WorldWideScience

Sample records for breakage dna repair

  1. DNA breakage, repair and lethality after 125I decay in rec+ and recA strains of Escherichia coli

    International Nuclear Information System (INIS)

    Iodine-125 decays by electron capture and is known to cause extensive molecular fragmentation via the Auger effect. 125I was incorporated into the DNA of exponentially-growing E. coli K12 AB2487, a recA mutant, and E. coli K12 AB2497, the corresponding rec+ strain as 5-iododeoxyuridine (IUdR), an analogue of thymidine. Radioactive bacteria were stored at -1960C, and samples were periodically assayed for loss of viability and for the induction of double-strand breaks (DSBs) in DNA. Each 125I decay in the DNA of either strain induced one DSB, i.e. proportional to (DSB) = 1.0. For the recA strain, proportional to (lethal) = 0.9 and for the rec+ strain, 0.4. Assays for biological repair of DSBs, involving incubation of thawed samples in growth-medium at 370C before the extraction of DNA, demonstrated significant repair of 125I-induced DSBs by rec+ cells but none by recA cells. For small numbers of decays, there was approximately a 1 : 1 correlation, for either strain, between lethal decays and post-incubation residual DSBs. Comparison with data for larger numbers of decays indicated that a typical rec+ cell can repair no more than three to four DSBs per completed genome (2.5 x 109 daltons). (author)

  2. DNA breakage drives nuclear search

    OpenAIRE

    Ira, Grzegorz; Hastings, Philip J.

    2012-01-01

    The search for a homologous template is a fundamental, yet largely uncharacterized, reaction in DNA double-strand break repair. Two reports now demonstrate that broken chromosomes increase their movement and explore large volumes of nuclear space searching for a homologous template. Break mobility requires resection and recombination enzymes, as well as damage-checkpoint components.

  3. Estimates of DNA strand breakage in bottlenose dolphin (Tursiops truncatus)

    OpenAIRE

    Blanco, M.; Cruz, D.; Carro, S.; López, R.; Díaz, A.; Santiago, L; Guevara, C.; Sánchez, L.; Cuetara, E.B.; López, N.

    2009-01-01

    The analysis of DNA damage by mean of Comet or single cell gel electrophoresis (SCGE) assay has been commonly used to assess genotoxic impact in aquatic animals being able to detect exposure to low concentrations of contaminants in a wide range of species. The aims of this work were 1) to evaluate the usefulness of the Comet to detect DNA strand breakage in dolphin leukocytes, 2) to use the DNA diffusion assay to determine the amount of DNA strand breakage associated with apoptosi...

  4. DNA双链断裂与同源重组修复的研究进展%Advance in Research of Homologous Recombination Repair in DNA Double Strands Breakage

    Institute of Scientific and Technical Information of China (English)

    董隽; 张天; 碧秀

    2015-01-01

    DNA双链断裂(DSB)是细胞受到电离辐射后最严重的DNA损伤,导致细胞凋亡、细胞周期阻滞以及DNA损伤修复。DNA损伤发生后,激活细胞内DNA损伤应答,启动DSB修复通路同源重组(HR)和非同源重组末端连接(NHEJ)。HR修复分为联会前期、联会期和联会后期,以姐妹染色单体为模板,进行无错误修复,是保护基因组完整性的主要机制。对IR导致的DSB HR和NHEJ具有互补关系,G2和S期HR是主要修复方式。HR是肿瘤发病风险、预后指标和治疗靶点,合成致死是HR用于肿瘤靶向治疗的重要机制。本文主要对DSB修复过程中所涉及HR修复通路中的分子机制、合成致死概念及其与NHEJ修复的关系作一综述,并探讨其成为转化医学研究和潜在临床应用的可能性。%DNA double strand breakage (DSB) is the most significantly biological effect when cells are exposed to ionizing radiation (IR) which may result in apoptosis, checkpoint arrest, cellular senescence and DSB repair. DNA damage response (DDR) is activated with induction of DNA damage. The mechanisms involved in DSB repair include homologous recombination (HR) and non-homologous end-joining (NHEJ). HR, a template-dependent and mostly error-free pathway, plays a crucial role in protecting genome fidelity from DSB. It can be divided into three phases including presynaptic, synaptic and postsynaptic phases. For the repair of DSBs caused by IR, HR is mainly restricted in G2 and S phases while NHEJ and HR function complementarily. HR is related to the risk of tumorigenesis, predicts the survival of several kinds of carcinoma and is a novel target of cancer therapy. This article has comprehensively reviewed the progress in understanding of the mechanism of HR repair, its associated factors affecting the fidelity in DSB repair, the concept of synthetic lethality and its association with NHEJ repair. The potential of its clinical application by

  5. Protection of DNA strand breakage by radiation exposure

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jeong Ho; Kim, In Gyu; Lee, Kang Suk; Kim, Kug Chan; Shim, Hae Won

    1997-12-01

    Human ceruloplasmin, the plasma copper containing protein, is thought to play an essential role in iron metabolism, but it also has antioxidant properties. Ceruloplasmin directly scavenged hydroxyl radicals (.OH) generated in dithiothreitol/FeCl{sub 3} system besides inhibitory function of hydroxyl radical formation and lipid peroxidation. Polyamines, spermidine and spermine, significantly protected the supercoiled DNA strand breakage by hydroxyl radicals and DNA strand breakage by UV was highly protected by all four polyamines used in this study. In polyamine deficient mutant KL527. It was shown that cell survivability following UV irradiation was slightly increased by exogenous polyamines putrescine and spermidine supplement. However the cell survivability of wild type (MG 1655) was not influenced by polyamine supplement. In {gamma}-irradiated cells, cell survivability of polyamine-deficient mutant strain KL527 was significantly increased by exogenous putrescine supplement and that of wild type strain MG1655 was similar irrespective of polyamine supplement. These results implicate the possibility that polyamines play a potent role in radioprotection of cell and DNA level. (author). 32 refs., 8 figs

  6. Workshop on DNA repair.

    NARCIS (Netherlands)

    A.R. Lehmann (Alan); J.H.J. Hoeijmakers (Jan); A.A. van Zeeland (Albert); C.M.P. Backendorf (Claude); B.A. Bridges; A. Collins; R.P.D. Fuchs; G.P. Margison; R. Montesano; E. Moustacchi; A.T. Natarajan; M. Radman; A. Sarasin; E. Seeberg; C.A. Smith; M. Stefanini (Miria); L.H. Thompson; G.P. van der Schans; C.A. Weber (Christine); M.Z. Zdzienika

    1992-01-01

    textabstractA workshop on DNA repair with emphasis on eukaryotic systems was held, under the auspices of the EC Concerted Action on DNA Repair and Cancer, at Noordwijkerhout (The Netherlands) 14-19 April 1991. The local organization of the meeting was done under the auspices of the Medical Genetic C

  7. DNA repair protocols

    DEFF Research Database (Denmark)

    Bjergbæk, Lotte

    In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...

  8. Optimality in DNA repair.

    Science.gov (United States)

    Richard, Morgiane; Fryett, Matthew; Miller, Samantha; Booth, Ian; Grebogi, Celso; Moura, Alessandro

    2012-01-01

    DNA within cells is subject to damage from various sources. Organisms have evolved a number of mechanisms to repair DNA damage. The activity of repair enzymes carries its own risk, however, because the repair of two nearby lesions may lead to the breakup of DNA and result in cell death. We propose a mathematical theory of the damage and repair process in the important scenario where lesions are caused in bursts. We use this model to show that there is an optimum level of repair enzymes within cells which optimises the cell's response to damage. This optimal level is explained as the best trade-off between fast repair and a low probability of causing double-stranded breaks. We derive our results analytically and test them using stochastic simulations, and compare our predictions with current biological knowledge. PMID:21945337

  9. Sophoridinol derivative 05D induces tumor cells apoptosis by topoisomerase1-mediated DNA breakage

    Directory of Open Access Journals (Sweden)

    Zhao W

    2016-05-01

    Full Text Available Wuli Zhao, Caixia Zhang, Chongwen Bi, Cheng Ye, Danqing Song, Xiujun Liu, Rongguang Shao Key Laboratory of Antibiotic Bioengineering, Ministry of Health, Laboratory of Oncology, Institute of Medicinal Biotechnology, Peking Union Medical College and Chinese Academy of Medical Sciences, Beijing, People’s Republic of China Abstract: Sophoridine is a quinolizidine natural product of Sophora alopecuroides and has been applied for treatment of malignant trophoblastic tumors. Although characterized by low toxicity, the limited-spectrum antitumor activity hinders its further applications. 05D, a derivative of sophoridine, exhibits a better anticancer activity on diverse cancer cells, including solid tumors, and hematologic malignancy. It could inhibit topoisomerase 1 (top1 activity by stabilizing DNA–top1 complex and induce mitochondria-mediated apoptosis by promoting DNA single- and double-strand breakage mediated by top1. Also, 05D induced HCT116 cells arrest at G1 phase by inactivating CDK2/CDK4–Rb–E2F and cyclinD1–CDK4–p21 checkpoint signal pathways. 05D suppressed the ataxia telangiectasia mutated (ATM and ATM and Rad3-related (ATR activation and decreased 53BP level, which contributed to DNA damage repair, suggesting that the novel compound 05D might be helpful to improve the antitumor activity of DNA damaging agent by repressing ATM and ATR activation and 53BP level. In addition, the priorities in molecular traits and druggability, such as a simple structure and formulation for oral administration, further prove 05D to be a promising targeting topoisomerase agent. Keywords: topoisomerase inhibitor, topoisomerase 1, DNA breakage, sophoridinol, anticancer, apoptosis, cell cycle

  10. Estimates of DNA strand breakage in bottlenose dolphin (Tursiops truncatus) leukocytes measured with the Comet and DNA diffusion assays

    OpenAIRE

    Adriana Díaz; Sandra Carro; Livia Santiago; Juan Estévez; Celia Guevara; Miriam Blanco; Laima Sánchez; Liena Sánchez; Nirka López; Danilo Cruz; Ronar López; Cuetara, Elizabeth B.; Jorge Luis Fuentes

    2009-01-01

    The analysis of DNA damage by mean of Comet or single cell gel electrophoresis (SCGE) assay has been commonly used to assess genotoxic impact in aquatic animals being able to detect exposure to low concentrations of contaminants in a wide range of species. The aims of this work were 1) to evaluate the usefulness of the Comet to detect DNA strand breakage in dolphin leukocytes, 2) to use the DNA diffusion assay to determine the amount of DNA strand breakage associated with apoptosis or necrosi...

  11. Estimates of DNA strand breakage in bottlenose dolphin (Tursiops truncatus leukocytes measured with the Comet and DNA diffusion assays

    Directory of Open Access Journals (Sweden)

    Adriana Díaz

    2009-01-01

    Full Text Available The analysis of DNA damage by mean of Comet or single cell gel electrophoresis (SCGE assay has been commonly used to assess genotoxic impact in aquatic animals being able to detect exposure to low concentrations of contaminants in a wide range of species. The aims of this work were 1 to evaluate the usefulness of the Comet to detect DNA strand breakage in dolphin leukocytes, 2 to use the DNA diffusion assay to determine the amount of DNA strand breakage associated with apoptosis or necrosis, and 3 to determine the proportion of DNA strand breakage that was unrelated to apoptosis and necrosis. Significant intra-individual variation was observed in all of the estimates of DNA damage. DNA strand breakage was overestimated because a considerable amount (~29% of the DNA damage was derived from apoptosis and necrosis. The remaining DNA damage in dolphin leukocytes was caused by factors unrelated to apoptosis and necrosis. These results indicate that the DNA diffusion assay is a complementary tool that can be used together with the Comet assay to assess DNA damage in bottlenose dolphins.

  12. Estimates of DNA strand breakage in bottlenose dolphin (Tursiops truncatus) leukocytes measured with the Comet and DNA diffusion assays.

    Science.gov (United States)

    Díaz, Adriana; Carro, Sandra; Santiago, Livia; Estévez, Juan; Guevara, Celia; Blanco, Miriam; Sánchez, Laima; Sánchez, Liena; López, Nirka; Cruz, Danilo; López, Ronar; Cuetara, Elizabeth B; Fuentes, Jorge Luis

    2009-04-01

    The analysis of DNA damage by mean of Comet or single cell gel electrophoresis (SCGE) assay has been commonly used to assess genotoxic impact in aquatic animals being able to detect exposure to low concentrations of contaminants in a wide range of species. The aims of this work were 1) to evaluate the usefulness of the Comet to detect DNA strand breakage in dolphin leukocytes, 2) to use the DNA diffusion assay to determine the amount of DNA strand breakage associated with apoptosis or necrosis, and 3) to determine the proportion of DNA strand breakage that was unrelated to apoptosis and necrosis. Significant intra-individual variation was observed in all of the estimates of DNA damage. DNA strand breakage was overestimated because a considerable amount (~29%) of the DNA damage was derived from apoptosis and necrosis. The remaining DNA damage in dolphin leukocytes was caused by factors unrelated to apoptosis and necrosis. These results indicate that the DNA diffusion assay is a complementary tool that can be used together with the Comet assay to assess DNA damage in bottlenose dolphins. PMID:21637693

  13. DNA strand breakage by 125I-decay in oligoDNA

    International Nuclear Information System (INIS)

    Full text: A double-stranded oligodeoxynucleotide containing 125I-dC in a defined location, with 5'- or 3'-32P-end-labelling of either strand, was used to investigate DNA strand breakage resulting from 125I decay. Samples of the 32P-end-labelled and 125I-dC containing oligoDNA were incubated in 20 mM phosphate buffer (PB), or PB + 2 M dimethylsulphoxide (DMSO) at 4 deg during 18-20 days. The 32P-end-labelled DNA fragments produced by 125I decays were separated on denaturing polyacrylamide gels, and the 3P activity in each fragment was determined by scintillation counting after elution from the gel. The fragment size distribution was then converted to a distribution of single stranded break probabilities at each nucleotide position. The results indicate that each 125I decay event produces at least one break in the 125I-dC containing strand, and causes breakage of the opposite strand in 75-80% of events. Thus, the double stranded break is produced by 125I decay with probability ∼0.8. Most of single stranded breaks (around 90%) occurred within 5-6 nucleotides of the 125I-dC, however DNA breaks were detected up to 18-20 nucleotides from the decay site. The average numbers of single stranded breaks per decay are 3.7 (PB) and 3.3 (PB+DMSO) in 125I-dC containing strand, and 1.5 (PB) and 1.3 (PB+DMSO) in the opposite strand. Deconvolution of strand break probabilities as a function of separation from the 125I, in terms of both distance (to target deoxyribosyl carbon atoms, in B-DNA) and nucleotide number, show that the latter is an important parameter for the shorter-range damage. This could indicate a role for attenuation/dissipation of damage through the stacked bases. In summary, the results represent a much more extensive set of data than available from earlier experiments on DNA breakage from l25I-decay, and may provide new mechanistic insights

  14. DNA repair deficiency in neurodegeneration

    DEFF Research Database (Denmark)

    Jeppesen, Dennis Kjølhede; Bohr, Vilhelm A; Stevnsner, Tinna V.

    2011-01-01

    Deficiency in repair of nuclear and mitochondrial DNA damage has been linked to several neurodegenerative disorders. Many recent experimental results indicate that the post-mitotic neurons are particularly prone to accumulation of unrepaired DNA lesions potentially leading to progressive...... neurodegeneration. Nucleotide excision repair is the cellular pathway responsible for removing helix-distorting DNA damage and deficiency in such repair is found in a number of diseases with neurodegenerative phenotypes, including Xeroderma Pigmentosum and Cockayne syndrome. The main pathway for repairing oxidative...... base lesions is base excision repair, and such repair is crucial for neurons given their high rates of oxygen metabolism. Mismatch repair corrects base mispairs generated during replication and evidence indicates that oxidative DNA damage can cause this pathway to expand trinucleotide repeats, thereby...

  15. Demonstration of DNA strand breakage induced by ultraviolet light

    International Nuclear Information System (INIS)

    The initial event in cellular carcinogenesis likely involves changes in the DNA at both the gene and chromosome levels, resulting from damage to the cell by outside agents. The authors have developed a visually striking experiment that demonstrates the damage to DNA caused by the common carcinogen, ultraviolet radiation. The protocol, suitable for undergraduate biochemistry and molecular biology courses, can be executed in one 3-4 hour laboratory period. Students become familiar with several common biochemical techniques, including electrophoretic separation of DNA molecules on horizontal agarose gels, measurement of microliter volumes, and the use of ultraviolet light sources. The experiment can be used to introduce diverse topics, including DNA biochemistry, reactive oxygen species, and cancer prevention

  16. Analysis of length distribution of short DNA fragments induced by 7Li ions using the random-breakage model

    Institute of Scientific and Technical Information of China (English)

    KONG Fuquan; ZHAO Kui; ZHAN Yong; CAO Tianguang; NI Meinan; SUI Li; CAI Minghui; ZHUO Yizhong

    2005-01-01

    Deoxyribonucleic acid (DNA) is an important bio-macromolecule. DNA double strand breaks (DSBs) are considered to be the most important initial damage responsible for all biological effects induced by ionizing radiation. In this paper the length distribution of DNA fragments induced by 7Li ionizing radiation is fitted with the random breakage model. In this model, the parameter u is the average number of DSBs on every DNA molecule induced by ionizing radiation. The fitting result shows that the random breakage model cannot describe the distribution of DNA fragments in lower doses, while the random breakage model is in better accordance with the experimental data in higher doses. It is shown that the length distribution of DNA fragments has random statistical feature in higher doses. In this situation, the random breakage model looks like a model without any parameter since the u has specific physical meaning and can directly be obtained from experimental data.

  17. Rethinking transcription coupled DNA repair.

    Science.gov (United States)

    Kamarthapu, Venu; Nudler, Evgeny

    2015-04-01

    Nucleotide excision repair (NER) is an evolutionarily conserved, multistep process that can detect a wide variety of DNA lesions. Transcription coupled repair (TCR) is a subpathway of NER that repairs the transcribed DNA strand faster than the rest of the genome. RNA polymerase (RNAP) stalled at DNA lesions mediates the recruitment of NER enzymes to the damage site. In this review we focus on a newly identified bacterial TCR pathway in which the NER enzyme UvrD, in conjunction with NusA, plays a major role in initiating the repair process. We discuss the tradeoff between the new and conventional models of TCR, how and when each pathway operates to repair DNA damage, and the necessity of pervasive transcription in maintaining genome integrity. PMID:25596348

  18. 37. Effect of Ni2O3 on DNA strand breakage and gene expression

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    @@In order to study the possible mechanism of carcinogenisis by Nickel compound to find sensitive, specific monitoring index for nickel induced carcinogenesis, the methods based on single cell gel electrophoresis to assay (comet assay ) Ni2O3, -induced DNA breakage of human embryo lung cell. Arbitrary primed PCR in combination with methylation-sensitive restriction enzyme Hha Ⅱ digestion and bisulphate genomic conversion was used to analyse the CpG island methylation pattern variation of

  19. Aging and DNA repair capability. [Review

    Energy Technology Data Exchange (ETDEWEB)

    Tice, R R

    1977-01-01

    A review of the literature on DNA repair processes in relation to aging is presented under the following headings: DNA repair processes; age-related occurrence of unrepaired DNA lesions; DNA repair capability as a function of age; tissue-specific DNA repair capability; acceleration of the aging process by exposure to DNA damaging agents; human genetic syndromes; and longevity and DNA repair processes. (HLW)

  20. Rethinking Transcription Coupled DNA Repair

    OpenAIRE

    Kamarthapu, Venu; Nudler, Evgeny

    2015-01-01

    Nucleotide excision repair (NER) is an evolutionarily conserved, multistep process that can detect a wide variety of DNA lesions. Transcription coupled repair (TCR) is a sub-pathway of NER that repairs the transcribed DNA strand faster than the rest of the genome. RNA polymerase (RNAP) stalled at DNA lesions mediates the recruitment of NER enzymes to the damage site. In this review we focus on a newly identified bacterial TCR pathway in which the NER enzyme UvrD, in conjunction with NusA, pla...

  1. DNA encoding a DNA repair protein

    Science.gov (United States)

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-08-15

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  2. Chromosome breakages associated with 45S ribosomal DNA sequences in spotted snakehead fish Channa punctatus.

    Science.gov (United States)

    Singh, Mamta; Barman, Anindya Sundar

    2013-01-01

    It is well known that transcriptionally inactive rRNA genes are correlated with DNA hyper-methylation and histone hypo-methylation and there is clear evidence in humans that DNA and histone modification which alter chromatin structure are related to chromosome fragility. Very little is known about the biological cause of 45S rDNA fragility. In this report we characterized the chromosome breakage or gap associated with 45S rDNA in a fish species Channa punctatus. The rDNA mapping in C. punctatus, showed many chromosome breakages or gap formations, and all occurred exclusively in the 45S rDNA sites in anterior kidney cells. We observed that the number of chromosomes plus chromosome fragments was often more than the expected 32 in most cells. Total 67 % metaphase spread showed the expected or normal 32 chromosomes, while 33 % metaphase spread showed 33 and/or 34 chromosomes and/or chromosome fragments. The chromosome lesions observed in this study are very similar cytologically to that of fragile sites observed in human chromosomes. Possible causes for the spontaneous expression of fragile sites and their potential biological significance are also discussed in present report.

  3. Mammalian DNA Repair. Final Report

    Energy Technology Data Exchange (ETDEWEB)

    None

    2003-01-24

    The Gordon Research Conference (GRC) on Mammalian DNA Repair was held at Harbortown Resort, Ventura Beach, CA. Emphasis was placed on current unpublished research and discussion of the future target areas in this field.

  4. DNA Repair Defects and Chromosomal Aberrations

    Science.gov (United States)

    Hada, Megumi; George, K. A.; Huff, J. L.; Pluth, J. M.; Cucinotta, F. A.

    2009-01-01

    Yields of chromosome aberrations were assessed in cells deficient in DNA doublestrand break (DSB) repair, after exposure to acute or to low-dose-rate (0.018 Gy/hr) gamma rays or acute high LET iron nuclei. We studied several cell lines including fibroblasts deficient in ATM (ataxia telangiectasia mutated; product of the gene that is mutated in ataxia telangiectasia patients) or NBS (nibrin; product of the gene mutated in the Nijmegen breakage syndrome), and gliomablastoma cells that are proficient or lacking in DNA-dependent protein kinase (DNA-PK) activity. Chromosomes were analyzed using the fluorescence in situ hybridization (FISH) chromosome painting method in cells at the first division post irradiation, and chromosome aberrations were identified as either simple exchanges (translocations and dicentrics) or complex exchanges (involving >2 breaks in 2 or more chromosomes). Gamma irradiation induced greater yields of both simple and complex exchanges in the DSB repair-defective cells than in the normal cells. The quadratic dose-response terms for both simple and complex chromosome exchanges were significantly higher for the ATM- and NBS-deficient lines than for normal fibroblasts. However, in the NBS cells the linear dose-response term was significantly higher only for simple exchanges. The large increases in the quadratic dose-response terms in these repair-defective cell lines points the importance of the functions of ATM and NBS in chromatin modifications to facilitate correct DSB repair and minimize the formation of aberrations. The differences found between ATM- and NBS-deficient cells at low doses suggest that important questions should with regard to applying observations of radiation sensitivity at high dose to low-dose exposures. For aberrations induced by iron nuclei, regression models preferred purely linear dose responses for simple exchanges and quadratic dose responses for complex exchanges. Relative biological effectiveness (RBE) factors of all of

  5. DNA repair in Chromobacterium violaceum.

    Science.gov (United States)

    Duarte, Fábio Teixeira; Carvalho, Fabíola Marques de; Bezerra e Silva, Uaska; Scortecci, Kátia Castanho; Blaha, Carlos Alfredo Galindo; Agnez-Lima, Lucymara Fassarella; Batistuzzo de Medeiros, Silvia Regina

    2004-03-31

    Chromobacterium violaceum is a Gram-negative beta-proteobacterium that inhabits a variety of ecosystems in tropical and subtropical regions, including the water and banks of the Negro River in the Brazilian Amazon. This bacterium has been the subject of extensive study over the last three decades, due to its biotechnological properties, including the characteristic violacein pigment, which has antimicrobial and anti-tumoral activities. C. violaceum promotes the solubilization of gold in a mercury-free process, and has been used in the synthesis of homopolyesters suitable for the production of biodegradable polymers. The complete genome sequence of this organism has been completed by the Brazilian National Genome Project Consortium. The aim of our group was to study the DNA repair genes in this organism, due to their importance in the maintenance of genomic integrity. We identified DNA repair genes involved in different pathways in C. violaceum through a similarity search against known sequences deposited in databases. The phylogenetic analyses were done using programs of the PHILYP package. This analysis revealed various metabolic pathways, including photoreactivation, base excision repair, nucleotide excision repair, mismatch repair, recombinational repair, and the SOS system. The similarity between the C. violaceum sequences and those of Neisserie miningitidis and Ralstonia solanacearum was greater than that between the C. violaceum and Escherichia coli sequences. The peculiarities found in the C. violaceum genome were the absence of LexA, some horizontal transfer events and a large number of repair genes involved with alkyl and oxidative DNA damage.

  6. DNA repair in PHA stimulated human lymphocytes

    International Nuclear Information System (INIS)

    Damage an repair of radiation induced DNA strand breaks were measured by alkaline lysis and hydroxyapatite chromatography. PHA stimulated human lymphocytes show that the rejoining process is complete within the first 50 min., afterwords secondary DNA damage and chromatid aberration. DNA repair, in synchronized culture, allows to evaluate individual repair capacity and this in turn can contribute to the discovery of individual who, although they do not demonstrate apparent clinical signs, are carriers of DNA repair deficiency. Being evident that a correlation exists between DNA repair capacity and carcinogenesis, the possibility of evaluating the existent relationship between DNA repair and survival in tumor cells comes therefore into discussion

  7. Important DNA repair proteins in DNA double-strand break repair pathways

    International Nuclear Information System (INIS)

    DNA double-strand break repair pathway is one of DNA damage repair pathways. DNA repair genes can repair DNA damage, maintain the integrity of the genetic information and inhibit the formation of tumors. There are two mechanisms-non-homologous end joining and homologous recombination to repair DNA double-strand break. In this review, an overview of important repair proteins of non--homologous end joining and homologous recombination pathways was introduced. (authors)

  8. Inhibition of human Chk1 causes increased initiation of DNA replication, phosphorylation of ATR targets, and DNA breakage

    DEFF Research Database (Denmark)

    Syljuåsen, Randi G; Sørensen, Claus Storgaard; Hansen, Lasse Tengbjerg;

    2005-01-01

    -nuclear phosphorylation of histone H2AX, p53, Smc1, replication protein A, and Chk1 itself in human S-phase cells. These phosphorylations were inhibited by ATR siRNA and caffeine, but they occurred independently of ATM. Chk1 inhibition also caused an increased initiation of DNA replication, which was accompanied by...... increased amounts of nonextractable RPA protein, formation of single-stranded DNA, and induction of DNA strand breaks. Moreover, these responses were prevented by siRNA-mediated downregulation of Cdk2 or the replication initiation protein Cdc45, or by addition of the CDK inhibitor roscovitine. We propose...... that Chk1 is required during normal S phase to avoid aberrantly increased initiation of DNA replication, thereby protecting against DNA breakage. These results may help explain why Chk1 is an essential kinase and should be taken into account when drugs to inhibit this kinase are considered for use in...

  9. DNA polymerase δ and DNA repair: DNA repair synthesis in human fibroblasts requires DNA polymerase δ

    International Nuclear Information System (INIS)

    When UV-irradiated cultured diploid human fibroblasts were permeabilized with Brij-58 then separated from soluble material by centrifugation, conservative DNA repair synthesis could be restored by a soluble factor obtained from the supernate of similarly treated HeLa cells. Monoclonal antibody to KB cell DNA polymerase α, while binding to HeLa DNA polymerase α, did not bind to the HeLa DNA polymerase δ. Moreover, at micromolar concentrations N2-(p-n-butylphenyl)-2'-deoxyguanosine 5'-triphosphate (BuPdGT) and 2(p-n-butylanilino)-2'-deoxyadenosine 5'-triphosphate (BuAdATP) were potent inhibitors of DNA polymerase α, but did not inhibit the DNA polymerase δ. Neither purified DNA polymerase α nor β could promote repair DNA synthesis in the permeabilized cells. Furthermore, if monoclonal antibodies to DNA polymerase α BuPdGTP, or BuAdATP was added to the reconstituted system, there was no significant inhibition

  10. How quantum entanglement in DNA synchronizes double-strand breakage by type II restriction endonucleases.

    Science.gov (United States)

    Kurian, P; Dunston, G; Lindesay, J

    2016-02-21

    Macroscopic quantum effects in living systems have been studied widely in pursuit of fundamental explanations for biological energy transport and sensing. While it is known that type II endonucleases, the largest class of restriction enzymes, induce DNA double-strand breaks by attacking phosphodiester bonds, the mechanism by which simultaneous cutting is coordinated between the catalytic centers remains unclear. We propose a quantum mechanical model for collective electronic behavior in the DNA helix, where dipole-dipole oscillations are quantized through boundary conditions imposed by the enzyme. Zero-point modes of coherent oscillations would provide the energy required for double-strand breakage. Such quanta may be preserved in the presence of thermal noise by the enzyme's displacement of water surrounding the DNA recognition sequence. The enzyme thus serves as a decoherence shield. Palindromic mirror symmetry of the enzyme-DNA complex should conserve parity, because symmetric bond-breaking ceases when the symmetry of the complex is violated or when physiological parameters are perturbed from optima. Persistent correlations in DNA across longer spatial separations-a possible signature of quantum entanglement-may be explained by such a mechanism.

  11. A method of calculating initial DNA strand breakage following the decay of incorporated 125I

    International Nuclear Information System (INIS)

    Two sources of individual Auger electron spectra and an electron track code were used with a simple model of the DNA to successfully simulate single-strand DNA breakage measured by Martin and Haseltine (1981). Conditions of the calculation were then extended to examine patterns of single-strand breaks in both strands of the DNA duplex to score double-strand breaks. Five types of break were scored. The total number of double-strand breaks (dsb) per decay at the site of the decay was 0.90 and 0.65 for the different Auger electron spectra. It was shown that for mammalian cells an additional source of double-strand breaks from low LET radiation added approximately 0.17 dsb/decay to each, giving a final total of 1.07 and 0.85 dsb/decay for mammalian cells depending on electron spectrum. It is shown that energy deposition in the DNA from the iodine decay is very complex, with a broad range of energy depositions and products. Even for a particular energy deposited in the DNA different types of strand-break are produced. These are identified and their probabilities calculated. (author)

  12. Binding of Multiple Rap1 Proteins Stimulates Chromosome Breakage Induction during DNA Replication.

    Directory of Open Access Journals (Sweden)

    Greicy H Goto

    2015-08-01

    Full Text Available Telomeres, the ends of linear eukaryotic chromosomes, have a specialized chromatin structure that provides a stable chromosomal terminus. In budding yeast Rap1 protein binds to telomeric TG repeat and negatively regulates telomere length. Here we show that binding of multiple Rap1 proteins stimulates DNA double-stranded break (DSB induction at both telomeric and non-telomeric regions. Consistent with the role of DSB induction, Rap1 stimulates nearby recombination events in a dosage-dependent manner. Rap1 recruits Rif1 and Rif2 to telomeres, but neither Rif1 nor Rif2 is required for DSB induction. Rap1-mediated DSB induction involves replication fork progression but inactivation of checkpoint kinase Mec1 does not affect DSB induction. Rap1 tethering shortens artificially elongated telomeres in parallel with telomerase inhibition, and this telomere shortening does not require homologous recombination. These results suggest that Rap1 contributes to telomere homeostasis by promoting chromosome breakage.

  13. DNA damage and repair mechanism. [DNA damage and repair mechanisms

    Energy Technology Data Exchange (ETDEWEB)

    Grossman, L.

    1976-01-01

    The ability of cells to survive in an environment specifically damaging to its DNA can be attributed to a variety of inherent repair mechanisms. This is a form of repair in which alterations are directly reversed to their original form. This reversibility is exemplified by the photoreactivation of ultraviolet-induced pyrimidine dimers. This phenomenon is attributable to the action of an enzyme, photolyase (photoreactivating enzyme), which is able to monomerize the uv-induced pyrimidine dimers in the presence of 320 to 370 nm light. Dilution of damage can be effected through a series of sister chromatid exchanges, controlled by recombinational mechanisms as a postreplication event. In this form of repair, replication proceeds to the point of damage, stops and resumes at the point of the next initiation site resulting in a gap in the newly synthesized daughter strand. It is presumed that those strands containing damaged regions exchange with undamaged regions of other DNA, strands, resulting in the eventual dilution of such damage.

  14. Inactivation of E. Coli cell viability and DNA Photo-breakage by Pulsed Nitrogen Laser Radiation

    International Nuclear Information System (INIS)

    The mutagenic and lethal effect of nitrogen laser radiation: 337.1 nm wave length, 1.5 millijoul pulse energy, 10 nanosecond pulse with and pulse repetition rate range from 1 to 50 Pulse/ second was evaluated on E. Coli cells. Results indicated that irradiation of E. coli JMP39 with pulse repetition of 8 , 16 , 32 pulse/sec, for 1, 5 , 10, 25 min respectively led to a significant decrease in cell count proportional to irradiation dose with significant increase in lacmutation frequency accompanied with some mutations in pattern of antibiotic resistance. The effect of nitrogen laser on the genomic content of the strain JMP39 was also studied by irradiating the total DNA with 30 pulse/second for 1 ,5, 15 , 30 min then subjected to both agarose gel electrophoresis and scanning spectrophotometry. The first technique revealed to DNA photo breakage and significant decrease in DNA absorbency was noticed by scanning spectrophotometry. This could be attributed to photo-decomposition resulted from multi-photo-excitation of UV-Laser pulses

  15. Titanium dioxide nanoparticles induce oxidative stress and DNA-adduct formation but not DNA-breakage in human lung cells

    Directory of Open Access Journals (Sweden)

    Schins Roel PF

    2009-06-01

    Full Text Available Abstract Titanium dioxide (TiO2, also known as titanium (IV oxide or anatase, is the naturally occurring oxide of titanium. It is also one of the most commercially used form. To date, no parameter has been set for the average ambient air concentration of TiO2 nanoparticles (NP by any regulatory agency. Previously conducted studies had established these nanoparticles to be mainly non-cyto- and -genotoxic, although they had been found to generate free radicals both acellularly (specially through photocatalytic activity and intracellularly. The present study determines the role of TiO2-NP (anatase, ∅ in vitro. For comparison, iron containing nanoparticles (hematite, Fe2O3, ∅ 2-NP did not induce DNA-breakage measured by the Comet-assay in both cell types. Generation of reactive oxygen species (ROS was measured acellularly (without any photocatalytic activity as well as intracellularly for both types of particles, however, the iron-containing NP needed special reducing conditions before pronounced radical generation. A high level of DNA adduct formation (8-OHdG was observed in IMR-90 cells exposed to TiO2-NP, but not in cells exposed to hematite NP. Our study demonstrates different modes of action for TiO2- and Fe2O3-NP. Whereas TiO2-NP were able to generate elevated amounts of free radicals, which induced indirect genotoxicity mainly by DNA-adduct formation, Fe2O3-NP were clastogenic (induction of DNA-breakage and required reducing conditions for radical formation.

  16. Xeroderma pigmentosum, DNA repair and carcinogenesis

    International Nuclear Information System (INIS)

    The following topics are reviewed: Symptoms of xeroderma pigmentosum; xeroderma pigmentosum as a defect in the biochemistry of repair of radiation damage; major classes of DNA damage and repair mechanisms; excision repair in relation to biochemical steps and the XP defect; sensitivity of xeroderma pigmentosum cells; host-cell reactivation of UV-damaged viruses; excision of pyrimidine dimers from human cells; formation and sealing of single strand breaks during dimer excision; insertion of new bases to repair DNA; and DNA repair, carcinogens, and carcinogenesis

  17. Radiation-induced DNA damage and DNA repair

    International Nuclear Information System (INIS)

    Although DNA undergoes various types of damage from radiation, active oxygen, and the like, a living body has a plurality of DNA repair mechanisms responding to the types of DNA damage. On the other hand, there are a system that results in cell death if the repair is impossible and a mechanism to lead to concretization if further repair is not accurately made. This paper explains the following items as the basic researches on these types of DNA damage and the repair mechanisms: (1) biological effects of DNA damage, (2) effect of DNA damage on DNA synthesis, and (3) effects of DNA damage on cells. It also explains the effects of radiation on cells with a focus on specific mechanism for (1) DNA damage caused by direct action due to radiation and by indirect action due mainly to active oxygen, and (2) DNA repair mechanism that works on DNA double-strand break (DSB). (A.O.)

  18. DNA repair and DNA antibodies during experimental mycoplasma arthritis

    International Nuclear Information System (INIS)

    To clarify the pathogenesis of a mycoplasma induced arthritis in rats, investigations were carried out on the influence of mycoplasma infection on DNA repair and the occurrence of DNA antibodies. During acute and subacute stage of the experimentally induced arthritis an inhibition of DNA repair could be observed. Besides the results indicated a correlation between reduced or inhibited DNA repair and the appearance of DNA antibodies could be found. The DNA-repair behaviour after the mycoplasma infection was compared with the influence of γ-irradiation

  19. DNA damage and repair in plants

    International Nuclear Information System (INIS)

    The biological impact of any DNA damaging agent is a combined function of the chemical nature of the induced lesions and the efficiency and accuracy of their repair. Although much has been learned frommicrobes and mammals about both the repair of DNA damage and the biological effects of the persistence of these lesions, much remains to be learned about the mechanism and tissue-specificity of repair in plants. This review focuses on recent work on the induction and repair of DNA damage in higher plants, with special emphasis on UV-induced DNA damage products. (author)

  20. Genetic ecotoxicology IV: survival and DNA strand breakage is dependent on genotype in radionuclide-exposed mosquitofish

    Energy Technology Data Exchange (ETDEWEB)

    Theodorakis, C.W. [Texas A and M University, Department of Wildlife and Fisheries Sciences, College Station, TX 77843-2258 (United States); Elbl, T. [University of Pennsylvania, Department of Cell and Molecular Biology, Philadelphia, PA 19102 (United States); Shugart, L.R. [L.R. Shugart and Associates, Oak Ridge, TN 37831 (United States)

    1999-05-01

    Western mosquitofish (Gambusia affinis) were caged in situ in a radioactively-contaminated pond in order to determine if survival and amount of DNA strand breakage were dependent on genotype. Genotypes of fish were determined using the randomly amplified polymorphic (RAPD) technique, and DNA strand breakage was determined using agarose gel electrophoresis. This study is a continuation of research undertaken at the Oak Ridge National Laboratory, which examined the effects of radionuclide contamination on the population genetic structure of mosquitofish. The previous research found 17 RAPD markers that were present at a higher frequency in contaminated than in reference populations ('contaminant-indicative bands'), and fish from contaminated sites which possessed these markers had higher fecundity and fewer strand breaks than fish which did not. One of the contaminated populations (Pond 3513) was colonized from one of the reference populations (Crystal Springs) in 1977. In the present study, fish were obtained from Crystal Springs and an additional reference site, and caged in Pond 3513. The percent survival and amount of DNA strand breakage were then determined for fish with and without the contaminant-indicative markers. When Crystal Springs fish were caged in Pond 3513, it was found that the genotypic distribution of the survivors was more similar to the native Pond 3513 population than to the Crystal Springs population. Furthermore, for nine of the contaminant-indicative markers, the percent survival was greater for fish which possessed these markers than for fish which did not. For five of these markers, fish which possessed them had higher DNA integrity (fewer strand breaks) than fish which did not. These data indicate that probability of survival and degree of DNA strand breakage in radionuclide-exposed mosquitofish are dependent on RAPD genotype, and are consistent with the hypothesis that the contaminant-indicative RAPD bands are markers of loci

  1. DNA Damage and Repair in Vascular Disease.

    Science.gov (United States)

    Uryga, Anna; Gray, Kelly; Bennett, Martin

    2016-01-01

    DNA damage affecting both genomic and mitochondrial DNA is present in a variety of both inherited and acquired vascular diseases. Multiple cell types show persistent DNA damage and a range of lesions. In turn, DNA damage activates a variety of DNA repair mechanisms, many of which are activated in vascular disease. Such DNA repair mechanisms either stall the cell cycle to allow repair to occur or trigger apoptosis or cell senescence to prevent propagation of damaged DNA. Recent evidence has indicated that DNA damage occurs early, is progressive, and is sufficient to impair function of cells composing the vascular wall. The consequences of persistent genomic and mitochondrial DNA damage, including inflammation, cell senescence, and apoptosis, are present in vascular disease. DNA damage can thus directly cause vascular disease, opening up new possibilities for both prevention and treatment. We review the evidence for and the causes, types, and consequences of DNA damage in vascular disease. PMID:26442438

  2. FBH1 promotes DNA double-strand breakage and apoptosis in response to DNA replication stress.

    Science.gov (United States)

    Jeong, Yeon-Tae; Rossi, Mario; Cermak, Lukas; Saraf, Anita; Florens, Laurence; Washburn, Michael P; Sung, Patrick; Schildkraut, Carl L; Schildkraut, Carl; Pagano, Michele

    2013-01-21

    Proper resolution of stalled replication forks is essential for genome stability. Purification of FBH1, a UvrD DNA helicase, identified a physical interaction with replication protein A (RPA), the major cellular single-stranded DNA (ssDNA)-binding protein complex. Compared with control cells, FBH1-depleted cells responded to replication stress with considerably fewer double-strand breaks (DSBs), a dramatic reduction in the activation of ATM and DNA-PK and phosphorylation of RPA2 and p53, and a significantly increased rate of survival. A minor decrease in ssDNA levels was also observed. All these phenotypes were rescued by wild-type FBH1, but not a FBH1 mutant lacking helicase activity. FBH1 depletion had no effect on other forms of genotoxic stress in which DSBs form by means that do not require ssDNA intermediates. In response to catastrophic genotoxic stress, apoptosis prevents the persistence and propagation of DNA lesions. Our findings show that FBH1 helicase activity is required for the efficient induction of DSBs and apoptosis specifically in response to DNA replication stress. PMID:23319600

  3. Spi-1/PU.1 oncogene accelerates DNA replication fork elongation and promotes genetic instability in the absence of DNA breakage.

    Science.gov (United States)

    Rimmelé, Pauline; Komatsu, Jun; Hupé, Philippe; Roulin, Christophe; Barillot, Emmanuel; Dutreix, Marie; Conseiller, Emmanuel; Bensimon, Aaron; Moreau-Gachelin, Françoise; Guillouf, Christel

    2010-09-01

    The multistage process of cancer formation is driven by the progressive acquisition of somatic mutations. Replication stress creates genomic instability in mammals. Using a well-defined multistep leukemia model driven by Spi-1/PU.1 overexpression in the mouse and Spi-1/PU.1-overexpressing human leukemic cells, we investigated the relationship between DNA replication and cancer progression. Here, using DNA molecular combing and flow cytometry methods, we show that Spi-1 increases the speed of replication by acting specifically on elongation rather than enhancing origin firing. This shortens the S-phase duration. Combining data from Spi-1 knockdown in murine cells with Spi-1 overexpression in human cells, we provide evidence that inappropriate Spi-1 expression is directly responsible for the replication alteration observed. Importantly, the acceleration of replication progression coincides with an increase in the frequency of genomic mutations without inducing DNA breakage. Thus, we propose that the hitherto unsuspected role for spi-1 oncogene in promoting replication elongation and genomic mutation promotes blastic progression during leukemic development.

  4. [A Nobel Prize for DNA repair].

    Science.gov (United States)

    Jordan, Bertrand

    2016-01-01

    This year's Nobel Prize for chemistry recognizes the seminal contributions of three researchers who discovered the existence and the basic mechanisms of DNA repair: base excision repair, mismatch repair, and nucleotide excision repair. They have since been joined by many scientists elucidating diverse aspects of these complex mechanisms that now constitute a thriving research field with many applications, notably for understanding oncogenesis and devising more effective therapies. PMID:26850617

  5. [A Nobel Prize for DNA repair].

    Science.gov (United States)

    Jordan, Bertrand

    2016-01-01

    This year's Nobel Prize for chemistry recognizes the seminal contributions of three researchers who discovered the existence and the basic mechanisms of DNA repair: base excision repair, mismatch repair, and nucleotide excision repair. They have since been joined by many scientists elucidating diverse aspects of these complex mechanisms that now constitute a thriving research field with many applications, notably for understanding oncogenesis and devising more effective therapies.

  6. DNA strand breakage by 125I decay: Plasmid DNA in dilute aqueous solution

    International Nuclear Information System (INIS)

    The question of the extent of damage to DNA, in particular double strand breaks, that can be caused by the decay of the Auger emitter 125I when it is covalently incorporated into the DNA requires resolution. In particular, experiments with plasmid DNA reported by Linz and Stoecklin would seem to indicate that the range of effect extends over the whole length of the molecule (a few 1,000's base pairs (bp)) in contrast to the generally accepted view that the decay is very localized (i.e. effect over a few 10's bp). This raises the question of whether a long range energy migration process is operative in DNA or whether the fragmentation can be accounted for by free radical diffusion. The authors report here experiments to help resolve this issue by investigating and trying to eliminate the possible effects of free radicals. The results which are broadly consistent with the findings of Linz and Stoecklin indicate that long-range damage in labeled DNA in aqueous solution is due to effects of free radicals. The authors confirm the high-LET nature of the 125I decay

  7. DNA repair phenotype and dietary antioxidant supplementation

    DEFF Research Database (Denmark)

    Guarnieri, Serena; Loft, Steffen; Riso, Patrizia;

    2008-01-01

    of DNA repair incisions were 65.2 (95 % CI 60.4, 70.0) and 86.1 (95 % CI 76.2, 99.9) among the male smokers and well-nourished subjects, respectively. The male smokers also had high baseline levels of oxidised guanines in MNBC. After supplementation, only the male smokers supplemented with slow......-release vitamin C tablets had increased DNA repair activity (27 (95 % CI 12, 41) % higher incision activity). These subjects also benefited from the supplementation by reduced levels of oxidised guanines in MNBC. In conclusion, nutritional status, DNA repair activity and DNA damage are linked, and beneficial...

  8. Active DNA demethylation by DNA repair: Facts and uncertainties.

    Science.gov (United States)

    Schuermann, David; Weber, Alain R; Schär, Primo

    2016-08-01

    Pathways that control and modulate DNA methylation patterning in mammalian cells were poorly understood for a long time, although their importance in establishing and maintaining cell type-specific gene expression was well recognized. The discovery of proteins capable of converting 5-methylcytosine (5mC) to putative substrates for DNA repair introduced a novel and exciting conceptual framework for the investigation and ultimate discovery of molecular mechanisms of DNA demethylation. Against the prevailing notion that DNA methylation is a static epigenetic mark, it turned out to be dynamic and distinct mechanisms appear to have evolved to effect global and locus-specific DNA demethylation. There is compelling evidence that DNA repair, in particular base excision repair, contributes significantly to the turnover of 5mC in cells. By actively demethylating DNA, DNA repair supports the developmental establishment as well as the maintenance of DNA methylation landscapes and gene expression patterns. Yet, while the biochemical pathways are relatively well-established and reviewed, the biological context, function and regulation of DNA repair-mediated active DNA demethylation remains uncertain. In this review, we will thus summarize and critically discuss the evidence that associates active DNA demethylation by DNA repair with specific functional contexts including the DNA methylation erasure in the early embryo, the control of pluripotency and cellular differentiation, the maintenance of cell identity, and the nuclear reprogramming. PMID:27247237

  9. Apparent Directional Scanning for DNA Repair

    OpenAIRE

    Zhao, Tong; Dinner, Aaron R.

    2007-01-01

    Recently it was observed that the DNA repair protein human O6-alkylguanine-DNA alkyltransferase repairs lesions at the 5′ ends of 70-nucleotide single-stranded DNA roughly threefold more frequently than lesions at the 3′ ends. Here, we introduce a coarse-grained model to show how a local asymmetry in binding kinetics (rather than thermodynamics) together with irreversible alkyl transfer can give rise to this apparent bias in sequence scanning. Exploration of the parameter space provides quant...

  10. DNA single strand breakage, DNA adducts, and sister chromatid exchange in lymphocytes and phenanthrene and pyrene metabolites in urine of coke oven workers.

    OpenAIRE

    W. Popp; Vahrenholz, C.; Schell, C; Grimmer, G.; Dettbarn, G; Kraus, R.; Brauksiepe, A; Schmeling, B; Gutzeit, T; von Bülow, J; Norpoth, K

    1997-01-01

    OBJECTIVES: To investigate the specificity of biological monitoring variables (excretion of phenanthrene and pyrene metabolites in urine) and the usefulness of some biomarkers of effect (alkaline filter elution, 32P postlabelling assay, measurement of sister chromatid exchange) in workers exposed to polycyclic aromatic hydrocarbons (PAHs). METHODS: 29 coke oven workers and a standardised control group were investigated for frequencies of DNA single strand breakage, DNA protein cross links (al...

  11. Estimating the DNA strand breakage using a fuzzy inference system and agarose gel electrophoresis, a case study with toothed carp Aphanius sophiae exposed to cypermethrin.

    Science.gov (United States)

    Poorbagher, Hadi; Moghaddam, Maryam Nasrollahpour; Eagderi, Soheil; Farahmand, Hamid

    2016-07-01

    The DNA breakage has been widely used in ecotoxicological studies to investigate effects of pesticides in fishes. The present study used a fuzzy inference system to quantify the breakage of DNA double strand in Aphanius sophiae exposed to the cypermethrin. The specimens were adapted to different temperatures and salinity for 14 days and then exposed to cypermethrin. DNA of each specimens were extracted, electrophoresed and photographed. A fuzzy system with three input variables and 27 rules were defined. The pixel value curve of DNA on each gel lane was obtained using ImageJ. The DNA breakage was quantified using the pixel value curve and fuzzy system. The defuzzified values were analyzed using a three-way analysis of variance. Cypermethrin had significant effects on DNA breakage. Fuzzy inference systems can be used as a tool to quantify the breakage of double strand DNA. DNA double strand of the gill of A. sophiae is sensitive enough to be used to detect cypermethrin in surface waters in concentrations much lower than those reported in previous studies. PMID:27000282

  12. Resveratrol mobilizes endogenous copper in human peripheral lymphocytes leading to oxidative DNA breakage: a putative mechanism for chemoprevention of cancer.

