WorldWideScience

Sample records for breakage dna repair

  1. DNA strand breakage repair in ataxia telangiectasia fibroblast-like cells

    International Nuclear Information System (INIS)

    Human diploid fibroblast-like cells derived from four patients with the genetic disease ataxia telangiectasia and from two non-mutant donors were examined for the repair of X-ray induced strand breaks in DNA. The ataxia telangiectasia cultures showed no significant differences from the non-mutant cultures in the kinetics and extent of strand repair. This suggests that the increased spontaneous and X-ray induced chromatid aberrations observed in ataxia telangiectasia cells are not caused by a defect in the repair of single strand breaks as might be suspected from a general model of aberration production

  2. Measurement of DNA strand breakage and DNA repair induced with hydrogen peroxide using single cell gel electrophoresis, alkaline DNA unwinding and alkaline elution of DNA

    International Nuclear Information System (INIS)

    Three techniques single cell gel electrophoresis (SCGE), alkaline elution of DNA, and alkaline DNA unwinding (ADU) were chosen to compare the sensitivity among these methods in detection of DNA damage and repair in human diploid VH10 cell line after short-term exposure to hydrogen peroxide. Using SCGE technique a dose-dependent increase in DNA migration was found in cell exposed to hydrogen peroxide in concentration range from 10 μmol/l. Alkaline DNA unwinding method detected increased level of single strand breaks (ssb) in concentration range from 25 μmol/l of H2O2, and alkaline elution of DNA estimated increased DNA elution rate from concentration 50 μmol/l of H2O2. In a time course study to evaluate the kinetics of DNA repair, both SCGE and ADU techniques showed that the repair of DNA strand breaks is very rapid; the level of ssb in treated cells has returned to near the background level within two hours. After this time damage remaining in the DNA was in the form of oxidised bases as revealed the incubation of treated cells with specific DNA repair endonuclease, formamidopyridine-DNA glycosylase. (author)

  3. DNA breakage, repair and lethality after 125I decay in rec+ and recA strains of Escherichia coli

    International Nuclear Information System (INIS)

    Iodine-125 decays by electron capture and is known to cause extensive molecular fragmentation via the Auger effect. 125I was incorporated into the DNA of exponentially-growing E. coli K12 AB2487, a recA mutant, and E. coli K12 AB2497, the corresponding rec+ strain as 5-iododeoxyuridine (IUdR), an analogue of thymidine. Radioactive bacteria were stored at -1960C, and samples were periodically assayed for loss of viability and for the induction of double-strand breaks (DSBs) in DNA. Each 125I decay in the DNA of either strain induced one DSB, i.e. proportional to (DSB) = 1.0. For the recA strain, proportional to (lethal) = 0.9 and for the rec+ strain, 0.4. Assays for biological repair of DSBs, involving incubation of thawed samples in growth-medium at 370C before the extraction of DNA, demonstrated significant repair of 125I-induced DSBs by rec+ cells but none by recA cells. For small numbers of decays, there was approximately a 1 : 1 correlation, for either strain, between lethal decays and post-incubation residual DSBs. Comparison with data for larger numbers of decays indicated that a typical rec+ cell can repair no more than three to four DSBs per completed genome (2.5 x 109 daltons). (author)

  4. DNA breakage drives nuclear search

    OpenAIRE

    Ira, Grzegorz; Hastings, Philip J.

    2012-01-01

    The search for a homologous template is a fundamental, yet largely uncharacterized, reaction in DNA double-strand break repair. Two reports now demonstrate that broken chromosomes increase their movement and explore large volumes of nuclear space searching for a homologous template. Break mobility requires resection and recombination enzymes, as well as damage-checkpoint components.

  5. Estimates of DNA strand breakage in bottlenose dolphin (Tursiops truncatus)

    OpenAIRE

    Blanco, M.; Cruz, D.; Carro, S.; López, R.; Díaz, A.; Santiago, L; Guevara, C.; Sánchez, L.; Cuetara, E.B.; López, N.

    2009-01-01

    The analysis of DNA damage by mean of Comet or single cell gel electrophoresis (SCGE) assay has been commonly used to assess genotoxic impact in aquatic animals being able to detect exposure to low concentrations of contaminants in a wide range of species. The aims of this work were 1) to evaluate the usefulness of the Comet to detect DNA strand breakage in dolphin leukocytes, 2) to use the DNA diffusion assay to determine the amount of DNA strand breakage associated with apoptosi...

  6. DNA repair

    International Nuclear Information System (INIS)

    In this chapter a series of DNA repair pathways are discussed which are available to the cell to cope with the problem of DNA damaged by chemical or physical agents. In the case of microorganisms our knowledge about the precise mechanism of each DNA repair pathway and the regulation of it has been improved considerably when mutants deficient in these repair mechanisms became available. In the case of mammalian cells in culture, until recently there were very little repair deficient mutants available, because in almost all mammalian cells in culture at least the diploid number of chromosomes is present. Therefore the frequency of repair deficient mutants in such populations is very low. Nevertheless because replica plating techniques are improving some mutants from Chinese hamsters ovary cells and L5178Y mouse lymphoma cells are now available. In the case of human cells, cultures obtained from patients with certain genetic diseases are available. A number of cells appear to be sensitive to some chemical or physical mutagens. These include cells from patients suffering from xeroderma pigmentosum, Ataxia telangiectasia, Fanconi's anemia, Cockayne's syndrome. However, only in the case of xeroderma pigmentosum cells, has the sensitivity to ultraviolet light been clearly correlated with a deficiency in excision repair of pyrimidine dimers. Furthermore the work with strains obtained from biopsies from man is difficult because these cells generally have low cloning efficiencies and also have a limited lifespan in vitro. It is therefore very important that more repair deficient mutants will become available from established cell lines from human or animal origin

  7. Analysis by pulsed-field gel electrophoresis of DNA double-strand breakage and repair in Deinococcus radiodurans and a radiosensitive mutant

    International Nuclear Information System (INIS)

    Double-strand break (dsb) induction and rejoining after ionizing radiation was analysed in Deinococcus radiodurans and a radiosensitive mutant by pulsed-field gel electrophoresis. Following 2 kGy, migration of genomic DNA (not restriction cleaved) from the plug into the gel was extensive, but was not observed after 90 min postirradiation recovery. By this time D. radiodurans chromosomes were intact, as demonstrated by restoration of the Not I restriction cleavage pattern of 11 bands, which we found to be the characteristic pattern in unirradiated cells. Following the higher exposure of 4 kGy, dsb rejoining took approximately 180 min. twice as long as required following the 2 kGy exposure. Restoration of dsb in the radiosensitive mutant strain 112, which appears to be defective in recombination, was markedly retarded at both 2 and 4 kGy. The Not I restriction fragments of wild-type D. radiodurans and the radiosensitive mutant were identical, totaling 3.58 Mbp, equivalent to 2.36 x 109 daltons per chromosome. (author)

  8. Induction of oxygen-dependent lethal damage by monochromatic UVB (313 nm) radiation: strand breakage, repair and cell death

    International Nuclear Information System (INIS)

    The action of UV-B (313 nm) radiation in cellular inactivation and induction and repair of DNA strand breaks were studied in a repair proficient strain and three repair deficient strains (polA, recA, uvrA) of Escherichia coli K-12. Although the induction of breaks was linear in purified T4 DNA and the polA strain, simultaneous induction and repair of breaks were observed in the uvrA, recA and repair proficient strains at doses 4 Jm-2. The final rates of induction in these strains were 1 x 10-4, 7.5 x 10-5 and 7.5 x 10-5 breaks/2.5 x 109 daltons/Jm-2, respectively. A highly efficient polA-dependent repair occurring at 00C in minimal buffer and a second slower type of repair occurring at 310C in the polA strain were detected. Oxygen dependence of cellular inactivation was observed for the polA and repair proficient strains irradiated at 313 nm thus providing biological evidence for an oxygen-dependent lesion involved in lethality in the short wavelength range of the solar u.v. The lower hypoxic break induction rates of the polA and the repair proficient strains, indicate oxygen-enhanced DNA breakage by 313 nm radiation. (author)

  9. Protection of DNA strand breakage by radiation exposure

    International Nuclear Information System (INIS)

    Human ceruloplasmin, the plasma copper containing protein, is thought to play an essential role in iron metabolism, but it also has antioxidant properties. Ceruloplasmin directly scavenged hydroxyl radicals (.OH) generated in dithiothreitol/FeCl3 system besides inhibitory function of hydroxyl radical formation and lipid peroxidation. Polyamines, spermidine and spermine, significantly protected the supercoiled DNA strand breakage by hydroxyl radicals and DNA strand breakage by UV was highly protected by all four polyamines used in this study. In polyamine deficient mutant KL527. It was shown that cell survivability following UV irradiation was slightly increased by exogenous polyamines putrescine and spermidine supplement. However the cell survivability of wild type (MG 1655) was not influenced by polyamine supplement. In γ-irradiated cells, cell survivability of polyamine-deficient mutant strain KL527 was significantly increased by exogenous putrescine supplement and that of wild type strain MG1655 was similar irrespective of polyamine supplement. These results implicate the possibility that polyamines play a potent role in radioprotection of cell and DNA level. (author). 32 refs., 8 figs

  10. Protection of DNA strand breakage by radiation exposure

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jeong Ho; Kim, In Gyu; Lee, Kang Suk; Kim, Kug Chan; Shim, Hae Won

    1997-12-01

    Human ceruloplasmin, the plasma copper containing protein, is thought to play an essential role in iron metabolism, but it also has antioxidant properties. Ceruloplasmin directly scavenged hydroxyl radicals (.OH) generated in dithiothreitol/FeCl{sub 3} system besides inhibitory function of hydroxyl radical formation and lipid peroxidation. Polyamines, spermidine and spermine, significantly protected the supercoiled DNA strand breakage by hydroxyl radicals and DNA strand breakage by UV was highly protected by all four polyamines used in this study. In polyamine deficient mutant KL527. It was shown that cell survivability following UV irradiation was slightly increased by exogenous polyamines putrescine and spermidine supplement. However the cell survivability of wild type (MG 1655) was not influenced by polyamine supplement. In {gamma}-irradiated cells, cell survivability of polyamine-deficient mutant strain KL527 was significantly increased by exogenous putrescine supplement and that of wild type strain MG1655 was similar irrespective of polyamine supplement. These results implicate the possibility that polyamines play a potent role in radioprotection of cell and DNA level. (author). 32 refs., 8 figs

  11. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    DEFF Research Database (Denmark)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie; Liévin, Jacques; Körzdörfer, Thomas; Rotaru, Alexandru; Gothelf, Kurt Vesterager; Besenbacher, Flemming; Bald, Ilko

    2014-01-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...

  12. Workshop on DNA repair.

    NARCIS (Netherlands)

    A.R. Lehmann (Alan); J.H.J. Hoeijmakers (Jan); A.A. van Zeeland (Albert); C.M.P. Backendorf (Claude); B.A. Bridges; A. Collins; R.P.D. Fuchs; G.P. Margison; R. Montesano; E. Moustacchi; A.T. Natarajan; M. Radman; A. Sarasin; E. Seeberg; C.A. Smith; M. Stefanini (Miria); L.H. Thompson; G.P. van der Schans; C.A. Weber (Christine); M.Z. Zdzienika

    1992-01-01

    textabstractA workshop on DNA repair with emphasis on eukaryotic systems was held, under the auspices of the EC Concerted Action on DNA Repair and Cancer, at Noordwijkerhout (The Netherlands) 14-19 April 1991. The local organization of the meeting was done under the auspices of the Medical Genetic C

  13. DNA repair protocols

    DEFF Research Database (Denmark)

    Bjergbæk, Lotte

    In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...

  14. Sophoridinol derivative 05D induces tumor cells apoptosis by topoisomerase1-mediated DNA breakage

    Directory of Open Access Journals (Sweden)

    Zhao W

    2016-05-01

    Full Text Available Wuli Zhao, Caixia Zhang, Chongwen Bi, Cheng Ye, Danqing Song, Xiujun Liu, Rongguang Shao Key Laboratory of Antibiotic Bioengineering, Ministry of Health, Laboratory of Oncology, Institute of Medicinal Biotechnology, Peking Union Medical College and Chinese Academy of Medical Sciences, Beijing, People’s Republic of China Abstract: Sophoridine is a quinolizidine natural product of Sophora alopecuroides and has been applied for treatment of malignant trophoblastic tumors. Although characterized by low toxicity, the limited-spectrum antitumor activity hinders its further applications. 05D, a derivative of sophoridine, exhibits a better anticancer activity on diverse cancer cells, including solid tumors, and hematologic malignancy. It could inhibit topoisomerase 1 (top1 activity by stabilizing DNA–top1 complex and induce mitochondria-mediated apoptosis by promoting DNA single- and double-strand breakage mediated by top1. Also, 05D induced HCT116 cells arrest at G1 phase by inactivating CDK2/CDK4–Rb–E2F and cyclinD1–CDK4–p21 checkpoint signal pathways. 05D suppressed the ataxia telangiectasia mutated (ATM and ATM and Rad3-related (ATR activation and decreased 53BP level, which contributed to DNA damage repair, suggesting that the novel compound 05D might be helpful to improve the antitumor activity of DNA damaging agent by repressing ATM and ATR activation and 53BP level. In addition, the priorities in molecular traits and druggability, such as a simple structure and formulation for oral administration, further prove 05D to be a promising targeting topoisomerase agent. Keywords: topoisomerase inhibitor, topoisomerase 1, DNA breakage, sophoridinol, anticancer, apoptosis, cell cycle

  15. DNA Repair by Reversal of DNA Damage

    OpenAIRE

    Yi, Chengqi; He, Chuan

    2013-01-01

    Endogenous and exogenous factors constantly challenge cellular DNA, generating cytotoxic and/or mutagenic DNA adducts. As a result, organisms have evolved different mechanisms to defend against the deleterious effects of DNA damage. Among these diverse repair pathways, direct DNA-repair systems provide cells with simple yet efficient solutions to reverse covalent DNA adducts. In this review, we focus on recent advances in the field of direct DNA repair, namely, photolyase-, alkyltransferase-,...

  16. Plasmid DNA breakage by decay of DNA associated isotopes 123I and 125I

    International Nuclear Information System (INIS)

    The biological consequences of decay of DNA-associated 125I have been extensively investigated using a variety of systems. It is well established that decay of the isotope in close proximity to DNA produces a DSB with an efficiency close to 1. Much less information is available for another iodine isotope - 123I. It is a 'weaker' Auger emitter than 125I, and has much shorter half-life; 13.2 hours compared to 60 days for 125I. Cell culture studies indicate that decay of 123I is more than two times less efficient in killing V79 cells than decay of 125I, and produces from 0.45 to 0.74 DSB per decay in the cell nucleus. The Monte Carlo simulation of 123I decay and DSB induction has generated a value of 0.4 DSB per decay of incorporated isotope. We have adapted the plasmid DNA assay to compare strand breakage by decay of DNA-associated 125I and 125I, exploiting DNA minor groove binding ligand Hoechst 33258 labelled with either of these isotopes. Application of the plasmid assay to this study highlighted a range of important factors, which were taken into account to ensure a valid outcome. These factors involve the statistical implications of the nature of the breakage events (such as multiple breaks arising from a single decay event), two different sources of damage, namely internal (from DNA-associated decay events) and external (from decays occurring anywhere in solution), and consideration of the fraction of DNA-bound ligand. In our experiments, we incubated pBR322 plasmid with [125I]-iodoHoechst 33258 or with mixture of ligands labelled with 123I and 125I. The latter approach allows measurement of the ratio of probabilities of DSB formation per decay for the two isotopes, with much higher precision than determination of the individual breakage probabilities for each isotope. We obtained for the probability (per decay) of induction of DSB by the 125I-labeled ligand a value of 0.82 ± 0.05. Inclusion of DMSO as a radical scavenger, reduces this value to 0.65 ± 0

  17. Estimates of DNA strand breakage in bottlenose dolphin (Tursiops truncatus) leukocytes measured with the Comet and DNA diffusion assays

    OpenAIRE

    Adriana Díaz; Sandra Carro; Livia Santiago; Juan Estévez; Celia Guevara; Miriam Blanco; Laima Sánchez; Liena Sánchez; Nirka López; Danilo Cruz; Ronar López; Cuetara, Elizabeth B.; Jorge Luis Fuentes

    2009-01-01

    The analysis of DNA damage by mean of Comet or single cell gel electrophoresis (SCGE) assay has been commonly used to assess genotoxic impact in aquatic animals being able to detect exposure to low concentrations of contaminants in a wide range of species. The aims of this work were 1) to evaluate the usefulness of the Comet to detect DNA strand breakage in dolphin leukocytes, 2) to use the DNA diffusion assay to determine the amount of DNA strand breakage associated with apoptosis or necrosi...

  18. Estimates of DNA strand breakage in bottlenose dolphin (Tursiops truncatus) leukocytes measured with the Comet and DNA diffusion assays.

    Science.gov (United States)

    Díaz, Adriana; Carro, Sandra; Santiago, Livia; Estévez, Juan; Guevara, Celia; Blanco, Miriam; Sánchez, Laima; Sánchez, Liena; López, Nirka; Cruz, Danilo; López, Ronar; Cuetara, Elizabeth B; Fuentes, Jorge Luis

    2009-04-01

    The analysis of DNA damage by mean of Comet or single cell gel electrophoresis (SCGE) assay has been commonly used to assess genotoxic impact in aquatic animals being able to detect exposure to low concentrations of contaminants in a wide range of species. The aims of this work were 1) to evaluate the usefulness of the Comet to detect DNA strand breakage in dolphin leukocytes, 2) to use the DNA diffusion assay to determine the amount of DNA strand breakage associated with apoptosis or necrosis, and 3) to determine the proportion of DNA strand breakage that was unrelated to apoptosis and necrosis. Significant intra-individual variation was observed in all of the estimates of DNA damage. DNA strand breakage was overestimated because a considerable amount (~29%) of the DNA damage was derived from apoptosis and necrosis. The remaining DNA damage in dolphin leukocytes was caused by factors unrelated to apoptosis and necrosis. These results indicate that the DNA diffusion assay is a complementary tool that can be used together with the Comet assay to assess DNA damage in bottlenose dolphins. PMID:21637693

  19. Estimates of DNA strand breakage in bottlenose dolphin (Tursiops truncatus leukocytes measured with the Comet and DNA diffusion assays

    Directory of Open Access Journals (Sweden)

    Adriana Díaz

    2009-01-01

    Full Text Available The analysis of DNA damage by mean of Comet or single cell gel electrophoresis (SCGE assay has been commonly used to assess genotoxic impact in aquatic animals being able to detect exposure to low concentrations of contaminants in a wide range of species. The aims of this work were 1 to evaluate the usefulness of the Comet to detect DNA strand breakage in dolphin leukocytes, 2 to use the DNA diffusion assay to determine the amount of DNA strand breakage associated with apoptosis or necrosis, and 3 to determine the proportion of DNA strand breakage that was unrelated to apoptosis and necrosis. Significant intra-individual variation was observed in all of the estimates of DNA damage. DNA strand breakage was overestimated because a considerable amount (~29% of the DNA damage was derived from apoptosis and necrosis. The remaining DNA damage in dolphin leukocytes was caused by factors unrelated to apoptosis and necrosis. These results indicate that the DNA diffusion assay is a complementary tool that can be used together with the Comet assay to assess DNA damage in bottlenose dolphins.

  20. DNA strand breakage by 125I-decay in oligoDNA

    International Nuclear Information System (INIS)

    Full text: A double-stranded oligodeoxynucleotide containing 125I-dC in a defined location, with 5'- or 3'-32P-end-labelling of either strand, was used to investigate DNA strand breakage resulting from 125I decay. Samples of the 32P-end-labelled and 125I-dC containing oligoDNA were incubated in 20 mM phosphate buffer (PB), or PB + 2 M dimethylsulphoxide (DMSO) at 4 deg during 18-20 days. The 32P-end-labelled DNA fragments produced by 125I decays were separated on denaturing polyacrylamide gels, and the 3P activity in each fragment was determined by scintillation counting after elution from the gel. The fragment size distribution was then converted to a distribution of single stranded break probabilities at each nucleotide position. The results indicate that each 125I decay event produces at least one break in the 125I-dC containing strand, and causes breakage of the opposite strand in 75-80% of events. Thus, the double stranded break is produced by 125I decay with probability ∼0.8. Most of single stranded breaks (around 90%) occurred within 5-6 nucleotides of the 125I-dC, however DNA breaks were detected up to 18-20 nucleotides from the decay site. The average numbers of single stranded breaks per decay are 3.7 (PB) and 3.3 (PB+DMSO) in 125I-dC containing strand, and 1.5 (PB) and 1.3 (PB+DMSO) in the opposite strand. Deconvolution of strand break probabilities as a function of separation from the 125I, in terms of both distance (to target deoxyribosyl carbon atoms, in B-DNA) and nucleotide number, show that the latter is an important parameter for the shorter-range damage. This could indicate a role for attenuation/dissipation of damage through the stacked bases. In summary, the results represent a much more extensive set of data than available from earlier experiments on DNA breakage from l25I-decay, and may provide new mechanistic insights

  1. DNA breakage detection-fluorescence in situ hybridization (DBD-FISH in buccal cells

    Directory of Open Access Journals (Sweden)

    E. I. Cortés-Gutiérrez

    2012-12-01

    Full Text Available DNA breakage detection-fluorescence in situ hybridization (DBD-FISH is a recently developed technique that allows cell-by-cell detection and quantification of DNA breakage in the whole genome or within specific DNA sequences. The present investigation was conducted to adapt the methodology of DBD-FISH to the visualization and evaluation of DNA damage in buccal epithelial cells. DBD-FISH revealed that DNA damage increased significantly according to H2O2 concentration (r2=0.91. In conclusion, the DBD-FISH technique is easy to apply in buccal cells and provides prompt results that are easy to interpret. Future studies are needed to investigate the potential applicability of a buccal cell DBD-FISH model to human biomonitoring and nutritional work.

  2. DNA repair deficiency in neurodegeneration

    DEFF Research Database (Denmark)

    Jeppesen, Dennis Kjølhede; Bohr, Vilhelm A; Stevnsner, Tinna V.

    2011-01-01

    Deficiency in repair of nuclear and mitochondrial DNA damage has been linked to several neurodegenerative disorders. Many recent experimental results indicate that the post-mitotic neurons are particularly prone to accumulation of unrepaired DNA lesions potentially leading to progressive...... neurodegeneration. Nucleotide excision repair is the cellular pathway responsible for removing helix-distorting DNA damage and deficiency in such repair is found in a number of diseases with neurodegenerative phenotypes, including Xeroderma Pigmentosum and Cockayne syndrome. The main pathway for repairing oxidative...... base lesions is base excision repair, and such repair is crucial for neurons given their high rates of oxygen metabolism. Mismatch repair corrects base mispairs generated during replication and evidence indicates that oxidative DNA damage can cause this pathway to expand trinucleotide repeats, thereby...

  3. Demonstration of DNA strand breakage induced by ultraviolet light

    International Nuclear Information System (INIS)

    The initial event in cellular carcinogenesis likely involves changes in the DNA at both the gene and chromosome levels, resulting from damage to the cell by outside agents. The authors have developed a visually striking experiment that demonstrates the damage to DNA caused by the common carcinogen, ultraviolet radiation. The protocol, suitable for undergraduate biochemistry and molecular biology courses, can be executed in one 3-4 hour laboratory period. Students become familiar with several common biochemical techniques, including electrophoretic separation of DNA molecules on horizontal agarose gels, measurement of microliter volumes, and the use of ultraviolet light sources. The experiment can be used to introduce diverse topics, including DNA biochemistry, reactive oxygen species, and cancer prevention

  4. 37. Effect of Ni2O3 on DNA strand breakage and gene expression

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    @@In order to study the possible mechanism of carcinogenisis by Nickel compound to find sensitive, specific monitoring index for nickel induced carcinogenesis, the methods based on single cell gel electrophoresis to assay (comet assay ) Ni2O3, -induced DNA breakage of human embryo lung cell. Arbitrary primed PCR in combination with methylation-sensitive restriction enzyme Hha Ⅱ digestion and bisulphate genomic conversion was used to analyse the CpG island methylation pattern variation of

  5. Rethinking transcription coupled DNA repair.

    Science.gov (United States)

    Kamarthapu, Venu; Nudler, Evgeny

    2015-04-01

    Nucleotide excision repair (NER) is an evolutionarily conserved, multistep process that can detect a wide variety of DNA lesions. Transcription coupled repair (TCR) is a subpathway of NER that repairs the transcribed DNA strand faster than the rest of the genome. RNA polymerase (RNAP) stalled at DNA lesions mediates the recruitment of NER enzymes to the damage site. In this review we focus on a newly identified bacterial TCR pathway in which the NER enzyme UvrD, in conjunction with NusA, plays a major role in initiating the repair process. We discuss the tradeoff between the new and conventional models of TCR, how and when each pathway operates to repair DNA damage, and the necessity of pervasive transcription in maintaining genome integrity. PMID:25596348

  6. Aging and DNA repair capability. [Review

    Energy Technology Data Exchange (ETDEWEB)

    Tice, R R

    1977-01-01

    A review of the literature on DNA repair processes in relation to aging is presented under the following headings: DNA repair processes; age-related occurrence of unrepaired DNA lesions; DNA repair capability as a function of age; tissue-specific DNA repair capability; acceleration of the aging process by exposure to DNA damaging agents; human genetic syndromes; and longevity and DNA repair processes. (HLW)

  7. Rethinking Transcription Coupled DNA Repair

    OpenAIRE

    Kamarthapu, Venu; Nudler, Evgeny

    2015-01-01

    Nucleotide excision repair (NER) is an evolutionarily conserved, multistep process that can detect a wide variety of DNA lesions. Transcription coupled repair (TCR) is a sub-pathway of NER that repairs the transcribed DNA strand faster than the rest of the genome. RNA polymerase (RNAP) stalled at DNA lesions mediates the recruitment of NER enzymes to the damage site. In this review we focus on a newly identified bacterial TCR pathway in which the NER enzyme UvrD, in conjunction with NusA, pla...

  8. DNA encoding a DNA repair protein

    Science.gov (United States)

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-08-15

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  9. New approaches to biochemical radioprotection: antioxidants and DNA repair enhancement

    Science.gov (United States)

    Riklis, E.; Emerit, I.; Setlow, R. B.

    Chemical repair may be provided by radioprotective compounds present during exposure to ionizing radiation. Considering DNA as the most sensitive target it is feasible to biochemically improve protection by enhancing DNA repair mechanisms. Protection of DNA by reducing the amount of damage (by radical scavenging and chemical repair) followed by enhanced repair of DNA will provide much improved protection and recovery. Furthermore, in cases of prolonged exposure, such as is possible in prolonged space missions, or of unexpected variations in the intensity of radiation, as is possible when encountering solar flares, it is important to provide long-acting protection, and this may be provided by antioxidants and well functioning DNA repair systems. It has also become important to provide protection from the potentially damaging action of long-lived clastogenic factors which have been found in plasma of exposed persons from Hiroshima & Nagasaki, radiation accidents, radiotherapy patients and recently in ``liquidators'' - persons involved in salvage operations at the Chernobyl reactor. The clastogenic factor, which causes chromatid breaks in non-exposed plasma, might account for late effects and is posing a potential carcinogenic hazard /1/. The enzyme superoxide dismutase (SOD) has been shown to eliminate the breakage factor from cultured plasma of exposed persons /2/. Several compounds have been shown to enhance DNA repair: WR-2721 /3/, nicotinamide /4/, glutathione monoester (Riklis et al., unpublished) and others. The right combination of such compounds may prove effective in providing protection from a wide range of radiation exposures over a long period of time.

  10. Mammalian DNA Repair. Final Report

    Energy Technology Data Exchange (ETDEWEB)

    None

    2003-01-24

    The Gordon Research Conference (GRC) on Mammalian DNA Repair was held at Harbortown Resort, Ventura Beach, CA. Emphasis was placed on current unpublished research and discussion of the future target areas in this field.

  11. DNA repair in mammalian embryos.

    Science.gov (United States)

    Jaroudi, Souraya; SenGupta, Sioban

    2007-01-01

    Mammalian cells have developed complex mechanisms to identify DNA damage and activate the required response to maintain genome integrity. Those mechanisms include DNA damage detection, DNA repair, cell cycle arrest and apoptosis which operate together to protect the conceptus from DNA damage originating either in parental gametes or in the embryo's somatic cells. DNA repair in the newly fertilized preimplantation embryo is believed to rely entirely on the oocyte's machinery (mRNAs and proteins deposited and stored prior to ovulation). DNA repair genes have been shown to be expressed in the early stages of mammalian development. The survival of the embryo necessitates that the oocyte be sufficiently equipped with maternal stored products and that embryonic gene expression commences at the correct time. A Medline based literature search was performed using the keywords 'DNA repair' and 'embryo development' or 'gametogenesis' (publication dates between 1995 and 2006). Mammalian studies which investigated gene expression were selected. Further articles were acquired from the citations in the articles obtained from the preliminary Medline search. This paper reviews mammalian DNA repair from gametogenesis to preimplantation embryos to late gestational stages. PMID:17141556

  12. Recombinant DNA repair genes

    International Nuclear Information System (INIS)

    We have developed a gene transfer system with Chinese hamster ovary (CHO) cells to identify, characterize, and potentially isolate functionally homologous human or CHO genes regulating repair initiation

  13. DNA glycosylases: in DNA repair and beyond

    OpenAIRE

    Jacobs, Angelika L.; Schär, Primo

    2011-01-01

    The base excision repair machinery protects DNA in cells from the damaging effects of oxidation, alkylation, and deamination; it is specialized to fix single-base damage in the form of small chemical modifications. Base modifications can be mutagenic and/or cytotoxic, depending on how they interfere with the template function of the DNA during replication and transcription. DNA glycosylases play a key role in the elimination of such DNA lesions; they recognize and excise damaged bases, thereb...

  14. DNA Repair Defects and Chromosomal Aberrations

    Science.gov (United States)

    Hada, Megumi; George, K. A.; Huff, J. L.; Pluth, J. M.; Cucinotta, F. A.

    2009-01-01

    Yields of chromosome aberrations were assessed in cells deficient in DNA doublestrand break (DSB) repair, after exposure to acute or to low-dose-rate (0.018 Gy/hr) gamma rays or acute high LET iron nuclei. We studied several cell lines including fibroblasts deficient in ATM (ataxia telangiectasia mutated; product of the gene that is mutated in ataxia telangiectasia patients) or NBS (nibrin; product of the gene mutated in the Nijmegen breakage syndrome), and gliomablastoma cells that are proficient or lacking in DNA-dependent protein kinase (DNA-PK) activity. Chromosomes were analyzed using the fluorescence in situ hybridization (FISH) chromosome painting method in cells at the first division post irradiation, and chromosome aberrations were identified as either simple exchanges (translocations and dicentrics) or complex exchanges (involving >2 breaks in 2 or more chromosomes). Gamma irradiation induced greater yields of both simple and complex exchanges in the DSB repair-defective cells than in the normal cells. The quadratic dose-response terms for both simple and complex chromosome exchanges were significantly higher for the ATM- and NBS-deficient lines than for normal fibroblasts. However, in the NBS cells the linear dose-response term was significantly higher only for simple exchanges. The large increases in the quadratic dose-response terms in these repair-defective cell lines points the importance of the functions of ATM and NBS in chromatin modifications to facilitate correct DSB repair and minimize the formation of aberrations. The differences found between ATM- and NBS-deficient cells at low doses suggest that important questions should with regard to applying observations of radiation sensitivity at high dose to low-dose exposures. For aberrations induced by iron nuclei, regression models preferred purely linear dose responses for simple exchanges and quadratic dose responses for complex exchanges. Relative biological effectiveness (RBE) factors of all of

  15. DNA repair in PHA stimulated human lymphocytes

    International Nuclear Information System (INIS)

    Damage an repair of radiation induced DNA strand breaks were measured by alkaline lysis and hydroxyapatite chromatography. PHA stimulated human lymphocytes show that the rejoining process is complete within the first 50 min., afterwords secondary DNA damage and chromatid aberration. DNA repair, in synchronized culture, allows to evaluate individual repair capacity and this in turn can contribute to the discovery of individual who, although they do not demonstrate apparent clinical signs, are carriers of DNA repair deficiency. Being evident that a correlation exists between DNA repair capacity and carcinogenesis, the possibility of evaluating the existent relationship between DNA repair and survival in tumor cells comes therefore into discussion

  16. Inhibition of human Chk1 causes increased initiation of DNA replication, phosphorylation of ATR targets, and DNA breakage

    DEFF Research Database (Denmark)

    Syljuåsen, Randi G; Sørensen, Claus Storgaard; Hansen, Lasse Tengbjerg;

    2005-01-01

    -nuclear phosphorylation of histone H2AX, p53, Smc1, replication protein A, and Chk1 itself in human S-phase cells. These phosphorylations were inhibited by ATR siRNA and caffeine, but they occurred independently of ATM. Chk1 inhibition also caused an increased initiation of DNA replication, which was accompanied by...... increased amounts of nonextractable RPA protein, formation of single-stranded DNA, and induction of DNA strand breaks. Moreover, these responses were prevented by siRNA-mediated downregulation of Cdk2 or the replication initiation protein Cdc45, or by addition of the CDK inhibitor roscovitine. We propose...... that Chk1 is required during normal S phase to avoid aberrantly increased initiation of DNA replication, thereby protecting against DNA breakage. These results may help explain why Chk1 is an essential kinase and should be taken into account when drugs to inhibit this kinase are considered for use in...

  17. Important DNA repair proteins in DNA double-strand break repair pathways

    International Nuclear Information System (INIS)

    DNA double-strand break repair pathway is one of DNA damage repair pathways. DNA repair genes can repair DNA damage, maintain the integrity of the genetic information and inhibit the formation of tumors. There are two mechanisms-non-homologous end joining and homologous recombination to repair DNA double-strand break. In this review, an overview of important repair proteins of non--homologous end joining and homologous recombination pathways was introduced. (authors)

  18. How quantum entanglement in DNA synchronizes double-strand breakage by type II restriction endonucleases.

    Science.gov (United States)

    Kurian, P; Dunston, G; Lindesay, J

    2016-02-21

    Macroscopic quantum effects in living systems have been studied widely in pursuit of fundamental explanations for biological energy transport and sensing. While it is known that type II endonucleases, the largest class of restriction enzymes, induce DNA double-strand breaks by attacking phosphodiester bonds, the mechanism by which simultaneous cutting is coordinated between the catalytic centers remains unclear. We propose a quantum mechanical model for collective electronic behavior in the DNA helix, where dipole-dipole oscillations are quantized through boundary conditions imposed by the enzyme. Zero-point modes of coherent oscillations would provide the energy required for double-strand breakage. Such quanta may be preserved in the presence of thermal noise by the enzyme's displacement of water surrounding the DNA recognition sequence. The enzyme thus serves as a decoherence shield. Palindromic mirror symmetry of the enzyme-DNA complex should conserve parity, because symmetric bond-breaking ceases when the symmetry of the complex is violated or when physiological parameters are perturbed from optima. Persistent correlations in DNA across longer spatial separations-a possible signature of quantum entanglement-may be explained by such a mechanism. PMID:26682627

  19. A method of calculating initial DNA strand breakage following the decay of incorporated 125I

    International Nuclear Information System (INIS)

    Two sources of individual Auger electron spectra and an electron track code were used with a simple model of the DNA to successfully simulate single-strand DNA breakage measured by Martin and Haseltine (1981). Conditions of the calculation were then extended to examine patterns of single-strand breaks in both strands of the DNA duplex to score double-strand breaks. Five types of break were scored. The total number of double-strand breaks (dsb) per decay at the site of the decay was 0.90 and 0.65 for the different Auger electron spectra. It was shown that for mammalian cells an additional source of double-strand breaks from low LET radiation added approximately 0.17 dsb/decay to each, giving a final total of 1.07 and 0.85 dsb/decay for mammalian cells depending on electron spectrum. It is shown that energy deposition in the DNA from the iodine decay is very complex, with a broad range of energy depositions and products. Even for a particular energy deposited in the DNA different types of strand-break are produced. These are identified and their probabilities calculated. (author)

  20. DNA polymerase δ and DNA repair: DNA repair synthesis in human fibroblasts requires DNA polymerase δ

    International Nuclear Information System (INIS)

    When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernate of similarly treated HeLa cells. Monoclonal antibody to KB cell DNA polymerase α, while binding to HeLa DNA polymerase α, did not bind to the HeLa DNA polymerase δ. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGT) and 2(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase α, but did not inhibit the DNA polymerase δ. Neither purified DNA polymerase α nor β could promote repair DNA synthesis in the permeabilized cells. Furthermore, if monoclonal antibodies to DNA polymerase α BuPdGTP, or BuAdATP was added to the reconstituted system, there was no significant inhibition

  1. Inactivation of E. Coli cell viability and DNA Photo-breakage by Pulsed Nitrogen Laser Radiation

    International Nuclear Information System (INIS)

    The mutagenic and lethal effect of nitrogen laser radiation: 337.1 nm wave length, 1.5 millijoul pulse energy, 10 nanosecond pulse with and pulse repetition rate range from 1 to 50 Pulse/ second was evaluated on E. Coli cells. Results indicated that irradiation of E. coli JMP39 with pulse repetition of 8 , 16 , 32 pulse/sec, for 1, 5 , 10, 25 min respectively led to a significant decrease in cell count proportional to irradiation dose with significant increase in lacmutation frequency accompanied with some mutations in pattern of antibiotic resistance. The effect of nitrogen laser on the genomic content of the strain JMP39 was also studied by irradiating the total DNA with 30 pulse/second for 1 ,5, 15 , 30 min then subjected to both agarose gel electrophoresis and scanning spectrophotometry. The first technique revealed to DNA photo breakage and significant decrease in DNA absorbency was noticed by scanning spectrophotometry. This could be attributed to photo-decomposition resulted from multi-photo-excitation of UV-Laser pulses

  2. DNA damage and repair mechanism. [DNA damage and repair mechanisms

    Energy Technology Data Exchange (ETDEWEB)

    Grossman, L.

    1976-01-01

    The ability of cells to survive in an environment specifically damaging to its DNA can be attributed to a variety of inherent repair mechanisms. This is a form of repair in which alterations are directly reversed to their original form. This reversibility is exemplified by the photoreactivation of ultraviolet-induced pyrimidine dimers. This phenomenon is attributable to the action of an enzyme, photolyase (photoreactivating enzyme), which is able to monomerize the uv-induced pyrimidine dimers in the presence of 320 to 370 nm light. Dilution of damage can be effected through a series of sister chromatid exchanges, controlled by recombinational mechanisms as a postreplication event. In this form of repair, replication proceeds to the point of damage, stops and resumes at the point of the next initiation site resulting in a gap in the newly synthesized daughter strand. It is presumed that those strands containing damaged regions exchange with undamaged regions of other DNA, strands, resulting in the eventual dilution of such damage.

  3. Titanium dioxide nanoparticles induce oxidative stress and DNA-adduct formation but not DNA-breakage in human lung cells

    Directory of Open Access Journals (Sweden)

    Schins Roel PF

    2009-06-01

    Full Text Available Abstract Titanium dioxide (TiO2, also known as titanium (IV oxide or anatase, is the naturally occurring oxide of titanium. It is also one of the most commercially used form. To date, no parameter has been set for the average ambient air concentration of TiO2 nanoparticles (NP by any regulatory agency. Previously conducted studies had established these nanoparticles to be mainly non-cyto- and -genotoxic, although they had been found to generate free radicals both acellularly (specially through photocatalytic activity and intracellularly. The present study determines the role of TiO2-NP (anatase, ∅ in vitro. For comparison, iron containing nanoparticles (hematite, Fe2O3, ∅ 2-NP did not induce DNA-breakage measured by the Comet-assay in both cell types. Generation of reactive oxygen species (ROS was measured acellularly (without any photocatalytic activity as well as intracellularly for both types of particles, however, the iron-containing NP needed special reducing conditions before pronounced radical generation. A high level of DNA adduct formation (8-OHdG was observed in IMR-90 cells exposed to TiO2-NP, but not in cells exposed to hematite NP. Our study demonstrates different modes of action for TiO2- and Fe2O3-NP. Whereas TiO2-NP were able to generate elevated amounts of free radicals, which induced indirect genotoxicity mainly by DNA-adduct formation, Fe2O3-NP were clastogenic (induction of DNA-breakage and required reducing conditions for radical formation.

  4. Radiation-induced DNA damage and DNA repair

    International Nuclear Information System (INIS)

    Although DNA undergoes various types of damage from radiation, active oxygen, and the like, a living body has a plurality of DNA repair mechanisms responding to the types of DNA damage. On the other hand, there are a system that results in cell death if the repair is impossible and a mechanism to lead to concretization if further repair is not accurately made. This paper explains the following items as the basic researches on these types of DNA damage and the repair mechanisms: (1) biological effects of DNA damage, (2) effect of DNA damage on DNA synthesis, and (3) effects of DNA damage on cells. It also explains the effects of radiation on cells with a focus on specific mechanism for (1) DNA damage caused by direct action due to radiation and by indirect action due mainly to active oxygen, and (2) DNA repair mechanism that works on DNA double-strand break (DSB). (A.O.)

  5. Xeroderma pigmentosum, DNA repair and carcinogenesis

    International Nuclear Information System (INIS)

    The following topics are reviewed: Symptoms of xeroderma pigmentosum; xeroderma pigmentosum as a defect in the biochemistry of repair of radiation damage; major classes of DNA damage and repair mechanisms; excision repair in relation to biochemical steps and the XP defect; sensitivity of xeroderma pigmentosum cells; host-cell reactivation of UV-damaged viruses; excision of pyrimidine dimers from human cells; formation and sealing of single strand breaks during dimer excision; insertion of new bases to repair DNA; and DNA repair, carcinogens, and carcinogenesis

  6. Genetic ecotoxicology IV: survival and DNA strand breakage is dependent on genotype in radionuclide-exposed mosquitofish

    International Nuclear Information System (INIS)

    Western mosquitofish (Gambusia affinis) were caged in situ in a radioactively-contaminated pond in order to determine if survival and amount of DNA strand breakage were dependent on genotype. Genotypes of fish were determined using the randomly amplified polymorphic (RAPD) technique, and DNA strand breakage was determined using agarose gel electrophoresis. This study is a continuation of research undertaken at the Oak Ridge National Laboratory, which examined the effects of radionuclide contamination on the population genetic structure of mosquitofish. The previous research found 17 RAPD markers that were present at a higher frequency in contaminated than in reference populations ('contaminant-indicative bands'), and fish from contaminated sites which possessed these markers had higher fecundity and fewer strand breaks than fish which did not. One of the contaminated populations (Pond 3513) was colonized from one of the reference populations (Crystal Springs) in 1977. In the present study, fish were obtained from Crystal Springs and an additional reference site, and caged in Pond 3513. The percent survival and amount of DNA strand breakage were then determined for fish with and without the contaminant-indicative markers. When Crystal Springs fish were caged in Pond 3513, it was found that the genotypic distribution of the survivors was more similar to the native Pond 3513 population than to the Crystal Springs population. Furthermore, for nine of the contaminant-indicative markers, the percent survival was greater for fish which possessed these markers than for fish which did not. For five of these markers, fish which possessed them had higher DNA integrity (fewer strand breaks) than fish which did not. These data indicate that probability of survival and degree of DNA strand breakage in radionuclide-exposed mosquitofish are dependent on RAPD genotype, and are consistent with the hypothesis that the contaminant-indicative RAPD bands are markers of loci which impart

  7. DNA repair and DNA antibodies during experimental mycoplasma arthritis

    International Nuclear Information System (INIS)

    To clarify the pathogenesis of a mycoplasma induced arthritis in rats, investigations were carried out on the influence of mycoplasma infection on DNA repair and the occurrence of DNA antibodies. During acute and subacute stage of the experimentally induced arthritis an inhibition of DNA repair could be observed. Besides the results indicated a correlation between reduced or inhibited DNA repair and the appearance of DNA antibodies could be found. The DNA-repair behaviour after the mycoplasma infection was compared with the influence of γ-irradiation

  8. DNA damage and repair in plants

    International Nuclear Information System (INIS)

    The biological impact of any DNA damaging agent is a combined function of the chemical nature of the induced lesions and the efficiency and accuracy of their repair. Although much has been learned frommicrobes and mammals about both the repair of DNA damage and the biological effects of the persistence of these lesions, much remains to be learned about the mechanism and tissue-specificity of repair in plants. This review focuses on recent work on the induction and repair of DNA damage in higher plants, with special emphasis on UV-induced DNA damage products. (author)

  9. FBH1 promotes DNA double-strand breakage and apoptosis in response to DNA replication stress.

    Science.gov (United States)

    Jeong, Yeon-Tae; Rossi, Mario; Cermak, Lukas; Saraf, Anita; Florens, Laurence; Washburn, Michael P; Sung, Patrick; Schildkraut, Carl L; Schildkraut, Carl; Pagano, Michele

    2013-01-21

    Proper resolution of stalled replication forks is essential for genome stability. Purification of FBH1, a UvrD DNA helicase, identified a physical interaction with replication protein A (RPA), the major cellular single-stranded DNA (ssDNA)-binding protein complex. Compared with control cells, FBH1-depleted cells responded to replication stress with considerably fewer double-strand breaks (DSBs), a dramatic reduction in the activation of ATM and DNA-PK and phosphorylation of RPA2 and p53, and a significantly increased rate of survival. A minor decrease in ssDNA levels was also observed. All these phenotypes were rescued by wild-type FBH1, but not a FBH1 mutant lacking helicase activity. FBH1 depletion had no effect on other forms of genotoxic stress in which DSBs form by means that do not require ssDNA intermediates. In response to catastrophic genotoxic stress, apoptosis prevents the persistence and propagation of DNA lesions. Our findings show that FBH1 helicase activity is required for the efficient induction of DSBs and apoptosis specifically in response to DNA replication stress. PMID:23319600

  10. DNA Damage and Repair in Vascular Disease.

    Science.gov (United States)

    Uryga, Anna; Gray, Kelly; Bennett, Martin

    2016-01-01

    DNA damage affecting both genomic and mitochondrial DNA is present in a variety of both inherited and acquired vascular diseases. Multiple cell types show persistent DNA damage and a range of lesions. In turn, DNA damage activates a variety of DNA repair mechanisms, many of which are activated in vascular disease. Such DNA repair mechanisms either stall the cell cycle to allow repair to occur or trigger apoptosis or cell senescence to prevent propagation of damaged DNA. Recent evidence has indicated that DNA damage occurs early, is progressive, and is sufficient to impair function of cells composing the vascular wall. The consequences of persistent genomic and mitochondrial DNA damage, including inflammation, cell senescence, and apoptosis, are present in vascular disease. DNA damage can thus directly cause vascular disease, opening up new possibilities for both prevention and treatment. We review the evidence for and the causes, types, and consequences of DNA damage in vascular disease. PMID:26442438

  11. DNA strand breakage by 125I decay: Plasmid DNA in dilute aqueous solution

    International Nuclear Information System (INIS)

    The question of the extent of damage to DNA, in particular double strand breaks, that can be caused by the decay of the Auger emitter 125I when it is covalently incorporated into the DNA requires resolution. In particular, experiments with plasmid DNA reported by Linz and Stoecklin would seem to indicate that the range of effect extends over the whole length of the molecule (a few 1,000's base pairs (bp)) in contrast to the generally accepted view that the decay is very localized (i.e. effect over a few 10's bp). This raises the question of whether a long range energy migration process is operative in DNA or whether the fragmentation can be accounted for by free radical diffusion. The authors report here experiments to help resolve this issue by investigating and trying to eliminate the possible effects of free radicals. The results which are broadly consistent with the findings of Linz and Stoecklin indicate that long-range damage in labeled DNA in aqueous solution is due to effects of free radicals. The authors confirm the high-LET nature of the 125I decay

  12. [A Nobel Prize for DNA repair].

    Science.gov (United States)

    Jordan, Bertrand

    2016-01-01

    This year's Nobel Prize for chemistry recognizes the seminal contributions of three researchers who discovered the existence and the basic mechanisms of DNA repair: base excision repair, mismatch repair, and nucleotide excision repair. They have since been joined by many scientists elucidating diverse aspects of these complex mechanisms that now constitute a thriving research field with many applications, notably for understanding oncogenesis and devising more effective therapies. PMID:26850617

  13. DNA repair phenotype and dietary antioxidant supplementation

    DEFF Research Database (Denmark)

    Guarnieri, Serena; Loft, Steffen; Riso, Patrizia;

    2008-01-01

    of DNA repair incisions were 65.2 (95 % CI 60.4, 70.0) and 86.1 (95 % CI 76.2, 99.9) among the male smokers and well-nourished subjects, respectively. The male smokers also had high baseline levels of oxidised guanines in MNBC. After supplementation, only the male smokers supplemented with slow......-release vitamin C tablets had increased DNA repair activity (27 (95 % CI 12, 41) % higher incision activity). These subjects also benefited from the supplementation by reduced levels of oxidised guanines in MNBC. In conclusion, nutritional status, DNA repair activity and DNA damage are linked, and beneficial...

  14. Preferential DNA repair in expressed genes.

    Science.gov (United States)

    Hanawalt, P C

    1987-01-01

    Potentially deleterious alterations to DNA occur nonrandomly within the mammalian genome. These alterations include the adducts produced by many chemical carcinogens, but not the UV-induced cyclobutane pyrimidine dimer, which may be an exception. Recent studies in our laboratory have shown that the excision repair of pyrimidine dimers and certain other lesions is nonrandom in the mammalian genome, exhibiting a distinct preference for actively transcribed DNA sequences. An important consequence of this fact is that mutagenesis and carcinogenesis may be determined in part by the activities of the relevant genes. Repair may also be processive, and a model is proposed in which excision repair is coupled to transcription at the nuclear matrix. Similar but freely diffusing repair complexes may account for the lower overall repair efficiencies in the silent domains of the genome. Risk assessment in relation to chemical carcinogenesis requires assays that determine effective levels of DNA damage for producing malignancy. The existence of nonrandom repair in the genome casts into doubt the reliability of overall indicators of DNA binding and lesion repair for such determinations. Furthermore, some apparent differences between the intragenomic repair heterogeneity in rodent cells and that in human cells mandate a reevaluation of rodent test systems for human risk assessment. Tissue-specific and cell-specific differences in the coordinate regulation of gene expression and DNA repair may account for corresponding differences in the carcinogenic response. Images FIGURE 1. FIGURE 1. PMID:3447906

  15. Apparent Directional Scanning for DNA Repair

    OpenAIRE

    Zhao, Tong; Dinner, Aaron R.

    2007-01-01

    Recently it was observed that the DNA repair protein human O6-alkylguanine-DNA alkyltransferase repairs lesions at the 5′ ends of 70-nucleotide single-stranded DNA roughly threefold more frequently than lesions at the 3′ ends. Here, we introduce a coarse-grained model to show how a local asymmetry in binding kinetics (rather than thermodynamics) together with irreversible alkyl transfer can give rise to this apparent bias in sequence scanning. Exploration of the parameter space provides quant...

  16. DNA single strand breakage, DNA adducts, and sister chromatid exchange in lymphocytes and phenanthrene and pyrene metabolites in urine of coke oven workers.

    OpenAIRE

    W. Popp; Vahrenholz, C.; Schell, C; Grimmer, G.; Dettbarn, G; Kraus, R.; Brauksiepe, A; Schmeling, B; Gutzeit, T; von Bülow, J; Norpoth, K

    1997-01-01

    OBJECTIVES: To investigate the specificity of biological monitoring variables (excretion of phenanthrene and pyrene metabolites in urine) and the usefulness of some biomarkers of effect (alkaline filter elution, 32P postlabelling assay, measurement of sister chromatid exchange) in workers exposed to polycyclic aromatic hydrocarbons (PAHs). METHODS: 29 coke oven workers and a standardised control group were investigated for frequencies of DNA single strand breakage, DNA protein cross links (al...

  17. Estimating the DNA strand breakage using a fuzzy inference system and agarose gel electrophoresis, a case study with toothed carp Aphanius sophiae exposed to cypermethrin.

    Science.gov (United States)

    Poorbagher, Hadi; Moghaddam, Maryam Nasrollahpour; Eagderi, Soheil; Farahmand, Hamid

    2016-07-01

    The DNA breakage has been widely used in ecotoxicological studies to investigate effects of pesticides in fishes. The present study used a fuzzy inference system to quantify the breakage of DNA double strand in Aphanius sophiae exposed to the cypermethrin. The specimens were adapted to different temperatures and salinity for 14 days and then exposed to cypermethrin. DNA of each specimens were extracted, electrophoresed and photographed. A fuzzy system with three input variables and 27 rules were defined. The pixel value curve of DNA on each gel lane was obtained using ImageJ. The DNA breakage was quantified using the pixel value curve and fuzzy system. The defuzzified values were analyzed using a three-way analysis of variance. Cypermethrin had significant effects on DNA breakage. Fuzzy inference systems can be used as a tool to quantify the breakage of double strand DNA. DNA double strand of the gill of A. sophiae is sensitive enough to be used to detect cypermethrin in surface waters in concentrations much lower than those reported in previous studies. PMID:27000282

  18. Nuclear translocation contributes to regulation of DNA excision repair activities

    DEFF Research Database (Denmark)

    Knudsen, Nina Østergaard; Andersen, Sofie Dabros; Lützen, Anne; Nielsen, Finn Cilius; Rasmussen, Lene Juel

    2009-01-01

    DNA mutations are circumvented by dedicated specialized excision repair systems, such as the base excision repair (BER), nucleotide excision repair (NER), and mismatch repair (MMR) pathways. Although the individual repair pathways have distinct roles in suppressing changes in the nuclear DNA, it is...... co-import appears to be a mechanism employed by the composite repair systems NER and MMR to enhance and regulate nuclear accumulation of repair proteins thereby ensuring faithful DNA repair....

  19. Space Radiation Effects on Human Cells: Modeling DNA Breakage, DNA Damage Foci Distribution, Chromosomal Aberrations and Tissue Effects

    Science.gov (United States)

    Ponomarev, A. L.; Huff, J. L.; Cucinotta, F. A.

    2011-01-01

    Future long-tem space travel will face challenges from radiation concerns as the space environment poses health risk to humans in space from radiations with high biological efficiency and adverse post-flight long-term effects. Solar particles events may dramatically affect the crew performance, while Galactic Cosmic Rays will induce a chronic exposure to high-linear-energy-transfer (LET) particles. These types of radiation, not present on the ground level, can increase the probability of a fatal cancer later in astronaut life. No feasible shielding is possible from radiation in space, especially for the heavy ion component, as suggested solutions will require a dramatic increase in the mass of the mission. Our research group focuses on fundamental research and strategic analysis leading to better shielding design and to better understanding of the biological mechanisms of radiation damage. We present our recent effort to model DNA damage and tissue damage using computational models based on the physics of heavy ion radiation, DNA structure and DNA damage and repair in human cells. Our particular area of expertise include the clustered DNA damage from high-LET radiation, the visualization of DSBs (DNA double strand breaks) via DNA damage foci, image analysis and the statistics of the foci for different experimental situations, chromosomal aberration formation through DSB misrepair, the kinetics of DSB repair leading to a model-derived spectrum of chromosomal aberrations, and, finally, the simulation of human tissue and the pattern of apoptotic cell damage. This compendium of theoretical and experimental data sheds light on the complex nature of radiation interacting with human DNA, cells and tissues, which can lead to mutagenesis and carcinogenesis later in human life after the space mission.

  20. Antibody specific for a DNA repair protein

    Science.gov (United States)

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-07-11

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  1. Replication Stress-Induced Chromosome Breakage Is Correlated with Replication Fork Progression and Is Preceded by Single-Stranded DNA Formation

    OpenAIRE

    Feng, Wenyi; Di Rienzi, Sara C.; Raghuraman, M. K.; Brewer, Bonita J.

    2011-01-01

    Chromosome breakage as a result of replication stress has been hypothesized to be the direct consequence of defective replication fork progression, or “collapsed” replication forks. However, direct and genome-wide evidence that collapsed replication forks give rise to chromosome breakage is still lacking. Previously we showed that a yeast replication checkpoint mutant mec1-1, after transient exposure to replication impediment imposed by hydroxyurea (HU), failed to complete DNA replication, ac...

  2. Macromolecule oxidation and DNA repair in mussel (Mytilus edulis L.) gill following exposure to Cd and Cr(VI)

    International Nuclear Information System (INIS)

    The oxidation of DNA and lipid was analysed in the marine mussel (Mytilus edulis) in response to exposure (10 μg/l and 200 μg/l) to cadmium (Cd) and chromium [Cr(VI)]. Concentration dependent uptake of both metals into mussel tissues was established and levels of gill ATP were not depleted at these exposure levels. DNA strand breakage in gill cells (analysed by the comet assay) was elevated by both metals, however, DNA oxidation [measured by DNA strand breakage induced by the DNA repair enzyme formamidopyrimidine glycosylase (FPG)] was not elevated. This was despite a statistically significant increase in both malondialdehyde and 4-hydroxynonenal - indicative of lipid peroxidation - following treatment with Cd. In contrast, both frank DNA stand breaks and FPG-induced DNA strand breaks (indicative of DNA oxidation) were increased following injection of mussels with sodium dichromate (10.4 μg Cr(VI)/mussel). The metals also showed differential inhibitory potential towards DNA repair enzyme activity with Cd exhibiting inhibition of DNA cutting activity towards an oligonucleotide containing 8-oxo-7,8-dihydro-2'-deoxyguanosine and Cr(VI) showing inhibition of such activity towards an oligonucleotide containing ethenoadenosine, both at 200 μg/l. The metals thus show DNA damage activity in mussel gill with distinct mechanisms involving both direct and indirect (oxidative) DNA damage, as well as impairing different DNA repair capacities. A combination of these activities can contribute to adverse effects in these organisms

  3. Macromolecule oxidation and DNA repair in mussel (Mytilus edulis L.) gill following exposure to Cd and Cr(VI)

    Energy Technology Data Exchange (ETDEWEB)

    Emmanouil, C. [School of Biosciences, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom); Sheehan, T.M.T. [Regional Toxicology Laboratory, City Hospital, Dudley Road, Birmingham B18 7QH (United Kingdom); Chipman, J.K. [School of Biosciences, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom)]. E-mail: J.K.Chipman@bham.ac.uk

    2007-04-20

    The oxidation of DNA and lipid was analysed in the marine mussel (Mytilus edulis) in response to exposure (10 {mu}g/l and 200 {mu}g/l) to cadmium (Cd) and chromium [Cr(VI)]. Concentration dependent uptake of both metals into mussel tissues was established and levels of gill ATP were not depleted at these exposure levels. DNA strand breakage in gill cells (analysed by the comet assay) was elevated by both metals, however, DNA oxidation [measured by DNA strand breakage induced by the DNA repair enzyme formamidopyrimidine glycosylase (FPG)] was not elevated. This was despite a statistically significant increase in both malondialdehyde and 4-hydroxynonenal - indicative of lipid peroxidation - following treatment with Cd. In contrast, both frank DNA stand breaks and FPG-induced DNA strand breaks (indicative of DNA oxidation) were increased following injection of mussels with sodium dichromate (10.4 {mu}g Cr(VI)/mussel). The metals also showed differential inhibitory potential towards DNA repair enzyme activity with Cd exhibiting inhibition of DNA cutting activity towards an oligonucleotide containing 8-oxo-7,8-dihydro-2'-deoxyguanosine and Cr(VI) showing inhibition of such activity towards an oligonucleotide containing ethenoadenosine, both at 200 {mu}g/l. The metals thus show DNA damage activity in mussel gill with distinct mechanisms involving both direct and indirect (oxidative) DNA damage, as well as impairing different DNA repair capacities. A combination of these activities can contribute to adverse effects in these organisms.

  4. Human diseases associated with defective DNA repair

    International Nuclear Information System (INIS)

    The observations on xeroderma pigmentosum (XP) cells in culture were the first indications of defective DNA repair in association with human disease. Since then, a wealth of information on DNA repair in XP, and to a lesser extent in other diseases, has accumulated in the literature. Rather than clarifying the understanding of DNA repair mechanisms in normal cells and of defective DNA repair in human disease, the literature suggests an extraordinary complexity of both of the phenomena. In this review a number of discrete human diseases are considered separately. An attempt was made to systematically describe the pertinent clinical features and cellular and biochemical defects in these diseases, with an emphasis on defects in DNA metabolism, particularly DNA repair. Wherever possible observations have been correlated and unifying hypotheses presented concerning the nature of the basic defect(s) in these diseases. Discussions of the following diseases are presented: XP, ataxia telangiectasia; Fanconi's anemia; Hutchinson-Gilford progeria syndrome; Bloom's syndrome, Cockayne's syndrome; Down's syndrome; retinoblastoma; chronic lymphocytic leukemia; and other miscellaneous human diseases with possble DNA repair defects

  5. Mechanisms of DNA Repair in Mammalian Cells

    International Nuclear Information System (INIS)

    The authors examined DNA synthesis in cultured mammalian cells after irradiation with X-rays or ultraviolet light, using equilibrium density gradient and autoradiographic techniques. Unscheduled DNA synthesis (the synthesis of DNA by cells not in S phase of the cell cycle) occurs at doses of u.v. where survival is greater than 90% and at doses of X-rays where survival is of the order of 50%. At higher doses it was established that repair replication (insertion of precursors into parental strands of DNA ) occurs in these cells, and it is presumed that these two phenomena (unscheduled DNA synthesis and repair replication) are manifestations of the same repair process. During the time that these phenomena occur, very little degradation of DNA takes place, as measured by appearance of prelabelled components of DNA in the medium or in the acid soluble portion of the cell. This is in direct contrast to the situation in bacteria, in which extensive degradation of DNA occurs after irradiation, presumably as a result of enzymatic processes that remove many undamaged bases in addition to the ones injured by the irradiation. A small amount of radioactivity does appear in the acid soluble portion and in the media from prelabelled cells from both irradiated and control mammalian cell cultures. The amount in the medium from irradiated cultures is slightly, but significantly, greater than that from controls; thus there does appear to be a very low level of degradation of DNA in irradiated mammalian cells. These data indicate that the repair of DNA in mammalian cells does not involve the same steps as those that occur in bacteria. The results suggest instead that mammalian cells have a much more specific system for repair, which involves excision of only the damaged portion of the DNA. Possible mechanisms of repair of mammalian DNA are considered. (author)

  6. International congress on DNA damage and repair: Book of abstracts

    Energy Technology Data Exchange (ETDEWEB)

    1987-01-01

    This document contains the abstracts of 105 papers presented at the Congress. Topics covered include the Escherichia coli nucleotide excision repair system, DNA repair in malignant transformations, defective DNA repair, and gene regulation. (TEM)

  7. International congress on DNA damage and repair: Book of abstracts

    International Nuclear Information System (INIS)

    This document contains the abstracts of 105 papers presented at the Congress. Topics covered include the Escherichia coli nucleotide excision repair system, DNA repair in malignant transformations, defective DNA repair, and gene regulation

  8. Emerging roles of DNA-PK besides DNA repair.

    Science.gov (United States)

    Kong, Xianming; Shen, Ying; Jiang, Na; Fei, Xin; Mi, Jun

    2011-08-01

    The DNA-dependent protein kinase (DNA-PK) is a DNA-activated serine/threonine protein kinase, and abundantly expressed in almost all mammalian cells. The roles of DNA-PK in DNA-damage repair pathways, including non-homologous end-joining (NHEJ) repair and homologous recombinant (HR) repair, have been studied intensively. However, the high levels of DNA-PK in human cells are somewhat paradoxical in that it does not impart any increased ability to repair DNA damage. If DNA-PK essentially exceeds the demand for DNA damage repair, why do human cells universally express such high levels of this huge complex? DNA-PK has been recently reported to be involved in metabolic gene regulation in response to feeding/insulin stimulation; our studies have also suggested a role of DNA-PK in the regulation of the homeostasis of cell proliferation. These novel findings expand our horizons about the importance of DNA-PK. PMID:21514376

  9. DNA repair in human bronchial epithelial cells

    International Nuclear Information System (INIS)

    The purpose of this investigation was to compare the response of human cell types (bronchial epithelial cells and fibroblasts and skin fibroblasts) to various DNA damaging agents. Repair of DNA single strand breaks (SSB) induced by 5 krads of X-ray was similar for all cell types; approximately 90% of the DNA SSB were rejoined within one hour. During excision repair of DNA damage from u.v.-radiation, the frequencies of DNA SSB as estimated by the alkaline elution technique, were similar in all cell types. Repair replication as measured by BND cellulose chromatography was also similar in epithelial and fibroblastic cells after u.v.-irradiation. Similar levels of SSB were also observed in epithelial and fibroblastic cells after exposure to chemical carcinogens: 7,12-dimethylbenz[a]anthracene; benzo[a]pyrene diol epoxide (BPDE); or N-methyl-N-nitro-N-nitrosoguanidine. Significant repair replication of BPDE-induced DNA damage was detected in both bronchial epithelial and fibroblastic cells, although the level in fibroblasts was approximately 40% of that in epithelial cells. The pulmonary carcinogen asbestos did not damage DNA. DNA-protein crosslinks induced by formaldehyde were rapidly removed in bronchial cells. Further, epithelial and fibroblastic cells, which were incubated with formaldehyde and the polymerase inhibitor combination of cytosine arabinoside and hydroxyurea, accumulated DNA SSB at approximately equal frequencies. These results should provide a useful background for further investigations of the response of human bronchial cells to various DNA damaging agents

  10. DNA strand breakage by 125I-decay in a synthetic oligodeoxynucleotide. Fragment distribution and evaluation of DMSO protection effect

    International Nuclear Information System (INIS)

    A double stranded oligodeoxynucleotide containing a single 125I-dC in a defined location was used to investigate DNA strand breakage resulting from 125I decay. Samples of a 41 bp oligodeoxynucleotide were incubated in 20 mM phosphate buffer (PB), or PB plus 2 M dimethylsulphoxide (DMSO), at 4 C during 18-20 days. The 32P-5'-end labelled DNA fragments produced by 125I decays were separated on denaturing polyacrylamide gels, and the 32P activity in each fragment was determined by scintillation counting after elution of fragments from gel. Most of the breaks, around 90%, occurred within 4-5 nucleotides of the 125I-dC, but DNA breaks were detected up to 16 nucleotides from the decay site. The 125I-dC was located at the 21st nucleotide from the 32P-5'-end label, and since 32P was not detected in fragments longer than 20 nucleotides, it was assumed that all 125I decay events produce at least one break in the 125I-labelled DNA strand. The results show a considerable protection effect of DMSO on DNA breaks at sites >5-6 nucleotides from the 125I location. The probability of breaks in this region was decreased with DMSO by a factor of 2 to 8-fold, suggesting significant role for radical-mediated DNA breaks at the more distant sites. However, the total protection effect of DMSO is rather small: 1.1, because of the small contribution of breakage at distant sites to the total yield. (orig.)

