WorldWideScience

Sample records for brilliant green agar

  1. Immediate differentiation of salmonella-resembling colonies on brilliant green agar

    DEFF Research Database (Denmark)

    Jensen, Annette Nygaard; Hoorfar, Jeffrey

    2000-01-01

    A rapid biochemical system (OBIS) based on immediate enzymatic differentiation of Citrobacter, Proteus, Providencia, Hafnia and Morganella spp. from Salmonella on brilliant green agar was evaluated A total of 96 field isolates from various Salmonella serotypes, 18 Citrobacter freundii and 25...

  2. A comparison of EF-18 agar and modified brilliant green agar with lutensit for isolation of Salmonella from poultry samples

    DEFF Research Database (Denmark)

    Petersen, Line Hedegård

    1997-01-01

    -Vassiliadis broth, and 3) Plating onto EF-18 agar and BGA/L simultaneously. From a total of 1101 samples, Salmonella was isolated from 158, 157 of which were faecal samples. Thirtyone of these isolates were recovered on one medium only, 18 could not be found on BGA/L and 13 could not be found on EF-18 agar....... The relative specificity and sensitivity of each plating agar was determined by enumeration of false-positive and false-negative reactions. EF-18 agar compared favourably with BGA/L, displaying a sensitivity of 0.92 as opposed to 0.89 for BGA/L, calculated for the ''fecal samples'' group only. The calculated...... specificities for each group of samples were likewise considerably higher for EF-18 agar (0.75-0.91) than for BGA/L (0.35-0.55). Though EF-18 agar is slightly more expensive than BGA/L, the routine use of the former may result in a considerable reduction in overall laboratory costs due to its superior...

  3. of Brilliant Green

    Directory of Open Access Journals (Sweden)

    Rana Seyrani

    2016-01-01

    Full Text Available Novel hydrogel nanocomposites, based on κ-carrageenan polysaccharide, were prepared by graft copolymerization of acrylamide (AAM and maleic anhydride (MAH as comonomers in the presence of multiwall carbon nanotubes (MWCNT, using methylene bisacrylamide (MBA and ammonium persulfate (APS,former as a crosslinking agent and the latter as an initiator. The hydrogel nanocomposites structure was characterized by FTIR spectroscopy, scanning electron microscopy (SEM and XRD patterns, and their thermal stability was investigated by TGA thermal analysis. The hydrogel nanocomposites were evaluated using gel content measurements and swelling rate in distilled water and in saline solutions. The carbon nanotube content was examined in relation to its effect on the properties of nanocomposites. The results showed that with increasing carbon nanotube content, the rate of water absorbency and equilibrium swelling in distilled water decreased whereas the water absorbency in the saline solutions increased. Water retention capacity was also studied and the results indicated that the inclusion of carbon nanotube increased water retention under heating condition. Furthermore, the experimental conditions of adsorption kinetics and dynamics for the removal of cationic dye, Brilliant Green (BG, were studied in the range of 6-8 for pH, 10-60 min for time (t, and 10-300 mg/L for initial concentration (C0 of the dye. The optimum conditions obtained for adsorption of Brilliant Green dye were pH 7, t= 50 min and C0= 10 mg/L. Also, the results indicated that more than 98% of the maximum adsorption capacity toward Brilliant Green dye was achieved within the initial 10 min. The experimental tests showed that the hydrogels could be used as fast–responsive and high capacity sorbents in Brilliant Green removal processes from industrial waste water.

  4. Adsorption characteristics of brilliant green dye on kaolin

    International Nuclear Information System (INIS)

    Nandi, B.K.; Goswami, A.; Purkait, M.K.

    2009-01-01

    Experimental investigations were carried out to adsorb toxic brilliant green dye from aqueous medium using kaolin as an adsorbent. Characterization of kaolin is done by measuring: (i) particle size distribution using particle size analyzer, (ii) BET surface area using BET surface analyzer, and (iii) structural analysis using X-ray diffractometer. The effects of initial dye concentration, contact time, kaolin dose, stirring speed, pH and temperature were studied for the adsorption of brilliant green in batch mode. Adsorption experiments indicate that the extent of adsorption is strongly dependent on pH of solution. Free energy of adsorption (ΔG 0 ), enthalpy (ΔH 0 ) and entropy (ΔS 0 ) changes are calculated to know the nature of adsorption. The calculated values of ΔG 0 at 299 K and 323 K indicate that the adsorption process is spontaneous. The estimated values of ΔH 0 and ΔS 0 both show the negative sign, which indicate that the adsorption process is exothermic and the dye molecules are organized on the kaolin surface in less randomly fashion than in solution. The adsorption kinetic has been described by first-order, pseudo-second-order and intra-particle-diffusion models. It was observed that the rate of dye adsorption follows pseudo-second-order model for the dye concentration range studied in the present case. Standard adsorption isotherms were used to fit the experimental equilibrium data. It was found that the adsorption of brilliant green on kaolin follows the Langmuir adsorption isotherm

  5. Decolorization of brilliant green dye using immersed lamp sonophotocatalytic reactor

    Science.gov (United States)

    Gole, Vitthal L.; Priya, Astha; Danao, Sanjay P.

    2017-12-01

    The textile and dye industries require an enormous amount of water for processing and produce a large volume of wastewater. Generated wastewater had potential hazards and a threat to the aquatic biota. The present work investigates the decolorization of brilliant green dye using a combination of two advanced oxidation techniques viz sonocatalysis and photocatalysis (immersed lamp) known as sonophotocatalysis (3 L capacity). The efficiency of decolorization is further improved in the presence of various additives viz. copper oxide, zinc oxide, and sodium chloride. The maximum decolorization of brilliant green (BG) (94.8% in 120 min) obtained in the presence of zinc oxide. The total organic carbon of the treated samples was measured to monitor complete mineralization of BG. The sonophotocatalytic process (in the presence of zinc oxide) shows maximum mineralization. Synergic combination of two oxidation processes increased the production of oxidizing radicals. Continuous cleaning of catalyst surface (due to sonolysis effect) improves the activity of the catalyst for photolysis operation. The present work is highly useful for the development of a sonophotocatalytic process.

  6. Gamma Radiolysis Studies of Aqueous Solution of Brilliant Green Dye

    Directory of Open Access Journals (Sweden)

    D. V. Parwate

    2011-01-01

    Full Text Available The effect of γ–radiation on colour intensity of aqueous solution of Brilliant Green has been investigated at two different concentrations. The degradation of Brilliant Green (BG has also been investigated in presence of suspended ZnO, by adding different amounts of ZnO. Simultaneously the conductance and pH of each solution system were measured before and after γ-irradiation. All the γ–irradiations were performed at a dose rate of 0.60 kGyhr-1 in GC-900. The maximum dose required for the complete degradation of the dye was found to be 0.39 kGy. G(-dye values were found to decrease with increase in gamma dose and were in the range 4.26 - 12.81. The conductance (7.6 - 25.3 μS and pH values increased marginally with dose for both the concentrations. The rate of decolouration was found to be high at lower doses and the efficiency of dye removal was higher at low concentration of the dye. This may be attributed to the presence of reaction by-products from the destruction of parent compound build up and compete for reaction intermediate species. The rate of reaction and rate constants were calculated and it was found that the degradation reaction follows first order kinetics. It was found that the decolouration percentage was more in dye systems in absence of ZnO.

  7. Effects of operational parameters on the removal of brilliant green dye from aqueous solutions by electrocoagulation

    Directory of Open Access Journals (Sweden)

    Barun Kumar Nandi

    2017-05-01

    Full Text Available This paper presents an experimental study on the removal of brilliant green dye from aqueous solutions in a batch stirred electrocoagulation (EC reactor using iron electrodes. The main objectives of the experiments were to investigate the effects of the various operating parameters, such as current density, inter electrode distance, initial dye concentration, pH of the solution, EC duration and salt (NaCl concentrations on the brilliant green dye removal efficiency from synthetic wastewater containing in batch EC process. The experimental results showed that 99.59% dye removal was observed for initial dye concentration of 100 mg/L with current density of 41.7 A/m2, initial pH of 4.0 at the end of 30 min of operation. It was observed that, an increase in current density, time of operation and decrease in inter electrode distance improved the dye removal efficiency. Optimum pH for highest dye removal was 4.0–10.0. It was also observed that increase in salt (NaCl concentration in the solution reduces the specific electrical energy consumption (SEEC.

  8. Brilliant Green Dye Elimination from Water Using Psidium guajava Leaves and Solanum tuberosum Peels as Adsorbents in Environmentally Benign Way

    Directory of Open Access Journals (Sweden)

    Rabia Rehman

    2015-01-01

    Full Text Available The aim of this study is to check the feasibility of Psidium guajava (Guava leaves and peels of Solanum tuberosum (Potato as biosorbents in removal of Brilliant Green (BG in batch mode. Surface analysis of biosorbents was done by FT-IR and quantitatively analyzed by Boehm titration. The removal of dye was confirmed by UV-VIS spectroscopy. Isothermal modeling was studied by using Langmuir, Freundlich, and Temkin isotherms. Various isothermal parameters for adsorption of Brilliant Green such as qm=1.075 mg/g, 1.173 mg/g ΔG°=-3.397, and −2.397 KJ/mol were noted for Solanum tuberosum peels (PP and Psidium guajava leaves (GL, respectively. Similarly pH, moisture content, and various metals were quantitatively analyzed. Results showed that leaves of Psidium guajava were more effective for removal of Brilliant Green.

  9. Antiviral activity of gliotoxin, gentian violet and brilliant green against Nipah and Hendra virus in vitro

    Directory of Open Access Journals (Sweden)

    Meyer Adam G

    2009-11-01

    Full Text Available Abstract Background Using a recently described monolayer assay amenable to high throughput screening format for the identification of potential Nipah virus and Hendra virus antivirals, we have partially screened a low molecular weight compound library (>8,000 compounds directly against live virus infection and identified twenty eight promising lead molecules. Initial single blind screens were conducted with 10 μM compound in triplicate with a minimum efficacy of 90% required for lead selection. Lead compounds were then further characterised to determine the median efficacy (IC50, cytotoxicity (CC50 and the in vitro therapeutic index in live virus and pseudotype assay formats. Results While a number of leads were identified, the current work describes three commercially available compounds: brilliant green, gentian violet and gliotoxin, identified as having potent antiviral activity against Nipah and Hendra virus. Similar efficacy was observed against pseudotyped Nipah and Hendra virus, vesicular stomatitis virus and human parainfluenza virus type 3 while only gliotoxin inhibited an influenza A virus suggesting a non-specific, broad spectrum activity for this compound. Conclusion All three of these compounds have been used previously for various aspects of anti-bacterial and anti-fungal therapy and the current results suggest that while unsuitable for internal administration, they may be amenable to topical antiviral applications, or as disinfectants and provide excellent positive controls for future studies.

  10. Decolorization of synthetic brilliant green carpet industry dye through fungal co-culture technology.

    Science.gov (United States)

    Kumari, Simpal; Naraian, Ram

    2016-09-15

    Aim of the present study was to evaluate the efficiency of fungal co-culture for the decolorization of synthetic brilliant green carpet industry dye. For this purpose two lignocellulolytic fungi Pleurotus florida (PF) and Rhizoctonia solani (RS) were employed. The study includes determination of enzyme profiles (laccase and peroxidase), dye decolorization efficiency of co-culture and crude enzyme extracts. Both fungi produced laccase and Mn peroxidase and successfully decolorized solutions of different concentrations (2.0, 4.0, 6.0, & 8.0(w/v) of dye. The co-culture resulted highest 98.54% dye decolorization at 2% (w/v) of dye as compared to monocultures (82.12% with PF and 68.89% with RS) during 12 days of submerged fermentation. The lower levels of dyes were rapidly decolorized, while higher levels in slow order as 87.67% decolorization of 8% dye. The promising achievement of the study was remarkable decolorizing efficiency of co-culture over monocultures. The direct treatment of the mono and co-culture enzyme extracts to dye also influenced remarkable. The highest enzymatic decolorization was through combined (PF and RS) extracts, while lesser by monoculture extracts. Based on the observations and potentiality of co-culture technology; further it can be exploited for the bioremediation of areas contaminated with hazardous environmental pollutants including textile and other industry effluents. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Toxicity profiles of subretinal indocyanine green, Brilliant Blue G, and triamcinolone acetonide: a comparative study

    DEFF Research Database (Denmark)

    Ejstrup, Rasmus; Dornonville de la Cour, Morten; Heegaard, Steffen

    2012-01-01

    BACKGROUND: This study introduces a novel porcine model to examine the histopathological and electrophysiological consequences of retinotoxicity exerted by dyes commonly used for internal limiting membrane (ILM) staining. METHODS: Indocyanine green (ICG) 0.5 mg/ml, Brilliant Blue G (BBG) 0.25 mg....../ml and triamcinolone acetonide (TA) 13 mg/ml was injected subretinally in 12 vitrectomized pig eyes. At 6 weeks, retinas were examined by multifocal electroretinography (mfERG), ophthalmoscopy, fluorescein angiograpy, histopathology, and apoptosis assay. RESULTS: mfERG responses were significantly lower in ICG......-injected eyes than in healthy fellow eyes (p¿=¿0.039). The ratio between injected eyes and healthy fellow eyes was lower in the ICG group than in the BBG (p¿=¿0.009) and TA group (p¿=¿0.025). No difference between BBG and TA existed. All retinas were reattached, and fluorescein angiographies showed a window...

  12. Process Studies on Laser Welding of Copper with Brilliant Green and Infrared Lasers

    Science.gov (United States)

    Engler, Sebastian; Ramsayer, Reiner; Poprawe, Reinhart

    Copper materials are classified as difficult to weld with state-of-the-art lasers. High thermal conductivity in combination with low absorption at room temperature require high intensities for reaching a deep penetration welding process. The low absorption also causes high sensitivity to variations in surface conditions. Green laser radiation shows a considerable higher absorption at room temperature. This reduces the threshold intensity for deep penetration welding significantly. The influence of the green wavelength on energy coupling during heat conduction welding and deep penetration welding as well as the influence on the weld shape has been investigated.

  13. Process Studies on Laser Welding of Copper with Brilliant Green and Infrared Lasers

    OpenAIRE

    Engler, Sebastian; Ramsayer, Reiner; Poprawe, Reinhart

    2011-01-01

    Copper materials are classified as difficult to weld with state-of-the-art lasers. High thermal conductivity in combination with low absorption at room temperature require high intensities for reaching a deep penetration welding process. The low absorption also causes high sensitivity to variations in surface conditions. Green laser radiation shows a considerable higher absorption at room temperature. This reduces the threshold intensity for deep penetration welding significantly. The influen...

  14. Simultaneous studies on solar energy storage by CO2 reduction to HCOOH with Brilliant Green dye removal photoelectrochemically

    Directory of Open Access Journals (Sweden)

    V.S.K. Yadav

    2016-12-01

    Full Text Available The simultaneous study on photoelectrochemical CO2 reduction with Brilliant Green (BG dye removal was studied in the present work. Experimental studies were done in aqueous solutions of sodium and potassium based electrolytes using a cathode [Zinc (Zn and Tin (Sn] and a common cobalt oxide (Co3O4 anode electrocatalyst. The influence of reaction with electrolyte concentration for the both catalysts was shown clearly with respect to time. The selected electrocatalysts were able to reduce CO2 to formic acid (HCOOH along with high BG dye removal. With Sn as cathode, the maximum BG dye removal was obtained to be KHCO3–[95.9% (10 min–0.2 M], NaHCO3–[98.6% (15 min–0.6 M]. Similarly for Zn, KHCO3–[99.8% (10 min–0.4 M], NaHCO3–[99.9% (20 min–0.8 M] were observed respectively. Finally, the results have proven that higher efficiencies for BG dye removal were obtained along with HCOOH formation, which might be a better alternate for water purification and to decrease the atmospheric CO2 concentrations.

  15. New CNT/poly(brilliant green) and CNT/poly(3,4-ethylenedioxythiophene) based electrochemical enzyme biosensors.

    Science.gov (United States)

    Barsan, Madalina M; Pifferi, Valentina; Falciola, Luigi; Brett, Christopher M A

    2016-07-13

    A combination of the electroactive polymer poly(brilliant green) (PBG) or conducting polymer poly(3,4-ethylenedioxythiophene) (PEDOT) with carbon nanotubes to obtain CNT/PBG and CNT/PEDOT modified carbon film electrodes (CFE) has been investigated as a new biosensor platform, incorporating the enzymes glucose oxidase (GOx) as test enzyme, alcohol oxidase (AlcOx) or alcohol dehydrogenase (AlcDH). The sensing parameters were optimized for all biosensors based on CNT/PBG/CFE, CNT/PEDOT/CFE platforms. Under optimized conditions, both GOx biosensors exhibited very similar sensitivities, while in the case of AlcOx and AlcDH biosensors, AlcOx/CNT/PBG/CFE was found to give a higher sensitivity and lower detection limit. The influence of dissolved O2 on oxidase-biosensor performance was investigated and was shown to be different for each enzyme. Comparisons were made with similar reported biosensors, showing the advantages of the new biosensors, and excellent selectivity against potential interferents was successfully demonstrated. Finally, alcohol biosensors were successfully used for the determination of ethanol in alcoholic beverages. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Isolation of nontuberculous mycobacteria from soil using Middlebrook 7H10 agar with increased malachite green concentration.

    Science.gov (United States)

    Hu, Yuli; Yu, Xinglong; Zhao, Dun; Li, Runcheng; Liu, Yang; Ge, Meng; Hu, Huican

    2017-12-01

    Environmental exposure is considered to be responsible for nontuberculous mycobacterial infections in humans. To facilitate the isolation of mycobacteria from soil, Middlebrook 7H10 agar was optimized as an enhanced selective medium by increasing the concentration of malachite green. A series of modified Middlebrook 7H10 agar media with malachite green concentrations ranging from 2.5 to 2500 mg/L was evaluated using 20 soil samples decontaminated with 3% sodium dodecyl sulfate plus 2% NaOH for 30 min. Among these modified Middlebrook 7H10 media, the medium with malachite green at a concentration of 250 mg/L, i.e., at the same concentration as in Löwenstein-Jensen medium, was the most effective in terms of the number of plates with mycobacterial growth. This medium was further evaluated with 116 soil samples. The results showed that 87.1% (101/116) of the samples produced mycobacterial growth, and 15 samples (12.9%) produced no mycobacterial growth. Of the plates inoculated with the soil samples, each in duplicate, 5.2% (12/232) showed late contamination. In total, 19 mycobacterial species were isolated, including seven (36.8%) rapidly growing mycobacteria and 12 (63.2%) slowly growing mycobacteria. Our results demonstrate that the modified Middlebrook 7H10 agar with 250 mg/L malachite green is useful for the primary isolation of nontuberculous mycobacteria from soil.

  17. A simple conductometric method for trace level determination of brilliant green in water based on β-cyclodextrin and silver nitrate and determination of their thermodynamic parameters

    Directory of Open Access Journals (Sweden)

    Roya Mohammad Zadeh Kakhki

    2014-12-01

    Full Text Available A gravimetric and complexometric titration method based on conductometric technique is presented for the quantitative determination of brilliant green (BG in water. The equilibrium constants and the thermodynamic parameters for the complex formation of β-cyclodextrin (β-CD with brilliant green (BG and precipitation of silver nitrate with BG have been determined by conductivity measurements in water. The results suggest that stable 1:1 complex is formed between BG and β-cyclodextrin and the thermodynamic parameters (ΔHc°,ΔSc° for this complexation reaction have been determined from temperature dependence of the stability constant using the van’t Hoff plots. Based on the obtained results, the conductometric method for the determination of BG in the presence of β-CD at 25 °C was developed in the range of 10−8–10−3 molL−1 and with AgNO3 is 10−3–10−5 molL−1.

  18. Green fabrication of agar-conjugated Fe{sub 3}O{sub 4} magnetic nanoparticles

    Energy Technology Data Exchange (ETDEWEB)

    Hsieh, S; Huang, B Y; Lin, P Y; Chang, C W [Department of Chemistry and Center for Nanoscience and Nanotechnology, National Sun Yat-sen University, Kaohsiung 80424, Taiwan (China); Hsieh, S L [Department of Seafood Science, National Kaohsiung Marine University, Kaohsiung 81157, Taiwan (China); Wu, C C [Department of Nutrition and Health Sciences, Chang Jung Christian University, Tainan 71101, Taiwan (China); Wu, C H [Department of Computer Science and Information Engineering, National University of Kaohsiung, Kaohsiung 80811, Taiwan (China); Huang, Y S, E-mail: shsieh@facmail.NSYSU.edu.tw [Department of Food Science and Technology, Tajen University, Pingtung 90741, Taiwan (China)

    2010-11-05

    Magnetic nanoparticles are of great interest both for fundamental research and emerging applications. In the biomedical field, magnetite (Fe{sub 3}O{sub 4}) has shown promise as a hyperthermia-based tumor therapeutic. However, preparing suitable solubilized magnetite nanoparticles is challenging, primarily due to aggregation and poor biocompatibility. Thus methods for coating Fe{sub 3}O{sub 4} NPs with biocompatible stabilizers are required. We report a new method for preparing Fe{sub 3}O{sub 4} nanoparticles by co-precipitation within the pores of agar gel samples. Permeated agar gels were then dried and ground into a powder, yielding agar-conjugated Fe{sub 3}O{sub 4} nanoparticles. Samples were characterized using XRD, FTIR, TGA, TEM and SQUID. This method for preparing agar-coated Fe{sub 3}O{sub 4} nanoparticles is environmentally friendly, inexpensive and scalable.

  19. Antiplasmodial activities of dyes against Plasmodium falciparum asexual and sexual stages: Contrasted uptakes of triarylmethanes Brilliant green, Green S (E142, and Patent Blue V (E131 by erythrocytes

    Directory of Open Access Journals (Sweden)

    Louis-Jérôme Leba

    2017-12-01

    Full Text Available The search for safe antimalarial compounds acting against asexual symptom-responsible stages and sexual transmission-responsible forms of Plasmodium species is one of the major challenges in malaria elimination programs. So far, among current drugs approved for human use, only primaquine has transmission-blocking activity. The discovery of small molecules targeting different Plasmodium falciparum life stages remains a priority in antimalarial drug research. In this context, several independent studies have recently reported antiplasmodial and transmission-blocking activities of commonly used stains, dyes and fluorescent probes against P. falciparum including chloroquine-resistant isolates. Herein we have studied the antimalarial activities of dyes with different scaffold and we report that the triarylmethane dye (TRAM Brilliant green inhibits the growth of asexual stages (IC50 ≤ 2 μM and has exflagellation-blocking activity (IC50 ≤ 800 nM against P. falciparum reference strains (3D7, 7G8 and chloroquine-resistant clinical isolate (Q206. In a second step we have investigated the antiplasmodial activities of two polysulfonated triarylmethane food dyes. Green S (E142 is weakly active against P. falciparum asexual stage (IC50 ≃ 17 μM whereas Patent Blue V (E131 is inactive in both antimalarial assays. By applying liquid chromatography techniques for the culture supernatant analysis after cell washings and lysis, we report the detection of Brilliant green in erythrocytes, the selective uptake of Green S (E142 by infected erythrocytes, whereas Patent Blue V (E131 could not be detected within non-infected and 3D7-infected erythrocytes. Overall, our results suggest that two polysulfonated food dyes might display different affinity with transporters or channels on infected RBC membrane. Keywords: Antimalarial dyes, Transmission blocking, Triarylmethanes, Drug uptake, Brilliant green, Food dyes

  20. Poly(brilliant green) and poly(thionine) modified carbon nanotube coated carbon film electrodes for glucose and uric acid biosensors.

    Science.gov (United States)

    Ghica, M Emilia; Brett, Christopher M A

    2014-12-01

    Poly(brilliant green) (PBG) and poly(thionine) (PTH) films have been formed on carbon film electrodes (CFEs) modified with carbon nanotubes (CNT) by electropolymerisation using potential cycling. Voltammetric and electrochemical impedance characterisation were performed. Glucose oxidase and uricase, as model enzymes, were immobilised on top of PBG/CNT/CFE and PTH/CNT/CFE for glucose and uric acid (UA) biosensing. Amperometric determination of glucose and UA was carried out in phosphate buffer pH 7.0 at -0.20 and +0.30 V vs. SCE, respectively, and the results were compared with other similarly modified electrodes existing in the literature. An interference study and recovery measurements in natural samples were successfully performed, indicating these architectures to be good and promising biosensor platforms. Copyright © 2014 Elsevier B.V. All rights reserved.

  1. Determination of residues of three triphenylmethane dyes and their metabolites (malachite green, leuco malachite green, crystal violet, leuco crystal violet, and brilliant green) in aquaculture products by LC/MS/MS: first action 2012.25.

    Science.gov (United States)

    Hurtaud-Pessel, Dominique; Couëdor, Pierrick; Verdon, Eric; Dowell, Dawn

    2013-01-01

    During the AOAC Annual Meeting held from September 30 to October 3, 2012 in Las Vegas, NV, the Expert Review Panel (ERP) on Veterinary Drug Residues reviewed data for the method for determination of residues of three triphenylmethane dyes and their metabolites (malachite green, leuco malachite green, crystal violet, leuco crystal violet, and brilliant green) in aquaculture products by LC/MS/MS, previously published in the Journal of Chromatography A 1218, 1632-1645 (2006). The method data were reviewed and compared to the standard method performance requirements (SMPRs) found in SMPR 2009.001, published in AOAC's Official Methods of Analysis, 19th Ed. (2012). The ERP determined that the data were acceptable, and the method was approved AOAC Official First Action. The method uses acetonitrile to isolate the analyte from the matrix. Then determination is conducted by LCIMS/MS with positive electrospray ionization. Accuracy ranged from 100.1 to 109.8% for samples fortified at levels of 0.5, 0.75, 1.0, and 2.0 microg/kg. Precision ranged from 2.0 to 10.3% RSD for the intraday samples and 1.9 to 10.6% for the interday samples analyzed over 3 days. The described method is designed to accurately operate in the analytical range from 0.5 to 2 microg/kg, where the minimum required performance limit for laboratories has been fixed in the European Union at 2.0 microg/kg for these banned substances and their metabolites. Upper levels of concentrations (1-100 microg/kg) can be analyzed depending on the different optional calibrations used.

  2. Antiplasmodial activities of dyes against Plasmodium falciparum asexual and sexual stages: Contrasted uptakes of triarylmethanes Brilliant green, Green S (E142), and Patent Blue V (E131) by erythrocytes.

    Science.gov (United States)

    Leba, Louis-Jérôme; Popovici, Jean; Estevez, Yannick; Pelleau, Stéphane; Legrand, Eric; Musset, Lise; Duplais, Christophe

    2017-12-01

    The search for safe antimalarial compounds acting against asexual symptom-responsible stages and sexual transmission-responsible forms of Plasmodium species is one of the major challenges in malaria elimination programs. So far, among current drugs approved for human use, only primaquine has transmission-blocking activity. The discovery of small molecules targeting different Plasmodium falciparum life stages remains a priority in antimalarial drug research. In this context, several independent studies have recently reported antiplasmodial and transmission-blocking activities of commonly used stains, dyes and fluorescent probes against P. falciparum including chloroquine-resistant isolates. Herein we have studied the antimalarial activities of dyes with different scaffold and we report that the triarylmethane dye (TRAM) Brilliant green inhibits the growth of asexual stages (IC 50  ≤ 2 μM) and has exflagellation-blocking activity (IC 50  ≤ 800 nM) against P. falciparum reference strains (3D7, 7G8) and chloroquine-resistant clinical isolate (Q206). In a second step we have investigated the antiplasmodial activities of two polysulfonated triarylmethane food dyes. Green S (E142) is weakly active against P. falciparum asexual stage (IC 50 ≃ 17 μM) whereas Patent Blue V (E131) is inactive in both antimalarial assays. By applying liquid chromatography techniques for the culture supernatant analysis after cell washings and lysis, we report the detection of Brilliant green in erythrocytes, the selective uptake of Green S (E142) by infected erythrocytes, whereas Patent Blue V (E131) could not be detected within non-infected and 3D7-infected erythrocytes. Overall, our results suggest that two polysulfonated food dyes might display different affinity with transporters or channels on infected RBC membrane. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  3. Could microwave induced catalytic oxidation (MICO) process over CoFe2O4 effectively eliminate brilliant green in aqueous solution?

    International Nuclear Information System (INIS)

    Ju, Yongming; Wang, Xiaoyan; Qiao, Junqin; Li, Guohua; Wu, You; Li, Yuan; Zhang, Xiuyu; Xu, Zhencheng; Qi, Jianying; Fang, Jiande; Dionysiou, Dionysios D.

    2013-01-01

    Highlights: • The elimination of BG over CoFe 2 O 4 (CP) was mainly due to the residue of NaOH. • Salicylic acid failed to capture hydroxyl radicals within MICO process. • This study indicated dim prospects for the MICO-based elimination of contaminants. -- Abstract: In this study, we adopted the chemical co-precipitation (CP) method and sol–gel method followed by calcination at temperatures of 100–900 °C for 12 h to synthesize CoFe 2 O 4 materials, which were further characterized by TEM, XRD and XPS techniques. The properties of CoFe 2 O 4 materials were evaluated in a microwave (MW) induced catalytic oxidation (MICO) process for the elimination of brilliant green (BG). The results showed that: (1) the removal rates of BG gradually decreased over a series of CoFe 2 O 4 materials prepared by CP method and calcinated with 100–700 °C (except 900 °C) for 12 h within three reuse cycles; for comparison, no removal of BG was obtained over CoFe 2 O 4 synthesized by sol–gel method and CoFe 2 O 4 -900 (CP); (2) no hydroxyl radicals were captured with salicylic acid used as molecular probe in the MICO process; (3) MW irradiation enhanced the release of residual NaOH within the microstructure of CoFe 2 O 4 and further discolored BG, because BG is sensitive to pH; (4) granular activated carbon (GAC), an excellent MW-absorbing material possessing higher dielectric loss tangent compared to that of a series of CoFe 2 O 4 materials, could not remove BG in suspensions at a higher efficiency, even if the loading amount was 20 g L −1 . Accordingly, MICO process over CoFe 2 O 4 materials and GAC could not effectively eliminate BG in suspensions

  4. Could microwave induced catalytic oxidation (MICO) process over CoFe2O4 effectively eliminate brilliant green in aqueous solution?

    Science.gov (United States)

    Ju, Yongming; Wang, Xiaoyan; Qiao, Junqin; Li, Guohua; Wu, You; Li, Yuan; Zhang, Xiuyu; Xu, Zhencheng; Qi, Jianying; Fang, Jiande; Dionysiou, Dionysios D

    2013-12-15

    In this study, we adopted the chemical co-precipitation (CP) method and sol-gel method followed by calcination at temperatures of 100-900°C for 12h to synthesize CoFe2O4 materials, which were further characterized by TEM, XRD and XPS techniques. The properties of CoFe2O4 materials were evaluated in a microwave (MW) induced catalytic oxidation (MICO) process for the elimination of brilliant green (BG). The results showed that: (1) the removal rates of BG gradually decreased over a series of CoFe2O4 materials prepared by CP method and calcinated with 100-700°C (except 900°C) for 12h within three reuse cycles; for comparison, no removal of BG was obtained over CoFe2O4 synthesized by sol-gel method and CoFe2O4-900 (CP); (2) no hydroxyl radicals were captured with salicylic acid used as molecular probe in the MICO process; (3) MW irradiation enhanced the release of residual NaOH within the microstructure of CoFe2O4 and further discolored BG, because BG is sensitive to pH; (4) granular activated carbon (GAC), an excellent MW-absorbing material possessing higher dielectric loss tangent compared to that of a series of CoFe2O4 materials, could not remove BG in suspensions at a higher efficiency, even if the loading amount was 20 g L(-1). Accordingly, MICO process over CoFe2O4 materials and GAC could not effectively eliminate BG in suspensions. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Could microwave induced catalytic oxidation (MICO) process over CoFe{sub 2}O{sub 4} effectively eliminate brilliant green in aqueous solution?

    Energy Technology Data Exchange (ETDEWEB)

    Ju, Yongming, E-mail: juyongming@scies.org [South China Institute of Environmental Science, Ministry of Environmental Protection (MEP), Guangzhou 510655 (China); Wang, Xiaoyan [South China Institute of Environmental Science, Ministry of Environmental Protection (MEP), Guangzhou 510655 (China); Qiao, Junqin [Center of Material Analysis, Nanjing University, Nanjing 210093, Jiangsu Province (China); Li, Guohua [South China Institute of Environmental Science, Ministry of Environmental Protection (MEP), Guangzhou 510655 (China); Wu, You [Department of Urology, The Affiliated Hospital to Nantong University, Nantong University, Nantong 226001, Jiangsu Province (China); Li, Yuan, E-mail: liyuan@scies.org [South China Institute of Environmental Science, Ministry of Environmental Protection (MEP), Guangzhou 510655 (China); Zhang, Xiuyu; Xu, Zhencheng; Qi, Jianying; Fang, Jiande [South China Institute of Environmental Science, Ministry of Environmental Protection (MEP), Guangzhou 510655 (China); Dionysiou, Dionysios D., E-mail: dionysios.d.dionysiou@uc.edu [Environmental Engineering and Science Program, University of Cincinnati, Cincinnati, OH 45221-0012 (United States)

    2013-12-15

    Highlights: • The elimination of BG over CoFe{sub 2}O{sub 4}(CP) was mainly due to the residue of NaOH. • Salicylic acid failed to capture hydroxyl radicals within MICO process. • This study indicated dim prospects for the MICO-based elimination of contaminants. -- Abstract: In this study, we adopted the chemical co-precipitation (CP) method and sol–gel method followed by calcination at temperatures of 100–900 °C for 12 h to synthesize CoFe{sub 2}O{sub 4} materials, which were further characterized by TEM, XRD and XPS techniques. The properties of CoFe{sub 2}O{sub 4} materials were evaluated in a microwave (MW) induced catalytic oxidation (MICO) process for the elimination of brilliant green (BG). The results showed that: (1) the removal rates of BG gradually decreased over a series of CoFe{sub 2}O{sub 4} materials prepared by CP method and calcinated with 100–700 °C (except 900 °C) for 12 h within three reuse cycles; for comparison, no removal of BG was obtained over CoFe{sub 2}O{sub 4} synthesized by sol–gel method and CoFe{sub 2}O{sub 4}-900 (CP); (2) no hydroxyl radicals were captured with salicylic acid used as molecular probe in the MICO process; (3) MW irradiation enhanced the release of residual NaOH within the microstructure of CoFe{sub 2}O{sub 4} and further discolored BG, because BG is sensitive to pH; (4) granular activated carbon (GAC), an excellent MW-absorbing material possessing higher dielectric loss tangent compared to that of a series of CoFe{sub 2}O{sub 4} materials, could not remove BG in suspensions at a higher efficiency, even if the loading amount was 20 g L{sup −1}. Accordingly, MICO process over CoFe{sub 2}O{sub 4} materials and GAC could not effectively eliminate BG in suspensions.

  6. Artificial neural network-genetic algorithm based optimization for the adsorption of methylene blue and brilliant green from aqueous solution by graphite oxide nanoparticle.

    Science.gov (United States)

    Ghaedi, M; Zeinali, N; Ghaedi, A M; Teimuori, M; Tashkhourian, J

    2014-05-05

    In this study, graphite oxide (GO) nano according to Hummers method was synthesized and subsequently was used for the removal of methylene blue (MB) and brilliant green (BG). The detail information about the structure and physicochemical properties of GO are investigated by different techniques such as XRD and FTIR analysis. The influence of solution pH, initial dye concentration, contact time and adsorbent dosage was examined in batch mode and optimum conditions was set as pH=7.0, 2 mg of GO and 10 min contact time. Employment of equilibrium isotherm models for description of adsorption capacities of GO explore the good efficiency of Langmuir model for the best presentation of experimental data with maximum adsorption capacity of 476.19 and 416.67 for MB and BG dyes in single solution. The analysis of adsorption rate at various stirring times shows that both dyes adsorption followed a pseudo second-order kinetic model with cooperation with interparticle diffusion model. Subsequently, the adsorption data as new combination of artificial neural network was modeled to evaluate and obtain the real conditions for fast and efficient removal of dyes. A three-layer artificial neural network (ANN) model is applicable for accurate prediction of dyes removal percentage from aqueous solution by GO following conduction of 336 experimental data. The network was trained using the obtained experimental data at optimum pH with different GO amount (0.002-0.008 g) and 5-40 mg/L of both dyes over contact time of 0.5-30 min. The ANN model was able to predict the removal efficiency with Levenberg-Marquardt algorithm (LMA), a linear transfer function (purelin) at output layer and a tangent sigmoid transfer function (tansig) at hidden layer with 10 and 11 neurons for MB and BG dyes, respectively. The minimum mean squared error (MSE) of 0.0012 and coefficient of determination (R(2)) of 0.982 were found for prediction and modeling of MB removal, while the respective value for BG was the

  7. Wood (Bagassa guianensis Aubl) and green coconut mesocarp (cocos nucifera) residues as textile dye removers (Remazol Red and Remazol Brilliant Violet).

    Science.gov (United States)

    Monteiro, Mônica S; de Farias, Robson F; Chaves, José Alberto Pestana; Santana, Sirlane A; Silva, Hildo A S; Bezerra, Cícero W B

    2017-12-15

    In this work the efficiency of two lignocellulosic waste materials, wood residues and coconut mesocarp, were investigated as adsorbents towards two representative textile dyes (Remazol Red, RR and Remazol Brilliant Violet, RBV). The moisture, carbohydrate, protein, lipid, ash and fiber contents of both natural matrices were characterized. The materials were also characterized by infrared spectroscopy, X-ray diffractometry, scanning electron microscopy, specific surface area analysis and thermogravimetry. The adsorption of dyes was monitored by using UV-Vis spectrophotometry. It was verified that both, coconut mesocarp (CM) and wood residues can act as effective adsorbents towards the investigated dyes. It is verified that the maximum adsorption capacity Γ M (mg g -1 ) for RBV and RR are 7.28 and 3.97 towards CM and 0.64 and 0.71 towrads SD. Furthermore, it was verified that the adsorption is strongly pH dependent and, as a general behavior, an increase in the pH value is associated with a decrease of the total amount of adsorbed dye. The adsorption of violet dye onto coconut mesocarp is well described by the Langmuir model, while all the remazol red fitted better with the Freundlich equation. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. Highly efficient simultaneous ultrasonic assisted adsorption of brilliant green and eosin B onto ZnS nanoparticles loaded activated carbon: Artificial neural network modeling and central composite design optimization

    Science.gov (United States)

    Jamshidi, M.; Ghaedi, M.; Dashtian, K.; Ghaedi, A. M.; Hajati, S.; Goudarzi, A.; Alipanahpour, E.

    2016-01-01

    In this work, central composite design (CCD) combined with response surface methodology (RSM) and desirability function approach (DFA) gives useful information about operational condition and also to obtain useful information about interaction and main effect of variables concerned to simultaneous ultrasound-assisted removal of brilliant green (BG) and eosin B (EB) by zinc sulfide nanoparticles loaded on activated carbon (ZnS-NPs-AC). Spectra overlap between BG and EB dyes was extensively reduced and/or omitted by derivative spectrophotometric method, while multi-layer artificial neural network (ML-ANN) model learned with Levenberg-Marquardt (LM) algorithm was used for building up a predictive model and prediction of the BG and EB removal. The ANN efficiently was able to forecast the simultaneous BG and EB removal that was confirmed by reasonable numerical value i.e. MSE of 0.0021 and R2 of 0.9589 and MSE of 0.0022 and R2 of 0.9455 for testing data set, respectively. The results reveal acceptable agreement among experimental data and ANN predicted results. Langmuir as the best model for fitting experimental data relevant to BG and EB removal indicates high, economic and profitable adsorption capacity (258.7 and 222.2 mg g- 1) that supports and confirms its applicability for wastewater treatment.

  9. Simultaneous removal of binary mixture of Brilliant Green and Crystal Violet using derivative spectrophotometric determination, multivariate optimization and adsorption characterization of dyes on surfactant modified nano-γ-alumina

    Science.gov (United States)

    Zolgharnein, Javad; Bagtash, Maryam; Shariatmanesh, Tahere

    2015-02-01

    The present study deals with the simultaneous removal of Brilliant Green (BG) and Crystal Violet (CV) by surfactant-modified alumina. The utilization of alumina nanoparticles with an anionic surfactant (sodium dodecyl sulfate (SDS)) as a novel and efficient adsorbent is successfully carried out to remove two cationic dyes from aqueous solutions in binary batch systems. A first-order derivative spectrophotometric method is developed for the simultaneous determination of BG and CV in binary solutions. The linear concentration range and limits of detection for the simultaneous determination of BG and CV were found to be: 1-20, 1-15 mg/L, 0.3 and 0.5 mg/L, respectively. The influence of various parameters, such as contact time, initial concentration of dyes and sorbent mass on the dye adsorption is investigated. A response surface methodology achieved through performing the Box-Behnken design is utilized to optimize the removal of dyes by surfactant-modified nanoparticle alumina through a batch adsorption process. The proposed quadratic model resulting from the Box-Behnken design approach fitted very well with the experimental data. The optimal conditions for dye removal were contact time t = 50 min, sorbent dose = 0.036 g, CBG (Initial BG concentration) = 215 mg/L and CCV (Initial CV concentration) = 170 mg/L. Furthermore, FT-IR analysis, the isotherms and kinetics of adsorption were also explored.

  10. 20 g PPV with indocyanine green-assisted ILM peeling versus 23 g PPV with brilliant blue G-assisted ILM peeling for epiretinal membrane.

    Science.gov (United States)

    Manousaridis, Kleanthis; Peter, Silvia; Mennel, Stefan

    2016-06-01

    To compare the anatomical and visual outcomes of 20 gauge (g) pars plana vitrectomy (PPV) with indocyanine green (ICG)-assisted internal limiting membrane (ILM) peeling and 23 g PPV with brilliant blue G (BBG)-assisted ILM peeling for idiopathic epiretinal membrane (ERM). 38 eyes of 38 patients with idiopathic ERM were included. They were divided in two groups: group 1 (18 eyes) underwent 20 g PPV with ICG-assisted ILM peeling and group 2 (20 eyes) 23 g PPV with BBG-assisted ILM peeling. Postoperative best-corrected visual acuity (BCVA) and central macular thickness (CMT) were compared. Average BCVA in group 1 improved significantly from 0.60 logarithm of the minimal angle of resolution (log MAR) at baseline to 0.3 log MAR postoperatively. Average BCVA in group 2 improved significantly from 0.60 log MAR at baseline to 0.3 log MAR postoperatively. Mean CMT reduced significantly from 473 to 375 μm in group 1 and from 486 to 396 μm in group 2. There were no significant differences in the BCVA and CMT between the groups. Both surgical methods appeared to be safe and provided similar anatomical and visual outcomes.

  11. A DISTANT QUASAR'S BRILLIANT LIGHT

    Science.gov (United States)

    2002-01-01

    The arrow in this image, taken by a ground-based telescope, points to a distant quasar, the brilliant core of an active galaxy residing billions of light-years from Earth. As light from this faraway object travels across space, it picks up information on galaxies and the vast clouds of material between galaxies as it moves through them. The Space Telescope Imaging Spectrograph aboard NASA's Hubble Space Telescope decoded the quasar's light to find the spectral 'fingerprints' of highly ionized (energized) oxygen, which had mixed with invisible clouds of hydrogen in intergalactic space. The quasar's brilliant beam pierced at least four separate filaments of the invisible hydrogen laced with the telltale oxygen. The presence of oxygen between the galaxies implies there are huge quantities of hydrogen in the universe. Credits: WIYN Telescope at Kitt Peak National Observatory in Arizona. The telescope is owned and operated by the University of Wisconsin, Indiana University, Yale University, and the National Optical Astronomy Observatories.

  12. Brilliant Star in a Colourful Neighbourhood

    Science.gov (United States)

    2010-07-01

    A spectacular new image from ESO's Wide Field Imager at the La Silla Observatory in Chile shows the brilliant and unusual star WR 22 and its colourful surroundings. WR 22 is a very hot and bright star that is shedding its atmosphere into space at a rate many millions of times faster than the Sun. It lies in the outer part of the dramatic Carina Nebula from which it formed. Very massive stars live fast and die young. Some of these stellar beacons have such intense radiation passing through their thick atmospheres late in their lives that they shed material into space many millions of times more quickly than relatively sedate stars such as the Sun. These rare, very hot and massive objects are known as Wolf-Rayet stars [1], after the two French astronomers who first identified them in the mid-nineteenth century, and one of the most massive ones yet measured is known as WR 22. It appears at the centre of this picture, which was created from images taken through red, green and blue filters with the Wide Field Imager on the MPG/ESO 2.2-metre telescope at ESO's La Silla Observatory in Chile. WR 22 is a member of a double star system and has been measured to have a mass at least 70 times that of the Sun. WR 22 lies in the southern constellation of Carina, the keel of Jason's ship Argo in Greek mythology. Although the star lies over 5000 light-years from the Earth it is so bright that it can just be faintly seen with the unaided eye under good conditions. WR 22 is one of many exceptionally brilliant stars associated with the beautiful Carina Nebula (also known as NGC 3372) and the outer part of this huge region of star formation in the southern Milky Way forms the colourful backdrop to this image. The subtle colours of the rich background tapestry are a result of the interactions between the intense ultraviolet radiation coming from hot massive stars, including WR 22, and the vast gas clouds, mostly hydrogen, from which they formed. The central part of this enormous complex

  13. How to be Brilliant at Algebra

    CERN Document Server

    Webber, Beryl

    2010-01-01

    How to be Brilliant at Algebra is contains 40 photocopiable worksheets designed to improve students' understanding of number relationships and patterns. They will learn about: odds and evens; patterns; inverse operations; variables; calendars; equations; pyramid numbers; digital root patterns; prime numbers; Fibonacci numbers; Pascal's triangle.

  14. Brilliant blue, green and orange-red emission band on Tm{sup 3+}-, Tb{sup 3+}- and Eu{sup 3+}-doped ZrO{sub 2} nanocrystals

    Energy Technology Data Exchange (ETDEWEB)

    Romero, V H; De la Rosa, E; Lopez-Luke, T [Centro de Investigaciones en Optica, A.P. 1-948, Leon Gto., 37160 (Mexico); Salas, P [Centro de Fisica Aplicada y TecnologIa Avanzada, Universidad Nacional Autonoma de Mexico, A.P. 1-1010, Queretaro, Qro. 76000 (Mexico); Angeles-Chavez, C, E-mail: elder@cio.m [Instituto Mexicano del Petroleo, Programa de IngenierIa Molecular, A.P. 11-848, Mexico, D.F. 07730 (Mexico)

    2010-11-24

    Tm{sup 3+}-, Tb{sup 3+}- and Eu{sup 3+}-doped ZrO{sub 2} nanocrystals were prepared by a facile precipitation method with a hydrothermal process. Structural characterization showed a crystallite size ranging from 30 to 40 nm, and monoclinic and tetragonal zirconia phases were observed depending on the dopant concentration. The monoclinic phase was dominant for 0.5 mol% of Tb{sup 3+} and Eu{sup 3+}, and the tetragonal phase was 100% stabilized for 2 mol% of Tm{sup 3+} and Tb{sup 3+}. The structure of emission bands associated with Eu{sup 3+} confirms the substitution of Zr{sup 4+} located at C{sub 1} and D{sub 2h} symmetry sites for the monoclinic and tetragonal phases. The emission of three primary colours, red, green and blue, was obtained from Eu{sup 3+}, Tb{sup 3+} and Tm{sup 3+}, respectively, which makes this nanophosphor an excellent candidate for use in photonics applications. The emitted signal was analysed as a function of ion concentration and the optimum concentration was determined.

  15. How to be Brilliant at Numbers

    CERN Document Server

    Webber, Beryl

    2010-01-01

    How to be Brilliant at Numbers will help students to develop an understanding of numbers, place value, fractions and decimals. They will develop the language of number, and of the relationships between numbers. They will also use mathematics to solve problems and will develop mathematical reasoning. Using the worksheets in this book, pupils will learn about: ancient Greek numbers; coins; digits; consecutive numbers; magic ladders; fractions; matching pairs; multiples of 10; rounding; decimal un

  16. Brilliant Corners: Approaches to Jazz and Comics

    Directory of Open Access Journals (Sweden)

    Nicolas Pillai

    2016-08-01

    Full Text Available The call for papers Brilliant Corners: Approaches to Jazz and Comics was published on 30 July 2015. In it, the editors made a public invitation for scholarship that proposed meeting points between the disciplines of jazz studies and comics studies. This editorial discusses the motivations for the collection, the editorial methodology, and the research articles included. Finally, the editors suggest some areas in which jazz studies and comics scholarship might address under-researched and fertile topics.

  17. How to be Brilliant at Mental Arithmetic

    CERN Document Server

    Webber, Beryl

    2010-01-01

    How to be Brilliant at Mental Arithmetic addresses the twin pillars of mental arithmetic - mental recall and mental agility. Mental recall depends on familiarity with number bonds and plenty of opportunity to practise. Mental agility depends more on confidence with the number system and the four operations. Using the worksheets in this book, students will learn about: tens and units; addition, subtraction, multiplication and division; addition shortcuts; product squares; quick recall; number se

  18. Inoculation Expedition of Agar wood

    International Nuclear Information System (INIS)

    Peng, C.S.; Mohd Fajri Osman; Rusli Zakaria

    2015-01-01

    Inoculation expedition of agar wood is a main field works for researcher in Nuclear Malaysia to prove the real inoculation of agar wood in real jungle. These expeditions was conducted fourth times in the jungles of Malaysia including Gunung Tebu in Terengganu, Murum in Belaga, Sarawak, Kampung Timbang in Kota Belud, Sabah and Nuclear Malaysia itself. This expedition starts from preparation of samples and equipment, transportation into the jungle, searching and recognition of agar wood and lastly, inoculation of the agar wood. Safety aspects precedence set out in the preparation and implementation of this expedition. (author)

  19. A Brilliant Example for Women--Comments on "My Brilliant Career"

    Science.gov (United States)

    Zhang, Xiuqing

    2014-01-01

    Based on the theory of American feminist critic Elaine Showalter, this paper analyzes a peculiar feature of early Australian novel "My Brilliant Career" and discovers that it spans three phases of Women's Literature. Through her indefatigable strive for equality between men and women, independent personality and self-fulfillment, the…

  20. Brilliant research perspectives DESY's accelerator "PETRA" to become a most brilliant light source

    CERN Multimedia

    2003-01-01

    From 2007 onwards, the PETRA accelerator at the Helmholtz research center DESY will be converted into the most brilliant storage-ring-based X-ray source worldwide. Current plans envision 13 to 15 experimental stations, which will be equipped with so-called undulators: long magnet arrangements delivering X-ray radiation with especially high brilliance (1 page).

  1. Transpassive Dissolution of Copper and Rapid Formation of Brilliant Colored Copper Oxide Films

    Science.gov (United States)

    Fredj, Narjes; Burleigh, T. David; New Mexico Tech Team

    2014-03-01

    This investigation describes an electrochemical technique for growing adhesive copper oxide films on copper with attractive colors ranging from gold-brown to pearl with intermediate colors from red violet to gold green. The technique consists of anodically dissolving copper at transpassive potentials in hot sodium hydroxide, and then depositing brilliant color films of Cu2O onto the surface of copper after the anodic potential has been turned off. The color of the copper oxide film depends on the temperature, the anodic potential, the time t1 of polarization, and the time t2, which is the time of immersion after potential has been turned off. The brilliant colored films were characterized using glancing angle x-ray diffraction, and the film was found to be primarily Cu2O. Cyclic voltammetry, chronopotentiometry, scanning electron microscopy, and x-ray photoelectron spectroscopy were also used to characterize these films.

  2. How to be a brilliant English teacher

    CERN Document Server

    Wright, Trevor

    2012-01-01

    Now in its second edition, Trevor Wright's hugely popular How to be a Brilliant English Teacher is packed with practical advice drawn from his extensive and successful experience as an English teacher, examiner and teacher trainer. This accessible and readable guide offers sound theoretical principles with exciting practical suggestions for the classroom. Fully updated to include a new expanded section on differentiation and inclusion, as well as covering new material on behaviour management and teaching poetry for enjoyment and personal response, this book tackles other tricky areas such as: Starting with Shakespeare Effective planning and assessment Learning to love objectives Working small texts and big texts Drama. Trainee teachers will find support and inspiration in this book and practising English teachers can use it as an empowering self-help guide for improving their skills. Trevor Wright addresses many of the anxieties that English teachers face, offering focused and realistic solutions.

  3. green

    Directory of Open Access Journals (Sweden)

    Elena Grigoryeva

    2011-02-01

    Full Text Available The “green” topic follows the “youngsters”, which is quite natural for the Russian language.Traditionally these words put together sound slightly derogatory. However, “green” also means fresh, new and healthy.For Russia, and for Siberia in particular, “green” architecture does sound new and fresh. Forced by the anxious reality, we are addressing this topic intentionally. The ecological crisis, growing energy prices, water, air and food deficits… Alexander Rappaport, our regular author, writes: “ It has been tolerable until a certain time, but under transition to the global civilization, as the nature is destroyed, and swellings of megapolises expand incredibly fast, the size and the significance of all these problems may grow a hundredfold”.However, for this very severe Siberian reality the newness of “green” architecture may turn out to be well-forgotten old. A traditional Siberian house used to be built on principles of saving and environmental friendliness– one could not survive in Siberia otherwise.Probably, in our turbulent times, it is high time to fasten “green belts”. But we should keep from enthusiastic sticking of popular green labels or repainting of signboards into green color. We should avoid being drowned in paper formalities under “green” slogans. And we should prevent the Earth from turning into the planet “Kin-dza-dza”.

  4. Semi-autonomous controller for data acquisition, the Brilliant ADC

    International Nuclear Information System (INIS)

    Breidenbach, M.; Frank, E.; Hall, J.; Nelson, D.

    1977-10-01

    A set of high speed 16-bit computers and ADC's designed and built for the data collection, compression, and correction system of the SLAC/LBL Mark II Magnetic Detector. The ''Brilliant ADC'' controls the analog multiplexing of a CAMAC crate of data acquisition modules, digitizes the analog data, and executes microprogrammed algorithms for data handling and correction

  5. Kinetics and Mechanism of the Oxidation of Coomassie Brilliant Blue ...

    African Journals Online (AJOL)

    NICOLAAS

    Kinetics and Mechanism of the Oxidation of Coomassie Brilliant Blue-R dye by Hypochlorite and Role of Acid there in. Srinivasu Nadupalli, Venkata D.B.C. Dasireddy, Neil A. Koorbanally and Sreekantha B. Jonnalagadda*. School of Chemistry and Physics, University of KwaZulu-Natal, Westville Campus, Private.

  6. Brilliant camouflage : photonic crystals in the diamond weevil, Entimus imperialis

    NARCIS (Netherlands)

    Wilts, Bodo D.; Michielsen, Kristel; Kuipers, Jeroen; Raedt, Hans De; Stavenga, Doekele G.

    2012-01-01

    The neotropical diamond weevil, Entimus imperialis, is marked by rows of brilliant spots on the overall black elytra. The spots are concave pits with intricate patterns of structural-coloured scales, consisting of large domains of three-dimensional photonic crystals that have a diamond-type

  7. Morphological identification of Candida species on glucose agar, rice extract agar and corn meal agar with and without Tween-80.

    Science.gov (United States)

    Joshi, K R; Solanki, A; Prakash, P

    1993-01-01

    A comparative study for the identification of 32 known strains of Candida species on the basis of morphology on glucose agar, rice extract agar and corn meal agar with and without Tween 80 revealed that when Tween 80 is incorporated in the media identification is possible for 96.8% of the species within 48 hours on rice extract agar and for 96.8% of the species within 48 hours on rice extract agar and for 90.6% of the species on glucose agar. The germ tubes and chlamydospores were also produced more on rice extract agar than on 0.1% glucose agar. Rice extract agar with Tween 80 can be used as single medium for morphologic identification of Candida species. The inoculated medium is first incubated at 37 degrees C for 3 hours and examined for germ tube formation and then incubated at 25 degrees C for 24 to 72 hours and examined for appearance of chlamydospores and mycelial morphology.

  8. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    Energy Technology Data Exchange (ETDEWEB)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo, E-mail: thilo.hofmann@univie.ac.at

    2016-09-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  9. Agar agar-stabilized milled zerovalent iron particles for in situ groundwater remediation

    International Nuclear Information System (INIS)

    Velimirovic, Milica; Schmid, Doris; Wagner, Stephan; Micić, Vesna; Kammer, Frank von der; Hofmann, Thilo

    2016-01-01

    Submicron-scale milled zerovalent iron (milled ZVI) particles produced by grinding macroscopic raw materials could provide a cost-effective alternative to nanoscale zerovalent iron (nZVI) particles for in situ degradation of chlorinated aliphatic hydrocarbons in groundwater. However, the aggregation and settling of bare milled ZVI particles from suspension presents a significant obstacle to their in situ application for groundwater remediation. In our investigations we reduced the rapid aggregation and settling rate of bare milled ZVI particles from suspension by stabilization with a “green” agar agar polymer. The transport potential of stabilized milled ZVI particle suspensions in a diverse array of natural heterogeneous porous media was evaluated in a series of well-controlled laboratory column experiments. The impact of agar agar on trichloroethene (TCE) removal by milled ZVI particles was assessed in laboratory-scale batch reactors. The use of agar agar significantly enhanced the transport of milled ZVI particles in all of the investigated porous media. Reactivity tests showed that the agar agar-stabilized milled ZVI particles were reactive towards TCE, but that their reactivity was an order of magnitude less than that of bare, non-stabilized milled ZVI particles. Our results suggest that milled ZVI particles could be used as an alternative to nZVI particles as their potential for emplacement into contaminated zone, their reactivity, and expected longevity are beneficial for in situ groundwater remediation. - Highlights: • Rapid aggregation and sedimentation were observed in bare milled ZVI particles. • Agar agar improved the stability of milled ZVI particle suspensions. • Agar agar enhanced the transport of milled ZVI particles in heterogeneous sands. • Agar agar reduced the reactivity of milled ZVI particles towards TCE.

  10. Menu Proposal to Use Powdered Agar

    OpenAIRE

    土屋, ひろ子; 嶋村, 桃子; 小松, 沙霧

    2015-01-01

    The author was involved in the development of the menu items that might be sold at “Taisho Village”, a theme park. Requirements in the menu development were that cooking should be simple as it starts cooking after receiving orders and it should have attractive appearances. Powdered agar has advantages over rod-shaped or string-shaped agar, with easiness of handling such as its ready solubility in water and no need to wash, rehydrate or strain. Because powdered agar is easy to use in cooking,...

  11. Agar from some Hawaiian red algae

    Energy Technology Data Exchange (ETDEWEB)

    Santos, G.A.; Doty, M.S.

    1983-08-01

    From describing the agars of Gelidiella acerosa Forskk., Gelidium pluma Loomis, G. pusillum (Stackh.) Lejolis, Gracilaria abbotiana Hoyle, G. bursapastoris (Gmelin) Silva, G. canaliculata (Kutzing) Sonder, G. coronopifolia J.Ag., G. epihippisora Hoyle, Pterocladia caerulescens (Kutzing) Santelices and P. capillacea (Gmelin) Born. and Thur. as found in Hawaiian samples of these species, it is concluded that the species of Gelidium and especially Pterocladia and Gelidiella may merit more consideration for usage due to their agar gel strengths. The nature of the gel from Gracilaria abbottiana suggests the generic status might well be reexamined. The agars from the Gelidiella and the other Gracilaria species should be studied further for their prospective values to the food industry other than gel strength. Mixtures of the agars from G. bursapastoris and G. coronopifolia would merit attention for the taste texture of their mixtures. (Refs. 18).

  12. Morphological development of Morchella conica mycelium on different agar media.

    Science.gov (United States)

    Guler, P; Ozkaya, E G

    2009-07-01

    The present study presents the development of mycelium of Morchella conica where different concentration of sucrose added at different agar media. For this sucrose have been added as 0.25, 0.50, 0.75, 1.00 and 1.25% concentration to wheat agar potato dextrose agar malt extract agar and complete medium yeast agar The radial growth speed, morphologic specifications, radial growth radius and pigmentation of mycelium were taken as criteria, the development period of mycelium in wheat agar was completed in 4 days and mycelium were very thin. The colonization period of the mycelium was determined; 7 days in potato dextrose agar 5 days in malt extract agar and 5 days at complete medium yeast agar. The development of the mycelium; at potato dextrose agar was dense and circular; at malt extract agar and at completed medium yeast agar was rhizomorphic. Mycelium has developed very well at sucrose medium and formed creamy and light yellow pigmentation.