    Science.gov (United States)

    Hadi, S M; Ullah, M F; Azmi, A S; Ahmad, A; Shamim, U; Zubair, H; Khan, H Y

    2010-06-01

    Plant polyphenols are important components of human diet, and a number of them are considered to possess chemopreventive and therapeutic properties against cancer. They are recognized as naturally occurring anti-oxidants but also act as pro-oxidants catalyzing DNA degradation in the presence of metal ions such as copper. The plant polyphenol resveratrol confers resistance to plants against fungal agents and has been implicated as a cancer chemopreventive agent. Of particular interest is the observation that resveratrol has been found to induce apoptosis in cancer cell lines but not in normal cells. Over the last few years, we have shown that resveratrol is capable of causing DNA breakage in cells such as human lymphocytes. Such cellular DNA breakage is inhibited by copper specific chelators but not by iron and zinc chelating agents. Similar results are obtained by using permeabilized cells or with isolated nuclei, indicating that chromatin-bound copper is mobilized in this reaction. It is well established that tissue, cellular and serum copper levels are considerably elevated in various malignancies. Therefore, cancer cells may be more subject to electron transfer between copper ions and resveratrol to generate reactive oxygen species responsible for DNA cleavage. The results are in support of our hypothesis that anti-cancer mechanism of plant polyphenols involves mobilization of endogenous copper and the consequent pro-oxidant action. Such a mechanism better explains the anti-cancer effects of resveratrol, as it accounts for the preferential cytotoxicity towards cancer cells.

  13. Mobilization of Copper ions by Flavonoids in Human Peripheral Lymphocytes Leads to Oxidative DNA Breakage: A Structure Activity Study

    Directory of Open Access Journals (Sweden)

    Hussain Arif

    2015-11-01

    Full Text Available Epidemiological studies have linked dietary consumption of plant polyphenols with lower incidence of various cancers. In particular, flavonoids (present in onion, tomato and other plant sources induce apoptosis and cytotoxicity in cancer cells. These can therefore be used as lead compounds for the synthesis of novel anticancer drugs with greater bioavailability. In the present study, we examined the chemical basis of cytotoxicity of flavonoids by studying the structure–activity relationship of myricetin (MN, fisetin (FN, quercetin (QN, kaempferol (KL and galangin (GN. Using single cell alkaline gel electrophoresis (comet assay, we established the relative efficiency of cellular DNA breakage as MN > FN > QN > KL > GN. Also, we determined that the cellular DNA breakage was the result of mobilization of chromatin-bound copper ions and the generation of reactive oxygen species. The relative DNA binding affinity order was further confirmed using molecular docking and thermodynamic studies through the interaction of flavonoids with calf thymus DNA. Our results suggest that novel anti-cancer molecules should have ortho-dihydroxy groups in B-ring and hydroxyl groups at positions 3 and 5 in the A-ring system. Additional hydroxyl groups at other positions further enhance the cellular cytotoxicity of the flavonoids.

  14. Space Radiation Effects on Human Cells: Modeling DNA Breakage, DNA Damage Foci Distribution, Chromosomal Aberrations and Tissue Effects

    Science.gov (United States)

    Ponomarev, A. L.; Huff, J. L.; Cucinotta, F. A.

    2011-01-01

    Future long-tem space travel will face challenges from radiation concerns as the space environment poses health risk to humans in space from radiations with high biological efficiency and adverse post-flight long-term effects. Solar particles events may dramatically affect the crew performance, while Galactic Cosmic Rays will induce a chronic exposure to high-linear-energy-transfer (LET) particles. These types of radiation, not present on the ground level, can increase the probability of a fatal cancer later in astronaut life. No feasible shielding is possible from radiation in space, especially for the heavy ion component, as suggested solutions will require a dramatic increase in the mass of the mission. Our research group focuses on fundamental research and strategic analysis leading to better shielding design and to better understanding of the biological mechanisms of radiation damage. We present our recent effort to model DNA damage and tissue damage using computational models based on the physics of heavy ion radiation, DNA structure and DNA damage and repair in human cells. Our particular area of expertise include the clustered DNA damage from high-LET radiation, the visualization of DSBs (DNA double strand breaks) via DNA damage foci, image analysis and the statistics of the foci for different experimental situations, chromosomal aberration formation through DSB misrepair, the kinetics of DSB repair leading to a model-derived spectrum of chromosomal aberrations, and, finally, the simulation of human tissue and the pattern of apoptotic cell damage. This compendium of theoretical and experimental data sheds light on the complex nature of radiation interacting with human DNA, cells and tissues, which can lead to mutagenesis and carcinogenesis later in human life after the space mission.

  15. Replication Stress-Induced Chromosome Breakage Is Correlated with Replication Fork Progression and Is Preceded by Single-Stranded DNA Formation

    OpenAIRE

    Feng, Wenyi; Di Rienzi, Sara C.; Raghuraman, M. K.; Brewer, Bonita J.

    2011-01-01

    Chromosome breakage as a result of replication stress has been hypothesized to be the direct consequence of defective replication fork progression, or “collapsed” replication forks. However, direct and genome-wide evidence that collapsed replication forks give rise to chromosome breakage is still lacking. Previously we showed that a yeast replication checkpoint mutant mec1-1, after transient exposure to replication impediment imposed by hydroxyurea (HU), failed to complete DNA replication, ac...

  16. International congress on DNA damage and repair: Book of abstracts

    International Nuclear Information System (INIS)

    This document contains the abstracts of 105 papers presented at the Congress. Topics covered include the Escherichia coli nucleotide excision repair system, DNA repair in malignant transformations, defective DNA repair, and gene regulation

  17. International congress on DNA damage and repair: Book of abstracts

    Energy Technology Data Exchange (ETDEWEB)

    1987-01-01

    This document contains the abstracts of 105 papers presented at the Congress. Topics covered include the Escherichia coli nucleotide excision repair system, DNA repair in malignant transformations, defective DNA repair, and gene regulation. (TEM)

  18. Emerging roles of DNA-PK besides DNA repair.

    Science.gov (United States)

    Kong, Xianming; Shen, Ying; Jiang, Na; Fei, Xin; Mi, Jun

    2011-08-01

    The DNA-dependent protein kinase (DNA-PK) is a DNA-activated serine/threonine protein kinase, and abundantly expressed in almost all mammalian cells. The roles of DNA-PK in DNA-damage repair pathways, including non-homologous end-joining (NHEJ) repair and homologous recombinant (HR) repair, have been studied intensively. However, the high levels of DNA-PK in human cells are somewhat paradoxical in that it does not impart any increased ability to repair DNA damage. If DNA-PK essentially exceeds the demand for DNA damage repair, why do human cells universally express such high levels of this huge complex? DNA-PK has been recently reported to be involved in metabolic gene regulation in response to feeding/insulin stimulation; our studies have also suggested a role of DNA-PK in the regulation of the homeostasis of cell proliferation. These novel findings expand our horizons about the importance of DNA-PK. PMID:21514376

  19. DNA repair in human bronchial epithelial cells

    International Nuclear Information System (INIS)

    The purpose of this investigation was to compare the response of human cell types (bronchial epithelial cells and fibroblasts and skin fibroblasts) to various DNA damaging agents. Repair of DNA single strand breaks (SSB) induced by 5 krads of X-ray was similar for all cell types; approximately 90% of the DNA SSB were rejoined within one hour. During excision repair of DNA damage from u.v.-radiation, the frequencies of DNA SSB as estimated by the alkaline elution technique, were similar in all cell types. Repair replication as measured by BND cellulose chromatography was also similar in epithelial and fibroblastic cells after u.v.-irradiation. Similar levels of SSB were also observed in epithelial and fibroblastic cells after exposure to chemical carcinogens: 7,12-dimethylbenz[a]anthracene; benzo[a]pyrene diol epoxide (BPDE); or N-methyl-N-nitro-N-nitrosoguanidine. Significant repair replication of BPDE-induced DNA damage was detected in both bronchial epithelial and fibroblastic cells, although the level in fibroblasts was approximately 40% of that in epithelial cells. The pulmonary carcinogen asbestos did not damage DNA. DNA-protein crosslinks induced by formaldehyde were rapidly removed in bronchial cells. Further, epithelial and fibroblastic cells, which were incubated with formaldehyde and the polymerase inhibitor combination of cytosine arabinoside and hydroxyurea, accumulated DNA SSB at approximately equal frequencies. These results should provide a useful background for further investigations of the response of human bronchial cells to various DNA damaging agents

  20. 44. Study the level of DNA breakage in workers exposed to styrene by single cell gel electrophoresis

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    Objective: Study the level of DNA breakage in workers exposed to styrene. Methods: 35 workers aging from 18 to 40 exposed to styrene half a year above were observed as exposed group, in the mean time, 57 workers in the same district who hadn't been exposed to known genotoxicant were selected as control. Bloods of them were sampled and DNA lesions were detected by single cell gel electrophoresis. Results: Compared with control, the ratio between the length of Comet tail and the total length of Comet in exposed group significantly increased, especially it raised following the styrene concentration exposed, but it was not different among different working age groups. Conclusions: DNA is damaged by styrene, and it appears as dose-response relationship.

  1. Human DNA repair and recombination genes

    International Nuclear Information System (INIS)

    Several genes involved in mammalian DNA repair pathways were identified by complementation analysis and chromosomal mapping based on hybrid cells. Eight complementation groups of rodent mutants defective in the repair of uv radiation damage are now identified. At least seven of these genes are probably essential for repair and at least six of them control the incision step. The many genes required for repair of DNA cross-linking damage show overlap with those involved in the repair of uv damage, but some of these genes appear to be unique for cross-link repair. Two genes residing on human chromosome 19 were cloned from genomic transformants using a cosmid vector, and near full-length cDNA clones of each gene were isolated and sequenced. Gene ERCC2 efficiently corrects the defect in CHO UV5, a nucleotide excision repair mutant. Gene XRCC1 normalizes repair of strand breaks and the excessive sister chromatid exchange in CHO mutant EM9. ERCC2 shows a remarkable /approximately/52% overall homology at both the amino acid and nucleotide levels with the yeast RAD3 gene. Evidence based on mutation induction frequencies suggests that ERCC2, like RAD3, might also be an essential gene for viability. 100 refs., 4 tabs

  2. DNA strand breakage by 125I-decay in a synthetic oligodeoxynucleotide. Fragment distribution and evaluation of DMSO protection effect

    International Nuclear Information System (INIS)

    A double stranded oligodeoxynucleotide containing a single 125I-dC in a defined location was used to investigate DNA strand breakage resulting from 125I decay. Samples of a 41 bp oligodeoxynucleotide were incubated in 20 mM phosphate buffer (PB), or PB plus 2 M dimethylsulphoxide (DMSO), at 4 C during 18-20 days. The 32P-5'-end labelled DNA fragments produced by 125I decays were separated on denaturing polyacrylamide gels, and the 32P activity in each fragment was determined by scintillation counting after elution of fragments from gel. Most of the breaks, around 90%, occurred within 4-5 nucleotides of the 125I-dC, but DNA breaks were detected up to 16 nucleotides from the decay site. The 125I-dC was located at the 21st nucleotide from the 32P-5'-end label, and since 32P was not detected in fragments longer than 20 nucleotides, it was assumed that all 125I decay events produce at least one break in the 125I-labelled DNA strand. The results show a considerable protection effect of DMSO on DNA breaks at sites >5-6 nucleotides from the 125I location. The probability of breaks in this region was decreased with DMSO by a factor of 2 to 8-fold, suggesting significant role for radical-mediated DNA breaks at the more distant sites. However, the total protection effect of DMSO is rather small: 1.1, because of the small contribution of breakage at distant sites to the total yield. (orig.)

  3. DNA repair genes in the Megavirales pangenome.

    Science.gov (United States)

    Blanc-Mathieu, Romain; Ogata, Hiroyuki

    2016-06-01

    The order 'Megavirales' represents a group of eukaryotic viruses with a large genome encoding a few hundred up to two thousand five hundred genes. Several members of Megavirales possess genes involved in major DNA repair pathways. Some of these genes were likely inherited from an ancient virus world and some others were derived from the genomes of their hosts. Here we examine molecular phylogenies of key DNA repair enzymes in light of recent hypotheses on the origin of Megavirales, and propose that the last common ancestors of the individual families of the order Megavirales already possessed DNA repair functions to achieve and maintain a moderately large genome and that this repair capacity gradually increased, in a family-dependent manner, during their recent evolution.

  4. Role of Fanconi Anemia FANCG in Preventing Double-Strand Breakage and Chromosomal Rearrangement during DNA Replication

    Energy Technology Data Exchange (ETDEWEB)

    Tebbs, R S; Hinz, J M; Yamada, N A; Wilson, J B; Jones, N J; Salazar, E P; Thomas, C B; Jones, I M; Thompson, L H

    2003-10-04

    The Fanconi anemia (FA) proteins overlap with those of homologous recombination through FANCD1/BRCA2, but the biochemical functions of other FA proteins are unknown. By constructing and characterizing a null fancg mutant of hamster CHO cells, we present several new insights for FA. The fancg cells show a broad sensitivity to genotoxic agents, not supporting the conventional concept of sensitivity to only DNA crosslinking agents. The aprt mutation rate is normal, but hprt mutations are reduced, which we ascribe to the lethality of large deletions. CAD and dhfr gene amplification rates are increased, implying excess chromosomal breakage during DNA replication, and suggesting amplification as a contributing factor to cancer-proneness in FA patients. In S-phase cells, both spontaneous and mutagen-induced Rad51 nuclear foci are elevated. These results support a model in which FancG protein helps to prevent collapse of replication forks by allowing translesion synthesis or lesion bypass through homologous recombination.

  5. Calcitriol-copper interaction leads to non enzymatic, reactive oxygen species mediated DNA breakage and modulation of cellular redox scavengers in hepatocellular carcinoma.

    Science.gov (United States)

    Rizvi, Asim; Farhan, Mohd; Naseem, Imrana; Hadi, S M

    2016-09-01

    Calcitriol is the metabolically active form of Vitamin D and is known to kill cancer cells. Using the rat model of DEN induced hepatocellular carcinoma we show that there is a marked increase in cellular levels of copper in hepatocellular carcinoma and that calcitriol-copper interaction leads to reactive oxygen species mediated DNA breakage selectively in hepatocellular carcinoma cells. In vivo studies show that calcitriol selectively induces severe fluctuations in cellular enzymatic and non enzymatic scavengers of reactive oxygen species in the malignant tissue. Lipid peroxidation, a well established marker of oxidative stress, was found to increase, and substantial cellular DNA breakage was observed. We propose that calcitriol is a proxidant in the cellular milieu of hepatocellular carcinoma cells, and this copper mediated prooxidant action of calcitriol causes selective DNA breakage in malignant cells, while sparing normal (non malignant) cells. PMID:27343126

  6. DNA repair mechanism in radioresistant bacteria

    International Nuclear Information System (INIS)

    Many radiation resistant bacteria have been isolated from various sources which are not in high background field. Since Deinococcus radiodurans had been isolated first in 1956, studies on the mechanism for radioresistance were carried out mostly using this bacterium. DNA in this bacterium isn't protected against injury induced by not only ionizing radiation but also ultraviolet light. Therefore, DNA damages induced by various treatments are efficiently and accurately repaired in this cells. Damages in base and/or sugar in DNA are removed by endonucleases which, if not all, are synthesized during postirradiation incubation. Following the endonucleolytic cleavage the strand scissions in DNA are seemed to be rejoined by a process common for the repair of strand scissions induced by such as ionizing radiations. Induce protein(s) is also involved in this rejoining process of strand scissions. DNA repair genes were classified into three phenotypic groups. (1)Genes which are responsible for the endonucleolytic activities. (2) Genes involved in the rejoining of DNA strand scissions. (3) Genes which participate in genetic recombination and repair. Three genes belong to (1) and (2) were cloned onto approximately 1 kbp DNA fragments which base sequences have been determined. (author)

  7. Electrically monitoring DNA repair by photolyase

    OpenAIRE

    Derosa, Maria C.; Sancar, Aziz; Barton, Jacqueline K.

    2005-01-01

    Cyclobutane pyrimidine dimers are the major DNA photoproducts produced upon exposure to UV radiation. If left unrepaired, these lesions can lead to replication errors, mutation, and cell death. Photolyase is a light-activated flavoenzyme that binds to pyrimidine dimers in DNA and repairs them in a reaction triggered by electron transfer from the photoexcited flavin cofactor to the dimer. Using gold electrodes modified with DNA duplexes containing a cyclobutane thymine dimer (T T), here we pr...

  8. DNA repair variants and breast cancer risk.

    Science.gov (United States)

    Grundy, Anne; Richardson, Harriet; Schuetz, Johanna M; Burstyn, Igor; Spinelli, John J; Brooks-Wilson, Angela; Aronson, Kristan J

    2016-05-01

    A functional DNA repair system has been identified as important in the prevention of tumour development. Previous studies have hypothesized that common polymorphisms in DNA repair genes could play a role in breast cancer risk and also identified the potential for interactions between these polymorphisms and established breast cancer risk factors such as physical activity. Associations with breast cancer risk for 99 single nucleotide polymorphisms (SNPs) from genes in ten DNA repair pathways were examined in a case-control study including both Europeans (644 cases, 809 controls) and East Asians (299 cases, 160 controls). Odds ratios in both additive and dominant genetic models were calculated separately for participants of European and East Asian ancestry using multivariate logistic regression. The impact of multiple comparisons was assessed by correcting for the false discovery rate within each DNA repair pathway. Interactions between several breast cancer risk factors and DNA repair SNPs were also evaluated. One SNP (rs3213282) in the gene XRCC1 was associated with an increased risk of breast cancer in the dominant model of inheritance following adjustment for the false discovery rate (P breast cancer risk or their modification by breast cancer risk factors were observed.

  9. DNA repair variants and breast cancer risk.

    Science.gov (United States)

    Grundy, Anne; Richardson, Harriet; Schuetz, Johanna M; Burstyn, Igor; Spinelli, John J; Brooks-Wilson, Angela; Aronson, Kristan J

    2016-05-01

    A functional DNA repair system has been identified as important in the prevention of tumour development. Previous studies have hypothesized that common polymorphisms in DNA repair genes could play a role in breast cancer risk and also identified the potential for interactions between these polymorphisms and established breast cancer risk factors such as physical activity. Associations with breast cancer risk for 99 single nucleotide polymorphisms (SNPs) from genes in ten DNA repair pathways were examined in a case-control study including both Europeans (644 cases, 809 controls) and East Asians (299 cases, 160 controls). Odds ratios in both additive and dominant genetic models were calculated separately for participants of European and East Asian ancestry using multivariate logistic regression. The impact of multiple comparisons was assessed by correcting for the false discovery rate within each DNA repair pathway. Interactions between several breast cancer risk factors and DNA repair SNPs were also evaluated. One SNP (rs3213282) in the gene XRCC1 was associated with an increased risk of breast cancer in the dominant model of inheritance following adjustment for the false discovery rate (P breast cancer risk or their modification by breast cancer risk factors were observed. Environ. Mol. Mutagen. 57:269-281, 2016. © 2016 Wiley Periodicals, Inc. PMID:27060854

  10. Regulation of DNA repair by parkin

    International Nuclear Information System (INIS)

    Mutation of parkin is one of the most prevalent causes of autosomal recessive Parkinson's disease (PD). Parkin is an E3 ubiquitin ligase that acts on a variety of substrates, resulting in polyubiquitination and degradation by the proteasome or monoubiquitination and regulation of biological activity. However, the cellular functions of parkin that relate to its pathological involvement in PD are not well understood. Here we show that parkin is essential for optimal repair of DNA damage. Parkin-deficient cells exhibit reduced DNA excision repair that can be restored by transfection of wild-type parkin, but not by transfection of a pathological parkin mutant. Parkin also protects against DNA damage-induced cell death, an activity that is largely lost in the pathological mutant. Moreover, parkin interacts with the proliferating cell nuclear antigen (PCNA), a protein that coordinates DNA excision repair. These results suggest that parkin promotes DNA repair and protects against genotoxicity, and implicate DNA damage as a potential pathogenic mechanism in PD.

  11. Homologous recombination in DNA repair and DNA damage tolerance

    Institute of Scientific and Technical Information of China (English)

    Xuan Li; Wolf-Dietrich Heyer

    2008-01-01

    Homologous recombination (HR) comprises a series of interrelated pathways that function in the repair of DNA double-stranded breaks (DSBs) and interstrand crosslinks (ICLs). In addition, recombination provides critical sup-port for DNA replication in the recovery of stalled or broken replication forks, contributing to tolerance of DNA damage. A central core of proteins, most critically the RecA homolog Rad51, catalyzes the key reactions that typify HR: homology search and DNA strand invasion. The diverse functions of recombination are reflected in the need for context-specific factors that perform supplemental functions in conjunction with the core proteins. The inability to properly repair complex DNA damage and resolve DNA replication stress leads to genomic instability and contributes to cancer etiology. Mutations in the BRCA2 recombination gene cause predisposition to breast and ovarian cancer as well as Fanconi anemia, a cancer predisposition syndrome characterized by a defect in the repair of DNA interstrand crosslinks. The cellular functions of recombination are also germane to DNA-based treatment modaUties of cancer, which target replicating cells by the direct or indirect induction of DNA lesions that are substrates for recombination pathways. This review focuses on mechanistic aspects of HR relating to DSB and ICL repair as well as replication fork support.

  12. Amifostine Protection Against Mitomycin-induced Chromosomal Breakage in Fanconi Anaemia Lymphocytes

    OpenAIRE

    Lopes, Miriam T. P.; Salas, Carlos E.; Fernanda S. G. Kehdy; Camelo, Ricardo M.

    2008-01-01

    Fanconi anaemia (FA) is a rare genetic chromosomal instability syndrome caused by impairment of DNA repair and reactive oxygen species (ROS) imbalance. This disease is also related to bone marrow failure and cancer. Treatment of these complications with radiation and alkylating agents may enhance chromosomal breakage. We have evaluated the effect of amifostine (AMF) on basal and mitomycin C (MMC)-induced chromosomal breakage in FA blood cells using the micronucleus assay. The basal micronucle...

  13. DNA repair: keeping it together

    DEFF Research Database (Denmark)

    Lisby, Michael; Rothstein, Rodney

    2004-01-01

    A protein scaffold has been identified that holds a chromosome together in the event of a DNA double-strand break. This scaffold is dependent on Rad52 and the Rad50-Mre11-Xrs2 complex and withstands the pulling forces of the mitotic spindle during DNA damage checkpoint arrest.......A protein scaffold has been identified that holds a chromosome together in the event of a DNA double-strand break. This scaffold is dependent on Rad52 and the Rad50-Mre11-Xrs2 complex and withstands the pulling forces of the mitotic spindle during DNA damage checkpoint arrest....

  14. DNA repair, immunosuppression, and skin cancer.

    Science.gov (United States)

    Yarosh, Daniel B

    2004-11-01

    UV radiation (UVR) produces erythema within the first 24 hours of exposure, suppression of the immune system within the first 10 days, and, for many people, over the course of decades, skin cancer. Although UVR damages many skin targets, DNA damage in the form of cyclobutane pyrimidine dimers (CPDs) is an important mediator of these sequelae. The action spectrum for erythema parallels the action spectrum for CPD formation in skin, and in the absence of repair, as in the genetic disease xeroderma pigmentosum (XP), skin cancer rates are dramatically increased. DNA repair in skin can be enhanced by the delivery of DNA repair enzymes encapsulated in liposomes. Used in this way, photoreactivation of CPDs greatly diminishes erythema and the suppression of contact hypersensitivity (CHS). UV endonucleases delivered by liposomes also prevent UV-induced suppression of delayed-type hypersensitivity. In a clinical study of patients with XP, T4 endonuclease V (T4N5) liposome lotion applied for one year reduced the rates of actinic keratosis (AK) and skin cancer compared with placebo. These results showed that strategies to increase sun protection should include measures to reduce DNA damage and increase the rate of DNA repair.

  15. Repair of DNA-containing pyrimidine dimers

    International Nuclear Information System (INIS)

    Ultraviolet light-induced pyrimidine dimers in DNA are recognized and repaired by a number of unique cellular surveillance systems. The most direct biochemical mechanism responding to this kind of genotoxicity involves direct photoreversal by flavin enzymes that specifically monomerize pyrimidine:pyrimidine dimers monophotonically in the presence of visible light. Incision reactions are catalyzed by a combined pyrimidine dimer DNA-glycosylase:apyrimidinic endonuclease found in some highly UV-resistant organisms. At a higher level of complexity, Escherichia coli has a uvr DNA repair system comprising the UvrA, UvrB, and UvrC proteins responsible for incision. There are several preincision steps governed by this pathway, which includes an ATP-dependent UvrA dimerization reaction required for UvrAB nucleoprotein formation. This complex formation driven by ATP binding is associated with localized topological unwinding of DNA. This same protein complex can catalyze an ATPase-dependent 5'----3'-directed strand displacement of D-loop DNA or short single strands annealed to a single-stranded circular or linear DNA. This putative translocational process is arrested when damaged sites are encountered. The complex is now primed for dual incision catalyzed by UvrC. The remainder of the repair process involves UvrD (helicase II) and DNA polymerase I for a coordinately controlled excision-resynthesis step accompanied by UvrABC turnover. Furthermore, it is proposed that levels of repair proteins can be regulated by proteolysis. UvrB is converted to truncated UvrB* by a stress-induced protease that also acts at similar sites on the E. coli Ada protein. Although UvrB* can bind with UvrA to DNA, it cannot participate in helicase or incision reactions. It is also a DNA-dependent ATPase.21 references

  16. Repair of DNA-containing pyrimidine dimers

    Energy Technology Data Exchange (ETDEWEB)

    Grossman, L.; Caron, P.R.; Mazur, S.J.; Oh, E.Y.

    1988-08-01

    Ultraviolet light-induced pyrimidine dimers in DNA are recognized and repaired by a number of unique cellular surveillance systems. The most direct biochemical mechanism responding to this kind of genotoxicity involves direct photoreversal by flavin enzymes that specifically monomerize pyrimidine:pyrimidine dimers monophotonically in the presence of visible light. Incision reactions are catalyzed by a combined pyrimidine dimer DNA-glycosylase:apyrimidinic endonuclease found in some highly UV-resistant organisms. At a higher level of complexity, Escherichia coli has a uvr DNA repair system comprising the UvrA, UvrB, and UvrC proteins responsible for incision. There are several preincision steps governed by this pathway, which includes an ATP-dependent UvrA dimerization reaction required for UvrAB nucleoprotein formation. This complex formation driven by ATP binding is associated with localized topological unwinding of DNA. This same protein complex can catalyze an ATPase-dependent 5'----3'-directed strand displacement of D-loop DNA or short single strands annealed to a single-stranded circular or linear DNA. This putative translocational process is arrested when damaged sites are encountered. The complex is now primed for dual incision catalyzed by UvrC. The remainder of the repair process involves UvrD (helicase II) and DNA polymerase I for a coordinately controlled excision-resynthesis step accompanied by UvrABC turnover. Furthermore, it is proposed that levels of repair proteins can be regulated by proteolysis. UvrB is converted to truncated UvrB* by a stress-induced protease that also acts at similar sites on the E. coli Ada protein. Although UvrB* can bind with UvrA to DNA, it cannot participate in helicase or incision reactions. It is also a DNA-dependent ATPase.21 references.

  17. DNA-mediated charge transport for DNA repair

    OpenAIRE

    Boon, Elizabeth M; Livingston, Alison L.; Chmiel, Nikolas H.; David, Sheila S.; Barton, Jacqueline K.

    2003-01-01

    MutY, like many DNA base excision repair enzymes, contains a [4Fe4S](2+) cluster of undetermined function. Electrochemical studies of MutY bound to a DNA-modified gold electrode demonstrate that the [4Fe4S] cluster of MutY can be accessed in a DNA-mediated redox reaction. Although not detectable without DNA, the redox potential of DNA-bound MutY is approximate to275 mV versus NHE, which is characteristic of HiPiP iron proteins. Binding to DNA is thus associated with a change in [4Fe4S](3+/2+)...

  18. Fragile DNA Repair Mechanism Reduces Ageing in Multicellular Model

    DEFF Research Database (Denmark)

    Bendtsen, Kristian Moss; Juul, Jeppe Søgaard; Trusina, Ala

    2012-01-01

    DNA damages, as well as mutations, increase with age. It is believed that these result from increased genotoxic stress and decreased capacity for DNA repair. The two causes are not independent, DNA damage can, for example, through mutations, compromise the capacity for DNA repair, which in turn...... increases the amount of unrepaired DNA damage. Despite this vicious circle, we ask, can cells maintain a high DNA repair capacity for some time or is repair capacity bound to continuously decline with age? We here present a simple mathematical model for ageing in multicellular systems where cells subjected...... to DNA damage can undergo full repair, go apoptotic, or accumulate mutations thus reducing DNA repair capacity. Our model predicts that at the tissue level repair rate does not continuously decline with age, but instead has a characteristic extended period of high and non-declining DNA repair...

  19. Assessment of Human DNA Repair (NER) Capacity With DNA Repair Rate (DRR) by Comet Assay

    Institute of Scientific and Technical Information of China (English)

    WEI ZHENG; JI-LIANG HE; LI-FEN JIN; JIAN-LIN LOU; BAO-HONG WANG

    2005-01-01

    Objective Alkaline comet assay was used to evaluate DNA repair (nucleotide excision repair, NER) capacity of human fresh lymphocytes from 12 young healthy non-smokers (6 males and 6 females). Methods Lymphocytes were exposed to UV-C (254 nm) at the dose rate of 1.5 J/m2/sec. Novobiocin (NOV) and aphidicolin (APC), DNA repair inhibitors, were utilized to imitate the deficiency of DNA repair capacity at the incision and ligation steps of NER. Lymphocytes from each donor were divided into three grougs: UVC group, UVC plus NOV group, and UVC plus APC group. DNA single strand breaks were detected in UVC irradiated cells incubated for 0, 30, 60, 90, 120, 180, and 240 min after UVC irradiation. DNA repair rate (DRR) served as an indicator of DNA repair capacity. Results The results indicated that the maximum DNA damage (i.e. maximum tail length) in the UVC group mainly appeared at 90 min. The ranges of DRRs in the UVC group were 62.84%-98.71%. Average DRR value was 81.84%. The DRR difference between males and females was not significant (P<0.05). However, the average DRR value in the UVC plus NOV group and the UVC plus APC group was 52.98% and 39.57% respectively, which were significantly lower than that in the UVC group (P<0.01). Conclusion The comet assay is a rapid, simple and sensitive screening test to assess individual DNA repair (NER) capacity. It is suggested that the time to detect DNA single strand breaks in comet assay should include 0 (before UV irradiation), 90 and 240 min after exposure to 1.5 J·m-2 UVC at least. The DRR, as an indicator, can represent the individual DNA repair capacity in comet assay.

  20. Calculation of DNA strand breakage by neutralisation effect after 125I decays in a synthetic oligodeoxynucleotide using charge transfer theory

    International Nuclear Information System (INIS)

    The decay of the radioisotope 125I into 125Te is typically followed by the emission of two groups of approximately 10 electrons each via Auger processes. In deoxyribonucleic acid (DNA) with 125I incorporated, these electrons produce various types of damage to DNA, e.g. single strand breaks (SSBs) and double strand breaks (DSBs) through direct actions of physical tracks, or indirect actions of radicals produced in water. Among the direct actions one should consider not only the excitation and ionisation of DNA by Auger electrons, but also the neutralisation of highly charged 125mTe ions with electrons from neighbouring molecules. Comparison between experiment and simulation done recently revealed that without including neutralisation effect the simulated yield of SSBs was 50% less than the measured result. In the present work a calculation of DNA strand breakage by the neutralization effect in a 41-mer synthetic oligodeoxynucleotide (oligo-DNA) model was done using the charge transfer theory. Calculation based on transfer rate using the newly evaluated electronic coupling of DNA bases showed that the positive charge (hole) transfer rate is of the order of magnitudes of several 1013s-1, implying that a charge higher than 10 units might not build on a 125mTe atom. The potential energy accumulated on the decay base is transferred to bases along the DNA chain nearby and destroys those bases and ionises the sugar-phosphate group, leading a DNA SSB with a frequency of 0.2% per eV in average. (authors)

  1. Mechanisms of mutagenesis and DNA repair

    International Nuclear Information System (INIS)

    The research deals with mechanisms of excision repair in Escherichia coli exposed to chemicals or ultraviolet (uv) radiation. During the past year attention has been focused on the incision proteins that initiate removal of pyrimidine dimers, benzo[a]pyrene adducts, and other bulky lesions from DNA. The product of the E. Coli uvrD gene was isolated and shown to be important in mediating closure of single strand DNA breaks promoted by the incision complex coded for by the uvrA, uvrB, and uvrC gene products. This suggests that the uvrD gene product (now known to be a helicase) is necessary either for dislodging the incision complex from the nicked DNA or for preparing a DNA primer-template configuration suitable for proper repair resynthesis

  2. DNA Repair Systems: Guardians of the Genome

    Indian Academy of Sciences (India)

    2016-10-01

    The 2015 Nobel Prize in Chemistry was awarded jointly to Tomas Lindahl, Paul Modrich and Aziz Sancar to honour their accomplishments in the field of DNA repair. Ever since the discovery of DNA structure and their importance in the storage of genetic information, questions about their stability became pertinent. A molecule which is crucial for the development and propagation of an organism must be closely monitored so that the genetic information is not corrupted. Thanks to the pioneering research work of Lindahl, Sancar, Modrich and their colleagues, we now have an holistic awareness of how DNA damage occurs and how the damage is rectified in bacteria as well as in higher organisms including human beings. A comprehensive understanding of DNA repair has proven crucial in the fight against cancer and other debilitating diseases.

  3. Early days of DNA repair: discovery of nucleotide excision repair and homology-dependent recombinational repair.

    Science.gov (United States)

    Rupp, W Dean

    2013-12-13

    The discovery of nucleotide excision repair in 1964 showed that DNA could be repaired by a mechanism that removed the damaged section of a strand and replaced it accurately by using the remaining intact strand as the template. This result showed that DNA could be actively metabolized in a process that had no precedent. In 1968, experiments describing postreplication repair, a process dependent on homologous recombination, were reported. The authors of these papers were either at Yale University or had prior Yale connections. Here we recount some of the events leading to these discoveries and consider the impact on further research at Yale and elsewhere.

  4. Chromatin challenges during DNA replication and repair

    DEFF Research Database (Denmark)

    Groth, Anja; Rocha, Walter; Verreault, Alain;

    2007-01-01

    the challenge of maintenance, cells have evolved efficient nucleosome-assembly pathways and chromatin-maturation mechanisms that reproduce chromatin organization in the wake of DNA replication and repair. The aim of this Review is to describe how these pathways operate and to highlight how the epigenetic...

  5. Nobel Recognizes Seminal Work in DNA Repair.

    Science.gov (United States)

    2015-12-01

    Three scientists will share this year's Nobel Prize in Chemistry for pioneering research that established the inherent instability of DNA and the cellular mechanisms underlying its repair. Their discoveries of how living cells function have aided in developing new cancer therapies.

  6. DNA repair genotypes and phenotypes and cancer susceptibility

    Institute of Scientific and Technical Information of China (English)

    Qingyi Wei

    2008-01-01

    @@ The role of DNA repair in the etiology of cancers has been well illustrated in several hereditary syndromes, in which an inherited defect in DNA repair and related biological processes is associated with extraordinarily high incidence of cancer.

  7. SU-E-T-241: Monte Carlo Simulation Study About the Prediction of Proton-Induced DNA Strand Breakage On the Double Helix Structure

    Energy Technology Data Exchange (ETDEWEB)

    Shin, J; Park, S; Jeong, J; Jeong, C [National Cancer Center, Goyang, Gyeonggi-do (Korea, Republic of); Lim, Y; Lee, S [National Cancer Center in Korea, Goyang, Gyeonggi-do (Korea, Republic of); SHIN, D [National Cancer Center, Goyangsi, Gyeonggi-do (Korea, Republic of); Incerti, S [Universite Bordeaux 1, CNRS.IN2P3, Centres d’Etudes Nucleaires de Bordeau, Gradignan, Gradignan (France)

    2014-06-01

    Purpose: In particle therapy and radiobiology, the investigation of mechanisms leading to the death of target cancer cells induced by ionising radiation is an active field of research. Recently, several studies based on Monte Carlo simulation codes have been initiated in order to simulate physical interactions of ionising particles at cellular scale and in DNA. Geant4-DNA is the one of them; it is an extension of the general purpose Geant4 Monte Carlo simulation toolkit for the simulation of physical interactions at sub-micrometre scale. In this study, we present Geant4-DNA Monte Carlo simulations for the prediction of DNA strand breakage using a geometrical modelling of DNA structure. Methods: For the simulation of DNA strand breakage, we developed a specific DNA geometrical structure. This structure consists of DNA components, such as the deoxynucleotide pairs, the DNA double helix, the nucleosomes and the chromatin fibre. Each component is made of water because the cross sections models currently available in Geant4-DNA for protons apply to liquid water only. Also, at the macroscopic-scale, protons were generated with various energies available for proton therapy at the National Cancer Center, obtained using validated proton beam simulations developed in previous studies. These multi-scale simulations were combined for the validation of Geant4-DNA in radiobiology. Results: In the double helix structure, the deposited energy in a strand allowed to determine direct DNA damage from physical interaction. In other words, the amount of dose and frequency of damage in microscopic geometries was related to direct radiobiological effect. Conclusion: In this report, we calculated the frequency of DNA strand breakage using Geant4- DNA physics processes for liquid water. This study is now on-going in order to develop geometries which use realistic DNA material, instead of liquid water. This will be tested as soon as cross sections for DNA material become available in Geant4

  8. Epigenetic reduction of DNA repair in progression togastrointestinal cancer

    Institute of Scientific and Technical Information of China (English)

    2015-01-01

    Deficiencies in DNA repair due to inherited germ-linemutations in DNA repair genes cause increased risk ofgastrointestinal (GI) cancer. In sporadic GI cancers,mutations in DNA repair genes are relatively rare.However, epigenetic alterations that reduce expressionof DNA repair genes are frequent in sporadic GI cancers.These epigenetic reductions are also found in fielddefects that give rise to cancers. Reduced DNA repairlikely allows excessive DNA damages to accumulatein somatic cells. Then either inaccurate translesionsynthesis past the un-repaired DNA damages or errorproneDNA repair can cause mutations. ErroneousDNA repair can also cause epigenetic alterations (i.e. ,epimutations, transmitted through multiple replicationcycles). Some of these mutations and epimutations maycause progression to cancer. Thus, deficient or absentDNA repair is likely an important underlying cause ofcancer. Whole genome sequencing of GI cancers showthat between thousands to hundreds of thousands ofmutations occur in these cancers. Epimutations thatreduce DNA repair gene expression and occur early inprogression to GI cancers are a likely source of this highgenomic instability. Cancer cells deficient in DNA repairare more vulnerable than normal cells to inactivation byDNA damaging agents. Thus, some of the most clinicallyeffective chemotherapeutic agents in cancer treatmentare DNA damaging agents, and their effectivenessoften depends on deficient DNA repair in cancer cells.Recently, at least 18 DNA repair proteins, each activein one of six DNA repair pathways, were found to besubject to epigenetic reduction of expression in GIcancers. Different DNA repair pathways repair differenttypes of DNA damage. Evaluation of which DNA repairpathway(s) are deficient in particular types of GI cancerand/or particular patients may prove useful in guidingchoice of therapeutic agents in cancer therapy.

  9. Energy and Technology Review: Unlocking the mysteries of DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Quirk, W.A.

    1993-04-01

    DNA, the genetic blueprint, has the remarkable property of encoding its own repair following diverse types of structural damage induced by external agents or normal metabolism. We are studying the interplay of DNA damaging agents, repair genes, and their protein products to decipher the complex biochemical pathways that mediate such repair. Our research focuses on repair processes that correct DNA damage produced by chemical mutagens and radiation, both ionizing and ultraviolet. The most important type of DNA repair in human cells is called excision repair. This multistep process removes damaged or inappropriate pieces of DNA -- often as a string of 29 nucleotides containing the damage -- and replaces them with intact ones. We have isolated, cloned, and mapped several human repair genes associated with the nucleotide excision repair pathway and involved in the repair of DNA damage after exposure to ultraviolet light or mutagens in cooked food. We have shown that a defect in one of these repair genes, ERCC2, is responsible for the repair deficiency in one of the groups of patients with the recessive genetic disorder xeroderma pigmentosum (XP group D). We are exploring ways to purify sufficient quantities (milligrams) of the protein products of these and other repair genes so that we can understand their functions. Our long-term goals are to link defective repair proteins to human DNA repair disorders that predispose to cancer, and to produce DNA-repair-deficient mice that can serve as models for the human disorders.

  10. Ancient bacteria show evidence of DNA repair

    DEFF Research Database (Denmark)

    Johnson, Sarah Stewart; Hebsgaard, Martin B; Christensen, Torben R;

    2007-01-01

    Recent claims of cultivable ancient bacteria within sealed environments highlight our limited understanding of the mechanisms behind long-term cell survival. It remains unclear how dormancy, a favored explanation for extended cellular persistence, can cope with spontaneous genomic decay over...... geological timescales. There has been no direct evidence in ancient microbes for the most likely mechanism, active DNA repair, or for the metabolic activity necessary to sustain it. In this paper, we couple PCR and enzymatic treatment of DNA with direct respiration measurements to investigate long...... that this long-term survival is closely tied to cellular metabolic activity and DNA repair that over time proves to be superior to dormancy as a mechanism in sustaining bacteria viability....

  11. Fragile DNA repair mechanism reduces ageing in multicellular model.

    Directory of Open Access Journals (Sweden)

    Kristian Moss Bendtsen

    Full Text Available DNA damages, as well as mutations, increase with age. It is believed that these result from increased genotoxic stress and decreased capacity for DNA repair. The two causes are not independent, DNA damage can, for example, through mutations, compromise the capacity for DNA repair, which in turn increases the amount of unrepaired DNA damage. Despite this vicious circle, we ask, can cells maintain a high DNA repair capacity for some time or is repair capacity bound to continuously decline with age? We here present a simple mathematical model for ageing in multicellular systems where cells subjected to DNA damage can undergo full repair, go apoptotic, or accumulate mutations thus reducing DNA repair capacity. Our model predicts that at the tissue level repair rate does not continuously decline with age, but instead has a characteristic extended period of high and non-declining DNA repair capacity, followed by a rapid decline. Furthermore, the time of high functionality increases, and consequently slows down the ageing process, if the DNA repair mechanism itself is vulnerable to DNA damages. Although counterintuitive at first glance, a fragile repair mechanism allows for a faster removal of compromised cells, thus freeing the space for healthy peers. This finding might be a first step toward understanding why a mutation in single DNA repair protein (e.g. Wrn or Blm is not buffered by other repair proteins and therefore, leads to severe ageing disorders.

  12. DNA repair in cancer: emerging targets for personalized therapy

    International Nuclear Information System (INIS)

    Genomic deoxyribonucleic acid (DNA) is under constant threat from endogenous and exogenous DNA damaging agents. Mammalian cells have evolved highly conserved DNA repair machinery to process DNA damage and maintain genomic integrity. Impaired DNA repair is a major driver for carcinogenesis and could promote aggressive cancer biology. Interestingly, in established tumors, DNA repair activity is required to counteract oxidative DNA damage that is prevalent in the tumor microenvironment. Emerging clinical data provide compelling evidence that overexpression of DNA repair factors may have prognostic and predictive significance in patients. More recently, DNA repair inhibition has emerged as a promising target for anticancer therapy. Synthetic lethality exploits intergene relationships where the loss of function of either of two related genes is nonlethal, but loss of both causes cell death. Exploiting this approach by targeting DNA repair has emerged as a promising strategy for personalized cancer therapy. In the current review, we focus on recent advances with a particular focus on synthetic lethality targeting in cancer

  13. Repair of nonreplicating UV-irradiated DNA

    Energy Technology Data Exchange (ETDEWEB)

    Martin, S.J.; Hays, J.B.

    1986-05-01

    Repair of irradiated phage lambda DNA in E. coli has been studied by a repressed-infection system: superinfection of homoimmune lysogenic bacteria; assay for restoration of transcribility to phage-encoded lac genes; extraction of DNA and assay for infectivity in transfection of uvrB/sup -/ recA/sup -/ recB/sup -/ spheroplasts, and for removal of cyclobutane pyrimidine dimers (CBP-dimers) by UV-endonuclease treatment and alkaline sedimentation. In uvr/sup +/ repressed infections with 254-nm irradiated phages (60 J/m/sup 2/) lac transcription was rapidly returned to undamaged levels, concomitant with restoration of infectivity and removal of CBP-dimers. In uvrD/sup -/ cells, the frequency of phage gene inactivation corresponded to the estimated frequency of CBP-dimers per gene. In uvrA/sup -/ bacteria, however, lac expression was only 1/10 to 1/3 of that predicted by the expected frequency of gene inactivation, as if damage elsewhere affected transcription; recovery of infectivity and removal of CBP-dimers was almost completely inhibited. lac/sup +/ and lacUV5 phages, expected to respond oppositely to changes in superhelical density, were constructed as probes for topological changes during DNA repair. The assays for transfection infectivity and CBP-dimer-removal have been extended to studies of repair of UV-irradiated phage DNA injected into oocytes of the frog Xenopus laevis.

  14. Repair of nonreplicating UV-irradiated DNA

    International Nuclear Information System (INIS)

    Repair of irradiated phage λ DNA in E. coli has been studied by a repressed-infection system: superinfection of homoimmune lysogenic bacteria; assay for restoration of transcribility to phage-encoded lac genes; extraction of DNA and assay for infectivity in transfection of uvrB- recA- recB- spheroplasts, and for removal of cyclobutane pyrimidine dimers (CBP-dimers) by UV-endonuclease treatment and alkaline sedimentation. In uvr+ repressed infections with 254-nm irradiated phages (60 J/m2) lac transcription was rapidly returned to undamaged levels, concomitant with restoration of infectivity and removal of CBP-dimers. In uvrD- cells, the frequency of phage gene inactivation corresponded to the estimated frequency of CBP-dimers per gene. In uvrA- bacteria, however, lac expression was only 1/10 to 1/3 of that predicted by the expected frequency of gene inactivation, as if damage elsewhere affected transcription; recovery of infectivity and removal of CBP-dimers was almost completely inhibited. lac+ and lacUV5 phages, expected to respond oppositely to changes in superhelical density, were constructed as probes for topological changes during DNA repair. The assays for transfection infectivity and CBP-dimer-removal have been extended to studies of repair of UV-irradiated phage DNA injected into oocytes of the frog Xenopus laevis

  15. Stripped-down DNA repair in a highly reduced parasite

    Directory of Open Access Journals (Sweden)

    Fast Naomi M

    2007-03-01

    Full Text Available Abstract Background Encephalitozoon cuniculi is a member of a distinctive group of single-celled parasitic eukaryotes called microsporidia, which are closely related to fungi. Some of these organisms, including E. cuniculi, also have uniquely small genomes that are within the prokaryotic range. Thus, E. cuniculi has undergone a massive genome reduction which has resulted in a loss of genes from diverse biological pathways, including those that act in DNA repair. DNA repair is essential to any living cell. A loss of these mechanisms invariably results in accumulation of mutations and/or cell death. Six major pathways of DNA repair in eukaryotes include: non-homologous end joining (NHEJ, homologous recombination repair (HRR, mismatch repair (MMR, nucleotide excision repair (NER, base excision repair (BER and methyltransferase repair. DNA polymerases are also critical players in DNA repair processes. Given the close relationship between microsporidia and fungi, the repair mechanisms present in E. cuniculi were compared to those of the yeast Saccharomyces cerevisiae to ascertain how the process of genome reduction has affected the DNA repair pathways. Results E. cuniculi lacks 16 (plus another 6 potential absences of the 56 DNA repair genes sought via BLASTP and PSI-BLAST searches. Six of 14 DNA polymerases or polymerase subunits are also absent in E. cuniculi. All of these genes are relatively well conserved within eukaryotes. The absence of genes is not distributed equally among the different repair pathways; some pathways lack only one protein, while there is a striking absence of many proteins that are components of both double strand break repair pathways. All specialized repair polymerases are also absent. Conclusion Given the large number of DNA repair genes that are absent from the double strand break repair pathways, E. cuniculi is a prime candidate for the study of double strand break repair with minimal machinery. Strikingly, all of the

  16. Polymorphisms in DNA Repair Genes, Smoking, and Pancreatic Adenocarcinoma Risk

    OpenAIRE

    Robert R McWilliams; William R Bamlet; Cunningham, Julie M.; Goode, Ellen L.; de ANDRADE, MARIZA; Lisa A Boardman; Petersen, Gloria M.

    2008-01-01

    Base excision repair and nucleotide excision repair are vital responses to multiple types of DNA damage, including damage from tobacco exposure. Single-nucleotide polymorphisms (SNP) in these pathways may affect DNA repair capacity and therefore influence risk for cancer development. We performed a clinic-based, case-control study comprising 481 consecutive patients with confirmed pancreatic adenocarcinoma and 625 healthy controls. Allele and genotype frequencies for 16 SNPs in DNA repair gen...

  17. A-type lamins maintain the positional stability of DNA damage repair foci in mammalian nuclei.

    Directory of Open Access Journals (Sweden)

    Robert Mahen

    Full Text Available A-type lamins encoded by LMNA form a structural fibrillar meshwork within the mammalian nucleus. How this nuclear organization may influence the execution of biological processes involving DNA transactions remains unclear. Here, we characterize changes in the dynamics and biochemical interactions of lamin A/C after DNA damage. We find that DNA breakage reduces the mobility of nucleoplasmic GFP-lamin A throughout the nucleus as measured by dynamic fluorescence imaging and spectroscopy in living cells, suggestive of incorporation into stable macromolecular complexes, but does not induce the focal accumulation of GFP-lamin A at damage sites. Using a proximity ligation assay and biochemical analyses, we show that lamin A engages chromatin via histone H2AX and its phosphorylated form (γH2AX induced by DNA damage, and that these interactions are enhanced after DNA damage. Finally, we use three-dimensional time-lapse imaging to show that LMNA inactivation significantly reduces the positional stability of DNA repair foci in living cells. This defect is partially rescued by the stable expression of GFP-lamin A. Thus collectively, our findings suggest that the dynamic structural meshwork formed by A-type lamins anchors sites of DNA repair in mammalian nuclei, providing fresh insight into the control of DNA transactions by nuclear structural organization.

  18. Surface area as a dose metric for carbon black nanoparticles: A study of oxidative stress, DNA single-strand breakage and inflammation in rats

    Science.gov (United States)

    Chuang, Hsiao-Chi; Chen, Li-Chen; Lei, Yu-Chen; Wu, Kuen-Yuh; Feng, Po-Hao; Cheng, Tsun-Jen

    2015-04-01

    Combustion-derived nanoparticles are characterised by a high surface area (SA) per mass. SA is proposed to regulate the bioreactivity of nanoparticles; however, the dose metric for carbon black remains controversial. To determine the relationships between bioreactivity and SA, male spontaneously hypertensive rats were exposed to carbon black (CB) nanoparticles (15, 51 and 95 nm) via intratracheal instillation for 24 h. Pulmonary exposure to CB resulted in a significant increase in systemic 8-hydroxy-2‧-deoxyguanosine (8-OHdG), DNA single-strand breakages in peripheral blood cells and pulmonary cell infiltration in rats. The oxidative potential and particularly the corresponding SA of CB were correlated with the level of 8-OHdG, DNA single-strand breakages and pulmonary cell infiltration in rats. We conclude that SA is an important dose metric for CB that can regulate oxidative stress and DNA damage in rats. Furthermore, this observation was more significant for smaller sized CB.

