly reduce Listeria and Salmonella contamination, but color change is not a good

  5. Shrimp quality and safety management along the supply chain in Benin

    OpenAIRE

    Dabade, D.S.

    2015-01-01

    Abstract This thesis focuses on quality and safety management of tropical shrimp (Penaeus spp.) using Benin (West Africa) as an example of a shrimp exporting country. The entire supply chain, from fishing areas (brackish waters) to shrimp processing plants, was investigated. The steps of the chain prior to shrimp processing at the freezer plants were critical for shrimp quality and safety because of prevailing temperature abuse and inappropriate hygienic conditions. Combining culture-dependen...

  6. Impacts of Shrimp Farming on the Socioeconomic and Environmental Conditions in the Coastal Regions of Bangladesh

    OpenAIRE

    Islam, M S; M. Serajul Islam; Wahab, M.A.; A.A. Miah; A.H.M. Mustafa Kamal

    2003-01-01

    The study was carried out to analyze the comparative economic returns of alternate shrimp-crop farming and to assess the socioeconomic and environmental impacts of shrimp farming in coastal areas of Bangladesh. Shrimp farmers as well as other groups of people such as land lessors, shrimp farm labourers and shrimp seed collectors directly benefited and affected were randomly selected for the study. Accordingly, an appropriate number of all these sample households were selected from four differ...

  7. Risk associated with toxic blooms of marine phytoplankton functional groups on Artemia franciscana

    Institute of Scientific and Technical Information of China (English)

    Ana Dors; Mara Carmen Bartolom; Sebastin Snchez-Fortn

    2014-01-01

    Objective:To study mortality of copepod Artemia franciscana against the occurrence of harmful marine algae and possible toxicological changes exhibited by binary and tertiary combinations of these harmful algae toxins. Methods:Tweenty four hours acute toxicity assays were performed with selected concentrations of Alexandrium minutum, Prorocentrum lima and Nitzschia N1c1 living cells. Additionally, the results were analyzed using the median-effect/combination index (CI)-isobologram equation to assess possible changes in the toxic effect induced by phytoplankton functional groups. Results:Biotoxin equivalent values obtained by immunodetection were (2.12±0.10), (8.60±1.30) and (4.32±1.67) pg/cell for saxitoxin, okadaic acid and domoic acid, respectively. The 24-h LC50 values estimated to saxitoxin and okadaic acid equivalents were 4.06 and 6.27 µg/L, significantly below the value obtained for Nitzschia N1c1, which was established at 467.33 µg/L. CI analysis applied on phytoplankton assemblages showed that both ternary mixture as the binary combinations exhibited antagonic action on toxic effects in Artemia nauplii, which were significantly lower than the toxic effect exhibited by each species studied. Conclusions:These results show that, although these harmful algae represent a serious risk to estuarine zooplankton community, the presence of phytoplankton functional groups within the same bloom can reduce the potential risk compared to the expected risk when each of the phytoplankton groups are evaluated individually.

  8. Involvement of cyclin K posttranscriptional regulation in the formation of Artemia diapause cysts.

    Directory of Open Access Journals (Sweden)

    Yang Zhao

    Full Text Available BACKGROUND: Artemia eggs tend to develop ovoviviparously to yield nauplius larvae in good rearing conditions; while under adverse situations, they tend to develop oviparously and encysted diapause embryos are formed instead. However, the intrinsic mechanisms regulating this process are not well understood. PRINCIPAL FINDING: This study has characterized the function of cyclin K, a regulatory subunit of the positive transcription elongation factor b (P-TEFb in the two different developmental pathways of Artemia. In the diapause-destined embryo, Western blots showed that the cyclin K protein was down-regulated as the embryo entered dormancy and reverted to relatively high levels of expression once development resumed, consistent with the fluctuations in phosphorylation of position 2 serines (Ser2 in the C-terminal domain (CTD of the largest subunit (Rpb1 of RNA polymerase II (RNAP II. Interestingly, the cyclin K transcript levels remained constant during this process. In vitro translation data indicated that the template activity of cyclin K mRNA stored in the postdiapause cyst was repressed. In addition, in vivo knockdown of cyclin K in developing embryos by RNA interference eliminated phosphorylation of the CTD Ser2 of RNAP II and induced apoptosis by inhibiting the extracellular signal-regulated kinase (ERK survival signaling pathway. CONCLUSIONS/SIGNIFICANCE: Taken together, these findings reveal a role for cyclin K in regulating RNAP II activity during diapause embryo development, which involves the post-transcriptional regulation of cyclin K. In addition, a further role was identified for cyclin K in regulating the control of cell survival during embryogenesis through ERK signaling pathways.