  13. Identification of Cryptococcus neoformans isolates using Staib agar without creatinine

    OpenAIRE

    Nardelli, Vanessa; Pérez, Celina; Mata-Essayag, Sofía; Colella, María Teresa; Roselló, Arantza; Hartung de Capriles, Claudia; Landaeta, María Eugenia; Olaizola, Carolina; Magaldi, Sylvia

    2005-01-01

    In mycology, culture is the best way to demonstrate and identify pathogenic fungi. Many kinds of media have been developed and modified, using fungal biochemical properties to recognize them. The most common media are Sabouraud, Malt Agar, Cornmeal agar, Potato-dextrose agar, and Staib agar. Staib agar has been widely used for identification of yeasts from the genus Cryptococcus and other fungi. The aim of this study was to demonstrate the usefulness of Staib agar, and of a modified Staib med...

  14. STABILITAS ANTOSIANIN JANTUNG PISANG KEPOK (Musa paradisiaca L TERHADAP CAHAYA SEBAGAI PEWARNA AGAR-AGAR

    Directory of Open Access Journals (Sweden)

    Lydia Ninan Lestario

    2015-02-01

    jantung pisang kepok yang disinari dengan intensitas 780-2.214 lux selama 10 jam masih disukai panelis, sedangkan yang disinari dengan intensitas 10.340 sudah tidak disukai panelis. Kata kunci: Antosianin, jantung pisang, agar-agar, intensitas cahaya, laju degradasi warna

  15. Sorption of U(VI) on natural sepiolite and sepiolite-agar agar composite adsorbent

    International Nuclear Information System (INIS)

    Esen, K.; Donat, R.; Cetisli, H.; Aytas, S.

    2006-01-01

    Adsorption of uranium (VI) ions onto clay minerals is one of the significant reactions affecting the transport of uranium in the environment. The use of composite adsorbents for the removal of metal ions and radionuclide from industrial wastes has attracted great interest to researchers in recent years[1]. In this study, natural sepiolite type clay and an organic compound, agar agar, were chosen as the adsorbent material. Composite adsorbent was prepared from sepiolite and agar agar. Adsorption of uranium (VI) on this composite and on natural sepiolite adsorbent was investigated. Thermodynamic investigations were carried out to get more information about the adsorption of uranium. Adsorption of U (VI) has been studied as a function of solution pH, time, temperature and initial concentration of uranium on natural sepiolite and agar agar composite. The maximum sorption yield of U (VI) on composite and on sepiolite from batch experiments is calculated approximately 89% and 76% respectively in the optimum experimental adsorption condition. The adsorption data were fitted to Freundlich and Dubinin-Radushkevich (D-R) adsorption isotherms. Using the experimental data obtained different temperatures, thermodynamic constants ΔH d egree, ΔS d egree and ΔG d egree were calculated. The results show that the adsorption process on natural sepiolite and sepiolite-agar agar composite are both egzothermic natures. [1] S. M. Hasany, M. M. Saeed, M. Ahmed, J. Radioanal. Nucl. Chem. Vol. 252 (3), 477-484 (2002)

  16. Report and recommendations of the Brilliant powerplant expansion project committee

    International Nuclear Information System (INIS)

    2001-01-01

    An application was submitted in December 2000 for a project approval certificate for the Brilliant Powerplant Expansion Project (BEP). It included the construction and operation of a new powerhouse with a generating capacity of close to 100 MW, a new intake and tailrace channels, as well as tailrace channel improvements, a powerhouse access bridge over the Kootenay River downstream from the Brilliant Dam, a 600 metre 230 kV transmission link and 230 kV switchyard (the switchyard is no longer part of the project), a construction site and excavation materials disposal areas, and access to the site from Highway 3A and also from Robson Road. Both before and during the environmental assessment review, comprehensive public consultation was undertaken. The issues that were examined were environmental effects, operations, socio-economic effects, health effects, and the cultural and heritage effects. It was concluded that the effects issues related to the construction of the project had been resolved, based on the information provided in the Application and on the mitigation and compensation measures. The potential impact on fish and fish habitat were examined under the operations heading. Again, the committee determined that the proponent had committed to target minimum flows and restrictions, and that the effects issues associated with the operations of the project had been resolved. Increased traffic through the community of Brilliant represented the main focus of the evaluation of the socio-economic effects. Positive economic and employment effects on local communities were expected, and the proponent was ready to address any potential negative social effects to the satisfaction of the committee. Groundwater resources were the only potentially significant effect identified under the heading health effects, and adequate compensation and mitigation measures were committed by the proponent to address the issue. The cultural and heritage effects identified archaeological

  17. Extraction of agar from Gelidium sesquipedale (Rhodopyta) and surface characterization of agar based films.

    Science.gov (United States)

    Guerrero, P; Etxabide, A; Leceta, I; Peñalba, M; de la Caba, K

    2014-01-01

    The chemical structure of the agar obtained from Gelidium sesquipedale (Rhodophyta) has been determined by (13)C nuclear magnetic resonance ((13)C NMR) and Fourier transform infrared spectroscopy (FTIR). Agar (AG) films with different amounts of soy protein isolate (SPI) were prepared using a thermo-moulding method, and transparent and hydrophobic films were obtained and characterized. FTIR analysis provided a detailed description of the binding groups present in the films, such as carboxylic, hydroxyl and sulfonate groups, while the surface composition was examined using X-ray photoelectron spectroscopy (XPS). The changes observed by FTIR and XPS spectra suggested interactions between functional groups of agar and SPI. This is a novel approach to the characterization of agar-based films and provides knowledge about the compatibility of agar and soy protein for further investigation of the functional properties of biodegradable films based on these biopolymers. Copyright © 2013 Elsevier Ltd. All rights reserved.

  18. Crecimiento y habilidad decolorante potencial de Hyphomycetes (Deuteromycetes de Río Santiago sobre medio agarizado suplementado con cromóforos sintéticos Growth and potential decolorizing ability of Hyphomycetes (Deuteromycetes from Río Santiago on agar medium supplemented with synthetic chromophores

    Directory of Open Access Journals (Sweden)

    Romina Liberto

    2005-12-01

    Full Text Available Se analizó la capacidad de Dictyosporium triramosum, Minimidochium parvum y Tetraploa aristata, aisladas de materia orgánica colectada en Río Santiago (Provincia de Buenos Aires, Argentina, para crecer y decolorar medios agarizados y suplementados con diferentes cromóforos sintéticos al 0,01 % (p v-1. Cristal violeta y verde brillante redujeron el crecimiento de las 3 cepas revelando los mayores porcentajes de inhibición. Mientras que eosina y rosa de bengala no afectaron a D. triramosum, valores superiores al 50 % de inhibición se observaron en M. parvum y T. aristata. Rojo congo y rojo neutral redujeron a D. triramosum y M. parvum en un 12-17 %, pero no a T. aristata. D. triramosum y T. aristata no resultaron afectados por azul de toluidina, mientras M. parvum fue inhibido por el colorante. Rojo de metilo sólo inhibió a M. parvum y T. aristata. Las 3 cepas probadas revelaron capacidad para decolorar el medio suplementado con azul de toluidina y rojo de metilo. D. triramosum decoloró además el medio suplementado con cristal violeta y rojo congo, y T. aristata el medio con cristal violeta y rojo neutral. Ninguno de los hongos estudiados decoloró los medios con eosina, rosa de bengala y verde brillante.The ability of Dictyosporium triramosum, Minimidochium parvum and Tetraploa aristata, isolated from organic matter collected in Río Santiago (Buenos Aires Province, Argentina, to grow and decolorize agar media supplemented with different synthetic chromophores at 0.01% (w v-1 was analyzed. Crystal violet and brilliant green reduced the growth of the three strains showing the highest inhibition percentages. While eosin and rose bengal did not affect D. triramosum, growth inhibition values superior to 50 % were observed for M. parvum and T. aristata. Congo red and neutral red inhibited growth of both D. triramosum and M. parvum in a 12-17%, but those dyes did not reduced T. aristata growth. D. triramosum and T. aristata were not affected

  19. [Boerhaave: a brilliant mind and a virtuous character].

    Science.gov (United States)

    Lama, Alexis; van Wijngaarden, Dagmar

    2002-09-01

    Hermann Boerhaave (1668-1738), a physician and humanist, is considered one of the most influential clinicians and professors of the eighteenth century. He was a medical teacher in Leiden, Holland, reaching great fame and celebrity in his city and around, extending outside of Europe into China. His contemporaries would name him "Europe's professor". He obtained his academic degrees in philosophy, chemistry and botany, but continued in medicine which more befit his nature. This brilliant man declared himself in favour of experimental knowledge instead of theory and, following Thomas Sydenham, he greatly contributed in making clinical medicine more systematic. In some extent he was the founder of academic hospitals. Boerhaave was an affectionate, cheerful and correct man, an admirable example of moderation, vigour, humbleness and devotion. In the last months of his life, suffering a painful disease, he showed his strength by letting his soul master himself, and resigned to the will of God.

  20. Micropipette Deflection Measurements of Agar-Glass Adhesion

    Science.gov (United States)

    Parg, Richard; Shelton, Erin; Dutcher, John

    Micropipette deflection experiments were used to study the adhesive strength at an agar-glass interface. Agar is a hydrogel commonly used in biological research; however, many of the mechanical properties of this hydrogel are not well characterized. By measuring the peak force required to slide an agar puck supported by a Teflon ring across a clean glass slide, we are able to compare the adhesive strength of 1 % w/w and 1.5 % w/w agar. On average, the force required to break the agar-glass interface was approximately a factor of 2 larger for 1.5 % w/w agar than for 1 % w/w agar. We discuss this result within the context of a simple model of agar adhesion. Additional experiments were performed to measure the kinetic friction between agar and glass to obtain insight into its dependence on agar concentration.

  1. Seleksi Kemampuan Pematangan Oosit Domba Menggunakan Teknik Brilliant Cressyl Blue

    Directory of Open Access Journals (Sweden)

    Mohamad Agus Setiadi

    2010-12-01

    Full Text Available In present study the developmental competence of sheep oocytes to reach maturation at secondmetaphase (M II was observed following selection of oocytes using brilliant cressyl blue (BCB.Immature oocytes were harvested from ovaries collected at abattoir; the selected according to theircolour appearence (cytoplasm colour after being exposed to BCB and incubated for 90 minutes at5% CO2 incubator at 39oC. The selected oocytes were grouped into two based on their cytoplsmcolour i.e. group of oocytes (BCB+ with blue cytoplasm and growing oocytes (BCB- the unstainedcytoplasm. The control group including freshly collected oocytes which were then selected usingroutine method by observing morphological character under microscope. Each treated group ofoocytes (BCB+ and BCB- and the control were processed for maturation into culture media (TissueCulture Medium199+10 IU/ml Pregnant Mare Serum Gonadothropine+10 IU Human ChorionicGonadothropine+1?g/ml estradiol benzoat +10% fetal bovine serum then incubated for 24 hours at5% CO2 incubator at 39oC. Finally oocytes from each treated group and the control were stainedwith arceto orcein 2% to observe the number of oocytes which reach maturatuion at M II. Theresult showed that the percentage of oocytes reaching M II were significantly higher in BCB+ group(54% compared to BCB- group (8%. It is concluded that BCB is a potential method for selectionofcompetent oocytes

  2. Anti-prion activity of Brilliant Blue G.

    Directory of Open Access Journals (Sweden)

    Yoshifumi Iwamaru

    Full Text Available BACKGROUND: Prion diseases are fatal neurodegenerative disorders with no effective therapy currently available. Accumulating evidence has implicated over-activation of P2X7 ionotropic purinergic receptor (P2X7R in the progression of neuronal loss in several neurodegenerative diseases. This has led to the speculation that simultaneous blockade of this receptor and prion replication can be an effective therapeutic strategy for prion diseases. We have focused on Brilliant Blue G (BBG, a well-known P2X7R antagonist, possessing a chemical structure expected to confer anti-prion activity and examined its inhibitory effect on the accumulation of pathogenic isoforms of prion protein (PrPres in a cellular and a mouse model of prion disease in order to determine its therapeutic potential. PRINCIPAL FINDINGS: BBG prevented PrPres accumulation in infected MG20 microglial and N2a neural cells at 50% inhibitory concentrations of 14.6 and 3.2 µM, respectively. Administration of BBG in vivo also reduced PrPres accumulation in the brains of mice with prion disease. However, it did not appear to alleviate the disease progression compared to the vehicle-treated controls, implying a complex role of P2X7R on the neuronal degeneration in prion diseases. SIGNIFICANCE: These results provide novel insights into the pathophysiology of prion diseases and have important implications for the treatment.

  3. Evaluation of a Chromogenic Agar under Development To Screen for VRE Colonization ▿

    OpenAIRE

    Kallstrom, George; Doern, Christopher D.; Dunne, W. Michael

    2010-01-01

    BBL CHROMagar VanRE (CVRE) was compared with bile esculin azide agar plus vancomycin to screen for vancomycin-resistant enterococcus (VRE) colonization. CVRE distinguishes Enterococcus faecalis (green colonies) from Enterococcus faecium (mauve colonies) on the basis of chromogenic substrate use. CVRE sensitivity and specificity were 98.6% and 99.1%. Positive and negative predictive values were 95.9% and 99.7%.

  4. 21 CFR 866.4600 - Ouchterlony agar plate.

    Science.gov (United States)

    2010-04-01

    ...) MEDICAL DEVICES IMMUNOLOGY AND MICROBIOLOGY DEVICES Immunology Laboratory Equipment and Reagents § 866.4600 Ouchterlony agar plate. (a) Identification. An ouchterlony agar plate for clinical use is a device...

  5. Agar alternatives for micropropagation of African violet ( Saintpaulia ...

    African Journals Online (AJOL)

    Agar is one of the most popular solidifying agents in plant tissue culture. High price of pure grade agar and fear of over exploitation of its resources caused searching for low cost alternatives. In this study, liquid medium with cotton substratum and different combinations of starch, semolina, potato powder and agar in two ...

  6. Gari agar as culture media for mycological studies | Okorondu ...

    African Journals Online (AJOL)

    Gari agar was prepared by weighing 28 g of Gari, 14 g of agar powder and 8 g of Hibiscus rabdariffa powder to 1 L of sterile water. A conventional media, Sabouraud Dextrose Agar (SDA) was prepared as control according to manufacturer's procedure. Aliquot of appropriate dilutions of 1 g of agricultural soil was inoculated ...

  7. Radiation sterilization of triple sugar iron agar

    International Nuclear Information System (INIS)

    Altmann, G.; Eisenberg, E.; Bogokowsky, B.

    1979-01-01

    Triple sugar iron agar (TSI), a medium used for the identification of enteric bacteria, was sterilized by gamma radiation using radiation doses of 750-2000 krad. The radio-sterilized medium, slightly modified by increasing its Phenol Red content, performed well when tested with different enterobacteriaceae and other gram negative bacteria. Growth, change of indicator reaction in slant and butt and formation of gas and H 2 S were equal in irradiated and autoclaved TSI. Slants of irradiated TSI in stoppered plastic tubes kept their diagnostic properties during storage for at least 4 months. Gamma irradiation appears to be an attractive and economical method of sterilising nutrient media in sealed tubes or other containers, avoiding the risk of contamination during processing. (author)

  8. Estudio comparativo del agar Iso-Sensitest y el agar Mueller-Hinton

    Directory of Open Access Journals (Sweden)

    Margaret Ordoñez Smith de Danies

    1993-12-01

    Full Text Available Se estudiaron 710 cepas bacterianas provenientes de diferentes muestras para comparar las zonas de inhibición de los diámetros obtenidos en agar Iso-Sensitest y el agar Mueller Hinton. Se realizaron bajo la técnica de difusión en disco de la NCCLS (Comité Nacional para los Estándares de Laboratorio Clínico. Estadísticamente, al analizar el chi-cuadrado de las muestras estudiadas, se observó una confiabilidad del 99%, por lo tanto no hay diferencia entre los dos medios de cultivo. En el agar Iso-Sensitest se obtuvo una mejor nitidez con los diámetros de los halos de inhibición, se encontró un 62,0% de mejor lectura o mayor visibilidad en los diámetros de las zonas de inhibición con los cultivos de Enterococcus sp., un 21,4% con el Staphylococcus aureus y 20,0% en el caso de la Providencia stuartii.

  9. Europe Unveils 20-Year Plan for Brilliant Future in Astronomy

    Science.gov (United States)

    2008-11-01

    Astronomy is enjoying a golden age of fundamental, exciting discoveries. Europe is at the forefront, thanks to 50 years of progress in cooperation. To remain ahead over the next two to three decades, Europe must prioritise and coordinate the investment of its financial and human resources even more closely. The ASTRONET network, backed by the entire European scientific community, supported by the European Commission, and coordinated by the CNRS, today presents its Roadmap for a brilliant future for European astronomy. ESO's European Extremely Large Telescope is ranked as one of two top-priority large ground-based projects. Astronet and the E-ELT ESO PR Photo 43a/08 The E-ELT Europe is a leader in astronomy today, with the world's most successful optical observatory, ESO's Very Large Telescope, and cutting-edge facilities in radio astronomy and in space. In an unprecedented effort demonstrating the potential of European scientific cooperation, all of European astronomy is now joining forces to define the scientific challenges for the future and construct a common plan to address them in a cost-effective manner. In 2007, a top-level Science Vision was prepared to assess the most burning scientific questions over the next quarter century, ranging from dark energy to life on other planets. European astronomy now presents its Infrastructure Roadmap, a comprehensive 20-year plan to coordinate national and community investments to meet these challenges in a cost-effective manner. The Roadmap not only prioritises the necessary new frontline research facilities from radio telescopes to planetary probes, in space and on the ground, but also considers such key issues as existing facilities, human resources, ICT infrastructure, education and outreach, and cost -- of operations as well as construction. This bold new initiative -- ASTRONET -- was created by the major European funding agencies with support from the European Commission and is coordinated by the National Institute

  10. Seasonal variations of agar extracted from different life stages of ...

    African Journals Online (AJOL)

    Seasonality in yield, physical and chemical properties of the native agar from different life stages of Gracilaria cliftonii was investigated over a period of six seasons (autumn 2008–winter 2009). Agar yield and its properties varied as a function of seasons and life stages but there was no significant correlation between ...

  11. Methods for identifying lipoxygenase producing microorganisms on agar plates

    NARCIS (Netherlands)

    Nyyssola, A.; Heshof, R.; Haarmann, T.; Eidner, J.; Westerholm-Parvinen, A.; Langfelder, K.; Kruus, K.; Graaff, de L.H.; Buchert, J.

    2012-01-01

    Plate assays for lipoxygenase producing microorganisms on agar plates have been developed. Both potassium iodide-starch and indamine dye formation methods were effective for detecting soybean lipoxygenase activity on agar plates. A positive result was also achieved using the beta-carotene bleaching

  12. Assessment of Native Agar Gels Extracted from Gracilaria debilis ...

    African Journals Online (AJOL)

    Native agar gels extracted from Gracilaria debilis and G. salicornia harvested during the rainy and dry seasons, were assessed for culturing the microorganisms Micrococcus luteus, Saccharomyces cerevisiae and Pleurotus flabellatus. Agars extracted from plants harvested during the rainy season were suitable for culturing ...

  13. Preparation of Polyaniline/Filter-paper Composite for Removal of Coomassie Brilliant Blue

    DEFF Research Database (Denmark)

    Liu, Wanwan; Li, Xiaoqiang; Li, Mengjuan

    2015-01-01

    Polyaniline/filter-paper (PANI/FP) composite was prepared by in-situ polymerization of polyaniline onto filter-paper and subsequently evaluated for the removal of Coomassie brilliant blue (CBB) from aqueous solution. Scanning electron microscopy (SEM), thermogravimetric analysis (TGA) and Fourier...

  14. AGAR PENULISAN RESEP TETAP UP TO DATE

    Directory of Open Access Journals (Sweden)

    Rahmatini Rahmatini

    2009-09-01

    Full Text Available AbstrakResep adalah suatu permintaan tertulis dari dokter, dokter gigi atau dokter hewan kepada apoteker untuk membuatkan obat dalam bentuk sediaan tertentu dan menyerahkannya kepada pasien. Resep merupakan perwujudan akhir dari kompetensi, pengetahuan dan keahlian dokter dalam menerapkan pengetahuannya dalam bidang farmakologi dan terapi.Penulisan resep harus ditulis dengan jelas sehingga dapat dibaca oleh petugas di apotek. Resep yang ditulis dengan tidak jelas akan menimbulkan terjadinya kesalahan saat peracikan / penyiapan obat dan penggunaan obat yang diresepkan.Ilmu pengetahuan tentang obat selalu berubah, obat – obat baru selalu muncul di pasaran.Secara umum, seorang dokter harus mengikuti perkembangan dalam terapi obat. Bila muncul efek samping akibat obat yang seharusnya diketahui dan dapat dicegah oleh dokter, maka dokter akan berhadapan dengan hukum.Agar penulisan resep tetap up to date, seorang dokter harus mengumpulkan berbagai informasi yang tersedia. Sumber informasi yang dapat digunakan adalah : Buku acuan, Kompendium obat, Daftar Obat Esensial Nasional (DOEN dan Pedoman terapi, Buletin obat, Jurnal Kedokteran, Pusat informasi obat,Informasi melalui komputer, Sumber informasi dari industri farmasi, dan informasi lisan.Bandingkan kelebihan dan kekurangan berbagai sumber informasi. Tugas seorang dokter adalah melakukan cara terbaik untuk tetap up to date dengan mendaftar sumber informasi yang dapat dimanfaatkan. Carilah sedikitnya satu dari yang berikut ini : (1 jurnal kedokteran: (2 buletin obat; (3 buku acuan farmakologi atau acuan klinis; (4 komisi terapi maupun konsultan, atau lulusan pasca sarjana farmakologi. Dengan bekal pengetahuan dan kemampuan untuk melakukan penilaian secara kritis setiap bentuk informasi, diharapkan dokter tetap up to date dalam menulis resepKata kunci : Resep – up to- date.Abstract Prescription is a written request from a doctor, dentist or veterinarian to the pharmacist to make a particular drug

  15. Suitability of various plant derived gelling agents as agar substitute ...

    African Journals Online (AJOL)

    USER

    2012-06-05

    Jun 5, 2012 ... of three test fungi (Trichoderma harzianum, Alternaria alternata and Alternaria solani) as good as agar. ... used for cell culture, derived from plants or animals and .... and used to jell various foods, drugs and cosmetics) and rice.

  16. Rheological properties of agar and carrageenan from Ghanaian red seaweeds

    DEFF Research Database (Denmark)

    Rhein-Knudsen, Nanna; Ale, Marcel Tutor; Ajalloueian, Fatemeh

    2017-01-01

    spectroscopy (FTIR) analysis on the hydrocolloids extracted from H. musciformis (and K. alvarezii) indicated κ-carrageenan, C. crenulata hydrocolloids were mainly ι-carrageenan, and the H. dentata hydrocolloids were agar. Gelling temperatures ranged from 32 to 36 °C for the κ-carrageenan hydrocolloid samples...... comparable with κ-carrageenan from K. alvarezii, whereas the H. dentata agar properties were different from those of a commercial agar sample. This work shows that certain red seaweed species in Ghana contain hydrocolloids with desirable properties for high value applications....... and Cryptonemia crenulata, expected to hold carrageenan, contained 21–26% by weight of galactose. A commercial Kappaphycus alvarezii carrageenan sample had 30% galactose residues by weight. Hydropuntia dentata, expected to contain agar, contained 15% by weight of galactose-monomers. Fourier transform infrared...

  17. Hichrom candida agar for identification of candida species

    OpenAIRE

    Baradkar V; Mathur M; Kumar S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore for...

  18. Detection of extracellular proteases from microorganisms on agar plates

    Directory of Open Access Journals (Sweden)

    Alane Beatriz Vermelho

    1996-12-01

    Full Text Available We present herein an improved assay for detecting the presence of extracellular proteases from microorganisms on agar plates. Using different substrates (gelatin, BSA, hemoglobin incorporated into the agar and varying the culture medium composition, we were able to detect proteolytic activities from Pseudomonas aeruginosa, Micrococcus luteus and Serratia marcescens as well as the influence that these components displayed in the expression of these enzymes. For all microorganisms tested we found that in agar-BHI or yeast extract medium containing gelatin the sensitivity of proteinase detection was considerably greater than in BSA-agar or hemoglobin-agar. However, when BSA or hemoglobin were added to the culture medium, there was an increase in growth along with a marked reduction in the amount of proteinase production. In the case of M. luteus the incorporation of glycerol in BHI or yeast extract gelatin-agar induced protease liberation. Our results indicate that the technique described here is of value for detecting extracellular proteases directly in the culture medium, by means of a qualitative assay, simple, inexpensive, straight forward method to assess the presence of the proteolytic activity of a given microorganism colony with great freedom in substrate selection.

  19. Thermal characterization of magnetically aligned carbonyl iron/agar composites.

    Science.gov (United States)

    Diaz-Bleis, D; Vales-Pinzón, C; Freile-Pelegrín, Y; Alvarado-Gil, J J

    2014-01-01

    Composites of magnetic particles into polymeric matrices have received increasing research interest due to their capacity to respond to external magnetic or electromagnetic fields. In this study, agar from Gelidium robustum has been chosen as natural biocompatible polymer to build the matrix of the magnetic carbonyl iron particles (CIP) for their uses in biomedical fields. Heat transfer behavior of the CIP-agar composites containing different concentrations (5, 10, 15, 20, 25 and 30% w/w) of magnetically aligned and non-aligned CIP in the agar matrix was studied using photothermal radiometry (PTR) in the back-propagation emission configuration. The morphology of the CIP-agar composites with aligned and non-aligned CIP under magnetic field was also evaluated by scanning electron microscopy (SEM). The results revealed a dominant effect of CIP concentration over the alignment patterns induced by the magnetic field, which agrees with the behavior of the thermal diffusivity and thermal conductivity. Agar served as a perfect matrix to be used with CIP, and CIP-agar composites magnetically aligned at 20% CIP concentration can be considered as promising 'smart' material for hyperthermia treatments in the biomedical field. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Differentiating Agar wood Oil Quality Using Artificial Neural Network

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Nor Azah Mohd Ali; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Agar wood oil is well known as expensive oil extracted from the resinous of fragrant heartwood. The oil is getting high demand in the market especially from the Middle East countries, China and Japan because of its unique odor. As part of an on-going research in grading the agar wood oil quality, the application of Artificial Neural Network (ANN) is proposed in this study to analyze agar wood oil quality using its chemical profiles. The work involves of selected agar wood oil from low and high quality, the extraction of chemical compounds using GC-MS and Z-score to identify of the significant compounds as input to the network. The ANN programming algorithm was developed and computed automatically via Matlab software version R2010a. Back-propagation training algorithm and sigmoid transfer function were used to optimize the parameters in the training network. The result obtained showed the capability of ANN in analyzing the agar wood oil quality hence beneficial for the further application such as grading and classification for agar wood oil. (author)

  1. NATO Advanced Research Workshop on Brilliant Light Facilities and Research in Life and Material Sciences

    CERN Document Server

    Tsakanov, Vasili; Brilliant Light in Life and Material Sciences

    2007-01-01

    The present book contains an excellent overview of the status and highlights of brilliant light facilities and their applications in biology, chemistry, medicine, materials and environmental sciences. Overview papers on diverse fields of research by leading experts are accompanied by the highlights in the near and long-term perspectives of brilliant X-Ray photon beam usage for fundamental and applied research. The book includes advanced topics in the fields of high brightness photon beams, instrumentation, the spectroscopy, microscopy, scattering and imaging experimental techniques and their applications. The book is strongly recommended for students, engineers and scientists in the field of accelerator physics, X-ray optics and instrumentation, life, materials and environmental sciences, bio and nanotechnology.

  2. Reduction of cytotoxicity of benzalkonium chloride and octenidine by Brilliant Blue G

    OpenAIRE

    Bartok, Melinda; Tandon, Rashmi; Alfaro-Espinoza, Gabriela; Ullrich, Matthias S.; Gabel, Detlef

    2015-01-01

    The irritative effects of preservatives found in ophthalmologic solution, or of antiseptics used for skin disinfection is a consistent problem for the patients. The reduction of the toxic effects of these compounds is desired. Brilliant Blue G (BBG) has shown to meet the expected effect in presence of benzalkonium chloride (BAK), a well known preservative in ophthalmic solutions, and octenidine dihydrochloride (Oct), used as antiseptic in skin and wound disinfection. BBG shows a significant p...

  3. TUDOR LUPAŞCU – A BRILLIANT SCIENTIST AND SKILFULL MANAGER

    Directory of Open Access Journals (Sweden)

    Gheorghe Duca

    2010-06-01

    Full Text Available The Moldovan chemical community has recently honoured Professor Tudor LUPAŞCU on the occasion of his 60’s anniversary. Known as brilliant scientist and skilful manager, Professor LUPASCU is now the director of the Institute of Chemistry and one of the founders of the “Chemistry Journal of Moldova”, being the Managing Editor from the very beginning of its activity.

  4. Advanced Oxidation of Tartrazine and Brilliant Blue with Pulsed Ultraviolet Light Emitting Diodes

    OpenAIRE

    Scott, Robert; Mudimbi, Patrick; Miller, Michael E.; Magnuson, Matthew; Willison, Stuart; Phillips, Rebecca; Harper, Willie F.

    2017-01-01

    This study investigated the effect of ultraviolet light-emitting diodes (UVLEDs) coupled with hydrogen peroxide as an advanced oxidation process (AOP) for the degradation of two test chemicals. Brilliant Blue FCF consistently exhibited greater degradation than tartrazine, with 83% degradation after 300 minutes at the 100% duty cycle compared with only 17% degradation of tartrazine under the same conditions. These differences are attributable to the structural properties of the compounds. Duty...

  5. Agar/collagen membrane as skin dressing for wounds

    Energy Technology Data Exchange (ETDEWEB)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing [Biomedical Engineering Institute, Jinan University, Guangzhou (China)], E-mail: tshunqt@jnu.edu.cn, E-mail: tmuss@jnu.edu.cn

    2008-12-15

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 {sup 0}C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  6. Agar/collagen membrane as skin dressing for wounds

    International Nuclear Information System (INIS)

    Bao Lei; Yang Wei; Mao Xuan; Mou Shansong; Tang Shunqing

    2008-01-01

    Agar, a highly hydrophilic polymer, has a special gel property and favorable biocompatibility, but moderate intension strength in an aqueous condition and a low degradation rate. In order to tailor both properties of mechanical intension and degradation, type I collagen was composited with agar in a certain ratio by drying at 50 0 C or by a freeze-dry process. Glutaraldehyde was chosen as a crosslinking agent, and the most favorable condition for crosslinking was that the weight ratio of agar to glutaraldehyde was 66.7 and the pH value about 5. Dynamic mechanical analysis results showed that the single agar membrane had a modulus value between 640 MPa and 1064 MPa, but it was between 340 MPa and 819 MPa after being composited with type I collagen. It was discovered under an optical microscope that the pores were interconnected in the composite scaffolds instead of the honeycomb-like pores in a single type I collagen scaffold or the laminated gaps in a single agar scaffold. The results of an acute toxicity test disclosed that the composites were not toxic to mice although the composites were crosslinked with a certain concentration of glutaraldehyde. The results of gross examinations showed that when the composite membranes or scaffolds were applied to a repair rabbit skin lesion, the composites had a good repair effect without infection, liquid exudation or visible scar in the lesion covered with them. But in the control group, the autologous skin showed necrosis and there were a lot of scar tissues in the lesion site. H and E staining results showed that the repair tissue was similar to the normal one and very few scaffolds or membranes were left without degradation after 2 or 3 weeks. In conclusion, it is proved that type I collagen increases the toughness of the agar membrane, and the agar/type I collagen composites are promising biomaterials as wound dressings for healing burns or ulcers.

  7. Metaphysical green

    DEFF Research Database (Denmark)

    Earon, Ofri

    2011-01-01

    to adapt to urban environment. It explores the potential of Sensation of Green in the city. The paper questions whether the Sensation of Green could introduce a new spectrum of greens, beside the real green. It develops the term of metaphysical green – does green have to be green or can it be only...

  8. Light transfer in agar immobilized microalgae cell cultures

    Science.gov (United States)

    Kandilian, Razmig; Jesus, Bruno; Legrand, Jack; Pilon, Laurent; Pruvost, Jérémy

    2017-09-01

    This paper experimentally and theoretically investigates light transfer in agar-immobilized cell cultures. Certain biotechnological applications such as production of metabolites secreted by photosynthetic microorganisms require cells to be immobilized in biopolymers to minimize contamination and to facilitate metabolite recovery. In such applications, light absorption by cells is one of the most important parameters affecting cell growth or metabolite productivity. Modeling light transfer therein can aid design and optimize immobilized-cell reactors. In this study, Parachlorella kessleri cells with areal biomass concentrations ranging from 0.36 to 16.9 g/m2 were immobilized in 2.6 mm thick agar gels. The average absorption and scattering cross-sections as well as the scattering phase function of P. kessleri cells were measured. Then, the absorption and transport scattering coefficients of the agar gel were determined using an inverse method based on the modified two-flux approximation. The forward model was used to predict the normal-hemispherical transmittance and reflectance of the immobilized-cell films accounting for absorption and scattering by both microalgae and the agar gel. Good agreement was found between the measured and predicted normal-hemispherical transmittance and reflectance provided absorption and scattering by agar were taken into account. Moreover, good agreement was found between experimentally measured and predicted mean rate of photon absorption. Finally, optimal areal biomass concentration was determined to achieve complete absorption of the incident radiation.

  9. Green(ing) infrastructure

    CSIR Research Space (South Africa)

    Van Wyk, Llewellyn V

    2014-03-01

    Full Text Available the generation of electricity from renewable sources such as wind, water and solar. Grey infrastructure – In the context of storm water management, grey infrastructure can be thought of as the hard, engineered systems to capture and convey runoff..., pumps, and treatment plants.  Green infrastructure reduces energy demand by reducing the need to collect and transport storm water to a suitable discharge location. In addition, green infrastructure such as green roofs, street trees and increased...

  10. Photothermal characterization of the gelation process in Gelidium robustum Agar

    Science.gov (United States)

    Freile-Pelegrín, Y.; Bante, J.; Alvarado-Gil, J. J.; Yánez-Limón, J. M.

    2005-06-01

    Agar is a hydrophilic colloid formed by polysaccharides, whose ability to form reversible gels simply by cooling hot aqueous solutions is the most important property and can be regarded as the prototype and model for all gelling systems. In this paper the evolution of the gelation process of agar obtained from algae of the species Gelidium robustum, using the photopyroelectric technique is reported. It is shown that thermal effusivity increase when the agar is cooled, reaching a maximum value around 37°C. The increase in thermal effusivity can be related to the increasing of the bondings in the gel as temperature decreases, reaching the maximum at the gelation point. The decrease of the thermal effusivity at lower temperature could be due to the syneresis process involving a gradual release of water after gelation.

  11. Hichrom candida agar for identification of Candida species.

    Science.gov (United States)

    Baradkar, V P; Mathur, M; Kumar, S

    2010-01-01

    Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%); C. parapsilosis (80 and 98.03%), C. glabrata (90.90 and 88.23%), C. tropicalis (100 and 100%) and C. dubliniensis (60 and 96.55%) respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  12. Hichrom candida agar for identification of candida species

    Directory of Open Access Journals (Sweden)

    Baradkar V

    2010-01-01

    Full Text Available Chromogenic media are frequently used in direct and rapid identification of yeasts because different Candida species produce unique colors on these media. We used 60 isolates of Candida species including 30 C. albicans, 10 C. parapsilosis, 11 C. glabrata, five C. tropicalis, and four C. dubliniensis, isolated from various clinical specimens, to evaluate the performance of HiChrome Candida agar. These strains had been identified by germ tube test, morphology on cornmeal agar, chlamydospore formation on tobacco agar and sugar assimilation tests. The sensitivity and specificity results were: C. albicans (96.55 and 96.42%; C. parapsilosis (80 and 98.03%, C. glabrata (90.90 and 88.23%, C. tropicalis (100 and 100% and C. dubliniensis (60 and 96.55% respectively. HiChrom Candida agaris medium has been useful and capable of presumptive, rapid identification of Candida species within 48 hours.

  13. Assay for adhesion and agar invasion in S. cerevisiae.

    Science.gov (United States)

    Guldal, Cemile G; Broach, James

    2006-11-08

    Yeasts are found in natural biofilms, where many microorganisms colonize surfaces. In artificial environments, such as surfaces of man-made objects, biofilms can reduce industrial productivity, destroy structures, and threaten human life. 1-3 On the other hand, harnessing the power of biofilms can help clean the environment and generate sustainable energy. 4-8 The ability of S. cerevisiae to colonize surfaces and participate in complex biofilms was mostly ignored until the rediscovery of the differentiation programs triggered by various signaling pathways and environmental cues in this organism. 9, 10 The continuing interest in using S. cerevisiae as a model organism to understand the interaction and convergence of signaling pathways, such as the Ras-PKA, Kss1 MAPK, and Hog1 osmolarity pathways, quickly placed S. cerevisiae in the junction of biofilm biology and signal transduction research. 11-20 To this end, differentiation of yeast cells into long, adhesive, pseudohyphal filaments became a convenient readout for the activation of signal transduction pathways upon various environmental changes. However, filamentation is a complex collection of phenotypes, which makes assaying for it as if it were a simple phenotype misleading. In the past decade, several assays were successfully adopted from bacterial biofilm studies to yeast research, such as MAT formation assays to measure colony spread on soft agar and crystal violet staining to quantitatively measure cell-surface adherence. 12, 21 However, there has been some confusion in assays developed to qualitatively assess the adhesive and invasive phenotypes of yeast in agar. Here, we present a simple and reliable method for assessing the adhesive and invasive quality of yeast strains with easy-to-understand steps to isolate the adhesion assessment from invasion assessment. Our method, adopted from previous studies, 10, 16 involves growing cells in liquid media and plating on differential nutrient conditions for growth

  14. PEMBUATAN KARBON AKTIF DARI KULIT JERUK KEPROK (Citrus reticulata UNTUK ADSORBSI PEWARNA REMAZOL BRILLIANT BLUE

    Directory of Open Access Journals (Sweden)

    Asriningtyas Ajeng Erprihana

    2014-12-01

    Full Text Available Limbah kulit jeruk keprok (Citrus reticulata sering dijumpai di industri pembuatan berbagai macam minuman seperti jus, sirup, dan sari buah. Limbah kulit jeruk ini hanya akan dibuang begitu saja dengan jumlah banyak, dan pada akhirnya limbah ini akan mencemari lingkungan. Salah satu upaya peningkatan nilai ekonomis limbah kulit jeruk dapat dilakukan dengan mengolahnya menjadi karbon aktif. Penelitian ini bertujuan untuk menghasilkan karbon aktif dari kulit jeruk keprok dengan aktivasi kimia, luas permukaan, serta mengetahui kemampuannya dalam mengadsorpsi zat warna Remazol Brilliant Blue. Kulit jeruk yang telah dibersihkan dari kotoran, dikeringkan menggunakan oven pada suhu 120oC selama 3 jam. Aktivator yang digunakan dalam penelitian ini adalah H3PO4 dengan rasio massa aktivator : massa karbon 1:1. Aktivasi dilakukan pada temperatur 600oC selama 1 jam, kulit jeruk kemudian dicuci dengan aquades dan dikeringkan menggunakan oven pada suhu 150oC selama 6 jam. Setelah itu, dilakukan uji bilangan iodin terhadap sampel hasil penelitian. Adsorpsi zat warna Remazol Brilliant Blue oleh karbon aktif kulit jeruk dilakukan dengan variasi waktu kontak dan massa karbon aktif untuk mencari kondisi adsorpsi optimum. Kondisi optimum adsorpsi zat warna Remazol Brilliant Blue oleh karbon aktif pada kulit jeruk keprok pada waktu kontak 30 menit dengan massa karbon aktif 1 gram. Karbon aktif dari kulit jeruk keprok memiliki luas permukaan karbon aktif sebesar 529,17 mg/g berdasarkan daya serapnya terhadap larutan iodin. Orange peel (Citrus reticulate waste is often found in industrial manufacturing various kinds of beverages such as juice, syrup, fruit juice. Orange peel waste is just be thrown away with the lot number, and in the end of this waste will pollute the environment. One of the efforts to increase the economic value of orange peel waste by using the process which convert waste into activated carbon. This research aims are to produce activated carbon

  15. Preparation of Agar-Agar from the Red Seaweed Pterocladia capillacea off the Coast of Alexandria, Egypt.

    Science.gov (United States)

    Rao, A V; Bekheet, I A

    1976-10-01

    The effect of different treatments on the quality of agar produced from Pterocladia has been studied, and the conditions for the production of material of good quality have been standardized. In the modified process, sun-bleached seaweed was washed well in water, soaked for 24 h, and then ground to a pulp and rinsed again in water. The pulp was then extracted with water (weed-to-water ratio, 1:30) under pressure for 2 h after adjusting the pH to 6 by the addition of acetic acid. The agar gel, after freeze thawing, was bleached with NaClO before drying in a current of hot air. Pretreatment of the seaweed with alkali at 80 degrees C for 2 h prior to extraction was found to improve the quality of agar to a very great extent.

  16. Epiretinal membrane negative staining and double peeling in a single block with Brilliant Blue G.

    Science.gov (United States)

    Martins, David; Neves, Pedro

    2018-01-01

    To describe a surgical technique for combined peeling of epiretinal and internal limiting membranes. The authors present their procedure of choice for epiretinal membrane surgery: negative staining effect using Brilliant Blue G and single block removal of the epiretinal and internal limiting membranes in a single step. A total of 26 eyes were operated with the described technique. In all cases, the peeling was performed successfully and with no complications. Minimum postoperative follow-up was 12 months. There were no recurrences of epiretinal membranes. The ideal surgical approach for epiretinal membranes should attempt to reduce mechanical trauma, light exposure, and dye toxicity.

  17. Improved isolation of Vibro vulnificus from seawater and sediment with cellobiose-colistin agar

    DEFF Research Database (Denmark)

    Høi, L.; Dalsgaard, Inger; Dalsgaard, A.

    1998-01-01

    An improved selective medium, cellobiose-colistin (CC) agar, gave a significantly higher (P agar, In a total of 446 alkaline peptone water preenrichments amended...... with polymyxin B, V. vulnificus was isolated from 154 preenrichments (35%) with mCPC agar and from 179 preenrichments (40%) with CC agar. CC agar gave a higher plating efficiency of V. vulnificus cells than did cellobiose-polymyxin B-colistin (CPC) agar, mCPC agar, or thiosulfate-citrate-bile salts-sucrose (TCBS......) agar; the only significant difference was observed with TCBS agar, which gave much lower plating efficiencies than the other selective media. Determination of MICs demonstrated that the concentrations of colistin and polymyxin B in CPC agar inhibit growth of a proportion of V. vulnificus strains....

  18. Characterization of Gluten-free Bread Prepared From Maize, Rice and Tapioca Flours using the Hydrocolloid Seaweed Agar-Agar

    OpenAIRE

    Alvarenga, Nuno Bartolomeu; Cebola Lidon, Fernando; Belga, Elisa; Motrena, Patrícia; Guerreiro, Suse; Carvalho, Maria João; Canada, João

    2011-01-01

    Disponível em livre acesso no sítio do DOAJ em http://recent-science.com/index This work aims to check the rheological, physicochemical and sensory characteristics of gluten-free bread produced with corn, rice and tapioca flours, using the hydrocolloid seaweed agar-agar. Relatively to wheat bread, it was found that the pH was slightly lower in gluten-free bread. In the crust only the brightness remained significantly different between both bread types, but in the kernel, the parameters a*,...

  19. Corn and potato starch as an agar alternative for Solanum ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-01-04

    Jan 4, 2010 ... Media with 50, 60 g/l of PS or 60 g/l of CS and 50 g/l of CS + agar at 1 g/l significantly enhanced the ... Skoog (1962) medium supplemented 30 g/l of sucrose and 1 mg/l .... Arregui LM, Veramendi J, Mingo-Castel AM (2003).

  20. How selective are agar cultures for malignant transformation?

    NARCIS (Netherlands)

    Klein, J.C.

    1981-01-01

    In vitro assays that permit cloning of tumour cells in soft agar have been improved during the last 5 years. Two of them are claimed to be useful as test systems for the screening of new anticancer drugs and even for drug sensitivity testing of individual human tumours in devising individualized

  1. Growth of strontium oxalate crystals in agar–agar gel

    Indian Academy of Sciences (India)

    Growth of strontium oxalate crystals in agar–agar gel. P V DALAL. ∗ and K B SARAF. Postgraduate Department of Physics, Pratap College, Amalner 425 401, India. MS received 16 March 2008; revised 5 April 2010. Abstract. Single crystals of strontium oxalate have been grown by using strontium chloride and oxalic acid in.

  2. Retinal Biocompatibility of Brilliant Blue G with Deuterated Water for Chromovitrectomy

    Directory of Open Access Journals (Sweden)

    Emmerson Badaró

    2014-01-01

    Full Text Available Purpose: To investigate the retinal biocompatibility of Brilliant Blue G with deuterated water (BBG-D2O as a vital dye for chromovitrectomy. Methods: In this animal study, 0.05 mL of 0.25 g/L Brilliant Blue G (BBG associated with 0.13 mL/mL of deuterium oxide (D2O was injected intravitreally in the right eye and the same amount of balanced salt solution (BSS was injected similarly in the left eye of rabbits. Clinical examination and histology with light microscopy were performed after seven days. Retinal cell layers were evaluated for morphologic alterations. Electroretinographic (ERG changes were also assessed at baseline and 7 days after the injections. Results: A total of 6 rabbits were included in the study. The gross histopathologic appearance of the retina, choroid, sclera and optic nerve was within normal limits without any sign of severe retinal necrosis or cystic degeneration. Light microscopy showed that BBG-D2O caused no substantial alterations in retinal layers as compared to control eyes. The injection of BBG-D2O did not induce considerable functional ERG alterations. Conclusion: Intravitreal injection of BBG-D2O 0.25 g/L seems to induce no retinal toxicity as documented by lack of functional and histological changes.

  3. Development of a selective agar plate for the detection of Campylobacter spp. in fresh produce.

    Science.gov (United States)

    Yoo, Jin-Hee; Choi, Na-Young; Bae, Young-Min; Lee, Jung-Su; Lee, Sun-Young

    2014-10-17

    This study was conducted to develop a selective medium for the detection of Campylobacter spp. in fresh produce. Campylobacter spp. (n=4), non-Campylobacter (showing positive results on Campylobacter selective agar) strains (n=49) isolated from fresh produce, indicator bacteria (n=13), and spoilage bacteria isolated from fresh produce (n=15) were plated on four Campylobacter selective media. Bolton agar and modified charcoal cefoperazone deoxycholate agar (mCCDA) exhibited higher sensitivity for Campylobacter spp. than did Preston agar and Hunt agar, although certain non-Campylobacter strains isolated from fresh produce by using a selective agar isolation method, were still able to grow on Bolton agar and mCCDA. To inhibit the growth of non-Campylobacter strains, Bolton agar and mCCDA were supplemented with 5 antibiotics (rifampicin, polymyxin B, sodium metabisulfite, sodium pyruvate, ferrous sulfate) and the growth of Campylobacter spp. (n=7) and non-Campylobacter strains (n=44) was evaluated. Although Bolton agar supplemented with rifampicin (BR agar) exhibited a higher selectivity for Campylobacter spp. than did mCCDA supplemented with antibiotics, certain non-Campylobacter strains were still able to grow on BR agar (18.8%). When BR agar with various concentrations of sulfamethoxazole-trimethoprim were tested with Campylobacter spp. (n=8) and non-Campylobacter (n=7), sulfamethoxazole-trimethoprim was inhibitory against 3 of 7 non-Campylobacter strains. Finally, we validated the use of BR agar containing 50mg/L sulfamethoxazole (BRS agar) or 0.5mg/L ciprofloxacin (BRCS agar) and other selective agars for the detection of Campylobacter spp. in chicken and fresh produce. All chicken samples were positive for Campylobacter spp. when tested on mCCDA, BR agar, and BRS agar. In fresh produce samples, BRS agar exhibited the highest selectivity for Campylobacter spp., demonstrating its suitability for the detection of Campylobacter spp. in fresh produce. Copyright

  4. Towards green loyalty: the influences of green perceived risk, green image, green trust and green satisfaction

    Science.gov (United States)

    Chrisjatmiko, K.

    2018-01-01

    The paper aims to present a comprehensive framework for the influences of green perceived risk, green image, green trust and green satisfaction to green loyalty. The paper also seeks to account explicitly for the differences in green perceived risk, green image, green trust, green satisfaction and green loyalty found among green products customers. Data were obtained from 155 green products customers. Structural equation modeling was used in order to test the proposed hypotheses. The findings show that green image, green trust and green satisfaction has positive effects to green loyalty. But green perceived risk has negative effects to green image, green trust and green satisfaction. However, green perceived risk, green image, green trust and green satisfaction also seems to be a good device to gain green products customers from competitors. The contributions of the paper are, firstly, a more complete framework of the influences of green perceived risk, green image, green trust and green satisfaction to green loyalty analyses simultaneously. Secondly, the study allows a direct comparison of the difference in green perceived risk, green image, green trust, green satisfaction and green loyalty between green products customers.

  5. Enzymatic desulfation of the red seaweeds agar by Marinomonas arylsulfatase.

    Science.gov (United States)

    Wang, Xueyan; Duan, Delin; Fu, Xiaoting

    2016-12-01

    Agar and sulfated galactans were isolated from the red seaweeds Gracilariopsis lemaneiformis and Gelidium amansii. A previously purified arylsulfatase from Marinomonas sp. FW-1 was used to remove sulfate groups in agar and sulfated galactans. After enzymatic desulfation, the sulfate content decreased to about 0.16% and gel strength increased about two folds. Moreover, there was no difference between the DNA electrophoresis spectrum on the gel of the arylsulfatase-treated agar and that of the commercial agarose. In order to reveal the desulfation ratio and site, chemical and structural identification of sulfated galactan were carried out. G. amansii sulfated galactan with 7.4% sulfated content was composed of galactose and 3,6-anhydro-l-galactose. Meanwhile, G. lemaneiformis sulfated galactan with 8.5% sulfated content was composed of galactose, 3,6-anhydro-l-galactose, 2-O-methyl-3,6-anhydro-l-galactose and xylose. Data from 13 C NMR, FT-IR, GC-MS provided evidence of sulfate groups at C-4 and C-6 of d-galactose and C-6 of l-galactose both in GRAP and GEAP. Data from GC-MS revealed that desulfation was carried out by the arylsulfatase at the sulfate bonds at C-4 and C-6 of d-galactose and C-6 of l-galactose, with a desulfation ratio of 83.4% and 86.0% against GEAP and GRAP, respectively. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Use of electron beam on aflatoxins degradation in coconut agar

    International Nuclear Information System (INIS)

    Rogovschi, Vladimir D.; Nunes, Thaise C.F.; Villavicencio, Anna L.C.H.; Aquino, Simone; Goncalez, Edlayne; Correa, Benedito

    2009-01-01

    The fungi Aspergillus flavus are capable of producing toxic metabolites, such as aflatoxin, that is one of the most important human carcinogens, according to the 'International Agency for Research on Cancer'. The aim of this study was to compare the effect of electron beam irradiation on degradation of aflatoxin B1 present in laboratorial residues with a dose of 0 kGy and 5.0 kGy. The fungi were cultivated in potato dextrose agar (PDA) for 7 days and transferred to a coconut agar medium, incubated at a temperature of 25 deg C for 14 days to produce the laboratorial wastes (coconut agar) containing aflatoxins. The samples were conditioned in petri dish for radiation treatment of contaminated material and processed in the Electron Accelerator with 0 kGy and 5.0 kGy. Aflatoxin B 1 was extracted with chloroform and separated on a thin layer chromatography plate (TLC) with chloroform: acetone (9:1). All the control and irradiated samples were analyzed in a Shimadzu Densitometer. The detection limit of this methodology is 0.1μg kg -1 . The results indicate that the irradiated samples had a reduction of 75.49 % in the analyzed dose. (author)

  7. Utilization of cocoa pod husk waste as potential adsorbents for Remazol Brilliant Violet 5R removal

    International Nuclear Information System (INIS)

    Tan Tong Siang; Mohd Azmier Ahmad

    2010-01-01

    Removal of Remazol Brilliant Violet 5R (RBV5R) dye from aqueous solution by adsorption onto activated carbon produced from cocoa pod husk (CPH) waste was investigated. Adsorption isotherms were derived at 30 degree Celsius on the basis of batch analysis. Isotherm data were treated according to Langmuir and Freundlich models. Kinetics of adsorption was followed by in situ UV-spectroscopy and the data were treated according to pseudo-first-order and pseudo-second-order models. The fits of experimental data to these equations were examined. It was found that the adsorption process by RVB5R dye onto activated carbon (AC) follows the Freundlich and pseudo-first-order model. (author)

  8. Removal of remazol brilliant blue R dye from aqueous solutions using yeast biomass as biosorbent

    International Nuclear Information System (INIS)

    Barreda-Reyes, Karen L.; Ortega-López, Jocelyn; Ortega-Regules, Ana E.; Santiago-Santiago, Luis A.; Netzahuatl-Muñoz, Alma R.

    2015-01-01

    The main purpose of this study was to obtain kinetic and equilibrium parameters for the anthraquinone dye r emoval of Remazol Brilliant Blue R dye from aqueous solutions using yeast biomass as biosorbent, and identify the functional groups responsible for biosorption by infrared spectrometry. Biosorption dye kinetics at temperatures of 10 °C, 20 °C, 30 °C and 40 °C were fitted correctly by the pseudo-first and pseudo-second order models. The values of thermodynamic activation parameters indicated that the biosorption process is endothermic and no spontaneous. Sorption isotherm at 20 °C, pH 2,0 and a biomass concentration of 1,0 g L-1 was obtained, finding a value of 127,6 mg g-1 for the saturated monolayer according to the Langmuir model. Infrared studies showed that carboxyl and amide are the main functional groups responsible for dye biosorption. (author)

  9. Advanced Oxidation of Tartrazine and Brilliant Blue with Pulsed Ultraviolet Light Emitting Diodes.

    Science.gov (United States)

    Scott, Robert; Mudimbi, Patrick; Miller, Michael E; Magnuson, Matthew; Willison, Stuart; Phillips, Rebecca; Harper, Willie F

    2017-01-01

      This study investigated the effect of ultraviolet light-emitting diodes (UVLEDs) coupled with hydrogen peroxide as an advanced oxidation process (AOP) for the degradation of two test chemicals. Brilliant Blue FCF consistently exhibited greater degradation than tartrazine, with 83% degradation after 300 minutes at the 100% duty cycle compared with only 17% degradation of tartrazine under the same conditions. These differences are attributable to the structural properties of the compounds. Duty cycle was positively correlated with the first-order rate constants (k) for both chemicals but, interestingly, negatively correlated with the normalized first-order rate constants (k/duty cycle). Synergistic effects of both hydraulic mixing and LED duty cycle were manifested as novel oscillations in the effluent contaminant concentration. Further, LED output and efficiency were dependent upon duty cycle and less efficient over time perhaps due to heating effects on semiconductor performance.

  10. BRILLIANT PEBBLES: A METHOD FOR DETECTION OF VERY LARGE INTERSTELLAR GRAINS

    International Nuclear Information System (INIS)

    Socrates, Aristotle; Draine, Bruce T.

    2009-01-01

    A photon of wavelength λ ∼ 1 μm interacting with a dust grain of radius a p ∼ 1 mm (a 'pebble') undergoes scattering in the forward direction, largely within a small characteristic diffraction angle θ s ∼ λ/a p ∼ 100''. Though millimeter-size dust grains contribute negligibly to the interstellar medium's visual extinction, the signal they produce in scattered light may be detectable, especially for variable sources. Observations of light scattered at small angles allow for the direct measurement of the large grain population; variable sources can also yield tomographic information of the interstellar medium's mass distribution. The ability to detect brilliant pebble halos requires a careful understanding of the instrument point-spread function.

  11. Recovery of Lactobacillus bulgaricus and Streptococcus thermophilus on Nine Commonly Used Agar Media1

    Science.gov (United States)

    Moon, Nancy J.; Hamann, A. C.; Reinbold, G. W.

    1974-01-01

    Of the nine media tested, Eugon, Elliker's lactic agar, pH 6.8, and modified tryptic soy broth agars showed superior recovery of Lactobacillus bulgaricus and Streptococcus thermophilus strains. PMID:16350006

  12. Speciation of Candida using chromogenic and cornmeal agar with determination of fluconazole sensitivity

    OpenAIRE

    Saroj Golia; K. Mallika Reddy; K. Sujatha Karjigi; Vivek Hittinahalli

    2013-01-01

    Objective and background: Candidiasis is an important cause of fungal infections. This study was carried out to determine the species incidence using chrom agar & cornmeal agar, susceptibility pattern to fluconazole by microbroth dilution methods of yeasts isolated from the clinical samples. Method: Positive samples for candidiasis where collected from 112 patients at Dr B R AMC from April 2010 to April 2011, processed by routine methods, chrom agar media and corn meal agar was used to spec...

  13. NMR spectroscopy study of agar-based polymers electrolytes

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, R.I.; Tambelli, C.E. [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Fac. de Zootecnia e Engenharia de Alimentos; Raphael, E. [Universidade Federal de Sao Joao del-Rey (UFSJ), MG (Brazil). Dept. de Ciencias Naturais; Silva, I.D.A.; Magon, C.J.; Donoso, J.P. [Universidade de Sao Paulo (IFSC/USP), Sao Carlos, SP (Brazil). Inst. de Fisica

    2012-07-01

    Full text: This communication presents the results of preparation and characterization of transparent films obtained from agar and acetic acid. The films were characterized by electrochemical impedance spectroscopy (EIS) and nuclear magnetic resonance (NMR). The film formed by agar (Sigma Aldrich) was dispersed in water and kept under stirring and heating at 100 deg C. Next, glycerol, formaldehyde and different quantities of acetic acid (25 and 50 wt%) were added to this solution. The obtained solution was placed on a glass plate and left to dry for 48 hours in oven at 50 deg C to obtain the films, which were kept under vacuum before characterization. The ionic conductivity of the films display an Arrhenius behavior with activation energy E{sub a} = 78 (25 wt% of acetic acid) and E{sub a} = 87 kJ/mol (50 wt% of acetic acid). The conductivity values were 3:0 X 10{sup -6} and 1:2 X 10{sup -4} S/cm at room temperature and 4:4 X 10{sup -4} and 1:5 X 10{sup -3}S/cm at 70 deg C, for the 25 and 50 wt% of acetic acid respectively. To investigate the mechanism of protonic conduction in the polymer proton conductor proton NMR measurements were performed in the temperature range 200-370 K. The {sup 1}H-NMR results exhibit the qualitative feature associated with the proton mobility, namely the presence of well defined {sup 1}H spin-lattice relaxation maxima at 300 K. Activation energy of the order of 40 kJ/mol was obtained from the {sup 1}H-NMR line narrowing data. The ionic conductivity of the film combined with their transparency, flexibility, homogeneity and good adhesion to the glasses or metals indicate that agar-based SPEs are promising materials for used on optoelectronic applications. (author)

  14. Quantitative SIMS Imaging of Agar-Based Microbial Communities.

    Science.gov (United States)

    Dunham, Sage J B; Ellis, Joseph F; Baig, Nameera F; Morales-Soto, Nydia; Cao, Tianyuan; Shrout, Joshua D; Bohn, Paul W; Sweedler, Jonathan V

    2018-05-01

    After several decades of widespread use for mapping elemental ions and small molecular fragments in surface science, secondary ion mass spectrometry (SIMS) has emerged as a powerful analytical tool for molecular imaging in biology. Biomolecular SIMS imaging has primarily been used as a qualitative technique; although the distribution of a single analyte can be accurately determined, it is difficult to map the absolute quantity of a compound or even to compare the relative abundance of one molecular species to that of another. We describe a method for quantitative SIMS imaging of small molecules in agar-based microbial communities. The microbes are cultivated on a thin film of agar, dried under nitrogen, and imaged directly with SIMS. By use of optical microscopy, we show that the area of the agar is reduced by 26 ± 2% (standard deviation) during dehydration, but the overall biofilm morphology and analyte distribution are largely retained. We detail a quantitative imaging methodology, in which the ion intensity of each analyte is (1) normalized to an external quadratic regression curve, (2) corrected for isomeric interference, and (3) filtered for sample-specific noise and lower and upper limits of quantitation. The end result is a two-dimensional surface density image for each analyte. The sample preparation and quantitation methods are validated by quantitatively imaging four alkyl-quinolone and alkyl-quinoline N-oxide signaling molecules (including Pseudomonas quinolone signal) in Pseudomonas aeruginosa colony biofilms. We show that the relative surface densities of the target biomolecules are substantially different from values inferred through direct intensity comparison and that the developed methodologies can be used to quantitatively compare as many ions as there are available standards.