  19. 5-bp Classical Satellite DNA Loci from Chromosome-1 Instability in Cervical Neoplasia Detected by DNA Breakage Detection/Fluorescence in Situ Hybridization (DBD-FISH

    Directory of Open Access Journals (Sweden)

    Jaime Gosálvez

    2013-02-01

    Full Text Available We aimed to evaluate the association between the progressive stages of cervical neoplasia and DNA damage in 5-bp classical satellite DNA sequences from chromosome-1 in cervical epithelium and in peripheral blood lymphocytes using DNA breakage detection/fluorescence in situ hybridization (DBD-FISH. A hospital-based unmatched case-control study was conducted in 2011 with a sample of 30 women grouped according to disease stage and selected according to histological diagnosis; 10 with low-grade squamous intraepithelial lesions (LG-SIL, 10 with high-grade SIL (HG-SIL, and 10 with no cervical lesions, from the Unidad Medica de Alta Especialidad of The Mexican Social Security Institute, IMSS, Mexico. Specific chromosome damage levels in 5-bp classical satellite DNA sequences from chromosome-1 were evaluated in cervical epithelium and peripheral blood lymphocytes using the DBD-FISH technique. Whole-genome DNA hybridization was used as a reference for the level of damage. Results of Kruskal-Wallis test showed a significant increase according to neoplastic development in both tissues. The instability of 5-bp classical satellite DNA sequences from chromosome-1 was evidenced using chromosome-orientation FISH. In conclusion, we suggest that the progression to malignant transformation involves an increase in the instability of 5-bp classical satellite DNA sequences from chromosome-1.

  20. Iodine-125 induced DNA strand breakage: Contributions of different physical and chemical radiation action mechanisms

    International Nuclear Information System (INIS)

    The decay of the radioisotope 125I into 125Te is typically followed by the emission of two groups of approximately 10 electrons each. In deoxyribonucleic acid (DNA) with 125I incorporated, these electrons produce various types of damage to DNA, e.g. single and double strand breaks. They occur through direct actions of physical tracks, or indirect actions of radicals produced in water. Among the direct actions one should consider not only the excitation and ionization of DNA by electrons but also the neutralization of highly charged 125mTe ions with electrons from neighboring molecules. The present work begins with a detailed description of electron tracks with the use of the PARTRAC code, compares results with recent experiments, and concludes with a firm assessment of the contribution to the strand break yields from the neutralization effect. (orig.)

  1. Epigenetic changes of DNA repair genes in cancer

    Institute of Scientific and Technical Information of China (English)

    Christoph Lahtz; Gerd P. Pfeifer

    2011-01-01

    'Every Hour Hurts, The Last One Kills'. That is an old saying about getting old. Every day, thousands of DNA damaging events take place in each cell of our body, but efficient DNA repair systems have evolved to prevent that. However, our DNA repair system and that of most other organisms are not as perfect as that of Deinococcus radiodurans, for example, which is able to repair massive amounts of DNA damage at one time. In many instances, accumulation of DNA damage has been linked to cancer, and genetic deficiencies in specific DNA repair genes are associated with tumor-prone phenotypes. In addition to mutations, which can be either inherited or somatically acquired, epigenetic silencing of DNA repair genes may promote tumorigenesis. This review will summarize current knowledge of the epigenetic inactivation of different DNA repair components in human cancer.

  2. Prenatal diagnosis of ataxia-telangiectasia and Nijmegen Breakage Syndrome by the assay of radioresistant DNA synthesis

    International Nuclear Information System (INIS)

    Prenatal diagnosis was performed in 16 pregnancies at risk of ataxia-telangiectasia (A-T) or Nijmegen Breakage Syndrome (NBS). Radioresistant DNA synthesis (RDS) was investigated in cultured chorionic villus (CV) cells and/or amniotic fluid (AF) cells. In four pregnancies, an affected foetus was diagnosed with increased RDS in cultured CV cells. In three of the four cases confirmation of the diagnosis was obtained by analysis of AF cells and/or skin fibroblasts from the foetus cultured after termination of the pregnancy; in the fourth case a fibroblast culture from the aborted foetus failed. In one case, only AF cells could be analysed in a late stage of pregnancy; pregnancy was terminated due to intermediate/equivocal results but the foetus fibroblasts showed normal RDS. Normal RDS was demonstrated in the other 11 pregnancies at 25% risk either by analysis of CB cells (nine cases) or of AF cells (two cases). In some cases the (normal) results on the CV cells were corroborated by subsequent analysis of Af cells. The results suggest that RDS analysis of CV cells allows reliable prenatal diagnosis of A-T/NBS. However, amniocentesis may be necessary to confirm normal results on CV cells if the foetus is female (because of the risk of maternal cell contamination) or in the rare case of equivocal results. (author)

  3. DNA Amplification by Breakage/Fusion/Bridge Cycles Initiated by Spontaneous Telomere Loss in a Human Cancer Cell Line

    Directory of Open Access Journals (Sweden)

    Anthony W.l. Lo

    2002-01-01

    Full Text Available The development of genomic instability is an important step in generatingthe multiple genetic changes required for cancer. One consequence of genomic instability is the overexpression of oncogenes due to gene amplification. One mechanism for gene amplification is the breakagelfusionlbridge (B/F/Bcyclethatinvolvesthe repeated fusion and breakage of chromosomes following the loss of a telomere. B/F/B cycles have been associated with low-copy gene amplification in human cancer cells, and have been proposed to be an initiating event in high-copy gene amplification. We have found that spontaneous telomere loss on a marker chromosome 16 in a human tumor cell line results in sister chromatid fusion and prolonged periods of chromosome instability. The high rate of anaphase bridges involving chromosome 16 demonstrates that this instability results from B/F/B cycles. The amplification of subtelomeric DNA on the marker chromosome provides conclusive evidence that B/F/B cycles initiated by spontaneous telomere loss are a mechanism for gene amplification in human cancer cells.

  4. Use of the DBD-FISH technique for detecting DNA breakage in response to high doses of X-rays.

    Science.gov (United States)

    Cortés-Gutiérrez, Elva I; Dávila-Rodríguez, Martha I; Cerda-Flores, Ricardo M; Fernández, José Luis; López-Fernández, Carmen; Gosálvez, Jaime

    2014-11-01

    The aim of this study was to generate a dose-response curve using the DNA breakage detection-fluorescent in situ hybridization (DBD-FISH) test as a biomarker of initial genetic effects induced by high doses of X-rays. A dose-response curve was obtained by measuring the ex vivo responses to increasing doses (0-50 Gy) of X-rays in the peripheral blood lymphocytes of ten healthy donors. The overall dose-response curve was constructed using integrated density (ID; area × fluorescence intensity) as a measure of genetic damage induced by irradiation. The correlation coefficient was high (r = 0.934, b(0) = 10.408, and b(1) = 0.094). One-way ANOVA with the Student-Newman-Keuls test for multiple comparisons showed significant differences among the average ln ID values according to dose. Our results suggest the usefulness of the DBD-FISH technique for measuring intrinsic individual cellular radio sensitivity ex vivo.

  5. Prenatal diagnosis of ataxia-telangiectasia and Nijmegen Breakage Syndrome by the assay of radioresistant DNA synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Kleijer, W.J.; Kraan, M. van der; Los, F.J. [Erasmus Univ., Rotterdam (Netherlands). Dept. of Clinical Genetics; Jaspers, N.G.J. [Erasmus Univ., Rotterdam (Netherlands). Lab. of Cell Biology and Genetics

    1994-12-01

    Prenatal diagnosis was performed in 16 pregnancies at risk of ataxia-telangiectasia (A-T) or Nijmegen Breakage Syndrome (NBS). Radioresistant DNA synthesis (RDS) was investigated in cultured chorionic villus (CV) cells and/or amniotic fluid (AF) cells. In four pregnancies, an affected foetus was diagnosed with increased RDS in cultured CV cells. In three of the four cases confirmation of the diagnosis was obtained by analysis of AF cells and/or skin fibroblasts from the foetus cultured after termination of the pregnancy; in the fourth case a fibroblast culture from the aborted foetus failed. In one case, only AF cells could be analysed in a late stage of pregnancy; pregnancy was terminated due to intermediate/equivocal results but the foetus fibroblasts showed normal RDS. Normal RDS was demonstrated in the other 11 pregnancies at 25% risk either by analysis of CB cells (nine cases) or of AF cells (two cases). In some cases the (normal) results on the CV cells were corroborated by subsequent analysis of Af cells. The results suggest that RDS analysis of CV cells allows reliable prenatal diagnosis of A-T/NBS. However, amniocentesis may be necessary to confirm normal results on CV cells if the foetus is female (because of the risk of maternal cell contamination) or in the rare case of equivocal results. (author).

  6. DNA repair and mutagenesis of singlestranded bacteriophages

    Energy Technology Data Exchange (ETDEWEB)

    Doubleday, O.P.; Brandenburger, A.; Wagner, R. Jr.; Radman, M. (Brussels Univ. (Belgium)); Godson, G.N.

    1981-01-01

    Virtually all radiation-induced mutagenesis is believed to result from an error-prone repair activity (SOS repair) and to involve mutations occurring both at the site of radiation-induced lesions (targeted mutations) and in undamaged DNA (untargeted mutations). To examine the relative contributions of targeted and untargeted mutations to ..gamma.. and ultraviolet (UV) radiation mutagenesis we have determined the DNA sequences of 174 M13 revertant phages isolated from stocks of irradiated or unirradiated amber mutants grown in irradiated or unirradiated host bacteria. We have detected no obvious specificity of mutagenesis and find no evidence of a predominance of targeted mutations associated with either UV- or ..gamma..-irradiation of the phages or with the induction of the host SOS repair system. In particular, pyrimidine dimers do not appear to be the principal sites of UV-induced bare substitution mutagenesis, suggesting that such UV-induced mutagenesis may be untargeted or occur at sites of lesions other than pyrimidine dimers.

  7. Nijmegen breakage syndrome (NBS

    Directory of Open Access Journals (Sweden)

    Chrzanowska Krystyna H

    2012-02-01

    Full Text Available Abstract Nijmegen breakage syndrome (NBS is a rare autosomal recessive syndrome of chromosomal instability mainly characterized by microcephaly at birth, combined immunodeficiency and predisposition to malignancies. Due to a founder mutation in the underlying NBN gene (c.657_661del5 the disease is encountered most frequently among Slavic populations. The principal clinical manifestations of the syndrome are: microcephaly, present at birth and progressive with age, dysmorphic facial features, mild growth retardation, mild-to-moderate intellectual disability, and, in females, hypergonadotropic hypogonadism. Combined cellular and humoral immunodeficiency with recurrent sinopulmonary infections, a strong predisposition to develop malignancies (predominantly of lymphoid origin and radiosensitivity are other integral manifestations of the syndrome. The NBN gene codes for nibrin which, as part of a DNA repair complex, plays a critical nuclear role wherever double-stranded DNA ends occur, either physiologically or as a result of mutagenic exposure. Laboratory findings include: (1 spontaneous chromosomal breakage in peripheral T lymphocytes with rearrangements preferentially involving chromosomes 7 and 14, (2 sensitivity to ionizing radiation or radiomimetics as demonstrated in vitro by cytogenetic methods or by colony survival assay, (3 radioresistant DNA synthesis, (4 biallelic hypomorphic mutations in the NBN gene, and (5 absence of full-length nibrin protein. Microcephaly and immunodeficiency are common to DNA ligase IV deficiency (LIG4 syndrome and severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation due to NHEJ1 deficiency (NHEJ1 syndrome. In fact, NBS was most commonly confused with Fanconi anaemia and LIG4 syndrome. Genetic counselling should inform parents of an affected child of the 25% risk for further children to be affected. Prenatal molecular genetic diagnosis is possible if disease

  8. 40 CFR 798.5500 - Differential growth inhibition of repair proficient and repair deficient bacteria: “Bacterial DNA...

    Science.gov (United States)

    2010-07-01

    ... repair proficient and repair deficient bacteria: âBacterial DNA damage or repair tests.â 798.5500 Section... CONTROL ACT (CONTINUED) HEALTH EFFECTS TESTING GUIDELINES Genetic Toxicity § 798.5500 Differential growth inhibition of repair proficient and repair deficient bacteria: “Bacterial DNA damage or repair tests.”...

  9. Comet assay to measure DNA repair: approach and applications

    OpenAIRE

    Azqueta, Amaya; SLYSKOVA, JANA; Langie, Sabine A. S.; O’Neill Gaivão, Isabel; Collins, Andrew

    2014-01-01

    Cellular repair enzymes remove virtually all DNA damage before it is fixed; repair therefore plays a crucial role in preventing cancer. Repair studied at the level of transcription correlates poorly with enzyme activity, and so assays of phenotype are needed. In a biochemical approach, substrate nucleoids containing specific DNA lesions are incubated with cell extract; repair enzymes in the extract induce breaks at damage sites; and the breaks are measured with the comet assay. The nature of ...

  10. A brief history of the DNA repair field

    Institute of Scientific and Technical Information of China (English)

    Errol C Friedberg

    2008-01-01

    The history of the repair of damaged DNA can be traced to the mid-1930s. Since then multiple DNA repair mecha-nisms, as well as other biological responses to DNA damage, have been discovered and their regulation has been studied. This article briefly recounts the early history of this field.

  11. DNA double strand break repair pathway choice following ionizing radiation

    International Nuclear Information System (INIS)

    A DNA double strand break (DSB) is one of the critical DNA lesions leading to cell death if unrepaired. DSB is repaired by two distinct repair pathways, i.e. non-homologous end-joining (NHEJ) or homologous recombination (HR). NHEJ contributes to DSB repair throughout the cell cycle, while HR is active during S/G2 phase following DNA replication. We aim to elucidate the molecular mechanisms underlying DSB repair pathway choice at two ended DSBs in G2 phase following ionizing radiation (IR). Here, we discuss recent work that provides new insights into DSB repair pathways choice including our study. (author)

  12. Cloning of Salmonella typhimurium DNA encoding mutagenic DNA repair.

    OpenAIRE

    Thomas, S M; Sedgwick, S G

    1989-01-01

    Mutagenic DNA repair in Escherichia coli is encoded by the umuDC operon. Salmonella typhimurium DNA which has homology with E. coli umuC and is able to complement E. coli umuC122::Tn5 and umuC36 mutations has been cloned. Complementation of umuD44 mutants and hybridization with E. coli umuD also occurred, but these activities were much weaker than with umuC. Restriction enzyme mapping indicated that the composition of the cloned fragment is different from the E. coli umuDC operon. Therefore, ...

  13. Mechanism of DNA loading by the DNA repair helicase XPD.

    Science.gov (United States)

    Constantinescu-Aruxandei, Diana; Petrovic-Stojanovska, Biljana; Penedo, J Carlos; White, Malcolm F; Naismith, James H

    2016-04-01

    The xeroderma pigmentosum group D (XPD) helicase is a component of the transcription factor IIH complex in eukaryotes and plays an essential role in DNA repair in the nucleotide excision repair pathway. XPD is a 5' to 3' helicase with an essential iron-sulfur cluster. Structural and biochemical studies of the monomeric archaeal XPD homologues have aided a mechanistic understanding of this important class of helicase, but several important questions remain open. In particular, the mechanism for DNA loading, which is assumed to require large protein conformational change, is not fully understood. Here, DNA binding by the archaeal XPD helicase fromThermoplasma acidophilumhas been investigated using a combination of crystallography, cross-linking, modified substrates and biochemical assays. The data are consistent with an initial tight binding of ssDNA to helicase domain 2, followed by transient opening of the interface between the Arch and 4FeS domains, allowing access to a second binding site on helicase domain 1 that directs DNA through the pore. A crystal structure of XPD fromSulfolobus acidocaldiariusthat lacks helicase domain 2 has an otherwise unperturbed structure, emphasizing the stability of the interface between the Arch and 4FeS domains in XPD. PMID:26896802

  14. Role of polynucleotide kinase/phosphatase in mitochondrial DNA repair

    OpenAIRE

    Tahbaz, Nasser; Subedi, Sudip; Weinfeld, Michael

    2011-01-01

    Mutations in mitochondrial DNA (mtDNA) are implicated in a broad range of human diseases and in aging. Compared to nuclear DNA, mtDNA is more highly exposed to oxidative damage due to its proximity to the respiratory chain and the lack of protection afforded by chromatin-associated proteins. While repair of oxidative damage to the bases in mtDNA through the base excision repair pathway has been well studied, the repair of oxidatively induced strand breaks in mtDNA has been less thoroughly exa...

  15. DNA repair and radiation sensitivity in mammalian cells

    International Nuclear Information System (INIS)

    Ionizing radiation induces various types of damage in mammalian cells including DNA single-strand breaks, DNA double-strand breaks (DSB), DNA-protein cross links, and altered DNA bases. Although human cells can repair many of these lesions there is little detailed knowledge of the nature of the genes and the encoded enzymes that control these repair processes. We report here on the cellular and genetic analyses of DNA double-strand break repair deficient mammalian cells. It has been well established that the DNA double-strand break is one of the major lesions induced by ionizing radiation. Utilizing rodent repair-deficient mutant, we have shown that the genes responsible for DNA double-strand break repair are also responsible for the cellular expression of radiation sensitivity. The molecular genetic analysis of DSB repair in rodent/human hybrid cells indicate that at least 6 different genes in mammalian cells are responsible for the repair of radiation-induced DNA double-strand breaks. Mapping and the prospect of cloning of human radiation repair genes are reviewed. Understanding the molecular and genetic basis of radiation sensitivity and DNA repair in man will provide a rational foundation to predict the individual risk associated with radiation exposure and to prevent radiation-induced genetic damage in the human population

  16. DNA damage and repair in human cells exposed to sunlight

    International Nuclear Information System (INIS)

    Cultured human cells were treated with direct sunlight under conditions which minimised the hypertonic, hyperthermic and fixative effects of solar radiation. Sunlight produced similar levels of DNA strand breaks as equitoxic 254 nm UV in two fibroblast strains and a melanoma cell line, but DNA repair synthesis and inhibition of semiconservative DNA synthesis and of DNA chain elongation were significantly less for sunlight-exposed cells. DNA breaks induced by sunlight were removed more rapidly. Thus, the repair of solar damage differs considerably from 254 nm UV repair. Glass-filtered sunlight (>320 nm) was not toxic to cells and did not induce repair synthesis but gave a low level of short-lived DNA breaks and some inhibition of DNA chain elongation; thymidine uptake was enhanced. Filtered sunlight slightly enhanced UV-induced repair synthesis and UV toxicity; photoreactivation of UV damage was not found. Attempts to transform human fibroblasts using sunlight, with or without phorbol ester, were unsuccessful. (author)

  17. Protein found to promote DNA repair, prevent cancer

    Institute of Scientific and Technical Information of China (English)

    2008-01-01

    @@ An abundant chromosomal protein that binds to damaged DNA prevents cancer development by enhancing DNA repair, researchers at University of Texas reported on-line in the Proceedings of the National Academies of Science.

  18. Repair of DNA lesions associated with triplex-forming oligonucleotides.

    Science.gov (United States)

    Chin, Joanna Y; Glazer, Peter M

    2009-04-01

    Triplex-forming oligonucleotides (TFOs) are gene targeting tools that can bind in the major groove of duplex DNA in a sequence-specific manner. When bound to DNA, TFOs can inhibit gene expression, can position DNA-reactive agents to specific locations in the genome, or can induce targeted mutagenesis and recombination. There is evidence that third strand binding, alone or with an associated cross-link, is recognized and metabolized by DNA repair factors, particularly the nucleotide excision repair pathway. This review examines the evidence for DNA repair of triplex-associated lesions. PMID:19072762

  19. Chromosomal bands affected by acute oil exposure and DNA repair errors.

    Directory of Open Access Journals (Sweden)

    Gemma Monyarch

    Full Text Available BACKGROUND: In a previous study, we showed that individuals who had participated in oil clean-up tasks after the wreckage of the Prestige presented an increase of structural chromosomal alterations two years after the acute exposure had occurred. Other studies have also reported the presence of DNA damage during acute oil exposure, but little is known about the long term persistence of chromosomal alterations, which can be considered as a marker of cancer risk. OBJECTIVES: We analyzed whether the breakpoints involved in chromosomal damage can help to assess the risk of cancer as well as to investigate their possible association with DNA repair efficiency. METHODS: Cytogenetic analyses were carried out on the same individuals of our previous study and DNA repair errors were assessed in cultures with aphidicolin. RESULTS: Three chromosomal bands, 2q21, 3q27 and 5q31, were most affected by acute oil exposure. The dysfunction in DNA repair mechanisms, expressed as chromosomal damage, was significantly higher in exposed-oil participants than in those not exposed (p= 0.016. CONCLUSION: The present study shows that breaks in 2q21, 3q27 and 5q31 chromosomal bands, which are commonly involved in hematological cancer, could be considered useful genotoxic oil biomarkers. Moreover, breakages in these bands could induce chromosomal instability, which can explain the increased risk of cancer (leukemia and lymphomas reported in chronically benzene-exposed individuals. In addition, it has been determined that the individuals who participated in clean-up of the oil spill presented an alteration of their DNA repair mechanisms two years after exposure.

  20. DNA Mismatch Repair and Oxidative DNA Damage: Implications for Cancer Biology and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Bridge, Gemma; Rashid, Sukaina; Martin, Sarah A., E-mail: sarah.martin@qmul.ac.uk [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ (United Kingdom)

    2014-08-05

    Many components of the cell, including lipids, proteins and both nuclear and mitochondrial DNA, are vulnerable to deleterious modifications caused by reactive oxygen species. If not repaired, oxidative DNA damage can lead to disease-causing mutations, such as in cancer. Base excision repair and nucleotide excision repair are the two DNA repair pathways believed to orchestrate the removal of oxidative lesions. However, recent findings suggest that the mismatch repair pathway may also be important for the response to oxidative DNA damage. This is particularly relevant in cancer where mismatch repair genes are frequently mutated or epigenetically silenced. In this review we explore how the regulation of oxidative DNA damage by mismatch repair proteins may impact on carcinogenesis. We discuss recent studies that identify potential new treatments for mismatch repair deficient tumours, which exploit this non-canonical role of mismatch repair using synthetic lethal targeting.

  1. DNA Mismatch Repair and Oxidative DNA Damage: Implications for Cancer Biology and Treatment

    International Nuclear Information System (INIS)

    Many components of the cell, including lipids, proteins and both nuclear and mitochondrial DNA, are vulnerable to deleterious modifications caused by reactive oxygen species. If not repaired, oxidative DNA damage can lead to disease-causing mutations, such as in cancer. Base excision repair and nucleotide excision repair are the two DNA repair pathways believed to orchestrate the removal of oxidative lesions. However, recent findings suggest that the mismatch repair pathway may also be important for the response to oxidative DNA damage. This is particularly relevant in cancer where mismatch repair genes are frequently mutated or epigenetically silenced. In this review we explore how the regulation of oxidative DNA damage by mismatch repair proteins may impact on carcinogenesis. We discuss recent studies that identify potential new treatments for mismatch repair deficient tumours, which exploit this non-canonical role of mismatch repair using synthetic lethal targeting

  2. Evidence implying DNA polymerase beta function in excision repair.

    OpenAIRE

    Siedlecki, J A; Szyszko, J.; Pietrzykowska, I; Zmudzka, B

    1980-01-01

    Comparison was made of the ability of calf thymus DNA polymerases alpha and beta to replicate the following templates: native E. coli CR-34 DNA (T-DNA), calf thymus DNA activated by DNase I (act.DNA), BU-DNA (from E. coli CR-34 cells cultured on BUdR-containing medium) with damages resulting from incomplete excision repair, as well as thermally denatured act.DNA and BU-DNA (s.s.act.DNA and s.s.BU-DNA). 3H-TTP incorporation during extensive replication of act.DNA was similar for both enzymes, ...

  3. FAN1 mutations cause karyomegalic interstitial nephritis, linking chronic kidney failure to defective DNA damage repair.

    Science.gov (United States)

    Zhou, Weibin; Otto, Edgar A; Cluckey, Andrew; Airik, Rannar; Hurd, Toby W; Chaki, Moumita; Diaz, Katrina; Lach, Francis P; Bennett, Geoffrey R; Gee, Heon Yung; Ghosh, Amiya K; Natarajan, Sivakumar; Thongthip, Supawat; Veturi, Uma; Allen, Susan J; Janssen, Sabine; Ramaswami, Gokul; Dixon, Joanne; Burkhalter, Felix; Spoendlin, Martin; Moch, Holger; Mihatsch, Michael J; Verine, Jerome; Reade, Richard; Soliman, Hany; Godin, Michel; Kiss, Denes; Monga, Guido; Mazzucco, Gianna; Amann, Kerstin; Artunc, Ferruh; Newland, Ronald C; Wiech, Thorsten; Zschiedrich, Stefan; Huber, Tobias B; Friedl, Andreas; Slaats, Gisela G; Joles, Jaap A; Goldschmeding, Roel; Washburn, Joseph; Giles, Rachel H; Levy, Shawn; Smogorzewska, Agata; Hildebrandt, Friedhelm

    2012-08-01

    Chronic kidney disease (CKD) represents a major health burden. Its central feature of renal fibrosis is not well understood. By exome sequencing, we identified mutations in FAN1 as a cause of karyomegalic interstitial nephritis (KIN), a disorder that serves as a model for renal fibrosis. Renal histology in KIN is indistinguishable from that of nephronophthisis, except for the presence of karyomegaly. The FAN1 protein has nuclease activity and acts in DNA interstrand cross-link (ICL) repair within the Fanconi anemia DNA damage response (DDR) pathway. We show that cells from individuals with FAN1 mutations have sensitivity to the ICL-inducing agent mitomycin C but do not exhibit chromosome breakage or cell cycle arrest after diepoxybutane treatment, unlike cells from individuals with Fanconi anemia. We complemented ICL sensitivity with wild-type FAN1 but not with cDNA having mutations found in individuals with KIN. Depletion of fan1 in zebrafish caused increased DDR, apoptosis and kidney cysts. Our findings implicate susceptibility to environmental genotoxins and inadequate DNA repair as novel mechanisms contributing to renal fibrosis and CKD.

  4. Targeting DNA-repair systems brings hopes to cancer patients

    Institute of Scientific and Technical Information of China (English)

    2007-01-01

    @@ CAS researchers have recently raised a hypothesis to circumvent tumor resistance to radio- and chemo-therapy and to enhance the efficacy of DNAdamaging agents by interfering with DNA repair. "There are emerging anticancer therapeutic opportunities in targeting DNA-repair systems," they asserted.

  5. The use of caspase inhibitors in pulsed-field gel electrophoresis may improve the estimation of radiation-induced DNA repair and apoptosis

    International Nuclear Information System (INIS)

    Radiation-induced DNA double-strand break (DSB) repair can be tested by using pulsed-field gel electrophoresis (PFGE) in agarose-encapsulated cells. However, previous studies have reported that this assay is impaired by the spontaneous DNA breakage in this medium. We investigated the mechanisms of this fragmentation with the principal aim of eliminating it in order to improve the estimation of radiation-induced DNA repair. Samples from cancer cell cultures or xenografted tumours were encapsulated in agarose plugs. The cell plugs were then irradiated, incubated to allow them to repair, and evaluated by PFGE, caspase-3, and histone H2AX activation (γH2AX). In addition, apoptosis inhibition was evaluated through chemical caspase inhibitors. We confirmed that spontaneous DNA fragmentation was associated with the process of encapsulation, regardless of whether cells were irradiated or not. This DNA fragmentation was also correlated to apoptosis activation in a fraction of the cells encapsulated in agarose, while non-apoptotic cell fraction could rejoin DNA fragments as was measured by γH2AX decrease and PFGE data. We were able to eliminate interference of apoptosis by applying specific caspase inhibitors, and improve the estimation of DNA repair, and apoptosis itself. The estimation of radiation-induced DNA repair by PFGE may be improved by the use of apoptosis inhibitors. The ability to simultaneously determine DNA repair and apoptosis, which are involved in cell fate, provides new insights for using the PFGE methodology as functional assay

  6. Repair of damaged DNA in vivo: Final technical report

    International Nuclear Information System (INIS)

    This contract was initiated in 1962 with the US Atomic Energy Commission to carry out basic research on the effects of radiation on the process of DNA replication in bacteria. Within the first contract year we discovered repair replication at the same time that Setlow and Carrier discovered pyrimidine dimer excision. These discoveries led to the elucidation of the process of excision-repair, one of the most important mechanisms by which living systems, including humans, respond to structural damage in their genetic material. We improved methodology for distinguishing repair replication from semiconservative replication and instructed others in these techniques. Painter then was the first to demonstrate repair replication in ultraviolet irradiated human cells. He, in turn, instructed James Cleaver who discovered that skin fibroblasts from patients with xeroderma pigmentosum were defective in excision-repair. People with this genetic defect are extremely sensitive to sunlight and they develop carcinomas and melanomas of the skin with high frequency. The existence of this hereditary disease attests to the importance of DNA repair in man. We certainly could not survive in the normal ultraviolet flux from the sun if our DNA were not continuously monitored for damage and repaired. Other hereditary diseases such as ataxia telangiectasia, Cockayne's syndrome, Blooms syndrome and Fanconi's anemia also involve deficiencies in DNA damage processing. The field of DNA repair has developed rapidly as we have learned that most environmental chemical carcinogens as well as radiation produce repairable damage in DNA. 251 refs

  7. Role of DNA repair in host immune response and inflammation.

    Science.gov (United States)

    Fontes, Fabrícia Lima; Pinheiro, Daniele Maria Lopes; Oliveira, Ana Helena Sales de; Oliveira, Rayssa Karla de Medeiros; Lajus, Tirzah Braz Petta; Agnez-Lima, Lucymara Fassarella

    2015-01-01

    In recent years, the understanding of how DNA repair contributes to the development of innate and acquired immunity has emerged. The DNA damage incurred during the inflammatory response triggers the activation of DNA repair pathways, which are required for host-cell survival. Here, we reviewed current understanding of the mechanism by which DNA repair contributes to protection against the oxidized DNA damage generated during infectious and inflammatory diseases and its involvement in innate and adaptive immunity. We discussed the functional role of DNA repair enzymes in the immune activation and the relevance of these processes to: transcriptional regulation of cytokines and other genes involved in the inflammatory response; V(D)J recombination; class-switch recombination (CSR); and somatic hypermutation (SHM). These three last processes of DNA damage repair are required for effective humoral adaptive immunity, creating genetic diversity in developing T and B cells. Furthermore, viral replication is also dependent on host DNA repair mechanisms. Therefore, the elucidation of the pathways of DNA damage and its repair that activate innate and adaptive immunity will be important for a better understanding of the immune and inflammatory disorders and developing new therapeutic interventions for treatment of these diseases and for improving their outcome. PMID:25795123

  8. Mitochondrial DNA repair and association with aging--an update

    DEFF Research Database (Denmark)

    Diaz, Ricardo Gredilla; Bohr, Vilhelm A; Stevnsner, Tinna V.

    2010-01-01

    Mitochondrial DNA is constantly exposed to oxidative injury. Due to its location close to the main site of reactive oxygen species, the inner mitochondrial membrane, mtDNA is more susceptible than nuclear DNA to oxidative damage. The accumulation of DNA damage is thought to play a critical role...... proteins and novel DNA repair pathways, thought to be exclusively present in the nucleus, have recently been described also to be present in mitochondria. Here we review the main mitochondrial DNA repair pathways and their association with the aging process....

  9. DNA repair: Dynamic defenders against cancer and aging

    Energy Technology Data Exchange (ETDEWEB)

    Fuss, Jill O.; Cooper, Priscilla K.

    2006-04-01

    You probably weren't thinking about your body's cellular DNA repair systems the last time you sat on the beach in the bright sunshine. Fortunately, however, while you were subjecting your DNA to the harmful effects of ultraviolet light, your cells were busy repairing the damage. The idea that our genetic material could be damaged by the sun was not appreciated in the early days of molecular biology. When Watson and Crick discovered the structure of DNA in 1953 [1], it was assumed that DNA is fundamentally stable since it carries the blueprint of life. However, over 50 years of research have revealed that our DNA is under constant assault by sunlight, oxygen, radiation, various chemicals, and even our own cellular processes. Cleverly, evolution has provided our cells with a diverse set of tools to repair the damage that Mother Nature causes. DNA repair processes restore the normal nucleotide sequence and DNA structure of the genome after damage [2]. These responses are highly varied and exquisitely regulated. DNA repair mechanisms are traditionally characterized by the type of damage repaired. A large variety of chemical modifications can alter normal DNA bases and either lead to mutations or block transcription if not repaired, and three distinct pathways exist to remove base damage. Base excision repair (BER) corrects DNA base alterations that do not distort the overall structure of the DNA helix such as bases damaged by oxidation resulting from normal cellular metabolism. While BER removes single damaged bases, nucleotide excision repair (NER) removes short segments of nucleotides (called oligonucleotides) containing damaged bases. NER responds to any alteration that distorts the DNA helix and is the mechanism responsible for repairing bulky base damage caused by carcinogenic chemicals such as benzo [a]pyrene (found in cigarette smoke and automobile exhaust) as well as covalent linkages between adjacent pyrimidine bases resulting from the ultraviolet

  10. Molecular basis for DNA strand displacement by NHEJ repair polymerases

    OpenAIRE

    Bartlett, Edward J.; Brissett, Nigel C.; Plocinski, Przemyslaw; Carlberg, Tom; Doherty, Aidan J.

    2015-01-01

    The non-homologous end-joining (NHEJ) pathway repairs DNA double-strand breaks (DSBs) in all domains of life. Archaea and bacteria utilize a conserved set of multifunctional proteins in a pathway termed Archaeo-Prokaryotic (AP) NHEJ that facilitates DSB repair. Archaeal NHEJ polymerases (Pol) are capable of strand displacement synthesis, whilst filling DNA gaps or partially annealed DNA ends, which can give rise to unligatable intermediates. However, an associated NHEJ phosphoesterase (PE) re...

  11. Charge-transport-mediated recruitment of DNA repair enzymes

    OpenAIRE

    Fok, Pak-Wing; Guo, Chin-Lin; Chou, Tom

    2008-01-01

    Damaged or mismatched bases in DNA can be repaired by base excision repair enzymes (BER) that replace the defective base. Although the detailed molecular structures of many BER enzymes are known, how they colocalize to lesions remains unclear. One hypothesis involves charge transport (CT) along DNA [Yavin et al., Proc. Natl. Acad. Sci. U.S.A. 102, 3546 (2005)]. In this CT mechanism, electrons are released by recently adsorbed BER enzymes and travel along the DNA. The electrons can scatter (by...

  12. Mechanisms of interstrand DNA crosslink repair and human disorders.

    Science.gov (United States)

    Hashimoto, Satoru; Anai, Hirofumi; Hanada, Katsuhiro

    2016-01-01

    Interstrand DNA crosslinks (ICLs) are the link between Watson-Crick strands of DNAs with the covalent bond and prevent separation of DNA strands. Since the ICL lesion affects both strands of the DNA, the ICL repair is not simple. So far, nucleotide excision repair (NER), structure-specific endonucleases, translesion DNA synthesis (TLS), homologous recombination (HR), and factors responsible for Fanconi anemia (FA) are identified to be involved in ICL repair. Since the presence of ICL lesions causes severe defects in transcription and DNA replication, mutations in these DNA repair pathways give rise to a various hereditary disorders. NER plays an important role for the ICL recognition and removal in quiescent cells, and defects of NER causes congential progeria syndrome, such as xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy. On the other hand, the ICL repair in S phase requires more complicated orchestration of multiple factors, including structure-specific endonucleases, and TLS, and HR. Disturbed this ICL repair orchestration in S phase causes genome instability resulting a cancer prone disease, Fanconi anemia. So far more than 30 factors in ICL repair have already identified. Recently, a new factor, UHRF1, was discovered as a sensor of ICLs. In addition to this, numbers of nucleases that are involved in the first incision, also called unhooking, of ICL lesions have also been identified. Here we summarize the recent studies of ICL associated disorders and repair mechanism, with emphasis in the first incision of ICLs. PMID:27350828

  13. Human longevity and variation in DNA damage response and repair

    DEFF Research Database (Denmark)

    Debrabant, Birgit; Soerensen, Mette; Flachsbart, Friederike;

    2014-01-01

    others. Data were applied on 592 SNPs from 77 genes involved in nine sub-processes: DNA-damage response, base excision repair (BER), nucleotide excision repair, mismatch repair, non-homologous end-joining, homologous recombinational repair (HRR), RecQ helicase activities (RECQ), telomere functioning...... and mitochondrial DNA processes. The study population was 1089 long-lived and 736 middle-aged Danes. A self-contained set-based test of all SNPs displayed association with longevity (P-value=9.9 × 10-5), supporting that the overall pathway could affect longevity. Investigation of the nine sub-processes using...

  14. Artesunate derived from traditional Chinese medicine induces DNA damage and repair.

    Science.gov (United States)

    Li, Paul C H; Lam, Elena; Roos, Wynand P; Zdzienicka, Malgorzata Z; Kaina, Bernd; Efferth, Thomas

    2008-06-01

    Artesunate is a semisynthetic derivative from artemisinin, a natural product from the Chinese herb Artemisia annua L. It exerts antimalarial activity, and, additionally, artemisinin and its derivatives are active against cancer cells. The active moiety is an endoperoxide bridge. Its cleavage leads to the formation of reactive oxygen species and carbon-centered radicals. These highly reactive molecules target several proteins in Plasmodia, which is thought to result in killing of the microorganism. DNA damage induced by artemisinins has not yet been described. Here, we show that artesunate induces apoptosis and necrosis. It also induces DNA breakage in a dose-dependent manner as shown by single-cell gel electrophoresis. This genotoxic effect was confirmed by measuring the level of gamma-H2AX, which is considered to be an indication of DNA double-strand breaks (DSB). Polymerase beta-deficient cells were more sensitive than the wild-type to artesunate, indicating that the drug induces DNA damage that is repaired by base excision repair. irs1 and VC8 cells defective in homologous recombination (HR) due to inactivation of XRCC2 and BRCA2, respectively, were more sensitive to artesunate than the corresponding wild-type. This was also true for XR-V15B cells defective in nonhomologous end-joining (NHEJ) due to inactivation of Ku80. The data indicate that DSBs induced by artesunate are repaired by the HR and NHEJ pathways. They suggest that DNA damage induced by artesunate contributes to its therapeutic effect against cancer cells. PMID:18519695

  15. Dynamics and mechanism of UV-damaged DNA repair in indole-thymine dimer adduct: molecular origin of low repair quantum efficiency.

    Science.gov (United States)

    Guo, Xunmin; Liu, Zheyun; Song, Qinhua; Wang, Lijuan; Zhong, Dongping

    2015-02-26

    Many biomimetic chemical systems for repair of UV-damaged DNA showed very low repair efficiency, and the molecular origin is still unknown. Here, we report our systematic characterization of the repair dynamics of a model compound of indole-thymine dimer adduct in three solvents with different polarity. By resolving all elementary steps including three electron-transfer processes and two bond-breaking and bond-formation dynamics with femtosecond resolution, we observed the slow electron injection in 580 ps in water, 4 ns in acetonitrile, and 1.38 ns in dioxane, the fast back electron transfer without repair in 120, 150, and 180 ps, and the slow bond splitting in 550 ps, 1.9 ns, and 4.5 ns, respectively. The dimer bond cleavage is clearly accelerated by the solvent polarity. By comparing with the biological repair machine photolyase with a slow back electron transfer (2.4 ns) and a fast bond cleavage (90 ps), the low repair efficiency in the biomimetic system is mainly determined by the fast back electron transfer and slow bond breakage. We also found that the model system exists in a dynamic heterogeneous C-clamped conformation, leading to a stretched dynamic behavior. In water, we even identified another stacked form with ultrafast cyclic electron transfer, significantly reducing the repair efficiency. Thus, the comparison of the repair efficiency in different solvents is complicated and should be cautious, and only the dynamics by resolving all elementary steps can finally determine the total repair efficiency. Finally, we use the Marcus electron-transfer theory to analyze all electron-transfer reactions and rationalize all observed electron-transfer dynamics.

  16. Telomeric Allelic Imbalance Indicates Defective DNA Repair and Sensitivity to DNA-Damaging Agents

    DEFF Research Database (Denmark)

    Birkbak, Nicolai J.; Wang, Zhigang C.; Kim, Ji-Young;

    2012-01-01

    DNA repair competency is one determinant of sensitivity to certain chemotherapy drugs, such as cisplatin. Cancer cells with intact DNA repair can avoid the accumulation of genome damage during growth and also can repair platinum-induced DNA damage. We sought genomic signatures indicative...... of defective DNA repair in cell lines and tumors and correlated these signatures to platinum sensitivity. The number of subchromosomal regions with allelic imbalance extending to the telomere (NtAI) predicted cisplatin sensitivity in vitro and pathologic response to preoperative cisplatin treatment in patients....... Thus, accumulation of telomeric allelic imbalance is a marker of platinum sensitivity and suggests impaired DNA repair. SIGNIFICANCE: Mutations in BRCA genes cause defects in DNA repair that predict sensitivity to DNA damaging agents, including platinum; however, some patients without BRCA mutations...

  17. Automated Image Processing for the Analysis of DNA Repair Dynamics

    CERN Document Server

    Riess, Thorsten; Tomas, Martin; Ferrando-May, Elisa; Merhof, Dorit

    2011-01-01

    The efficient repair of cellular DNA is essential for the maintenance and inheritance of genomic information. In order to cope with the high frequency of spontaneous and induced DNA damage, a multitude of repair mechanisms have evolved. These are enabled by a wide range of protein factors specifically recognizing different types of lesions and finally restoring the normal DNA sequence. This work focuses on the repair factor XPC (xeroderma pigmentosum complementation group C), which identifies bulky DNA lesions and initiates their removal via the nucleotide excision repair pathway. The binding of XPC to damaged DNA can be visualized in living cells by following the accumulation of a fluorescent XPC fusion at lesions induced by laser microirradiation in a fluorescence microscope. In this work, an automated image processing pipeline is presented which allows to identify and quantify the accumulation reaction without any user interaction. The image processing pipeline comprises a preprocessing stage where the ima...

  18. Methods to alter levels of a DNA repair protein

    Science.gov (United States)

    Petrini, John H.; Morgan, William Francis; Maser, Richard Scott; Carney, James Patrick

    2006-10-17

    An isolated and purified DNA molecule encoding a DNA repair protein, p95, is provided, as is isolated and purified p95. Also provided are methods of detecting p95 and DNA encoding p95. The invention further provides p95 knock-out mice.

  19. Role of Nicotinamide in DNA Damage, Mutagenesis, and DNA Repair

    Directory of Open Access Journals (Sweden)

    Devita Surjana

    2010-01-01

    Full Text Available Nicotinamide is a water-soluble amide form of niacin (nicotinic acid or vitamin B3. Both niacin and nicotinamide are widely available in plant and animal foods, and niacin can also be endogenously synthesized in the liver from dietary tryptophan. Nicotinamide is also commercially available in vitamin supplements and in a range of cosmetic, hair, and skin preparations. Nicotinamide is the primary precursor of nicotinamide adenine dinucleotide (NAD+, an essential coenzyme in ATP production and the sole substrate of the nuclear enzyme poly-ADP-ribose polymerase-1 (PARP-1. Numerous in vitro and in vivo studies have clearly shown that PARP-1 and NAD+ status influence cellular responses to genotoxicity which can lead to mutagenesis and cancer formation. This paper will examine the role of nicotinamide in the protection from carcinogenesis, DNA repair, and maintenance of genomic stability.

  20. Recognition and repair of chemically heterogeneous structures at DNA ends.

    Science.gov (United States)

    Andres, Sara N; Schellenberg, Matthew J; Wallace, Bret D; Tumbale, Percy; Williams, R Scott

    2015-01-01

    Exposure to environmental toxicants and stressors, radiation, pharmaceutical drugs, inflammation, cellular respiration, and routine DNA metabolism all lead to the production of cytotoxic DNA strand breaks. Akin to splintered wood, DNA breaks are not "clean." Rather, DNA breaks typically lack DNA 5'-phosphate and 3'-hydroxyl moieties required for DNA synthesis and DNA ligation. Failure to resolve damage at DNA ends can lead to abnormal DNA replication and repair, and is associated with genomic instability, mutagenesis, neurological disease, ageing and carcinogenesis. An array of chemically heterogeneous DNA termini arises from spontaneously generated DNA single-strand and double-strand breaks (SSBs and DSBs), and also from normal and/or inappropriate DNA metabolism by DNA polymerases, DNA ligases and topoisomerases. As a front line of defense to these genotoxic insults, eukaryotic cells have accrued an arsenal of enzymatic first responders that bind and protect damaged DNA termini, and enzymatically tailor DNA ends for DNA repair synthesis and ligation. These nucleic acid transactions employ direct damage reversal enzymes including Aprataxin (APTX), Polynucleotide kinase phosphatase (PNK), the tyrosyl DNA phosphodiesterases (TDP1 and TDP2), the Ku70/80 complex and DNA polymerase β (POLβ). Nucleolytic processing enzymes such as the MRE11/RAD50/NBS1/CtIP complex, Flap endonuclease (FEN1) and the apurinic endonucleases (APE1 and APE2) also act in the chemical "cleansing" of DNA breaks to prevent genomic instability and disease, and promote progression of DNA- and RNA-DNA damage response (DDR and RDDR) pathways. Here, we provide an overview of cellular first responders dedicated to the detection and repair of abnormal DNA termini. PMID:25111769

  1. Arsenic-Induced Antioxidant Depletion, Oxidative DNA Breakage, and Tissue Damages are Prevented by the Combined Action of Folate and Vitamin B12.

    Science.gov (United States)

    Acharyya, Nirmallya; Deb, Bimal; Chattopadhyay, Sandip; Maiti, Smarajit

    2015-11-01

    Arsenic is a grade I human carcinogen. It acts by disrupting one-carbon (1C) metabolism and cellular methyl (-CH3) pool. The -CH3 group helps in arsenic disposition and detoxification of the biological systems. Vitamin B12 and folate, the key promoters of 1C metabolism were tested recently (daily 0.07 and 4.0 μg, respectively/100 g b.w. of rat for 28 days) to evaluate their combined efficacy in the protection from mutagenic DNA-breakage and tissue damages. The selected tissues like intestine (first-pass site), liver (major xenobiotic metabolizer) and lung (major arsenic accumulator) were collected from arsenic-ingested (0.6 ppm/same schedule) female rats. The hemo-toxicity and liver and kidney functions were monitored. Our earlier studies on arsenic-exposed humans can correlate carcinogenesis with DNA damage. Here, we demonstrate that the supplementation of physiological/therapeutic dose of vitamin B12 and folate protected the rodents significantly from arsenic-induced DNA damage (DNA fragmentation and comet assay) and hepatic and renal tissue degeneration (histo-architecture, HE staining). The level of arsenic-induced free-radical products (TBARS and conjugated diene) was significantly declined by the restored actions of several antioxidants viz. urate, thiol, catalase, xanthine oxidase, lactoperoxidase, and superoxide dismutase in the tissues of vitamin-supplemented group. The alkaline phosphatase, transaminases, urea and creatinine (hepatic and kidney toxicity marker), and lactate dehydrogenase (tissue degeneration marker) were significantly impaired in the arsenic-fed group. But a significant protection was evident in the vitamin-supplemented group. In conclusion, the combined action of folate and B12 results in the restitution in the 1C metabolic pathway and cellular methyl pool. The cumulative outcome from the enhanced arsenic methylation and antioxidative capacity was protective against arsenic induced mutagenic DNA breakages and tissue damages.

  2. DDB2 (Damaged DNA binding protein 2) in nucleotide excision repair and DNA damage response

    OpenAIRE

    Stoyanova, Tanya; Roy, Nilotpal; Kopanja, Dragana; Raychaudhuri, Pradip; Bagchi, Srilata

    2009-01-01

    DDB2 was identified as a protein involved in the Nucleotide Excision Repair (NER), a major DNA repair mechanism that repairs UV damage to prevent accumulation of mutations and tumorigenesis. However, recent studies indicated additional functions of DDB2 in the DNA damage response pathway. Herein, we discuss the proposed mechanisms by which DDB2 activates NER and programmed cell death upon DNA damage through its E3 ligase activity.

  3. Unilateral ureteral obstruction induces DNA repair by APE1

    DEFF Research Database (Denmark)

    Aamann, Maria Diget; Norregaard, Rikke; Kristensen, Marie Louise V;

    2016-01-01

    Ureteral obstruction is associated with oxidative stress and fibrosis development of the kidney parenchyma. Apurinic/apyrimidinic endonuclease I (APE1) is an essential DNA repair enzyme for repair of oxidative DNA lesions and regulates several transcription factors. The aim of this study was to...... inner medulla (IM). In contrast, APE1 protein level was not regulated in IM and ISOM and only slightly increased in cortex. APE1 DNA repair activity was not significantly changed. A different pattern of regulation was observed after 7 days UUO with APE1 mRNA increase in cortex but not in ISOM and IM....... APE1 protein level in cortex, ISOM and IM increased significantly. Importantly, we observed a significant increase in APE1 DNA repair activity in cortex and IM. To confirm our model we investigated HO-1, collagen I, fibronectin I, and α-SMA levels. In vitro we found the transcriptional regulatory...

  4. D-ribose inhibits DNA repair synthesis in human lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zunica, G.; Marini, M.; Brunelli, M.A.; Chiricolo, M.; Franceschi, C.

    1986-07-31

    D-ribose is cytotoxic for quiescent human lymphocytes and severely inhibits their PHA-induced proliferation at concentrations (25-50 mM) at which other simple sugars are ineffective. In order to explain these effects, DNA repair synthesis was evaluated in PHA-stimulated human lymphocytes treated with hydroxyurea and irradiated. D-ribose, in contrast to other reducing sugars, did not induce repair synthesis and therefore did not apparently damage DNA in a direct way, although it markedly inhibited gamma ray-induced repair. Taking into account that lymphocytes must rejoin physiologically-formed DNA strand breaks in order to enter the cell cycle, we suggest that D-ribose exerts its cytotoxic activity by interfering with metabolic pathways critical for the repair of DNA breaks.

  5. 4. DNA REPAIR CAPACITY IN LUNG CANCER PATIENTS

    Institute of Scientific and Technical Information of China (English)

    2001-01-01

    @@The ability for DNA repair is an important host factor which influences the individual susceptibility to genotoxic carcinogen exposures. It has been shown in different case-control studies that DNA repair capacity (DRC) can be reduced in lung cancer patients.We have used an alkaline comet assay to measure the cellular DRC in peri-pheral blood lymphocytes of lung cancer patients and tumor-free control

  6. Mitochondrial DNA repair: a novel therapeutic target for heart failure.

    Science.gov (United States)

    Marín-García, José

    2016-09-01

    Mitochondria play a crucial role in a variety of cellular processes ranging from energy metabolism, generation of reactive oxygen species (ROS) and Ca(2+) handling to stress responses, cell survival and death. Malfunction of the organelle may contribute to the pathogenesis of neuromuscular, cancer, premature aging and cardiovascular diseases (CVD), including myocardial ischemia, cardiomyopathy and heart failure (HF). Mitochondria contain their own genome organized into DNA-protein complexes, called "mitochondrial nucleoids," along with multiprotein machineries, which promote mitochondrial DNA (mtDNA) replication, transcription and repair. Although the mammalian organelle possesses almost all known nuclear DNA repair pathways, including base excision repair, mismatch repair and recombinational repair, the proximity of mtDNA to the main sites of ROS production and the lack of protective histones may result in increased susceptibility to various types of mtDNA damage. These include accumulation of mtDNA point mutations and/or deletions and decreased mtDNA copy number, which will impair mitochondrial function and finally, may lead to CVD including HF. PMID:26940911

  7. Efficient Repair of Abasic Sites in DNA by Mitochondrial Enzymes

    OpenAIRE

    Pinz, Kevin G.; Bogenhagen, Daniel F.