  11. Human DNA repair and recombination genes

    International Nuclear Information System (INIS)

    Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identified. At least seven of these genes are probably essential for repair and at least six of them control the incision step. The many genes required for repair of DNA cross-linking damage show overlap with those involved in the repair of uv damage, but some of these genes appear to be unique for cross-link repair. Two genes residing on human chromosome 19 were cloned from genomic transformants using a cosmid vector, and near full-length cDNA clones of each gene were isolated and sequenced. Gene ERCC2 efficiently corrects the defect in CHO UV5, a nucleotide excision repair mutant. Gene XRCC1 normalizes repair of strand breaks and the excessive sister chromatid exchange in CHO mutant EM9. ERCC2 shows a remarkable /approximately/52% overall homology at both the amino acid and nucleotide levels with the yeast RAD3 gene. Evidence based on mutation induction frequencies suggests that ERCC2, like RAD3, might also be an essential gene for viability. 100 refs., 4 tabs

  12. Role of Fanconi Anemia FANCG in Preventing Double-Strand Breakage and Chromosomal Rearrangement during DNA Replication

    Energy Technology Data Exchange (ETDEWEB)

    Tebbs, R S; Hinz, J M; Yamada, N A; Wilson, J B; Jones, N J; Salazar, E P; Thomas, C B; Jones, I M; Thompson, L H

    2003-10-04

    The Fanconi anemia (FA) proteins overlap with those of homologous recombination through FANCD1/BRCA2, but the biochemical functions of other FA proteins are unknown. By constructing and characterizing a null fancg mutant of hamster CHO cells, we present several new insights for FA. The fancg cells show a broad sensitivity to genotoxic agents, not supporting the conventional concept of sensitivity to only DNA crosslinking agents. The aprt mutation rate is normal, but hprt mutations are reduced, which we ascribe to the lethality of large deletions. CAD and dhfr gene amplification rates are increased, implying excess chromosomal breakage during DNA replication, and suggesting amplification as a contributing factor to cancer-proneness in FA patients. In S-phase cells, both spontaneous and mutagen-induced Rad51 nuclear foci are elevated. These results support a model in which FancG protein helps to prevent collapse of replication forks by allowing translesion synthesis or lesion bypass through homologous recombination.

  13. Calcitriol-copper interaction leads to non enzymatic, reactive oxygen species mediated DNA breakage and modulation of cellular redox scavengers in hepatocellular carcinoma.

    Science.gov (United States)

    Rizvi, Asim; Farhan, Mohd; Naseem, Imrana; Hadi, S M

    2016-09-01

    Calcitriol is the metabolically active form of Vitamin D and is known to kill cancer cells. Using the rat model of DEN induced hepatocellular carcinoma we show that there is a marked increase in cellular levels of copper in hepatocellular carcinoma and that calcitriol-copper interaction leads to reactive oxygen species mediated DNA breakage selectively in hepatocellular carcinoma cells. In vivo studies show that calcitriol selectively induces severe fluctuations in cellular enzymatic and non enzymatic scavengers of reactive oxygen species in the malignant tissue. Lipid peroxidation, a well established marker of oxidative stress, was found to increase, and substantial cellular DNA breakage was observed. We propose that calcitriol is a proxidant in the cellular milieu of hepatocellular carcinoma cells, and this copper mediated prooxidant action of calcitriol causes selective DNA breakage in malignant cells, while sparing normal (non malignant) cells. PMID:27343126

  14. Chromatin challenges during DNA replication and repair

    DEFF Research Database (Denmark)

    Groth, Anja; Rocha, Walter; Verreault, Alain;

    2007-01-01

    Inheritance and maintenance of the DNA sequence and its organization into chromatin are central for eukaryotic life. To orchestrate DNA-replication and -repair processes in the context of chromatin is a challenge, both in terms of accessibility and maintenance of chromatin organization. To meet the...... challenge of maintenance, cells have evolved efficient nucleosome-assembly pathways and chromatin-maturation mechanisms that reproduce chromatin organization in the wake of DNA replication and repair. The aim of this Review is to describe how these pathways operate and to highlight how the epigenetic...

  15. DNA repair mechanism in radioresistant bacteria

    International Nuclear Information System (INIS)

    Many radiation resistant bacteria have been isolated from various sources which are not in high background field. Since Deinococcus radiodurans had been isolated first in 1956, studies on the mechanism for radioresistance were carried out mostly using this bacterium. DNA in this bacterium isn't protected against injury induced by not only ionizing radiation but also ultraviolet light. Therefore, DNA damages induced by various treatments are efficiently and accurately repaired in this cells. Damages in base and/or sugar in DNA are removed by endonucleases which, if not all, are synthesized during postirradiation incubation. Following the endonucleolytic cleavage the strand scissions in DNA are seemed to be rejoined by a process common for the repair of strand scissions induced by such as ionizing radiations. Induce protein(s) is also involved in this rejoining process of strand scissions. DNA repair genes were classified into three phenotypic groups. (1)Genes which are responsible for the endonucleolytic activities. (2) Genes involved in the rejoining of DNA strand scissions. (3) Genes which participate in genetic recombination and repair. Three genes belong to (1) and (2) were cloned onto approximately 1 kbp DNA fragments which base sequences have been determined. (author)

  16. Electrically monitoring DNA repair by photolyase

    OpenAIRE

    Derosa, Maria C.; Sancar, Aziz; Barton, Jacqueline K.

    2005-01-01

    Cyclobutane pyrimidine dimers are the major DNA photoproducts produced upon exposure to UV radiation. If left unrepaired, these lesions can lead to replication errors, mutation, and cell death. Photolyase is a light-activated flavoenzyme that binds to pyrimidine dimers in DNA and repairs them in a reaction triggered by electron transfer from the photoexcited flavin cofactor to the dimer. Using gold electrodes modified with DNA duplexes containing a cyclobutane thymine dimer (T T), here we pr...

  17. DNA repair variants and breast cancer risk.

    Science.gov (United States)

    Grundy, Anne; Richardson, Harriet; Schuetz, Johanna M; Burstyn, Igor; Spinelli, John J; Brooks-Wilson, Angela; Aronson, Kristan J

    2016-05-01

    A functional DNA repair system has been identified as important in the prevention of tumour development. Previous studies have hypothesized that common polymorphisms in DNA repair genes could play a role in breast cancer risk and also identified the potential for interactions between these polymorphisms and established breast cancer risk factors such as physical activity. Associations with breast cancer risk for 99 single nucleotide polymorphisms (SNPs) from genes in ten DNA repair pathways were examined in a case-control study including both Europeans (644 cases, 809 controls) and East Asians (299 cases, 160 controls). Odds ratios in both additive and dominant genetic models were calculated separately for participants of European and East Asian ancestry using multivariate logistic regression. The impact of multiple comparisons was assessed by correcting for the false discovery rate within each DNA repair pathway. Interactions between several breast cancer risk factors and DNA repair SNPs were also evaluated. One SNP (rs3213282) in the gene XRCC1 was associated with an increased risk of breast cancer in the dominant model of inheritance following adjustment for the false discovery rate (P breast cancer risk or their modification by breast cancer risk factors were observed. Environ. Mol. Mutagen. 57:269-281, 2016. © 2016 Wiley Periodicals, Inc. PMID:27060854

  18. Regulation of DNA repair by parkin

    International Nuclear Information System (INIS)

    Mutation of parkin is one of the most prevalent causes of autosomal recessive Parkinson's disease (PD). Parkin is an E3 ubiquitin ligase that acts on a variety of substrates, resulting in polyubiquitination and degradation by the proteasome or monoubiquitination and regulation of biological activity. However, the cellular functions of parkin that relate to its pathological involvement in PD are not well understood. Here we show that parkin is essential for optimal repair of DNA damage. Parkin-deficient cells exhibit reduced DNA excision repair that can be restored by transfection of wild-type parkin, but not by transfection of a pathological parkin mutant. Parkin also protects against DNA damage-induced cell death, an activity that is largely lost in the pathological mutant. Moreover, parkin interacts with the proliferating cell nuclear antigen (PCNA), a protein that coordinates DNA excision repair. These results suggest that parkin promotes DNA repair and protects against genotoxicity, and implicate DNA damage as a potential pathogenic mechanism in PD.

  19. Amifostine Protection Against Mitomycin-induced Chromosomal Breakage in Fanconi Anaemia Lymphocytes

    OpenAIRE

    Lopes, Miriam T. P.; Salas, Carlos E.; Fernanda S. G. Kehdy; Camelo, Ricardo M.

    2008-01-01

    Fanconi anaemia (FA) is a rare genetic chromosomal instability syndrome caused by impairment of DNA repair and reactive oxygen species (ROS) imbalance. This disease is also related to bone marrow failure and cancer. Treatment of these complications with radiation and alkylating agents may enhance chromosomal breakage. We have evaluated the effect of amifostine (AMF) on basal and mitomycin C (MMC)-induced chromosomal breakage in FA blood cells using the micronucleus assay. The basal micronucle...

  20. Homologous recombination in DNA repair and DNA damage tolerance

    Institute of Scientific and Technical Information of China (English)

    Xuan Li; Wolf-Dietrich Heyer

    2008-01-01

    Homologous recombination (HR) comprises a series of interrelated pathways that function in the repair of DNA double-stranded breaks (DSBs) and interstrand crosslinks (ICLs). In addition, recombination provides critical sup-port for DNA replication in the recovery of stalled or broken replication forks, contributing to tolerance of DNA damage. A central core of proteins, most critically the RecA homolog Rad51, catalyzes the key reactions that typify HR: homology search and DNA strand invasion. The diverse functions of recombination are reflected in the need for context-specific factors that perform supplemental functions in conjunction with the core proteins. The inability to properly repair complex DNA damage and resolve DNA replication stress leads to genomic instability and contributes to cancer etiology. Mutations in the BRCA2 recombination gene cause predisposition to breast and ovarian cancer as well as Fanconi anemia, a cancer predisposition syndrome characterized by a defect in the repair of DNA interstrand crosslinks. The cellular functions of recombination are also germane to DNA-based treatment modaUties of cancer, which target replicating cells by the direct or indirect induction of DNA lesions that are substrates for recombination pathways. This review focuses on mechanistic aspects of HR relating to DSB and ICL repair as well as replication fork support.

  1. DNA repair: keeping it together

    DEFF Research Database (Denmark)

    Lisby, Michael; Rothstein, Rodney

    2004-01-01

    A protein scaffold has been identified that holds a chromosome together in the event of a DNA double-strand break. This scaffold is dependent on Rad52 and the Rad50-Mre11-Xrs2 complex and withstands the pulling forces of the mitotic spindle during DNA damage checkpoint arrest.......A protein scaffold has been identified that holds a chromosome together in the event of a DNA double-strand break. This scaffold is dependent on Rad52 and the Rad50-Mre11-Xrs2 complex and withstands the pulling forces of the mitotic spindle during DNA damage checkpoint arrest....

  2. Calculation of DNA strand breakage by neutralisation effect after 125I decays in a synthetic oligodeoxynucleotide using charge transfer theory

    International Nuclear Information System (INIS)

    The decay of the radioisotope 125I into 125Te is typically followed by the emission of two groups of approximately 10 electrons each via Auger processes. In deoxyribonucleic acid (DNA) with 125I incorporated, these electrons produce various types of damage to DNA, e.g. single strand breaks (SSBs) and double strand breaks (DSBs) through direct actions of physical tracks, or indirect actions of radicals produced in water. Among the direct actions one should consider not only the excitation and ionisation of DNA by Auger electrons, but also the neutralisation of highly charged 125mTe ions with electrons from neighbouring molecules. Comparison between experiment and simulation done recently revealed that without including neutralisation effect the simulated yield of SSBs was 50% less than the measured result. In the present work a calculation of DNA strand breakage by the neutralization effect in a 41-mer synthetic oligodeoxynucleotide (oligo-DNA) model was done using the charge transfer theory. Calculation based on transfer rate using the newly evaluated electronic coupling of DNA bases showed that the positive charge (hole) transfer rate is of the order of magnitudes of several 1013s-1, implying that a charge higher than 10 units might not build on a 125mTe atom. The potential energy accumulated on the decay base is transferred to bases along the DNA chain nearby and destroys those bases and ionises the sugar-phosphate group, leading a DNA SSB with a frequency of 0.2% per eV in average. (authors)

  3. DNA-mediated charge transport for DNA repair

    OpenAIRE

    Boon, Elizabeth M; Livingston, Alison L.; Chmiel, Nikolas H.; David, Sheila S.; Barton, Jacqueline K.

    2003-01-01

    MutY, like many DNA base excision repair enzymes, contains a [4Fe4S](2+) cluster of undetermined function. Electrochemical studies of MutY bound to a DNA-modified gold electrode demonstrate that the [4Fe4S] cluster of MutY can be accessed in a DNA-mediated redox reaction. Although not detectable without DNA, the redox potential of DNA-bound MutY is approximate to275 mV versus NHE, which is characteristic of HiPiP iron proteins. Binding to DNA is thus associated with a change in [4Fe4S](3+/2+)...

  4. Repair of DNA-containing pyrimidine dimers

    International Nuclear Information System (INIS)

    Ultraviolet light-induced pyrimidine dimers in DNA are recognized and repaired by a number of unique cellular surveillance systems. The most direct biochemical mechanism responding to this kind of genotoxicity involves direct photoreversal by flavin enzymes that specifically monomerize pyrimidine:pyrimidine dimers monophotonically in the presence of visible light. Incision reactions are catalyzed by a combined pyrimidine dimer DNA-glycosylase:apyrimidinic endonuclease found in some highly UV-resistant organisms. At a higher level of complexity, Escherichia coli has a uvr DNA repair system comprising the UvrA, UvrB, and UvrC proteins responsible for incision. There are several preincision steps governed by this pathway, which includes an ATP-dependent UvrA dimerization reaction required for UvrAB nucleoprotein formation. This complex formation driven by ATP binding is associated with localized topological unwinding of DNA. This same protein complex can catalyze an ATPase-dependent 5'----3'-directed strand displacement of D-loop DNA or short single strands annealed to a single-stranded circular or linear DNA. This putative translocational process is arrested when damaged sites are encountered. The complex is now primed for dual incision catalyzed by UvrC. The remainder of the repair process involves UvrD (helicase II) and DNA polymerase I for a coordinately controlled excision-resynthesis step accompanied by UvrABC turnover. Furthermore, it is proposed that levels of repair proteins can be regulated by proteolysis. UvrB is converted to truncated UvrB* by a stress-induced protease that also acts at similar sites on the E. coli Ada protein. Although UvrB* can bind with UvrA to DNA, it cannot participate in helicase or incision reactions. It is also a DNA-dependent ATPase.21 references

  5. Repair of DNA-containing pyrimidine dimers

    Energy Technology Data Exchange (ETDEWEB)

    Grossman, L.; Caron, P.R.; Mazur, S.J.; Oh, E.Y.

    1988-08-01

    Ultraviolet light-induced pyrimidine dimers in DNA are recognized and repaired by a number of unique cellular surveillance systems. The most direct biochemical mechanism responding to this kind of genotoxicity involves direct photoreversal by flavin enzymes that specifically monomerize pyrimidine:pyrimidine dimers monophotonically in the presence of visible light. Incision reactions are catalyzed by a combined pyrimidine dimer DNA-glycosylase:apyrimidinic endonuclease found in some highly UV-resistant organisms. At a higher level of complexity, Escherichia coli has a uvr DNA repair system comprising the UvrA, UvrB, and UvrC proteins responsible for incision. There are several preincision steps governed by this pathway, which includes an ATP-dependent UvrA dimerization reaction required for UvrAB nucleoprotein formation. This complex formation driven by ATP binding is associated with localized topological unwinding of DNA. This same protein complex can catalyze an ATPase-dependent 5'----3'-directed strand displacement of D-loop DNA or short single strands annealed to a single-stranded circular or linear DNA. This putative translocational process is arrested when damaged sites are encountered. The complex is now primed for dual incision catalyzed by UvrC. The remainder of the repair process involves UvrD (helicase II) and DNA polymerase I for a coordinately controlled excision-resynthesis step accompanied by UvrABC turnover. Furthermore, it is proposed that levels of repair proteins can be regulated by proteolysis. UvrB is converted to truncated UvrB* by a stress-induced protease that also acts at similar sites on the E. coli Ada protein. Although UvrB* can bind with UvrA to DNA, it cannot participate in helicase or incision reactions. It is also a DNA-dependent ATPase.21 references.

  6. Mutagenesis and DNA repair in mammalian cells

    International Nuclear Information System (INIS)

    Two aspects of DNA damage and repair in mammalian cells were investigated. Using a lambda phage shuttle vector, a system was developed to study mutations arising in the DNA of mammalian cells. This system was used to determine the spectrum of mutations induced in cellular DNA by ultraviolet light. Also, the repair of base pair mismatches in DNA was studied by the development of a method to detect a DNA mismatch repair activity in extracts made from cultured human cells. In order to study mutations arising in mammalian cells, stable mouse L cell lines were established with multiple copies of lambda phage vector which contains the supF gene of E. coli as a target for mutagenesis. Rescue of viable phage from high molecular weight mouse cell DNA using lambda in vitro packaging extracts was efficient and yielded a negligible background of phage with mutations in the supF gene. From mouse cells exposed to 12 J/m2 of 254 nm ultraviolet (UV) light, 78,510 phage were rescued of which eight were found to have mutant supF genes. DNA sequence analysis of the mutants suggests that the primary site of UV mutagenesis in mammalian cells is at pyrimidine-cytosine (Py-C) sequences, and that the most frequent mutation at this site is a C to T transition

  7. Fragile DNA Repair Mechanism Reduces Ageing in Multicellular Model

    DEFF Research Database (Denmark)

    Bendtsen, Kristian Moss; Juul, Jeppe Søgaard; Trusina, Ala

    2012-01-01

    DNA damages, as well as mutations, increase with age. It is believed that these result from increased genotoxic stress and decreased capacity for DNA repair. The two causes are not independent, DNA damage can, for example, through mutations, compromise the capacity for DNA repair, which in turn...... increases the amount of unrepaired DNA damage. Despite this vicious circle, we ask, can cells maintain a high DNA repair capacity for some time or is repair capacity bound to continuously decline with age? We here present a simple mathematical model for ageing in multicellular systems where cells subjected...... to DNA damage can undergo full repair, go apoptotic, or accumulate mutations thus reducing DNA repair capacity. Our model predicts that at the tissue level repair rate does not continuously decline with age, but instead has a characteristic extended period of high and non-declining DNA repair...

  8. Assessment of Human DNA Repair (NER) Capacity With DNA Repair Rate (DRR) by Comet Assay

    Institute of Scientific and Technical Information of China (English)

    WEI ZHENG; JI-LIANG HE; LI-FEN JIN; JIAN-LIN LOU; BAO-HONG WANG

    2005-01-01

    Objective Alkaline comet assay was used to evaluate DNA repair (nucleotide excision repair, NER) capacity of human fresh lymphocytes from 12 young healthy non-smokers (6 males and 6 females). Methods Lymphocytes were exposed to UV-C (254 nm) at the dose rate of 1.5 J/m2/sec. Novobiocin (NOV) and aphidicolin (APC), DNA repair inhibitors, were utilized to imitate the deficiency of DNA repair capacity at the incision and ligation steps of NER. Lymphocytes from each donor were divided into three grougs: UVC group, UVC plus NOV group, and UVC plus APC group. DNA single strand breaks were detected in UVC irradiated cells incubated for 0, 30, 60, 90, 120, 180, and 240 min after UVC irradiation. DNA repair rate (DRR) served as an indicator of DNA repair capacity. Results The results indicated that the maximum DNA damage (i.e. maximum tail length) in the UVC group mainly appeared at 90 min. The ranges of DRRs in the UVC group were 62.84%-98.71%. Average DRR value was 81.84%. The DRR difference between males and females was not significant (P<0.05). However, the average DRR value in the UVC plus NOV group and the UVC plus APC group was 52.98% and 39.57% respectively, which were significantly lower than that in the UVC group (P<0.01). Conclusion The comet assay is a rapid, simple and sensitive screening test to assess individual DNA repair (NER) capacity. It is suggested that the time to detect DNA single strand breaks in comet assay should include 0 (before UV irradiation), 90 and 240 min after exposure to 1.5 J·m-2 UVC at least. The DRR, as an indicator, can represent the individual DNA repair capacity in comet assay.

  9. Ancient bacteria show evidence of DNA repair

    DEFF Research Database (Denmark)

    Johnson, Sarah Stewart; Hebsgaard, Martin B; Christensen, Torben R;

    2007-01-01

    geological timescales. There has been no direct evidence in ancient microbes for the most likely mechanism, active DNA repair, or for the metabolic activity necessary to sustain it. In this paper, we couple PCR and enzymatic treatment of DNA with direct respiration measurements to investigate long...... this long-term survival is closely tied to cellular metabolic activity and DNA repair that over time proves to be superior to dormancy as a mechanism in sustaining bacteria viability.......-term survival of bacteria sealed in frozen conditions for up to one million years. Our results show evidence of bacterial survival in samples up to half a million years in age, making this the oldest independently authenticated DNA to date obtained from viable cells. Additionally, we find strong evidence that...

  10. Mechanisms of mutagenesis and DNA repair

    International Nuclear Information System (INIS)

    The research deals with mechanisms of excision repair in Escherichia coli exposed to chemicals or ultraviolet (uv) radiation. During the past year attention has been focused on the incision proteins that initiate removal of pyrimidine dimers, benzo[a]pyrene adducts, and other bulky lesions from DNA. The product of the E. Coli uvrD gene was isolated and shown to be important in mediating closure of single strand DNA breaks promoted by the incision complex coded for by the uvrA, uvrB, and uvrC gene products. This suggests that the uvrD gene product (now known to be a helicase) is necessary either for dislodging the incision complex from the nicked DNA or for preparing a DNA primer-template configuration suitable for proper repair resynthesis

  11. Monophosphate end groups produced in radiation induced strand breakage in DNA

    International Nuclear Information System (INIS)

    A solution of DNA was gamma-irradiated and treated with monophosphatase for studies on the amount of inorganic phosphate released as a function of time. Studies were also conducted on: effect of alkali on yield of monophosphate end groups; induction of DNA strand breaks by treatment with DNAase; initial G values for monophosphate termini; and effect of alkali on radioinduced DNA damage

  12. DNA repair genotypes and phenotypes and cancer susceptibility

    Institute of Scientific and Technical Information of China (English)

    Qingyi Wei

    2008-01-01

    @@ The role of DNA repair in the etiology of cancers has been well illustrated in several hereditary syndromes, in which an inherited defect in DNA repair and related biological processes is associated with extraordinarily high incidence of cancer.

  13. Epigenetic reduction of DNA repair in progression togastrointestinal cancer

    Institute of Scientific and Technical Information of China (English)

    2015-01-01

    Deficiencies in DNA repair due to inherited germ-linemutations in DNA repair genes cause increased risk ofgastrointestinal (GI) cancer. In sporadic GI cancers,mutations in DNA repair genes are relatively rare.However, epigenetic alterations that reduce expressionof DNA repair genes are frequent in sporadic GI cancers.These epigenetic reductions are also found in fielddefects that give rise to cancers. Reduced DNA repairlikely allows excessive DNA damages to accumulatein somatic cells. Then either inaccurate translesionsynthesis past the un-repaired DNA damages or errorproneDNA repair can cause mutations. ErroneousDNA repair can also cause epigenetic alterations (i.e. ,epimutations, transmitted through multiple replicationcycles). Some of these mutations and epimutations maycause progression to cancer. Thus, deficient or absentDNA repair is likely an important underlying cause ofcancer. Whole genome sequencing of GI cancers showthat between thousands to hundreds of thousands ofmutations occur in these cancers. Epimutations thatreduce DNA repair gene expression and occur early inprogression to GI cancers are a likely source of this highgenomic instability. Cancer cells deficient in DNA repairare more vulnerable than normal cells to inactivation byDNA damaging agents. Thus, some of the most clinicallyeffective chemotherapeutic agents in cancer treatmentare DNA damaging agents, and their effectivenessoften depends on deficient DNA repair in cancer cells.Recently, at least 18 DNA repair proteins, each activein one of six DNA repair pathways, were found to besubject to epigenetic reduction of expression in GIcancers. Different DNA repair pathways repair differenttypes of DNA damage. Evaluation of which DNA repairpathway(s) are deficient in particular types of GI cancerand/or particular patients may prove useful in guidingchoice of therapeutic agents in cancer therapy.

  14. Molecular mechanisms of mutagenesis and DNA repair

    International Nuclear Information System (INIS)

    Most organisms including man have evolved ways to handle damage produce in DNA by environmental agents including chemical mutagens and carcinogens. The process of repair of some types of damage is highly regulated in a tissue and cell line-specific fashion and varies from organism to organism. Thus, the ultimate biological effects of the lesions depend not only on the extent of their formation but on the efficiency of their removal as well. The research objectives of this laboratory are to elucidate the mechanism and regulation of repair of damage in DNA produced by simple alkylating mutagens and carcinogens, as well as the mutagenic changes in DNA produced as a result of persistence of unrepaired lesions. Specifically, the current topics of the authors research are (1) to elucidate the enzymatic mechanism of the human repair enzyme, DNA-O6-methylguanine methyltransferase, and to determine the molecular mechanism of its regulation and (2) to study the nature of mutations induced by the presence of alkylated bases and ionizing radiation-damaged bases in DNA using shuttle plasmids that replicate both in human cells and E. coli. The following report on last year's experiments bear upon the first objective

  15. Energy and Technology Review: Unlocking the mysteries of DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Quirk, W.A.

    1993-04-01

    DNA, the genetic blueprint, has the remarkable property of encoding its own repair following diverse types of structural damage induced by external agents or normal metabolism. We are studying the interplay of DNA damaging agents, repair genes, and their protein products to decipher the complex biochemical pathways that mediate such repair. Our research focuses on repair processes that correct DNA damage produced by chemical mutagens and radiation, both ionizing and ultraviolet. The most important type of DNA repair in human cells is called excision repair. This multistep process removes damaged or inappropriate pieces of DNA -- often as a string of 29 nucleotides containing the damage -- and replaces them with intact ones. We have isolated, cloned, and mapped several human repair genes associated with the nucleotide excision repair pathway and involved in the repair of DNA damage after exposure to ultraviolet light or mutagens in cooked food. We have shown that a defect in one of these repair genes, ERCC2, is responsible for the repair deficiency in one of the groups of patients with the recessive genetic disorder xeroderma pigmentosum (XP group D). We are exploring ways to purify sufficient quantities (milligrams) of the protein products of these and other repair genes so that we can understand their functions. Our long-term goals are to link defective repair proteins to human DNA repair disorders that predispose to cancer, and to produce DNA-repair-deficient mice that can serve as models for the human disorders.

  16. Fragile DNA repair mechanism reduces ageing in multicellular model.

    Directory of Open Access Journals (Sweden)

    Kristian Moss Bendtsen

    Full Text Available DNA damages, as well as mutations, increase with age. It is believed that these result from increased genotoxic stress and decreased capacity for DNA repair. The two causes are not independent, DNA damage can, for example, through mutations, compromise the capacity for DNA repair, which in turn increases the amount of unrepaired DNA damage. Despite this vicious circle, we ask, can cells maintain a high DNA repair capacity for some time or is repair capacity bound to continuously decline with age? We here present a simple mathematical model for ageing in multicellular systems where cells subjected to DNA damage can undergo full repair, go apoptotic, or accumulate mutations thus reducing DNA repair capacity. Our model predicts that at the tissue level repair rate does not continuously decline with age, but instead has a characteristic extended period of high and non-declining DNA repair capacity, followed by a rapid decline. Furthermore, the time of high functionality increases, and consequently slows down the ageing process, if the DNA repair mechanism itself is vulnerable to DNA damages. Although counterintuitive at first glance, a fragile repair mechanism allows for a faster removal of compromised cells, thus freeing the space for healthy peers. This finding might be a first step toward understanding why a mutation in single DNA repair protein (e.g. Wrn or Blm is not buffered by other repair proteins and therefore, leads to severe ageing disorders.

  17. DNA repair in cancer: emerging targets for personalized therapy

    International Nuclear Information System (INIS)

    Genomic deoxyribonucleic acid (DNA) is under constant threat from endogenous and exogenous DNA damaging agents. Mammalian cells have evolved highly conserved DNA repair machinery to process DNA damage and maintain genomic integrity. Impaired DNA repair is a major driver for carcinogenesis and could promote aggressive cancer biology. Interestingly, in established tumors, DNA repair activity is required to counteract oxidative DNA damage that is prevalent in the tumor microenvironment. Emerging clinical data provide compelling evidence that overexpression of DNA repair factors may have prognostic and predictive significance in patients. More recently, DNA repair inhibition has emerged as a promising target for anticancer therapy. Synthetic lethality exploits intergene relationships where the loss of function of either of two related genes is nonlethal, but loss of both causes cell death. Exploiting this approach by targeting DNA repair has emerged as a promising strategy for personalized cancer therapy. In the current review, we focus on recent advances with a particular focus on synthetic lethality targeting in cancer

  18. Repair of nonreplicating UV-irradiated DNA

    Energy Technology Data Exchange (ETDEWEB)

    Martin, S.J.; Hays, J.B.

    1986-05-01

    Repair of irradiated phage lambda DNA in E. coli has been studied by a repressed-infection system: superinfection of homoimmune lysogenic bacteria; assay for restoration of transcribility to phage-encoded lac genes; extraction of DNA and assay for infectivity in transfection of uvrB/sup -/ recA/sup -/ recB/sup -/ spheroplasts, and for removal of cyclobutane pyrimidine dimers (CBP-dimers) by UV-endonuclease treatment and alkaline sedimentation. In uvr/sup +/ repressed infections with 254-nm irradiated phages (60 J/m/sup 2/) lac transcription was rapidly returned to undamaged levels, concomitant with restoration of infectivity and removal of CBP-dimers. In uvrD/sup -/ cells, the frequency of phage gene inactivation corresponded to the estimated frequency of CBP-dimers per gene. In uvrA/sup -/ bacteria, however, lac expression was only 1/10 to 1/3 of that predicted by the expected frequency of gene inactivation, as if damage elsewhere affected transcription; recovery of infectivity and removal of CBP-dimers was almost completely inhibited. lac/sup +/ and lacUV5 phages, expected to respond oppositely to changes in superhelical density, were constructed as probes for topological changes during DNA repair. The assays for transfection infectivity and CBP-dimer-removal have been extended to studies of repair of UV-irradiated phage DNA injected into oocytes of the frog Xenopus laevis.

  19. Repair of nonreplicating UV-irradiated DNA

    International Nuclear Information System (INIS)

    Repair of irradiated phage λ DNA in E. coli has been studied by a repressed-infection system: superinfection of homoimmune lysogenic bacteria; assay for restoration of transcribility to phage-encoded lac genes; extraction of DNA and assay for infectivity in transfection of uvrB- recA- recB- spheroplasts, and for removal of cyclobutane pyrimidine dimers (CBP-dimers) by UV-endonuclease treatment and alkaline sedimentation. In uvr+ repressed infections with 254-nm irradiated phages (60 J/m2) lac transcription was rapidly returned to undamaged levels, concomitant with restoration of infectivity and removal of CBP-dimers. In uvrD- cells, the frequency of phage gene inactivation corresponded to the estimated frequency of CBP-dimers per gene. In uvrA- bacteria, however, lac expression was only 1/10 to 1/3 of that predicted by the expected frequency of gene inactivation, as if damage elsewhere affected transcription; recovery of infectivity and removal of CBP-dimers was almost completely inhibited. lac+ and lacUV5 phages, expected to respond oppositely to changes in superhelical density, were constructed as probes for topological changes during DNA repair. The assays for transfection infectivity and CBP-dimer-removal have been extended to studies of repair of UV-irradiated phage DNA injected into oocytes of the frog Xenopus laevis

  20. Stripped-down DNA repair in a highly reduced parasite

    Directory of Open Access Journals (Sweden)

    Fast Naomi M

    2007-03-01

    Full Text Available Abstract Background Encephalitozoon cuniculi is a member of a distinctive group of single-celled parasitic eukaryotes called microsporidia, which are closely related to fungi. Some of these organisms, including E. cuniculi, also have uniquely small genomes that are within the prokaryotic range. Thus, E. cuniculi has undergone a massive genome reduction which has resulted in a loss of genes from diverse biological pathways, including those that act in DNA repair. DNA repair is essential to any living cell. A loss of these mechanisms invariably results in accumulation of mutations and/or cell death. Six major pathways of DNA repair in eukaryotes include: non-homologous end joining (NHEJ, homologous recombination repair (HRR, mismatch repair (MMR, nucleotide excision repair (NER, base excision repair (BER and methyltransferase repair. DNA polymerases are also critical players in DNA repair processes. Given the close relationship between microsporidia and fungi, the repair mechanisms present in E. cuniculi were compared to those of the yeast Saccharomyces cerevisiae to ascertain how the process of genome reduction has affected the DNA repair pathways. Results E. cuniculi lacks 16 (plus another 6 potential absences of the 56 DNA repair genes sought via BLASTP and PSI-BLAST searches. Six of 14 DNA polymerases or polymerase subunits are also absent in E. cuniculi. All of these genes are relatively well conserved within eukaryotes. The absence of genes is not distributed equally among the different repair pathways; some pathways lack only one protein, while there is a striking absence of many proteins that are components of both double strand break repair pathways. All specialized repair polymerases are also absent. Conclusion Given the large number of DNA repair genes that are absent from the double strand break repair pathways, E. cuniculi is a prime candidate for the study of double strand break repair with minimal machinery. Strikingly, all of the

  1. Surface area as a dose metric for carbon black nanoparticles: A study of oxidative stress, DNA single-strand breakage and inflammation in rats

    Science.gov (United States)

    Chuang, Hsiao-Chi; Chen, Li-Chen; Lei, Yu-Chen; Wu, Kuen-Yuh; Feng, Po-Hao; Cheng, Tsun-Jen

    2015-04-01

    Combustion-derived nanoparticles are characterised by a high surface area (SA) per mass. SA is proposed to regulate the bioreactivity of nanoparticles; however, the dose metric for carbon black remains controversial. To determine the relationships between bioreactivity and SA, male spontaneously hypertensive rats were exposed to carbon black (CB) nanoparticles (15, 51 and 95 nm) via intratracheal instillation for 24 h. Pulmonary exposure to CB resulted in a significant increase in systemic 8-hydroxy-2‧-deoxyguanosine (8-OHdG), DNA single-strand breakages in peripheral blood cells and pulmonary cell infiltration in rats. The oxidative potential and particularly the corresponding SA of CB were correlated with the level of 8-OHdG, DNA single-strand breakages and pulmonary cell infiltration in rats. We conclude that SA is an important dose metric for CB that can regulate oxidative stress and DNA damage in rats. Furthermore, this observation was more significant for smaller sized CB.

  2. 5-bp Classical Satellite DNA Loci from Chromosome-1 Instability in Cervical Neoplasia Detected by DNA Breakage Detection/Fluorescence in Situ Hybridization (DBD-FISH

    Directory of Open Access Journals (Sweden)

    Jaime Gosálvez

    2013-02-01

    Full Text Available We aimed to evaluate the association between the progressive stages of cervical neoplasia and DNA damage in 5-bp classical satellite DNA sequences from chromosome-1 in cervical epithelium and in peripheral blood lymphocytes using DNA breakage detection/fluorescence in situ hybridization (DBD-FISH. A hospital-based unmatched case-control study was conducted in 2011 with a sample of 30 women grouped according to disease stage and selected according to histological diagnosis; 10 with low-grade squamous intraepithelial lesions (LG-SIL, 10 with high-grade SIL (HG-SIL, and 10 with no cervical lesions, from the Unidad Medica de Alta Especialidad of The Mexican Social Security Institute, IMSS, Mexico. Specific chromosome damage levels in 5-bp classical satellite DNA sequences from chromosome-1 were evaluated in cervical epithelium and peripheral blood lymphocytes using the DBD-FISH technique. Whole-genome DNA hybridization was used as a reference for the level of damage. Results of Kruskal-Wallis test showed a significant increase according to neoplastic development in both tissues. The instability of 5-bp classical satellite DNA sequences from chromosome-1 was evidenced using chromosome-orientation FISH. In conclusion, we suggest that the progression to malignant transformation involves an increase in the instability of 5-bp classical satellite DNA sequences from chromosome-1.

  3. The effect of mitotic inhibitors on DNA strand size and radiation-associated break repair in Down syndrome fibroblasts

    International Nuclear Information System (INIS)

    The effect of mitotic inhibitors on formation and repair of DNA breaks was studied in cultured fibroblasts from patients with Down syndrome in order to investigate the hypothesis that the karyotyping procedure itself may play a role in the increased chromosome breakage seen in these cells after gamma radiation exposure. Using the nondenaturing elution and alkaline elution techniques to examine fibroblasts from Down syndrome patients and from controls, no specific abnormalities in Down syndrome cells could be detected after exposure to mitotic inhibitors, including rate and extent of elution of DNA from filters as well as repair of radiation-induced DNA breaks. In both normal and Down syndrome cell strains, however, exposure to mitotic inhibitors was associated with a decrease in cellular DNA strand size, suggesting the presence of drug-induced DNA strand breaks. The mechanism of increased chromosome sensitivity of Down syndrome cells to gamma radiation remains unknown. (orig.)

  4. Use of recombinant DNA mollecules to study the repair of DNA damage and radiation mutagenesis

    International Nuclear Information System (INIS)

    Small recombinant genes, carried on plasmid DNA molecules, can be used in the analysis of radiation responses in mammalian cells. Examples are given to illustrate their use in studies on the repair of DNA strand breakage and on radiation mutagenesis. Some radiation-sensitive mutants, notably cells from patients with the human disorder ataxia-telangiectasia (A-T), appear to be normal in their ability to rejoin DNA doublestrand breaks (dsb) when measured with conventional biochemical methods. However, it is the fidelity of the dsb rejoining process that is important to gene function, and this can be measured using transferred recombinant DNA molecules in which 'model' dsb are precisely placed in a selectable gene. This approach has revealed that an A-T line shows a highly significant reduction in dsb rejoin fidelity compared to normal human cells, and a similar defect has been found in a new radiosensitive hamster cell mutant, irs1. In parallel with repair studies, we have developed the use of small recombinant genes as targets for mutation induction in mammalian cells. These genes are transferred into suitable recipient cells and selected for single-copy stable integration. Mutation by X-rays has revealed a variety of types of mutagenic change, provided a selectable marker gene is tagged to the target gene to stop complete deletion of the transferred molecule. We have also been studying a large set of mutants in a gene normally present in mammalian cells, and have found that ionising radiations give approximately 7+% large mutational changes (mostly large deletions), while a chemical mutagen gave exclusively small 'point' mutations

  5. Iodine-125 induced DNA strand breakage: Contributions of different physical and chemical radiation action mechanisms

    International Nuclear Information System (INIS)

    The decay of the radioisotope 125I into 125Te is typically followed by the emission of two groups of approximately 10 electrons each. In deoxyribonucleic acid (DNA) with 125I incorporated, these electrons produce various types of damage to DNA, e.g. single and double strand breaks. They occur through direct actions of physical tracks, or indirect actions of radicals produced in water. Among the direct actions one should consider not only the excitation and ionization of DNA by electrons but also the neutralization of highly charged 125mTe ions with electrons from neighboring molecules. The present work begins with a detailed description of electron tracks with the use of the PARTRAC code, compares results with recent experiments, and concludes with a firm assessment of the contribution to the strand break yields from the neutralization effect. (orig.)

  6. Polymorphisms in DNA Repair Genes, Smoking, and Pancreatic Adenocarcinoma Risk

    OpenAIRE

    Robert R McWilliams; William R Bamlet; Cunningham, Julie M.; Goode, Ellen L.; de ANDRADE, MARIZA; Lisa A Boardman; Petersen, Gloria M.

    2008-01-01

    Base excision repair and nucleotide excision repair are vital responses to multiple types of DNA damage, including damage from tobacco exposure. Single-nucleotide polymorphisms (SNP) in these pathways may affect DNA repair capacity and therefore influence risk for cancer development. We performed a clinic-based, case-control study comprising 481 consecutive patients with confirmed pancreatic adenocarcinoma and 625 healthy controls. Allele and genotype frequencies for 16 SNPs in DNA repair gen...

  7. Epigenetic changes of DNA repair genes in cancer

    Institute of Scientific and Technical Information of China (English)

    Christoph Lahtz; Gerd P. Pfeifer

    2011-01-01

    'Every Hour Hurts, The Last One Kills'. That is an old saying about getting old. Every day, thousands of DNA damaging events take place in each cell of our body, but efficient DNA repair systems have evolved to prevent that. However, our DNA repair system and that of most other organisms are not as perfect as that of Deinococcus radiodurans, for example, which is able to repair massive amounts of DNA damage at one time. In many instances, accumulation of DNA damage has been linked to cancer, and genetic deficiencies in specific DNA repair genes are associated with tumor-prone phenotypes. In addition to mutations, which can be either inherited or somatically acquired, epigenetic silencing of DNA repair genes may promote tumorigenesis. This review will summarize current knowledge of the epigenetic inactivation of different DNA repair components in human cancer.

  8. Prenatal diagnosis of ataxia-telangiectasia and Nijmegen Breakage Syndrome by the assay of radioresistant DNA synthesis

    International Nuclear Information System (INIS)

    Prenatal diagnosis was performed in 16 pregnancies at risk of ataxia-telangiectasia (A-T) or Nijmegen Breakage Syndrome (NBS). Radioresistant DNA synthesis (RDS) was investigated in cultured chorionic villus (CV) cells and/or amniotic fluid (AF) cells. In four pregnancies, an affected foetus was diagnosed with increased RDS in cultured CV cells. In three of the four cases confirmation of the diagnosis was obtained by analysis of AF cells and/or skin fibroblasts from the foetus cultured after termination of the pregnancy; in the fourth case a fibroblast culture from the aborted foetus failed. In one case, only AF cells could be analysed in a late stage of pregnancy; pregnancy was terminated due to intermediate/equivocal results but the foetus fibroblasts showed normal RDS. Normal RDS was demonstrated in the other 11 pregnancies at 25% risk either by analysis of CB cells (nine cases) or of AF cells (two cases). In some cases the (normal) results on the CV cells were corroborated by subsequent analysis of Af cells. The results suggest that RDS analysis of CV cells allows reliable prenatal diagnosis of A-T/NBS. However, amniocentesis may be necessary to confirm normal results on CV cells if the foetus is female (because of the risk of maternal cell contamination) or in the rare case of equivocal results. (author)

  9. DNA repair in proteus mirabilis. Pt. 4

    International Nuclear Information System (INIS)

    Post-irradiation DNA degradation in P. mirabilis rec+ strains after UV irradiation is found to be more extensive in starvation buffer than in growth medium. In growth medium restriction of protein synthesis, but not DNA synthesis, largely prevents the expression of 'breakdown limitation'. By the addition of chloramphenicol during post-irradiation incubation in growth medium the expression of breakdown limitation was followed and found to occur 20 to 40 min after UV irradiation. Pre-irradiation by a low dose of UV leads after a corresponding time of post-irradiation incubation to breakdown limitation even in starvation buffer after a second UV exposure. Post-irradiation DNA degradation is presumed to be initiated at the sites of DNA lesions which arise at replication points damaged by UV. While pre-starvation restricts the efficiency of postirradiation DNA degradation by the reduction of the number of replication points active at the time of irradiation, caffeine as well as 2.4-dinitrophenol inhibit DNA degradation even in rec- cells probably by the interference with nicking or exonucleoltytic events initiated at those sites in the absence of breakdown limitation. Breakdown limitation is postulated to be due to inducible derepression of REC-functions which lead to the protection and, probably, repair of DNA lesions arising at the replication points following UV exposure. (orig.)

  10. Nijmegen breakage syndrome (NBS

    Directory of Open Access Journals (Sweden)

    Chrzanowska Krystyna H

    2012-02-01

    Full Text Available Abstract Nijmegen breakage syndrome (NBS is a rare autosomal recessive syndrome of chromosomal instability mainly characterized by microcephaly at birth, combined immunodeficiency and predisposition to malignancies. Due to a founder mutation in the underlying NBN gene (c.657_661del5 the disease is encountered most frequently among Slavic populations. The principal clinical manifestations of the syndrome are: microcephaly, present at birth and progressive with age, dysmorphic facial features, mild growth retardation, mild-to-moderate intellectual disability, and, in females, hypergonadotropic hypogonadism. Combined cellular and humoral immunodeficiency with recurrent sinopulmonary infections, a strong predisposition to develop malignancies (predominantly of lymphoid origin and radiosensitivity are other integral manifestations of the syndrome. The NBN gene codes for nibrin which, as part of a DNA repair complex, plays a critical nuclear role wherever double-stranded DNA ends occur, either physiologically or as a result of mutagenic exposure. Laboratory findings include: (1 spontaneous chromosomal breakage in peripheral T lymphocytes with rearrangements preferentially involving chromosomes 7 and 14, (2 sensitivity to ionizing radiation or radiomimetics as demonstrated in vitro by cytogenetic methods or by colony survival assay, (3 radioresistant DNA synthesis, (4 biallelic hypomorphic mutations in the NBN gene, and (5 absence of full-length nibrin protein. Microcephaly and immunodeficiency are common to DNA ligase IV deficiency (LIG4 syndrome and severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation due to NHEJ1 deficiency (NHEJ1 syndrome. In fact, NBS was most commonly confused with Fanconi anaemia and LIG4 syndrome. Genetic counselling should inform parents of an affected child of the 25% risk for further children to be affected. Prenatal molecular genetic diagnosis is possible if disease

  11. RNA-directed repair of DNA double-strand breaks.

    Science.gov (United States)

    Yang, Yun-Gui; Qi, Yijun

    2015-08-01

    DNA double-strand breaks (DSBs) are among the most deleterious DNA lesions, which if unrepaired or repaired incorrectly can cause cell death or genome instability that may lead to cancer. To counteract these adverse consequences, eukaryotes have evolved a highly orchestrated mechanism to repair DSBs, namely DNA-damage-response (DDR). DDR, as defined specifically in relation to DSBs, consists of multi-layered regulatory modes including DNA damage sensors, transducers and effectors, through which DSBs are sensed and then repaired via DNAprotein interactions. Unexpectedly, recent studies have revealed a direct role of RNA in the repair of DSBs, including DSB-induced small RNA (diRNA)-directed and RNA-templated DNA repair. Here, we summarize the recent discoveries of RNA-mediated regulation of DSB repair and discuss the potential impact of these novel RNA components of the DSB repair pathway on genomic stability and plasticity. PMID:25960340

  12. 40 CFR 798.5500 - Differential growth inhibition of repair proficient and repair deficient bacteria: “Bacterial DNA...

    Science.gov (United States)

    2010-07-01

    ... recommendations as specified under 40 CFR part 792, subpart J the following specific information should be... repair proficient and repair deficient bacteria: âBacterial DNA damage or repair tests.â 798.5500 Section... inhibition of repair proficient and repair deficient bacteria: “Bacterial DNA damage or repair tests.”...

  13. Comet assay to measure DNA repair: approach and applications

    OpenAIRE

    Azqueta, Amaya; SLYSKOVA, JANA; Langie, Sabine A. S.; O’Neill Gaivão, Isabel; Collins, Andrew

    2014-01-01

    Cellular repair enzymes remove virtually all DNA damage before it is fixed; repair therefore plays a crucial role in preventing cancer. Repair studied at the level of transcription correlates poorly with enzyme activity, and so assays of phenotype are needed. In a biochemical approach, substrate nucleoids containing specific DNA lesions are incubated with cell extract; repair enzymes in the extract induce breaks at damage sites; and the breaks are measured with the comet assay. The nature of ...

  14. A brief history of the DNA repair field

    Institute of Scientific and Technical Information of China (English)

    Errol C Friedberg

    2008-01-01

    The history of the repair of damaged DNA can be traced to the mid-1930s. Since then multiple DNA repair mecha-nisms, as well as other biological responses to DNA damage, have been discovered and their regulation has been studied. This article briefly recounts the early history of this field.

  15. Mitochondrial DNA repair and association with aging--an update

    DEFF Research Database (Denmark)

    Diaz, Ricardo Gredilla; Bohr, Vilhelm A; Stevnsner, Tinna V.

    2010-01-01

    the aging process and to be particularly deleterious in post-mitotic cells. Thus, DNA repair is an important mechanism for maintenance of genomic integrity. Despite the importance of mitochondria in the aging process, it was thought for many years that mitochondria lacked an enzymatic DNA repair...... system comparable to that in the nuclear compartment. However, it is now well established that DNA repair actively takes place in mitochondria. Oxidative DNA damage processing, base excision repair mechanisms were the first to be described in these organelles, and consequently the best understood....... However, new proteins and novel DNA repair pathways, thought to be exclusively present in the nucleus, have recently been described also to be present in mitochondria. Here we review the main mitochondrial DNA repair pathways and their association with the aging process....

  16. DNA double strand break repair pathway choice following ionizing radiation

    International Nuclear Information System (INIS)

    A DNA double strand break (DSB) is one of the critical DNA lesions leading to cell death if unrepaired. DSB is repaired by two distinct repair pathways, i.e. non-homologous end-joining (NHEJ) or homologous recombination (HR). NHEJ contributes to DSB repair throughout the cell cycle, while HR is active during S/G2 phase following DNA replication. We aim to elucidate the molecular mechanisms underlying DSB repair pathway choice at two ended DSBs in G2 phase following ionizing radiation (IR). Here, we discuss recent work that provides new insights into DSB repair pathways choice including our study. (author)

  17. Cloning of Salmonella typhimurium DNA encoding mutagenic DNA repair.

    OpenAIRE

    Thomas, S M; Sedgwick, S G

    1989-01-01

    Mutagenic DNA repair in Escherichia coli is encoded by the umuDC operon. Salmonella typhimurium DNA which has homology with E. coli umuC and is able to complement E. coli umuC122::Tn5 and umuC36 mutations has been cloned. Complementation of umuD44 mutants and hybridization with E. coli umuD also occurred, but these activities were much weaker than with umuC. Restriction enzyme mapping indicated that the composition of the cloned fragment is different from the E. coli umuDC operon. Therefore, ...

  18. Mechanism of DNA loading by the DNA repair helicase XPD.

    Science.gov (United States)

    Constantinescu-Aruxandei, Diana; Petrovic-Stojanovska, Biljana; Penedo, J Carlos; White, Malcolm F; Naismith, James H

    2016-04-01

    The xeroderma pigmentosum group D (XPD) helicase is a component of the transcription factor IIH complex in eukaryotes and plays an essential role in DNA repair in the nucleotide excision repair pathway. XPD is a 5' to 3' helicase with an essential iron-sulfur cluster. Structural and biochemical studies of the monomeric archaeal XPD homologues have aided a mechanistic understanding of this important class of helicase, but several important questions remain open. In particular, the mechanism for DNA loading, which is assumed to require large protein conformational change, is not fully understood. Here, DNA binding by the archaeal XPD helicase fromThermoplasma acidophilumhas been investigated using a combination of crystallography, cross-linking, modified substrates and biochemical assays. The data are consistent with an initial tight binding of ssDNA to helicase domain 2, followed by transient opening of the interface between the Arch and 4FeS domains, allowing access to a second binding site on helicase domain 1 that directs DNA through the pore. A crystal structure of XPD fromSulfolobus acidocaldiariusthat lacks helicase domain 2 has an otherwise unperturbed structure, emphasizing the stability of the interface between the Arch and 4FeS domains in XPD. PMID:26896802

  19. Role of polynucleotide kinase/phosphatase in mitochondrial DNA repair

    OpenAIRE

    Tahbaz, Nasser; Subedi, Sudip; Weinfeld, Michael

    2011-01-01

    Mutations in mitochondrial DNA (mtDNA) are implicated in a broad range of human diseases and in aging. Compared to nuclear DNA, mtDNA is more highly exposed to oxidative damage due to its proximity to the respiratory chain and the lack of protection afforded by chromatin-associated proteins. While repair of oxidative damage to the bases in mtDNA through the base excision repair pathway has been well studied, the repair of oxidatively induced strand breaks in mtDNA has been less thoroughly exa...

  20. DNA repair and radiation sensitivity in mammalian cells

    International Nuclear Information System (INIS)

    Ionizing radiation induces various types of damage in mammalian cells including DNA single-strand breaks, DNA double-strand breaks (DSB), DNA-protein cross links, and altered DNA bases. Although human cells can repair many of these lesions there is little detailed knowledge of the nature of the genes and the encoded enzymes that control these repair processes. We report here on the cellular and genetic analyses of DNA double-strand break repair deficient mammalian cells. It has been well established that the DNA double-strand break is one of the major lesions induced by ionizing radiation. Utilizing rodent repair-deficient mutant, we have shown that the genes responsible for DNA double-strand break repair are also responsible for the cellular expression of radiation sensitivity. The molecular genetic analysis of DSB repair in rodent/human hybrid cells indicate that at least 6 different genes in mammalian cells are responsible for the repair of radiation-induced DNA double-strand breaks. Mapping and the prospect of cloning of human radiation repair genes are reviewed. Understanding the molecular and genetic basis of radiation sensitivity and DNA repair in man will provide a rational foundation to predict the individual risk associated with radiation exposure and to prevent radiation-induced genetic damage in the human population

  1. Physiological and pathological variability of DNA repair in human

    International Nuclear Information System (INIS)

    DNA repair plays a crucial role in protection of human genetic material against genotoxic agents including carcinogens, ensuring genome stability. Variability of DNA repair was observed on many levels. These are several mechanisms of damage removal and a number of enzymes taking part in the specific steps of DNA repair. Hence, variations in efficiency of DNA repair among healthy individuals can be explained in term of genetic polymorphism. There are also some exogenous and endogenous factors affecting the DNA repair machinery in human organism. The first group includes diet and genotoxic exposure whereas the second comprises age (negative linear correlation) and health status. Within the group of health status factor neo-plasticity and diseases with hereditary DNA repair deficit are discussed extensively. The well documented heterogeneity of DNA repair inside the genome concerns differences between classes of DNA (e.g. nuclear v. mitochondrial or repetitive v. single copy) and preferential repair of activity transcribed genes. The main message of the article is that DNA repair should be recognized as fairly individual and, moreover, as being modulated by many factors. (author). 25 refs, 2 figs

  2. DNA damage and repair in human cells exposed to sunlight

    International Nuclear Information System (INIS)

    Cultured human cells were treated with direct sunlight under conditions which minimised the hypertonic, hyperthermic and fixative effects of solar radiation. Sunlight produced similar levels of DNA strand breaks as equitoxic 254 nm UV in two fibroblast strains and a melanoma cell line, but DNA repair synthesis and inhibition of semiconservative DNA synthesis and of DNA chain elongation were significantly less for sunlight-exposed cells. DNA breaks induced by sunlight were removed more rapidly. Thus, the repair of solar damage differs considerably from 254 nm UV repair. Glass-filtered sunlight (>320 nm) was not toxic to cells and did not induce repair synthesis but gave a low level of short-lived DNA breaks and some inhibition of DNA chain elongation; thymidine uptake was enhanced. Filtered sunlight slightly enhanced UV-induced repair synthesis and UV toxicity; photoreactivation of UV damage was not found. Attempts to transform human fibroblasts using sunlight, with or without phorbol ester, were unsuccessful. (author)

  3. Induction of strand breaks in polyribonucleotides and DNA by the sulphate radical anion: role of electron loss centres as precursors of strand breakage

    International Nuclear Information System (INIS)

    The interaction of the sulphate radical anion, SO4.-, with the polyribonucleotides, poly U and poly C, in deaerated, aqueous solutions at pH 7.5 results in strand breakage (sb) with efficiencies of 57 and 23%, respectively, determined by time resolved laser light scattering (TRLS). Most sb are produced within 70 μs, the risetime of the detection system. Oxygen inhibits the induction of sb in poly U and poly C by SO4.-through its interaction with a radical precursor to sb. In contrast, the interaction of SO4.- with poly A and single stranded DNA does not lead to significant strand breakage (≤ 5% efficiency). From optical studies, the interaction of poly A and poly G with SO4.- radicals yields predominantly the corresponding one electron oxidized base radicals. (author)

  4. Repair of UV-irradiated plasmid DNA in excision repair deficient mutants of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    The repair of UV-irradiated DNA of plasmid YEp13 was studied in the incision defective strains by measurement of cell transformation frequency. In Saccharomyces cerevisiae, rad1,2,3 and 4 mutants could repair UV-damaged plasmid DNA. In Escherichia coli, uvrA mutant was unable to repair UV-damaged plasmid DNA; however, pretreatment of the plasmid with Micrococcus luteus endonuclease increased repair. It was concluded that all the mutations of yeast were probably limited only to the nuclear DNA. (author)

  5. Cancer-prone diseases and DNA repair

    International Nuclear Information System (INIS)

    A promising approach to a better understanding of the human carcinogenic process is the investigation of molecular mechanisms governing mankind's genetic susceptibility to cancer. In view of the repertoire of hereditary disorders accompanied by increased risk of developing neoplasia, the human genome contains a number of loci, any one of which, in its mutated form, confers marked predisposition to malignancy. Indeed, the study of heritable variations in sensitivity to harmful environmental agents, termed ecogenetics, is rapidly emerging as a rewarding experimental tack for clarifying the cause and course of malignant transformation. One of the most active branches of ecogenetic experimentation is the in vitro investigation of cultured cells derived from patients in whom excessive cancer occurrence is associated with an untoward response to a known environmental carcinogen. These patients, for the most part, are afflicted with rare, clinically well-defined diseases characterized by a simple Mendelian monogenic mode of inheritance. Cells cultured from these subjects typically display enhanced sensitivity to the lethal action of the relevant environmental agent and, in some cases, anomalies in the ability to process - that is, to repair, bypass, or otherwise circumvent - damage inflicted on DNA by the same agent. The archetypal disorder for these studies is xeroderma pigmentosum (XP). In this autosomal recessively transmitted affliction, marked propensity to sunlight-induced skin neoplasms and in vitro cellular hypersensitivity to the cytotoxic, mutagenic, and carcinogenic actions of ultraviolet (UV) rays are causally linked to deficiencies in enzymatic processes that repair or bypass UV-induced cyclobutyl pyrimidine dimers in DNA

  6. Protein found to promote DNA repair, prevent cancer

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    @@ An abundant chromosomal protein that binds to damaged DNA prevents cancer development by enhancing DNA repair, researchers at University of Texas reported on-line in the Proceedings of the National Academies of Science.

  7. Clinical Variability and Novel Mutations in the NHEJ1 Gene in Patients with a Nijmegen Breakage Syndrome-like Phenotype

    OpenAIRE

    Varon, Raymonda; Dutrannoy, Véronique; Demuth, Ilja; Konrat, Kateryna; Neitzel, Heidemarie; Radszewski, Janina; Rothe, Susanne; Sperling, Karl; Digweed, Martin; Baumann, Ulrich; Schindler, Detlev; Gillessen-Kaesbach, Gabriele; Schellenberger, Mario T; Keng, Wee Teik; Nallusamy, Revathy

    2010-01-01

    Abstract We have previously shown that mutations in the genes encoding DNA Ligase IV (LIGIV) and RAD50, involved in DNA repair by non-homologous-end joining (NHEJ), lead to clinical and cellular features similar to those of Nijmegen Breakage Syndrome (NBS). Very recently, a new member of the NHEJ repair pathway, NHEJ1, was discovered and mutations in patients with features resembling NBS were described. Here we report on 5 patients from 4 families of different ethnic origin with th...

  8. Repair of DNA lesions associated with triplex-forming oligonucleotides.

    Science.gov (United States)

    Chin, Joanna Y; Glazer, Peter M

    2009-04-01

    Triplex-forming oligonucleotides (TFOs) are gene targeting tools that can bind in the major groove of duplex DNA in a sequence-specific manner. When bound to DNA, TFOs can inhibit gene expression, can position DNA-reactive agents to specific locations in the genome, or can induce targeted mutagenesis and recombination. There is evidence that third strand binding, alone or with an associated cross-link, is recognized and metabolized by DNA repair factors, particularly the nucleotide excision repair pathway. This review examines the evidence for DNA repair of triplex-associated lesions. PMID:19072762

  9. Chromosomal bands affected by acute oil exposure and DNA repair errors.

    Directory of Open Access Journals (Sweden)

    Gemma Monyarch

    Full Text Available BACKGROUND: In a previous study, we showed that individuals who had participated in oil clean-up tasks after the wreckage of the Prestige presented an increase of structural chromosomal alterations two years after the acute exposure had occurred. Other studies have also reported the presence of DNA damage during acute oil exposure, but little is known about the long term persistence of chromosomal alterations, which can be considered as a marker of cancer risk. OBJECTIVES: We analyzed whether the breakpoints involved in chromosomal damage can help to assess the risk of cancer as well as to investigate their possible association with DNA repair efficiency. METHODS: Cytogenetic analyses were carried out on the same individuals of our previous study and DNA repair errors were assessed in cultures with aphidicolin. RESULTS: Three chromosomal bands, 2q21, 3q27 and 5q31, were most affected by acute oil exposure. The dysfunction in DNA repair mechanisms, expressed as chromosomal damage, was significantly higher in exposed-oil participants than in those not exposed (p= 0.016. CONCLUSION: The present study shows that breaks in 2q21, 3q27 and 5q31 chromosomal bands, which are commonly involved in hematological cancer, could be considered useful genotoxic oil biomarkers. Moreover, breakages in these bands could induce chromosomal instability, which can explain the increased risk of cancer (leukemia and lymphomas reported in chronically benzene-exposed individuals. In addition, it has been determined that the individuals who participated in clean-up of the oil spill presented an alteration of their DNA repair mechanisms two years after exposure.

  10. DNA Mismatch Repair and Oxidative DNA Damage: Implications for Cancer Biology and Treatment

    International Nuclear Information System (INIS)

    Many components of the cell, including lipids, proteins and both nuclear and mitochondrial DNA, are vulnerable to deleterious modifications caused by reactive oxygen species. If not repaired, oxidative DNA damage can lead to disease-causing mutations, such as in cancer. Base excision repair and nucleotide excision repair are the two DNA repair pathways believed to orchestrate the removal of oxidative lesions. However, recent findings suggest that the mismatch repair pathway may also be important for the response to oxidative DNA damage. This is particularly relevant in cancer where mismatch repair genes are frequently mutated or epigenetically silenced. In this review we explore how the regulation of oxidative DNA damage by mismatch repair proteins may impact on carcinogenesis. We discuss recent studies that identify potential new treatments for mismatch repair deficient tumours, which exploit this non-canonical role of mismatch repair using synthetic lethal targeting

  11. DNA Mismatch Repair and Oxidative DNA Damage: Implications for Cancer Biology and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Bridge, Gemma; Rashid, Sukaina; Martin, Sarah A., E-mail: sarah.martin@qmul.ac.uk [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ (United Kingdom)

    2014-08-05

    Many components of the cell, including lipids, proteins and both nuclear and mitochondrial DNA, are vulnerable to deleterious modifications caused by reactive oxygen species. If not repaired, oxidative DNA damage can lead to disease-causing mutations, such as in cancer. Base excision repair and nucleotide excision repair are the two DNA repair pathways believed to orchestrate the removal of oxidative lesions. However, recent findings suggest that the mismatch repair pathway may also be important for the response to oxidative DNA damage. This is particularly relevant in cancer where mismatch repair genes are frequently mutated or epigenetically silenced. In this review we explore how the regulation of oxidative DNA damage by mismatch repair proteins may impact on carcinogenesis. We discuss recent studies that identify potential new treatments for mismatch repair deficient tumours, which exploit this non-canonical role of mismatch repair using synthetic lethal targeting.