  15. The routine use of modified Borelli's lactritmel agar (MBLA).

    Science.gov (United States)

    Kaminski, G W

    1985-07-01

    The original formula of Borelli's lactritmel agar (BLA)(3) which contains wheat flour, milk and honey, has been modified by replacing the wheat flour with dehydrated Bacto Corn Meal Agar (Difco) and by slightly altering the concentrations of the milk and honey. The modified medium (MBLA) is less turbid, less particulate, and easier to prepare than BLA. Although Trichophyton rubrum usually produces a wine-red pigment with BLA, most strains initially produce a yellow pigment, with the red pigment developing later. The corn meal in MBLA reduces this tendency and stimulates the early formation of deep wine red pigment, MBLA enhances sporulation of dermatophytes and various fungi which fail to sporulate on other media, and maintains characteristic growth without developing pleomorphic degeneration. It has been used routinely since 1972 as a reliable aid to the differentiation of T. rubrum and T. mentagrophytes. Since 1975 selective MBLA has been used as a routine primary isolation medium for dermatophytes, and has proved to be most useful.

  16. Borelli's lactritmel agar induces conidiation in rare-macroconidia producing dermatophytic fungi.

    Science.gov (United States)

    Ilkit, Macit; Gümral, Ramazan; Döğen, Aylin

    2012-10-01

    Macroconidia are among the most important indicators used to identify dermatophytic fungi, but several do not usually sporulate and/or produce macroconidia on Sabouraud glucose agar. Specifically, Microsporum audouinii, M. ferrugineum, Trichophyton concentricum, T. schoenleinii, T. verrucosum, and T. violaceum (including T. soudanense and T. yaoundei) rarely form macroconidia and, therefore, cannot be easily identified. In this study, we investigated the production of macroconidia on nine common laboratory media, including Borelli's lactritmel agar (BLA), modified Borelli's lactritmel agar (MBLA), brain heart infusion agar (BHIA), Christensen's urease agar in Petri dishes (UPA), cornmeal dextrose agar (CMDA), Lowenstein-Jensen agar (LJA), malt extract agar (MEA), oatmeal agar (OA), and potato dextrose agar (PDA). The performance of these media was evaluated using 18 rare-macroconidia producing isolates, including representative of the six species mentioned above. All cultures in this study were incubated at 26°C on the bench, and conidia formation on each was investigated at 5, 10, 15, 20, 25, and 30 days of incubation. BLA apparently improved macroconidia production after 15 days and was the most useful nutrient agar medium to induce these phenotypic characters in daily practice, closely followed by OA, PDA, and MBLA.

  17. Element distribution of the barley plant grown in an agar slice suspended culture

    International Nuclear Information System (INIS)

    Makino-Nakanishi, Tomoko; Matsumoto, Satoshi

    1991-01-01

    An agar slice suspended culture was devised for the further study of the barley root. The roots were placed into an agar covered with a nylon cloth and suspended in a water culture vessel. Barley roots grown in the agar developed hardly any root hair. The element contents of the root grown in the agar culture and that in the water culture were measured by neutron activation analysis. The concentrations of K, Mg and Cl in the root grown in the agar were about half of these grown in the water. Na and Mn concentrations were the same and Ca concentration was slightly higher when grown in the agar. The agar system is expected to provide more information to study the root hair. (author)

  18. Reduction of cytotoxicity of benzalkonium chloride and octenidine by Brilliant Blue G.

    Science.gov (United States)

    Bartok, Melinda; Tandon, Rashmi; Alfaro-Espinoza, Gabriela; Ullrich, Matthias S; Gabel, Detlef

    2015-01-01

    The irritative effects of preservatives found in ophthalmologic solution, or of antiseptics used for skin disinfection is a consistent problem for the patients. The reduction of the toxic effects of these compounds is desired. Brilliant Blue G (BBG) has shown to meet the expected effect in presence of benzalkonium chloride (BAK), a well known preservative in ophthalmic solutions, and octenidine dihydrochloride (Oct), used as antiseptic in skin and wound disinfection. BBG shows a significant protective effect on human corneal epithelial (HCE) cells against BAK and Oct toxicity, increasing the cell survival up to 51 % at the highest BAK or Oct concentration tested, which is 0.01 %, both at 30 min incubation. Although BBG is described as a P2x7 receptor antagonist, other selective P2x7 receptor antagonists, OxATP (adenosine 5'-triphosphate-2',3'-dialdehyde) and DPPH (N'-(3,5-dichloropyridin-4-yl)-3-phenylpropanehydrazide), did not reduce the cytotoxicity of neither BAK nor Oct. Therefore we assume that the protective effect of BBG is not due to its action on the P2x7 receptor. Brilliant Blue R (BBR), a dye similar to BBG, was also tested for protective effect on BAK and Oct toxicity. In presence of BAK no significant protective effect was observed. Instead, with Oct a comparable protective effect was seen with that of BBG. To assure that the bacteriostatic effect is not affected by the combinations of BAK/BBG, Oct/BBG and Oct/BBR, bacterial growth inhibition was analyzed on different Gram-negative and Gram-positive bacteria. All combinations of BAK or Oct with BBG hinder growth of Gram-positive bacteria. The combinations of 0.001 % Oct and BBR above 0.025 % do not hinder the growth of B. subtilis. For Gram-negative bacteria, BBG and BBR reduce, but do not abolish, the antimicrobial effect of BAK nor of Oct. In conclusion, the addition of BBG at bacterial inhibitory concentrations is suggested in the ready-to-use ophthalmic preparations and antiseptic solutions.

  19. Comparative study of bio-ethanol production from mahula (Madhuca latifolia L.) flowers by Saccharomyces cerevisiae cells immobilized in agar agar and Ca-alginate matrices

    Energy Technology Data Exchange (ETDEWEB)

    Behera, Shuvashish; Mohanty, Rama Chandra [Department of Botany, Utkal University, Vani Vihar, Bhubaneswar 751004, Orissa (India); Kar, Shaktimay; Ray, Ramesh Chandra [Microbiology Laboratory, Central Tuber Crops Research Institute (Regional Centre), Bhubaneswar 751019, Orissa (India)

    2010-01-15

    Batch fermentation of mahula (Madhuca latifolia L., a tree commonly found in tropical rain forest) flowers was carried out using immobilized cells (in agar agar and calcium alginate) and free cells of Saccharomyces cerevisiae. The ethanol yields were 151.2, 154.5 and 149.1 g kg{sup -1} flowers using immobilized (in agar agar and calcium alginate) and free cells, respectively. Cell entrapment in calcium alginate was found to be marginally superior to those in agar agar (2.2% more) as well as over free cell (3.5% more) as regard to ethanol yield from mahula flowers is concerned. Further, the immobilized cells were physiologically active at least for three cycles [150.6, 148.5 and 146.5 g kg{sup -1} (agar agar) and 152.8, 151.5 and 149.5 g kg{sup -1} flowers (calcium alginate) for first, second and third cycle, respectively] of ethanol fermentation without apparently lowering the productivity. Mahula flowers, a renewable, non-food-grade cheap carbohydrate substrate from non-agricultural environment such as forest can serve as an alternative to food grade sugar/starchy crops such as maize, sugarcane for bio-ethanol production. (author)

  20. Development of edible films from tapioca starch and agar, enriched with red cabbage (Brassica oleracea) as a sausage deterioration bio-indicator

    Science.gov (United States)

    Aditya Wardana, Ata; Dewanti Widyaningsih, Tri

    2017-12-01

    Sausage spoilage has been identified as a cause of some food poisoning cases. Development of a bioindicator film is one of the alternative methods to detect sausage deterioration. The objectives of this paper were to develop a bioindicator edible films (BEF) from tapioca starch (TS), agar, and red cabbage juice (RC), and to evaluate its performance on sausage deterioration detection. The experiment had a 3x3 randomized factorial experimental design (agar: 3, 5, 7% by weight of TS; RC: 10, 15, 20% v/v based on 100% of suspension). Glycerol was used as the plasticizer. The results showed that the addition of agar into the film solution increased the thickness, elongation, and tensile strength, and decreased water vapour transmission rate (WVTR). While the addition of RC increased the thickness, but decreased elongation, tensile strength, and WVTR. BEF consisting of 2% tapioca starch, 7% (w/w) agar and 10 % (v/v) RC was chosen to apply on sausage. It could detect an increase in the microbial population and in the pH variations as result of sausage deterioration at 24, 48, and 72 h shown through color changes of BEF from bright purple at 0 h to light purple, dark purple-blue, and purple-green color respectively.

  1. Effect of heavy metals ondecolorization of reactive brilliant red by newly isolated microorganisms

    International Nuclear Information System (INIS)

    Nosheen, S.; Arshad, M.

    2011-01-01

    This study involves aerobic decolorisation of reactive azo dye reactive brilliant red 2KBP by newly isolated microbial strains (two bacterial and one fungal strain) in presence of heavy metals including cobalt chloride, ferric chloride, zinc sulphate, copper sulphate and nickel chloride. Many heavy metals are necessary for microbial growth and are required in very small amounts however at higher levels they become toxic. So was the objective of present work to check the effect of concentration of heavy metals on the potential of microbial strains to decolorize azo dyes. All the heavy metals under consideration were added in range of 0.5 gl-1-2.5gl/sup -1/. All heavy metals showed inhibitory effect on decolorization capacity of bacterial as well as fungal strain .At optimum conditions bacterial strains named as B1 and B2 removed 84% and 78% while fungal strain decolorized 90.4% of dye. Cobalt and nickel showed greater inhibitors on% decolorization of dyes than Zinc and iron. Fungal strain showed greater negative effect. Heavy metals might affect enzyme activities and thus reducing removal of dye. (author)

  2. High resolution laser micro sintering / melting using q-switched and high brilliant laser radiation

    Science.gov (United States)

    Exner, H.; Streek, A.

    2015-03-01

    Since the discovery of selective laser sintering/melting, numerous modifications have been made to upgrade or customize this technology for industrial purposes. Laser micro sintering (LMS) is one of those modifications: Powders with particles in the range of a few micrometers are used to obtain products with highly resolved structures. Pulses of a q-switched laser had been considered necessary in order to generate sinter layers from the micrometer scaled metal powders. LMS has been applied with powders from metals as well as from ceramic and cermet feedstock's to generate micro parts. Recent technological progress and the application of high brilliant continuous laser radiation have now allowed an efficient laser sintering/melting of micrometer scaled metal powders. Thereby it is remarkable that thin sinter layers are generated using high continuous laser power. The principles of the process, the state of the art in LMS concerning its advantages and limitations and furthermore the latest results of the recent development of this technology will be presented. Laser Micro Sintering / Laser Micro Melting (LMM) offer a vision for a new dimension of additive fabrication of miniature and precise parts also with application potential in all engineering fields.

  3. Coomassie Brilliant Blue G-250 Dye: An Application for Forensic Fingerprint Analysis.

    Science.gov (United States)

    Brunelle, Erica; Le, Anh Minh; Huynh, Crystal; Wingfield, Kelly; Halámková, Lenka; Agudelo, Juliana; Halámek, Jan

    2017-04-04

    The Bradford reagent, comprised of the Coomassie Brilliant Blue G-250 dye, methanol, and phosphoric acid, has been traditionally used for quantifying proteins. Use of this reagent in the Bradford assay relies on the binding of the Coomassie Blue G-250 dye to proteins. However, the ability of the dye to react with a small group of amino acids (arginine, histidine, lysine, phenylalanine, tyrosine, and tryptophan) makes it a viable chemical assay for fingerprint analysis in order to identify the biological sex of the fingerprint originator. It is recognized that the identification of biological sex has been readily accomplished using two other methods; however, both of those systems are reliant upon a large group of amino acids, 23 to be precise. The Bradford assay, described here, was developed specifically to aid in the transition from targeting large groups of amino acids, as demonstrated in the previous studies, to targeting only a single amino acid without compromising the intensity of the response and/or the ability to differentiate between two attributes. In this work, we aim to differentiate between female fingerprints and male fingerprints.

  4. Decolorization and biodegradation of remazol brilliant blue R by bilirubin oxidase.

    Science.gov (United States)

    Liu, Youxun; Huang, Juan; Zhang, Xiaoyu

    2009-12-01

    The dye-decolorizing potential of bilirubin oxidase (BOX) was demonstrated for an anthraquinone dye, remazol brilliant blue R (RBBR). The dye was decolorized 40% within 4 h by the BOX alone, whereas it was more efficient in the presence of 2, 2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS), showing 91.5% decolorization within 25 min. The effects of operational parameters on decolorization were examined. The results showed that the decolorization efficiency decreased with increasing RBBR concentration, and a marked inhibition effect was exhibited when the dye concentrations were above 100 mg l(-1). The optimum temperature for enzymatic decolorization was 40 degrees C. BOX showed efficient decolorization of the dye with a wide pH range of 5-8.5. The maximum decolorization activity occurred at pH 8 with ABTS and at pH 5 without ABTS. Analysis of RBBR ultraviolet and visible (UV-VIS) spectra after BOX treatment indicated that the decolorization of RBBR was due to biodegradation. Our results suggested that ABTS can serve as an electron mediator to facilitate the oxidation of RBBR, and the BOX-ABTS mediator-involved dye decolorization mechanism was similar to that of laccase. Operation over a wide range of pH and efficient decolorization suggested that the BOX can be used to decolorize synthetic dyes from effluents, especially for anthraquinonic dyes.

  5. Green Tourism

    OpenAIRE

    Hasan, Ali

    2014-01-01

    Green tourism is defined as environmentally friendly tourism activities with various focuses and meanings. In a broad term, green tourism is about being an environmentally friendly tourist or providing environmentally friendly tourist services. The green tourism concept would be highly appealing to tourism enterprises and operators owing to increasing governmental pressure to improve environmental performance by adopting effective and tangible environmental management techniques. Green to...

  6. Metaphysical green

    OpenAIRE

    Earon, Ofri

    2011-01-01

    “Sensation of Green is about the mental process like touching, seeing, hearing, or smelling, resulting from the immediate stimulation of landscape forms, plants, trees, wind and water. Sensation of Green triggers a feeling of scale, cheerfulness, calmness and peace. The spatial performance of Sensation of Green is created by a physical interaction between the language of space and the language of nature” The notion of Sensation of Green was developed through a previous study ‘Learning from th...

  7. Adsorption Behavior and Kinetic Characteristic of Cibacron Brilliant Red 3B-A by Granular Activated Carbon

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jong Jib [Kongju National University, Cheonan (Korea, Republic of)

    2014-08-15

    In this paper, the adsorption behavior and kinetic characteristics of cibacron brilliant red 3B-A from aqueous solution using granular activated carbon were investigated. The effect of various parameters such as adsorbent dose, pH, initial concentration, contact time and temperature on the adsorption system were studied. Base on the estimated Langmuir constant (R{sub L}) and Freundlich constant (1/n), This process could be employed as effective treatment method. From the Temkin constant (B) and Dubinin-Radushkevich constant (E), This adsorption process is physical adsorption. From kinetic experiments, the adsorption process followed the pseudo second order model with good correlation. Base on the Gibbs free energy and enthalpy, the adsorption of cibacron brilliant red 3B-A onto granular activated carbon was physisorption and endothermic in nature.

  8. Adsorption Behavior and Kinetic Characteristic of Cibacron Brilliant Red 3B-A by Granular Activated Carbon

    International Nuclear Information System (INIS)

    Lee, Jong Jib

    2014-01-01

    In this paper, the adsorption behavior and kinetic characteristics of cibacron brilliant red 3B-A from aqueous solution using granular activated carbon were investigated. The effect of various parameters such as adsorbent dose, pH, initial concentration, contact time and temperature on the adsorption system were studied. Base on the estimated Langmuir constant (R L ) and Freundlich constant (1/n), This process could be employed as effective treatment method. From the Temkin constant (B) and Dubinin-Radushkevich constant (E), This adsorption process is physical adsorption. From kinetic experiments, the adsorption process followed the pseudo second order model with good correlation. Base on the Gibbs free energy and enthalpy, the adsorption of cibacron brilliant red 3B-A onto granular activated carbon was physisorption and endothermic in nature

  9. Calibration of the BASS acoustic current meter with carrageenan agar

    Science.gov (United States)

    Morrison, A.T.; Williams, A.J.; Martini, M.

    1993-01-01

    The BASS current meter can measure currents down to the millimeter per second range. Due to the dependence of zero offset on pressure, determining a sensor referenced velocity requires accurate in situ zeroing of the meter. Previously, flow was restricted during calibration by placing plastic bags around the acoustic volume. In this paper, bacterial grade and carrageenan agars are used in the laboratory to create a zero flow condition during calibration and are shown to be acoustically transparent. Additionally, the results of open ocean and dockside carrageenan and plastic bag comparisons are presented. Carrageenan is shown to reliably provide a low noise, zero mean flow environment that is largely independent of ambient conditions. The improved zeros make millimeter per second accuracy possible under field conditions.

  10. Aqueous Two-Phase Systems: A New Approach for the Determination of Brilliant Blue FCF in Water and Food Samples

    Directory of Open Access Journals (Sweden)

    Sabah Shiri

    2013-01-01

    Full Text Available A novel, simple, and more sensitive spectrophotometric procedure has been developed for the determination of brilliant blue FCF in water and food samples by an aqueous two-phase system (ATPS. In this method, adequate amount of polyethylene glycol/ sodium carbonate (PEG-4000/Na2CO3 was added to aqueous solution for formation of a homogeneous solution. To the mixture solution, suitable amount of Na2CO3 was added, the mixture solution was shaken until the salt was dissolved, and then it was separated into two clear phases easily and rapidly. The target analyte in the water sample was extracted into the polyethylene glycol phase. After extraction, measuring the absorbance at 634 nm was done. The effects of different parameters such as polyethylene glycol (type and concentration, pH, salt (type and amount, centrifuge time, and temperature on the ATPS of dye was investigated and optimum conditions were established. Linear calibration curves were obtained in the range of 0.25–750 ng/mL for brilliant blue FCF under optimum conditions. Detection limit based on three times the standard deviation of the blank (3Sb was 0.12 ng/mL. The relative standard deviation (RSD for 400 ng/mL was 3.14%. The method was successfully applied to the determination of brilliant blue FCF in spiked samples with satisfactory results. The relative recovery was between 96.0 and 102.2%.

  11. Determination of green, blue and yellow artificial food colorants and their abuse in herb-coloured green Easter beers on tap.

    Science.gov (United States)

    Stachová, Ivana; Lhotská, Ivona; Solich, Petr; Šatínský, Dalibor

    2016-07-01

    Beer is one of the most popular alcoholic beverages worldwide. For consumer acceptance, significant factors are its taste, flavour and colour. This study determines selected synthetic green, blue and yellow food colorants in popular Easter herb-coloured green beers on tap produced in breweries on Holy Thursday. The abuse of beer colouring with Tartrazine (E 102), Quinoline yellow (E 104), Sunset yellow (E 110), Patent blue (E 131), Indigo carmine (E 132), Brilliant blue FCF (E 133), Green S (E 142) and Fast green FCF (E 143) was assessed in 11 green beer samples purchased in local restaurants. HPLC was used for the separation and detection of artificial colorants with diode-array detection and a Chromolith Performance CN 100 × 4.6 mm column with guard pre-column Chromolith CN 5 × 4.6 mm. Separation was performed in gradient elution with mobile phase containing methanol-aqueous 2% ammonium acetate at pH 7.0. The study showed that eight beers (70%) marketed in the Czech Republic contained artificial colorants (Tartrazine and Brilliant blue FCF). The concentration of colorants found in analysed green herb-coloured beers ranged from 1.58 to 3.49 mg l(-)(1) for Tartrazine, 0.45-2.18 mg l(-)(1) for Brilliant blue, while Indigo carmine was detected only once at concentration 2.36 mg l(-)(1). Only three beers showed no addition of the synthetic colorants. However, the levels of artificial colorants found in beers marketed in the Czech region were very low and did not show a serious risk for consumers' health.

  12. Metaphysical green

    DEFF Research Database (Denmark)

    Earon, Ofri

    2011-01-01

    example is a tiny Danish summer house from 1918 . The second example is ‘House before House’ , in Tokyo. The third example is a prefabricated house ‘CHU’ . The analysis evaluates the characteristics of diverse tones of green – from green image to green sensation. The analysis is based on the original...... of Sensation of Green is created by a physical interaction between the language of space and the language of nature” The notion of Sensation of Green was developed through a previous study ‘Learning from the Summer House’ investigating the unique architectural characteristics of the Danish summer houses...... the Sensation of Green? Three existing examples are agents to this discussion. The first example is a Danish summer house. The other two are international urban examples. While the summer house articulates the original meaning of Sensation of Green, the urban examples illustrate its urban context. The first...

  13. Antibacterial activity of the crude extract of Chinese green tea ...

    African Journals Online (AJOL)

    Antibacterial activity of the crude extract of Chinese green tea (Camellia sinensis) on Listeria monocytogenes. TI Mbata, LU Debiao, A Saikia. Abstract. The antibacterial activity of the methanol and aqueous extract of Camellia sinensis on Listeria monocytogenes were investigated using agar-gel diffusion, paper disk ...

  14. Coomassie Brilliant Blue G is a more potent antagonist of P2 purinergic responses than Reactive Blue 2 (Cibacron Blue 3GA) in rat parotid acinar cells

    International Nuclear Information System (INIS)

    Soltoff, S.P.; McMillian, M.K.; Talamo, B.R.

    1989-01-01

    The ability of Brilliant Blue G (Coomassie Brilliant Blue G) and Reactive Blue 2 (Cibacron Blue 3GA) to block the effects of extracellular ATP on rat parotid acinar cells was examined by evaluating their effects on ATP-stimulated 45Ca 2+ entry and the elevation of [Ca 2+ ]i (Fura 2 fluorescence). ATP (300 microM) increased the rate of Ca 2+ entry to more than 25-times the basal rate and elevated [Ca 2+ ]i to levels more than three times the basal value. Brilliant Blue G and Reactive Blue 2 greatly reduced the entry of 45 Ca 2+ into parotid cells, but the potency of Brilliant Blue G (IC50 approximately 0.4 microM) was about 100-times that of Reactive Blue 2. Fura 2 studies demonstrated that inhibitory concentrations of these compounds did not block the cholinergic response of these cells, thus demonstrating the selectivity of the dye compounds for purinergic receptors. Unlike Reactive Blue 2, effective concentrations of Brilliant Blue G did not substantially quench Fura 2 fluorescence. The greater potency of Brilliant Blue G suggests that it may be very useful in identifying P2-type purinergic receptors, especially in studies which utilize fluorescent probes

  15. Intense, brilliant micro γ-beams in nuclear physics and applications

    Science.gov (United States)

    Habs, D.; Gasilov, S.; Lang, C.; Thirolf, P. G.; Jentschel, M.; Diehl, R.; Schroer, C.; Barty, C. P. J.; Zamfir, N. V.

    2011-06-01

    900, we can obtain small spots for each of the beamlets. While focusing the beamlets to a much smaller spot size, we can bend them effectively with micro wedges to e.g. parallel beamlets. We can monochromatize these γ beamlets within the rocking curve of a common Laue crystal, using an additional angle selection by a collimator to reach a strongly reduced band width of 10-4 - 10-6. We propose the use of a further lens/wedge arrays or Bragg reflection to superimpose the beamlets to a very small total γ beam spot. Many experiments gain much from the high beam resolution and the smaller focal spot. This new γ optics requires high resolution diagnostics, where we want to optimize the focusing, using very thin target wires of a specific nuclear resonance fluorescence (NRF) isotope to monitor the focusing for the resonance energy. With such beams we can explore new nuclear physics of higher excited states with larger level densities. New phenomena, like the transition from chaotic to regular nuclear motion, weakly-bound halo states or states decaying by tunneling can be studied. The higher level density also allows to probe parity violating nuclear forces more sensitively. This γ optics improves many applications, like a more brilliant positron source, a more brilliant neutron source, higher specific activity of medical radioisotopes or NRF micro-imaging.

  16. Comparison of different fungal agar for the environmental monitoring of pharmaceutical-grade cleanrooms.

    Science.gov (United States)

    Gebala, Barbara; Sandle, Tim

    2013-01-01

    In relation to a growth in reported incidents of fungal contamination of pharmaceutical products, there has been a developing interest by U.S. and U.K. regulators concerning the risk of fungi. This paper describes a study undertaken to examine the suitability of different commercially available mycological agars for the environmental monitoring of pharmaceutical-grade cleanrooms. Five agars were evaluated in relation to the detection of both numbers and different species of fungi (yeasts and moulds). The objective was to determine if one mycological medium is more suitable than another. Data was collected using different sampling techniques (settle plates, active air samples, and contact plates) from different locations within representative cleanrooms. Samples were taken over a 3 month time period. The study results indicated that fungi are not distributed evenly across cleanrooms and that that the prevalence of fungi partly relates to the room design and operation. In relation to the different agar types, the study indicated that Sabouraud dextrose agar was the most effective at detecting the widest number of different types of isolates, and that Sabouraud dextrose agar and malt extract agar were the most efficient in terms of the numbers of recovered isolates. Other media, notably potato dextrose agar, was relatively less effective. There has been an increased regulatory concern about the presence of fungi in cleanrooms. Some environmental monitoring regimes are not especially orientated towards the examination of fungi, and it may be that special agars are required. Given the choice of different agars available, this paper outlines a case study where different fungal agars were evaluated. The study showed that Sabouraud dextrose agar was the optimal agar.

  17. Brilliant radiation sources by laser-plasma accelerators and optical undulators

    Energy Technology Data Exchange (ETDEWEB)

    Debus, Alexander

    2012-09-06

    This thesis investigates the use of high-power lasers for synchrotron radiation sources with high brilliance, from the EUV to the hard X-ray spectral range. Hereby lasers accelerate electrons by laser-wakefield acceleration (LWFA), act as optical undulators, or both. Experimental evidence shows for the first time that LWFA electron bunches are shorter than the driving laser and have a length scale comparable to the plasma wavelength. Furthermore, a first proof of principle experiment demonstrates that LWFA electrons can be exploited to generate undulator radiation. Building upon these experimental findings, as well as extensive numerical simulations of Thomson scattering, the theoretical foundations of a novel interaction geometry for laser-matter interaction are developed. This new method is very general and when tailored towards relativistically moving targets not being limited by the focusability (Rayleigh length) of the laser, while it does not require a waveguide. In a theoretical investigation of Thomson scattering, the optical analogue of undulator radiation, the limits of Thomson sources in scaling towards higher peak brilliances are highlighted. This leads to a novel method for generating brilliant, highly tunable X-ray sources, which is highly energy efficient by circumventing the laser Rayleigh limit through a novel traveling-wave Thomson scattering (TWTS) geometry. This new method suggests increases in X-ray photon yields of 2-3 orders of magnitudes using existing lasers and a way towards efficient, optical undulators to drive a free-electron laser. The results presented here extend far beyond the scope of this work. The possibility to use lasers as particle accelerators, as well as optical undulators, leads to very compact and energy efficient synchrotron sources. The resulting monoenergetic radiation of high brilliance in a range from extreme ultraviolet (EUV) to hard X-ray radiation is of fundamental importance for basic research, medical

  18. Brilliant radiation sources by laser-plasma accelerators and optical undulators

    International Nuclear Information System (INIS)

    Debus, Alexander

    2012-01-01

    This thesis investigates the use of high-power lasers for synchrotron radiation sources with high brilliance, from the EUV to the hard X-ray spectral range. Hereby lasers accelerate electrons by laser-wakefield acceleration (LWFA), act as optical undulators, or both. Experimental evidence shows for the first time that LWFA electron bunches are shorter than the driving laser and have a length scale comparable to the plasma wavelength. Furthermore, a first proof of principle experiment demonstrates that LWFA electrons can be exploited to generate undulator radiation. Building upon these experimental findings, as well as extensive numerical simulations of Thomson scattering, the theoretical foundations of a novel interaction geometry for laser-matter interaction are developed. This new method is very general and when tailored towards relativistically moving targets not being limited by the focusability (Rayleigh length) of the laser, while it does not require a waveguide. In a theoretical investigation of Thomson scattering, the optical analogue of undulator radiation, the limits of Thomson sources in scaling towards higher peak brilliances are highlighted. This leads to a novel method for generating brilliant, highly tunable X-ray sources, which is highly energy efficient by circumventing the laser Rayleigh limit through a novel traveling-wave Thomson scattering (TWTS) geometry. This new method suggests increases in X-ray photon yields of 2-3 orders of magnitudes using existing lasers and a way towards efficient, optical undulators to drive a free-electron laser. The results presented here extend far beyond the scope of this work. The possibility to use lasers as particle accelerators, as well as optical undulators, leads to very compact and energy efficient synchrotron sources. The resulting monoenergetic radiation of high brilliance in a range from extreme ultraviolet (EUV) to hard X-ray radiation is of fundamental importance for basic research, medical

  19. EVALUACIÓN POR MÉTODO ECOMÉTRICO DE AGAR OBTENIDO DE ALGAS ROJAS COLOMBIANAS

    Directory of Open Access Journals (Sweden)

    A. Villalobos

    2007-12-01

    Full Text Available The purpose of this study was to evaluate the productivity on agar-agar of two species of red algae of thegenera Gracilaria belonging from the Colombiam Caribean coast (G. cylindrica and G. mammillarisobtained in laboratory. Productivity of culture media elaborated with base agar - agar was determinedusing the ecometric method with 20 different bacterial species. Results obtained from ICA and ICRshowed that agar extracted from Gracilaria cylindrica and Gracillaria mammillaris are equally productive,this shows that both species can be used for agar production. For better results, it is still necessary tooptimize extraction processes and purification of agar in both species of algae.

  20. Screening agars for MRSA: evaluation of a stepwise diagnostic approach with two different selective agars for the screening for methicillin-resistant Staphylococcus aureus (MRSA).

    Science.gov (United States)

    Micheel, Volker; Hogan, Benedikt; Köller, Thomas; Warnke, Philipp; Crusius, Sabine; Hinz, Rebecca; Hagen, Ralf Matthias; Schwarz, Norbert Georg; Frickmann, Hagen

    2015-01-01

    Colonization with methicillin-resistant Staphylococcus aureus (MRSA) poses a hygiene risk that does not spare field hospitals or military medical field camps during military deployments. Diagnostic options for unambiguously identifying MRSA isolates are usually scarce in military environments. In this study, we assessed the stepwise application of two different selective agars for the specific identification of MRSA in screening analyses. Nasal swabs from 1541 volunteers were subjected to thioglycollate broth enrichment and subsequently screened on CHROMagar MRSA selective agar for the identification of MRSA. The MRSA identity of suspicious-looking colonies was confirmed afterwards or excluded by another selective agar, chromID MRSA. All isolates from the selective agars with MRSA-specific colony morphology were identified by biochemical methods and mass spectrometry. The initial CHROMagar MRSA screening identified suspicious colonies in 36 out of 1541 samples. A total of 25 of these 36 isolates showed MRSA-like growth on chromID agar. Out of these 25 isolates, 24 were confirmed as MRSA, while one isolate was identified as Staphylococcus kloosii. From the 11 strains that did not show suspicious growth on chromID agar, 3 were methicillin-sensitive Staphylococcus aureus (MSSA, with one instance of co-colonization with Corynebacterium spp.), 2 were confirmed as MRSA (with 1 instance of co-colonization with MSSA), 2 were lost during passaging and could not be re-cultured, one could not be identified by the applied approaches, and the remaining 3 strains were identified as Staphylococcus saprophyticus, Staphylococcus hominis (co-colonized with Macrococcus caseolyticus) and Staphylococcus cohnii, respectively. The application of the selective agar CHROMagar MRSA alone proved to be too non-specific to allow for a reliable diagnosis of the presence of MRSA. The combined use of two selective agars in a stepwise approach reduced this non-specificity with an acceptably low

  1. Green Chemistry

    Energy Technology Data Exchange (ETDEWEB)

    Collison, Melanie

    2011-05-15

    Green chemistry is the science of chemistry used in a way that will not use or create hazardous substances. Dr. Rui Resendes is working in this field at GreenCentre Canada, an offshoot of PARTEQ Innovations in Kingston, Ontario. GreenCentre's preliminary findings suggest their licensed product {sup S}witchable Solutions{sup ,} featuring 3 classes of solvents and a surfactant, may be useful in bitumen oil sands extraction.

  2. Green roofs

    CSIR Research Space (South Africa)

    Van Wyk, Llewellyn V

    2010-04-01

    Full Text Available , beetles and spiders); and the number of birds that nest in vegetated roofs (including kestrels, swallows, and wagtails). Objective The primary objective of a green roof is to create a living habitat in an otherwise barren environment, hence the use... the negative environmental impacts including plant and insect specie loss. Thus at a philosophical level green roofs support the notion “replace what you displace”. Key ecological issues that can be addressed through green roofs include: Negative effects...

  3. Agar dilution method for susceptibility testing of Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    Marta C de Castillo

    1996-12-01

    Full Text Available The antibiotic susceptibilities of Neisseria gonorrhoeae isolates obtained from patients attending a clinic for sexually transmitted diseases in Tucumán, Argentina, were determined by the agar dilution method (MIC. 3.5% of the isolates produced ²-lactamase. A total of 96.5% of ²-lactamase negative isolates tested were susceptible to penicillin (MIC < 2 µgml-1; 14.03% of the tested isolates were resistant to tetracycline (MIC < 2 µgml-1, and 98% of the tested isolates were susceptible to spectinomycin (MIC < 64 µgml-1. The MICs for 95% of the isolates, tested for other drugs were: < 2 µgml-1 for cefoxitin, < 0.06 µgml-1 for cefotaxime, < 0.25 µgml-1 for norfloxacin, < 10 µgml-1 for cephaloridine, < 10 µgml-1 for cephalexin, and < 50 µgml-1 for kanamycin. Antibiotic resistance among N. gonorrhoeae isolates from Tucumán, Argentina, appeared to be primarily limited to penicillin and tetracycline, which has been a general use against gonorrhoeae in Tucumán since 1960. Periodic monitoring of the underlying susceptibility profiles of the N. gonorrhoeae strains prevalent in areas of frequent transmission may provide clues regarding treatment options and emerging of drug resistance.

  4. Heavy metal accumulation by carrageenan and agar producing algae

    Energy Technology Data Exchange (ETDEWEB)

    Burdin, K.S. [Moscow State Univ. (Russian Federation). Faculty of Biology; Bird, K.T. [North Carolina Univ., Wilmington, NC (United States). Center for Marine Science Research

    1994-09-01

    The accumulation of six heavy metals Cu, Cd, Ni, Zn, Mn and Pb was measured in living and lzophilized algal thalli. The agar producing algae were Gracilaria tikvahiae and Gelidium pusillum. The carrageenan producing macroalgae were Agardhiella subulata and the gametophyte and tetrasporophyte phases of Chondrus crispus. These produce primarily iota, kappa and lambda carrageenans, respectively. At heavy metal concentrations of 0.5 mg L{sup -1}, living thalli of Gracilaria tikvahiae generally showed the greatest amount of accumulation of the 6 heavy metals tested. The accumulation of Pb was greater in the living thalli of all four species than in the lyophilized thalli. Except for Agardhiella subulata, lyophilized thalli showed greater accumulation of Ni, Cu and Zn. There was no difference in heavy metal accumulation between living and lyophilized thalli in the accumulation of Cd. Manganese showed no accumulation at the tested concentration. There did not appear to be a relationship between algal hydrocolloid characteristics and the amounts of heavy metals accumulated. (orig.)

  5. Green thunderstorms

    Science.gov (United States)

    Gallagher, Frank Woolsey, III

    Many people around the world have observed green light apparently emanating from severe thunderstorms, but until recently there has been no scientific study of the phenomenon. Green thunderstorms have been observed from time to time in association with deep convection or severe weather events. Some skeptics who have not personally observed a green thunderstorm suggest that they are some kind of illusion. The existence of green thunderstorms has been objectively demonstrated by recording spectra of light from thunderstorms using a handheld spectrophotometer. During the spring and summer of 1995 and the spring of 1996 numerous storms were observed and spectra of the light emanating from these storms were recorded. Observations were made both at the ground and aboard research aircraft. Furthermore, time series of spectra were recorded as the observed color of some storms changed from dark blue to a bluish-green. Several hypotheses have been advanced to explain the occurrence of green light in connection with severe storms. Fankhauser gave some observational support to the belief that green light from thunderstorms is possible and believed that the source of the light is from the blue sky penetrating thin regions in the clouds. Fraser believes that light from the setting sun, in combination with the process of scattering by atmospheric molecules, creates the green light associated with severe weather and the thunderstorm acts only as a black backdrop. Unfortunately, no cloud illuminated by the sun is black and the green airlight produced by the Fraser theory is in reality overwhelmed by light reflected by the cloud. Often the unusual coloration has been attributed to hail or to reflection of light from foliage on the ground. The quantitative measurements made during the observation period fail to support these assumptions. We have observed thunderstorms to be green over ground that was not green and we have observed blue thunderstorms over ground that was green

  6. Effect of milrinone on the developmental competence of growing lamb oocytes identified with brilliant cresyl blue.

    Science.gov (United States)

    Wang, Liqin; Jiang, Xiangjiu; Wu, Yangsheng; Lin, Jiapeng; Zhang, Li; Yang, Nan; Huang, Juncheng

    2016-11-01

    Juvenile in vitro embryo transfer is a novel technique that can be used to increase the rate of genetic gain in a population and presents an alternative to embryo technologies on the basis of adult animals. However, oocytes from prepubertal animals have a lower viability than those obtained from adult ewe oocyte donors. In this research, we aimed to determine the optimum concentration and time of treatment of oocytes from prepubertal lambs with brilliant cresyl blue (BCB) stain and milrinone during IVM. This would improve the developmental rate of lamb oocytes and embryos after IVF. First, lamb cumulus-oocyte complexes were cultured under different concentrations (13 or 26 μM) of BCB staining. Treated lamb oocytes were then divided into BCB- (colorless cytoplasm) and BCB+ (colored cytoplasm) groups on the basis of their glucose-6-phosphate dehydrogenase activity. The blastocyst efficiency rate of BCB+ oocytes treated with 13 μM BCB (37.03%) was significantly higher than that of BCB+ oocytes treated with 26 μM BCB (23.25%) and that of nontreated BCB control oocytes (15.37%), as well as that of BCB- oocytes (6.28%). Both control oocytes and BCB+ oocytes exhibited significantly higher cleavage rates (60.15% and 73.44%, respectively) than that of BCB- oocytes (36.19%). Moreover, the diameter and glutathione content of BCB+ oocytes were found to be significantly greater than those of BCB- oocytes (163.37 vs. 159.25 μm and 6.39 vs. 0.26 pM, respectively). After culturing BCB- oocytes in different concentrations of milrinone (0, 50, 75, and 100 μM) for 3, 6, or 9 hours, results reported that supplementation of IVM medium with 75 μM milrinone for 6 hours yielded a significantly higher proportion of blastocysts than the other treatments. These results show that the staining of lamb cumulus-oocyte complexes with 13 μM BCB before IVM may be used to select developmentally competent lamb oocytes. Furthermore, they suggest that milrinone can be used to promote

  7. Genome sequence of the agar-degrading marine bacterium Alteromonadaceae sp. strain G7.

    Science.gov (United States)

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F

    2012-12-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  8. Genome Sequence of the Agar-Degrading Marine Bacterium Alteromonadaceae sp. Strain G7

    OpenAIRE

    Kwak, Min-Jung; Song, Ju Yeon; Kim, Byung Kwon; Chi, Won-Jae; Kwon, Soon-Kyeong; Choi, Soobeom; Chang, Yong-Keun; Hong, Soon-Kwang; Kim, Jihyun F.

    2012-01-01

    Here, we present the high-quality draft genome sequence of the agar-degrading marine gammaproteobacterium Alteromonadaceae sp. strain G7, which was isolated from coastal seawater to be utilized as a bioresource for production of agar-derived biofuels. The 3.91-Mb genome contains a number of genes encoding algal polysaccharide-degrading enzymes such as agarases and sulfatases.

  9. Pembuatan Bakto Agar dari Rumput Laut Gelidium rigidum untuk Media Tumbuh bagi Mikroorganisme

    Directory of Open Access Journals (Sweden)

    Murdinah murdinah

    2008-06-01

    Full Text Available ABSTRAK Telah dilakukan penelitian tentang pembuatan bakto agar dari rumput laut Gelidium rigidum untuk media tumbuh bagi mikroorganisme. Pembuatan bakto agar dilakukan dengan variasi waktu ekstraksi yaitu 1, 2, dan 3 jam pada suhu 121°C dan tekanan 1,1 atm. Bakto agar dianalisis rendemen dan mutunya yang meliputi kadar air, kadar abu, kadar abu tak larut asam, kadar sulfat, kekuatan gel, pH, titik leleh, dan titik jendal. Uji mikrobiologi yang diamati meliputi angka lempeng total bakteri (ALT dan diameter koloni. Dari hasil pengamatan diketahui bahwa bakto agar hasil ekstraksi dari rumput laut jenis Gelidium rigidum selama 2 jam mutunya menyamai bakto agar komersial, khususnya dari nilai kadar air, pH, kadar abu, kadar abu tak larut asam, kekuatan gel, serta kemampuannya menumbuhkan bakteri yang terdapat pada ikan segar dan kultur murni yaitu E. coli dan L. lactis. Tetapi dalam hal kadar sulfat, titik leleh, dan titik jendal masih di bawah mutu bakto agar komersial. Hasil penelitian juga menunjukkan bahwa waktu ekstraksi selama 2 jam menghasilkan bakto agar yang memenuhi standar bakto agar komersial dengan karakteristik kadar air 10,41%, kadar abu 2,1%, kadar abu tak larut asam 0,18%, kekuatan gel 670,72 g/cm2, dan pH 7,1.

  10. Development of novel agar media for isolating guaiacol producing Alicyclobacillus spp.

    Science.gov (United States)

    Chang, S S; Park, S H; Kang, D H

    2013-06-03

    The purpose of this study is to develop a selective and differential medium (SK2 agar) for isolating guaiacol producing Alicyclobacillus. Forty-one selected dyes and vanillic acid were incorporated in SK agar for screening selective and differential agents. Two guaiacol producing (1016, 1101) and two non-guaiacol producing (19220, C-GD 1-1) Alicyclobacillus isolates were streaked onto media and color differentiation of the isolates was assessed. Among 41 tested dyes, Chrome Azurol S (CAS) allowed color differentiation of the two types of Alicyclobacillus. Colonies of guaiacol producing Alicyclobacillus isolates appeared as dark purple to royal blue color with yellow background, whereas non-guaiacol producing Alicyclobacillus isolates produced cream colored colonies with yellow background. Vanillic acid not only served as a precursor for guaiacol formation but also inhibited non-guaiacol producing Alicyclobacillus. Non-guaiacol producing isolates did not grow on SK agar containing more than 70 ppm vanillic acid, whereas the recovery of guaiacol producing isolates was unaffected. When compared with other Alicyclobacillus isolation media, not only was SK2 agar capable of selectively recovering guaiacol-producing Alicyclobacillus, the degree of growth was also approximately equal if not better than orange serum agar, potato dextrose agar, and K agar. The development of SK2 agar provides the fruit juice industry with an inexpensive, simple to use alternative for the detection of guaiacol producing Alicyclobacillus. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Agar composition affects in vitro screening of biocontrol activity of antagonistic microorganisms

    NARCIS (Netherlands)

    Bosmans, Lien; De Bruijn, I.; de Mot, Rene; Readers, Hans; Lievens, Bart

    2016-01-01

    Agar-based screening assays are the method of choice when evaluating antagonistic potential of bacterial biocontrol-candidates against pathogens.Weshowed thatwhen using the samemedium, but different agar compositions, the activity of a bacterial antagonist against Agrobacteriumwas strongly affected.

  12. Behaviorally Green

    DEFF Research Database (Denmark)

    Sunstein, Cass; Reisch, Lucia A.

    2016-01-01

    of suggestion, inertia, and loss aversion. If well-chosen, green defaults are likely to have large effects in reducing the economic and environmental harms associated with various products and activities. Such defaults may or may not be more expensive to consumers. In deciding whether to establish green...

  13. Green Tea

    Science.gov (United States)

    ... and cancer. Green tea is consumed as a beverage. It is also sold in liquid extracts, capsules, and tablets and is sometimes used in topical products (intended to be applied to the skin). How Much Do We Know? Although many studies have been done on green tea and its ...

  14. Green consumerism

    DEFF Research Database (Denmark)

    de Groot, Judith I.M.; Schuitema, Geertje; Garson, Carrie Lee

    and biospheric values influence the importance of such ‘green’ product characteristics on purchasing intentions. In two within-subjects full-factorial experimental studies (N = 100 and N = 107), we found that purchase intentions of products were only steered by green characteristics if prices were low...... and the brand was familiar. Green product characteristics did not influence purchase intentions at all when these proself product characteristics were not fulfilled (i.e., high prices and unfamiliar brands). The importance of proself and green product characteristics on purchasing intentions was also......Our presentation will focus on the influence of product characteristics and values on green consumerism. Although generally a majority of consumers support the idea of purchasing green products, we argue, based on social dilemma theory, that proself product characteristics and egoistic...

  15. Green lights

    DEFF Research Database (Denmark)

    Fisker, Peter Kielberg

    This study investigates the effect of drought on economic activity globally using remote sensing data. In particular, predicted variation in greenness is correlated with changes in the density of artificial light observed at night on a grid of 0.25 degree latitude-longitude pixels. I define drought...... as greenness estimated by lagged variation in monthly rainfall and temperature. This definition of drought performs well in identifying self-reported drought events since 2000 compared with measures of drought that do not take greenness into account, and the subsequent analysis indicates that predicted...... variation in greenness is positively associated with year-on-year changes in luminosity: If a unit of observation experiences a predicted variation in greenness that lies 1 standard deviation below the global mean, on average 1.5 - 2.5 light pixels out of 900 are extinguished that year. Finally, an attempt...

  16. Preparation and application of agar/alginate/collagen ternary blend functional food packaging films.

    Science.gov (United States)

    Wang, Long-Feng; Rhim, Jong-Whan

    2015-09-01

    Ternary blend agar/alginate/collagen (A/A/C) hydrogel films with silver nanoparticles (AgNPs) and grapefruit seed extract (GSE) were prepared. Their performance properties, transparency, tensile strength (TS), water vapor permeability (WVP), water contact angle (CA), water swelling ratio (SR), water solubility (WS), and antimicrobial activity were determined. The A/A/C film was highly transparent, and both AgNPs and GSE incorporated blend films (A/A/C(AgNPs) and A/A/C(GSE)) exhibited UV-screening effect, especially, the A/A/C(GSE) film had high UV-screening effect without sacrificing the transmittance. In addition, the A/A/C blend films formed efficient hydrogel film with the water holding capacity of 23.6 times of their weight. Both A/A/C(AgNPs) and A/A/C(GSE) composite films exhibited strong antimicrobial activity against both Gram-positive (Listeria monocytogenes) and Gram-negative (Escherichia coli) food-borne pathogenic bacteria. The test results of fresh potatoes packaging revealed that all the A/A/C ternary blend films prevented forming of condensed water on the packaged film surface, both A/A/C(AgNPs) and A/A/C(GSE) composite films prevented greening of potatoes during storage. The results indicate that the ternary blend hydrogel films incorporated with AgNPs or GSE can be used not only as antifogging packaging films for highly respiring fresh agriculture produce, but also as an active food packaging system utilizing their strong antimicrobial activity. Copyright © 2015 Elsevier B.V. All rights reserved.

  17. Current knowledge on agarolytic enzymes and the industrial potential of agar-derived sugars.

    Science.gov (United States)

    Yun, Eun Ju; Yu, Sora; Kim, Kyoung Heon

    2017-07-01

    Agar is a major cell wall carbohydrate of red macroalgae (Rhodophyta). Sugars derived from agar, such as agarooligosaccharides (AOSs), neoagarooligosaccharides (NAOSs), neoagarobiose (NAB), and 3,6-anhydro-L-galactose (L-AHG), possess various physiological activities. These agar-derived sugars can be produced by hydrolysis using chemicals or agarolytic enzymes. Despite the industrial potential of agar-derived sugars, their application has been hampered mainly due to the absence of efficient processes for the liquefaction and saccharification of agar. In this review, we have focused on strategies for producing high value-added sugars from agarose via chemical or enzymatic liquefaction and enzymatic saccharification. The liquefaction of agarose is a key step for preventing gelling and increasing the solubility of agarose in water by prehydrolyzing agarose into AOSs or NAOSs. For the industrial use of agar-derived sugars, AOS, NAOS, NAB, and L-AHG can be used as functional biomaterials owing to their physiological activities such as antiinflammation, skin whitening, and moisturizing. Recently, it was reported that AHG could be considered as a new anticariogenic sugar to replace xylitol. This review provides a comprehensive overview of processes for the hydrolysis of agar or agarose to produce high value-added sugars and the industrial application of these sugars.

  18. AGAR FROM MALAYSIAN RED SEAWEED AS POTENTIAL MATERIAL FOR SYNTHESIS OF BIOPLASTIC FILM

    Directory of Open Access Journals (Sweden)

    SIEW-LING HII

    2016-07-01

    Full Text Available The main aim of this study was to identify the potential use of agar extracted from red seaweed, Gracilaria salicornia, collected from the coastal area of Malaysia as the raw material for synthesis of bioplastic film. Agar was extracted via two extraction methods: (1 alkali extraction method and (2 photo bleaching extraction method. The yields of agar by both of the methods were 9 to 11 %. The alkali extracted agar (AEA and photo bleached agar (PBA were incorporated as the raw materials for the formation of bioplastic films while sago starch and glycerol were added to increase workability. Physicochemical properties of the two bioplastic films were characterised. FTIR analysis confirmed the presence of agar in both plastic films with the presence of 3,6- anhydrogalactose residues and further indicated that the interactions of agar and sago starch were strong in both PBA and AEA films. The results showed that tensile strength and percent elongation of PBA film (3.067 MPa, 3.270 % was higher than AEA film (2.431 MPa, 2.476 %. Thermogravimetric analysis (TGA; % residual weight revealed that AEA film has higher thermal stability (14.80 % than PBA film (10.27 % while rheological results proved that both films exhibited non-Newtonian behaviors. The AEA film was completely decomposed after 30 days in the soil burial test. Results of current study show a wide range of future possibilities and commercial applications of AEA and PBA bioplastic films.

  19. Green Engineering

    Science.gov (United States)

    Green Engineering is the design, commercialization and use of processes and products that are feasible and economical while reducing the generation of pollution at the source and minimizing the risk to human health and the environment.

  20. Green Roofs

    Energy Technology Data Exchange (ETDEWEB)

    None

    2004-08-01

    A New Technology Demonstration Publication Green roofs can improve the energy performance of federal buildings, help manage stormwater, reduce airborne emissions, and mitigate the effects of urban heat islands.

  1. Going Green

    Centers for Disease Control (CDC) Podcasts

    This podcast is for a general audience and provides information on how to recycle, re-use, and restore. It also covers the benefits of “Going Green" on the environment, health, and social interaction.

  2. Green lasers

    DEFF Research Database (Denmark)

    Jensen, Ole Bjarlin

    2010-01-01

    Well over a dozen papers at this year's Photonics West meeting in San Francisco boasted improvements in harmonic generation to produce visible laser beams, most of them in the green spectral range......Well over a dozen papers at this year's Photonics West meeting in San Francisco boasted improvements in harmonic generation to produce visible laser beams, most of them in the green spectral range...

  3. Green Nudging

    OpenAIRE

    Evans, Nicholas; Eickers, Stephanie; Geene, Leonie; Todorovic, Marijana; Villmow, Annika; Forschungsstelle für Umweltpolitik (FFU), Freie Universität Berlin

    2018-01-01

    Traditional environmental policy instruments have not always proven successful in fostering environmentally friendly behaviour. The question remains: how can policymakers tackle the attitude-behaviour gap when it comes to pro-environmental choices and sustainable lifestyles? One solution that has emerged is green nudging, a new and potentially promising policy tool born of behavioural economics and experimental psychology. This paper contributes to the current discussion surrounding green nud...

  4. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate.

    Science.gov (United States)

    Wang, Xiaoling; Wang, Guoqing; Hao, Mudong

    2015-01-01

    Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick's first law, and Monod's kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  5. Simultaneous Preconcentration and Determination of Brilliant Blue and Sunset Yellow in Foodstuffs by Solid-Phase Extraction Combined UV-Vis Spectrophotometry.

    Science.gov (United States)

    Bişgin, Abdullah Taner

    2018-05-29

    Background: Brilliant Blue and Sunset Yellow, two highly water-soluble synthetic food dyes, are the most popular food dyes used and consumed. Although they are not highly toxic, some health problems can be observed when excessive amounts of food products containing these dyes are consumed. Objectives: The aim of the study was to develop a simultaneous UV-Vis combined solid-phase extraction method, based on the adsorption onto Amberlite XAD-8 resin, for determination of Brilliant Blue and Sunset Yellow dyes. Methods: Sample solution was poured into the reservoir of the column and permitted to gravitationally pass through the column at 2 mL/min flow rate. Adsorbed dyes were eluted to 5 mL of final volume with 1 mol/L HNO₃ in ethanol solution by applying a 2 mL/min flow rate. Dye concentrations of the solution were determined at 483 and 630 nm for Sunset Yellow and Brilliant Blue, respectively. Results: The detection limits of the method for Brilliant Blue and Sunset Yellow were determined as 0.13 and 0.66 ng/mL, respectively. Preconcentration factor was 80. Brilliant Blue contents of real food samples were found to be between 11 and 240 μg/g. Sunset Yellow concentrations of foodstuffs were determined to be between 19 and 331 μg/g. Conclusions: Economical, effective, and simple simultaneous determination of Brilliant Blue and Sunset Yellow was achieved by using a solid-phase extraction combined UV-Vis spectrometry method. Highlights: The method is applicable and suitable for routine analysis in quality control laboratories without the need for expert personnel and high operational costs because the instrumentation is simple and inexpensive.

  6. Low density, microcellular, dopable, agar/gelatin foams for pulsed power experiments

    Energy Technology Data Exchange (ETDEWEB)

    McNamara, W.F. [Orion International Technologies, Inc., Albuquerque, NM (United States); Aubert, J.H. [Sandia National Lab., Albuquerque, NM (United States)

    1997-04-01

    Low-density, microcellular foams prepared from the natural polymers agar and gelatin have been developed for pulsed-power physics experiments. Numerous experiments were supported with foams having densities at or below 10 mg/cm{sup 3}. For some of the experiments, the agar/gelatin foam was uniformly doped with metallic elements using soluble salts. Depending on the method of preparation, cell sizes were typically below 10 microns and for one process were below 1.0 micron.

  7. A radiobiological comparison of human tumor soft-agar clonogenic assays.

    Science.gov (United States)

    West, C M; Sutherland, R M

    1986-06-15

    Radiation survival curves have been generated for 3 human tumor cell lines as a means of comparing and evaluating the validity of human tumor soft-agar clonogenic assays. The assays investigated were the Hamburger-Salmon, Courtenay-Mills, Courtenay-Mills plus additions, soft agar (no additions), and soft agar plus additions. The additions were formulated to supplement the media used in soft agar assays of primary ovarian and cervical carcinoma specimens. Supplementing the media with additions led to a 2- to 3-fold increase in PE of CaSki cells but had no effect on the PEs of ME180 and OWI cells. Radiation survival curves were similar in all assays for CaSki and OWI but differed for ME180 cells. For ME180 cells, the Courtenay-Mills and soft agar assays plus additions produced the most radioresistant curves (Do = 2.2 Gy); the cells were more responsive when assayed by the Hamburger-Salmon method (Do = 1.5 Gy), and the soft agar and Courtenay-Mills assays gave the most radiosensitive curves (Do = 1.2 Gy). These results demonstrate that the PE of human tumor cell lines may be increased with no effect on radiation survival; radiation survival may be altered without changes in PE and neither may be altered by applying modifications and supplements to existing clonogenic assays.

  8. Effect of Red Seaweed Polysaccharides Agar (Gracilaria changii) on Thermal Properties and Microstructure of Wheat Starch

    International Nuclear Information System (INIS)

    Faizal, P.K.

    2009-01-01

    This study has been carried out on the mixture of Gracilaria changii agar (0.1 %, 0.2 %, 0.4 % and 0.8 %) with wheat starch. Scanning electron microscopy (SEM) was performed for morphology observation, and starch thermal analysis were carried out to determine the properties of gelatinization and retrogradation. Proximate analysis has been determined for isolated wheat starch and agar. Through SEM, interaction was first observed at 64 degree Celsius for 0.4 % agar but at 0.8 % of agar, a more extensive bridging was formed which enveloped the starch granules. Differential scanning calorimetric (DSC) result shows that as the addition of agar decreased the onset temperature (T o ) of gelatinization significantly (p< 0.05) but increased the gelatinized enthalpy (ΔH gel ), gelatinized temperature range (R g ) and Peak Height Index (PHI) significantly (p < 0.05). Agar lowered the retrogradation enthalpy (ΔH ret ), retrogradation range (R ret ) and retrogradation percentage (% R) of wheat starch significantly (p < 0.05). (author)

  9. Green banking

    Directory of Open Access Journals (Sweden)

    Maja Drobnjaković

    2013-06-01

    Full Text Available There is an urgent need to march towards “low - carbon economy”. Global challenges of diminishing fossil fuel reserves, climate change, environmental management and finite natural resources serving an expanding world population - these reasons mean that urgent action is required to transition to solutions which minimize environmental impact and are sustainable. We are at the start of the low - carbon revolution and those that have started on their low - carbon journey already are seeing benefits such as new markets and customers, improved economic, social and environmental performance, and reduced bills and risks. Green investment banks offer alternative financial services: green car loans, energy efficiency mortgages, alternative energy venture capital, eco - savings deposits and green credit cards. These items represent innovative financial products.

  10. Scavenging remazol brilliant blue R dye using microwave-assisted activated carbon from acacia sawdust: Equilibrium and kinetics studies

    Science.gov (United States)

    Yusop, M. F. M.; Aziz, H. A.; Ahmad, M. A.

    2017-10-01

    This work explores the feasibility of microwave-assisted acacia wood based activated carbon (AWAC) for remazol brilliant blue R (RBBR) dye removal from synthetic wastewater. Acacia wood (AW) was impregnated with potassium hydroxide (KOH) and heated using microwave, resulting tremendously high fixed carbon content, surface area, total pore volume and adsorption capacity of 81.14%, 1045.56m2/g, 0.535cm3/g and 263.16mg/g respectively. Batch study conducted divulged an increasing trend in RBBR uptake when initial RBBR concentration and contact time were increased. pH study revealed that RBBR adsorption was best at acidic condition. Langmuir isotherm model fitted well the adsorption equilibrium data while the adsorption kinetic was found to follow the pseudo-second-order kinetic model.

  11. Green times

    International Nuclear Information System (INIS)

    Hasenclever, W.D.; Hasenclever, C.

    1982-01-01

    The authors, founding members of the ''Green Party'' have in mind to make a very personal contribution to a better understanding of the present political situation which, although it seems to have reached a deadlock, still offers positive chances and prospects. New approaches in policy are mentioned which may help to overcome the present state of resignation of many adolescents and adults. Among other things, they describe themselves setting out for new pathways, the ''Greens'' in Parliament, prospect for the future, opportunities of the ecologically oriented economic policy. Finally, they call upon the reader to think and develop further under the motto ''What we all can do''. (HSCH) [de

  12. The Frequency of "Brilliant" and "Genius" in Teaching Evaluations Predicts the Representation of Women and African Americans across Fields.