  9. Feeding adult of Artemia salina (Crustacea-Branchiopoda on the dinoflagellate Gyrodinium corsicum (Gymnodiniales and the Chryptophyta Rhodomonas baltica

    Directory of Open Access Journals (Sweden)

    Rauquírio André Albuquerque Marinho da Costa

    2005-07-01

    Full Text Available Experiments were carried out on feeding performance and survival rates of adult Artemia salina exposed to no axenic strains of the dinoflagellate Gyrodinium corsicum and of the Chryptophyta Rhodomonas baltica. Filtration rates on R. baltica and G. corsicum varied from 3.35 to 7.14 ml.artemia-1.h-1 and from 2.97 to 15.86 ml.artemia-1.h-1, respectively. The ingestion rates observed for A. salina did not indicate any digestive dysfunction or physiological impairment for organisms fed on G. corsicum and their functional response were similar to those observed for other organisms like copepod fed on different food concentrations. Mortality rates oscillated from 2.5% to 100% when A. salina was fed on R. baltica or G. corsicum, respectively. Highest mortality rates observed for organisms fed on G. corsicum indicated that this dinoflagellate presented a hazard effect on A. salina that was not possible to confirm if it was related to toxin production or to nutritive inadequacy of this dinoflagellate as food for organisms of this species.Experimentos foram desenvolvidos para estudar as taxas de alimentação e de sobrevivência de Artemia salina alimentada com cepas não tóxicas do dinoflagelado Gyrodinium corsicum e da Chryptophyta Rhodomonas baltica. As taxas de filtração sobre R. baltica e G. corsicum variaram entre 3,35 e 7,14 ml.artemia-1.h-1 e 2,97 e 15,86 ml.artemia-1.h-, respectivamente. As taxas de ingestão observadas para A. salina não indicaram disfunção digestiva ou prejuízo fisiológico nos organismos alimentados com G. corsicum, sendo a resposta funcional destes organismos similar a observada em copépodos alimentados com diferentes concentrações de alimento. As taxas de mortalidade de A. salina oscilaram entre 2,5 e 100% quando alimentada com R. baltica e G. corsicum, respectivamente. As maiores taxas de mortalidade observadas para os organismos alimentados com G. corsicum indicam que este dinoflagelado apresenta algum efeito

  10. Brine: a computer program to compute brine migration adjacent to a nuclear waste canister in a salt repository

    International Nuclear Information System (INIS)

    This report presents a mathematical model used to predict brine migration toward a nuclear waste canister in a bedded salt repository. The mathematical model is implemented in a computer program called BRINE. The program is written in FORTRAN and executes in the batch mode on a CDC 7600. A description of the program input requirements and output available is included. Samples of input and output are given

  11. Beyond symbiosis: cleaner shrimp clean up in culture.

    Science.gov (United States)

    Militz, Thane A; Hutson, Kate S

    2015-01-01

    Cleaner organisms exhibit a remarkable natural behaviour where they consume ectoparasites attached to "client" organisms. While this behaviour can be utilized as a natural method of parasitic disease control (or biocontrol), it is not known whether cleaner organisms can also limit reinfection from parasite eggs and larvae within the environment. Here we show that cleaner shrimp, Lysmata amboinensis, consume eggs and larvae of a harmful monogenean parasite, Neobenedenia sp., in aquaculture. Shrimp consumed parasite eggs under diurnal (63%) and nocturnal (14%) conditions as well as infectious larvae (oncomiracidia) diurnally (26%). Furthermore, we trialled the inclusion of cleaner shrimp for preventative parasite management of ornamental fish, Pseudanthias squamipinnis, and found shrimp reduced oncomiracidia infection success of host fish by half compared to controls (held without shrimp). Fish held without cleaner shrimp exhibited pigmentation changes as a result of infection, possibly indicative of a stress response. These results provide the first empirical evidence that cleaner organisms reduce parasite loads in the environment through non-symbiotic cleaning activities. Our research findings have relevance to aquaculture and the marine ornamental trade, where cleaner shrimp could be applied for prophylaxis and control of ectoparasite infections. PMID:25706952