  12. Biosynthesis of the human DNA repair enzyme uracil DNA glycosylase

    International Nuclear Information System (INIS)

    Anti-human uracil DNA glycosylase monoclonal antibodies have been used to study the in vitro and in vivo biosynthesis of this human base excision repair enzyme. The in vitro translation of poly(A+)uracil DNA glycosylase mRNA was examined by immunoprecipitation of the [35S]methionine-labeled translation products. As identified by sucrose density analysis, immunoreactive in vitro products of 37,000 daltons and 24,000 daltons were translated from 16S poly(A+)RNA and from 11S poly (A+)RNA, respectively. However, only the 37,000 Mr polypeptide could be detected by immunoblot analysis of crude human placental and fibroblast extracts or by immunoprecipitation of [35S] labeled normal human cell extracts. This relative molecular weight correspond to the molecular weight observed for homogeneous human placental uracil DNA glycosylase. A placental mRNA preparation was used to construct a cDNA library in pUC8. Immunological screening identified two recombinant DNA plasmids each containing a 340 base pair insert. Northern blot analysis demonstrated that the insert hybridized to a 16S poly (A+)mRNA. These results suggest that immunoreactive uracil DNA glycosylase protein was synthesized at its enzymatically active molecular weight as the primary translation product of a 16S poly (A+)mRNA

  13. Evidence implying DNA polymerase beta function in excision repair.

    OpenAIRE

    Siedlecki, J A; Szyszko, J.; Pietrzykowska, I; Zmudzka, B

    1980-01-01

    Comparison was made of the ability of calf thymus DNA polymerases alpha and beta to replicate the following templates: native E. coli CR-34 DNA (T-DNA), calf thymus DNA activated by DNase I (act.DNA), BU-DNA (from E. coli CR-34 cells cultured on BUdR-containing medium) with damages resulting from incomplete excision repair, as well as thermally denatured act.DNA and BU-DNA (s.s.act.DNA and s.s.BU-DNA). 3H-TTP incorporation during extensive replication of act.DNA was similar for both enzymes, ...

  14. Caffeine, cyclic AMP and postreplication repair of mammalian DNA

    International Nuclear Information System (INIS)

    The methylxanthines, caffeine and theophylline, inhibit postreplication repair of DNA in mammalian cells. Because they also inhibit cyclic AMP phosphodiesterase, it was thought that there might be some connection between concentrations of cyclic AMP and postreplication repair. This possibility was tested by performing DNA sedimentation experiments with a cyclic AMP-resistant mouse lymphoma cell mutant and its wild-type counterpart. The results show that there is no connection between cellular cyclic AMP concentrations and the rate of postreplication repair. Therefore, it is more likely that caffeine and theophylline inhibit postreplication repair by some other means, such as by binding to DNA

  15. Repair of DNA damage in light sensitive human skin diseases

    Energy Technology Data Exchange (ETDEWEB)

    Horkay, I.; Varga, L.; Tam' asi P., Gundy, S.

    1978-12-01

    Repair of uv-light induced DNA damage and changes in the semiconservative DNA synthesis were studied by in vitro autoradiography in the skin of patients with lightdermatoses (polymorphous light eruption, porphyria cutanea tarda, erythropoietic protoporphyria) and xeroderma pigmentosum as well as in that of healthy controls. In polymorphous light eruption the semiconservative DNA replication rate was more intensive in the area of the skin lesions and in the repeated phototest site, the excision repair synthesis appeared to be unaltered. In cutaneous prophyrias a decreased rate of the repair incorporation could be detected. Xeroderma pigmentosum was characterized by a strongly reduced repair synthesis.

  16. Rad52 SUMOylation affects the efficiency of the DNA repair

    DEFF Research Database (Denmark)

    Altmannova, Veronika; Eckert-Boulet, Nadine; Arneric, Milica;

    2010-01-01

    Homologous recombination (HR) plays a vital role in DNA metabolic processes including meiosis, DNA repair, DNA replication and rDNA homeostasis. HR defects can lead to pathological outcomes, including genetic diseases and cancer. Recent studies suggest that the post-translational modification by...... recombination and DNA repair....... recombination mediator protein Rad52. Interestingly, Rad52 SUMOylation is enhanced by single-stranded DNA, and we show that SUMOylation of Rad52 also inhibits its DNA binding and annealing activities. The biochemical effects of SUMO modification in vitro are accompanied by a shorter duration of spontaneous Rad...

  17. DNA repair in proteus mirabilis. 5

    International Nuclear Information System (INIS)

    Inducible cell lysis in UV-irradiated cultures of Proteus mirabilis PG VI rec+ derivatives is due to the induction of a defective prophage dP VI. This lytic response is found to account for the extraordinary high UV sensitivity of P. mirabilis rec+ strains. Lysis of cells after UV or mitomycin C treatment is accompanied by the release of various defective phage particles including head-tail, tail and polysheath structures. Survival of P. mirabilis is shown to be strongly affected by the plating procedure. It is supposed that plating of UV-irradiated rec+ cells after a distinct time of growth in liquid medium some how enhances the efficiency of repair activities rather than to prevent inducible cell lysis in P. mirabilis from occurring. The resident defective prophage interferes with the multiplication of infectious temperate phages (π1) as indicated by the efficiency of plating and plaque size. The extent of host-controlled reactivation of UV-irradiated phages, however, was not influenced by the lysogenic state of the host bacteria. The derepression of the resident prophage is thought to correlate with the appearence after UV exposure of a distinct and relatively stable low molecular weight DNA which is assumed to originate from enzymatic fragmentation rather than postmortal nicking of chromosomal DNA in P. mirabilis. Mutants are described which lost the inducible cell lysis response and, in case of PG 1300- also lost the immunity for bacteriolytic activities formed by PG VI strains after lysogenic induction. Whilst this derivative of P. mirabilis might either be cured for the defective prophage or rendered noninducible by mutation this substrain lost also both the extrasensitivity against UV and the chromosomal DNA fragmentation. The extent of the UV-induced DNA degradation response seems not to be markedly affected by these DNA fragmentations. (author)

  18. DNA-repair gene variants are associated with glioblastoma survival

    DEFF Research Database (Denmark)

    Wibom, Carl; Sjöström, Sara; Henriksson, Roger;

    2012-01-01

    Abstract Patient outcome from glioma may be influenced by germline variation. Considering the importance of DNA repair in cancer biology as well as in response to treatment, we studied the relationship between 1458 SNPs, which captured the majority of the common genetic variation in 136 DNA repair...

  19. Targeting DNA-repair systems brings hopes to cancer patients

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    @@ CAS researchers have recently raised a hypothesis to circumvent tumor resistance to radio- and chemo-therapy and to enhance the efficacy of DNAdamaging agents by interfering with DNA repair. "There are emerging anticancer therapeutic opportunities in targeting DNA-repair systems," they asserted.

  20. The use of caspase inhibitors in pulsed-field gel electrophoresis may improve the estimation of radiation-induced DNA repair and apoptosis

    International Nuclear Information System (INIS)

    Radiation-induced DNA double-strand break (DSB) repair can be tested by using pulsed-field gel electrophoresis (PFGE) in agarose-encapsulated cells. However, previous studies have reported that this assay is impaired by the spontaneous DNA breakage in this medium. We investigated the mechanisms of this fragmentation with the principal aim of eliminating it in order to improve the estimation of radiation-induced DNA repair. Samples from cancer cell cultures or xenografted tumours were encapsulated in agarose plugs. The cell plugs were then irradiated, incubated to allow them to repair, and evaluated by PFGE, caspase-3, and histone H2AX activation (γH2AX). In addition, apoptosis inhibition was evaluated through chemical caspase inhibitors. We confirmed that spontaneous DNA fragmentation was associated with the process of encapsulation, regardless of whether cells were irradiated or not. This DNA fragmentation was also correlated to apoptosis activation in a fraction of the cells encapsulated in agarose, while non-apoptotic cell fraction could rejoin DNA fragments as was measured by γH2AX decrease and PFGE data. We were able to eliminate interference of apoptosis by applying specific caspase inhibitors, and improve the estimation of DNA repair, and apoptosis itself. The estimation of radiation-induced DNA repair by PFGE may be improved by the use of apoptosis inhibitors. The ability to simultaneously determine DNA repair and apoptosis, which are involved in cell fate, provides new insights for using the PFGE methodology as functional assay

  1. Mechanisms of DNA repair, recombination and mutagenesis in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    Full text. 1. It was confirmed that from the six DNA polymerases discovered in yeast cells, only DNA polymerases δ, ε and ζ are engaged in dark repair of lesions caused by UV-light and MMS. DNA polymerase δ is involved in the repair of both types of lesions, while DNA polymerase ε and ζ only in lesions caused by UV and MMS, respectively. Other polymerases are not involved or play only a minor role in repair. The results obtained are being prepared for publication. 2. Studies on the involvement of the three replicative DNA polymerases in mitotic gene conversion induced by mono- and bifunctional psoralens (and also by UV- light or MMS) revealed that DNA polymerases α and δ are the main polymerases responsible for induced intragenic conversion. DNA polymerase ε seems to play minor role in this process. It is possible that DNA polymerase α may also be involved in DNA repair synthesis but only in cases when the opening of new replication forks is necessary for repair. 3. Studies on the influence of mutations in the replicative and nonreplicative DNA polymerases on adaptive mutations in the cells of Saccharomyces cerevisiae were continued. We found that thermosensitive mutation in the POL2 gene encoding DNA polymerase ε increased the frequency of adaptive mutation in a similar manner as found earlier for DNA polymerase δ. A similar effect was observed also in strains with deletions in the MSH3 gene responsible for mismatch repair. Mutations in other DNA polymerases, including the essential DNA polymerase α and the inessential DNA polymerases β and ζ revealed no effect on this process. Analysis of DNA sequences in the revertants showed that in all cases the obtained reversions resulted from a single nucleotide deletion most often in sequences having short homopolymer tracts. The results obtained suggest that errors arising during DNA elongation and their persistence in mutants deficient in mismatch repair activity seem to be the source of the adaptive

  2. Repair of damaged DNA in vivo: Final technical report

    International Nuclear Information System (INIS)

    This contract was initiated in 1962 with the US Atomic Energy Commission to carry out basic research on the effects of radiation on the process of DNA replication in bacteria. Within the first contract year we discovered repair replication at the same time that Setlow and Carrier discovered pyrimidine dimer excision. These discoveries led to the elucidation of the process of excision-repair, one of the most important mechanisms by which living systems, including humans, respond to structural damage in their genetic material. We improved methodology for distinguishing repair replication from semiconservative replication and instructed others in these techniques. Painter then was the first to demonstrate repair replication in ultraviolet irradiated human cells. He, in turn, instructed James Cleaver who discovered that skin fibroblasts from patients with xeroderma pigmentosum were defective in excision-repair. People with this genetic defect are extremely sensitive to sunlight and they develop carcinomas and melanomas of the skin with high frequency. The existence of this hereditary disease attests to the importance of DNA repair in man. We certainly could not survive in the normal ultraviolet flux from the sun if our DNA were not continuously monitored for damage and repaired. Other hereditary diseases such as ataxia telangiectasia, Cockayne's syndrome, Blooms syndrome and Fanconi's anemia also involve deficiencies in DNA damage processing. The field of DNA repair has developed rapidly as we have learned that most environmental chemical carcinogens as well as radiation produce repairable damage in DNA. 251 refs

  3. Role of DNA repair in host immune response and inflammation.

    Science.gov (United States)

    Fontes, Fabrícia Lima; Pinheiro, Daniele Maria Lopes; Oliveira, Ana Helena Sales de; Oliveira, Rayssa Karla de Medeiros; Lajus, Tirzah Braz Petta; Agnez-Lima, Lucymara Fassarella

    2015-01-01

    In recent years, the understanding of how DNA repair contributes to the development of innate and acquired immunity has emerged. The DNA damage incurred during the inflammatory response triggers the activation of DNA repair pathways, which are required for host-cell survival. Here, we reviewed current understanding of the mechanism by which DNA repair contributes to protection against the oxidized DNA damage generated during infectious and inflammatory diseases and its involvement in innate and adaptive immunity. We discussed the functional role of DNA repair enzymes in the immune activation and the relevance of these processes to: transcriptional regulation of cytokines and other genes involved in the inflammatory response; V(D)J recombination; class-switch recombination (CSR); and somatic hypermutation (SHM). These three last processes of DNA damage repair are required for effective humoral adaptive immunity, creating genetic diversity in developing T and B cells. Furthermore, viral replication is also dependent on host DNA repair mechanisms. Therefore, the elucidation of the pathways of DNA damage and its repair that activate innate and adaptive immunity will be important for a better understanding of the immune and inflammatory disorders and developing new therapeutic interventions for treatment of these diseases and for improving their outcome. PMID:25795123

  4. Effect of bromodeoxyuridine on radiation-induced DNA damage and repair based on DNA fragment size using pulsed-field gel electrophoresis

    International Nuclear Information System (INIS)

    We have used biphasic linear ramping pulsed-field gel electrophoresis (PFGE) to understand the effect of incorporation of bromodeoxyuridine (BrdUrd) on radiation-induced DNA damage and repair. This technique permits a determination of the fragment size distribution produced immediately after irradiation as well as during the repair period. We found that incorporation of BrdUrd increased the induction and decreased the repair of radiation damage. The fragment size distribution was consistent with a random breakage model. When we found that significantly more damage was detected after irradiation of deproteinized DNA compared to intact cells, we studied the effects of BrdUrd incorporation on the radiation response of cells or DNA at various phases of preparation for electrophoresis: cells adherent to the culture dish (A), trypsinized cells (B), agarose-embedded cells (C) and deproteinized DNA (D). Although there was a general tendency to detect more damage when irradiation was performed later in the preparation process, steps B and C were the only successive steps which were significantly different. These findings demonstrate that incorporation of BrdUrd randomly increases the induction of radiation damage and decreases its repair at the level of 200 kbp to 5 Mbp fragments. Furthermore, they confirm that the amount of damage detected depends upon the conditions of the cells or DNA at the time of irradiation. 34 refs., 5 figs., 2 tabs

  5. Effects of DNA3′pp5′G capping on 3′ end repair reactions and of an embedded pyrophosphate-linked guanylate on ribonucleotide surveillance

    OpenAIRE

    Chauleau, Mathieu; Das, Ushati; Shuman, Stewart

    2015-01-01

    When DNA breakage results in a 3′-PO4 terminus, the end is considered ‘dirty’ because it cannot prime repair synthesis by DNA polymerases or sealing by classic DNA ligases. The noncanonical ligase RtcB can guanylylate the DNA 3′-PO4 to form a DNA3′pp5′GOH cap. Here we show that DNA capping precludes end joining by classic ATP-dependent and NAD+-dependent DNA ligases, prevents template-independent nucleotide addition by mammalian terminal transferase, blocks exonucleolytic proofreading by Esch...

  6. DNA repair: Dynamic defenders against cancer and aging

    Energy Technology Data Exchange (ETDEWEB)

    Fuss, Jill O.; Cooper, Priscilla K.

    2006-04-01

    You probably weren't thinking about your body's cellular DNA repair systems the last time you sat on the beach in the bright sunshine. Fortunately, however, while you were subjecting your DNA to the harmful effects of ultraviolet light, your cells were busy repairing the damage. The idea that our genetic material could be damaged by the sun was not appreciated in the early days of molecular biology. When Watson and Crick discovered the structure of DNA in 1953 [1], it was assumed that DNA is fundamentally stable since it carries the blueprint of life. However, over 50 years of research have revealed that our DNA is under constant assault by sunlight, oxygen, radiation, various chemicals, and even our own cellular processes. Cleverly, evolution has provided our cells with a diverse set of tools to repair the damage that Mother Nature causes. DNA repair processes restore the normal nucleotide sequence and DNA structure of the genome after damage [2]. These responses are highly varied and exquisitely regulated. DNA repair mechanisms are traditionally characterized by the type of damage repaired. A large variety of chemical modifications can alter normal DNA bases and either lead to mutations or block transcription if not repaired, and three distinct pathways exist to remove base damage. Base excision repair (BER) corrects DNA base alterations that do not distort the overall structure of the DNA helix such as bases damaged by oxidation resulting from normal cellular metabolism. While BER removes single damaged bases, nucleotide excision repair (NER) removes short segments of nucleotides (called oligonucleotides) containing damaged bases. NER responds to any alteration that distorts the DNA helix and is the mechanism responsible for repairing bulky base damage caused by carcinogenic chemicals such as benzo [a]pyrene (found in cigarette smoke and automobile exhaust) as well as covalent linkages between adjacent pyrimidine bases resulting from the ultraviolet

  7. Molecular basis for DNA strand displacement by NHEJ repair polymerases

    OpenAIRE

    Bartlett, Edward J.; Brissett, Nigel C.; Plocinski, Przemyslaw; Carlberg, Tom; Doherty, Aidan J.

    2015-01-01

    The non-homologous end-joining (NHEJ) pathway repairs DNA double-strand breaks (DSBs) in all domains of life. Archaea and bacteria utilize a conserved set of multifunctional proteins in a pathway termed Archaeo-Prokaryotic (AP) NHEJ that facilitates DSB repair. Archaeal NHEJ polymerases (Pol) are capable of strand displacement synthesis, whilst filling DNA gaps or partially annealed DNA ends, which can give rise to unligatable intermediates. However, an associated NHEJ phosphoesterase (PE) re...

  8. Charge-transport-mediated recruitment of DNA repair enzymes

    OpenAIRE

    Fok, Pak-Wing; Guo, Chin-Lin; Chou, Tom

    2008-01-01

    Damaged or mismatched bases in DNA can be repaired by base excision repair enzymes (BER) that replace the defective base. Although the detailed molecular structures of many BER enzymes are known, how they colocalize to lesions remains unclear. One hypothesis involves charge transport (CT) along DNA [Yavin et al., Proc. Natl. Acad. Sci. U.S.A. 102, 3546 (2005)]. In this CT mechanism, electrons are released by recently adsorbed BER enzymes and travel along the DNA. The electrons can scatter (by...

  9. Mechanisms of interstrand DNA crosslink repair and human disorders.

    Science.gov (United States)

    Hashimoto, Satoru; Anai, Hirofumi; Hanada, Katsuhiro

    2016-01-01

    Interstrand DNA crosslinks (ICLs) are the link between Watson-Crick strands of DNAs with the covalent bond and prevent separation of DNA strands. Since the ICL lesion affects both strands of the DNA, the ICL repair is not simple. So far, nucleotide excision repair (NER), structure-specific endonucleases, translesion DNA synthesis (TLS), homologous recombination (HR), and factors responsible for Fanconi anemia (FA) are identified to be involved in ICL repair. Since the presence of ICL lesions causes severe defects in transcription and DNA replication, mutations in these DNA repair pathways give rise to a various hereditary disorders. NER plays an important role for the ICL recognition and removal in quiescent cells, and defects of NER causes congential progeria syndrome, such as xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy. On the other hand, the ICL repair in S phase requires more complicated orchestration of multiple factors, including structure-specific endonucleases, and TLS, and HR. Disturbed this ICL repair orchestration in S phase causes genome instability resulting a cancer prone disease, Fanconi anemia. So far more than 30 factors in ICL repair have already identified. Recently, a new factor, UHRF1, was discovered as a sensor of ICLs. In addition to this, numbers of nucleases that are involved in the first incision, also called unhooking, of ICL lesions have also been identified. Here we summarize the recent studies of ICL associated disorders and repair mechanism, with emphasis in the first incision of ICLs. PMID:27350828

  10. Human longevity and variation in DNA damage response and repair

    DEFF Research Database (Denmark)

    Debrabant, Birgit; Soerensen, Mette; Flachsbart, Friederike;

    2014-01-01

    others. Data were applied on 592 SNPs from 77 genes involved in nine sub-processes: DNA-damage response, base excision repair (BER), nucleotide excision repair, mismatch repair, non-homologous end-joining, homologous recombinational repair (HRR), RecQ helicase activities (RECQ), telomere functioning...... and mitochondrial DNA processes. The study population was 1089 long-lived and 736 middle-aged Danes. A self-contained set-based test of all SNPs displayed association with longevity (P-value=9.9 × 10-5), supporting that the overall pathway could affect longevity. Investigation of the nine sub-processes using...

  11. Telomeric Allelic Imbalance Indicates Defective DNA Repair and Sensitivity to DNA-Damaging Agents

    DEFF Research Database (Denmark)

    Birkbak, Nicolai J.; Wang, Zhigang C.; Kim, Ji-Young;

    2012-01-01

    DNA repair competency is one determinant of sensitivity to certain chemotherapy drugs, such as cisplatin. Cancer cells with intact DNA repair can avoid the accumulation of genome damage during growth and also can repair platinum-induced DNA damage. We sought genomic signatures indicative of...... defective DNA repair in cell lines and tumors and correlated these signatures to platinum sensitivity. The number of subchromosomal regions with allelic imbalance extending to the telomere (NtAI) predicted cisplatin sensitivity in vitro and pathologic response to preoperative cisplatin treatment in patients...... mutation. Thus, accumulation of telomeric allelic imbalance is a marker of platinum sensitivity and suggests impaired DNA repair. SIGNIFICANCE: Mutations in BRCA genes cause defects in DNA repair that predict sensitivity to DNA damaging agents, including platinum; however, some patients without BRCA...

  12. Investigation of DNA damage and repair mechanism using deinococcus radiodurans

    International Nuclear Information System (INIS)

    Deninococcus Radiodurans, formerly known as Micrococcus Radiodurans, is a popular bacterium because of its high resistance to damage by carcinogens such as ionizing radiation (Dean et. al. 1966; Kitayama and Matsuyama 1968) and UV radiation (Gasvon et. al., 1995; Arrange et. al. 1993). In this report, we investigated the high resistance to ionizing radiation by this bacterium. The bacteria had been exposed from I to 5 kGy of gamma radiation and then incubated in TGY medium to study their ability to repair the broken DNA. The repair time was measured by Pulse Field Gel Electrophoresis (PFGE) method. The repair time for each dose was determined. Also in order to ensure that the repair was perfect, the bacterium was subjected to a second exposure of ionizing radiation after it has fully repaired. It was found that the 'second' repair characteristic was similar to the first repair. This confirmed that the repair after the exposure to the ionizing radiation was perfect

  13. Automated Image Processing for the Analysis of DNA Repair Dynamics

    CERN Document Server

    Riess, Thorsten; Tomas, Martin; Ferrando-May, Elisa; Merhof, Dorit

    2011-01-01

    The efficient repair of cellular DNA is essential for the maintenance and inheritance of genomic information. In order to cope with the high frequency of spontaneous and induced DNA damage, a multitude of repair mechanisms have evolved. These are enabled by a wide range of protein factors specifically recognizing different types of lesions and finally restoring the normal DNA sequence. This work focuses on the repair factor XPC (xeroderma pigmentosum complementation group C), which identifies bulky DNA lesions and initiates their removal via the nucleotide excision repair pathway. The binding of XPC to damaged DNA can be visualized in living cells by following the accumulation of a fluorescent XPC fusion at lesions induced by laser microirradiation in a fluorescence microscope. In this work, an automated image processing pipeline is presented which allows to identify and quantify the accumulation reaction without any user interaction. The image processing pipeline comprises a preprocessing stage where the ima...

  14. Connecting the Dots: From DNA Damage and Repair to Aging.

    Science.gov (United States)

    Pan, Mei-Ren; Li, Kaiyi; Lin, Shiaw-Yih; Hung, Wen-Chun

    2016-01-01

    Mammalian cells evolve a delicate system, the DNA damage response (DDR) pathway, to monitor genomic integrity and to prevent the damage from both endogenous end exogenous insults. Emerging evidence suggests that aberrant DDR and deficient DNA repair are strongly associated with cancer and aging. Our understanding of the core program of DDR has made tremendous progress in the past two decades. However, the long list of the molecules involved in the DDR and DNA repair continues to grow and the roles of the new "dots" are under intensive investigation. Here, we review the connection between DDR and DNA repair and aging and discuss the potential mechanisms by which deficient DNA repair triggers systemic effects to promote physiological or pathological aging. PMID:27164092

  15. Connecting the Dots: From DNA Damage and Repair to Aging

    Directory of Open Access Journals (Sweden)

    Mei-Ren Pan

    2016-05-01

    Full Text Available Mammalian cells evolve a delicate system, the DNA damage response (DDR pathway, to monitor genomic integrity and to prevent the damage from both endogenous end exogenous insults. Emerging evidence suggests that aberrant DDR and deficient DNA repair are strongly associated with cancer and aging. Our understanding of the core program of DDR has made tremendous progress in the past two decades. However, the long list of the molecules involved in the DDR and DNA repair continues to grow and the roles of the new “dots” are under intensive investigation. Here, we review the connection between DDR and DNA repair and aging and discuss the potential mechanisms by which deficient DNA repair triggers systemic effects to promote physiological or pathological aging.

  16. Acetylation regulates DNA repair mechanisms in human cells.

    Science.gov (United States)

    Piekna-Przybylska, Dorota; Bambara, Robert A; Balakrishnan, Lata

    2016-06-01

    The p300-mediated acetylation of enzymes involved in DNA repair and replication has been previously shown to stimulate or inhibit their activities in reconstituted systems. To explore the role of acetylation on DNA repair in cells we constructed plasmid substrates carrying inactivating damages in the EGFP reporter gene, which should be repaired in cells through DNA mismatch repair (MMR) or base excision repair (BER) mechanisms. We analyzed efficiency of repair within these plasmid substrates in cells exposed to deacetylase and acetyltransferase inhibitors, and also in cells deficient in p300 acetyltransferase. Our results indicate that protein acetylation improves DNA mismatch repair in MMR-proficient HeLa cells and also in MMR-deficient HCT116 cells. Moreover, results suggest that stimulated repair of mismatches in MMR-deficient HCT116 cells is done though a strand-displacement synthesis mechanism described previously for Okazaki fragments maturation and also for the EXOI-independent pathway of MMR. Loss of p300 reduced repair of mismatches in MMR-deficient cells, but did not have evident effects on BER mechanisms, including the long patch BER pathway. Hypoacetylation of the cells in the presence of acetyltransferase inhibitor, garcinol generally reduced efficiency of BER of 8-oxoG damage, indicating that some steps in the pathway are stimulated by acetylation. PMID:27104361

  17. Metabolism, genomics, and DNA repair in the mouse aging liver

    DEFF Research Database (Denmark)

    Lebel, Michel; de Souza-Pinto, Nadja C; Bohr, Vilhelm A

    2011-01-01

    , such as oxidized bases or persistent breaks, increase with age and correlate well with the presence of senescent hepatocytes. The level of DNA damage and/or mutation can be affected by changes in carcinogen activation, decreased ability to repair DNA, or a combination of these factors. This paper...... covers some of the DNA repair pathways affecting liver homeostasis with age using rodents as model systems....... hepatic metabolic and detoxification activities, with implications for systemic aging and age-related disease. It has become clear, using rodent models as biological tools, that genetic instability in the form of gross DNA rearrangements or point mutations accumulate in the liver with age. DNA lesions...

  18. Human DNA repair diseases: From genome instability to cancer

    Directory of Open Access Journals (Sweden)

    Carlos R. Machado

    1997-12-01

    Full Text Available Several human genetic syndromes have long been recognized to be defective in DNA repair mechanisms. This was first discovered by Cleaver (1968, who showed that cells from patients with xeroderma pigmentosum (XP were defective for the ability to remove ultraviolet (UV-induced lesions from their genome. Since then, new discoveries have promoted DNA repair studies to one of the most exciting areas of molecular biology. The present work intends to give a brief summary of the main known human genetic diseases related to DNA repair and how they may be linked to acquired diseases such as cancer

  19. Methods to alter levels of a DNA repair protein

    Science.gov (United States)

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-10-17

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  20. Recognition and repair of chemically heterogeneous structures at DNA ends.

    Science.gov (United States)

    Andres, Sara N; Schellenberg, Matthew J; Wallace, Bret D; Tumbale, Percy; Williams, R Scott

    2015-01-01

    Exposure to environmental toxicants and stressors, radiation, pharmaceutical drugs, inflammation, cellular respiration, and routine DNA metabolism all lead to the production of cytotoxic DNA strand breaks. Akin to splintered wood, DNA breaks are not "clean." Rather, DNA breaks typically lack DNA 5'-phosphate and 3'-hydroxyl moieties required for DNA synthesis and DNA ligation. Failure to resolve damage at DNA ends can lead to abnormal DNA replication and repair, and is associated with genomic instability, mutagenesis, neurological disease, ageing and carcinogenesis. An array of chemically heterogeneous DNA termini arises from spontaneously generated DNA single-strand and double-strand breaks (SSBs and DSBs), and also from normal and/or inappropriate DNA metabolism by DNA polymerases, DNA ligases and topoisomerases. As a front line of defense to these genotoxic insults, eukaryotic cells have accrued an arsenal of enzymatic first responders that bind and protect damaged DNA termini, and enzymatically tailor DNA ends for DNA repair synthesis and ligation. These nucleic acid transactions employ direct damage reversal enzymes including Aprataxin (APTX), Polynucleotide kinase phosphatase (PNK), the tyrosyl DNA phosphodiesterases (TDP1 and TDP2), the Ku70/80 complex and DNA polymerase β (POLβ). Nucleolytic processing enzymes such as the MRE11/RAD50/NBS1/CtIP complex, Flap endonuclease (FEN1) and the apurinic endonucleases (APE1 and APE2) also act in the chemical "cleansing" of DNA breaks to prevent genomic instability and disease, and promote progression of DNA- and RNA-DNA damage response (DDR and RDDR) pathways. Here, we provide an overview of cellular first responders dedicated to the detection and repair of abnormal DNA termini. PMID:25111769

  1. Role of Nicotinamide in DNA Damage, Mutagenesis, and DNA Repair

    Directory of Open Access Journals (Sweden)

    Devita Surjana

    2010-01-01

    Full Text Available Nicotinamide is a water-soluble amide form of niacin (nicotinic acid or vitamin B3. Both niacin and nicotinamide are widely available in plant and animal foods, and niacin can also be endogenously synthesized in the liver from dietary tryptophan. Nicotinamide is also commercially available in vitamin supplements and in a range of cosmetic, hair, and skin preparations. Nicotinamide is the primary precursor of nicotinamide adenine dinucleotide (NAD+, an essential coenzyme in ATP production and the sole substrate of the nuclear enzyme poly-ADP-ribose polymerase-1 (PARP-1. Numerous in vitro and in vivo studies have clearly shown that PARP-1 and NAD+ status influence cellular responses to genotoxicity which can lead to mutagenesis and cancer formation. This paper will examine the role of nicotinamide in the protection from carcinogenesis, DNA repair, and maintenance of genomic stability.

  2. A novel cell permeable DNA replication and repair marker

    OpenAIRE

    Herce, Henry D.; Rajan, Malini; Lättig-Tünnemann, Gisela; Fillies, Marion; Cardoso, M. Cristina

    2014-01-01

    Proliferating Cell Nuclear Antigen (PCNA) is a key protein in DNA replication and repair. The dynamics of replication and repair in live cells is usually studied introducing translational fusions of PCNA. To obviate the need for transfection and bypass the problem of difficult to transfect and/or short lived cells, we have now developed a cell permeable replication and/or repair marker. The design of this marker has three essential molecular components: (1) an optimized artificial PCNA bindin...

  3. THE EFFECTS OF STRESS ON DNA REPAIR CAPACITY

    OpenAIRE

    Forlenza, Michael J; Latimer, Jean J.; Baum, Andrew

    2000-01-01

    Research has shown that lymphocytes of high-distress patients have reduced DNA repair relative to that of low-distress patients and healthy controls. Furthermore, deficits in repair are associated with an increased risk of cancer. Using and academic stress model, we hypothesized that students would exhibit lower levels of Nucleotide Excision Repair (NER) during a stressful exam period when compared to a lower stress period. Participants were 19 healthy graduate level students. NER was measure...

  4. DDB2 (Damaged DNA binding protein 2) in nucleotide excision repair and DNA damage response

    OpenAIRE

    Stoyanova, Tanya; Roy, Nilotpal; Kopanja, Dragana; Raychaudhuri, Pradip; Bagchi, Srilata

    2009-01-01

    DDB2 was identified as a protein involved in the Nucleotide Excision Repair (NER), a major DNA repair mechanism that repairs UV damage to prevent accumulation of mutations and tumorigenesis. However, recent studies indicated additional functions of DDB2 in the DNA damage response pathway. Herein, we discuss the proposed mechanisms by which DDB2 activates NER and programmed cell death upon DNA damage through its E3 ligase activity.

  5. Unilateral ureteral obstruction induces DNA repair by APE1

    DEFF Research Database (Denmark)

    Aamann, Maria Diget; Norregaard, Rikke; Kristensen, Marie Louise V;

    2016-01-01

    Ureteral obstruction is associated with oxidative stress and fibrosis development of the kidney parenchyma. Apurinic/apyrimidinic endonuclease I (APE1) is an essential DNA repair enzyme for repair of oxidative DNA lesions and regulates several transcription factors. The aim of this study was to...... inner medulla (IM). In contrast, APE1 protein level was not regulated in IM and ISOM and only slightly increased in cortex. APE1 DNA repair activity was not significantly changed. A different pattern of regulation was observed after 7 days UUO with APE1 mRNA increase in cortex but not in ISOM and IM....... APE1 protein level in cortex, ISOM and IM increased significantly. Importantly, we observed a significant increase in APE1 DNA repair activity in cortex and IM. To confirm our model we investigated HO-1, collagen I, fibronectin I, and α-SMA levels. In vitro we found the transcriptional regulatory...

  6. D-ribose inhibits DNA repair synthesis in human lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zunica, G.; Marini, M.; Brunelli, M.A.; Chiricolo, M.; Franceschi, C.

    1986-07-31

    D-ribose is cytotoxic for quiescent human lymphocytes and severely inhibits their PHA-induced proliferation at concentrations (25-50 mM) at which other simple sugars are ineffective. In order to explain these effects, DNA repair synthesis was evaluated in PHA-stimulated human lymphocytes treated with hydroxyurea and irradiated. D-ribose, in contrast to other reducing sugars, did not induce repair synthesis and therefore did not apparently damage DNA in a direct way, although it markedly inhibited gamma ray-induced repair. Taking into account that lymphocytes must rejoin physiologically-formed DNA strand breaks in order to enter the cell cycle, we suggest that D-ribose exerts its cytotoxic activity by interfering with metabolic pathways critical for the repair of DNA breaks.

  7. Dynamic regulation of cerebral DNA repair genes by psychological stress

    DEFF Research Database (Denmark)

    Forsberg, Kristin; Aalling, Nadia; Wörtwein, Gitta;

    2015-01-01

    Neuronal genotoxic insults from oxidative stress constitute a putative molecular link between stress and depression on the one hand, and cognitive dysfunction and dementia risk on the other. Oxidative modifications to DNA are repaired by specific enzymes; a process that plays a critical role...... for maintaining genomic integrity. The aim of the present study was to characterize the pattern of cerebral DNA repair enzyme regulation after stress through the quantification of a targeted range of gene products involved in different types of DNA repair. 72 male Sprague-Dawley rats were subjected to either...... restraint stress (6h/day) or daily handling (controls), and sacrificed after 1, 7 or 21 stress sessions. The mRNA expression of seven genes (Ogg1, Ape1, Ung1, Neil1, Xrcc1, Ercc1, Nudt1) involved in the repair of oxidatively damaged DNA was determined by quantitative real time polymerase chain reaction...

  8. Molecular mechanisms of DNA repair inhibition by caffeine

    International Nuclear Information System (INIS)

    Caffeine potentiates the mutagenic and lethal effects of genotoxic agents. It is thought that this is due, at least in some organisms, to inhibition of DNA repair. However, direct evidence for inhibition of repair enzymes has been lacking. Using purified Escherichia coli DNA photolyase and (A)BC excinuclease, we show that the drug inhibits photoreactivation and nucleotide excision repair by two different mechanisms. Caffeine inhibits photoreactivation by interfering with the specific binding of photolyase to damaged DNA, and it inhibits nucleotide excision repair by promoting nonspecific binding of the damage-recognition subunit, UvrA, of (A)BC excinuclease. A number of other intercalators, including acriflavin and ethidium bromide, appear to inhibit the excinuclease by a similar mechanism--that is, by trapping the UvrA subunit in nonproductive complexes on undamaged DNA

  9. p53 in the DNA-Damage-Repair Process.

    Science.gov (United States)

    Williams, Ashley B; Schumacher, Björn

    2016-01-01

    The cells in the human body are continuously challenged by a variety of genotoxic attacks. Erroneous repair of the DNA can lead to mutations and chromosomal aberrations that can alter the functions of tumor suppressor genes or oncogenes, thus causing cancer development. As a central tumor suppressor, p53 guards the genome by orchestrating a variety of DNA-damage-response (DDR) mechanisms. Already early in metazoan evolution, p53 started controlling the apoptotic demise of genomically compromised cells. p53 plays a prominent role as a facilitator of DNA repair by halting the cell cycle to allow time for the repair machineries to restore genome stability. In addition, p53 took on diverse roles to also directly impact the activity of various DNA-repair systems. It thus appears as if p53 is multitasking in providing protection from cancer development by maintaining genome stability. PMID:27048304

  10. 4. DNA REPAIR CAPACITY IN LUNG CANCER PATIENTS

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    @@The ability for DNA repair is an important host factor which influences the individual susceptibility to genotoxic carcinogen exposures. It has been shown in different case-control studies that DNA repair capacity (DRC) can be reduced in lung cancer patients.We have used an alkaline comet assay to measure the cellular DRC in peri-pheral blood lymphocytes of lung cancer patients and tumor-free control

  11. Mitochondrial DNA repair: a novel therapeutic target for heart failure.

    Science.gov (United States)

    Marín-García, José

    2016-09-01

    Mitochondria play a crucial role in a variety of cellular processes ranging from energy metabolism, generation of reactive oxygen species (ROS) and Ca(2+) handling to stress responses, cell survival and death. Malfunction of the organelle may contribute to the pathogenesis of neuromuscular, cancer, premature aging and cardiovascular diseases (CVD), including myocardial ischemia, cardiomyopathy and heart failure (HF). Mitochondria contain their own genome organized into DNA-protein complexes, called "mitochondrial nucleoids," along with multiprotein machineries, which promote mitochondrial DNA (mtDNA) replication, transcription and repair. Although the mammalian organelle possesses almost all known nuclear DNA repair pathways, including base excision repair, mismatch repair and recombinational repair, the proximity of mtDNA to the main sites of ROS production and the lack of protective histones may result in increased susceptibility to various types of mtDNA damage. These include accumulation of mtDNA point mutations and/or deletions and decreased mtDNA copy number, which will impair mitochondrial function and finally, may lead to CVD including HF. PMID:26940911

  12. Efficient Repair of Abasic Sites in DNA by Mitochondrial Enzymes

    OpenAIRE

    Pinz, Kevin G.; Bogenhagen, Daniel F.

    1998-01-01

    Mutations in mitochondrial DNA (mtDNA) cause a variety of relatively rare human diseases and may contribute to the pathogenesis of other, more common degenerative diseases. This stimulates interest in the capacity of mitochondria to repair damage to mtDNA. Several recent studies have shown that some types of damage to mtDNA may be repaired, particularly if the lesions can be processed through a base excision mechanism that employs an abasic site as a common intermediate. In this paper, we dem...

  13. Heavy Metal Exposure Influences Double Strand Break DNA Repair Outcomes

    Science.gov (United States)

    Morales, Maria E.; Derbes, Rebecca S.; Ade, Catherine M.; Ortego, Jonathan C.; Stark, Jeremy; Deininger, Prescott L.; Roy-Engel, Astrid M.

    2016-01-01

    Heavy metals such as cadmium, arsenic and nickel are classified as carcinogens. Although the precise mechanism of carcinogenesis is undefined, heavy metal exposure can contribute to genetic damage by inducing double strand breaks (DSBs) as well as inhibiting critical proteins from different DNA repair pathways. Here we take advantage of two previously published culture assay systems developed to address mechanistic aspects of DNA repair to evaluate the effects of heavy metal exposures on competing DNA repair outcomes. Our results demonstrate that exposure to heavy metals significantly alters how cells repair double strand breaks. The effects observed are both specific to the particular metal and dose dependent. Low doses of NiCl2 favored resolution of DSBs through homologous recombination (HR) and single strand annealing (SSA), which were inhibited by higher NiCl2 doses. In contrast, cells exposed to arsenic trioxide preferentially repaired using the “error prone” non-homologous end joining (alt-NHEJ) while inhibiting repair by HR. In addition, we determined that low doses of nickel and cadmium contributed to an increase in mutagenic recombination-mediated by Alu elements, the most numerous family of repetitive elements in humans. Sequence verification confirmed that the majority of the genetic deletions were the result of Alu-mediated non-allelic recombination events that predominantly arose from repair by SSA. All heavy metals showed a shift in the outcomes of alt-NHEJ repair with a significant increase of non-templated sequence insertions at the DSB repair site. Our data suggest that exposure to heavy metals will alter the choice of DNA repair pathway changing the genetic outcome of DSBs repair. PMID:26966913

  14. Purification of mammalian DNA repair protein XRCC1

    Energy Technology Data Exchange (ETDEWEB)

    Chen, I. [Univ. of California, Berkeley, CA (United States)

    1995-11-01

    Malfunctioning DNA repair systems lead to cancer mutations, and cell death. XRCC1 (X-ray Repair Cross Complementing) is a human DNA repair gene that has been found to fully correct the x-ray repair defect in Chinese hamster ovary (CHO) cell mutant EM9. The corresponding protein (XRCC1) encoded by this gene has been linked to a DNA repair pathway known as base excision repair, and affects the activity of DNA ligase III. Previously, an XRCC1 cDNA minigene (consisting of the uninterrupted coding sequence for XRCC1 protein followed by a decahistidine tag) was constructed and cloned into vector pET-16b for the purpose of: (1) overproduction of XRCC1 in both prokaryotic and eukaryotic cells; and (2) to facilitate rapid purification of XRCC1 from these systems. A vector is basically a DNA carrier that allows recombinant protein to be cloned and overexpressed in host cells. In this study, XRCC1 protein was overexpressed in E. coli and purified by immobilized metal affinity chromatography. Currently, the XRCC1 minigene is being inserted into a new vector [pET-26b(+)] in hopes to increase overexpression and improve purification. Once purified XRCC1 can be crystallized for structural studies, or studied in vitro for its biological function.

  15. DNA damage and repair in age-related macular degeneration

    Energy Technology Data Exchange (ETDEWEB)

    Szaflik, Jacek P. [Department of Ophthalmology, Medical University of Warsaw and Samodzielny Publiczny Szpital Okulistyczny, Sierakowskiego 13, 03-710 Warsaw (Poland); Janik-Papis, Katarzyna; Synowiec, Ewelina; Ksiazek, Dominika [Department of Molecular Genetics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland); Zaras, Magdalena [Department of Ophthalmology, Medical University of Warsaw and Samodzielny Publiczny Szpital Okulistyczny, Sierakowskiego 13, 03-710 Warsaw (Poland); Wozniak, Katarzyna [Department of Molecular Genetics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland); Szaflik, Jerzy [Department of Ophthalmology, Medical University of Warsaw and Samodzielny Publiczny Szpital Okulistyczny, Sierakowskiego 13, 03-710 Warsaw (Poland); Blasiak, Janusz, E-mail: januszb@biol.uni.lodz.pl [Department of Molecular Genetics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland)

    2009-10-02

    Age-related macular degeneration (AMD) is a retinal degenerative disease that is the main cause of vision loss in individuals over the age of 55 in the Western world. Clinically relevant AMD results from damage to the retinal pigment epithelial (RPE) cells thought to be mainly caused by oxidative stress. The stress also affects the DNA of RPE cells, which promotes genome instability in these cells. These effects may coincide with the decrease in the efficacy of DNA repair with age. Therefore individuals with DNA repair impaired more than average for a given age may be more susceptible to AMD if oxidative stress affects their RPE cells. This may be helpful in AMD risk assessment. In the present work we determined the level of basal (measured in the alkaline comet assay) endogenous and endogenous oxidative DNA damage, the susceptibility to exogenous mutagens and the efficacy of DNA repair in lymphocytes of 100 AMD patients and 110 age-matched individuals without visual disturbances. The cells taken from AMD patients displayed a higher extent of basal endogenous DNA damage without differences between patients of dry and wet forms of the disease. DNA double-strand breaks did not contribute to the observed DNA damage as checked by the neutral comet assay and pulsed field gel electrophoresis. The extent of oxidative modification to DNA bases was grater in AMD patients than in the controls, as probed by DNA repair enzymes NTH1 and Fpg. Lymphocytes from AMD patients displayed a higher sensitivity to hydrogen peroxide and UV radiation and repaired lesions induced by these factors less effectively than the cells from the control individuals. We postulate that the impaired efficacy of DNA repair may combine with enhanced sensitivity of RPE cells to blue and UV lights, contributing to the pathogenesis of AMD.

  16. DNA damage and repair in age-related macular degeneration

    International Nuclear Information System (INIS)

    Age-related macular degeneration (AMD) is a retinal degenerative disease that is the main cause of vision loss in individuals over the age of 55 in the Western world. Clinically relevant AMD results from damage to the retinal pigment epithelial (RPE) cells thought to be mainly caused by oxidative stress. The stress also affects the DNA of RPE cells, which promotes genome instability in these cells. These effects may coincide with the decrease in the efficacy of DNA repair with age. Therefore individuals with DNA repair impaired more than average for a given age may be more susceptible to AMD if oxidative stress affects their RPE cells. This may be helpful in AMD risk assessment. In the present work we determined the level of basal (measured in the alkaline comet assay) endogenous and endogenous oxidative DNA damage, the susceptibility to exogenous mutagens and the efficacy of DNA repair in lymphocytes of 100 AMD patients and 110 age-matched individuals without visual disturbances. The cells taken from AMD patients displayed a higher extent of basal endogenous DNA damage without differences between patients of dry and wet forms of the disease. DNA double-strand breaks did not contribute to the observed DNA damage as checked by the neutral comet assay and pulsed field gel electrophoresis. The extent of oxidative modification to DNA bases was grater in AMD patients than in the controls, as probed by DNA repair enzymes NTH1 and Fpg. Lymphocytes from AMD patients displayed a higher sensitivity to hydrogen peroxide and UV radiation and repaired lesions induced by these factors less effectively than the cells from the control individuals. We postulate that the impaired efficacy of DNA repair may combine with enhanced sensitivity of RPE cells to blue and UV lights, contributing to the pathogenesis of AMD.

  17. The ERCC1-xeroderma pigmentosum group F DNA repair complex

    OpenAIRE

    Sijbers, Anneke

    1999-01-01

    textabstractIn its long nucleotide-chains, the DNA double helix contains the genetic information for ten thousands of proteins. The DNA molecule, however, is subject to constant change. In order to l11ailltaill its integrity, several luechallisms that cope with DNA damage, inflicted byvarious naturally occurring and man-made agents, have evolved. Individuals with the rare genetic disease xeroderma pigmentosum demonstrate the importance of DNA repair systems. These patients carry a defect in p...

  18. Beyond DNA repair: additional functions of PARP-1 in cancer.

    OpenAIRE

    AliceNWeaver; EddySYang

    2013-01-01

    Poly(ADP-ribose) polymerases (PARPs) are DNA-dependent nuclear enzymes that transfer negatively charged ADP-ribose moieties from cellular nicotinamide-adenine-dinucleotide (NAD+) to a variety of protein substrates, altering protein-protein and protein-DNA interactions. The most studied of these enzymes is PARP-1, which is an excellent therapeutic target in cancer due to its pivotal role in the DNA damage response. Clinical studies have shown susceptibility to PARP inhibitors in DNA repair d...

  19. Repair of DNA lesions associated with triplex-forming oligonucleotides

    OpenAIRE

    Chin, Joanna Y; Glazer, Peter M.

    2009-01-01

    Triplex-forming oligonucleotides (TFOs) are gene targeting tools that can bind in the major groove of duplex DNA in a sequence-specific manner. When bound to DNA, TFOs can inhibit gene expression, can position DNA-reactive agents to specific locations in the genome, or can induce targeted mutagenesis and recombination. There is evidence that third strand binding, alone or with an associated cross-link, is recognized and metabolized by DNA repair factors, particularly the nucleotide excision r...

  20. DNA damage and repair in human skin in situ

    International Nuclear Information System (INIS)

    Understanding the molecular and cellular origins of sunlight-induced skin cancers in man requires knowledge of the damages inflicted on human skin during sunlight exposure, as well as the ability of cells in skin to repair or circumvent such damage. Although repair has been studied extensively in procaryotic and eucaryotic cells - including human cells in culture - there are important differences between repair by human skin cells in culture and human skin in situ: quantitative differences in rates of repair, as well as qualitative differences, including the presence or absence of repair mechanisms. Quantitation of DNA damage and repair in human skin required the development of new approaches for measuring damage at low levels in nanogram quantities of non-radioactive DNA. The method allows for analysis of multiple samples and the resulting data should be related to behavior of the DNA molecules by analytic expressions. Furthermore, it should be possible to assay a variety of lesions using the same methodology. The development of new analysis methods, new technology, and new biochemical probes for the study of DNA damage and repair are described. 28 refs., 4 figs

  1. The repair fidelity of restriction enzyme-induced double strand breaks in plasmid DNA correlates with radioresistance in human tumor cell lines

    International Nuclear Information System (INIS)

    The accuracy of DNA repair may play a role in determining the cytotoxic effect of ionizing radiation. Repair, as measured by DNA strand breakage, often shows little difference between tumor cell lines of widely different radiosensitivity. The mechanism by which DNA fragments are rejoined is poorly understood. This study used plasmid transfection as a probe to assess the balance between correct repair and misrepair. A general trend for sensitive cells to show lower repair fidelity relative to resistant cells was observed. The type of double-strand cleavage of the plasmid (staggered or blunt) made little difference to the measured repair fidelity, in contrast to published studies in which restriction-enzyme breaks had been introduced into DNA within chromatin. Specific comparison of parent lines and their radiosensitive clones showed significant differences in repair fidelity for a relatively small change in radiation response, which was in line with the overall correlation. These same pairs have previously been shown to have no difference in the loss of DNA fragmentation with time after irradiation, and Southern analysis had confirmed the integrated plasmid copy number was similar in the cell lines compared. The number of intact copies of the damaged gene relative to the undamaged gene mirrored the observed repair fidelity. However, in one cell line out of the 10 studied, an exception to the observed trend was found. In comparison of two equally radioresistant bladder cancer cell lines, large differences in repair fidelity were observed. Again, no difference in the integrated copy number was found, and the damaged gene was highly rearranged or deleted in the cell line with low repair fidelity. It is suggested that repair fidelity can be, but is not invariably, a measure of correct repair relative to misrepair, resulting from the processing of double-strand breaks and, hence, the response to ionizing radiation. 24 refs., 2 figs., 2 tabs

  2. Role of poly(ADP-ribosepolymerase 2 in DNA repair

    Directory of Open Access Journals (Sweden)

    Lavrik O. I.

    2012-06-01

    Full Text Available Poly(ADP-ribosylation is a posttranslational protein modification significant for the genomic stability and cell survival in response to DNA damage. Poly(ADP-ribosylation is catalyzed by poly(ADP-ribosepolymerases (PARPs, which use NAD+ as a substrate, synthesize polymer of (ADP-ribose (PAR covalently attached to nuclear proteins including PARP themselves. PARPs constitute a large family of proteins, in which PARP1 is the most abundant and best-characterized member. In spite of growing body of PARPs’ role in cellular processes, PARP2, the closest homolog of PARP1, still remains poorly characterized at the level of its contribution to different pathways of DNA repair. An overview summarizes in vivo and in vitro data on PARP2 implication in specialized DNA repair processes, base excision repair and double strand break repair.

  3. An Overview of the Molecular Mechanisms of Recombinational DNA Repair.

    Science.gov (United States)

    Kowalczykowski, Stephen C

    2015-11-01

    Recombinational DNA repair is a universal aspect of DNA metabolism and is essential for genomic integrity. It is a template-directed process that uses a second chromosomal copy (sister, daughter, or homolog) to ensure proper repair of broken chromosomes. The key steps of recombination are conserved from phage through human, and an overview of those steps is provided in this review. The first step is resection by helicases and nucleases to produce single-stranded DNA (ssDNA) that defines the homologous locus. The ssDNA is a scaffold for assembly of the RecA/RAD51 filament, which promotes the homology search. On finding homology, the nucleoprotein filament catalyzes exchange of DNA strands to form a joint molecule. Recombination is controlled by regulating the fate of both RecA/RAD51 filaments and DNA pairing intermediates. Finally, intermediates that mature into Holliday structures are disjoined by either nucleolytic resolution or topological dissolution. PMID:26525148

  4. Molecular Pathways: Targeting DNA Repair Pathway Defects Enriched in Metastasis.

    Science.gov (United States)

    Corcoran, Niall M; Clarkson, Michael J; Stuchbery, Ryan; Hovens, Christopher M

    2016-07-01

    The maintenance of a pristine genome, free from errors, is necessary to prevent cellular transformation and degeneration. When errors in DNA are detected, DNA damage repair (DDR) genes and their regulators are activated to effect repair. When these DDR pathways are themselves mutated or aberrantly downregulated, cancer and neurodegenerative disorders can ensue. Multiple lines of evidence now indicate, however, that defects in key regulators of DNA repair pathways are highly enriched in human metastasis specimens and hence may be a key step in the acquisition of metastasis and the ability of localized disease to disseminate. Some of the key regulators of checkpoints in the DNA damage response are the TP53 protein and the PARP enzyme family. Targeting of these pathways, especially through PARP inhibition, is now being exploited therapeutically to effect significant clinical responses in subsets of individuals, particularly in patients with ovarian cancer or prostate cancer, including cancers with a marked metastatic burden. Targeting DNA repair-deficient tumors with drugs that take advantage of the fundamental differences between normal repair-proficient cells and repair-deficient tumors offers new avenues for treating advanced disease in the future. Clin Cancer Res; 22(13); 3132-7. ©2016 AACR. PMID:27169997

  5. Genetics of repair of radiation damage to DNA in bacteria

    International Nuclear Information System (INIS)

    The goal of this project is to study the consequences to bacterial DNA of damage by radiation and chemical agents. By correlating the extent of physical and biological damage to DNA, as expressed in various mutants defective in specific DNA repair pathways, we hope to determine mechanisms of biological inactivation of DNA and ways in which the damage can be repaired. We have measured physical damage to DNA in Bacillus subtilis and Escherichia coli by use of alkaline sucrose gradient centrifugation, which indicates the distance between breaks or alkali-labile lesions in single strands of DNA. Biological damage is measured by loss of viability or by loss of transforming activity in treated DNA from B. subtilis, and by the production of sites for DNA repair synthesis by DNA polymerase I (Pol I) in toluene-treated E. coli. We have investigated effects of ultraviolet light (both far-uv and near-uv), ionizing radiation, and selected chemical agents, in the presence or absence of sensitizing or protective agents. A major goal was to characterize DNA repair processes in vivo in B. subtilis. A number of radiation-sensitive mutants were studied, with the result that we have learned a great many details about the repair of DNA in uv-irradiated cells: We have now also studied the induction of methyltransferase in B. subtilis exposed to low concentrations of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). In collaboration with Sankar Mitra and R.S. Foote (Biology Division), we have shown that the basal level of methyltransferase in B. subtilis is about ten-fold higher than in E. coli and that there is about a ten-fold increase during adaptation. Our future studies will focus on the radioprotective effects of alcohols that act as OH radical scavengers but also react to irradiation by the formation of a radical on the carbon alpha to the hydroxyl

  6. Role of polynucleotide kinase/phosphatase in mitochondrial DNA repair

    Science.gov (United States)

    Tahbaz, Nasser; Subedi, Sudip; Weinfeld, Michael

    2012-01-01

    Mutations in mitochondrial DNA (mtDNA) are implicated in a broad range of human diseases and in aging. Compared to nuclear DNA, mtDNA is more highly exposed to oxidative damage due to its proximity to the respiratory chain and the lack of protection afforded by chromatin-associated proteins. While repair of oxidative damage to the bases in mtDNA through the base excision repair pathway has been well studied, the repair of oxidatively induced strand breaks in mtDNA has been less thoroughly examined. Polynucleotide kinase/phosphatase (PNKP) processes strand-break termini to render them chemically compatible for the subsequent action of DNA polymerases and ligases. Here, we demonstrate that functionally active full-length PNKP is present in mitochondria as well as nuclei. Downregulation of PNKP results in an accumulation of strand breaks in mtDNA of hydrogen peroxide-treated cells. Full restoration of repair of the H2O2-induced strand breaks in mitochondria requires both the kinase and phosphatase activities of PNKP. We also demonstrate that PNKP contains a mitochondrial-targeting signal close to the C-terminus of the protein. We further show that PNKP associates with the mitochondrial protein mitofilin. Interaction with mitofilin may serve to translocate PNKP into mitochondria. PMID:22210862

  7. Recombinant methods for screening human DNA excision repair proficiency

    International Nuclear Information System (INIS)

    A method for measuring DNA excision repair in response to ultraviolet radiation (UV)-induced DNA damage has been developed, validated, and field-tested in cultured human lymphocytes. The methodology is amenable to population-based screening and should facilitate future epidemiologic studies seeking to investigate associations between excision repair proficiency and cancer susceptibility. The impetus for such endeavors derives from the belief that the high incidence of skin cancer in the genetic disorder xeroderma pigmentosum (XP) primarily is a result of the reduced capacity of patients cells to repair UV-induced DNA damage. For assay, UV-irradiated non-replicating recombinant plasmid DNA harboring a chloramphenicol acetyltransferase (CAT) indicator gene is introduced into lymphocytes using DEAE-dextran short-term transfection conditions. Exposure to UV induces transcriptionally-inactivating DNA photoproducts in the plasmid DNA which inactivate CAT gene expression. Excision repair of the damaged CAT gene is monitored indirectly as a function of reactivated CAT enzyme activity following a 40 hour repair/expression incubation period

  8. ABH2 Couples Regulation of Ribosomal DNA Transcription with DNA Alkylation Repair

    Directory of Open Access Journals (Sweden)

    Pishun Li

    2013-08-01

    Full Text Available Transcription has been linked to DNA damage. How the most highly transcribed mammalian ribosomal (rDNA genes maintain genome integrity in the absence of transcription-coupled DNA damage repair is poorly understood. Here, we report that ABH2/ALKBH2, a DNA alkylation repair enzyme, is highly enriched in the nucleolus. ABH2 interacts with DNA repair proteins Ku70 and Ku80 as well as nucleolar proteins nucleolin, nucleophosmin 1, and upstream binding factor (UBF. ABH2 associates with and promotes rDNA transcription through its DNA repair activity. ABH2 knockdown impairs rDNA transcription and leads to increased single-stranded and double-stranded DNA breaks that are more pronounced in the rDNA genes, whereas ABH2 overexpression protects cells from methyl-methanesulfonate-induced DNA damage and inhibition of rDNA transcription. In response to massive alkylation damage, ABH2 rapidly redistributes from the nucleolus to nucleoplasm. Our study thus reveals a critical role of ABH2 in maintaining rDNA gene integrity and transcription and provides insight into the ABH2 DNA repair function.

  9. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  10. Molecular basis for DNA strand displacement by NHEJ repair polymerases.

    Science.gov (United States)

    Bartlett, Edward J; Brissett, Nigel C; Plocinski, Przemyslaw; Carlberg, Tom; Doherty, Aidan J

    2016-03-18

    The non-homologous end-joining (NHEJ) pathway repairs DNA double-strand breaks (DSBs) in all domains of life. Archaea and bacteria utilize a conserved set of multifunctional proteins in a pathway termed Archaeo-Prokaryotic (AP) NHEJ that facilitates DSB repair. Archaeal NHEJ polymerases (Pol) are capable of strand displacement synthesis, whilst filling DNA gaps or partially annealed DNA ends, which can give rise to unligatable intermediates. However, an associated NHEJ phosphoesterase (PE) resects these products to ensure that efficient ligation occurs. Here, we describe the crystal structures of these archaeal (Methanocella paludicola) NHEJ nuclease and polymerase enzymes, demonstrating their strict structural conservation with their bacterial NHEJ counterparts. Structural analysis, in conjunction with biochemical studies, has uncovered the molecular basis for DNA strand displacement synthesis in AP-NHEJ, revealing the mechanisms that enable Pol and PE to displace annealed bases to facilitate their respective roles in DSB repair. PMID:26405198

  11. Somatic cell genetics approach to dissecting mammalian DNA repair

    International Nuclear Information System (INIS)

    This review article examines the application of the methods and concepts of somatic cell genetics to the study of DNA repair. The first steps of this approach involve classical procedures of mutant isolation, complementation analysis, and mapping of genes using hybrid cells. Subsequent steps utilize the techniques of DNA-mediated gene transfer and methodologies of the recombinant DNA field. Several human repair genes have been cloned, but they have not been used to overproduce proteins thus far. This article highlights the more important developments and attempts to review in detail all of the isolated mutant cell lines that may be altered in the repair processes. Faster methods of gene cloning are greatly needed because the procedures for making secondary transformants from total genomic DNA are tedious

  12. DNA repair in murine embryonic stem cells and differentiated cells

    International Nuclear Information System (INIS)

    Embryonic stem (ES) cells are rapidly proliferating, self-renewing cells that have the capacity to differentiate into all three germ layers to form the embryo proper. Since these cells are critical for embryo formation, they must have robust prophylactic mechanisms to ensure that their genomic integrity is preserved. Indeed, several studies have suggested that ES cells are hypersensitive to DNA damaging agents and readily undergo apoptosis to eliminate damaged cells from the population. Other evidence suggests that DNA damage can cause premature differentiation in these cells. Several laboratories have also begun to investigate the role of DNA repair in the maintenance of ES cell genomic integrity. It does appear that ES cells differ in their capacity to repair damaged DNA compared to differentiated cells. This minireview focuses on repair mechanisms ES cells may use to help preserve genomic integrity and compares available data regarding these mechanisms with those utilized by differentiated cells

  13. Electron Transfer Mechanisms of DNA Repair by Photolyase

    Science.gov (United States)

    Zhong, Dongping

    2015-04-01

    Photolyase is a flavin photoenzyme that repairs two DNA base damage products induced by ultraviolet (UV) light: cyclobutane pyrimidine dimers and 6-4 photoproducts. With femtosecond spectroscopy and site-directed mutagenesis, investigators have recently made significant advances in our understanding of UV-damaged DNA repair, and the entire enzymatic dynamics can now be mapped out in real time. For dimer repair, six elementary steps have been characterized, including three electron transfer reactions and two bond-breaking processes, and their reaction times have been determined. A unique electron-tunneling pathway was identified, and the critical residues in modulating the repair function at the active site were determined. The dynamic synergy between the elementary reactions for maintaining high repair efficiency was elucidated, and the biological nature of the flavin active state was uncovered. For 6-4 photoproduct repair, a proton-coupled electron transfer repair mechanism has been revealed. The elucidation of electron transfer mechanisms and two repair photocycles is significant and provides a molecular basis for future practical applications, such as in rational drug design for curing skin cancer.

  14. Differences in mutagenic and recombinational DNA repair in enterobacteria

    International Nuclear Information System (INIS)

    The incidence of recombinational DNA repair and inducible mutagenic DNA repair has been examined in Escherichia coli and 11 related species of enterobacteria. Recombinational repair was found to be a common feature of the DNA repair repertoire of at least 6 genera of enterobacteria. This conclusion is based on observations of (i) damage-induced synthesis of RecA-like proteins, (ii) nucleotide hybridization between E. coli recA sequences and some chromosomal DNAs, and (iii) recA-negative complementation by plasmids showing SOS-inducible expression of truncated E. coli recA genes. The mechanism of DNA damage-induced gene expression is therefore sufficiently conserved to allow non-E. coli regulatory elements to govern expression of these cloned truncated E. coli recA genes. In contrast, the process of mutagenic repair, which uses umuC+ umuD+ gene products in E. coli, appeared less widespread. Little ultraviolet light-induced mutagenesis to rifampicin resistance was detected outside the genus Escherichia, and even within the genus induced mutagenesis was detected in only 3 out of 6 species. Nucleotide hybridization showed that sequences like the E. coli umuCD+ gene are not found in these poorly mutable organisms. Evolutionary questions raised by the sporadic incidence of inducible mutagenic repair are discussed

  15. Effects of environmental exposure: Interplay between helix-distorting and oxidative DNA lesions and their repair

    OpenAIRE

    Lakså, Solveig Margrethe B.

    2012-01-01

    DNA lesions are introduced in all living organisms every day, both via endogenous processes and by exposure to an array of DNA damaging agents. DNA lesions require repair for the sustenance of life. Base excision repair (BER) and nucleotide excision repair (NER) are DNA repair pathways involved in removal of oxidative DNA lesions and helix-distorting DNA lesions, respectively. Several studies suggest interactions or crosstalk between these pathways, involving overlapping activities for remova...