    Science.gov (United States)

    Storage, Daniel; Horne, Zachary; Cimpian, Andrei; Leslie, Sarah-Jane

    2016-01-01

    Women and African Americans-groups targeted by negative stereotypes about their intellectual abilities-may be underrepresented in careers that prize brilliance and genius. A recent nationwide survey of academics provided initial support for this possibility. Fields whose practitioners believed that natural talent is crucial for success had fewer female and African American PhDs. The present study seeks to replicate this initial finding with a different, and arguably more naturalistic, measure of the extent to which brilliance and genius are prized within a field. Specifically, we measured field-by-field variability in the emphasis on these intellectual qualities by tallying-with the use of a recently released online tool-the frequency of the words "brilliant" and "genius" in over 14 million reviews on RateMyProfessors.com, a popular website where students can write anonymous evaluations of their instructors. This simple word count predicted both women's and African Americans' representation across the academic spectrum. That is, we found that fields in which the words "brilliant" and "genius" were used more frequently on RateMyProfessors.com also had fewer female and African American PhDs. Looking at an earlier stage in students' educational careers, we found that brilliance-focused fields also had fewer women and African Americans obtaining bachelor's degrees. These relationships held even when accounting for field-specific averages on standardized mathematics assessments, as well as several competing hypotheses concerning group differences in representation. The fact that this naturalistic measure of a field's focus on brilliance predicted the magnitude of its gender and race gaps speaks to the tight link between ability beliefs and diversity.

  13. The Frequency of "Brilliant" and "Genius" in Teaching Evaluations Predicts the Representation of Women and African Americans across Fields.

    Directory of Open Access Journals (Sweden)

    Daniel Storage

    Full Text Available Women and African Americans-groups targeted by negative stereotypes about their intellectual abilities-may be underrepresented in careers that prize brilliance and genius. A recent nationwide survey of academics provided initial support for this possibility. Fields whose practitioners believed that natural talent is crucial for success had fewer female and African American PhDs. The present study seeks to replicate this initial finding with a different, and arguably more naturalistic, measure of the extent to which brilliance and genius are prized within a field. Specifically, we measured field-by-field variability in the emphasis on these intellectual qualities by tallying-with the use of a recently released online tool-the frequency of the words "brilliant" and "genius" in over 14 million reviews on RateMyProfessors.com, a popular website where students can write anonymous evaluations of their instructors. This simple word count predicted both women's and African Americans' representation across the academic spectrum. That is, we found that fields in which the words "brilliant" and "genius" were used more frequently on RateMyProfessors.com also had fewer female and African American PhDs. Looking at an earlier stage in students' educational careers, we found that brilliance-focused fields also had fewer women and African Americans obtaining bachelor's degrees. These relationships held even when accounting for field-specific averages on standardized mathematics assessments, as well as several competing hypotheses concerning group differences in representation. The fact that this naturalistic measure of a field's focus on brilliance predicted the magnitude of its gender and race gaps speaks to the tight link between ability beliefs and diversity.

  14. Brilliant iridescence of Morpho butterfly wing scales is due to both a thin film lower lamina and a multilayered upper lamina

    NARCIS (Netherlands)

    Giraldo, M A; Stavenga, D G

    2016-01-01

    Butterflies belonging to the nymphalid subfamily, Morphinae, are famous for their brilliant blue wing coloration and iridescence. These striking optical phenomena are commonly explained as to originate from multilayer reflections by the ridges of the wing scales. Because the lower lamina of the

  15. Going Green

    Science.gov (United States)

    Witkowsky, Kathy

    2009-01-01

    Going green saves money and can even make money. Sustainable practices promote better health, less absenteeism, and more productivity. They also attract students, who are paying increasing attention to schools' environmental policies. Beyond being the smart thing to do, administrators at the University of Washington say repeatedly, it's the right…

  16. Buying Green

    Science.gov (United States)

    Layng, T. V. Joe

    2010-01-01

    In "Buying Green," Joe Layng recognizes that, like all choices we make, our decisions as consumers are more likely to be influenced by their short-term consequences for us as individuals (price, quality) than they are by their long-term consequences for society (environmental impact). He believes that the equation can be tilted in favor of greener…

  17. Green pioneers.

    Science.gov (United States)

    Trueland, Jennifer

    The government has set tough targets for the NHS in England to reduce its carbon footprint. In this article, nurses and managers at Nottinghamshire Healthcare NHS Trust explain how a programme of 'greening' initiatives - including a trial of electric cars for community staff - have slashed the trust's CO2 output.

  18. Automatically Green

    DEFF Research Database (Denmark)

    Sunstein, Cass R.; Reisch, Lucia

    2014-01-01

    reasons include the power of suggestion; inertia and procrastination; and loss aversion. If well-chosen, green defaults are likely to have large effects in reducing the economic and environmental harms associated with various products and activities. Such defaults may or may not be more expensive...

  19. Automatically Green

    DEFF Research Database (Denmark)

    Sunstein, Cass R.; Reisch, Lucia

    reasons include the power of suggestion; inertia and procrastination; and loss aversion. If well-chosen, green defaults are likely to have large effects in reducing the economic and environmental harms associated with various products and activities. Such defaults may or may not be more expensive...

  20. Going Green

    Centers for Disease Control (CDC) Podcasts

    2008-04-18

    This podcast is for a general audience and provides information on how to recycle, re-use, and restore. It also covers the benefits of “Going Green" on the environment, health, and social interaction.  Created: 4/18/2008 by National Center for Environmental Health (NCEH), ATSDR.   Date Released: 5/8/2008.

  1. Lipoprotein processing is essential for resistance of Mycobacterium tuberculosis to malachite green.

    Science.gov (United States)

    Banaei, Niaz; Kincaid, Eleanor Z; Lin, S-Y Grace; Desmond, Edward; Jacobs, William R; Ernst, Joel D

    2009-09-01

    Malachite green, a synthetic antimicrobial dye, has been used for over 50 years in mycobacterial culture medium to inhibit the growth of contaminants. The molecular basis of mycobacterial resistance to malachite green is unknown, although the presence of malachite green-reducing enzymes in the cell envelope has been suggested. The objective of this study was to investigate the role of lipoproteins in resistance of Mycobacterium tuberculosis to malachite green. The replication of an M. tuberculosis lipoprotein signal peptidase II (lspA) mutant (DeltalspA::lspAmut) on Middlebrook agar with and without 1 mg/liter malachite green was investigated. The lspA mutant was also compared with wild-type M. tuberculosis in the decolorization rate of malachite green and sensitivity to sodium dodecyl sulfate (SDS) detergent and first-line antituberculosis drugs. The lspA mutant has a 10(4)-fold reduction in CFU-forming efficiency on Middlebrook agar with malachite green. Malachite green is decolorized faster in the presence of the lspA mutant than wild-type bacteria. The lspA mutant is hypersensitive to SDS detergent and shows increased sensitivity to first-line antituberculosis drugs. In summary, lipoprotein processing by LspA is essential for resistance of M. tuberculosis to malachite green. A cell wall permeability defect is likely responsible for the hypersensitivity of lspA mutant to malachite green.

  2. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    Directory of Open Access Journals (Sweden)

    Marol Serhat

    2003-10-01

    Full Text Available Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37°C. Results The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. Conclusions It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  3. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species.

    Science.gov (United States)

    Yücesoy, Mine; Marol, Serhat

    2003-10-29

    The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 Trichosporon spp., 4 C. kefyr, 2 C. lusitaniae, 1 Saccharomyces cerevisiae and 1 Geotrichum candidum were included. The strains were first identified by germ tube test, morphological characteristics on cornmeal tween 80 agar and Vitek 32 and API 20 C AUX systems. In parallel, they were also streaked onto CHROMagar Candida and bismuth sulphite glucose glycine yeast agar plates. The results were read according to the color, morphology of the colonies and the existance of halo around them after 48 hours of incubation at 37 degrees C. The sensitivity and specificity values for C. albicans strains were found to be 99.4, 100% for CHROMagar Candida and 87.0, 75.2% for BiGGY agar, respectively. The sensitivity of CHROMagar Candida to identify C. tropicalis, C. glabrata and C. krusei ranged between 90.9 and 100% while the specificity was 100%. The sensitivity rates for BiGGY agar were 66.6 and 100% while the specificity values were found to be 95.4 and 100% for C. tropicalis and C. krusei, respectively. It can be concluded that the use of CHROMagar Candida is an easy and reliable method for the presumptive identification of most commonly isolated Candida species especially C. albicans, C. tropicalis and C. krusei. The lower sensitivity and specificity of BiGGY agar to identify commonly isolated Candida species potentially limits the clinical usefulness of this agar.

  4. Formulation of Hydrocolloid-Agar, Sucrose, and Acidulant on Jam Leather Product Development

    Directory of Open Access Journals (Sweden)

    Wahyu Ramadhan

    2017-04-01

    Full Text Available Tallying agar powder as a texturizer in guava single sheet jam instigate the product more convenience to consumed. The aims of this research were to determine the best concentration of sucrose, citric acid and agar powder to form a good quality guava jam slice. The research method are optimization and formulationof sucrose, citric acid and agar-agar on making guava jam single sheets product. Physochemical and sensory tests were performed to reveal the best formulation of guava jam slice and the Bayes method used to determine the optimization of the selected formula. Based on the results of formulation and analysis, itwas obtained that  the guava jam slice with Acidulant concentration (0.02%, 0.04%, 0.06%, sucrose (70%, 80%, 90%, 100% and agar powder (0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2% had pH 3.63-3.90, sugar content 34.68 g/100 g – 35.76 g/100 g, color intensity L*, a*, b* with ΔE* value was 37,88-53,97, fiber content 1.01%-1.59%, and water activity 0.852-0.893. Rheology properties for texture profile (hardness, cohesiveness, springiness, adhesive force, and gumminess also showed significant value with agar powder formulation. Based on the Bayes test and hedonic test, it was found that the best formula was for guava jam slices with the addition of 90% sucrose, citric acid 0.04% and agar powder 0.9%. From the best formula, it was found the shelf life prediction model of Arrhenius formula was ln k = 20.222-6660.6(1/T and the nutrition facts contribute total energy 45 kcal, fat 0%, carbohydrate 9%, protein 2% and dietary fiber 3%.

  5. Comparison of selective agars recommended by method ISO 11290-1 and chromogenic agars for the isolation of Listeria sp. in refrigerated sausages

    Directory of Open Access Journals (Sweden)

    Thalyta Marina Benetti

    2012-12-01

    Full Text Available The aim of this study was to determine the prevalence of Listeria sp. in refrigerated sausages, and to compare the performance of the selective plating media employed in the ISO 11290-1 method (PALCAM and Oxford agars with chromogenic agars (Chromogenic Listeria agars CM 1080 (OCLA and CM 1084. The prevalence of Listeria sp. detected was 52.9%, comprising 13.7% L. monocytogenes strains. The efficacy of the four agars for the isolation of L. monocytogenes proved to be satisfactory. Despite differences in composition of the chromogenic media assessed, these disparities did not affect concordance among results. However, PALCAM agar was shown to suppress other microorganisms more effectively, being more applicable for detecting Listeria strains present in lower quantities. Based on these results, the use of PALCAM agar, in combination with a chromogenic media, is recommended for enhanced isolation of atypical Listeria sp. strains in meat products.Este estudo teve como objetivo a análise da prevalência de Listeria sp. em linguiças resfriadas e a comparação dos meios seletivos utilizados no plaqueamento do método ISO 11290-1 (Ágar PALCAM e Ágar Oxford, e ágares cromogênicos (Ágares Listeria Cromogênico CM 1080 (OCLA e CM 1084 (ISO. A frequência de Listeria sp. foi de 52,9%, sendo que destas, 13,7% corresponderam à L. monocytogenes. A eficácia dos quatro ágares para o isolamento de L. monocytogenes demonstrou-se satisfatória. Apesar de haver algumas diferenças nas composições dos meios cromogênicos analisados, estas não pareceram influenciar nas concordâncias entre os resultados expressos. Contudo, o ágar PALCAM mostrou-se mais eficaz na supressão de outros micro-organismos, aumentando, assim, a possibilidade de detecção de espécies de Listeria presentes em número reduzido. Através deste trabalho sugere-se a utilização do ágar PALCAM associado a um meio cromogênico para aumentar a chance de isolamento de cepas at

  6. Effects of shape and size of agar gels on heating uniformity during pulsed microwave treatment.

    Science.gov (United States)

    Soto-Reyes, Nohemí; Temis-Pérez, Ana L; López-Malo, Aurelio; Rojas-Laguna, Roberto; Sosa-Morales, María Elena

    2015-05-01

    Model gel systems with different shape (sphere, cylinder, and slab) and size (180 and 290 g) were prepared with agar (5%) and sucrose (5%). Dielectric constant (ε'), loss factor (ε"), thermophysical properties, and temperature distribution of the model system were measured. Each agar model system was immersed and suspended in water, and then, heated in a microwave oven with intermittent heating until the core temperature reached 50 °C. The ε' and ε" of agar gels decreased when frequency increased. The density and thermal conductivity values of the agar gels were 1033 kg/m(3) and 0.55 W/m °C, respectively. The temperature distribution of sphere, cylinder, and slab was different when similar power doses were applied. The slab reached 50 °C in less time (10 min) and showed a more uniform heating than spheres and cylinders in both sizes. Agar model systems of 180 g heated faster than those of 290 g. The coldest point was the center of the model systems in all studied cases. Shape and size are critical food factors that affect the heating uniformity during microwave heating processes. © 2015 Institute of Food Technologists®

  7. Antimicrobial and physical-mechanical properties of agar-based films incorporated with grapefruit seed extract.

    Science.gov (United States)

    Kanmani, Paulraj; Rhim, Jong-Whan

    2014-02-15

    The use of synthetic petroleum based packaging films caused serious environmental problems due to their difficulty in recycling and poor biodegradability. Therefore, present study was aimed to develop natural biopolymer-based antimicrobial packaging films as an alternative for the synthetic packaging films. As a natural antimicrobial agent, grapefruit seed extract (GSE) has been incorporated into agar to prepare antimicrobial packaging film. The films with different concentrations of GSE were prepared by a solvent casting method and the resulting composite films were examined physically and mechanically. In addition, the films were characterized by FE-SEM, XRD, FT-IR and TGA. The incorporation of GSE caused increase in color, UV barrier, moisture content, water solubility and water vapor permeability, while decrease in surface hydrophobicity, tensile strength and elastic modulus of the films. As the concentration of GSE increased from 0.6 to 13.3 μg/mL, the physical and mechanical properties of the films were affected significantly. The addition of GSE changed film microstructure of the film, but did not influence the crystallinity of agar and thermal stability of the agar-based films. The agar/GSE films exhibited distinctive antimicrobial activity against three test food pathogens, such as Listeria monocytogenes, Bacillus cereus and Escherichia coli. These results suggest that agar/GSE films have potential to be used in an active food packaging systems for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2013 Elsevier Ltd. All rights reserved.

  8. Strategies to improve the mechanical strength and water resistance of agar films for food packaging applications.

    Science.gov (United States)

    Sousa, Ana M M; Gonçalves, Maria P

    2015-11-05

    Agar films possess several properties adequate for food packaging applications. However, their high cost-production and quality variations caused by physiological and environmental factors affecting wild seaweeds make them less attractive for industries. In this work, native (NA) and alkali-modified (AA) agars obtained from sustainably grown seaweeds (integrated multi-trophic aquaculture) were mixed with locust bean gum (LBG) to make 'knife-coated' films with fixed final concentration (1 wt%) and variable agar/LBG ratios. Agar films were easier to process upon LBG addition (viscosity increase and gelling character decrease of the film-forming solutions observed by dynamic oscillatory and steady shear measurements). The mechanical properties and water resistance were optimal for films with 50 and/or 75% LBG contents and best in the case of NA (cheaper to extract). These findings can help reduce the cost-production of agar packaging films. Moreover, the controlled cultivation of seaweeds can provide continuous and reliable feedstock for transformation industries. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Time domain NMR study of Agar-gelatin blends; Estudo por RMN no dominio do tempo de blendas de Agar- gelatina

    Energy Technology Data Exchange (ETDEWEB)

    Mattos, Ritamara; Pericini, H.A.; Tambelli, Caio E., E-mail: tambelli@usp.br [Universidade de Sao Paulo (USP), Pirassununga, SP (Brazil). Faculdade de Zootecnia e Engenharia de Alimentos; Raphael, Ellen [Universidade Federal de Sao Joao del Rei (UFSJ), MG (Brazil). Departamento de Ciencias Naturais; Magon, Claudio J.; Donoso, P. [Universidade de Sao Paulo (USP), Sao Carlos, SP (Brazil). Instituto de Fisica

    2015-07-01

    This communication presents results of {sup 1}H time domain nuclear magnetic resonance of Agar-Gelatin blends plasticised with glycerol, cross-linked with formaldehyde and containing acetic acid. The spin-spin relaxation decay curves of samples obtained from CPMG experiments were inverted into corresponding distributions of relaxation times using NNLS (Non Negative Least Square) algorithm. The continuous distributions reveals up to four components of spin-spin relaxation times (T{sub 2}). The two components at short T{sub 2} were associated with protons in different environments of Agar and gelatin polymer chain. The two components at longer T{sub 2} can be associated with the glycerol that is the responsible to promote the proton conduction in the blend. (author)

  10. Pengaruh Green Marketing Hotel Terhadap Green Consumer Behavior

    OpenAIRE

    Yo Fernandez, Eunike Christe; Tjoanda, Evelyn

    2017-01-01

    Penelitian ini dilakukan untuk mengetahui pengaruh dari green marketing hotel terhadap green consumer behavior. Green marketing memiliki 3 dimensi, yaitu green product, green price, dan green promotion. Penelitian ini melibatkan 272 responden masyarakat Surabaya dan menggunakan metode regresi linear berganda. Hasil penelitian menunjukkan bahwa green product dan green price berpengaruh secara positif dan signifikan sedangkan green promotion berpengaruh namun tidak signifikan terhadap green con...

  11. Green Computing

    Directory of Open Access Journals (Sweden)

    K. Shalini

    2013-01-01

    Full Text Available Green computing is all about using computers in a smarter and eco-friendly way. It is the environmentally responsible use of computers and related resources which includes the implementation of energy-efficient central processing units, servers and peripherals as well as reduced resource consumption and proper disposal of electronic waste .Computers certainly make up a large part of many people lives and traditionally are extremely damaging to the environment. Manufacturers of computer and its parts have been espousing the green cause to help protect environment from computers and electronic waste in any way.Research continues into key areas such as making the use of computers as energy-efficient as Possible, and designing algorithms and systems for efficiency-related computer technologies.

  12. Evaluation of modified dichloran 18% glycerol (DG18) agar for enumerating fungi in wheat flour: a collaborative study.

    Science.gov (United States)

    Beuchat, L R; Hwang, C A

    1996-04-01

    Dichloran 18% glycerol agar base supplemented with 100 micrograms of chloramphenicol ml-1 (DG18 agar) was compared to DG18 agar supplemented with 100 micrograms of Triton X-301 ml-1 (DG18T) and DG18 agar supplemented with 1 microgram of iprodione [3-(3,5-dichlorophenyl)-N-(1-methyl-ethyl)-2,4-dioxo-1-imidazolidine- carboxamide] ml-1 (DG18I agar) for enumeration of fungi in ten brands of wheat flour. As the flours contained low fungal populations, all were inoculated with two to four strains of xerophilic fungi (Aspergillus candidus, A. penicillioides, Eurotium amstelodami, E. intermedium, E. repens, E. rubrum, E. tonophilum, E. umbrosum and Wallemia sebi), after which counts ranged from 3.87 to 6.37 log10 CFU g-1. Significantly higher populations (p repens or E. tonophilum had also been inoculated into at least one of the three flours showing significantly higher numbers of CFU on DG18T agar. Analysis of collapsed data from all samples showed that DG18T agar was significantly better than DG18 or DG18I agars at p < 0.10 but not at p < 0.05. Coefficients of variation for reproducibility (among-laboratory variation) were 8.4%, 7.5% and 8.6%, respectively, for DG18, DG18T and DG18I agars. DG18I agar restricted colony development most, especially for Eurotium species. Naturally occurring Penicillium species grew equally well on DG18 and DG18T agars, whereas W. sebi grew well on all three media. DG18T agar was judged to be superior to DG18 and DG18I agars for enumerating fungi in wheat flours.

  13. Green toxicology.

    Science.gov (United States)

    Maertens, Alexandra; Anastas, Nicholas; Spencer, Pamela J; Stephens, Martin; Goldberg, Alan; Hartung, Thomas

    2014-01-01

    Historically, early identification and characterization of adverse effects of industrial chemicals was difficult because conventional toxicological test methods did not meet R&D needs for rapid, relatively inexpensive methods amenable to small amounts of test material. The pharmaceutical industry now front-loads toxicity testing, using in silico, in vitro, and less demanding animal tests at earlier stages of product development to identify and anticipate undesirable toxicological effects and optimize product development. The Green Chemistry movement embraces similar ideas for development of less toxic products, safer processes, and less waste and exposure. Further, the concept of benign design suggests ways to consider possible toxicities before the actual synthesis and to apply some structure/activity rules (SAR) and in silico methods. This requires not only scientific development but also a change in corporate culture in which synthetic chemists work with toxicologists. An emerging discipline called Green Toxicology (Anastas, 2012) provides a framework for integrating the principles of toxicology into the enterprise of designing safer chemicals, thereby minimizing potential toxicity as early in production as possible. Green Toxicology`s novel utility lies in driving innovation by moving safety considerations to the earliest stage in a chemical`s lifecycle, i.e., to molecular design. In principle, this field is no different than other subdisciplines of toxicology that endeavor to focus on a specific area - for example, clinical, environmental or forensic toxicology. We use the same principles and tools to evaluate an existing substance or to design a new one. The unique emphasis is in using 21st century toxicology tools as a preventative strategy to "design out" undesired human health and environmental effects, thereby increasing the likelihood of launching a successful, sustainable product. Starting with the formation of a steering group and a series of workshops

  14. Green Gold

    International Nuclear Information System (INIS)

    Salamandra Martinez, Carlos

    2004-01-01

    The main purpose of this work is to offer a general panoramic of the processes or experiences pilot that are carried out in the Project Green Gold, as strategy of environmental sustainability and organizational invigoration in Choco, especially in the 12 communities of the municipalities of Tado and Condoto. It is also sought to offer a minimum of information on the techniques of handmade production and to show the possibilities to carry out in a rational way the use and use of the natural resources. The Project Green Gold is carried out by the Corporation Green Gold (COV) and co-financed with resources of international and national character, the intervention of the financial resources it achievement mainly for the use of clean processes in the extraction stages and metals benefit. The project is centered primarily in the absence of use of products or toxic substances as the mercury, fair trade, organizational invigoration, execution of 11 approaches and certification of the metals Gold and Platinum. The COV, it has come executing the proposal from the year 2001 with the premise of contributing to the balance between the rational exploitation of the natural resources and the conservation of the environment in the Choco. In the project they are used technical handmade characteristic of the region framed inside the mining activity and production activities are diversified in the productive family units. Those producing with the support of entities of juridical character, specify the necessary game rules for the extraction and products commercialization

  15. Effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of stone casts.

    Science.gov (United States)

    Hiraguchi, Hisako; Nakagawa, Hisami; Kaketani, Masahiro; Hirose, Hideharu; Nishiyama, Minoru

    2007-05-01

    This study investigated the effects of disinfection of combined agar/alginate impressions on the dimensional accuracy of resultant stone casts. Impressions of a master cast designed to simulate an abutment tooth were prepared by combining each of two brands of cartridge-form agar impression materials with an alginate impression material. The impressions were immersed in 1% sodium hypochlorite for 10 minutes or 2% glutaraldehyde for 30 minutes. The remaining impressions were sprayed with these two disinfectants and then stored in sealed bags for 10, 30, 60, and 120 minutes. Stone casts obtained from the non-disinfected impressions were also prepared as control. Changes in diameter of the stone casts were then measured. Results indicated that storage for 10 minutes after spraying with 1% sodium hypochlorite was an appropriate disinfection method for combined agar/alginate impressions, as well as immersion in 1% sodium hypochlorite for 10 minutes.

  16. Modeling of the Bacillus subtilis Bacterial Biofilm Growing on an Agar Substrate

    Directory of Open Access Journals (Sweden)

    Xiaoling Wang

    2015-01-01

    Full Text Available Bacterial biofilms are organized communities composed of millions of microorganisms that accumulate on almost any kinds of surfaces. In this paper, a biofilm growth model on an agar substrate is developed based on mass conservation principles, Fick’s first law, and Monod’s kinetic reaction, by considering nutrient diffusion between biofilm and agar substrate. Our results show biofilm growth evolution characteristics such as biofilm thickness, active biomass, and nutrient concentration in the agar substrate. We quantitatively obtain biofilm growth dependence on different parameters. We provide an alternative mathematical method to describe other kinds of biofilm growth such as multiple bacterial species biofilm and also biofilm growth on various complex substrates.

  17. GreenLight Model 960.

    Science.gov (United States)

    Fernandes, Richard; Carey, Conn; Hynes, James; Papkovsky, Dmitri

    2013-01-01

    The importance of food safety has resulted in a demand for a more rapid, high-throughput method for total viable count (TVC). The industry standard for TVC determination (ISO 4833:2003) is widely used but presents users with some drawbacks. The method is materials- and labor-intensive, requiring multiple agar plates per sample. More importantly, the method is slow, with 72 h typically required for a definitive result. Luxcel Biosciences has developed the GreenLight Model 960, a microtiter plate-based assay providing a rapid high-throughput method of aerobic bacterial load assessment through analysis of microbial oxygen consumption. Results are generated in 1-12 h, depending on microbial load. The mix and measure procedure allows rapid detection of microbial oxygen consumption and equates oxygen consumption to microbial load (CFU/g), providing a simple, sensitive means of assessing the microbial contamination levels in foods (1). As bacteria in the test sample grow and respire, they deplete O2, which is detected as an increase in the GreenLight probe signal above the baseline level (2). The time required to reach this increase in signal can be used to calculate the CFU/g of the original sample, based on a predetermined calibration. The higher the initial microbial load, the earlier this threshold is reached (1).

  18. Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf

    Directory of Open Access Journals (Sweden)

    Ricardo J. Licea Moreno

    2001-04-01

    Full Text Available Here are presented the results on in vitro multiplication of lemon grass (Cymbopogon citratus (D. C. Stapf.; it is a very important medicinal plant because its analgesic, antinflamatory and hipotensor properties, among others, useful to elaborate several medicaments with a high popular acceptation. The main aim of this research was to set up the influence of agar concentration in culture medium during in vitro establishment on multiplication of lemon grass. Were used three treatments: (1 liquid medium with filter paper bridges, (2 3 g.l-1 of agar (BIOCEN and (3 6 g.l-1 of agar (BIOCEN. The explants were inoculated on a culture media containing Murashige and Skoog salts (1962, Heinz and Mee vitamins (1969, myoinositol 100 mg.l-1, 6-BAP 0.2 mg.l-1 and sucrose 20 g.l-1. Meristematic tips were inoculated on the treatments described above under sun light conditions, once desinfected. The explants Influence of agar concentration on in vitro multiplication of Cymbopogon citratus (D. C. Stapf. were maintained 21 days in this culture media and later it is were subcultured 5 times each 21 days, on the same multiplication culture media containing Murashige and Skoog salts (1962, tiamine 1 mg.l-1, myoinositol 100 mg.l-1, 6-BAP 0.3 mg.l-1 and sucrose 30 g.l-1. The pH was 5.7 for all culture media. The results showed the relevance of agar concentration during in vitro establishment on multiplication of lemon grass. Differences among treatments until the 2nd subculture was observed. 3.43 new axillary shoots from each explant cultured on a culture media supplemented with 3 g.l-1 of agar was reached. Key words: lemon grass, medicinal plants, micropropagation, tissue culture

  19. Greens of the European Green Capitals

    Science.gov (United States)

    Cömertler, Seval

    2017-10-01

    Well established and maintained green areas have a key role on reaching the high quality of life and sustainability in urban environments. Therefore, green areas must be carefully accounted and evaluated in the urban planning affairs. In this context, the European Green Capitals, which attach a great importance to the green areas, have a great potential to act as a role model for both small and big cities in all around the world. These leading cities (chronologically, Stockholm, Hamburg, Vitoria-Gasteiz, Nantes, Copenhagen, Bristol, Ljubljana, Essen and Nijmegen) are inspiring for the other cities which seek to achieve more sustainable and environmentally friendly places through green areas. From this point of view, the aim of this paper was to investigate the green areas of the European Green Capitals. The paper covered whole European Green Capitals, and the application form of each Green Capital was used as a primary data source. Consequently, the paper put forwarded that the European Green Capitals have considerably large amount and high proportion of green areas. Further, these cities provide an excellent access to the public green areas. As a result of abundant provision and proper distribution, the almost all citizens in most of the Green Capitals live within a distance of 300 meters to a green area. For further researches, the paper suggested that these green capitals should be investigated in terms of their efforts, measures, goals and plans, policies and implications to administer, to protect, to enhance and to expand the green areas.

  20. PAMAM templated N,Pt co-doped TiO2 for visible light photodegradation of brilliant black.

    Science.gov (United States)

    Nzaba, Sarre Kadia Myra; Ntsendwana, Bulelwa; Mamba, Bhekie Brilliance; Kuvarega, Alex Tawanda

    2018-05-01

    This study examined the photocatalytic degradation of an azo dye brilliant black (BB) using non-metal/metal co-doped TiO 2 . N,Pt co-doped TiO 2 photocatalysts were prepared by a modified sol-gel method using amine-terminated polyamidoamine dendrimer generation 0 (PG0) as a template and source of nitrogen. Structural, morphological, and textural properties were evaluated using scanning electron microscopy coupled to energy-dispersive X-ray spectroscopy (SEM/EDX), high-resolution transmission electron microscopy (HRTEM), X-ray diffraction spectroscopy (XRD), X-ray photoelectron spectroscopy (XPS), thermal gravimetric analysis (TGA), Fourier transform infrared (FTIR), Raman spectroscopy (RS), photoluminescence (PL) and ultra-violet/visible spectroscopy (UV-Vis). The synthesized photocatalysts exhibited lower band gap energies as compared to the Degussa P-25, revealing a red shift in band gap towards the visible light absorption region. Photocatalytic activity of N,Pt co-doped TiO 2 was measured by the reaction of photocatalytic degradation of BB dye. Enhanced photodegradation efficiency of BB was achieved after 180-min reaction time with an initial concentration of 50 ppm. This was attributed to the rod-like shape of the materials, larger surface area, and enhanced absorption of visible light induced by N,Pt co-doping. The N,Pt co-doped TiO 2 also exhibited pseudo-first-order kinetic behavior with half-life and rate constant of 0.37 and 0.01984 min -1 , respectively. The mechanism of the photodegradation of BB under the visible light irradiation was proposed. The obtained results prove that co-doping of TiO 2 with N and Pt contributed to the enhanced photocatalytic performances of TiO 2 for visible light-induced photodegradation of organic contaminants for environmental remediation. Therefore, this work provides a new approach to the synthesis of PAMAM templated N,Pt co-doped TiO 2 for visible light photodegradation of brilliant black.

  1. Outcomes of 23-gauge pars plana vitrectomy and internal limiting membrane peeling with brilliant blue in macular hole

    Directory of Open Access Journals (Sweden)

    Nohutcu A

    2011-08-01

    Full Text Available Huseyin Sanisoglu1, Mehmet Sahin Sevim1, Betul Aktas1, Semra Sevim2, Ahmet Nohutcu11Haydarpasa Numune Education and Research Hospital, Department of Ophthalmology, 2Uskudar State Hospital, Eye Clinic, Istanbul, TurkeyPurpose: The evaluation of anatomic and visual outcomes in macular hole cases treated with internal limiting membrane (ILM peeling, brilliant blue (BB, and 23-gauge pars plana vitrectomy (PPV.Materials and methods: Fifty eyes of 48 patients who presented between July 2007 and December 2009 with the diagnosis of stage 2, 3, or 4 macular holes according to Gass Classification who had undergone PPV and ILM peeling were included in this study. Pre- and postoperative macular examinations were assessed with spectral-domain optical coherence tomography. 23 G sutureless PPV and ILM peeling with BB was performed on all patients.Results: The mean age of patients was 63.34 ± 9.6 years. Stage 2 macular hole was determined in 17 eyes (34%, stage 3 in 24 eyes (48%, and stage 4 in 9 eyes (18%. The mean follow-up time was 13.6 ± 1.09 months. Anatomic closure was detected in 46/50 eyes (92%, whereas, in four cases, macular hole persisted and a second operation was not required due to subretinal fluid drainage. At follow-up after 2 months, persistant macular hole was detected in one case and it was closed with reoperation. At 12 months, an increase in visual acuity in 41 eyes was observed, while it remained at the same level in six eyes. In three eyes visual acuity decreased. There was a postoperative statistically significant increase in visual acuity in stage 2 and 3 cases (P < 0.05, however, no increase in visual acuity in stage 4 cases was observed.Conclusion: PPV and ILM peeling in stage 2, 3, and 4 macular hole cases provide successful anatomic outcomes, however, in delayed cases, due to photoreceptor loss, it has no effect on functional recovery. BB, used for clarity of ILM, may be beneficial due to its low retinal toxicity.Keywords: macular

  2. Radiation effects on agar, alginates and carrageenan to be used as food additives

    International Nuclear Information System (INIS)

    Aliste, A.J.; Vieira, F.F.; Mastro, N.L. del

    2000-01-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  3. Radiation effects on agar, alginates and carrageenan to be used as food additives

    Energy Technology Data Exchange (ETDEWEB)

    Aliste, A.J. E-mail: nlmastro@net.ipen.br; Vieira, F.F.; Mastro, N.L. del

    2000-03-01

    Agar, alginates and carrageenan are hydrocolloids that induce stabilization of physical properties of the food product during shelf life and prevention of undesirable changes such as moisture migration, gas cell coalescence or textural profile changes. In this work, agar, alginates and carrageenan was irradiated as powder with different doses (0-10 kGy) of Co-60 and the rheological functional performance of water solutions of these irradiated additives was studied. The results are analyzed taking in account the future applications of those additives in irradiated foods. (author)

  4. Formation of Ramified Colony of Fungus Aspergillus Oryzae on Agar Media

    Science.gov (United States)

    Matsuura, Shu; Miyazima, Sasuke

    Ramified colonies of fungus Aspergillus oryzae have been found to grow at a low growth rate on "liquid-like" agar media with low concentrations of agar and glucose. Box-counting fractal dimensions of the individual colony branches have been found to decrease with the time of incubation. Addition of glucose solution in the interior of branched colonies has brought about the production of the hyphal filaments almost only at the apical region of the colony branches. Active growth of the ramified colonies is localized in the peripheral zone, and this growth manner implies that the fungus is exhibiting a positive exploitation.

  5. Comparison of Sabouraud dextrose and Pagano-Levin agar media for detection and isolation of yeasts from oral samples.

    OpenAIRE

    Samaranayake, L P; MacFarlane, T W; Williamson, M I

    1987-01-01

    The sensitivities of Sabouraud dextrose agar and modified Pagano-Levin agar for the primary isolation of yeasts and the recovery of multiple yeast species from single clinical samples were compared by using oral-rinse samples. Although there was a highly significant positive correlation between the numbers of yeasts recovered from both media, modified Pagano-Levin agar was far superior in detecting multiple yeast species in a single sample. Of 150 oral samples containing yeasts, 23 (15.3%) co...

  6. The effect of gamma - Radiation on the degradation of a diazo dye (diamine brilliant violet B ) in aqueous solutions

    International Nuclear Information System (INIS)

    El-Assy, N.B.; Abdel-Fattah, A.A.

    1986-01-01

    The effect of gamma radiation on the color intensity of aerated o 2-saturated and N 2-saturated aqueous solutions of diamine brilliant violet B (D B V B) was investigated. The studies of the absorption spectra show that the de coloration of the dye is promoted by the presence of oxygen and that the framework of the chromophores is destroyed almost completely at 2.9 KGy for concentration 4.75 x 10-2 g/L in the presence of oxygen. The kinetics of deceleration of solutions of (D B V B) turned out to be of the first order with respect to the dye concentration (from 0.02 to 0.1 g/L). The change of pH through the irradiation process was followed and it was found that,the ph of the solution decreased by increasing the dose, indicating that, the degradation of the dye molecule was accompanied by the formation of some organic acids especially in the presence of oxygen. The Gd-values for different initial concentrations at different doses were tabulated and a scheme for the deceleration process was proposed

  7. Degradation of Active Brilliant Red X-3B by a microwave discharge electrodeless lamp in the presence of activated carbon.

    Science.gov (United States)

    Fu, Jie; Wen, Teng; Wang, Qing; Zhang, Xue-Wei; Zeng, Qing-Fu; An, Shu-Qing; Zhu, Hai-Liang

    2010-06-01

    Degradation of Active Brilliant Red X-3B (X-3B) in aqueous solution by a microwave discharge electrodeless lamp (MDEL) in the presence of activated carbon was investigated. The preliminary results proved this method could effectively degrade X-3B in aqueous solution. The removal percentages of colour and chemical oxygen demand were up to approximately 99% and 66%, respectively, at the conditions of 0.8 g/L dye concentration, 20 g/L activated carbon, pH 7.0 and 8 min microwave irradiation time. The degradation basically belonged to first-order reaction kinetics and its rate constant was 0.42 min(-1). No aromatic organics were detected in the final treated solution, indicating that the mineralization was relatively complete. By studying the change in solution properties, it could be concluded that MDEL-assisted oxidation was the dominant reaction mechanism. In addition, the influence of operational parameters and reuse of activated carbon were also discussed.

  8. Mechanism of Coomassie Brilliant Blue G-250 binding to cetyltrimethylammonium bromide: an interference with the Bradford assay.

    Science.gov (United States)

    Aminian, Mahdi; Nabatchian, Fariba; Vaisi-Raygani, Asad; Torabi, Mojgan

    2013-03-15

    The Bradford protein assay is a popular method because of its rapidity, sensitivity, and relative specificity. This method is subject to some interference by nonprotein compounds. In this study, we describe the interference of cetyltrimethylammonium bromide (CTAB) with the Bradford assay. This interference is based on the interaction of Coomassie Brilliant Blue G-250 (CBB) with this cationic detergent. This study suggests that both electrostatic and hydrophobic interactions are involved in the interaction of CTAB and CBB. The anionic and neutral forms of CBB bind to CTAB by electrostatic attraction, which accelerates hydrophobic interactions of these CBB forms and the hydrophobic tail of CTAB. Consequently, the hydrophobic regions of the dominant free cationic form of CBB dye compete for the tail of CTAB with two other forms of the dye and gradually displace the primary hydrophobic interactions and rearrange the primary CBB-CTAB complex. This interaction of CTAB and CBB dye produces a primary 650-nm-absorbing complex that then gradually rearranges to a complex that shows an absorbance shoulder at 800-950 nm. This study conclusively shows a strong response of CBB to CTAB that causes a time-dependent and nearly additive interference with the Bradford assay. This study also may promote an application of CBB for CTAB quantification. Copyright © 2012 Elsevier Inc. All rights reserved.

  9. Removal of reactive dye Remazol Brilliant Blue R from aqueous solutions by using anaerobically digested sewage sludge based adsorbents

    Directory of Open Access Journals (Sweden)

    Özçimen Didem

    2016-01-01

    Full Text Available In this study, adsorbents were produced from sewage sludge via chemical and thermal activation processes. Experiments were carried out in a tubular furnace at the heating rate of 20˚C min-1 and temperature of 550 ˚C with a nitrogen flow rate of 400 mL min-1 for 1 h. Dye adsorption experiments were performed with Remazol Brilliant Blue R for its several concentrations under batch equilibrium conditions by comparing sewage sludge based adsorbents with raw material and a commercial activated carbon. Maximum adsorption capacities of carbonized sewage sludge (CSWS and activated sewage sludge (ASWS were found as 7.413 mg g-1 and 9.376 mg g-1 for 100 mg L-1 dye solution, whereas commercial activated carbon had a capacity of 11.561 mg g-1. Freundlich and Langmuir isotherms were used to explain the adsorption mechanism together with pseudo-first-order and pseudo-second-order kinetic models. Langmuir isotherm, which had adsorption capacities of 34.60 mg g-1 (CSWS and 72.99 mg g-1 (ASWS, provided better fit to the equilibrium data than that of Freundlich isotherm. Pseudo second-order, model which had adsorption capacities of 7.451 mg g-1 (CSWS and 9.319 mg g-1 (ASWS, was very favorable to explain the adsorption kinetics of the dye with high regression coefficients.

  10. Study on Brilliant Blue-chitosan System by Dual-wavelength Overlapping Resonance Rayleigh Scattering Method and its Analytical Applications

    Science.gov (United States)

    Ma, Caijuan; Sun, Zijun; Liu, Guihua; Su, Zhengquan; Bai, Yan

    2018-02-01

    The method was presented for the sensitive and selective determination of chitosan (CTS) in health products with Brilliant Blue (BB) as a probe, based on dual-wavelength overlapping resonance Rayleigh scattering (DWO-RRS). In weakly acidic buffer solution, the binding of CTS and BB could result in the RRS intensities getting enhanced significantly at RRS peaks of 344 nm and 452 nm, and the scattering intensities of the two peaks were proportional to the concentration of CTS within a certain range. When the RRS intensities of the two wavelengths were superposed, the results showed higher sensitivity. Under the optimum experimental conditions, the total of the two increased RRS intensities was linear to the CTS concentration in the range of 0.02-1.80 μg/mL and the limit of detection (LOD) was 7.45 ng/mL. In this work, the optimum conditions and the effects of some foreign substances were studied. Accordingly, the new method based on DWO-RRS for the determination of CTS was developed. In addition, the effect of the molecular weight and the deacetylation degree between different chitosan molecules was discussed. Finally, this assay was applied to determine the concentration of CTS in health products with satisfactory results.

  11. Inner retinal thinning after Brilliant Blue G-assisted internal limiting membrane peeling for vitreoretinal interface disorders.

    Science.gov (United States)

    Ambiya, Vikas; Goud, Abhilash; Khodani, Mitali; Chhablani, Jay

    2017-04-01

    The aim of this study was to evaluate ganglion cell layer and nerve fiber layer thickness after Brilliant Blue G (BBG)-assisted internal limiting membrane (ILM) peeling for vitreomacular disorders. Retrospective analysis of spectral domain optical coherence tomography (SD-OCT) of 42 eyes of 42 patients, who underwent pars plana vitrectomy with BBG-assisted ILM peeling, was performed. Inclusion criteria were idiopathic macular hole, idiopathic vitreomacular traction, and idiopathic epiretinal membrane. Key exclusion criteria were vitreoretinal interface abnormalities secondary to any other diseases, follow-up period of less than 3 months, and any other associated retinal pathology. Average, minimum, and sectoral ganglion cell, and inner plexiform layers (GCIPL) and retinal nerve fiber layer (RNFL) parameters were collected. Changes in these parameters from baseline to 3- and 6-month visits after surgery were analyzed. At 3 months after surgery, we found a statistically significant reduction in the average GCIPL thickness (P = 0.031) and also in the superior sectors (P peeling for vitreomacular interface disorders leads to thinning of the inner retina including GCIPL and RNFL. These structural changes should be correlated with retinal function tests to explore the pros and cons of this surgical step.

  12. Electrochemical Determination of Brilliant Blue and Tartrazine Based on an Ionic Liquid-Modified Expanded Graphite Paste Electrode.

    Science.gov (United States)

    Wang, Wenchang; Chen, Ye; Zhang, Jing; Wang, Xue; Chen, Zhidong

    2015-01-01

    A sensitive electrochemical method was developed for the simultaneous determination of Brilliant Blue (BB) and tartrazine (Tz) using an ionic liquid-modified expanded graphite paste electrode (IL-EGPE). The IL-EGPE was prepared by mixing ionic liquid-expanded graphite composite (IL-EG) with solid paraffin. Compared with the EGPE, the IL-EGPE remarkably enhanced the electrocatalytic oxidation signals of BB and Tz. Under optimal experimental conditions, the designed IL-EGPE exhibited wide linear responses to BB and Tz ranging from 5.0×10(-9) to 4.0×10(-6) M and 1.0×10(-8) to 1.0×10(-6) M, respectively. The detection limits for BB and Tz were 2.0×10(-9) M (1.6 ng/mL) and 3.3×10(-9) M (1.8 ng/mL) at an S/N of 3, respectively. This electrode showed good reproducibility, stability, and reusability. The proposed method was successfully applied in the simultaneous determination of BB and Tz in a soft drink with satisfactory results.

  13. Chemical Modification of Oryza sativa Linnaeus Husk with Urea for Removal of Brilliant Vital Red and Murexide Dyes from Water by Adsorption in Environmentally Benign Way

    International Nuclear Information System (INIS)

    Rehman, R.; Mahmud, T.; Kanwal, F.; Aslam, M.N.; Nisar, H.

    2013-01-01

    Oryza sativa Linnaeus is an important food item all around the world. Due to its huge consumption, a large amount of rice husk is generated as agrowaste which can be used for water treatment by adsorption. Its adsorption capacity further can be enhanced by chemical medication. In the present study, urea modified rice husk has been used for removing Brilliant Vital Red and Murexide form water in an efficient way. After optimizing operating conditions, isothermal and thermodynamical studies were carried out, which showed that maximum adsorption capacity of urea modified rice husk for removing Brilliant Vital Red and Murexide dyes were 28.93 and 30.74 mg.g/sup -1/. Adsorbent characterization was carried out by recording its FT-IR spectra. (author)

  14. Comparison of the Cellient(™) automated cell block system and agar cell block method.

    Science.gov (United States)

    Kruger, A M; Stevens, M W; Kerley, K J; Carter, C D

    2014-12-01

    To compare the Cellient(TM) automated cell block system with the agar cell block method in terms of quantity and quality of diagnostic material and morphological, histochemical and immunocytochemical features. Cell blocks were prepared from 100 effusion samples using the agar method and Cellient system, and routinely sectioned and stained for haematoxylin and eosin and periodic acid-Schiff with diastase (PASD). A preliminary immunocytochemical study was performed on selected cases (27/100 cases). Sections were evaluated using a three-point grading system to compare a set of morphological parameters. Statistical analysis was performed using Fisher's exact test. Parameters assessing cellularity, presence of single cells and definition of nuclear membrane, nucleoli, chromatin and cytoplasm showed a statistically significant improvement on Cellient cell blocks compared with agar cell blocks (P cell groups, PASD staining or the intensity or clarity of immunocytochemical staining. A discrepant immunocytochemistry (ICC) result was seen in 21% (13/63) of immunostains. The Cellient technique is comparable with the agar method, with statistically significant results achieved for important morphological features. It demonstrates potential as an alternative cell block preparation method which is relevant for the rapid processing of fine needle aspiration samples, malignant effusions and low-cellularity specimens, where optimal cell morphology and architecture are essential. Further investigation is required to optimize immunocytochemical staining using the Cellient method. © 2014 John Wiley & Sons Ltd.

  15. Hyperspectral image reconstruction using RGB color for foodborne pathogen detection on agar plates

    Science.gov (United States)

    Yoon, Seung-Chul; Shin, Tae-Sung; Park, Bosoon; Lawrence, Kurt C.; Heitschmidt, Gerald W.

    2014-03-01

    This paper reports the latest development of a color vision technique for detecting colonies of foodborne pathogens grown on agar plates with a hyperspectral image classification model that was developed using full hyperspectral data. The hyperspectral classification model depended on reflectance spectra measured in the visible and near-infrared spectral range from 400 and 1,000 nm (473 narrow spectral bands). Multivariate regression methods were used to estimate and predict hyperspectral data from RGB color values. The six representative non-O157 Shiga-toxin producing Eschetichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) were grown on Rainbow agar plates. A line-scan pushbroom hyperspectral image sensor was used to scan 36 agar plates grown with pure STEC colonies at each plate. The 36 hyperspectral images of the agar plates were divided in half to create training and test sets. The mean Rsquared value for hyperspectral image estimation was about 0.98 in the spectral range between 400 and 700 nm for linear, quadratic and cubic polynomial regression models and the detection accuracy of the hyperspectral image classification model with the principal component analysis and k-nearest neighbors for the test set was up to 92% (99% with the original hyperspectral images). Thus, the results of the study suggested that color-based detection may be viable as a multispectral imaging solution without much loss of prediction accuracy compared to hyperspectral imaging.

  16. Investigation of dental alginate and agar impression materials as a brain simulant for ballistic testing.

    Science.gov (United States)

    Falland-Cheung, Lisa; Piccione, Neil; Zhao, Tianqi; Lazarjan, Milad Soltanipour; Hanlin, Suzanne; Jermy, Mark; Waddell, J Neil

    2016-06-01

    Routine forensic research into in vitro skin/skull/brain ballistic blood backspatter behavior has traditionally used gelatin at a 1:10 Water:Powder (W:P) ratio by volume as a brain simulant. A limitation of gelatin is its high elasticity compared to brain tissue. Therefore this study investigated the use of dental alginate and agar impression materials as a brain simulant for ballistic testing. Fresh deer brain, alginate (W:P ratio 91.5:8.5) and agar (W:P ratio 81:19) specimens (n=10) (11×22×33mm) were placed in transparent Perspex boxes of the same internal dimensions prior to shooting with a 0.22inch caliber high velocity air gun. Quantitative analysis to establish kinetic energy loss, vertical displacement elastic behavior and qualitative analysis to establish elasticity behavior was done via high-speed camera footage (SA5, Photron, Japan) using Photron Fastcam Viewer software (Version 3.5.1, Photron, Japan) and visual observation. Damage mechanisms and behavior were qualitatively established by observation of the materials during and after shooting. The qualitative analysis found that of the two simulant materials tested, agar behaved more like brain in terms of damage and showed similar mechanical response to brain during the passage of the projectile, in terms of energy absorption and vertical velocity displacement. In conclusion agar showed a mechanical and subsequent damage response that was similar to brain compared to alginate. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  17. Mechanical, Thermal and Surface Investigations of Chitosan/Agar/PVA Ternary Blended Films

    Directory of Open Access Journals (Sweden)

    Esam A. El-Hefian

    2011-01-01

    Full Text Available The mechanical and thermal properties of chitosan/agar/poly vinyl alcohol (CS/AG/PVA ternary blended films having various proportions considering chitosan as the main component were investigated. The various variables static water contact angle such as contact angle, drop base area, drop volume and drop height was also studied in correlation with the variation of time. Results obtained from mechanical measurements showed a noticeable increase in the tensile strength (TS coincided with a sharp decrease in elongation percent at break (E% of blended films with increasing agar and PVA contents. The DSC results prevailed the development of an interaction between chitosan individual components: agar and PVA. Moreover, an enhancement of the wettability of the blends was obtained with increasing agar and PVA contents. It was also found that the pure CS film and the blended films with 90/05/05 and 80/10/10 compositions were more affected by time than blended films with other compositions when the contact angle, the drop height and the drop length were studied as a function of time. In addition, when the drop is initially placed on the substrate, the drop area and the drop volume of all films remained almost constant up to a certain time after which they showed a slight difference with the elapse of time.

  18. Medium dependant production of corymbiferone a novel product from Penicillium hordei cultured on plant tissue agar

    DEFF Research Database (Denmark)

    Overy, David Patrick; Zidorn, C.; Petersen, B.O.

    2005-01-01

    Medium dependant production and the structure elucidation of corymbiferone (1) from the fungus Penicillitan hordei grown on oatmeal and macerated tulip, yellow onion and red onion agars are reported. Compound 1 possesses an unusual oxygenated aromatic structure with a lactone bridge preventing full...

  19. Spore-to-spore agar culture of the myxomycete Physarum globuliferum.

    Science.gov (United States)

    Liu, Pu; Wang, Qi; Li, Yu

    2010-02-01

    The ontogeny of the myxomycete Physarum globuliferum was observed on corn meal agar and hanging drop cultures without adding sterile oat flakes, bacteria or other microorganisms. Its complete life cycle including spore germination, myxamoebae, swarm cells, plasmodial development, and maturity of fructifications was demonstrated. Details of spore-to-spore development are described and illustrated.

  20. Potato carrot agar with manganese as an isolation medium for Alternaria, Epicoccum and Phoma

    DEFF Research Database (Denmark)

    Sørensen, Jens Laurids; Mogensen, Jesper Mølgaard; Thrane, Ulf

    2009-01-01

    A semi-selective medium for isolation of Alternaria spp., Epicoccum sp. and Phoma spp. from soil and plant samples was developed. The basal medium was a modified potato carrot agar (PCA), containing 10 g/L of potato and carrot. It is known that the target genera sporulate well on standard PCA when...

  1. Cell cytotoxicity and mycotoxin and secondary metabolite production by common penicillia on cheese agar

    DEFF Research Database (Denmark)

    Gareis, M.; Larsen, Thomas Ostenfeld; Frisvad, Jens Christian

    2002-01-01

    Known or potential new fungal starter culture species such as Penicillium camemberti, P. roqueforti, P. nalgiovense, P. caseifulvum, and P. solitum have been cultivated on a cheese agar medium together with the common cheese contaminants P. commune, P. crustosum, P. discolor, P. atramentosum, and P...

  2. Phenotypic differentiation of species from Aspergillus section Flavi on neutral red desiccated coconut agar

    DEFF Research Database (Denmark)

    Atanda, O. O.; Adetunji, M. C.; Ezekiel, C. N.

    2014-01-01

    In order to facilitate easy and rapid identification of aflatoxin-producing Aspergillus species, the phenotypic traits of Aspergillus section Flavi isolates were examined on neutral red desiccated coconut agar (NRDCA). Phenotype variations in colony morphology and the relationship between colour...

  3. Thallium toxicosis in a dog consequent to ingestion of Mycoplasma agar plates.

    Science.gov (United States)

    Puschner, Birgit; Basso, Marguerite M; Graham, Thomas W

    2012-01-01

    A 1-year-old dog ingested a mixture of blood agar and Mycoplasma agar plates. The Mycoplasma agar plates contained thallium acetate, which resulted in an estimated minimum dose of 5 mg thallium acetate/kg bodyweight. Clinical signs over the course of 2-3 weeks included vomiting, diarrhea, weight loss, alopecia, dysphonia, ataxia, paresthesia, intension tremors, megaesophagus with subsequent aspiration pneumonia, and several seizure episodes. The dog was treated with intravenous fluids and placement of a gastric feeding tube. Thallium concentrations in hair were 8.2 µg/g in samples taken on day 19, 16.4 µg/g in samples taken 3 months after exposure, 13.4 µg/g in samples taken 5 months after exposure, and nondetectable in samples taken 7 months after exposure. The blood thallium concentration was 190 µg/l on day 19 and nondetec table 3 months after exposure. Megaesophagus and dysphonia continued for 10 months after exposure. This case of thallium poisoning following ingestion of mycoplasma agar plates demonstrates that unusual sources of thallium still exist and suggests that thallium toxicosis should be included in the list of differential diagnoses in dogs presented with megaesophagus, especially if alopecia and other unexplained peripheral neuropathies are present. Hair and blood samples are useful specimens to reach an accurate diagnosis even if taken several weeks post exposure. The postexposure blood and hair thallium concentrations reported in this case are useful data for diagnosticians investigating dogs with potential thallium poisoning.

  4. Colwellia agarivorans sp. nov., an agar-digesting marine bacterium isolated from coastal seawater

    Science.gov (United States)

    A novel Gram-stain-negative, facultatively anaerobic, yellowish and agar-digesting marine bacterium, designated strain QM50**T, was isolated from coastal seawater in an aquaculture site near Qingdao, China. Phylogenetic analysis based on 16S rDNA sequences revealed that the novel isolate represented...

  5. Effects of season on the yield and quality of agar from Gelidium ...

    African Journals Online (AJOL)

    The aim of this work was to study the seasonal variations in the yield and physicochemical properties of agar of Gelidium sesquipedale. The algae were col lected from January 2011 to December 2011, from the coast of Mostaganem, western Algeria. The overall results show that the dry biomass of Gelidium sesquipedale ...

  6. Can serums be replaced by Mueller‑Hinton agar in germ tube test?

    African Journals Online (AJOL)

    2016-03-03

    Mar 3, 2016 ... various serums (i.e., human, rabbit, horse, and fetal bovine serum) used in the GTT and Mueller‑Hinton agar (MHA). Materials and Methods: Fifty species isolated from various clinical samples that were defined as C. albicans by both conventional and DNA sequence analysis methods were included in the ...

  7. Colony formation in agar: in vitro assay for haemopoietic stem cells

    NARCIS (Netherlands)

    Dicke, K.A.; Platenburg, M.G.C.; Bekkum, D.W. van

    1971-01-01

    Using a method in which embryo fibroblasts were used as feeder layers, the colony forming capacity in agar of a variety of mouse haemopoietic suspensions was compared with their CFUs content. A striking parallelism between the results of the two assays was found. In addition, under certain

  8. Growth and study of barium oxalate single crystals in agar gel

    Indian Academy of Sciences (India)

    Barium oxalate was grown in agar gel at ambient temperature. The effect of various parameters like gel concentration, gel setting time and concentration of the reactants on the growth of these crystals was studied. Prismatic platy shaped spherulites and dendrites were obtained. The grown crystals were characterized by ...

  9. Green Manufacturing

    Energy Technology Data Exchange (ETDEWEB)

    Patten, John

    2013-12-31

    Green Manufacturing Initiative (GMI): The initiative provides a conduit between the university and industry to facilitate cooperative research programs of mutual interest to support green (sustainable) goals and efforts. In addition to the operational savings that greener practices can bring, emerging market demands and governmental regulations are making the move to sustainable manufacturing a necessity for success. The funding supports collaborative activities among universities such as the University of Michigan, Michigan State University and Purdue University and among 40 companies to enhance economic and workforce development and provide the potential of technology transfer. WMU participants in the GMI activities included 20 faculty, over 25 students and many staff from across the College of Engineering and Applied Sciences; the College of Arts and Sciences' departments of Chemistry, Physics, Biology and Geology; the College of Business; the Environmental Research Institute; and the Environmental Studies Program. Many outside organizations also contribute to the GMI's success, including Southwest Michigan First; The Right Place of Grand Rapids, MI; Michigan Department of Environmental Quality; the Michigan Department of Energy, Labor and Economic Growth; and the Michigan Manufacturers Technical Center.

  10. Green chemistry

    International Nuclear Information System (INIS)

    Warner, John C.; Cannon, Amy S.; Dye, Kevin M.

    2004-01-01

    A grand challenge facing government, industry, and academia in the relationship of our technological society to the environment is reinventing the use of materials. To address this challenge, collaboration from an interdisciplinary group of stakeholders will be necessary. Traditionally, the approach to risk management of materials and chemicals has been through inerventions intended to reduce exposure to materials that are hazardous to health and the environment. In 1990, the Pollution Prevention Act encouraged a new tact-elimination of hazards at the source. An emerging approach to this grand challenge seeks to embed the diverse set of environmental perspectives and interests in the everyday practice of the people most responsible for using and creating new materials--chemists. The approach, which has come to be known as Green Chemistry, intends to eliminate intrinsic hazard itself, rather than focusing on reducing risk by minimizing exposure. This chapter addresses the representation of downstream environmental stakeholder interests in the upstream everyday practice that is reinventing chemistry and its material inputs, products, and waste as described in the '12 Principles of Green Chemistry'

  11. Green urbanity

    Directory of Open Access Journals (Sweden)

    Alenka Fikfak

    2012-01-01

    Full Text Available Tourism and other culture-based types of small business, which are the leitmotif in the planning of the Europark Ruardi, are becoming the guiding motif in the spatial development of urban centres that are influenced by dynamic transformation processes. The system should build upon the exploitation of both local and regional environmental features. This would encourage the quest for special environmental features, with an emphasis on their conservation, i.e. sustainable development, and connections in a wider context.The Europark is seen as a new strategic point of the Zasavje Region (the region of the central Sava Valley, which is linked to other important points in a region relevant for tourism. Due to the "smallness" of the region and/or the proximity of such points, development can be fast and effective. The interaction of different activities in space yields endless opportunities for users, who choose their own goals and priorities in the use of space. Four theme areas of the Europark area planning are envisaged. The organisation of activities is based on the composition of the mosaic field patterns, where green fields intertwine with areas of different, existing and new, urban functions. The fields of urban and recreation programmes are connected with a network of green areas and walking trails, along which theme park settings are arranged.