    1998-01-01

    Mutations in mitochondrial DNA (mtDNA) cause a variety of relatively rare human diseases and may contribute to the pathogenesis of other, more common degenerative diseases. This stimulates interest in the capacity of mitochondria to repair damage to mtDNA. Several recent studies have shown that some types of damage to mtDNA may be repaired, particularly if the lesions can be processed through a base excision mechanism that employs an abasic site as a common intermediate. In this paper, we dem...

  8. Purification of mammalian DNA repair protein XRCC1

    Energy Technology Data Exchange (ETDEWEB)

    Chen, I. [Univ. of California, Berkeley, CA (United States)

    1995-11-01

    Malfunctioning DNA repair systems lead to cancer mutations, and cell death. XRCC1 (X-ray Repair Cross Complementing) is a human DNA repair gene that has been found to fully correct the x-ray repair defect in Chinese hamster ovary (CHO) cell mutant EM9. The corresponding protein (XRCC1) encoded by this gene has been linked to a DNA repair pathway known as base excision repair, and affects the activity of DNA ligase III. Previously, an XRCC1 cDNA minigene (consisting of the uninterrupted coding sequence for XRCC1 protein followed by a decahistidine tag) was constructed and cloned into vector pET-16b for the purpose of: (1) overproduction of XRCC1 in both prokaryotic and eukaryotic cells; and (2) to facilitate rapid purification of XRCC1 from these systems. A vector is basically a DNA carrier that allows recombinant protein to be cloned and overexpressed in host cells. In this study, XRCC1 protein was overexpressed in E. coli and purified by immobilized metal affinity chromatography. Currently, the XRCC1 minigene is being inserted into a new vector [pET-26b(+)] in hopes to increase overexpression and improve purification. Once purified XRCC1 can be crystallized for structural studies, or studied in vitro for its biological function.

  9. DNA damage and repair in age-related macular degeneration

    Energy Technology Data Exchange (ETDEWEB)

    Szaflik, Jacek P. [Department of Ophthalmology, Medical University of Warsaw and Samodzielny Publiczny Szpital Okulistyczny, Sierakowskiego 13, 03-710 Warsaw (Poland); Janik-Papis, Katarzyna; Synowiec, Ewelina; Ksiazek, Dominika [Department of Molecular Genetics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland); Zaras, Magdalena [Department of Ophthalmology, Medical University of Warsaw and Samodzielny Publiczny Szpital Okulistyczny, Sierakowskiego 13, 03-710 Warsaw (Poland); Wozniak, Katarzyna [Department of Molecular Genetics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland); Szaflik, Jerzy [Department of Ophthalmology, Medical University of Warsaw and Samodzielny Publiczny Szpital Okulistyczny, Sierakowskiego 13, 03-710 Warsaw (Poland); Blasiak, Janusz, E-mail: januszb@biol.uni.lodz.pl [Department of Molecular Genetics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland)

    2009-10-02

    Age-related macular degeneration (AMD) is a retinal degenerative disease that is the main cause of vision loss in individuals over the age of 55 in the Western world. Clinically relevant AMD results from damage to the retinal pigment epithelial (RPE) cells thought to be mainly caused by oxidative stress. The stress also affects the DNA of RPE cells, which promotes genome instability in these cells. These effects may coincide with the decrease in the efficacy of DNA repair with age. Therefore individuals with DNA repair impaired more than average for a given age may be more susceptible to AMD if oxidative stress affects their RPE cells. This may be helpful in AMD risk assessment. In the present work we determined the level of basal (measured in the alkaline comet assay) endogenous and endogenous oxidative DNA damage, the susceptibility to exogenous mutagens and the efficacy of DNA repair in lymphocytes of 100 AMD patients and 110 age-matched individuals without visual disturbances. The cells taken from AMD patients displayed a higher extent of basal endogenous DNA damage without differences between patients of dry and wet forms of the disease. DNA double-strand breaks did not contribute to the observed DNA damage as checked by the neutral comet assay and pulsed field gel electrophoresis. The extent of oxidative modification to DNA bases was grater in AMD patients than in the controls, as probed by DNA repair enzymes NTH1 and Fpg. Lymphocytes from AMD patients displayed a higher sensitivity to hydrogen peroxide and UV radiation and repaired lesions induced by these factors less effectively than the cells from the control individuals. We postulate that the impaired efficacy of DNA repair may combine with enhanced sensitivity of RPE cells to blue and UV lights, contributing to the pathogenesis of AMD.

  10. The ERCC1-xeroderma pigmentosum group F DNA repair complex

    OpenAIRE

    Sijbers, Anneke

    1999-01-01

    textabstractIn its long nucleotide-chains, the DNA double helix contains the genetic information for ten thousands of proteins. The DNA molecule, however, is subject to constant change. In order to l11ailltaill its integrity, several luechallisms that cope with DNA damage, inflicted byvarious naturally occurring and man-made agents, have evolved. Individuals with the rare genetic disease xeroderma pigmentosum demonstrate the importance of DNA repair systems. These patients carry a defect in p...

  11. Repair of DNA lesions associated with triplex-forming oligonucleotides

    OpenAIRE

    Chin, Joanna Y; Glazer, Peter M.

    2009-01-01

    Triplex-forming oligonucleotides (TFOs) are gene targeting tools that can bind in the major groove of duplex DNA in a sequence-specific manner. When bound to DNA, TFOs can inhibit gene expression, can position DNA-reactive agents to specific locations in the genome, or can induce targeted mutagenesis and recombination. There is evidence that third strand binding, alone or with an associated cross-link, is recognized and metabolized by DNA repair factors, particularly the nucleotide excision r...

  12. The repair fidelity of restriction enzyme-induced double strand breaks in plasmid DNA correlates with radioresistance in human tumor cell lines

    International Nuclear Information System (INIS)

    The accuracy of DNA repair may play a role in determining the cytotoxic effect of ionizing radiation. Repair, as measured by DNA strand breakage, often shows little difference between tumor cell lines of widely different radiosensitivity. The mechanism by which DNA fragments are rejoined is poorly understood. This study used plasmid transfection as a probe to assess the balance between correct repair and misrepair. A general trend for sensitive cells to show lower repair fidelity relative to resistant cells was observed. The type of double-strand cleavage of the plasmid (staggered or blunt) made little difference to the measured repair fidelity, in contrast to published studies in which restriction-enzyme breaks had been introduced into DNA within chromatin. Specific comparison of parent lines and their radiosensitive clones showed significant differences in repair fidelity for a relatively small change in radiation response, which was in line with the overall correlation. These same pairs have previously been shown to have no difference in the loss of DNA fragmentation with time after irradiation, and Southern analysis had confirmed the integrated plasmid copy number was similar in the cell lines compared. The number of intact copies of the damaged gene relative to the undamaged gene mirrored the observed repair fidelity. However, in one cell line out of the 10 studied, an exception to the observed trend was found. In comparison of two equally radioresistant bladder cancer cell lines, large differences in repair fidelity were observed. Again, no difference in the integrated copy number was found, and the damaged gene was highly rearranged or deleted in the cell line with low repair fidelity. It is suggested that repair fidelity can be, but is not invariably, a measure of correct repair relative to misrepair, resulting from the processing of double-strand breaks and, hence, the response to ionizing radiation. 24 refs., 2 figs., 2 tabs

  13. Global genome nucleotide excision repair is organized into domains that promote efficient DNA repair in chromatin

    Science.gov (United States)

    Yu, Shirong; Evans, Katie; Bennett, Mark; Webster, Richard M.; Leadbitter, Matthew; Teng, Yumin; Waters, Raymond

    2016-01-01

    The rates at which lesions are removed by DNA repair can vary widely throughout the genome, with important implications for genomic stability. To study this, we measured the distribution of nucleotide excision repair (NER) rates for UV-induced lesions throughout the budding yeast genome. By plotting these repair rates in relation to genes and their associated flanking sequences, we reveal that, in normal cells, genomic repair rates display a distinctive pattern, suggesting that DNA repair is highly organized within the genome. Furthermore, by comparing genome-wide DNA repair rates in wild-type cells and cells defective in the global genome–NER (GG-NER) subpathway, we establish how this alters the distribution of NER rates throughout the genome. We also examined the genomic locations of GG-NER factor binding to chromatin before and after UV irradiation, revealing that GG-NER is organized and initiated from specific genomic locations. At these sites, chromatin occupancy of the histone acetyl-transferase Gcn5 is controlled by the GG-NER complex, which regulates histone H3 acetylation and chromatin structure, thereby promoting efficient DNA repair of UV-induced lesions. Chromatin remodeling during the GG-NER process is therefore organized into these genomic domains. Importantly, loss of Gcn5 significantly alters the genomic distribution of NER rates; this has implications for the effects of chromatin modifiers on the distribution of mutations that arise throughout the genome. PMID:27470111

  14. Molecular Pathways: Targeting DNA Repair Pathway Defects Enriched in Metastasis.

    Science.gov (United States)

    Corcoran, Niall M; Clarkson, Michael J; Stuchbery, Ryan; Hovens, Christopher M

    2016-07-01

    The maintenance of a pristine genome, free from errors, is necessary to prevent cellular transformation and degeneration. When errors in DNA are detected, DNA damage repair (DDR) genes and their regulators are activated to effect repair. When these DDR pathways are themselves mutated or aberrantly downregulated, cancer and neurodegenerative disorders can ensue. Multiple lines of evidence now indicate, however, that defects in key regulators of DNA repair pathways are highly enriched in human metastasis specimens and hence may be a key step in the acquisition of metastasis and the ability of localized disease to disseminate. Some of the key regulators of checkpoints in the DNA damage response are the TP53 protein and the PARP enzyme family. Targeting of these pathways, especially through PARP inhibition, is now being exploited therapeutically to effect significant clinical responses in subsets of individuals, particularly in patients with ovarian cancer or prostate cancer, including cancers with a marked metastatic burden. Targeting DNA repair-deficient tumors with drugs that take advantage of the fundamental differences between normal repair-proficient cells and repair-deficient tumors offers new avenues for treating advanced disease in the future. Clin Cancer Res; 22(13); 3132-7. ©2016 AACR. PMID:27169997

  15. DNA repair: a changing geography? (1964-2008).

    Science.gov (United States)

    Maisonobe, Marion; Giglia-Mari, Giuseppina; Eckert, Denis

    2013-07-01

    This article aims to explain the current state of DNA Repair studies' global geography by focusing on the genesis of the community. Bibliometric data is used to localize scientific activities related to DNA Repair at the city level. The keyword "DNA Repair" was introduced first by American scientists. It started to spread after 1964 that is to say, after P. Howard-Flanders (Yale University), P. Hanawalt (Stanford University) and R. Setlow (Oak Ridge Laboratories) found evidence for Excision Repair mechanisms. It was the first stage in the emergence of an autonomous scientific community. In this article, we will try to assess to what extent the geo-history of this scientific field is determinant in understanding its current geography. In order to do so, we will localize the places where the first "DNA Repair" publications were signed fifty years ago and the following spatial diffusion process, which led to the current geography of the field. Then, we will focus on the evolution of the research activity of "early entrants" in relation to the activity of "latecomers". This article is an opportunity to share with DNA Repair scientists some research results of a dynamic field in Science studies: spatial scientometrics.

  16. An Overview of the Molecular Mechanisms of Recombinational DNA Repair.

    Science.gov (United States)

    Kowalczykowski, Stephen C

    2015-11-01

    Recombinational DNA repair is a universal aspect of DNA metabolism and is essential for genomic integrity. It is a template-directed process that uses a second chromosomal copy (sister, daughter, or homolog) to ensure proper repair of broken chromosomes. The key steps of recombination are conserved from phage through human, and an overview of those steps is provided in this review. The first step is resection by helicases and nucleases to produce single-stranded DNA (ssDNA) that defines the homologous locus. The ssDNA is a scaffold for assembly of the RecA/RAD51 filament, which promotes the homology search. On finding homology, the nucleoprotein filament catalyzes exchange of DNA strands to form a joint molecule. Recombination is controlled by regulating the fate of both RecA/RAD51 filaments and DNA pairing intermediates. Finally, intermediates that mature into Holliday structures are disjoined by either nucleolytic resolution or topological dissolution. PMID:26525148

  17. Genetics of repair of radiation damage to DNA in bacteria

    International Nuclear Information System (INIS)

    The goal of this project is to study the consequences to bacterial DNA of damage by radiation and chemical agents. By correlating the extent of physical and biological damage to DNA, as expressed in various mutants defective in specific DNA repair pathways, we hope to determine mechanisms of biological inactivation of DNA and ways in which the damage can be repaired. We have measured physical damage to DNA in Bacillus subtilis and Escherichia coli by use of alkaline sucrose gradient centrifugation, which indicates the distance between breaks or alkali-labile lesions in single strands of DNA. Biological damage is measured by loss of viability or by loss of transforming activity in treated DNA from B. subtilis, and by the production of sites for DNA repair synthesis by DNA polymerase I (Pol I) in toluene-treated E. coli. We have investigated effects of ultraviolet light (both far-uv and near-uv), ionizing radiation, and selected chemical agents, in the presence or absence of sensitizing or protective agents. A major goal was to characterize DNA repair processes in vivo in B. subtilis. A number of radiation-sensitive mutants were studied, with the result that we have learned a great many details about the repair of DNA in uv-irradiated cells: We have now also studied the induction of methyltransferase in B. subtilis exposed to low concentrations of N-methyl-N'-nitro-N-nitrosoguanidine (MNNG). In collaboration with Sankar Mitra and R.S. Foote (Biology Division), we have shown that the basal level of methyltransferase in B. subtilis is about ten-fold higher than in E. coli and that there is about a ten-fold increase during adaptation. Our future studies will focus on the radioprotective effects of alcohols that act as OH radical scavengers but also react to irradiation by the formation of a radical on the carbon alpha to the hydroxyl

  18. Modulation of DNA base excision repair during neuronal differentiation

    DEFF Research Database (Denmark)

    Sykora, Peter; Yang, Jenq-Lin; Ferrarelli, Leslie K;

    2013-01-01

    DNA damage susceptibility and base excision DNA repair (BER) capacity in undifferentiated and differentiated human neural cells. The results show that undifferentiated human SH-SY5Y neuroblastoma cells are less sensitive to oxidative damage than their differentiated counterparts, in part because...

  19. Role of polynucleotide kinase/phosphatase in mitochondrial DNA repair

    Science.gov (United States)

    Tahbaz, Nasser; Subedi, Sudip; Weinfeld, Michael

    2012-01-01

    Mutations in mitochondrial DNA (mtDNA) are implicated in a broad range of human diseases and in aging. Compared to nuclear DNA, mtDNA is more highly exposed to oxidative damage due to its proximity to the respiratory chain and the lack of protection afforded by chromatin-associated proteins. While repair of oxidative damage to the bases in mtDNA through the base excision repair pathway has been well studied, the repair of oxidatively induced strand breaks in mtDNA has been less thoroughly examined. Polynucleotide kinase/phosphatase (PNKP) processes strand-break termini to render them chemically compatible for the subsequent action of DNA polymerases and ligases. Here, we demonstrate that functionally active full-length PNKP is present in mitochondria as well as nuclei. Downregulation of PNKP results in an accumulation of strand breaks in mtDNA of hydrogen peroxide-treated cells. Full restoration of repair of the H2O2-induced strand breaks in mitochondria requires both the kinase and phosphatase activities of PNKP. We also demonstrate that PNKP contains a mitochondrial-targeting signal close to the C-terminus of the protein. We further show that PNKP associates with the mitochondrial protein mitofilin. Interaction with mitofilin may serve to translocate PNKP into mitochondria. PMID:22210862

  20. DNA-repair gene variants are associated with glioblastoma survival

    DEFF Research Database (Denmark)

    Wibom, Carl; Sjöström, Sara; Henriksson, Roger;

    2012-01-01

    Abstract Patient outcome from glioma may be influenced by germline variation. Considering the importance of DNA repair in cancer biology as well as in response to treatment, we studied the relationship between 1458 SNPs, which captured the majority of the common genetic variation in 136 DNA repai...

  1. Recombinant methods for screening human DNA excision repair proficiency

    International Nuclear Information System (INIS)

    A method for measuring DNA excision repair in response to ultraviolet radiation (UV)-induced DNA damage has been developed, validated, and field-tested in cultured human lymphocytes. The methodology is amenable to population-based screening and should facilitate future epidemiologic studies seeking to investigate associations between excision repair proficiency and cancer susceptibility. The impetus for such endeavors derives from the belief that the high incidence of skin cancer in the genetic disorder xeroderma pigmentosum (XP) primarily is a result of the reduced capacity of patients cells to repair UV-induced DNA damage. For assay, UV-irradiated non-replicating recombinant plasmid DNA harboring a chloramphenicol acetyltransferase (CAT) indicator gene is introduced into lymphocytes using DEAE-dextran short-term transfection conditions. Exposure to UV induces transcriptionally-inactivating DNA photoproducts in the plasmid DNA which inactivate CAT gene expression. Excision repair of the damaged CAT gene is monitored indirectly as a function of reactivated CAT enzyme activity following a 40 hour repair/expression incubation period

  2. ABH2 Couples Regulation of Ribosomal DNA Transcription with DNA Alkylation Repair

    Directory of Open Access Journals (Sweden)

    Pishun Li

    2013-08-01

    Full Text Available Transcription has been linked to DNA damage. How the most highly transcribed mammalian ribosomal (rDNA genes maintain genome integrity in the absence of transcription-coupled DNA damage repair is poorly understood. Here, we report that ABH2/ALKBH2, a DNA alkylation repair enzyme, is highly enriched in the nucleolus. ABH2 interacts with DNA repair proteins Ku70 and Ku80 as well as nucleolar proteins nucleolin, nucleophosmin 1, and upstream binding factor (UBF. ABH2 associates with and promotes rDNA transcription through its DNA repair activity. ABH2 knockdown impairs rDNA transcription and leads to increased single-stranded and double-stranded DNA breaks that are more pronounced in the rDNA genes, whereas ABH2 overexpression protects cells from methyl-methanesulfonate-induced DNA damage and inhibition of rDNA transcription. In response to massive alkylation damage, ABH2 rapidly redistributes from the nucleolus to nucleoplasm. Our study thus reveals a critical role of ABH2 in maintaining rDNA gene integrity and transcription and provides insight into the ABH2 DNA repair function.

  3. DNA Repair and the Accumulation of Oxidatively Damaged DNA Are Affected by Fruit Intake in Mice

    DEFF Research Database (Denmark)

    Croteau, Deborah L; de Souza-Pinto, Nadja C; Harboe, Charlotte;

    2010-01-01

    were fed for 14 weeks a control diet or a diet with 8% peach or nectarine extract. The activities of DNA repair enzymes, the level of DNA damage, and gene expression changes were measured. Our study showed that repair of various oxidative DNA lesions was more efficient in liver extracts derived from......Aging is associated with elevated oxidative stress and DNA damage. To achieve healthy aging, we must begin to understand how diet affects cellular processes. We postulated that fruit-enriched diets might initiate a program of enhanced DNA repair and thereby improve genome integrity. C57Bl/6 J mice......-fed mice. Taken together, these results suggest that an increased intake of fruits might modulate the efficiency of DNA repair, resulting in altered levels of DNA damage....

  4. Molecular basis for DNA strand displacement by NHEJ repair polymerases.

    Science.gov (United States)

    Bartlett, Edward J; Brissett, Nigel C; Plocinski, Przemyslaw; Carlberg, Tom; Doherty, Aidan J

    2016-03-18

    The non-homologous end-joining (NHEJ) pathway repairs DNA double-strand breaks (DSBs) in all domains of life. Archaea and bacteria utilize a conserved set of multifunctional proteins in a pathway termed Archaeo-Prokaryotic (AP) NHEJ that facilitates DSB repair. Archaeal NHEJ polymerases (Pol) are capable of strand displacement synthesis, whilst filling DNA gaps or partially annealed DNA ends, which can give rise to unligatable intermediates. However, an associated NHEJ phosphoesterase (PE) resects these products to ensure that efficient ligation occurs. Here, we describe the crystal structures of these archaeal (Methanocella paludicola) NHEJ nuclease and polymerase enzymes, demonstrating their strict structural conservation with their bacterial NHEJ counterparts. Structural analysis, in conjunction with biochemical studies, has uncovered the molecular basis for DNA strand displacement synthesis in AP-NHEJ, revealing the mechanisms that enable Pol and PE to displace annealed bases to facilitate their respective roles in DSB repair. PMID:26405198

  5. Electron Transfer Mechanisms of DNA Repair by Photolyase

    Science.gov (United States)

    Zhong, Dongping

    2015-04-01

    Photolyase is a flavin photoenzyme that repairs two DNA base damage products induced by ultraviolet (UV) light: cyclobutane pyrimidine dimers and 6-4 photoproducts. With femtosecond spectroscopy and site-directed mutagenesis, investigators have recently made significant advances in our understanding of UV-damaged DNA repair, and the entire enzymatic dynamics can now be mapped out in real time. For dimer repair, six elementary steps have been characterized, including three electron transfer reactions and two bond-breaking processes, and their reaction times have been determined. A unique electron-tunneling pathway was identified, and the critical residues in modulating the repair function at the active site were determined. The dynamic synergy between the elementary reactions for maintaining high repair efficiency was elucidated, and the biological nature of the flavin active state was uncovered. For 6-4 photoproduct repair, a proton-coupled electron transfer repair mechanism has been revealed. The elucidation of electron transfer mechanisms and two repair photocycles is significant and provides a molecular basis for future practical applications, such as in rational drug design for curing skin cancer.

  6. The validity of sedimentation data from high molecular weight DNA and the effects of additives on radiation-induced single-strand breakage

    International Nuclear Information System (INIS)

    The optimization of many of the factors governing reproducible sedimentation behaviour of high molecular weight single-strand DNA in a particular alkaline sucrose density gradient system is described. A range of angular momenta is defined for which a constant strand breakage efficiency is required, despite a rotor speed effect which increases the measured molecular weights at decreasing rotor speeds for larger DNA molecules. The possibility is discussed that the bimodal control DNA profiles obtained after sedimentation at 11 500 rev/min (12 400 g) or less represent structural subunits of the chromatid. The random induction of single-strand DNA breaks by ionizing radiation is demonstrated by the computer-derived fits to the experimental profiles. The enhancement of single-strand break (SSB) yields in hypoxic cells by oxygen, para-nitroacetophenone (PNAP), or any of the three nitrofuran derivatives used was well correlated with increased cell killing. Furthermore, reductions in SSB yields for known hydroxyl radical (OH.) scavengers correlates with the reactivities of these compounds toward OH.. This supports the contention that some type of OH.-induced initial lesion, which may ultimately be expressed as an unrepaired or misrepaired double-strand break, constitutes a lethal event. (author)

  7. Regulation of DNA double-strand break repair pathway choice

    Institute of Scientific and Technical Information of China (English)

    Meena Shrivastav; Leyma P De Haro; Jac A Nickoloff

    2008-01-01

    DNA double-strand breaks (DSBs) are critical lesions that can result in cell death or a wide variety of genetic alterations including large- or small-scale deletions, loss of heterozygosity, translocations, and chromosome loss. DSBs are repaired by non-homologous end-joining (NHEJ) and homologous recombination (HR), and defects in these pathways cause genome instability and promote tumorigenesis. DSBs arise from endogenous sources includ-ing reactive oxygen species generated during cellular metabolism, collapsed replication forks, and nucleases, and from exogenous sources including ionizing radiation and chemicals that directly or indirectly damage DNA and are commonly used in cancer therapy. The DSB repair pathways appear to compete for DSBs, but the balance between them differs widely among species, between different cell types of a single species, and during different cell cycle phases of a single cell type. Here we review the regulatory factors that regulate DSB repair by NHEJ and HR in yeast and higher eukaryotes. These factors include regulated expression and phosphorylation of repair proteins, chromatin modulation of repair factor accessibility, and the availability of homologous repair templates. While most DSB repair proteins appear to function exclusively in NHEJ or HR, a number of proteins influence both pathways, including the MRE11/RAD50/NBS1 (XRS2) complex, BRCA1, histone H2AX, PARP-1, RAD18, DNA-dependent protein kinase catalytic subunit (DNA-PKcs), and ATM. DNA-PKcs plays a role in mammalian NHEJ, but it also influences HR through a complex regulatory network that may involve crosstalk with ATM, and the regulation of at least 12 proteins involved in HR that are phosphorylated by DNA-PKcs and/or ATM.

  8. Repair of DNA damage induced by ultraviolet radiation

    International Nuclear Information System (INIS)

    Studies documenting the depletion of the ozone layer and the resulting increases in UV-B radiation (280-320 nm) at the Earth's surface have served to focus attention on the biological effects of UV light. One obvious target for UVB- induced damage is DNA. Although a11 biological tissues are rich in UV-absorbing agents (largely nucleic acids and proteins) and plants produce additional UV-absorbing pigments, no DNA in superficial tissue can completely avoid UV exposure. Plants, like a11 living organisms, must have some capacity for the repair of UV-induced DNA damage. Because plants are unique in the obligatory nature of their exposure to UV, it is also conceivable that they may have evolved particularly efficient mechanisms for the elimination of UV-induced DNA damage. This review will summarize what we know about DNA repair mechanisms in higher plants. Readers interested in broader aspects of UV-induced damage and UV filters are directed to recent reviews (Middleton and Teramura, 1994; Strid et al., 1994; Fiscus and Booker, 1995). Our knowledge of DNA repair mechanisms in plants lags far behind our understanding of these pathways in animals, and a significant number of questions concerning the basic phenomenology of DNA repair in plants remain to be addressed

  9. Chromosomal Aberrations in DNA Repair Defective Cell Lines: Comparisons of Dose Rate and Radiation Quality

    Science.gov (United States)

    George, K. A.; Hada, M.; Patel, Z.; Huff, J.; Pluth, J. M.; Cucinotta, F. A.

    2009-01-01

    Chromosome aberration yields were assessed in DNA double-strand break repair (DSB) deficient cells after acute doses of gamma-rays or high-LET iron nuclei, or low dose-rate (0.018 Gy/hr) gamma-rays. We studied several cell lines including fibroblasts deficient in ATM (product of the gene that is mutated in ataxia telangiectasia patients) or NBS (product of the gene mutated in the Nijmegen breakage syndrome), and gliomablastoma cells that are proficient or lacking in DNA-dependent protein kinase, DNA-PK activity. Chromosomes were analyzed using the fluorescence in-situ hybridization (FISH) chromosome painting method in cells at the first division post-irradiation and chromosome aberrations were identified as either simple exchanges (translocations and dicentrics) or complex exchanges (involving >2 breaks in 2 or more chromosomes). Gamma radiation induced higher yields of both simple and complex exchanges in the DSB repair defective cells than in the normal cells. The quadratic dose-response terms for both chromosome exchange types were significantly higher for the ATM and NBS defective lines than for normal fibroblasts. However, the linear dose-response term was significantly higher only for simple exchanges in the NBS cells. Large increases in the quadratic dose response terms indicate the important roles of ATM and NBS in chromatin modifications that facilitate correct DSB repair and minimize aberration formation. Differences in the response of AT and NBS deficient cells at lower doses suggests important questions about the applicability of observations of radiation sensitivity at high dose to low dose exposures. For all iron nuclei irradiated cells, regression models preferred purely linear and quadratic dose responses for simple and complex exchanges, respectively. All the DNA repair defective cell lines had lower Relative biological effectiveness (RBE) values than normal cells, the lowest being for the DNA-PK-deficient cells, which was near unity. To further

  10. The effect of DNA repair defects on reproductive performance in nucleotide excision repair (NER) mouse models: an epidemiological approach

    NARCIS (Netherlands)

    Tsai, P.S.; Nielen, M.; Horst, G.T.J. van der; Colenbrander, B.; Heesterbeek, J.A.P.; Fentener van Vlissingen, J.M.

    2005-01-01

    In this study, we used an epidemiological approach to analyze an animal database of DNA repair deficient mice on reproductive performance in five Nucleotide Excision Repair (NER) mutant mouse models on a C57BL/6 genetic background, namely CSA, CSB, XPA, XPC [models for the human DNA repair disorders

  11. Identification of Saccharomyces cerevisiae DNA ligase IV: involvement in DNA double-strand break repair.

    OpenAIRE

    Teo, S H; Jackson, S P

    1997-01-01

    DNA ligases catalyse the joining of single and double-strand DNA breaks, which is an essential final step in DNA replication, recombination and repair. Mammalian cells have four DNA ligases, termed ligases I-IV. In contrast, other than a DNA ligase I homologue (encoded by CDC9), no other DNA ligases have hitherto been identified in Saccharomyces cerevisiae. Here, we report the identification and characterization of a novel gene, LIG4, which encodes a protein with strong homology to mammalian ...

  12. Biomarkers of oxidative damage to DNA and repair.

    Science.gov (United States)

    Loft, Steffen; Høgh Danielsen, Pernille; Mikkelsen, Lone; Risom, Lotte; Forchhammer, Lykke; Møller, Peter

    2008-10-01

    Oxidative-stress-induced damage to DNA includes a multitude of lesions, many of which are mutagenic and have multiple roles in cancer and aging. Many lesions have been characterized by MS-based methods after extraction and digestion of DNA. These preparation steps may cause spurious base oxidation, which is less likely to occur with methods such as the comet assay, which are based on nicking of the DNA strand at modified bases, but offer less specificity. The European Standards Committee on Oxidative DNA Damage has concluded that the true levels of the most widely studied lesion, 8-oxodG (8-oxo-7,8-dihydro-2'-deoxyguanosine), in cellular DNA is between 0.5 and 5 lesions per 10(6) dG bases. Base excision repair of oxidative damage to DNA can be assessed by nicking assays based on oligonucleotides with lesions or the comet assay, by mRNA expression levels or, in the case of, e.g., OGG1 (8-oxoguanine DNA glycosylase 1), responsible for repair of 8-oxodG, by genotyping. Products of repair in DNA or the nucleotide pool, such as 8-oxodG, excreted into the urine can be assessed by MS-based methods and generally reflects the rate of damage. Experimental and population-based studies indicate that many environmental factors, including particulate air pollution, cause oxidative damage to DNA, whereas diets rich in fruit and vegetables or antioxidant supplements may reduce the levels and enhance repair. Urinary excretion of 8-oxodG, genotype and expression of OGG1 have been associated with risk of cancer in cohort settings, whereas altered levels of damage, repair or urinary excretion in case-control settings may be a consequence rather than the cause of the disease. PMID:18793191

  13. Deficiency of the DNA repair protein nibrin increases the basal but not the radiation induced mutation frequency in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Wessendorf, Petra [Institute of Medical and Human Genetics, Charité – Universitätsmedizin Berlin, Augustenburger Platz 1, D-13353 Berlin (Germany); Vijg, Jan [Albert Einstein College of Medicine, Michael F. Price Center, 1301 Morris Park Avenue, Bronx, NY 10461 (United States); Nussenzweig, André [Laboratory of Genome Integrity, National Cancer Institute, National Institute of Health, 37 Convent Drive, Room 1106, Bethesda, MD 20892 (United States); Digweed, Martin, E-mail: martin.digweed@charite.de [Institute of Medical and Human Genetics, Charité – Universitätsmedizin Berlin, Augustenburger Platz 1, D-13353 Berlin (Germany)

    2014-11-15

    Highlights: • lacZ mutant frequencies measured in vivo in mouse models of radiosensitive Nijmegen Breakage Syndrome. • Spontaneous mutation frequencies are increased in lymphatic tissue due to Nbn mutation. • Single base transitions, not deletions, dominate the mutation spectrum. • Radiation induced mutation frequencies are not increased due to Nbn mutation. - Abstract: Nibrin (NBN) is a member of a DNA repair complex together with MRE11 and RAD50. The complex is associated particularly with the repair of DNA double strand breaks and with the regulation of cell cycle check points. Hypomorphic mutation of components of the complex leads to human disorders characterised by radiosensitivity and increased tumour occurrence, particularly of the lymphatic system. We have examined here the relationship between DNA damage, mutation frequency and mutation spectrum in vitro and in vivo in mouse models carrying NBN mutations and a lacZ reporter plasmid. We find that NBN mutation leads to increased spontaneous DNA damage in fibroblasts in vitro and high basal mutation rates in lymphatic tissue of mice in vivo. The characteristic mutation spectrum is dominated by single base transitions rather than the deletions and complex rearrangements expected after abortive repair of DNA double strand breaks. We conclude that in the absence of wild type nibrin, the repair of spontaneous errors, presumably arising during DNA replication, makes a major contribution to the basal mutation rate. This applies also to cells heterozygous for an NBN null mutation. Mutation frequencies after irradiation in vivo were not increased in mice with nibrin mutations as might have been expected considering the radiosensitivity of NBS patient cells in vitro. Evidently apoptosis is efficient, even in the absence of wild type nibrin.

  14. Deficiency of the DNA repair protein nibrin increases the basal but not the radiation induced mutation frequency in vivo

    International Nuclear Information System (INIS)

    Highlights: • lacZ mutant frequencies measured in vivo in mouse models of radiosensitive Nijmegen Breakage Syndrome. • Spontaneous mutation frequencies are increased in lymphatic tissue due to Nbn mutation. • Single base transitions, not deletions, dominate the mutation spectrum. • Radiation induced mutation frequencies are not increased due to Nbn mutation. - Abstract: Nibrin (NBN) is a member of a DNA repair complex together with MRE11 and RAD50. The complex is associated particularly with the repair of DNA double strand breaks and with the regulation of cell cycle check points. Hypomorphic mutation of components of the complex leads to human disorders characterised by radiosensitivity and increased tumour occurrence, particularly of the lymphatic system. We have examined here the relationship between DNA damage, mutation frequency and mutation spectrum in vitro and in vivo in mouse models carrying NBN mutations and a lacZ reporter plasmid. We find that NBN mutation leads to increased spontaneous DNA damage in fibroblasts in vitro and high basal mutation rates in lymphatic tissue of mice in vivo. The characteristic mutation spectrum is dominated by single base transitions rather than the deletions and complex rearrangements expected after abortive repair of DNA double strand breaks. We conclude that in the absence of wild type nibrin, the repair of spontaneous errors, presumably arising during DNA replication, makes a major contribution to the basal mutation rate. This applies also to cells heterozygous for an NBN null mutation. Mutation frequencies after irradiation in vivo were not increased in mice with nibrin mutations as might have been expected considering the radiosensitivity of NBS patient cells in vitro. Evidently apoptosis is efficient, even in the absence of wild type nibrin

  15. Chromatin structure modulates DNA repair by photolyase in vivo.

    OpenAIRE

    Suter, B.; Livingstone-Zatchej, M; Thoma, F

    1997-01-01

    Yeast and many other organisms use nucleotide excision repair (NER) and photolyase in the presence of light (photoreactivation) to repair cyclobutane pyrimidine dimers (CPDs), a major class of DNA lesions generated by UV light. To study the role of photoreactivation at the chromatin level in vivo, we used yeast strains which contained minichromosomes (YRpTRURAP, YRpCS1) with well-characterized chromatin structures. The strains were either proficient (RAD1) or deficient (rad1 delta) in NER. In...

  16. Repair and Antirepair DNA Helicases in Helicobacter pylori▿ †

    OpenAIRE

    Kang, Josephine; Martin J Blaser

    2008-01-01

    Orthologs of RecG and RuvABC are highly conserved among prokaryotes; in Escherichia coli, they participate in independent pathways that branch migrate Holliday junctions during recombinational DNA repair. RecG also has been shown to directly convert stalled replication forks into Holliday junctions. The bacterium Helicobacter pylori, with remarkably high levels of recombination, possesses RecG and RuvABC homologs, but in contrast to E. coli, H. pylori RecG limits recombinational repair. We no...

  17. Small molecules, inhibitors of DNA-PK, targeting DNA repair and beyond

    Directory of Open Access Journals (Sweden)

    David eDavidson

    2013-01-01

    Full Text Available Many current chemotherapies function by damaging genomic DNA in rapidly dividing cells ultimately leading to cell death. This therapeutic approach differentially targets cancer cells that generally display rapid cell division compared to normal tissue cells. However, although these treatments are initially effective in arresting tumor growth and reducing tumor burden, resistance and disease progression eventually occur. A major mechanism underlying this resistance is increased levels of cellular DNA repair. Most cells have complex mechanisms in place to repair DNA damage that occurs due to environmental exposures or normal metabolic processes. These systems, initially overwhelmed when faced with chemotherapy induced DNA damage, become more efficient under constant selective pressure and as a result chemotherapies become less effective. Thus, inhibiting DNA repair pathways using target specific small molecule inhibitors may overcome cellular resistance to DNA damaging chemotherapies. Non-homologous end joining (NHEJ a major mechanism for the repair of double strand breaks (DSB in DNA is regulated in part by the serine/threonine kinase, DNA dependent protein kinase (DNA-PK. The DNA-PK holoenzyme acts as a scaffold protein tethering broken DNA ends and recruiting other repair molecules. It also has enzymatic activity that may be involved in DNA damage signaling. Because of its’ central role in repair of DSBs, DNA-PK has been the focus of a number of small molecule studies. In these studies specific DNA-PK inhibitors have shown efficacy in synergizing chemotherapies in vitro. However, compounds currently known to specifically inhibit DNA-PK are limited by poor pharmacokinetics: these compounds have poor solubility and have high metabolic lability in vivo leading to short serum half-lives. Future improvement in DNA-PK inhibition will likely be achieved by designing new molecules based on the recently reported crystallographic structure of DNA

  18. Active DNA demethylation by oxidation and repair

    Institute of Scientific and Technical Information of China (English)

    Zhizhong Gong; Jian-Kang Zhu

    2011-01-01

    DNA methylation and demethylation are increasingly recognized as important epigenetic factors in both plants and animals.DNA methylation,which is catalyzed by DNA methyltransferases (DNMTs),is a relatively stable and heritable modification that controls gene expression,cellular differentiation,genomic imprinting,paramutation,transposon movement,X-inactivation,and embryogenesis [1].The methylation of cytosine to 5-methylcytosine (5mC) is an important example of DNA modification in animals and plants.This highlight concerns DNA demethylation mechanisms in mammals and whether they are similar to that in plants.

  19. Damage and repair of ancient DNA

    DEFF Research Database (Denmark)

    Mitchell, David; Willerslev, Eske; Hansen, Anders

    2005-01-01

    , and extensive degradation. In the course of this review, we will discuss the current aDNA literature describing the importance of aDNA studies as they relate to important biological questions and the difficulties associated with extracting useful information from highly degraded and damaged substrates derived......Under certain conditions small amounts of DNA can survive for long periods of time and can be used as polymerase chain reaction (PCR) substrates for the study of phylogenetic relationships and population genetics of extinct plants and animals, including hominids. Because of extensive DNA...... degradation, these studies are limited to species that lived within the past 10(4)-10(5) years (Late Pleistocene), although DNA sequences from 10(6) years have been reported. Ancient DNA (aDNA) has been used to study phylogenetic relationships of protists, fungi, algae, plants, and higher eukaryotes...

  20. Eukaryotic DNA repair is blocked at different steps by inhibitors of DNA topoisomerases and of DNA polymerases α and β

    International Nuclear Information System (INIS)

    Inhibitors of (a) DNA topoisomerases (novobiocin and nalidixic acid) and of (b) eukaryotic DNA polymerases α (cytosine arabinoside) and β (dideoxythymidine) blocked different steps of DNA repair, demonstrated by the effects of the inhibitors on the relaxation of supercoiled DNA nucleoids following treatment of human cell cultures with ultraviolet light (1-3 J/m2) or MNNG (5 or 20 μM) and the subsequent restoration of the supercoiled nucleoids during repair incubation. Inhibition of repair by novobiocin was partially reversible; upon its removal from the culture medium, the nucleoid DNA of repairing cells became relaxed. The DNA polymerase inhibitors allowed the initial relaxation of DNA after treatment of the cells with ultraviolet or MNNG but delayed the regeneration of rapidly-sedimenting (supercoiled) nucleoid DNA for 2-4 h. Dideoxythymidine (1 mM) was more effective than cytosine arabinoside (1 μM) in producing this delay, but neither inhibitor by itself blocked repair permanently. Incubation of ultraviolet-irradiated cells with 1 μM cytosine arabinoside plus 1 mM dideoxythymidine blocked the completion of repair for 24 h, whereas incubation with 10 μM cytosine arabinoside or 5 mM dideoxythymidine produced only temporary repair delays of 2-4 h. Thus, it is likely that the two DNA polymerase inhibitors act upon separate targets and that both targets are involved in repair. (Auth.)

  1. Chromatin factors affecting DNA repair in mammalian cell nuclei

    International Nuclear Information System (INIS)

    We are investigating chromatin factors that participate in the incision step of DNA repair in eukaryotic cells. Localization of repair activity within nuclei, the stability and extractability of activity, the specificity for recognizing damage in chromatin or purified DNA as substrates are of interest in this investigation of human cells, CHO cells, and their radiation sensitive mutants. We have developed procedures that provide nuclei in which their DNA behaves as a collection of circular molecules. The integrity of the DNA in human nuclei can be maintained during incubation in appropriate buffers for as long as 60 minutes. When cells or nuclei are exposed to uv light prior to incubation, incisions presumably associated with DNA repair can be demonstrated. Incision activity is stable to prior extraction of nuclei with 0.6 M NaCl, which removes many nonhistone proteins. Our studies are consistent with an hypothesis that factors responsible for initiating DNA repair are localized in the nuclear matrix. 18 references, 3 figures

  2. Identification of DNA repair genes in the human genome

    International Nuclear Information System (INIS)

    To identify human DNA repair genes we have transfected human genomic DNA ligated to a dominant marker to excision repair deficient xeroderma pigmentosum (XP) and CHO cells. This resulted in the cloning of a human gene, ERCC-1, that complements the defect of a UV- and mitomycin-C sensitive CHO mutant 43-3B. The ERCC-1 gene has a size of 15 kb, consists of 10 exons and is located in the region 19q13.2-q13.3. Its primary transcript is processed into two mRNAs by alternative splicing of an internal coding exon. One of these transcripts encodes a polypeptide of 297 aminoacids. A putative DNA binding protein domain and nuclear location signal could be identified. Significant AA-homology is found between ERCC-1 and the yeast excision repair gene RAD10. 58 references, 6 figures, 1 table

  3. Scintillometric determination of DNA repair in human cell lines

    International Nuclear Information System (INIS)

    The ability of a variety of chemical and physical agents to stimulate DNA repair synthesis in human cell cultures was tested by a simplified scintillometric procedure, with the use of hydroxyurea (HU) to suppress DNA replicative synthesis. After incubation with [3H]thymidine, the radioactivity incorporated into DNA was determined in controls (C) and treated (T) cultures and in the corresponding HU series (Csub(HU), Tsub(HU)). The ratios Tsub(HU)/Csub(HU) and Tsub(HU)/T:Csub(HU)/C, indicating absolute and relative increases of DNA radioactivity, were calculated. When both ratios were significantly higher than 1, they were taken as indices of DNA repair stimulation. (orig./AJ)

  4. Protein-protein interactions in DNA mismatch repair.

    Science.gov (United States)

    Friedhoff, Peter; Li, Pingping; Gotthardt, Julia

    2016-02-01

    The principal DNA mismatch repair proteins MutS and MutL are versatile enzymes that couple DNA mismatch or damage recognition to other cellular processes. Besides interaction with their DNA substrates this involves transient interactions with other proteins which is triggered by the DNA mismatch or damage and controlled by conformational changes. Both MutS and MutL proteins have ATPase activity, which adds another level to control their activity and interactions with DNA substrates and other proteins. Here we focus on the protein-protein interactions, protein interaction sites and the different levels of structural knowledge about the protein complexes formed with MutS and MutL during the mismatch repair reaction. PMID:26725162

  5. Mathematical modelling of the automated FADU assay for the quantification of DNA strand breaks and their repair in human peripheral mononuclear blood cells

    International Nuclear Information System (INIS)

    Cells continuously undergo DNA damage from exogenous agents like irradiation or genotoxic chemicals or from endogenous radicals produced by normal cellular metabolic activities. DNA strand breaks are one of the most common genotoxic lesions and they can also arise as intermediates of DNA repair activity. Unrepaired DNA damage can lead to genomic instability, which can massively compromise the health status of organisms. Therefore it is important to measure and quantify DNA damage and its repair. We have previously published an automated method for measuring DNA strand breaks based on fluorimetric detection of alkaline DNA unwinding [1], and here we present a mathematical model of the FADU assay, which enables to an analytic expression for the relation between measured fluorescence and the number of strand breaks. Assessment of the formation and also the repair of DNA strand breaks is a crucial functional parameter to investigate genotoxicity in living cells. A reliable and convenient method to quantify DNA strand breakage is therefore of significant importance for a wide variety of scientific fields, e.g. toxicology, pharmacology, epidemiology and medical sciences

  6. Nampt is involved in DNA double-strand break repair

    Institute of Scientific and Technical Information of China (English)

    Bingtao Zhu; Xiaoli Deng; Yifan Sun; Lin Bai; Zhikai Xiahou; Yusheng Cong; Xingzhi Xu

    2012-01-01

    DNA double-strand break (DSB) is the most severe form of DNA damage,which is repaired mainly through high-fidelity homologous recombination (HR) or error-prone non-homologous end joining (NHEJ).Defects in the DNA damage response lead to genomic instability and ultimately predispose organs to cancer.Nicotinamide phosphoribosyltransferase (Nampt),which is involved in nicotinamide adenine dinucleotide metabolism,is overexpressed in a variety of tumors.In this report,we found that Nampt physically associated with CtlP and DNA-PKcs/Ku80,which are key factors in HR and NHEJ,respectively.Depletion of Nampt by small interfering RNA (siRNA) led to defective NHEJ-mediated DSB repair and enhanced HR-mediated repair.Furthermore,the inhibition of Nampt expression promoted proliferation of cancer cells and normal human fibroblasts and decreased β-galactosidase staining,indicating a delay in the onset of cellular senescence in normal human fibroblasts.Taken together,our results suggest that Nampt is a suppressor of HR-mediated DSB repair and an enhancer of NHEJ-mediated DSB repair,contributing to the acceleration of cellular senescence.

  7. The DNA repair complex DNA-PK, a pharmacological target in cancer chemotherapy and radiotherapy

    International Nuclear Information System (INIS)

    A line of investigation in the search for sensitizing tumor cells to chemotherapy or radiotherapy relies on the selection of DNA repair inhibitors. In the area of DNA repair mechanisms, DNA-dependent protein kinase (DNA-PK) represents a key complex. Indeed DNA-PK is involved in the non-homologous end joining (NHEJ) process that corresponds to the major activity responsible for cell survival after ionizing radiation or chemotherapeutic treatment producing DNA double strand breaks. DNA-PK belongs to the PI3-K related kinase family and specific inhibitors have been recently selected and evaluated as radio- and chemo-sensitizers. These drugs, along with other ways to inhibit the DSBs repair process, are presented and discussed. (authors)

  8. DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair.

    Science.gov (United States)

    Mentegari, Elisa; Kissova, Miroslava; Bavagnoli, Laura; Maga, Giovanni; Crespan, Emmanuele

    2016-01-01

    DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell's genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy. PMID:27589807

  9. DNA Polymerases λ and β: The Double-Edged Swords of DNA Repair

    Directory of Open Access Journals (Sweden)

    Elisa Mentegari

    2016-08-01

    Full Text Available DNA is constantly exposed to both endogenous and exogenous damages. More than 10,000 DNA modifications are induced every day in each cell’s genome. Maintenance of the integrity of the genome is accomplished by several DNA repair systems. The core enzymes for these pathways are the DNA polymerases. Out of 17 DNA polymerases present in a mammalian cell, at least 13 are specifically devoted to DNA repair and are often acting in different pathways. DNA polymerases β and λ are involved in base excision repair of modified DNA bases and translesion synthesis past DNA lesions. Polymerase λ also participates in non-homologous end joining of DNA double-strand breaks. However, recent data have revealed that, depending on their relative levels, the cell cycle phase, the ratio between deoxy- and ribo-nucleotide pools and the interaction with particular auxiliary proteins, the repair reactions carried out by these enzymes can be an important source of genetic instability, owing to repair mistakes. This review summarizes the most recent results on the ambivalent properties of these enzymes in limiting or promoting genetic instability in mammalian cells, as well as their potential use as targets for anticancer chemotherapy.

  10. Genotoxic thresholds, DNA repair, and susceptibility in human populations

    International Nuclear Information System (INIS)

    It has been long assumed that DNA damage is induced in a linear manner with respect to the dose of a direct acting genotoxin. Thus, it is implied that direct acting genotoxic agents induce DNA damage at even the lowest of concentrations and that no 'safe' dose range exists. The linear (non-threshold) paradigm has led to the one-hit model being developed. This 'one hit' scenario can be interpreted such that a single DNA damaging event in a cell has the capability to induce a single point mutation in that cell which could (if positioned in a key growth controlling gene) lead to increased proliferation, leading ultimately to the formation of a tumour. There are many groups (including our own) who, for a decade or more, have argued, that low dose exposures to direct acting genotoxins may be tolerated by cells through homeostatic mechanisms such as DNA repair. This argument stems from the existence of evolutionary adaptive mechanisms that allow organisms to adapt to low levels of exogenous sources of genotoxins. We have been particularly interested in the genotoxic effects of known mutagens at low dose exposures in human cells and have identified for the first time, in vitro genotoxic thresholds for several mutagenic alkylating agents (Doak et al., 2007). Our working hypothesis is that DNA repair is primarily responsible for these thresholded effects at low doses by removing low levels of DNA damage but becoming saturated at higher doses. We are currently assessing the roles of base excision repair (BER) and methylguanine-DNA methyltransferase (MGMT) for roles in the identified thresholds (Doak et al., 2008). This research area is currently important as it assesses whether 'safe' exposure levels to mutagenic chemicals can exist and allows risk assessment using appropriate safety factors to define such exposure levels. Given human variation, the mechanistic basis for genotoxic thresholds (e.g. DNA repair) has to be well defined in order that susceptible individuals are

  11. Redox cycling of endogenous copper by ferulic acid leads to cellular DNA breakage and consequent cell death: A putative cancer chemotherapy mechanism.