  12. Prediction of shelled shrimp weight by machine vision

    Institute of Scientific and Technical Information of China (English)

    Peng-min PAN; Jian-ping LI; Gu-lai LV; Hui YANG; Song-ming ZHU; Jian-zhong LOU

    2009-01-01

    The weight of shelled shrimp is an important parameter for grading process. The weight prediction of shelled shrimp by contour area is not accurate enough because of the ignorance of the shrimp thickness. In this paper, a multivariate prediction model containing area, perimeter, length, and width was established. A new calibration algorithm for extracting length of shelled shrimp was proposed, which contains binary image thinning, branch recognition and elimination, and length reconstruction, while its width was calculated during the process of length extracting. The model was further validated with another set of images from 30 shelled shrimps. For a comparison purpose, artificial neural network (ANN) was used for the shrimp weight predication. The ANN model resulted in a better prediction accuracy (with the average relative error at 2.67%), but took a tenfold increase in calculation time compared with the weight-area-perimeter (WAP) model (with the average relative error at 3.02%). We thus conclude that the WAP model is a better method for the prediction of the weight of shelled red shrimp.

  13. Evaluation of brine disposal from the Bryan Mound Site of the Strategic Petroleum Reserve Program. Final report of predisposal studies. Chapter 4. Appendix 7

    Energy Technology Data Exchange (ETDEWEB)

    Hann, Jr, Roy W.; Randall, Robert E. [eds.

    1981-02-01

    This report describes nekton communities off Freeport, Texas prior to brine disposal based on trawl studies in the period October 1977 to February 1980. Trawling was conducted aboard chartered commercial shrimp trawlers along a transect in depths of 3 to 25 fathoms to describe the general background of nekton communities off Freeport. An array of stations were occupied at the diffuser site in 12 fathoms of water to describe in detail nekton communities near the diffuser. Collections at each station, in general, were made once a month during the day and once a month at night, cruises being about two weeks apart in time. Projected diffuser locations, stations occupied, etc., changed during the course of the project, and the Materials and Methods (Section 4.2) should be consulted for details.

  14. Prospecção fitoquímica de Sonchus oleraceus e sua toxicidade sobre o microcrustáceo Artemia salina Phytochemical prospecting of Sonchus oleraceus and its toxicity to Artemia salina

    Directory of Open Access Journals (Sweden)

    J.M. Lima

    2009-03-01

    Full Text Available A espécie vegetal Sonchus oleraceus é uma planta daninha presente em diversas culturas no Brasil e de utilização na medicina popular. Neste trabalho, realizou-se a prospecção fitoquímica dessa espécie com extratos em etanol, água e diclorometano, bem como testes de toxicidade sobre o microcrustáceo Artemia salina. O extrato aquoso apresentou em sua composição açúcares redutores, compostos fenólicos, taninos, flavonóides e cumarinas. No extrato etanólico, observaram-se os mesmos compostos qualificados no extrato aquoso, com exceção de cumarinas. Em diclorometano, verificou se a presença de saponinas, derivados triterpênicos e esteróides. No teste de toxicidade sobre Artemia salina, os dados convergiram para frações de extrato aquoso de 5.117,2 ppm, indicando ser um extrato de baixa toxicidade.Sonchus oleraceus is a common weed in Brazil, also used as a medicinal plant. Phytochemical prospecting of this species was carried out in this work using extracts obtained in ethanol, water and dichloromethane. A toxicity study of the aqueous extract was also conducted, using the micro crustaceous Artemia salina. The aqueous extract presented sugar reducers, phenolic compounds, tannins, flavonoids and coumarins in its composition. The compounds found in the aqueous extract were also detected in the ethanol extract, except for the coumarins. Saponin, triterpenes and steroids were identified in the dichloromethane extract. The toxicity test on Artemia salina pointed to aqueous extract fractions of 5,117.2 ppm, indicative of low toxicity.