  12. Green shipping management

    CERN Document Server

    Lun, Y H Venus; Wong, Christina W Y; Cheng, T C E

    2016-01-01

    This book presents theory-driven discussion on the link between implementing green shipping practices (GSP) and shipping firm performance. It examines the shipping industry’s challenge of supporting economic growth while enhancing environmental performance. Consisting of nine chapters, the book covers topics such as the conceptualization of green shipping practices (GSPs), measurement scales for evaluating GSP implementation, greening capability, greening and performance relativity (GPR), green management practice, green shipping network, greening capacity, and greening propensity. In view of the increasing quest for environment protection in the shipping sector, this book provides a good reference for firms to understand and evaluate their capability in carrying out green operations on their shipping activities.

  13. From green architecture to architectural green

    DEFF Research Database (Denmark)

    Earon, Ofri

    2011-01-01

    that describes the architectural exclusivity of this particular architecture genre. The adjective green expresses architectural qualities differentiating green architecture from none-green architecture. Currently, adding trees and vegetation to the building’s facade is the main architectural characteristics...... they have overshadowed the architectural potential of green architecture. The paper questions how a green space should perform, look like and function. Two examples are chosen to demonstrate thorough integrations between green and space. The examples are public buildings categorized as pavilions. One......The paper investigates the topic of green architecture from an architectural point of view and not an energy point of view. The purpose of the paper is to establish a debate about the architectural language and spatial characteristics of green architecture. In this light, green becomes an adjective...

  14. « Beautiful Idiots and Brilliant Lunatics » Social Comedy, Nostalgia and a World of Fantasy (Wilde and Hofmannsthal)

    OpenAIRE

    François, Anne-Isabelle

    2016-01-01

    The article focuses on the social comedies where a reception is being held, these passages offering a key to understanding not only the lasting popularity of the productions, but also the symbolic value and general ambivalence of Wilde’s theatrical picture of the Victorian upper class. The acts present an extremely brilliant, though exaggerated mirror world and act thus as critical comments upon the fabric of British society, a glowing Schein on the brink of disappearing forever. Wilde’s stag...

  15. A simple method for simultaneous spectrophotometric determination of brilliant blue fcf and sunset yellow fcf in food samples after cloud point extraction

    International Nuclear Information System (INIS)

    Heydari, R.

    2016-01-01

    In this study, a simple and low-cost method for extraction and pre-concentration of brilliant blue FCF and sunset yellow FCF in food samples using cloud point extraction (CPE) and spectrophotometric detection was developed. The effects of main factors such as solution pH, surfactant concentration, salt and its concentration, incubation time and temperature on the CPE of both dyes were investigated and optimized. Linear range of calibration graphs were obtained in the range of 16.0-1300 ng mL-1 for brilliant blue FCF and 25.0-1300 ng mL/sup -1/ for sunset yellow FCF under the optimum conditions. Limit of detection values for brilliant blue FCF and sunset yellow FCF were 3 and 6 ng mL-1, respectively. The relative standard deviation (RSD) values of both dyes for repeated measurements (n=6) were less than 4.57 %. The obtained results were demonstrated the proposed method can be applied satisfactory to determine these dyes in different food samples. (author)

  16. Influence of operating conditions on the removal of brilliant vital red dye from aqueous media by bio-sorption using rice husk

    International Nuclear Information System (INIS)

    Rehman, R.; Anwar, J.; Mahmud, T.; Salman, M.; Shafique, U.

    2011-01-01

    Bio-sorption is emerging as an economical and eco friendly methodology for the removal of hazardous and toxic chemicals from waste water. The operating conditions have a great influence on the efficiency of this process. Conventional and indigenous bio sorbents like bagasse, wheat husk and rice husk have been evaluated for their removing efficiency of Brilliant Vital Red dye from water. Rice husk is proved better among them. The effect of important operating conditions for the removal of the dye using rice husk were studied. The observed optimum values for various factors are; 0.2 g of bio sorbent, 25 ppm initial dye concentration, 30 deg. C temperature, 15 minutes contact time, 300 rpm stirring speed and 2.0 ph. Langmuir adsorption isotherm model was also applied to evaluate maximum adsorption capacity of rice husk for Brilliant Vital Red dye. Q/sub max/ value was 15.06 which indicated that rice husk can effectively be used for the removal of Brilliant Vital Red dye from wastewater using the optimized operational conditions. This study would be accommodative with regard to practical wastewater treatment. (author)

  17. Use of Dehydrated Agar to Estimate Microbial Water Quality for Horticulture Irrigation.

    Science.gov (United States)

    Meador, Dustin P; Fisher, Paul R; Guy, Charles L; Harmon, Philip F; Peres, Natalia A; Teplitski, Max

    2016-07-01

    Petrifilms are dehydrated agar culture plates that have been used to quantify colony forming units (CFU) mL of either aerobic bacteria (Petrifilm-AC) or fungus (Petrifilm-YM), depending on substrate composition. Microbes in irrigation systems can indicate biofilm risk and potential clogging of irrigation emitters. The research objective was to compare counts on Petrifilms versus traditional, hydrated-agar plates using samples collected from recirculated irrigation waters and cultures of isolated known species. The estimated count (in CFU mL) from a recirculated irrigation sample after 7 d of incubation on Petrifilm-YM was only 5.5% of the count quantified using sabouraud dextrose agar (SDA) with chloramphenicol after 14 d. In a separate experiment with a known species, Petrifilm-YM did not successfully culture zoospores of . Isolates of viable zoospores were cultured successfully on potato-dextrose agar (PDA), with comparable counts with a vegetable juice medium supplemented with the antibiotics pimaricin, ampicillin, rifamycin, pentochloronitrobenzene and hymexazol (PARP-H). The quantification of pv. Begoniaceae on Petrifilm-AC was not significantly different ( < 0.05) than on PDA, but was lower than on Reasoner and Goldrich agar (R2A) or with a hemocytometer. The current formulation of Petrifilm-YM is unlikely to be a useful monitoring method for plant pathogens in irrigation water because of the inability to successfully culture oomycetes. However, Petrifilm-AC was an effective method to quantify bacteria and can provide an easy-to-use on-farm tool to monitor biofilm risk and microbial density. Copyright © by the American Society of Agronomy, Crop Science Society of America, and Soil Science Society of America, Inc.

  18. Green business will remain green

    International Nuclear Information System (INIS)

    Marcan, P.

    2008-01-01

    It all started with two words. Climate change. The carbon dioxide trading scheme, which was the politicians' idea on solving the number one global problem, followed. Four years ago, when the project was begun, there was no data for project initiation. Quotas for polluters mainly from energy production and other energy demanding industries were distributed based on spreadsheets, maximum output and expected future development of economies. Slovak companies have had a chance to profit from these arrangements since 2005. Many of them took advantage of the situation and turned the excessive quotas into an extraordinary profit which often reached hundreds of million Sk. The fact that the price of free quotas offered for sale dropped basically to 0 in 2006 only proved that the initial distribution was too generous. And the market reacted to the first official measurements of emissions. Slovak companies also contributed to this development. However, when planning the maximum emission volumes for 2008-2012 period, in spite of the fact that actual data were available, their expectations were not realistic. A glance at the figures in the proposal of the Ministry of Environment is sufficient to realize that there will be no major change in the future. And so for many Slovak companies business with a green future will remain green for the next five years. The state decided to give to selected companies even more free space as far as emissions are concerned. The most privileged companies can expect quotas increased by tens of percent. (author)

  19. Green Power Partner Resources

    Science.gov (United States)

    EPA Green Power Partners can access tools and resources to help promote their green power commitments. Partners use these tools to communicate the benefits of their green power use to their customers, stakeholders, and the general public.

  20. Green Vehicle Guide

    Science.gov (United States)

    ... label Buy green. Save green. Learn about MPG math Discover fuel-saving tips Promote green ... U.S. consumers who have already purchased new vehicles under the fuel economy & greenhouse gas standard! More about the standards » Check ...

  1. Green Transformational Leadership and Green Performance: The Mediation Effects of Green Mindfulness and Green Self-Efficacy

    Directory of Open Access Journals (Sweden)

    Yu-Shan Chen

    2014-09-01

    Full Text Available No prior literature explores the influence of green transformational leadership on green performance, thus, this study develops a novel research framework to fill the research gap. This study investigates the influence of green transformational leadership on green performance and discusses the mediation effects of green mindfulness and green self-efficacy by means of structural equation modeling (SEM. The results indicate that green transformational leadership positively influences green mindfulness, green self-efficacy, and green performance. Moreover, this study demonstrates that the positive relationship between green transformational leadership and green performance is partially mediated by the two mediators: green mindfulness and green self-efficacy. It means that green transformational leadership can not only directly affect green performance positively but also indirectly affect it positively through green mindfulness and green self-efficacy. Therefore, firms need to raise their green transformational leadership, green mindfulness, and green self-efficacy to increase their green performance.

  2. Differentiating non-0157:H7 STEC serogroups from ground beef plated on agar media by hyperspetral imaging

    Science.gov (United States)

    Introduction: The development of an assay to detect and confirm a positive non-O157:H7 isolate is challenging when mixed morphologically results are obtained from the serogroups growing on Rainbow agar. Rainbow agar is only claimed by the manufacturer to be very specific for E.coli O157:H7 strain...

  3. Discolored Red Seaweed Pyropia yezoensis with Low Commercial Value Is a Novel Resource for Production of Agar Polysaccharides.

    Science.gov (United States)

    Sasuga, Keiji; Yamanashi, Tomoya; Nakayama, Shigeru; Ono, Syuetsu; Mikami, Koji

    2018-04-26

    The red seaweed Pyropia yezoensis has been demonstrated to be a novel resource for the production of high-quality agar. P. yezoensis is grown for the food industry in large-scale Japanese mariculture operations. However, discolored P. yezoensis is mostly discarded as an industrial waste, although it has some kind of utility values. Here, we evaluated the utility of discolored P. yezoensis as a resource for agar production. The quality of agar from the discolored seaweed was comparable to that from normal seaweed. In addition, as a distinguishing characteristic, agar yield was higher from discolored seaweeds than from normal types. Moreover, we successfully used agar from discolored P. yezoensis for bacterial plate media and DNA electrophoresis gels without agarose purification. Thus, our results demonstrate that discolored P. yezoensis is suitable for agar production and use in life science research. Diverting discolored P. yezoensis from disposal to agar production provides a solution to the current industrial waste problem in mariculture, as well as a secure source of agar for research purposes.

  4. Effect of lignin on water vapor barrier, mechanical, and structural properties of agar/lignin composite films.

    Science.gov (United States)

    Shankar, Shiv; Reddy, Jeevan Prasad; Rhim, Jong-Whan

    2015-11-01

    Biodegradable composite films were prepared using two renewable resources based biopolymers, agar and lignin alkali. The lignin was used as a reinforcing material and agar as a biopolymer matrix. The effect of lignin concentration (1, 3, 5, and 10wt%) on the performance of the composite films was studied. In addition, the mechanical, water vapor barrier, UV light barrier properties, FE-SEM, and TGA of the films were analyzed. The agar/lignin films exhibited higher mechanical and UV barrier properties along with lower water vapor permeability compared to the neat agar film. The FTIR and SEM results showed the compatibility of lignin with agar polymer. The swelling ratio and moisture content of agar/lignin composite films were decreased with increase in lignin content. The thermostability and char content of agar/lignin composite films increased with increased lignin content. The results suggested that agar/lignin films have a potential to be used as a UV barrier food packaging material for maintaining food safety and extending the shelf-life of the packaged food. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus

    NARCIS (Netherlands)

    Laarhoven, Bob; Elissen, H.J.H.; Temmink, H.; Buisman, C.J.N.

    2016-01-01

    An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv). The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water

  6. On the quantitative Amido Black B staining of protein spots in agar gel at low local protein concentrations

    NARCIS (Netherlands)

    Jansen, M.T.

    1962-01-01

    Protein spots in agar gel of identical protein content but different in surface area are found to bind different amounts of dye upon staining with Amido Black B. The lower the protein concentration within the agar gel, the more the Amido Black B content of the spot falls short of the value expected

  7. Central Region Green Infrastructure

    Data.gov (United States)

    Minnesota Department of Natural Resources — This Green Infrastructure data is comprised of 3 similar ecological corridor data layers ? Metro Conservation Corridors, green infrastructure analysis in counties...

  8. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    International Nuclear Information System (INIS)

    Akasaka, Tsukasa; Matsuoka, Makoto; Hashimoto, Takeshi; Abe, Shigeaki; Uo, Motohiro; Watari, Fumio

    2010-01-01

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  9. Agar Sediment Test for Assessing the Suitability of Organic Waste Streams for Recovering Nutrients by the Aquatic Worm Lumbriculus variegatus.

    Directory of Open Access Journals (Sweden)

    Bob Laarhoven

    Full Text Available An agar sediment test was developed to evaluate the suitability of organic waste streams from the food industry for recovering nutrients by the aquatic worm Lumbriculus variegatus (Lv. The effects of agar gel, sand, and food quantities in the sediment test on worm growth, reproduction, and water quality were studied. Agar gel addition ameliorated growth conditions by reducing food hydrolysis and altering sediment structure. Best results for combined reproduction and growth were obtained with 0.6% agar-gel (20 ml, 10 g. fine sand, 40 g. coarse sand, and 105 mg fish food (Tetramin. With agar gel, ingestion and growth is more the result of addition of food in its original quality. Final tests with secondary potato starch sludge and wheat bran demonstrated that this test is appropriate for the comparison of solid feedstuffs and suspended organic waste streams. This test method is expected to be suitable for organic waste studies using other sediment dwelling invertebrates.

  10. The bactericidal effect of carbon nanotube/agar composites irradiated with near-infrared light on Streptococcus mutans

    Energy Technology Data Exchange (ETDEWEB)

    Akasaka, Tsukasa, E-mail: akasaka@den.hokudai.ac.jp [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Matsuoka, Makoto [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan); Hashimoto, Takeshi [Meijo Nano Carbon Co. Ltd., Otsubashi bldg. 4F, 3-4-10 Marunouchi, Naka-ku, Nagoya 460-0002 (Japan); Abe, Shigeaki; Uo, Motohiro; Watari, Fumio [Graduate School of Dental Medicine, Hokkaido University, Kita13 Nishi7, Kita-ku, Sapporo 060-8586 (Japan)

    2010-10-15

    Dental caries are mainly associated with oral pathogens, and Streptococcus mutans is a primary cariogenic organism. Many methods have been established to eliminate S. mutans from the oral cavity. This study aimed to evaluate the effect of carbon nanotube (CNT)/agar composites irradiated with near-infrared (NIR) light on S. mutans, as a potential photothermal antimicrobial nanotherapy. A colony-forming unit assay clearly showed that CNT/agar composites attain bactericidal activity after NIR light irradiation; this bactericidal activity is higher than that of graphite (GP)/agar and activated carbon (AC)/agar composites. Furthermore, it was observed that longer irradiation times immobilized S. mutans in the CNT/agar composite.

  11. The green building envelope : Vertical greening

    NARCIS (Netherlands)

    Ottelé, M.

    2011-01-01

    Planting on roofs and façades is one of the most innovative and fastest developing fields of green technologies with respect to the built environment and horticulture. This thesis is focused on vertical greening of structures and to the multi-scale benefits of vegetation. Vertical green can improve

  12. How Green is 'Green' Energy?

    Science.gov (United States)

    Gibson, Luke; Wilman, Elspeth N; Laurance, William F

    2017-12-01

    Renewable energy is an important piece of the puzzle in meeting growing energy demands and mitigating climate change, but the potentially adverse effects of such technologies are often overlooked. Given that climate and ecology are inextricably linked, assessing the effects of energy technologies requires one to consider their full suite of global environmental concerns. We review here the ecological impacts of three major types of renewable energy - hydro, solar, and wind energy - and highlight some strategies for mitigating their negative effects. All three types can have significant environmental consequences in certain contexts. Wind power has the fewest and most easily mitigated impacts; solar energy is comparably benign if designed and managed carefully. Hydropower clearly has the greatest risks, particularly in certain ecological and geographical settings. More research is needed to assess the environmental impacts of these 'green' energy technologies, given that all are rapidly expanding globally. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Control of the pattern of perithecium development in Sordaria fimicola on agar medium.

    Science.gov (United States)

    Pollock, R T

    1975-06-01

    In a Sordaria fimicola (Rob.) Ces. and de Not. colony grown on agar medium in a petri plate, perithecia developed in a narrow band around the plate edge after the colony margin reached the edge. Physical wounding of the colony carried out shortly before or during the time perithecia were developing around the plate edge stimulated perithecium development in the wound area. Diffusion barriers were created by cutting small trenches in the agar parallel to the plate edge. The trenches were made at several different positions between the plate center and edge using cultures of several different ages, and the resultant distribution of perithecia along the trench edges suggested that the colony center and periphery produce diffusible inhibitors of perithecium development. These inhibitors may be responsible, in part, for the observed pattern of perithecium development in the colony.

  14. Substances used as gelling agent alternative to the agar in culture media for in vitro propagation

    Directory of Open Access Journals (Sweden)

    Darío Alonso Martin Gordo

    2012-10-01

    Full Text Available The cultivation of plant fibers is achieved through the implementation of a group of techniques widely used for the propagation of plants in vitro. However, one disadvantage of these techniques is the high cost of components used for the crop’s medium, among these, the agar (primary gelling agent, has seen a price increase due to high demand. This article consults several studies regarding substances that have been utilized as alternative gelling agents, among which highlight starches (native or modified and several plant gums and bacterial excretions that have been used in processes of organogenesis, embryogenesis and vegetative proliferation. The starches and gums studied showed favorable results in the in vitro cultivation of some plant species. The study demonstrates that both gums and starches may be potential substitutes (either partial or total for agar, achieve a decrease in costs associated with starches, and have an ability to be chemically modified to improve gelling capacity.

  15. Sterilization of MacConkey agar and CLED medium by gamma-radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Eisenberg, E; Altmann, G

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by gamma-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4 degrees C and compared well with freshly autoclaved media.

  16. Sterilization of MacConkey agar and CLED medium by. gamma. -radiation

    Energy Technology Data Exchange (ETDEWEB)

    Bogokowsky, B; Altmann, G [Sheba Medical Center, Tel Hashomer (Israel); Tel Aviv Univ. (Israel). Medical School); Eisenberg, E [Israel Atomic Energy Commission, Yavne. Soreq Nuclear Research Center

    1983-10-01

    MacConkey agar and Cystine-Lactose-Electrolyte-Deficient (CLED) agar, media widely used in the bacteriological laboratory and recommended for the detection of urinary tract infections, were sterilized by ..gamma..-radiation at a dose of 1.5 Mrad. Both were modified and adapted to radiation sterilization by adding sodium thioglycollate as a radioprotectant, and by increasing their indicator content. The media performed well when tested with different Enterobacteria and other micro-organisms. Growth and change of indicator reaction were equal in irradiated and autoclaved culture media. Culture media were also evaluated after storage for one month at room temperature and at 4/sup 0/C and compared well with freshly autoclaved media.

  17. Ophthalmic ester removal in the agar state giant molecule; Kantenjo kobunshi de futarusan esuteru jokyo

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-10-01

    Matsubara professors of Tokyo College of Pharmacy developed the technique which simply removed phthalic ester from the solution. The property in which the giant molecule called the poly N isopropyl acrylamide cohered like the agar, when 32 degrees C is exceeded, was utilized, and the phthalic ester of poor solubility is taken in the flocculation stage. It is expected with that it can be utilized for wastewater treatment and solicitation quantity thing analysis in the environment. (translated by NEDO)

  18. Comparison of the Etest and the routine multi-disc agar diffusion ...

    African Journals Online (AJOL)

    Results: On the Etest strips, Staph aureus was 83.5% sensitive to ciprofloxacin, 52.6% to gentamicin, 48.5% to ampicillin and 8.2% to chloramphenicol while on the multi-disc agar diffusion plates 80.4% of Staph aureus were sensitive to ciprofloxacin, 49.5% to gentamicin, 39.2% to ampicillin and 12.4% to chloramphenicol.

  19. Rapid Isolation and Susceptibility Testing of Leptospira spp. Using a New Solid Medium, LVW Agar

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Paris, Daniel H.; Langla, Sayan; Thaipadunpanit, Janjira; Chierakul, Wirongrong; Smythe, Lee D.; White, Nicholas J.; Day, Nicholas P. J.; Peacock, Sharon J.

    2013-01-01

    Pathogenic Leptospira spp., the causative agents of leptospirosis, are slow-growing Gram-negative spirochetes. Isolation of Leptospira from clinical samples and testing of antimicrobial susceptibility are difficult and time-consuming. Here, we describe the development of a new solid medium that facilitates more-rapid growth of Leptospira spp. and the use of this medium to evaluate the Etest's performance in determining antimicrobial MICs to drugs in common use for leptospirosis. The medium was developed by evaluating the effects of numerous factors on the growth rate of Leptospira interrogans strain NR-20157. These included the type of base agar, the concentration of rabbit serum (RS), and the concentration and duration of CO2 incubation during the initial period of culture. The highest growth rate of NR-20157 was achieved using a Noble agar base supplemented with 10% RS (named LVW agar), with an initial incubation at 30°C in 5% CO2 for 2 days prior to continuous culture in air at 30°C. These conditions were used to develop the Etest for three species, L. interrogans (NR-20161), L. kirschnerii (NR-20327), and L. borgpetersenii (NR-20151). The MICs were read on day 7 for all samples. The Etest was then performed on 109 isolates of pathogenic Leptospira spp. The MIC90 values for penicillin G, doxycycline, cefotaxime, ceftriaxone, and chloramphenicol were 0.64 units/ml and 0.19, 0.047, 0.5, and 2 μg/ml, respectively. The use of LVW agar, which enables rapid growth, isolation of single colonies, and simple antimicrobial susceptibility testing for Leptospira spp., provides an opportunity for new areas of fundamental and applied research. PMID:23114772

  20. Performance of CHROMAGAR candida and BIGGY agar for identification of yeast species

    OpenAIRE

    Marol Serhat; Yücesoy Mine

    2003-01-01

    Abstract Background The importance of identifying the pathogenic fungi rapidly has encouraged the development of differential media for the presumptive identification of yeasts. In this study two differential media, CHROMagar Candida and bismuth sulphite glucose glycine yeast agar, were evaluated for the presumptive identification of yeast species. Methods A total number of 270 yeast strains including 169 Candida albicans, 33 C. tropicalis, 24 C. glabrata, 18 C. parapsilosis, 12 C. krusei, 5 ...

  1. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    International Nuclear Information System (INIS)

    Losse, G.; Mueller, F.; Fischer, S.

    1989-01-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied 131 I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author)

  2. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    International Nuclear Information System (INIS)

    Kim, Dong-Hyun; Lee, Se-Ho; Kim, Kyoung-Nam; Kim, Kwang-Mahn; Shim, In-Bo; Lee, Yong-Keun

    2005-01-01

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe 3 O 4 and SrFe 12 O 19 ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic

  3. Growth of non-Campylobacter, oxidase-positive bacteria on selective Campylobacter agar.

    OpenAIRE

    Moskowitz, L B; Chester, B

    1982-01-01

    A total of 67 oxidase-positive, gram-negative bacteria were tested for growth on selective Campylobacter agar (Blaser formulation, BBL Microbiology Systems, Cockeysville, Md.) at 42 degrees C under microaerophilic conditions. Although the growth of most of these bacteria was prevented, all strains of Achromobacter xylosoxidans, Pseudomonas aeruginosa, Pseudomonas putrefaciens, Pseudomonas alcaligenes, and Pseudomonas pseudoalcaligenes grew as well as Campylobacter fetus subsp. jejuni.

  4. Scintigraphic evidence of the retarded insulin liberation from agar embeddings in suppositories

    Energy Technology Data Exchange (ETDEWEB)

    Losse, G; Mueller, F; Fischer, S; Wunderlich, G; Hacker, E

    1989-05-01

    It is reported on the retardation and protective effect of insulin-agar-embeddings in triglyceride suppositories by in vitro and in vivo tests on rabbits. The discovered effects were visually followed by gamma scanning of adequate rectally applied /sup 131/I-insulin specimens in the rectum and thyroid gland and, in relation with the glucose lowering course, the liberation, distribution and biovailability of the immobilized hormone was illustrated. (author).

  5. Comparing the disk-diffusion and agar dilution tests for Neisseria gonorrhoeae antimicrobial susceptibility testing

    Directory of Open Access Journals (Sweden)

    Hsi Liu

    2016-11-01

    Full Text Available Abstract Background We assessed the validity of testing for antimicrobial susceptibility of clinical and mutant Neisseria gonorrhoeae (GC isolates by disk diffusion in comparison to agar dilution, and Etest® (bioMerieux, France, respectively, for three third generation extended spectrum cephalosporins (ESC: ceftriaxone (CRO, cefixime (CFX, and cefpodoxime (CPD. Methods One hundred and five clinical isolates and ten laboratory-mutants were tested following Clinical Laboratory Standard Institute (CLSI and manufacturer’s standards for each of the three methods. The measured diameters by the disk diffusion method were tested for correlation with the MIC values by agar dilution. In addition, comparisons with the Etest® were made. Categorical results for concordance, based on standard CLSI cutoffs, between the disk diffusion and the other two methods, respectively, were tested using the Chi-square statistics. Reproducibility was tested for CFX across a 6-month interval by repeated disk tests. Results Across all 115 specimens, the disk diffusion tests produced good categorical agreements, exhibiting concordance of 93.1%, 92.1%, and 90.4% with agar dilution and 93.0%, 92.1%, and 90.4% with Etest®, for CRO, CFX, and CPD, respectively. Pearson correlations between disk-diffusion diameters and agar dilution MIC’s were -0.59, -0.67, and -0.81 for CRO, CFX, and CPD, respectively. The correlations between disk diffusion and Etest® were -0.58, -0.73, and -0.49. Pearson correlation between the CFX disk readings over a 6-month interval was 91%. Conclusions Disk diffusion tests remain to be a useful, reliable and fast screening method for qualitative antimicrobial susceptibility testing for ceftriaxone, cefixime, and cefpodoxime.

  6. Preparation of amine-impregnated silica foams using agar as the gelling agent

    Energy Technology Data Exchange (ETDEWEB)

    Jardim, Iara M., E-mail: iaramj01@yahoo.com.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Department of Chemical Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, 5° andar (Brazil); Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M. [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil); Vasconcelos, Wander L., E-mail: wlv@demet.ufmg.br [Department of Metallurgical and Materials Engineering, Federal University of Minas Gerais – UFMG, Avenida Presidente Antônio Carlos, 6627, Campus UFMG, Belo Horizonte, MG, CEP: 31270-901, Escola de Engenharia, bloco 2, sala, 2230 (Brazil)

    2016-10-15

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  7. Preparation of amine-impregnated silica foams using agar as the gelling agent

    International Nuclear Information System (INIS)

    Jardim, Iara M.; Souza, Douglas F.; Vasconcelos, Daniela C.L.; Nunes, Eduardo H.M.; Vasconcelos, Wander L.

    2016-01-01

    In this work we successfully prepared amine-impregnated gel-cast silica foams using agar and atmospheric air as the gelling agent and heat treatment atmosphere, respectively. The concentration of 3,6-anhydrogalactose in agar was evaluated by ultraviolet–visible spectroscopy (UV–Vis). The obtained foams were examined by Fourier transform infrared spectroscopy (FTIR), thermogravimetric analysis (TG) coupled to mass spectrometry (TG-MS), scanning electron microscopy (SEM), X-ray microtomography (micro-CT), and Archimedes method. The cold crushing strength of the materials prepared in this work was assessed using a mechanical testing stage available in the micro-CT system. The obtained foams exhibited a highly interconnected pore network, with an expressive presence of open pores. Samples heat-treated at 1300 °C for 2 h showed both an expressive porosity (≈ 77%) and a significant cold crushing strength (≈ 1.4 MPa). It was observed that the calcination of the prepared materials at 1200 °C for times as long as 16 h may lead to the rupture of pore walls. FTIR and TG-MS revealed that amine groups were properly incorporated into the foams structure. - Highlights: •Successful preparation of amine-impregnated gel-cast silica foams •Agar used as the gelling agent •Samples with expressive porosity and cold crushing strength •Sintering times as long as 16 h led to the rupture of the pore network.

  8. An Agar-Based Method for Plating Marine Protozoan Parasites of the Genus Perkinsus.

    Directory of Open Access Journals (Sweden)

    Emma R Cold

    Full Text Available The genus Perkinsus includes protozoan parasites of mollusks responsible for losses in the aquaculture industry and hampering the recovery of natural shellfish beds worldwide, and they are a key taxon for understanding intracellular parasitism adaptations. The ability to propagate the parasite in liquid media, in the absence of the host, has been crucial for improving understanding of its biology; however, alternative techniques to grow the parasite are needed to explore other basic aspects of the Perkinsus spp. biology. We optimized a DME: Ham's F12-5% FBS- containing solid agar medium for plating Perkinsus marinus. This solid medium supported trophozoite propagation both by binary fission and schizogony. Colonies were visible to the naked eye 17 days after plating. We tested the suitability of this method for several applications, including the following: 1 Subcloning P. marinus isolates: single discrete P. marinus colonies were obtained from DME: Ham's F12-5% FBS- 0.75% agar plates, which could be further propagated in liquid medium; 2 Subcloning engineered Perkinsus mediterraneus MOE[MOE]: GFP by streaking cultures on plates; 3 Chemical susceptibility: Infusing the DME: Ham's F12-5% FBS- 0.75% agar plates with triclosan resulted in inhibition of the parasite propagation in a dose-dependent manner. Altogether, our plating method has the potential for becoming a key tool for investigating diverse aspects of Perkinsus spp. biology, developing new molecular tools, and for biotechnological applications.

  9. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar

    Directory of Open Access Journals (Sweden)

    Fabíola Silveira-Gomes

    2011-08-01

    Full Text Available INTRODUCTION: Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. METHODS: Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. RESULTS: Our results showed that 17 (21.5% isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4% of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores. CONCLUSIONS: The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  10. Differentiation between Candida albicans and Candida dubliniensis using hypertonic Sabouraud broth and tobacco agar.

    Science.gov (United States)

    Silveira-Gomes, Fabíola; Sarmento, Dayse Nogueira; Espírito-Santo, Elaine Patrícia Tavares do; Souza, Nádia de Oliveira; Pinto, Thifany Mendes; Marques-da-Silva, Silvia Helena

    2011-01-01

    Opportunistic fungal infections in immunocompromised hosts are caused by Candida species, and the majority of such infections are due to Candida albicans. However, the emerging pathogen Candida dubliniensis demonstrates several phenotypic characteristics in common with C. albicans, such as production of germ tubes and chlamydospores, calling attention to the development of stable resistance to fluconazole in vitro. The aim of this study was to evaluate the performance of biochemistry identification in the differentiating between C. albicans and C. dubliniensis, by phenotyping of yeast identified as C. albicans. Seventy-nine isolates identified as C. albicans by the API system ID 32C were grown on Sabouraud dextrose agar at 30°C for 24-48h and then inoculated on hypertonic Sabouraud broth and tobacco agar. Our results showed that 17 (21.5%) isolates were growth-inhibited on hypertonic Sabouraud broth, a phenotypic trait inconsistent with C. albicans in this medium. However, the results observed on tobacco agar showed that only 9 (11.4%) of the growth-inhibited isolates produced characteristic colonies of C. dubliniensis (rough colonies, yellowish-brown with abundant fragments of hyphae and chlamydospores). The results suggest that this method is a simple tool for screening C. albicans and non-albicans yeast and for verification of automated identification.

  11. Calibration of Ge(Li) semiconductor detector by method using agar volume source

    International Nuclear Information System (INIS)

    Yanase, Nobuyuki; Kasai, Atsushi

    1979-12-01

    The Ge(Li) semiconductor detector was calibrated for measurements of environmental samples. The radioisotopes used for standard sources are 22 Na, 51 Cr, 56 Co, 57 Co, 133 Ba, 137 Cs, 144 Ce and 241 Am. These are mixed with hot agar aqueous solution and fixed uniformly in a cylindrical plastic case in cooling. The agar volume source is advantageous in handling over the fluid aqueous source. The prepared cylindrical standard sources are in diameters 6 and 8 cm and thicknesses 1, 5, 10, 20, 30 and 40 mm (only for 8 cm diameter). The radioactivities of prepared standard sources are between 0.03 μCi and 0.2 μCi. It takes only a week to make the calibration except data processing. The obtained full energy peak efficiency curves include 5 - 10% error due to preparation of agar source, reference radioactivity data of purchased standard solutions, reference data of branching ratio of gamma-ray and sum effect. The efficiency curves, however, are sufficient for quantitative analysis of environmental samples. (author)

  12. N-acetylgalatosamine-mediated regulation of the aga operon by AgaR in Streptococcus pneumoniae

    Directory of Open Access Journals (Sweden)

    Muhammad Afzal

    2016-09-01

    Full Text Available Here, we analyze the transcriptomic response of Streptococcus pneumoniae D39 to N-acetylgalactosamine (NAGa. Transcriptome comparison of S. pneumoniae D39 grown NAGaM17 (0.5% NAGa + M17 to that grown in GM17 (0.5% Glucose + M17 revealed the elevated expression of various carbon metabolic genes/operons, including a PTS operon (denoted here as the aga operon, which is putatively involved in NAGa transport and utilization, in the presence of NAGa. We further studied the role of a GntR-family transcriptional regulator (denoted here as AgaR in the regulation of aga operon. Our transcriptome and RT-PCR data suggest the role of AgaR as a transcriptional repressor of the aga operon. We predicted a 20-bp operator site of AagR (5’- ATAATTAATATAACAACAAA -3’ in the promoter region of the aga operon (PbgaC, which was further verified by mutating the AgaR operator site in the respective promoter. The role of CcpA in the additional regulation of the aga operon was elucidated by further transcriptome analyses and confirmed by quantitative RT-PCR.

  13. Unfolding Green Defense

    DEFF Research Database (Denmark)

    Larsen, Kristian Knus

    2015-01-01

    In recent years, many states have developed and implemented green solutions for defense. Building on these initiatives NATO formulated the NATO Green Defence Framework in 2014. The framework provides a broad basis for cooperation within the Alliance on green solutions for defense. This report aims...... to inform and support the further development of green solutions by unfolding how green technologies and green strategies have been developed and used to handle current security challenges. The report, initially, focuses on the security challenges that are being linked to green defense, namely fuel...... consumption in military operations, defense expenditure, energy security, and global climate change. The report then proceeds to introduce the NATO Green Defence Framework before exploring specific current uses of green technologies and green strategies for defense. The report concludes that a number...

  14. Green industrial policy

    OpenAIRE

    Dani Rodrik

    2014-01-01

    Green growth requires green technologies: production techniques that economize on exhaustible resources and emit fewer greenhouse gases. The availability of green technologies both lowers social costs in the transition to a green growth path and helps achieve a satisfactory rate of material progress under that path. The theoretical case in favour of using industrial policy to facilitate green growth is quite strong. Economists’ traditional scepticism on industrial policy is grounded instead o...

  15. Competitive adsorption of Reactive Orange 16 and Reactive Brilliant Blue R on polyaniline/bacterial extracellular polysaccharides composite-A novel eco-friendly polymer

    Energy Technology Data Exchange (ETDEWEB)

    Janaki, V. [Department of Chemistry, Periyar University, Salem 636011, Tamil Nadu (India); Vijayaraghavan, K. [Singapore-Delft Water Alliance, National University of Singapore, 117577 (Singapore); Ramasamy, A.K. [Department of Chemistry, Periyar University, Salem 636011, Tamil Nadu (India); Lee, Kui-Jae [Division of Biotechnology, Advanced Institute of Environment and Bioscience, College of Environmental and Bioresource Sciences, Chonbuk National University, Iksan 570752 (Korea, Republic of); Oh, Byung-Taek, E-mail: btoh@jbnu.ac.kr [Division of Biotechnology, Advanced Institute of Environment and Bioscience, College of Environmental and Bioresource Sciences, Chonbuk National University, Iksan 570752 (Korea, Republic of); Kamala-Kannan, Seralathan, E-mail: kannan@jbnu.ac.kr [Division of Biotechnology, Advanced Institute of Environment and Bioscience, College of Environmental and Bioresource Sciences, Chonbuk National University, Iksan 570752 (Korea, Republic of)

    2012-11-30

    Highlights: Black-Right-Pointing-Pointer Competitive adsorption of reactive dyes onto polyaniline/bacterial extracellular polysaccharides composite. Black-Right-Pointing-Pointer The composite have functional groups of both polyaniline and bacterial extracellular polysaccharides. Black-Right-Pointing-Pointer The presence of Reactive Brilliant Blue R diminished the uptake of Reactive Orange 16. Black-Right-Pointing-Pointer Electrostatic interaction was identified as a major mechanism in adsorption process. Black-Right-Pointing-Pointer Reactive Brilliant Blue R and Reactive Orange 16 adsorption was endothermic process. - Abstract: The performance of polyaniline/extracellular polymeric substances (Pn/EPS) composite as an adsorbent to remove the anionic reactive dyes, Reactive Brilliant Blue R (RBBR) and Reactive Orange 16 (RO), was investigated in single and binary systems. The pH{sub pzc} of Pn/EPS composite was calculated as 3.7 through potentiometric mass titration method. Electrostatic interaction between the dye anion and the nitrogen present in the polymer was identified as a major mechanism in adsorption process. Single component isotherms followed the Langmuir model with the maximum adsorption capacity of 0.5775 mmol g{sup -1} for RBBR and 0.4748 mmol g{sup -1} for RO. In binary system, both the reactive dye anions compete with each other and resulted in lower uptake. Binary adsorption data were interpreted well by the Sheindorf-Rehbun-Sheintuch equation as compared to extended Langmuir model with constant interaction factor. Kinetic analysis of single solute followed pseudo-first order model. Thermodynamic studies computed that RBBR and RO adsorption was endothermic, spontaneous, and feasible process.

  16. Measurements of 161 Double Stars With a High-Speed CCD: The Winter/Spring 2017 Observing Program at Brilliant Sky Observatory, Part 2

    Science.gov (United States)

    Harshaw, Richard

    2018-04-01

    In the winter and spring of 2017, an aggressive observing program of measuring close double stars with speckle interferometry and CCD imaging was undertaken at Brilliant Sky Observatory, my observing site in Cave Creek, Arizona. A total of 596 stars were observed, 8 of which were rejected for various reasons, leaving 588 pairs. Of these, 427 were observed and measured with speckle interferometry, while the remaining 161 were measured with a CCD. This paper reports the results of the observations of the 161 CCD cases. A separate paper in this issue will report the speckle measurements of the 427 other pairs.

  17. Measurements of 427 Double Stars With Speckle Interferometry: The Winter/Spring 2017 Observing Program at Brilliant Sky Observatory, Part 1

    Science.gov (United States)

    Harshaw, Richard

    2018-04-01

    In the winter and spring of 2017, an aggressive observing program of measuring close double stars with speckle interferometry and CCD imaging was undertaken at Brilliant Sky Observatory, my observing site in Cave Creek, Arizona. A total of 596 stars were observed, 8 of which were rejected for various reasons, leaving 588 pairs. Of these, 427 were observed and measured with speckle interferometry, while the remaining 161 were measured with a CCD. This paper reports the results of the observations of the 427 speckle cases. A separate paper in this issue will report the CCD measurements of the 161 other pairs.

  18. Identification of non-Listeria spp. bacterial isolates yielding a β-D-glucosidase-positive phenotype on Agar Listeria according to Ottaviani and Agosti (ALOA).

    Science.gov (United States)

    Angelidis, Apostolos S; Kalamaki, Mary S; Georgiadou, Sofia S

    2015-01-16

    Agar Listeria according to Ottaviani and Agosti (ALOA) is the mandatory medium used for the detection and enumeration of Listeria monocytogenes in foods according to the official International Organization for Standardization (ISO) methods. On ALOA, Listeria spp. appear as bluish-green colonies due to the production of β-D-glucosidase, an enzyme that cleaves 5-bromo-4-chloro-3-indolyl-β-D-glucopyranoside, a chromogenic substrate included in the formulation of the medium. The present work reports on bacterial isolates (n=64) from ready-to-eat soft cheeses, which are able to grow on ALOA, forming bluish-green colonies and therefore phenotypically resemble Listeria spp. All isolates were also capable of growing on the selective media PALCAM and RAPID L'mono. The isolates were characterised with biochemical tests including those specified in the ISO standards for the confirmation of Listeria spp. and identified via partial sequencing of their 16S rRNA gene. According to sequencing results the isolates represented 12 different bacterial species or species-groups belonging to seven different genera: Bacillus spp. (B. circulans, B. clausii, B. licheniformis and B. oleronius), Cellulosimicrobium spp. (C. funkei), Enterococcus spp. (E. faecalis, E. faecium/durans), Kocuria spp. (K. kristinae), Marinilactibacillus spp. (M. psychrotolerans), Rothia spp. (R. terrae) and Staphylococcus spp. (S. sciuri and S. saprophyticus subsp. saprophyticus/xylosus). Cellulosimicrobium spp. have never been previously isolated from foods. These results significantly extend the list of bacteria previously known as capable of growing on ALOA as bluish-green colonies and suggest that there may be room for further improvement in the medium's inhibitory properties towards non-Listeria spp., Gram-positive bacteria present in foods. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. Microbiological quality of some brands of intravenous fluids ...

    African Journals Online (AJOL)

    Microbiological quality of some brands of intravenous fluids produced by some pharmaceutical companies in Nigeria was investigated. Membrane filtration method was used for concentration of contaminating organisms in the intravenous fluids. Thioglycollate medium, Tryptone Soya broth, Brilliant Green Agar ...

  20. AgarTrap: a simplified Agrobacterium-mediated transformation method for sporelings of the liverwort Marchantia polymorpha L.

    Science.gov (United States)

    Tsuboyama, Shoko; Kodama, Yutaka

    2014-01-01

    The liverwort Marchantia polymorpha L. is being developed as an emerging model plant, and several transformation techniques were recently reported. Examples are biolistic- and Agrobacterium-mediated transformation methods. Here, we report a simplified method for Agrobacterium-mediated transformation of sporelings, and it is termed Agar-utilized Transformation with Pouring Solutions (AgarTrap). The procedure of the AgarTrap was carried out by simply exchanging appropriate solutions in a Petri dish, and completed within a week, successfully yielding sufficient numbers of independent transformants for molecular analysis (e.g. characterization of gene/protein function) in a single experiment. The AgarTrap method will promote future molecular biological study in M. polymorpha.

  1. Ergosterol purification from basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm.

    Directory of Open Access Journals (Sweden)

    V. O. Antonyuk

    2014-08-01

    Full Text Available Ergosterol (ergosta-5 ,7,22-trien-3β-ol is a compound found only in fungi. Ergosterol has medical interest, as it is easily converted into Vitamin D2. In the previous work we have studied 22 species of true fungi. The highest quantity of ergosterol was found in basidiomes of Clouded Agaric (Clitocybe nebularis (Fr. Kumm. Meanwhile, there is no data on the purification of ergosterol from this fungus in the literature. The aim of research. The aim of research is to elaborate a rational method of obtaining ergosterol from basidiomes of Clouded Agaric and assess the perspectives of the raw material for its purification. Materials and methods. In order to choose the best method of ergosterol purification, it was obtained in two ways: 1 by alkaline hydrolisis that was used in the preparation of ergosterol from baker yeast and 2 by the extraction of raw matherial by methanol with following chromatography on silica gel. A substance with high ergosterol level was purified from marc basidiomes of Clouded Agaric by methanol extraction with following of freezing the methanol extract and the following chromatography on silica gel. This substance was dissolved in hexane and purified by chromatography on silica gel by washing the column sequentially with hexane, hexane - ethyl acetate (6:1 , hexane -ethyl acetate -methanol 4:2:1. The obtained fractions were dried and weighed. The analysis of the obtained compounds was carried out by gas-liquid сhromatography - mass spectrometry , Lieberman-Burchard reaction and TLC on silica gel. Chromatograms were spraied with saturated sodium antimony in chloroform. Results and discussion Pure ergosterol was obtained from dried baker's yeast and basidiomes marc of Clouded Agaric by alkaline hydrolysis followed by methylene chloride extraction of raw material and crystallization from ethanol and mixtures of benzene with ethanol (yield 0.71% and 0.52% . Methanol extraction of dried basidiomes marc of Clouded Agaric

  2. Green corridors basics

    DEFF Research Database (Denmark)

    Panagakos, George

    2016-01-01

    SuperGreen project, which aimed at advancing the green corridor concept through a benchmarking exercise involving Key Performance Indicators (KPIs). The chapter discusses the available definitions of green corridors and identifies the characteristics that distinguish a green corridor from any other...... efficient surface transportation corridor. After providing examples of green corridor projects in Europe, it focuses on the KPIs that have been proposed by various projects for monitoring the performance of a freight corridor. Emphasis is given to the SuperGreen KPIs, covering the economic, technical...

  3. Observation of interactions between hydrophilic ionic liquid and water on wet agar gels by FE-SEM and its mechanism

    International Nuclear Information System (INIS)

    Takahashi, Chisato; Shirai, Takashi; Fuji, Masayoshi

    2012-01-01

    Highlights: ► The mechanism of SEM observation of agar gel using ionic liquid was investigated. ► Weak hydrogen bond between ionic liquid and water exist even under vacuum condition. ► Ionic liquid binding ability with water is useful for observing wet material using FE-SEM. ► We could optimize the water concentrations of sample of IL and wet material mixtures. ► SEM observation of fine morphology of agar gel in optimum water content. - Abstract: In the present study, an attempt is made to understand the mechanism of field emission electron microscopy (FE-SEM) observation of wet agar gel using a typical hydrophilic ionic liquid (IL) 1-butyl-3-methylimidazolium tetrafluoroborate; [BMIM][BF 4 ]. The IL interaction with water molecules within agar gel during sample preparation condition for FE-SEM observation was investigated using Raman spectroscopy. Results showed that water molecules within agar gel form weak hydrogen bond such as BF 4 − ⋯HOH⋯BF 4 − by interaction with BF 4 − of IL, and, it remained stable even under vacuum condition at 60 °C, 24 h. This interaction was found to be helpful for IL displacement of the water molecules within agar gel. From this study, it was found that the exact morphology of gel materials in FE-SEM condition can be observed by optimization of water concentrations of IL and gel mixtures. Thus, using IL, agar gel or any other material under wet condition can be observed without drying in FE-SEM chamber, and, present result gives an insight to the mechanism of FE-SEM observation of agar gel using IL without any conducting coating.

  4. Cytotoxicity of ferrite particles by MTT and agar diffusion methods for hyperthermic application

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Dong-Hyun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Lee, Se-Ho [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kyoung-Nam [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Kim, Kwang-Mahn [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of); Shim, In-Bo [Department of Electronic Physics, Kookmin University, Seoul 136-702 (Korea, Republic of); Lee, Yong-Keun [Brain Korea 21 Project for Medical Science, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of) and Department and Research Institute of Dental Biomaterials and Bioengineering, Yonsei University College of Dentistry, Seoul 120-752 (Korea, Republic of)]. E-mail: leeyk@yumc.yonsei.ac.kr

    2005-05-15

    We investigated the cytotoxicity of the prepared various ferrites (Fe-, Li-, Ni/Zn/Cu-, Ba-, Sr-, Co-, Co/Ni-ferrites) using MTT assay as well as agar diffusion method. Their cytotoxicity was compared with that of alginate-encapsulated ferrites. In the MTT assay, Fe{sub 3}O{sub 4} and SrFe{sub 12}O{sub 19} ferrite showed the highest cell viability of 90%. Alginate-encapsulated Ba-ferrite was ranked mildly cytotoxic, whereas their ferrite particles were ranked cytotoxic.

  5. Three-dimensional characterization of bacterial microcolonies on solid agar-based culture media.

    Science.gov (United States)

    Drazek, Laurent; Tournoud, Maud; Derepas, Frédéric; Guicherd, Maryse; Mahé, Pierre; Pinston, Frédéric; Veyrieras, Jean-Baptiste; Chatellier, Sonia

    2015-02-01

    For the last century, in vitro diagnostic process in microbiology has mainly relied on the growth of bacteria on the surface of a solid agar medium. Nevertheless, few studies focused in the past on the dynamics of microcolonies growth on agar surface before 8 to 10h of incubation. In this article, chromatic confocal microscopy has been applied to characterize the early development of a bacterial colony. This technology relies on a differential focusing depth of the white light. It allows one to fully measure the tridimensional shape of microcolonies more quickly than classical confocal microscopy but with the same spatial resolution. Placing the device in an incubator, the method was able to individually track colonies growing on an agar plate, and to follow the evolution of their surface or volume. Using an appropriate statistical modeling framework, for a given microorganism, the doubling time has been estimated for each individual colony, as well as its variability between colonies, both within and between agar plates. A proof of concept led on four bacterial strains of four distinct species demonstrated the feasibility and the interest of the approach. It showed in particular that doubling times derived from early tri-dimensional measurements on microcolonies differed from classical measurements in micro-dilutions based on optical diffusion. Such a precise characterization of the tri-dimensional shape of microcolonies in their late-lag to early-exponential phase could be beneficial in terms of in vitro diagnostics. Indeed, real-time monitoring of the biomass available in a colony could allow to run well established microbial identification workflows like, for instance, MALDI-TOF mass-spectrometry, as soon as a sufficient quantity of material is available, thereby reducing the time needed to provide a diagnostic. Moreover, as done for pre-identification of macro-colonies, morphological indicators such as three-dimensional growth profiles derived from

  6. Effect of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel

    International Nuclear Information System (INIS)

    Palaniandavar, N.; Gnanam, F.D.; Ramasamy, P.

    1986-01-01

    The interrelated effects of growth parameters on spatial pattern formation of cadmium hydroxide in agar gel medium have been investigated. The main parameters are concentration of electrolytes, pH of the medium, density of the gel, the concentration of parasitic electrolyte and the concentration of additives. The pattern formation is explained on the basis of electrical double layer theory coupled with diffusion. Using Shinohara's revised coagulation concept, the flocculation value is calculated. With suitable combinations of parameter values, dendritic growth and spherulitic growth of cadmium hydroxide crystals have been observed. (author)

  7. Biofilm Removal and Antimicrobial Activities of Agar Hydrogel Containing Colloid Nano-Silver against Staphylococcus aureus and Salmonella typhimurium

    Directory of Open Access Journals (Sweden)

    Leyla Sadat Bouryabaf

    2017-10-01

    Full Text Available Background:    Antibacterial and biofilm removal effects of agar hydrogel incorporating silver nanoparticles (SNP at various concentrations were studied against Staphylococcus aureus and Salmonella typhimurium in vitro.Methods:      The minimum inhibitory concentrations (MIC of SNP was determined by agar dilution method. Then, hydrogels were prepared by mixing of 0.5% w/v agar and SNP (1/2 MIC, MIC, and 2 MIC and their inhibitory efficacies against planktonic and biofilm forms of bacteria were measured using agar spot and microtiter test, respectively.Results:    The MIC value was 125 µg/ mL for both bacteria. All SNP hydrogels represented antibacterial activity against Staphylococcus aureus and S. typhimurium on agar culture, which was significant compared to control group (silver sulfadiazine cream. The developed biofilm of S. aureus and S. typhimurium were strongly (85% reduction and modernly affected (60% reduction by SNP hydrogels during 15 min contact time, respectively. A dose-dependent biofilm reduction was not demonstrated when different SNP concentrations were tested. Moreover, the results from this study confirmed the moderate sanitizing ability of SNP loaded hydrogel against planktonic forms of both bacteria, which SNP (2MIC hydrogel decreased only 2.3 log10 CFU/ mL in a primary population of S. typhimurium during 15 min exposure time.Conclusion:     We recommended SNP incorporated agar hydrogel as an effective biofilm removal sanitizer.

  8. Comparison of manual mycobacteria growth indicator tube and epsilometer test with agar proportion method for susceptibility testing of Mycobacterium tuberculosis

    Directory of Open Access Journals (Sweden)

    N Karabulut

    2014-01-01

    Full Text Available Background and Objectives: Antimycobacterial susceptibility tests take weeks, and delayed therapy can lead to spread of Mycobacterium tuberculosis. Therefore, rapid, accurate and cost-effective methods are required for proper therapy selection. In this study, the Mycobacteria growth indicator tube (MGIT and epsilometer test (Etest methods were compared to the agar proportion method for susceptibility testing of Mycobacterium tuberculosis. Materials and Methods: The susceptibility tests against isoniazid (INH, rifampin (RIF, streptomycin (STM and ethambutol (ETM of 51 M. tuberculosis complex isolates were analyzed by the MGIT, Etest and agar proportion methods. Results: The concordance between MGIT/Etest and agar proportion methods was 98% for INH and 100% for RIF, STM, ETM. There were not statistically significant differences in results of the susceptibility tests between MGIT/Etest and the reference agar proportion method. Conclusion: The results have shown that MGIT and Etest methods can be used instead of the agar proportion method, because these two methods are more rapid and easier than the agar proportion method.

  9. The Efficiency of UVC Radiation in the Inactivation of Listeria monocytogenes on Beef-Agar Food Models

    Directory of Open Access Journals (Sweden)

    Christian James

    2015-01-01

    Full Text Available The aim of this study is to evaluate the eff ect of meat content and surface smoothness on the deactivation of Listeria monocytogenes in beef-agar food models achieved by shortwave ultraviolet (UVC light. Food models with various meat contents were made using chopped beef slices and agar solution. Prepared models together with a Listeria selective agar (LSA plate and a slice of cooked beef were inoculated with L. monocytogenes and then exposed to UVC light. Population of Listeria reduced to below the level of detection on the LSA plates. As the content of beef in the beef-agar models increased, more L. monocytogenes cells survived. Survival was greatest on the treated cooked slice of beef. To bett er understand the effect of surface irregularities, a white light interferometer was used to analyse the surface smoothness of beef-agar media and LSA plates. No correlation was observed between the surface roughness of seven out of nine types of produced beef-agar media and the degree of inactivation resulting from UVC radiation at the given dose, whereas, less bacterial cells were killed as beef content of the food models increased. The findings of the current study show that the chemical composition of the treated sample also plays an important role in pathogen resistance and survival, meaning that two samples with similar surface irregularities but diff erent chemical composition might produce very diff erent inactivation results when exposed to UVC light.

  10. High photocatalytic performance of BiOI/Bi{sub 2}WO{sub 6} toward toluene and Reactive Brilliant Red

    Energy Technology Data Exchange (ETDEWEB)

    Li Huiquan [School of Chemistry and Chemical Engineering, Fuyang Normal College, Fuyang 236041 (China); Key Laboratory of Mesoscopic Chemistry of MOE, Jiangsu Provincial Key Laboratory of Nanotechnology, School of Chemistry and Chemical Engineering, Nanjing University, Nanjing 210093 (China); Cui Yumin, E-mail: cuiyumin0908@163.com [School of Chemistry and Chemical Engineering, Fuyang Normal College, Fuyang 236041 (China); Hong Wenshan [School of Chemistry and Chemical Engineering, Fuyang Normal College, Fuyang 236041 (China)

    2013-01-01

    Graphical abstract: When BiOI/Bi{sub 2}WO{sub 6} catalyst was exposed to UV or visible light, the electrons in the valence band of Bi{sub 2}WO{sub 6} would be excited into the conduction band and then injected into the more positive conduction band of BiOI. Therefore, the photoelectrons were generated from Bi{sub 2}WO{sub 6} and transferred across the interface between BiOI and Bi{sub 2}WO{sub 6} to the surface of BiOI, leaving the photogenerated holes in the valence band of Bi{sub 2}WO{sub 6}. In this way, the photoinduced electron-hole pairs were effectively separated. Highlights: Black-Right-Pointing-Pointer BiOI sensitized Bi{sub 2}WO{sub 6} catalysts were successfully prepared by a facile method. Black-Right-Pointing-Pointer The 13.2% BiOI/Bi{sub 2}WO{sub 6} catalyst exhibits higher photoactivities than P25. Black-Right-Pointing-Pointer A possible transfer process of photogenerated carriers was proposed. - Abstract: BiOI sensitized nano-Bi{sub 2}WO{sub 6} photocatalysts with different BiOI contents were successfully synthesized by a facile deposition method at room temperature, and characterized by X-ray diffraction (XRD), X-ray photoelectron spectroscopy (XPS) high-resolution transmission electron microscopy (HR-TEM), photoluminescence (PL) spectra, UV-vis diffuse reflection spectroscopy (UV-vis DRS) and Brunauer-Emmett-Teller (BET) surface area measurements. The photocatalytic activity of BiOI/Bi{sub 2}WO{sub 6} was evaluated by the photo-degradation of Reactive Brilliant Red (X-3B) in suspended solution and toluene in gas phase. It has been shown that the BiOI/Bi{sub 2}WO{sub 6} catalysts exhibit a coexistence of both tetragonal BiOI and orthorhombic Bi{sub 2}WO{sub 6} phases. With increasing BiOI content, the absorption intensity of BiOI/Bi{sub 2}WO{sub 6} catalysts increases in the 380-600 nm region and the absorption edge shifts significantly to longer wavelengths as compared to pure Bi{sub 2}WO{sub 6}. The 13.2% BiOI/Bi{sub 2}WO{sub 6} catalyst exhibits

  11. Green Power Partnership 100 Green Power Users

    Science.gov (United States)

    EPA's Green Power Partnership is a voluntary program designed to reduce the environmental impact of electricity generation by promoting renewable energy. Partners on this list use green power to meet 100 of their U.S. organization-wide electricity use.

  12. Urban Greening Bay Area

    Science.gov (United States)

    Information about the San Francisco Bay Water Quality Project (SFBWQP) Urban Greening Bay Area, a large-scale effort to re-envision urban landscapes to include green infrastructure (GI) making communities more livable and reducing stormwater runoff.

  13. Tribal Green Building Toolkit

    Science.gov (United States)

    This Tribal Green Building Toolkit (Toolkit) is designed to help tribal officials, community members, planners, developers, and architects develop and adopt building codes to support green building practices. Anyone can use this toolkit!

  14. Green Power Partner List

    Science.gov (United States)

    The U.S. EPA's Green Power Partnership is a voluntary program designed to reduce the environmental impact of electricity generation by promoting renewable energy. There are thousands of Green Power Partners, all listed on this page.

  15. Green Power Communities

    Science.gov (United States)

    GPCs are towns, villages, cities, counties, or tribal governments in which the local government, businesses, and residents collectively use green power in amounts that meet or exceed EPA's Green Power Community purchase requirements.

  16. Blue-Green Algae

    Science.gov (United States)

    ... that taking a specific blue-green algae product (Super Blue-Green Algae, Cell Tech, Klamath Falls, OR) ... system. Premenstrual syndrome (PMS). Depression. Digestion. Heart disease. Memory. Wound healing. Other conditions. More evidence is needed ...

  17. Green Bank Observatory (GBO)

    Data.gov (United States)

    Federal Laboratory Consortium — The largest fully steerable telescope in the world - the Robert C. Byrd Green Bank Telescope (GBT), began observations in Green Bank, West Virginia in 2000and is a...

  18. Green Infrastructure Modeling Toolkit

    Science.gov (United States)

    Green infrastructure, such as rain gardens, green roofs, porous pavement, cisterns, and constructed wetlands, is becoming an increasingly attractive way to recharge aquifers and reduce the amount of stormwater runoff that flows into wastewater treatment plants or into waterbodies...

  19. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane; Behzad, Ali Reza; Khashab, Niveen M.; Al-Ghoul, Mazen

    2012-01-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  20. Visualization of Biosurfactant Film Flow in a Bacillus subtilis Swarm Colony on an Agar Plate.

    Science.gov (United States)

    Kim, Kyunghoon; Kim, Jung Kyung

    2015-08-26

    Collective bacterial dynamics plays a crucial role in colony development. Although many research groups have studied the behavior of fluidic swarm colonies, the detailed mechanics of its motion remains elusive. Here, we developed a visualization method using submicron fluorescent beads for investigating the flow field in a thin layer of fluid that covers a Bacillus subtilis swarm colony growing on an agar plate. The beads were initially embedded in the agar plate and subsequently distributed spontaneously at the upper surface of the expanding colony. We conducted long-term live cell imaging of the B. subtilis colony using the fluorescent tracers, and obtained high-resolution velocity maps of microscale vortices in the swarm colony using particle image velocimetry. A distinct periodic fluctuation in the average speed and vorticity of flow in swarm colony was observed at the inner region of the colony, and correlated with the switch between bacterial swarming and growth phases. At the advancing edge of the colony, both the magnitudes of velocity and vorticity of flow in swarm colony were inversely correlated with the spreading speed of the swarm edge. The advanced imaging tool developed in this study would facilitate further understanding of the effect of micro vortices in swarm colony on the collective dynamics of bacteria.