    Science.gov (United States)

    Sarwar, Tarique; Zafaryab, Md; Husain, Mohammed Amir; Ishqi, Hassan Mubarak; Rehman, Sayeed Ur; Rizvi, M Moshahid Alam; Tabish, Mohammad

    2015-12-01

    Ferulic acid (FA) is a plant polyphenol showing diverse therapeutic effects against cancer, diabetes, cardiovascular and neurodegenerative diseases. FA is a known antioxidant at lower concentrations, however at higher concentrations or in the presence of metal ions such as copper, it may act as a pro-oxidant. It has been reported that copper levels are significantly raised in different malignancies. Cancer cells are under increased oxidative stress as compared to normal cells. Certain therapeutic substances like polyphenols can further increase this oxidative stress and kill cancer cells without affecting the proliferation of normal cells. Through various in vitro experiments we have shown that the pro-oxidant properties of FA are enhanced in the presence of copper. Comet assay demonstrated the ability of FA to cause oxidative DNA breakage in human peripheral lymphocytes which was ameliorated by specific copper-chelating agent such as neocuproine and scavengers of ROS. This suggested the mobilization of endogenous copper in ROS generation and consequent DNA damage. These results were further validated through cytotoxicity experiments involving different cell lines. Thus, we conclude that such a pro-oxidant mechanism involving endogenous copper better explains the anticancer activities of FA. This would be an alternate non-enzymatic, and copper-mediated pathway for the cytotoxic activities of FA where it can selectively target cancer cells with elevated levels of copper and ROS.

  12. Mismatch repair and nucleotide excision repair proteins cooperate in the recognition of DNA interstrand crosslinks.

    Science.gov (United States)

    Zhao, Junhua; Jain, Aklank; Iyer, Ravi R; Modrich, Paul L; Vasquez, Karen M

    2009-07-01

    DNA interstrand crosslinks (ICLs) are among the most cytotoxic types of DNA damage, thus ICL-inducing agents such as psoralen, are clinically useful chemotherapeutics. Psoralen-modified triplex-forming oligonucleotides (TFOs) have been used to target ICLs to specific genomic sites to increase the selectivity of these agents. However, how TFO-directed psoralen ICLs (Tdp-ICLs) are recognized and processed in human cells is unclear. Previously, we reported that two essential nucleotide excision repair (NER) protein complexes, XPA-RPA and XPC-RAD23B, recognized ICLs in vitro, and that cells deficient in the DNA mismatch repair (MMR) complex MutSbeta were sensitive to psoralen ICLs. To further investigate the role of MutSbeta in ICL repair and the potential interaction between proteins from the MMR and NER pathways on these lesions, we performed electrophoretic mobility-shift assays and chromatin immunoprecipitation analysis of MutSbeta and NER proteins with Tdp-ICLs. We found that MutSbeta bound to Tdp-ICLs with high affinity and specificity in vitro and in vivo, and that MutSbeta interacted with XPA-RPA or XPC-RAD23B in recognizing Tdp-ICLs. These data suggest that proteins from the MMR and NER pathways interact in the recognition of ICLs, and provide a mechanistic link by which proteins from multiple repair pathways contribute to ICL repair. PMID:19468048

  13. Triplex technology in studies of DNA damage, DNA repair, and mutagenesis.

    Science.gov (United States)

    Mukherjee, Anirban; Vasquez, Karen M

    2011-08-01

    Triplex-forming oligonucleotides (TFOs) can bind to the major groove of homopurine-homopyrimidine stretches of double-stranded DNA in a sequence-specific manner through Hoogsteen hydrogen bonding to form DNA triplexes. TFOs by themselves or conjugated to reactive molecules can be used to direct sequence-specific DNA damage, which in turn results in the induction of several DNA metabolic activities. Triplex technology is highly utilized as a tool to study gene regulation, molecular mechanisms of DNA repair, recombination, and mutagenesis. In addition, TFO targeting of specific genes has been exploited in the development of therapeutic strategies to modulate DNA structure and function. In this review, we discuss advances made in studies of DNA damage, DNA repair, recombination, and mutagenesis by using triplex technology to target specific DNA sequences. PMID:21501652

  14. Nucleotide Excision Repair and Transcription-coupled DNA Repair Abrogate the Impact of DNA Damage on Transcription.

    Science.gov (United States)

    Nadkarni, Aditi; Burns, John A; Gandolfi, Alberto; Chowdhury, Moinuddin A; Cartularo, Laura; Berens, Christian; Geacintov, Nicholas E; Scicchitano, David A

    2016-01-01

    DNA adducts derived from carcinogenic polycyclic aromatic hydrocarbons like benzo[a]pyrene (B[a]P) and benzo[c]phenanthrene (B[c]Ph) impede replication and transcription, resulting in aberrant cell division and gene expression. Global nucleotide excision repair (NER) and transcription-coupled DNA repair (TCR) are among the DNA repair pathways that evolved to maintain genome integrity by removing DNA damage. The interplay between global NER and TCR in repairing the polycyclic aromatic hydrocarbon-derived DNA adducts (+)-trans-anti-B[a]P-N(6)-dA, which is subject to NER and blocks transcription in vitro, and (+)-trans-anti-B[c]Ph-N(6)-dA, which is a poor substrate for NER but also blocks transcription in vitro, was tested. The results show that both adducts inhibit transcription in human cells that lack both NER and TCR. The (+)-trans-anti-B[a]P-N(6)-dA lesion exhibited no detectable effect on transcription in cells proficient in NER but lacking TCR, indicating that NER can remove the lesion in the absence of TCR, which is consistent with in vitro data. In primary human cells lacking NER, (+)-trans-anti-B[a]P-N(6)-dA exhibited a deleterious effect on transcription that was less severe than in cells lacking both pathways, suggesting that TCR can repair the adduct but not as effectively as global NER. In contrast, (+)-trans-anti-B[c]Ph-N(6)-dA dramatically reduces transcript production in cells proficient in global NER but lacking TCR, indicating that TCR is necessary for the removal of this adduct, which is consistent with in vitro data showing that it is a poor substrate for NER. Hence, both global NER and TCR enhance the recovery of gene expression following DNA damage, and TCR plays an important role in removing DNA damage that is refractory to NER.

  15. Dynamic regulation of cerebral DNA repair genes by psychological stress

    DEFF Research Database (Denmark)

    Forsberg, Kristin; Aalling, Nadia; Wörtwein, Gitta;

    2015-01-01

    restraint stress (6h/day) or daily handling (controls), and sacrificed after 1, 7 or 21 stress sessions. The mRNA expression of seven genes (Ogg1, Ape1, Ung1, Neil1, Xrcc1, Ercc1, Nudt1) involved in the repair of oxidatively damaged DNA was determined by quantitative real time polymerase chain reaction...

  16. DNA Repair-Protein Relocalization After Heavy Ion Exposure

    Science.gov (United States)

    Metting, N. F.

    1999-01-01

    Ionizing radiation is good at making DNA double strand breaks, and high linear energy transfer (LET) radiations such as heavy ion particles are particularly efficient. For this reason, the proteins belonging to repair systems that deal with double strand breaks are of particular interest. One such protein is Ku, a component in the non-homologous recombination repair system. The Ku protein is an abundant, heterodimeric DNA end-binding complex, composed of one 70 and one 86 kDa subunit. Ku protein binds to DNA ends, nicks, gaps, and regions of transition between single and double-stranded structure. These binding properties suggest an important role in DNA repair. The Ku antigen is important in this study because it is present in relatively large copy numbers and it is part of a double-strand-break repair system. More importantly, we consistently measure an apparent upregulation in situ that is not verified by whole-cell-lysate immunoblot measurements. This apparent upregulation is triggered by very low doses of radiation, thus showing a potentially useful high sensitivity. However, elucidation of the mechanism underlying this phenomenon is still to be done.

  17. UV Radiation Damage and Bacterial DNA Repair Systems

    Science.gov (United States)

    Zion, Michal; Guy, Daniel; Yarom, Ruth; Slesak, Michaela

    2006-01-01

    This paper reports on a simple hands-on laboratory procedure for high school students in studying both radiation damage and DNA repair systems in bacteria. The sensitivity to ultra-violet (UV) radiation of both "Escherichia coli" and "Serratia marcescens" is tested by radiating them for varying time periods. Two growth temperatures are used in…

  18. Methylation levels of P16 and TP53 that are involved in DNA strand breakage of 16HBE cells treated by hexavalent chromium.

    Science.gov (United States)

    Hu, Guiping; Li, Ping; Li, Yang; Wang, Tiancheng; Gao, Xin; Zhang, Wenxiao; Jia, Guang

    2016-05-13

    The correlations between methylation levels of p16 and TP53 with DNA strand breakage treated by hexavalent chromium [Cr(VI)] remain unknown. In this research, Human bronchial epithelial cells (16HBE cells) in vitro and bioinformatics analysis were used to analyze the epigenetic role in DNA damage and potential biomarkers. CCK-8 and single cell gel electrophoresis assay were chosen to detect the cellular biological damage. MALDI-TOF-MS was used to detect the methylation levels of p16 and TP53. qRT-PCR was used to measure their expression levels in different Cr(VI) treatment groups. The transcription factors with target sequences of p16 and TP53 were predicted using various bioinformatics software. The findings showed that the cellular toxicity and DNA strand damage were Cr(VI) concentration dependent. The hypermethylation of CpG1, CpG31 and CpG32 of p16 was observed in Cr(VI) treated groups. There was significant positive correlation between the CpG1 methylation level of p16 and cell damage. In Cr(VI) treated groups, the expression level of p16 was lower than that in control group. The expression level of TP53 increased when the Cr(VI)concentration above 5μM. About p16, there was significant negative correlation between the CpG1 methylation levels with its expression level. A lot of binding sites for transcription factors existed in our focused CpG islands of p16. All the results suggested that the CpG1 methylation level of p16 could be used as a biomarker of epigenetic effect caused by Cr(VI) treatment, which can enhance cell damage by regulating its expression or affecting some transcription factors to combine with their DNA strand sites. PMID:27005777

  19. Distribution of DNA repair-related ESTs in sugarcane

    Directory of Open Access Journals (Sweden)

    W.C. Lima

    2001-12-01

    Full Text Available DNA repair pathways are necessary to maintain the proper genomic stability and ensure the survival of the organism, protecting it against the damaging effects of endogenous and exogenous agents. In this work, we made an analysis of the expression patterns of DNA repair-related genes in sugarcane, by determining the EST (expressed sequence tags distribution in the different cDNA libraries of the SUCEST transcriptome project. Three different pathways - photoreactivation, base excision repair and nucleotide excision repair - were investigated by employing known DNA repair proteins as probes to identify homologous ESTs in sugarcane, by means of computer similarity search. The results showed that DNA repair genes may have differential expressions in tissues, depending on the pathway studied. These in silico data provide important clues on the potential variation of gene expression, to be confirmed by direct biochemical analysis.As vias de reparo de DNA são requeridas para manter a necessária estabilidade genômica e garantir a sobrevivência do organismo, frente aos efeitos deletérios causados por fatores endógenos e exógenos. Neste trabalho, realizamos a análise dos padrões de expressão dos genes de reparo de DNA encontrados na cana-de-açúcar, pela determinação da distribuição de ESTs nas diferentes bibliotecas de cDNA no projeto de transcriptoma SUCEST. Três vias de reparo - fotorreativação, reparo por excisão de bases e reparo por excisão de nucleotídeos - foram estudadas através do uso de proteínas de reparo como sondas para identificação de ESTs homólogos em cana-de-açúcar, com base na procura computacional de similaridade. Os resultados indicam que os genes de reparo de DNA possuem uma expressão diferencial nos tecidos, dependendo da via de reparo analisada. Esses dados in silico fornecem importantes indícios da expressão diferencial, a qual deve ser confirmada por análises bioquímicas diretas.

  20. Role of nuclear hexokinase II in DNA repair

    International Nuclear Information System (INIS)

    A common signature of many cancer cells is a high glucose catabolic rate primarily due to the over expression of Type II hexokinase (HKII; responsible for the phosphorylation of glucose), generally known as cytosolic and mitochondrial bound enzyme that also suppresses cell death. Although, nuclear localization and transcriptional regulation of HKII has been reported in yeast; we and few others have recently demonstrated its nuclear localization in malignant cell lines. Interestingly, modification of a human glioma cell line (BMG-1) for enhancing glycolysis through mitochondrial respiration (OPMBMG cells) resulted in a higher nuclear localization of HKII as compared to the parental cells with concomitant increase in DNA repair and radio-resistance. Further, the glucose phosphorylation activity of the nuclear HKII was nearly 2 folds higher in the relatively more radioresistant HeLa cells (human cervical cancer cell line) as compared to MRC-5 cells (human normal lung fibroblast cell line). Therefore, we hypothesize that nuclear HKII facilitates DNA repair, in a hither to unknown mechanism, that may partly contribute to the enhanced resistance of highly glycolytic cells to radiation. Sequence alignment studies suggest that the isoenzymes, HKI and HKII share strong homology in the kinase active site, which is also found in few protein kinases. Interestingly HKI has been shown to phosphorylate H2A in-vitro. Further, in-silico protein-protein interaction data suggest that HKII can interact with several DNA repair proteins including ATM. Taken together; available experimental evidences as well as in-silico predictions strongly suggest that HKII may play a role in DNA repair by phosphorylation of certain DNA repair proteins. (author)

  1. Cdt2-mediated XPG degradation promotes gap-filling DNA synthesis in nucleotide excision repair

    OpenAIRE

    Han, Chunhua; Wani, Gulzar; Zhao, Ran; Qian, Jiang; Sharma, Nidhi; He, Jinshan; Zhu, Qianzheng; Wang, Qi-En; Wani, Altaf A.

    2014-01-01

    Xeroderma pigmentosum group G (XPG) protein is a structure-specific repair endonuclease, which cleaves DNA strands on the 3′ side of the DNA damage during nucleotide excision repair (NER). XPG also plays a crucial role in initiating DNA repair synthesis through recruitment of PCNA to the repair sites. However, the fate of XPG protein subsequent to the excision of DNA damage has remained unresolved. Here, we show that XPG, following its action on bulky lesions resulting from exposures to UV ir...

  2. Impact of radiotherapy on PBMCs DNA repair capacity - Use of a multiplexed functional repair assay

    International Nuclear Information System (INIS)

    Radiation therapy is an essential part of cancer treatment as about 50% of patients will receive radiations at least once. Significant broad variation in radiosensitivity has been demonstrated in patients. About 5-10% of patients develop acute toxicity after radiotherapy. Therefore there is a need for the identification of markers able to predict the occurrence of adverse effects and thus adapt the radiotherapy regimen for radiosensitive patients. As a first step toward this goal, and considering the DNA repair defects associated with hypersensitivity radiation syndromes, we investigated the DNA repair phenotype of patients receiving radiotherapy. More precisely, we used a functional repair assay on support to follow the evolution of the glycosylases/AP endonuclease activities of PBMCs extracts of a series of patients during the time course of radiotherapy. For each patient, we collected one PBMCs sample before the first radiotherapy application (S1) and three samples after (S2 to S4) (one day and one week after application 1, and one at the end of the radiotherapy protocol). These four samples have been analysed for 11 donors. Clustering analyses of the results demonstrated a great heterogeneity of responses among the patients. Interestingly, this heterogeneity decreased between S1 and S4 where only 2 classes of patients remained if we except one patient that exhibited an atypical DNA repair phenotype. Furthermore, we showed that repair of several oxidized bases significantly increased between S1 and S3 or S4 (8oxoG, thymine glycol, A paired with 8oxoG), suggesting an adaptation of patients repair systems to the oxidative stress generated by the ionising radiations. Our preliminary results provided evidence that the DNA repair phenotype was impacted by the radiotherapy regimen. Further characterization of patients with known repair defects are needed to determine if atypical repair phenotypes could be associated with radiotherapy complications. Finally

  3. Involvement of the yeast DNA polymerase delta in DNA repair in vivo

    International Nuclear Information System (INIS)

    The POL3 encoded catalytic subunit of DNA polymerase delta possesses a highly conserved C-terminal cysteine-rich domain in Saccharomyces cerevisiae. Mutations in some of its cysteine codons display a lethal phenotype, which demonstrates an essential function of this domain. The thermosensitive mutant pol3-13, in which a serine replaces a cysteine of this domain, exhibits a range of defects in DNA repair, such as hypersensitivity to different DNA-damaging agents and deficiency for induced mutagenesis and for recombination. These phenotypes are observed at 24 degrees, a temperature at which DNA replication is almost normal; this differentiates the functions of POL3 in DNA repair and DNA replication. Since spontaneous mutagenesis and spontaneous recombination are efficient in pol3-13, we propose that POL3 plays an important role in DNA repair after irradiation, particularly in the error-prone and recombinational pathways. Extragenic suppressors of pol3-13 are allelic to sdp5-1, previously identified as an extragenic suppressor of pol3-11. SDP5, which is identical to HYS2, encodes a protein homologous to the p50 subunit of bovine and human DNA polymerase delta. SDP5 is most probably the p55 subunit of Pol delta of S. cerevisiae and seems to be associated with the catalytic subunit for both DNA replication and DNA repair. (author)

  4. Targeting DNA Damage and Repair by Curcumin

    OpenAIRE

    Ji, Zhenyu

    2010-01-01

    Curcumin is a compound with anti-tumor effects in a tolerable dose. A recent paper by Rowe et al described that curcumin induced DNA damage in triple negative breast cancer cells and regulated BRCA1 protein expression and modification.1 Related research and potential use of curcumin will be discussed in this article.

  5. DNA repair and transcription deficiency syndromes

    NARCIS (Netherlands)

    W. Vermeulen (Wim)

    1995-01-01

    textabstractThe genetic information of all living organisms is stored in DNA, a long macromolecule composed of four different nucleotides. Preservation of the sequence of nucleotides, defining the genetic code, is a prerequisite for a faithful transmission of the genetic information to subsequent ge

  6. Xeroderma pigmentosum and the role of DNA repair in oncogenesis

    International Nuclear Information System (INIS)

    Biochemical and genetic information on xeroderma pigmentosum (XP) has been briefly reviewed. This indicates that 80 to 90% of all XP patients are defective in the excision repair of pyrimidine dimers and are unable to perform the first step of this process. However, in spite of its apparent biochemical homogeneity, XP is genetically heterogeneous and many genes appear to be responsible for the function of the factor defective in XP. Ten to 20% of all XP patients (called XP-variants) are capable of 'dimer excision repair' but have difficulties in replicating UV-damaged DNA. The defects of XP and XP-variant affect also the repair of DNA damage caused by a number of chemical mutagens and carcinogens. This has important theoretical and practical implications since it indicates that the repair systems defective in XP must have broad specificity and that even XP cells not exposed to the harmful effect of light may suffer from poor repair of DNA damage. With regard to cancer, two questions have been considered. Namely, does XP provide a valid general model for UV-carcinogenesis in man and does it show how DNA damage leads to malignant transformation. The first question was answered in the affirmative in view of some clinical but, mainly, of cell biological data indicating that normal and excision defective XP cells differ, more quantitatively than qualitatively, in their response to UV-light. With regard to the second question XP seems to provide some support for various theories on carcinogenesis and, DNA repair defects may favour actinic carcinogenesis in a complex, non-univocous manner. Possibly the most important lesson imparted by XP is that, in man, the stability of the genetic material is dependent on the function of repair systems whose failure may predispose to cancer. In addition, the study of XP has stressed the fact that many genes control DNA metabolism and new evidence is accumulating to show that defects in such genes may contribute significantly to the

  7. DNA triple helix formation: A potential tool for genetic repair

    Directory of Open Access Journals (Sweden)

    Nayak A

    2006-01-01

    Full Text Available DNA triple helices offer new perspectives towards oligonucleotide-directed gene regulation. Triple helix forming oligonucleotides, which bind to double-stranded DNA, are of special interest since they are targeted to the gene itself rather than to its mRNA product (as in the antisense strategy. However, the poor stability of some of these structures might limit their use under physiological conditions. Specific ligands can intercalate into DNA triple helices and stabilize them. This review summarizes recent advances in this field while also highlighting major obstacles that remain to be overcome, before the application of triplex technology to therapeutic gene repair can be achieved.

  8. Chemical carcinogenesis — the price for DNA-repair?

    Science.gov (United States)

    Wintersberger, Ulrike

    1982-03-01

    This essay examines the possibility of merging the mutation theory of cancer with the hypothesis that cancer is a change in the state of the differentiation of cells. It is suggested that during normal development DNA rearrangements occur, concerning genes which code for differentiation specific cell communication proteins. These proteins are responsible for the proper functioning of growth control in a multicellular organism. DNA-damaging agents — mutagens — induce DNA repair enzymes, some of which may catalyse illegitimate genome rearrangements, thus leading to a change of the balance between growth and differentiation. A cell with a selective advantage may arise and become the origin of a tumor.

  9. Molecular Understanding of Efficient DNA Repair Machinery of Photolyase

    Science.gov (United States)

    Tan, Chuang; Liu, Zheyun; Li, Jiang; Guo, Xunmin; Wang, Lijuan; Zhong, Dongping

    2012-06-01

    Photolyases repair the UV-induced pyrimidine dimers in damage DNA with high efficiency, through a cylic light-driven electron transfer radical mechanism. We report here our systematic studies of the repair dynamics in E. coli photolyase with mutation of five active-site residues. The significant loss of repair efficiency by the mutation indicates that those active-site residues play an important role in the DNA repair by photolyase. To understand how the active-site residues modulate the efficiency, we mapped out the entire evolution of each elementary step during the repair in those photolyase mutants with femtosecond resolution. We completely analyzed the electron transfer dynamics using the Sumi-Marcus model. The results suggest that photolyase controls the critical electron transfer and the ring-splitting of pyrimidine dimer through modulation of the redox potentials and reorganization energies, and stabilization of the anionic intermediates, maintaining the dedicated balance of all the reaction steps and achieving the maximum function activity.

  10. Cycling with BRCA2 from DNA repair to mitosis

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyunsook, E-mail: HL212@snu.ac.kr

    2014-11-15

    Genetic integrity in proliferating cells is guaranteed by the harmony of DNA replication, appropriate DNA repair, and segregation of the duplicated genome. Breast cancer susceptibility gene BRCA2 is a unique tumor suppressor that is involved in all three processes. Hence, it is critical in genome maintenance. The functions of BRCA2 in DNA repair and homology-directed recombination (HDR) have been reviewed numerous times. Here, I will briefly go through the functions of BRCA2 in HDR and focus on the emerging roles of BRCA2 in telomere homeostasis and mitosis, then discuss how BRCA2 exerts distinct functions in a cell-cycle specific manner in the maintenance of genomic integrity. - Highlights: • BRCA2 is a multifaceted tumor suppressor and is crucial in genetic integrity. • BRCA2 exerts distinct functions in cell cycle-specific manner. • Mitotic kinases regulate diverse functions of BRCA2 in mitosis and cytokinesis.

  11. Cycling with BRCA2 from DNA repair to mitosis

    International Nuclear Information System (INIS)

    Genetic integrity in proliferating cells is guaranteed by the harmony of DNA replication, appropriate DNA repair, and segregation of the duplicated genome. Breast cancer susceptibility gene BRCA2 is a unique tumor suppressor that is involved in all three processes. Hence, it is critical in genome maintenance. The functions of BRCA2 in DNA repair and homology-directed recombination (HDR) have been reviewed numerous times. Here, I will briefly go through the functions of BRCA2 in HDR and focus on the emerging roles of BRCA2 in telomere homeostasis and mitosis, then discuss how BRCA2 exerts distinct functions in a cell-cycle specific manner in the maintenance of genomic integrity. - Highlights: • BRCA2 is a multifaceted tumor suppressor and is crucial in genetic integrity. • BRCA2 exerts distinct functions in cell cycle-specific manner. • Mitotic kinases regulate diverse functions of BRCA2 in mitosis and cytokinesis

  12. The Protective Effects of N-Acetylcysteine on Exogenous Hydrogen Peroxide and Endogenous Superoxide Anion induced DNA Strand Breakage in Human Spermatozoa%`

    Institute of Scientific and Technical Information of China (English)

    徐德祥; 沈汉民; 王俊南

    2001-01-01

    Objective To explore the protective effects of N-Acetylcysteine (NAC) on exogenous hydrogen peroxide and endogenous superoxide anion-induced DNA strand breakage in human spermatozoa by using the single-cell gel electropherosis (SCGE)Methods Sperm cells were exposed to 0. 5 mmol/L of H2O2 or 5. 0 mmol/L of β -NADPH with or without 0. 1, 0. 5, 1. 0 mmol/L of NAC. The percentage of sperm comet cells and the comet tail lengths were measured in the treated sperm cells by using SCGE.Results Both percentage of comet sperm nuclei and mean tail length in sperm cells exposed to 0. 5 mmol/L hydrogen peroxide with different concentrations of NAC decrease significantly in a dose-dependent manner as compared with sperm cells exposed to H2O2 without NAC or catalase. Although mean tail length in sperm cells exposed to 5. 0 mmol/L of β-NADPH with different concentrations of NAC decreases significantly compared with sperm cells exposed to β-NADPH without NAC or SOD,there were no significant differences on the percentage of sperm comet cells between sperm cells exposed to 5. 0 mmol/L of β-NADPH with different concentrations of NAC and sperm cells exposed to 5. 0 mmol/L of β-NADPH without NAC.Conclusion NAC has a protective effect on exogenous hydrogen peroxide-induced DNA damage, while protective effect of NAC against O2- induced DNA strand break age is significant but very weak.

  13. Aspects of DNA repair and nucleotide pool imbalance

    Energy Technology Data Exchange (ETDEWEB)

    Holliday, R.

    1985-01-01

    Evidence that optimum repair depends on adequate pools of deoxynucleotide triphosphates (dNTPs) comes from the study of pyrimidine auxotrophs of Ustilago maydis. These strains are sensitive to UV light and X-rays, and for pyr1-1 it has been shown that the intracellular concentration of dTTP is reduced about 7-fold. The survival curve of pyr1-1 after UV-treatment, and split dose experiments with wild-type cells, provide evidence for an inducible repair mechanism, which probably depends on genetic recombination. Although inducible repair saves cellular resources, it has the disadvantage of becoming ineffective at doses which are high enough to inactivate the repressed structural gene(s) for repair enzymes. It is clear that a wide variety of repair mechanisms have evolved to remove lesions which arise either spontaneously or as a result of damage from external agents. Nevertheless, it would be incorrect to assume that all species require all possible pathways of repair. It is now well established that the accuracy of DNA and protein synthesis depends on proof-reading or editing mechanisms. Optimum accuracy levels will evolve from the balance between error avoidance in macromolecular synthesis and physiological efficiency in growth and propagation.

  14. Genetic variations in DNA repair genes, radiosensitivity to cancer and susceptibility to acute tissue reactions in radiotherapy-treated cancer patients

    Energy Technology Data Exchange (ETDEWEB)

    Chistiakov, Dimitry A. (Dept. of Pathology, Univ. of Pittsburgh, Pittsburgh (US)); Voronova, Natalia V. (Dept. of Molecular Diagnostics, National Research Center GosNIIgenetika, Moscow (RU)); Chistiakov, Pavel A. (Dept. of Radiology, Cancer Research Center, Moscow (RU))

    2008-06-15

    Ionizing radiation is a well established carcinogen for human cells. At low doses, radiation exposure mainly results in generation of double strand breaks (DSBs). Radiation-related DSBs could be directly linked to the formation of chromosomal rearrangements as has been proven for radiation-induced thyroid tumors. Repair of DSBs presumably involves two main pathways, non-homologous end joining (NHEJ) and homologous recombination (HR). A number of known inherited syndromes, such as ataxia telangiectasia, ataxia-telangiectasia like-disorder, radiosensitive severe combined immunodeficiency, Nijmegen breakage syndrome, and LIG4 deficiency are associated with increased radiosensitivity and/or cancer risk. Many of them are caused by mutations in DNA repair genes. Recent studies also suggest that variations in the DNA repair capacity in the general population may influence cancer susceptibility. In this paper, we summarize the current status of DNA repair proteins as potential targets for radiation-induced cancer risk. We will focus on genetic alterations in genes involved in HR- and NHEJ-mediated repair of DSBs, which could influence predisposition to radiation-related cancer and thereby explain interindividual differences in radiosensitivity or radioresistance in a general population

  15. Repair and recombination induced by triple helix DNA.

    Science.gov (United States)

    Chin, Joanna Y; Schleifman, Erica B; Glazer, Peter M

    2007-01-01

    Triple-helix DNA structures can form endogenously at mirror repeat polypurine/polypyrimidine sequences or by introduction of triplex-forming oligonucleotides (TFOs). Recent evidence suggests that triple helices are sources of genetic instability, and are subject to increased rates of mutagenesis and recruitment of repair factors. Indeed, observations using TFOs suggest that triple helices provoke a variety of biological processes which can be harnessed to modulate gene expression and induce heritable changes in targeted genes. This review surveys the biological applications of TFOs, with particular attention to their recombinogenic and mutagenic potential, and summarizes available evidence for the mechanism of triplex and triplex-associated repair. PMID:17485375

  16. DNA ligase I selectively affects DNA synthesis by DNA polymerases delta and epsilon suggesting differential functions in DNA replication and repair.

    OpenAIRE

    Mossi, R; Ferrari, E.; Hübscher, U

    1998-01-01

    The joining of single-stranded breaks in double-stranded DNA is an essential step in many important processes such as DNA replication, DNA repair, and genetic recombination. Several data implicate a role for DNA ligase I in DNA replication, probably coordinated by the action of other enzymes and proteins. Since both DNA polymerases delta and epsilon show multiple functions in different DNA transactions, we investigated the effect of DNA ligase I on various DNA synthesis events catalyzed by th...

  17. DNA repair in neurons: So if they don't divide what's to repair?

    Energy Technology Data Exchange (ETDEWEB)

    Fishel, Melissa L. [Department of Pediatrics (Section of Hematology/Oncology), Herman B Wells Center for Pediatric Research, Indiana University School of Medicine, 1044 W. Walnut, Room 302C, Indianapolis, IN 46202 (United States); Vasko, Michael R. [Department of Pharmacology and Toxicology, Indiana University School of Medicine, 1044 W. Walnut St., Indianapolis, IN 46202 (United States); Kelley, Mark R. [Department of Pediatrics (Section of Hematology/Oncology), Herman B Wells Center for Pediatric Research, Indiana University School of Medicine, 1044 W. Walnut, Room 302C, Indianapolis, IN 46202 (United States) and Department of Pharmacology and Toxicology, Indiana University School of Medicine, 1044 W. Walnut St., Indianapolis, IN 46202 (United States) and Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, 1044 W. Walnut, Room 302C, Indianapolis, IN 46202 (United States)]. E-mail: mkelley@iupui.edu

    2007-01-03

    Neuronal DNA repair remains one of the most exciting areas for investigation, particularly as a means to compare the DNA repair response in mitotic (cancer) vs. post-mitotic (neuronal) cells. In addition, the role of DNA repair in neuronal cell survival and response to aging and environmental insults is of particular interest. DNA damage caused by reactive oxygen species (ROS) such as generated by mitochondrial respiration includes altered bases, abasic sites, and single- and double-strand breaks which can be prevented by the DNA base excision repair (BER) pathway. Oxidative stress accumulates in the DNA of the human brain over time especially in the mitochondrial DNA (mtDNA) and is proposed to play a critical role in aging and in the pathogenesis of several neurological disorders including Parkinson's disease, ALS, and Alzheimer's diseases. Because DNA damage accumulates in the mtDNA more than nuclear DNA, there is increased interest in DNA repair pathways and the consequence of DNA damage in the mitochondria of neurons. The type of damage that is most likely to occur in neuronal cells is oxidative DNA damage which is primarily removed by the BER pathway. Following the notion that the bulk of neuronal DNA damage is acquired by oxidative DNA damage and ROS, the BER pathway is a likely area of focus for neuronal studies of DNA repair. BER variations in brain aging and pathology in various brain regions and tissues are presented. Therefore, the BER pathway is discussed in greater detail in this review than other repair pathways. Other repair pathways including direct reversal, nucleotide excision repair (NER), mismatch repair (MMR), homologous recombination and non-homologous end joining are also discussed. Finally, there is a growing interest in the role that DNA repair pathways play in the clinical arena as they relate to the neurotoxicity and neuropathy associated with cancer treatments. Among the numerous side effects of cancer treatments, major

  18. Radiosensitivity, radio-curability and DNA repair

    International Nuclear Information System (INIS)

    Improvements in accuracy stand as the heart of the success of today's radiotherapy. The dose may be delivered with a sub millimetric accuracy, may also conform to complex shapes, or track external and internal organ motions. In parallel, we may increase the tumour's radio-curability by modulating the biological effects generated by ionizing radiation into the patient. It was precisely the topic of the 2009 Lucien-Mallet prize organized by the French Society for Radiation Oncology (SFRO) and the Centre Antoine-Beclere under the auspices of the Fondation de France. In this review we will precisely describe the integrated molecular response to ionizing radiations. Starting from early observations, we are going to introduce the concept of cellular radiosensitivity as the global response of the irradiated cell. We will then focus into the cell and especially its nucleus. We will describe here the most complex and deleterious radioinduced damages. In the next chapter, we will dissect the molecular pathway that aims to detect and repair the previous lesions. The last part of the review will finally deal with the diagnostic, prognostic and therapeutic impacts emerging from the alliance between clinical and molecular radiobiology. (author)

  19. Effects of hyperthermia on DNA repair pathways: one treatment to inhibit them all.

    Science.gov (United States)

    Oei, Arlene L; Vriend, Lianne E M; Crezee, Johannes; Franken, Nicolaas A P; Krawczyk, Przemek M

    2015-01-01

    The currently available arsenal of anticancer modalities includes many DNA damaging agents that can kill malignant cells. However, efficient DNA repair mechanisms protect both healthy and cancer cells against the effects of treatment and contribute to the development of drug resistance. Therefore, anti-cancer treatments based on inflicting DNA damage can benefit from inhibition of DNA repair. Hyperthermia - treatment at elevated temperature - considerably affects DNA repair, among other cellular processes, and can thus sensitize (cancer) cells to DNA damaging agents. This effect has been known and clinically applied for many decades, but how heat inhibits DNA repair and which pathways are targeted has not been fully elucidated. In this review we attempt to summarize the known effects of hyperthermia on DNA repair pathways relevant in clinical treatment of cancer. Furthermore, we outline the relationships between the effects of heat on DNA repair and sensitization of cells to various DNA damaging agents. PMID:26245485

  20. Pathophysiology of Bronchoconstriction: Role of Oxidatively Damaged DNA Repair

    Science.gov (United States)

    Bacsi, Attila; Pan, Lang; Ba, Xueqing; Boldogh, Istvan

    2016-01-01

    Purpose of review To provide an overview on the present understanding of roles of oxidative DNA damage repair in cell signaling underlying bronchoconstriction common to, but not restricted to various forms of asthma and chronic obstructive pulmonary disease Recent findings Bronchoconstriction is a tightening of smooth muscle surrounding the bronchi and bronchioles with consequent wheezing and shortness of breath. Key stimuli include air pollutants, viral infections, allergens, thermal and osmotic changes, and shear stress of mucosal epithelium, triggering a wide range of cellular, vascular and neural events. Although activation of nerve fibers, the role of G-proteins, protein kinases and Ca++, and molecular interaction within contracting filaments of muscle are well defined, the overarching mechanisms by which a wide range of stimuli initiate these events are not fully understood. Many, if not all, stimuli increase levels of reactive oxygen species (ROS), which are signaling and oxidatively modifying macromolecules, including DNA. The primary ROS target in DNA is guanine, and 8-oxoguanine is one of the most abundant base lesions. It is repaired by 8-oxoguanine DNA glycosylase1 (OGG1) during base excision repair processes. The product, free 8-oxoG base, is bound by OGG1 with high affinity, and the complex then functions as an activator of small GTPases, triggering pathways for inducing gene expression and contraction of intracellular filaments in mast and smooth muscle cells. Summary Oxidative DNA damage repair-mediated cell activation signaling result in gene expression that “primes” the mucosal epithelium and submucosal tissues to generate mediators of airway smooth muscle contractions. PMID:26694039

  1. Protein–DNA charge transport: Redox activation of a DNA repair protein by guanine radical

    OpenAIRE

    Yavin, Eylon; Boal, Amie K.; Stemp, Eric D. A.; Boon, Elizabeth M; Livingston, Alison L.; O'Shea, Valerie L.; David, Sheila S.; Barton, Jacqueline K.

    2005-01-01

    DNA charge transport (CT) chemistry provides a route to carry out oxidative DNA damage from a distance in a reaction that is sensitive to DNA mismatches and lesions. Here, DNA-mediated CT also leads to oxidation of a DNA-bound base excision repair enzyme, MutY. DNA-bound Ru(III), generated through a flash/quench technique, is found to promote oxidation of the [4Fe-4S](2+) cluster of MutY to [4Fe-4S](3+) and its decomposition product [3Fe-4S](1+). Flash/quench experiments monitored by EPR spec...

  2. Molecular cloning of human uracil-DNA glycosylase, a highly conserved DNA repair enzyme.

    OpenAIRE

    Olsen, L C; Aasland, R; Wittwer, C U; Krokan, H E; Helland, D E

    1989-01-01

    Uracil-DNA glycosylase is the DNA repair enzyme responsible for the removal of uracil from DNA, and it is present in all organisms investigated. Here we report on the cloning and sequencing of a cDNA encoding the human uracil-DNA glycosylase. The sequences of uracil-DNA glycosylases from yeast, Escherichia coli, herpes simplex virus type 1 and 2, and homologous genes from varicella-zoster and Epstein-Barr viruses are known. It is shown in this report that the predicted amino acid sequence of ...

  3. True Lies: The Double Life of the Nucleotide Excision Repair Factors in Transcription and DNA Repair

    Directory of Open Access Journals (Sweden)

    Nicolas Le May

    2010-01-01

    Full Text Available Nucleotide excision repair (NER is a major DNA repair pathway in eukaryotic cells. NER removes structurally diverse lesions such as pyrimidine dimers, arising upon UV irradiation or bulky chemical adducts, arising upon exposure to carcinogens and some chemotherapeutic drugs. NER defects lead to three genetic disorders that result in predisposition to cancers, accelerated aging, neurological and developmental defects. During NER, more than 30 polypeptides cooperate to recognize, incise, and excise a damaged oligonucleotide from the genomic DNA. Recent papers reveal an additional and unexpected role for the NER factors. In the absence of a genotoxic attack, the promoters of RNA polymerases I- and II-dependent genes recruit XPA, XPC, XPG, and XPF to initiate gene expression. A model that includes the growth arrest and DNA damage 45α protein (Gadd45α and the NER factors, in order to maintain the promoter of active genes under a hypomethylated state, has been proposed but remains controversial. This paper focuses on the double life of the NER factors in DNA repair and transcription and describes the possible roles of these factors in the RNA synthesis process.

  4. Targeting telomerase and DNA repair in human cancers

    International Nuclear Information System (INIS)

    Telomerase reactivation is essential for telomere maintenance in human cancer cells ensuring indefinite proliferation. Targeting telomere homeostasis has become one of the promising strategies in the therapeutic management of tumours. One major potential drawback, however, is the time lag between telomerase inhibition and critically shortened telomeres triggering cell death, allowing cancer cells to acquire drug resistance. Numerous studies over the last decade have highlighted the role of DNA repair proteins such as Poly (ADP-Ribose) Polymerase-1 (PARP-1), and DNA-dependent protein kinase (DNA-PKcs) in the maintenance of telomere homoeostasis. Dysfunctional telomeres, resulting from the loss of telomeric DNA repeats or the loss of function of telomere-associated proteins trigger DNA damage responses similar to that observed for double strand breaks. We have been working on unravelling such synthetic lethality in cancer cells and this talk would be on one such recently concluded study that demonstrates that inhibition of DNA repair pathways, i.e., NHEJ pathway and that of telomerase could be an alternative strategy to enhance anti-tumour effects and circumvent the possibility of drug resistance. (author)

  5. Diversity of Endonuclease V: From DNA Repair to RNA Editing

    Directory of Open Access Journals (Sweden)

    Isao Kuraoka

    2015-09-01

    Full Text Available Deamination of adenine occurs in DNA, RNA, and their precursors via a hydrolytic reaction and a nitrosative reaction. The generated deaminated products are potentially mutagenic because of their structural similarity to natural bases, which in turn leads to erroneous nucleotide pairing and subsequent disruption of cellular metabolism. Incorporation of deaminated precursors into the nucleic acid strand occurs during nucleotide synthesis by DNA and RNA polymerases or base modification by DNA- and/or RNA-editing enzymes during cellular functions. In such cases, removal of deaminated products from DNA and RNA by a nuclease might be required depending on the cellular function. One such enzyme, endonuclease V, recognizes deoxyinosine and cleaves 3' end of the damaged base in double-stranded DNA through an alternative excision repair mechanism in Escherichia coli, whereas in Homo sapiens, it recognizes and cleaves inosine in single-stranded RNA. However, to explore the role of endonuclease V in vivo, a detailed analysis of cell biology is required. Based on recent reports and developments on endonuclease V, we discuss the potential functions of endonuclease V in DNA repair and RNA metabolism.

  6. Low-dose formaldehyde delays DNA damage recognition and DNA excision repair in human cells.

    Directory of Open Access Journals (Sweden)

    Andreas Luch

    Full Text Available OBJECTIVE: Formaldehyde is still widely employed as a universal crosslinking agent, preservative and disinfectant, despite its proven carcinogenicity in occupationally exposed workers. Therefore, it is of paramount importance to understand the possible impact of low-dose formaldehyde exposures in the general population. Due to the concomitant occurrence of multiple indoor and outdoor toxicants, we tested how formaldehyde, at micromolar concentrations, interferes with general DNA damage recognition and excision processes that remove some of the most frequently inflicted DNA lesions. METHODOLOGY/PRINCIPAL FINDINGS: The overall mobility of the DNA damage sensors UV-DDB (ultraviolet-damaged DNA-binding and XPC (xeroderma pigmentosum group C was analyzed by assessing real-time protein dynamics in the nucleus of cultured human cells exposed to non-cytotoxic (<100 μM formaldehyde concentrations. The DNA lesion-specific recruitment of these damage sensors was tested by monitoring their accumulation at local irradiation spots. DNA repair activity was determined in host-cell reactivation assays and, more directly, by measuring the excision of DNA lesions from chromosomes. Taken together, these assays demonstrated that formaldehyde obstructs the rapid nuclear trafficking of DNA damage sensors and, consequently, slows down their relocation to DNA damage sites thus delaying the excision repair of target lesions. A concentration-dependent effect relationship established a threshold concentration of as low as 25 micromolar for the inhibition of DNA excision repair. CONCLUSIONS/SIGNIFICANCE: A main implication of the retarded repair activity is that low-dose formaldehyde may exert an adjuvant role in carcinogenesis by impeding the excision of multiple mutagenic base lesions. In view of this generally disruptive effect on DNA repair, we propose that formaldehyde exposures in the general population should be further decreased to help reducing cancer risks.

  7. Enhanced base excision repair capacity in carotid atherosclerosis may protect nuclear DNA but not mitochondrial DNA

    DEFF Research Database (Denmark)

    Skarpengland, Tonje; B. Dahl, Tuva; Skjelland, Mona;

    2016-01-01

    Lesional and systemic oxidative stress has been implicated in the pathogenesis of atherosclerosis, potentially leading to accumulation of DNA base lesions within atherosclerotic plaques. Although base excision repair (BER) is a major pathway counteracting oxidative DNA damage, our knowledge on BE...

  8. DNA-repair measurements by use of the modified comet assay

    DEFF Research Database (Denmark)

    Godschalk, Roger W L; Ersson, Clara; Riso, Patrizia;

    2013-01-01

    The measurement of DNA-repair activity by extracts from cells or tissues by means of the single-cell gel electrophoresis (comet) assay has a high potential to become widely used in biomonitoring studies. We assessed the inter-laboratory variation in reported values of DNA-repair activity on...... line as having the highest level of DNA-repair activity. The two laboratories that reported discordant results (with another cell line having the highest level of DNA-repair activity) were those that reported to have little experience with the modified comet assay to assess DNA repair. The laboratories...

  9. DNA damage and Repair Modify DNA methylation and Chromatin Domain of the Targeted Locus: Mechanism of allele methylation polymorphism.

    Science.gov (United States)

    Russo, Giusi; Landi, Rosaria; Pezone, Antonio; Morano, Annalisa; Zuchegna, Candida; Romano, Antonella; Muller, Mark T; Gottesman, Max E; Porcellini, Antonio; Avvedimento, Enrico V

    2016-01-01

    We characterize the changes in chromatin structure, DNA methylation and transcription during and after homologous DNA repair (HR). We find that HR modifies the DNA methylation pattern of the repaired segment. HR also alters local histone H3 methylation as well chromatin structure by inducing DNA-chromatin loops connecting the 5' and 3' ends of the repaired gene. During a two-week period after repair, transcription-associated demethylation promoted by Base Excision Repair enzymes further modifies methylation of the repaired DNA. Subsequently, the repaired genes display stable but diverse methylation profiles. These profiles govern the levels of expression in each clone. Our data argue that DNA methylation and chromatin remodelling induced by HR may be a source of permanent variation of gene expression in somatic cells. PMID:27629060

  10. Role of DNA lesions and DNA repair in mutagenesis by carcinogens in diploid human fibroblasts

    International Nuclear Information System (INIS)

    The authors investigated the cytotoxicity, mutagenicity, and transforming activity of carcinogens and radiation in diploid human fibroblasts, using cells which differ in their DNA repair capacity. The results indicate that cell killing and induction of mutations are correlated with the number of specific lesions remaining unrepaired in the cells at a particular time posttreatment. DNA excision repair acts to eliminate potentially cytotoxic and mutagenic (and transforming) damage from DNA before these can be converted into permanent cellular effects. Normal human fibroblasts were derived from skin biopsies or circumcision material. Skin fibroblasts from xeroderma pigmentosum (XP) patients provided cells deficient in nucleotide excision repair of pyrimidine dimers or DNA adducts formed by bulky ring structures. Cytotoxicity was determined from loss of ability to form a colony. The genetic marker used was resistance to 6-thioguanine (TG). Transformation was measured by determining the frequency of anchorage-independent cells

  11. DNA repair activity in fish and interest in ecotoxicology: a review.

    Science.gov (United States)

    Kienzler, Aude; Bony, Sylvie; Devaux, Alain

    2013-06-15

    The knowledge of DNA repair in a target species is of first importance as it is the primary line of defense against genotoxicants, and a better knowledge of DNA repair capacity in fish could help to interpret genotoxicity data and/or assist in the choice of target species, developmental stage and tissues to focus on, both for environmental biomonitoring studies and DNA repair testing. This review focuses in a first part on what is presently known on a mechanistic basis, about the various DNA repair systems in fish, in vivo and in established cell lines. Data on base excision repair (BER), direct reversal with O⁶-alkylguanine transferase and double strand breaks repair, although rather scarce, are being reviewed, as well as nucleotide excision repair (NER) and photoreactivation repair (PER), which are by far the most studied repair mechanisms in fish. Most of these repair mechanisms seem to be strongly species and tissue dependent; they also depend on the developmental stage of the organisms. BER is efficient in vivo, although no data has been found on in vitro models. NER activity is quite low or even inexistent depending on the studies; however this lack is partly compensated by a strong PER activity, especially in early developmental stage. In a second part, a survey of the ecotoxicological studies integrating DNA repair as a parameter responding to single or mixture of contaminant is realized. Three main approaches are being used: the measurement of DNA repair gene expression after exposure, although it has not yet been clearly established whether gene expression is indicative of repair capacity; the monitoring of DNA damage removal by following DNA repair kinetics; and the modulation of DNA repair activity following exposure in situ, in order to assess the impact of exposure history on DNA repair capacity. Since all DNA repair processes are possible targets for environmental pollutants, we can also wonder at which extent such a modulation of repair capacities

  12. DNA repair, human cancer and assessment of radiation hazards

    International Nuclear Information System (INIS)

    Cancers, like genetic defects, are thought to be caused primarily by changes in DNA. Part of the evidence in support of this hypothesis derives from the study of certain rare hereditary disorders in man associated with high risk of cancer. Cells derived from patients suffering from at least one of these disorders, ataxia telangiectasia, appear to be defective in their ability to repair the damage caused by radiation and/or certain other environmental agents. Studies of the consequences of DNA repair suggest that currently accepted estimates of the carcinogenic hazards of low level radiation are substantially correct. There would appear to be some margin of safety involved in these risk estimates for the majority of the population, but any major reduction in the currently accepted risk estimates appears inadvisable in view of the existence of potentially radiosensitive subgroups forming a minority in the general population. (author)

  13. DNA repair: the culprit for tumor-initiating cell survival?

    OpenAIRE

    Mathews, Lesley A.; Cabarcas, Stephanie M.; Farrar, William L.

    2011-01-01

    The existence of “tumor-initiating cells” (TICs) has been a topic of heated debate for the last few years within the field of cancer biology. Their continuous characterization in a variety of solid tumors has led to an abundance of evidence supporting their existence. TICs are believed to be responsible for resistance against conventional treatment regimes of chemotherapy and radiation, ultimately leading to metastasis and patient demise. This review summarizes DNA repair mechanism(s) and the...

  14. ASSOCIATIONS BETWEEN POLYMORPHISMS IN DNA REPAIR GENES AND GLIOBLASTOMA

    OpenAIRE

    McKean-Cowdin, Roberta; Barnholtz-Sloan, Jill; Inskip, Peter; Ruder, Avima; Butler, MaryAnn; Rajaraman, Preetha; Razavi, Pedram; Patoka, Joe; Wiencke, John; Bondy, Melissa; Wrensch, Margaret

    2009-01-01

    A pooled analysis was conducted to examine the association between select variants in DNA repair genes and glioblastoma multiforme (GBM), the most common and deadliest form of adult brain tumors. Genetic data for approximately 1,000 GBM cases and 2,000 controls were combined from four centers in the United States that have conducted case-control studies of adult GBM including the National Cancer Institute, the National Institute for Occupational Safety and Health, the University of Texas M.D....