  15. Determination of Contamination Profiles of Human Bacterial Pathogens in Shrimp Obtained from Java, Indonesia

    International Nuclear Information System (INIS)

    Shrimp continues to be an important export commodity for Indonesia and contributed significantly to the country’s revenue. However, shrimp exports have been frequently rejected by importing countries due to filth, Salmonella and insanitary conditions. This study was conducted to evaluate the profiles of bacterial contamination of ocean and aquaculture shrimp obtained from the area of West, Central and East Java; frozen shrimp and shrimp during industry production of frozen shrimp. The study indicated that both ocean and aquaculture shrimp obtained from the study area were heavily contaminated. On the average, shrimp obtained from West Java were more contaminated than those obtained from East and Central Java. The total bacterial counts were generally higher in ocean shrimp than those of aquaculture ones. Salmonella was present in two of 32 samples of ocean shrimp and in four of 32 samples of aquaculture shrimp obtained from the study area. Vibrio cholerae was not detected in shrimp from West Java, but was found in three out of 16 samples obtained from East and Central Java. V. parahaemolyticus was frequently identified in aquaculture shrimp but absent in fresh ocean shrimp. Studies on shrimp collected from six sampling points during frozen shrimp production revealed that processing will reduce the number of total bacterial, E. coli, and Staphylococal counts. However, the processing did not effectively reduce the incidence of Salmonella or V. parahaemolyticus when the raw material has been contaminated with the pathogens. Sizing and grading as well as arrangement of shrimp before freezing were considered as the critical points where bacteria should be controlled to inhibit growth and cross contamination with bacteria such as Listeria. Implementation of Good Agricultural Practices in production of raw shrimp as well as Hazard Analysis Critical Control Point at the line processing are expected to improve the quality of fresh and frozen shrimp. (author)

  16. Effects of brine migration on waste storage systems. Final report

    International Nuclear Information System (INIS)

    Processes which can lead to mobilization of brine adjacent to spent fuel or nuclear waste canisters and some of the thermomechanical consequences have been investigated. Velocities as high as 4 x 10-7 m s-1 (13 m y-1) are calculated at the salt/canister boundary. As much as 40 liters of pure NaCl brine could accumulate around each canister during a 10-year storage period. Accumulations of bittern brines would probably be less, in the range of 2 to 5 liters. With 0.5% water, NaCl brine accumulation over a 10-year storage cycle around a spent fuel canister producing 0.6 kW of heat is expected to be less than 1 liter for centimeter-size inclusions and less than 0.5 liter for millimeter-size inclusions. For bittern brines, about 25 years would be required to accumulate 0.4 liter. The most serious mechanical consequence of brine migration would be the increased mobility of the waste canister due to pressure solution. In pressure solution enhanced deformation, the existence of a thin film of fluid either between grains or between media (such as between a canister and the salt) provides a pathway by which the salt can be redistributed leading to a marked increase in strain rates in wet rock relative to dry rock. In salt, intergranular water will probably form discontinuous layers rather than films so that they would dominate pressure solution. A mathematical model of pressure solution indicates that pressure solution will not lead to appreciable canister motions except possibly in fine grained rocks (less than 10-4 m). In fine grained salts, details of the contact surface between the canister and the salt bed may lead to large pressure solution motions. A numerical model indicates that heat transfer in the brine layer surrounding a spent fuel canister is not conduction dominated but has a significant convective component

  17. 卤虫属分类研究进展%Progress on Researches of Taxonomy on Genus Artemia

    Institute of Scientific and Technical Information of China (English)