  16. Repair of DNA damage induced by ultraviolet radiation

    International Nuclear Information System (INIS)

    Studies documenting the depletion of the ozone layer and the resulting increases in UV-B radiation (280-320 nm) at the Earth's surface have served to focus attention on the biological effects of UV light. One obvious target for UVB- induced damage is DNA. Although a11 biological tissues are rich in UV-absorbing agents (largely nucleic acids and proteins) and plants produce additional UV-absorbing pigments, no DNA in superficial tissue can completely avoid UV exposure. Plants, like a11 living organisms, must have some capacity for the repair of UV-induced DNA damage. Because plants are unique in the obligatory nature of their exposure to UV, it is also conceivable that they may have evolved particularly efficient mechanisms for the elimination of UV-induced DNA damage. This review will summarize what we know about DNA repair mechanisms in higher plants. Readers interested in broader aspects of UV-induced damage and UV filters are directed to recent reviews (Middleton and Teramura, 1994; Strid et al., 1994; Fiscus and Booker, 1995). Our knowledge of DNA repair mechanisms in plants lags far behind our understanding of these pathways in animals, and a significant number of questions concerning the basic phenomenology of DNA repair in plants remain to be addressed

  17. Regulation of DNA double-strand break repair pathway choice

    Institute of Scientific and Technical Information of China (English)

    Meena Shrivastav; Leyma P De Haro; Jac A Nickoloff

    2008-01-01

    DNA double-strand breaks (DSBs) are critical lesions that can result in cell death or a wide variety of genetic alterations including large- or small-scale deletions, loss of heterozygosity, translocations, and chromosome loss. DSBs are repaired by non-homologous end-joining (NHEJ) and homologous recombination (HR), and defects in these pathways cause genome instability and promote tumorigenesis. DSBs arise from endogenous sources includ-ing reactive oxygen species generated during cellular metabolism, collapsed replication forks, and nucleases, and from exogenous sources including ionizing radiation and chemicals that directly or indirectly damage DNA and are commonly used in cancer therapy. The DSB repair pathways appear to compete for DSBs, but the balance between them differs widely among species, between different cell types of a single species, and during different cell cycle phases of a single cell type. Here we review the regulatory factors that regulate DSB repair by NHEJ and HR in yeast and higher eukaryotes. These factors include regulated expression and phosphorylation of repair proteins, chromatin modulation of repair factor accessibility, and the availability of homologous repair templates. While most DSB repair proteins appear to function exclusively in NHEJ or HR, a number of proteins influence both pathways, including the MRE11/RAD50/NBS1 (XRS2) complex, BRCA1, histone H2AX, PARP-1, RAD18, DNA-dependent protein kinase catalytic subunit (DNA-PKcs), and ATM. DNA-PKcs plays a role in mammalian NHEJ, but it also influences HR through a complex regulatory network that may involve crosstalk with ATM, and the regulation of at least 12 proteins involved in HR that are phosphorylated by DNA-PKcs and/or ATM.

  18. Chromosomal Aberrations in DNA Repair Defective Cell Lines: Comparisons of Dose Rate and Radiation Quality

    Science.gov (United States)

    George, K. A.; Hada, M.; Patel, Z.; Huff, J.; Pluth, J. M.; Cucinotta, F. A.

    2009-01-01

    Chromosome aberration yields were assessed in DNA double-strand break repair (DSB) deficient cells after acute doses of gamma-rays or high-LET iron nuclei, or low dose-rate (0.018 Gy/hr) gamma-rays. We studied several cell lines including fibroblasts deficient in ATM (product of the gene that is mutated in ataxia telangiectasia patients) or NBS (product of the gene mutated in the Nijmegen breakage syndrome), and gliomablastoma cells that are proficient or lacking in DNA-dependent protein kinase, DNA-PK activity. Chromosomes were analyzed using the fluorescence in-situ hybridization (FISH) chromosome painting method in cells at the first division post-irradiation and chromosome aberrations were identified as either simple exchanges (translocations and dicentrics) or complex exchanges (involving >2 breaks in 2 or more chromosomes). Gamma radiation induced higher yields of both simple and complex exchanges in the DSB repair defective cells than in the normal cells. The quadratic dose-response terms for both chromosome exchange types were significantly higher for the ATM and NBS defective lines than for normal fibroblasts. However, the linear dose-response term was significantly higher only for simple exchanges in the NBS cells. Large increases in the quadratic dose response terms indicate the important roles of ATM and NBS in chromatin modifications that facilitate correct DSB repair and minimize aberration formation. Differences in the response of AT and NBS deficient cells at lower doses suggests important questions about the applicability of observations of radiation sensitivity at high dose to low dose exposures. For all iron nuclei irradiated cells, regression models preferred purely linear and quadratic dose responses for simple and complex exchanges, respectively. All the DNA repair defective cell lines had lower Relative biological effectiveness (RBE) values than normal cells, the lowest being for the DNA-PK-deficient cells, which was near unity. To further

  19. Identification of Saccharomyces cerevisiae DNA ligase IV: involvement in DNA double-strand break repair.

    OpenAIRE

    Teo, S H; Jackson, S P

    1997-01-01

    DNA ligases catalyse the joining of single and double-strand DNA breaks, which is an essential final step in DNA replication, recombination and repair. Mammalian cells have four DNA ligases, termed ligases I-IV. In contrast, other than a DNA ligase I homologue (encoded by CDC9), no other DNA ligases have hitherto been identified in Saccharomyces cerevisiae. Here, we report the identification and characterization of a novel gene, LIG4, which encodes a protein with strong homology to mammalian ...

  20. Damage and repair of ancient DNA

    DEFF Research Database (Denmark)

    Mitchell, David; Willerslev, Eske; Hansen, Anders

    2005-01-01

    Under certain conditions small amounts of DNA can survive for long periods of time and can be used as polymerase chain reaction (PCR) substrates for the study of phylogenetic relationships and population genetics of extinct plants and animals, including hominids. Because of extensive DNA...... degradation, these studies are limited to species that lived within the past 10(4)-10(5) years (Late Pleistocene), although DNA sequences from 10(6) years have been reported. Ancient DNA (aDNA) has been used to study phylogenetic relationships of protists, fungi, algae, plants, and higher eukaryotes such as...... early native Americans. Hence, ancient DNA contains information pertinent to numerous fields of study including evolution, population genetics, ecology, climatology, medicine, archeology, and behavior. The major obstacles to the study of aDNA are its extremely low yield, contamination with modern DNA...

  1. Isolating human DNA repair genes using rodent-cell mutants

    International Nuclear Information System (INIS)

    The DNA repair systems of rodent and human cells appear to be at least as complex genetically as those in lower eukaryotes and bacteria. The use of mutant lines of rodent cells as a means of identifying human repair genes by functional complementation offers a new approach toward studying the role of repair in mutagenesis and carcinogenesis. In each of six cases examined using hybrid cells, specific human chromosomes have been identified that correct CHO cell mutations affecting repair of damage from uv or ionizing radiations. This finding suggests that both the repair genes and proteins may be virtually interchangeable between rodent and human cells. Using cosmid vectors, human repair genes that map to chromosome 19 have cloned as functional sequences: ERCC2 and XRCC1. ERCC1 was found to have homology with the yeast excision repair gene RAD10. Transformants of repair-deficient cell lines carrying the corresponding human gene show efficient correction of repair capacity by all criteria examined. 39 refs., 1 fig., 1 tab

  2. Deficiency of the DNA repair protein nibrin increases the basal but not the radiation induced mutation frequency in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Wessendorf, Petra [Institute of Medical and Human Genetics, Charité – Universitätsmedizin Berlin, Augustenburger Platz 1, D-13353 Berlin (Germany); Vijg, Jan [Albert Einstein College of Medicine, Michael F. Price Center, 1301 Morris Park Avenue, Bronx, NY 10461 (United States); Nussenzweig, André [Laboratory of Genome Integrity, National Cancer Institute, National Institute of Health, 37 Convent Drive, Room 1106, Bethesda, MD 20892 (United States); Digweed, Martin, E-mail: martin.digweed@charite.de [Institute of Medical and Human Genetics, Charité – Universitätsmedizin Berlin, Augustenburger Platz 1, D-13353 Berlin (Germany)

    2014-11-15

    Highlights: • lacZ mutant frequencies measured in vivo in mouse models of radiosensitive Nijmegen Breakage Syndrome. • Spontaneous mutation frequencies are increased in lymphatic tissue due to Nbn mutation. • Single base transitions, not deletions, dominate the mutation spectrum. • Radiation induced mutation frequencies are not increased due to Nbn mutation. - Abstract: Nibrin (NBN) is a member of a DNA repair complex together with MRE11 and RAD50. The complex is associated particularly with the repair of DNA double strand breaks and with the regulation of cell cycle check points. Hypomorphic mutation of components of the complex leads to human disorders characterised by radiosensitivity and increased tumour occurrence, particularly of the lymphatic system. We have examined here the relationship between DNA damage, mutation frequency and mutation spectrum in vitro and in vivo in mouse models carrying NBN mutations and a lacZ reporter plasmid. We find that NBN mutation leads to increased spontaneous DNA damage in fibroblasts in vitro and high basal mutation rates in lymphatic tissue of mice in vivo. The characteristic mutation spectrum is dominated by single base transitions rather than the deletions and complex rearrangements expected after abortive repair of DNA double strand breaks. We conclude that in the absence of wild type nibrin, the repair of spontaneous errors, presumably arising during DNA replication, makes a major contribution to the basal mutation rate. This applies also to cells heterozygous for an NBN null mutation. Mutation frequencies after irradiation in vivo were not increased in mice with nibrin mutations as might have been expected considering the radiosensitivity of NBS patient cells in vitro. Evidently apoptosis is efficient, even in the absence of wild type nibrin.

  3. Deficiency of the DNA repair protein nibrin increases the basal but not the radiation induced mutation frequency in vivo

    International Nuclear Information System (INIS)

    Highlights: • lacZ mutant frequencies measured in vivo in mouse models of radiosensitive Nijmegen Breakage Syndrome. • Spontaneous mutation frequencies are increased in lymphatic tissue due to Nbn mutation. • Single base transitions, not deletions, dominate the mutation spectrum. • Radiation induced mutation frequencies are not increased due to Nbn mutation. - Abstract: Nibrin (NBN) is a member of a DNA repair complex together with MRE11 and RAD50. The complex is associated particularly with the repair of DNA double strand breaks and with the regulation of cell cycle check points. Hypomorphic mutation of components of the complex leads to human disorders characterised by radiosensitivity and increased tumour occurrence, particularly of the lymphatic system. We have examined here the relationship between DNA damage, mutation frequency and mutation spectrum in vitro and in vivo in mouse models carrying NBN mutations and a lacZ reporter plasmid. We find that NBN mutation leads to increased spontaneous DNA damage in fibroblasts in vitro and high basal mutation rates in lymphatic tissue of mice in vivo. The characteristic mutation spectrum is dominated by single base transitions rather than the deletions and complex rearrangements expected after abortive repair of DNA double strand breaks. We conclude that in the absence of wild type nibrin, the repair of spontaneous errors, presumably arising during DNA replication, makes a major contribution to the basal mutation rate. This applies also to cells heterozygous for an NBN null mutation. Mutation frequencies after irradiation in vivo were not increased in mice with nibrin mutations as might have been expected considering the radiosensitivity of NBS patient cells in vitro. Evidently apoptosis is efficient, even in the absence of wild type nibrin

  4. Biomarkers of oxidative damage to DNA and repair.

    Science.gov (United States)

    Loft, Steffen; Høgh Danielsen, Pernille; Mikkelsen, Lone; Risom, Lotte; Forchhammer, Lykke; Møller, Peter

    2008-10-01

    Oxidative-stress-induced damage to DNA includes a multitude of lesions, many of which are mutagenic and have multiple roles in cancer and aging. Many lesions have been characterized by MS-based methods after extraction and digestion of DNA. These preparation steps may cause spurious base oxidation, which is less likely to occur with methods such as the comet assay, which are based on nicking of the DNA strand at modified bases, but offer less specificity. The European Standards Committee on Oxidative DNA Damage has concluded that the true levels of the most widely studied lesion, 8-oxodG (8-oxo-7,8-dihydro-2'-deoxyguanosine), in cellular DNA is between 0.5 and 5 lesions per 10(6) dG bases. Base excision repair of oxidative damage to DNA can be assessed by nicking assays based on oligonucleotides with lesions or the comet assay, by mRNA expression levels or, in the case of, e.g., OGG1 (8-oxoguanine DNA glycosylase 1), responsible for repair of 8-oxodG, by genotyping. Products of repair in DNA or the nucleotide pool, such as 8-oxodG, excreted into the urine can be assessed by MS-based methods and generally reflects the rate of damage. Experimental and population-based studies indicate that many environmental factors, including particulate air pollution, cause oxidative damage to DNA, whereas diets rich in fruit and vegetables or antioxidant supplements may reduce the levels and enhance repair. Urinary excretion of 8-oxodG, genotype and expression of OGG1 have been associated with risk of cancer in cohort settings, whereas altered levels of damage, repair or urinary excretion in case-control settings may be a consequence rather than the cause of the disease. PMID:18793191

  5. Repair of UV-damaged incoming plasmid DNA in Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    A whole-cell transformation assay was used for the repair of UV-damaged plasma DNA in highly-transformable haploid strains of Saccharomyces cerevisiae having different repair capabilities. The experiments described demonstrate that three epistasis groups (Friedberg 1988) are involved in the repair of UV-incoming DNA and that the repair processes act less efficiently on incoming DNA than they do on chromosomal DNA. The implications of these findings for UV repair in Saccharomyces cerevisiae are discussed. (author)

  6. Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond

    Directory of Open Access Journals (Sweden)

    David eDavidson

    2013-01-01

    Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA

  7. Active DNA demethylation by oxidation and repair

    Institute of Scientific and Technical Information of China (English)

    Zhizhong Gong; Jian-Kang Zhu

    2011-01-01

    DNA methylation and demethylation are increasingly recognized as important epigenetic factors in both plants and animals.DNA methylation,which is catalyzed by DNA methyltransferases (DNMTs),is a relatively stable and heritable modification that controls gene expression,cellular differentiation,genomic imprinting,paramutation,transposon movement,X-inactivation,and embryogenesis [1].The methylation of cytosine to 5-methylcytosine (5mC) is an important example of DNA modification in animals and plants.This highlight concerns DNA demethylation mechanisms in mammals and whether they are similar to that in plants.

  8. Heterochromatin formation via recruitment of DNA repair proteins

    OpenAIRE

    Kirkland, JG; Peterson, MR; Still, CD; Brueggeman, L; Dhillon, N; Kamakaka, RT

    2015-01-01

    © 2015 Kirkland, Peterson, Still, Brueggeman, et al. Heterochromatin formation and nuclear organization are important in gene regulation and genome fidelity. Proteins involved in gene silencing localize to sites of damage and some DNA repair proteins localize to heterochromatin, but the biological importance of these correlations remains unclear. In this study, we examined the role of double-strand-break repair proteins in gene silencing and nuclear organization. We find that the ATM kinase T...

  9. Chromatin structure modulates DNA repair by photolyase in vivo.

    OpenAIRE

    Suter, B.; Livingstone-Zatchej, M; Thoma, F

    1997-01-01

    Yeast and many other organisms use nucleotide excision repair (NER) and photolyase in the presence of light (photoreactivation) to repair cyclobutane pyrimidine dimers (CPDs), a major class of DNA lesions generated by UV light. To study the role of photoreactivation at the chromatin level in vivo, we used yeast strains which contained minichromosomes (YRpTRURAP, YRpCS1) with well-characterized chromatin structures. The strains were either proficient (RAD1) or deficient (rad1 delta) in NER. In...

  10. Eukaryotic DNA repair is blocked at different steps by inhibitors of DNA topoisomerases and of DNA polymerases α and β

    International Nuclear Information System (INIS)

    Inhibitors of (a) DNA topoisomerases (novobiocin and nalidixic acid) and of (b) eukaryotic DNA polymerases α (cytosine arabinoside) and β (dideoxythymidine) blocked different steps of DNA repair, demonstrated by the effects of the inhibitors on the relaxation of supercoiled DNA nucleoids following treatment of human cell cultures with ultraviolet light (1-3 J/m2) or MNNG (5 or 20 μM) and the subsequent restoration of the supercoiled nucleoids during repair incubation. Inhibition of repair by novobiocin was partially reversible; upon its removal from the culture medium, the nucleoid DNA of repairing cells became relaxed. The DNA polymerase inhibitors allowed the initial relaxation of DNA after treatment of the cells with ultraviolet or MNNG but delayed the regeneration of rapidly-sedimenting (supercoiled) nucleoid DNA for 2-4 h. Dideoxythymidine (1 mM) was more effective than cytosine arabinoside (1 μM) in producing this delay, but neither inhibitor by itself blocked repair permanently. Incubation of ultraviolet-irradiated cells with 1 μM cytosine arabinoside plus 1 mM dideoxythymidine blocked the completion of repair for 24 h, whereas incubation with 10 μM cytosine arabinoside or 5 mM dideoxythymidine produced only temporary repair delays of 2-4 h. Thus, it is likely that the two DNA polymerase inhibitors act upon separate targets and that both targets are involved in repair. (Auth.)

  11. Chromatin factors affecting DNA repair in mammalian cell nuclei

    International Nuclear Information System (INIS)

    We are investigating chromatin factors that participate in the incision step of DNA repair in eukaryotic cells. Localization of repair activity within nuclei, the stability and extractability of activity, the specificity for recognizing damage in chromatin or purified DNA as substrates are of interest in this investigation of human cells, CHO cells, and their radiation sensitive mutants. We have developed procedures that provide nuclei in which their DNA behaves as a collection of circular molecules. The integrity of the DNA in human nuclei can be maintained during incubation in appropriate buffers for as long as 60 minutes. When cells or nuclei are exposed to uv light prior to incubation, incisions presumably associated with DNA repair can be demonstrated. Incision activity is stable to prior extraction of nuclei with 0.6 M NaCl, which removes many nonhistone proteins. Our studies are consistent with an hypothesis that factors responsible for initiating DNA repair are localized in the nuclear matrix. 18 references, 3 figures

  12. Mathematical modelling of the automated FADU assay for the quantification of DNA strand breaks and their repair in human peripheral mononuclear blood cells

    International Nuclear Information System (INIS)

    Cells continuously undergo DNA damage from exogenous agents like irradiation or genotoxic chemicals or from endogenous radicals produced by normal cellular metabolic activities. DNA strand breaks are one of the most common genotoxic lesions and they can also arise as intermediates of DNA repair activity. Unrepaired DNA damage can lead to genomic instability, which can massively compromise the health status of organisms. Therefore it is important to measure and quantify DNA damage and its repair. We have previously published an automated method for measuring DNA strand breaks based on fluorimetric detection of alkaline DNA unwinding [1], and here we present a mathematical model of the FADU assay, which enables to an analytic expression for the relation between measured fluorescence and the number of strand breaks. Assessment of the formation and also the repair of DNA strand breaks is a crucial functional parameter to investigate genotoxicity in living cells. A reliable and convenient method to quantify DNA strand breakage is therefore of significant importance for a wide variety of scientific fields, e.g. toxicology, pharmacology, epidemiology and medical sciences

  13. Scintillometric determination of DNA repair in human cell lines

    International Nuclear Information System (INIS)

    The ability of a variety of chemical and physical agents to stimulate DNA repair synthesis in human cell cultures was tested by a simplified scintillometric procedure, with the use of hydroxyurea (HU) to suppress DNA replicative synthesis. After incubation with [3H]thymidine, the radioactivity incorporated into DNA was determined in controls (C) and treated (T) cultures and in the corresponding HU series (Csub(HU), Tsub(HU)). The ratios Tsub(HU)/Csub(HU) and Tsub(HU)/T:Csub(HU)/C, indicating absolute and relative increases of DNA radioactivity, were calculated. When both ratios were significantly higher than 1, they were taken as indices of DNA repair stimulation. (orig./AJ)

  14. Protein-protein interactions in DNA mismatch repair.

    Science.gov (United States)

    Friedhoff, Peter; Li, Pingping; Gotthardt, Julia

    2016-02-01

    The principal DNA mismatch repair proteins MutS and MutL are versatile enzymes that couple DNA mismatch or damage recognition to other cellular processes. Besides interaction with their DNA substrates this involves transient interactions with other proteins which is triggered by the DNA mismatch or damage and controlled by conformational changes. Both MutS and MutL proteins have ATPase activity, which adds another level to control their activity and interactions with DNA substrates and other proteins. Here we focus on the protein-protein interactions, protein interaction sites and the different levels of structural knowledge about the protein complexes formed with MutS and MutL during the mismatch repair reaction. PMID:26725162

  15. Identification of DNA repair genes in the human genome

    International Nuclear Information System (INIS)

    To identify human DNA repair genes we have transfected human genomic DNA ligated to a dominant marker to excision repair deficient xeroderma pigmentosum (XP) and CHO cells. This resulted in the cloning of a human gene, ERCC-1, that complements the defect of a UV- and mitomycin-C sensitive CHO mutant 43-3B. The ERCC-1 gene has a size of 15 kb, consists of 10 exons and is located in the region 19q13.2-q13.3. Its primary transcript is processed into two mRNAs by alternative splicing of an internal coding exon. One of these transcripts encodes a polypeptide of 297 aminoacids. A putative DNA binding protein domain and nuclear location signal could be identified. Significant AA-homology is found between ERCC-1 and the yeast excision repair gene RAD10. 58 references, 6 figures, 1 table

  16. Nampt is involved in DNA double-strand break repair

    Institute of Scientific and Technical Information of China (English)

    Bingtao Zhu; Xiaoli Deng; Yifan Sun; Lin Bai; Zhikai Xiahou; Yusheng Cong; Xingzhi Xu

    2012-01-01

    DNA double-strand break (DSB) is the most severe form of DNA damage,which is repaired mainly through high-fidelity homologous recombination (HR) or error-prone non-homologous end joining (NHEJ).Defects in the DNA damage response lead to genomic instability and ultimately predispose organs to cancer.Nicotinamide phosphoribosyltransferase (Nampt),which is involved in nicotinamide adenine dinucleotide metabolism,is overexpressed in a variety of tumors.In this report,we found that Nampt physically associated with CtlP and DNA-PKcs/Ku80,which are key factors in HR and NHEJ,respectively.Depletion of Nampt by small interfering RNA (siRNA) led to defective NHEJ-mediated DSB repair and enhanced HR-mediated repair.Furthermore,the inhibition of Nampt expression promoted proliferation of cancer cells and normal human fibroblasts and decreased β-galactosidase staining,indicating a delay in the onset of cellular senescence in normal human fibroblasts.Taken together,our results suggest that Nampt is a suppressor of HR-mediated DSB repair and an enhancer of NHEJ-mediated DSB repair,contributing to the acceleration of cellular senescence.

  17. The influence of DNA repair inhibitors on the mutation rate

    International Nuclear Information System (INIS)

    The simultaneous influence of gamma-radiation and DNA-repair inhibiting substances on the mutation frequency of mice was investigated in vivo with the micronucleus test. The detergens Tween 80, vitamin A, and the antiphlogisticum phenylbutazone were used as DNA-repair inhibiting substances. Using the same irradiation doses, a statistic significant increase of mutagenicity respectively micronucleus frequency was found in high concentrations of Tween 80 and in all used dosages of vitamin A, but not in phenylbutazone and in low concentrations of tween. (auth.)

  18. Induction and repair of double- and single-strand DNA breaks in bacteriophage lambda superinfecting Escherichia coli

    International Nuclear Information System (INIS)

    Induction and repair of double-and single-strand DNA breaks have been measured after decays of 125I and 3H incorporated into the DNA and after external irradiation with 4 MeV electrons. For the decay experiments, cells of wild type Escherichia coli K-12 were superinfected with bacteriophage lambda DNA labelled with 5'-(125I)iodo-2'-deoxyuridine or with (methyl-3H)thymidine and frozen in liquid nitrogen. Aliquots were thawed at intervals and lysed at neutral pH, and the phage DNA was assayed for double- and single-strand breakage by neutral sucrose gradient centrifugation. The gradients used allowed measurements of both kinds of breaks in the same gradient. Decays of 125I induced 0.39 single-strand breaks per double-strand break. No repair of either break type could be detected. Each 3H disintegration caused 0.20 single-strand breaks and very few double-strand breaks. The single-strand breaks were rapidly rejoined after the cells were thawed. For irradiation with 4 MeV electrons, cells of wild type E. coli K-12 were superinfected with phage lambda and suspended in growth medium. Irradiation induced 42 single-strand breaks per double-strand break. The rates of break induction were 6.75 x 10-14 (double-strand breaks) and 2.82 x 10-12 (single-strand breaks) per rad and per dalton. The single-strand breaks were rapidly repaired upon incubation whereas the double-strand breaks seemed to remain unrepaired. It is concluded that double-strand breaks in superinfecting bacteriophage lambda DNA are repaired to a very small extent, if at all. (Author)

  19. The DNA repair complex DNA-PK, a pharmacological target in cancer chemotherapy and radiotherapy

    International Nuclear Information System (INIS)

    A line of investigation in the search for sensitizing tumor cells to chemotherapy or radiotherapy relies on the selection of DNA repair inhibitors. In the area of DNA repair mechanisms, DNA-dependent protein kinase (DNA-PK) represents a key complex. Indeed DNA-PK is involved in the non-homologous end joining (NHEJ) process that corresponds to the major activity responsible for cell survival after ionizing radiation or chemotherapeutic treatment producing DNA double strand breaks. DNA-PK belongs to the PI3-K related kinase family and specific inhibitors have been recently selected and evaluated as radio- and chemo-sensitizers. These drugs, along with other ways to inhibit the DSBs repair process, are presented and discussed. (authors)

  20. DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair.

    Science.gov (United States)

    Mentegari, Elisa; Kissova, Miroslava; Bavagnoli, Laura; Maga, Giovanni; Crespan, Emmanuele

    2016-01-01

    DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell's genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy. PMID:27589807

  1. DNA repair by HDR in experimental tumorigenesis

    OpenAIRE

    Westermark, Ulrica

    2008-01-01

    The aim of this thesis was to further understand how defects in the homology-directed repair (HDR) pathway affect tumor formation and development. To study proteins involved in HDR is challenging since most of its members are required for cell viability. For our studies we have therefore taken a dominant-negative approach to address the importance of the BRCA1 interacting protein BARD1 in HDR (paper I) and investigate the role of HDR in PDGFB-induced gliomagenesis by interfe...

  2. DNA damage and repair in Stylonychia lemnae (Ciliata, Protozoa)

    International Nuclear Information System (INIS)

    Irradiation with X rays, UV irradiation after incorporation of bromodeoxyuridine (BU) into the DNA, and cis-platinum (cis-Pt) treatment each cause the loss of micronuclei of Stylonychia lemnae while the macronuclei are not severely affected. The abilities of both nuclei to repair DNA were investigated. Unscheduled DNA synthesis could not be demonstrated after X-ray irradiation, but it was found after treatment with BU/UV and cis-Pt in macro- and micronuclei. The extent of the repair process in the micro- and macronuclei was alike, as indicated by grain counts of [6-3H]thymidine-treated cells. One reason for the different sensitivity of both nuclei to DNA-damaging treatment may be the different number of gene copies in the macro- and micronuclei

  3. Methylation levels of P16 and TP53 that are involved in DNA strand breakage of 16HBE cells treated by hexavalent chromium.

    Science.gov (United States)

    Hu, Guiping; Li, Ping; Li, Yang; Wang, Tiancheng; Gao, Xin; Zhang, Wenxiao; Jia, Guang

    2016-05-13

    The correlations between methylation levels of p16 and TP53 with DNA strand breakage treated by hexavalent chromium [Cr(VI)] remain unknown. In this research, Human bronchial epithelial cells (16HBE cells) in vitro and bioinformatics analysis were used to analyze the epigenetic role in DNA damage and potential biomarkers. CCK-8 and single cell gel electrophoresis assay were chosen to detect the cellular biological damage. MALDI-TOF-MS was used to detect the methylation levels of p16 and TP53. qRT-PCR was used to measure their expression levels in different Cr(VI) treatment groups. The transcription factors with target sequences of p16 and TP53 were predicted using various bioinformatics software. The findings showed that the cellular toxicity and DNA strand damage were Cr(VI) concentration dependent. The hypermethylation of CpG1, CpG31 and CpG32 of p16 was observed in Cr(VI) treated groups. There was significant positive correlation between the CpG1 methylation level of p16 and cell damage. In Cr(VI) treated groups, the expression level of p16 was lower than that in control group. The expression level of TP53 increased when the Cr(VI)concentration above 5μM. About p16, there was significant negative correlation between the CpG1 methylation levels with its expression level. A lot of binding sites for transcription factors existed in our focused CpG islands of p16. All the results suggested that the CpG1 methylation level of p16 could be used as a biomarker of epigenetic effect caused by Cr(VI) treatment, which can enhance cell damage by regulating its expression or affecting some transcription factors to combine with their DNA strand sites. PMID:27005777

  4. Genotoxic thresholds, DNA repair, and susceptibility in human populations

    International Nuclear Information System (INIS)

    It has been long assumed that DNA damage is induced in a linear manner with respect to the dose of a direct acting genotoxin. Thus, it is implied that direct acting genotoxic agents induce DNA damage at even the lowest of concentrations and that no 'safe' dose range exists. The linear (non-threshold) paradigm has led to the one-hit model being developed. This 'one hit' scenario can be interpreted such that a single DNA damaging event in a cell has the capability to induce a single point mutation in that cell which could (if positioned in a key growth controlling gene) lead to increased proliferation, leading ultimately to the formation of a tumour. There are many groups (including our own) who, for a decade or more, have argued, that low dose exposures to direct acting genotoxins may be tolerated by cells through homeostatic mechanisms such as DNA repair. This argument stems from the existence of evolutionary adaptive mechanisms that allow organisms to adapt to low levels of exogenous sources of genotoxins. We have been particularly interested in the genotoxic effects of known mutagens at low dose exposures in human cells and have identified for the first time, in vitro genotoxic thresholds for several mutagenic alkylating agents (Doak et al., 2007). Our working hypothesis is that DNA repair is primarily responsible for these thresholded effects at low doses by removing low levels of DNA damage but becoming saturated at higher doses. We are currently assessing the roles of base excision repair (BER) and methylguanine-DNA methyltransferase (MGMT) for roles in the identified thresholds (Doak et al., 2008). This research area is currently important as it assesses whether 'safe' exposure levels to mutagenic chemicals can exist and allows risk assessment using appropriate safety factors to define such exposure levels. Given human variation, the mechanistic basis for genotoxic thresholds (e.g. DNA repair) has to be well defined in order that susceptible individuals are

  5. Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.

    Science.gov (United States)

    Mukherjee, Anirban; Vasquez, Karen M

    2011-08-01

    Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. PMID:21501652

  6. Mismatch repair and nucleotide excision repair proteins cooperate in the recognition of DNA interstrand crosslinks.

    Science.gov (United States)

    Zhao, Junhua; Jain, Aklank; Iyer, Ravi R; Modrich, Paul L; Vasquez, Karen M

    2009-07-01

    DNA interstrand crosslinks (ICLs) are among the most cytotoxic types of DNA damage, thus ICL-inducing agents such as psoralen, are clinically useful chemotherapeutics. Psoralen-modified triplex-forming oligonucleotides (TFOs) have been used to target ICLs to specific genomic sites to increase the selectivity of these agents. However, how TFO-directed psoralen ICLs (Tdp-ICLs) are recognized and processed in human cells is unclear. Previously, we reported that two essential nucleotide excision repair (NER) protein complexes, XPA-RPA and XPC-RAD23B, recognized ICLs in vitro, and that cells deficient in the DNA mismatch repair (MMR) complex MutSbeta were sensitive to psoralen ICLs. To further investigate the role of MutSbeta in ICL repair and the potential interaction between proteins from the MMR and NER pathways on these lesions, we performed electrophoretic mobility-shift assays and chromatin immunoprecipitation analysis of MutSbeta and NER proteins with Tdp-ICLs. We found that MutSbeta bound to Tdp-ICLs with high affinity and specificity in vitro and in vivo, and that MutSbeta interacted with XPA-RPA or XPC-RAD23B in recognizing Tdp-ICLs. These data suggest that proteins from the MMR and NER pathways interact in the recognition of ICLs, and provide a mechanistic link by which proteins from multiple repair pathways contribute to ICL repair. PMID:19468048

  7. UV Radiation Damage and Bacterial DNA Repair Systems

    Science.gov (United States)

    Zion, Michal; Guy, Daniel; Yarom, Ruth; Slesak, Michaela

    2006-01-01

    This paper reports on a simple hands-on laboratory procedure for high school students in studying both radiation damage and DNA repair systems in bacteria. The sensitivity to ultra-violet (UV) radiation of both "Escherichia coli" and "Serratia marcescens" is tested by radiating them for varying time periods. Two growth temperatures are used in…

  8. DNA Repair-Protein Relocalization After Heavy Ion Exposure

    Science.gov (United States)

    Metting, N. F.

    1999-01-01

    Ionizing radiation is good at making DNA double strand breaks, and high linear energy transfer (LET) radiations such as heavy ion particles are particularly efficient. For this reason, the proteins belonging to repair systems that deal with double strand breaks are of particular interest. One such protein is Ku, a component in the non-homologous recombination repair system. The Ku protein is an abundant, heterodimeric DNA end-binding complex, composed of one 70 and one 86 kDa subunit. Ku protein binds to DNA ends, nicks, gaps, and regions of transition between single and double-stranded structure. These binding properties suggest an important role in DNA repair. The Ku antigen is important in this study because it is present in relatively large copy numbers and it is part of a double-strand-break repair system. More importantly, we consistently measure an apparent upregulation in situ that is not verified by whole-cell-lysate immunoblot measurements. This apparent upregulation is triggered by very low doses of radiation, thus showing a potentially useful high sensitivity. However, elucidation of the mechanism underlying this phenomenon is still to be done.

  9. Distribution of DNA repair-related ESTs in sugarcane

    Directory of Open Access Journals (Sweden)

    W.C. Lima

    2001-12-01

    Full Text Available DNA repair pathways are necessary to maintain the proper genomic stability and ensure the survival of the organism, protecting it against the damaging effects of endogenous and exogenous agents. In this work, we made an analysis of the expression patterns of DNA repair-related genes in sugarcane, by determining the EST (expressed sequence tags distribution in the different cDNA libraries of the SUCEST transcriptome project. Three different pathways - photoreactivation, base excision repair and nucleotide excision repair - were investigated by employing known DNA repair proteins as probes to identify homologous ESTs in sugarcane, by means of computer similarity search. The results showed that DNA repair genes may have differential expressions in tissues, depending on the pathway studied. These in silico data provide important clues on the potential variation of gene expression, to be confirmed by direct biochemical analysis.As vias de reparo de DNA são requeridas para manter a necessária estabilidade genômica e garantir a sobrevivência do organismo, frente aos efeitos deletérios causados por fatores endógenos e exógenos. Neste trabalho, realizamos a análise dos padrões de expressão dos genes de reparo de DNA encontrados na cana-de-açúcar, pela determinação da distribuição de ESTs nas diferentes bibliotecas de cDNA no projeto de transcriptoma SUCEST. Três vias de reparo - fotorreativação, reparo por excisão de bases e reparo por excisão de nucleotídeos - foram estudadas através do uso de proteínas de reparo como sondas para identificação de ESTs homólogos em cana-de-açúcar, com base na procura computacional de similaridade. Os resultados indicam que os genes de reparo de DNA possuem uma expressão diferencial nos tecidos, dependendo da via de reparo analisada. Esses dados in silico fornecem importantes indícios da expressão diferencial, a qual deve ser confirmada por análises bioquímicas diretas.

  10. Cdt2-mediated XPG degradation promotes gap-filling DNA synthesis in nucleotide excision repair

    OpenAIRE

    Han, Chunhua; Wani, Gulzar; Zhao, Ran; Qian, Jiang; Sharma, Nidhi; He, Jinshan; Zhu, Qianzheng; Wang, Qi-En; Wani, Altaf A.

    2014-01-01

    Xeroderma pigmentosum group G (XPG) protein is a structure-specific repair endonuclease, which cleaves DNA strands on the 3′ side of the DNA damage during nucleotide excision repair (NER). XPG also plays a crucial role in initiating DNA repair synthesis through recruitment of PCNA to the repair sites. However, the fate of XPG protein subsequent to the excision of DNA damage has remained unresolved. Here, we show that XPG, following its action on bulky lesions resulting from exposures to UV ir...

  11. The Protective Effects of N-Acetylcysteine on Exogenous Hydrogen Peroxide and Endogenous Superoxide Anion induced DNA Strand Breakage in Human Spermatozoa%`

    Institute of Scientific and Technical Information of China (English)

    徐德祥; 沈汉民; 王俊南

    2001-01-01

    Objective To explore the protective effects of N-Acetylcysteine (NAC) on exogenous hydrogen peroxide and endogenous superoxide anion-induced DNA strand breakage in human spermatozoa by using the single-cell gel electropherosis (SCGE)Methods Sperm cells were exposed to 0. 5 mmol/L of H2O2 or 5. 0 mmol/L of β -NADPH with or without 0. 1, 0. 5, 1. 0 mmol/L of NAC. The percentage of sperm comet cells and the comet tail lengths were measured in the treated sperm cells by using SCGE.Results Both percentage of comet sperm nuclei and mean tail length in sperm cells exposed to 0. 5 mmol/L hydrogen peroxide with different concentrations of NAC decrease significantly in a dose-dependent manner as compared with sperm cells exposed to H2O2 without NAC or catalase. Although mean tail length in sperm cells exposed to 5. 0 mmol/L of β-NADPH with different concentrations of NAC decreases significantly compared with sperm cells exposed to β-NADPH without NAC or SOD,there were no significant differences on the percentage of sperm comet cells between sperm cells exposed to 5. 0 mmol/L of β-NADPH with different concentrations of NAC and sperm cells exposed to 5. 0 mmol/L of β-NADPH without NAC.Conclusion NAC has a protective effect on exogenous hydrogen peroxide-induced DNA damage, while protective effect of NAC against O2- induced DNA strand break age is significant but very weak.

  12. Role of nuclear hexokinase II in DNA repair

    International Nuclear Information System (INIS)

    A common signature of many cancer cells is a high glucose catabolic rate primarily due to the over expression of Type II hexokinase (HKII; responsible for the phosphorylation of glucose), generally known as cytosolic and mitochondrial bound enzyme that also suppresses cell death. Although, nuclear localization and transcriptional regulation of HKII has been reported in yeast; we and few others have recently demonstrated its nuclear localization in malignant cell lines. Interestingly, modification of a human glioma cell line (BMG-1) for enhancing glycolysis through mitochondrial respiration (OPMBMG cells) resulted in a higher nuclear localization of HKII as compared to the parental cells with concomitant increase in DNA repair and radio-resistance. Further, the glucose phosphorylation activity of the nuclear HKII was nearly 2 folds higher in the relatively more radioresistant HeLa cells (human cervical cancer cell line) as compared to MRC-5 cells (human normal lung fibroblast cell line). Therefore, we hypothesize that nuclear HKII facilitates DNA repair, in a hither to unknown mechanism, that may partly contribute to the enhanced resistance of highly glycolytic cells to radiation. Sequence alignment studies suggest that the isoenzymes, HKI and HKII share strong homology in the kinase active site, which is also found in few protein kinases. Interestingly HKI has been shown to phosphorylate H2A in-vitro. Further, in-silico protein-protein interaction data suggest that HKII can interact with several DNA repair proteins including ATM. Taken together; available experimental evidences as well as in-silico predictions strongly suggest that HKII may play a role in DNA repair by phosphorylation of certain DNA repair proteins. (author)

  13. DNA repair in spermatocytes and spermatids of the mouse

    International Nuclear Information System (INIS)

    When male mice are exposed to chemical agents that reach the germ cells several outcomes are possible in terms of the germ cell unscheduled DNA synthesis (UDS) response and removal of DNA adducts. It is possible that: the chemical binds to the DNA and induces a UDS response with concomittant removal of DNA adducts; the chemical binds to the DNA but no UDS response is induced; or the chemical does not bind to DNA and no UDS is induced. Many mutagens have been shown to induce a UDS response in postgonial germ cell stages of the male mouse up through midspermatids, but the relationship between this UDS and the repair of genetic damage within the germ cells is still unknown. While some mutagens appear to have an effect only in germ-cell stages where no UDS occurs, others are able to induce genetic damage in stages where UDS has been induced

  14. Involvement of the yeast DNA polymerase delta in DNA repair in vivo

    International Nuclear Information System (INIS)

    The POL3 encoded catalytic subunit of DNA polymerase delta possesses a highly conserved C-terminal cysteine-rich domain in Saccharomyces cerevisiae. Mutations in some of its cysteine codons display a lethal phenotype, which demonstrates an essential function of this domain. The thermosensitive mutant pol3-13, in which a serine replaces a cysteine of this domain, exhibits a range of defects in DNA repair, such as hypersensitivity to different DNA-damaging agents and deficiency for induced mutagenesis and for recombination. These phenotypes are observed at 24 degrees, a temperature at which DNA replication is almost normal; this differentiates the functions of POL3 in DNA repair and DNA replication. Since spontaneous mutagenesis and spontaneous recombination are efficient in pol3-13, we propose that POL3 plays an important role in DNA repair after irradiation, particularly in the error-prone and recombinational pathways. Extragenic suppressors of pol3-13 are allelic to sdp5-1, previously identified as an extragenic suppressor of pol3-11. SDP5, which is identical to HYS2, encodes a protein homologous to the p50 subunit of bovine and human DNA polymerase delta. SDP5 is most probably the p55 subunit of Pol delta of S. cerevisiae and seems to be associated with the catalytic subunit for both DNA replication and DNA repair. (author)

  15. Impact of radiotherapy on PBMCs DNA repair capacity - Use of a multiplexed functional repair assay

    International Nuclear Information System (INIS)

    Radiation therapy is an essential part of cancer treatment as about 50% of patients will receive radiations at least once. Significant broad variation in radiosensitivity has been demonstrated in patients. About 5-10% of patients develop acute toxicity after radiotherapy. Therefore there is a need for the identification of markers able to predict the occurrence of adverse effects and thus adapt the radiotherapy regimen for radiosensitive patients. As a first step toward this goal, and considering the DNA repair defects associated with hypersensitivity radiation syndromes, we investigated the DNA repair phenotype of patients receiving radiotherapy. More precisely, we used a functional repair assay on support to follow the evolution of the glycosylases/AP endonuclease activities of PBMCs extracts of a series of patients during the time course of radiotherapy. For each patient, we collected one PBMCs sample before the first radiotherapy application (S1) and three samples after (S2 to S4) (one day and one week after application 1, and one at the end of the radiotherapy protocol). These four samples have been analysed for 11 donors. Clustering analyses of the results demonstrated a great heterogeneity of responses among the patients. Interestingly, this heterogeneity decreased between S1 and S4 where only 2 classes of patients remained if we except one patient that exhibited an atypical DNA repair phenotype. Furthermore, we showed that repair of several oxidized bases significantly increased between S1 and S3 or S4 (8oxoG, thymine glycol, A paired with 8oxoG), suggesting an adaptation of patients repair systems to the oxidative stress generated by the ionising radiations. Our preliminary results provided evidence that the DNA repair phenotype was impacted by the radiotherapy regimen. Further characterization of patients with known repair defects are needed to determine if atypical repair phenotypes could be associated with radiotherapy complications. Finally

  16. Targeting DNA Damage and Repair by Curcumin

    OpenAIRE

    Ji, Zhenyu

    2010-01-01

    Curcumin is a compound with anti-tumor effects in a tolerable dose. A recent paper by Rowe et al described that curcumin induced DNA damage in triple negative breast cancer cells and regulated BRCA1 protein expression and modification.1 Related research and potential use of curcumin will be discussed in this article.

  17. DNA triple helix formation: A potential tool for genetic repair

    Directory of Open Access Journals (Sweden)

    Nayak A

    2006-01-01

    Full Text Available DNA triple helices offer new perspectives towards oligonucleotide-directed gene regulation. Triple helix forming oligonucleotides, which bind to double-stranded DNA, are of special interest since they are targeted to the gene itself rather than to its mRNA product (as in the antisense strategy. However, the poor stability of some of these structures might limit their use under physiological conditions. Specific ligands can intercalate into DNA triple helices and stabilize them. This review summarizes recent advances in this field while also highlighting major obstacles that remain to be overcome, before the application of triplex technology to therapeutic gene repair can be achieved.

  18. Chemical carcinogenesis — the price for DNA-repair?

    Science.gov (United States)

    Wintersberger, Ulrike

    1982-03-01

    This essay examines the possibility of merging the mutation theory of cancer with the hypothesis that cancer is a change in the state of the differentiation of cells. It is suggested that during normal development DNA rearrangements occur, concerning genes which code for differentiation specific cell communication proteins. These proteins are responsible for the proper functioning of growth control in a multicellular organism. DNA-damaging agents — mutagens — induce DNA repair enzymes, some of which may catalyse illegitimate genome rearrangements, thus leading to a change of the balance between growth and differentiation. A cell with a selective advantage may arise and become the origin of a tumor.

  19. Xeroderma pigmentosum and the role of DNA repair in oncogenesis

    International Nuclear Information System (INIS)

    Biochemical and genetic information on xeroderma pigmentosum (XP) has been briefly reviewed. This indicates that 80 to 90% of all XP patients are defective in the excision repair of pyrimidine dimers and are unable to perform the first step of this process. However, in spite of its apparent biochemical homogeneity, XP is genetically heterogeneous and many genes appear to be responsible for the function of the factor defective in XP. Ten to 20% of all XP patients (called XP-variants) are capable of 'dimer excision repair' but have difficulties in replicating UV-damaged DNA. The defects of XP and XP-variant affect also the repair of DNA damage caused by a number of chemical mutagens and carcinogens. This has important theoretical and practical implications since it indicates that the repair systems defective in XP must have broad specificity and that even XP cells not exposed to the harmful effect of light may suffer from poor repair of DNA damage. With regard to cancer, two questions have been considered. Namely, does XP provide a valid general model for UV-carcinogenesis in man and does it show how DNA damage leads to malignant transformation. The first question was answered in the affirmative in view of some clinical but, mainly, of cell biological data indicating that normal and excision defective XP cells differ, more quantitatively than qualitatively, in their response to UV-light. With regard to the second question XP seems to provide some support for various theories on carcinogenesis and, DNA repair defects may favour actinic carcinogenesis in a complex, non-univocous manner. Possibly the most important lesson imparted by XP is that, in man, the stability of the genetic material is dependent on the function of repair systems whose failure may predispose to cancer. In addition, the study of XP has stressed the fact that many genes control DNA metabolism and new evidence is accumulating to show that defects in such genes may contribute significantly to the

  20. Cycling with BRCA2 from DNA repair to mitosis

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyunsook, E-mail: HL212@snu.ac.kr

    2014-11-15

    Genetic integrity in proliferating cells is guaranteed by the harmony of DNA replication, appropriate DNA repair, and segregation of the duplicated genome. Breast cancer susceptibility gene BRCA2 is a unique tumor suppressor that is involved in all three processes. Hence, it is critical in genome maintenance. The functions of BRCA2 in DNA repair and homology-directed recombination (HDR) have been reviewed numerous times. Here, I will briefly go through the functions of BRCA2 in HDR and focus on the emerging roles of BRCA2 in telomere homeostasis and mitosis, then discuss how BRCA2 exerts distinct functions in a cell-cycle specific manner in the maintenance of genomic integrity. - Highlights: • BRCA2 is a multifaceted tumor suppressor and is crucial in genetic integrity. • BRCA2 exerts distinct functions in cell cycle-specific manner. • Mitotic kinases regulate diverse functions of BRCA2 in mitosis and cytokinesis.

  1. Cycling with BRCA2 from DNA repair to mitosis

    International Nuclear Information System (INIS)

    Genetic integrity in proliferating cells is guaranteed by the harmony of DNA replication, appropriate DNA repair, and segregation of the duplicated genome. Breast cancer susceptibility gene BRCA2 is a unique tumor suppressor that is involved in all three processes. Hence, it is critical in genome maintenance. The functions of BRCA2 in DNA repair and homology-directed recombination (HDR) have been reviewed numerous times. Here, I will briefly go through the functions of BRCA2 in HDR and focus on the emerging roles of BRCA2 in telomere homeostasis and mitosis, then discuss how BRCA2 exerts distinct functions in a cell-cycle specific manner in the maintenance of genomic integrity. - Highlights: • BRCA2 is a multifaceted tumor suppressor and is crucial in genetic integrity. • BRCA2 exerts distinct functions in cell cycle-specific manner. • Mitotic kinases regulate diverse functions of BRCA2 in mitosis and cytokinesis

  2. DNA ligase I selectively affects DNA synthesis by DNA polymerases delta and epsilon suggesting differential functions in DNA replication and repair.

    OpenAIRE

    Mossi, R; Ferrari, E.; Hübscher, U

    1998-01-01

    The joining of single-stranded breaks in double-stranded DNA is an essential step in many important processes such as DNA replication, DNA repair, and genetic recombination. Several data implicate a role for DNA ligase I in DNA replication, probably coordinated by the action of other enzymes and proteins. Since both DNA polymerases delta and epsilon show multiple functions in different DNA transactions, we investigated the effect of DNA ligase I on various DNA synthesis events catalyzed by th...

  3. Resident enhanced repair: novel repair process action on plasmid DNA transformed into Escherichia coli K-12

    International Nuclear Information System (INIS)

    The survival of UV-irradiated DNA of plasmid NTP16 was monitored after its transformation into recipient cells containing an essentially homologous undamaged plasmid, pLV9. The presence of pLV9 resulted in a substantial increase in the fraction of damaged NTP16 molecules which survived in the recipient cells. This enhanced survival requires the host uvrA+ and uvrB+ gene products, but not the host recA+ gene product. The requirement for both homologous DNA and the uvrA+ gene products suggests that a novel repair process may act on plasmid DNA. Possible mechanisms for this process are considered

  4. Genetic variations in DNA repair genes, radiosensitivity to cancer and susceptibility to acute tissue reactions in radiotherapy-treated cancer patients

    Energy Technology Data Exchange (ETDEWEB)

    Chistiakov, Dimitry A. (Dept. of Pathology, Univ. of Pittsburgh, Pittsburgh (US)); Voronova, Natalia V. (Dept. of Molecular Diagnostics, National Research Center GosNIIgenetika, Moscow (RU)); Chistiakov, Pavel A. (Dept. of Radiology, Cancer Research Center, Moscow (RU))

    2008-06-15

    Ionizing radiation is a well established carcinogen for human cells. At low doses, radiation exposure mainly results in generation of double strand breaks (DSBs). Radiation-related DSBs could be directly linked to the formation of chromosomal rearrangements as has been proven for radiation-induced thyroid tumors. Repair of DSBs presumably involves two main pathways, non-homologous end joining (NHEJ) and homologous recombination (HR). A number of known inherited syndromes, such as ataxia telangiectasia, ataxia-telangiectasia like-disorder, radiosensitive severe combined immunodeficiency, Nijmegen breakage syndrome, and LIG4 deficiency are associated with increased radiosensitivity and/or cancer risk. Many of them are caused by mutations in DNA repair genes. Recent studies also suggest that variations in the DNA repair capacity in the general population may influence cancer susceptibility. In this paper, we summarize the current status of DNA repair proteins as potential targets for radiation-induced cancer risk. We will focus on genetic alterations in genes involved in HR- and NHEJ-mediated repair of DSBs, which could influence predisposition to radiation-related cancer and thereby explain interindividual differences in radiosensitivity or radioresistance in a general population

  5. Human diseases with genetically altered DNA repair processes

    International Nuclear Information System (INIS)

    DNA repair of single-strand breaks (produced by ionizing radiation) and of base damage (produced by ultraviolet (UV) light) are two repair mechanisms that most mammalian cells possess. Genetic defects in these repair mechanisms are exemplified by cells from the human premature-aging disease, progeria, which fail to rejoin single-strand breaks, and the skin disease, xeroderma pigmentosum (XP), which exhibits high actinic carcinogenesis and involves failure to repair base damage. In terms of the response of XP cells, many chemical carcinogens can be classified as either X-ray-like (i.e., they cause damage that XP cells can repair) or UV-like (i.e., they cause damage that XP cells cannot repair). The first group contains some of the more strongly carcinogenic chemicals (e.g., alkylating agents). XP occurs in at least two clinical forms, and somatic cell hybridization indicates at least three complementation groups. In order to identify cell lines from various different laboratories unambiguously, a modified nomenclature of XP lines is proposed

  6. Repair and recombination induced by triple helix DNA.

    Science.gov (United States)

    Chin, Joanna Y; Schleifman, Erica B; Glazer, Peter M

    2007-01-01

    Triple-helix DNA structures can form endogenously at mirror repeat polypurine/polypyrimidine sequences or by introduction of triplex-forming oligonucleotides (TFOs). Recent evidence suggests that triple helices are sources of genetic instability, and are subject to increased rates of mutagenesis and recruitment of repair factors. Indeed, observations using TFOs suggest that triple helices provoke a variety of biological processes which can be harnessed to modulate gene expression and induce heritable changes in targeted genes. This review surveys the biological applications of TFOs, with particular attention to their recombinogenic and mutagenic potential, and summarizes available evidence for the mechanism of triplex and triplex-associated repair. PMID:17485375

  7. DNA repair in neurons: So if they don't divide what's to repair?

    Energy Technology Data Exchange (ETDEWEB)

    Fishel, Melissa L. [Department of Pediatrics (Section of Hematology/Oncology), Herman B Wells Center for Pediatric Research, Indiana University School of Medicine, 1044 W. Walnut, Room 302C, Indianapolis, IN 46202 (United States); Vasko, Michael R. [Department of Pharmacology and Toxicology, Indiana University School of Medicine, 1044 W. Walnut St., Indianapolis, IN 46202 (United States); Kelley, Mark R. [Department of Pediatrics (Section of Hematology/Oncology), Herman B Wells Center for Pediatric Research, Indiana University School of Medicine, 1044 W. Walnut, Room 302C, Indianapolis, IN 46202 (United States) and Department of Pharmacology and Toxicology, Indiana University School of Medicine, 1044 W. Walnut St., Indianapolis, IN 46202 (United States) and Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, 1044 W. Walnut, Room 302C, Indianapolis, IN 46202 (United States)]. E-mail: mkelley@iupui.edu

    2007-01-03

    Neuronal DNA repair remains one of the most exciting areas for investigation, particularly as a means to compare the DNA repair response in mitotic (cancer) vs. post-mitotic (neuronal) cells. In addition, the role of DNA repair in neuronal cell survival and response to aging and environmental insults is of particular interest. DNA damage caused by reactive oxygen species (ROS) such as generated by mitochondrial respiration includes altered bases, abasic sites, and single- and double-strand breaks which can be prevented by the DNA base excision repair (BER) pathway. Oxidative stress accumulates in the DNA of the human brain over time especially in the mitochondrial DNA (mtDNA) and is proposed to play a critical role in aging and in the pathogenesis of several neurological disorders including Parkinson's disease, ALS, and Alzheimer's diseases. Because DNA damage accumulates in the mtDNA more than nuclear DNA, there is increased interest in DNA repair pathways and the consequence of DNA damage in the mitochondria of neurons. The type of damage that is most likely to occur in neuronal cells is oxidative DNA damage which is primarily removed by the BER pathway. Following the notion that the bulk of neuronal DNA damage is acquired by oxidative DNA damage and ROS, the BER pathway is a likely area of focus for neuronal studies of DNA repair. BER variations in brain aging and pathology in various brain regions and tissues are presented. Therefore, the BER pathway is discussed in greater detail in this review than other repair pathways. Other repair pathways including direct reversal, nucleotide excision repair (NER), mismatch repair (MMR), homologous recombination and non-homologous end joining are also discussed. Finally, there is a growing interest in the role that DNA repair pathways play in the clinical arena as they relate to the neurotoxicity and neuropathy associated with cancer treatments. Among the numerous side effects of cancer treatments, major

  8. Repairing of N-mustard derivative BO-1055 induced DNA damage requires NER, HR, and MGMT-dependent DNA repair mechanisms

    OpenAIRE

    Kuo, Ching-Ying; Chou, Wen-Cheng; Wu, Chin-Chung; Wong, Teng-Song; Kakadiya, Rajesh; Lee, Te-Chang; Su, Tsann-Long; Wang, Hui-Chun

    2015-01-01

    Alkylating agents are frequently used as first-line chemotherapeutics for various newly diagnosed cancers. Disruption of genome integrity by such agents can lead to cell lethality if DNA lesions are not removed. Several DNA repair mechanisms participate in the recovery of mono- or bi-functional DNA alkylation. Thus, DNA repair capacity is correlated with the therapeutic response. Here, we assessed the function of novel water-soluble N-mustard BO-1055 (ureidomustin) in DNA damage response and ...

  9. Biomarkers of oxidative damage to DNA and repair

    DEFF Research Database (Denmark)

    Loft, Steffen; Høgh Danielsen, Pernille; Mikkelsen, Lone;

    2008-01-01

    Oxidative-stress-induced damage to DNA includes a multitude of lesions, many of which are mutagenic and have multiple roles in cancer and aging. Many lesions have been characterized by MS-based methods after extraction and digestion of DNA. These preparation steps may cause spurious base oxidation...... environmental factors, including particulate air pollution, cause oxidative damage to DNA, whereas diets rich in fruit and vegetables or antioxidant supplements may reduce the levels and enhance repair. Urinary excretion of 8-oxodG, genotype and expression of OGG1 have been associated with risk of cancer in......, which is less likely to occur with methods such as the comet assay, which are based on nicking of the DNA strand at modified bases, but offer less specificity. The European Standards Committee on Oxidative DNA Damage has concluded that the true levels of the most widely studied lesion, 8-oxodG (8-oxo-7...

  10. Radiosensitivity, radio-curability and DNA repair

    International Nuclear Information System (INIS)

    Improvements in accuracy stand as the heart of the success of today's radiotherapy. The dose may be delivered with a sub millimetric accuracy, may also conform to complex shapes, or track external and internal organ motions. In parallel, we may increase the tumour's radio-curability by modulating the biological effects generated by ionizing radiation into the patient. It was precisely the topic of the 2009 Lucien-Mallet prize organized by the French Society for Radiation Oncology (SFRO) and the Centre Antoine-Beclere under the auspices of the Fondation de France. In this review we will precisely describe the integrated molecular response to ionizing radiations. Starting from early observations, we are going to introduce the concept of cellular radiosensitivity as the global response of the irradiated cell. We will then focus into the cell and especially its nucleus. We will describe here the most complex and deleterious radioinduced damages. In the next chapter, we will dissect the molecular pathway that aims to detect and repair the previous lesions. The last part of the review will finally deal with the diagnostic, prognostic and therapeutic impacts emerging from the alliance between clinical and molecular radiobiology. (author)

  11. Molecular cloning of human uracil-DNA glycosylase, a highly conserved DNA repair enzyme.

    OpenAIRE

    Olsen, L C; Aasland, R; Wittwer, C U; Krokan, H E; Helland, D E

    1989-01-01

    Uracil-DNA glycosylase is the DNA repair enzyme responsible for the removal of uracil from DNA, and it is present in all organisms investigated. Here we report on the cloning and sequencing of a cDNA encoding the human uracil-DNA glycosylase. The sequences of uracil-DNA glycosylases from yeast, Escherichia coli, herpes simplex virus type 1 and 2, and homologous genes from varicella-zoster and Epstein-Barr viruses are known. It is shown in this report that the predicted amino acid sequence of ...

  12. Protein–DNA charge transport: Redox activation of a DNA repair protein by guanine radical

    OpenAIRE

    Yavin, Eylon; Boal, Amie K.; Stemp, Eric D. A.; Boon, Elizabeth M; Livingston, Alison L.; O'Shea, Valerie L.; David, Sheila S.; Barton, Jacqueline K.

    2005-01-01

    DNA charge transport (CT) chemistry provides a route to carry out oxidative DNA damage from a distance in a reaction that is sensitive to DNA mismatches and lesions. Here, DNA-mediated CT also leads to oxidation of a DNA-bound base excision repair enzyme, MutY. DNA-bound Ru(III), generated through a flash/quench technique, is found to promote oxidation of the [4Fe-4S](2+) cluster of MutY to [4Fe-4S](3+) and its decomposition product [3Fe-4S](1+). Flash/quench experiments monitored by EPR spec...

  13. A Molecular Bar-Coded DNA Repair Resource for Pooled Toxicogenomic Screens

    OpenAIRE

    Rooney, John P.; Patil, Ashish; Zappala, Maria R.; Conklin, Douglas S.; Cunningham, Richard P.; Begley, Thomas J

    2008-01-01

    DNA damage from exogenous and endogenous sources can promote mutations and cell death. Fortunately, cells contain DNA repair and damage signalling pathways to reduce the mutagenic and cytotoxic effects of DNA damage. The identification of specific DNA repair proteins and the coordination of DNA repair pathways after damage has been a central theme to the field of Genetic Toxicology and we have developed a tool for use in this area. We have produced 99 molecular bar-coded Escherichia coli gene...

  14. Pathophysiology of Bronchoconstriction: Role of Oxidatively Damaged DNA Repair

    Science.gov (United States)

    Bacsi, Attila; Pan, Lang; Ba, Xueqing; Boldogh, Istvan

    2016-01-01

    Purpose of review To provide an overview on the present understanding of roles of oxidative DNA damage repair in cell signaling underlying bronchoconstriction common to, but not restricted to various forms of asthma and chronic obstructive pulmonary disease Recent findings Bronchoconstriction is a tightening of smooth muscle surrounding the bronchi and bronchioles with consequent wheezing and shortness of breath. Key stimuli include air pollutants, viral infections, allergens, thermal and osmotic changes, and shear stress of mucosal epithelium, triggering a wide range of cellular, vascular and neural events. Although activation of nerve fibers, the role of G-proteins, protein kinases and Ca++, and molecular interaction within contracting filaments of muscle are well defined, the overarching mechanisms by which a wide range of stimuli initiate these events are not fully understood. Many, if not all, stimuli increase levels of reactive oxygen species (ROS), which are signaling and oxidatively modifying macromolecules, including DNA. The primary ROS target in DNA is guanine, and 8-oxoguanine is one of the most abundant base lesions. It is repaired by 8-oxoguanine DNA glycosylase1 (OGG1) during base excision repair processes. The product, free 8-oxoG base, is bound by OGG1 with high affinity, and the complex then functions as an activator of small GTPases, triggering pathways for inducing gene expression and contraction of intracellular filaments in mast and smooth muscle cells. Summary Oxidative DNA damage repair-mediated cell activation signaling result in gene expression that “primes” the mucosal epithelium and submucosal tissues to generate mediators of airway smooth muscle contractions. PMID:26694039

  15. Low-dose formaldehyde delays DNA damage recognition and DNA excision repair in human cells.

    Directory of Open Access Journals (Sweden)

    Andreas Luch

    Full Text Available OBJECTIVE: Formaldehyde is still widely employed as a universal crosslinking agent, preservative and disinfectant, despite its proven carcinogenicity in occupationally exposed workers. Therefore, it is of paramount importance to understand the possible impact of low-dose formaldehyde exposures in the general population. Due to the concomitant occurrence of multiple indoor and outdoor toxicants, we tested how formaldehyde, at micromolar concentrations, interferes with general DNA damage recognition and excision processes that remove some of the most frequently inflicted DNA lesions. METHODOLOGY/PRINCIPAL FINDINGS: The overall mobility of the DNA damage sensors UV-DDB (ultraviolet-damaged DNA-binding and XPC (xeroderma pigmentosum group C was analyzed by assessing real-time protein dynamics in the nucleus of cultured human cells exposed to non-cytotoxic (<100 μM formaldehyde concentrations. The DNA lesion-specific recruitment of these damage sensors was tested by monitoring their accumulation at local irradiation spots. DNA repair activity was determined in host-cell reactivation assays and, more directly, by measuring the excision of DNA lesions from chromosomes. Taken together, these assays demonstrated that formaldehyde obstructs the rapid nuclear trafficking of DNA damage sensors and, consequently, slows down their relocation to DNA damage sites thus delaying the excision repair of target lesions. A concentration-dependent effect relationship established a threshold concentration of as low as 25 micromolar for the inhibition of DNA excision repair. CONCLUSIONS/SIGNIFICANCE: A main implication of the retarded repair activity is that low-dose formaldehyde may exert an adjuvant role in carcinogenesis by impeding the excision of multiple mutagenic base lesions. In view of this generally disruptive effect on DNA repair, we propose that formaldehyde exposures in the general population should be further decreased to help reducing cancer risks.

  16. Targeting telomerase and DNA repair in human cancers

    International Nuclear Information System (INIS)

    Telomerase reactivation is essential for telomere maintenance in human cancer cells ensuring indefinite proliferation. Targeting telomere homeostasis has become one of the promising strategies in the therapeutic management of tumours. One major potential drawback, however, is the time lag between telomerase inhibition and critically shortened telomeres triggering cell death, allowing cancer cells to acquire drug resistance. Numerous studies over the last decade have highlighted the role of DNA repair proteins such as Poly (ADP-Ribose) Polymerase-1 (PARP-1), and DNA-dependent protein kinase (DNA-PKcs) in the maintenance of telomere homoeostasis. Dysfunctional telomeres, resulting from the loss of telomeric DNA repeats or the loss of function of telomere-associated proteins trigger DNA damage responses similar to that observed for double strand breaks. We have been working on unravelling such synthetic lethality in cancer cells and this talk would be on one such recently concluded study that demonstrates that inhibition of DNA repair pathways, i.e., NHEJ pathway and that of telomerase could be an alternative strategy to enhance anti-tumour effects and circumvent the possibility of drug resistance. (author)

  17. Both genetic and dietary factors underlie individual differences in DNA damage levels and DNA repair capacity

    Czech Academy of Sciences Publication Activity Database

    Slyšková, Jana; Lorenzo, Y.; Karlsen, A.; Carlsen, M. H.; Novosadová, Vendula; Blomhoff, R.; Vodička, Pavel; Collins, A. R.