  15. Associations between polymorphisms in DNA repair genes and glioblastoma.

    Science.gov (United States)

    McKean-Cowdin, Roberta; Barnholtz-Sloan, Jill; Inskip, Peter D; Ruder, Avima M; Butler, Maryann; Rajaraman, Preetha; Razavi, Pedram; Patoka, Joe; Wiencke, John K; Bondy, Melissa L; Wrensch, Margaret

    2009-04-01

    A pooled analysis was conducted to examine the association between select variants in DNA repair genes and glioblastoma multiforme, the most common and deadliest form of adult brain tumors. Genetic data for approximately 1,000 glioblastoma multiforme cases and 2,000 controls were combined from four centers in the United States that have conducted case-control studies on adult glioblastoma multiforme, including the National Cancer Institute, the National Institute for Occupational Safety and Health, the University of Texas M. D. Anderson Cancer Center, and the University of California at San Francisco. Twelve DNA repair single-nucleotide polymorphisms were selected for investigation in the pilot collaborative project. The C allele of the PARP1 rs1136410 variant was associated with a 20% reduction in risk for glioblastoma multiforme (odds ratio(CT or CC), 0.80; 95% confidence interval, 0.67-0.95). A 44% increase in risk for glioblastoma multiforme was found for individuals homozygous for the G allele of the PRKDC rs7003908 variant (odds ratio(GG), 1.44; 95% confidence interval, 1.13-1.84); there was a statistically significant trend (P = 0.009) with increasing number of G alleles. A significant, protective effect was found when three single-nucleotide polymorphisms (ERCC2 rs13181, ERCC1 rs3212986, and GLTSCR1 rs1035938) located near each other on chromosome 19 were modeled as a haplotype. The most common haplotype (AGC) was associated with a 23% reduction in risk (P = 0.03) compared with all other haplotypes combined. Few studies have reported on the associations between variants in DNA repair genes and brain tumors, and few specifically have examined their impact on glioblastoma multiforme. Our results suggest that common variation in DNA repair genes may be associated with risk for glioblastoma multiforme. PMID:19318434

  16. DNA polymerase III requirement for repair of DNA damage caused by methyl methanesulfonate and hydrogen peroxide

    International Nuclear Information System (INIS)

    The pcbA1 mutation allows DNA replication dependent on DNA polymerase I at the restrictive temperature in polC(Ts) strains. Cells which carry pcbA1, a functional DNA polymerase I, and a temperature-sensitive DNA polymerase III gene were used to study the role of DNA polymerase III in DNA repair. At the restrictive temperature for DNA polymerase III, these strains were more sensitive to the alkylating agent methyl methanesulfonate (MMS) and hydrogen peroxide than normal cells. The same strains showed no increase in sensitivity to bleomycin, UV light, or psoralen at the restrictive temperature. The sensitivity of these strains to MMS and hydrogen peroxide was not due to the pcbAl allele, and normal sensitivity was restored by the introduction of a chromosomal or cloned DNA polymerase III gene, verifying that the sensitivity was due to loss of DNA polymerase III alpha-subunit activity. A functional DNA polymerase III is required for the reformation of high-molecular-weight DNA after treatment of cells with MMS or hydrogen peroxide, as demonstrated by alkaline sucrose sedimentation results. Thus, it appears that a functional DNA polymerase III is required for the optimal repair of DNA damage by MMS or hydrogen peroxide

  17. DNA Repair Decline During Mouse Spermiogenesis Results in the Accumulation of Heritable DNA Damage

    Energy Technology Data Exchange (ETDEWEB)

    Marchetti, Francesco; Marchetti, Francesco; Wyrobek, Andrew J.

    2007-12-01

    The post-meiotic phase of mouse spermatogenesis (spermiogenesis) is very sensitive to the genomic effects of environmental mutagens because as male germ cells form mature sperm they progressively lose the ability to repair DNA damage. We hypothesized that repeated exposures to mutagens during this repair-deficient phase result in the accumulation of heritable genomic damage in mouse sperm that leads to chromosomal aberrations in zygotes after fertilization. We used a combination of single or fractionated exposures to diepoxybutane (DEB), a component of tobacco smoke, to investigate how differential DNA repair efficiencies during the three weeks of spermiogenesis affected the accumulation of DEB-induced heritable damage in early spermatids (21-15 days before fertilization, dbf), late spermatids (14-8 dbf) and sperm (7-1 dbf). Analysis of chromosomal aberrations in zygotic metaphases using PAINT/DAPI showed that late spermatids and sperm are unable to repair DEB-induced DNA damage as demonstrated by significant increases (P<0.001) in the frequencies of zygotes with chromosomal aberrations. Comparisons between single and fractionated exposures suggested that the DNA repair-deficient window during late spermiogenesis may be less than two weeks in the mouse and that during this repair-deficient window there is accumulation of DNA damage in sperm. Finally, the dose-response study in sperm indicated a linear response for both single and repeated exposures. These findings show that the differential DNA repair capacity of post-meioitic male germ cells has a major impact on the risk of paternally transmitted heritable damage and suggest that chronic exposures that may occur in the weeks prior to fertilization because of occupational or lifestyle factors (i.e, smoking) can lead to an accumulation of genetic damage in sperm and result in heritable chromosomal aberrations of paternal origin.

  18. DNA repair decline during mouse spermiogenesis results in the accumulation of heritable DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Marchetti, Francesco; Marchetti, Francesco; Wryobek, Andrew J

    2008-02-21

    The post-meiotic phase of mouse spermatogenesis (spermiogenesis) is very sensitive to the genomic effects of environmental mutagens because as male germ cells form mature sperm they progressively lose the ability to repair DNA damage. We hypothesized that repeated exposures to mutagens during this repair-deficient phase result in the accumulation of heritable genomic damage in mouse sperm that leads to chromosomal aberrations in zygotes after fertilization. We used a combination of single or fractionated exposures to diepoxybutane (DEB), a component of tobacco smoke, to investigate how differential DNA repair efficiencies during the three weeks of spermiogenesis affected the accumulation of DEB-induced heritable damage in early spermatids (21-15 days before fertilization, dbf), late spermatids (14-8 dbf) and sperm (7- 1 dbf). Analysis of chromosomalaberrations in zygotic metaphases using PAINT/DAPI showed that late spermatids and sperm are unable to repair DEB-induced DNA damage as demonstrated by significant increases (P<0.001) in the frequencies of zygotes with chromosomal aberrations. Comparisons between single and fractionated exposures suggested that the DNA repair-deficient window during late spermiogenesis may be less than two weeks in the mouse and that during this repair-deficient window there is accumulation of DNA damage in sperm. Finally, the dose-response study in sperm indicated a linear response for both single and repeated exposures. These findings show that the differential DNA repair capacity of post-meioitic male germ cells has a major impact on the risk of paternally transmitted heritable damage and suggest that chronic exposures that may occur in the weeks prior to fertilization because of occupational or lifestyle factors (i.e, smoking) can lead to an accumulation of genetic damage in sperm and result in heritable chromosomal aberrations of paternal origin.

  19. Genomic landscape of DNA repair genes in cancer

    Science.gov (United States)

    Carneiro, Benedito A.; Chandra, Sunandana; Kaplan, Jason; Kalyan, Aparna; Santa-Maria, Cesar A.; Platanias, Leonidas C.; Giles, Francis J.

    2016-01-01

    DNA repair genes are frequently mutated in cancer, yet limited data exist regarding the overall genomic landscape and functional implications of these alterations in their entirety.  We created comprehensive lists of DNA repair genes and indirect caretakers.  Mutation, copy number variation (CNV), and expression frequencies of these genes were analyzed in COSMIC. Mutation co-occurrence, clinical outcomes, and mutation burden were analyzed in TCGA. We report the 20 genes most frequently with mutations (n > 19,689 tumor samples for each gene), CNVs (n > 1,556), or up- or down-regulated (n = 7,998).  Mutual exclusivity was observed as no genes displayed both high CNV gain and loss or high up- and down-regulation, and CNV gain and loss positively correlated with up- and down-regulation, respectively. Co-occurrence of mutations differed between cancers, and mutations in many DNA repair genes were associated with higher total mutation burden. Mutation and CNV frequencies offer insights into which genes may play tumor suppressive or oncogenic roles, such as NEIL2 and RRM2B, respectively.  Mutual exclusivities within CNV and expression frequencies, and correlations between CNV and expression, support the functionality of these genomic alterations. This study provides comprehensive lists of candidate genes as potential biomarkers for genomic instability, novel therapeutic targets, or predictors of immunotherapy efficacy. PMID:27004405

  20. Metabolism, genomics, and DNA repair in the mouse aging liver

    DEFF Research Database (Denmark)

    Lebel, Michel; de Souza-Pinto, Nadja C; Bohr, Vilhelm A

    2011-01-01

    The liver plays a pivotal role in the metabolism of nutrients, drugs, hormones, and metabolic waste products, thereby maintaining body homeostasis. The liver undergoes substantial changes in structure and function within old age. Such changes are associated with significant impairment of many...... hepatic metabolic and detoxification activities, with implications for systemic aging and age-related disease. It has become clear, using rodent models as biological tools, that genetic instability in the form of gross DNA rearrangements or point mutations accumulate in the liver with age. DNA lesions......, such as oxidized bases or persistent breaks, increase with age and correlate well with the presence of senescent hepatocytes. The level of DNA damage and/or mutation can be affected by changes in carcinogen activation, decreased ability to repair DNA, or a combination of these factors. This paper covers some...

  1. Repair of triplex-directed DNA alkylation by nucleotide excision repair

    OpenAIRE

    Ziemba, Amy; Derosier, L. Chris; Methvin, Russell; Song, Chun-Yan; Clary, Eric; Kahn, Wendy; Milesi, David; Gorn, Vladimir; Reed, Mike; Ebbinghaus, Scot

    2001-01-01

    Triplex-forming oligonucleotides (TFOs) are being investigated as highly specific DNA binding agents to inhibit the expression of clinically relevant genes. So far, they have been shown to inhibit transcription from the HER-2/neu gene in vitro, whereas their use in vivo has been studied to a limited extent. This study uses a TFO–chlorambucil (chl) conjugate capable of forming site-specific covalent guanine adducts within the HER-2/neu promoter. We demonstrate that nucleotide excision repair (...

  2. Cadmium affects viability of bone marrow mesenchymal stem cells through membrane impairment, intracellular calcium elevation and DNA breakage

    Directory of Open Access Journals (Sweden)

    Abnosi Mohammad Hussein

    2010-01-01

    Full Text Available Background: Cadmium is an important heavy metal with occupational and environmental hazard. Cadmium toxicity results mainly in bone-related complication such as itai-itai disease. Mesenchymal stem cells of the bone marrow have the ability to differentiate to osteoblasts which ensure the well-being of the bone tissue. Thus the aim was to investigate the effect of cadmium on viability of rat bone marrow mesenchymal stem cells. Materials and Methods: The rat bone marrow mesenchymal stem cells were grown to confluency in DMEM medium supplemented with 15% fetal bovine serum and penicillin-streptomycin up to third passage. Then the cells were treated with 0, 5, 15, 25, 35, and 45 of CdCl 2 at 12, 24, 36, and 48 h, and their viability was investigated using trypan blue staining. In addition, after treatment with selected dose (15 and 45 μM and time (24 and 48 h the cell morphology, DNA damage and calcium content of the cells were evaluated. Data was analyzed using one and two-way ANOVA (Tukey test and the P2+ was observed. Conclusion: Cadmium chloride is a toxic compound which might affect the well-being of bone tissue through affecting the mesenchymal stem cells.

  3. Evaluation of radio-induced DNA damage and their repair in human lymphocytes by comet assay or single cell gel electrophoresis

    International Nuclear Information System (INIS)

    The comet assay, also called single cell gel electrophoresis technique, permits to evaluate quantitatively DNA breakage induced by chemical and physical agents at the level of the single cell. The present paper refers to the construction of dose-response curves to DNA damage and repair studies in human peripheral lymphocytes, utilizing the comet assay for the radiosensitivity analysis. So, the blood samples were obtained from healthy donors (40-50 year old), irradiated in a 60 Co source (GAMMACEL 220) with doses of 0.17, 0.25, 0.57, 1.10, 2.12 and 4.22 Gy (0.59 Gy/min.) and processed 1 and 24 hours after the exposition. Results obtained showed a increase in the total lenght of comet (DNA migration) as a function of radiation dose in samples processed 1 and 24 hours after the treatment. The DNA lesion in irradiated lymphocytes with 4.22 Gy (means value of 101.4 μm) were 3.4 times higher than in the untreated lymphocytes (mean value of 30 μm) instead of 24 hours after the irradiation were 1.5 times higher (mean value of 46.3 μm). This reduction on DNA repair occurred in these cells. It was also possible visualized the presence of subpopulations of the cells with different sensitivity and repair capacity to ionizing radiation in these donors. (author). 8 refs., 3 figs

  4. Dietary Berries and Ellagic Acid Prevent Oxidative DNA Damage and Modulate Expression of DNA Repair Genes

    Directory of Open Access Journals (Sweden)

    Ramesh C. Gupta

    2008-03-01

    Full Text Available DNA damage is a pre-requisite for the initiation of cancer and agents that reduce this damage are useful in cancer prevention. In this study, we evaluated the ability of whole berries and berry phytochemical, ellagic acid to reduce endogenous oxidative DNA damage. Ellagic acid was selected based on > 95% inhibition of 8-oxodeoxyguosine (8-oxodG and other unidentified oxidative DNA adducts induced by 4-hydroxy-17B;-estradiol and CuCl2 in vitro. Inhibition of the latter occurred at lower concentrations (10 u(microM than that for 8-oxodG (100 u(microM. In the in vivo study, female CD-1 mice (n=6 were fed either a control diet or diet supplemented with ellagic acid (400 ppm and dehydrated berries (5% w/w with varying ellagic acid contents -- blueberry (low, strawberry (medium and red raspberry (high, for 3 weeks. Blueberry and strawberry diets showed moderate reductions in endogenous DNA adducts (25%. However, both red raspberry and ellagic acid diets showed a significant reduction of 59% (p < 0.001 and 48% (p < 0.01, respectively. Both diets also resulted in a 3-8 fold over-expression of genes involved in DNA repair such as xeroderma pigmentosum group A complementing protein (XPA, DNA excision repair protein (ERCC5 and DNA ligase III (DNL3. These results suggest that red raspberry and ellagic acid reduce endogenous oxidative DNA damage by mechanisms which may involve increase in DNA repair.

  5. DNA repair capacity in lymphocytes of professionally occupied persons

    International Nuclear Information System (INIS)

    Full text: Introduction: A chronic exposure to gamma ionizing radiation (γ- YL ) as a result of professional activity can accumulate increased levels of damages in the DNA molecules of the exposed people, including hazardous double-strand and other complex, difficult to repair genotoxic lesions. In case of no repair or faulty repair, the radiation induced damage would lead to mutations and chromosomal aberrations, which can initiate oncogenic transformations of cells. This requires systematic biomonitoring and molecular epidemiology studies on cell reparative capacity and radiation response to the occupational exposure. Materials and Methods: Mononuclear cells were studied from peripheral blood of 40 persons from Kozloduy NPP with occupational exposure (mean age 46.6 , and radiation exposure from 0,1 to 588,1 mSv) and 20 unexposed controls (mean age 43 years). The levels of the double-stranded DNA damage were analyzed with neutral Comet assay (gel electrophoresis of single cells at neutral pH) and are presented as a percentage of DNA comet tail (% DNA in tail). The reparative capacity was determined after further in vitro irradiation of the cells with 3 Gy. Results: The levels of double-strand DNA damage measured for occupational exposure and controls before and after additional in vitro exposure of lymphocytes to 3 Gy γ- YL vary widely, reflecting important differences in individual reparative capacity and radiation response of the studied people. The comparison of the occupational exposure in the control group showed that the two groups have very similar baseline levels of unrepaired DNA damages and reparative capacities. The persons involved in both groups also showed a relatively high capacity for radiation- induced lesions repair. Conclusion: No connection was established between the occupational exposure and the levels of persistent unrepaired two-strand DNA damages and cell reparative capacity.The Individual radiation responses of the persons included in

  6. Studies on bleomycin-induced repair DNA synthesis in permeable mouse ascites sarcoma cells.

    Directory of Open Access Journals (Sweden)

    Mori,Shigeru

    1989-04-01

    Full Text Available To study the mechanism of DNA excision repair, a DNA repair system employing permeable mouse sarcoma (SR-C3H/He cells was established and characterized. SR-C3H/He cells were permeabilized with a 0.0175% Triton X-100 solution. The permeable cells were treated with 1 mM ATP and 0.11 mM bleomycin, and then washed thoroughly to remove ATP and bleomycin. Repair DNA synthesis occurred in the bleomycin-damaged, permeable SR-C3H/He cells when incubated with ATP and four deoxyribonucleoside triphosphates. The repair nature of the DNA synthesis was confirmed by the BrdUMP density shift technique, and by the reduced sensitivity of the newly synthesized DNA to Escherichia coli exonuclease III. The DNA synthesis was optimally enhanced by addition of 0.08 M NaCl. Studies using selective inhibitors of DNA synthesis showed that aphidicolin-sensitive DNA polymerase (DNA polymerase alpha and/or delta and DNA polymerase beta were involved in the repair process. The present DNA repair system is thought to be useful to study nuclear DNA damage by bleomycin, removal of the damaged ends by an exonuclease, repair DNA synthesis by DNA polymerases and repair patch ligation by DNA ligase(s.

  7. Understanding the molecular mechanism of formaldehyde-induced DNA-protein crosslink repair

    Science.gov (United States)

    Formaldehyde induces DNA-protein crosslinks (DPCs) in several experimental in vitro and in vivo test systems, as well as in exposed human workers. DPCs are repaired by several DNA repair pathways in different species, but the molecular understanding of DPC repair in human tissues...

  8. Repairing of N-mustard derivative BO-1055 induced DNA damage requires NER, HR, and MGMT-dependent DNA repair mechanisms.

    Science.gov (United States)

    Kuo, Ching-Ying; Chou, Wen-Cheng; Wu, Chin-Chung; Wong, Teng-Song; Kakadiya, Rajesh; Lee, Te-Chang; Su, Tsann-Long; Wang, Hui-Chun

    2015-09-22

    Alkylating agents are frequently used as first-line chemotherapeutics for various newly diagnosed cancers. Disruption of genome integrity by such agents can lead to cell lethality if DNA lesions are not removed. Several DNA repair mechanisms participate in the recovery of mono- or bi-functional DNA alkylation. Thus, DNA repair capacity is correlated with the therapeutic response. Here, we assessed the function of novel water-soluble N-mustard BO-1055 (ureidomustin) in DNA damage response and repair mechanisms. As expected, BO-1055 induces ATM and ATR-mediated DNA damage response cascades, including downstream Chk1/Chk2 phosphorylation, S/G2 cell-cycle arrest, and cell death. Further investigation revealed that cell survival sensitivity to BO-1055 is comparable to that of mitomycin C. Both compounds require nucleotide excision repair and homologous recombination, but not non-homologous end-joining, to repair conventional cross-linking DNA damage. Interestingly and unlike mitomycin C and melphalan, MGMT activity was also observed in BO-1055 damage repair systems, which reflects the occurrence of O-alkyl DNA lesions. Combined treatment with ATM/ATR kinase inhibitors significantly increases BO-1055 sensitivity. Our study pinpoints that BO-1055 can be used for treating tumors that with deficient NER, HR, and MGMT DNA repair genes, or for synergistic therapy in tumors that DNA damage response have been suppressed. PMID:26208482

  9. Norbixin ingestion did not induce any detectable DNA breakage in liver and kidney but caused a considerable impairment in plasma glucose levels of rats and mice.

    Science.gov (United States)

    Fernandes, Ana C.S.; Almeida, Carla A.; Albano, Franco; Laranja, Gustavo A.T.; Felzenszwalb, Israel; Lage, Celso L.S.; de Sa, Cristiano C.N.F.; Moura, Anibal S.; Kovary, Karla

    2002-07-01

    From the seeds of Bixa orellana are extracted the carotenoids bixin and norbixin that have been widely used for coloring food. In this study, the toxicity of norbixin, purified or not (annatto extract containing 50% norbixin), was investigated in mice and rats after 21 days of ingestion through drinking water. Mice were exposed to doses of 56 and 351 mg/kg (annatto extract) and 0.8, 7.6, 66 and 274 mg/kg (norbixin). Rats were exposed to doses of 0.8, 7.5 and 68 mg/kg (annatto extract) and 0.8, 8.5 and 74 mg/kg (norbixin). In rats, no toxicity was detected by plasma chemistry. In mice, norbixin induced an increase in plasma alanine aminotransferase activity (ALT) while both norbixin and annatto extract induced a decrease in plasma total protein and globulins (P < 0.05). However, no signs of toxicity were detected in liver by histopathological analysis. No enhancement in DNA breakage was detected in liver or kidney from mice treated with annatto pigments, as evaluated by the comet assay. Nevertheless, there was a remarkable effect of norbixin on the glycemia of both rodent species. In rats, norbixin induced hyperglycemia that ranged from 26.9% (8.5 mg/kg norbixin, to 52.6% (74 mg/kg norbixin, P < 0.01) above control levels. In mice, norbixin induced hypoglycemia that ranged from 14.4% (0.8 mg/kg norbixin, P < 0.05) to 21.5% (66 mg/kg norbixin, P < 0.001) below control levels. Rats and mice treated with annatto pigments showed hyperinsulinemia and hypoinsulinemia, respectively indicating that pancreatic beta-cells were functional. More studies should be performed to fully understand of how species-related differences influences the biological fate of norbixin. PMID:12121828

  10. DNA Repair Gene Patterns as Prognostic and Predictive Factors in Molecular Breast Cancer Subtypes

    OpenAIRE

    Santarpia, Libero; Iwamoto, Takayuki; Di Leo, Angelo; Hayashi, Naoki; Bottai, Giulia; Stampfer, Martha; André, Fabrice; Turner, Nicholas C.; Symmans, W Fraser; Hortobágyi, Gabriel N.; Pusztai, Lajos; Bianchini, Giampaolo

    2013-01-01

    DNA repair pathways can enable tumor cells to survive DNA damage induced by chemotherapy and thus provide prognostic and/or predictive value. In this study, the authors sought to assess the differential expression, bimodal distribution, and prognostic and predictive role of DNA repair genes in individual breast cancer molecular subtypes including estrogen receptor-positive/ HER2-negative, estrogen receptor-negative/HER2-negative, and HER2-positive cancers. The predictive value of DNA repair g...

  11. Understanding DNA Repair in Hyperthermophilic Archaea: Persistent Gaps and Other Reasons to Focus on the Fork

    OpenAIRE

    Grogan, Dennis W.

    2015-01-01

    Although hyperthermophilic archaea arguably have a great need for efficient DNA repair, they lack members of several DNA repair protein families broadly conserved among bacteria and eukaryotes. Conversely, the putative DNA repair genes that do occur in these archaea often do not generate the expected phenotype when deleted. The prospect that hyperthermophilic archaea have some unique strategies for coping with DNA damage and replication errors has intellectual and technological appeal, but re...

  12. Ser1778 of 53BP1 Plays a Role in DNA Double-strand Break Repairs

    OpenAIRE

    Lee, Jung-Hee; Cheong, Hyang-Min; Kang, Mi-Young; Kim, Sang-Young; Kang, Yoonsung

    2009-01-01

    53BP1 is an important genome stability regulator, which protects cells against double-strand breaks. Following DNA damage, 53BP1 is rapidly recruited to sites of DNA breakage, along with other DNA damage response proteins, including γ-H2AX, MDC1, and BRCA1. The recruitment of 53BP1 requires a tandem Tudor fold which associates with methylated histones H3 and H4. It has already been determined that the majority of DNA damage response proteins are phosphorylated by ATM and/or ATR after DNA dama...

  13. Inhibition of DNA replication, DNA repair synthesis, and DNA polymerases α and δ by butylphenyl deoxyguanosine triphosphate

    International Nuclear Information System (INIS)

    Semiconservative DNA replication in growing mammalian cells and ultraviolet (UV)-induced DNA repair synthesis in nongrowing mammalian cells are mediated by one or both of the aphidicolin-sensitive DNA polymerases, α and/or δ. They have studied the inhibition of replication and repair synthesis in permeable human cells by N2 (p-n-butylphenyl)-2'-deoxyguanosine-5'-triphosphate (BuPh dGTP), an agent which inhibits polymerase α strongly and polymerase δ weakly. Both processes are inhibited by BuPh-dGTP in competition with dGTP. The K/sub i/'s are, for replication, 2-3 μM and, for repair synthesis, 3-4 μM, consistent with the involvement of the same DNA polymerase in both processes. Inhibition of isolated human polymerase α by BuPh-dGTP is also competitive with dGTP, but the K/sub i/ is approximately 10 nM, several hundred-fold lower than the K/sub i/'s of replication and repair synthesis. Isolated polymerase δ is inhibited by BuPh-dGTP at doses similar to those which inhibit replication and repair synthesis, however, attempts to determine the K/sub i/ of polymerase δ were hampered by the finding that the dependence of δ activity on deoxyribunucleotide concentration is parabolic at low doses. This behavior differs from the behavior of polymerase α and of cellular DNA replication and repair synthesis, all of which show a simple, hyperbolic relationship between activity and deoxyribonucleotide concentration. Thus, inhibition of DNA replication and UV induced DNA repair synthesis by BuPh dGTP is quantitatively similar to DNA polymerase δ, but some other characteristics of the cellular processes are more similar to those of polymerase α

  14. Dynamic DNA binding licenses a repair factor to bypass roadblocks in search of DNA lesions.

    Science.gov (United States)

    Brown, Maxwell W; Kim, Yoori; Williams, Gregory M; Huck, John D; Surtees, Jennifer A; Finkelstein, Ilya J

    2016-01-01

    DNA-binding proteins search for specific targets via facilitated diffusion along a crowded genome. However, little is known about how crowded DNA modulates facilitated diffusion and target recognition. Here we use DNA curtains and single-molecule fluorescence imaging to investigate how Msh2-Msh3, a eukaryotic mismatch repair complex, navigates on crowded DNA. Msh2-Msh3 hops over nucleosomes and other protein roadblocks, but maintains sufficient contact with DNA to recognize a single lesion. In contrast, Msh2-Msh6 slides without hopping and is largely blocked by protein roadblocks. Remarkably, the Msh3-specific mispair-binding domain (MBD) licences a chimeric Msh2-Msh6(3MBD) to bypass nucleosomes. Our studies contrast how Msh2-Msh3 and Msh2-Msh6 navigate on a crowded genome and suggest how Msh2-Msh3 locates DNA lesions outside of replication-coupled repair. These results also provide insights into how DNA repair factors search for DNA lesions in the context of chromatin. PMID:26837705

  15. Melatonin enhances DNA repair capacity possibly by affecting genes involved in DNA damage responsive pathways

    Directory of Open Access Journals (Sweden)

    Liu Ran

    2013-01-01

    Full Text Available Abstract Background Melatonin, a hormone-like substance involved in the regulation of the circadian rhythm, has been demonstrated to protect cells against oxidative DNA damage and to inhibit tumorigenesis. Results In the current study, we investigated the effect of melatonin on DNA strand breaks using the alkaline DNA comet assay in breast cancer (MCF-7 and colon cancer (HCT-15 cell lines. Our results demonstrated that cells pretreated with melatonin had significantly shorter Olive tail moments compared to non-melatonin treated cells upon mutagen (methyl methanesulfonate, MMS exposure, indicating an increased DNA repair capacity after melatonin treatment. We further examined the genome-wide gene expression in melatonin pretreated MCF-7 cells upon carcinogen exposure and detected altered expression of many genes involved in multiple DNA damage responsive pathways. Genes exhibiting altered expression were further analyzed for functional interrelatedness using network- and pathway-based bioinformatics analysis. The top functional network was defined as having relevance for “DNA Replication, Recombination, and Repair, Gene Expression, [and] Cancer”. Conclusions These findings suggest that melatonin may enhance DNA repair capacity by affecting several key genes involved in DNA damage responsive pathways.

  16. DNA damage by reactive species: Mechanisms, mutation and repair

    Indian Academy of Sciences (India)

    N R Jena

    2012-07-01

    DNA is continuously attacked by reactive species that can affect its structure and function severely. Structural modifications to DNA mainly arise from modifications in its bases that primarily occur due to their exposure to different reactive species. Apart from this, DNA strand break, inter- and intra-strand crosslinks and DNA–protein crosslinks can also affect the structure of DNA significantly. These structural modifications are involved in mutation, cancer and many other diseases. As it has the least oxidation potential among all the DNA bases, guanine is frequently attacked by reactive species, producing a plethora of lethal lesions. Fortunately, living cells are evolved with intelligent enzymes that continuously protect DNA from such damages. This review provides an overview of different guanine lesions formed due to reactions of guanine with different reactive species. Involvement of these lesions in inter- and intra-strand crosslinks, DNA–protein crosslinks and mutagenesis are discussed. How certain enzymes recognize and repair different guanine lesions in DNA are also presented.

  17. Cloning and characterization of human DNA repair genes

    International Nuclear Information System (INIS)

    The isolation of two addition human genes that give efficient restoration of the repair defects in other CHO mutant lines is reported. The gene designated ERCC2 (Excision Repair Complementing Chinese hamster) corrects mutant UV5 from complementation group 1. They recently cloned this gene by first constructing a secondary transformant in which the human gene was shown to have become physically linked to the bacterial gpt dominant-marker gene by cotransfer in calcium phosphate precipitates in the primary transfection. Transformants expressing both genes were recovered by selecting for resistance to both UV radiation and mycophenolic acid. Using similar methods, the human gene that corrects CHO mutant EM9 was isolated in cosmids and named XRCC1 (X-ray Repair Complementing Chinese hamster). In this case, transformants were recovered by selecting for resistance to CldUrd, which kills EM9 very efficiently. In both genomic and cosmid transformants, the XRCC1 gene restored resistance to the normal range. DNA repair was studied using the kinetics of strand-break rejoining, which was measured after exposure to 137Cs γ-rays

  18. Green tea and skin cancer: photoimmunology, angiogenesis and DNA repair.

    Science.gov (United States)

    Katiyar, Suchitra; Elmets, Craig A; Katiyar, Santosh K

    2007-05-01

    Human skin is constantly exposed to numerous noxious physical, chemical and environmental agents. Some of these agents directly or indirectly adversely affect the skin. Cutaneous overexposure to environmental solar ultraviolet (UV) radiation (290-400 nm) has a variety of adverse effects on human health, including the development of melanoma and nonmelanoma skin cancers. Therefore, there is a need to develop measures or strategies, and nutritional components are increasingly being explored for this purpose. The polyphenols present in green tea (Camellia sinensis) have been shown to have numerous health benefits, including protection from UV carcinogenesis. (-)-Epigallocatechin-3-gallate (EGCG) is the major and most photoprotective polyphenolic component of green tea. In this review article, we have discussed the most recent investigations and mechanistic studies that define and support the photoprotective efficacy of green tea polyphenols (GTPs) against UV carcinogenesis. The oral administration of GTPs in drinking water or the topical application of EGCG prevents UVB-induced skin tumor development in mice, and this prevention is mediated through: (a) the induction of immunoregulatory cytokine interleukin (IL) 12; (b) IL-12-dependent DNA repair following nucleotide excision repair mechanism; (c) the inhibition of UV-induced immunosuppression through IL-12-dependent DNA repair; (d) the inhibition of angiogenic factors; and (e) the stimulation of cytotoxic T cells in a tumor microenvironment. New mechanistic information strongly supports and explains the chemopreventive activity of GTPs against photocarcinogenesis.

  19. Genetics Home Reference: Warsaw breakage syndrome

    Science.gov (United States)

    ... helping repair mistakes in DNA and ensuring proper DNA replication, the ChlR1 enzyme is involved in maintaining the ... cannot unwind the DNA strands to help with DNA replication and repair. A lack of functional ChlR1 impairs ...

  20. Involvement of DNA polymerase δ in DNA repair synthesis in human fibroblasts at late times after ultraviolet irradiation

    International Nuclear Information System (INIS)

    DNA repair synthesis following UV irradiation of confluent human fibroblasts has a biphasic time course with an early phase of rapid nucleotide incorporation and a late phase of much slower nucleotide incorporation. The biphasic nature of this curve suggests that two distinct DNA repair systems may be operative. Previous studies have specifically implicated DNA polymerase δ as the enzyme involved in DNA repair synthesis occurring immediately after UV damage. In this paper, the authors describe studies of DNA polymerase involvement in DNA repair synthesis in confluent human fibroblasts at late times after UV irradiation. Late UV-induced DNA repair synthesis in both intact and permeable cells was found to be inhibited by aphidicolin, indicating the involvement of one of the aphidicolin-sensitive DNA polymerases, α or δ. In permeable cells, the process was further analyzed by using the nucleotide analogue (butylphenyl)-2'-deoxyguanosine 5'-triphosphate, which inhibits DNA polymerase α several hundred times more strongly than it inhibits DNA polymerase δ. The (butylphenyl)-2'-deoxyguanosine 5'-triphosphate inhibition curve for late UV-induced repair synthesis was very similar to that for polymerase δ. It appears that repair synthesis at late time after UV irradiation, like repair synthesis at early times, is mediated by DNA polymerase δ

  1. Induction of DNA breakage in X-irradiated nucleoids selectively stripped of nuclear proteins in two mouse lymphoma cell lines differing in radiosensitivity

    International Nuclear Information System (INIS)

    The role of nuclear proteins in protection of DNA against ionizing radiation and their contribution to the radiation sensitivity was examined by an alkaline version of comet assay in two L5178Y (LY) mouse lymphoma cell lines differing in sensitivity t o ionizing radiation. LY-S cells are twice more sensitive to ionizing radiation than LY-R cells (D0 values of survival curves are 0.5 Gy and 1 Gy, respectively). Sequential removal of nuclear proteins by extraction with NaCl of different concentrations increased the X-ray induced DNA damage in LY-R nucleoids. In contrast, in the radiation sensitive LY-S cell line, depletion of nuclear proteins practically did not affect DNA damage. Although there is no doubt that the main cause of LY-S cells' sensitivity to ionizing radiation is a defect in the repair of double-strand breaks, our data support the concept that nuclear matrix organization may contribute to the cellular susceptibility to DNA damaging agents. (author)

  2. Physical interaction between components of DNA mismatch repair and nucleotide excision repair

    International Nuclear Information System (INIS)

    Nucleotide excision repair (NER) and DNA mismatch repair are required for some common processes although the biochemical basis for this requirement is unknown. Saccharomyces cerevisiae RAD14 was identified in a two-hybrid screen using MSH2 as 'bait,' and pairwise interactions between MSH2 and RAD1, RAD2, RAD3, RAD10, RAD14, and RAD25 subsequently were demonstrated by two-hybrid analysis. MSH2 coimmunoprecipitated specifically with epitope-tagged versions of RAD2, RAD10, RAD14, and RAD25. MSH2 and RAD10 were found to interact in msh3 msh6 and mlh1 pms1 double mutants, suggesting a direct interaction with MSH2. Mutations in MSH2 increased the UV sensitivity of NER-deficient yeast strains, and msh2 mutations were epistatic to the mutator phenotype observed in NER-deficient strains. These data suggest that MSH2 and possibly other components of DNA mismatch repair exist in a complex with NER proteins, providing a biochemical and genetical basis for these proteins to function in common processes

  3. Disruption of Maternal DNA Repair Increases Sperm-DerivedChromosomal Aberrations

    Energy Technology Data Exchange (ETDEWEB)

    Marchetti, Francesco; Essers, Jeroun; Kanaar, Roland; Wyrobek,Andrew J.

    2007-02-07

    The final weeks of male germ cell differentiation occur in aDNA repair-deficient environment and normal development depends on theability of the egg to repair DNA damage in the fertilizing sperm. Geneticdisruption of maternal DNA double-strand break repair pathways in micesignificantly increased the frequency of zygotes with chromosomalstructural aberrations after paternal exposure to ionizing radiation.These findings demonstrate that radiation-induced DNA sperm lesions arerepaired after fertilization by maternal factors and suggest that geneticvariation in maternal DNA repair can modulate the risk of early pregnancylosses and of children with chromosomal aberrations of paternalorigin.

  4. Correction of the DNA repair defect in xeroderma pigmentosum group E by injection of a DNA damage-binding protein.

    OpenAIRE

    Keeney, S.; Eker, André; Brody, T.; Vermeulen, Wim; Bootsma, Dirk; Hoeijmakers, Jan; Linn, S.(Florida International University, Miami, USA)

    1994-01-01

    textabstractCells from a subset of patients with the DNA-repair-defective disease xeroderma pigmentosum complementation group E (XP-E) are known to lack a DNA damage-binding (DDB) activity. Purified human DDB protein was injected into XP-E cells to test whether the DNA-repair defect in these cells is caused by a defect in DDB activity. Injected DDB protein stimulated DNA repair to normal levels in those strains that lack the DDB activity but did not stimulate repair in cells from other xerode...

  5. Possible new variant of Nijmegen breakage syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Der Kaloustian, V.M.; Booth, A.; Elliott, A.M. [Montreal Children`s Hospital and McGill Univ., Montreal (Canada)] [and others

    1996-10-02

    We report on a child with microcephaly, small facial and body size, and immune deficiency. The phenotype is consistent with Nijmegen breakage syndrome (NBS), with additional clinical manifestations and laboratory findings not reported heretofore. Most investigations, including the results of radiation-resistant DNA synthesis, concurred with the diagnosis of NBS. Cytogenetic analysis documented abnormalities in virtually all cells examined. Along with the high frequency of breaks and rearrangements of chromosomes 7 and 14, we found breakage and monosomies involving numerous other chromosomes. Because of some variation in the clinical presentation and some unusual cytogenetic findings, we suggest that our patient may represent a new variant of Nijmegen breakage syndrome. 34 refs., 3 figs., 7 tabs.

  6. DNA repair genotype and lung cancer risk in the beta-carotene and retinol efficacy trial

    OpenAIRE

    Doherty, Jennifer A; Sakoda, Lori C.; Loomis, Melissa M; Barnett, Matt J.; Julianto, Liberto; Thornquist, Mark D; Neuhouser, Marian L; Weiss, Noel S.; Goodman, Gary E.; Chen, Chu

    2013-01-01

    Many carcinogens in tobacco smoke cause DNA damage, and some of that damage can be mitigated by the actions of DNA repair enzymes. In a case-control study nested within the Beta-Carotene and Retinol Efficacy Trial, a randomized chemoprevention trial in current and former heavy smokers, we examined whether lung cancer risk was associated with variation in 26 base excision repair, mismatch repair, and homologous recombination repair genes. Analyses were limited to Caucasians (744 cases, 1477 co...

  7. Biomarkers of oxidative damage to DNA and repair

    DEFF Research Database (Denmark)

    Loft, Steffen; Høgh Danielsen, Pernille; Mikkelsen, Lone;

    2008-01-01

    Oxidative-stress-induced damage to DNA includes a multitude of lesions, many of which are mutagenic and have multiple roles in cancer and aging. Many lesions have been characterized by MS-based methods after extraction and digestion of DNA. These preparation steps may cause spurious base oxidation......, which is less likely to occur with methods such as the comet assay, which are based on nicking of the DNA strand at modified bases, but offer less specificity. The European Standards Committee on Oxidative DNA Damage has concluded that the true levels of the most widely studied lesion, 8-oxodG (8-oxo-7......,8-dihydro-2'-deoxyguanosine), in cellular DNA is between 0.5 and 5 lesions per 10(6) dG bases. Base excision repair of oxidative damage to DNA can be assessed by nicking assays based on oligonucleotides with lesions or the comet assay, by mRNA expression levels or, in the case of, e.g., OGG1 (8-oxoguanine...

  8. Needle breakage: incidence and prevention.

    Science.gov (United States)

    Malamed, Stanley F; Reed, Kenneth; Poorsattar, Susan

    2010-10-01

    Since the introduction of nonreusable, stainless steel dental local anesthetic needles, needle breakage has become an extremely rare complication of dental local anesthetic injections. But although rare, dental needle breakage can, and does, occur. Review of the literature and personal experience brings into focus several commonalities which, when avoided, can minimize the risk of needle breakage with the fragment being retained from occurring.

  9. Destabilized SMC5/6 complex leads to chromosome breakage syndrome with severe lung disease.

    Science.gov (United States)

    van der Crabben, Saskia N; Hennus, Marije P; McGregor, Grant A; Ritter, Deborah I; Nagamani, Sandesh C S; Wells, Owen S; Harakalova, Magdalena; Chinn, Ivan K; Alt, Aaron; Vondrova, Lucie; Hochstenbach, Ron; van Montfrans, Joris M; Terheggen-Lagro, Suzanne W; van Lieshout, Stef; van Roosmalen, Markus J; Renkens, Ivo; Duran, Karen; Nijman, Isaac J; Kloosterman, Wigard P; Hennekam, Eric; Orange, Jordan S; van Hasselt, Peter M; Wheeler, David A; Palecek, Jan J; Lehmann, Alan R; Oliver, Antony W; Pearl, Laurence H; Plon, Sharon E; Murray, Johanne M; van Haaften, Gijs

    2016-08-01

    The structural maintenance of chromosomes (SMC) family of proteins supports mitotic proliferation, meiosis, and DNA repair to control genomic stability. Impairments in chromosome maintenance are linked to rare chromosome breakage disorders. Here, we have identified a chromosome breakage syndrome associated with severe lung disease in early childhood. Four children from two unrelated kindreds died of severe pulmonary disease during infancy following viral pneumonia with evidence of combined T and B cell immunodeficiency. Whole exome sequencing revealed biallelic missense mutations in the NSMCE3 (also known as NDNL2) gene, which encodes a subunit of the SMC5/6 complex that is essential for DNA damage response and chromosome segregation. The NSMCE3 mutations disrupted interactions within the SMC5/6 complex, leading to destabilization of the complex. Patient cells showed chromosome rearrangements, micronuclei, sensitivity to replication stress and DNA damage, and defective homologous recombination. This work associates missense mutations in NSMCE3 with an autosomal recessive chromosome breakage syndrome that leads to defective T and B cell function and acute respiratory distress syndrome in early childhood. PMID:27427983

  10. DNA repair in a Fanconi's anemia fibroblast cell strain

    International Nuclear Information System (INIS)

    DNA repair and colony survival were measured in fibroblasts from a patient with Fanconi's anemia, HG 261, and from normal human donors after exposure to these cells to the cross-linking agent mitomycin C, X-rays or ultraviolet light. Survival was similar in HG 261 and normal cells after X-ray or ultraviolet radiation, but was reduced in the Fanconi's anemia cells after treatment with mitomycin C. The level of DNA cross-linking, as measured by the method of alkaline elution, was the same in both cell strains after exposure to various doses of mitomycin C. With incubation after drug treatment, a gradual decrease in the amount of cross-linking was observed, the rate of this apparent repair of cross-link damage was the same in both normal and HG 261 cells. The rejoining of DNA single strand breaks after X-irradiation and the production of excision breaks after ultraviolet radiation were also normal in HG 261 cells as determined by alkaline elution. (Auth.)

  11. Influence of the OGG1 Ser326Cys polymorphism on oxidatively damaged DNA and repair activity

    DEFF Research Database (Denmark)

    Jensen, Annie; Løhr, Mille; Eriksen, Louise;

    2012-01-01

    Oxidatively damaged DNA base lesions are considered to be mainly repaired by 8-oxoguanine DNA glycosylase (OGG1) mediated pathways. We investigated the effect of the OGG1 Ser326Cys polymorphism on the level and repair of oxidatively damaged DNA in mononuclear blood cells (MNBC) by means of the co...

  12. Effect of DNA polymerase inhibitors on DNA repair in intact and permeable human fibroblasts: Evidence that DNA polymerases. delta. and. beta. are involved in DNA repair synthesis induced by N-methyl-N prime -nitro-N-nitrosoguanidine

    Energy Technology Data Exchange (ETDEWEB)

    Hammond, R.A.; Miller, M.R. (West Virginia Univ. Health Sciences Center, Morgantown (USA)); McClung, J.K. (Samuel Roberts Noble Foundation, Inc., East Ardmore, OK (USA))

    1990-01-09

    The involvement of DNA polymerases {alpha}, {beta}, and {delta} in DNA repair synthesis induced by N-methyl-N{prime}-nitro-N-nitrosoguanidine (MNNG) was investigated in human fibroblasts (HF). The effects of anti-(DNA polymerase {alpha}) monoclonal antibody, (p-n-butylphenyl)deoxyguanosine triphosphate (BuPdGTP), dideoxythymidine triphosphate (ddTTP), and aphidicolin on MNNG-induced DNA repair synthesis were investigated to dissect the roles of the different DNA polymerases. A subcellular system (permeable cells), in which DNA repair synthesis and DNA replication were differentiated by CsCl gradient centrifugation of BrdUMP density-labeled DNA, was used to examine the effects of the polymerase inhibitors. Another approach investigated the effects of several of these inhibitors of MNNG-induced DNA repair synthesis in intact cells by measuring the amount of ({sup 3}H)thymidine incorporated into repair DNA as determined by autoradiography and quantitation with an automated video image analysis system. In permeable cells, MNNG-induced DNA repair synthesis was inhibited 56% by 50 {mu}g of aphidicolin/mL, 6% by 10 {mu}M BuPdGTP, 13% by anti-(DNA polymerse {alpha}) monoclonal antibodies, and 29% by ddTTP. In intact cells, MNNG-induced DNA repair synthesis was inhibited 57% by 50 {mu}g of aphidicolin/mL and was not significantly inhibited by microinjecting anti-(DNA polymerase {alpha}) antibodies into HF nuclei. These results indicate that both DNA polymerase {delta} and {beta} are involved in repairing DNA damage caused by MNNG.

  13. DNA-mediated transfer of a human DNA repair gene that controls sister chromatid exchange.

    OpenAIRE

    Thompson, L H; Brookman, K W; Minkler, J L; Fuscoe, J C; Henning, K A; Carrano, A V

    1985-01-01

    The Chinese hamster cell line mutant EM9, which has a reduced ability to repair DNA strand breaks, is noted for its highly elevated frequency of sister chromatid exchange, a property shared with cells from individuals with Bloom's syndrome. The defect in EM9 cells was corrected by fusion hybridization with normal human fibroblasts and by transfection with DNA from hybrid cells. The transformants showed normalization of sister chromatid exchange frequency but incomplete correction of the repai...

  14. Antibiotic persistence: the role of spontaneous DNA repair response.

    Science.gov (United States)

    Debbia, E A; Roveta, S; Schito, A M; Gualco, L; Marchese, A

    2001-01-01

    Persisters are a small proportion of a bacterial population that exists in a physiological state permitting survival despite the lethal activity of antibiotics. To explain this phenomenon, it has been suggested that persisters are bacteria repairing spontaneous errors of DNA synthesis. To verify this assumption, Escherichia coli AB1157 and its lexA3 derivative were exposed to a dose 6x MIC of various antibiotics representative of different molecular mechanisms of action (ampicillin, ceftriaxone, meropenem, amikacin, ciprofloxacin). Bacterial cell counts, after 24 hr of exposure to the antimicrobials, revealed a reduction of about 90% of viable organisms in the lexA3 strains in comparison to the lexA+. In several cases, the number of colony-forming units decreased below the limit of assay. This behavior was noted with all antibiotics used, alone or in combination (amikacin plus ceftriaxone and amikacin plus ciprofloxacin). The same experiments were repeated using E. coli AB1157 cultured in the presence of mitomycin C (0.25x MIC), and the number of survivors exceeded by about 90% the values found in the nonexposed control. In contrast, in the sulA background, mitomycin C reacted synergically with all the antibiotics tested causing a strong reduction of the survivors in comparison with the control. The addition of chloramphenicol (0.125x MIC), on the contrary, caused a reduction of the number of survivors of about 90%. These findings indicate that, when DNA repair is active (a mechanism known to block cell division), the number of survivors is greater than that observed with lexA3. Thus, in addition to other possible explanations, persisters might be a fraction of bacteria that during antibiotic treatment are not growing because they are repairing spontaneous errors of DNA synthesis.

  15. Preferential repair of nuclear matrix associated DNA in xeroderma pigmentosum complementation group C

    International Nuclear Information System (INIS)

    The distribution of ultraviolet-induced DNA repair patches in the genome of xeroderma pigmentosum cells of complementation group C was investigated by determining the molecular weight distribution of repair labeled DNA and prelabeled DNA in alkaline sucrose gradients after treatment with the dimer-specific endonuclease V of bacteriophage T4. The results suggest that DNA-repair synthesis in xeroderma pigmentosum cells of complementation group C occurs in localized regions of the genome. Analysis of the spatial distribution of ultraviolet-induced repair patches in DNA loops attached to the nuclear matrix revealed that in xeroderma pigmentosum cells of complementation group C repair patches are preferentially situated near the attachment sites of DNA loops at the nuclear matrix. In normal human fibroblasts the authors observed no enrichment of repair-labeled DNA at the nuclear matrix and repair patches appeared to be distributed randomly along the DNA loops. The enrichment of repair-labeled DNA at the nuclear matrix in xeroderma pigmentosum cells of complementation group C may indicate that the residual DNA-repair synthesis in these cells occurs preferentially in regions of the genome. (Auth.)

  16. Integrating Multi-omics Data to Dissect Mechanisms of DNA repair Dysregulation in Breast Cancer

    Science.gov (United States)

    Liu, Chao; Rohart, Florian; Simpson, Peter T.; Khanna, Kum Kum; Ragan, Mark A.; Lê Cao, Kim-Anh

    2016-01-01

    DNA repair genes and pathways that are transcriptionally dysregulated in cancer provide the first line of evidence for the altered DNA repair status in tumours, and hence have been explored intensively as a source for biomarker discovery. The molecular mechanisms underlying DNA repair dysregulation, however, have not been systematically investigated in any cancer type. In this study, we performed a statistical analysis to dissect the roles of DNA copy number alteration (CNA), DNA methylation (DM) at gene promoter regions and the expression changes of transcription factors (TFs) in the differential expression of individual DNA repair genes in normal versus tumour breast samples. These gene-level results were summarised at pathway level to assess whether different DNA repair pathways are affected in distinct manners. Our results suggest that CNA and expression changes of TFs are major causes of DNA repair dysregulation in breast cancer, and that a subset of the identified TFs may exert global impacts on the dysregulation of multiple repair pathways. Our work hence provides novel insights into DNA repair dysregulation in breast cancer. These insights improve our understanding of the molecular basis of the DNA repair biomarkers identified thus far, and have potential to inform future biomarker discovery. PMID:27666291

  17. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in primary melanocytes.

    Science.gov (United States)

    Thompson, Benjamin C; Surjana, Devita; Halliday, Gary M; Damian, Diona L

    2014-07-01

    Cutaneous melanoma is a significant cause of morbidity and mortality. Nicotinamide is a safe, widely available vitamin that reduces the immune suppressive effects of UV, enhances DNA repair in keratinocytes and has shown promise in the chemoprevention of non-melanoma skin cancer. Here, we report the effect of nicotinamide on DNA damage and repair in primary human melanocytes. Nicotinamide significantly enhanced the repair of oxidative DNA damage (8-oxo-7,8-dihydro-2'-deoxyguanosine) and cyclobutane pyrimidine dimers induced by UV exposure. It also enhanced the repair of 8-oxo-7,8-dihydro-2'-deoxyguanosine induced by the culture conditions in unirradiated melanocytes. A significant increase in the percentage of melanocytes undergoing unscheduled but not scheduled DNA synthesis was observed, confirming that nicotinamide enhances DNA repair in human melanocytes. In summary, nicotinamide, by enhancing DNA repair in melanocytes, is a potential agent for the chemoprevention of cutaneous melanoma.

  18. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in primary melanocytes.