    张伟峰; 郝浩永; 陈莉

    2008-01-01

    卤虫(Anemia)属于节肢动物门(Phylum Arthropoda),甲壳纲(Class Crustacea),鳃足亚纲(SubclassBranchiopoda),无甲目(Order Anostraca),卤虫科(Family Artemidae).世界卤虫根据生殖方式可分为两性生殖卤虫和孤雌生殖卤虫两大类.利用生殖隔离实验将世界两性卤虫分为8个种:Anemiafranciscana Kellogg、Artemia persimilis Piccinelli et Prosdoeimi、Anemia rnonica Verrill、Anemia salina Linnaeus、Artemia urmianaGünther、Anemia tunisiana Bowen et Sterling、Anemia sinica Cai和Anemia tibetiana Abatzopouios,Zhang et Sorge-loos.其中,我国发现有A.sinica和A.tibetiana两种两性卤虫.孤雌生殖卤虫统称为Artemia parthenogenetica,并在其后加上产地的地名以示区别.

  18. Effects of a brine discharge over soft bottom Polychaeta assemblage

    Energy Technology Data Exchange (ETDEWEB)

    Pilar-Ruso, Yoana del [Dpto. de Ciencias del Mar y Biologia Aplicada, Universidad de Alicante, Campus de San Vicente del Raspeig, Ap. 99, E-03080, Alicante (Spain)], E-mail: yoana.delpilar@ua.es; Ossa-Carretero, Jose Antonio de la; Gimenez-Casalduero, Francisca; Sanchez-Lizaso, Jose Luis [Dpto. de Ciencias del Mar y Biologia Aplicada, Universidad de Alicante, Campus de San Vicente del Raspeig, Ap. 99, E-03080, Alicante (Spain)

    2008-11-15

    Desalination is a growing activity that has introduced a new impact, brine discharge, which may affect benthic communities. Although the role of polychaetes as indicators to assess organic pollution is well known, their tolerance to salinity changes has not been examined to such a great extent. The aim of this study was to examine the effect of brine discharge over soft bottom polychaete assemblage along the Alicante coast (Southeast Spain) over a two year period. Changes in the polychaete assemblage was analysed using univariate and multivariate techniques. We compared a transect in front of the discharge with two controls. At each transect we sampled at three depths (4, 10 and 15 m) during winter and summer. We have observed different sensitivity of polychaete families to brine discharges, Ampharetidae being the most sensitive, followed by Nephtyidae and Spionidae. Syllidae and Capitellidae showed some resistance initially, while Paraonidae proved to be a tolerant family. - The Polychaete assemblage is affected by the brine discharge of the Alicante desalination plant and we detect different sensitivity levels in polychaete families to brine impact.

  19. Chemistry of glass corrosion in high saline brines

    International Nuclear Information System (INIS)

    Corrosion data obtained in laboratory tests can be used for the performance assessment of nuclear waste glasses in a repository if the data are quantitatively described in the frame of a geochemical model. Experimental data were obtained for conventional pH values corrected for liquid junction, amorphous silica solubility and glass corrosion in concentrated salt brines. The data were interpreted with a geochemical model. The brine chemistry was described with the Pitzer formalism using a data base which allows calculation of brine compositions in equilibrium with salt minerals at temperatures up to 200C. In MgCl2 dominated brines Mg silicates form and due to the consumption of Mg the pH decreases with proceeding reaction. A constant pH (about 4) and composition of alteration products is achieved, when the alkali release from the glass balances the Mg consumption. The low pH results in high release of rare earth elements REE (rare earth elements) and U from the glass. In the NaCl dominated brine MgCl2 becomes exhausted by Mg silicate formation. As long as there is still Mg left in solution the pH decreases. After exhaustion of Mg the pH rises with the alkali release from the glass and analcime is formed

  20. COMPARISON OF CARBON AND NITROGEN FLUXES IN TIDEFLAT FOOD WEBS DOMINATED BY BURROWING SHRIMP OR BY CULTURED OYSTERS

    Science.gov (United States)

    Two species of indigenous, thalassinid burrowing shrimps are pests to the benthic culture of Pacific oysters (Crassostrea gigas) because deposition of sediment excavated by the shrimps buries or smothers the oysters. Carbaryl pesticide is used to reduce burrowing shrimp densitie...