  1. Mechanical and water barrier properties of agar/κ-carrageenan/konjac glucomannan ternary blend biohydrogel films.

    Science.gov (United States)

    Rhim, Jong-Whan; Wang, Long-Feng

    2013-07-01

    Multicomponent hydrogel films composed of agar, κ-carrageenan, konjac glucomannan powder, and nanoclay (Cloisite(®) 30B) were prepared and their mechanical and water barrier properties such as water vapor permeability (WVP), water contact angle (CA), water solubility (WS), water uptake ratio (WUR), water vapor uptake ratio (WVUR) were determined. Mechanical, water vapor barrier, and water resistance properties of the ternary blend film exhibited middle range of individual component films, however, they increased significantly after formation of nanocomposite with the clay. Especially, the water holding capacity of the ternary blend biopolymer films increased tremendously, from 800% to 1681% of WUR for agar and κ-carrageenan films up to 5118% and 5488% of WUR for the ternary blend and ternary blend nanocomposite films, respectively. Water vapor adsorption behavior of films was also tested by water vapor adsorption kinetics and water vapor adsorption isotherms test. Preliminary test result for fresh spinach packaging revealed that the ternary blend biohydrogel films had a high potential for the use as an antifogging film for packaging highly respiring agricultural produce. In addition, the ternary blend nanocomposite film showed an antimicrobial activity against Gram-positive bacteria, Listeria monocytogenes. Copyright © 2013 Elsevier Ltd. All rights reserved.

  2. Gamma radiation effect on agar viscosity for use in food industry

    International Nuclear Information System (INIS)

    Aliste, Antonio J.; Del Mastro, Nelida L.

    1999-01-01

    The application of food radiation processing is increasing worldwide mainly because of its efficiency in the industrial decontamination of packaged food products. Indeed, the process neither introduces any undesirable elements nor increases the temperature, thus allowing the preparation of ready-to-use products which remain stable for long periods at room temperature. The aim of this work was to study the effect of Co-60 gamma radiation on the viscosity of agar. This hydrocolloid derived from seaweed is a galactose polymer with a high hysteresis capacity (great difference among melting and gelification temperature) which is extremely important when used as additive for the food industry. Commercial agar was irradiated with doses of 0, 1, 5 and 10 kGy. Proper dilutions were prepared and the viscosity was measured in a Brookfield model LVDVIII viscosimeters. The relationships viscosity/dose for the temperatures of 45 deg C and 60 deg C were established. The decrease of the viscosity was 71.4% and 49.6% respectively when the applied dose was 10 kGy. The implications of the use of this additive in food irradiation are discussed. (author)

  3. Mechanical response of agar gel irradiated with Nd:YAG nanosecond laser pulses

    Science.gov (United States)

    Pérez-Gutiérrez, Francisco G.; Evans, Rodger; Camacho-López, Santiago; Aguilar, Guillermo

    2010-02-01

    Nanosecond long laser pulses are used in medical applications where precise tissue ablation with minimal thermal and mechanical collateral damage is required. When a laser pulse is incident on a material, optical energy will be absorbed by a combination of linear and nonlinear absorption according to both: laser light intensity and material properties. In the case of water or gels, the first results in heat generation and thermoelastic expansion; while the second results in an expanding plasma formation that launches a shock wave and a cavitation/boiling bubble. Plasma formation due to nonlinear absorption of nanosecond laser pulses is originated by a combination of multiphoton ionization and thermionic emission of free electrons, which is enhanced when the material has high linear absorption coefficient. In this work, we present measurements of pressure transients originated when 6 ns laser pulses are incident on agar gels with varying linear absorption coefficient, mechanical properties and irradiation geometry using laser radiant exposures above threshold for bubble formation. The underlying hypothesis is that pressure transients are composed of the superposition of both: shock wave originated by hot expanding plasma resulting from nonlinear absorption of optical energy and, thermoelastic expansion originated by heat generation due to linear absorption of optical energy. The objective of this work is to evaluate the relative contribution of each absorption mechanism to mechanical effects in agar gel. Real time pressure transients are recorded with PVDF piezoelectric sensors and time-resilved imaging from 50 μm to 10 mm away from focal point.

  4. An agar gel membrane-PDMS hybrid microfluidic device for long term single cell dynamic study.

    Science.gov (United States)

    Wong, Ieong; Atsumi, Shota; Huang, Wei-Chih; Wu, Tung-Yun; Hanai, Taizo; Lam, Miu-Ling; Tang, Ping; Yang, Jian; Liao, James C; Ho, Chih-Ming

    2010-10-21

    Significance of single cell measurements stems from the substantial temporal fluctuations and cell-cell variability possessed by individual cells. A major difficulty in monitoring surface non-adherent cells such as bacteria and yeast is that these cells tend to aggregate into clumps during growth, obstructing the tracking or identification of single-cells over long time periods. Here, we developed a microfluidic platform for long term single-cell tracking and cultivation with continuous media refreshing and dynamic chemical perturbation capability. The design highlights a simple device-assembly process between PDMS microchannel and agar membrane through conformal contact, and can be easily adapted by microbiologists for their routine laboratory use. The device confines cell growth in monolayer between an agar membrane and a glass surface. Efficient nutrient diffusion through the membrane and reliable temperature maintenance provide optimal growth condition for the cells, which exhibited fast exponential growth and constant distribution of cell sizes. More than 24 h of single-cell tracking was demonstrated on a transcription-metabolism integrated synthetic biological model, the gene-metabolic oscillator. Single cell morphology study under alcohol toxicity allowed us to discover and characterize cell filamentation exhibited by different E. coli isobutanol tolerant strains. We believe this novel device will bring new capabilities to quantitative microbiology, providing a versatile platform for single cell dynamic studies.

  5. Evaluation of a modified Cefsulodin-Irgasan-Novobiocin agar for isolation of Yersinia spp.

    Directory of Open Access Journals (Sweden)

    Lai Kuan Tan

    Full Text Available Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml and in artificially contaminated pork (10(4 cfu/ml were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii. The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria.

  6. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM

    KAUST Repository

    Rahbani, Janane

    2012-12-26

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Characterization of internal structure of hydrated agar and gelatin matrices by cryo-SEM.

    Science.gov (United States)

    Rahbani, Janane; Behzad, Ali R; Khashab, Niveen M; Al-Ghoul, Mazen

    2013-02-01

    There has been a considerable interest in recent years in developing polymer gel matrices for many important applications such as 2DE for quantization and separation of a variety of proteins and drug delivery system to control the release of active agents. However, a well-defined knowledge of the ultrastructures of the gels has been elusive. In this study, we report the characterization of two different polymers used in 2DE: Gelatin, a naturally occurring polymer derived from collagen (protein) and agar, a polymer of polysaccharide (sugar) origin. Low-temperature SEM is used to examine the internal structure of these gels in their frozen natural hydrated states. Results of this study show that both polymers have an array of hollow cells that resembles honeycomb structures. While agar pores are almost circular, the corresponding Gaussian curve is very broad exhibiting a range of radii from nearly 370 to 700 nm. Gelatin pores are smaller and more homogeneous reflecting a narrower distribution from nearly 320 to 650 nm. Overall, these ultrastructural findings could be used to correlate with functions of the polymers. © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. An electrochemical approach to monitor pH change in agar media during plant tissue culture.

    Science.gov (United States)

    Wang, Min; Ha, Yang

    2007-05-15

    In this work, metal oxide microelectrodes were developed to monitor pH change in agar media during plant tissue culture. An antimony wire was produced by a new approach "capillary melt method". The surface of the obtained antimony wire was oxidized in a potassium nitrate melt to fabricate an antimony oxide film for pH sensing. Characterization results show that the oxide layer grown on the wire surface consists of Sb(2)O(3) crystal phase. The sensing response, open-circuit potential, of the electrode has a good linear relationship (R(2)=1.00) with pH value of the test solution. Adding organic compounds into the test media would not affect the linear relationship, although the slope of the lines varied with different ingredients added. The antimony oxide electrodes were employed to continuously monitor pH change of agar culture media during a 2-week plant tissue culture of Dendrobium candidum. The antimony oxide electrode fabricated this way has the advantages of low cost, easy fabrication, fast response, and almost no contamination introduced into the system. It would be suitable for in situ and continuous pH measurement in many bio applications.

  9. Evaluation of a Modified Cefsulodin-Irgasan-Novobiocin Agar for Isolation of Yersinia spp

    Science.gov (United States)

    Tan, Lai Kuan; Ooi, Peck Toung; Carniel, Elisabeth; Thong, Kwai Lin

    2014-01-01

    Y. enterocolitica and Y. pseudotuberculosis are important food borne pathogens. However, the presence of competitive microbiota makes the isolation of Y. enterocolitica and Y. pseudotuberculosis from naturally contaminated foods difficult. We attempted to evaluate the performance of a modified Cefsulodin-Irgasan-Novobiocin (CIN) agar in the differentiation of Y. enterocolitica from non-Yersinia species, particularly the natural intestinal microbiota. The modified CIN enabled the growth of Y. enterocolitica colonies with the same efficiency as CIN and Luria-Bertani agar. The detection limits of the modified CIN for Y. enterocolitica in culture medium (10 cfu/ml) and in artificially contaminated pork (104 cfu/ml) were also comparable to those of CIN. However, the modified CIN provided a better discrimination of Yersinia colonies from other bacteria exhibiting Yersinia-like colonies on CIN (H2S-producing Citrobacter freundii, C. braakii, Enterobacter cloacae, Aeromonas hydrophila, Providencia rettgeri, and Morganella morganii). The modified CIN exhibited a higher recovery rate of Y. enterocolitica from artificially prepared bacterial cultures and naturally contaminated samples compared with CIN. Our results thus demonstrated that the use of modified CIN may be a valuable means to increase the recovery rate of food borne Yersinia from natural samples, which are usually contaminated by multiple types of bacteria. PMID:25170941

  10. Show Me the Green

    Science.gov (United States)

    Norbury, Keith

    2013-01-01

    Gone are the days when green campus initiatives were a balm to the soul and a drain on the wallet. Today's environmental initiatives are all about saving lots of green--in every sense of the word. The environmental benefits of green campus projects--whether wind turbines or better insulation--are pretty clear. Unfortunately, in today's…

  11. Green roof Malta

    OpenAIRE

    Gatt, Antoine

    2015-01-01

    In Malta, buildings cover one third of the Island, leaving greenery in the dirt track. Green roofs are one way to bring plants back to urban areas with loads of benefits. Antoine Gatt, who manages the LifeMedGreenRoof project at the University of Malta, tells us more. http://www.um.edu.mt/think/green-roof-malta/

  12. EPA's Green Roof Research

    Science.gov (United States)

    This is a presentation on the basics of green roof technology. The presentation highlights some of the recent ORD research projects on green roofs and provices insight for the end user as to the benefits for green roof technology. It provides links to currently available EPA re...

  13. In the Green

    Science.gov (United States)

    Kennedy, Mike

    2011-01-01

    Education officials used to debate whether they could afford to pursue green design and construction. Now the green movement has gained a foothold not just in education, but in society at large, and the prevailing attitude seems to have shifted. Can schools afford "not" to go green? As budgets are slashed repeatedly, education administrators must…

  14. The green agenda

    CERN Document Server

    Calder, Alan

    2009-01-01

    This business guide to Green IT was written to introduce, to a business audience, the opposing groups and the key climate change concepts, to provide an overview of a Green IT strategy and to set out a straightforward, bottom line-orientated Green IT action plan.

  15. The Green Man

    Science.gov (United States)

    Watson-Newlin, Karen

    2010-01-01

    The Jolly Green Giant. Robin Hood. The Bamberg Cathedral. Tales of King Arthur. Ecology. What do they have in common? What legends and ancient myths are shrouded in the tales of the Green Man? Most often perceived as an ancient Celtic symbol as the god of spring and summer, the Green Man disappears and returns year after year, century after…

  16. Green Transformational Leadership and Green Performance: The Mediation Effects of Green Mindfulness and Green Self-Efficacy

    OpenAIRE

    Yu-Shan Chen; Ching-Hsun Chang; Yu-Hsien Lin

    2014-01-01

    No prior literature explores the influence of green transformational leadership on green performance, thus, this study develops a novel research framework to fill the research gap. This study investigates the influence of green transformational leadership on green performance and discusses the mediation effects of green mindfulness and green self-efficacy by means of structural equation modeling (SEM). The results indicate that green transformational leadership positively influences green min...

  17. Green Thunderstorms Observed.

    Science.gov (United States)

    Gallagher, Frank W., III; Beasley, William H.; Bohren, Craig F.

    1996-12-01

    Green thunderstorms have been observed from time to time in association with deep convection or severe weather events. Often the green coloration has been attributed to hail or to reflections of light from green foliage on the ground. Some skeptics who have not personally observed a green thunderstorm do not believe that green thunderstorms exist. They suggest that the green storms may be fabrications by excited observers. The authors have demonstrated the existence of green thunderstorms objectively using a spectrophotometer. During the spring and summer of 1995 the authors observed numerous storms and recorded hundreds of spectra of the light emanating corn these storms. It was found that the subjective judgment of colors can vary somewhat between observers, but the variation is usually in the shade of green. The authors recorded spectra of green and nongreen thunderstorms and recorded spectral measurements as a storm changed its appearance from dark blue to a bluish green. The change in color is gradual when observed from a stationary position. Also, as the light from a storm becomes greener, the luminance decreases. The authors also observed and recorded the spectrum of a thunderstorm during a period of several hours as they flew in an aircraft close to a supercell that appeared somewhat green. The authors' observations refute the ground reflection hypothesis and raise questions about explanations that require the presence of hail.

  18. Colonyzer: automated quantification of micro-organism growth characteristics on solid agar

    Directory of Open Access Journals (Sweden)

    Young Alexander

    2010-05-01

    Full Text Available Abstract Background High-throughput screens comparing growth rates of arrays of distinct micro-organism cultures on solid agar are useful, rapid methods of quantifying genetic interactions. Growth rate is an informative phenotype which can be estimated by measuring cell densities at one or more times after inoculation. Precise estimates can be made by inoculating cultures onto agar and capturing cell density frequently by plate-scanning or photography, especially throughout the exponential growth phase, and summarising growth with a simple dynamic model (e.g. the logistic growth model. In order to parametrize such a model, a robust image analysis tool capable of capturing a wide range of cell densities from plate photographs is required. Results Colonyzer is a collection of image analysis algorithms for automatic quantification of the size, granularity, colour and location of micro-organism cultures grown on solid agar. Colonyzer is uniquely sensitive to extremely low cell densities photographed after dilute liquid culture inoculation (spotting due to image segmentation using a mixed Gaussian model for plate-wide thresholding based on pixel intensity. Colonyzer is robust to slight experimental imperfections and corrects for lighting gradients which would otherwise introduce spatial bias to cell density estimates without the need for imaging dummy plates. Colonyzer is general enough to quantify cultures growing in any rectangular array format, either growing after pinning with a dense inoculum or growing with the irregular morphology characteristic of spotted cultures. Colonyzer was developed using the open source packages: Python, RPy and the Python Imaging Library and its source code and documentation are available on SourceForge under GNU General Public License. Colonyzer is adaptable to suit specific requirements: e.g. automatic detection of cultures at irregular locations on streaked plates for robotic picking, or decreasing analysis time by

  19. The effect of magnetic nanoparticles on the acoustic properties of tissue-mimicking agar-gel phantoms

    Energy Technology Data Exchange (ETDEWEB)

    Józefczak, A., E-mail: aras@amu.edu.pl [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kaczmarek, K. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland); Kubovčíková, M. [Institute of Experimental Physics, Slovak Academy of Sciences, Košice (Slovakia); Rozynek, Z.; Hornowski, T. [Institute of Acoustics, Faculty of Physics, Adam Mickiewicz University, Poznań (Poland)

    2017-06-01

    In ultrasonic hyperthermia, ultrasound-induced heating is achieved by the absorption of wave energy and its conversion into heat. The effectiveness of ultrasounds can be improved by using sonosensitisers that greatly attenuate ultrasonic waves and then dissipate the acquired energy in the form of heat. One possible candidate for such a sonosensitiser are superparamagnetic iron oxide nanoparticles. Here, we used magnetic nanoparticles embedded in a tissue-mimicking agar-gel matrix. Such tissue-mimicking phantoms possess acoustic properties similar to those of real tissues, and are used as a tool for performance testing and optimisation of medical ultrasound systems. In this work, we studied the effect of magnetic nanoparticles on the acoustic properties of agar-gel phantoms, including the attenuation of ultrasonic waves. - Highlights: • Ultrasonic insertion technique is used to study acoustic properties of agar-gel phantoms with and without magnetic particles. • The addition of magnetic nanoparticles improves effectiveness of ultrasound heating in agar phantoms. • Acoustics properties of a pure agar-gel phantom are altered by adding nanoparticles.

  20. Diffusion of manganese ions in agar gel containing alkali metal chlorides

    International Nuclear Information System (INIS)

    Borhade, A.V.

    2000-01-01

    The obstruction effect for tracer-diffusion of Mn 2+ ions in the presence of different supporting electrolytes (LiCl, NaCl, KCl, CsCl) at various concentrations has been studied at 25 deg C using the zone diffusion technique. It has been observed that the obstruction effect determined in terms of α increases with concentration of the electrolyte. Further, for a given concentration it is found to decrease with increasing charge density of the cation. We also report here on the effect of temperature on obstruction and found that is constant over the temperature range studied (25-45 deg C). These observations are explained on the basis of competitive hydration between ions and agar macromolecules. (author)

  1. Antimicrobial Disk Susceptibility Testing of Leptospira spp. Using Leptospira Vanaporn Wuthiekanun (LVW) Agar.

    Science.gov (United States)

    Wuthiekanun, Vanaporn; Amornchai, Premjit; Langla, Sayan; White, Nicholas J; Day, Nicholas P J; Limmathurotsakul, Direk; Peacock, Sharon J

    2015-08-01

    Leptospira Vanaporn Wuthiekanun (LVW) agar was used to develop a disk diffusion assay for Leptospira spp. Ten pathogenic Leptospira isolates were tested, all of which were susceptible to 17 antimicrobial agents (amoxicillin/clavulanic acid, amoxicillin, azithromycin, cefoxitin, ceftazidime, ceftriaxone, chloramphenicol, ciprofloxacin, clindamycin, doripenem, doxycycline, gentamicin, linezolid, nitrofurantoin, penicillin, piperacillin/tazobactam, and tetracycline). All 10 isolates had no zone of growth inhibition for four antimicrobials (fosfomycin, nalidixic acid, rifampicin, and trimethoprim/sulfamethoxazole). Of the ten Leptospira, seven had a growth inhibition zone of ≤ 21 mm for aztreonam, the zone diameter susceptibility break point for Enterobacteriaceae. This assay could find utility as a simple screening method during the epidemiological surveillance of antimicrobial resistance in Leptospira spp. © The American Society of Tropical Medicine and Hygiene.

  2. Perfect state of Cryptococcus neoformans, Filobasidiella neoformans, on pigeon manure filtrate agar

    Energy Technology Data Exchange (ETDEWEB)

    Staib, F.

    1981-02-01

    To enable studies of the dependence of Cryptococcus neoformans and its perfect and imperfect states upon bird manure as a habitat of this pathogen, a nutrient medium closely resembling natural conditions was prepared. As sole nutrient, the water soluble ingredients of manure from pigeons (Columbia livia) were used. There was no heat sterilization of the manure filtrate. Using a standard pair of C. neoformans strains for mating, it could be demonstrated that the perfect state of the fungus developed on this so called pigeon manure filtrate agar within 48 h at 26 degrees C. This medium is supposed to help in the elucidation of the epidemiological significance of the perfect and imperfect states of this pathogen.

  3. Agar hydrogel with silver nanoparticles to prolong the shelf life of Fior di Latte cheese.

    Science.gov (United States)

    Incoronato, A L; Conte, A; Buonocore, G G; Del Nobile, M A

    2011-04-01

    The objective of this work was to evaluate the effectiveness of an antimicrobial packaging system containing active nanoparticles on the quality deterioration of Fior di Latte cheese. To this aim, 3 concentrations of silver montmorillonite embedded in agar were used. The cell loads of spoilage and useful microorganisms were monitored during a refrigerated storage period. Moreover, cheese sensory quality (i.e., odor, color, consistency, and overall quality) was evaluated by means of a panel test. Results showed that the active packaging system markedly increased the shelf life of Fior di Latte cheese, due to the ability of silver cations to control microbial proliferation, without affecting the functional dairy microbiota and the sensory characteristics of the product. The active packaging system developed in this work could be used to prolong the shelf life of Fior di Latte and boost its distribution beyond local market borders. Copyright © 2011 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  4. Diagnostic Value of Processing Cytologic Aspirates of Renal Tumors in Agar Cell (Tissue) Blocks

    DEFF Research Database (Denmark)

    Smedts, F.; Schrik, M.; Horn, T.

    2010-01-01

    smears were prepared after each aspiration for conventional cytology and the remaining aspirate was processed for the improved agar microbiopsy (AM) method. Conventional cytology slides, AM slides and surgical specimens were diagnosed separately, after which the diagnoses were compared....... Immunohistochemistry was performed as required on the AM sections. Surgical specimens served as the gold standard. Results In 53% of conventional cytologic smears, the cellular yield was sufficient to render a correct diagnosis. In 12% the diagnosis was incorrect, in 21% only a differential diagnosis could be fin......-initiated, and in 14% too few diagnostic cells were present in the conventional smears for cytologic diagnosis. It was, however, possible to correctly diagnose histologic sections from 97% of AM tissue blocks. In 11 cases this was facilitated with immunochemistry. In only 1 case did the AM tissue block contain too few...

  5. Optimasi Waktu Proses Hidrolisis dan Fermentasi dalam Produksi Bioetanol dari Limbah Pengolahan Agar (Gracilaria sp. Industri

    Directory of Open Access Journals (Sweden)

    Rodiah Nurbaya Sari

    2013-12-01

    menggunakan kapang Trichoderma viride dan khamir Saccharomyces cerevisiae. Penelitian yang dilakukan terdiri dari beberapa tahap yaitu karakterisasi limbah agar industri, hidrolisis enzimatis menggunakan kapang Trichoderma viride penghasil selulase, dan fermentasi dengan khamir Saccharomyces cerevisiae. Hasilnya menunjukkan bahwa waktu optimal untuk hidrolisis enzimatis adalah 4 hari pada suhu 28 oC dan pH 3,91; aktivitas CMCase 210,48 IU/ml dan menghasilkan total gula pereduksi 6,74 mg/ml. Sedangkan untuk waktu fermentasi yang optimal adalah 2 hari pada suhu 32 oC dan pH 4,66 dengan nilai OD 600 nm 0,0181 menghasilkan etanol kasar dengan kadar 0,47% (b/b.

  6. The presence of embedded bacterial pure cultures in agar plates stimulate the culturability of soil bacteria

    DEFF Research Database (Denmark)

    Burmølle, Mette; Johnsen, Kaare; Abu Al-Soud, Waleed Mohamad Abdel F

    2009-01-01

    Traditional methods for bacterial cultivation recover only a small fraction of bacteria from all sorts of natural environments, and attempts have been made to improve the bacterial culturability. Here we describe the development of a cultivation method, based on the embedment of pure bacterial...... cultures in between two layers of agar. Plates containing either embedded Pseudomonas putida or Arthrobacter globiformis resulted in higher numbers of CFUs of soil bacteria (21% and 38%, respectively) after 833 h of incubation, compared to plates with no embedded strain. This indicates a stimulatory effect...... of the bacterial pure cultures on the cultivation of soil bacteria. Analysis of partial 16S rRNA gene sequences revealed a phylogenetical distribution of the soil isolates into 7 classes in 4 phyla. No difference was observed at the phylum or class level when comparing isolates grouped according to embedded strain...

  7. GREEN MANAGEMENT: THE REALITY OF BEING GREEN IN BUSINESS

    OpenAIRE

    Tran, Ben

    2009-01-01

    Green management and going green are not as clear cut and easy as hyped by the general media. While going ecologically green is indeed beneficial and appropriate, the process and procedure of becoming green is anything but easy. Firstly, turning green is largely not a legal requirement, but a voluntary process. Thus, even though LEED (which is by far the more publicly known green certification standard) governs the certification of the green management effort, it is not a compulsory condition...

  8. Cytotoxicity of dental alloys, metals, and ceramics assessed by millipore filter, agar overlay, and MTT tests.

    Science.gov (United States)

    Sjögren, G; Sletten, G; Dahl, J E

    2000-08-01

    Biocompatibility of dental materials is dependent on the release of elements from the materials. In addition, the composition, pretreatment, and handling of the materials influence the element release. This study evaluated the cytotoxicity of dental alloys, metals, and ceramics, with specific emphasis on the effects of altering the composition and the pretreatment. By using cells from a mouse fibroblast cell line and the agar overlay test, Millipore filter test, and MTT test, cytotoxicity of various metals, metal alloys, and ceramics for dental restoration were studied. Effects of altering the composition of a high noble gold alloy and of pretreatment of a ceramic-bonding alloy were also studied. In addition, the release of elements into the cell culture medium by the materials studied was measured using an inductively coupled plasma optical emission spectrophotometer. The results of the MTT test were analyzed statistically using ANOVA and Scheffé test at a significance level of P filter tests. For the MTT test, no significant differences were observed between these materials and controls, with the exception of JS C-gold and unalloyed titanium. The modified materials were ranked from "mildly cytotoxic" to "moderately cytotoxic" in the agar overlay and Millipore filter tests and from "noncytotoxic" to "moderately cytotoxic" in the MTT test. Thus, cytotoxicity was related to the alloy composition and treatment. The release of Cu and Zn seemed to be important for the cytotoxic effect. Alterations in the composition and the pretreatment can greatly influence the cytotoxicity, and the results stress the importance of carefully following the manufacturers' instructions when handling dental materials.

  9. Effects of Antifungal Soaked Silicone Hydrogel Contact Lenses on Candida albicans in an Agar Eye Model.

    Science.gov (United States)

    Phan, Chau-Minh; Bajgrowicz, Magdalena; McCanna, David J; Subbaraman, Lakshman N; Jones, Lyndon

    2016-09-01

    To evaluate the effects of two commercial silicone hydrogel contact lenses (CLs) soaked with natamycin (NA) or fluconazole (FL) on the growth of Candida albicans in an in vitro eye model. Three-D printed molds were used as a cast for making eye-shaped models comprising potato dextrose agar. Senofilcon A (SA) and lotrafilcon B (LB) CLs were incubated with either 2 mL of NA or FL at a concentration of 1 mg/mL for 24 hr. To simulate a fungal infection, the eye models were coated with C. albicans. The drug-soaked lenses were placed on top of the eye models. Seven experimental conditions were examined: (1) NA-SA, (2) NA-LB, (3) FL-SA, (4) FL-LB, (5) SA, (6) LB, and (7) control-no lens. At specified time points (t=1, 8, 16, 24, 48 hr), the agar eyes from each experimental condition were removed from the incubator and photographed. The yeast cells from the 24 and 48 hr time point were also analyzed using light microscopy. At 24 and 48 hr, there was considerable growth observed for all conditions except for the NA-SA and NA-LB conditions. When observed under the microscope at 24 and 48 hr, the morphology of the yeast cells in the FL-SA and SA condition were similar to that of the control (oval shaped). There was limited hyphae growth observed for LB and significant visible hyphae growth for the NA-LB group. For NA-SA, NA-LB, and FL-LB groups, the cells were significantly smaller compared with the control. For NA-SA and NA-LB, there was limited growth of C. albicans observed on the eye models even after 48 hr. Under the microscope, the cell morphology differ noticeably between each testing condition, and is dependent on drug-lens combinations.

  10. Copper removal by algae Gelidium, agar extraction algal waste and granulated algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2008-03-01

    Biosorption of copper ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). The effects of contact time, pH, ionic strength (IS) and temperature on the biosorption process have been studied. Equilibrium data follow both Langmuir and Langmuir-Freundlich models. The parameters of Langmuir equilibrium model were: q(max)=33.0mgg(-1), K(L)=0.015mgl(-1); q(max)=16.7mgg(-1), K(L)=0.028mgl(-1) and q(max)=10.3mgg(-1), K(L)=0.160mgl(-1) respectively for Gelidium, algal waste and composite material at pH=5.3, T=20 degrees C and IS=0.001M. Increasing the pH, the number of deprotonated active sites increases and so the uptake capacity of copper ions. In the case of high ionic strengths, the contribution of the electrostatic component to the overall binding decreases, and so the uptake capacity. The temperature has little influence on the uptake capacity principally for low equilibrium copper concentrations. Changes in standard enthalpy, Gibbs energy and entropy during biosorption were determined. Kinetic data at different solution pH (3, 4 and 5.3) were fitted to pseudo-first-order and pseudo-second-order models. The adsorptive behaviour of biosorbent particles was modelled using a batch reactor mass transfer kinetic model, which successfully predicts Cu(II) concentration profiles.

  11. Brilliant iridescence of Morpho butterfly wing scales is due to both a thin film lower lamina and a multilayered upper lamina.

    Science.gov (United States)

    Giraldo, M A; Stavenga, D G

    2016-05-01

    Butterflies belonging to the nymphalid subfamily, Morphinae, are famous for their brilliant blue wing coloration and iridescence. These striking optical phenomena are commonly explained as to originate from multilayer reflections by the ridges of the wing scales. Because the lower lamina of the scales of related nymphalid butterflies, the Nymphalinae, plays a dominant role in the wing coloration, by acting as a thin film reflector, we investigated single blue scales of three characteristic Morpho species: M. epistrophus, M. helenor and M. cypris. The experimental data obtained by spectrophotometry, scatterometry and scanning electron microscopy demonstrated that also in the Morpho genus the lower lamina of both the cover and ground scales acts as an optical thin film reflector, contributing importantly to the blue structural coloration of the wings. Melanin pigment has a contrast-enhancing function in a sub-class of ground scales.

  12. Green energy in Europe: selling green energy with green certificates

    International Nuclear Information System (INIS)

    Ouillet, L.

    2002-01-01

    Sales of green power products are booming in Europe: 50,000 customers in the United Kingdom, 775,000 in the Netherlands and 300,000 in Germany. Laws of physics are however formal: the way in which electricity flows within the grid does not allow suppliers to assure customers that they are directly receiving electricity produced exclusively from renewable energy sources. What are marketers selling their customers then? Laetitia Ouillet, Greenprices, takes a closer look and focuses on the potential of selling green energy in the forms of renewable energy certificates. (Author)

  13. Zinc-air cell with KOH-treated agar layer between electrode and electrolyte containing hydroponics gel

    Energy Technology Data Exchange (ETDEWEB)

    Otham, R. [International Islamic University, Kuala Lumpur (Malaysia); Yahaya, A. H. [University of Malaya, Dept. of Chemistry, Kuala Lumpur (Malaysia); Arof, A. K. [University of Malaya, Dept. of Physics, Kuala Lumpur (Malaysia)

    2002-07-01

    Zinc-air electrochemical power sources possess the highest density compared to other zinc anode batteries, due their free and unlimited supply from the ambient air. In this experiment zinc-air cells have been fabricated employing hydroponics gel as an alternative alkaline electrolyte gelling agent. Thin KOH-treated agar layer was applied between the electrode-electrolyte interfaces which produced significant enhancement of the cells' capacities, indicating that the application of thin agar layer will improve the electrode-gelled electrolyte interfaces. Promising results have been achieved with porous zinc anode prepared from dried zinc-graphite-gelatinized agar paste; e g. a zinc-air cell employing a porous zinc anode has demonstrated a capacity of 1470 mAh rated at 0.1 A continuous discharge. 32 refs., 9 figs.

  14. Pathogens and Heavy Metals Concentration in Green Leafy Vegetables

    Directory of Open Access Journals (Sweden)

    Abida Begum

    2010-01-01

    Full Text Available Presence of heavy metal and bacterial pathogen in randomly collected samples of green leafy from various stations of Bengaluru city was detected. Heavy metals (cadmium, zinc, copper, iron, chromium, nickel and lead were analyzed by tri-acid digestion method. The presence of heavy metals in general was in the order of Cd>Zn>Cu>Fe>Cr>Pb. Trace metal concentration in all green leafy vegetables of stations 1-5 were within permissible limit and it has been exceeded in station 6-10. This indicated high levels of soil contamination pose potential danger for the vegetables grown in the vicinity of Arakere lake, Bannerghatta road, Gottigere lake, Naganaikanakere, Bommasandra lake, Hulimavu lake, Kelaginakere and Amblipura lake. The total bacteria and coliforms were enumerated on TSA (Tryptone Soya Agar and VRBA (Violet Red Bile Agar media respectively. The total bacterial count in randomly collected samples of coriander ranged from 296 cfu/g to 8 cfu/g, in palak from 16 cfu/g to 0.9 cfu/g, whereas in case of cabbage was 104 cfu/g to 0.9 cfu/g which is an indication of improper pre-harvest and post harvest handling.

  15. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Science.gov (United States)

    Yeh, Ellen; Pinsky, Benjamin A; Banaei, Niaz; Baron, Ellen Jo

    2009-07-03

    Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost-prohibitive commercial sheep blood, offers the opportunity to

  16. Hair sheep blood, citrated or defibrinated, fulfills all requirements of blood agar for diagnostic microbiology laboratory tests.

    Directory of Open Access Journals (Sweden)

    Ellen Yeh

    Full Text Available BACKGROUND: Blood agar is used for the identification and antibiotic susceptibility testing of many bacterial pathogens. In the developing world, microbiologists use human blood agar because of the high cost and inhospitable conditions for raising wool sheep or horses to supply blood. Many pathogens either fail to grow entirely or exhibit morphologies and hemolytic patterns on human blood agar that confound colony recognition. Furthermore, human blood can be hazardous to handle due to HIV and hepatitis. This study investigated whether blood from hair sheep, a hardy, low-maintenance variety of sheep adapted for hot climates, was suitable for routine clinical microbiology studies. METHODS AND FINDINGS: Hair sheep blood obtained by jugular venipuncture was anticoagulated by either manual defibrination or collection in human blood bank bags containing citrate-phosphate-dextrose. Trypticase soy 5% blood agar was made from both forms of hair sheep blood and commercial defibrinated wool sheep blood. Growth characteristics, colony morphologies, and hemolytic patterns of selected human pathogens, including several streptococcal species, were evaluated. Specialized identification tests, including CAMP test, reverse CAMP test, and satellite colony formation with Haemophilus influenzae and Abiotrophia defectiva were also performed. Mueller-Hinton blood agar plates prepared from the three blood types were compared in antibiotic susceptibility tests by disk diffusion and E-test. CONCLUSIONS: The results of all studies showed that blood agar prepared from citrated hair sheep blood is suitable for microbiological tests used in routine identification and susceptibility profiling of human pathogens. The validation of citrated hair sheep blood eliminates the labor-intensive and equipment-requiring process of manual defibrination. Use of hair sheep blood, in lieu of human blood currently used by many developing world laboratories and as an alternative to cost

  17. Enhanced chlorine resistance of tap water-adapted Legionella pneumophila as compared with agar medium-passaged strains.

    Science.gov (United States)

    Kuchta, J M; States, S J; McGlaughlin, J E; Overmeyer, J H; Wadowsky, R M; McNamara, A M; Wolford, R S; Yee, R B

    1985-07-01

    Previous studies have shown that bacteria maintained in a low-nutrient "natural" environment such as swimming pool water are much more resistant to disinfection by various chemical agents than strains maintained on rich media. In the present study a comparison was made of the chlorine (Cl2) susceptibility of hot-water tank isolates of Legionella pneumophila maintained in tap water and strains passaged on either nonselective buffered charcoal-yeast extract or selective differential glycine-vancomycin-polymyxin agar medium. Our earlier work has shown that environmental and clinical isolates of L. pneumophila maintained on agar medium are much more resistant to Cl2 than coliforms are. Under the present experimental conditions (21 degrees C, pH 7.6 to 8.0, and 0.25 mg of free residual Cl2 per liter, we found the tap water-maintained L. pneumophila strains to be even more resistant than the agar-passaged isolates. Under these conditions, 99% kill of tap water-maintained strains of L. pneumophila was usually achieved within 60 to 90 min compared with 10 min for agar-passaged strains. Samples from plumbing fixtures in a hospital yielded legionellae which were "super"-chlorine resistant when assayed under natural conditions. After one agar passage their resistance dropped to levels of comparable strains which had not been previously exposed to additional chlorination. These studies more closely approximate natural conditions than our previous work and show that tap water-maintained L. pneumophila is even more resistant to Cl2 than its already resistant agar medium-passaged counterpart.

  18. Green growth in fisheries

    DEFF Research Database (Denmark)

    Nielsen, Max; Ravensbeck, Lars; Nielsen, Rasmus

    2014-01-01

    harming the environment. Fishery is an environment-dependent sector and it has been argued that there is no potential for green growth in the sector owing to global overexploitation, leaving no scope for production growth. The purpose of this paper is to explain what green growth is and to develop......Climate change and economic growth have gained a substantial amount of attention over the last decade. Hence, in order to unite the two fields of interest, the concept of green growth has evolved. The concept of green growth focuses on how to achieve growth in environment-dependent sectors, without...... a conceptual framework. Furthermore, the aim is to show that a large green growth potential actually exists in fisheries and to show how this potential can be achieved. The potential green growth appears as value-added instead of production growth. The potential can be achieved by reducing overcapacity...

  19. Variation in the excitability of developed D. discoideum cells as a function of agar concentration in the substrate

    Science.gov (United States)

    Oikawa, Noriko; Bae, Albert; Amselem, Gabriel; Bodenschatz, Eberhard

    2010-03-01

    In the absence of nutrients, Dictyostelium discoideum cells enter a developmental cycle--they signal each other, aggregate, and ultimately form fruiting bodies. During the signaling stage, the cells relay waves of cyclic adenosine 3',5' monophosphate (cAMP). We observed a transition from spiral to circular patterns in the signaling wave, depending on the agar concentration of the substrate. In this talk we will present the changes in the times for the onset of signaling and synchronization versus agar concentration, as measured by spectral entropy. We also will discuss the origin of these effects.

  20. Green electricity buyer's guide

    International Nuclear Information System (INIS)

    Kelly, B.; Klein, S.; Olivastri, B.

    2002-06-01

    The electricity produced in whole or in large part from renewable energy sources like wind, small hydro electricity and solar energy, is generally referred to as green electricity. The authors designed this buyer's guide to assist customers in their understanding of green electricity, as the customers can now choose their electricity supplier. The considerations and steps involved in the purchasse of green electricity are identified, and advice is provided on ways to maximize the benefits from the purchase of green electricity. In Alberta and Ontario, customers have access to a competitive electricity market. The emphasis when developing this guide was placed firmly on the large buyers, as they can have enormous positive influence on the new market for green electricity. The first chapter of the document provides general information on green electricity. In chapter two, the authors explore the opportunity for environmental leadership. Chapter three reviews the basics of green electricity, which provides the link to chapter four dealing with the creation of a policy. Purchasing green electricity is dealt with in Chapter five, and maximizing the benefits of green electricity are examined in Chapter Six. 24 refs., 3 tabs

  1. GREEN PACKAGING, GREEN PRODUCT, GREEN ADVERTISING, PERSEPSI, DAN MINAT BELI KONSUMEN

    OpenAIRE

    Imam Santoso; Rengganis Fitriani

    2016-01-01

    Environmental problems become one of the strategic issues in achieving global competitiveness. One of the issues is products that are made from environmental friendly materials or known as green product. Furthermore, in green products marketing, the company also uses green packaging and green advertising concept. This study aimed to analyze the effect of green packaging, green products, and green advertising on consumer perception and purchasing intention. The study was conducted in Ketawangg...

  2. Extracción, identificación y prueba microbiológica del agar extraído de Gracilaria fortissima dawson (rhodophyta, gigartinales, gracilariaceae (ING

    Directory of Open Access Journals (Sweden)

    M.V. Sánchez

    2016-03-01

    Full Text Available The red seaweed Gracilaria fortissima colected in the caribean coast of Costa Rica, was studied for the extraction, identification and microbiological performance of the agar contend of this plant, as well as the mineral contend. The research was done focused on the agar quality included pH, % extraction, geling point, fusion point and gel strength, as well as infrared analysis and the performance as a microbiological culture of bacteria and fungus and compared with commercial agar from BDH chemicals.

  3. Customers’ Intention to Use Green Products: the Impact of Green Brand Dimensions and Green Perceived Value

    Directory of Open Access Journals (Sweden)

    Doszhanov Aibek

    2015-01-01

    Full Text Available This study aimed to identify the relationships between green brand dimension (green brand awareness, green brand image, and green brand trust, green perceived value and customer’s intention to use green products. Data was collected through structured survey questionnaire from 384 customers of three hypermarkets in Kuala-Lumpur. Data was analyzed based on multiple regression analysis. The results indicate that there are significant relationships between green brand awareness, green brand trust, green perceived value, and customer’s intention to use green products. However, green brand image was not found to have significant relationship with customer’s intention to use green products. The discussion presented suggestions for marketers and researchers interested in green branding.

  4. Comparison of Neisseria gonorrhoeae MICs Obtained by Etest and Agar Dilution for Ceftriaxone, Cefpodoxime, Cefixime and Azithromycin.

    Science.gov (United States)

    Gose, Severin; Kong, Carol J; Lee, Yer; Samuel, Michael C; Bauer, Heidi M; Dixon, Paula; Soge, Olusegun O; Lei, John; Pandori, Mark

    2013-10-24

    We evaluated Neisseria gonorrhoeae Etest minimum inhibitory concentrations (MICs) relative to agar dilution MICs for 664 urethral isolates for ceftriaxone (CRO) and azithromycin (AZM), 351 isolates for cefpodoxime (CPD) and 315 isolates for cefixime (CFM). Etest accurately determined CPD, CFM and AZM MICs, but resulted in higher CRO MICs. © 2013. Published by Elsevier B.V. All rights reserved.

  5. Agar Plates Made from Common Supermarket Substances and Bacillus subtilis Natto as an Inexpensive Approach to Microbiology Education

    Directory of Open Access Journals (Sweden)

    Franz-Josef Scharfenberg

    2015-08-01

    Full Text Available To address the possible limitations that financial restrictions may have on students’ independent experimentation at school, we developed and implemented an inexpensive approach for basic microbiology education. We describe four nutrient agars consisting only of everyday substances available from the supermarket or online that we developed to replace standard agars and specific agars. Additionally, we selected Bacillus subtilis natto as an example of a pure-culture species. Our tip first reports the four supermarket-substance agar variants; second, it suggests utilizing them to introduce basic microbiological techniques; and third, it introduces B. subtilis natto in the context of the antibacterial effects of antibiotics as well as of supermarket products which students can bring to class from home. We implemented our approach in microbiology education at school as well as in pre-service teacher education and in in-service teacher professional development courses at our university. Finally, our paper provides worksheets for all the experiments. Editor's Note:The ASM advocates that students must successfully demonstrate the ability to explain and practice safe laboratory techniques. For more information, read the laboratory safety section of the ASM Curriculum Recommendations: Introductory Course in Microbiology and the Guidelines for Biosafety in Teaching Laboratories, available at www.asm.org. The Editors of JMBE recommend that adopters of the protocols included in this article follow a minimum of Biosafety Level 1 practices. If the soil plates described in the activity are opened, a minimum of Biosafety Level 2 is required.

  6. Choline chloride based ionic liquid analogues as tool for the fabrication of agar films with improved mechanical properties

    Science.gov (United States)

    In the present paper, we test the suitability of Choline-Cl/urea (DES-U) and Choline-Cl/glycerol (DES-G) eutectic mixtures at 1:2 molar ratios for the production of agar biodegradable films. A three-step process is proposed: pre-solubilization of polymer in DES followed by compression-molding and s...

  7. Detection of Fusobacterium nucleatum in two cases of empyema and lung abscess using paromomycin-vancomycin supplemented Brucella HK agar.

    Science.gov (United States)

    Nagaoka, Kentaro; Yanagihara, Katsunori; Morinaga, Yoshitomo; Kohno, Shigeru

    2017-02-01

    Fusobacterium nucleatum was found in patients with empyema or pulmonary abscess, using paromomycin-vancomycin Brucella HK agar. In vitro examination revealed that growth of the strains differed significantly in different media. Clinicians should be aware that suboptimal F. nucleatum cultivation methods may result in an underestimation of its frequency. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Effects of immersion disinfection of agar-alginate combined impressions on the surface properties of stone casts.

    Science.gov (United States)

    Iwasaki, Yukiko; Hiraguchi, Hisako; Iwasaki, Eriko; Yoneyama, Takayuki

    2016-01-01

    This study investigated the effects of disinfection of agar-alginate combined impressions on the surface properties of the resulting stone casts. Two brands of cartridge-form agar impression material and one alginate impression material were used. Agar-alginate combined impressions of smooth glass plates were prepared. The impressions were immersed in 0.55% ortho-phthalaldehyde solution or 0.5% sodium hypochlorite solution for 1, 3, 5 and 10 min. A stone cast made with an impression that had not been immersed was prepared as a control. The surface roughness (Ra) of the stone casts was measured, and the cast surfaces were observed by SEM. Immersion of agar-alginate combined impressions in 0.5% sodium hypochlorite solution for up to 10 min had no serious adverse effects on the surface properties of the stone casts. In contrast, even 1 min of immersion in 0.55% ortho-phthalaldehyde solution caused deterioration of the cast surface properties.

  9. Agar/gelatin bilayer gel matrix fabricated by simple thermo-responsive sol-gel transition method.

    Science.gov (United States)

    Wang, Yifeng; Dong, Meng; Guo, Mengmeng; Wang, Xia; Zhou, Jing; Lei, Jian; Guo, Chuanhang; Qin, Chaoran

    2017-08-01

    We present a simple and environmentally-friendly method to generate an agar/gelatin bilayer gel matrix for further biomedical applications. In this method, the thermally responsive sol-gel transitions of agar and gelatin combined with the different transition temperatures are exquisitely employed to fabricate the agar/gelatin bilayer gel matrix and achieve separate loading for various materials (e.g., drugs, fluorescent materials, and nanoparticles). Importantly, the resulting bilayer gel matrix provides two different biopolymer environments (a polysaccharide environment vs a protein environment) with a well-defined border, which allows the loaded materials in different layers to retain their original properties (e.g., magnetism and fluorescence) and reduce mutual interference. In addition, the loaded materials in the bilayer gel matrix exhibit an interesting release behavior under the control of thermal stimuli. Consequently, the resulting agar/gelatin bilayer gel matrix is a promising candidate for biomedical applications in drug delivery, controlled release, fluorescence labeling, and bio-imaging. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. [Thin layer agar represents a cost-effective alternative for the rapid diagnosis of multi-drug resistant tuberculosis].

    Science.gov (United States)

    Hernández-Sarmiento, José M; Martínez-Negrete, Milton A; Castrillón-Velilla, Diana M; Mejía-Espinosa, Sergio A; Mejía-Mesa, Gloria I; Zapata-Fernández, Elsa M; Rojas-Jiménez, Sara; Marín-Castro, Andrés E; Robledo-Restrepo, Jaime A

    2014-01-01

    Using cost-benefit analysis for comparing the thin-layer agar culture method to the standard multiple proportion method used in diagnosing multidrug-resistant tuberculosis (MDR TB). A cost-benefit evaluation of two diagnostic tests was made at the Corporación para Investigaciones Biológicas (CIB) in Medellín, Colombia. 100 patients were evaluated; 10.8% rifampicin resistance and 14.3% isoniazid resistance were found. A computer-based decision tree model was used for cost-effectiveness analysis (Treeage Pro); the thin-layer agar culture method was most cost-effective, having 100% sensitivity, specificity and predictive values for detecting rifampicin and isoniazid resistance. The multiple proportion method value was calculated as being US$ 71 having an average 49 day report time compared to US$ 18 and 14 days for the thin-layer agar culture method. New technologies have been developed for diagnosing tuberculosis which are apparently faster and more effective; their operating characteristics must be evaluated as must their effectiveness in terms of cost-benefit. The present study established that using thin-layer agar culture was cheaper, equally effective and could provide results more quickly than the traditional method. This implies that a patient could receive MDR TB treatment more quickly.

  11. Evaluatie van de membraanfiltratiemethode op mCP-agar voor bepaling van sporen van Clostridium perfringens in water

    NARCIS (Netherlands)

    Schets FM; Medema GJ; LWL

    1995-01-01

    Current Dutch and European drinking water standards include criteria for spores of sulphite reducing clostridia. This has some inherent disadvantages. The reproducibility of the enumeration method for spores of sulphite reducing clostridia (SSRC) in Sulphite Cycloserine Agar (SCA) is poor. Some

  12. A simple agar plate preparation for effective transfer of Ureaplasma colonies onto nitrocellulose membranes for colony immunoblotting.

    Science.gov (United States)

    Zimmerman, Carl-Ulrich R; Stiedl, Thomas; Spergser, Joachim; Rosengarten, Renate

    2014-09-01

    A simple method for preparing agar plates is presented, which allows an efficient transfer of Ureaplasma colonies to nitrocellulose membranes for subsequent immunological detection. This simple and reproducible procedure was used to demonstrate antigenic variation in the phase-variable mba-locus of Ureaplasma parvum serovar 3. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Greening the Future

    Science.gov (United States)

    Williamson, Norma Velia

    2011-01-01

    Because educators vicariously touch the future through their students, the author believes that they sometimes have the uncanny ability to see the future. One common future forecast is the phenomenal growth of green jobs in the emerging green economy, leading to the creation of the "Reach of the Sun" Solar Energy Academy at La Mirada…

  14. Green Buildings and Health.

    Science.gov (United States)

    Allen, Joseph G; MacNaughton, Piers; Laurent, Jose Guillermo Cedeno; Flanigan, Skye S; Eitland, Erika Sita; Spengler, John D

    2015-09-01

    Green building design is becoming broadly adopted, with one green building standard reporting over 3.5 billion square feet certified to date. By definition, green buildings focus on minimizing impacts to the environment through reductions in energy usage, water usage, and minimizing environmental disturbances from the building site. Also by definition, but perhaps less widely recognized, green buildings aim to improve human health through design of healthy indoor environments. The benefits related to reduced energy and water consumption are well-documented, but the potential human health benefits of green buildings are only recently being investigated. The objective of our review was to examine the state of evidence on green building design as it specifically relates to indoor environmental quality and human health. Overall, the initial scientific evidence indicates better indoor environmental quality in green buildings versus non-green buildings, with direct benefits to human health for occupants of those buildings. A limitation of much of the research to date is the reliance on indirect, lagging and subjective measures of health. To address this, we propose a framework for identifying direct, objective and leading "Health Performance Indicators" for use in future studies of buildings and health.

  15. Green product innovation strategy

    NARCIS (Netherlands)

    Driessen, P.H.

    2005-01-01

    Over the last decades, companies have started to incorporate green issues in product innovation strategies. This dissertation studies green product innovation strategy, its antecedents and its outcomes. A three-stage approach is followed. In the first stage, the topic is explored and a preliminary

  16. Green for rarity

    International Nuclear Information System (INIS)

    Raal, F.A.; Robinson, D.N.

    1980-01-01

    Green diamonds once recovered from Witwatersrand gold/uranium deposits, are now a thing of the past with the modernisation of extraction metallurgy methods. The green colouration has been shown to be due to radiation from uranium present in the ore

  17. Green Building Research Laboratory

    Energy Technology Data Exchange (ETDEWEB)

    Sailor, David Jean [Portland State Univ., Portland, OR (United States)

    2013-12-29

    This project provided support to the Green Building Research Laboratory at Portland State University (PSU) so it could work with researchers and industry to solve technical problems for the benefit of the green building industry. It also helped to facilitate the development of PSU’s undergraduate and graduate-level training in building science across the curriculum.

  18. Green Cleaning Label Power

    Science.gov (United States)

    Balek, Bill

    2012-01-01

    Green cleaning plays a significant and supportive role in helping education institutions meet their sustainability goals. However, identifying cleaning products, supplies and equipment that truly are environmentally preferable can be daunting. The marketplace is inundated with products and services purporting to be "green" or environmentally…

  19. Introduction: Experimental Green Strategies

    DEFF Research Database (Denmark)

    Peters, Terri

    2011-01-01

    Defining new ways in which archietcts are responding to the challenge of creating sustainable architecture , Experimental Green Strategies present a state of the art in applied ecological architectural research.......Defining new ways in which archietcts are responding to the challenge of creating sustainable architecture , Experimental Green Strategies present a state of the art in applied ecological architectural research....

  20. Green heterogeneous wireless networks

    CERN Document Server

    Ismail, Muhammad; Nee, Hans-Peter; Qaraqe, Khalid A; Serpedin, Erchin

    2016-01-01

    This book focuses on the emerging research topic "green (energy efficient) wireless networks" which has drawn huge attention recently from both academia and industry. This topic is highly motivated due to important environmental, financial, and quality-of-experience (QoE) considerations. Specifically, the high energy consumption of the wireless networks manifests in approximately 2% of all CO2 emissions worldwide. This book presents the authors’ visions and solutions for deployment of energy efficient (green) heterogeneous wireless communication networks. The book consists of three major parts. The first part provides an introduction to the "green networks" concept, the second part targets the green multi-homing resource allocation problem, and the third chapter presents a novel deployment of device-to-device (D2D) communications and its successful integration in Heterogeneous Networks (HetNets). The book is novel in that it specifically targets green networking in a heterogeneous wireless medium, which re...

  1. Development and Validation of a Microbiological Agar Assay for Determination of Orbifloxacin in Pharmaceutical Preparations

    Directory of Open Access Journals (Sweden)

    Hérida R. N. Salgado

    2011-08-01

    Full Text Available Orbifloxacin is a fluoroquinolone with broad-spectrum antimicrobial activity, and belongs to the third generation of quinolones. Regarding the quality control of medicines, a validated microbiological assay for determination of orbifloxacin in pharmaceutical formulations has not as yet been reported. For this purpose, this paper reports the development and validation of a simple, sensitive, accurate and reproducible agar diffusion method to quantify orbifloxacin in tablet formulations. The assay is based on the inhibitory effect of orbifloxacin upon the strain of Staphylococcus aureus ATCC 25923 used as test microorganism. The results were treated statistically by analysis of variance and were found to be linear (r = 0.9992 in the selected range of 16.0–64.0 μg/mL, precise with relative standard deviation (RSD of repeatability intraday = 2.88%, intermediate precision RSD = 3.33%, and accurate (100.31%. The results demonstrated the validity of the proposed bioassay, which allows reliable orbifloxacin quantitation in pharmaceutical samples and therefore can be used as a useful alternative methodology for the routine quality control of this medicine.

  2. Hypertonic sabouraud dextrose agar as a substrate for differentiation of Candida dubliniensis.

    Science.gov (United States)

    Akgül, Oncü; Cerikçioğlu, Nilgün

    2009-06-01

    In this study, we aimed to detect the proportion of Candida dubliniensis among yeast strains previously identified as C. albicans by using several phenotypic methods and PCR.For this purpose, we screened 300 strains by using phenotypic tests suggested for the identification of C. dubliniensis in the literature, but we detected high proportion of false-positive reactions. Only two strains (0.6%) were detected as true C. dubliniensis by PCR and API ID 32C methods. Moreover, these two strains gave the expected results with all the phenotypic tests, including modified salt tolerance test for C. dubliniensis.In conclusion, none of the phenotypic methods, except for the modified salt tolerance test, revealed 100% successful results in discrimination of C. albicans and C. dubliniensis species. However, in the tobacco agar test, the rate of false positivity was as low as 0.6%. We suggest that in the case of absence of PCR and other automatized identification systems, these two phenotypic tests can be used in routine laboratories to obtain a presumptive result.

  3. Internal properties assessment in agar wood trees using ultrasonic velocity measurement

    International Nuclear Information System (INIS)

    Mohd Noorul Ikhsan Mohamed; Mohamad Pauzi Ismail; Mat Rasol Awang; Mohd Fajri Osman; Fakhruzi, M.; Hashim, M.M.

    2010-01-01

    This paper presents the application of ultrasonic velocity in agar wood trees (Aquilaria crassna) with the purpose of evaluating the relationship of the ultrasonic velocity to the variations of internal properties of trees. In this study, three circular cross-sectional discs from the freshly cut tree were selected as samples. First sample with a big hole (decay) in the middle, second sample with internal resinous and the last one is the sample with no defects. The through transmission ultrasonic testing method was carried out using Tico ultrasonic pulse velocity tester which is from Switzerland. Two-dimensional image of internal properties evaluation by an ultrasonic investigation was obtained using Matlab. The results showed that the ultrasonic wave cannot pass through the internal decay or resinous so that the wave went round it and thus ultrasonic wave velocity significantly decreased by increasing the hole or resinous. The difference in color of the image generated by Matlab software based on variation of ultrasonic velocity between the internal decay area and its surrounding area was obvious. Therefore, the properties of internal properties of the three could be detected by ultrasonic line imaging technique. (author)

  4. Functional properties of edible agar-based and starch-based films for food quality preservation.

    Science.gov (United States)

    Phan, The D; Debeaufort, F; Luu, D; Voilley, A

    2005-02-23

    Edible films made of agar (AG), cassava starch (CAS), normal rice starch (NRS), and waxy (glutinous) rice starch (WRS) were elaborated and tested for a potential use as edible packaging or coating. Their water vapor permeabilities (WVP) were comparable with those of most of the polysaccharide-based films and with some protein-based films. Depending on the environmental moisture pressure, the WVP of the films varies and remains constant when the relative humidity (RH) is >84%. Equilibrium sorption isotherms of these films have been measured; the Guggenheim-Anderson-de Boer (GAB) model was used to describe the sorption isotherm and contributed to a better knowledge of hydration properties. Surface hydrophobicity and wettability of these films were also investigated using the sessile drop contact angle method. The results obtained suggested the migration of the lipid fraction toward evaporation surface during film drying. Among these polysaccharide-based films, AG-based film and CAS-based film displayed more interesting mechanical properties: they are transparent, clear, homogeneous, flexible, and easily handled. NRS- and WRS-based films were relatively brittle and have a low tension resistance. Microstructure of film cross section was observed by environmental scanning electron microscopy to better understand the effect of the structure on the functional properties. The results suggest that AG-based film and CAS-based films, which show better functional properties, are promising systems to be used as food packaging or coating instead of NRS- and WRS-based films.

  5. Estimating the Diffusion Coefficients of Sugars Using Diffusion Experiments in Agar-Gel and Computer Simulations.

    Science.gov (United States)

    Miyamoto, Shuichi; Atsuyama, Kenji; Ekino, Keisuke; Shin, Takashi

    2018-01-01

    The isolation of useful microbes is one of the traditional approaches for the lead generation in drug discovery. As an effective technique for microbe isolation, we recently developed a multidimensional diffusion-based gradient culture system of microbes. In order to enhance the utility of the system, it is favorable to have diffusion coefficients of nutrients such as sugars in the culture medium beforehand. We have, therefore, built a simple and convenient experimental system that uses agar-gel to observe diffusion. Next, we performed computer simulations-based on random-walk concepts-of the experimental diffusion system and derived correlation formulas that relate observable diffusion data to diffusion coefficients. Finally, we applied these correlation formulas to our experimentally-determined diffusion data to estimate the diffusion coefficients of sugars. Our values for these coefficients agree reasonably well with values published in the literature. The effectiveness of our simple technique, which has elucidated the diffusion coefficients of some molecules which are rarely reported (e.g., galactose, trehalose, and glycerol) is demonstrated by the strong correspondence between the literature values and those obtained in our experiments.