    Science.gov (United States)

    Thompson, Benjamin C; Surjana, Devita; Halliday, Gary M; Damian, Diona L

    2014-07-01

    Cutaneous melanoma is a significant cause of morbidity and mortality. Nicotinamide is a safe, widely available vitamin that reduces the immune suppressive effects of UV, enhances DNA repair in keratinocytes and has shown promise in the chemoprevention of non-melanoma skin cancer. Here, we report the effect of nicotinamide on DNA damage and repair in primary human melanocytes. Nicotinamide significantly enhanced the repair of oxidative DNA damage (8-oxo-7,8-dihydro-2'-deoxyguanosine) and cyclobutane pyrimidine dimers induced by UV exposure. It also enhanced the repair of 8-oxo-7,8-dihydro-2'-deoxyguanosine induced by the culture conditions in unirradiated melanocytes. A significant increase in the percentage of melanocytes undergoing unscheduled but not scheduled DNA synthesis was observed, confirming that nicotinamide enhances DNA repair in human melanocytes. In summary, nicotinamide, by enhancing DNA repair in melanocytes, is a potential agent for the chemoprevention of cutaneous melanoma. PMID:24798949

  19. FGF2 mediates DNA repair in epidermoid carcinoma cells exposed to ionizing radiation

    International Nuclear Information System (INIS)

    Fibroblast growth factor 2 (FGF2) is a well-known survival factor. However, its role in DNA repair is poorly documented. The present study was designed to investigate in epidermoid carcinoma cells the potential role of FGF2 in DNA repair. The side population (SP) with cancer stem cell-like properties and the main population (MP) were isolated from human A431 squamous carcinoma cells. Radiation-induced DNA damage and repair were assessed using the alkaline comet assay. FGF2 expression was quantified by enzyme linked immunosorbent assay (ELISA). SP cells exhibited rapid repair of radiation induced DNA damage and a high constitutive level of nuclear FGF2. Blocking FGF2 signaling abrogated the rapid DNA repair. In contrast, in MP cells, a slower repair of damage was associated with low basal expression of FGF2. Moreover, the addition of exogenous FGF2 accelerated DNA repair in MP cells. When irradiated, SP cells secreted FGF2, whereas MP cells did not. FGF2 was found to mediate DNA repair in epidermoid carcinoma cells. We postulate that carcinoma stem cells would be intrinsically primed to rapidly repair DNA damage by a high constitutive level of nuclear FGF2. In contrast, the main population with a low FGF2 content exhibits a lower repair rate which can be increased by exogenous FGF2. (authors)

  20. Genetic and environmental influence on DNA strand break repair: a twin study

    DEFF Research Database (Denmark)

    Garm, Christian; Moreno-Villanueva, Maria; Bürkle, Alexander;

    2013-01-01

    Accumulation of DNA damage deriving from exogenous and endogenous sources has significant consequences for cellular survival, and is implicated in aging, cancer, and neurological diseases. Different DNA repair pathways have evolved in order to maintain genomic stability. Genetic and environmental...... factors are likely to influence DNA repair capacity. In order to gain more insight into the genetic and environmental contribution to the molecular basis of DNA repair, we have performed a human twin study, where we focused on the consequences of some of the most abundant types of DNA damage (single...... dizygotic). We did not detect genetic effects on the DNA-strand break variables in our study....

  1. Radioimmunoassay studies on repair of ultraviolet damaged DNA in cultured animal cells

    International Nuclear Information System (INIS)

    UV (ultraviolet) damaged DNA and its repair of various cultured animal cells were observed by radioimmunoassay using anti-serum against the UV irradiation induced heat-degenerated DNA. There is some difference among the cells of used animals according to their DNA repairabilities. The cells were divided into four groups according to the existence or strength of their repairabilities. 1) excision repair type: cells of men and chimpanzees. 2) photoreactivation type: cells derived from Tachydromus tachydromoides and chicks. 3) photoreactivation with excision repair: cells of rats, kangaroos and mosquitos. 4) non-excision repair type: cells of mice, Meriones and rats. Animal cells have plural types of repair. Main types of repair will differ according to the kind of animals. (Ichikawa, K.)

  2. Review: Clinical aspects of hereditary DNA Mismatch repair gene mutations.

    Science.gov (United States)

    Sijmons, Rolf H; Hofstra, Robert M W

    2016-02-01

    Inherited mutations of the DNA Mismatch repair genes MLH1, MSH2, MSH6 and PMS2 can result in two hereditary tumor syndromes: the adult-onset autosomal dominant Lynch syndrome, previously referred to as Hereditary Non-Polyposis Colorectal Cancer (HNPCC) and the childhood-onset autosomal recessive Constitutional Mismatch Repair Deficiency syndrome. Both conditions are important to recognize clinically as their identification has direct consequences for clinical management and allows targeted preventive actions in mutation carriers. Lynch syndrome is one of the more common adult-onset hereditary tumor syndromes, with thousands of patients reported to date. Its tumor spectrum is well established and includes colorectal cancer, endometrial cancer and a range of other cancer types. However, surveillance for cancers other than colorectal cancer is still of uncertain value. Prophylactic surgery, especially for the uterus and its adnexa is an option in female mutation carriers. Chemoprevention of colorectal cancer with aspirin is actively being investigated in this syndrome and shows promising results. In contrast, the Constitutional Mismatch Repair Deficiency syndrome is rare, features a wide spectrum of childhood onset cancers, many of which are brain tumors with high mortality rates. Future studies are very much needed to improve the care for patients with this severe disorder. PMID:26746812

  3. Novel Image Processing Interface to Relate DSB Spatial Distribution from Immunofluorescence Foci Experiments to the State-of-the-Art Models of DNA Breakage

    Science.gov (United States)

    Ponomarev, A. L.; Cucinotta, F. A.

    2004-01-01

    A recently developed software (NASARadiationTrackImage) allows a quick and automatic segmentation of foci that indicate spatial localization of specific proteins that are visualized by immunofluorescence. Of interest are the spatial and temporal distribution of foci such as gammaH2AX, a signal of the phosphorylation of a variant of the histone H2A that has been shown to correspond to DSBs, or proteins involved in DSB processing, such as ATM, Rad51, and p53, following exposures of human cells to high charge and energy (HZE) ion irradiation. Experimental data are recorded as sets of two-dimensional images in color with cells and foci of gammaH2AX, ATM, Rad51 or others shown. Different cells, levels of radiation and timing after radiation were recorded. The software allows us to calculate the number of foci per cell, overall intensity of light in foci and their spatial organization. A simple statistical model allows for testing of foci overlap (eclipse). A more complex statistical model previously known as DNAbreak simulates track structure and random chromosome geometry. It has one adjustable parameter corresponding to an average intensity of DSB creation in cubic micrometers of DNA volume per particle track or unit dose. Its limitation is the low-resolution limit both in physical space and DSB's along DNA. It works adequately on the scale of a cell and provides further insights on how the geometry of tracks and DNA affects genomic damage of the cell and subsequent repair. Future developments of the model for the description of the time evolution of DNA damage response proteins, and more robust track structure models will be discussed.

  4. Immunoglobulin variable region hypermutation is associated with a DNA repair deficit

    International Nuclear Information System (INIS)

    The molecular mechanism of Ig variable region hypermutation is unknown, but has been hypothesized to involve an error-prone DNA repair process. In this study, the authors used a novel PCR-based assay to compare repair of UV-induced DNA damage in mantle zone versus germinal center B lymphocytes. They observed that DNA repair activity within rearranged VDJ loci was sluggish in germinal center B lymphocytes compared to repair activity monitored in mantle zone B lymphocytes. In contrast, DNA repair times within the germline VH5 gene family, the variable region JH endash CH intron, and the N-ras gene was rapid and similar in both germinal center and mantle zone B cells. These results reflect a DNA repair deficit which, as expected for hypermutation, is selective for rearranged Ig VDG in germinal center cells. To directly measure the fidelity of DNA repair, the repaired PCR-amplified gene segments were analyzed for sequence changes by restriction enzyme digestion. In experiments thus far, repair of germline VH5 was error-free in both germinal center and mantle zone B cells. However, while rearranged VH5 segments were also error-free in mantle zone cells, they were highly mutated in germinal center cells. These findings provide direct biochemical evidence for the role of a sequence- and stage-specific error-prone DNA repair pathway in Ig V gene hypermutation

  5. In TFIIH, XPD helicase is exclusively devoted to DNA repair.

    Directory of Open Access Journals (Sweden)

    Jochen Kuper

    2014-09-01

    Full Text Available The eukaryotic XPD helicase is an essential subunit of TFIIH involved in both transcription and nucleotide excision repair (NER. Mutations in human XPD are associated with several inherited diseases such as xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy. We performed a comparative analysis of XPD from Homo sapiens and Chaetomium thermophilum (a closely related thermostable fungal orthologue to decipher the different molecular prerequisites necessary for either transcription or DNA repair. In vitro and in vivo assays demonstrate that mutations in the 4Fe4S cluster domain of XPD abrogate the NER function of TFIIH and do not affect its transcriptional activity. We show that the p44-dependent activation of XPD is promoted by the stimulation of its ATPase activity. Furthermore, we clearly demonstrate that XPD requires DNA binding, ATPase, and helicase activity to function in NER. In contrast, these enzymatic properties are dispensable for transcription initiation. XPD helicase is thus exclusively devoted to NER and merely acts as a structural scaffold to maintain TFIIH integrity during transcription.

  6. DNA damage, repair and photoadaptation in a Xiphophorus fish hybrid.

    Science.gov (United States)

    Mitchell, David L; Paniker, Lakshmi; Douki, Thierry

    2009-01-01

    Exposure to sunlight is responsible for most cutaneous malignant melanomas in the human population. It is very likely that DNA damage is an initial event in melanomagenesis, however, the role played by this damage is an open question. To this end, we used a hemipigmented F(1) hybrid of the fish genus Xiphophorus and HPLC tandem mass spectrometry to examine the effects of melanin on the induction and repair of the predominant UV-induced photoproducts formed in skin cell DNA. We found that heavily pigmented skin cells had about half the damage of nonpigmented cells and the relative induction of the major photoproducts was independent of the degree of pigmentation. The efficiency of photoenzymatic repair was the same in nonpigmented and pigmented areas of the fish. We found no evidence of residual damage at 10 days after the last exposure. Most striking was that repeated exposure to multiple doses of UVB caused a very significant photoadaptive response. Rather than an accumulation of damage after five doses of UVB we saw a significant reduction in the amount of damage induced after the final dose compared with the initial dose. The relevance of these observations is discussed in the context of melanoma susceptibility and UVB thresholds.

  7. DNA Repair in Despair-Vitamin D Is Not Fair.

    Science.gov (United States)

    Gocek, Elżbieta; Studzinski, George P

    2016-08-01

    The role of vitamin D as a treatment option for neoplastic diseases, once considered to have a bright future, remains controversial. The preclinical studies discussed herein show compelling evidence that Vitamin D Derivatives (VDDs) can convert some cancer and leukemia cells to a benign phenotype, by differentiation/maturation, cell cycle arrest, or induction of apoptosis. Furthermore, there is considerable, though still evolving, knowledge of the molecular mechanisms underlying these changes. However, the attempts to clearly document that the treatment outcomes of human neoplastic diseases can be positively influenced by VDDs have been, so far, disappointing. The clinical trials to date of VDDs, alone or combined with other agents, have not shown consistent results. It is our contention, shared by others, that there were limitations in the design or execution of these trials which have not yet been fully addressed. Based on the connection between upregulation of JNK by VDDs and DNA repair, we propose a new avenue of attack on cancer cells by increasing the toxicity of the current, only partially effective, cancer chemotherapeutic drugs by combining them with VDDs. This can impair DNA repair and thus kill the malignant cells, warranting a comprehensive study of this novel concept. J. Cell. Biochem. 117: 1733-1744, 2016. © 2016 Wiley Periodicals, Inc. PMID:27122067

  8. DNA repair in lymphocytes from patients with secondary leukemia as measured by strand rejoining and unscheduled DNA synthesis

    DEFF Research Database (Denmark)

    Bohr, V; Køber, L

    1985-01-01

    The ability to repair damage to DNA was compared in 2 groups of patients having undergone treatment for leukemia, one of which developed secondary leukemia (SL), and the other without signs of secondary malignancy (treated controls). Both were related to normal controls. DNA repair was assessed...

  9. Repair of ultraviolet-damaged transforming DNA in a mismatch repair-deficient strain of Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Bagci, H.; Stuy, J.H. (Florida State Univ., Tallahassee (USA). Dept. of Biological Science)

    1982-03-01

    Ultraviolet inactivation of Haemophilus influenzae transforming DNA followed inverse square root kinetics in both mismatch repair-proficient (hex/sup +/) and deficient (hex-1) recipients. No DNA concentration effect was seen with UV-excision repair-deficient (uvr/sup -/) strains. Low-efficiency genetic markers remained more sensitive than high-efficiency ones when they were assayed on excision repair-deficient hex/sup +/ uvr/sup -/ strains. They were equally resistant when hex/sup -/ uvr/sup -/ recipients were used. This was explained by assuming that recombinational repair of UV lesions in the donor strand and mismatch repair of the recipient strand may overlap and cause double strand interruptions. This will eliminate low-efficiency transformants.

  10. Enhanced DNA repair of cyclobutane pyrimidine dimers changes the biological response to UV-B radiation

    Energy Technology Data Exchange (ETDEWEB)

    Yarosh, Daniel B

    2002-11-30

    The goal of DNA repair enzyme therapy is the same as that for gene therapy: to rescue a defective proteome/genome by introducing a substitute protein/DNA. The danger of inadequate DNA repair is highlighted in the genetic disease xeroderma pigmentosum. These patients are hypersensitive to sunlight and develop multiple cutaneous neoplasms very early in life. The bacterial DNA repair enzyme T4 endonuclease V was shown over 25 years ago to be capable of reversing the defective repair in xeroderma pigmentosum cells. This enzyme, packaged in an engineered delivery vehicle, has been shown to traverse the stratum corneum, reach the nuclei of living cells of the skin, and enhance the repair of UV-induced cyclobutane pyrimidine dimers (CPD). In such a system, changes in DNA repair, mutagenesis, and cell signaling can be studied without manipulation of the genome.

  11. Genetic manipulation in Sulfolobus islandicus and functional analysis of DNA repair genes

    DEFF Research Database (Denmark)

    Zhang, Changyi; Tian, Bin; Li, Suming;

    2013-01-01

    enzymes already impaired cell growth, highlighting their important roles in archaeal DNA repair. Systematically characterizing these mutants and generating mutants lacking two or more DNA repair genes will yield further insights into the genetic mechanisms of DNA repair in this model organism.......Recently, a novel gene-deletion method was developed for the crenarchaeal model Sulfolobus islandicus, which is a suitable tool for addressing gene essentiality in depth. Using this technique, we have investigated functions of putative DNA repair genes by constructing deletion mutants and studying...... their phenotype. We found that this archaeon may not encode a eukarya-type of NER (nucleotide excision repair) pathway because depleting each of the eukaryal NER homologues XPD, XPB and XPF did not impair the DNA repair capacity in their mutants. However, among seven homologous recombination proteins...

  12. Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.

    NARCIS (Netherlands)

    B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1997-01-01

    textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA glyc

  13. Overexpression of DNA ligase III in mitochondria protects cells against oxidative stress and improves mitochondrial DNA base excision repair

    DEFF Research Database (Denmark)

    Akbari, Mansour; Keijzers, Guido; Maynard, Scott;

    2014-01-01

    by rotenone. Our results suggest that the amount of DNA ligase III in mitochondria may be critical for cell survival following prolonged oxidative stress, and demonstrate a functional link between mitochondrial DNA damage and repair, cell survival upon oxidative stress, and removal of dysfunctional......Base excision repair (BER) is the most prominent DNA repair pathway in human mitochondria. BER also results in a temporary generation of AP-sites, single-strand breaks and nucleotide gaps. Thus, incomplete BER can result in the generation of DNA repair intermediates that can disrupt mitochondrial...... DNA replication and transcription and generate mutations. We carried out BER analysis in highly purified mitochondrial extracts from human cell lines U2OS and HeLa, and mouse brain using a circular DNA substrate containing a lesion at a specific position. We found that DNA ligation is significantly...

  14. Mechanisms of DNA Repair by Photolyase and Excision Nuclease (Nobel Lecture).

    Science.gov (United States)

    Sancar, Aziz

    2016-07-18

    Ultraviolet light damages DNA by converting two adjacent thymines into a thymine dimer which is potentially mutagenic, carcinogenic, or lethal to the organism. This damage is repaired by photolyase and the nucleotide excision repair system in E. coli by nucleotide excision repair in humans. The work leading to these results is presented by Aziz Sancar in his Nobel Lecture. PMID:27337655

  15. Double-strand break repair and G4 DNA stability in Caenorhabditis elegans

    NARCIS (Netherlands)

    Pontier, D.B.

    2010-01-01

    DNA double-strand breaks (DSBs) can be repaired by three canonical repair pathways. Homologous recombination (HR) uses the sister chromatid or homologous chromosome as a template to repair the DSB in an error-free manner. In non-homologous end-joining (NHEJ), the broken ends are ligated with little

  16. Mechanisms of DNA Repair by Photolyase and Excision Nuclease (Nobel Lecture).

    Science.gov (United States)

    Sancar, Aziz

    2016-07-18

    Ultraviolet light damages DNA by converting two adjacent thymines into a thymine dimer which is potentially mutagenic, carcinogenic, or lethal to the organism. This damage is repaired by photolyase and the nucleotide excision repair system in E. coli by nucleotide excision repair in humans. The work leading to these results is presented by Aziz Sancar in his Nobel Lecture.

  17. Sharpening the ends for repair: mechanisms and regulation of DNA resection.

    Science.gov (United States)

    Paudyal, Sharad C; You, Zhongsheng

    2016-07-01

    DNA end resection is a key process in the cellular response to DNA double-strand break damage that is essential for genome maintenance and cell survival. Resection involves selective processing of 5' ends of broken DNA to generate ssDNA overhangs, which in turn control both DNA repair and checkpoint signaling. DNA resection is the first step in homologous recombination-mediated repair and a prerequisite for the activation of the ataxia telangiectasia mutated and Rad3-related (ATR)-dependent checkpoint that coordinates repair with cell cycle progression and other cellular processes. Resection occurs in a cell cycle-dependent manner and is regulated by multiple factors to ensure an optimal amount of ssDNA required for proper repair and genome stability. Here, we review the latest findings on the molecular mechanisms and regulation of the DNA end resection process and their implications for cancer formation and treatment. PMID:27174871

  18. Photoprotection by topical DNA repair enzymes: molecular correlates of clinical studies.

    Science.gov (United States)

    Yarosh, D B; O'Connor, A; Alas, L; Potten, C; Wolf, P

    1999-02-01

    A new approach to photoprotection is to repair DNA damage after UV exposure. This can be accomplished by delivery of a DNA repair enzyme with specificity to UV-induced cyclobutane pyrimidine dimers into skin by means of specially engineered liposomes. Treatment of DNA-repair-deficient xeroderma pigmentosum patients or skin cancer patients with T4N5 liposome lotion containing such DNA repair liposomes increases the removal of DNA damage in the first few hours after treatment. In these studies, a DNA repair effect was observed in some patients treated with heat-inactivated enzyme. Unexpectedly, it was discovered that the heat-inactivated T4 endonuclease V enzyme refolds and recovers enzymatic activity. These studies demonstrate that measurements of molecular changes induced by biological drugs are useful adjuvants to clinical studies.

  19. The Impact of Hedgehog Signaling Pathway on DNA Repair Mechanisms in Human Cancer

    Directory of Open Access Journals (Sweden)

    Erhong Meng

    2015-07-01

    Full Text Available Defined cellular mechanisms have evolved that recognize and repair DNA to protect the integrity of its structure and sequence when encountering assaults from endogenous and exogenous sources. There are five major DNA repair pathways: mismatch repair, nucleotide excision repair, direct repair, base excision repair and DNA double strand break repair (including non-homologous end joining and homologous recombination repair. Aberrant activation of the Hedgehog (Hh signaling pathway is a feature of many cancer types. The Hh pathway has been documented to be indispensable for epithelial-mesenchymal transition, invasion and metastasis, cancer stemness, and chemoresistance. The functional transcription activators of the Hh pathway include the GLI proteins. Inhibition of the activity of GLI can interfere with almost all DNA repair types in human cancer, indicating that Hh/GLI functions may play an important role in enabling tumor cells to survive lethal types of DNA damage induced by chemotherapy and radiotherapy. Thus, Hh signaling presents an important therapeutic target to overcome DNA repair-enabled multi-drug resistance and consequently increase chemotherapeutic response in the treatment of cancer.

  20. The Impact of Hedgehog Signaling Pathway on DNA Repair Mechanisms in Human Cancer

    Energy Technology Data Exchange (ETDEWEB)

    Meng, Erhong; Hanna, Ann; Samant, Rajeev S.; Shevde, Lalita A., E-mail: lsamant@uab.edu [Department of Pathology, Comprehensive Cancer Center, University of Alabama at Birmingham, WTI320D, 1824 6th Avenue South, Birmingham, AL 35233 (United States)

    2015-07-21

    Defined cellular mechanisms have evolved that recognize and repair DNA to protect the integrity of its structure and sequence when encountering assaults from endogenous and exogenous sources. There are five major DNA repair pathways: mismatch repair, nucleotide excision repair, direct repair, base excision repair and DNA double strand break repair (including non-homologous end joining and homologous recombination repair). Aberrant activation of the Hedgehog (Hh) signaling pathway is a feature of many cancer types. The Hh pathway has been documented to be indispensable for epithelial-mesenchymal transition, invasion and metastasis, cancer stemness, and chemoresistance. The functional transcription activators of the Hh pathway include the GLI proteins. Inhibition of the activity of GLI can interfere with almost all DNA repair types in human cancer, indicating that Hh/GLI functions may play an important role in enabling tumor cells to survive lethal types of DNA damage induced by chemotherapy and radiotherapy. Thus, Hh signaling presents an important therapeutic target to overcome DNA repair-enabled multi-drug resistance and consequently increase chemotherapeutic response in the treatment of cancer.

  1. The Impact of Hedgehog Signaling Pathway on DNA Repair Mechanisms in Human Cancer

    International Nuclear Information System (INIS)

    Defined cellular mechanisms have evolved that recognize and repair DNA to protect the integrity of its structure and sequence when encountering assaults from endogenous and exogenous sources. There are five major DNA repair pathways: mismatch repair, nucleotide excision repair, direct repair, base excision repair and DNA double strand break repair (including non-homologous end joining and homologous recombination repair). Aberrant activation of the Hedgehog (Hh) signaling pathway is a feature of many cancer types. The Hh pathway has been documented to be indispensable for epithelial-mesenchymal transition, invasion and metastasis, cancer stemness, and chemoresistance. The functional transcription activators of the Hh pathway include the GLI proteins. Inhibition of the activity of GLI can interfere with almost all DNA repair types in human cancer, indicating that Hh/GLI functions may play an important role in enabling tumor cells to survive lethal types of DNA damage induced by chemotherapy and radiotherapy. Thus, Hh signaling presents an important therapeutic target to overcome DNA repair-enabled multi-drug resistance and consequently increase chemotherapeutic response in the treatment of cancer

  2. Association between age and repair of oxidatively damaged DNA in human peripheral blood mononuclear cells

    DEFF Research Database (Denmark)

    Løhr, Mille; Jensen, Annie; Eriksen, Louise;

    2015-01-01

    damaged DNA in peripheral blood mononuclear cells (PBMCs). We isolated PBMCs from subjects aged 18-83 years, as part of a health survey of the Danish population that focussed on lifestyle factors. The level of DNA repair activity was measured as incisions on potassium bromate-damaged DNA by the comet...... assay. There was an inverse association between age and DNA repair activity with a 0.65% decline in activity per year from age 18 to 83 (95% confidence interval: 0.16-1.14% per year). Univariate regression analysis also indicated inverse associations between DNA repair activity and waist-hip ratio (P...

  3. Repair of DNA treated with γ-irradiation and chemical carcinogens. Progress report, 1980-1983

    International Nuclear Information System (INIS)

    We have studied in vitro DNA repair with the isolation and characterization of DNA glycosylases active in the removable of 3-methyladenine and the problem of repair of DNA in chromatin. The second area of focus has been on transposable elements and carcinogen action. The work on DNA adducts with β-propiolactone was done to define potential new substrates useful in a search for new glycosylases

  4. How SUMOylation Fine-Tunes the Fanconi Anemia DNA Repair Pathway.

    Science.gov (United States)

    Coleman, Kate E; Huang, Tony T

    2016-01-01

    Fanconi anemia (FA) is a rare human genetic disorder characterized by developmental defects, bone marrow failure and cancer predisposition, primarily due to a deficiency in the repair of DNA interstrand crosslinks (ICLs). ICL repair through the FA DNA repair pathway is a complicated multi-step process, involving at least 19 FANC proteins and coordination of multiple DNA repair activities, including homologous recombination, nucleotide excision repair and translesion synthesis (TLS). SUMOylation is a critical regulator of several DNA repair pathways, however, the role of this modification in controlling the FA pathway is poorly understood. Here, we summarize recent advances in the fine-tuning of the FA pathway by small ubiquitin-like modifier (SUMO)-targeted ubiquitin ligases (STUbLs) and other SUMO-related interactions, and discuss the implications of these findings in the design of novel therapeutics for alleviating FA-associated condition, including cancer. PMID:27148358

  5. Inhibition of poly(ADP-ribose)polymerase-1 and DNA repair by uranium.

    Science.gov (United States)

    Cooper, Karen L; Dashner, Erica J; Tsosie, Ranalda; Cho, Young Mi; Lewis, Johnnye; Hudson, Laurie G

    2016-01-15

    Uranium has radiological and non-radiological effects within biological systems and there is increasing evidence for genotoxic and carcinogenic properties attributable to uranium through its heavy metal properties. In this study, we report that low concentrations of uranium (as uranyl acetate; uranium exacerbates DNA damage and cytotoxicity induced by hydrogen peroxide, suggesting that uranium may inhibit DNA repair processes. Concentrations of uranyl acetate in the low micromolar range inhibited the zinc finger DNA repair protein poly(ADP-ribose) polymerase (PARP)-1 and caused zinc loss from PARP-1 protein. Uranyl acetate exposure also led to zinc loss from the zinc finger DNA repair proteins Xeroderma Pigmentosum, Complementation Group A (XPA) and aprataxin (APTX). In keeping with the observed inhibition of zinc finger function of DNA repair proteins, exposure to uranyl acetate enhanced retention of induced DNA damage. Co-incubation of uranyl acetate with zinc largely overcame the impact of uranium on PARP-1 activity and DNA damage. These findings present evidence that low concentrations of uranium can inhibit DNA repair through disruption of zinc finger domains of specific target DNA repair proteins. This may provide a mechanistic basis to account for the published observations that uranium exposure is associated with DNA repair deficiency in exposed human populations.

  6. Targeting the DNA Repair Pathway in Ewing Sarcoma

    Directory of Open Access Journals (Sweden)

    Elizabeth Stewart

    2014-11-01

    Full Text Available Ewing sarcoma (EWS is a tumor of the bone and soft tissue that primarily affects adolescents and young adults. With current therapies, 70% of patients with localized disease survive, but patients with metastatic or recurrent disease have a poor outcome. We found that EWS cell lines are defective in DNA break repair and are sensitive to PARP inhibitors (PARPis. PARPi-induced cytotoxicity in EWS cells was 10- to 1,000-fold higher after administration of the DNA-damaging agents irinotecan or temozolomide. We developed an orthotopic EWS mouse model and performed pharmacokinetic and pharmacodynamic studies using three different PARPis that are in clinical development for pediatric cancer. Irinotecan administered on a low-dose, protracted schedule previously optimized for pediatric patients was an effective DNA-damaging agent when combined with PARPis; it was also better tolerated than combinations with temozolomide. Combining PARPis with irinotecan and temozolomide gave complete and durable responses in more than 80% of the mice.

  7. MCM9 Is Required for Mammalian DNA Mismatch Repair.

    Science.gov (United States)

    Traver, Sabine; Coulombe, Philippe; Peiffer, Isabelle; Hutchins, James R A; Kitzmann, Magali; Latreille, Daniel; Méchali, Marcel

    2015-09-01

    DNA mismatch repair (MMR) is an evolutionarily conserved process that corrects DNA polymerase errors during replication to maintain genomic integrity. In E. coli, the DNA helicase UvrD is implicated in MMR, yet an analogous helicase activity has not been identified in eukaryotes. Here, we show that mammalian MCM9, a protein involved in replication and homologous recombination, forms a complex with MMR initiation proteins (MSH2, MSH3, MLH1, PMS1, and the clamp loader RFC) and is essential for MMR. Mcm9-/- cells display microsatellite instability and MMR deficiency. The MCM9 complex has a helicase activity that is required for efficient MMR since wild-type but not helicase-dead MCM9 restores MMR activity in Mcm9-/- cells. Moreover, MCM9 loading onto chromatin is MSH2-dependent, and in turn MCM9 stimulates the recruitment of MLH1 to chromatin. Our results reveal a role for MCM9 and its helicase activity in mammalian MMR. PMID:26300262

  8. Functions and Dynamics of DNA Repair Proteins in Mitosis and Meiosis

    NARCIS (Netherlands)

    E.J. Uringa

    2005-01-01

    textabstractMy PhD project encompassed studies on the functions of several different proteins, all involved in DNA repair, in somatic and germ-line cells. Hr6b and Rad18Sc are involved in a DNA repair mechanism called ‘Replicative Damage Bypass’ (RDB), and function as ubiquitin conjugating enzym

  9. DNA repair pathways in radiation induced cellular damage: a molecular approach

    NARCIS (Netherlands)

    L.R. van Veelen (Lieneke)

    2005-01-01

    markdownabstract__Abstract__ DNA damage, especially double-strand breaks, can be induced by endogenous or exogenous darnaging agents, such as ionizing radiation. Repair of DNA damage is very important in maintaining genomic stability. Incorrect repair may lead to chromosomal aberrations, translocat

  10. Analysis of DNA repair gene polymorphisms and survival in low-grade and anaplastic gliomas

    DEFF Research Database (Denmark)

    Berntsson, Shala Ghaderi; Wibom, Carl; Sjöström, Sara;

    2011-01-01

    The purpose of this study was to explore the variation in DNA repair genes in adults with WHO grade II and III gliomas and their relationship to patient survival. We analysed a total of 1,458 tagging single-nucleotide polymorphisms (SNPs) that were selected to cover DNA repair genes, in 81 grade ...

  11. DNA-damage foci to detect and characterize DNA repair alterations in children treated for pediatric malignancies.

    Directory of Open Access Journals (Sweden)

    Nadine Schuler

    Full Text Available PURPOSE: In children diagnosed with cancer, we evaluated the DNA damage foci approach to identify patients with double-strand break (DSB repair deficiencies, who may overreact to DNA-damaging radio- and chemotherapy. In one patient with Fanconi anemia (FA suffering relapsing squamous cell carcinomas of the oral cavity we also characterized the repair defect in biopsies of skin, mucosa and tumor. METHODS AND MATERIALS: In children with histologically confirmed tumors or leukemias and healthy control-children DSB repair was investigated by counting γH2AX-, 53BP1- and pATM-foci in blood lymphocytes at defined time points after ex-vivo irradiation. This DSB repair capacity was correlated with treatment-related normal-tissue responses. For the FA patient the defective repair was also characterized in tissue biopsies by analyzing DNA damage response proteins by light and electron microscopy. RESULTS: Between tumor-children and healthy control-children we observed significant differences in mean DSB repair capacity, suggesting that childhood cancer is based on genetic alterations affecting DNA repair. Only 1 out of 4 patients with grade-4 normal-tissue toxicities revealed an impaired DSB repair capacity. The defective DNA repair in FA patient was verified in irradiated blood lymphocytes as well as in non-irradiated mucosa and skin biopsies leading to an excessive accumulation of heterochromatin-associated DSBs in rapidly cycling cells. CONCLUSIONS: Analyzing human tissues we show that DSB repair alterations predispose to cancer formation at younger ages and affect the susceptibility to normal-tissue toxicities. DNA damage foci analysis of blood and tissue samples allows one to detect and characterize DSB repair deficiencies and enables identification of patients at risk for high-grade toxicities. However, not all treatment-associated normal-tissue toxicities can be explained by DSB repair deficiencies.

  12. Cytoplasmic sequestration of an O6-methylguanine-DNA methyltransferase enhancer binding protein in DNA repair-deficient human cells

    OpenAIRE

    Frank Y. Chen; Harris, Linda C.; Joanna S Remack; Brent, Thomas P.

    1997-01-01

    O6-Methylguanine-DNA methyltransferase (MGMT), an enzyme that repairs adducts at O6 of guanine in DNA, is a major determinant of susceptibility to simple methylating carcinogens or of tumor response to anticancer chloroethylating drugs. To investigate the mechanisms underlying cellular expression of this DNA repair enzyme, we focused on the role of a 59-bp enhancer of the human MGMT gene in the regulation of its expression. By using chloramphenicol acetyltransferase reporter assays, we found ...

  13. Critical Role of RecN in Recombinational DNA Repair and Survival of Helicobacter pylori▿

    OpenAIRE

    Wang, Ge; Maier, Robert J.

    2007-01-01

    Homologous recombination is one of the key mechanisms responsible for the repair of DNA double-strand breaks. Recombinational repair normally requires a battery of proteins, each with specific DNA recognition, strand transfer, resolution, or other functions. Helicobacter pylori lacks many of the proteins normally involved in the early stage (presynapsis) of recombinational repair, but it has a RecN homologue with an unclear function. A recN mutant strain of H. pylori was shown to be much more...

  14. A matter of life or death: modeling DNA damage and repair in bacteria.

    Science.gov (United States)

    Karschau, Jens; de Almeida, Camila; Richard, Morgiane C; Miller, Samantha; Booth, Ian R; Grebogi, Celso; de Moura, Alessandro P S

    2011-02-16

    DNA damage is a hazard all cells must face, and evolution has created a number of mechanisms to repair damaged bases in the chromosome. Paradoxically, many of these repair mechanisms can create double-strand breaks in the DNA molecule which are fatal to the cell. This indicates that the connection between DNA repair and death is far from straightforward, and suggests that the repair mechanisms can be a double-edged sword. In this report, we formulate a mathematical model of the dynamics of DNA damage and repair, and we obtain analytical expressions for the death rate. We predict a counterintuitive relationship between survival and repair. We can discriminate between two phases: below a critical threshold in the number of repair enzymes, the half-life decreases with the number of repair enzymes, but becomes independent of the number of repair enzymes above the threshold. We are able to predict quantitatively the dependence of the death rate on the damage rate and other relevant parameters. We verify our analytical results by simulating the stochastic dynamics of DNA damage and repair. Finally, we also perform an experiment with Escherichia coli cells to test one of the predictions of our model. PMID:21320424

  15. UV-inducible DNA repair in the cyanobacteria Anabaena spp

    International Nuclear Information System (INIS)

    Strains of the filamentous cyanobacteria Anabaena spp. were capable of very efficient photoreactivation of UV irradiation-induced damage to DNA. Cells were resistant to several hundred joules of UV irradiation per square meter under conditions that allowed photoreactivation, and they also photoreactivated UV-damaged cyanophage efficiently. Reactivation of UV-irradiated cyanophage (Weigle reactivation) also occurred; UV irradiation of host cells greatly enhanced the plaque-forming ability of irradiated phage under nonphotoreactivating conditions. Postirradiation incubation of the host cells under conditions that allowed photoreactivation abolished the ability of the cells to perform Weigle reactivation of cyanophage N-1. Mitomycin C also induced Weigle reactivation of cyanophage N-1, but nalidixic acid did not. The inducible repair system (defined as the ability to perform Weigle reactivation of cyanophages) was relatively slow and inefficient compared with photoreactivation

  16. Complex DNA repair pathways as possible therapeutic targets to overcome temozolomide resistance in glioblastoma

    Directory of Open Access Journals (Sweden)

    Koji eYoshimoto

    2012-12-01

    Full Text Available Many conventional chemotherapeutic drugs exert their cytotoxic function by inducing DNA damage in the tumor cell. Therefore, a cell-inherent DNA repair pathway, which reverses the DNA-damaging effect of the cytotoxic drugs, can mediate therapeutic resistance to chemotherapy. The monofunctional DNA-alkylating agent temozolomide (TMZ is a commonly used chemotherapeutic drug and the gold standard treatment for glioblastoma. Although the activity of DNA repair protein O6-methylguanine-DNA methyltransferase (MGMT has been described as the main modulator to determine the sensitivity of glioblastoma to TMZ, a subset of glioblastoma does not respond despite MGMT inactivation, suggesting that another DNA repair mechanism may also modulate the tolerance to TMZ. Considerable interest has focused on MGMT, mismatch repair (MMR, and the base-excision repair (BER pathway in the mechanism of mediating TMZ resistance, but emerging roles for the DNA strand-break repair pathway have been demonstrated. In the first part of this review article, we briefly review the significant role of MGMT, MMR, and the BER pathway in the tolerance to TMZ; in the last part, we review the recent publications that demonstrate possible roles of DNA strand-break repair pathways, such as single-strand break (SSB repair and double-strand break (DSB repair, as well as the Fanconi anemia pathway in the repair process after alkylating agent-based therapy. It is possible that all of these repair pathways have a potential to modulate the sensitivity to TMZ and aid in overcoming the therapeutic resistance in the clinic.

  17. Approaches to diagnose DNA mismatch repair gene defects in cancer.

    Science.gov (United States)

    Peña-Diaz, Javier; Rasmussen, Lene Juel

    2016-02-01

    The DNA repair pathway mismatch repair (MMR) is responsible for the recognition and correction of DNA biosynthetic errors caused by inaccurate nucleotide incorporation during replication. Faulty MMR leads to failure to address the mispairs or insertion deletion loops (IDLs) left behind by the replicative polymerases and results in increased mutation load at the genome. The realization that defective MMR leads to a hypermutation phenotype and increased risk of tumorigenesis highlights the relevance of this pathway for human disease. The association of MMR defects with increased risk of cancer development was first observed in colorectal cancer patients that carried inactivating germline mutations in MMR genes and the disease was named as hereditary non-polyposis colorectal cancer (HNPCC). Currently, a growing list of cancers is found to be MMR defective and HNPCC has been renamed Lynch syndrome (LS) partly to include the associated risk of developing extra-colonic cancers. In addition, a number of non-hereditary, mostly epigenetic, alterations of MMR genes have been described in sporadic tumors. Besides conferring a strong cancer predisposition, genetic or epigenetic inactivation of MMR genes also renders cells resistant to some chemotherapeutic agents. Therefore, diagnosis of MMR deficiency has important implications for the management of the patients, the surveillance of their relatives in the case of LS and for the choice of treatment. Some of the alterations found in MMR genes have already been well defined and their pathogenicity assessed. Despite this substantial wealth of knowledge, the effects of a large number of alterations remain uncharacterized (variants of uncertain significance, VUSs). The advent of personalized genomics is likely to increase the list of VUSs found in MMR genes and anticipates the need of diagnostic tools for rapid assessment of their pathogenicity. This review describes current tools and future strategies for addressing the relevance

  18. Crystal Structures of DNA-Whirly Complexes and Their Role in Arabidopsis Organelle Genome Repair

    Energy Technology Data Exchange (ETDEWEB)

    Cappadocia, Laurent; Maréchal, Alexandre; Parent, Jean-Sébastien; Lepage, Étienne; Sygusch, Jurgen; Brisson, Normand (Montreal)

    2010-09-07

    DNA double-strand breaks are highly detrimental to all organisms and need to be quickly and accurately repaired. Although several proteins are known to maintain plastid and mitochondrial genome stability in plants, little is known about the mechanisms of DNA repair in these organelles and the roles of specific proteins. Here, using ciprofloxacin as a DNA damaging agent specific to the organelles, we show that plastids and mitochondria can repair DNA double-strand breaks through an error-prone pathway similar to the microhomology-mediated break-induced replication observed in humans, yeast, and bacteria. This pathway is negatively regulated by the single-stranded DNA (ssDNA) binding proteins from the Whirly family, thus indicating that these proteins could contribute to the accurate repair of plant organelle genomes. To understand the role of Whirly proteins in this process, we solved the crystal structures of several Whirly-DNA complexes. These reveal a nonsequence-specific ssDNA binding mechanism in which DNA is stabilized between domains of adjacent subunits and rendered unavailable for duplex formation and/or protein interactions. Our results suggest a model in which the binding of Whirly proteins to ssDNA would favor accurate repair of DNA double-strand breaks over an error-prone microhomology-mediated break-induced replication repair pathway.

  19. PARP-1 and Ku compete for repair of DNA double strand breaks by distinct NHEJ pathways

    Science.gov (United States)

    Wang, Minli; Wu, Weizhong; Wu, Wenqi; Rosidi, Bustanur; Zhang, Lihua; Wang, Huichen; Iliakis, George

    2006-01-01

    Poly(ADP-ribose)polymerase 1 (PARP-1) recognizes DNA strand interruptions in vivo and triggers its own modification as well as that of other proteins by the sequential addition of ADP-ribose to form polymers. This modification causes a release of PARP-1 from DNA ends and initiates a variety of responses including DNA repair. While PARP-1 has been firmly implicated in base excision and single strand break repair, its role in the repair of DNA double strand breaks (DSBs) remains unclear. Here, we show that PARP-1, probably together with DNA ligase III, operates in an alternative pathway of non-homologous end joining (NHEJ) that functions as backup to the classical pathway of NHEJ that utilizes DNA-PKcs, Ku, DNA ligase IV, XRCC4, XLF/Cernunnos and Artemis. PARP-1 binds to DNA ends in direct competition with Ku. However, in irradiated cells the higher affinity of Ku for DSBs and an excessive number of other forms of competing DNA lesions limit its contribution to DSB repair. When essential components of the classical pathway of NHEJ are absent, PARP-1 is recruited for DSB repair, particularly in the absence of Ku and non-DSB lesions. This form of DSB repair is sensitive to PARP-1 inhibitors. The results define the function of PARP-1 in DSB repair and characterize a candidate pathway responsible for joining errors causing genomic instability and cancer. PMID:17088286

  20. Ultraviolet-induced DNA excision repair in human B and T lymphocytes. 3. Repair in lymphocyte from chronic lymphocytic leukaemia

    International Nuclear Information System (INIS)

    This study examined the capacity of lymphocytes from individuals with chronic lymphocytic leukaemia (CLL) to undertake ultraviolet (u.v.)-induced DNA repair in comparison to control and age-matched purified B and T lymphocytes. The technique was independent of incorporation of radioactive precursor, i.e. by the recovery of normal sedimentation behaviour of nucleoid bodies obtained from these cells by lysis in high salt and non-ionic detergent. Recovery of normal sedimentation was associated with restoration of DNA supercoiling. CLL cells were found to be as sensitive to u.v. and to repair at similar rates as age-matched B controls. They were considerably more sensitive than young B cells and repaired less efficiently. Reasons for previous reported discrepancies in CLL repair were discussed. (author)

  1. Understanding extreme resistance to DNA damage in D. radiodurans: genomic inputs and proteomic insights into extraordinary DNA repair

    International Nuclear Information System (INIS)

    Deinococcus radiodurans, a model extremophile, tolerates very high doses of virtually all DNA damaging agents such as ionizing radiations, UV, desiccation or mutagenic chemicals. It repairs its damaged DNA, from hundreds of fragments to intact chromosome, with absolute fidelity. Its genome displays acquisition of eukaryotic DNA repair pathways and deletion of universal prokaryotic DNA repair pathways, along with several ORFs that encode proteins with unusual domain combinations, expanded gene families and uncharacterized proteins. Yet, it is one of the most DNA repair efficient organism known today. To understand gamma radiation responsive global modifications in the proteome, respective proteome profiles were resolved by 2D electrophoresis and the gamma radiation responsive differentially expressed proteins were identified by MALDI mass spectrometry. Exposure to gamma irradiation set in immediate growth arrest, a phase during which the organism reassembles its shattered genome and recycles the radiation-damaged biomolecules. A proteomic investigation of this phase revealed highest up-regulation of DNA repair proteins involved in strand annealing, nucleotide excision repair, non-homologous end joining and homologous recombination pathways. Another set of differentially expressed proteins were metabolic enzymes that appeared to modulate metabolism to utilize stored glycogen and slow down amino acid biosynthesis. Oxidative stress alleviation machinery, which was constitutively present in abundance, displayed minor modulation. The gamma radiation responsive proteome modulations emphasize focused multi-factorial DNA repair and metabolic modulations, during post-irradiation recovery. (author)

  2. Toxicity DNA damage and inhibition of DNA repair synthesis in human melanoma cells by concentrated sunlight

    International Nuclear Information System (INIS)

    A water lens was used to focus solar radiation, giving an 8-fold concentration of the total spectrum and a cytocidal flux similar to that of laboratory UV sources. Survival curves for human melanoma cells were similar for sunlight and 254 nm UV. An xeroderma pigmentosum lymphoblastoid line was equally sensitive to both agents and human cell lines sensitive to ionizing radiation (lymphoblastoid lines), crosslinking agents or monofunctional alkylating agents (melanoma lines) had the same 254 nm UV and solar survival responses as appropriate control lines. Two melanoma sublines derived separately by 16 cycles of treatment with sunlight or 254 nm UV were crossresistant to both agents. In one melanoma cell line, DNA strand breaks and DNA protein crosslinking were induced in melanoma cells by sunlight but pyrimidine dimers and DNA interstrand crosslinking could not be detected. The solar fluence response of DNA repair synthesis was much less than that from equitoxic 254 nm UV, reaching a maximum near the D0 value and then declining; but semiconservative DNA synthesis remained high. These effects were not due to changes in thymidine pool sizes. Solar exposure did not have a major effect on 254 nm UV-induced repair synthesis. (author)

  3. Repair and genetic consequences of DNA double strand breaks during animal development

    NARCIS (Netherlands)

    Lemmens, Bennie Benjamin Lodewijk Gerardus

    2014-01-01

    The genetic code of life is stored in DNA molecules that consist of two parallel strands of coupled nucleotides that form a DNA double helix. One of the most deleterious forms of DNA damage is a DNA double-strand break (DSB) in which both strands of the helix are broken. When not repaired adequately

  4. Ultraviolet light-resistant primary transfectants of xeroderma pigmentosum cells are also DNA repair-proficient

    International Nuclear Information System (INIS)

    In a previous work, an immortal xeroderma pigmentosum cell line belonging to complementation group C was complemented to a UV-resistant phenotype by transfection with a human cDNA clone library. We now report that the primary transformants selected for UV-resistance also acquired normal levels of DNA repair. This was assessed both by measurement of UV-induced [3H]thymidine incorporation and by equilibrium sedimentation analysis of repair-DNA synthesis. Therefore, the transduced DNA element which confers normal UV-resistance also corrects the excision repair defect of the xeroderma pigmentosum group C cell line

  5. PARP-1 and Ku compete for repair of DNA double strand breaks by distinct NHEJ pathways

    OpenAIRE

    Wang, Minli; Wu, Weizhong; Wu, Wenqi; Rosidi, Bustanur; Zhang, Lihua; Wang, Huichen; Iliakis, George

    2006-01-01

    Poly(ADP-ribose)polymerase 1 (PARP-1) recognizes DNA strand interruptions in vivo and triggers its own modification as well as that of other proteins by the sequential addition of ADP-ribose to form polymers. This modification causes a release of PARP-1 from DNA ends and initiates a variety of responses including DNA repair. While PARP-1 has been firmly implicated in base excision and single strand break repair, its role in the repair of DNA double strand breaks (DSBs) remains unclear. Here, ...

  6. Carcinogen-induced DNA repair in nucleotide-permeable Escherichia coli cells. Induction of DNA repair by the carcinogens methyl and ethyl nitrosourea and methyl methanesulfonate.

    Science.gov (United States)

    Thielmann, H W; Vosberg, H P; Reygers, U

    1975-08-15

    Ether-permeabilized (nucleotide-permeable) cells of Escherichia coli show excision repair of their DNA after having been exposed to the carcinogens N-methyl-N-nitrosourea (MeNOUr), N-ethyl-N-nitrosourea (EtNOUr) and methyl methanesulfonate (MeSO2OMe) which are known to bind covalently to DNA. Defect mutations in genes uvrA, uvrB, uvrC, recA, recB, recC and rep did not inhibit this excision repair. Enzymic activities involved in this repair were identified by measuring size reduction of DNA, DNA degradation to acid-soluble nucleotides and repair polymerization. 1. In permeabilized cells methyl and ethyl nitrosourea induced endonucleolytic cleavage of endogenous DNA, as determined by size reduction of denatured DNA in neutral and alkaline sucrose gradients. An enzymic activity from E. coli K-12 cell extracts was purified (greater than 2000-fold) and was found to cleave preferentially methyl-nitrosourea-treated DNA and to convert the methylated supercoiled DNA duplex (RFI) of phage phiX 174 into the nicked circular form. 2. Degradation of alkylated cellular DNA to acid solubility was diminished in a mutant lacking the 5' leads to 3' exonucleolytic activity of DNA polymerase I but was not affected in a mutant which lacked the DNA polymerizing but retained the 5' leads 3' exonucleolytic activity of DNA polymerase I. 3. An easily measurable effect is carcinogen-induced repair polymerization, making it suitable for detection of covalent binding of carcinogens and potentially carcinogenic compounds. PMID:170107

  7. DNA repair in bacterial cultures and plasmid DNA exposed to infrared laser for treatment of pain

    International Nuclear Information System (INIS)

    Biostimulation of tissues by low intensity lasers has been described on a photobiological basis and clinical protocols are recommended for treatment of various diseases, but their effects on DNA are controversial. The objective of this work was to evaluate effects of low intensity infrared laser exposure on survival and bacterial filamentation in Escherichia coli cultures, and induction of DNA lesions in bacterial plasmids. In E. coli cultures and plasmids exposed to an infrared laser at fluences used to treat pain, bacterial survival and filamentation and DNA lesions in plasmids were evaluated by electrophoretic profile. Data indicate that the infrared laser (i) increases survival of E. coli wild type in 24 h of stationary growth phase, (ii) induces bacterial filamentation, (iii) does not alter topological forms of plasmids and (iv) does not alter the electrophoretic profile of plasmids incubated with exonuclease III or formamidopyrimidine DNA glycosylase. A low intensity infrared laser at the therapeutic fluences used to treat pain can alter survival of E. coli wild type, induce filamentation in bacterial cells, depending on physiologic conditions and DNA repair, and induce DNA lesions other than single or double DNA strand breaks or alkali-labile sites, which are not targeted by exonuclease III or formamidopyrimidine DNA glycosylase. (letter)

  8. 1-β-D-arabinofuranosylcytosine is cytotoxic in quiescent normal lymphocytes undergoing DNA excision repair

    International Nuclear Information System (INIS)

    We have sought to clarify the potential activity of the S-phase-specific antileukemic agent 1-β-D-arabinofuranosylcytosine (ara-C), an inhibitor of DNA synthesis, in quiescent cells that are substantially non-sensitive to nucleoside analogues. It was hypothesized that the combination of ara-C with DNA damaging agents that initiate DNA repair will expand ara-C cytotoxicity to non-cycling cells. The repair kinetics, which included incision of damaged DNA, gap-filling by DNA synthesis and rejoining by ligation, were evaluated using the single cell gel electrophoresis (Comet) assay and the thymidine incorporation assay. When normal lymphocytes were treated with ultraviolet C or with 1,3-bis(2-chloroethyl)-1-nitrosourea (BCNU), the processes of DNA excision repair were promptly initiated and rapidly completed. When the cells were incubated with ara-C prior to irradiation or BCNU treatment, the steps of DNA synthesis and rejoining in the repair processes were both inhibited. The ara-C-mediated inhibition of the repair processes was concentration-dependent, with the effect peaking at 10μM. The combination of ara-C with these DNA repair initiators exerted subsequent cytotoxicity, which was proportional to the extent of the repair inhibition in the presence of ara-C. In conclusion, ara-C was cytotoxic in quiescent cells undergoing DNA repair. This might be attributed to unrepaired DNA damage that remained in the cells, thereby inducing lethal cytotoxicity. Alternatively, ara-C might exert its own cytotoxicity by inhibiting DNA synthesis in the repair processes. Such a strategy may be effective against a dormant subpopulation in acute leukemia that survives chemotherapy. (author)

  9. Differential genetic interactions between Sgs1, DNA-damage checkpoint components and DNA repair factors in the maintenance of chromosome stability

    Directory of Open Access Journals (Sweden)

    Doerfler Lillian

    2011-10-01

    Full Text Available Abstract Background Genome instability is associated with human cancers and chromosome breakage syndromes, including Bloom's syndrome, caused by inactivation of BLM helicase. Numerous mutations that lead to genome instability are known, yet how they interact genetically is poorly understood. Results We show that spontaneous translocations that arise by nonallelic homologous recombination in DNA-damage-checkpoint-defective yeast lacking the BLM-related Sgs1 helicase (sgs1Δ mec3Δ are inhibited if cells lack Mec1/ATR kinase. Tel1/ATM, in contrast, acts as a suppressor independently of Mec3 and Sgs1. Translocations are also inhibited in cells lacking Dun1 kinase, but not in cells defective in a parallel checkpoint branch defined by Chk1 kinase. While we had previously shown that RAD51 deletion did not inhibit translocation formation, RAD59 deletion led to inhibition comparable to the rad52Δ mutation. A candidate screen of other DNA metabolic factors identified Exo1 as a strong suppressor of chromosomal rearrangements in the sgs1Δ mutant, becoming even more important for chromosomal stability upon MEC3 deletion. We determined that the C-terminal third of Exo1, harboring mismatch repair protein binding sites and phosphorylation sites, is dispensable for Exo1's roles in chromosomal rearrangement suppression, mutation avoidance and resistance to DNA-damaging agents. Conclusions Our findings suggest that translocations between related genes can form by Rad59-dependent, Rad51-independent homologous recombination, which is independently suppressed by Sgs1, Tel1, Mec3 and Exo1 but promoted by Dun1 and the telomerase-inhibitor Mec1. We propose a model for the functional interaction between mitotic recombination and the DNA-damage checkpoint in the suppression of chromosomal rearrangements in sgs1Δ cells.