    2014-01-01

    Roč. 16, APR 2014 (2014), s. 66-73. ISSN 1568-7864 R&D Projects: GA ČR(CZ) GAP304/12/1585 Institutional support: RVO:68378041 ; RVO:86652036 Keywords : DNA damage * DNA repair capacity * diet Subject RIV: EB - Genetics ; Molecular Biology; EI - Biotechnology ; Bionics (BTO-N) Impact factor: 3.111, year: 2014

  18. True Lies: The Double Life of the Nucleotide Excision Repair Factors in Transcription and DNA Repair

    Directory of Open Access Journals (Sweden)

    Nicolas Le May

    2010-01-01

    Full Text Available Nucleotide excision repair (NER is a major DNA repair pathway in eukaryotic cells. NER removes structurally diverse lesions such as pyrimidine dimers, arising upon UV irradiation or bulky chemical adducts, arising upon exposure to carcinogens and some chemotherapeutic drugs. NER defects lead to three genetic disorders that result in predisposition to cancers, accelerated aging, neurological and developmental defects. During NER, more than 30 polypeptides cooperate to recognize, incise, and excise a damaged oligonucleotide from the genomic DNA. Recent papers reveal an additional and unexpected role for the NER factors. In the absence of a genotoxic attack, the promoters of RNA polymerases I- and II-dependent genes recruit XPA, XPC, XPG, and XPF to initiate gene expression. A model that includes the growth arrest and DNA damage 45α protein (Gadd45α and the NER factors, in order to maintain the promoter of active genes under a hypomethylated state, has been proposed but remains controversial. This paper focuses on the double life of the NER factors in DNA repair and transcription and describes the possible roles of these factors in the RNA synthesis process.

  19. DNA-repair measurements by use of the modified comet assay

    DEFF Research Database (Denmark)

    Godschalk, Roger W L; Ersson, Clara; Riso, Patrizia;

    2013-01-01

    The measurement of DNA-repair activity by extracts from cells or tissues by means of the single-cell gel electrophoresis (comet) assay has a high potential to become widely used in biomonitoring studies. We assessed the inter-laboratory variation in reported values of DNA-repair activity on...... line as having the highest level of DNA-repair activity. The two laboratories that reported discordant results (with another cell line having the highest level of DNA-repair activity) were those that reported to have little experience with the modified comet assay to assess DNA repair. The laboratories...

  20. DNA Repair and the Accumulation of Oxidatively Damaged DNA Are Affected by Fruit Intake in Mice

    DEFF Research Database (Denmark)

    Croteau, Deborah L; de Souza-Pinto, Nadja C; Harboe, Charlotte;

    2010-01-01

    were fed for 14 weeks a control diet or a diet with 8% peach or nectarine extract. The activities of DNA repair enzymes, the level of DNA damage, and gene expression changes were measured. Our study showed that repair of various oxidative DNA lesions was more efficient in liver extracts derived from...... mice fed fruit-enriched diets. In support of these findings, gas chromatography-mass spectrometry analysis revealed that there was a decrease in the levels of formamidopyrimidines in peach-fed mice compared with the controls. Additionally, microarray analysis revealed that NTH1 was upregulated in peach...

  1. Role of DNA lesions and DNA repair in mutagenesis by carcinogens in diploid human fibroblasts

    International Nuclear Information System (INIS)

    The authors investigated the cytotoxicity, mutagenicity, and transforming activity of carcinogens and radiation in diploid human fibroblasts, using cells which differ in their DNA repair capacity. The results indicate that cell killing and induction of mutations are correlated with the number of specific lesions remaining unrepaired in the cells at a particular time posttreatment. DNA excision repair acts to eliminate potentially cytotoxic and mutagenic (and transforming) damage from DNA before these can be converted into permanent cellular effects. Normal human fibroblasts were derived from skin biopsies or circumcision material. Skin fibroblasts from xeroderma pigmentosum (XP) patients provided cells deficient in nucleotide excision repair of pyrimidine dimers or DNA adducts formed by bulky ring structures. Cytotoxicity was determined from loss of ability to form a colony. The genetic marker used was resistance to 6-thioguanine (TG). Transformation was measured by determining the frequency of anchorage-independent cells

  2. Functional evaluation of DNA repair in human biopsies and their relation to other cellular biomarkers

    OpenAIRE

    Slyskova, Jana; Langie, Sabine A. S.; Collins, Andrew R.; Vodicka, Pavel

    2014-01-01

    Thousands of DNA lesions are estimated to occur in each cell every day and almost all are recognized and repaired. DNA repair is an essential system that prevents accumulation of mutations which can lead to serious cellular malfunctions. Phenotypic evaluation of DNA repair activity of individuals is a relatively new approach. Methods to assess base and nucleotide excision repair pathways (BER and NER) in peripheral blood cells based on modified comet assay protocols have been widely applied i...

  3. Cadmium affects viability of bone marrow mesenchymal stem cells through membrane impairment, intracellular calcium elevation and DNA breakage

    Directory of Open Access Journals (Sweden)

    Abnosi Mohammad Hussein

    2010-01-01

    Full Text Available Background: Cadmium is an important heavy metal with occupational and environmental hazard. Cadmium toxicity results mainly in bone-related complication such as itai-itai disease. Mesenchymal stem cells of the bone marrow have the ability to differentiate to osteoblasts which ensure the well-being of the bone tissue. Thus the aim was to investigate the effect of cadmium on viability of rat bone marrow mesenchymal stem cells. Materials and Methods: The rat bone marrow mesenchymal stem cells were grown to confluency in DMEM medium supplemented with 15% fetal bovine serum and penicillin-streptomycin up to third passage. Then the cells were treated with 0, 5, 15, 25, 35, and 45 of CdCl 2 at 12, 24, 36, and 48 h, and their viability was investigated using trypan blue staining. In addition, after treatment with selected dose (15 and 45 μM and time (24 and 48 h the cell morphology, DNA damage and calcium content of the cells were evaluated. Data was analyzed using one and two-way ANOVA (Tukey test and the P2+ was observed. Conclusion: Cadmium chloride is a toxic compound which might affect the well-being of bone tissue through affecting the mesenchymal stem cells.

  4. DNA repair, human cancer and assessment of radiation hazards

    International Nuclear Information System (INIS)

    Cancers, like genetic defects, are thought to be caused primarily by changes in DNA. Part of the evidence in support of this hypothesis derives from the study of certain rare hereditary disorders in man associated with high risk of cancer. Cells derived from patients suffering from at least one of these disorders, ataxia telangiectasia, appear to be defective in their ability to repair the damage caused by radiation and/or certain other environmental agents. Studies of the consequences of DNA repair suggest that currently accepted estimates of the carcinogenic hazards of low level radiation are substantially correct. There would appear to be some margin of safety involved in these risk estimates for the majority of the population, but any major reduction in the currently accepted risk estimates appears inadvisable in view of the existence of potentially radiosensitive subgroups forming a minority in the general population. (author)

  5. DNA polymerase III requirement for repair of DNA damage caused by methyl methanesulfonate and hydrogen peroxide

    International Nuclear Information System (INIS)

    The pcbA1 mutation allows DNA replication dependent on DNA polymerase I at the restrictive temperature in polC(Ts) strains. Cells which carry pcbA1, a functional DNA polymerase I, and a temperature-sensitive DNA polymerase III gene were used to study the role of DNA polymerase III in DNA repair. At the restrictive temperature for DNA polymerase III, these strains were more sensitive to the alkylating agent methyl methanesulfonate (MMS) and hydrogen peroxide than normal cells. The same strains showed no increase in sensitivity to bleomycin, UV light, or psoralen at the restrictive temperature. The sensitivity of these strains to MMS and hydrogen peroxide was not due to the pcbAl allele, and normal sensitivity was restored by the introduction of a chromosomal or cloned DNA polymerase III gene, verifying that the sensitivity was due to loss of DNA polymerase III alpha-subunit activity. A functional DNA polymerase III is required for the reformation of high-molecular-weight DNA after treatment of cells with MMS or hydrogen peroxide, as demonstrated by alkaline sucrose sedimentation results. Thus, it appears that a functional DNA polymerase III is required for the optimal repair of DNA damage by MMS or hydrogen peroxide

  6. A novel cell permeable DNA replication and repair marker.

    Science.gov (United States)

    Herce, Henry D; Rajan, Malini; Lättig-Tünnemann, Gisela; Fillies, Marion; Cardoso, M Cristina

    2014-01-01

    Proliferating Cell Nuclear Antigen (PCNA) is a key protein in DNA replication and repair. The dynamics of replication and repair in live cells is usually studied introducing translational fusions of PCNA. To obviate the need for transfection and bypass the problem of difficult to transfect and/or short lived cells, we have now developed a cell permeable replication and/or repair marker. The design of this marker has three essential molecular components: (1) an optimized artificial PCNA binding peptide; (2) a cell-penetrating peptide, derived from the HIV-1 Trans Activator of Transcription (TAT); (3) an in vivo cleavable linker, linking the two peptides. The resulting construct was taken up by human, hamster and mouse cells within minutes of addition to the media. Inside the cells, the cargo separated from the vector peptide and bound PCNA effectively. Both replication and repair sites could be directly labeled in live cells making it the first in vivo cell permeable peptide marker for these two fundamental cellular processes. Concurrently, we also introduced a quick peptide based PCNA staining method as an alternative to PCNA antibodies for immunofluorescence applications. In summary, we present here a versatile tool to instantaneously label repair and replication processes in fixed and live cells. PMID:25484186

  7. DNA repair: the culprit for tumor-initiating cell survival?

    OpenAIRE

    Mathews, Lesley A.; Cabarcas, Stephanie M.; Farrar, William L.

    2011-01-01

    The existence of “tumor-initiating cells” (TICs) has been a topic of heated debate for the last few years within the field of cancer biology. Their continuous characterization in a variety of solid tumors has led to an abundance of evidence supporting their existence. TICs are believed to be responsible for resistance against conventional treatment regimes of chemotherapy and radiation, ultimately leading to metastasis and patient demise. This review summarizes DNA repair mechanism(s) and the...

  8. ASSOCIATIONS BETWEEN POLYMORPHISMS IN DNA REPAIR GENES AND GLIOBLASTOMA

    OpenAIRE

    McKean-Cowdin, Roberta; Barnholtz-Sloan, Jill; Inskip, Peter; Ruder, Avima; Butler, MaryAnn; Rajaraman, Preetha; Razavi, Pedram; Patoka, Joe; Wiencke, John; Bondy, Melissa; Wrensch, Margaret

    2009-01-01

    A pooled analysis was conducted to examine the association between select variants in DNA repair genes and glioblastoma multiforme (GBM), the most common and deadliest form of adult brain tumors. Genetic data for approximately 1,000 GBM cases and 2,000 controls were combined from four centers in the United States that have conducted case-control studies of adult GBM including the National Cancer Institute, the National Institute for Occupational Safety and Health, the University of Texas M.D....

  9. Associations between polymorphisms in DNA repair genes and glioblastoma.

    Science.gov (United States)

    McKean-Cowdin, Roberta; Barnholtz-Sloan, Jill; Inskip, Peter D; Ruder, Avima M; Butler, Maryann; Rajaraman, Preetha; Razavi, Pedram; Patoka, Joe; Wiencke, John K; Bondy, Melissa L; Wrensch, Margaret

    2009-04-01

    A pooled analysis was conducted to examine the association between select variants in DNA repair genes and glioblastoma multiforme, the most common and deadliest form of adult brain tumors. Genetic data for approximately 1,000 glioblastoma multiforme cases and 2,000 controls were combined from four centers in the United States that have conducted case-control studies on adult glioblastoma multiforme, including the National Cancer Institute, the National Institute for Occupational Safety and Health, the University of Texas M. D. Anderson Cancer Center, and the University of California at San Francisco. Twelve DNA repair single-nucleotide polymorphisms were selected for investigation in the pilot collaborative project. The C allele of the PARP1 rs1136410 variant was associated with a 20% reduction in risk for glioblastoma multiforme (odds ratio(CT or CC), 0.80; 95% confidence interval, 0.67-0.95). A 44% increase in risk for glioblastoma multiforme was found for individuals homozygous for the G allele of the PRKDC rs7003908 variant (odds ratio(GG), 1.44; 95% confidence interval, 1.13-1.84); there was a statistically significant trend (P = 0.009) with increasing number of G alleles. A significant, protective effect was found when three single-nucleotide polymorphisms (ERCC2 rs13181, ERCC1 rs3212986, and GLTSCR1 rs1035938) located near each other on chromosome 19 were modeled as a haplotype. The most common haplotype (AGC) was associated with a 23% reduction in risk (P = 0.03) compared with all other haplotypes combined. Few studies have reported on the associations between variants in DNA repair genes and brain tumors, and few specifically have examined their impact on glioblastoma multiforme. Our results suggest that common variation in DNA repair genes may be associated with risk for glioblastoma multiforme. PMID:19318434

  10. DNA damage and nucleotide excision repair capacity in healthy individuals

    Czech Academy of Sciences Publication Activity Database

    Slyšková, Jana; Naccarati, Alessio; Poláková, Veronika; Pardini, Barbara; Vodičková, Ludmila; Štětina, R.; Schmuczerová, Jana; Šmerhovský, Z.; Lipská, L.; Vodička, Pavel

    2011-01-01

    Roč. 25, č. 7 (2011), s. 511-517. ISSN 0893-6692 R&D Projects: GA ČR GAP304/10/1286; GA MŠk 7F10069 Grant ostatní: GA MŠk(CZ) GAUK124710 Institutional research plan: CEZ:AV0Z50390512 Keywords : BPDE-induced DNA repair capacity * comet assay * interindividual variability Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.709, year: 2011

  11. DNA Repair Decline During Mouse Spermiogenesis Results in the Accumulation of Heritable DNA Damage

    Energy Technology Data Exchange (ETDEWEB)

    Marchetti, Francesco; Marchetti, Francesco; Wyrobek, Andrew J.

    2007-12-01

    The post-meiotic phase of mouse spermatogenesis (spermiogenesis) is very sensitive to the genomic effects of environmental mutagens because as male germ cells form mature sperm they progressively lose the ability to repair DNA damage. We hypothesized that repeated exposures to mutagens during this repair-deficient phase result in the accumulation of heritable genomic damage in mouse sperm that leads to chromosomal aberrations in zygotes after fertilization. We used a combination of single or fractionated exposures to diepoxybutane (DEB), a component of tobacco smoke, to investigate how differential DNA repair efficiencies during the three weeks of spermiogenesis affected the accumulation of DEB-induced heritable damage in early spermatids (21-15 days before fertilization, dbf), late spermatids (14-8 dbf) and sperm (7-1 dbf). Analysis of chromosomal aberrations in zygotic metaphases using PAINT/DAPI showed that late spermatids and sperm are unable to repair DEB-induced DNA damage as demonstrated by significant increases (P<0.001) in the frequencies of zygotes with chromosomal aberrations. Comparisons between single and fractionated exposures suggested that the DNA repair-deficient window during late spermiogenesis may be less than two weeks in the mouse and that during this repair-deficient window there is accumulation of DNA damage in sperm. Finally, the dose-response study in sperm indicated a linear response for both single and repeated exposures. These findings show that the differential DNA repair capacity of post-meioitic male germ cells has a major impact on the risk of paternally transmitted heritable damage and suggest that chronic exposures that may occur in the weeks prior to fertilization because of occupational or lifestyle factors (i.e, smoking) can lead to an accumulation of genetic damage in sperm and result in heritable chromosomal aberrations of paternal origin.

  12. DNA repair decline during mouse spermiogenesis results in the accumulation of heritable DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Marchetti, Francesco; Marchetti, Francesco; Wryobek, Andrew J

    2008-02-21

    The post-meiotic phase of mouse spermatogenesis (spermiogenesis) is very sensitive to the genomic effects of environmental mutagens because as male germ cells form mature sperm they progressively lose the ability to repair DNA damage. We hypothesized that repeated exposures to mutagens during this repair-deficient phase result in the accumulation of heritable genomic damage in mouse sperm that leads to chromosomal aberrations in zygotes after fertilization. We used a combination of single or fractionated exposures to diepoxybutane (DEB), a component of tobacco smoke, to investigate how differential DNA repair efficiencies during the three weeks of spermiogenesis affected the accumulation of DEB-induced heritable damage in early spermatids (21-15 days before fertilization, dbf), late spermatids (14-8 dbf) and sperm (7- 1 dbf). Analysis of chromosomalaberrations in zygotic metaphases using PAINT/DAPI showed that late spermatids and sperm are unable to repair DEB-induced DNA damage as demonstrated by significant increases (P<0.001) in the frequencies of zygotes with chromosomal aberrations. Comparisons between single and fractionated exposures suggested that the DNA repair-deficient window during late spermiogenesis may be less than two weeks in the mouse and that during this repair-deficient window there is accumulation of DNA damage in sperm. Finally, the dose-response study in sperm indicated a linear response for both single and repeated exposures. These findings show that the differential DNA repair capacity of post-meioitic male germ cells has a major impact on the risk of paternally transmitted heritable damage and suggest that chronic exposures that may occur in the weeks prior to fertilization because of occupational or lifestyle factors (i.e, smoking) can lead to an accumulation of genetic damage in sperm and result in heritable chromosomal aberrations of paternal origin.

  13. DNA-repair capacity and lipid peroxidation in chronic alcoholics.

    Science.gov (United States)

    Topinka, J; Binková, B; Srám, R J; Fojtíková, I

    1991-07-01

    The possible impact of long-term overexposure to ethanol was studied in a group of chronic alcoholics in the psychiatric hospital. The level of DNA methylation and unscheduled DNA synthesis (UDS) induced by N-methyl-N-nitrosourea (MNU) in lymphocytes and lipid peroxidation (LPO) in plasma were used as markers of injury caused by alcohol abuse. The data were correlated with plasma levels of some natural antioxidants (vitamins A, C and E) and vitamin B12. The following results were obtained. The degree of DNA methylation by MNU in lymphocytes was the same in the exposed and control groups under our experimental conditions. The DNA excision-repair capacity of lymphocytes measured as UDS was decreased in alcoholics (p less than 0.01) and LPO in plasma was significantly higher (p less than 0.01) as a consequence of alcohol overconsumption. By the simple regression method, a correlation was found between LPO and vitamin C levels (LPO = -0.078 x vit. C + 1.9; p less than 0.05) and between UDS and LPO values (UDS = -0.384 x LPO + 4.1; p less than 0.05). These results support the hypothesis of a connection of cell membrane status and DNA damage and repair and the possible role of active oxygen species in cell damage caused by ethanol. PMID:2067553

  14. Mitochondrial DNA repairs double-strand breaks in yeast chromosomes.

    Science.gov (United States)

    Ricchetti, M; Fairhead, C; Dujon, B

    1999-11-01

    The endosymbiotic theory for the origin of eukaryotic cells proposes that genetic information can be transferred from mitochondria to the nucleus of a cell, and genes that are probably of mitochondrial origin have been found in nuclear chromosomes. Occasionally, short or rearranged sequences homologous to mitochondrial DNA are seen in the chromosomes of different organisms including yeast, plants and humans. Here we report a mechanism by which fragments of mitochondrial DNA, in single or tandem array, are transferred to yeast chromosomes under natural conditions during the repair of double-strand breaks in haploid mitotic cells. These repair insertions originate from noncontiguous regions of the mitochondrial genome. Our analysis of the Saccharomyces cerevisiae mitochondrial genome indicates that the yeast nuclear genome does indeed contain several short sequences of mitochondrial origin which are similar in size and composition to those that repair double-strand breaks. These sequences are located predominantly in non-coding regions of the chromosomes, frequently in the vicinity of retrotransposon long terminal repeats, and appear as recent integration events. Thus, colonization of the yeast genome by mitochondrial DNA is an ongoing process. PMID:10573425

  15. Repair of triplex-directed DNA alkylation by nucleotide excision repair

    OpenAIRE

    Ziemba, Amy; Derosier, L. Chris; Methvin, Russell; Song, Chun-Yan; Clary, Eric; Kahn, Wendy; Milesi, David; Gorn, Vladimir; Reed, Mike; Ebbinghaus, Scot

    2001-01-01

    Triplex-forming oligonucleotides (TFOs) are being investigated as highly specific DNA binding agents to inhibit the expression of clinically relevant genes. So far, they have been shown to inhibit transcription from the HER-2/neu gene in vitro, whereas their use in vivo has been studied to a limited extent. This study uses a TFO–chlorambucil (chl) conjugate capable of forming site-specific covalent guanine adducts within the HER-2/neu promoter. We demonstrate that nucleotide excision repair (...

  16. Evaluation of radio-induced DNA damage and their repair in human lymphocytes by comet assay or single cell gel electrophoresis

    International Nuclear Information System (INIS)

    The comet assay, also called single cell gel electrophoresis technique, permits to evaluate quantitatively DNA breakage induced by chemical and physical agents at the level of the single cell. The present paper refers to the construction of dose-response curves to DNA damage and repair studies in human peripheral lymphocytes, utilizing the comet assay for the radiosensitivity analysis. So, the blood samples were obtained from healthy donors (40-50 year old), irradiated in a 60 Co source (GAMMACEL 220) with doses of 0.17, 0.25, 0.57, 1.10, 2.12 and 4.22 Gy (0.59 Gy/min.) and processed 1 and 24 hours after the exposition. Results obtained showed a increase in the total lenght of comet (DNA migration) as a function of radiation dose in samples processed 1 and 24 hours after the treatment. The DNA lesion in irradiated lymphocytes with 4.22 Gy (means value of 101.4 μm) were 3.4 times higher than in the untreated lymphocytes (mean value of 30 μm) instead of 24 hours after the irradiation were 1.5 times higher (mean value of 46.3 μm). This reduction on DNA repair occurred in these cells. It was also possible visualized the presence of subpopulations of the cells with different sensitivity and repair capacity to ionizing radiation in these donors. (author). 8 refs., 3 figs

  17. Dietary Berries and Ellagic Acid Prevent Oxidative DNA Damage and Modulate Expression of DNA Repair Genes

    Directory of Open Access Journals (Sweden)

    Ramesh C. Gupta

    2008-03-01

    Full Text Available DNA damage is a pre-requisite for the initiation of cancer and agents that reduce this damage are useful in cancer prevention. In this study, we evaluated the ability of whole berries and berry phytochemical, ellagic acid to reduce endogenous oxidative DNA damage. Ellagic acid was selected based on > 95% inhibition of 8-oxodeoxyguosine (8-oxodG and other unidentified oxidative DNA adducts induced by 4-hydroxy-17B;-estradiol and CuCl2 in vitro. Inhibition of the latter occurred at lower concentrations (10 u(microM than that for 8-oxodG (100 u(microM. In the in vivo study, female CD-1 mice (n=6 were fed either a control diet or diet supplemented with ellagic acid (400 ppm and dehydrated berries (5% w/w with varying ellagic acid contents -- blueberry (low, strawberry (medium and red raspberry (high, for 3 weeks. Blueberry and strawberry diets showed moderate reductions in endogenous DNA adducts (25%. However, both red raspberry and ellagic acid diets showed a significant reduction of 59% (p < 0.001 and 48% (p < 0.01, respectively. Both diets also resulted in a 3-8 fold over-expression of genes involved in DNA repair such as xeroderma pigmentosum group A complementing protein (XPA, DNA excision repair protein (ERCC5 and DNA ligase III (DNL3. These results suggest that red raspberry and ellagic acid reduce endogenous oxidative DNA damage by mechanisms which may involve increase in DNA repair.

  18. Radiation induced strand breaks and time scale for repair of broken strands in superinfecting phage lambda DNA in Escherichia coli lysogenic for lambda

    International Nuclear Information System (INIS)

    The production of the first radiation induced break in covalent lambda DNA molecules in pol+ and pol A 1 lysogenic host cells was measured after exposure to electrons from a linear accelerator and transfer to alkaline detergent within 100 ms from the onset of irradiation. The results revealed the presence of an oxygen effect in DNA strand breakage. In both pol+ and pol A 1 host cells the rate of production in nitrogen was 1.2x10-12 DNA single strand breaks per rad per dalton as compared to 5x10-12 in oxygen. The yields of strand breaks in lambda DNA in pol+ host cells under oxygenated or anoxic conditions are independent of whether the cells are irradiated in buffer at room temperature, in buffer at ice temperature, or in growth medium at 370C. These results indicate that enzymic repair of DNA strand breaks before analysis is insignificant in these experiments. The presence of an oxygen effect in DNA strand breakage under these conditions suggest that an actual difference exists between initial number of breaks produced in nitrogen and in oxygen. The kinetics of rejoining of broken molecules under optimal growth conditions was measured by incubating the irradiated host cells prior to lysis. In pol+ host cells 50% of the lambda DNA molecules broken in presence of oxygen are rejoined within 10 to 20 seconds of incubation. A significantly lower recovery is seen in pol+ host cells after irradiation in nitrogen. The rejoining of broken lambda DNA strands in pol A 1 host cells is impaired after irradiation in presence of oxygen as well as under anoxia. These results show that DNA polymerase I is needed for the rapid rejoining of radiation induced strand breaks in the DNA, and that oxygen promoted strand breaks are more easily rejoined than are those produced in nitrogen. (author)

  19. Studies on bleomycin-induced repair DNA synthesis in permeable mouse ascites sarcoma cells.

    Directory of Open Access Journals (Sweden)

    Mori,Shigeru

    1989-04-01

    Full Text Available To study the mechanism of DNA excision repair, a DNA repair system employing permeable mouse sarcoma (SR-C3H/He cells was established and characterized. SR-C3H/He cells were permeabilized with a 0.0175% Triton X-100 solution. The permeable cells were treated with 1 mM ATP and 0.11 mM bleomycin, and then washed thoroughly to remove ATP and bleomycin. Repair DNA synthesis occurred in the bleomycin-damaged, permeable SR-C3H/He cells when incubated with ATP and four deoxyribonucleoside triphosphates. The repair nature of the DNA synthesis was confirmed by the BrdUMP density shift technique, and by the reduced sensitivity of the newly synthesized DNA to Escherichia coli exonuclease III. The DNA synthesis was optimally enhanced by addition of 0.08 M NaCl. Studies using selective inhibitors of DNA synthesis showed that aphidicolin-sensitive DNA polymerase (DNA polymerase alpha and/or delta and DNA polymerase beta were involved in the repair process. The present DNA repair system is thought to be useful to study nuclear DNA damage by bleomycin, removal of the damaged ends by an exonuclease, repair DNA synthesis by DNA polymerases and repair patch ligation by DNA ligase(s.

  20. DNA repair capacity in lymphocytes of professionally occupied persons

    International Nuclear Information System (INIS)

    Full text: Introduction: A chronic exposure to gamma ionizing radiation (γ- YL ) as a result of professional activity can accumulate increased levels of damages in the DNA molecules of the exposed people, including hazardous double-strand and other complex, difficult to repair genotoxic lesions. In case of no repair or faulty repair, the radiation induced damage would lead to mutations and chromosomal aberrations, which can initiate oncogenic transformations of cells. This requires systematic biomonitoring and molecular epidemiology studies on cell reparative capacity and radiation response to the occupational exposure. Materials and Methods: Mononuclear cells were studied from peripheral blood of 40 persons from Kozloduy NPP with occupational exposure (mean age 46.6 , and radiation exposure from 0,1 to 588,1 mSv) and 20 unexposed controls (mean age 43 years). The levels of the double-stranded DNA damage were analyzed with neutral Comet assay (gel electrophoresis of single cells at neutral pH) and are presented as a percentage of DNA comet tail (% DNA in tail). The reparative capacity was determined after further in vitro irradiation of the cells with 3 Gy. Results: The levels of double-strand DNA damage measured for occupational exposure and controls before and after additional in vitro exposure of lymphocytes to 3 Gy γ- YL vary widely, reflecting important differences in individual reparative capacity and radiation response of the studied people. The comparison of the occupational exposure in the control group showed that the two groups have very similar baseline levels of unrepaired DNA damages and reparative capacities. The persons involved in both groups also showed a relatively high capacity for radiation- induced lesions repair. Conclusion: No connection was established between the occupational exposure and the levels of persistent unrepaired two-strand DNA damages and cell reparative capacity.The Individual radiation responses of the persons included in

  1. Ser1778 of 53BP1 Plays a Role in DNA Double-strand Break Repairs

    OpenAIRE

    Lee, Jung-Hee; Cheong, Hyang-Min; Kang, Mi-Young; Kim, Sang-Young; Kang, Yoonsung

    2009-01-01

    53BP1 is an important genome stability regulator, which protects cells against double-strand breaks. Following DNA damage, 53BP1 is rapidly recruited to sites of DNA breakage, along with other DNA damage response proteins, including γ-H2AX, MDC1, and BRCA1. The recruitment of 53BP1 requires a tandem Tudor fold which associates with methylated histones H3 and H4. It has already been determined that the majority of DNA damage response proteins are phosphorylated by ATM and/or ATR after DNA dama...

  2. Repairing of N-mustard derivative BO-1055 induced DNA damage requires NER, HR, and MGMT-dependent DNA repair mechanisms.

    Science.gov (United States)

    Kuo, Ching-Ying; Chou, Wen-Cheng; Wu, Chin-Chung; Wong, Teng-Song; Kakadiya, Rajesh; Lee, Te-Chang; Su, Tsann-Long; Wang, Hui-Chun

    2015-09-22

    Alkylating agents are frequently used as first-line chemotherapeutics for various newly diagnosed cancers. Disruption of genome integrity by such agents can lead to cell lethality if DNA lesions are not removed. Several DNA repair mechanisms participate in the recovery of mono- or bi-functional DNA alkylation. Thus, DNA repair capacity is correlated with the therapeutic response. Here, we assessed the function of novel water-soluble N-mustard BO-1055 (ureidomustin) in DNA damage response and repair mechanisms. As expected, BO-1055 induces ATM and ATR-mediated DNA damage response cascades, including downstream Chk1/Chk2 phosphorylation, S/G2 cell-cycle arrest, and cell death. Further investigation revealed that cell survival sensitivity to BO-1055 is comparable to that of mitomycin C. Both compounds require nucleotide excision repair and homologous recombination, but not non-homologous end-joining, to repair conventional cross-linking DNA damage. Interestingly and unlike mitomycin C and melphalan, MGMT activity was also observed in BO-1055 damage repair systems, which reflects the occurrence of O-alkyl DNA lesions. Combined treatment with ATM/ATR kinase inhibitors significantly increases BO-1055 sensitivity. Our study pinpoints that BO-1055 can be used for treating tumors that with deficient NER, HR, and MGMT DNA repair genes, or for synergistic therapy in tumors that DNA damage response have been suppressed. PMID:26208482

  3. Understanding DNA Repair in Hyperthermophilic Archaea: Persistent Gaps and Other Reasons to Focus on the Fork

    OpenAIRE

    Grogan, Dennis W.

    2015-01-01

    Although hyperthermophilic archaea arguably have a great need for efficient DNA repair, they lack members of several DNA repair protein families broadly conserved among bacteria and eukaryotes. Conversely, the putative DNA repair genes that do occur in these archaea often do not generate the expected phenotype when deleted. The prospect that hyperthermophilic archaea have some unique strategies for coping with DNA damage and replication errors has intellectual and technological appeal, but re...

  4. DNA Repair Gene Patterns as Prognostic and Predictive Factors in Molecular Breast Cancer Subtypes

    OpenAIRE

    Santarpia, Libero; Iwamoto, Takayuki; Di Leo, Angelo; Hayashi, Naoki; Bottai, Giulia; Stampfer, Martha; André, Fabrice; Turner, Nicholas C.; Symmans, W Fraser; Hortobágyi, Gabriel N.; Pusztai, Lajos; Bianchini, Giampaolo

    2013-01-01

    DNA repair pathways can enable tumor cells to survive DNA damage induced by chemotherapy and thus provide prognostic and/or predictive value. In this study, the authors sought to assess the differential expression, bimodal distribution, and prognostic and predictive role of DNA repair genes in individual breast cancer molecular subtypes including estrogen receptor-positive/ HER2-negative, estrogen receptor-negative/HER2-negative, and HER2-positive cancers. The predictive value of DNA repair g...

  5. Inhibition of DNA replication, DNA repair synthesis, and DNA polymerases α and δ by butylphenyl deoxyguanosine triphosphate

    International Nuclear Information System (INIS)

    Semiconservative DNA replication in growing mammalian cells and ultraviolet (UV)-induced DNA repair synthesis in nongrowing mammalian cells are mediated by one or both of the aphidicolin-sensitive DNA polymerases, α and/or δ. They have studied the inhibition of replication and repair synthesis in permeable human cells by N2 (p-n-butylphenyl)-2'-deoxyguanosine-5'-triphosphate (BuPh dGTP), an agent which inhibits polymerase α strongly and polymerase δ weakly. Both processes are inhibited by BuPh-dGTP in competition with dGTP. The K/sub i/'s are, for replication, 2-3 μM and, for repair synthesis, 3-4 μM, consistent with the involvement of the same DNA polymerase in both processes. Inhibition of isolated human polymerase α by BuPh-dGTP is also competitive with dGTP, but the K/sub i/ is approximately 10 nM, several hundred-fold lower than the K/sub i/'s of replication and repair synthesis. Isolated polymerase δ is inhibited by BuPh-dGTP at doses similar to those which inhibit replication and repair synthesis, however, attempts to determine the K/sub i/ of polymerase δ were hampered by the finding that the dependence of δ activity on deoxyribunucleotide concentration is parabolic at low doses. This behavior differs from the behavior of polymerase α and of cellular DNA replication and repair synthesis, all of which show a simple, hyperbolic relationship between activity and deoxyribonucleotide concentration. Thus, inhibition of DNA replication and UV induced DNA repair synthesis by BuPh dGTP is quantitatively similar to DNA polymerase δ, but some other characteristics of the cellular processes are more similar to those of polymerase α

  6. Genetics Home Reference: Warsaw breakage syndrome

    Science.gov (United States)

    ... helping repair mistakes in DNA and ensuring proper DNA replication, the ChlR1 enzyme is involved in maintaining the ... cannot unwind the DNA strands to help with DNA replication and repair. A lack of functional ChlR1 impairs ...

  7. DNA repair capacity in the rat respiratory tract

    International Nuclear Information System (INIS)

    A product of alkylating agents and DNA, O6-methylguanine, can mispair with thymine, resulting in initiation of a carcinogenic tissue response. O6-alkylguanine-DNA alkyltransferase (AGT) is an acceptor protein responsible for repairing O6-methylguanine. The purpose of our experiments was to characterize AGT activity in vitro in tissue and cell extracts of the respiratory tract, a target tissue for inhaled alkylating agents. Removal of [3H]Methyl from O6-methylguanine was measured by high-pressure liquid chromatography after incubation of tissue and cell extracts with the [3H]DNA. With the exception of tracheal and bronchial extracts, all tissues and cells analyzed contained AGT activity, which increased in proportion to the amount of protein added to reaction flasks. AGT activity in tracheal and bronchial extracts was only detected at the highest protein concentration used (1.5 mg protein/mL) and ranged from 10-15 fmole/mg protein. AGT activity in the respiratory tract was highest in the lung and a region of the nasal tissue (i.e., ethmoturbinates) and ranged from 45-75 fmole/mg protein. These data suggest that methylated DNA in specific regions of the rat respiratory tract should be readily repaired, albeit to different extents. (author)

  8. DNA damage by reactive species: Mechanisms, mutation and repair

    Indian Academy of Sciences (India)

    N R Jena

    2012-07-01

    DNA is continuously attacked by reactive species that can affect its structure and function severely. Structural modifications to DNA mainly arise from modifications in its bases that primarily occur due to their exposure to different reactive species. Apart from this, DNA strand break, inter- and intra-strand crosslinks and DNA–protein crosslinks can also affect the structure of DNA significantly. These structural modifications are involved in mutation, cancer and many other diseases. As it has the least oxidation potential among all the DNA bases, guanine is frequently attacked by reactive species, producing a plethora of lethal lesions. Fortunately, living cells are evolved with intelligent enzymes that continuously protect DNA from such damages. This review provides an overview of different guanine lesions formed due to reactions of guanine with different reactive species. Involvement of these lesions in inter- and intra-strand crosslinks, DNA–protein crosslinks and mutagenesis are discussed. How certain enzymes recognize and repair different guanine lesions in DNA are also presented.

  9. Induction of DNA breakage in X-irradiated nucleoids selectively stripped of nuclear proteins in two mouse lymphoma cell lines differing in radiosensitivity

    International Nuclear Information System (INIS)

    The role of nuclear proteins in protection of DNA against ionizing radiation and their contribution to the radiation sensitivity was examined by an alkaline version of comet assay in two L5178Y (LY) mouse lymphoma cell lines differing in sensitivity t o ionizing radiation. LY-S cells are twice more sensitive to ionizing radiation than LY-R cells (D0 values of survival curves are 0.5 Gy and 1 Gy, respectively). Sequential removal of nuclear proteins by extraction with NaCl of different concentrations increased the X-ray induced DNA damage in LY-R nucleoids. In contrast, in the radiation sensitive LY-S cell line, depletion of nuclear proteins practically did not affect DNA damage. Although there is no doubt that the main cause of LY-S cells' sensitivity to ionizing radiation is a defect in the repair of double-strand breaks, our data support the concept that nuclear matrix organization may contribute to the cellular susceptibility to DNA damaging agents. (author)

  10. Possible new variant of Nijmegen breakage syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Der Kaloustian, V.M.; Booth, A.; Elliott, A.M. [Montreal Children`s Hospital and McGill Univ., Montreal (Canada)] [and others

    1996-10-02

    We report on a child with microcephaly, small facial and body size, and immune deficiency. The phenotype is consistent with Nijmegen breakage syndrome (NBS), with additional clinical manifestations and laboratory findings not reported heretofore. Most investigations, including the results of radiation-resistant DNA synthesis, concurred with the diagnosis of NBS. Cytogenetic analysis documented abnormalities in virtually all cells examined. Along with the high frequency of breaks and rearrangements of chromosomes 7 and 14, we found breakage and monosomies involving numerous other chromosomes. Because of some variation in the clinical presentation and some unusual cytogenetic findings, we suggest that our patient may represent a new variant of Nijmegen breakage syndrome. 34 refs., 3 figs., 7 tabs.

  11. Induced excision repair is required for repair of lesions in the vicinity of DNA replication forks

    International Nuclear Information System (INIS)

    A technique for resolving DNA fragments containing replication forks from linear DNA fragments by two-dimensional agarose gel electrophoresis is described. The technique is based on the altered mobility in agarose of branched structures relative to linear double-stranded molecules as a function of gel concentration and voltage. When pulse-labeled DNA is isolated, purified, fragmented by digestion with restriction nucleases, and run in the two-dimensional gel system, the bulk of the DNA migrates in a single arc visible by staining with ethidium bromide. However, when autoradiograms are prepared from the gels, it can be seen that the nascent DNA, represented by the radioactive pulse label, is contained in a second distinct arc. We have shown by a variety of criteria that the nascent DNA migrating in this minor arc has properties consistent with replication fork structures. We have now applied this technique to testing the hypothesis that long patch repair occurs at lesions in the vicinity of DNA replication forks. 2 figs

  12. Reprint of "Oxidant and environmental toxicant-induced effects compromise DNA ligation during base excision DNA repair".

    Science.gov (United States)

    Çağlayan, Melike; Wilson, Samuel H

    2015-12-01

    DNA lesions arise from many endogenous and environmental agents, and such lesions can promote deleterious events leading to genomic instability and cell death. Base excision repair (BER) is the main DNA repair pathway responsible for repairing single strand breaks, base lesions and abasic sites in mammalian cells. During BER, DNA substrates and repair intermediates are channeled from one step to the next in a sequential fashion so that release of toxic repair intermediates is minimized. This includes handoff of the product of gap-filling DNA synthesis to the DNA ligation step. The conformational differences in DNA polymerase β (pol β) associated with incorrect or oxidized nucleotide (8-oxodGMP) insertion could impact channeling of the repair intermediate to the final step of BER, i.e., DNA ligation by DNA ligase I or the DNA Ligase III/XRCC1 complex. Thus, modified DNA ligase substrates produced by faulty pol β gap-filling could impair coordination between pol β and DNA ligase. Ligation failure is associated with 5'-AMP addition to the repair intermediate and accumulation of strand breaks that could be more toxic than the initial DNA lesions. Here, we provide an overview of the consequences of ligation failure in the last step of BER. We also discuss DNA-end processing mechanisms that could play roles in reversal of impaired BER. PMID:26596511

  13. Involvement of DNA polymerase δ in DNA repair synthesis in human fibroblasts at late times after ultraviolet irradiation

    International Nuclear Information System (INIS)

    DNA repair synthesis following UV irradiation of confluent human fibroblasts has a biphasic time course with an early phase of rapid nucleotide incorporation and a late phase of much slower nucleotide incorporation. The biphasic nature of this curve suggests that two distinct DNA repair systems may be operative. Previous studies have specifically implicated DNA polymerase δ as the enzyme involved in DNA repair synthesis occurring immediately after UV damage. In this paper, the authors describe studies of DNA polymerase involvement in DNA repair synthesis in confluent human fibroblasts at late times after UV irradiation. Late UV-induced DNA repair synthesis in both intact and permeable cells was found to be inhibited by aphidicolin, indicating the involvement of one of the aphidicolin-sensitive DNA polymerases, α or δ. In permeable cells, the process was further analyzed by using the nucleotide analogue (butylphenyl)-2'-deoxyguanosine 5'-triphosphate, which inhibits DNA polymerase α several hundred times more strongly than it inhibits DNA polymerase δ. The (butylphenyl)-2'-deoxyguanosine 5'-triphosphate inhibition curve for late UV-induced repair synthesis was very similar to that for polymerase δ. It appears that repair synthesis at late time after UV irradiation, like repair synthesis at early times, is mediated by DNA polymerase δ

  14. Cloning and characterization of human DNA repair genes

    International Nuclear Information System (INIS)

    The isolation of two addition human genes that give efficient restoration of the repair defects in other CHO mutant lines is reported. The gene designated ERCC2 (Excision Repair Complementing Chinese hamster) corrects mutant UV5 from complementation group 1. They recently cloned this gene by first constructing a secondary transformant in which the human gene was shown to have become physically linked to the bacterial gpt dominant-marker gene by cotransfer in calcium phosphate precipitates in the primary transfection. Transformants expressing both genes were recovered by selecting for resistance to both UV radiation and mycophenolic acid. Using similar methods, the human gene that corrects CHO mutant EM9 was isolated in cosmids and named XRCC1 (X-ray Repair Complementing Chinese hamster). In this case, transformants were recovered by selecting for resistance to CldUrd, which kills EM9 very efficiently. In both genomic and cosmid transformants, the XRCC1 gene restored resistance to the normal range. DNA repair was studied using the kinetics of strand-break rejoining, which was measured after exposure to 137Cs γ-rays

  15. Evaluation of radio-induced DNA damage and their repair in human lymphocytes by comet assay or single cell gel electrophoresis; Avaliacao do dano radioinduzido no DNA e reparo em linfocitos humanos pelo metodo do cometa (single cell gel electrophoresis)

    Energy Technology Data Exchange (ETDEWEB)

    Nascimento, Patricia A. do; Suzuki, Miriam F.; Okazaki, Kayo [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil)

    1997-12-01

    The comet assay, also called single cell gel electrophoresis technique, permits to evaluate quantitatively DNA breakage induced by chemical and physical agents at the level of the single cell. The present paper refers to the construction of dose-response curves to DNA damage and repair studies in human peripheral lymphocytes, utilizing the comet assay for the radiosensitivity analysis. So, the blood samples were obtained from healthy donors (40-50 year old), irradiated in a {sup 60} Co source (GAMMACEL 220) with doses of 0.17, 0.25, 0.57, 1.10, 2.12 and 4.22 Gy (0.59 Gy/min.) and processed 1 and 24 hours after the exposition. Results obtained showed a increase in the total lenght of comet (DNA migration) as a function of radiation dose in samples processed 1 and 24 hours after the treatment. The DNA lesion in irradiated lymphocytes with 4.22 Gy (means value of 101.4 {mu}m) were 3.4 times higher than in the untreated lymphocytes (mean value of 30 {mu}m) instead of 24 hours after the irradiation were 1.5 times higher (mean value of 46.3 {mu}m). This reduction on DNA repair occurred in these cells. It was also possible visualized the presence of subpopulations of the cells with different sensitivity and repair capacity to ionizing radiation in these donors. (author). 8 refs., 3 figs.

  16. Disruption of Maternal DNA Repair Increases Sperm-DerivedChromosomal Aberrations

    Energy Technology Data Exchange (ETDEWEB)

    Marchetti, Francesco; Essers, Jeroun; Kanaar, Roland; Wyrobek,Andrew J.

    2007-02-07

    The final weeks of male germ cell differentiation occur in aDNA repair-deficient environment and normal development depends on theability of the egg to repair DNA damage in the fertilizing sperm. Geneticdisruption of maternal DNA double-strand break repair pathways in micesignificantly increased the frequency of zygotes with chromosomalstructural aberrations after paternal exposure to ionizing radiation.These findings demonstrate that radiation-induced DNA sperm lesions arerepaired after fertilization by maternal factors and suggest that geneticvariation in maternal DNA repair can modulate the risk of early pregnancylosses and of children with chromosomal aberrations of paternalorigin.

  17. Correction of the DNA repair defect in xeroderma pigmentosum group E by injection of a DNA damage-binding protein.

    OpenAIRE

    Keeney, S.; Eker, André; Brody, T.; Vermeulen, Wim; Bootsma, Dirk; Hoeijmakers, Jan; Linn, S.(Florida International University, Miami, USA)

    1994-01-01

    textabstractCells from a subset of patients with the DNA-repair-defective disease xeroderma pigmentosum complementation group E (XP-E) are known to lack a DNA damage-binding (DDB) activity. Purified human DDB protein was injected into XP-E cells to test whether the DNA-repair defect in these cells is caused by a defect in DDB activity. Injected DDB protein stimulated DNA repair to normal levels in those strains that lack the DDB activity but did not stimulate repair in cells from other xerode...

  18. Destabilized SMC5/6 complex leads to chromosome breakage syndrome with severe lung disease.

    Science.gov (United States)

    van der Crabben, Saskia N; Hennus, Marije P; McGregor, Grant A; Ritter, Deborah I; Nagamani, Sandesh C S; Wells, Owen S; Harakalova, Magdalena; Chinn, Ivan K; Alt, Aaron; Vondrova, Lucie; Hochstenbach, Ron; van Montfrans, Joris M; Terheggen-Lagro, Suzanne W; van Lieshout, Stef; van Roosmalen, Markus J; Renkens, Ivo; Duran, Karen; Nijman, Isaac J; Kloosterman, Wigard P; Hennekam, Eric; Orange, Jordan S; van Hasselt, Peter M; Wheeler, David A; Palecek, Jan J; Lehmann, Alan R; Oliver, Antony W; Pearl, Laurence H; Plon, Sharon E; Murray, Johanne M; van Haaften, Gijs

    2016-08-01

    The structural maintenance of chromosomes (SMC) family of proteins supports mitotic proliferation, meiosis, and DNA repair to control genomic stability. Impairments in chromosome maintenance are linked to rare chromosome breakage disorders. Here, we have identified a chromosome breakage syndrome associated with severe lung disease in early childhood. Four children from two unrelated kindreds died of severe pulmonary disease during infancy following viral pneumonia with evidence of combined T and B cell immunodeficiency. Whole exome sequencing revealed biallelic missense mutations in the NSMCE3 (also known as NDNL2) gene, which encodes a subunit of the SMC5/6 complex that is essential for DNA damage response and chromosome segregation. The NSMCE3 mutations disrupted interactions within the SMC5/6 complex, leading to destabilization of the complex. Patient cells showed chromosome rearrangements, micronuclei, sensitivity to replication stress and DNA damage, and defective homologous recombination. This work associates missense mutations in NSMCE3 with an autosomal recessive chromosome breakage syndrome that leads to defective T and B cell function and acute respiratory distress syndrome in early childhood. PMID:27427983

  19. Physical interaction between components of DNA mismatch repair and nucleotide excision repair

    International Nuclear Information System (INIS)

    Nucleotide excision repair (NER) and DNA mismatch repair are required for some common processes although the biochemical basis for this requirement is unknown. Saccharomyces cerevisiae RAD14 was identified in a two-hybrid screen using MSH2 as 'bait,' and pairwise interactions between MSH2 and RAD1, RAD2, RAD3, RAD10, RAD14, and RAD25 subsequently were demonstrated by two-hybrid analysis. MSH2 coimmunoprecipitated specifically with epitope-tagged versions of RAD2, RAD10, RAD14, and RAD25. MSH2 and RAD10 were found to interact in msh3 msh6 and mlh1 pms1 double mutants, suggesting a direct interaction with MSH2. Mutations in MSH2 increased the UV sensitivity of NER-deficient yeast strains, and msh2 mutations were epistatic to the mutator phenotype observed in NER-deficient strains. These data suggest that MSH2 and possibly other components of DNA mismatch repair exist in a complex with NER proteins, providing a biochemical and genetical basis for these proteins to function in common processes

  20. DNA repair genotype and lung cancer risk in the beta-carotene and retinol efficacy trial

    OpenAIRE

    Doherty, Jennifer A; Sakoda, Lori C.; Loomis, Melissa M; Barnett, Matt J.; Julianto, Liberto; Thornquist, Mark D; Neuhouser, Marian L; Weiss, Noel S.; Goodman, Gary E.; Chen, Chu

    2013-01-01

    Many carcinogens in tobacco smoke cause DNA damage, and some of that damage can be mitigated by the actions of DNA repair enzymes. In a case-control study nested within the Beta-Carotene and Retinol Efficacy Trial, a randomized chemoprevention trial in current and former heavy smokers, we examined whether lung cancer risk was associated with variation in 26 base excision repair, mismatch repair, and homologous recombination repair genes. Analyses were limited to Caucasians (744 cases, 1477 co...

  1. DNA repair in a Fanconi's anemia fibroblast cell strain

    International Nuclear Information System (INIS)

    DNA repair and colony survival were measured in fibroblasts from a patient with Fanconi's anemia, HG 261, and from normal human donors after exposure to these cells to the cross-linking agent mitomycin C, X-rays or ultraviolet light. Survival was similar in HG 261 and normal cells after X-ray or ultraviolet radiation, but was reduced in the Fanconi's anemia cells after treatment with mitomycin C. The level of DNA cross-linking, as measured by the method of alkaline elution, was the same in both cell strains after exposure to various doses of mitomycin C. With incubation after drug treatment, a gradual decrease in the amount of cross-linking was observed, the rate of this apparent repair of cross-link damage was the same in both normal and HG 261 cells. The rejoining of DNA single strand breaks after X-irradiation and the production of excision breaks after ultraviolet radiation were also normal in HG 261 cells as determined by alkaline elution. (Auth.)

  2. Acetylation regulates WRN catalytic activities and affects base excision DNA repair

    DEFF Research Database (Denmark)

    Muftuoglu, Meltem; Kusumoto, Rika; Speina, Elzbieta;

    2008-01-01

    The Werner protein (WRN), defective in the premature aging disorder Werner syndrome, participates in a number of DNA metabolic processes, and we have been interested in the possible regulation of its function in DNA repair by post-translational modifications. Acetylation mediated by histone...... acetyltransferases is of key interest because of its potential importance in aging, DNA repair and transcription....

  3. Effect of DNA polymerase inhibitors on DNA repair in intact and permeable human fibroblasts: Evidence that DNA polymerases δ and β are involved in DNA repair synthesis induced by N-methyl-N'-nitro-N-nitrosoguanidine

    International Nuclear Information System (INIS)

    The involvement of DNA polymerases α, β, and δ in DNA repair synthesis induced by N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) was investigated in human fibroblasts (HF). The effects of anti-(DNA polymerase α) monoclonal antibody, (p-n-butylphenyl)deoxyguanosine triphosphate (BuPdGTP), dideoxythymidine triphosphate (ddTTP), and aphidicolin on MNNG-induced DNA repair synthesis were investigated to dissect the roles of the different DNA polymerases. A subcellular system (permeable cells), in which DNA repair synthesis and DNA replication were differentiated by CsCl gradient centrifugation of BrdUMP density-labeled DNA, was used to examine the effects of the polymerase inhibitors. Another approach investigated the effects of several of these inhibitors of MNNG-induced DNA repair synthesis in intact cells by measuring the amount of [3H]thymidine incorporated into repair DNA as determined by autoradiography and quantitation with an automated video image analysis system. In permeable cells, MNNG-induced DNA repair synthesis was inhibited 56% by 50 μg of aphidicolin/mL, 6% by 10 μM BuPdGTP, 13% by anti-(DNA polymerse α) monoclonal antibodies, and 29% by ddTTP. In intact cells, MNNG-induced DNA repair synthesis was inhibited 57% by 50 μg of aphidicolin/mL and was not significantly inhibited by microinjecting anti-(DNA polymerase α) antibodies into HF nuclei. These results indicate that both DNA polymerase δ and β are involved in repairing DNA damage caused by MNNG

  4. DNA-mediated transfer of a human DNA repair gene that controls sister chromatid exchange.

    OpenAIRE

    Thompson, L H; Brookman, K W; Minkler, J L; Fuscoe, J C; Henning, K A; Carrano, A V

    1985-01-01

    The Chinese hamster cell line mutant EM9, which has a reduced ability to repair DNA strand breaks, is noted for its highly elevated frequency of sister chromatid exchange, a property shared with cells from individuals with Bloom's syndrome. The defect in EM9 cells was corrected by fusion hybridization with normal human fibroblasts and by transfection with DNA from hybrid cells. The transformants showed normalization of sister chromatid exchange frequency but incomplete correction of the repai...

  5. Preferential repair of nuclear matrix associated DNA in xeroderma pigmentosum complementation group C

    International Nuclear Information System (INIS)

    The distribution of ultraviolet-induced DNA repair patches in the genome of xeroderma pigmentosum cells of complementation group C was investigated by determining the molecular weight distribution of repair labeled DNA and prelabeled DNA in alkaline sucrose gradients after treatment with the dimer-specific endonuclease V of bacteriophage T4. The results suggest that DNA-repair synthesis in xeroderma pigmentosum cells of complementation group C occurs in localized regions of the genome. Analysis of the spatial distribution of ultraviolet-induced repair patches in DNA loops attached to the nuclear matrix revealed that in xeroderma pigmentosum cells of complementation group C repair patches are preferentially situated near the attachment sites of DNA loops at the nuclear matrix. In normal human fibroblasts the authors observed no enrichment of repair-labeled DNA at the nuclear matrix and repair patches appeared to be distributed randomly along the DNA loops. The enrichment of repair-labeled DNA at the nuclear matrix in xeroderma pigmentosum cells of complementation group C may indicate that the residual DNA-repair synthesis in these cells occurs preferentially in regions of the genome. (Auth.)

  6. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in primary melanocytes.

    Science.gov (United States)

    Thompson, Benjamin C; Surjana, Devita; Halliday, Gary M; Damian, Diona L

    2014-07-01

    Cutaneous melanoma is a significant cause of morbidity and mortality. Nicotinamide is a safe, widely available vitamin that reduces the immune suppressive effects of UV, enhances DNA repair in keratinocytes and has shown promise in the chemoprevention of non-melanoma skin cancer. Here, we report the effect of nicotinamide on DNA damage and repair in primary human melanocytes. Nicotinamide significantly enhanced the repair of oxidative DNA damage (8-oxo-7,8-dihydro-2'-deoxyguanosine) and cyclobutane pyrimidine dimers induced by UV exposure. It also enhanced the repair of 8-oxo-7,8-dihydro-2'-deoxyguanosine induced by the culture conditions in unirradiated melanocytes. A significant increase in the percentage of melanocytes undergoing unscheduled but not scheduled DNA synthesis was observed, confirming that nicotinamide enhances DNA repair in human melanocytes. In summary, nicotinamide, by enhancing DNA repair in melanocytes, is a potential agent for the chemoprevention of cutaneous melanoma. PMID:24798949

  7. FGF2 mediates DNA repair in epidermoid carcinoma cells exposed to ionizing radiation

    International Nuclear Information System (INIS)

    Fibroblast growth factor 2 (FGF2) is a well-known survival factor. However, its role in DNA repair is poorly documented. The present study was designed to investigate in epidermoid carcinoma cells the potential role of FGF2 in DNA repair. The side population (SP) with cancer stem cell-like properties and the main population (MP) were isolated from human A431 squamous carcinoma cells. Radiation-induced DNA damage and repair were assessed using the alkaline comet assay. FGF2 expression was quantified by enzyme linked immunosorbent assay (ELISA). SP cells exhibited rapid repair of radiation induced DNA damage and a high constitutive level of nuclear FGF2. Blocking FGF2 signaling abrogated the rapid DNA repair. In contrast, in MP cells, a slower repair of damage was associated with low basal expression of FGF2. Moreover, the addition of exogenous FGF2 accelerated DNA repair in MP cells. When irradiated, SP cells secreted FGF2, whereas MP cells did not. FGF2 was found to mediate DNA repair in epidermoid carcinoma cells. We postulate that carcinoma stem cells would be intrinsically primed to rapidly repair DNA damage by a high constitutive level of nuclear FGF2. In contrast, the main population with a low FGF2 content exhibits a lower repair rate which can be increased by exogenous FGF2. (authors)

  8. DNA repair-related genes in sugarcane expressed sequence tags (ESTs)

    OpenAIRE

    Costa R.M.A.; Lima W.C.; Vogel C.I.G.; Berra C.M.; Luche D.D.; Medina-Silva R.; Galhardo R.S.; Menck C.F.M.; Oliveira V.R.

    2001-01-01

    There is much interest in the identification and characterization of genes involved in DNA repair because of their importance in the maintenance of the genome integrity. The high level of conservation of DNA repair genes means that these genetic elements may be used in phylogenetic studies as a source of information on the genetic origin and evolution of species. The mechanisms by which damaged DNA is repaired are well understood in bacteria, yeast and mammals, but much remains to be learned ...

  9. Chk2-dependent phosphorylation of XRCC1 in the DNA damage response promotes base excision repair

    OpenAIRE

    Chou, Wen-Cheng; Wang, Hui-Chun; Wong, Fen-Hwa; Ding, Shian-ling; Wu, Pei-Ei; Shieh, Sheau-Yann; Shen, Chen-Yang

    2008-01-01

    The DNA damage response (DDR) has an essential function in maintaining genomic stability. Ataxia telangiectasia-mutated (ATM)-checkpoint kinase 2 (Chk2) and ATM- and Rad3-related (ATR)-Chk1, triggered, respectively, by DNA double-strand breaks and blocked replication forks, are two major DDRs processing structurally complicated DNA damage. In contrast, damage repaired by base excision repair (BER) is structurally simple, but whether, and how, the DDR is involved in repairing this damage is un...

  10. Genetic and environmental influence on DNA strand break repair: a twin study

    DEFF Research Database (Denmark)

    Garm, Christian; Moreno-Villanueva, Maria; Bürkle, Alexander;

    2013-01-01

    Accumulation of DNA damage deriving from exogenous and endogenous sources has significant consequences for cellular survival, and is implicated in aging, cancer, and neurological diseases. Different DNA repair pathways have evolved in order to maintain genomic stability. Genetic and environmental...... factors are likely to influence DNA repair capacity. In order to gain more insight into the genetic and environmental contribution to the molecular basis of DNA repair, we have performed a human twin study, where we focused on the consequences of some of the most abundant types of DNA damage (single...... dizygotic). We did not detect genetic effects on the DNA-strand break variables in our study....

  11. Stable interactions between DNA polymerase δ catalytic and structural subunits are essential for efficient DNA repair

    International Nuclear Information System (INIS)

    Eukaryotic DNA polymerase δ (Pol δ) activity is crucial for chromosome replication and DNA repair and thus, plays an essential role in genome stability. In Saccharomyces cerevisiae, Pol δ is a heterotrimeric complex composed of the catalytic subunit Pol3, the structural B subunit Pol31, and Pol32, an additional auxiliary subunit. Pol3 interacts with Pol31 thanks to its C-terminal domain (CTD) and this interaction is of functional importance both in DNA replication and DNA repair. Interestingly, deletion of the last four C-terminal Pol3 residues, LSKW, in the Pol3-ct mutant does not affect DNA replication but leads to defects in homologous recombination and in break-induced replication (BIR) repair pathways. The defect associated with pol3-ct could result from a defective interaction between Pol δ and a protein involved in recombination. However, we show that the LSKW motif is required for the interaction between Pol3 C-terminal end and Pol31. This loss of interaction is relevant in vivo since we found that pol3-ct confers HU sensitivity on its own and synthetic lethality with a Pol32 deletion. Moreover, Pol3-ct shows genetic interactions, both suppression and synthetic lethality, with Pol31 mutant alleles. Structural analyses indicate that the B subunit of Pol displays a major conserved region at its surface and that Pol31 alleles interacting with Pol3-ct, correspond to substitutions of Pol31 amino acids that are situated in this particular region. Superimposition of our Pol31 model on the 3D architecture of the phylo-genetically related DNA polymerase α (Pol α) suggests that Pol3 CTD interacts with the conserved region of Pol31, thus providing a molecular basis to understand the defects associated with pol3-ct. Taken together, our data highlight a stringent dependence on Pol δ complex stability in DNA repair. (authors)

  12. Novel Image Processing Interface to Relate DSB Spatial Distribution from Immunofluorescence Foci Experiments to the State-of-the-Art Models of DNA Breakage

    Science.gov (United States)

    Ponomarev, A. L.; Cucinotta, F. A.

    2004-01-01

    A recently developed software (NASARadiationTrackImage) allows a quick and automatic segmentation of foci that indicate spatial localization of specific proteins that are visualized by immunofluorescence. Of interest are the spatial and temporal distribution of foci such as gammaH2AX, a signal of the phosphorylation of a variant of the histone H2A that has been shown to correspond to DSBs, or proteins involved in DSB processing, such as ATM, Rad51, and p53, following exposures of human cells to high charge and energy (HZE) ion irradiation. Experimental data are recorded as sets of two-dimensional images in color with cells and foci of gammaH2AX, ATM, Rad51 or others shown. Different cells, levels of radiation and timing after radiation were recorded. The software allows us to calculate the number of foci per cell, overall intensity of light in foci and their spatial organization. A simple statistical model allows for testing of foci overlap (eclipse). A more complex statistical model previously known as DNAbreak simulates track structure and random chromosome geometry. It has one adjustable parameter corresponding to an average intensity of DSB creation in cubic micrometers of DNA volume per particle track or unit dose. Its limitation is the low-resolution limit both in physical space and DSB's along DNA. It works adequately on the scale of a cell and provides further insights on how the geometry of tracks and DNA affects genomic damage of the cell and subsequent repair. Future developments of the model for the description of the time evolution of DNA damage response proteins, and more robust track structure models will be discussed.

  13. Radioimmunoassay studies on repair of ultraviolet damaged DNA in cultured animal cells

    International Nuclear Information System (INIS)

    UV (ultraviolet) damaged DNA and its repair of various cultured animal cells were observed by radioimmunoassay using anti-serum against the UV irradiation induced heat-degenerated DNA. There is some difference among the cells of used animals according to their DNA repairabilities. The cells were divided into four groups according to the existence or strength of their repairabilities. 1) excision repair type: cells of men and chimpanzees. 2) photoreactivation type: cells derived from Tachydromus tachydromoides and chicks. 3) photoreactivation with excision repair: cells of rats, kangaroos and mosquitos. 4) non-excision repair type: cells of mice, Meriones and rats. Animal cells have plural types of repair. Main types of repair will differ according to the kind of animals. (Ichikawa, K.)

  14. Review: Clinical aspects of hereditary DNA Mismatch repair gene mutations.

    Science.gov (United States)

    Sijmons, Rolf H; Hofstra, Robert M W

    2016-02-01

    Inherited mutations of the DNA Mismatch repair genes MLH1, MSH2, MSH6 and PMS2 can result in two hereditary tumor syndromes: the adult-onset autosomal dominant Lynch syndrome, previously referred to as Hereditary Non-Polyposis Colorectal Cancer (HNPCC) and the childhood-onset autosomal recessive Constitutional Mismatch Repair Deficiency syndrome. Both conditions are important to recognize clinically as their identification has direct consequences for clinical management and allows targeted preventive actions in mutation carriers. Lynch syndrome is one of the more common adult-onset hereditary tumor syndromes, with thousands of patients reported to date. Its tumor spectrum is well established and includes colorectal cancer, endometrial cancer and a range of other cancer types. However, surveillance for cancers other than colorectal cancer is still of uncertain value. Prophylactic surgery, especially for the uterus and its adnexa is an option in female mutation carriers. Chemoprevention of colorectal cancer with aspirin is actively being investigated in this syndrome and shows promising results. In contrast, the Constitutional Mismatch Repair Deficiency syndrome is rare, features a wide spectrum of childhood onset cancers, many of which are brain tumors with high mortality rates. Future studies are very much needed to improve the care for patients with this severe disorder. PMID:26746812

  15. Genetic polymorphisms in DNA repair genes and possible links with DNA repair rates, chromosomal aberrations and single-strand breaks in DNA

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Kumar, R.; Štětina, R.; Sanyal, S.; Souček, P.; Haufroid, V.; Dušinská, M.; Kuricová, M.; Zámečníková, M.; Musak, L.; Buchancová, J.; Norppa, H.; Hirvonen, A.; Vodičková, L.; Naccarati, Alessio; Matoušů, Zora; Hemminki, K.