  6. Acidity Tunable Ionic Liquids as Catalysts for Conversion of Agar into Mixed Sugars

    Energy Technology Data Exchange (ETDEWEB)

    Kim, Churl; Kim, Hoon Sik [Kyung Hee Univ., Seoul (Korea, Republic of); Ryu, Hyun Jin; Kim, Sang Hyoun; Yoon, Jeong Jun; Kim, Yong Jin [Korea Institute of Industrial Technology, Cheonan (Korea, Republic of)

    2010-02-15

    To summarize, various factors affecting yields of Gal, AG, and 5-HMF formation during saccharification were investigated using agar as a substrate in the presence of several bisulfate-based acidic ionic liquids as catalysts. The result was compared with employing sulfuric acid from the viewpoint of sugar yields and 5-HMF formation. [Bmim][HSO{sub 4}], [Hmim][HSO{sub 4}], [Morph] [HSO{sub 4}], [Bu{sub 4}N][HSO{sub 4}], [Bu{sub 4}P][HSO{sub 4}], [Chol][HSO{sub 4}] showed moderate to high yields of Gal and AG with a remarkable decrease in 5-HMF formation compared with sulfuric acid. Among them, [Chol][HSO{sub 4}] ionic liquid was found to exhibit the highest yield of sugars with an acceptable concentration of 5-HMF that does not inhibit the fermentation process. Generally, there are five major bottom lines for a bioethanol process to be economically viable: the feedstock must be plentiful, inexpensive, in high energy conversion rate, in low demand for food industry, and finally, has to be cultivated in sustainable systems.

  7. Unraveling the nuclear and chloroplast genomes of an agar producing red macroalga, Gracilaria changii (Rhodophyta, Gracilariales).

    Science.gov (United States)

    Ho, Chai-Ling; Lee, Wei-Kang; Lim, Ee-Leen

    2018-03-01

    Agar and agarose have wide applications in food and pharmaceutical industries. Knowledge on the genome of red seaweeds that produce them is still lacking. To fill the gap in genome analyses of these red algae, we have sequenced the nuclear and organellar genomes of an agarophyte, Gracilaria changii. The partial nuclear genome sequence of G. changii has a total length of 35.8Mb with 10,912 predicted protein coding sequences. Only 39.4% predicted proteins were found to have significant matches to protein sequences in SwissProt. The chloroplast genome of G. changii is 183,855bp with a total of 201 open reading frames (ORFs), 29 tRNAs and 3 rRNAs predicted. Five genes: ssrA, leuC and leuD CP76_p173 (orf139) and pbsA were absent in the chloroplast genome of G. changii. The genome information is valuable in accelerating functional studies of individual genes and resolving evolutionary relationship of red seaweeds. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Comparison of three techniques for production goat lentivirus antigen used in the agar gel immunodifusion test

    Directory of Open Access Journals (Sweden)

    Raymundo Rizaldo Pinheiro

    2005-12-01

    Full Text Available The Caprine Arthritis Encephalitis (CAE is a disease who cause considerable economic losses, including loss in the milk production and reduction of the useful life of the animal. In the diagnosis of this disease the agar gel immunodifusion test (AGID is used worldwide as the selection test. The objective of thid work was to test three different concentrations of bovine fetal serum (BFS in the production of the antigen (Ag for the diagnosis of the CAE virus (CAEV, to verify amongst the three methods the most efficient concentration and which the antigen concentration of the antigen produced is appropriate for the test. The method of the AMICON and the concentration of the Ag for dialysis was indicated, however the system AMICON, despite the implantation costs, promoted minor loss of antigen, little time expense in the processing and greater simplicity. With relation to the amount of BFS placed after the viral inoculation it was verified that 5% of BFS the amount that presented better resulted. The antigen concentration 100 times was more indicated, therefore it allowed the diagnosis of the CAEV for two proteins (gp 135 and p28. The concentration of the Ag for precipitation/ultracentrifugation, used for imunoenzimatic tests, did not present resulted satisfactory used in the AGID.

  9. Antimicrobial susceptibility of Brazilian Clostridium difficile strains determined by agar dilution and disk diffusion

    Directory of Open Access Journals (Sweden)

    Edmir Geraldo Fraga

    2016-09-01

    Full Text Available Clostridium difficile is a leading cause of diarrhea in hospitalized patients worldwide. While metronidazole and vancomycin are the most prescribed antibiotics for the treatment of this infection, teicoplanin, tigecycline and nitazoxanide are alternatives drugs. Knowledge on the antibiotic susceptibility profiles is a basic step to differentiate recurrence from treatment failure due to antimicrobial resistance. Because C. difficile antimicrobial susceptibility is largely unknown in Brazil, we aimed to determine the profile of C. difficile strains cultivated from stool samples of inpatients with diarrhea and a positive toxin A/B test using both agar dilution and disk diffusion methods. All 50 strains tested were sensitive to metronidazole according to CLSI and EUCAST breakpoints with an MIC90 value of 2 μg/mL. Nitazoxanide and tigecycline were highly active in vitro against these strains with an MIC90 value of 0.125 μg/mL for both antimicrobials. The MIC90 were 4 μg/mL and 2 μg/mL for vancomycin and teicoplanin, respectively. A resistance rate of 8% was observed for moxifloxacin. Disk diffusion can be used as an alternative to screen for moxifloxacin resistance, nitazoxanide, tigecycline and metronidazole susceptibility, but it cannot be used for testing glycopeptides. Our results suggest that C. difficile strains from São Paulo city, Brazil, are susceptible to metronidazole and have low MIC90 values for most of the current therapeutic options available in Brazil.

  10. Theoretical and experimental NMR studies on muscimol from fly agaric mushroom (Amanita muscaria)

    Science.gov (United States)

    Kupka, Teobald; Wieczorek, Piotr P.

    2016-01-01

    In this article we report results of combined theoretical and experimental NMR studies on muscimol, the bioactive alkaloid from fly agaric mushroom (Amanita muscaria). The assignment of 1H and 13C NMR spectra of muscimol in DMSO-d6 was supported by additional two-dimensional heteronuclear correlated spectra (2D NMR) and gauge independent atomic orbital (GIAO) NMR calculations using density functional theory (DFT). The effect of solvent in theoretical calculations was included via polarized continuum model (PCM) and the hybrid three-parameter B3LYP density functional in combination with 6-311++G(3df,2pd) basis set enabled calculation of reliable structures of non-ionized (neutral) molecule and its NH and zwitterionic forms in the gas phase, chloroform, DMSO and water. GIAO NMR calculations, using equilibrium and rovibrationally averaged geometry, at B3LYP/6-31G* and B3LYP/aug-cc-pVTZ-J levels of theory provided muscimol nuclear magnetic shieldings. The theoretical proton and carbon chemical shifts were critically compared with experimental NMR spectra measured in DMSO. Our results provide useful information on its structure in solution. We believe that such data could improve the understanding of basic features of muscimol at atomistic level and provide another tool in studies related to GABA analogs.

  11. Building the green way.

    Science.gov (United States)

    Lockwood, Charles

    2006-06-01

    Just five or six years ago, the term "green building" evoked visions of barefoot, tie-dyed, granola-munching denizens. There's been a large shift in perception. Of course, green buildings are still known for conserving natural resources by, for example, minimizing on-site grading, using alternative materials, and recycling construction waste. But people now see the financial advantages as well. Well-designed green buildings yield lower utility costs, greater employee productivity, less absenteeism, and stronger attraction and retention of workers than standard buildings do. Green materials, mechanical systems, and furnishings have become more widely available and considerably less expensive than they used to be-often cheaper than their standard counterparts. So building green is no longer a pricey experiment; just about any company can do it on a standard budget by following the ten rules outlined by the author. Reliable building-rating systems like the U.S. Green Building Council's rigorous Leadership in Energy and Environmental Design (LEED) program have done much to underscore the benefits of green construction. LEED evaluates buildings and awards points in several areas, such as water efficiency and indoor environmental quality. Other rating programs include the UK's BREEAM (Building Research Establishment's Environmental Assessment Method) and Australia's Green Star. Green construction is not simply getting more respect; it is rapidly becoming a necessity as corporations push it fully into the mainstream over the next five to ten years. In fact, the author says, the owners of standard buildings face massive obsolescence. To avoid this problem, they should carry out green renovations. Corporations no longer have an excuse for eschewing environmental and economic sustainability. They have at their disposal tools proven to lower overhead costs, improve productivity, and strengthen the bottom line.

  12. [Variations in hyperbilirrubinemia in low birth weight newborns under phototherapy and continous or discontinous agar oral administration (author's transl)].

    Science.gov (United States)

    Colomer, J; Moya, M; Marco, V; De Paredes, C; Escrivá, F; Vila, R

    1975-06-01

    Therapeutic attitude in hyperbilirrubinemia is always worth because other infrequent complications but not for this, less important. Phototherapy innocuousness, largely demonstrated, fosters its profilactic use at beginning and not only for those babies with serum bilirrubin over 10 mg % in the first day of life. Previously we have reported positive results with agar oral administration without collateral effects. On this grounds we have planned the following experience in a homogenous group of L.B.W.: one group was fed with agar previously to each formula administration; other group received the same amount of agar but divided in only three administrations in 24 hours; the last group received continuous phototherapy for 96 hours with a white cold fluorescent light from a source of 8-Vita-lite lamp of 40 watts with a intensity of 500 foot candle and 30 lumens. All of these babies weighed less than 2.500 g. and were between 10 and 90 percentil of Lubschenko diagram. They were fed with the same formula and same time table with no infusions, rejecting all that presented any type of pathology. Obstetric conditions were basically identical. This population was randomly divided in four groups. 1) Control group with no profilaxis, but with identical bilirrubin andhematocrit determinations. 2) Group with continuous agar oral administration, 125 mg. before each of the seven formula feeding. 3) Group with discontinuous agar administration, 250 mg. before three of the seven formula feeding. 4) Group with continuous phototherapy for 96 hours. These is initial identification of the groups with statistic signification, and after that a quantitative and sequential evolution of bilirrubin is analized in each group.

  13. Clarkesville Green Infrastructure Implementation Strategy

    Science.gov (United States)

    The report outlines the 2012 technical assistance for Clarkesville, GA to develop a Green Infrastructure Implementation Strategy, which provides the basic building blocks for a green infrastructure plan:

  14. Analysis of High Quality Agar wood Oil Chemical Compounds By Means Of SPME/ GC-MS and Z-Score Technique

    International Nuclear Information System (INIS)

    Nurlaila Ismail; Mohd Ali Nor Azah; Mailina Jamil; Saiful Nizam Tajuddin; Mohd Nasir Taib

    2013-01-01

    Currently, the grading of the agar wood oil to the high and low quality is done using manually such as human trained grader. It was performed based on the agar wood oil physical properties such as human experience and perception and the oil colour, odor and long lasting aroma. Several researchers found that chemical profiles of the oil should be utilized to overcome the problem facing by manual techniques for example human nose cannot tolerate with the many oils at the same time, so that accurate result can be obtained in grading the agar wood oil. The analysis involved of SPME/ GC-MS and Z-score techniques have been proposed in this study to analyze the chemical compounds especially from the high quality samples of agar wood oil (Aquilariamalaccensis) from Malaysia. Two SPME fibers were used such as divinylbenzene-carbogen-polydimethylsiloxane (DVB-CAR-PDMS) and polydimethylsiloxane (PDMS) in extracting the oils compound under three different sampling temperature conditions such as 40, 60 and 80 degree Celsius. The chemical compounds extracted by SPME/ GC-MS were analyzed. The chemical compounds as identified by Z-score as significant compounds were discussed before the conclusion is made. It was found that 10-epi-γ-eudesmol, aromadendrene, β-agar ofuran, α-agar ofuran and γ-eudesmol were highlighted as significant for high quality agar wood oil and can be used as a marker compounds in classifying the agar wood oil. (author)

  15. Equivalency testing of TTC Tergitol 7 agar (ISO 9308-1:2000) with five culture media for the detection of E. coli in water samples in Greece.

    Science.gov (United States)

    Mavridou, A; Smeti, E; Mandilara, G; Mandilara, G; Boufa, P; Vagiona-Arvanitidou, M; Vantarakis, A; Vassilandonopoulou, G; Pappa, O; Roussia, V; Tzouanopoulos, A; Livadara, M; Aisopou, I; Maraka, V; Nikolaou, E; Mandilara, G

    2010-01-01

    In this study ten laboratories in Greece compared the performance of reference method TTC Tergitol 7 Agar (with the additional test of beta-glucuronidase production) with five alternative methods, to detect E. coli in water, in line with European Water Directive recommendations. The samples were prepared by spiking drinking water with sewage effluent following a standard protocol. Chlorinated and non-chlorinated samples were used. The statistical analysis was based on the mean relative difference of confirmed counts and was performed in line with ISO 17994. The results showed that in total, three of the alternative methods (Chromocult Coliform agar, Membrane Lauryl Sulfate agar and Trypton Bilex-glucuronidase medium) were not different from TTC Tergitol 7 agar (TTC Tergitol 7 agar vs Chromocult Coliform agar, 294 samples, mean RD% 5.55; vs MLSA, 302 samples, mean RD% 1; vs TBX, 297 samples, mean RD% -2.78). The other two alternative methods (Membrane Faecal coliform medium and Colilert 18/ Quantitray) gave significantly higher counts than TTC Tergitol 7 agar (TTC Tergitol 7 agar vs MFc, 303 samples, mean RD% 8.81; vs Colilert-18/Quantitray, 76 samples, mean RD% 18.91). In other words, the alternative methods generated performance that was as reliable as, or even better than, the reference method. This study will help laboratories in Greece overcome culture and counting problems deriving from the EU reference method for E. coli counts in water samples.

  16. Comparison of Rosco Neo-Sensitabs with Oxoid paper disks in EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar

    DEFF Research Database (Denmark)

    Justesen, U S; Acar, Ziyap; Olsson, K

    2013-01-01

    This study compared Neo-Sensitabs with Oxoid paper disks using the European Committee on Antimicrobial Susceptibility Testing (EUCAST) disk diffusion antimicrobial susceptibility test on Mueller-Hinton agar. The EUCAST-recommended quality control strains (Escherichia coli ATCC 25922, Pseudomonas...... paper disks for EUCAST disk diffusion antimicrobial susceptibility testing on Mueller-Hinton agar....

  17. Selling the green dream

    International Nuclear Information System (INIS)

    Wood, E.

    2005-01-01

    The article discusses the marketing and sales of energy generated from renewable energy sources. To purchase environmental energy in the USA, the consumer need do no more than tick a box on a sheet of paper. But, it is not just households that opt for green energy: businesses are also willing customers. A factor in the success in selling green energy to big business is that the retail price of wind power can be held constant over periods of several years, whereas fossil fuel prices can fluctuate wildly. Details of sources and sales of the top ten companies selling green energy are given

  18. Manufacturing Green Consensus

    DEFF Research Database (Denmark)

    Gulsrud, Natalie Marie; Ooi, Can Seng

    2014-01-01

    In an increasingly global economy, being green, or having an environmentally sustainbale place brand, provides a competitive advantage. Singapore, long known as the ``garden city´´ has been a leader in green city imaging since the founding of the equatorial city-state, contributing, in large part...... to the city’s profile as the economic giant of Southeast Asia. Using a political ecology lens, the paper aims to uncover the contested socio-economic narratives of green city imaging by examining the evolution of the garden city branding scheme since Singapore’s independence in 1959. Results show...

  19. About green political parties

    Directory of Open Access Journals (Sweden)

    Orlović Slobodan P.

    2015-01-01

    Full Text Available In this work the author refers to some legal and political questions in connection with green political parties. Those questions cover: the ideology of green political parties, their number and influence, both in general and in Serbia. The first part of work is generally speaking about political parties - their definition, ideology, role and action. Main thesis in this work is that green political parties, by their appearance, were something new on the political scene. But quickly, because of objective and subjective reasons, they were changing original ideas and were beginning to resemble to all other political parties. In this way, they lost their vanguard and political alternativeness.

  20. Chromium and zinc uptake by algae Gelidium and agar extraction algal waste: kinetics and equilibrium.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2007-11-19

    Biosorption of chromium and zinc ions by an industrial algal waste, from agar extraction industry has been studied in a batch system. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction, and the industrial waste immobilized with polyacrylonitrile (composite material). Langmuir and Langmuir-Freundlich equilibrium models describe well the equilibrium data. The parameters of Langmuir equilibrium model at pH 5.3 and 20 degrees C were for the algae, q(L)=18 mg Cr(III)g(-1) and 13 mgZn(II)g(-1), K(L) = 0.021l mg(-1)Cr(III) and 0.026l mg(-1) Zn(II); for the algal waste, q(L)=12 mgCr(III)g(-1) and 7mgZn(II)g(-1), K(L)=0.033lmg(-1) Cr(III) and 0.042l mg(-1) Zn(II); for the composite material, q(L) = 9 mgCr(III)g(-1) and 6 mgZn(II)g(-1), K(L)=0.032l mg(-1)Cr(III) and 0.034l mg(-1)Zn(II). The biosorbents exhibited a higher preference for Cr(III) ions and algae Gelidium is the best one. The pseudo-first-order Lagergren and pseudo-second-order models fitted well the kinetic data for the two metal ions. Kinetic constants and equilibrium uptake concentrations given by the pseudo-second-order model for an initial Cr(III) and Zn(II) concentration of approximately 100 mgl(-1), at pH 5.3 and 20 degrees C were k(2,ads)=0.04 g mg(-1)Cr(III)min(-1) and 0.07 g mg(-1)Zn(II)min(-1), q(eq)=11.9 mgCr(III)g(-1) and 9.5 mgZn(II)g(-1) for algae; k(2,ads)=0.17 g mg(-1)Cr(III)min(-1) and 0.19 g mg(-1)Zn(II)min(-1), q(eq)=8.3 mgCr(III)g(-1) and 5.6 mgZn(II)g(-1) for algal waste; k(2,ads)=0.01 g mg(-1)Cr(III)min(-1) and 0.18 g mg(-1)Zn(II)min(-1), q(eq)=8.0 mgCr(III)g(-1) and 4.4 mgZn(II)g(-1) for composite material. Biosorption was modelled using a batch adsorber mass transfer kinetic model, which successfully predicts Cr(III) and Zn(II) concentration profiles. The calculated average homogeneous diffusivities, D(h), were 4.2 x 10(-8), 8.3 x 10(-8) and 1.4 x 10(-8)cm(2)s(-1) for Cr(III) and 4.8 x 10(-8), 9.7 x 10(-8) and 6.2 x 10(-8)cm(2)s(-1

  1. Sustainable green urban planning: the Green Credit Tool

    NARCIS (Netherlands)

    Cilliers, E.J.; Diemont, E.; Stobbelaar, D.J.; Timmermans, W.

    2010-01-01

    Purpose – The Green Credit Tool is evaluated as a method to quantify the value of green-spaces and to determine how these green-space-values can be replaced or compensated for within urban spatial planning projects. Design/methodology/approach – Amersfoort Local Municipality created the Green Credit

  2. Direct impression on agar surface as a diagnostic sampling procedure for candida balanitis.

    Science.gov (United States)

    Lisboa, Carmen; Santos, António; Azevedo, Filomena; Pina-Vaz, Cidália; Rodrigues, Acácio Gonçalves

    2010-02-01

    The diagnosis of candida balanitis should be based upon both clinical and mycological data. The procedure of material collection is a critical issue to confirm or rule out the clinical diagnosis of candida balanitis. To compare direct impression of the glans on the agar surface of solid culture media with the collection of genital exudates with cotton swab for the diagnosis of candida balanitis. A prospective cross-sectional study was carried out during a 36-month period. Sexually transmitted disease clinic attendees with balanitis and asymptomatic men were included. Specimens for yeast culture were collected from the glans penis and inner preputial layer using the direct impression on CHROMagar candida medium and by swabbing with a sterile cotton swab. Among 478 men enrolled, 189 had balanitis. The prevalence of candida balanitis was 17.8% (85/478) confirmed after culture by direct impression; the swab method detected only 54/85 (63.5%) of these men. Of the 289 asymptomatic men, 36 (12.5%) yielded Candida spp; the swab method detected only 38.9% of these men. The risk of having candida balanitis is 8.9 (IC 95% 2.48 to 32.04) whenever the number of candida colonies recovered by direct impression was greater than 10. Direct impression on CHROMagar candida medium resulted in the highest Candida spp recovery rate. More than 10 colonies yielded by impression culture were statistically associated with candida balanitis. This method shows the ideal profile for sampling the male genital area for yeasts and should be included in the management of balanitis.

  3. In vitro antifungal susceptibility testing of Scopulariopsis brevicaulis strains using agar diffusion method.

    Science.gov (United States)

    Skóra, Magdalena; Macura, Anna B

    2011-01-01

    The genus Scopulariopsis is a common soil saprotroph and has been isolated from air, organic waste and also from plant, animal and human tissues. Scopulariopsis has mainly been associated in humans with superficial mycoses, but it has also been described as the cause of subcutaneous and invasive infections. The most common aetiological agent of infections in humans is Scopulariopsis brevicaulis. This species has been reported to be resistant in vitro to broad-spectrum antifungal agents available today. The aim of the study was to establish in vitro antifungal susceptibility of 35 S. brevicaulis strains against amphotericin B (AMB), flucytosine (FC), caspofungin (CAS), terbinafine (TER), ciclopirox (CIC), voriconazole (VOR), clotrimazole (CTR), miconazole (MCZ), econazole (ECO), ketoconazole (KET), itraconazole (ITR), and fluconazole (FLU). Antifungal susceptibility tests were evaluated by an agar diffusion method (Neo-Sensitabs, Rosco, Denmark). AMB, FC, CAS, ITR and FLU showed no antifungal activity against S. brevicaulis. TER, CIC, CTR, KET, VOR, ECO, and MCZ revealed inhibitory activity for S. brevicaulis, but it varied for each of the drugs. The best antifungal effect was observed for TER and CIC. All isolates had large inhibition zones for TER and CIC. CTR was also inhibitory for all tested S. brevicaulis isolates, but the diameters of inhibition zones were smaller than for TER and CIC. Nearly 89% isolates showed inhibition zones for KET and the mean diameter of the inhibition zone was comparable to CTR. The least antifungal activity exhibited VQR, ECO and MCZ. Because of the multiresistance of S. brevicaulis, infections due to this species may not respond to particular antifungal treatment and other therapeutic approaches should be considered, e.g., combined therapy and/or surgery.

  4. Evaluation of semisolid agar method for antifungal susceptibility test of T. rubrum

    Directory of Open Access Journals (Sweden)

    Sultana Razia

    2016-08-01

    Full Text Available Background: With increasing fungal disease many newer antifungal drugs are available with different spectrum of activ­ity. Antifungal susceptibility test will help clinicians for selection of effective drug and thereby treatment of patient. Objective: The study was undertaken to perform a simple screening drug susceptibility test of T. rnbrum by Semi Solid Agar Antifungal Susceptibility (SAAS Method: Perfonnance of susceptibility method was assessed by comparing the MICs of three commonly prescribed antifungal agents namely- tluconazole (FCZ, itraconazole (ITZ and terbinafine (TER to the CLSI (Clinical and Laboratory Standard Institute recommended M-38, a broth microdilution method. Results: In SAAS method, among twenty nine T. rubrum, twenty five (86.2% were susceptible (MIC range 0.5-64 µg/ml to Fluconazole (FCZ and four (13.7% were resistant (MIC value >64 µg/ml. In broth microdilution method, among twenty nine T. rubrum, twenty six (89.6% were susceptible (MIC range 0.3-64 µg/ml to FCZ and three (10.3% were resistant (MIC value >64 µg/ml. In case of both ITZ and TER, all were susceptible (MIC range 0.3-64 µg/ml to both methods. The SAAS method demonstrated the susceptibility pattern of T. rubrum against FCZ, ITZ and TER usually within 72 to 96 hours after organism isolation and results were concordance with the results of CLSI broth microdilution method. Conclusion: Though it is a newer method with proper standardization of the test method, SAAS method is simple and easily applicable screening method for susceptibility testing of antifungal agents against dermatophytes in any microbiology laboratories.

  5. Perbedaan Cara Penyebaran Suspensi terhadap Jumlah Bakteri pada Media Eosin Methylene Blue Agar

    Directory of Open Access Journals (Sweden)

    Ahmad Nuzuludin Kadri

    2015-06-01

    Full Text Available Dalam rangka pengawasan mutu secara biologis dilakukan pengujian laboratorium untuk mengisolasi dan melakukan jumlah penghitungan jumlah bakteri patogen (enumerasi. Tujuan dari penelitian ini adalah untuk mengetahui perbedaan cara penyebaran suspensi dengan menggunakan batang gelas bengkok, mikropipet dan ose terhadap jumlah bakteri yang terhitung pada media Eosin Methylene Blue Agar. Sampel diambil dari air susu kambing yang kemudian dihitung jumlah bakteri-nya dengan tiga kelompok perlakuan yaitu menggunakan batang gelas bengkok, mikropipet dan ose. Data hasil penelitian dianalisis menggunakan sidik ragam, bila hasilnya berbeda nyata maka dilanjutkan dengan uji Duncan. Jumlah bakteri yang terhitung dengan menggunakan batang gelas bengkok, mikropipet dan ose per ml berturut-turut mengandung 9.722.222 cfu, 68.944.444 cfu dan 116.444.444 cfu. Dengan sidik ragam, perlakuan cara penyebaran dengan menggunakan mikropipet dan ose berbeda sangat nyata (P<0,01 terhadap jumlah bakteri yang terhitung dengan menggunakan batang gelas bengkok. Setelah di uji dengan uji Duncan, rata-rata jumlah bakteri yang terhitung dengan menggunakan mikropipet dan ose lebih tinggi sangat nyata (P<0,01 dibandingkan dengan menggunakan batang gelas bengkok, sedangkan rata-rata jumlah bakteri yang terhitung menggunakan ose lebih tinggi sangat nyata (P<0,01 dibandingkan dengan menggunakan mikropipet. Kesimpulan dari penelitian ini adalah terdapat perbedaan cara penyebaran suspensi dengan menggunakan batang gelas bengkok,mikropipet dan ose terhadap jumlah bakteri pada media EMBA. Penyebaran bakteri menggunakan ose lebih banyak (P<0,01 dibandingkan mikropipet dan batang gelas bengkok. Sedangkan penyebaran bakteri menggunakan mikropipet lebih banyak (P<0,01 dibandingkan dengan gelas bengkok.

  6. Halococcus agarilyticus sp. nov., an agar-degrading haloarchaeon isolated from commercial salt.

    Science.gov (United States)

    Minegishi, Hiroaki; Echigo, Akinobu; Shimane, Yasuhiro; Kamekura, Masahiro; Itoh, Takashi; Ohkuma, Moriya; Usami, Ron

    2015-05-01

    Two agar-degrading halophilic archaeal strains, 62 E(T) and 197 A, were isolated from commercial salt samples. Cells were non-motile cocci, approximately 1.2-2.0 µm in diameter and stained Gram-negative. Colonies were pink-pigmented. Strain 62 E(T) was able to grow with 24-30% (w/v) NaCl (optimum, 27%), at pH 6.5-8.5 (optimum, pH 7.5) and at 22-47 °C (optimum, 42 °C). The 16S rRNA gene sequences of strains 62 E(T) and 197 A were identical, and the level of DNA-DNA relatedness between them was 90 and 90% (reciprocally). The closest relative was Halococcus saccharolyticus JCM 8878(T) with 99.7% similarity in 16S rRNA orthologous gene sequences, followed by Halococcus salifodinae JCM 9578(T) (99.6%), while similarities with other species of the genus Halococcus were equal to or lower than 95.1%. The rpoB' gene tree strongly supported that the two strains were members of the genus Halococcus . Mean DNA-DNA relatedness between strain 62 E(T) and H. saccharolyticus JCM 8878(T) and H. salifodinae JCM 9578(T) was 46 and 44%, respectively. The major polar lipids were archaeol derivatives of phosphatidylglycerol, phosphatidylglycerol phosphate methyl ester, derived from both C20C20 and C20C25 archaeol, and sulfated diglycosyl archaeol-1. Several unidentified glycolipids were present. Based on the phenotypic and phylogenetic analyses, the isolates are considered to represent a novel species of the genus Halococcus , for which the name Halococcus agarilyticus sp. nov. is proposed. The type strain is 62 E(T) ( = JCM 19592(T) =KCTC 4143(T)). © 2015 IUMS.

  7. Agar Technique for the Cultivation In Vitro of Bone-Marrow Colonies

    Energy Technology Data Exchange (ETDEWEB)

    Metcalf, D. [Walter and Eliza Hall Institute, Royal Melbourne Hospital, Melbourne, VIC (Australia)

    1969-07-15

    In solid-state agar cultures certain haemopoietic cells proliferate and form discrete colonies of 200 - 4000 cells. Colony formation is dependent on stimulation by the colony-stimulating factor, and this is achieved by (1) the use of a cell feeder layer, (2) the addition of conditioned medium, or (3) the addition of human or mouse serum or urine containing the factor. All colonies initially contain granulocytic cells which differentiate from myeloblasts to polymorphs as colony growth proceeds. Later colonies develop a second population of phagocytic mononuclear cells (macrophages). The colony-forming-system is simple, readily quantitated and highly reproducible. Linear dose responses occur between the dose of colony-stimulating factor and the number and size of colonies developing from a standard number of bone-marrow cells. In-vitro colony formation has been achieved with haemopoietic cells of the following species: mouse, rat, hamster, guinea pig, rabbit and human. In the adult mouse, colony-forming cells are located in the bone marrow, spleen and blood and in the embryo, in the yolk sac, liver and spleen. The colony-forming cell appears to be an early member of the granulocytic series. The colony-forming system has been used as a quantitative assay system: (1) to assay levels of colony-stimulating factor in serum and urine and in the chemical- characterization and purification of the factor; and (2) to enumerate the number of colony-forming cells in haemopoietic tissues in response to a variety of experimental procedures and disease states. Since the system is applicable to human bone-marrow cells, it should prove of value in the quantitative assay of (1) survival of human bone marrow on storage, and (2) bone-marrow content of granulocytic precursor cells in various disease states and following various types of therapy. The system is not suitable for the mass production in vitro of haemopoietic cells for therapeutic use. (author)

  8. Influence of Ce Doping on the Electrical and Optical Properties of TiO2 and Its Photocatalytic Activity for the Degradation of Remazol Brilliant Blue R

    Directory of Open Access Journals (Sweden)

    Aisha Malik

    2013-01-01

    Full Text Available Nanocrystalline TiO2 particles doped with different concentrations of Cerium (Ce, 1–10% have been synthesized using sol-gel method. The prepared particles were characterized by standard analytical techniques such as X-ray diffraction (XRD, FTIR and Scanning Electron Microscopy (SEM, and Transmission Electron Microscopy (TEM. The XRD analysis shows no change in crystal structure of TiO2 after doping with different concentrations of Ce, which indicates the single-phase polycrystalline material. The SEM analysis shows the partial crystalline nature of undoped, and doped TiO2 and TEM analysis shows the particle sizes were in the range of 9–14 nm in size. The a.c. analysis shows that the dielectric constant ε and dielectric loss tan δ decrease with the increase in frequency. The dielectric property decreases with the increase in dopant concentration. It is also observed that the impedance increases with an increase in dopant concentration. The photocatalytic activity of the synthesized particles (Ce-doped TiO2 with dopant concentration of 9% (Ce showed the highest photocatalytic activity for the degradation of the dye derivative Remazol Brilliant Blue R in an immersion well photochemical reactor with 500 W halogen linear lamp in the presence of atmospheric oxygen.

  9. Visible-light photocatalytic decolorization of reactive brilliant red X-3B on Cu{sub 2}O/crosslinked-chitosan nanocomposites prepared via one step process

    Energy Technology Data Exchange (ETDEWEB)

    Cao, Chunhua [College of Resource and Environmental Science, Wuhan University, Wuhan 430072 (China); Key Laboratory of Optoelectronic Chemical Materials and Devices of Ministry of Education, College of Chemical and Environmental Engineering, Jianghan University, Wuhan 430056 (China); Xiao, Ling, E-mail: xiaoling9119@yahoo.cn [College of Resource and Environmental Science, Wuhan University, Wuhan 430072 (China); Liu, Li; Zhu, Huayue [College of Resource and Environmental Science, Wuhan University, Wuhan 430072 (China); Chen, Chunhua; Gao, Lin [Key Laboratory of Optoelectronic Chemical Materials and Devices of Ministry of Education, College of Chemical and Environmental Engineering, Jianghan University, Wuhan 430056 (China)

    2013-04-15

    Cu{sub 2}O/crosslinked-chitosan nanocomposites (Cu{sub 2}O/CS NCs) were in situ prepared via a simple one-step liquid phase precipitation–reduction process and characterized by XRD, FT-IR, SEM, TEM, BET, XPS and UV–vis/DRS. The characterization results showed that Cu{sub 2}O/CS NCs were almost similar spherical or ellipsoidal and the surface was rough and porous because Cu{sub 2}O particle was wrapped in chitosan. The chitosan layer was especially favorable for improving the adsorption ability of dye and molecular oxygen and restraining the recombination of electrons–holes pair. The visible-light photocatalytic decolorization behavior on Cu{sub 2}O/CS NCs was evaluated using reactive brilliant red X-3B (X-3B) as a model pollutant. The influences of various experimental factors on X-3B decolorization were investigated. It was found that the photocatalytic decolorization process on Cu{sub 2}O/CS NCs followed apparent pseudo-first-order kinetics model. The dye X-3B could be decolorized more efficiently in acidic media than in alkaline media. Cu{sub 2}O/CS NCs exhibited enhanced visible-light photocatalytic activity compared with other photocatalysts reported before under similar experimental conditions.

  10. Synthesis of highly uniform Cu2O spheres by a two-step approach and their assembly to form photonic crystals with a brilliant color.

    Science.gov (United States)

    Su, Xin; Chang, Jie; Wu, Suli; Tang, Bingtao; Zhang, Shufen

    2016-03-21

    Monodisperse semiconductor colloidal spheres with a high refractive index hold great potential for building photonic crystals with a strong band gap, but the difficulty in separating the nucleation and growth processes makes it challenging to prepare highly uniform semiconductor colloidal spheres. Herein, real monodisperse Cu2O spheres were prepared via a hot-injection & heating-up two-step method using diethylene glycol as a milder reducing agent. The diameter of the as prepared Cu2O spheres can be tuned from 90 nm to 190 nm precisely. The SEM images reveal that the obtained Cu2O spheres have a narrow size distribution, which permits their self-assembly to form photonic crystals. The effects of precursor concentration and heating rates on the size and morphology of the Cu2O spheres were investigated in detail. The results indicate that the key points of the method include the burst nucleation to form seeds at a high temperature followed by rapid cooling to prevent agglomeration, and appropriate precursor concentration as well as a moderate growth rate during the further growth process. Importantly, photonic crystal films exhibiting a brilliant structural color were fabricated with the obtained monodisperse Cu2O spheres as building blocks, proving the possibility of making photonic crystals with a strong band gap. The developed method was also successfully applied to prepare monodisperse CdS spheres with diameters in the range from 110 nm to 210 nm.

  11. Adsorption of Reactive Brilliant Red X-3B in Aqueous Solutions on Clay–Biochar Composites from Bagasse and Natural Attapulgite

    Directory of Open Access Journals (Sweden)

    Si Chen

    2018-05-01

    Full Text Available The study aims to determine the adsorption mechanism of reactive brilliant red X-3B (RBR on a novel low-cost clay–biochar composite with different proportions of bagasse and natural attapulgite (ATP. Pure bagasse, pure ATP, and two mixtures with weight ratios of 1:5 and 1:3 were pyrolyzed at 700 °C for 4 h in a muffle furnace. Biochar samples were characterized with an element analyzer and by scanning electron microscopy, X-ray diffraction, Fourier transform infrared, X-ray photoelectron spectroscopy, Brunauer–Emmett–Teller method, and zeta potential measurement. Results of the batch and leaching experiments showed that the adsorption capacities followed the order of 1:3 clay–biochar > 1:5 clay–biochar > bagasse biochar > pure ATP. Furthermore, ATP and bagasse exerted a synergistic effect on the adsorption of RBR. The adsorption data showed good correlation with the Langmuir isotherm, and the kinetic data were fitted to the pseudo-second-order model. The adsorption of RBR on clay-biochar involved electrostatic interaction, hydrogen bond, π–π interactions, and surface participation. The modification of biochar by ATP improved the adsorption capacity by increasing functional groups and creating adsorption sites. Therefore, ATP-modified clay–biochar composites could be effective adsorbents for the removal of RBR from wastewater.

  12. Interaction of Brilliant Blue dye solution with soil and its effect on mobility of compounds around the zones of preferenial flows at spruce stand

    Directory of Open Access Journals (Sweden)

    Bebej Juraj

    2017-06-01

    Full Text Available We performed field experiment with 10 g l−1 concentration of Brilliant Blue solutes in 100 l of water sprinkling on 1 × 1 m surface of the Dystric Cambisol. Consequently, four vertical profiles were exposed at experimental plot after 2 hours (CUT 2, 24 hours (CUT 24, 27 hours (CUT 27 and after 504 hours (CUT 504 in order to analyse spatiotemporal interactions among the BB solution (Na-salts, soil exchangeable complex and fine earth soil (% samples extracted from both the high and low coloured zones located around the optically visualised macropore preferred flow (PF zones. The concentration changes were quantifying via soil profiles not affected by BB (termed as REF located in the close vicinity of experimental plot. Observed changes in pH (H2O, chemical composition of fineearth soil, as well as in concentration of Na+ in soil exchangeable complex to suggest, the BB dye solution didn’t represent an inert tracer, but compounds strongly involved in reaction with surrounding soils. Recorded chemical trends seems to be the result both the competitive processes between the Na+ of BB dye solution and composition of surrounding soil exchangeable complex, as well and the spatial-temporal controlled mechanism of dye solution transfer in soil.

  13. Green Supplier Selection Criteria

    DEFF Research Database (Denmark)

    Nielsen, Izabela Ewa; Banaeian, Narges; Golinska, Paulina

    2014-01-01

    Green supplier selection (GSS) criteria arise from an organization inclination to respond to any existing trends in environmental issues related to business management and processes, so GSS is integrating environmental thinking into conventional supplier selection. This research is designed...... to determine prevalent general and environmental supplier selection criteria and develop a framework which can help decision makers to determine and prioritize suitable green supplier selection criteria (general and environmental). In this research we considered several parameters (evaluation objectives......) to establish suitable criteria for GSS such as their production type, requirements, policy and objectives instead of applying common criteria. At first a comprehensive and deep review on prevalent and green supplier selection literatures performed. Then several evaluation objectives defined to assess the green...

  14. Green Building Standards

    Science.gov (United States)

    Many organizations have developed model codes or rating systems that communities may use to develop green building programs or revise building ordinances. Some of the major options are listed on this page.

  15. Introduction: Green Building Handbook

    CSIR Research Space (South Africa)

    Van Wyk, Llewellyn V

    2010-08-01

    Full Text Available By recognising the specific environmental challenges facing South Africa, mindful of the government‘s commitment to reducing South Africa‘s Greenhouse gas emissions, and acknowledging the need to build social cohesion, the Green Building Handbook...

  16. Green certificates causing inconvenience?

    International Nuclear Information System (INIS)

    Torgersen, Lasse

    2002-01-01

    From early 2002, producers of green energy in selected countries have been able to benefit from generous financial support in the Netherlands. Thus, there has been increased sale of green certificates from Norway and Sweden. But the condition that physical energy delivery should accompany the certificates has caused a marked rise in the price of energy in transit through Germany to the Netherlands. This article discusses the green certificate concept and the experience gained from the Netherlands. One conclusion is that if large-scale trade with green certificates is introduced in Europe without the condition of accompanying energy delivery, then producers of hydro-electric power in Norway and Sweden may be the losers

  17. Green space as classroom

    DEFF Research Database (Denmark)

    Bentsen, Peter; Schipperijn, Jasper; Jensen, Frank Søndergaard

    2013-01-01

    More and more Danish teachers have started introducing curriculum-based outdoor learning as a weekly or biweekly ‘outdoor school’ day for school children. This move towards schooling in non-classroom spaces presents a challenge for green space managers. Basic managerial knowledge related to what......, who, when and where has thus far only been supported by anecdotal evidence, but seems fundamental to the decision-making of a range of green space providers. The present study aims to describe, characterise and discuss outdoor teachers’ use, preferences and ecostrategies in relation to green space....... A nationwide survey was conducted among Danish teachers practising outdoor teaching (107 respondents), and it showed that a majority used and preferred forest areas. The outdoor teachers used mainly school grounds and local green space for their outdoor teaching with a majority using the same place or mostly...

  18. Green by Default

    DEFF Research Database (Denmark)

    Sunstein, Cass R.; Reisch, Lucia

    2013-01-01

    The article offers information on the two sources of energy including green energy and gray energy. It discusses several facts which includes lower levels of greenhouse gases and conventional pollutants, relationship between economic incentives and underlying preferences and potential effects...

  19. Green Sturgeon Acoustic Monitoring

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — This database is used to hold tracking data for green sturgeon tagged in Central California. The data collection began in late 2002 and is ongoing.

  20. Green Turtle Critical Habitat

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — These data represent the critical habitat for green turtle as designated by Federal Register Vol. 63, No. 46701, September 2, 1998, Rules and Regulations.

  1. Green Turtle Trophic Ecology

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — SWFSC is currently conducting a study of green sea turtle (Chelonia mydas) trophic ecology in the eastern Pacific. Tissue samples and stable carbon and stable...

  2. Decon Green (trademark)

    National Research Council Canada - National Science Library

    Wagner, George W; Procell, Lawrence R; Henderson, Vikki D; Sorrick, David C; Hess, Zoe A; Gehring, David G; Brickhouse, Mark D

    2004-01-01

    ...; it affords the broad-spectrum decontamination of chemical and biological warfare agents. Composed entirely of ingredients commonly found in cosmetics, detergents, laundry boosters, and vitamins, Decon Green (trademark...

  3. Superfund Green Remediation

    Science.gov (United States)

    Green remediation is the practice of considering all environmental effects of site cleanup and incorporating options – like the use of renewable energy resources – to maximize the environmental benefits of cleanups.

  4. ADVANTAGES OF GREEN TECHNOLOGY

    OpenAIRE

    Ghanshyam Das Soni

    2017-01-01

    Technology is application of knowledge to practical requirements. Green technologies encompass various aspects of technology which help us reduce the human impact on the environment and create ways of sustainable development. Social equitability, economic feasibility and sustainability are the key parameters for green technologies. Today the environment is racing towards the tipping point at which we would have done permanent irreversible damage to the planet earth. Our current actions are pu...

  5. What is a green building?

    NARCIS (Netherlands)

    Vreenegoor, R.C.P.; Krikke, T.; Mierlo, van B.P.; Pluijm, van der W.M.P.; Poortvliet, R.; Hensen, J.L.M.; Loomans, M.G.L.C.

    2009-01-01

    What is a green building? A large amount of definitions and green rating tools prove that an exact definition is still a point of discussion. To research the differences between green rating tools, four different buildings are assessed with: EPN, BREEAM, LEED, GreenCalc+ and EcoQuantum. These tools

  6. Effect of EDTA on Pb(II) Uptake and Translocation by Tumbleweed (Salsola Kali): Agar and Hydroponics Studies

    Energy Technology Data Exchange (ETDEWEB)

    de la Rosa, Guadalupe; Gardea-Torresdey, Jorge L.; Peralta-Videa, Jose R.; Aldrich, Mary

    2004-03-31

    Environmental accumulation of Pb represents a worldwide health hazard. While conventional cleanup techniques are generally expensive and soil disturbing, phytoremediation represents an inexpensive friendly option for the removal of contaminants from soil and water. In this research, tumbleweed (Salsola kali) plants exposed for 15 days to Pb(NO3)2 at 80 and 125 ppm in hydroponics and agar media, demonstrated a high capacity to uptake lead. The results showed that the plants cultivated in agar accumulated 25563, 5534 and 2185 mg Pb kg-1 DW in roots, stems and leaves, respectively. Moreover, Pb concentrations found in hydroponically grown tumbleweed plants tissues were 30744, 1511 and 1421 mg kg-1 DW in roots, stems and leaves, respectively. It was observed that EDTA enhanced Pb translocation. No Pb phytotoxic effects were observed during the experimental time period. Cellular structural features were also observed using TEM.

  7. Variation in Microbial Identification System Accuracy for Yeast Identification Depending on Commercial Source of Sabouraud Dextrose Agar

    OpenAIRE

    Kellogg, James A.; Bankert, David A.; Chaturvedi, Vishnu

    1999-01-01

    The accuracy of the Microbial Identification System (MIS; MIDI, Inc.) for identification of yeasts to the species level was compared by using 438 isolates grown on prepoured BBL Sabouraud dextrose agar (SDA) and prepoured Remel SDA. Correct identification was observed for 326 (74%) of the yeasts cultured on BBL SDA versus only 214 (49%) of yeasts grown on Remel SDA (P < 0.001). The commercial source of the SDA used in the MIS procedure significantly influences the system’s accuracy.

  8. Variation in Microbial Identification System accuracy for yeast identification depending on commercial source of Sabouraud dextrose agar.

    Science.gov (United States)

    Kellogg, J A; Bankert, D A; Chaturvedi, V

    1999-06-01

    The accuracy of the Microbial Identification System (MIS; MIDI, Inc. ) for identification of yeasts to the species level was compared by using 438 isolates grown on prepoured BBL Sabouraud dextrose agar (SDA) and prepoured Remel SDA. Correct identification was observed for 326 (74%) of the yeasts cultured on BBL SDA versus only 214 (49%) of yeasts grown on Remel SDA (P < 0.001). The commercial source of the SDA used in the MIS procedure significantly influences the system's accuracy.

  9. Performance of Chromogenic Candida agar and CHROMagar Candida in recovery and presumptive identification of monofungal and polyfungal vaginal isolates.

    Science.gov (United States)

    Ozcan, Kadri; Ilkit, Macit; Ates, Aylin; Turac-Bicer, Aygul; Demirhindi, Hakan

    2010-02-01

    Chromogenic Candida agar (OCCA) is a novel medium facilitating isolation and identification of Candida albicans, C. tropicalis, and C. krusei, as well as indicating polyfungal population in clinical samples. We compare the performance of OCCA, to CHROMagar Candida (CAC) and Sabouraud chloramphenicol agar (SCA). Vaginal swab samples from 392 women were simultaneously inoculated onto three study media. A total of 161 (41.1%) were found to be positive for fungi of which 140 (87%) were monofungal, and 21 (13%) polyfungal. One-hundred and fifty-seven samples (97.5%) were positive on CAC, 156 (96.9%) on OCCA, 148 (91.9%) on SCA and 144 (89.4%) samples were positive on all three media. The yeasts were identified by conventional methods including germ tube test, microscopic morphology on cornmeal-Tween 80 agar, and the commercial API 20C AUX. The 182 isolates were C. albicans (n = 104), C. glabrata (n = 51), C. krusei (n = 7), C. tropicalis (n = 5), C. famata (n = 3), C. kefyr (n = 3), C. zeylanoides (n = 3), C. colliculosa (n = 2), and other species of Candida (n = 4). Among the 21 polyfungal populations, 20 (95.2%) were detected in OCCA, 14 (66.7%) in CAC, and 13 (61.9%) in CAC and OCCA (P or=92.9% at 72 h. OCCA is more efficient and reliable for rapidly identifying C. albicans and polyfungal populations than CAC. However, CAC is more efficient for identifying C. krusei and C. tropicalis. A chromogenic agar with a higher isolation rate of yeasts and better detection of polyfungal populations than SCA, is suggested as a medium of first choice when available.

  10. Comparison of antibacterial activities of root-end filling materials by an agar diffusion assay and Alamar blue assay

    Directory of Open Access Journals (Sweden)

    Tsui-Hsien Huang

    2012-12-01

    Conclusion: We concluded that both the agar diffusion test and Alamar blue assay gave comparable findings of assessing the antimicrobial activity present in root-end filling materials. No antimicrobial activity was detected for mineral trioxide aggregate, calcium silicate cement, or amalgam after coming into contact with S. mutans, S. sanguinis and E. coli. IRM showed high antimicrobial activity against both S. sanguinis and E. coli.

  11. Mechanical touch responses of Arabidopsis TCH1-3 mutant roots on inclined hard-agar surface

    Science.gov (United States)

    Zha, Guodong; Wang, Bochu; Liu, Junyu; Yan, Jie; Zhu, Liqing; Yang, Xingyan

    2016-01-01

    The gravity-induced mechanical touch stimulus can affect plant root architecture. Mechanical touch responses of plant roots are an important aspect of plant root growth and development. Previous studies have reported that Arabidopsis TCH1-3 genes are involved in mechano-related events, how-ever, the physiological functions of TCH1-3 genes in Arabidopsis root mechanoresponses remain unclear. In the present study, we applied an inclined hard agar plate method to produce mechanical touch stimulus, and provided evidence that altered mechanical environment could influence root growth. Furthermore, tch1-3 Arabidopsis mutants were investigated on inclined agar surfaces to explore the functions of TCH1-3 genes on Arabidopsis root mechanoresponses. The results showed that two tch2 mutants, cml24-2 and cml24-4, exhibited significantly reduced root length, biased skewing, and decreased density of lateral root. In addition, primary root length and density of lateral root of tch3 (cml12-2) was significantly decreased on inclined agar surfaces. This study indicates that the tch2 and tch3 mutants are hypersensitive to mechanical touch stimulus, and TCH2 (CML24-2 and CML24-4) and TCH3 (CML12-2) genes may participate in the mechanical touch response of Arabidopsis roots.

  12. Irradiation of silver and agar/silver nanoparticles with argon, oxygen glow discharge plasma, and mercury lamp.

    Science.gov (United States)

    Ahmad, Mahmoud M; Abdel-Wahab, Essam A; El-Maaref, A A; Rawway, Mohammed; Shaaban, Essam R

    2014-01-01

    The irradiation effect of argon, oxygen glow discharge plasma, and mercury lamp on silver and agar/silver nanoparticle samples is studied. The irradiation time dependence of the synthesized silver and agar/silver nanoparticle absorption spectra and their antibacterial effect are studied and compared. In the agar/silver nanoparticle sample, as the irradiation time of argon glow discharge plasma or mercury lamp increases, the peak intensity and the full width at half maximum, FWHM, of the surface plasmon resonance absorption band is increased, however a decrease of the peak intensity with oxygen glow plasma has been observed. In the silver nanoparticle sample, as the irradiation time of argon, oxygen glow discharge plasma or mercury lamp increases, the peak intensity of the surface plasmon resonance absorption band is increased, however, there is no significant change in the FWHM of the surface plasmon resonance absorption band. The SEM results for both samples showed nanoparticle formation with mean size about 50 nm and 40 nm respectively. Throughout the irradiation time with the argon, oxygen glow discharge plasma or mercury lamp, the antibacterial activity of several kinds of Gram-positive and Gram-negative bacteria has been examined.

  13. Broth and agar hop-gradient plates used to evaluate the beer-spoilage potential of Lactobacillus and Pediococcus isolates.

    Science.gov (United States)

    Haakensen, M; Schubert, A; Ziola, B

    2009-03-15

    Identification of the beer-spoilage Lactobacillus and Pediococcus bacteria has largely taken two approaches; identification of spoilage-associated genes or identification of specific species of bacteria regardless of ability to grow in beer. The problem with these two approaches is that they are either overly inclusive (i.e., detect all bacteria of a given species regardless of spoilage potential) or overly selective (i.e., rely upon individual, putative spoilage-associated genes). Our goal was to design a method to assess the ability of Lactobacillus and Pediococcus to spoil beer that is independent of speciation or genetic background. In searching for a method by which to differentiate between beer-spoilage bacteria and bacteria that cannot grow in beer, we explored the ability of lactobacilli and pediococci isolates to grow in the presence of varying concentrations of hop-compounds and ethanol in broth medium versus on agar medium. The best method for differentiating between bacteria that can grow in beer and bacteria that do not pose a threat as beer-spoilage organisms was found to be a hop-gradient agar plate containing ethanol. This hop-gradient agar plate technique provides a rapid and simple solution to the dilemma of assessing the ability of Lactobacillus and Pediococcus isolates to grow in beer, and provides new insights into the different strategies used by these bacteria to survive under the stringent conditions of beer.

  14. The Influence of Proactive Green Innovation and Reactive Green Innovation on Green Product Development Performance: The Mediation Role of Green Creativity

    Directory of Open Access Journals (Sweden)

    Yu-Shan Chen

    2016-09-01

    Full Text Available This study fills the research gap in the exploration of the relationships between both proactive and reactive green innovations and green product development performance, and examines the mediating effect of green creativity. Structural equation modeling (SEM is utilized to test the hypotheses. From the sample of 146 valid respondents, the results show that proactive green innovation positively affects green creativity and green product development performance, and green creativity positively affects green product development performance. In addition, our findings also indicate that the relationship between proactive green innovation and green product development performance is partially mediated by green creativity. Accordingly, green creativity plays a critical role for companies to achieve a great green product development performance. However, reactive green innovation does not significantly influence green creativity and green product development performance. Companies should develop proactive green innovation rather than reactive green innovation in order to enhance their green creativity and increase their product development performance.

  15. The Influence of Environmental Friendliness on Green Trust: The Mediation Effects of Green Satisfaction and Green Perceived Quality

    Directory of Open Access Journals (Sweden)

    Yu-Shan Chen

    2015-07-01

    Full Text Available As global green trends became more prevalent, green marketing also developed into an important issue. Although prior literature explored the main factors affecting green trust, it was inconclusive as to how environmental friendliness could affect the green trust in green marketing. This study aims to focus on the positive influence of environmental friendliness on green trust, and explore the mediation effects of green satisfaction and green perceived quality. This study undertakes an empirical study by means of questionnaire survey. The respondents are consumers who have experience purchasing green products. This study applies structural equation modeling (SEM to test the hypotheses. The findings of this study indicate that (1 environmental friendliness has a significant positive impact on green satisfaction, green perceived quality, and green trust; (2 both green satisfaction and green perceived quality positively affect green trust; and (3 green satisfaction and green perceived quality partially mediate the positive relationship between environmental friendliness and green trust.

  16. Research on Candida dubliniensis in a Brazilian yeast collection obtained from cardiac transplant, tuberculosis, and HIV-positive patients, and evaluation of phenotypic tests using agar screening methods.

    Science.gov (United States)

    Ribeiro, Patrícia Monteiro; Querido, Silvia Maria Rodrigues; Back-Brito, Graziela Nueremberg; Mota, Adolfo José; Koga-Ito, Cristiane Yumi; Jorge, Antonio Olavo Cardoso

    2011-09-01

    The aim of this study was to research Candida dubliniensis among isolates present in a Brazilian yeast collection and to evaluate the main phenotypic methods for discrimination between C. albicans and C. dubliniensis from oral cavity. A total of 200 isolates, presumptively identified as C. albicans or C. dubliniensis obtained from heart transplant patients under immunosuppressive therapy, tuberculosis patients under antibiotic therapy, HIV-positive patients under antiretroviral therapy, and healthy subjects, were analyzed using the following phenotypic tests: formation and structural arrangement of chlamydospores on corn meal agar, casein agar, tobacco agar, and sunflower seed agar; growth at 45 °C; and germ tube formation. All strains were analyzed by polymerase chain reaction (PCR). In a preliminary screen for C. dubliniensis, 48 of the 200 isolates on corn meal agar, 30 of the 200 on casein agar, 16 of the 200 on tobacco agar, and 15 of the 200 on sunflower seed agar produced chlamydoconidia; 27 of the 200 isolates showed no or poor growth at 45 °C. All isolates were positive for germ tube formation. These isolates were considered suggestive of C. dubliniensis. All of them were subjected to PCR analysis using C. dubliniensis-specific primers. C. dubliniensis isolates were not found. C. dubliniensis isolates were not recovered in this study done with immunocompromised patients. Sunflower seed agar was the medium with the smallest number of isolates of C. albicans suggestive of C. dubliniensis. None of the phenotypic methods was 100% effective for discrimination between C. albicans and C. dubliniensis. Copyright © 2011 Elsevier Inc. All rights reserved.

  17. Green technology meets ecotoxicology

    Directory of Open Access Journals (Sweden)

    Kristina Radošević

    2016-01-01

    Full Text Available By applying concept and principles of green chemistry into different technological processes, green technologies are developed. The environmental and economic benefits of “green” approach is achieved through several directions, such as the use of renewable raw materials, creation of economic efficiency, the use of alternative reaction conditions, as well as the application of non-conventional solvents. From the point view of green chemistry, alternative solvents, in order to be a “green“ substitution to hazardous organic solvents, should be: non-volatile, non-flammable, stabile, synthesized by an environmentally friendly procedure, nontoxic and biodegradable. The toxic impact of all newly synthesized chemicals, such as alternative solvents, could be determined by methods and techniques of ecotoxicology. Ecotoxicology, an interdisciplinary scientific field, can serve as a way of monitoring the greenness of the processes. In vivo and in vitro experiments are used to study the effects of chemicals on different levels of organizations, from molecules to communities and ecosystem. The usage of in vitro methods is encouraged by a scientific community and regulatory agencies as an alternative to in vivo studies in order to reduce the number of laboratory animals used in the toxicological studies. Therefore, in this paper we gave a brief overview on the usage of animal cell cultures within the field of green chemistry and technology.

  18. Labelling it green

    Energy Technology Data Exchange (ETDEWEB)

    Evans, S.; Brocklehurst, F. [ETSU, Didcot (United Kingdom)

    1998-12-31

    The first two rounds of contracts awarded through the NFFO will expire in December 1998. These generators will then be looking for new contracts to supply renewable electricity. Since these projects were initiated the renewable energy market has grown steadily, but it is still mainly restricted to the protected market within NFFO. Consumer interest has grown steadily too, fuelled by the emergence of green energy supply companies. Market research has indicated that consumers would like the choice of green electricity, what remains unclear is if they would exercise this choice and to what extent they might pay a premium price for the privilege. From September 1998 the phased introduction of domestic sector franchise de-regulation commences. In principle, consumers can purchase their electricity from any supplier. This provides a golden opportunity for green generation. To make the most of this opportunity generators and suppliers will need to clearly explain to the public what their product is, how it is different and how everyone benefits from its use. A major marketing issue will be to provide assurance to the general public, that for example, they can indeed purchase energy from a windfarm in Wales, despite living in areas other than Wales. The DTI is assisting the expansion of the green market into the domestic sector via funding a project which plans to deliver an accreditation scheme in September 1998. This will provide a means of verifying the green claims of generators/supply companies. (Author)

  19. Production of trichothecenes and other secondary metabolites by Fusarium culmorum and Fusarium equiseti on common laboratory media and a soil organic matter agar: An ecological interpretation

    DEFF Research Database (Denmark)

    Hestbjerg, H.; Nielsen, Kristian Fog; Thrane, Ulf

    2002-01-01

    trichothecene production was detected for 94 of 102 F culmorum isolates, only 8 of 57 F equiseti isolates were positive. Profiles of secondary metabolites were compared by following growth on yeast extract sucrose agar (YES), potato sucrose agar (PSA), and an agar medium, prepared from soil organic matter (SOM......), which was included to simulate growth, conditions in soil. SOM supported the production of chrysogine by F culmorum. The two species utilized the media differently. F culmorum produced zearalenone (ZEA) on YES, whereas some F. equiseti isolates produced ZEA on PSA. Other F. equiseti isolates produced...

  20. Optimization of the agar-gel method for isolation of migrating Ascaris suum larvae from the liver and lungs of pigs

    DEFF Research Database (Denmark)

    Saeed, I.; Roepstorff, A.; Rasmussen, T.

    2001-01-01

    Experiments on use of an agar-gel method for recovery of migrating Ascaris suum larvae from the liver and lungs of pigs were conducted to obtain fast standardized methods. Subsamples of blended tissues of pig liver and lungs were mixed with agar to a final concentration of 1% agar and the larvae...... clean suspension which reduced the sample counting time. Blending the liver for 60 sec in a commercial blender showed significantly higher larvae recovery than blending for 30 sec. Addition of gentamycin to reduce bacterial growth during incubation, glucose to increase larval motility during migration...

  1. Enhanced solar light photodegradation of brilliant black bis-azo dye in aqueous solution by F, Sm3+ codoped TiO2

    Science.gov (United States)

    Mukonza, Sabastian S.; Nxumalo, Edward N.; Mamba, Bhekie B.; Mishra, Ajay K.