    2004-01-01

    Roč. 25, č. 5 (2004), s. 757-763. ISSN 0143-3334 R&D Projects: GA ČR GA310/03/0437; GA ČR GA310/01/0802 Institutional research plan: CEZ:AV0Z5039906 Keywords : DNA repair rates * genotoxicity Subject RIV: FM - Hygiene Impact factor: 5.375, year: 2004

  16. Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.

    NARCIS (Netherlands)

    B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1997-01-01

    textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA glyc

  17. Immunoglobulin variable region hypermutation is associated with a DNA repair deficit

    International Nuclear Information System (INIS)

    The molecular mechanism of Ig variable region hypermutation is unknown, but has been hypothesized to involve an error-prone DNA repair process. In this study, the authors used a novel PCR-based assay to compare repair of UV-induced DNA damage in mantle zone versus germinal center B lymphocytes. They observed that DNA repair activity within rearranged VDJ loci was sluggish in germinal center B lymphocytes compared to repair activity monitored in mantle zone B lymphocytes. In contrast, DNA repair times within the germline VH5 gene family, the variable region JH endash CH intron, and the N-ras gene was rapid and similar in both germinal center and mantle zone B cells. These results reflect a DNA repair deficit which, as expected for hypermutation, is selective for rearranged Ig VDG in germinal center cells. To directly measure the fidelity of DNA repair, the repaired PCR-amplified gene segments were analyzed for sequence changes by restriction enzyme digestion. In experiments thus far, repair of germline VH5 was error-free in both germinal center and mantle zone B cells. However, while rearranged VH5 segments were also error-free in mantle zone cells, they were highly mutated in germinal center cells. These findings provide direct biochemical evidence for the role of a sequence- and stage-specific error-prone DNA repair pathway in Ig V gene hypermutation

  18. Enhanced DNA repair of cyclobutane pyrimidine dimers changes the biological response to UV-B radiation

    Energy Technology Data Exchange (ETDEWEB)

    Yarosh, Daniel B

    2002-11-30

    The goal of DNA repair enzyme therapy is the same as that for gene therapy: to rescue a defective proteome/genome by introducing a substitute protein/DNA. The danger of inadequate DNA repair is highlighted in the genetic disease xeroderma pigmentosum. These patients are hypersensitive to sunlight and develop multiple cutaneous neoplasms very early in life. The bacterial DNA repair enzyme T4 endonuclease V was shown over 25 years ago to be capable of reversing the defective repair in xeroderma pigmentosum cells. This enzyme, packaged in an engineered delivery vehicle, has been shown to traverse the stratum corneum, reach the nuclei of living cells of the skin, and enhance the repair of UV-induced cyclobutane pyrimidine dimers (CPD). In such a system, changes in DNA repair, mutagenesis, and cell signaling can be studied without manipulation of the genome.

  19. Genetic manipulation in Sulfolobus islandicus and functional analysis of DNA repair genes

    DEFF Research Database (Denmark)

    Zhang, Changyi; Tian, Bin; Li, Suming;

    2013-01-01

    enzymes already impaired cell growth, highlighting their important roles in archaeal DNA repair. Systematically characterizing these mutants and generating mutants lacking two or more DNA repair genes will yield further insights into the genetic mechanisms of DNA repair in this model organism.......Recently, a novel gene-deletion method was developed for the crenarchaeal model Sulfolobus islandicus, which is a suitable tool for addressing gene essentiality in depth. Using this technique, we have investigated functions of putative DNA repair genes by constructing deletion mutants and studying...... their phenotype. We found that this archaeon may not encode a eukarya-type of NER (nucleotide excision repair) pathway because depleting each of the eukaryal NER homologues XPD, XPB and XPF did not impair the DNA repair capacity in their mutants. However, among seven homologous recombination proteins...

  20. In TFIIH, XPD helicase is exclusively devoted to DNA repair.

    Directory of Open Access Journals (Sweden)

    Jochen Kuper

    2014-09-01

    Full Text Available The eukaryotic XPD helicase is an essential subunit of TFIIH involved in both transcription and nucleotide excision repair (NER. Mutations in human XPD are associated with several inherited diseases such as xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy. We performed a comparative analysis of XPD from Homo sapiens and Chaetomium thermophilum (a closely related thermostable fungal orthologue to decipher the different molecular prerequisites necessary for either transcription or DNA repair. In vitro and in vivo assays demonstrate that mutations in the 4Fe4S cluster domain of XPD abrogate the NER function of TFIIH and do not affect its transcriptional activity. We show that the p44-dependent activation of XPD is promoted by the stimulation of its ATPase activity. Furthermore, we clearly demonstrate that XPD requires DNA binding, ATPase, and helicase activity to function in NER. In contrast, these enzymatic properties are dispensable for transcription initiation. XPD helicase is thus exclusively devoted to NER and merely acts as a structural scaffold to maintain TFIIH integrity during transcription.

  1. DNA Repair in Despair-Vitamin D Is Not Fair.

    Science.gov (United States)

    Gocek, Elżbieta; Studzinski, George P

    2016-08-01

    The role of vitamin D as a treatment option for neoplastic diseases, once considered to have a bright future, remains controversial. The preclinical studies discussed herein show compelling evidence that Vitamin D Derivatives (VDDs) can convert some cancer and leukemia cells to a benign phenotype, by differentiation/maturation, cell cycle arrest, or induction of apoptosis. Furthermore, there is considerable, though still evolving, knowledge of the molecular mechanisms underlying these changes. However, the attempts to clearly document that the treatment outcomes of human neoplastic diseases can be positively influenced by VDDs have been, so far, disappointing. The clinical trials to date of VDDs, alone or combined with other agents, have not shown consistent results. It is our contention, shared by others, that there were limitations in the design or execution of these trials which have not yet been fully addressed. Based on the connection between upregulation of JNK by VDDs and DNA repair, we propose a new avenue of attack on cancer cells by increasing the toxicity of the current, only partially effective, cancer chemotherapeutic drugs by combining them with VDDs. This can impair DNA repair and thus kill the malignant cells, warranting a comprehensive study of this novel concept. J. Cell. Biochem. 117: 1733-1744, 2016. © 2016 Wiley Periodicals, Inc. PMID:27122067

  2. Overexpression of DNA ligase III in mitochondria protects cells against oxidative stress and improves mitochondrial DNA base excision repair

    DEFF Research Database (Denmark)

    Akbari, Mansour; Keijzers, Guido; Maynard, Scott;

    2014-01-01

    Base excision repair (BER) is the most prominent DNA repair pathway in human mitochondria. BER also results in a temporary generation of AP-sites, single-strand breaks and nucleotide gaps. Thus, incomplete BER can result in the generation of DNA repair intermediates that can disrupt mitochondrial...... rotenone. Our results suggest that the amount of DNA ligase III in mitochondria may be critical for cell survival following prolonged oxidative stress, and demonstrate a functional link between mitochondrial DNA damage and repair, cell survival upon oxidative stress, and removal of dysfunctional...... DNA replication and transcription and generate mutations. We carried out BER analysis in highly purified mitochondrial extracts from human cell lines U2OS and HeLa, and mouse brain using a circular DNA substrate containing a lesion at a specific position. We found that DNA ligation is significantly...

  3. Proteomics reveals dynamic assembly of repair complexes during bypass of DNA cross-links

    DEFF Research Database (Denmark)

    Räschle, Markus; Smeenk, Godelieve; Hansen, Rebecca K;

    2015-01-01

    technique called chromatin mass spectrometry (CHROMASS) to study protein recruitment dynamics during perturbed DNA replication in Xenopus egg extracts. Using CHROMASS, we systematically monitored protein assembly and disassembly on ICL-containing chromatin. Among numerous prospective DNA repair factors, we...

  4. Sharpening the ends for repair: mechanisms and regulation of DNA resection.

    Science.gov (United States)

    Paudyal, Sharad C; You, Zhongsheng

    2016-07-01

    DNA end resection is a key process in the cellular response to DNA double-strand break damage that is essential for genome maintenance and cell survival. Resection involves selective processing of 5' ends of broken DNA to generate ssDNA overhangs, which in turn control both DNA repair and checkpoint signaling. DNA resection is the first step in homologous recombination-mediated repair and a prerequisite for the activation of the ataxia telangiectasia mutated and Rad3-related (ATR)-dependent checkpoint that coordinates repair with cell cycle progression and other cellular processes. Resection occurs in a cell cycle-dependent manner and is regulated by multiple factors to ensure an optimal amount of ssDNA required for proper repair and genome stability. Here, we review the latest findings on the molecular mechanisms and regulation of the DNA end resection process and their implications for cancer formation and treatment. PMID:27174871

  5. Helicobacter pylori infection affects mitochondrial function and DNA repair, thus, mediating genetic instability in gastric cells

    DEFF Research Database (Denmark)

    Machado, Ana Manuel Dantas; Madsen, Claus Desler; Bøggild, Cecilie Sisse Line;

    2013-01-01

    causes mtDNA mutations and a decrease of mtDNA content. Consequently, we show a decrease of respiration coupled ATP turnover and respiratory capacity and accordingly a lower level and activity of complex I of the electron transport chain. We wanted to investigate if the increased mutational load in the...... mitochondrial genome was caused by down-regulation of mitochondrial DNA repair pathways. We lowered the expression of APE-1 and YB-1, which are believed to be involved in mitochondrial base excision repair and mismatch repair. Our results suggest that both APE-1 and YB-1 are involved in mtDNA repair during H....... pylori infection, furthermore, the results demonstrate that multiple DNA repair activities are involved in protecting mtDNA during infection....

  6. Association of DNA repair polymorphisms with DNA repair functional outcomes in healthy human subjects

    Czech Academy of Sciences Publication Activity Database

    Vodička, Pavel; Štětina, R.; Poláková, Veronika; Tulupová, Elena; Naccarati, Alessio; Vodičková, Ludmila; Kumar, R.; Hánová, Monika; Pardini, Barbara; Slyšková, Jana; Musak, L.; De Palma, G.; Souček, P.; Hemminki, K.

    2007-01-01

    Roč. 28, č. 3 (2007), s. 657-664. ISSN 0143-3334 R&D Projects: GA MZd NR8563; GA ČR GA310/05/2626 Institutional research plan: CEZ:AV0Z50390512 Keywords : Base excision DNA * Single-strand breaks * Peripheral blood lymphocytes Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 5.406, year: 2007

  7. Double-strand break repair and G4 DNA stability in Caenorhabditis elegans

    NARCIS (Netherlands)

    Pontier, D.B.

    2010-01-01

    DNA double-strand breaks (DSBs) can be repaired by three canonical repair pathways. Homologous recombination (HR) uses the sister chromatid or homologous chromosome as a template to repair the DSB in an error-free manner. In non-homologous end-joining (NHEJ), the broken ends are ligated with little

  8. Mechanisms of DNA Repair by Photolyase and Excision Nuclease (Nobel Lecture).

    Science.gov (United States)

    Sancar, Aziz

    2016-07-18

    Ultraviolet light damages DNA by converting two adjacent thymines into a thymine dimer which is potentially mutagenic, carcinogenic, or lethal to the organism. This damage is repaired by photolyase and the nucleotide excision repair system in E. coli by nucleotide excision repair in humans. The work leading to these results is presented by Aziz Sancar in his Nobel Lecture. PMID:27337655

  9. Alkylation damage in DNA and RNA--repair mechanisms and medical significance

    DEFF Research Database (Denmark)

    Drabløs, Finn; Feyzi, Emadoldin; Aas, Per Arne;

    2004-01-01

    G-DNA alkyltransferase (MGMT or AGT) that repairs the base in one step. However, the genotoxicity and cytotoxicity of O(6)-meG is mainly due to recognition of O(6)-meG/T (or C) mispairs by the mismatch repair system (MMR) and induction of futile repair cycles, eventually resulting in cytotoxic double-strand breaks...

  10. Association between age and repair of oxidatively damaged DNA in human peripheral blood mononuclear cells

    DEFF Research Database (Denmark)

    Løhr, Mille; Jensen, Annie; Eriksen, Louise;

    2015-01-01

    damaged DNA in peripheral blood mononuclear cells (PBMCs). We isolated PBMCs from subjects aged 18-83 years, as part of a health survey of the Danish population that focussed on lifestyle factors. The level of DNA repair activity was measured as incisions on potassium bromate-damaged DNA by the comet...... assay. There was an inverse association between age and DNA repair activity with a 0.65% decline in activity per year from age 18 to 83 (95% confidence interval: 0.16-1.14% per year). Univariate regression analysis also indicated inverse associations between DNA repair activity and waist-hip ratio (P...

  11. The Impact of Hedgehog Signaling Pathway on DNA Repair Mechanisms in Human Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Meng, Erhong; Hanna, Ann; Samant, Rajeev S.; Shevde, Lalita A., E-mail: lsamant@uab.edu [Department of Pathology, Comprehensive Cancer Center, University of Alabama at Birmingham, WTI320D, 1824 6th Avenue South, Birmingham, AL 35233 (United States)

    2015-07-21

    Defined cellular mechanisms have evolved that recognize and repair DNA to protect the integrity of its structure and sequence when encountering assaults from endogenous and exogenous sources. There are five major DNA repair pathways: mismatch repair, nucleotide excision repair, direct repair, base excision repair and DNA double strand break repair (including non-homologous end joining and homologous recombination repair). Aberrant activation of the Hedgehog (Hh) signaling pathway is a feature of many cancer types. The Hh pathway has been documented to be indispensable for epithelial-mesenchymal transition, invasion and metastasis, cancer stemness, and chemoresistance. The functional transcription activators of the Hh pathway include the GLI proteins. Inhibition of the activity of GLI can interfere with almost all DNA repair types in human cancer, indicating that Hh/GLI functions may play an important role in enabling tumor cells to survive lethal types of DNA damage induced by chemotherapy and radiotherapy. Thus, Hh signaling presents an important therapeutic target to overcome DNA repair-enabled multi-drug resistance and consequently increase chemotherapeutic response in the treatment of cancer.

  12. The Impact of Hedgehog Signaling Pathway on DNA Repair Mechanisms in Human Cancer

    Directory of Open Access Journals (Sweden)

    Erhong Meng

    2015-07-01

    Full Text Available Defined cellular mechanisms have evolved that recognize and repair DNA to protect the integrity of its structure and sequence when encountering assaults from endogenous and exogenous sources. There are five major DNA repair pathways: mismatch repair, nucleotide excision repair, direct repair, base excision repair and DNA double strand break repair (including non-homologous end joining and homologous recombination repair. Aberrant activation of the Hedgehog (Hh signaling pathway is a feature of many cancer types. The Hh pathway has been documented to be indispensable for epithelial-mesenchymal transition, invasion and metastasis, cancer stemness, and chemoresistance. The functional transcription activators of the Hh pathway include the GLI proteins. Inhibition of the activity of GLI can interfere with almost all DNA repair types in human cancer, indicating that Hh/GLI functions may play an important role in enabling tumor cells to survive lethal types of DNA damage induced by chemotherapy and radiotherapy. Thus, Hh signaling presents an important therapeutic target to overcome DNA repair-enabled multi-drug resistance and consequently increase chemotherapeutic response in the treatment of cancer.

  13. The Impact of Hedgehog Signaling Pathway on DNA Repair Mechanisms in Human Cancer

    International Nuclear Information System (INIS)

    Defined cellular mechanisms have evolved that recognize and repair DNA to protect the integrity of its structure and sequence when encountering assaults from endogenous and exogenous sources. There are five major DNA repair pathways: mismatch repair, nucleotide excision repair, direct repair, base excision repair and DNA double strand break repair (including non-homologous end joining and homologous recombination repair). Aberrant activation of the Hedgehog (Hh) signaling pathway is a feature of many cancer types. The Hh pathway has been documented to be indispensable for epithelial-mesenchymal transition, invasion and metastasis, cancer stemness, and chemoresistance. The functional transcription activators of the Hh pathway include the GLI proteins. Inhibition of the activity of GLI can interfere with almost all DNA repair types in human cancer, indicating that Hh/GLI functions may play an important role in enabling tumor cells to survive lethal types of DNA damage induced by chemotherapy and radiotherapy. Thus, Hh signaling presents an important therapeutic target to overcome DNA repair-enabled multi-drug resistance and consequently increase chemotherapeutic response in the treatment of cancer

  14. Repair of DNA treated with γ-irradiation and chemical carcinogens. Progress report, 1980-1983

    International Nuclear Information System (INIS)

    We have studied in vitro DNA repair with the isolation and characterization of DNA glycosylases active in the removable of 3-methyladenine and the problem of repair of DNA in chromatin. The second area of focus has been on transposable elements and carcinogen action. The work on DNA adducts with β-propiolactone was done to define potential new substrates useful in a search for new glycosylases

  15. DNA excision repair in cell extracts from human cell lines exhibiting hypersensitivity to DNA-damaging agents

    International Nuclear Information System (INIS)

    Whole cell extracts from human lymphoid cell lines can perform in vitro DNA repair synthesis in plasmids damaged by agents including UV or cis-diamminedichloroplatinum(II) (cis-DDP). Extracts from xeroderma pigmentosum (XP) cells are defective in repair synthesis. We have now studied in vitro DNA repair synthesis using extracts from lymphoblastoid cell lines representing four human hereditary syndromes with increased sensitivity to DNA-damaging agents. Extracts of cell lines from individuals with the sunlight-sensitive disorders dysplastic nevus syndrome or Cockayne's syndrome (complementation groups A and B) showed normal DNA repair synthesis in plasmids with UV photoproducts. This is consistent with in vivo measurements of the overall DNA repair capacity in such cell lines. A number of extracts were prepared from two cell lines representing the variant form of XP (XP-V). Half of the extracts prepared showed normal levels of in vitro DNA repair synthesis in plasmids containing UV lesions, but the remainder of the extracts from the same cell lines showed deficient repair synthesis, suggesting the possibility of an unusually labile excision repair protein in XP-V. Fanconi's anemia (FA) cells show cellular hypersensitivity to cross-linking agents including cis-DDP. Extracts from cell lines belonging to two different complementation groups of FA showed normal DNA repair synthesis in plasmids containing cis-DDP or UV adducts. Thus, there does not appear to be an overall excision repair defect in FA, but the data do not exclude a defect in the repair of interstrand DNA cross-links

  16. DNA-membrane complex restoration in Micrococcus radiodurans after X-irradiation: relation to repair, DNA synthesis and DNA degradation

    International Nuclear Information System (INIS)

    The DNA-membrane complex in Micrococcus radiodurans was shown to be essentially constituted of proteins, lipids and DNA. The complex was dissociated immediately after X-irradiation of cells and restored during post-incubation in complete medium. In X-irradiated protoplasts some DNA remained associated with the complex. Restoration of the complex during post-incubation was only seen in a medium favouring DNA polymerase and ligase activities. Under this condition no DNA synthesis occurred, suggesting that complex restoration may involve ligase activity. The complex restoration in the wild type and the X-ray sensitive mutant UV17 of M. radiodurans was strictly dependent on the X-ray dose. It was correlated with survival and DNA degradation but always preceded the onset of DNA synthesis after X-irradiation. At the same dose the complex restoration was about 2 fold lower in mutant than in wild type cells indicating that the restoration of the complex is related to repair capacity. The results are consistent with the idea that the complex protects X-irradiated DNA of M. radiodurans from further breakdown and, subsequently, permits DNA synthesis and repair to occur. (author)

  17. Repair of single-strand breaks induced in the DNA of Proteus mirabilis by excision repair after UV-irradiation

    International Nuclear Information System (INIS)

    Single-strand breaks have been produced in the DNA of P. mirabilis after UV-irradiation in dependence on the incident UV-doses. It has been found that there exists a discrepancy between the single-strand breaks estimated from sedimentation in alkaline sucrose gradients and the expected single-strand breaks approximated from measurements of dimer excision. The low number in incision breaks observed by sedimentation experiments is an indication that the cells are able to repair the excision-induced breaks as fast as they are formed. Toluenized cells have been used for investigation of the incision step independently of subsequent repair processes. In presence of NMN the appearance of more single-strand breaks in the DNA has been observed. Furthermore, the number of incision breaks in toluenized cells increased in presence of exogenous ATP. The completion of the excision repair process has been investigated by observing the rejoining of incision breaks. After irradiation with UV-doses higher than approximately 240 erg/mm2 the number of single-strand breaks remaining unrepaired in the DNA increased. Studies of the influence of nutrition conditions on the repair process have shown approximately the same capacity for repair of single-strand breaks in growth medium as well as in buffer. Progress in the excision repair was also followed by investigation of the DNA synthesized at the template-DNA containing the pyrimidine dimers. In comparison with E. coli, P. mirabilis showed a somewhat lower efficiency for the repair of single-strand breaks during the excision repair. (author)

  18. Cytoplasmic sequestration of an O6-methylguanine-DNA methyltransferase enhancer binding protein in DNA repair-deficient human cells

    OpenAIRE

    Frank Y. Chen; Harris, Linda C.; Joanna S Remack; Brent, Thomas P.

    1997-01-01

    O6-Methylguanine-DNA methyltransferase (MGMT), an enzyme that repairs adducts at O6 of guanine in DNA, is a major determinant of susceptibility to simple methylating carcinogens or of tumor response to anticancer chloroethylating drugs. To investigate the mechanisms underlying cellular expression of this DNA repair enzyme, we focused on the role of a 59-bp enhancer of the human MGMT gene in the regulation of its expression. By using chloramphenicol acetyltransferase reporter assays, we found ...

  19. MCM9 Is Required for Mammalian DNA Mismatch Repair.

    Science.gov (United States)

    Traver, Sabine; Coulombe, Philippe; Peiffer, Isabelle; Hutchins, James R A; Kitzmann, Magali; Latreille, Daniel; Méchali, Marcel

    2015-09-01

    DNA mismatch repair (MMR) is an evolutionarily conserved process that corrects DNA polymerase errors during replication to maintain genomic integrity. In E. coli, the DNA helicase UvrD is implicated in MMR, yet an analogous helicase activity has not been identified in eukaryotes. Here, we show that mammalian MCM9, a protein involved in replication and homologous recombination, forms a complex with MMR initiation proteins (MSH2, MSH3, MLH1, PMS1, and the clamp loader RFC) and is essential for MMR. Mcm9-/- cells display microsatellite instability and MMR deficiency. The MCM9 complex has a helicase activity that is required for efficient MMR since wild-type but not helicase-dead MCM9 restores MMR activity in Mcm9-/- cells. Moreover, MCM9 loading onto chromatin is MSH2-dependent, and in turn MCM9 stimulates the recruitment of MLH1 to chromatin. Our results reveal a role for MCM9 and its helicase activity in mammalian MMR. PMID:26300262

  20. DNA-damage foci to detect and characterize DNA repair alterations in children treated for pediatric malignancies.

    Directory of Open Access Journals (Sweden)

    Nadine Schuler

    Full Text Available PURPOSE: In children diagnosed with cancer, we evaluated the DNA damage foci approach to identify patients with double-strand break (DSB repair deficiencies, who may overreact to DNA-damaging radio- and chemotherapy. In one patient with Fanconi anemia (FA suffering relapsing squamous cell carcinomas of the oral cavity we also characterized the repair defect in biopsies of skin, mucosa and tumor. METHODS AND MATERIALS: In children with histologically confirmed tumors or leukemias and healthy control-children DSB repair was investigated by counting γH2AX-, 53BP1- and pATM-foci in blood lymphocytes at defined time points after ex-vivo irradiation. This DSB repair capacity was correlated with treatment-related normal-tissue responses. For the FA patient the defective repair was also characterized in tissue biopsies by analyzing DNA damage response proteins by light and electron microscopy. RESULTS: Between tumor-children and healthy control-children we observed significant differences in mean DSB repair capacity, suggesting that childhood cancer is based on genetic alterations affecting DNA repair. Only 1 out of 4 patients with grade-4 normal-tissue toxicities revealed an impaired DSB repair capacity. The defective DNA repair in FA patient was verified in irradiated blood lymphocytes as well as in non-irradiated mucosa and skin biopsies leading to an excessive accumulation of heterochromatin-associated DSBs in rapidly cycling cells. CONCLUSIONS: Analyzing human tissues we show that DSB repair alterations predispose to cancer formation at younger ages and affect the susceptibility to normal-tissue toxicities. DNA damage foci analysis of blood and tissue samples allows one to detect and characterize DSB repair deficiencies and enables identification of patients at risk for high-grade toxicities. However, not all treatment-associated normal-tissue toxicities can be explained by DSB repair deficiencies.

  1. Repair in E. coli of transforming plasmid DNA damaged by psoralen plus near-ultraviolet irradiation

    International Nuclear Information System (INIS)

    Treatment of DNA with psoralen plus near-ultraviolet irradiation gives rise to both monoadducts and cross-links. The authors have examined the repair of plasmid NTP16 DNA treated in this way in vitro and then used to transform E. coli. Monoadducts are found to be potentially lethal, and can be repaired by uvr-dependent and recA-dependent pathways. The presence of a related resident plasmid in the transformed cells can enhance the survival of the incoming damaged NTP16 DNA. This effect is not recA-dependent. Removal of unbound psoralen from the plasmid DNA and exposure to further NUV is known to increase the ratio of cross-links to monoadducts, and the authors demonstrate that such cross-linked plasmid DNA is not readily repaired following transformation. However in the presence of homologous DNA there is evidence for the repair, and hence uptake by the cell, of cross-linked DNA. (Auth.)

  2. DNA Repair Gene Polymorphisms May Be Associated with Prognosis of Upper Urinary Tract Transitional Cell Carcinoma

    OpenAIRE

    Miwa Sasaki; Shigeru Sakano; Naoko Okayama; Jumpei Akao; Tomohiko Hara; Yoshihisa Kawai; Chietaka Ohmi; Yuji Hinoda; Katsusuke Naito

    2008-01-01

    Upper urinary tract transitional cell carcinoma (UUT-TCC) is quite an uncommon disease, and its prognosis differs among individuals irrespective of tumor stage. DNA repair gene polymorphisms are reported to result in the modulation of the repair capacity and might influence the prognosis of UUT-TCC. We examined the associations between functional polymorphisms in five DNA repair genes, and the prognosis of UUT-TCC in 103 UUT-TCC patients. Variant alleles in xeroderma pigmentosum complementati...

  3. Tribute to dr louis keith: twin and physician extraordinaire/twin research reports: influences on asthma severity; chimerism revisited; DNA strand break repair/media reports: twins born apart; elevated twin frequencies; celebrity father of twins; conjoined twinning.

    Science.gov (United States)

    Segal, Nancy L

    2014-10-01

    The International Society for Twin Studies has lost a valued friend and colleague. Dr Louis Keith, Emeritus Professor of Obstetrics and Gynecology at Northwestern University, in Chicago, passed away on Sunday, July 6, 2014. His life and work with twins will be acknowledged at the November 2014 International Twin Congress in Budapest, Hungary. Next, twin research reports on the severity of asthma symptoms, a case of chimerism, and factors affecting DNA breakage and repair mechanisms are reviewed. Media reports cover twins born apart, elevated twin frequencies, a celebrity father of twins, and a family's decision to keep conjoined twins together. PMID:25213730

  4. Repair of radiation-induced DNA damage in nondividing populations of human diploid fibroblasts

    International Nuclear Information System (INIS)

    The occurrence of DNA repair in uv- (254 nm) and x-irradiated normal human diploid fibroblasts maintained in a quiescent, nondividing state using low serum (0.5%) medium was ascertained. Techniques that detect different steps of the excision repair process were used so that the extent of completion of repair at single sites could be determined. These included measuring the disappearance of pyrimidine dimers by chromatography, detecting repair synthesis by density-gradient and autoradiographic methods and detecting the rejoining of repaired regions and repair of x-ray-induced single-strand DNA breaks using alkaline sucrose gradients. Results show that dimer excision occurs and the subsequent steps of repair synthesis and ligation are completed. About 50% of the dimers formed by exposure to 20 J/m2 is excised in the initial 24-h post-uv period. DNA repair (unscheduled DNA synthesis) can be detected through a 5-d post-uv period. The fraction of damaged sites eventually repaired is not known. X-ray-induced single-strand DNA breaks are repaired rapidly

  5. Time effectiveness of DNA injury and its repair induced by irradiation using single cell gel electrophoresis

    International Nuclear Information System (INIS)

    Objective: To improve the accuracy of estimation of radiation biodosimetry after radiation accident, to explore the time-effect relationship of DNA repair after irradiation, and to describe the curves and plane of DNA repair. Methods: The neutral single cell gel electrophoresis (SCGE) was performed to estimate the repair of DNA double-strand break (DNA-DSB) in human lymphocytes induced by different dose of radiation at 3, 24, 48, 72 h post irradiation. Results: Better goodness of fit was obtained not only in the dose-response curves at different time points, but also in the time-response curves at different doses. A smooth three-dimensional plane model was obtained when combining the two curves. Conclusions: The curves of DNA-DSB repair showed a linear relationship, and repair of radiation-plane model could be used for biological dosimetry. (authors)

  6. Complex DNA repair pathways as possible therapeutic targets to overcome temozolomide resistance in glioblastoma

    Directory of Open Access Journals (Sweden)

    Koji eYoshimoto

    2012-12-01

    Full Text Available Many conventional chemotherapeutic drugs exert their cytotoxic function by inducing DNA damage in the tumor cell. Therefore, a cell-inherent DNA repair pathway, which reverses the DNA-damaging effect of the cytotoxic drugs, can mediate therapeutic resistance to chemotherapy. The monofunctional DNA-alkylating agent temozolomide (TMZ is a commonly used chemotherapeutic drug and the gold standard treatment for glioblastoma. Although the activity of DNA repair protein O6-methylguanine-DNA methyltransferase (MGMT has been described as the main modulator to determine the sensitivity of glioblastoma to TMZ, a subset of glioblastoma does not respond despite MGMT inactivation, suggesting that another DNA repair mechanism may also modulate the tolerance to TMZ. Considerable interest has focused on MGMT, mismatch repair (MMR, and the base-excision repair (BER pathway in the mechanism of mediating TMZ resistance, but emerging roles for the DNA strand-break repair pathway have been demonstrated. In the first part of this review article, we briefly review the significant role of MGMT, MMR, and the BER pathway in the tolerance to TMZ; in the last part, we review the recent publications that demonstrate possible roles of DNA strand-break repair pathways, such as single-strand break (SSB repair and double-strand break (DSB repair, as well as the Fanconi anemia pathway in the repair process after alkylating agent-based therapy. It is possible that all of these repair pathways have a potential to modulate the sensitivity to TMZ and aid in overcoming the therapeutic resistance in the clinic.

  7. UV-inducible DNA repair in the cyanobacteria Anabaena spp

    International Nuclear Information System (INIS)

    Strains of the filamentous cyanobacteria Anabaena spp. were capable of very efficient photoreactivation of UV irradiation-induced damage to DNA. Cells were resistant to several hundred joules of UV irradiation per square meter under conditions that allowed photoreactivation, and they also photoreactivated UV-damaged cyanophage efficiently. Reactivation of UV-irradiated cyanophage (Weigle reactivation) also occurred; UV irradiation of host cells greatly enhanced the plaque-forming ability of irradiated phage under nonphotoreactivating conditions. Postirradiation incubation of the host cells under conditions that allowed photoreactivation abolished the ability of the cells to perform Weigle reactivation of cyanophage N-1. Mitomycin C also induced Weigle reactivation of cyanophage N-1, but nalidixic acid did not. The inducible repair system (defined as the ability to perform Weigle reactivation of cyanophages) was relatively slow and inefficient compared with photoreactivation

  8. Crystal Structures of DNA-Whirly Complexes and Their Role in Arabidopsis Organelle Genome Repair

    Energy Technology Data Exchange (ETDEWEB)

    Cappadocia, Laurent; Maréchal, Alexandre; Parent, Jean-Sébastien; Lepage, Étienne; Sygusch, Jurgen; Brisson, Normand (Montreal)

    2010-09-07

    DNA double-strand breaks are highly detrimental to all organisms and need to be quickly and accurately repaired. Although several proteins are known to maintain plastid and mitochondrial genome stability in plants, little is known about the mechanisms of DNA repair in these organelles and the roles of specific proteins. Here, using ciprofloxacin as a DNA damaging agent specific to the organelles, we show that plastids and mitochondria can repair DNA double-strand breaks through an error-prone pathway similar to the microhomology-mediated break-induced replication observed in humans, yeast, and bacteria. This pathway is negatively regulated by the single-stranded DNA (ssDNA) binding proteins from the Whirly family, thus indicating that these proteins could contribute to the accurate repair of plant organelle genomes. To understand the role of Whirly proteins in this process, we solved the crystal structures of several Whirly-DNA complexes. These reveal a nonsequence-specific ssDNA binding mechanism in which DNA is stabilized between domains of adjacent subunits and rendered unavailable for duplex formation and/or protein interactions. Our results suggest a model in which the binding of Whirly proteins to ssDNA would favor accurate repair of DNA double-strand breaks over an error-prone microhomology-mediated break-induced replication repair pathway.

  9. PARP-1 and Ku compete for repair of DNA double strand breaks by distinct NHEJ pathways

    Science.gov (United States)

    Wang, Minli; Wu, Weizhong; Wu, Wenqi; Rosidi, Bustanur; Zhang, Lihua; Wang, Huichen; Iliakis, George

    2006-01-01

    Poly(ADP-ribose)polymerase 1 (PARP-1) recognizes DNA strand interruptions in vivo and triggers its own modification as well as that of other proteins by the sequential addition of ADP-ribose to form polymers. This modification causes a release of PARP-1 from DNA ends and initiates a variety of responses including DNA repair. While PARP-1 has been firmly implicated in base excision and single strand break repair, its role in the repair of DNA double strand breaks (DSBs) remains unclear. Here, we show that PARP-1, probably together with DNA ligase III, operates in an alternative pathway of non-homologous end joining (NHEJ) that functions as backup to the classical pathway of NHEJ that utilizes DNA-PKcs, Ku, DNA ligase IV, XRCC4, XLF/Cernunnos and Artemis. PARP-1 binds to DNA ends in direct competition with Ku. However, in irradiated cells the higher affinity of Ku for DSBs and an excessive number of other forms of competing DNA lesions limit its contribution to DSB repair. When essential components of the classical pathway of NHEJ are absent, PARP-1 is recruited for DSB repair, particularly in the absence of Ku and non-DSB lesions. This form of DSB repair is sensitive to PARP-1 inhibitors. The results define the function of PARP-1 in DSB repair and characterize a candidate pathway responsible for joining errors causing genomic instability and cancer. PMID:17088286

  10. PARP-1 and Ku compete for repair of DNA double strand breaks by distinct NHEJ pathways.

    Science.gov (United States)

    Wang, Minli; Wu, Weizhong; Wu, Wenqi; Rosidi, Bustanur; Zhang, Lihua; Wang, Huichen; Iliakis, George

    2006-01-01

    Poly(ADP-ribose)polymerase 1 (PARP-1) recognizes DNA strand interruptions in vivo and triggers its own modification as well as that of other proteins by the sequential addition of ADP-ribose to form polymers. This modification causes a release of PARP-1 from DNA ends and initiates a variety of responses including DNA repair. While PARP-1 has been firmly implicated in base excision and single strand break repair, its role in the repair of DNA double strand breaks (DSBs) remains unclear. Here, we show that PARP-1, probably together with DNA ligase III, operates in an alternative pathway of non-homologous end joining (NHEJ) that functions as backup to the classical pathway of NHEJ that utilizes DNA-PKcs, Ku, DNA ligase IV, XRCC4, XLF/Cernunnos and Artemis. PARP-1 binds to DNA ends in direct competition with Ku. However, in irradiated cells the higher affinity of Ku for DSBs and an excessive number of other forms of competing DNA lesions limit its contribution to DSB repair. When essential components of the classical pathway of NHEJ are absent, PARP-1 is recruited for DSB repair, particularly in the absence of Ku and non-DSB lesions. This form of DSB repair is sensitive to PARP-1 inhibitors. The results define the function of PARP-1 in DSB repair and characterize a candidate pathway responsible for joining errors causing genomic instability and cancer. PMID:17088286

  11. Genotoxicity of dichlorvos in strains of Drosophila melanogaster defective in DNA repair.

    Science.gov (United States)

    Mishra, Manish; Sharma, A; Shukla, A K; Kumar, R; Dwivedi, U N; Kar Chowdhuri, D

    2014-05-15

    Dichlorvos (DDVP), an organophosphate pesticide, is reported to be genotoxic at high concentrations. However, the roles of DNA damage repair pathways in DDVP genotoxicity are not well characterized. To test whether pre- and post-replication pathways are involved, we measured changes in DNA migration (Comet assay) in the midgut cells of Drosophila melanogaster Oregon R+ larvae and in some mutants of pre- (mei-9, mus201, and mus207) and post- (mei-41 and mus209)replication DNA repair pathways. Insects were exposed to environmentally relevant concentrations of DDVP (up to 15ng/ml) for 48h. After insect exposure to 0.15ng/ml DDVP, we observed greater DNA damage in pre-replication repair mutants; effects on Oregon R+ and post-replication repair mutants were insignificant. In contrast, significant DNA damage was observed in the post-replication repair mutants after their exposure to 1.5 and 15ng/ml DDVP. The pre-replication repair mutant mus207 showed maximum sensitivity to DDVP, suggestive of alkylation damage to DNA. We also examined mutants (SOD- and urate-null) that are sensitive to oxidative stress and the results indicate that significant oxidative DNA damage occurs in DDVP-exposed mutants. This study suggests involvement of both pre- and post-replication repair pathways against DDVP-induced DNA damage in Drosophila, with oxidative DNA damage leading to genotoxicity. PMID:24614193

  12. Understanding extreme resistance to DNA damage in D. radiodurans: genomic inputs and proteomic insights into extraordinary DNA repair

    International Nuclear Information System (INIS)

    Deinococcus radiodurans, a model extremophile, tolerates very high doses of virtually all DNA damaging agents such as ionizing radiations, UV, desiccation or mutagenic chemicals. It repairs its damaged DNA, from hundreds of fragments to intact chromosome, with absolute fidelity. Its genome displays acquisition of eukaryotic DNA repair pathways and deletion of universal prokaryotic DNA repair pathways, along with several ORFs that encode proteins with unusual domain combinations, expanded gene families and uncharacterized proteins. Yet, it is one of the most DNA repair efficient organism known today. To understand gamma radiation responsive global modifications in the proteome, respective proteome profiles were resolved by 2D electrophoresis and the gamma radiation responsive differentially expressed proteins were identified by MALDI mass spectrometry. Exposure to gamma irradiation set in immediate growth arrest, a phase during which the organism reassembles its shattered genome and recycles the radiation-damaged biomolecules. A proteomic investigation of this phase revealed highest up-regulation of DNA repair proteins involved in strand annealing, nucleotide excision repair, non-homologous end joining and homologous recombination pathways. Another set of differentially expressed proteins were metabolic enzymes that appeared to modulate metabolism to utilize stored glycogen and slow down amino acid biosynthesis. Oxidative stress alleviation machinery, which was constitutively present in abundance, displayed minor modulation. The gamma radiation responsive proteome modulations emphasize focused multi-factorial DNA repair and metabolic modulations, during post-irradiation recovery. (author)

  13. Approaches to diagnose DNA mismatch repair gene defects in cancer.

    Science.gov (United States)

    Peña-Diaz, Javier; Rasmussen, Lene Juel

    2016-02-01

    The DNA repair pathway mismatch repair (MMR) is responsible for the recognition and correction of DNA biosynthetic errors caused by inaccurate nucleotide incorporation during replication. Faulty MMR leads to failure to address the mispairs or insertion deletion loops (IDLs) left behind by the replicative polymerases and results in increased mutation load at the genome. The realization that defective MMR leads to a hypermutation phenotype and increased risk of tumorigenesis highlights the relevance of this pathway for human disease. The association of MMR defects with increased risk of cancer development was first observed in colorectal cancer patients that carried inactivating germline mutations in MMR genes and the disease was named as hereditary non-polyposis colorectal cancer (HNPCC). Currently, a growing list of cancers is found to be MMR defective and HNPCC has been renamed Lynch syndrome (LS) partly to include the associated risk of developing extra-colonic cancers. In addition, a number of non-hereditary, mostly epigenetic, alterations of MMR genes have been described in sporadic tumors. Besides conferring a strong cancer predisposition, genetic or epigenetic inactivation of MMR genes also renders cells resistant to some chemotherapeutic agents. Therefore, diagnosis of MMR deficiency has important implications for the management of the patients, the surveillance of their relatives in the case of LS and for the choice of treatment. Some of the alterations found in MMR genes have already been well defined and their pathogenicity assessed. Despite this substantial wealth of knowledge, the effects of a large number of alterations remain uncharacterized (variants of uncertain significance, VUSs). The advent of personalized genomics is likely to increase the list of VUSs found in MMR genes and anticipates the need of diagnostic tools for rapid assessment of their pathogenicity. This review describes current tools and future strategies for addressing the relevance

  14. Ultraviolet-induced DNA excision repair in human B and T lymphocytes. 3. Repair in lymphocyte from chronic lymphocytic leukaemia

    International Nuclear Information System (INIS)

    This study examined the capacity of lymphocytes from individuals with chronic lymphocytic leukaemia (CLL) to undertake ultraviolet (u.v.)-induced DNA repair in comparison to control and age-matched purified B and T lymphocytes. The technique was independent of incorporation of radioactive precursor, i.e. by the recovery of normal sedimentation behaviour of nucleoid bodies obtained from these cells by lysis in high salt and non-ionic detergent. Recovery of normal sedimentation was associated with restoration of DNA supercoiling. CLL cells were found to be as sensitive to u.v. and to repair at similar rates as age-matched B controls. They were considerably more sensitive than young B cells and repaired less efficiently. Reasons for previous reported discrepancies in CLL repair were discussed. (author)

  15. Toxicity DNA damage and inhibition of DNA repair synthesis in human melanoma cells by concentrated sunlight

    International Nuclear Information System (INIS)

    A water lens was used to focus solar radiation, giving an 8-fold concentration of the total spectrum and a cytocidal flux similar to that of laboratory UV sources. Survival curves for human melanoma cells were similar for sunlight and 254 nm UV. An xeroderma pigmentosum lymphoblastoid line was equally sensitive to both agents and human cell lines sensitive to ionizing radiation (lymphoblastoid lines), crosslinking agents or monofunctional alkylating agents (melanoma lines) had the same 254 nm UV and solar survival responses as appropriate control lines. Two melanoma sublines derived separately by 16 cycles of treatment with sunlight or 254 nm UV were crossresistant to both agents. In one melanoma cell line, DNA strand breaks and DNA protein crosslinking were induced in melanoma cells by sunlight but pyrimidine dimers and DNA interstrand crosslinking could not be detected. The solar fluence response of DNA repair synthesis was much less than that from equitoxic 254 nm UV, reaching a maximum near the D0 value and then declining; but semiconservative DNA synthesis remained high. These effects were not due to changes in thymidine pool sizes. Solar exposure did not have a major effect on 254 nm UV-induced repair synthesis. (author)

  16. DNA repair and the evolution of transformation in Bacillus subtilis. 3. Sex with damaged DNA

    International Nuclear Information System (INIS)

    Natural genetic transformation in the bacterium Bacillus subtilis provides an experimental system for studying the evolutionary function of sexual recombination. The repair hypothesis proposes that during transformation the exogenous DNA taken up by cells is used as template for recombinational repair of damages in the recipient cell's genome. Earlier results demonstrated that the population density of transformed cells (i.e., sexual cells) increases, relative to nontransformed cells (primarily asexual cells), with increasing dosage of ultraviolet irradiation, provided that the cells are transformed with undamaged homologous DNA after they have become damaged. In nature, however, donor DNA for transformation is likely to come from cells that are as damaged as the recipient cells. In order to better simulate the effects of transformation in natural populations we conducted similar experiments as those just described using damaged donor DNA. The authors document in this report that transformants continue to increase in relative density even if they are transformed with damaged donor DNA. These results suggest that sites of transformation are often damaged sites in the recipient cell's genome

  17. Ultraviolet light-resistant primary transfectants of xeroderma pigmentosum cells are also DNA repair-proficient

    International Nuclear Information System (INIS)

    In a previous work, an immortal xeroderma pigmentosum cell line belonging to complementation group C was complemented to a UV-resistant phenotype by transfection with a human cDNA clone library. We now report that the primary transformants selected for UV-resistance also acquired normal levels of DNA repair. This was assessed both by measurement of UV-induced [3H]thymidine incorporation and by equilibrium sedimentation analysis of repair-DNA synthesis. Therefore, the transduced DNA element which confers normal UV-resistance also corrects the excision repair defect of the xeroderma pigmentosum group C cell line

  18. PARP-1 and Ku compete for repair of DNA double strand breaks by distinct NHEJ pathways

    OpenAIRE

    Wang, Minli; Wu, Weizhong; Wu, Wenqi; Rosidi, Bustanur; Zhang, Lihua; Wang, Huichen; Iliakis, George

    2006-01-01

    Poly(ADP-ribose)polymerase 1 (PARP-1) recognizes DNA strand interruptions in vivo and triggers its own modification as well as that of other proteins by the sequential addition of ADP-ribose to form polymers. This modification causes a release of PARP-1 from DNA ends and initiates a variety of responses including DNA repair. While PARP-1 has been firmly implicated in base excision and single strand break repair, its role in the repair of DNA double strand breaks (DSBs) remains unclear. Here, ...

  19. DNA repair in bacterial cultures and plasmid DNA exposed to infrared laser for treatment of pain

    International Nuclear Information System (INIS)

    Biostimulation of tissues by low intensity lasers has been described on a photobiological basis and clinical protocols are recommended for treatment of various diseases, but their effects on DNA are controversial. The objective of this work was to evaluate effects of low intensity infrared laser exposure on survival and bacterial filamentation in Escherichia coli cultures, and induction of DNA lesions in bacterial plasmids. In E. coli cultures and plasmids exposed to an infrared laser at fluences used to treat pain, bacterial survival and filamentation and DNA lesions in plasmids were evaluated by electrophoretic profile. Data indicate that the infrared laser (i) increases survival of E. coli wild type in 24 h of stationary growth phase, (ii) induces bacterial filamentation, (iii) does not alter topological forms of plasmids and (iv) does not alter the electrophoretic profile of plasmids incubated with exonuclease III or formamidopyrimidine DNA glycosylase. A low intensity infrared laser at the therapeutic fluences used to treat pain can alter survival of E. coli wild type, induce filamentation in bacterial cells, depending on physiologic conditions and DNA repair, and induce DNA lesions other than single or double DNA strand breaks or alkali-labile sites, which are not targeted by exonuclease III or formamidopyrimidine DNA glycosylase. (letter)

  20. DNA repair in bacterial cultures and plasmid DNA exposed to infrared laser for treatment of pain

    Science.gov (United States)

    Canuto, K. S.; Sergio, L. P. S.; Marciano, R. S.; Guimarães, O. R.; Polignano, G. A. C.; Geller, M.; Paoli, F.; Fonseca, A. S.

    2013-06-01

    Biostimulation of tissues by low intensity lasers has been described on a photobiological basis and clinical protocols are recommended for treatment of various diseases, but their effects on DNA are controversial. The objective of this work was to evaluate effects of low intensity infrared laser exposure on survival and bacterial filamentation in Escherichia coli cultures, and induction of DNA lesions in bacterial plasmids. In E. coli cultures and plasmids exposed to an infrared laser at fluences used to treat pain, bacterial survival and filamentation and DNA lesions in plasmids were evaluated by electrophoretic profile. Data indicate that the infrared laser (i) increases survival of E. coli wild type in 24 h of stationary growth phase, (ii) induces bacterial filamentation, (iii) does not alter topological forms of plasmids and (iv) does not alter the electrophoretic profile of plasmids incubated with exonuclease III or formamidopyrimidine DNA glycosylase. A low intensity infrared laser at the therapeutic fluences used to treat pain can alter survival of E. coli wild type, induce filamentation in bacterial cells, depending on physiologic conditions and DNA repair, and induce DNA lesions other than single or double DNA strand breaks or alkali-labile sites, which are not targeted by exonuclease III or formamidopyrimidine DNA glycosylase.

  1. Carcinogen-induced DNA repair in nucleotide-permeable Escherichia coli cells. Induction of DNA repair by the carcinogens methyl and ethyl nitrosourea and methyl methanesulfonate.

    Science.gov (United States)

    Thielmann, H W; Vosberg, H P; Reygers, U

    1975-08-15

    Ether-permeabilized (nucleotide-permeable) cells of Escherichia coli show excision repair of their DNA after having been exposed to the carcinogens N-methyl-N-nitrosourea (MeNOUr), N-ethyl-N-nitrosourea (EtNOUr) and methyl methanesulfonate (MeSO2OMe) which are known to bind covalently to DNA. Defect mutations in genes uvrA, uvrB, uvrC, recA, recB, recC and rep did not inhibit this excision repair. Enzymic activities involved in this repair were identified by measuring size reduction of DNA, DNA degradation to acid-soluble nucleotides and repair polymerization. 1. In permeabilized cells methyl and ethyl nitrosourea induced endonucleolytic cleavage of endogenous DNA, as determined by size reduction of denatured DNA in neutral and alkaline sucrose gradients. An enzymic activity from E. coli K-12 cell extracts was purified (greater than 2000-fold) and was found to cleave preferentially methyl-nitrosourea-treated DNA and to convert the methylated supercoiled DNA duplex (RFI) of phage phiX 174 into the nicked circular form. 2. Degradation of alkylated cellular DNA to acid solubility was diminished in a mutant lacking the 5' leads to 3' exonucleolytic activity of DNA polymerase I but was not affected in a mutant which lacked the DNA polymerizing but retained the 5' leads 3' exonucleolytic activity of DNA polymerase I. 3. An easily measurable effect is carcinogen-induced repair polymerization, making it suitable for detection of covalent binding of carcinogens and potentially carcinogenic compounds. PMID:170107

  2. New Family of Deamination Repair Enzymes in Uracil-DNA Glycosylase Superfamily*

    OpenAIRE

    Lee, Hyun-Wook; Dominy, Brian N.; Cao, Weiguo

    2011-01-01

    DNA glycosylases play a major role in the repair of deaminated DNA damage. Previous investigations identified five families within the uracil-DNA glycosylase (UDG) superfamily. All enzymes within the superfamily studied thus far exhibit uracil-DNA glycosylase activity. Here we identify a new class of DNA glycosylases in the UDG superfamily that lacks UDG activity. Instead, these enzymes act as hypoxanthine-DNA glycosylases in vitro and in vivo. Molecular modeling and structure-guided mutation...

  3. Differential genetic interactions between Sgs1, DNA-damage checkpoint components and DNA repair factors in the maintenance of chromosome stability

    Directory of Open Access Journals (Sweden)

    Doerfler Lillian

    2011-10-01

    Full Text Available Abstract Background Genome instability is associated with human cancers and chromosome breakage syndromes, including Bloom's syndrome, caused by inactivation of BLM helicase. Numerous mutations that lead to genome instability are known, yet how they interact genetically is poorly understood. Results We show that spontaneous translocations that arise by nonallelic homologous recombination in DNA-damage-checkpoint-defective yeast lacking the BLM-related Sgs1 helicase (sgs1Δ mec3Δ are inhibited if cells lack Mec1/ATR kinase. Tel1/ATM, in contrast, acts as a suppressor independently of Mec3 and Sgs1. Translocations are also inhibited in cells lacking Dun1 kinase, but not in cells defective in a parallel checkpoint branch defined by Chk1 kinase. While we had previously shown that RAD51 deletion did not inhibit translocation formation, RAD59 deletion led to inhibition comparable to the rad52Δ mutation. A candidate screen of other DNA metabolic factors identified Exo1 as a strong suppressor of chromosomal rearrangements in the sgs1Δ mutant, becoming even more important for chromosomal stability upon MEC3 deletion. We determined that the C-terminal third of Exo1, harboring mismatch repair protein binding sites and phosphorylation sites, is dispensable for Exo1's roles in chromosomal rearrangement suppression, mutation avoidance and resistance to DNA-damaging agents. Conclusions Our findings suggest that translocations between related genes can form by Rad59-dependent, Rad51-independent homologous recombination, which is independently suppressed by Sgs1, Tel1, Mec3 and Exo1 but promoted by Dun1 and the telomerase-inhibitor Mec1. We propose a model for the functional interaction between mitotic recombination and the DNA-damage checkpoint in the suppression of chromosomal rearrangements in sgs1Δ cells.

  4. 1-β-D-arabinofuranosylcytosine is cytotoxic in quiescent normal lymphocytes undergoing DNA excision repair

    International Nuclear Information System (INIS)

    We have sought to clarify the potential activity of the S-phase-specific antileukemic agent 1-β-D-arabinofuranosylcytosine (ara-C), an inhibitor of DNA synthesis, in quiescent cells that are substantially non-sensitive to nucleoside analogues. It was hypothesized that the combination of ara-C with DNA damaging agents that initiate DNA repair will expand ara-C cytotoxicity to non-cycling cells. The repair kinetics, which included incision of damaged DNA, gap-filling by DNA synthesis and rejoining by ligation, were evaluated using the single cell gel electrophoresis (Comet) assay and the thymidine incorporation assay. When normal lymphocytes were treated with ultraviolet C or with 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU), the processes of DNA excision repair were promptly initiated and rapidly completed. When the cells were incubated with ara-C prior to irradiation or BCNU treatment, the steps of DNA synthesis and rejoining in the repair processes were both inhibited. The ara-C-mediated inhibition of the repair processes was concentration-dependent, with the effect peaking at 10μM. The combination of ara-C with these DNA repair initiators exerted subsequent cytotoxicity, which was proportional to the extent of the repair inhibition in the presence of ara-C. In conclusion, ara-C was cytotoxic in quiescent cells undergoing DNA repair. This might be attributed to unrepaired DNA damage that remained in the cells, thereby inducing lethal cytotoxicity. Alternatively, ara-C might exert its own cytotoxicity by inhibiting DNA synthesis in the repair processes. Such a strategy may be effective against a dormant subpopulation in acute leukemia that survives chemotherapy. (author)

  5. Bulge, Bubble, and Y: How a RNA Exonuclease Repairs DNA, in Detail

    OpenAIRE

    Yu-Yuan Hsiao; Woei-Horng Fang; Chia-Chia Lee; Yi-Ping Chen; Yuan, Hanna S.

    2014-01-01

    DNA repair mechanisms are essential for preservation of genome integrity. However, it is not clear how DNA are selected and processed at broken ends by exonucleases during repair pathways. Here we show that the DnaQ-like exonuclease RNase T is critical for Escherichia coli resistance to various DNA-damaging agents and UV radiation. RNase T specifically trims the 3' end of structured DNA, including bulge, bubble, and Y-structured DNA, and it can work with Endonuclease V to restore the deaminat...

  6. Trypanosoma cruzi contains a single detectable uracil-DNA glycosylase and repairs uracil exclusively via short patch base excision repair

    DEFF Research Database (Denmark)

    Pena Diaz, Javier; Akbari, Mansour; Sundheim, Ottar; Farez-Vidal, M Esther; Andersen, Sonja; Sneve, Ragnhild; Gonzalez-Pacanowska, Dolores; Krokan, Hans E; Slupphaug, Geir

    2004-01-01

    Enzymes involved in genomic maintenance of human parasites are attractive targets for parasite-specific drugs. The parasitic protozoan Trypanosoma cruzi contains at least two enzymes involved in the protection against potentially mutagenic uracil, a deoxyuridine triphosphate nucleotidohydrolase (d......UTPase) and a uracil-DNA glycosylase belonging to the highly conserved UNG-family. Uracil-DNA glycosylase activities excise uracil from DNA and initiate a multistep base-excision repair (BER) pathway to restore the correct nucleotide sequence. Here we report the biochemical characterisation of T.cruzi UNG (Tc......UNG) and its contribution to the total uracil repair activity in T.cruzi. TcUNG is shown to be the major uracil-DNA glycosylase in T.cruzi. The purified recombinant TcUNG exhibits substrate preference for removal of uracil in the order ssU>U:G>U:A, and has no associated thymine-DNA glycosylase activity. T.cruzi...

  7. DNA damage induced by boron neutron capture therapy is partially repaired by DNA ligase IV.

    Science.gov (United States)

    Kondo, Natsuko; Sakurai, Yoshinori; Hirota, Yuki; Tanaka, Hiroki; Watanabe, Tsubasa; Nakagawa, Yosuke; Narabayashi, Masaru; Kinashi, Yuko; Miyatake, Shin-ichi; Hasegawa, Masatoshi; Suzuki, Minoru; Masunaga, Shin-ichiro; Ohnishi, Takeo; Ono, Koji

    2016-03-01

    Boron neutron capture therapy (BNCT) is a particle radiation therapy that involves the use of a thermal or epithermal neutron beam in combination with a boron ((10)B)-containing compound that specifically accumulates in tumor. (10)B captures neutrons and the resultant fission reaction produces an alpha ((4)He) particle and a recoiled lithium nucleus ((7)Li). These particles have the characteristics of high linear energy transfer (LET) radiation and therefore have marked biological effects. High-LET radiation is a potent inducer of DNA damage, specifically of DNA double-strand breaks (DSBs). The aim of the present study was to clarify the role of DNA ligase IV, a key player in the non-homologous end-joining repair pathway, in the repair of BNCT-induced DSBs. We analyzed the cellular sensitivity of the mouse embryonic fibroblast cell lines Lig4-/- p53-/- and Lig4+/+ p53-/- to irradiation using a thermal neutron beam in the presence or absence of (10)B-para-boronophenylalanine (BPA). The Lig4-/- p53-/- cell line had a higher sensitivity than the Lig4+/+ p53-/-cell line to irradiation with the beam alone or the beam in combination with BPA. In BNCT (with BPA), both cell lines exhibited a reduction of the 50 % survival dose (D 50) by a factor of 1.4 compared with gamma-ray and neutron mixed beam (without BPA). Although it was found that (10)B uptake was higher in the Lig4+/+ p53-/- than in the Lig4-/- p53-/- cell line, the latter showed higher sensitivity than the former, even when compared at an equivalent (10)B concentration. These results indicate that BNCT-induced DNA damage is partially repaired using DNA ligase IV. PMID:26573366

  8. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    International Nuclear Information System (INIS)

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [32P]-based oligonucleotide cleavage assay (MPG substrate 5′-CCGCTεAGCGGGTACCGAGCTCGAAT; εA = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 ± 1.67 fmol/μg DNA/h vs 3.47 ± 1.35 fmol/μg DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16–7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  9. Life forms employ different repair strategies of repair single- and double strand DNA breaks caused by different qualities of radiation: criticality of RecA mediated repair system

    International Nuclear Information System (INIS)

    Different qualities of radiation, either through direct or indirect pathway, induce qualitative different spectrum of damages in DNA, which are also different in in vitro and in vivo systems. The single- and double strand breaks of DNA are of special interest as they lead to serious biological consequences. The implications of such damage to DNA and their processing by various inherent repair pathways together decide the fate of the living form

  10. Inhibition of poly(ADP-ribose)polymerase-1 and DNA repair by uranium.

    Science.gov (United States)

    Cooper, Karen L; Dashner, Erica J; Tsosie, Ranalda; Cho, Young Mi; Lewis, Johnnye; Hudson, Laurie G

    2016-01-15

    Uranium has radiological and non-radiological effects within biological systems and there is increasing evidence for genotoxic and carcinogenic properties attributable to uranium through its heavy metal properties. In this study, we report that low concentrations of uranium (as uranyl acetate; Xeroderma Pigmentosum, Complementation Group A (XPA) and aprataxin (APTX). In keeping with the observed inhibition of zinc finger function of DNA repair proteins, exposure to uranyl acetate enhanced retention of induced DNA damage. Co-incubation of uranyl acetate with zinc largely overcame the impact of uranium on PARP-1 activity and DNA damage. These findings present evidence that low concentrations of uranium can inhibit DNA repair through disruption of zinc finger domains of specific target DNA repair proteins. This may provide a mechanistic basis to account for the published observations that uranium exposure is associated with DNA repair deficiency in exposed human populations. PMID:26627003

  11. Alkaline gel electrophoresis assay to detect DNA strand breaks and repair mechanisms in Escherichia coli

    International Nuclear Information System (INIS)

    Reactive oxygen species (ROS) can induce lesions in different cellular targets, including DNA. Stannous chloride (SnCl2) is a ROS generator, leading to lethality in Escherichia coli (E. coli), with the base excision repair (BER) mechanism playing a role in this process. Many techniques have been developed to detect genotoxicity, as comet assay, in eukaryotic cells, and plasmid DNA agarose gel electrophoresis. In this study, an adaptation of the alkaline gel electrophoresis method was carried out to ascertain the induction of strand breaks by SnCl2 in bacterial DNA, from E. coli BER mutants, and its repair pathway. Results obtained show that SnCl2 was able to induce DNA strand breaks in all strains tested. Moreover, endonuclease IV and exonuclease III play a role in DNA repair. On the whole, data has shown that the alkaline gel electrophoresis assay could be used both for studying DNA strand breaks induction and for associated repair mechanisms. (author)

  12. PARP-1: Friend or Foe of DNA Damage and Repair in Tumorigenesis?

    Energy Technology Data Exchange (ETDEWEB)

    Swindall, Amanda F.; Stanley, Jennifer A. [Department of Radiation Oncology Comprehensive Cancer Center, University of Alabama at Birmingham School of Medicine, 176F HSROC Suite 2232B, 1700 6th Avenue South, Birmingham, AL 35249 (United States); Yang, Eddy S., E-mail: eyang@uab.edu [Department of Radiation Oncology Comprehensive Cancer Center, University of Alabama at Birmingham School of Medicine, 176F HSROC Suite 2232B, 1700 6th Avenue South, Birmingham, AL 35249 (United States); Department of Cell, Developmental and Integrative Biology, University of Alabama at Birmingham, Birmingham, AL 35249 (United States); Department of Pharmacology and Toxicology, University of Alabama at Birmingham, Birmingham, AL 35249 (United States)

    2013-07-26

    Oxidative stress induced by reactive oxygen species can result in DNA damage within cells and subsequently increase risk for carcinogenesis. This may be averted by repair of DNA damage through the base or nucleotide excision repair (BER/NER) pathways. PARP, a BER protein, is known for its role in DNA-repair. However, multiple lesions can occur within a small range of DNA, known as oxidative clustered DNA lesions (OCDLs), which are difficult to repair and may lead to the more severe DNA double-strand break (DSB). Inefficient DSB repair can then result in increased mutagenesis and neoplastic transformation. OCDLs occur more frequently within a variety of tumor tissues. Interestingly, PARP is highly expressed in several human cancers. Additionally, chronic inflammation may contribute to tumorigenesis through ROS-induced DNA damage. Furthermore, PARP can modulate inflammation through interaction with NFκB and regulating the expression of inflammatory signaling molecules. Thus, the upregulation of PARP may present a double-edged sword. PARP is needed to repair ROS-induced DNA lesions, but PARP expression may lead to increased inflammation via upregulation of NFκB signaling. Here, we discuss the role of PARP in the repair of oxidative damage versus the formation of OCDLs and speculate on the feasibility of PARP inhibition for the treatment and prevention of cancers by exploiting its role in inflammation.

  13. PARP-1: Friend or Foe of DNA Damage and Repair in Tumorigenesis?

    International Nuclear Information System (INIS)

    Oxidative stress induced by reactive oxygen species can result in DNA damage within cells and subsequently increase risk for carcinogenesis. This may be averted by repair of DNA damage through the base or nucleotide excision repair (BER/NER) pathways. PARP, a BER protein, is known for its role in DNA-repair. However, multiple lesions can occur within a small range of DNA, known as oxidative clustered DNA lesions (OCDLs), which are difficult to repair and may lead to the more severe DNA double-strand break (DSB). Inefficient DSB repair can then result in increased mutagenesis and neoplastic transformation. OCDLs occur more frequently within a variety of tumor tissues. Interestingly, PARP is highly expressed in several human cancers. Additionally, chronic inflammation may contribute to tumorigenesis through ROS-induced DNA damage. Furthermore, PARP can modulate inflammation through interaction with NFκB and regulating the expression of inflammatory signaling molecules. Thus, the upregulation of PARP may present a double-edged sword. PARP is needed to repair ROS-induced DNA lesions, but PARP expression may lead to increased inflammation via upregulation of NFκB signaling. Here, we discuss the role of PARP in the repair of oxidative damage versus the formation of OCDLs and speculate on the feasibility of PARP inhibition for the treatment and prevention of cancers by exploiting its role in inflammation

  14. PARP-1: Friend or Foe of DNA Damage and Repair in Tumorigenesis?

    Directory of Open Access Journals (Sweden)

    Eddy S. Yang

    2013-07-01

    Full Text Available Oxidative stress induced by reactive oxygen species can result in DNA damage within cells and subsequently increase risk for carcinogenesis. This may be averted by repair of DNA damage through the base or nucleotide excision repair (BER/NER pathways. PARP, a BER protein, is known for its role in DNA-repair. However, multiple lesions can occur within a small range of DNA, known as oxidative clustered DNA lesions (OCDLs, which are difficult to repair and may lead to the more severe DNA double-strand break (DSB. Inefficient DSB repair can then result in increased mutagenesis and neoplastic transformation. OCDLs occur more frequently within a variety of tumor tissues. Interestingly, PARP is highly expressed in several human cancers. Additionally, chronic inflammation may contribute to tumorigenesis through ROS-induced DNA damage. Furthermore, PARP can modulate inflammation through interaction with NFκB and regulating the expression of inflammatory signaling molecules. Thus, the upregulation of PARP may present a double-edged sword. PARP is needed to repair ROS-induced DNA lesions, but PARP expression may lead to increased inflammation via upregulation of NFκB signaling. Here, we discuss the role of PARP in the repair of oxidative damage versus the formation of OCDLs and speculate on the feasibility of PARP inhibition for the treatment and prevention of cancers by exploiting its role in inflammation.