    2017-05-01

    This research focuses on improving the photocatalytic efficiency of TiO2 during the photo-mineralisation of brilliant black (BN) bis-azo dye pollutant in aqueous solution. This was achieved by improving the visible light activity of TiO2 photocatalyst semiconductor through co-doping of fluorine (F) and trivalent samarium ions (Sm3+) into a TiO2 matrix using a modified sol-gel synthesis method. Structural, morphological, and textural properties were evaluated using ultra-violet /visible spectroscopy (UV-visible), Raman spectroscopy, scanning electron microscopy coupled to energy dispersive X-ray spectroscopy (SEM/EDX) and X-ray diffraction spectroscopy (XRD). Photocatalytic and degradation efficiencies were assessed by decolourisation of BN dye in aqueous solution. Complete degradation of BN was attained after an irradiation time of 3 h using F, Sm3+-TiO2 (0.6% Sm3+) compared to 73.4% achieved using pristine TiO2. Pseudo first order kinetics rate constants (Ka) were 2.73×10-2 and 6.6×10-3 min-1 for Sm3+-TiO2 (0.6%Sm3+) and pristine TiO2, respectively, which translates to a remarkably high enhancement factor of 4. The results obtained established that doping of TiO2 by F and Sm3+ enhances the photocatalytic performance of TiO2 during solar light radiation which enables the utilisation of freely available and clean solar energy.

  2. Synthesis and characterization of Acacia gum-Fe0Np-silica nanocomposite: an efficient Fenton-like catalyst for the degradation of Remazol Brilliant Violet dye

    Science.gov (United States)

    Singh, Vandana; Singh, Jadveer; Srivastava, Preeti

    2018-04-01

    Acacia gum-Fe0Np-silica nanocomposite (GFS1) has been crafted through sol-gel technique using a two-step process that involved the reduction of iron salt to zerovalent iron nanoparticles (Fe0Nps) followed by their impregnation within Acacia gum-silica matrix. GFS1 was characterized using Fourier transform infrared spectroscopy (FTIR), high-resolution transmission electron microscopy (HR-TEM), energy dispersive X-ray analysis (EDX), field emission scanning electron microscopy (FE-SEM), vibrating sample magnetometry (VSM), and X-ray photoelectron spectroscopy (XPS) techniques. GFS1 is decorated with Fe0Nps of 5 nm average size. The VSM study revealed that GFS1 has ferromagnetic nature. GFS1 was used as a heterogeneous Fenton-like catalyst for the degradation of azo dyes using Remazol Brilliant Violet (RBV) dye as a model dye. In first 5 min of operation, > 86% dye degradation was achieved and 94% dye (from 100 mg L-1 dye solution) was successfully degraded in 50 min. The dye degradation followed pseudo-first-order kinetics. The GFS1 performed efficiently well over the wide range of dye concentrations (25-200 mg L-1). The catalyst was reused for eight repeated cycles where 12.5% dye degradation was possible even in the eighth cycle. The catalyst behaved fairly well for the degradation of Metanil Yellow (MY) and Orange G (OG) dyes also. Under the optimum conditions of RBV dye degradation, Metanil Yellow (MY) and Orange G (OG) dyes were degraded to the extent of 97 and 26.3%, respectively.

  3. Trading green electricity

    International Nuclear Information System (INIS)

    Davies, M.

    1997-01-01

    A study has been carried out into the feasibility of developing an electricity trading mechanism which would allow consumers to purchase electricity which has been derived from renewable energy resources. This study was part funded by the European Commission (ALTENER), the Department of Trade and Industry and a number of private sector companies. The trading mechanism is known as the Green Pool. As a result of the findings of this study discussions are being held with potential generators and suppliers to establish a Green Pool plc. The aim is to encourage the development of new renewable energy projects outside the NFFO and SRO schemes. The Green Pool plc will be owned by the generators and its main objective will be to market the electricity produced by its members. (Author)

  4. Certified: green power

    International Nuclear Information System (INIS)

    Rhodes, S.; Brown, L.

    1999-01-01

    Deregulation of the energy industry in the USA may be a force favouring the environment but for the consumer it is something of a nightmare since there are so many options with respect to both price, service and environmental awareness. However, there is now a marked tendency for companies wishing to be seen as 'green' to favour environmentally aware suppliers. Indeed, some suppliers holding formal qualifications in 'greenness' believe they are justified in charging a premium for their energy. The question is asked 'what is green?' and the authors discuss the answers at some length: the hydro industry fares well in such a discussion. The authors (from Scientific Certification Systems) believe that certification provides a rational explanation of prices and why charging a premium may be justifiable.(UK)

  5. GREEN BANKING IN ROMANIA

    Directory of Open Access Journals (Sweden)

    Dumitrascu Mihaela

    2014-07-01

    Full Text Available The paper investigates the green banking in Romania, a new approach of conducting the banking business through considering the corporate social responsibility and environmental aspects. Nowadays, it is difficult to face the globalization and competition in order to asssure the implementation of the green banking practices. The aim of the present study is to identify corporations that have sustainability concerns. To achieve this objective, we set some hypothesis and after this we showed that the corporations are more likely to be included in the list of top banks in the world. Our study is relevant for future research in this area, because of the importance of such aspects in corporations nowadays.The conclusions of our study is that green banking practices in Romania is in an incipient stage

  6. Green Logistics Management

    Science.gov (United States)

    Chang, Yoon S.; Oh, Chang H.

    Nowadays, environmental management becomes a critical business consideration for companies to survive from many regulations and tough business requirements. Most of world-leading companies are now aware that environment friendly technology and management are critical to the sustainable growth of the company. The environment market has seen continuous growth marking 532B in 2000, and 590B in 2004. This growth rate is expected to grow to 700B in 2010. It is not hard to see the environment-friendly efforts in almost all aspects of business operations. Such trends can be easily found in logistics area. Green logistics aims to make environmental friendly decisions throughout a product lifecycle. Therefore for the success of green logistics, it is critical to have real time tracking capability on the product throughout the product lifecycle and smart solution service architecture. In this chapter, we introduce an RFID based green logistics solution and service.

  7. Why Green Taxation

    DEFF Research Database (Denmark)

    Hjøllund, Lene; Svendsen, Gert Tinggaard

    2001-01-01

    According to economists solving environmental problems is simple. Politicians should simply impose a uniform tax on harmful emissions. However, the actual design of such green taxation shows that politicians do not follow their advice. CO2 taxation in OECD, for example, is highly differentiated...... and much in favour of industry. In fact, CO2 tax rates for industry are, on average, six times lower than those for households. We argue that the reason for this tax differentiation is that industry, in contrast to households, has a strong capability to lobby. Therefore, green taxation is effectively...... blocked and the desired environmental results are not being achieved. Why then is green taxation persistently applied in relation to industry? We argue that strong fiscal incentives drive this policy choice at the expense of environmental concerns because it allows environmental bureaucracies to budget-maximize....

  8. Ligninolytic enzymes production and Remazol brilliant blue R decolorization by tropical brazilian basidiomycetes fungi Produção de enzimas ligninolíticas e descoloração do corante azul brilhante de Remazol R por fungos basidiomicetos tropicais brasileiros

    Directory of Open Access Journals (Sweden)

    Kátia M. G. Machado

    2005-09-01

    Full Text Available Remazol Brilliant Blue R (RBBR dye was used as substrate to evaluate ligninolytic activity in 125 basidiomycetous fungi isolated from tropical ecosystems. The extracellular RBBR decolorizing activity produced when selected fungi were grown in solid media and in soil contaminated with organochlorines was also evaluated. A total of 106 fungi decolorized the RBBR during the growth in malt extract agar (MEA, 2%; 96 fungi showed a mycelia growth and decolorization activity stronger than the P. chrysosporium used as reference. Extracellular extracts of 35 selected fungi grown on solid medium with sugar cane bagasse (BGS were evaluated for RBBR decolorization and peroxidase activity. All fungi showed peroxidase activities, but 5 of those were unable to decolorize the RBBR. Different patterns of ligninolytic enzymes were detected in 12 fungi extracts. Mn-dependent peroxidase (MnP was produced by Peniophora cinerea, Psilocybe castanella, three strains of Trametes villosa, T. versicolor, Melanoporia nigra and Trichaptum byssogenum. All 12 fungi had laccase activity. Trogia buccinalis showed the highest RBBR decolorization and did not produce MnP activity. RBBR decolorization without MnP production was also observed for three strains of Lentinum tested. Higher levels of peroxidase and laccase cannot be related to high RBBR decolorization. RBBR decolorization by extracellular extract was also detected during the growth of P. castanella, L. crinitus, P. cinerea and two strains of T. Villosa in pentachlorophenol- and hexachlorobenzene-contaminated soils. These fungi showed higher RBBR decolorization when grown in the presence of organochlorine compounds than when in non contaminated soil.O corante azul brilhante Remazol R (RBBR foi usado como substrato para avaliar 125 fungos basidiomicetos isolados de ecossistemas tropicais brasileiros quanto a atividade ligninolítica. A descoloração do RBBR por extratos obtidos do crescimento de fungos em meio sólido e

  9. Green Chemistry Pedagogy

    Science.gov (United States)

    Kolopajlo, Larry

    2017-02-01

    This chapter attempts to show how the practice of chemistry teaching and learning is enriched by the incorporation of green chemistry (GC) into lectures and labs. To support this viewpoint, evidence from a wide range of published papers serve as a cogent argument that GC attracts and engages both science and nonscience students, enhances chemistry content knowledge, and improves the image of the field, while preparing the world for a sustainable future. Published pedagogy associated with green and sustainable chemistry is critically reviewed and discussed.

  10. GREEN CORE HOUSE

    Directory of Open Access Journals (Sweden)

    NECULAI Oana

    2017-05-01

    Full Text Available The Green Core House is a construction concept with low environmental impact, having as main central element a greenhouse. The greenhouse has the innovative role to use the biomass energy provided by plants to save energy. Although it is the central piece, the greenhouse is not the most innovative part of the Green Core House, but the whole building ensemble because it integrates many other sustainable systems as "waste purification systems", "transparent photovoltaic panels" or "double skin façades".

  11. Green in software engineering

    CERN Document Server

    Calero Munoz, Coral

    2015-01-01

    This is the first book that presents a comprehensive overview of sustainability aspects in software engineering. Its format follows the structure of the SWEBOK and covers the key areas involved in the incorporation of green aspects in software engineering, encompassing topics from requirement elicitation to quality assurance and maintenance, while also considering professional practices and economic aspects. The book consists of thirteen chapters, which are structured in five parts. First the "Introduction" gives an overview of the primary general concepts related to Green IT, discussing wha

  12. Green Chemistry Metrics with Special Reference to Green Analytical Chemistry

    OpenAIRE

    Marek Tobiszewski; Mariusz Marć; Agnieszka Gałuszka; Jacek Namieśnik

    2015-01-01

    The concept of green chemistry is widely recognized in chemical laboratories. To properly measure an environmental impact of chemical processes, dedicated assessment tools are required. This paper summarizes the current state of knowledge in the field of development of green chemistry and green analytical chemistry metrics. The diverse methods used for evaluation of the greenness of organic synthesis, such as eco-footprint, E-Factor, EATOS, and Eco-Scale are described. Both the well-establis...

  13. Sustainable house construction and green financing. Explanation for 'green mortgages'

    International Nuclear Information System (INIS)

    1997-05-01

    The Dutch government finances the sustainable construction of new houses by means of so-called 'green loans'. Extra costs for the construction of a sustainable house are compensated by a lower interest rate for a green loan. In this brochure it is explained when green financing of house construction is possible and how to apply for such loans

  14. Plants as green phones

    NARCIS (Netherlands)

    Soler, R.; Harvey, J.A.; Bezemer, T.M.; Stuefer, J.F.

    2008-01-01

    Plants can act as vertical communication channels or `green phones¿ linking soil-dwelling insects and insects in the aboveground ecosystem. When root-feeding insects attack a plant, the direct defense system of the shoot is activated, leading to an accumulation of phytotoxins in the leaves. The

  15. Putting on the green

    Science.gov (United States)

    The green chemistry movement is scrutinized for marks of tangible success in this short perspective. Beginning with the easily identified harm of the Union Carbide Bhopal, India disaster and the concerns of Love Canal site in Niagara Falls, NY the public can begin to more easily ...

  16. Green, Brown, and probability

    CERN Document Server

    Chung, Kai Lai

    1995-01-01

    This volume shows modern probabilistic methods in action: Brownian Motion Process as applied to the electrical phenomena investigated by Green et al., beginning with the Newton-Coulomb potential and ending with solutions by first and last exits of Brownian paths from conductors.

  17. Why Green Taxation

    DEFF Research Database (Denmark)

    Hjøllund, Lene; Svendsen, Gert Tinggaard

    2001-01-01

    According to economists solving environmental problems is simple. Politicians should simply impose a uniform tax on harmful emissions. However, the actual design of such green taxation shows that politicians do not follow their advice. CO2 taxation in OECD, for example, is highly differentiated...

  18. News: Green Chemistry & Technology

    Science.gov (United States)

    A series of 21 articles focused on different features of green chemistry in a recent issue of Chemical Reviews. Topics extended over a wide range to include the design of sustainable synthetic processes to biocatalysis. A selection of perspectives follows as part of this colu

  19. The Green Obligation

    Science.gov (United States)

    Adams, Cameron

    2007-01-01

    As the green movement grows, studies provide conclusive evidence about the benefits of environmentally conscious practices indoors and outdoors. Schools are no exception. Many of these studies demonstrate how poor indoor air quality (IAQ) in schools adversely affects many of the nation's 55 million students with health problems such as asthma and…

  20. A green chemistry approach

    Indian Academy of Sciences (India)

    Administrator

    One-pot synthesis of quinaldine derivatives by using microwave irradiation without any solvent – A green chemistry approach. JAVAD SAFARI*, SAYED HOSSEIN BANITABA and SEPEHR SADEGH SAMIEI. Department of Chemistry, The Faculty of sciences, University of Kashan, Kashan,. P.O. Box 87317-51167, I.R. Iran.

  1. Between green and grey

    NARCIS (Netherlands)

    Jeanet Kullberg

    2016-01-01

    Original title: Tussen groen en grijs Taking cuttings is cool. Growing vegetables is all the rage. Green oases can now be found scattered throughout Dutch towns and cities: community gardens and roof gardens where residents can go to relax and enjoy themselves, improve the appearance of their

  2. Developing Green Line Products

    DEFF Research Database (Denmark)

    Muñoz-Marin, Ana Maria; Lassen, Astrid Heidemann; Poulsen, Søren Bolvig

    2011-01-01

    This publication is based on the Master thesis “User-driven ecoinnovation process: Towards the implementation of the Green product line at JELD-WEN” written by Ana Maria Muñoz-Marin as her Graduation Project for the MSc. Global Innovation Management degree. The company-based experiment was carried...

  3. Being 'green' helps profitability?

    International Nuclear Information System (INIS)

    Austin, D.

    1999-01-01

    Pollution reduction beyond regulatory compliance is gaining momentum among firms, but managers ask if being 'green' helps profitability. Evidence suggests it doesn't hurt, but when we see environmentally attractive firms with sound financial performance, it cannot yet say which is cause and which is effect [it

  4. Lean Green Machines

    Science.gov (United States)

    Villano, Matt

    2011-01-01

    Colleges and universities have been among the leaders nationwide in adopting green initiatives, partly due to their demographics, but also because they are facing their own budget pressures. Virtualization has become the poster child of many schools' efforts, because it provides significant bang for the buck. However, more and more higher…

  5. Greening China Naturally

    Science.gov (United States)

    Shixiong Cao; Ge Sun; Zhiqiang Zhang; Liding Che; Qi Feng; et. al.

    2011-01-01

    China leads the world in afforestation, and is one of the few countries whose forested area is increasing. However, this massive “greening” effort has been less effective than expected; afforestation has sometimes produced unintended environmental, ecological, and socioeconomic consequences, and has failed to achieve the desired ecological benefits. Where afforestation...

  6. Nanoreactors for green catalysis

    NARCIS (Netherlands)

    de Martino, M.T.; Abdelmohsen, L.K.E.A.; Rutjes, Floris P.J.T.; van Hest, J.C.M.; Hessel, V.

    2018-01-01

    Sustainable and environmentally benign production are key drivers for developments in the chemical industrial sector, as protecting our planet has become a significant element that should be considered for every industrial breakthrough or technological advancement. As a result, the concept of green

  7. Green Maritime Logistics

    DEFF Research Database (Denmark)

    Psaraftis, Harilaos N.

    2016-01-01

    By green maritime logistics we mean achieving an acceptable environmental performance of the maritime transport logistical supply chain while at the same time respecting traditional economic criteria. In this paper the environmental focus is on maritime emissions. Achieving such goal may involve ...

  8. Green Software Products

    NARCIS (Netherlands)

    Jagroep, E.A.

    2017-01-01

    The rising energy consumption of the ICT industry has triggered a quest for more green, energy efficient ICT solutions. The role of software as the true consumer of power and its potential contribution to reach sustainability goals has increasingly been acknowledged. At the same time, it is shown to

  9. Frobenius Green functors

    OpenAIRE

    Baker, Andrew

    2012-01-01

    These notes provide an informal introduction to a type of Mackey functor that arises naturally in algebraic topology in connection with Morava $K$-theory of classifying spaces of finite groups. The main aim is to identify key algebraic aspects of the Green functor structure obtained by applying a Morava $K$-theory to such classifying spaces.

  10. Global Green Growth Institute

    DEFF Research Database (Denmark)

    Müller, Anders Riel

    2017-01-01

    Har man fulgt historien om Venstres gruppeformand Lars Løkkes rejser på 1. klasse i forbindelse med formandsposten for Global Green Growth Institute (GGGI) er der sikkert nogle der undrer sig over, hvad GGGI er for en størrelse. Medierne præsenterer GGGI som en international klimaorganisation, der...

  11. Green Building Tools for Tribes

    Science.gov (United States)

    Tribal green building tools and funding information to support tribal building code adoption, healthy building, siting, energy efficiency, renewable energy, water conservation, green building materials, recycling and adaptation and resilience.

  12. Green Manufacturing Fundamentals and Applications

    CERN Document Server

    2013-01-01

    Green Manufacturing: Fundamentals and Applications introduces the basic definitions and issues surrounding green manufacturing at the process, machine and system (including supply chain) levels. It also shows, by way of several examples from different industry sectors, the potential for substantial improvement and the paths to achieve the improvement. Additionally, this book discusses regulatory and government motivations for green manufacturing and outlines the path for making manufacturing more green as well as making production more sustainable. This book also: • Discusses new engineering approaches for manufacturing and provides a path from traditional manufacturing to green manufacturing • Addresses regulatory and economic issues surrounding green manufacturing • Details new supply chains that need to be in place before going green • Includes state-of-the-art case studies in the areas of automotive, semiconductor and medical areas as well as in the supply chain and packaging areas Green Manufactu...

  13. Benefits of Green Power Partnership

    Science.gov (United States)

    The U.S. EPA's Green Power Partnership is a voluntary partnership program designed to reduce the environmental impact of electricity generation by promoting renewable energy. Learn about the benefits of becoming a Green Power Partner.

  14. Enumerating actinomycetes in compost bioaerosols at source—Use of soil compost agar to address plate 'masking'

    Science.gov (United States)

    Taha, M. P. M.; Drew, G. H.; Tamer Vestlund, A.; Aldred, D.; Longhurst, P. J.; Pollard, S. J. T.

    Actinomycetes are the dominant bacteria isolated from bioaerosols sampled at composting facilities. Here, a novel method for the isolation of actinomycetes is reported, overcoming masking of conventional agar plates, as well as reducing analysis time and costs. Repeatable and reliable actinomycetes growth was best achieved using a soil compost media at an incubation temperature of 44 °C and 7 days' incubation. The results are of particular value to waste management operators and their advisors undertaking regulatory risk assessments that support environmental approvals for compost facilities.

  15. High internal phase agar hydrogel dispersions in cocoa butter and chocolate as a route towards reducing fat content.

    Science.gov (United States)

    Skelhon, Thomas S; Olsson, Patrik K A; Morgan, Adam R; Bon, Stefan A F

    2013-09-01

    Reducing the fat content of chocolate formulations is a major challenge for the confectionery industry. We report the suspension of aqueous microgel agar particles of up to 80% v/v within sunflower oil, cocoa butter, and ultimately chocolate. The optimised emulsification process involves a shear-cooling step. We demonstrate the versatility of our method when applied to white, milk, and dark chocolate formulations, whilst preserving the desired polymorph V of the cocoa butter matrix. In addition, we show that this technology can be used as a strategy to disperse alcoholic beverages into chocolate confectionery.

  16. A Direct Quantitative Agar-Plate Based Assay for Analysis of Pseudomonas protegens PF-5 Degradation of Polyurethane Films (Postprint)

    Science.gov (United States)

    2014-10-02

    was dissolved in methanol ; Irogran (1 g) was dissolved in 25 mL THF; and AS-P108 was prepared by adding 0.3 g of catalyst to 10 g of resin and then... Selected results are in Supple- mental Information. 3. Results 3.1. General growth characteristics of Pf-5 on M9/citrate agar plates Dilutions of P...minimal. An IR map with the color scale corresponding to the in- tensity of the 1735 cm1 carbonyl absorbance from the urethane and ester components is

  17. The green highway forum

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    2006-07-01

    In late 2004, as part of American Coal Ash Association's (ACAA) strategic planning process, a plan was approved by its Board of Directors implementing a 'green highways' concept which emphasized use of coal combustion products (CCPs) in highways in a variety of ways including being used alone, in combination with other forms of CCPs, and combined with non ash materials. The incentives behind the developed concept were the derived advantages from beneficial technical economic and environmental impacts. Although the primary use of fly ash is concrete, other forms of CCPs could be considered for more non-traditional highway applications. For example, these might include soils stabilization, binders for in-place pavement recycling, use in flowable fills, aggregates, source materials for structural fills and embankments, components in manufactured soils, and for granular base courses beneath pavements. At this same time, unknown to ACCA, EPA Region 3 in Philadelphia was working with the Wetlands and Watershed Work Group, a non-profit organization involved in wetlands policy and management along with the Federal Highway Administration (FHWA) on their own Green Highways initiative. These groups were planning a conference, the 'Green Highway Forum'. This was held in College Park, Maryland at the University of Maryland, Nov 8-10 2005. At the conference a draft 'roadmap' was presented as a guide to executive level participants bringing the diverse viewpoints of many agencies and interest groups together. Ten guiding principals were considered. The 'Green Highways' is a new effort to recognize the 'greenness' of many projects already completed and those to be initiated. 2 photos.

  18. Green function on product networks

    OpenAIRE

    Arauz Lombardía, Cristina; Carmona Mejías, Ángeles; Encinas Bachiller, Andrés Marcos

    2012-01-01

    Our objective is to determine the Green function of product networks in terms of the Green function of one of the factor networks and the eigenvalues and eigenfunctions of the Schr odinger operator of the other factor network, which we consider that are known. Moreover, we use these results to obtain the Green function of spider networks in terms of Green functions over cicles and paths. Peer Reviewed

  19. GREEN PACKAGING, GREEN PRODUCT, GREEN ADVERTISING, PERSEPSI, DAN MINAT BELI KONSUMEN

    Directory of Open Access Journals (Sweden)

    Imam Santoso

    2016-12-01

    Full Text Available Environmental problems become one of the strategic issues in achieving global competitiveness. One of the issues is products that are made from environmental friendly materials or known as green product. Furthermore, in green products marketing, the company also uses green packaging and green advertising concept. This study aimed to analyze the effect of green packaging, green products, and green advertising on consumer perception and purchasing intention. The study was conducted in Ketawanggede Village, Lowokwaru Sub-district, Malang City. The sampling method used nonprobability accidential sampling techniques. The numbers of respondents were 113 consumers in study site. Data were collected by interview using questionnaires. The method of analysis used Generalized Structured Component Analysis (GSCA. The analysis showed that the green packaging, green products, and green advertising had positive significant influence on consumer perceptions. Meanwhile, green product and consumer perception had positive significant influence on purchasing interest, but the green packaging and green advertising has not found sufficient evidence in influencing purchasing intention.

  20. It's Not Easy Building Green.

    Science.gov (United States)

    Higgins, Joseph

    2003-01-01

    Discusses green buildings, facilities designed, constructed, and operated in an environmentally friendly and resource-efficient way. Discusses reasons for campuses to "go green," the "shades of green" or variations in environmental-friendliness, certification through the Leadership in Energy and Environmental Design (LEED) rating system, financial…

  1. Green mortgages in the Netherlands

    International Nuclear Information System (INIS)

    Bosch, N.

    1997-01-01

    Since November 1996 sustainable building of houses is also part of the fiscal Regulation for Green Projects (i.e. the stimulation of environment-friendly investments). The extension of that financial regulation resulted in a new product: Green Mortgages. The conditions that have to be met to be qualified for a Green Mortgage are briefly outlined

  2. Green economy and related concepts

    NARCIS (Netherlands)

    Loiseau, Eleonore; Saikku, Laura; Antikainen, Riina; Droste, Nils; Hansjürgens, Bernd; Pitkänen, Kati; Leskinen, Pekka; Kuikman, Peter; Thomsen, Marianne

    2016-01-01

    For the last ten years, the notion of a green economy has become increasingly attractive to policy makers. However, green economy covers a lot of diverse concepts and its links with sustainability are not always clear. In this article, we focus on definitions of green economy and related concepts

  3. Guide to Purchasing Green Power

    Science.gov (United States)

    The Guide for Purchasing Green Power is a comprehensive guide for current and potential buyers of green power with information about green power purchasing. The Guide is created cooperatively between the EPA, the U.S. Department of Energy, the World Resou

  4. Investing in a green future

    Science.gov (United States)

    Clapp, Christa

    2018-01-01

    The growing green bond market reflects the financial sector's awakening to climate risk. New research examining the US municipal bond market suggests a positive green bond premium in recent years, driven by differences in credit quality. As climate-risk disclosure becomes more widespread, investors may show willingness to pay green premiums.

  5. Green Roofs for Stormwater Management

    Science.gov (United States)

    This project evaluated green roofs as a stormwater management tool. Results indicate that the green roofs are capable of removing 40% of the annual rainfall volume from a roof through retention and evapotranspiration. Rainfall not retained by green roofs is detained, effectively...

  6. Green Consumerism : an Eco-Friendly Behaviour Form Through The Green Product Consumption and Green Marketing

    OpenAIRE

    Handayani, Wiwik

    2017-01-01

    This research is referred to analyse the influence of consumer attitude of green product towards purchase intention. The consumer attitude of green product is a psychological tendencies that is expressed by evaluating a certain entity with some advantage or disadvantage considerations. The problem of this research is the low of cunsumer awareness to consume green product, because the lack to comprehend the importance of green product usage for health and eco-friendly. The purpose of this rese...

  7. Fluconazole-containing agar Sabouraud dextrose plates are not useful when screening for susceptibility in Candida albicans.

    Science.gov (United States)

    Bordallo-Cardona, M A; Marcos-Zambrano, L J; Gómez G de la Pedrosa, E; Escribano, P; Bouza, E; Guinea, J; Cantón, R

    2017-04-01

    Fluconazole is an alternative for candidemic patients who are not critically ill. Fluconazole is mainly fungistatic and does not completely inhibit visual Candida albicans growth. We studied the usefulness of fluconazole-containing Sabouraud dextrose agar plates for detecting susceptibility to fluconazole in C. albicans. Adjusted inocula of 19 isolates were transferred directly onto fluconazole-containing Sabouraud dextrose plates (concentrations ranging from 0.125 mg/L to 128 mg/L). The fluconazole MIC in fresh isolates and after growth on the fluconazole-containing plate at 128 mg/L was recorded following the EUCAST EDef 7.2 guidelines. Then isolates were classified according to their degree of trailing production, based on microdilution procedure. All isolates were able to grow on all fluconazole-containing plates, even those isolates susceptible to fluconazole. In fact, we selected isolates with different degrees of trailing based on microdilution procedures. 50% of isolates classified as heavy trailers, 35.71% as moderate trailers, and 14.28% as slight trailers. The use of fluconazole-containing Sabouraud dextrose agar plates was not a reliable method to detect fluconazole susceptibility in C. albicans isolates; growth of the isolates was a trailing effect rather than true resistance.

  8. In vitro fermentation and prebiotic potential of novel low molecular weight polysaccharides derived from agar and alginate seaweeds.

    Science.gov (United States)

    Ramnani, Priya; Chitarrari, Roberto; Tuohy, Kieran; Grant, John; Hotchkiss, Sarah; Philp, Kevin; Campbell, Ross; Gill, Chris; Rowland, Ian

    2012-02-01

    Fermentation properties and prebiotic potential of novel low molecular weight polysaccharides (LMWPs) derived from agar and alginate bearing seaweeds was investigated. Ten LMWPs were supplemented to pH, temperature controlled anaerobic batch cultures inoculated with human feces from three donors, in triplicate. Microbiota changes were monitored using Fluorescent in-situ hybridization and short chain fatty acids, the fermentation end products were analysed using gas chromatography. Of the ten LMWPs tested, Gelidium seaweed CC2253 of molecular weight 64.64 KDa showed a significant increase in bifidobacterial populations from log(10) 8.06 at 0 h to log(10) 8.55 at 24 h (p = 0.018). For total bacterial populations, alginate powder CC2238 produced a significant increase from log(10) 9.01 at 0 h to log(10) 9.58 at 24 h (p = 0.032). No changes were observed in the other bacterial groups tested viz. Bacteroides, Lactobacilli/Enterococci, Eubacterium rectale/Clostridium coccoides and Clostridium histolyticum. The polysaccharides also showed significant increases in total SCFA production, particularly acetic and propionic acids, indicating that they were readily fermented. In conclusion, some LMWPs derived from agar and alginate bearing seaweeds were fermented by gut bacteria and exhibited potential to be used a novel source of prebiotics. Copyright © 2011 Elsevier Ltd. All rights reserved.

  9. Determination of in vitro synergy for dual antimicrobial therapy against resistant Neisseria gonorrhoeae using Etest and agar dilution.

    Science.gov (United States)

    Wind, Carolien M; de Vries, Henry J C; van Dam, Alje P

    2015-03-01

    In response to antimicrobial resistance of Neisseria gonorrhoeae to last-resort extended-spectrum cephalosporins, combination therapy of azithromycin+ceftriaxone is now recommended. Dual therapy can be effective to treat monoresistant strains as well as multidrug-resistant strains, preferably employing the effect of in vitro synergy. As reports on in vitro synergy of azithromycin+ceftriaxone in N. gonorrhoeae are conflicting, in this study an evaluation of this combination was performed using a cross-wise Etest method and agar dilution. Synergy was defined as a fractional inhibitory concentration index (FICI) of ≤0.5. To identify other dual treatment options for gonorrhoea, in vitro synergy was evaluated for 65 dual antimicrobial combinations using Etest. Azithromycin, cefixime, ceftriaxone, colistin, ertapenem, fosfomycin, gentamicin, minocycline, moxifloxacin, rifampicin, spectinomycin and tigecycline were screened for synergy in all possible combinations. No synergy or antagonism was found for any of the 65 combinations. The geometric mean FICI ranged from 0.82 to 2.00. The mean FICI of azithromycin+ceftriaxone was 1.18 (Etest) and 0.55 (agar dilution). The difference between both methods did not result in a difference in interpretation of synergy. Ceftriaxone-resistant strain F89 was tested in all combinations and no synergy was found for any of them. Most importantly, the ceftriaxone minimum inhibitory concentration of F89 was not decreased below the breakpoint with any concentration of azithromycin. Copyright © 2014 Elsevier B.V. and the International Society of Chemotherapy. All rights reserved.

  10. Green roofs; Les toitures vegetalisees

    Energy Technology Data Exchange (ETDEWEB)

    Seghier, C.

    2006-03-15

    Impervious surface coverage keeps spreading in cities. Streets, sidewalks, parking lots and roofs are waterproof, meaning greater amounts of water to channel and treat and higher flood risks during heavy rainfalls. Green roofing can play a key part in addressing this alarming issue. There are three types of green roofs: extensive, semi-intensive and intensive. The extensive green roof technique uses a thin soil covering with a variety of species providing year-round plant coverage. The plants are not necessarily horticultural in which case routine maintenance is minimal. No watering is needed. Usually extensive green roofs create an ecosystem. The semi-intensive green roof technique uses a soil covering of average thickness and serves to create decorative roofing. Although maintenance is moderate, watering is essential. The intensive green roof technique produces a terrace roof garden. Another advantage of green roofs is they increase the life cycle of the sealing. Roof sealing protection may see the span of its life cycle, now at about fifteen years, doubled if the building has a green roof. planning professionals still know very little about green roofing solutions. Yet, green roofing provides unquestionable ecological qualities and thermal and acoustic performance that have proven to be environmentally friendly. Yet France lags behind northern European countries in green roofing. The Germans, Swiss, Austrians, Scandinavians and Dutch have been using the technique for more than twenty years. (A.L.B.)

  11. Green buildings pay

    DEFF Research Database (Denmark)

    Naboni, Emanuele; Edwards, Brian

    The new edition of ‘Green Buildings Pay’ authored by Brian Edwards and Emanuele Naboni explores the business and professional benefits which derive from architectural design driven by sustainability. With a new sub-title ‘Green Buildings Pay: design, productivity and ecology’ the book argues...... that environmental design has altered how we design, construct and manage buildings. The book has relevance to those who not only design and engineer buildings but to those who commission architecture and those who occupy the products of this process. Hence, the user is a key consideration. The book examines via...... a number of LEED and BREEAM cases the buildings which flow from corporate environmental responsibility. A number of office and university buildings are examined from three main perspectives- the architect, client and user. One key finding is that architectural innovation has been driven by ecological...

  12. The green protest

    International Nuclear Information System (INIS)

    Brun, R.

    1978-01-01

    The increasing public interest in the 'green' and the 'coloured' made the politicians alert. The ecological movement and the public initiatives show their effects. What 'utopists', 'crazy people' think about large technical development gains public importance. The uneasiness about a social development which was directed only by increasing spending power and permanent expansion, begins to articulate itself. Values such as solidarity and community, considerateness for fellow men and environment which had been eliminated in the past, are regaining their meaning. From the point of view of this steadily increasing movement, the phenomenon of the 'green parties' is investigated. In this context, the persons involved give their opinions, as well as representatives of the established parties, thus giving this volume the character of a documentation on an important trend in today's events. (orig.) [de

  13. Green and lean management

    CERN Document Server

    Davim, J

    2017-01-01

    This book focusses on the challenges and changes organizational management faces in an era when the need to develop environmentally aware processes meets high levels of competition. It covers the synergetic effects, how re-use, recycling, waste reduction, and other sustainable production strategies can add value, low costs and time of production. Sustainable business behavior is not only an environmental perspective on management, but more and more contains an organizational perspective. Taking into account these issues, green and lean management appears as the way managers can drive their employees to continuously improve the management processes that add value to the organization and costumers. This book provides information on principles, strategies, models, and applications of green and lean management, and at the same time communicates the latest research activity relating to this scientific field world-wide.

  14. Towards green construction

    International Nuclear Information System (INIS)

    Bajracharya, Bijaya B.; Shrestha, Prasanna M.

    2000-01-01

    Sustainability is the key to any development works. In the operation phase, hydro power is the most sustainable form of energy. However construction activities for the same power station are usually far from being green. The popular myth is that construction activity converts green into grey. Despite this popular myth, construction of a hydro power project in Nepal has made the project area greener than earlier during the construction phase itself. Choice of construction technology, appropriate level of environmental impact assessment, monitoring of environmental parameters along side the construction progress followed by mitigation at the right time; launching community development programmes side by side, having environmental specification in contractual documents and self-reliance to fulfill environmental obligations by contractors itself are the key factors in the environmental management within the construction activities. The main conclusions in the paper is the need to change the way to think about the project constraints

  15. Green dentistry: The future

    Directory of Open Access Journals (Sweden)

    Mensudar Rathakrishnan

    2017-01-01

    Full Text Available Dentistry is a profession dedicated to promote health and wellness of the people. Green dentistry is a relatively new emerging concept in dentistry. Most dental offices are privately-owned small businesses and have no financial advantage to invest in many environmental-friendly practices. For this reason, more research is needed to find cost-effective environmental alternatives in dentistry. The aim of this article is to expand awareness and practice of eco-friendly dentistry.

  16. The Influence of Consumers Perception of Green Products on Green Purchase Intention

    OpenAIRE

    Wilson Kong; Amran Harun; Rini Suryati Sulong; Jaratin Lily

    2014-01-01

    Green consumerism has increasingly received attention since the increased level of consumer awareness towards green products. Therefore, the aim of this paper had been to examine the influence of consumer perception of green products on green purchase intention. In this study, perception of green products was conceptualized as a multidimensional variable comprised of green corporate perception, eco-label, green advertising, green packaging, and green product value. By using a survey, a total ...

  17. Green Chemistry Metrics with Special Reference to Green Analytical Chemistry

    Directory of Open Access Journals (Sweden)

    Marek Tobiszewski

    2015-06-01

    Full Text Available The concept of green chemistry is widely recognized in chemical laboratories. To properly measure an environmental impact of chemical processes, dedicated assessment tools are required. This paper summarizes the current state of knowledge in the field of development of green chemistry and green analytical chemistry metrics. The diverse methods used for evaluation of the greenness of organic synthesis, such as eco-footprint, E-Factor, EATOS, and Eco-Scale are described. Both the well-established and recently developed green analytical chemistry metrics, including NEMI labeling and analytical Eco-scale, are presented. Additionally, this paper focuses on the possibility of the use of multivariate statistics in evaluation of environmental impact of analytical procedures. All the above metrics are compared and discussed in terms of their advantages and disadvantages. The current needs and future perspectives in green chemistry metrics are also discussed.

  18. Green Chemistry Metrics with Special Reference to Green Analytical Chemistry.

    Science.gov (United States)

    Tobiszewski, Marek; Marć, Mariusz; Gałuszka, Agnieszka; Namieśnik, Jacek

    2015-06-12

    The concept of green chemistry is widely recognized in chemical laboratories. To properly measure an environmental impact of chemical processes, dedicated assessment tools are required. This paper summarizes the current state of knowledge in the field of development of green chemistry and green analytical chemistry metrics. The diverse methods used for evaluation of the greenness of organic synthesis, such as eco-footprint, E-Factor, EATOS, and Eco-Scale are described. Both the well-established and recently developed green analytical chemistry metrics, including NEMI labeling and analytical Eco-scale, are presented. Additionally, this paper focuses on the possibility of the use of multivariate statistics in evaluation of environmental impact of analytical procedures. All the above metrics are compared and discussed in terms of their advantages and disadvantages. The current needs and future perspectives in green chemistry metrics are also discussed.

  19. Reduction of malachite green to leucomalachite green by intestinal bacteria.

    OpenAIRE

    Henderson, A L; Schmitt, T C; Heinze, T M; Cerniglia, C E

    1997-01-01

    Intestinal microfloras from human, rat, mouse, and monkey fecal samples and 14 pure cultures of anaerobic bacteria representative of those found in the human gastrointestinal tract metabolized the triphenylmethane dye malachite green to leucomalachite green. The reduction of malachite green to the leuco derivative suggests that intestinal microflora could play an important role in the metabolic activation of the triphenylmethane dye to a potential carcinogen.

  20. Inactivation of pathogenic bacteria inoculated onto a Bacto™ agar model surface using TiO2-UVC photocatalysis, UVC and chlorine treatments.

    Science.gov (United States)

    Yoo, S; Ghafoor, K; Kim, S; Sun, Y W; Kim, J U; Yang, K; Lee, D-U; Shahbaz, H M; Park, J

    2015-09-01

    The aim of this study was to study inactivation of different pathogenic bacteria on agar model surface using TiO2-UV photocatalysis (TUVP). A unified food surface model was simulated using Bacto(™) agar, a routinely used microbial medium. The foodborne pathogenic bacteria Escherichia coli K12 (as a surrogate for E. coli O157:H7), Salmonella Typhimurium, Staphylococcus aureus and Listeria monocytogenes were inoculated onto the agar surface, followed by investigation of TUVP-assisted inactivation and morphological changes in bacterial cells. The TUVP process showed higher bacterial inactivation, particularly for Gram-negative bacteria, than UVC alone and a control (dark reaction). A TUVP treatment of 17·2 mW cm(-2) (30% lower than the UVC light intensity) reduced the microbial load on the agar surface by 4·5-6·0 log CFU cm(-2). UVC treatment of 23·7 mW cm(-2) caused 3·0-5·3 log CFU cm(-2) reduction. The use of agar model surface is effective for investigation of bacterial disinfection and TUVP is a promising nonthermal technique. The results showing effects of photocatalysis and other treatments for inactivation of bacterial pathogens on model surface can be useful for applying such processes for disinfection of fruit, vegetables and other similar surfaces. © 2015 The Society for Applied Microbiology.

  1. Prevalence of fecal shedding of Salmonella organisms among captive green iguanas and potential public health implications.

    Science.gov (United States)

    Burnham, B R; Atchley, D H; DeFusco, R P; Ferris, K E; Zicarelli, J C; Lee, J H; Angulo, F J

    1998-07-01

    To determine prevalence of fecal shedding of Salmonella organisms among captive green iguanas (Iguana iguana). Cohort study. 12 captive green iguanas. Iguanas were isolated in an environmental chamber, and fecal samples were collected weekly for 10 consecutive weeks. Samples were incubated aerobically in tetrathionate broth for 18 to 24 hours. Aliquots were then transferred to Hektoen and Salmonella-Shigella agar plates and incubated for an additional 18 to 24 hours. Isolated colonies were subcultured on nutrient agar slants, and Salmonella isolates were serogrouped and serotyped. All 12 iguanas were found to be shedding Salmonella organisms at least once during the study, and multiple serotypes were isolated from 7 of the 12. Salmonella organisms were isolated from 88 of 106 (83%) fecal samples; 21 samples contained multiple Salmonella serotypes. Overall, 11 Salmonella serotypes were identified. In 74 of 100 instances, when a particular Salmonella serotype was isolated from an individual iguana, the same serotype was also isolated from a subsequent fecal sample from that iguana. Results suggested that most iguanas have a stable mixture of Salmonella serotypes in their intestinal tracts and intermittently or continuously shed Salmonella organisms in their feces. Veterinarians should advise their clients on precautions for reducing the risk of acquiring these organisms from their pets. Public health officials trying to determine whether an iguana is the source of a specific Salmonella serotype that caused infection in human patients should submit at least 3 fecal samples collected from the iguana 1 week apart for bacterial culture.

  2. The Green Experiment: Cities, Green Stormwater Infrastructure, and Sustainability

    Directory of Open Access Journals (Sweden)

    Christopher M. Chini

    2017-01-01

    Full Text Available Green infrastructure is a unique combination of economic, social, and environmental goals and benefits that requires an adaptable framework for planning, implementing, and evaluating. In this study, we propose an experimental framework for policy, implementation, and subsequent evaluation of green stormwater infrastructure within the context of sociotechnical systems and urban experimentation. Sociotechnical systems describe the interaction of complex systems with quantitative and qualitative impacts. Urban experimentation—traditionally referencing climate change programs and their impacts—is a process of evaluating city programs as if in a laboratory setting with hypotheses and evaluated results. We combine these two concepts into a singular framework creating a policy feedback cycle (PFC for green infrastructure to evaluate municipal green infrastructure plans as an experimental process within the context of a sociotechnical system. After proposing and discussing the PFC, we utilize the tool to research and evaluate the green infrastructure programs of 27 municipalities across the United States. Results indicate that green infrastructure plans should incorporate community involvement and communication, evaluation based on project motivation, and an iterative process for knowledge production. We suggest knowledge brokers as a key resource in connecting the evaluation stage of the feedback cycle to the policy phase. We identify three important needs for green infrastructure experimentation: (i a fluid definition of green infrastructure in policy; (ii maintenance and evaluation components of a green infrastructure plan; and (iii communication of the plan to the community.

  3. Buying and selling green: deregulation and green power marketing

    International Nuclear Information System (INIS)

    Evans, Andrew

    2000-01-01

    This article discusses the increasing trend towards deregulation of electricity markets, and the driving forces for liberalisation in the EU and North America. The use of green tariffs offered by utilities to differentiate themselves from competitors and to gain and keep customers is reported, and the situation with regard to green energy within the deregulated electricity markets in Australia, the EU, Denmark, Finland, Germany, the Netherlands, Portugal, Sweden, the UK, Canada and the USA is outlined. Customers switching as a result of green tariffs, the growing role of renewables, and opportunities for the promotion of green tariffs are discussed. (UK)

  4. Green roofs and the LEED green building rating system

    Energy Technology Data Exchange (ETDEWEB)

    Kula, R. [Sustainable Solutions Inc., Wagoner, OK (United States)

    2005-07-01

    The sustainable building industry is becoming increasingly aware of the host of public and private benefits that green roofs can provide in built environments. In dense urban environments, green roofs function to reduce stormwater runoff, urban heat island effects, and particulate matter (PM) pollution. The emerging green roof industry is now poised to support the efforts of green building networks in North America. This paper discussed the general benefits of green roofs, and their recognition within the Leadership in Energy and Environmental Design (LEED) Green Building Rating System. A case study of Mountain Equipment Co-op's Winnipeg site was presented. The building's green roof was directly responsible for earning 5 credits and contributing to the achievement of an additional 2 credits under the LEEDS certification process. Credits were earned for reduced site disturbance; landscape design to reduce heat islands; and water efficiency. The green roof at the site provided the vast majority of the building's cooling needs through an evaporative cooling trough. A photovoltaic pump was used to feed the building's irrigation system, as well as to pump ground water through cooling valances. It was concluded that the rise of sustainable building practices and the LEED Green Building Rating System will revolutionize the way new buildings are constructed.

  5. The Influence of Proactive Green Innovation and Reactive Green Innovation on Green Product Development Performance: The Mediation Role of Green Creativity

    OpenAIRE

    Yu-Shan Chen; Tai-Wei Chang; Chun-Yu Lin; Pi-Yu Lai; Kuan-Hung Wang

    2016-01-01

    This study fills the research gap in the exploration of the relationships between both proactive and reactive green innovations and green product development performance, and examines the mediating effect of green creativity. Structural equation modeling (SEM) is utilized to test the hypotheses. From the sample of 146 valid respondents, the results show that proactive green innovation positively affects green creativity and green product development performance, and green creativity positivel...

  6. Biomimetic synthesis of hollow calcium carbonate with the existence of the agar matrix and bovine serum albumin

    Energy Technology Data Exchange (ETDEWEB)

    Feng, Jianhua, E-mail: fjh2008@126.com; Wu, Gang; Qing, Chengsong

    2016-01-01

    Proteins play important roles in the process of biomineralization. Vaterite and calcite have been synthesized by the reaction of Na{sub 2}CO{sub 3} and CaCl{sub 2} in the bovine serum albumin (BSA) and agar system. The samples have been characterized by Fourier transform infrared spectroscopy (FT-IR) and X-ray diffraction (XRD). The shape of CaCO{sub 3} crystal has been analyzed by scanning electronic microscopy (SEM). The results show that calcite is a single product in the absence of BSA, but the product is a mixture of calcite and vaterite in the presence of BSA. The spheral shell of CaCO{sub 3} crystal was obtained when the concentration of BSA increased to 9.0 mg/mL. - Highlights: • Biomimetic synthesis of hollow calcium carbonate • Calcification mechanisms in the presence of both protein and polysaccharides • Biomineralization under the action of protein and polysaccharides.

  7. Commercial green energy. Final report

    International Nuclear Information System (INIS)

    Kalweit, B.

    1998-11-01

    Firms offering a Green electricity product have discovered that residential customers are willing to pay extra for the assurance that their electricity is generated through the use of non-polluting or renewable resources. This research investigated the market potential for Green energy at the next level of the energy consuming chain, commercial establishments at which small and medium sized businesses interface with customers. Green energy is proving to be an attractive proposition to some consumers in the residential marketplace. Is there a possibility that Green energy can also be sold to commercial enterprises? This research project sought to answer this question and to investigate the factors that might lead small business people to opt for Green. Answers to these questions will help energy companies target the businesses most likely to accept Green power with the right product set and product features

  8. In vitro susceptibility of filamentous fungi to copper nanoparticles assessed by rapid XTT colorimetry and agar dilution method.

    Science.gov (United States)

    Ghasemian, E; Naghoni, A; Tabaraie, B; Tabaraie, T

    2012-12-01

    Metal nanoparticles and their uses in various aspects have recently drawn a great deal of attention. One of the major applications is that it can be used as an antimicrobial agent. They can be considered in approaches targeted to decrease the harms caused by microorganisms, specifically fungi, threatening the medical and industrial areas. The aim of this study was to investigate the antifungal activity of synthesized copper nanoparticles (CuNPs) against four filamentous fungi including Alternaria alternata, Aspergillus flavus, Fusarium solani, and Penicillium chrysogenum. Zerovalent copper nanoparticles of mean size 8nm were synthesized by inert gas condensation (IGC) method. The antifungal activity of these synthesized copper nanoparticles was measured against selected fungi by using two different techniques including agar dilution method and XTT reduction assay. The minimal inhibitory concentrations (MICs) for copper nanoparticles by agar dilution method were less or equal to 40mg/L for P. chrysogenum, less or equal to 60mg/L for A. alternata, less or equal to 60mg/L for F. solani, and less or equal to 80mg/L for A. flavus. And also MICs obtained by XTT reduction assay ranged from 40 to 80mg/L. Our data demonstrated that the copper nanoparticles inhibited fungal growth, but the fungal sensitivity to copper nanoparticles varies depending on the fungal species. Therefore, it is advisable that the minimal inhibitory concentrations (MICs) be examined before using these compounds. It is hoped that, in future, copper nanoparticles could replace some antifungal agents, making them applicable to many different medical devices and antimicrobial control system. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  9. Equilibrium and kinetic modelling of Cd(II) biosorption by algae Gelidium and agar extraction algal waste.

    Science.gov (United States)

    Vilar, Vítor J P; Botelho, Cidália M S; Boaventura, Rui A R

    2006-01-01

    In this study an industrial algal waste from agar extraction has been used as an inexpensive and effective biosorbent for cadmium (II) removal from aqueous solutions. This biosorbent was compared with the algae Gelidium itself, which is the raw material for agar extraction. Equilibrium data follow both Langmuir and Redlich-Peterson models. The parameters of Langmuir equilibrium model are q(max)=18.0 mgg(-1), b=0.19 mgl(-1) and q(max)=9.7 mgg(-1), b=0.16 mgl(-1), respectively for Gelidium and the algal waste. Kinetic experiments were conducted at initial Cd(II) concentrations in the range 6-91 mgl(-1). Data were fitted to pseudo-first- and second-order Lagergren models. For an initial Cd(II) concentration of 91 mgl(-1) the parameters of the pseudo-first-order Lagergren model are k(1,ads)=0.17 and 0.87 min(-1); q(eq)=16.3 and 8.7 mgg(-1), respectively, for Gelidium and algal waste. Kinetic constants vary with the initial metal concentration. The adsorptive behaviour of biosorbent particles was modelled using a batch reactor mass transfer kinetic model. The model successfully predicts Cd(II) concentration profiles and provides significant insights on the biosorbents performance. The homogeneous diffusivity, D(h), is in the range 0.5-2.2 x10(-8) and 2.1-10.4 x10(-8)cm(2)s(-1), respectively, for Gelidium and algal waste.

  10. Evaluation of the thin agar layer method for the recovery of pressure-injured and heat-injured Listeria monocytogenes.

    Science.gov (United States)

    Lavieri, Nicolas A; Sebranek, Joseph G; Cordray, Joseph C; Dickson, James S; Jung, Stephanie; Manu, David K; Mendonça, Aubrey F; Brehm-Stecher, Byron F; Stock, Joseph; Stalder, Kenneth J

    2014-05-01

    A sublethally injured bacterial cell has been defined as a cell that survives a stress such as heating, freezing, acid treatment, or other antimicrobial intervention but can repair the cellular damage exerted by the stressor and later regain its original ability to grow. Consequently, sublethally injured cells are not likely to be included in conventional enumeration procedures, which could result in unrealistically low counts unless efforts are made to encourage recovery of the injured cells before enumeration. The objective of this study was to evaluate the use of the thin agar layer (TAL) method for the recovery of pressure-injured and heat-injured Listeria monocytogenes in a tryptic soy broth with 0.6% yeast extract system. Pressure injury consisted of treatment of a culture of mixed L. monocytogenes strains with high hydrostatic pressure at 400 or 600 MPa for 1 s, 2 min, 4 min, or 6 min at a process temperature of 12±2 °C. Heat injury consisted of treatment of a culture of mixed L. monocytogenes strains at 60±1 °C for 3, 6, or 9 min. Growth media were tryptic soy agar (TSA) with 0.6% yeast extract, modified Oxford medium (MOX), and TAL, which consisted of a 7-ml layer of TSA overlaid onto solidified MOX. Counts of viable L. monocytogenes on TAL were higher than those on MOX in the heat-injury experiment but not in the pressure-injury experiment. Therefore, the effectiveness of the TAL method may be specific to the type of injury applied to the microorganism and should be investigated in a variety of cellular injury scenarios.

  11. Black-box modeling to estimate tissue temperature during radiofrequency catheter cardiac ablation: feasibility study on an agar phantom model

    International Nuclear Information System (INIS)

    Blasco-Gimenez, Ramón; Lequerica, Juan L; Herrero, Maria; Hornero, Fernando; Berjano, Enrique J

    2010-01-01

    The aim of this work was to study linear deterministic models to predict tissue temperature during radiofrequency cardiac ablation (RFCA) by measuring magnitudes such as electrode temperature, power and impedance between active and dispersive electrodes. The concept involves autoregressive models with exogenous input (ARX), which is a particular case of the autoregressive moving average model with exogenous input (ARMAX). The values of the mode parameters were determined from a least-squares fit of experimental data. The data were obtained from radiofrequency ablations conducted on agar models with different contact pressure conditions between electrode and agar (0 and 20 g) and different flow rates around the electrode (1, 1.5 and 2 L min −1 ). Half of all the ablations were chosen randomly to be used for identification (i.e. determination of model parameters) and the other half were used for model validation. The results suggest that (1) a linear model can be developed to predict tissue temperature at a depth of 4.5 mm during RF cardiac ablation by using the variables applied power, impedance and electrode temperature; (2) the best model provides a reasonably accurate estimate of tissue temperature with a 60% probability of achieving average errors better than 5 °C; (3) substantial errors (larger than 15 °C) were found only in 6.6% of cases and were associated with abnormal experiments (e.g. those involving the displacement of the ablation electrode) and (4) the impact of measuring impedance on the overall estimate is negligible (around 1 °C)

  12. Effects of extracellular matrix proteins on macrophage differentiation, growth, and function: comparison of liquid and agar culture systems

    Science.gov (United States)

    Armstrong, J. W.; Chapes, S. K.; Spooner, B. S. (Principal Investigator)

    1994-01-01

    Both spaceflight and skeletal unloading suppress the haematopoietic differentiation of macrophages (Sonnenfeld et al., Aviat. Space Environ. Med., 61:648-653, 1990; Armstrong et al., J. Appl. Physiol., 75:2734-2739, 1993). The mechanism behind this reduction in haematopoiesis has yet to be elucidated. However, changes in bone marrow extracellular matrix (ECM) may be involved. To further understand the role of ECM products in macrophage differentiation, we have performed experiments evaluating the effects of fibronectin, laminin, collagen type I, and collagen type IV on macrophage development and function. Bone marrow-derived macrophages cultured on four different ECM substrates in liquid culture medium showed less growth than those cultured on plastic. Significant morphological differences were seen on each of the substrates used. Phenotypically and functionally, as measured by class II major histocompatibility molecule (MHCII) expression, MAC-2 expression, and the secretion of interleukin-6 (IL-6) and tumor necrosis factor-alpha (TNF-alpha), these macrophages were similar. In contrast, bone marrow-derived macrophages cultured in suspension, using agar, showed no difference in growth when exposed to ECM proteins. However, IL-6 and TNF-alpha secretion was affected by fibronectin, laminin, collagen type I, and collagen type IV in a concentration-dependent manner. We conclude that the ECM products fibronectin, laminin, collagen type I, and collagen type IV have profound effects on macrophage development and function. Additionally, we suggest that an ECM-supplemented agar culture system provides an environment more analogous to in vivo bone marrow than does a traditional liquid culture system.

  13. Picturing Urban Green Attachments

    DEFF Research Database (Denmark)

    Blok, Anders; Meilvang, Marie Leth

    2015-01-01

    In this article, we explore the cultural-political tensions and ambiguities of urban ecology, by way of following how activists move and translate between ‘familiar’ and ‘public’ engagements in the green city. Empirically, we locate our exploration in and around Nordhavnen (The North Harbor......), a large-scale sustainable urban development project in Copenhagen. Invoking Laurent Thévenot’s pragmatic sociology of ‘regimes of engagement’, we sketch a culturally sensitive approach to urban ecological activism, highlighting the critical moral capacities involved in building new forms of ‘commonality...

  14. Legume Logic & Green Manuring

    OpenAIRE

    Basavanagowda Nagabhushana, Nandeesh

    2014-01-01

    Brown plant hopper showed me the way into organic farming. In 2001, I started my practice with logic of legumes just to cut down the 45 percent expenses of my paddy on fertilizers, pesticides and herbicides. Later as I realized each and every plant carries it’s own nutrients, medicinal values and characters. Plants like millets, oil seeds, spices, di-cots, monocots and weeds all being used as a green manure. For all my agriculture problems and crop demands, I look for the answers only thro...

  15. Harmonic supergraphs. Green functions

    International Nuclear Information System (INIS)

    Galperin, A.; Ivanov, E.; Gievetsky, V.; Sokatchev, E.

    1985-01-01

    The quantization procedure in the harmonic superspace approach is worked out. Harmonic distributions are introduced and are used to construct the analytic superspace delta-functions and the Green functions for the hypermultiplet and the N=2 Yang-Mills superfields. The gauge fixing is described and the relevant Faddeev-Popov ghosts are defined. The corresponding BRST transformations are found. The harmonic superspace quantization of the N=2 gauge theory turns out to be rather simple and has many parallels with that for the standard (N=0) Yang-Mills theory. In particular, no ghosts-forghosts are needed

  16. Campaign Country Going Green?

    DEFF Research Database (Denmark)

    Poulsen, Bo

    2017-01-01

    justification. This paper finally discusses the reason for this greening of government initiated Danish energy saving campaigns, which is seen as an indirect result of the 1987 UN report, Our Common Future. The 1988 general election in Denmark led to the formation of a new center-right government coalition...... economics and not least a significant portion of patriotism. Environmental justification was almost entirely absent throughout the 1970s and 1980s. This changed only from 1989 onwards, as government initiatives to curb the ever rising consumption of energy commenced an extensive use of environmental...

  17. Green Consumption Behavior Antecedents

    DEFF Research Database (Denmark)

    Pagiaslis, Anastasios; Krystallis Krontalis, Athanasios

    2014-01-01

    The present study adds to the evolving literature on green consumer behavior by examining through statistically robust methods the effect and interrelationships of the key constructs of environmental concern, consumer environmental knowledge, beliefs about biofuels, and behavioral intention (i...... for the environment has a positive and direct impact on environmental knowledge, beliefs, and behavioral intention. Also, demographics determine levels of concern for the environment and environmental knowledge. All constructs associate positively with one another delineating that the interdependencies between them...... are important when accounting for environmental behavior. Future research should validate present results with the use of cross-cultural samples and investigate whether environmental concern increases due to social desirability response bias....

  18. Green Tourism Marketing Model1

    OpenAIRE

    Hasan, Ali

    2015-01-01

    Green Tourism Marketing Model research as efforts to develop environmentally friendly tourism destination, the synergy of government, business and community participation become the driving force of tourism product development with highly competitive. In the long term, this research aims to provide the marketing concept of green tourism as economic development efforts and strengthen the environment (eco-growth) through the development of green tourism marketing models. The ...

  19. The trashing of Big Green

    International Nuclear Information System (INIS)

    Felten, E.

    1990-01-01

    The Big Green initiative on California's ballot lost by a margin of 2-to-1. Green measures lost in five other states, shocking ecology-minded groups. According to the postmortem by environmentalists, Big Green was a victim of poor timing and big spending by the opposition. Now its supporters plan to break up the bill and try to pass some provisions in the Legislature

  20. The guide to greening cities

    National Research Council Canada - National Science Library

    Johnston, Sadhu Aufochs

    2013-01-01

    ... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 17 CHAPTER 3. Leading in the Community: Using City Assets, Policy, Partnerships, and Persuasion . . Case in Point: Returning to Green City Roots and Loving El...