  15. New tools to study DNA double-strand break repair pathway choice.

    Directory of Open Access Journals (Sweden)

    Daniel Gomez-Cabello

    Full Text Available A broken DNA molecule is difficult to repair, highly mutagenic, and extremely cytotoxic. Such breaks can be repaired by homology-independent or homology-directed mechanisms. Little is known about the network that controls the repair pathway choice except that a licensing step for homology-mediated repair exists, called DNA-end resection. The choice between these two repair pathways is a key event for genomic stability maintenance, and an imbalance of the ratio is directly linked with human diseases, including cancer. Here we present novel reporters to study the balance between both repair options in human cells. In these systems, a double-strand break can be alternatively repaired by homology-independent or -dependent mechanisms, leading to the accumulation of distinct fluorescent proteins. These reporters thus allow the balance between both repair pathways to be analyzed in different experimental setups. We validated the reporters by analyzing the effect of protein downregulation of the DNA end resection and non-homologous end-joining pathways. Finally, we analyzed the role of the DNA damage response on double-strand break (DSB repair mechanism selection. Our reporters could be used in the future to understand the roles of specific factors, whole pathways, or drugs in DSB repair pathway choice, or for genome-wide screening. Moreover, our findings can be applied to increase gene-targeting efficiency, making it a beneficial tool for a broad audience in the biological sciences.

  16. SIRT6 stabilizes DNA-dependent protein kinase at chromatin for DNA double-strand break repair

    DEFF Research Database (Denmark)

    McCord, Ronald A; Michishita, Eriko; Hong, Tao;

    2009-01-01

    -dependent protein kinase) and promotes DNA DSB repair. In response to DSBs, SIRT6 associates dynamically with chromatin and is necessary for an acute decrease in global cellular acetylation levels on histone H3 Lysine 9. Moreover, SIRT6 is required for mobilization of the DNA-PK catalytic subunit (DNA-PKcs) to...

  17. Suppression of DNA-dependent protein kinase sensitize cells to radiation without affecting DSB repair

    Energy Technology Data Exchange (ETDEWEB)

    Gustafsson, Ann-Sofie, E-mail: ann-sofie.gustafsson@bms.uu.se; Abramenkovs, Andris; Stenerlöw, Bo

    2014-11-15

    Highlights: • We reduced the level of DNA-PKcs with siRNA and examined cells after γ-irradiation. • Low DNA-PKcs levels lead to radiosensitivity but did not affect repair of DSB. • Low DNA-PKcs levels may block progression of mitosis. • DNA-PKcs role in mitotic progression is independent of its role in DSB repair. • We suggest different mechanisms by which loss of DNA-PKcs function sensitize cells. - Abstract: Efficient and correct repair of DNA double-strand break (DSB) is critical for cell survival. Defects in the DNA repair may lead to cell death, genomic instability and development of cancer. The catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) is an essential component of the non-homologous end joining (NHEJ) which is the major DSB repair pathway in mammalian cells. In the present study, by using siRNA against DNA-PKcs in four human cell lines, we examined how low levels of DNA-PKcs affected cellular response to ionizing radiation. Decrease of DNA-PKcs levels by 80–95%, induced by siRNA treatment, lead to extreme radiosensitivity, similar to that seen in cells completely lacking DNA-PKcs and low levels of DNA-PKcs promoted cell accumulation in G2/M phase after irradiation and blocked progression of mitosis. Surprisingly, low levels of DNA-PKcs did not affect the repair capacity and the removal of 53BP1 or γ-H2AX foci and rejoining of DSB appeared normal. This was in strong contrast to cells completely lacking DNA-PKcs and cells treated with the DNA-PKcs inhibitor NU7441, in which DSB repair were severely compromised. This suggests that there are different mechanisms by which loss of DNA-PKcs functions can sensitize cells to ionizing radiation. Further, foci of phosphorylated DNA-PKcs (T2609 and S2056) co-localized with DSB and this was independent of the amount of DNA-PKcs but foci of DNA-PKcs was only seen in siRNA-treated cells. Our study emphasizes on the critical role of DNA-PKcs for maintaining survival after radiation exposure

  18. DNA repair of UV photoproducts and mutagenesis in human mitochondrial DNA

    International Nuclear Information System (INIS)

    The induction and repair of DNA photolesions and mutations in the mitochondrial (mt) DNA of human cells in culture were analysed after cell exposure to UV-C light. The level of induction of cyclobutane pyrimidine dimers (CPD) in mitochondrial and nuclear DNA was comparable, while a higher frequency of pyrimidine (6-4) pyrimidone photoproducts (6-4 PP) was detected in mitochondrial than in nuclear DNA. Besides the known defect in CPD removal, mitochondria were shown to be deficient also in the excision of 6-4 PP. The effects of repair-defective conditions for the two major UV photolesions on mutagensis was assessed by analysing the frequency and spectrum of spontaneous and UV-induced mutations by restriction site mutation (RSM) method in a restriction endonuclease site, NciI (5'CCCGG3') located within the coding sequence of the mitochondrial gene for tRNA Leu. The spontaneous mutation frequency and spectrum at the NciI site of mitochondrial DNA was very similar to the RSM background mutation frequency (approximately 10-5) and type (predominantly GC > AT transitions at GL1) of the NciI site). Conversely, an approximately tenfold increase over background mutation frequency was recorded after cell exposure to 20 J/m2. In this case, the majority of mutations were C > T transitions preferentially located on the non-transcribed DNA strand at C1 and C2 of the NciI site. This mutation spectrum is expected by UV mutagenesis. This is the first evidence of induction of mutations in mitochondrial DNA by treatment of human cells with a carcinogen. (author)

  19. Normal formation and repair of γ-radiation-induced single and double strand DNA breaks in Down syndrome fibroblasts

    International Nuclear Information System (INIS)

    Fibroblasts from patients with Down syndrome (Trisomy 21) were examined for repair capability of γ-radiation-induced single strand and double strand DNA breaks. Formation and repair of DNA breaks were determined by DNA alkaline and non-denaturing elution techniques. Down syndrome fibroblasts were found to repair single strand and double strand breaks as well as fibroblasts from normal controls. (orig.)

  20. 53BP1 mediates productive and mutagenic DNA repair through distinct phosphoprotein interactions

    DEFF Research Database (Denmark)

    Callen, E.; Wong, N.; Chen, H.-T.;

    2013-01-01

    The DNA damage response (DDR) protein 53BP1 protects DNA ends from excessive resection in G1, and thereby favors repair by nonhomologous end-joining (NHEJ) as opposed to homologous recombination (HR). During S phase, BRCA1 antagonizes 53BP1 to promote HR. The pro-NHEJ and antirecombinase functions...... productive CSR and suppresses mutagenic DNA repair through distinct phosphodependent interactions with RIF1 and PTIP. © 2013 Elsevier Inc....

  1. Formaldehyde catabolism is essential in cells deficient for the Fanconi anemia DNA-repair pathway.

    Science.gov (United States)

    Rosado, Ivan V; Langevin, Frédéric; Crossan, Gerry P; Takata, Minoru; Patel, Ketan J

    2011-12-01

    Metabolism is predicted to generate formaldehyde, a toxic, simple, reactive aldehyde that can damage DNA. Here we report a synthetic lethal interaction in avian cells between ADH5, encoding the main formaldehyde-detoxifying enzyme, and the Fanconi anemia (FA) DNA-repair pathway. These results define a fundamental role for the combined action of formaldehyde catabolism and DNA cross-link repair in vertebrate cell survival. PMID:22081012

  2. The role of DNA base excision repair in brain homeostasis and disease

    DEFF Research Database (Denmark)

    Akbari, Mansour; Morevati, Marya; Croteau, Deborah;

    2015-01-01

    Chemical modification and spontaneous loss of nucleotide bases from DNA are estimated to occur at the rate of thousands per human cell per day. DNA base excision repair (BER) is a critical mechanism for repairing such lesions in nuclear and mitochondrial DNA. Defective expression or function of p...... energy homeostasis, mitochondrial function and cellular bioenergetics, with especially strong influence on neurological function. Further studies in this area could lead to novel approaches to prevent and treat human neurodegenerative disease....

  3. Responding to chromosomal breakage during M-phase: insights from a cell-free system

    Directory of Open Access Journals (Sweden)

    Costanzo Vincenzo

    2009-07-01

    Full Text Available Abstract DNA double strand breaks (DSBs activate ATM and ATR dependent checkpoints that prevent the onset of mitosis. However, how cells react to DSBs occurring when they are already in mitosis is poorly understood. The Xenopus egg extract has been utilized to study cell cycle progression and DNA damage checkpoints. Recently this system has been successfully used to uncover an ATM and ATR dependent checkpoint affecting centrosome driven spindle assembly. These studies have led to the identification of XCEP63 as major target of this pathway. XCEP63 is a coiled-coil rich protein localized at centrosome essential for proper spindle assembly. ATM and ATR directly phosphorylate XCEP63 on serine 560 inducing its delocalization from centrosome, which in turn delays spindle assembly. This pathway might contribute to regulate DNA repair or mitotic cell survival in the presence of chromosome breakage.

  4. 1999 Gordon Research Conference on Mammalian DNA Repair. Final Progress Report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-02-12

    This Conference will examine DNA repair as the key component in genomic surveillance that is so crucial to the overall integrity and function of mammalian cells. Recent discoveries have catapulted the field of DNA repair into a pivotal position for fundamental investigations into oncology, aging, environmental health, and developmental biology. We hope to highlight the most promising and exciting avenues of research in robust discussions at this conference. This Mammalian DNA Repair Gordon Conference differs from the past conferences in this series, in which the programs were broader in scope, with respect to topics and biological systems covered. A conference sponsored by the Genetics Society in April 1998 emphasized recombinational mechanisms for double-strand break repair and the role of mismatch repair deficiency in colorectal cancer. These topics will therefore receive somewhat less emphasis in the upcoming Conference. In view of the recent mechanistic advances in mammalian DNA repair, an upcoming comprehensive DNA repair meeting next autumn at Hilton Head; and the limited enrollment for Gordon Conferences we have decided to focus session-by-session on particular areas of controversy and/or new developments specifically in mammalian systems. Thus, the principal presentations will draw upon results from other cellular systems only to the extent that they impact our understanding of mammalian DNA repair.

  5. The 2015 Nobel Prize in Chemistry The Discovery of Essential Mechanisms that Repair DNA Damage.

    Science.gov (United States)

    Lindahl, Tomas; Modrich, Paul; Sancar, Aziz

    2016-01-01

    The Royal Swedish Academy awarded the Nobel Prize in Chemistry for 2015 to Tomas Lindahl, Paul Modrich and Aziz Sancar for their discoveries in fundamental mechanisms of DNA repair. This pioneering research described three different essential pathways that correct DNA damage, safeguard the integrity of the genetic code to ensure its accurate replication through generations, and allow proper cell division. Working independently of each other, Tomas Lindahl, Paul Modrich and Aziz Sancar delineated the mechanisms of base excision repair, mismatch repair and nucleotide excision repair, respectively. These breakthroughs challenged and dismissed the early view that the DNA molecule was very stable, paving the way for the discovery of human hereditary diseases associated with distinct DNA repair deficiencies and a susceptibility to cancer. It also brought a deeper understanding of cancer as well as neurodegenerative or neurological diseases, and let to novel strategies to treat cancer. PMID:27183258

  6. Cell-free assay measuring repair DNA synthesis in human fibroblasts

    International Nuclear Information System (INIS)

    Osmotic disruption of confluent cultured human fibroblasts that have been irradiated or exposed to chemical carcinogens allows the specific measurement of repair DNA synthesis using dTTP as a precursor. Fibroblasts similarly prepared from various xeroderma pigmentosum cell lines show the deficiencies of uv-induced DNA synthesis predicted from in vivo studies, while giving normal responses to methylmethanesulfonate. A pyrimidine-dimer-specific enzyme, T4 endonuclease V, stimulated the rate of uv-induced repair synthesis with normal and xeroderma pigmentosum cell lines. This system should prove useful for identifying agents that induce DNA repair, and cells that respond abnormally to such induction. It should also be applicable to an in vitro complementation assay with repair-defective cells and proteins obtained from repair-proficient cells. Finally, by using actively growing fibroblasts and thymidine in the system, DNA replication can be measured and studied in vitro

  7. Microhomology-mediated end joining is the principal mediator of double-strand break repair during mitochondrial DNA lesions

    OpenAIRE

    Tadi, Satish Kumar; Sebastian, Robin; Dahal, Sumedha; Babu, Ravi K.; Choudhary, Bibha; Raghavan, Sathees C.

    2016-01-01

    Mitochondrial DNA (mtDNA) deletions are associated with various mitochondrial disorders. The deletions identified in humans are flanked by short, directly repeated mitochondrial DNA sequences; however, the mechanism of such DNA rearrangements has yet to be elucidated. In contrast to nuclear DNA (nDNA), mtDNA is more exposed to oxidative damage, which may result in double-strand breaks (DSBs). Although DSB repair in nDNA is well studied, repair mechanisms in mitochondria are not characterized....

  8. FEN1 participates in repair of the 5'-phosphotyrosyl terminus of DNA single-strand breaks.

    Science.gov (United States)

    Kametani, Yukiko; Takahata, Chiaki; Narita, Takashi; Tanaka, Kiyoji; Iwai, Shigenori; Kuraoka, Isao

    2016-01-01

    Etoposide is a widely used anticancer drug and a DNA topoisomerase II (Top2) inhibitor. Etoposide produces Top2-attached single-strand breaks (Top2-SSB complex) and double-strand breaks (Top2-DSB complex) that are thought to induce cell death in tumor cells. The Top2-SSB complex is more abundant than the Top2-DSB complex. Human tyrosyl-DNA phosphodiesterase 2 (TDP2) is required for efficient repair of Top2-DSB complexes. However, the identities of the proteins involved in the repair of Top2-SSB complexes are unknown, although yeast genetic data indicate that 5' to 3' structure-specific DNA endonuclease activity is required for alternative repair of Top2 DNA damage. In this study, we purified a flap endonuclease 1 (FEN1) and xeroderma pigmentosum group G protein (XPG) in the 5' to 3' structure-specific DNA endonuclease family and synthesized single-strand break DNA substrates containing a 5'-phoshotyrosyl bond, mimicking the Top2-SSB complex. We found that FEN1 and XPG did not remove the 5'-phoshotyrosyl bond-containing DSB substrates but removed the 5'-phoshotyrosyl bond-containing SSB substrates. Under DNA repair conditions, FEN1 efficiently repaired the 5'-phoshotyrosyl bond-containing SSB substrates in the presence of DNA ligase and DNA polymerase. Therefore, FEN1 may play an important role in the repair of Top2-SSB complexes in etoposide-treated cells. PMID:26581212

  9. Cetuximab Induces Eme1-Mediated DNA Repair: a Novel Mechanism for Cetuximab Resistance

    Directory of Open Access Journals (Sweden)

    Agnieszka Weinandy

    2014-03-01

    Full Text Available Overexpression of the epidermal growth factor receptor (EGFR is observed in a large number of neoplasms. The monoclonal antibody cetuximab/Erbitux is frequently applied to treat EGFR-expressing tumors. However, the application of cetuximab alone or in combination with radio- and/or chemotherapy often yields only little benefit for patients. In the present study, we describe a mechanism that explains resistance of both tumor cell lines and cultured primary human glioma cells to cetuximab. Treatment of these cells with cetuximab promoted DNA synthesis in the absence of increased proliferation, suggesting that DNA repair pathways were activated. Indeed, we observed that cetuximab promoted the activation of the DNA damage response pathway and prevented the degradation of essential meiotic endonuclease 1 homolog 1 (Eme1, a heterodimeric endonuclease involved in DNA repair. The increased levels of Eme1 were necessary for enhanced DNA repair, and the knockdown of Eme1 was sufficient to prevent efficient DNA repair in response to ultraviolet-C light or megavoltage irradiation. These treatments reduced the survival of tumor cells, an effect that was reversed by cetuximab application. Again, this protection was dependent on Eme1. Taken together, these results suggest that cetuximab initiates pathways that result in the stabilization of Eme1, thereby resulting in enhanced DNA repair. Accordingly, cetuximab enhances DNA repair, reducing the effectiveness of DNA-damaging therapies. This aspect should be considered when using cetuximab as an antitumor agent and suggests that Eme1 is a negative predictive marker.

  10. Computational studies of radiation and oxidative damage to DNA and its recognition by repair enzyme

    International Nuclear Information System (INIS)

    Molecular dynamics (MD) simulation is used to study the time evolution of the recognition processes and to construct a model of the specific DNA-repair enzyme' complexes. MD simulations of the following molecules were performed: DNA dodecamer with thymine dimer (TD), DNA 30-mer with thymine glycol (TG), and respective specific repair enzymes T4 Endonuclease V and Endonuclease III. Both DNA lesions are experimentally suggested to be mutagenic and carcinogenic unless properly recognized and repaired by repair enzymes. In the case of TD, there is detected a strong kink around the TD site, that is not observed in native DNA. In addition there is observed a different value of electrostatic energy at the TD site - negative '-9 kcal/mol', in contrast to the nearly neutral value of the native thymine site. These two factors - structural changes and specific electrostatic energy - seem to be important for proper recognition of a TD damaged site and for formation of DNA-enzyme complex. Formation of this complex is the onset of the repair of DNA. In the case of TG damaged DNA the structural characteristics of the TG were calculated (charges, bond lengths, bond angles, etc.). The formed TG was used to replace the native thymine and then submitted to the simulation in the system with a repair enzyme with Endonuclease III for the purpose of the study of the formation of the DNA-enzyme complex. (author)

  11. Thermal breakage of a semiflexible polymer: breakage profile and rate

    International Nuclear Information System (INIS)

    Understanding fluctuation-induced breakages in polymers has important implications for basic and applied sciences. Here I present for the first time an analytical treatment of the thermal breakage problem of a semi-flexible polymer model that is asymptotically exact in the low temperature and high friction limits. Specifically, I provide analytical expressions for the breakage propensity and rate, and discuss the generalities of the results and their relevance to biopolymers. This work is fundamental to our understanding of the kinetics of living polymerisation. (paper)

  12. Writers, Readers, and Erasers of Histone Ubiquitylation in DNA Double-Strand Break Repair

    DEFF Research Database (Denmark)

    Smeenk, Godelieve; Mailand, Niels

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions, whose faulty repair may alter the content and organization of cellular genomes. To counteract this threat, numerous signaling and repair proteins are recruited hierarchically to the chromatin areas surrounding DSBs to facilitate...... accurate lesion repair and restoration of genome integrity. In vertebrate cells, ubiquitin-dependent modifications of histones adjacent to DSBs by RNF8, RNF168, and other ubiquitin ligases have a key role in promoting the assembly of repair protein complexes, serving as direct recruitment platforms for a...... integrity, as well as cell and organismal fitness....

  13. Rad9 plays an important role in DNA mismatch repair through physical interaction with MLH1

    OpenAIRE

    He, Wei; Zhao, Yun; Zhang, Chunbo; An, Lili; Hu, Zhishang; Liu, Yuheng; Han, Lu; Bi, Lijun; Xie, Zhensheng; Xue, Peng; Yang, Fuquan; Hang, Haiying

    2008-01-01

    Rad9 is conserved from yeast to humans and plays roles in DNA repair (homologous recombination repair, and base-pair excision repair) and cell cycle checkpoint controls. It has not previously been reported whether Rad9 is involved in DNA mismatch repair (MMR). In this study, we have demonstrated that both human and mouse Rad9 interacts physically with the MMR protein MLH1. Disruption of the interaction by a single-point mutation in Rad9 leads to significantly reduced MMR activity. This disrup...

  14. DNA double strand break damage by radiation and behavioral imaging of DNA repair enzymes

    International Nuclear Information System (INIS)

    The theme in the title is described mainly on authors' studies. Finding of a jellyfish GFP (green fluorescent protein) and its genomic recombination technique with a target protein have made it possible to investigate the behavior of the protein (the repair enzymes in this review) within a cell by fluorescent microscopy. Double strand breaks (DSBs), the most severe damage of DNA leading to cell death and carcinogenesis, are induced by irradiation of ionizing radiation and/or ultraviolet light, and repair mechanisms of non homologous end-joining and homologous recombinant repair are known major in mammalian cells and in lower eukaryotes, respectively. Authors used UVA for inducing DSBs under the presence of benzo[a]pyrene in mammalian cells like Chinese hamster ovary (CHO)-K1 and xrs-5, the behaviors of Ku70/80 repair molecules tagged by GFP were imaged by confocal laser microscopy, and one of findings was that Ku80 moved to the level most intensely irradiated. Fluorescent molecular imaging technique will be employed widely in clinical diagnosis and new drug development as well as in basic bioscience. (S.I.)

  15. DNA polymerase I-mediated ultraviolet repair synthesis in toluene-treated Escherichia coli

    International Nuclear Information System (INIS)

    DNA synthesis after ultraviolet irradiation is low in wild type toluene-treated cells. The level of repair incorporation is greater in strains deficient in DNA polymerase I. The low level of repair synthesis is attributable to the concerted action of DNA polymerase I and polynucleotide ligase. Repair synthesis is stimulated by blocking ligase activity with the addition of nicotinamide mononucleotide (NMN) or the use of a ligase temperature-sensitive mutant. NMN stimulation is specific for DNA polymerase I-mediated repair synthesis, as it is absent in isogenic strains deficient in the polymerase function or the 5' yields 3' exonuclease function associated with DNA polymerase I. DNA synthesis that is stimulated by NMN is proportional to the ultraviolet exposure at low doses, nonconservative in nature, and is dependent on the uvrA gene product but is independent of the recA gene product. These criteria place this synthesis in the excision repair pathway. The NMN-stimulated repair synthesis requires ATP and is N-ethylmaleimide-resistant. The use of NMN provides a direct means for evaluating the involvement of DNA polymerase I in excision repair

  16. Multiple gene sequence analysis using genes of the bacterial DNA repair pathway

    Directory of Open Access Journals (Sweden)

    Miguel Rotelok Neto

    2015-06-01

    Full Text Available The ability to recognize and repair abnormal DNA structures is common to all forms of life. Physiological studies and genomic sequencing of a variety of bacterial species have identified an incredible diversity of DNA repair pathways. Despite the amount of available genes in public database, the usual method to place genomes in a taxonomic context is based mainly on the 16S rRNA or housekeeping genes. Thus, the relationships among genomes remain poorly understood. In this work, an approach of multiple gene sequence analysis based on genes of DNA repair pathway was used to compare bacterial genomes. Housekeeping and DNA repair genes were searched in 872 completely sequenced bacterial genomes. Seven DNA repair and housekeeping genes from distinct metabolic pathways were selected, aligned, edited and concatenated head-to-tail to form a super-gene. Results showed that the multiple gene sequence analysis using DNA repair genes had better resolution at class level than the housekeeping genes. As housekeeping genes, the DNA repair genes were advantageous to separate bacterial groups at low taxonomic levels and also sensitive to genes derived from horizontal transfer.

  17. DNA repair in human xeroderma pigmentosum and chinese hamster cells

    International Nuclear Information System (INIS)

    The investigations described were performed to study the genetic heterogeneity of excision repair-deficient XP (xeroderma pigmentosum) strains and the biochemical defects in their repair processes after irradiation with ultraviolet radiation. (Auth.)

  18. Effect of Wortmannin on the repair profiles of DNA double-strand breaks in the whole genome and in interstitial telomeric sequences of Chinese hamster cells

    International Nuclear Information System (INIS)

    The DNA breakage detection-fluorescence in situ hybridization (DBD-FISH) procedure was applied to analyze the effect of Wortmannin (WM) in the rejoining kinetics of ionizing radiation-induced DNA double-strand breaks (DSBs) in the whole genome and in the long interstitial telomeric repeat sequence (ITRS) blocks from Chinese hamster cell lines. The results indicate that the ITRS blocks from wild-type Chinese hamster cell lines, CHO9 and V79B, exhibit a slower initial rejoining rate of ionizing radiation-induced DSBs than the genome overall. Neither Rad51C nor the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) activities, involved in homologous recombination (HR) and in non-homologous end-joining (NHEJ) pathways of DSB repair respectively, influenced the rejoining kinetics within ITRS in contrast to DNA sequences in the whole genome. Nevertheless, DSB removal rate within ITRS was decreased in the absence of Ku86 activity, though at a lower affectation level than in the whole genome, thus homogenizing both rejoining kinetics rates. WM treatment slowed down the DSB rejoining kinetics rate in ITRS, this effect being more pronounced in the whole genome, resulting in a similar pattern to that of the Ku86 deficient cells. In fact, no WM effect was detected in the Ku86 deficient Chinese hamster cells, so probably WM does not add further impairment in DSB rejoining than that resulted as a consequence of absence of Ku activity. The same slowing effect was also observed after treatment of Rad51C and DNA-PKcs defective hamster cells by WM, suggesting that: (1) there is no potentiation of the HR when the NHEJ is impaired by WM, either in the whole genome or in the ITRS, and (2) that this impairment may probably involve more targets than DNA-PKcs. These results suggest that there is an intragenomic heterogeneity in DSB repair, as well as in the effect of WM on this process

  19. Influence of XRCC1 Genetic Polymorphisms on Ionizing Radiation-Induced DNA Damage and Repair

    Directory of Open Access Journals (Sweden)

    Silvia Sterpone

    2010-01-01

    Full Text Available It is well known that ionizing radiation (IR can damage DNA through a direct action, producing single- and double-strand breaks on DNA double helix, as well as an indirect effect by generating oxygen reactive species in the cells. Mammals have evolved several and distinct DNA repair pathways in order to maintain genomic stability and avoid tumour cell transformation. This review reports important data showing a huge interindividual variability on sensitivity to IR and in susceptibility to developing cancer; this variability is principally represented by genetic polymorphisms, that is, DNA repair gene polymorphisms. In particular we have focussed on single nucleotide polymorphisms (SNPs of XRCC1, a gene that encodes for a scaffold protein involved basically in Base Excision Repair (BER. In this paper we have reported and presented recent studies that show an influence of XRCC1 variants on DNA repair capacity and susceptibility to breast cancer.

  20. Molecular dynamics of formation of TD lesioned DNA complexed with repair enzyme - onset of the enzymatic repair process

    International Nuclear Information System (INIS)

    To describe the first step of the enzymatic repair process (formation of complex enzyme-DNA), in which the thymine dimer (TD) part is removed from DNA, the 500 picosecond (ps) molecular dynamics (MD) simulation of TD lesioned DNA and part of repair enzyme cell (inclusive of catalytic center - Arg-22, Glu-23, Arg-26 and Thr-2) was performed. TD is UV originated lesion in DNA and T4 Endonuclease V is TD specific repair enzyme. Both molecules were located in the same simulation cell and their relative movement was examined. During the simulation the research was focused on the role of electrostatic energy in formation of complex enzyme-DNA. It is found, that during the first 100 ps of MD, the part of enzyme approaches the DNA surface at the TD lesion, interacts extensively by electrostatic and van der Walls interactions with TD part of DNA and forms complex that lasts stabile for 500 ps of MD. In the beginning of MD, the positive electrostatic interaction energy between part of enzyme and TD (∼ +10 kcal/mol) drives enzyme towards the DNA molecule. Water-mediated hydrogen bonds between enzyme and DNA help to keep complex stabile. As a reference, the MD simulation of the identical system with native DNA molecule (two native thymines (TT) instead of TD) was performed. In this system the negative electrostatic interaction energy between part of enzyme and TT (∼ -11 kcal/mol), in contrary to the positive one in the system with TD, doesn't drive enzyme towards DNA and complex is not formed. (author)

  1. DNA Repair Glycosylases with a [4Fe-4S] Cluster: A Redox Cofactor for DNA-mediated Charge Transport?

    OpenAIRE

    Boal, Amie K.; Yavin, Eylon; Barton, Jacqueline K.

    2007-01-01

    The [4Fe-4S] cluster is ubiquitous to a class of base excision repair enzymes, in organisms ranging from bacteria to man, and was first considered as a structural element, owing to its redox stability under physiological conditions. When studied bound to DNA, two of these repair proteins (MutY and Endonuclease III from Escherichia coli) display DNA-dependent reversible electron transfer with characteristics typical of high potential iron proteins. These results have inspired a reexamination o...

  2. Analysis of DNA double-strand break repair pathways in mice

    International Nuclear Information System (INIS)

    During the last years significant new insights have been gained into the mechanism and biological relevance of DNA double-strand break (DSB) repair in relation to genome stability. DSBs are a highly toxic DNA lesion, because they can lead to chromosome fragmentation, loss and translocations, eventually resulting in cancer. DSBs can be induced by cellular processes such as V(D)J recombination or DNA replication. They can also be introduced by exogenous agents DNA damaging agents such as ionizing radiation or mitomycin C. During evolution several pathways have evolved for the repair of these DSBs. The most important DSB repair mechanisms in mammalian cells are nonhomologous end-joining and homologous recombination. By using an undamaged repair template, homologous recombination ensures accurate DSB repair, whereas the untemplated nonhomologous end-joining pathway does not. Although both pathways are active in mammals, the relative contribution of the two repair pathways to genome stability differs in the different cell types. Given the potential differences in repair fidelity, it is of interest to determine the relative contribution of homologous recombination and nonhomologous end-joining to DSB repair. In this review, we focus on the biological relevance of DSB repair in mammalian cells and the potential overlap between nonhomologous end-joining and homologous recombination in different tissues

  3. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    International Nuclear Information System (INIS)

    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair

  4. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    Energy Technology Data Exchange (ETDEWEB)

    Ganesan, Shanthi, E-mail: shanthig@iastate.edu; Keating, Aileen F., E-mail: akeating@iastate.edu

    2015-02-01

    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  5. Capacity of ultraviolet-induced DNA repair in human glioma cells

    International Nuclear Information System (INIS)

    A DNA repair abnormality is likely related to an increased incidence of neoplasms in several autosomal recessive diseases such as xeroderma pigmentosum, Fanconi's anemia, Bloom's syndrome and ataxia telangiectasia. In human glioma cells, however, there are only a few reports on DNA repair. In this study, an ultraviolet (UV)-induced DNA repair was examined systematically in many human glioma cells. Two human malignant glioma cell lines (MMG-851, U-251-MG) and 7 human glioma cell strains (4, benign; 3, malignant) of short term culture, in which glial fibrillary acidic protein (GFAP) staining were positive, were used. To investigate the capacity of DNA repair, UV sensitivity was determined by colony formation; excision repair by autoradiography and Cytosine Arabinoside (Ara-C) assay; and post-replication repair by the joining rate of newly synthesized DNA. As a result, the colony-forming abilities of malignant glioma cell lines were lower than those of normal human fibroblasts, but no difference was found between two malignant glioma cell lines. The excision repair of the malignant group (2 cell lines and 3 cell strains) was apparently lower than that of the benign group (4 cell strains). In two malignant glioma cell lines, the excision repair of MMG-851 was lower than that of U-251-MG, and the post-replication repair of MMG-851 was higher than that of U-251-MG. These results were considered to correspond well with colony-forming ability. The results indicate that there are some differences in each human malignant glioma cell in its UV-induced DNA repair mechanism, and that the excision repair of the malignant glioma cells is apparently lower than that of the benign glioma cells. These findings may be useful for diagnosis and treatment. (author)

  6. Immunochemical approach to the study of DNA repair. Proposed technical program and technical progress report

    International Nuclear Information System (INIS)

    A simple immunochemical assay to quantify DNA lesions is being developed in order to facilitate the study of DNA repair. Antibodies have been raised to 5,6-dihydroxy-dihydrothymine and to thymine dimers and these have been used to measure DNA damages produced by osmium tetroxide and ultraviolet light, respectively. An enzyme immunoassay has been developed and the sensitivity of this method will be compared to physical, enzymatic, and chemical methods using PM2 bacteriophage DNA. Finally DNA repair will be assayed in several model systems

  7. ATP–stimulated DNA–mediated Redox Signaling by XPD, a DNA Repair and Transcription Helicase

    OpenAIRE

    Mui, Timothy P.; Fuss, Jill O.; Ishida, Justin P.; Tainer, John A.; Barton, Jacqueline K.

    2011-01-01

    Using DNA-modified electrodes, we show DNA-mediated signaling by XPD, a helicase that contains a [4Fe-4S] cluster and is critical for nucleotide excision repair and transcription. The DNA-mediated redox signal resembles that of base excision repair proteins, with a DNA-bound redox potential of ~80 mV versus NHE. Significantly, this signal increases with ATP hydrolysis. Moreover, the redox signal is substrate-dependent, reports on the DNA conformational changes associated with enzymatic functi...

  8. Analysis of DNA repair gene polymorphisms and survival in low-grade and anaplastic gliomas

    DEFF Research Database (Denmark)

    Berntsson, Shala Ghaderi; Wibom, Carl; Sjöström, Sara;

    2011-01-01

    The purpose of this study was to explore the variation in DNA repair genes in adults with WHO grade II and III gliomas and their relationship to patient survival. We analysed a total of 1,458 tagging single-nucleotide polymorphisms (SNPs) that were selected to cover DNA repair genes, in 81 grade II...... different DNA repair genes (ATM, NEIL1, NEIL2, ERCC6 and RPA4) which were associated with survival. Finally, these eight genetic variants were adjusted for treatment, malignancy grade, patient age and gender, leaving one variant, rs4253079, mapped to ERCC6, with a significant association to survival (OR 0...

  9. Recent progress with the DNA repair mutants of Chinese hamster ovary cells

    International Nuclear Information System (INIS)

    Repair deficient mutants of Chinese hamster ovary (CHO) cells are being used to identify human genes that correct the repair defects and to study mechanisms of DNA repair and mutagenesis. Five independent tertiary DNA transformants were obtained from the EM9 mutant. In these clones a human DNA sequence was identified that correlated with the resistance of the cells to CldUrd. After Eco RI digestion, Southern transfer, and hybridization of transformant DNAs with the BLUR-8 Alu family sequence, a common fragment of 25 to 30 kb was present. 37 refs., 4 figs., 3 tabs

  10. Individual sensitivity to radiations and DNA repair proficiency: the comet assay contribution

    International Nuclear Information System (INIS)

    Some are hereditary syndromes demonstrate high cancer risk and hypersensitivity in response to exposures to agents such as ultraviolet or ionising radiation, and are characterized by a defective processing of DNA damage. They highlight the importance of the individual risk associated to exposures. The comet assay, a simple technique that detects DNA strand breaks, requires few cells and allows examination of DNA repair capacities in established cell lines, in blood samples or biopsies. The assay has been validated on cellular systems with known repair defects such as xeroderma pigmentosum defective in nucleotide excision repair, on mutant rodent cell lines defective in DNA single strand breaks rejoining (XRCC5/Ku80 and XRCC7/DNAPKcs) (neutral conditions). This assay does not allow to distinguish a defective phenotype in ataxia telangiectasia cells. It shows in homozygous mouse embryo fibroblasts Brca2-/- an impaired DNA double strand break rejoining. Simplicity, rapidity and sensitivity of the alkaline comet assay allow to examine the response of lymphocytes. It has been applied to the analysis of the role of DNA repair in the pathogenesis of collagen diseases, and the involvement of individual DNA repair proficiency in the thyroid tumorigenesis induced in some patients after therapeutic irradiation at childhood has been questioned. Preliminary results of these studies suggest that this type of approach could help for adapting treatment modalities and surveillance in subgroups of patients defective in DNA repair process. It could also have some incidence in the radioprotection field. (author)

  11. Nick translation - a new assay for monitoring DNA damage and repair in cultured human fibroblasts

    International Nuclear Information System (INIS)

    An in vitro assay has been developed to detect DNA damage and repair following chemical treatment of human diploid fibroblasts. DNA damage is measured by following the Escherichia coli DNA polymerase I-catalyzed incorporation of radiolabeled deoxycytidine triphosphate (dCTP) into the DNA of lysolecithin-permeabilized cells. DNA strand breaks with free 3' OH termini serve as template sites for incorporation, and decrease of this incorporation with time, following removal of the test chemical, indicates loss (repair) of initial damage. Inhibition of the DNA excision repair process by the addition of the repair inhibitors arabinofuranosyl cytosine (ara-C) and hydroxyurea (HU) during the incubation period gives rise to an increased number of template sites, manifesting itself in increased incorporation and indicating the induction of long-patch excision repair. Results presented demonstrate that all 14 direct-acting carcinogens tested and 8 of 14 carcinogens requiring metabolic activation give positive indication of DNA damage, repair, or both. Eleven of 14 noncarcinogens tested were scored as negative, the other 3 having previously been shown to interact with cellular DNA. This assay is shown to have predictive capability at least equal to that of UDS assays but to allow a broader spectrum of genotoxic effects to be analyzed

  12. Postreplication repair in ultraviolet-irradiated human fibroblasts: formation and repair of DNA double-strand breaks

    International Nuclear Information System (INIS)

    A neutral filter elution assay was used to determine if the post-replicational formation and repair of DNA double-strand breaks (DSB) occurs in u.v.-irradiated human cells. Excision-deficient XP12 cells were pulse-labeled with [3H]thymidine after u.v. irradiation (1.5-3J/m2), and the nascent DNA was followed during repair incubation. With increasing u.v. radiation fluences, an increasing fraction of DNA was eluted at a fast rate, indicating that DSB were produced. The maximum yield DSB was observed after about 24 h of post-irradiation incubation at 370C. Similar results were also obtained with repair-proficient VA13 cells when irradiated at much higher fluences (7.5-15J/m2). It is concluded that, at the u.v. radiation fluences used, the DSB produced in u.v.-irradiated human cells are the result of post-replication repair events, and at incubation times >24 h some of these DSB are repaired. (author)

  13. Neil3 DNA Glycosylase in Maintenance and Repair of the Mammalian Brain

    OpenAIRE

    2012-01-01

    The DNA molecule is susceptible to damage induced by cellular metabolites and exogenous DNA damaging agents. Reactive oxygen species (ROS), generated as respiration by-products or arising from inflammatory reactions, are the most abundant endogenous DNA damaging agents and lead to the formation of a number of mutagenic and cytotoxic DNA lesions. To preserve DNA integrity and allow correct transmission of genetic information, several pathways for the repair of such lesions have evolved. Among ...

  14. Mitochondrial Targeted Endonuclease III DNA Repair Enzyme Protects against Ventilator Induced Lung Injury in Mice

    OpenAIRE

    Masahiro Hashizume; Marc Mouner; Joshua M. Chouteau; Gorodnya, Olena M.; Ruchko, Mykhaylo V.; Wilson, Glenn L.; Gillespie, Mark N.; Parker, James C.

    2014-01-01

    The mitochondrial targeted DNA repair enzyme, 8-oxoguanine DNA glycosylase 1, was previously reported to protect against mitochondrial DNA (mtDNA) damage and ventilator induced lung injury (VILI). In the present study we determined whether mitochondrial targeted endonuclease III (EndoIII) which cleaves oxidized pyrimidines rather than purines from damaged DNA would also protect the lung. Minimal injury from 1 h ventilation at 40 cmH2O peak inflation pressure (PIP) was reversed by EndoIII pret...

  15. HIV-1 and HIV-2 exhibit divergent interactions with HLTF and UNG2 DNA repair proteins.

    Science.gov (United States)

    Hrecka, Kasia; Hao, Caili; Shun, Ming-Chieh; Kaur, Sarabpreet; Swanson, Selene K; Florens, Laurence; Washburn, Michael P; Skowronski, Jacek

    2016-07-01

    HIV replication in nondividing host cells occurs in the presence of high concentrations of noncanonical dUTP, apolipoprotein B mRNA-editing, enzyme-catalytic, polypeptide-like 3 (APOBEC3) cytidine deaminases, and SAMHD1 (a cell cycle-regulated dNTP triphosphohydrolase) dNTPase, which maintains low concentrations of canonical dNTPs in these cells. These conditions favor the introduction of marks of DNA damage into viral cDNA, and thereby prime it for processing by DNA repair enzymes. Accessory protein Vpr, found in all primate lentiviruses, and its HIV-2/simian immunodeficiency virus (SIV) SIVsm paralogue Vpx, hijack the CRL4(DCAF1) E3 ubiquitin ligase to alleviate some of these conditions, but the extent of their interactions with DNA repair proteins has not been thoroughly characterized. Here, we identify HLTF, a postreplication DNA repair helicase, as a common target of HIV-1/SIVcpz Vpr proteins. We show that HIV-1 Vpr reprograms CRL4(DCAF1) E3 to direct HLTF for proteasome-dependent degradation independent from previously reported Vpr interactions with base excision repair enzyme uracil DNA glycosylase (UNG2) and crossover junction endonuclease MUS81, which Vpr also directs for degradation via CRL4(DCAF1) E3. Thus, separate functions of HIV-1 Vpr usurp CRL4(DCAF1) E3 to remove key enzymes in three DNA repair pathways. In contrast, we find that HIV-2 Vpr is unable to efficiently program HLTF or UNG2 for degradation. Our findings reveal complex interactions between HIV-1 and the DNA repair machinery, suggesting that DNA repair plays important roles in the HIV-1 life cycle. The divergent interactions of HIV-1 and HIV-2 with DNA repair enzymes and SAMHD1 imply that these viruses use different strategies to guard their genomes and facilitate their replication in the host. PMID:27335459

  16. DNA damage and gene therapy of xeroderma pigmentosum, a human DNA repair-deficient disease

    International Nuclear Information System (INIS)

    Graphical abstract: - Highlights: • Full correction of mutation in the XPC gene by engineered nucleases. • Meganucleases and TALENs are inhibited by 5-MeC for inducing double strand breaks. • Gene therapy of XP cells is possible using homologous recombination for DSB repair. - Abstract: Xeroderma pigmentosum (XP) is a genetic disease characterized by hypersensitivity to ultra-violet and a very high risk of skin cancer induction on exposed body sites. This syndrome is caused by germinal mutations on nucleotide excision repair genes. No cure is available for these patients except a complete protection from all types of UV radiations. We reviewed the various techniques to complement or to correct the genetic defect in XP cells. We, particularly, developed the correction of XP-C skin cells using the fidelity of the homologous recombination pathway during repair of double-strand break (DSB) in the presence of XPC wild type sequences. We used engineered nucleases (meganuclease or TALE nuclease) to induce a DSB located at 90 bp of the mutation to be corrected. Expression of specific TALE nuclease in the presence of a repair matrix containing a long stretch of homologous wild type XPC sequences allowed us a successful gene correction of the original TG deletion found in numerous North African XP patients. Some engineered nucleases are sensitive to epigenetic modifications, such as cytosine methylation. In case of methylated sequences to be corrected, modified nucleases or demethylation of the whole genome should be envisaged. Overall, we showed that specifically-designed TALE-nuclease allowed us to correct a 2 bp deletion in the XPC gene leading to patient's cells proficient for DNA repair and showing normal UV-sensitivity. The corrected gene is still in the same position in the human genome and under the regulation of its physiological promoter. This result is a first step toward gene therapy in XP patients

  17. DNA damage and gene therapy of xeroderma pigmentosum, a human DNA repair-deficient disease

    Energy Technology Data Exchange (ETDEWEB)

    Dupuy, Aurélie [Laboratory of Genetic Instability and Oncogenesis UMR8200CNRS, Institut Gustave Roussy and University Paris-Sud, Villejuif (France); Sarasin, Alain, E-mail: alain.sarasin@gustaveroussy.fr [Laboratory of Genetic Instability and Oncogenesis UMR8200CNRS, Institut Gustave Roussy and University Paris-Sud, Villejuif (France); Service de Génétique, Institut Gustave Roussy (France)

    2015-06-15

    Graphical abstract: - Highlights: • Full correction of mutation in the XPC gene by engineered nucleases. • Meganucleases and TALENs are inhibited by 5-MeC for inducing double strand breaks. • Gene therapy of XP cells is possible using homologous recombination for DSB repair. - Abstract: Xeroderma pigmentosum (XP) is a genetic disease characterized by hypersensitivity to ultra-violet and a very high risk of skin cancer induction on exposed body sites. This syndrome is caused by germinal mutations on nucleotide excision repair genes. No cure is available for these patients except a complete protection from all types of UV radiations. We reviewed the various techniques to complement or to correct the genetic defect in XP cells. We, particularly, developed the correction of XP-C skin cells using the fidelity of the homologous recombination pathway during repair of double-strand break (DSB) in the presence of XPC wild type sequences. We used engineered nucleases (meganuclease or TALE nuclease) to induce a DSB located at 90 bp of the mutation to be corrected. Expression of specific TALE nuclease in the presence of a repair matrix containing a long stretch of homologous wild type XPC sequences allowed us a successful gene correction of the original TG deletion found in numerous North African XP patients. Some engineered nucleases are sensitive to epigenetic modifications, such as cytosine methylation. In case of methylated sequences to be corrected, modified nucleases or demethylation of the whole genome should be envisaged. Overall, we showed that specifically-designed TALE-nuclease allowed us to correct a 2 bp deletion in the XPC gene leading to patient's cells proficient for DNA repair and showing normal UV-sensitivity. The corrected gene is still in the same position in the human genome and under the regulation of its physiological promoter. This result is a first step toward gene therapy in XP patients.

  18. DNA DAMAGE REPAIR AND CELL CYCLE CONTROL: A NATURAL BIO-DEFENSE MECHANISM

    Science.gov (United States)

    DNA DAMAGE REPAIR AND CELL CYCLE CONTROL: A natural bio-defense mechanismAnuradha Mudipalli.Maintenance of genetic information, including the correct sequence of nucleotides in DNA, is essential for replication, gene expression, and protein synthesis. DNA lesions onto...

  19. Repair of X-ray induced ruptures in DNA of blue-green alga Anacystis nidulans

    International Nuclear Information System (INIS)

    The work deals with systems of repair of radiation damage in the DNA of the blue-green alga Anacystis nidulans by the modified method of DNA fractionation by molecular weight with centrifuging in an alkaline sucrose gradient. It is shown that effective post-radiation repair of X-ray-induced breaks in DNA in A. nidulans cells takes place only after irradiation in a tris-HCl buffer at 200C. It is assumed that the system of restoration in actively metabolizing cells is similar to the mechanism of ''slow'' repair, which is responsible for repair synthesis and the elimination of the gaps formed during excision or post-replicative repair. On the basis of the differences found in the DNA sedimentation profiles immediately after irradiation of cells at 00 or 200 in a tris-HCl or a cerium buffer, the authors conclude that A. nidulans cells also have ''rapid'' repair systems which operate right in the irradiation period and resotre the single-strand breaks in DNA. Irradiation in a cerium buffer or at low temperature inhibited both the ''rapid'' and the ''slow'' repair of breaks in DNA. (V.A.P.)

  20. Functional evaluation of DNA repair in human biopsies and their relation to other cellular biomarkers

    Directory of Open Access Journals (Sweden)

    Jana eSlyskova

    2014-05-01

    Full Text Available Thousands of DNA lesions are estimated to occur in each cell every day and almost all are recognized and repaired. DNA repair is an essential system that prevents accumulation of mutations which can lead to serious cellular malfunctions. Phenotypic evaluation of DNA repair activity of individuals is a relatively new approach. Methods to assess base and nucleotide excision repair pathways (BER and NER in peripheral blood cells based on modified comet assay protocols have been widely applied in human epidemiological studies. These provided some interesting observations of individual DNA repair activity being suppressed among cancer patients. However, extension of these results to cancer target tissues requires a different approach. Here we describe the evaluation of BER and NER activities in extracts from deep-frozen colon biopsies using an upgraded version of the in vitro comet-based DNA repair assay in which twelve reactions on one microscope slide can be performed. The aim of this report is to provide a detailed, easy-to-follow protocol together with results of optimization experiments. Additionally, results obtained by functional assays were analysed in the context of other cellular biomarkers, namely single nucleotide polymorphisms and gene expressions. We have shown that measuring DNA repair activity is not easily replaceable by genomic or transcriptomic approaches, but should be applied with the latter techniques in a complementary manner. The ability to measure DNA repair directly in cancer target tissues might finally answer questions about the tissue-specificity of DNA repair processes and their real involvement in the process of carcinogenesis.

  1. Dynamic binding of replication protein a is required for DNA repair

    Science.gov (United States)

    Chen, Ran; Subramanyam, Shyamal; Elcock, Adrian H.; Spies, Maria; Wold, Marc S.

    2016-01-01

    Replication protein A (RPA), the major eukaryotic single-stranded DNA (ssDNA) binding protein, is essential for replication, repair and recombination. High-affinity ssDNA-binding by RPA depends on two DNA binding domains in the large subunit of RPA. Mutation of the evolutionarily conserved aromatic residues in these two domains results in a separation-of-function phenotype: aromatic residue mutants support DNA replication but are defective in DNA repair. We used biochemical and single-molecule analyses, and Brownian Dynamics simulations to determine the molecular basis of this phenotype. Our studies demonstrated that RPA binds to ssDNA in at least two modes characterized by different dissociation kinetics. We also showed that the aromatic residues contribute to the formation of the longer-lived state, are required for stable binding to short ssDNA regions and are needed for RPA melting of partially duplex DNA structures. We conclude that stable binding and/or the melting of secondary DNA structures by RPA is required for DNA repair, including RAD51 mediated DNA strand exchange, but is dispensable for DNA replication. It is likely that the binding modes are in equilibrium and reflect dynamics in the RPA–DNA complex. This suggests that dynamic binding of RPA to DNA is necessary for different cellular functions. PMID:27131385

  2. Non-DBS DNA Repair Genes Regulate Radiation-induced Cytogenetic Damage Repair and Cell Cycle Progression

    Science.gov (United States)

    Zhang, Ye; Rohde, Larry H.; Emami, Kamal; Casey, Rachael; Wu, Honglu

    2008-01-01

    Changes of gene expression profile are one of the most important biological responses in living cells after ionizing radiation (IR) exposure. Although some studies have shown that genes up-regulated by IR may play important roles in DNA damage repair, the relationship between the regulation of gene expression by IR, particularly genes not known for their roles in DSB repair, and its impact on cytogenetic responses has not been systematically studied. In the present study, the expression of 25 genes selected on the basis of their transcriptional changes in response to IR was individually knocked down by transfection with small interfering RNA in human fibroblast cells. The purpose of this study is to identify new roles of these selected genes on regulating DSB repair and cell cycle progression , as measured in the micronuclei formation and chromosome aberration. In response to IR, the formation of MN was significantly increased by suppressed expression of 5 genes: Ku70 in the DSB repair pathway, XPA in the NER pathway, RPA1 in the MMR pathway, and RAD17 and RBBP8 in cell cycle control. Knocked-down expression of 4 genes (MRE11A, RAD51 in the DSB pathway, SESN1, and SUMO1) significantly inhibited cell cycle progression, possibly because of severe impairment of DNA damage repair. Furthermore, loss of XPA, P21, or MLH1 expression resulted in both significantly enhanced cell cycle progression and increased yields of chromosome aberrations, indicating that these gene products modulate both cell cycle control and DNA damage repair. Most of the 11 genes that affected cytogenetic responses are not known to have clear roles influencing DBS repair. Nine of these 11 genes were up-regulated in cells exposed to gamma radiation, suggesting that genes transcriptionally modulated by IR were critical to regulate the biological consequences after IR.

  3. BMI1 Is Recruited to DNA Breaks and Contributes to DNA Damage-Induced H2A Ubiquitination and Repair ▿ †

    OpenAIRE

    Ginjala, Vasudeva; Nacerddine, Karim; Kulkarni, Atul; Oza, Jay; Hill, Sarah J.; Yao, Ming; Citterio, Elisabetta; van Lohuizen, Maarten; Ganesan, Shridar

    2011-01-01

    DNA damage activates signaling pathways that lead to modification of local chromatin and recruitment of DNA repair proteins. Multiple DNA repair proteins having ubiquitin ligase activity are recruited to sites of DNA damage, where they ubiquitinate histones and other substrates. This DNA damage-induced histone ubiquitination is thought to play a critical role in mediating the DNA damage response. We now report that the polycomb protein BMI1 is rapidly recruited to sites of DNA damage, where i...

  4. Repair of gamma-ray-induced DNA base damage in xeroderma pigmentosum cells

    International Nuclear Information System (INIS)

    The repair of DNA damage produced by 137Cs gamma irradiation was measured with a preparation from Micrococcus luteus containing DNA damage-specific endonucleases in combination with alkaline elution. The frequency of these endonuclease sensitive sites (ESS) was determined after 54 or 110 Gy of oxic irradiation in normal and xeroderma pigmentosum (XP) fibroblasts from complementation groups A, C, D, and G. Repair was rapid in all cell strains with greater than 50% repair after 1.5 h of repair incubation. At later repair times, 12-17 h, more ESS remained in XP than in normal cells. The frequency of excess ESS in XP cells was approximately 0.04 per 10(9) Da of DNA per Gy which was equivalent to 10% of the initial ESS produced. The removal of ESS was comparable in XP cells with normal radiosensitivity and XP3BR cells which have been reported to be moderately radiosensitive

  5. Repair of ultraviolet-light-induced DNA damage in Vibrio cholerae

    International Nuclear Information System (INIS)

    Repair of ultraviolet-light-induced DNA damage in a highly pathogenic Gram-negative bacterium, Vibrio cholerae, has been examined. All three strains of V. cholerae belonging to two serotypes, Inaba and Ogawa, are very sensitive to ultraviolet irradiation, having inactivation cross-sections ranging from 0.18 to 0.24 m2/J. Although these cells are proficient in repairing the DNA damage by a photoreactivation mechanism, they do not possess efficient dark repair systems. The mild toxinogenic strain 154 of classical Vibrios presumably lacks any excision repair mechanism and studies of irradiated cell DNA indicate that the ultraviolet-induced pyrimidine dimers may not be excised. Ultraviolet-irradiated cells after saturation of dark repair can be further photoreactivated. (Auth.)

  6. DNA repair in lymphocytes from patients with secondary leukemia as measured by strand rejoining and unscheduled DNA synthesis

    DEFF Research Database (Denmark)

    Bohr, V; Køber, L

    1985-01-01

    The ability to repair damage to DNA was compared in 2 groups of patients having undergone treatment for leukemia, one of which developed secondary leukemia (SL), and the other without signs of secondary malignancy (treated controls). Both were related to normal controls. DNA repair was assessed in...... isolated peripheral lymphocytes from the patients by measuring the rejoining of strand breaks following alkylation damage to the lymphocytes or by measuring unscheduled DNA synthesis. Day-to-day variability in the assays was considerable, but findings were that 5 out of 7 SL patients had repair...... deficiencies as measured by their ability to rejoin strand breaks, and 5 out of 7 had increased unscheduled DNA synthesis compared to treated and normal controls. All patients with SL and 4 out of 8 treated controls had inherent strand breaks in their DNA as compared to the normal controls when measured by...

  7. The barley EST DNA Replication and Repair Database (bEST-DRRD as a tool for the identification of the genes involved in DNA replication and repair

    Directory of Open Access Journals (Sweden)

    Gruszka Damian

    2012-06-01

    Full Text Available Abstract Background The high level of conservation of genes that regulate DNA replication and repair indicates that they may serve as a source of information on the origin and evolution of the species and makes them a reliable system for the identification of cross-species homologs. Studies that had been conducted to date shed light on the processes of DNA replication and repair in bacteria, yeast and mammals. However, there is still much to be learned about the process of DNA damage repair in plants. Description These studies, which were conducted mainly using bioinformatics tools, enabled the list of genes that participate in various pathways of DNA repair in Arabidopsis thaliana (L. Heynh to be outlined; however, information regarding these mechanisms in crop plants is still very limited. A similar, functional approach is particularly difficult for a species whose complete genomic sequences are still unavailable. One of the solutions is to apply ESTs (Expressed Sequence Tags as the basis for gene identification. For the construction of the barley EST DNA Replication and Repair Database (bEST-DRRD, presented here, the Arabidopsis nucleotide and protein sequences involved in DNA replication and repair were used to browse for and retrieve the deposited sequences, derived from four barley (Hordeum vulgare L. sequence databases, including the “Barley Genome version 0.05” database (encompassing ca. 90% of barley coding sequences and from two databases covering the complete genomes of two monocot models: Oryza sativa L. and Brachypodium distachyon L. in order to identify homologous genes. Sequences of the categorised Arabidopsis queries are used for browsing the repositories, which are located on the ViroBLAST platform. The bEST-DRRD is currently used in our project during the identification and validation of the barley genes involved in DNA repair. Conclusions The presented database provides information about the Arabidopsis genes involved in

  8. Genome analysis of DNA repair genes in the alpha proteobacterium Caulobacter crescentus

    Directory of Open Access Journals (Sweden)

    Menck Carlos FM

    2007-03-01

    Full Text Available Abstract Background The integrity of DNA molecules is fundamental for maintaining life. The DNA repair proteins protect organisms against genetic damage, by removal of DNA lesions or helping to tolerate them. DNA repair genes are best known from the gamma-proteobacterium Escherichia coli, which is the most understood bacterial model. However, genome sequencing raises questions regarding uniformity and ubiquity of these DNA repair genes and pathways, reinforcing the need for identifying genes and proteins, which may respond to DNA damage in other bacteria. Results In this study, we employed a bioinformatic approach, to analyse and describe the open reading frames potentially related to DNA repair from the genome of the alpha-proteobacterium Caulobacter crescentus. This was performed by comparison with known DNA repair related genes found in public databases. As expected, although C. crescentus and E. coli bacteria belong to separate phylogenetic groups, many of their DNA repair genes are very similar. However, some important DNA repair genes are absent in the C. crescentus genome and other interesting functionally related gene duplications are present, which do not occur in E. coli. These include DNA ligases, exonuclease III (xthA, endonuclease III (nth, O6-methylguanine-DNA methyltransferase (ada gene, photolyase-like genes, and uracil-DNA-glycosylases. On the other hand, the genes imuA and imuB, which are involved in DNA damage induced mutagenesis, have recently been described in C. crescentus, but are absent in E. coli. Particularly interesting are the potential atypical phylogeny of one of the photolyase genes in alpha-proteobacteria, indicating an origin by horizontal transfer, and the duplication of the Ada orthologs, which have diverse structural configurations, including one that is still unique for C. crescentus. Conclusion The absence and the presence of certain genes are discussed and predictions are made considering the particular

  9. Fast repair of oxidizing OH adducts of DNA by hydroxycinnamic acid derivatives. A pulse radiolytic study

    International Nuclear Information System (INIS)

    Using pulse radiolytic techniques, it has been demonstrated that the interactions of oxidizing OH adducts of DNA (ssDNA and dsDNA), polyA and polyG with hydroxycinnamic acid derivatives proceed via an electron transfer process (k=5-30x108 dm3 mol-1 s-1). In addition, the rates for fast repair of OH adducts of dAMP, polyA and DNA (ssDNA and dsDNA) are slower than the corresponding rates for the rest OH adducts of DNA constituents. The slower rates for repair of oxidizing OH adducts of dAMP may be the rate determining step during the interaction of hydroxycinnamic acid derivatives with OH adducts of DNA containing the varieties of OH adducts of DNA constituents

  10. Human DNA repair disorders in dermatology: A historical perspective, current concepts and new insight.

    Science.gov (United States)

    Moriwaki, Shinichi

    2016-02-01

    Products of DNA damage, such as cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6-4) pyrimidone photoproducts (6-4 PPs), are continually formed in genomes after exposure to UV radiation. When these DNA damages remain unrepaired in essential DNA sites for prolonged periods, DNA replication and transcription are hampered or mutation is induced, which may cause cell death, cellular senescence, and carcinogenesis of the skin. To protect against such UV-induced DNA damage, living organisms nicely retain "DNA repair systems", which can efficiently repair "harmful" DNA damage through precise mechanisms by the integrated functions of many proteins. In humans, the failure of DNA repair systems causes a variety of disorders. Dermatological conditions such as hereditary photodermatoses, xeroderma pigmentosum (XP) and Cockayne syndrome (CS) are caused by congenital functional defects in the nucleotide excision repair (NER) system or the translesion synthesis (TLS) system. In this review, we describe the historical progress, recent findings, and future prospects of studies of human diseases associated with DNA-repair defects. PMID:26493104

  11. Differential requirement for SUB1 in chromosomal and plasmid double-strand DNA break repair.

    Directory of Open Access Journals (Sweden)

    Lijian Yu

    Full Text Available Non homologous end joining (NHEJ is an important process that repairs double strand DNA breaks (DSBs in eukaryotic cells. Cells defective in NHEJ are unable to join chromosomal breaks. Two different NHEJ assays are typically used to determine the efficiency of NHEJ. One requires NHEJ of linearized plasmid DNA transformed into the test organism; the other requires NHEJ of a single chromosomal break induced either by HO endonuclease or the I-SceI restriction enzyme. These two assays are generally considered equivalent and rely on the same set of NHEJ genes. PC4 is an abundant DNA binding protein that has been suggested to stimulate NHEJ. Here we tested the role of PC4's yeast homolog SUB1 in repair of DNA double strand breaks using different assays. We found SUB1 is required for NHEJ repair of DSBs in plasmid DNA, but not in chromosomal DNA. Our results suggest that these two assays, while similar are not equivalent and that repair of plasmid DNA requires additional factor(s that are not required for NHEJ repair of chromosomal double-strand DNA breaks. Possible roles for Sub1 proteins in NHEJ of plasmid DNA are discussed.

  12. A cell-free system for DNA repair synthesis using purified enzymes from the Novikoff hepatoma

    International Nuclear Information System (INIS)

    Novikoff DNA polymerase-β and Novikoff DNase V have been used in a cell-free DNA excision repair system for UV-irradiated substrates to determine their DNA repair capabilities. The repair system was shown to depend upon UV-irradiated DNA, incision by phage T4 UV-endonuclease, excision by DNase V and synthesis by DNA polymerase-β; ligation was not included. Highly purified calf thymus DNA was UV-irradiated at 500-750 J/m2 and incised by T4 UV-endonuclease. The repair system was used to follow the purification of DNase V and DNA polymerase-β. For increased specificity, the parameters of UV-irradiation, incision, excision and synthesis were confirmed on highly supercoiled, covalently closed, phage PM2 DNA. Optimal DNA and Mg2+ concentrations were determined for the repair assay, which was shown to be linear with respect to time. Excision of the 3'-apyrimidinic site and the 5'-pyrimidine dimer by bidirectional DNase V, presumed to occur from the above experiments, was studied more thoroughly using lightly UV-irradiated [3H]poly(dT)poly (dA), labeled in both the base and the sugar, and incised with T4 UV-endonuclease

  13. Regulation of DNA repair in serum-stimulated xeroderma pigmentosum cells

    OpenAIRE

    1984-01-01

    The regulation of DNA repair during serum stimulation of quiescent cells was examined in normal human cells, in fibroblasts from three xeroderma pigmentosum complementation groups (A, C, and D), in xeroderma pigmentosum variant cells, and in ataxia telangiectasia cells. The regulation of nucleotide excision repair was examined by exposing cells to ultraviolet irradiation at discrete intervals after cell stimulation. Similarly, base excision repair was quantitated after exposure to methylmetha...

  14. A eukaryotic gene encoding an endonuclease that specifically repairs DNA damaged by ultraviolet light.

    OpenAIRE

    Yajima, H; Takao, M; Yasuhira, S; Zhao, J. H.; Ishii, C.; Inoue, H; Yasui, A

    1995-01-01

    Many eukaryotic organisms, including humans, remove ultraviolet (UV) damage from their genomes by the nucleotide excision repair pathway, which requires more than 10 separate protein factors. However, no nucleotide excision repair pathway has been found in the filamentous fungus Neurospora crassa. We have isolated a new eukaryotic DNA repair gene from N.crassa by its ability to complement UV-sensitive Escherichia coli cells. The gene is altered in a N.crassa mus-18 mutant and responsible for ...

  15. Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

    International Nuclear Information System (INIS)

    Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

  16. Induction and repair of DNA strand breaks in human tumor cells

    International Nuclear Information System (INIS)

    The presence of radioresistant or repair-proficient cells in a tumor is often associated with radiotherapy failure. The authors have begun to study the mechanisms of resistance in these tumor cells. Their initial studies focused on the induction and repair of DNA strand breaks as measured by DNA elution. Eight human tumor (5 squamous cell carcinomas, 2 melanomas, and 1 adenocarcinoma) and 2 nonmalignant cell lines have been examined. Their D/sub O/s range from 1.07 Gy to 2.81 Gy while their extrapolation numbers (n) range from 1.2 to 24.8. Three parameters are being investigated for X-ray-induced DNA single and double-strand breaks; 1) the initial number of breaks induced, 2) the residual DNA strand break frequency and 3) the time to repair 50% of the lesions. The kinetics of repair of DNA single-strand breaks were similar for all the lines studied. In 2 cases, radiosensitivity was associated with either a high residual DNA strand break frequency or a slower rate of repair. No single parameter or combination of parameters, however, consistently correlated with radiosensitivity or n. Thus, while differences in the induction and repair of DNA single-strand breaks might explain some of the observed differences in radiation responses, they are in general a poor predictor radiation sensitivity

  17. Nucleotide excision repair DNA synthesis by excess DNA polymerase beta: a potential source of genetic instability in cancer cells.

    Science.gov (United States)

    Canitrot, Y; Hoffmann, J S; Calsou, P; Hayakawa, H; Salles, B; Cazaux, C

    2000-09-01

    The nucleotide excision repair pathway contributes to genetic stability by removing a wide range of DNA damage through an error-free reaction. When the lesion is located, the altered strand is incised on both sides of the lesion and a damaged oligonucleotide excised. A repair patch is then synthesized and the repaired strand is ligated. It is assumed that only DNA polymerases delta and/or epsilon participate to the repair DNA synthesis step. Using UV and cisplatin-modified DNA templates, we measured in vitro that extracts from cells overexpressing the error-prone DNA polymerase beta exhibited a five- to sixfold increase of the ultimate DNA synthesis activity compared with control extracts and demonstrated the specific involvement of Pol beta in this step. By using a 28 nt gapped, double-stranded DNA substrate mimicking the product of the incision step, we showed that Pol beta is able to catalyze strand displacement downstream of the gap. We discuss these data within the scope of a hypothesis previously presented proposing that excess error-prone Pol beta in cancer cells could perturb the well-defined specific functions of DNA polymerases during error-free DNA transactions. PMID:10973926

  18. Turbulent breakage of ductile aggregates

    CERN Document Server

    Marchioli, Cristian

    2015-01-01

    In this paper we study breakage rate statistics of small colloidal aggregates in non-homogeneous anisotropic turbulence. We use pseudo-spectral direct numerical simulation of turbulent channel flow and Lagrangian tracking to follow the motion of the aggregates, modelled as sub-Kolmogorov massless particles. We focus specifically on the effects produced by ductile rupture: This rupture is initially activated when fluctuating hydrodynamic stresses exceed a critical value, $\\sigma>\\sigma_{cr}$, and is brought to completion when the energy absorbed by the aggregate meets the critical breakage value. We show that ductile rupture breakage rates are significantly reduced with respect to the case of instantaneous brittle rupture (i.e. breakage occurs as soon as $\\sigma>\\sigma_{cr}$). These discrepancies are due to the different energy values at play as well as to the statistical features of energy distribution in the anisotropic turbulence case examined.

  19. DNA repair in mammalian cells exposed to combinations of carcinogenic agents

    International Nuclear Information System (INIS)

    Cells defective in one or more aspects of repair are killed and often mutagenized more readily than normal cells by DNA damaging agents, and humans whose cells are deficient in repair are at an increased carcinogenic risk compared to normal individuals. The excision repair of uv induced pyrimidine dimers is a well studied system, but the details of the steps in this repair system are far from being understood in human cells. We know that there are a number of chemicals that mimic uv in that normal human cells repair DNA damage from both these agents and from uv by a long patch excision repair system, and that xeroderma pigmentosum cells defective in repair of uv are also defective in the repair of damage from these chemicals. The chemicals we have investigated are AAAF, 4-NQO, DMBA-epoxide, and ICR-170. We describe experiments, using several techniques, in which DNA excision repair is measured after treatment of various human cell strains with combinations of uv and these agents. If two agents have a common rate limiting step then, at doses high enough to saturate the repair system, one would expect the observed repair after a treatment with a combination of agents to be equal to that from one agent alone. Such is not the case for normal human or excision-deficient XP cells. In the former repair is additive and in the latter repair is usually appreciably less than that observed with either agent alone. Models that attempt to explain these surprising results involve complexes of enzymes and cofactors

  20. Aphidicolin inhibits repair of DNA in UV-irradiated human fibroblasts

    International Nuclear Information System (INIS)

    Aphidicolin, a specific inhibitor of DNA polymerase α, is shown to inhibit DNA repair in human diploid fibroblasts. Although aphidicolin has no apparent effect on the DNA of unirradiated cells, it causes a large number of strand breaks to accumulate in UV-irradiated cellular DNA. The number of breaks is the same as the number observed following a similar dose of ultraviolet light when cells are treated with arabinofuranosyl cytosine (araC) and hydroxyurea (HU), known inhibitors of repair. Moreover, two-dimensional paper chromatography shows that aphidicolin completely blocks removal of pyrimidine dimers. These observations are discussed in light of the proposed roles of DNA polymerases α and β in DNA replication and repair and the action of aphidicolin on polymerase α

  1. Conjugated linoleic acid inhibiting DNA repair damaged by x-ray

    International Nuclear Information System (INIS)

    Non-homologous end-joining is the most effective repair of DNA double strand break. Epidermal growth factor receptor activates DSB repairs. Integration of EGFR inhibitors with radiation or chemotherapy were used in lung cancer treatment. Radiosensitivity effect of conjugated linoleic acid on tumor cells and reduced metastasis are reported

  2. Pathway choice in DNA double strand break repair: Observations of a balancing act

    NARCIS (Netherlands)

    I. Brandsma (Inger); D.C. van Gent (Dik)

    2012-01-01

    textabstractProper repair of DNA double strand breaks (DSBs) is vital for the preservation of genomic integrity. There are two main pathways that repair DSBs, Homologous recombination (HR) and Non-homologous end-joining (NHEJ). HR is restricted to the S and G2 phases of the cell cycle due to the req

  3. Xeroderma pigmentosum group F caused by a defect in a structure-specific DNA repair endonuclease.

    NARCIS (Netherlands)

    A.M. Sijbers (Anneke); W.L. de Laat (Wouter); R.A. Ariza (Rafael); M. Biggerstaff (Maureen); Y-F. Wei; J.G. Moggs (Jonathan); K.C. Carter (Kenneth); B.K. Shell (Brenda); E. Evans (Elizabeth); M.C. de Jong (Mariska); S. Rademakers (Suzanne); J.D. de Rooij (Johan); N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan); R.D. Wood (Richard)

    1996-01-01

    textabstractNucleotide excision repair, which is defective in xeroderma pigmentosum (XP), involves incision of a DNA strand on each side of a lesion. We isolated a human gene homologous to yeast Rad1 and found that it corrects the repair defects of XP group F as well as rodent groups 4 and 11. Causa

  4. Non-homologous end joining is the responsible pathway for the repair of fludarabine-induced DNA double strand breaks in mammalian cells

    International Nuclear Information System (INIS)

    Fludarabine (FLU), an analogue of adenosine, interferes with DNA synthesis and inhibits the chain elongation leading to replication arrest and DNA double strand break (DSB) formation. Mammalian cells use two main pathways of DSB repair to maintain genomic stability: homologous recombination (HR) and non-homologous end joining (NHEJ). The aim of the present work was to evaluate the repair pathways employed in the restoration of DSB formed following replication arrest induced by FLU in mammalian cells. Replication inhibition was induced in human lymphocytes and fibroblasts by FLU. DSB occurred in a dose-dependent manner on early/middle S-phase cells, as detected by γH2AX foci formation. To test whether conservative HR participates in FLU-induced DSB repair, we measured the kinetics of Rad51 nuclear foci formation in human fibroblasts. There was no significant induction of Rad51 foci after FLU treatment. To further confirm these results, we analyzed the frequency of sister chromatid exchanges (SCE) in both human cells. We did not find increased frequencies of SCE after FLU treatment. To assess the participation of NHEJ pathway in the repair of FLU-induced damage, we used two chemical inhibitors of the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), vanillin and wortmannin. Human fibroblasts pretreated with DNA-PKcs inhibitors showed increased levels of chromosome breakages and became more sensitive to cell death. An active role of NHEJ pathway was also suggested from the analysis of Chinese hamster cell lines. XR-C1 (DNA-PKcs-deficient) and XR-V15B (Ku80-deficient) cells showed hypersensitivity to FLU as evidenced by the increased frequency of chromosome aberrations, decreased mitotic index and impaired survival rates. In contrast, CL-V4B (Rad51C-deficient) and V-C8 (Brca2-deficient) cell lines displayed a FLU-resistant phenotype. Together, our results suggest a major role for NHEJ repair in the preservation of genome integrity against FLU-induced DSB

  5. Non-homologous end joining is the responsible pathway for the repair of fludarabine-induced DNA double strand breaks in mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Campos-Nebel, Marcelo de [Departamento de Genetica, Instituto de Investigaciones Hematologicas Mariano R. Castex, Academia Nacional de Medicina, Buenos Aires (Argentina)], E-mail: mnebel@hematologia.anm.edu.ar; Larripa, Irene; Gonzalez-Cid, Marcela [Departamento de Genetica, Instituto de Investigaciones Hematologicas Mariano R. Castex, Academia Nacional de Medicina, Buenos Aires (Argentina)

    2008-11-10

    Fludarabine (FLU), an analogue of adenosine, interferes with DNA synthesis and inhibits the chain elongation leading to replication arrest and DNA double strand break (DSB) formation. Mammalian cells use two main pathways of DSB repair to maintain genomic stability: homologous recombination (HR) and non-homologous end joining (NHEJ). The aim of the present work was to evaluate the repair pathways employed in the restoration of DSB formed following replication arrest induced by FLU in mammalian cells. Replication inhibition was induced in human lymphocytes and fibroblasts by FLU. DSB occurred in a dose-dependent manner on early/middle S-phase cells, as detected by {gamma}H2AX foci formation. To test whether conservative HR participates in FLU-induced DSB repair, we measured the kinetics of Rad51 nuclear foci formation in human fibroblasts. There was no significant induction of Rad51 foci after FLU treatment. To further confirm these results, we analyzed the frequency of sister chromatid exchanges (SCE) in both human cells. We did not find increased frequencies of SCE after FLU treatment. To assess the participation of NHEJ pathway in the repair of FLU-induced damage, we used two chemical inhibitors of the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), vanillin and wortmannin. Human fibroblasts pretreated with DNA-PKcs inhibitors showed increased levels of chromosome breakages and became more sensitive to cell death. An active role of NHEJ pathway was also suggested from the analysis of Chinese hamster cell lines. XR-C1 (DNA-PKcs-deficient) and XR-V15B (Ku80-deficient) cells showed hypersensitivity to FLU as evidenced by the increased frequency of chromosome aberrations, decreased mitotic index and impaired survival rates. In contrast, CL-V4B (Rad51C-deficient) and V-C8 (Brca2-deficient) cell lines displayed a FLU-resistant phenotype. Together, our results suggest a major role for NHEJ repair in the preservation of genome integrity against FLU

  6. Tocopherol monoglucoside enhances repair of radiation-induced DNA strand breaks in vivo

    International Nuclear Information System (INIS)

    In the present study it is examined repair of DNA single strand breaks in peripheral blood leucocytes of mice exposed to 4 Gy whole body gamma radiation using alkaline single cell gel electrophoresis or comet assay

  7. A baculovirus photolyase with DNA repair activity and circadian clock regulatory function

    NARCIS (Netherlands)

    Biernat, M.A.; Eker, A.P.M.; Oers, van M.M.; Vlak, J.M.; Horst, van der G.T.J.; Chaves, I.

    2012-01-01

    Cryptochromes and photolyases belong to the same family of flavoproteins but, despite being structurally conserved, display distinct functions. Photolyases use visible light to repair ultraviolet-induced DNA damage. Cryptochromes, however, function as blue-light receptors, circadian photoreceptors,

  8. Formation and repair of DNA double-strand breaks in superinfecting phage lambda after ionizing irradiation of Escherichia coli host cells

    International Nuclear Information System (INIS)

    Cells of Escherichia coli containing superinfecting phage lambda DNA molecules were irradiated with 4-MeV electrons and lysed at neutral pH; the lysates were sedimented in neutral sucrose gradients to separate lambda DNA molecules containing no strand breaks, one or more single-strand breaks, or a double-strand break. About 40 single-strand breaks were induced for every double-strand break in both the presence and absence of oxygen. The single-strand breaks were rapidly repaired after irradiation in nitrogen anoxia and subsequent incubation in aerobic growth medium, but no net reduction in the number of double-strand breaks was observed. This is similar to observations after oxic irradiation. No quadratic dose dependence of double-strand break induction was found up to 500 krad in oxygen and up to 1800 krad in nitrogen anoxia. Also, no difference in double-strand breakage was observed when equal doses in the range of 60 to 80 krad were delivered either (i) acutely, with 1 sec. or (ii) intermittently, with time to repair most single-strand breaks before onset of the next radiation pulse. It is concluded that the proposed mechanism whereby two independently induced single-strand breaks pair to form a double-strand break is not significant in the biological dose range

  9. Radiation-Induced Survivin Nuclear Accumulation is Linked to DNA Damage Repair

    International Nuclear Information System (INIS)

    Purpose: Increased expression of survivin has been identified as a negative prognostic marker in a variety of human cancers. We have previously shown that survivin is a radiation-resistance factor and that the therapeutic effect of survivin knock-down might result from an impaired DNA repair capacity. In this study, we aimed to elucidate an interrelationship between survivin's cellular localization and DNA double-strand break repair. Methods and Materials: Survivin's cellular distribution and nuclear complex formation were assayed by Western blotting of subcellular fractions, by immunofluorescence staining, and co-immunoprecipitation in SW480 colorectal cancer cells. DNA repair capacity was analyzed by kinetics of γ-H2AX foci formation, and by DNA-dependent protein kinase (DNA-PKcs) assays in the presence of survivin-specific or nonspecific control siRNA. Results: Following irradiation, we observed a rapid nuclear accumulation of survivin and subsequent phosphorylation of the protein in the nucleus. Co-immunoprecipitation analyses from nuclear extracts revealed an interaction among survivin, Ku70, γ-H2AX, MDC1, and DNA-PKcs that was confirmed by immunofluorescence co-localization in nuclear foci. Survivin knock down by siRNA resulted in an impaired DNA double strand break repair, as demonstrated by an increased detection of γ-H2AX foci/nucleus at 60 min and a higher amount of residual γ-H2AX foci at 24 hr postirradiation. Furthermore, we detected in survivin-depleted cells a hampered S2056 autophosphorylation of DNA-PKcs and a significantly decreased DNA-PKcs kinase activity. Conclusion: These data indicate that nuclear survivin is linked to DNA double-strand break repair by interaction with members of the DNA double-strand breaks repair machinery, thus regulating DNA-PKcs activity.

  10. A new dimension in improved radiation protection by enhanced DNA repair

    International Nuclear Information System (INIS)

    Radioprotection and photo protection were dependent until now on measures to reduce the amount of damage formed by ionizing and ultraviolet radiations. In both cases the measures are not completely satisfactory: the classical radioprotectors are toxic arid exert serious side effects, and afford a protection factor not higher than around 2. The sunscreens filters are effective for certain wavelength ranges only, and not enough is known about the possible effects of the filters when they absorb light and turn into other chemical entities. Both approaches do not give an answer to damages which are formed in spite of the partial reduction of damage. A new approach offered here is dealing with the damage on a cellular / molecular level, by enhancing the activity of the natural repair enzymes whose task is to remove radiation and photoproducts, rejoin DNA strand breaks and repair the DNA. A combination of vitamins and antioxidants is fulfilling these tasks and provides protection from both ionizing and ultraviolet radiations by enhancing several folds the repair of DNA in living cells. Such a combination which contains the repair enhancers niacinamide and nordihydroguaiaretic acid is employed in preparations named EDNAR ( Enhanced DNA Repair, Patent pending) which demonstrate excellent results of enhancing DNA repair as measured by repair synthesis, and protecting the skin from sunburns as well as skin burns following radiotherapy. These lotions and creams, when not containing any chemical filters yet demonstrating a protective effect, may be called 'the sunscreens without sunscreens'. (author)

  11. Inefficient DNA Repair Is an Aging-Related Modifier of Parkinson’s Disease

    OpenAIRE

    Sara Sepe; Chiara Milanese; Sylvia Gabriels; Derks, Kasper W.J.; Cesar Payan-Gomez; Wilfred F.J. van IJcken; Yvonne M.A. Rijksen; Alex L. Nigg; Sandra Moreno; Silvia Cerri; Fabio Blandini; Hoeijmakers, Jan H.J.; Pier G. Mastroberardino

    2016-01-01

    The underlying relation between Parkinson’s disease (PD) etiopathology and its major risk factor, aging, is largely unknown. In light of the causative link between genome stability and aging, we investigate a possible nexus between DNA damage accumulation, aging, and PD by assessing aging-related DNA repair pathways in laboratory animal models and humans. We demonstrate that dermal fibroblasts from PD patients display flawed nucleotide excision repair (NER) capacity and that Ercc1 mutant mice...

  12. Inefficient DNA Repair Is an Aging-Related Modifier of Parkinson’s Disease

    OpenAIRE

    Sepe, Sara; Milanese, Chiara; Gabriels, Sylvia; Derks, Kasper W.J.; Payan-Gomez, Cesar; Wilfred F.J. van IJcken; Yvonne M.A. Rijksen; Nigg, Alex L.; Moreno, Sandra; Cerri, Silvia; Blandini, Fabio; Hoeijmakers, Jan H.J.; Mastroberardino, Pier G.

    2016-01-01

    Summary The underlying relation between Parkinson’s disease (PD) etiopathology and its major risk factor, aging, is largely unknown. In light of the causative link between genome stability and aging, we investigate a possible nexus between DNA damage accumulation, aging, and PD by assessing aging-related DNA repair pathways in laboratory animal models and humans. We demonstrate that dermal fibroblasts from PD patients display flawed nucleotide excision repair (NER) capacity and that Ercc1 mut...

  13. DNA-repair, chromosome alterations and chromatin structure under environmental pollutions

    International Nuclear Information System (INIS)

    54 abstracts, 20 of which are within the INIS scope, are presented. The papers are dealing with the influence of some chemicals, environmental pollutants as well as drugs, on the process of DNA repair after ionizing irradiation. Some advanced techniques of detecting genotoxic properties and some papers on the influence of DNA repair on cell differentiation were presented. Genetic changes in man, animals and plants as a consequence of the Chernobylsk accident were described

  14. A novel function of adenomatous polyposis coli (APC) in regulating DNA repair

    OpenAIRE

    Jaiswal, Aruna S.; Narayan, Satya

    2008-01-01

    Prevailing literature suggests diversified cellular functions for the adenomatous polyposis coli (APC) gene. Among them a recently discovered unique role of APC is in DNA repair. The APC gene can modulate the base excision repair (BER) pathway through an interaction with DNA polymerase β (Pol-β) and flap endonuclease 1 (Fen-1). Taken together with the transcriptional activation of APC gene by alkylating agents and modulation of BER activity, APC may play an important role in carcinogenesis an...

  15. Repetitious nature of repaired DNA in mammalian cells. Progress report, June 1, 1975--May 31, 1976

    International Nuclear Information System (INIS)

    The specific activity of DNA isolated from cultured mammalian cells labeled with tritiated thymidine was determined for 20 minute intervals beginning at different times post-uv irradiation, during the period in which post-replication repair is presumed to occur. It was concluded that the radioactivity incorporated into the DNA synthesized at different times post-uv irradiation, during the period of presumed post-replication repair, is uniformly distributed throughout the genome

  16. UvrD facilitates DNA repair by pulling RNA polymerase backwards

    OpenAIRE

    Epshtein, Vitaly; Kamarthapu, Venu; McGary, Katelyn; Svetlov, Vladimir; Ueberheide, Beatrix; Proshkin, Sergey; Mironov, Alexander; Nudler, Evgeny

    2014-01-01

    UvrD helicase is required for nucleotide excision repair, although its role in this process is not well defined. Here we show that Escherichia coli UvrD binds RNA polymerase during transcription elongation and, using its helicase/translocase activity, forces RNA polymerase to slide backward along DNA. By inducing backtracking, UvrD exposes DNA lesions shielded by blocked RNA polymerase, allowing nucleotide excision repair enzymes to gain access to sites of damage. Our results establish UvrD a...

  17. Multiple gene sequence analysis using genes of the bacterial DNA repair pathway

    OpenAIRE

    Miguel Rotelok Neto; Carolina Weigert Galvão; Leonardo Magalhães Cruz; Dieval Guizelini; Leilane Caline Silva; Jarem Raul Garcia; Rafael Mazer Etto

    2015-01-01

    The ability to recognize and repair abnormal DNA structures is common to all forms of life. Physiological studies and genomic sequencing of a variety of bacterial species have identified an incredible diversity of DNA repair pathways. Despite the amount of available genes in public database, the usual method to place genomes in a taxonomic context is based mainly on the 16S rRNA or housekeeping genes. Thus, the relationships among genomes remain poorly understood. In this work, an approach of...

  18. DNA double-strand break repair proteins are required to cap the ends of mammalian chromosomes

    OpenAIRE

    Bailey, Susan M.; Meyne, Julianne; Chen, David J.; Kurimasa, Akihiro; Li, Gloria C.; Lehnert, Bruce E.; Goodwin, Edwin H.

    1999-01-01

    Recent findings intriguingly place DNA double-strand break repair proteins at chromosome ends in yeast, where they help maintain normal telomere length and structure. In the present study, an essential telomere function, the ability to cap and thereby protect chromosomes from end-to-end fusions, was assessed in repair-deficient mouse cell lines. By using fluorescence in situ hybridization with a probe to telomeric DNA, spontaneously occurring chromosome aberrations were examined for telomere ...

  19. The Nucleotide Excision Repair System of Borrelia burgdorferi Is the Sole Pathway Involved in Repair of DNA Damage by UV Light

    OpenAIRE

    Hardy, Pierre-Olivier; Chaconas, George

    2013-01-01

    To survive and avoid accumulation of mutations caused by DNA damage, the genomes of prokaryotes encode a variety of DNA repair pathways most well characterized in Escherichia coli. Some of these are required for the infectivity of various pathogens. In this study, the importance of 25 DNA repair/recombination genes for Borrelia burgdorferi survival to UV-induced DNA damage was assessed. In contrast to E. coli, where 15 of these genes have an effect on survival of UV irradiation, disruption of...

  20. Psoralen plus near-ultraviolet light: a possible new method for measuring DNA repair synthesis

    International Nuclear Information System (INIS)

    A new method is proposed to inhibit semiconservative DNA synthesis in cultured cells while DNA repair synthesis is being measured. The cells are treated with the DNA-crosslinking agent Trioxalen (4,5,8-trimethylpsoralen) plus near-ultraviolet light, and consequently 99.5% inhibition of replicative DNA synthesis is achieved. Additional DNA-damaging agents induce thymidine incorporation into the double-stranded regions of the DNA. The new method gave results very similar to those obtained with the benzoylated naphthoylated DEAE (BND) cellulose method using three human fibroblast strains, of which one had deficient capacity for DNA repair synthesis following treatment with γ rays and methyl methanesulfonate. The advantages of the new method are simplicity and rapidity, as well as the high extent to which replicative DNA synthesis is inhibited

  1. Psoralen plus near-ultraviolet light: a possible new method for measuring DNA repair synthesis

    International Nuclear Information System (INIS)

    A new method is proposed to inhibit semiconservative DNA synthesis in cultured cells while DNA repair synthesis is being measured. The cells are treated with the DNA-crosslinking agent Trioxalen (4,5,8-trimethylpsoralen) plus near-ultraviolet light, and consequently 99.5% inhibition of replicative DNA synthesis is achieved. Additional DNA-damaging agents induce thymidine incorporation into the double-stranded regions of the DNA. The new method gave results very similar to those obtained with the benzoylated naphthoylated DEAE (BND) cellulose method using three human fibroblast strains, of which one had deficient capacity for DNA repair synthesis following treatment with gamma rays and methyl methanesulfonate. The advantages of the new method are simplicity and rapidity, as well as the high extent to which replicative DNA synthesis is inhibited

  2. Repair of nonreplicating UV-irradiated DNA: cooperative dark repair by Escherichia coli uvr and phr functions

    International Nuclear Information System (INIS)

    The system previously used to study recombination of nonreplicating UV-irradiated phage lambda DNA was adapted to study UV repair. Irradiated phages infected undamaged homoimmune lysogens. Pyrimidine dimer content (by treatment with Micrococcus luteus UV endonuclease and alkaline sucrose sedimentation) and a biological activity endpoint (infectivity in transfection of uvrB recA recB spheroplasts) were followed. Unless room light was excluded during DNA extraction procedures, photoreactivation (Phr function) was significant. In uvr Δphr bacteria, repair, by both assays, was very low but not zero. Even when light was totally excluded, Phr function appeared to play a role in Uvr-mediated excision repair: both dimer removal and restoration of infectivity were two to five times as efficient in uvr+ phr+ bacteria as in uvr+ Δphr bacteria. Similarly, UV-irradiated phages plated with higher efficiencies on phr+ than Δphr bacteria even under totally dark conditions. In uvr phr+ repressed infections, removal of dimers from nonreplicating DNA did not increase infectivity as much as in uvr2= infections, suggesting a requirement for repair of nondimer photoproducts by the uvrABC system

  3. Real-time observation of DNA repair: 2-aminopurine as a molecular probe

    Science.gov (United States)

    Krishnan, Rajagopal; Butcher, Christina E.; Oh, Dennis H.

    2008-02-01

    Triplex forming oligos (TFOs) that target psoralen photoadducts to specific DNA sequences have generated interest as a potential agent in gene therapy. TFOs also offer an opportunity to study the mechanism of DNA repair in detail. In an effort to understand the mechanism of DNA repair at a specific DNA sequence in real-time, we have designed a plasmid containing a psoralen reaction site adjacent to a TFO binding site corresponding to a sequence within the human interstitial collagenase gene. Two 2-aminopurine residues incorporated into the purine-rich strand of the TFO binding site and located within six nucleotides of the psoralen reaction site serve as molecular probes for excision repair events involving the psoralen photoadducts on that DNA strand. In duplex DNA, the 2-aminopurine fluorescence is quenched. However, upon thermal or formamide-induced denaturation of duplex DNA to single stranded DNA, the 2-aminopurine fluorescence increases by eight fold. These results suggest that monitoring 2-aminopurine fluorescence from plasmids damaged by psoralen TFOs may be a method for measuring excision of single-stranded damaged DNA from the plasmid in cells. A fluorescence-based molecular probe to the plasmid may significantly simplify the real-time observation of DNA repair in both populations of cells as well as single cells.

  4. Two pathways of DNA double-strand break repair in G1 cells of Saccharomyces cerevisiae

    International Nuclear Information System (INIS)

    The G1 cells of the diploid yeast Saccharomyces cerevislae are known to be capable of a slow repair of DNA double-strand breaks (DSB) during holding the cells in a non-nutrient medium. In the present paper, it has been shown that S. cerevislae cells γ-irradiated in the G1 phase of cell cycle are capable of fast repair of DNA DSB; this process is completed within 30-40 min of holding the cells in water at 28 deg C. For this reason, the kinetics of DNA DSB repair during holding the cells in a non-nutrient medium are biphasic, i.e., the first, ''fast'' phase is completed within 30-40 min; wheras the second, ''slow'' one, within 48 h. Mutations rad51, rad52, rad54 and rad55 inhibit the fast repair of DNA DSB, whereas mutations rad50, rad53 and rad57 do not practically influence this process. It has been shown that the observed fast and slow repair of DNA DSB in the G1 diploid cells of S, cerevislae are separate pathways of DNA DSB repair in yeast

  5. Photodynamic DNA damage induced by phycocyanin and its repair in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    M. Pádula

    1999-09-01

    Full Text Available In the present study, we analyzed DNA damage induced by phycocyanin (PHY in the presence of visible light (VL using a set of repair endonucleases purified from Escherichia coli. We demonstrated that the profile of DNA damage induced by PHY is clearly different from that induced by molecules that exert deleterious effects on DNA involving solely singlet oxygen as reactive species. Most of PHY-induced lesions are single strand breaks and, to a lesser extent, base oxidized sites, which are recognized by Nth, Nfo and Fpg enzymes. High pressure liquid chromatography coupled to electrochemical detection revealed that PHY photosensitization did not induce 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo at detectable levels. DNA repair after PHY photosensitization was also investigated. Plasmid DNA damaged by PHY photosensitization was used to transform a series of Saccharomyces cerevisiae DNA repair mutants. The results revealed that plasmid survival was greatly reduced in rad14 mutants, while the ogg1 mutation did not modify the plasmid survival when compared to that in the wild type. Furthermore, plasmid survival in the ogg1 rad14 double mutant was not different from that in the rad14 single mutant. The results reported here indicate that lethal lesions induced by PHY plus VL are repaired differently by prokaryotic and eukaryotic cells. Morever, nucleotide excision repair seems to play a major role in the recognition and repair of these lesions in Saccharomyces cerevisiae.

  6. Effect of intense, ultrashort laser pulses on DNA plasmids in their native state: strand breakages induced by {\\it in-situ} electrons

    CERN Document Server

    D'Souza, J S; Dharmdhikair, A K; Rao, B J; Mathur, D

    2010-01-01

    Single strand breaks are induced in DNA plasmids, pBR322 and pUC19, in aqueous media by intense ultrashort laser pulses (820 nm wavelength, 45 fs pulse duration, 1 kHz repetition rate) at intensities of 1-12 TW cm$^{-2}$. The intense laser radiation generates, {\\it in situ}, electrons that induce transformation of supercoiled DNA into relaxed DNA. The extent of electron-mediated relaxation of DNA structure is quantified. Introduction of electron and radical scavengers inhibits DNA damage.

  7. Effect of intense, ultrashort laser pulses on DNA plasmids in their native state: strand breakages induced by {\\it in-situ} electrons and radicals

    CERN Document Server

    D'Souza, J S; Dharmadhikari, A K; Rao, B J; Mathur, D

    2011-01-01

    Single strand breaks are induced in DNA plasmids, pBR322 and pUC19, in aqueous media exposed to strong fields generated using ultrashort laser pulses (820 nm wavelength, 45 fs pulse duration, 1 kHz repetition rate) at intensities of 1-12 TW cm$^{-2}$. The strong fields generate, {\\it in situ}, electrons and radicals that induce transformation of supercoiled DNA into relaxed DNA, the extent of which is quantified. Introduction of electron and radical scavengers inhibits DNA damage; results indicate that OH radicals are the primary (but not sole) cause of DNA damage.

  8. Persistence of Breakage in Specific Chromosome Bands 6 Years after Acute Exposure to Oil

    Science.gov (United States)

    Francés, Alexandra; Hildur, Kristin; Barberà, Joan Albert; Rodríguez-Trigo, Gema; Zock, Jan-Paul; Giraldo, Jesús; Monyarch, Gemma; Rodriguez-Rodriguez, Emma; de Castro Reis, Fernanda; Souto, Ana; Gómez, Federico P.; Pozo-Rodríguez, Francisco; Templado, Cristina; Fuster, Carme

    2016-01-01

    Background The identification of breakpoints involved in chromosomal damage could help to detect genes involved in genetic disorders, most notably cancer. Until now, only one published study, carried out by our group, has identified chromosome bands affected by exposure to oil from an oil spill. In that study, which was performed two years after the initial oil exposure in individuals who had participated in clean-up tasks following the wreck of the Prestige, three chromosomal bands (2q21, 3q27, 5q31) were found to be especially prone to breakage. A recent follow-up study, performed on the same individuals, revealed that the genotoxic damage had persisted six years after oil exposure. Objectives To determine whether there exist chromosome bands which are especially prone to breakages and to know if there is some correlation with those detected in the previous study. In addition, to investigate if the DNA repair problems detected previously persist in the present study. Design Follow-up study performed six years after the Prestige oil spill. Setting Fishermen cooperatives in coastal villages. Participants Fishermen highly exposed to oil spill who participated in previous genotoxic study six years after the oil. Measurements Chromosome damage in peripheral lymphocytes. For accurate identification of the breakpoints involved in chromosome damage of circulating lymphocytes, a sequential stain/G-banding technique was employed. To determine the most break-prone chromosome bands, two statistical methods, the Fragile Site Multinomial and the chi-square tests (where the bands were corrected by their length) were used. To compare the chromosome lesions, structural chromosome alterations and gaps/breaks between two groups of individuals we used the GEE test which takes into account a possible within-individual correlation. Dysfunctions in DNA repair mechanisms, expressed as chromosome damage, were assessed in cultures with aphidicolin by the GEE test. Results Cytogenetic

  9. Human RIF1 encodes an anti-apoptotic factor required for DNA repair

    OpenAIRE

    Wang, Haibo; Zhao, Ailian; Chen, Lin; Zhong, Xueyan; Liao, Ji; Gao, Min; Cai, Minghua; Lee, Dong-Hyun; Jing LI; Chowdhury, Dipanjan; Yang, Yun-Gui; Pfeifer, Gerd P.; Yen, Yun; Xu, Xingzhi

    2009-01-01

    Human Rap1-interacting protein 1 (RIF1) contributes to the ataxia telangiectasia, mutated-mediated DNA damage response against the dexterous effect of DNA lesions and plays a critical role in the S-phase checkpoint. However, the molecular mechanisms by which human RIF1 conquers DNA aberrations remain largely unknown. We here showed that inhibition of RIF1 expression by small interfering RNA led to defective homologous recombination-mediated DNA double-strand break repair and sensitized cancer...

  10. BMI1 is recruited to DNA breaks and contributes to DNA damage-induced H2A ubiquitination and repair.

    Science.gov (United States)

    Ginjala, Vasudeva; Nacerddine, Karim; Kulkarni, Atul; Oza, Jay; Hill, Sarah J; Yao, Ming; Citterio, Elisabetta; van Lohuizen, Maarten; Ganesan, Shridar

    2011-05-01

    DNA damage activates signaling pathways that lead to modification of local chromatin and recruitment of DNA repair proteins. Multiple DNA repair proteins having ubiquitin ligase activity are recruited to sites of DNA damage, where they ubiquitinate histones and other substrates. This DNA damage-induced histone ubiquitination is thought to play a critical role in mediating the DNA damage response. We now report that the polycomb protein BMI1 is rapidly recruited to sites of DNA damage, where it persists for more than 8 h. The sustained localization of BMI1 to damage sites is dependent on intact ATM and ATR and requires H2AX phosphorylation and recruitment of RNF8. BMI1 is required for DNA damage-induced ubiquitination of histone H2A at lysine 119. Loss of BMI1 leads to impaired repair of DNA double-strand breaks by homologous recombination and the accumulation of cells in G(2)/M. These data support a crucial role for BMI1 in the cellular response to DNA damage. PMID:21383063

  11. Alpha-phellandrene-induced DNA damage and affect DNA repair protein expression in WEHI-3 murine leukemia cells in vitro.

    Science.gov (United States)

    Lin, Jen-Jyh; Wu, Chih-Chung; Hsu, Shu-Chun; Weng, Shu-Wen; Ma, Yi-Shih; Huang, Yi-Ping; Lin, Jaung-Geng; Chung, Jing-Gung

    2015-11-01

    Although there are few reports regarding α-phellandrene (α-PA), a natural compound from Schinus molle L. essential oil, there is no report to show that α-PA induced DNA damage and affected DNA repair associated protein expression. Herein, we investigated the effects of α-PA on DNA damage and repair associated protein expression in murine leukemia cells. Flow cytometric assay was used to measure the effects of α-PA on total cell viability and the results indicated that α-PA induced cell death. Comet assay and 4,6-diamidino-2-phenylindole dihydrochloride staining were used for measuring DNA damage and condensation, respectively, and the results indicated that α-PA induced DNA damage and condensation in a concentration-dependent manner. DNA gel electrophoresis was used to examine the DNA damage and the results showed that α-PA induced DNA damage in WEHI-3 cells. Western blotting assay was used to measure the changes of DNA damage and repair associated protein expression and the results indicated that α-PA increased p-p53, p-H2A.X, 14-3-3-σ, and MDC1 protein expression but inhibited the protein of p53, MGMT, DNA-PK, and BRCA-1. PMID:24861204

  12. Ago2 facilitates Rad51 recruitment and DNA double-strand break repair by homologous recombination

    OpenAIRE

    Gao, Min; Wei, Wei; Li, Ming-ming; Wu, Yong-Sheng; Ba, Zhaoqing; Jin, Kang-Xuan; Li, Miao-Miao; Liao, You-Qi; Adhikari, Samir; Chong, Zechen; Zhang, Ting; Guo, Cai-Xia; Tang, Tie-Shan; Zhu, Bing-Tao; Xu, Xing-Zhi

    2014-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic lesions and pose a major threat to genome stability if not properly repaired. We and others have previously shown that a class of DSB-induced small RNAs (diRNAs) is produced from sequences around DSB sites. DiRNAs are associated with Argonaute (Ago) proteins and play an important role in DSB repair, though the mechanism through which they act remains unclear. Here, we report that the role of diRNAs in DSB repair is restricted to repair by h...

  13. A role for small RNAs in DNA double-strand break repair

    DEFF Research Database (Denmark)

    Wei, W.; Ba, Z.; Wu, Y.;

    2012-01-01

    Eukaryotes have evolved complex mechanisms to repair DNA double-strand breaks (DSBs) through coordinated actions of protein sensors, transducers, and effectors. Here we show that ∼21-nucleotide small RNAs are produced from the sequences in the vicinity of DSB sites in Arabidopsis and in human cells......RNAs are recruited by Argonaute 2 (AGO2) to mediate DSB repair. Knock down of Dicer or Ago2 in human cells reduces DSB repair. Our findings reveal a conserved function for small RNAs in the DSB repair pathway. We propose that diRNAs may function as guide molecules directing chromatin modifications or the...

  14. Genetic characterization of cells of homocystinuria patients with disrupted DNA repair system

    International Nuclear Information System (INIS)

    Fibroblasts obtained from biopsy material and lymphocytes of patients with homocystinuria were investigated for repair activity according to the following criteria: rejoined DNA breaks, induced by 4-nitroquinoline-1-oxide and γ-radiation; indices of reactivation and induced mutagenesis of smallpox vaccine virus treated with these mutagens. In lymphocytes a defect of DNA repair was observed according to all criteria investigated. During passage of fibroblast cultures, inhibition of repair activity of cells was preserved according to γ-type. Increase in the number of spontaneous and γ-induced mutations of virus was noted according to degree of passage of fibroblasts

  15. The C-terminal domain of Cernunnos/XLF is dispensable for DNA repair in vivo.

    Science.gov (United States)

    Malivert, Laurent; Callebaut, Isabelle; Rivera-Munoz, Paola; Fischer, Alain; Mornon, Jean-Paul; Revy, Patrick; de Villartay, Jean-Pierre

    2009-03-01

    The core nonhomologous end-joining DNA repair pathway is composed of seven factors: Ku70, Ku80, DNA-PKcs, Artemis, XRCC4 (X4), DNA ligase IV (L4), and Cernunnos/XLF (Cernunnos). Although Cernunnos and X4 are structurally related and participate in the same complex together with L4, they have distinct functions during DNA repair. L4 relies on X4 but not on Cernunnos for its stability, and L4 is required for optimal interaction of Cernunnos with X4. We demonstrate here, using in vitro-generated Cernunnos mutants and a series of functional assays in vivo, that the C-terminal region of Cernunnos is dispensable for its activity during DNA repair. PMID:19103754

  16. Identification of DNA polymerase molecules repairing DNA irradiated damage and molecular biological study on modified factors of mutation rate

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Koichi; Inoue, Shuji [National Inst. of Healthand Nutrition, Tokyo (Japan)

    1999-02-01

    DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit {delta} or {epsilon} which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)

  17. Identification of DNA polymerase molecules repairing DNA irradiated damage and molecular biological study on modified factors of mutation rate

    International Nuclear Information System (INIS)

    DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit δ or ε which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)

  18. The molecular origin of high DNA-repair efficiency by photolyase

    Science.gov (United States)

    Tan, Chuang; Liu, Zheyun; Li, Jiang; Guo, Xunmin; Wang, Lijuan; Sancar, Aziz; Zhong, Dongping

    2015-06-01

    The primary dynamics in photomachinery such as charge separation in photosynthesis and bond isomerization in sensory photoreceptor are typically ultrafast to accelerate functional dynamics and avoid energy dissipation. The same is also true for the DNA repair enzyme, photolyase. However, it is not known how the photoinduced step is optimized in photolyase to attain maximum efficiency. Here, we analyse the primary reaction steps of repair of ultraviolet-damaged DNA by photolyase using femtosecond spectroscopy. With systematic mutations of the amino acids involved in binding of the flavin cofactor and the cyclobutane pyrimidine dimer substrate, we report our direct deconvolution of the catalytic dynamics with three electron-transfer and two bond-breaking elementary steps and thus the fine tuning of the biological repair function for optimal efficiency. We found that the maximum repair efficiency is not enhanced by the ultrafast photoinduced process but achieved by the synergistic optimization of all steps in the complex repair reaction.

  19. Mitochondrial and Nuclear DNA Damage and Repair in Age-Related Macular Degeneration

    Directory of Open Access Journals (Sweden)

    Janusz Blasiak

    2013-01-01

    Full Text Available Aging and oxidative stress seem to be the most important factors in the pathogenesis of age-related macular degeneration (AMD, a condition affecting many elderly people in the developed world. However, aging is associated with the accumulation of oxidative damage in many biomolecules, including DNA. Furthermore, mitochondria may be especially important in this process because the reactive oxygen species produced in their electron transport chain can damage cellular components. Therefore, the cellular response to DNA damage, expressed mainly through DNA repair, may play an important role in AMD etiology. In several studies the increase in mitochondrial DNA (mtDNA damage and mutations, and the decrease in the efficacy of DNA repair have been correlated with the occurrence and the stage of AMD. It has also been shown that mitochondrial DNA accumulates more DNA lesions than nuclear DNA in AMD. However, the DNA damage response in mitochondria is executed by nucleus-encoded proteins, and thus mutagenesis in nuclear DNA (nDNA may affect the ability to respond to mutagenesis in its mitochondrial counterpart. We reported that lymphocytes from AMD patients displayed a higher amount of total endogenous basal and oxidative DNA damage, exhibited a higher sensitivity to hydrogen peroxide and UV radiation, and repaired the lesions induced by these factors less effectively than did cells from control individuals. We postulate that poor efficacy of DNA repair (i.e., is impaired above average for a particular age when combined with the enhanced sensitivity of retinal pigment epithelium cells to environmental stress factors, contributes to the pathogenesis of AMD. Collectively, these data suggest that the cellular response to both mitochondrial and nuclear DNA damage may play an important role in AMD pathogenesis.

  20. Protein phosphatase 5 is necessary for ATR-mediated DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Yoonsung [Department of Pharmacology, DNA Repair Research Center, Chosun University School of Medicine, 375 Seosuk-Dong, Gwangju 501-759 (Korea, Republic of); Cheong, Hyang-Min [Department of Life Science, College of Natural Science, Chung-Ang University, 221 Heuksuk-Dong, Dongjak-Ku, Seoul 156-756 (Korea, Republic of); Lee, Jung-Hee [Department of Pharmacology, DNA Repair Research Center, Chosun University School of Medicine, 375 Seosuk-Dong, Gwangju 501-759 (Korea, Republic of); Song, Peter I. [Department of Dermatology, University of Arkansas for Medical Science, 4301 West Markham, Slot 576, Little Rock, AR 72205 (Korea, Republic of); Lee, Kwang-Ho [Department of Life Science, College of Natural Science, Chung-Ang University, 221 Heuksuk-Dong, Dongjak-Ku, Seoul 156-756 (Korea, Republic of); Kim, Sang-Yong [Division of Endocrinology, Department of Internal Medicine, Chosun University School of Medicine, 375 Seosuk-Dong, Gwangju 501-759 (Korea, Republic of); Jun, Jae Yeoul [Department of Physiology, Chosun University School of Medicine, 375 Seosuk-Dong, Gwangju 501-759 (Korea, Republic of); You, Ho Jin, E-mail: hjyou@chosun.ac.kr [Department of Pharmacology, DNA Repair Research Center, Chosun University School of Medicine, 375 Seosuk-Dong, Gwangju 501-759 (Korea, Republic of)

    2011-01-07

    Research highlights: {yields} Serine/threonine protein phosphatase 5 (PP5) has been shown to participate in ataxia telangiectasia-mutated (ATM)- and ATR (ATM- and Rad3-related)-mediated checkpoint pathways, which plays an important role in the DNA damage response and maintenance of genomic stability. {yields} However, it is not clear exactly how PP5 participates in this process. {yields} Our results indicate that PP5 is more closely related with ATR-mediated pathway than ATM-mediated pathway in DNA damage repair. -- Abstract: Several recent studies have shown that protein phosphatase 5 (PP5) participates in cell cycle arrest after DNA damage, but its roles in DNA repair have not yet been fully characterized. We investigated the roles of PP5 in the repair of ultraviolet (UV)- and neocarzinostatin (NCS)-induced DNA damage. The results of comet assays revealed different repair patterns in UV- and NCS-exposed U2OS-PS cells. PP5 is only essential for Rad3-related (ATR)-mediated DNA repair. Furthermore, the phosphorylation of 53BP1 and BRCA1, important mediators of DNA damage repair, and substrates of ATR and ATM decreased in U2OS-PS cells exposed to UV radiation. In contrast, the cell cycle arrest proteins p53, CHK1, and CHK2 were normally phosphorylated in U2OS and U2OS-PS cells exposed to UV radiation or treated with NCS. In view of these results, we suggest that PP5 plays a crucial role in ATR-mediated repair of UV-induced DNA damage.

  1. Protein phosphatase 5 is necessary for ATR-mediated DNA repair

    International Nuclear Information System (INIS)

    Research highlights: → Serine/threonine protein phosphatase 5 (PP5) has been shown to participate in ataxia telangiectasia-mutated (ATM)- and ATR (ATM- and Rad3-related)-mediated checkpoint pathways, which plays an important role in the DNA damage response and maintenance of genomic stability. → However, it is not clear exactly how PP5 participates in this process. → Our results indicate that PP5 is more closely related with ATR-mediated pathway than ATM-mediated pathway in DNA damage repair. -- Abstract: Several recent studies have shown that protein phosphatase 5 (PP5) participates in cell cycle arrest after DNA damage, but its roles in DNA repair have not yet been fully characterized. We investigated the roles of PP5 in the repair of ultraviolet (UV)- and neocarzinostatin (NCS)-induced DNA damage. The results of comet assays revealed different repair patterns in UV- and NCS-exposed U2OS-PS cells. PP5 is only essential for Rad3-related (ATR)-mediated DNA repair. Furthermore, the phosphorylation of 53BP1 and BRCA1, important mediators of DNA damage repair, and substrates of ATR and ATM decreased in U2OS-PS cells exposed to UV radiation. In contrast, the cell cycle arrest proteins p53, CHK1, and CHK2 were normally phosphorylated in U2OS and U2OS-PS cells exposed to UV radiation or treated with NCS. In view of these results, we suggest that PP5 plays a crucial role in ATR-mediated repair of UV-induced DNA damage.

  2. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    International Nuclear Information System (INIS)

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL−1 and 50 μg mL−1 of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair activities

  3. Distinct kinetics of DNA repair protein accumulation at DNA lesions and cell cycle-dependent formation of gammaH2AX- and NBS1-positive repair foci

    Czech Academy of Sciences Publication Activity Database

    Suchánková, Jana; Kozubek, Stanislav; Legartová, Soňa; Sehnalová, Petra; Kuntzinger, T.; Bártová, Eva

    2015-01-01

    Roč. 107, č. 12 (2015), s. 440-454. ISSN 0248-4900 R&D Projects: GA ČR(CZ) GBP302/12/G157; GA ČR(CZ) GA13-07822S Institutional support: RVO:68081707 Keywords : Cell cycle * DNA repair * Interphase Subject RIV: BO - Biophysics Impact factor: 3.506, year: 2014

  4. DNA repair in gamma-and UV-irradiated Escherichia coli treated with caffeine and acriflavine

    International Nuclear Information System (INIS)

    A study is made of the postradiation effect of caffeine and acriflavine on the survival rate and DNA repair in E. coli exposed to γ- and UV-radiation. When added to postradiation growth medium caffeine and acriflavine lower the survival rate of γ-irradiated radioresistant strains, B/r and Bsub(s-1)γR, and UV-irradiated UV-resistant strain B/r, and do not appreciably influence the survival of strains that are sensitive to γ- and UV-radiation. The survival rate of UV-irradiated mutant BsUb(s-1) somewhat increases in the presence of caffeine. Caffeine and acriflavine inhibit repair of single-stranded DNA breaks induced in strain B/r by γ-radiation (slow repair) and UV light. Acriflavine arrests a recombination branch of postreplication repair of DNA in E. coli Bsub(s-1)γR Whereas caffeine does not influence this process

  5. Dual roles of DNA repair enzymes in RNA biology/post-transcriptional control.

    Science.gov (United States)

    Vohhodina, Jekaterina; Harkin, D Paul; Savage, Kienan I

    2016-09-01

    Despite consistent research into the molecular principles of the DNA damage repair pathway for almost two decades, it has only recently been found that RNA metabolism is very tightly related to this pathway, and the two ancient biochemical mechanisms act in alliance to maintain cellular genomic integrity. The close links between these pathways are well exemplified by examining the base excision repair pathway, which is now well known for dual roles of many of its members in DNA repair and RNA surveillance, including APE1, SMUG1, and PARP1. With additional links between these pathways steadily emerging, this review aims to provide a summary of the emerging roles for DNA repair proteins in the post-transcriptional regulation of RNAs. WIREs RNA 2016, 7:604-619. doi: 10.1002/wrna.1353 For further resources related to this article, please visit the WIREs website. PMID:27126972

  6. Coexistence of Different Electron-Transfer Mechanisms in the DNA Repair Process by Photolyase.

    Science.gov (United States)

    Lee, Wook; Kodali, Goutham; Stanley, Robert J; Matsika, Spiridoula

    2016-08-01

    DNA photolyase has been the topic of extensive studies due to its important role of repairing photodamaged DNA, and its unique feature of using light as an energy source. A crucial step in the repair by DNA photolyase is the forward electron transfer from its cofactor (FADH(-) ) to the damaged DNA, and the detailed mechanism of this process has been controversial. In the present study, we examine the forward electron transfer in DNA photolyase by carrying out high-level ab initio calculations in combination with a quantum mechanical/molecular mechanical (QM/MM) approach, and by measuring fluorescence emission spectra at low temperature. On the basis of these computational and experimental results, we demonstrate that multiple decay pathways exist in DNA photolyase depending on the wavelength at excitation and the subsequent transition. This implies that the forward electron transfer in DNA photolyase occurs not only by superexchange mechanism but also by sequential electron transfer. PMID:27362906

  7. Characterization of DNA repair phenotypes of Xeroderma pigmentosum cell lines by a paralleled in vitro test

    International Nuclear Information System (INIS)

    DNA is constantly damaged modifying the genetic information for which it encodes. Several cellular mechanisms as the Base Excision Repair (BER) and the Nucleotide Excision Repair (NER) allow recovering the right DNA sequence. The Xeroderma pigmentosum is a disease characterised by a deficiency in the NER pathway. The aim of this study was to propose an efficient and fast test for the diagnosis of this disease as an alternative to the currently available UDS test. DNA repair activities of XP cell lines were quantified using in vitro miniaturized and paralleled tests in order to establish DNA repair phenotypes of XPA and XPC deficient cells. The main advantage of the tests used in this study is the simultaneous measurement of excision or excision synthesis (ES) of several lesions by only one cellular extract. We showed on one hand that the relative ES of the different lesions depend strongly on the protein concentration of the nuclear extract tested. Working at high protein concentration allowed discriminating the XP phenotype versus the control one, whereas it was impossible under a certain concentration's threshold. On the other hand, while the UVB irradiation of control cells stimulated their repair activities, this effect was not observed in XP cells. This study brings new information on the XPA and XPC protein roles during BER and NER and underlines the complexity of the regulations of DNA repair processes. (author)

  8. Polymorphisms in human DNA repair genes and head and neck squamous cell carcinoma

    Indian Academy of Sciences (India)

    Rim Khlifi; Ahmed Rebai; Amel Hamza-Chaffai

    2012-12-01

    Genetic polymorphisms in some DNA repair proteins are associated with a number of malignant transformations like head and neck squamous cell carcinoma (HNSCC). Xeroderma pigmentosum group D (XPD) and X-ray repair cross-complementing proteins 1 (XRCC1) and 3 (XRCC3) genes are involved in DNA repair and were found to be associated with HNSCC in numerous studies. To establish our overall understanding of possible relationships between DNA repair gene polymorphisms and development of HNSCC, we surveyed the literature on epidemiological studies that assessed potential associations with HNSCC risk in terms of gene–environment interactions, genotype-induced functional defects in enzyme activity and/or protein expression, and the influence of ethnic origin on these associations.We conclude that large, well-designed studies of common polymorphisms in DNA repair genes are needed. Such studies may benefit from analysis of multiple genes or polymorphisms and from the consideration of relevant exposures that may influence the likelihood of HNSCC when DNA repair capacity is reduced.

  9. Repair of DNA treated with γ-irradiation and chemical carcinogens. Final report, June 1, 1981-May 31, 1984

    International Nuclear Information System (INIS)

    Work done in the past three years has been on DNA repair, on genetic transposition and on the effect of carcinogens on alu sequence transcription. DNA repair work was completed on β-propiolactone DNA adducts, on procaryotic and eucaryotic enzymes capable of removal of 3-methyladenine from DNA, and on in vitro repair of neucleosomal core particle DNA and chromatin DNA. Attempts were made to isolate a human transposable element through the isolation of double stranded RNA and probing of a human library. Experiments were also done to determine whether carcinogens altered the expression of alu sequences in human DNA

  10. A possible role of repair proteins BRCA1 and DNA-PK in the processing of oxidative DNA damage

    Directory of Open Access Journals (Sweden)

    Alexandros G Georgakilas

    2008-08-01

    Full Text Available BRCA1 and DNA-PK are two significant multifunctional proteins involved primarily in the processing of double strand breaks (DSBs. BRCA1 participates actively in homologous recombination (HR while DNA-PK in non-homologous end joining (NHEJ. In this mini review, we discuss all recent evidence for a possible involvement of these repair proteins also in the processing of oxidatively-induced DNA damage.Keyword: DNA damage, BRCA1, DNA-PKReceived: 6 June 2008, Accepted: 10 August 2008 Published online: 18 August 2008

  11. Radiation- and drug-induced DNA repair in mammalian oocytes and embryos

    Energy Technology Data Exchange (ETDEWEB)

    Pedersen, R A; Brandriff, B

    1979-01-01

    A review of studies showing ultraviolet- or drug-induced unscheduled DNA synthesis in mammalian oocytes and embryos suggests that the female gamete has an excision repair capacity from the earliest stages of oocyte growth. The oocyte's demonstrable excision repair capacity decreases at the time of meiotic maturation for unknown reasons, but the fully mature oocyte maintans a repair capacity, in contrast to the mature sperm, and contributes this to the zygote. Early embryo cells maintain relatively constant levels of excision repair until late fetal stages, when they lose their capacity for excision repair. These apparent changes in excision repair capacity do not have a simple relationship to known differences in radiation sensitivity of germ cells and embryos.

  12. Radiation- and drug-induced DNA repair in mammalian oocytes and embryos

    International Nuclear Information System (INIS)

    A review of studies showing ultraviolet- or drug-induced unscheduled DNA synthesis in mammalian oocytes and embryos suggests that the female gamete has an excision repair capacity from the earliest stages of oocyte growth. The oocyte's demonstrable excision repair capacity decreases at the time of meiotic maturation for unknown reasons, but the fully mature oocyte maintans a repair capacity, in contrast to the mature sperm, and contributes this to the zygote. Early embryo cells maintain relatively constant levels of excision repair until late fetal stages, when they lose their capacity for excision repair. These apparent changes in excision repair capacity do not have a simple relationship to known differences in radiation sensitivity of germ cells and embryos

  13. Genomic survey and expression analysis of DNA repair genes in the genus Leptospira.

    Science.gov (United States)

    Martins-Pinheiro, Marinalva; Schons-Fonseca, Luciane; da Silva, Josefa B; Domingos, Renan H; Momo, Leonardo Hiroyuki Santos; Simões, Ana Carolina Quirino; Ho, Paulo Lee; da Costa, Renata M A

    2016-04-01

    Leptospirosis is an emerging zoonosis with important economic and public health consequences and is caused by pathogenic leptospires. The genus Leptospira belongs to the order Spirochaetales and comprises saprophytic (L. biflexa), pathogenic (L. interrogans) and host-dependent (L. borgpetersenii) members. Here, we present an in silico search for DNA repair pathways in Leptospira spp. The relevance of such DNA repair pathways was assessed through the identification of mRNA levels of some genes during infection in animal model and after exposition to spleen cells. The search was performed by comparison of available Leptospira spp. genomes in public databases with known DNA repair-related genes. Leptospires exhibit some distinct and unexpected characteristics, for instance the existence of a redundant mechanism for repairing a chemically diverse spectrum of alkylated nucleobases, a new mutS-like gene and a new shorter version of uvrD. Leptospira spp. shares some characteristics from Gram-positive, as the presence of PcrA, two RecQ paralogs and two SSB proteins; the latter is considered a feature shared by naturally competent bacteria. We did not find a significant reduction in the number of DNA repair-related genes in both pathogenic and host-dependent species. Pathogenic leptospires were enriched for genes dedicated to base excision repair and non-homologous end joining. Their evolutionary history reveals a remarkable importance of lateral gene transfer events for the evolution of the genus. Up-regulation of specific DNA repair genes, including components of SOS regulon, during infection in animal model validates the critical role of DNA repair mechanisms for the complex interplay between host/pathogen. PMID:26527082

  14. Neocarzinostatin-mediated DNA damage and repair in wild-type and repair-deficient Chinese hamster ovary cells

    International Nuclear Information System (INIS)

    The formation and repair of neocarzinostatin (NCS)-mediated DNA damage were examined in two strains of Chinese hamster ovary cells. The response in strain EM9, a mutant line selected for its sensitivity to ethyl methanesulfonate and shown to have a defect in the repair of X-ray-induced DNA breaks, was compared with that observed in the parental strain (AA8). The DNA strand breaks and their subsequent rejoining were measured using the method of elution of DNA from filters under either alkaline (for single-strand breaks), or nondenaturing conditions (for double-strand breaks). Colony survival assays showed that the mutant was more sensitive to the action of NCS than was the parental strain by a factor of approximately 1.5. Elution analyses showed that the DNA from both strains was damaged by NCS; the mutant displayed more damage than the parent under the same treatment conditions. Single-strand breaks were produced with a frequency of about 10 to 15 times the frequency of double-strand breaks. Both strains were able to rejoin both single-strand breaks and double-strand breaks induced by NCS treatment. The strand break data suggest that the difference in NCS-mediated cytotoxicity between EM9 and AA8 cells may be directly related to the enhanced production of DNA strand breaks in EM9. However, the fact that much higher doses of NCS were required in the DNA studies compared to the colony survival assays implies that either a small number of DNA breaks occur in a critical region of the genome, or that lesions other than DNA strand breaks are partly responsible for the observed cytotoxicity

  15. Regulation of DNA double-strand break repair by ubiquitin and ubiquitin-like modifiers

    DEFF Research Database (Denmark)

    Schwertman, Petra; Bekker-Jensen, Simon; Mailand, Niels

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions. The swift recognition and faithful repair of such damage is crucial for the maintenance of genomic stability, as well as for cell and organismal fitness. Signalling by ubiquitin, SUMO and other ubiquitin-like modifiers (UBLs...

  16. DNA repair enables sex identification in genetic material from human teeth

    NARCIS (Netherlands)

    Kovatsi, L.; Nikou, D.; Triantaphyllou, S.; Njau, S. N.; Voutsaki, S.; Kouidou, S.

    2009-01-01

    Background: The purpose of this study was to test the effectiveness of a DNA repair protocol in improving genetic testing in compromised samples, frequently encountered in Forensic Medicine. Methods: In order to stretch the experiment conditions to the limits, as far as quality of samples and DNA is

  17. Colocalization of multiple DNA double-strand breaks at a single Rad52 repair centre

    DEFF Research Database (Denmark)

    Lisby, M.; Mortensen, Uffe Hasbro; Rothstein, R.

    2003-01-01

    DNA double-strand break repair (DSBR) is an essential process for preserving genomic integrity in all organisms. To investigate this process at the cellular level, we engineered a system of fluorescently marked DNA double-strand breaks (DSBs) in the yeast Saccharomyces cerevisiae to visualize in...

  18. Magnesium coordination controls the molecular switch function of DNA mismatch repair protein MutS

    NARCIS (Netherlands)

    J.H.G. Lebbink (Joyce); A. Fish (Alexander); A. Reumer (Annet); G. Natrajan; H.H.K. Winterwerp (Herrie); T.K. Sixma (Titia)

    2010-01-01

    textabstractThe DNA mismatch repair protein MutS acts as a molecular switch. It toggles between ADP and ATP states and is regulated by mismatched DNA. This is analogous to G-protein switches and the regulation of their "on" and "off" states by guanine exchange factors. Although GDP release in monome

  19. Nrf2 facilitates repair of radiation induced DNA damage through homologous recombination repair pathway in a ROS independent manner in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Jayakumar, Sundarraj; Pal, Debojyoti; Sandur, Santosh K., E-mail: sskumar@barc.gov.in

    2015-09-15

    Highlights: • Nrf2 inhibition in A549 cells led to attenuated DNA repair and radiosensitization. • Influence of Nrf2 on DNA repair is not linked to its antioxidant function. • Nrf2 influences DNA repair through homologous recombination (HR) repair pathway. • Many genes involved in HR pathway show ARE sequences in their upstream region. - Abstract: Nrf2 is a redox sensitive transcription factor that is involved in the co-ordinated transcription of genes involved in redox homeostasis. But the role of Nrf2 in DNA repair is not investigated in detail. We have employed A549 and MCF7 cells to study the role of Nrf2 on DNA repair by inhibiting Nrf2 using all-trans retinoic acid (ATRA) or by knock down approach prior to radiation exposure (4 Gy). DNA damage and repair analysis was studied by γH2AX foci formation and comet assay. Results suggested that the inhibition of Nrf2 in A549 or MCF7 cells led to significant slowdown in DNA repair as compared to respective radiation controls. The persistence of residual DNA damage even in the presence of free radical scavenger N-acetyl cysteine, suggested that the influence of Nrf2 on DNA repair was not linked to its antioxidant functions. Further, its influence on non-homologous end joining repair pathway was studied by inhibiting both Nrf2 and DNA-PK together. This led to synergistic reduction of survival fraction, indicating that Nrf2 may not be influencing the NHEJ pathway. To investigate the role of homologous recombination repair (HR) pathway, RAD51 foci formation was monitored. There was a significant reduction in the foci formation in cells treated with ATRA or shRNA against Nrf2 as compared to their respective radiation controls. Further, Nrf2 inhibition led to significant reduction in mRNA levels of RAD51. BLAST analysis was also performed on upstream regions of DNA repair genes to identify antioxidant response element and found that many repair genes that are involved in HR pathway may be regulated by Nrf2

  20. Nrf2 facilitates repair of radiation induced DNA damage through homologous recombination repair pathway in a ROS independent manner in cancer cells

    International Nuclear Information System (INIS)

    Highlights: • Nrf2 inhibition in A549 cells led to attenuated DNA repair and radiosensitization. • Influence of Nrf2 on DNA repair is not linked to its antioxidant function. • Nrf2 influences DNA repair through homologous recombination (HR) repair pathway. • Many genes involved in HR pathway show ARE sequences in their upstream region. - Abstract: Nrf2 is a redox sensitive transcription factor that is involved in the co-ordinated transcription of genes involved in redox homeostasis. But the role of Nrf2 in DNA repair is not investigated in detail. We have employed A549 and MCF7 cells to study the role of Nrf2 on DNA repair by inhibiting Nrf2 using all-trans retinoic acid (ATRA) or by knock down approach prior to radiation exposure (4 Gy). DNA damage and repair analysis was studied by γH2AX foci formation and comet assay. Results suggested that the inhibition of Nrf2 in A549 or MCF7 cells led to significant slowdown in DNA repair as compared to respective radiation controls. The persistence of residual DNA damage even in the presence of free radical scavenger N-acetyl cysteine, suggested that the influence of Nrf2 on DNA repair was not linked to its antioxidant functions. Further, its influence on non-homologous end joining repair pathway was studied by inhibiting both Nrf2 and DNA-PK together. This led to synergistic reduction of survival fraction, indicating that Nrf2 may not be influencing the NHEJ pathway. To investigate the role of homologous recombination repair (HR) pathway, RAD51 foci formation was monitored. There was a significant reduction in the foci formation in cells treated with ATRA or shRNA against Nrf2 as compared to their respective radiation controls. Further, Nrf2 inhibition led to significant reduction in mRNA levels of RAD51. BLAST analysis was also performed on upstream regions of DNA repair genes to identify antioxidant response element and found that many repair genes that are involved in HR pathway may be regulated by Nrf2