  10. DNA damage induced by boron neutron capture therapy is partially repaired by DNA ligase IV.

    Science.gov (United States)

    Kondo, Natsuko; Sakurai, Yoshinori; Hirota, Yuki; Tanaka, Hiroki; Watanabe, Tsubasa; Nakagawa, Yosuke; Narabayashi, Masaru; Kinashi, Yuko; Miyatake, Shin-ichi; Hasegawa, Masatoshi; Suzuki, Minoru; Masunaga, Shin-ichiro; Ohnishi, Takeo; Ono, Koji

    2016-03-01

    Boron neutron capture therapy (BNCT) is a particle radiation therapy that involves the use of a thermal or epithermal neutron beam in combination with a boron ((10)B)-containing compound that specifically accumulates in tumor. (10)B captures neutrons and the resultant fission reaction produces an alpha ((4)He) particle and a recoiled lithium nucleus ((7)Li). These particles have the characteristics of high linear energy transfer (LET) radiation and therefore have marked biological effects. High-LET radiation is a potent inducer of DNA damage, specifically of DNA double-strand breaks (DSBs). The aim of the present study was to clarify the role of DNA ligase IV, a key player in the non-homologous end-joining repair pathway, in the repair of BNCT-induced DSBs. We analyzed the cellular sensitivity of the mouse embryonic fibroblast cell lines Lig4-/- p53-/- and Lig4+/+ p53-/- to irradiation using a thermal neutron beam in the presence or absence of (10)B-para-boronophenylalanine (BPA). The Lig4-/- p53-/- cell line had a higher sensitivity than the Lig4+/+ p53-/-cell line to irradiation with the beam alone or the beam in combination with BPA. In BNCT (with BPA), both cell lines exhibited a reduction of the 50 % survival dose (D 50) by a factor of 1.4 compared with gamma-ray and neutron mixed beam (without BPA). Although it was found that (10)B uptake was higher in the Lig4+/+ p53-/- than in the Lig4-/- p53-/- cell line, the latter showed higher sensitivity than the former, even when compared at an equivalent (10)B concentration. These results indicate that BNCT-induced DNA damage is partially repaired using DNA ligase IV. PMID:26573366

  11. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    International Nuclear Information System (INIS)

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [32P]-based oligonucleotide cleavage assay (MPG substrate 5′-CCGCTεAGCGGGTACCGAGCTCGAAT; εA = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 ± 1.67 fmol/μg DNA/h vs 3.47 ± 1.35 fmol/μg DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16–7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  12. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Crosbie, Philip A.J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Watson, Amanda J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Agius, Raymond [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Barber, Philip V. [North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Margison, Geoffrey P. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Povey, Andrew C., E-mail: apovey@manchester.ac.uk [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom)

    2012-04-01

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [{sup 32}P]-based oligonucleotide cleavage assay (MPG substrate 5 Prime -CCGCT{epsilon}AGCGGGTACCGAGCTCGAAT; {epsilon}A = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 {+-} 1.67 fmol/{mu}g DNA/h vs 3.47 {+-} 1.35 fmol/{mu}g DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  13. Excision repair of UV radiation-induced DNA damage in Caenorhabditis elegans

    Energy Technology Data Exchange (ETDEWEB)

    Hartman, P.S.; Hevelone, J.; Dwarakanath, V.; Mitchell, D.L. (Texas Christian Univ., Fort Worth (USA))

    1989-06-01

    Radioimmunoassays were used to monitor the removal of antibody-binding sites associated with the two major UV radiation-induced DNA photoproducts (cyclobutane dimers and (6-4) photoproducts). Unlike with cultured human cells, where (6-4) photoproducts are removed more rapidly than cyclobutane dimers, the kinetics of repair were similar for both lesions. Repair capacity in wild type diminished throughout development. The radioimmunoassays were also employed to confirm the absence of photoreactivation in C. elegans. In addition, three radiation-sensitive mutants (rad-1, rad-2, rad-7) displayed normal repair capacities. An excision defect was much more pronounced in larvae than embryos in the fourth mutant tested (rad-3). This correlates with the hypersensitivity pattern of this mutant and suggests that DNA repair may be developmentally regulated in C. elegans. The mechanism of DNA repair in C. elegans as well as the relationship between the repair of specific photoproducts and UV radiation sensitivity during development are discussed.

  14. Life forms employ different repair strategies of repair single- and double strand DNA breaks caused by different qualities of radiation: criticality of RecA mediated repair system

    International Nuclear Information System (INIS)

    Different qualities of radiation, either through direct or indirect pathway, induce qualitative different spectrum of damages in DNA, which are also different in in vitro and in vivo systems. The single- and double strand breaks of DNA are of special interest as they lead to serious biological consequences. The implications of such damage to DNA and their processing by various inherent repair pathways together decide the fate of the living form

  15. Bulge, Bubble, and Y: How a RNA Exonuclease Repairs DNA, in Detail

    OpenAIRE

    Yu-Yuan Hsiao; Woei-Horng Fang; Chia-Chia Lee; Yi-Ping Chen; Yuan, Hanna S.

    2014-01-01

    DNA repair mechanisms are essential for preservation of genome integrity. However, it is not clear how DNA are selected and processed at broken ends by exonucleases during repair pathways. Here we show that the DnaQ-like exonuclease RNase T is critical for Escherichia coli resistance to various DNA-damaging agents and UV radiation. RNase T specifically trims the 3' end of structured DNA, including bulge, bubble, and Y-structured DNA, and it can work with Endonuclease V to restore the deaminat...

  16. New tools to study DNA double-strand break repair pathway choice.

    Directory of Open Access Journals (Sweden)

    Daniel Gomez-Cabello

    Full Text Available A broken DNA molecule is difficult to repair, highly mutagenic, and extremely cytotoxic. Such breaks can be repaired by homology-independent or homology-directed mechanisms. Little is known about the network that controls the repair pathway choice except that a licensing step for homology-mediated repair exists, called DNA-end resection. The choice between these two repair pathways is a key event for genomic stability maintenance, and an imbalance of the ratio is directly linked with human diseases, including cancer. Here we present novel reporters to study the balance between both repair options in human cells. In these systems, a double-strand break can be alternatively repaired by homology-independent or -dependent mechanisms, leading to the accumulation of distinct fluorescent proteins. These reporters thus allow the balance between both repair pathways to be analyzed in different experimental setups. We validated the reporters by analyzing the effect of protein downregulation of the DNA end resection and non-homologous end-joining pathways. Finally, we analyzed the role of the DNA damage response on double-strand break (DSB repair mechanism selection. Our reporters could be used in the future to understand the roles of specific factors, whole pathways, or drugs in DSB repair pathway choice, or for genome-wide screening. Moreover, our findings can be applied to increase gene-targeting efficiency, making it a beneficial tool for a broad audience in the biological sciences.

  17. PARP-1: Friend or Foe of DNA Damage and Repair in Tumorigenesis?

    International Nuclear Information System (INIS)

    Oxidative stress induced by reactive oxygen species can result in DNA damage within cells and subsequently increase risk for carcinogenesis. This may be averted by repair of DNA damage through the base or nucleotide excision repair (BER/NER) pathways. PARP, a BER protein, is known for its role in DNA-repair. However, multiple lesions can occur within a small range of DNA, known as oxidative clustered DNA lesions (OCDLs), which are difficult to repair and may lead to the more severe DNA double-strand break (DSB). Inefficient DSB repair can then result in increased mutagenesis and neoplastic transformation. OCDLs occur more frequently within a variety of tumor tissues. Interestingly, PARP is highly expressed in several human cancers. Additionally, chronic inflammation may contribute to tumorigenesis through ROS-induced DNA damage. Furthermore, PARP can modulate inflammation through interaction with NFκB and regulating the expression of inflammatory signaling molecules. Thus, the upregulation of PARP may present a double-edged sword. PARP is needed to repair ROS-induced DNA lesions, but PARP expression may lead to increased inflammation via upregulation of NFκB signaling. Here, we discuss the role of PARP in the repair of oxidative damage versus the formation of OCDLs and speculate on the feasibility of PARP inhibition for the treatment and prevention of cancers by exploiting its role in inflammation

  18. DNA repair in Haemophilus influenzae: isolation and characterization of an ultraviolet sensitive mutator mutant

    Energy Technology Data Exchange (ETDEWEB)

    Walter, R.B.

    1985-01-01

    DNA repair in Haemophilus influenzae appears to be quite different from that seen in Escherichia coli in that H. influenzae shows neither SOS nor adaptation phenomena. Repair of DNA lesions in H. influenzae has been seen to occur via recombinational, excision, and mismatch repair pathways acting independently of one another. The author has isolated an ultraviolet (UV)-sensitive mutator mutant (mutB1) of H. influenzae Rd which shows deficiencies in both recombinational and mismatch repair pathways. This mutant is sensitive to a variety of DNA damaging agents as well as being hypermutable by alkylating agents and base analogues. MutB1 cells do not show post-UV DNA breakdown but do begin excision after UV irradiation. Genetic transformation with UV-irradiated DNA on mut B1 recipients shows that high (HE) and low (LE) efficiency markers are transformed at a ratio of 1.0 as in the mismatch repair deficient hex 1 mutant; however, kinetics of UV-inactivation experiments indicate that HE markers are sensitized and act as LE markers do on wild type recipients. Thus, the mutB gene product appears to play a role in both DNA repair and genetic transformation. A model is outlined which presents a role for a DNA helicase in both DNA repair and genetic transformation of H. influenzae.

  19. PARP-1: Friend or Foe of DNA Damage and Repair in Tumorigenesis?

    Energy Technology Data Exchange (ETDEWEB)

    Swindall, Amanda F.; Stanley, Jennifer A. [Department of Radiation Oncology Comprehensive Cancer Center, University of Alabama at Birmingham School of Medicine, 176F HSROC Suite 2232B, 1700 6th Avenue South, Birmingham, AL 35249 (United States); Yang, Eddy S., E-mail: eyang@uab.edu [Department of Radiation Oncology Comprehensive Cancer Center, University of Alabama at Birmingham School of Medicine, 176F HSROC Suite 2232B, 1700 6th Avenue South, Birmingham, AL 35249 (United States); Department of Cell, Developmental and Integrative Biology, University of Alabama at Birmingham, Birmingham, AL 35249 (United States); Department of Pharmacology and Toxicology, University of Alabama at Birmingham, Birmingham, AL 35249 (United States)

    2013-07-26

    Oxidative stress induced by reactive oxygen species can result in DNA damage within cells and subsequently increase risk for carcinogenesis. This may be averted by repair of DNA damage through the base or nucleotide excision repair (BER/NER) pathways. PARP, a BER protein, is known for its role in DNA-repair. However, multiple lesions can occur within a small range of DNA, known as oxidative clustered DNA lesions (OCDLs), which are difficult to repair and may lead to the more severe DNA double-strand break (DSB). Inefficient DSB repair can then result in increased mutagenesis and neoplastic transformation. OCDLs occur more frequently within a variety of tumor tissues. Interestingly, PARP is highly expressed in several human cancers. Additionally, chronic inflammation may contribute to tumorigenesis through ROS-induced DNA damage. Furthermore, PARP can modulate inflammation through interaction with NFκB and regulating the expression of inflammatory signaling molecules. Thus, the upregulation of PARP may present a double-edged sword. PARP is needed to repair ROS-induced DNA lesions, but PARP expression may lead to increased inflammation via upregulation of NFκB signaling. Here, we discuss the role of PARP in the repair of oxidative damage versus the formation of OCDLs and speculate on the feasibility of PARP inhibition for the treatment and prevention of cancers by exploiting its role in inflammation.

  20. Epigenetic regulation of DNA repair machinery in Helicobacter pylori-induced gastric carcinogenesis.

    Science.gov (United States)

    Santos, Juliana Carvalho; Ribeiro, Marcelo Lima

    2015-08-14

    Although thousands of DNA damaging events occur in each cell every day, efficient DNA repair pathways have evolved to counteract them. The DNA repair machinery plays a key role in maintaining genomic stability by avoiding the maintenance of mutations. The DNA repair enzymes continuously monitor the chromosomes to correct any damage that is caused by exogenous and endogenous mutagens. If DNA damage in proliferating cells is not repaired because of an inadequate expression of DNA repair genes, it might increase the risk of cancer. In addition to mutations, which can be either inherited or somatically acquired, epigenetic silencing of DNA repair genes has been associated with carcinogenesis. Gastric cancer represents the second highest cause of cancer mortality worldwide. The disease develops from the accumulation of several genetic and epigenetic changes during the lifetime. Among the risk factors, Helicobacter pylori (H. pylori) infection is considered the main driving factor to gastric cancer development. Thus, in this review, we summarize the current knowledge of the role of H. pylori infection on the epigenetic regulation of DNA repair machinery in gastric carcinogenesis.

  1. Inhibition of poly(ADP-ribose)polymerase-1 and DNA repair by uranium.

    Science.gov (United States)

    Cooper, Karen L; Dashner, Erica J; Tsosie, Ranalda; Cho, Young Mi; Lewis, Johnnye; Hudson, Laurie G

    2016-01-15

    Uranium has radiological and non-radiological effects within biological systems and there is increasing evidence for genotoxic and carcinogenic properties attributable to uranium through its heavy metal properties. In this study, we report that low concentrations of uranium (as uranyl acetate; Xeroderma Pigmentosum, Complementation Group A (XPA) and aprataxin (APTX). In keeping with the observed inhibition of zinc finger function of DNA repair proteins, exposure to uranyl acetate enhanced retention of induced DNA damage. Co-incubation of uranyl acetate with zinc largely overcame the impact of uranium on PARP-1 activity and DNA damage. These findings present evidence that low concentrations of uranium can inhibit DNA repair through disruption of zinc finger domains of specific target DNA repair proteins. This may provide a mechanistic basis to account for the published observations that uranium exposure is associated with DNA repair deficiency in exposed human populations. PMID:26627003

  2. DNA repair of UV photoproducts and mutagenesis in human mitochondrial DNA

    International Nuclear Information System (INIS)

    The induction and repair of DNA photolesions and mutations in the mitochondrial (mt) DNA of human cells in culture were analysed after cell exposure to UV-C light. The level of induction of cyclobutane pyrimidine dimers (CPD) in mitochondrial and nuclear DNA was comparable, while a higher frequency of pyrimidine (6-4) pyrimidone photoproducts (6-4 PP) was detected in mitochondrial than in nuclear DNA. Besides the known defect in CPD removal, mitochondria were shown to be deficient also in the excision of 6-4 PP. The effects of repair-defective conditions for the two major UV photolesions on mutagensis was assessed by analysing the frequency and spectrum of spontaneous and UV-induced mutations by restriction site mutation (RSM) method in a restriction endonuclease site, NciI (5'CCCGG3') located within the coding sequence of the mitochondrial gene for tRNA Leu. The spontaneous mutation frequency and spectrum at the NciI site of mitochondrial DNA was very similar to the RSM background mutation frequency (approximately 10-5) and type (predominantly GC > AT transitions at GL1) of the NciI site). Conversely, an approximately tenfold increase over background mutation frequency was recorded after cell exposure to 20 J/m2. In this case, the majority of mutations were C > T transitions preferentially located on the non-transcribed DNA strand at C1 and C2 of the NciI site. This mutation spectrum is expected by UV mutagenesis. This is the first evidence of induction of mutations in mitochondrial DNA by treatment of human cells with a carcinogen. (author)

  3. 53BP1 mediates productive and mutagenic DNA repair through distinct phosphoprotein interactions

    DEFF Research Database (Denmark)

    Callen, E.; Wong, N.; Chen, H.-T.;

    2013-01-01

    The DNA damage response (DDR) protein 53BP1 protects DNA ends from excessive resection in G1, and thereby favors repair by nonhomologous end-joining (NHEJ) as opposed to homologous recombination (HR). During S phase, BRCA1 antagonizes 53BP1 to promote HR. The pro-NHEJ and antirecombinase functions...... productive CSR and suppresses mutagenic DNA repair through distinct phosphodependent interactions with RIF1 and PTIP. © 2013 Elsevier Inc....

  4. Formaldehyde catabolism is essential in cells deficient for the Fanconi anemia DNA-repair pathway.

    Science.gov (United States)

    Rosado, Ivan V; Langevin, Frédéric; Crossan, Gerry P; Takata, Minoru; Patel, Ketan J

    2011-11-13

    Metabolism is predicted to generate formaldehyde, a toxic, simple, reactive aldehyde that can damage DNA. Here we report a synthetic lethal interaction in avian cells between ADH5, encoding the main formaldehyde-detoxifying enzyme, and the Fanconi anemia (FA) DNA-repair pathway. These results define a fundamental role for the combined action of formaldehyde catabolism and DNA cross-link repair in vertebrate cell survival.

  5. Suppression of DNA-dependent protein kinase sensitize cells to radiation without affecting DSB repair

    Energy Technology Data Exchange (ETDEWEB)

    Gustafsson, Ann-Sofie, E-mail: ann-sofie.gustafsson@bms.uu.se; Abramenkovs, Andris; Stenerlöw, Bo

    2014-11-15

    Highlights: • We reduced the level of DNA-PKcs with siRNA and examined cells after γ-irradiation. • Low DNA-PKcs levels lead to radiosensitivity but did not affect repair of DSB. • Low DNA-PKcs levels may block progression of mitosis. • DNA-PKcs role in mitotic progression is independent of its role in DSB repair. • We suggest different mechanisms by which loss of DNA-PKcs function sensitize cells. - Abstract: Efficient and correct repair of DNA double-strand break (DSB) is critical for cell survival. Defects in the DNA repair may lead to cell death, genomic instability and development of cancer. The catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) is an essential component of the non-homologous end joining (NHEJ) which is the major DSB repair pathway in mammalian cells. In the present study, by using siRNA against DNA-PKcs in four human cell lines, we examined how low levels of DNA-PKcs affected cellular response to ionizing radiation. Decrease of DNA-PKcs levels by 80–95%, induced by siRNA treatment, lead to extreme radiosensitivity, similar to that seen in cells completely lacking DNA-PKcs and low levels of DNA-PKcs promoted cell accumulation in G2/M phase after irradiation and blocked progression of mitosis. Surprisingly, low levels of DNA-PKcs did not affect the repair capacity and the removal of 53BP1 or γ-H2AX foci and rejoining of DSB appeared normal. This was in strong contrast to cells completely lacking DNA-PKcs and cells treated with the DNA-PKcs inhibitor NU7441, in which DSB repair were severely compromised. This suggests that there are different mechanisms by which loss of DNA-PKcs functions can sensitize cells to ionizing radiation. Further, foci of phosphorylated DNA-PKcs (T2609 and S2056) co-localized with DSB and this was independent of the amount of DNA-PKcs but foci of DNA-PKcs was only seen in siRNA-treated cells. Our study emphasizes on the critical role of DNA-PKcs for maintaining survival after radiation exposure

  6. 1999 Gordon Research Conference on Mammalian DNA Repair. Final Progress Report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-02-12

    This Conference will examine DNA repair as the key component in genomic surveillance that is so crucial to the overall integrity and function of mammalian cells. Recent discoveries have catapulted the field of DNA repair into a pivotal position for fundamental investigations into oncology, aging, environmental health, and developmental biology. We hope to highlight the most promising and exciting avenues of research in robust discussions at this conference. This Mammalian DNA Repair Gordon Conference differs from the past conferences in this series, in which the programs were broader in scope, with respect to topics and biological systems covered. A conference sponsored by the Genetics Society in April 1998 emphasized recombinational mechanisms for double-strand break repair and the role of mismatch repair deficiency in colorectal cancer. These topics will therefore receive somewhat less emphasis in the upcoming Conference. In view of the recent mechanistic advances in mammalian DNA repair, an upcoming comprehensive DNA repair meeting next autumn at Hilton Head; and the limited enrollment for Gordon Conferences we have decided to focus session-by-session on particular areas of controversy and/or new developments specifically in mammalian systems. Thus, the principal presentations will draw upon results from other cellular systems only to the extent that they impact our understanding of mammalian DNA repair.

  7. The 2015 Nobel Prize in Chemistry The Discovery of Essential Mechanisms that Repair DNA Damage.

    Science.gov (United States)

    Lindahl, Tomas; Modrich, Paul; Sancar, Aziz

    2016-01-01

    The Royal Swedish Academy awarded the Nobel Prize in Chemistry for 2015 to Tomas Lindahl, Paul Modrich and Aziz Sancar for their discoveries in fundamental mechanisms of DNA repair. This pioneering research described three different essential pathways that correct DNA damage, safeguard the integrity of the genetic code to ensure its accurate replication through generations, and allow proper cell division. Working independently of each other, Tomas Lindahl, Paul Modrich and Aziz Sancar delineated the mechanisms of base excision repair, mismatch repair and nucleotide excision repair, respectively. These breakthroughs challenged and dismissed the early view that the DNA molecule was very stable, paving the way for the discovery of human hereditary diseases associated with distinct DNA repair deficiencies and a susceptibility to cancer. It also brought a deeper understanding of cancer as well as neurodegenerative or neurological diseases, and let to novel strategies to treat cancer.

  8. The 2015 Nobel Prize in Chemistry The Discovery of Essential Mechanisms that Repair DNA Damage.

    Science.gov (United States)

    Lindahl, Tomas; Modrich, Paul; Sancar, Aziz

    2016-01-01

    The Royal Swedish Academy awarded the Nobel Prize in Chemistry for 2015 to Tomas Lindahl, Paul Modrich and Aziz Sancar for their discoveries in fundamental mechanisms of DNA repair. This pioneering research described three different essential pathways that correct DNA damage, safeguard the integrity of the genetic code to ensure its accurate replication through generations, and allow proper cell division. Working independently of each other, Tomas Lindahl, Paul Modrich and Aziz Sancar delineated the mechanisms of base excision repair, mismatch repair and nucleotide excision repair, respectively. These breakthroughs challenged and dismissed the early view that the DNA molecule was very stable, paving the way for the discovery of human hereditary diseases associated with distinct DNA repair deficiencies and a susceptibility to cancer. It also brought a deeper understanding of cancer as well as neurodegenerative or neurological diseases, and let to novel strategies to treat cancer. PMID:27183258

  9. Cell-free assay measuring repair DNA synthesis in human fibroblasts

    International Nuclear Information System (INIS)

    Osmotic disruption of confluent cultured human fibroblasts that have been irradiated or exposed to chemical carcinogens allows the specific measurement of repair DNA synthesis using dTTP as a precursor. Fibroblasts similarly prepared from various xeroderma pigmentosum cell lines show the deficiencies of uv-induced DNA synthesis predicted from in vivo studies, while giving normal responses to methylmethanesulfonate. A pyrimidine-dimer-specific enzyme, T4 endonuclease V, stimulated the rate of uv-induced repair synthesis with normal and xeroderma pigmentosum cell lines. This system should prove useful for identifying agents that induce DNA repair, and cells that respond abnormally to such induction. It should also be applicable to an in vitro complementation assay with repair-defective cells and proteins obtained from repair-proficient cells. Finally, by using actively growing fibroblasts and thymidine in the system, DNA replication can be measured and studied in vitro

  10. RECQL4 Promotes DNA End Resection in Repair of DNA Double-Strand Breaks.

    Science.gov (United States)

    Lu, Huiming; Shamanna, Raghavendra A; Keijzers, Guido; Anand, Roopesh; Rasmussen, Lene Juel; Cejka, Petr; Croteau, Deborah L; Bohr, Vilhelm A

    2016-06-28

    The RecQ helicase RECQL4, mutated in Rothmund-Thomson syndrome, regulates genome stability, aging, and cancer. Here, we identify a crucial role for RECQL4 in DNA end resection, which is the initial and an essential step of homologous recombination (HR)-dependent DNA double-strand break repair (DSBR). Depletion of RECQL4 severely reduces HR-mediated repair and 5' end resection in vivo. RECQL4 physically interacts with MRE11-RAD50-NBS1 (MRN), which senses DSBs and initiates DNA end resection with CtIP. The MRE11 exonuclease regulates the retention of RECQL4 at laser-induced DSBs. RECQL4 also directly interacts with CtIP via its N-terminal domain and promotes CtIP recruitment to the MRN complex at DSBs. Moreover, inactivation of RECQL4's helicase activity impairs DNA end processing and HR-dependent DSBR without affecting its interaction with MRE11 and CtIP, suggesting an important role for RECQL4's unwinding activity in the process. Thus, we report that RECQL4 is an important participant in HR-dependent DSBR.

  11. DNA-PK-dependent RPA2 hyperphosphorylation facilitates DNA repair and suppresses sister chromatid exchange.

    Directory of Open Access Journals (Sweden)

    Hungjiun Liaw

    Full Text Available Hyperphosphorylation of RPA2 at serine 4 and serine 8 (S4, S8 has been used as a marker for activation of the DNA damage response. What types of DNA lesions cause RPA2 hyperphosphorylation, which kinase(s are responsible for them, and what is the biological outcome of these phosphorylations, however, have not been fully investigated. In this study we demonstrate that RPA2 hyperphosphorylation occurs primarily in response to genotoxic stresses that cause high levels of DNA double-strand breaks (DSBs and that the DNA-dependent protein kinase complex (DNA-PK is responsible for the modifications in vivo. Alteration of S4, S8 of RPA2 to alanines, which prevent phosphorylations at these sites, caused increased mitotic entry with concomitant increases in RAD51 foci and homologous recombination. Taken together, our results demonstrate that RPA2 hyperphosphorylation by DNA-PK in response to DSBs blocks unscheduled homologous recombination and delays mitotic entry. This pathway thus permits cells to repair DNA damage properly and increase cell viability.

  12. The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

    Science.gov (United States)

    Leem, S H; Ropp, P A; Sugino, A

    1994-08-11

    We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in DNA metabolism. The deletion strains did not exhibit UV-sensitivity. However, they did show weak sensitivity to MMS-treatment and exhibited a hyper-recombination phenotype when intragenic recombination was measured during meiosis. Furthermore, MAT alpha pol4 delta segregants had a higher frequency of illegitimate mating with a MAT alpha tester strain than that of wild-type cells. These results suggest that DNA polymerase IV participates in a double-strand break repair pathway. A 3.2kb of the POL4 transcript was weakly expressed in mitotically growing cells. During meiosis, a 2.2 kb POL4 transcript was greatly induced, while the 3.2 kb transcript stayed at constant levels. This induction was delayed in a swi4 delta strain during meiosis, while no effect was observed in a swi6 delta strain.

  13. Writers, Readers, and Erasers of Histone Ubiquitylation in DNA Double-Strand Break Repair

    DEFF Research Database (Denmark)

    Smeenk, Godelieve; Mailand, Niels

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions, whose faulty repair may alter the content and organization of cellular genomes. To counteract this threat, numerous signaling and repair proteins are recruited hierarchically to the chromatin areas surrounding DSBs to facilitate...... accurate lesion repair and restoration of genome integrity. In vertebrate cells, ubiquitin-dependent modifications of histones adjacent to DSBs by RNF8, RNF168, and other ubiquitin ligases have a key role in promoting the assembly of repair protein complexes, serving as direct recruitment platforms for a...... integrity, as well as cell and organismal fitness....

  14. FEN1 participates in repair of the 5'-phosphotyrosyl terminus of DNA single-strand breaks.

    Science.gov (United States)

    Kametani, Yukiko; Takahata, Chiaki; Narita, Takashi; Tanaka, Kiyoji; Iwai, Shigenori; Kuraoka, Isao

    2016-01-01

    Etoposide is a widely used anticancer drug and a DNA topoisomerase II (Top2) inhibitor. Etoposide produces Top2-attached single-strand breaks (Top2-SSB complex) and double-strand breaks (Top2-DSB complex) that are thought to induce cell death in tumor cells. The Top2-SSB complex is more abundant than the Top2-DSB complex. Human tyrosyl-DNA phosphodiesterase 2 (TDP2) is required for efficient repair of Top2-DSB complexes. However, the identities of the proteins involved in the repair of Top2-SSB complexes are unknown, although yeast genetic data indicate that 5' to 3' structure-specific DNA endonuclease activity is required for alternative repair of Top2 DNA damage. In this study, we purified a flap endonuclease 1 (FEN1) and xeroderma pigmentosum group G protein (XPG) in the 5' to 3' structure-specific DNA endonuclease family and synthesized single-strand break DNA substrates containing a 5'-phoshotyrosyl bond, mimicking the Top2-SSB complex. We found that FEN1 and XPG did not remove the 5'-phoshotyrosyl bond-containing DSB substrates but removed the 5'-phoshotyrosyl bond-containing SSB substrates. Under DNA repair conditions, FEN1 efficiently repaired the 5'-phoshotyrosyl bond-containing SSB substrates in the presence of DNA ligase and DNA polymerase. Therefore, FEN1 may play an important role in the repair of Top2-SSB complexes in etoposide-treated cells. PMID:26581212

  15. DNA double strand break damage by radiation and behavioral imaging of DNA repair enzymes

    International Nuclear Information System (INIS)

    The theme in the title is described mainly on authors' studies. Finding of a jellyfish GFP (green fluorescent protein) and its genomic recombination technique with a target protein have made it possible to investigate the behavior of the protein (the repair enzymes in this review) within a cell by fluorescent microscopy. Double strand breaks (DSBs), the most severe damage of DNA leading to cell death and carcinogenesis, are induced by irradiation of ionizing radiation and/or ultraviolet light, and repair mechanisms of non homologous end-joining and homologous recombinant repair are known major in mammalian cells and in lower eukaryotes, respectively. Authors used UVA for inducing DSBs under the presence of benzo[a]pyrene in mammalian cells like Chinese hamster ovary (CHO)-K1 and xrs-5, the behaviors of Ku70/80 repair molecules tagged by GFP were imaged by confocal laser microscopy, and one of findings was that Ku80 moved to the level most intensely irradiated. Fluorescent molecular imaging technique will be employed widely in clinical diagnosis and new drug development as well as in basic bioscience. (S.I.)

  16. Responding to chromosomal breakage during M-phase: insights from a cell-free system

    Directory of Open Access Journals (Sweden)

    Costanzo Vincenzo

    2009-07-01

    Full Text Available Abstract DNA double strand breaks (DSBs activate ATM and ATR dependent checkpoints that prevent the onset of mitosis. However, how cells react to DSBs occurring when they are already in mitosis is poorly understood. The Xenopus egg extract has been utilized to study cell cycle progression and DNA damage checkpoints. Recently this system has been successfully used to uncover an ATM and ATR dependent checkpoint affecting centrosome driven spindle assembly. These studies have led to the identification of XCEP63 as major target of this pathway. XCEP63 is a coiled-coil rich protein localized at centrosome essential for proper spindle assembly. ATM and ATR directly phosphorylate XCEP63 on serine 560 inducing its delocalization from centrosome, which in turn delays spindle assembly. This pathway might contribute to regulate DNA repair or mitotic cell survival in the presence of chromosome breakage.

  17. Production, Purification, and Characterization of 15N-Labeled DNA Repair Proteins as Internal Standards for Mass Spectrometric Measurements

    Science.gov (United States)

    Jaruga, Pawel; Nelson, Bryant C.; Lowenthal, Mark S.; Jemth, Ann-Sofie; Loseva, Olga; Coskun, Erdem; Helleday, Thomas

    2016-01-01

    Oxidatively induced DNA damage is caused in living organisms by a variety of damaging agents, resulting in the formation of a multiplicity of lesions, which are mutagenic and cytotoxic. Unless repaired by DNA repair mechanisms before DNA replication, DNA lesions can lead to genomic instability, which is one of the hallmarks of cancer. Oxidatively induced DNA damage is mainly repaired by base excision repair pathway with the involvement of a plethora of proteins. Cancer tissues develop greater DNA repair capacity than normal tissues by overexpressing DNA repair proteins. Increased DNA repair in tumors that removes DNA lesions generated by therapeutic agents before they became toxic is a major mechanism in the development of therapy resistance. Evidence suggests that DNA repair capacity may be a predictive biomarker of patient response. Thus, knowledge of DNA–protein expressions in disease-free and cancerous tissues may help predict and guide development of treatments and yield the best therapeutic response. Our laboratory has developed methodologies that use mass spectrometry with isotope dilution for the measurement of expression of DNA repair proteins in human tissues and cultured cells. For this purpose, full-length 15N-labeled analogs of a number of human DNA repair proteins have been produced and purified to be used as internal standards for positive identification and accurate quantification. This chapter describes in detail the protocols of this work. The use of 15N-labeled proteins as internal standards for the measurement of several DNA repair proteins in vivo is also presented. PMID:26791985

  18. Microhomology-mediated end joining is the principal mediator of double-strand break repair during mitochondrial DNA lesions

    OpenAIRE

    Tadi, Satish Kumar; Sebastian, Robin; Dahal, Sumedha; Babu, Ravi K.; Choudhary, Bibha; Raghavan, Sathees C.

    2016-01-01

    Mitochondrial DNA (mtDNA) deletions are associated with various mitochondrial disorders. The deletions identified in humans are flanked by short, directly repeated mitochondrial DNA sequences; however, the mechanism of such DNA rearrangements has yet to be elucidated. In contrast to nuclear DNA (nDNA), mtDNA is more exposed to oxidative damage, which may result in double-strand breaks (DSBs). Although DSB repair in nDNA is well studied, repair mechanisms in mitochondria are not characterized....

  19. Beyond repair foci: DNA double-strand break repair in euchromatic and heterochromatic compartments analyzed by transmission electron microscopy.

    Directory of Open Access Journals (Sweden)

    Yvonne Lorat

    Full Text Available PURPOSE: DNA double-strand breaks (DSBs generated by ionizing radiation pose a serious threat to the preservation of genetic and epigenetic information. The known importance of local chromatin configuration in DSB repair raises the question of whether breaks in different chromatin environments are recognized and repaired by the same repair machinery and with similar efficiency. An essential step in DSB processing by non-homologous end joining is the high-affinity binding of Ku70-Ku80 and DNA-PKcs to double-stranded DNA ends that holds the ends in physical proximity for subsequent repair. METHODS AND MATERIALS: Using transmission electron microscopy to localize gold-labeled pKu70 and pDNA-PKcs within nuclear ultrastructure, we monitored the formation and repair of actual DSBs within euchromatin (electron-lucent and heterochromatin (electron-dense in cortical neurons of irradiated mouse brain. RESULTS: While DNA lesions in euchromatin (characterized by two pKu70-gold beads, reflecting the Ku70-Ku80 heterodimer are promptly sensed and rejoined, DNA packaging in heterochromatin appears to retard DSB processing, due to the time needed to unravel higher-order chromatin structures. Complex pKu70-clusters formed in heterochromatin (consisting of 4 or ≥ 6 gold beads may represent multiple breaks in close proximity caused by ionizing radiation of highly-compacted DNA. All pKu70-clusters disappeared within 72 hours post-irradiation, indicating efficient DSB rejoining. However, persistent 53BP1 clusters in heterochromatin (comprising ≥ 10 gold beads, occasionally co-localizing with γH2AX, but not pKu70 or pDNA-PKcs, may reflect incomplete or incorrect restoration of chromatin structure rather than persistently unrepaired DNA damage. DISCUSSION: Higher-order organization of chromatin determines the accessibility of DNA lesions to repair complexes, defining how readily DSBs are detected and processed. DNA lesions in heterochromatin appear to be more

  20. Using the comet assay to study DNA repair: progress in the past decade.

    Directory of Open Access Journals (Sweden)

    Sabine Langie

    2015-06-01

    Full Text Available The comet assay is a versatile and sensitive method for measuring strand breaks in DNA. The first paper on this single-cell gel electrophoresis assay was published in 1984 by Ostling and Johanson (1984. This assay (with and without inclusion of lesion-specific enzymes is widely used as a biomarker assay in human population studies - primarily to measure DNA damage, but increasingly also to assess the capacity of cells for DNA repair. Ostling and Johanson were also the first to report experiments to measure DNA repair, by simply following the decrease of DNA damage over time after challenging cells with ionising radiation. However, this approach is time-consuming and laborious, and therefore not ideal for biomonitoring studies, which typically require high-throughput processing of many samples. As an alternative approach, the in vitro comet-based repair assay was developed: a cell extract is incubated with a DNA substrate containing specific lesions, and DNA incisions accumulate. The in vitro comet-based repair assay was first devised to measure base excision repair in lymphocytes (Collins et al., 2001. However, over the past decade it has been modified and improved to study incision of other lesions and thus other repair pathways, as well as being applied to tissue samples in addition to cell suspensions. The application of the in vitro repair assay in dietary intervention, environmental biomonitoring and animal studies will be discussed.

  1. DNA polymerase I-mediated ultraviolet repair synthesis in toluene-treated Escherichia coli

    International Nuclear Information System (INIS)

    DNA synthesis after ultraviolet irradiation is low in wild type toluene-treated cells. The level of repair incorporation is greater in strains deficient in DNA polymerase I. The low level of repair synthesis is attributable to the concerted action of DNA polymerase I and polynucleotide ligase. Repair synthesis is stimulated by blocking ligase activity with the addition of nicotinamide mononucleotide (NMN) or the use of a ligase temperature-sensitive mutant. NMN stimulation is specific for DNA polymerase I-mediated repair synthesis, as it is absent in isogenic strains deficient in the polymerase function or the 5' yields 3' exonuclease function associated with DNA polymerase I. DNA synthesis that is stimulated by NMN is proportional to the ultraviolet exposure at low doses, nonconservative in nature, and is dependent on the uvrA gene product but is independent of the recA gene product. These criteria place this synthesis in the excision repair pathway. The NMN-stimulated repair synthesis requires ATP and is N-ethylmaleimide-resistant. The use of NMN provides a direct means for evaluating the involvement of DNA polymerase I in excision repair

  2. How to Relate Complex DNA Repair Genotypes to Pathway Function and, Ultimately, Health Risk

    Energy Technology Data Exchange (ETDEWEB)

    Jones, IM

    2002-01-09

    Exposure to ionizing radiation increases the incidence of cancer. However, predicting which individuals are at most risk from radiation exposure is a distant goal. Predictive ability is needed to guide policies that regulate radiation exposure and ensure that medical treatments have maximum benefit and minimum risk. Differences between people in susceptibility to radiation are largely based on their genotype, the genes inherited from their parents. Among the important genes are those that produce proteins that repair DNA damaged by radiation. Base Excision Repair (BER) proteins repair single strand breaks and oxidized bases in DNA. Double Strand Break Repair proteins repair broken chromosomes. Using technologies and information from the Human Genome Project, we have previously determined that the DNA sequence of DNA repair genes varies within the human population. An average of 3-4 different variants were found that affect the protein for each of 37 genes studied. The average frequency of these variants is 5%. Given the many genes in each DNA repair pathway and their many variants, technical ability to determine an individual's repair genotype greatly exceeds ability to interpret the information. A long-term goal is to relate DNA repair genotypes to health risk from radiation. This study focused on the BER pathway. The BER genes are known, variants of the genes have been identified at LLNL, and LLNL had recently developed an assay for BER function using white blood cells. The goal of this initial effort was to begin developing data that could be used to test the hypothesis that many different genotypes have similar DNA repair capacity phenotypes (function). Relationships between genotype and phenotype could then be used to group genotypes with similar function and ultimately test the association of groups of genotypes with health risk from radiation. Genotypes with reduced repair function are expected to increase risk of radiation-induced health effects. The

  3. Targeting DNA repair, DNA metabolism and replication stress as anti-cancer strategies.

    Science.gov (United States)

    Puigvert, Jordi Carreras; Sanjiv, Kumar; Helleday, Thomas

    2016-01-01

    Anti-cancer therapies targeting and damaging the DNA have been extensively used in the last 50 years since the discovery of nitrogen mustards, antimetabolites and platin agents. The use of these drugs is often limited by dose-limiting side effects related to their poor specificity. In recent years, much effort has been put on the discovery and development of compounds that would exploit defects in DNA repair in cancer cells such as Wee1, Chk1 or PARP1 inhibitors. However, not all cancers respond to these inhibitors. Recently, new developments towards specifically targeting broader characteristics of cancer such as replication stress (RS) and lost redox homeostasis have emerged. Oncogenes induce proliferation signals, which also result in replication-associated DNA damage, i.e. RS. Our knowledge into overall causes of RS, lesions produced and how these are signalled in cells to activate cell cycle checkpoints is evolving. Inhibition of ATR, which would normally keep non-deleterious levels of RS, induces intolerable RS levels for cancer cells. Interestingly, links between replication and transcription appear to underlie RS along with a reduction of the dNTP pool. Remarkably, sanitization of the dNTP pool by MutT homologue 1, impeding incorporation of oxidized dNTPs into the DNA, seems to be crucial for cancer cell survival. In this minireview we present an overview of current and novel strategies to target DNA repair and exploit DNA damage to treat cancer. We present the current models for cancer-associated RS as well as cancer phenotypic lethality. Both strategies are poised to better target cancer cells and reduce side effects. PMID:26507796

  4. Polyphenolic compounds from Salvia species protect cellular DNA from oxidation and stimulate DNA repair in cultured human cells.

    Science.gov (United States)

    Ramos, Alice A; Azqueta, Amaya; Pereira-Wilson, Cristina; Collins, Andrew R

    2010-06-23

    DNA damage can lead to carcinogenesis if replication proceeds without proper repair. This study evaluated the effects of the water extracts of three Salvia sp., Salvia officinalis (SO), Salvia fruticosa (SF), and Salvia lavandulifolia (SL), and of the major phenolic constituents, rosmarinic acid (RA) and luteolin-7-glucoside (L-7-G), on DNA protection in Caco-2 and HeLa cells exposed to oxidative agents and on DNA repair in Caco-2 cells. The comet assay was used to measure DNA damage and repair capacity. The final concentration of each sage extract was 50 microg/mL, and concentrations of RA and L-7-G were 50 and 20 microM, respectively. After a short incubation (2 h), L-7-G protected DNA in Caco-2 cells from damage induced by H(2)O(2) (75 microM); also, after a long incubation (24 h), SF, RA, and L-7-G had protective effects in Caco-2 cells. In HeLa cells, SO, SF, and RA protected against damage induced by H(2)O(2) after 24 h of incubation. Assays of DNA repair show that SO, SF, and L-7-G increased the rate of DNA repair (rejoining of strand breaks) in Caco-2 cells treated with H(2)O(2). The incision activity of a Caco-2 cell extract on a DNA substrate containing specific damage (8-oxoGua) was also measured to evaluate effects on base excision repair (BER) activity. Preincubation for 24 h with SO and L-7-G had a BER inductive effect, increasing incision activity in Caco-2 cells. In conclusion, SO, SF, and the isolated compounds (RA and L-7-G) demonstrated chemopreventive activity by protecting cells against oxidative DNA damage and stimulating DNA repair (SO, SF, and L-7-G). PMID:20486687

  5. Analysis of DNA double-strand break repair pathways in mice

    International Nuclear Information System (INIS)

    During the last years significant new insights have been gained into the mechanism and biological relevance of DNA double-strand break (DSB) repair in relation to genome stability. DSBs are a highly toxic DNA lesion, because they can lead to chromosome fragmentation, loss and translocations, eventually resulting in cancer. DSBs can be induced by cellular processes such as V(D)J recombination or DNA replication. They can also be introduced by exogenous agents DNA damaging agents such as ionizing radiation or mitomycin C. During evolution several pathways have evolved for the repair of these DSBs. The most important DSB repair mechanisms in mammalian cells are nonhomologous end-joining and homologous recombination. By using an undamaged repair template, homologous recombination ensures accurate DSB repair, whereas the untemplated nonhomologous end-joining pathway does not. Although both pathways are active in mammals, the relative contribution of the two repair pathways to genome stability differs in the different cell types. Given the potential differences in repair fidelity, it is of interest to determine the relative contribution of homologous recombination and nonhomologous end-joining to DSB repair. In this review, we focus on the biological relevance of DSB repair in mammalian cells and the potential overlap between nonhomologous end-joining and homologous recombination in different tissues

  6. Influence of XRCC1 Genetic Polymorphisms on Ionizing Radiation-Induced DNA Damage and Repair

    Directory of Open Access Journals (Sweden)

    Silvia Sterpone

    2010-01-01

    Full Text Available It is well known that ionizing radiation (IR can damage DNA through a direct action, producing single- and double-strand breaks on DNA double helix, as well as an indirect effect by generating oxygen reactive species in the cells. Mammals have evolved several and distinct DNA repair pathways in order to maintain genomic stability and avoid tumour cell transformation. This review reports important data showing a huge interindividual variability on sensitivity to IR and in susceptibility to developing cancer; this variability is principally represented by genetic polymorphisms, that is, DNA repair gene polymorphisms. In particular we have focussed on single nucleotide polymorphisms (SNPs of XRCC1, a gene that encodes for a scaffold protein involved basically in Base Excision Repair (BER. In this paper we have reported and presented recent studies that show an influence of XRCC1 variants on DNA repair capacity and susceptibility to breast cancer.

  7. Capacity of ultraviolet-induced DNA repair in human glioma cells

    International Nuclear Information System (INIS)

    A DNA repair abnormality is likely related to an increased incidence of neoplasms in several autosomal recessive diseases such as xeroderma pigmentosum, Fanconi's anemia, Bloom's syndrome and ataxia telangiectasia. In human glioma cells, however, there are only a few reports on DNA repair. In this study, an ultraviolet (UV)-induced DNA repair was examined systematically in many human glioma cells. Two human malignant glioma cell lines (MMG-851, U-251-MG) and 7 human glioma cell strains (4, benign; 3, malignant) of short term culture, in which glial fibrillary acidic protein (GFAP) staining were positive, were used. To investigate the capacity of DNA repair, UV sensitivity was determined by colony formation; excision repair by autoradiography and Cytosine Arabinoside (Ara-C) assay; and post-replication repair by the joining rate of newly synthesized DNA. As a result, the colony-forming abilities of malignant glioma cell lines were lower than those of normal human fibroblasts, but no difference was found between two malignant glioma cell lines. The excision repair of the malignant group (2 cell lines and 3 cell strains) was apparently lower than that of the benign group (4 cell strains). In two malignant glioma cell lines, the excision repair of MMG-851 was lower than that of U-251-MG, and the post-replication repair of MMG-851 was higher than that of U-251-MG. These results were considered to correspond well with colony-forming ability. The results indicate that there are some differences in each human malignant glioma cell in its UV-induced DNA repair mechanism, and that the excision repair of the malignant glioma cells is apparently lower than that of the benign glioma cells. These findings may be useful for diagnosis and treatment. (author)

  8. DNA Repair Glycosylases with a [4Fe-4S] Cluster: A Redox Cofactor for DNA-mediated Charge Transport?

    OpenAIRE

    Boal, Amie K.; Yavin, Eylon; Barton, Jacqueline K.

    2007-01-01

    The [4Fe-4S] cluster is ubiquitous to a class of base excision repair enzymes, in organisms ranging from bacteria to man, and was first considered as a structural element, owing to its redox stability under physiological conditions. When studied bound to DNA, two of these repair proteins (MutY and Endonuclease III from Escherichia coli) display DNA-dependent reversible electron transfer with characteristics typical of high potential iron proteins. These results have inspired a reexamination o...

  9. Effect of Wortmannin on the repair profiles of DNA double-strand breaks in the whole genome and in interstitial telomeric sequences of Chinese hamster cells

    International Nuclear Information System (INIS)

    The DNA breakage detection-fluorescence in situ hybridization (DBD-FISH) procedure was applied to analyze the effect of Wortmannin (WM) in the rejoining kinetics of ionizing radiation-induced DNA double-strand breaks (DSBs) in the whole genome and in the long interstitial telomeric repeat sequence (ITRS) blocks from Chinese hamster cell lines. The results indicate that the ITRS blocks from wild-type Chinese hamster cell lines, CHO9 and V79B, exhibit a slower initial rejoining rate of ionizing radiation-induced DSBs than the genome overall. Neither Rad51C nor the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) activities, involved in homologous recombination (HR) and in non-homologous end-joining (NHEJ) pathways of DSB repair respectively, influenced the rejoining kinetics within ITRS in contrast to DNA sequences in the whole genome. Nevertheless, DSB removal rate within ITRS was decreased in the absence of Ku86 activity, though at a lower affectation level than in the whole genome, thus homogenizing both rejoining kinetics rates. WM treatment slowed down the DSB rejoining kinetics rate in ITRS, this effect being more pronounced in the whole genome, resulting in a similar pattern to that of the Ku86 deficient cells. In fact, no WM effect was detected in the Ku86 deficient Chinese hamster cells, so probably WM does not add further impairment in DSB rejoining than that resulted as a consequence of absence of Ku activity. The same slowing effect was also observed after treatment of Rad51C and DNA-PKcs defective hamster cells by WM, suggesting that: (1) there is no potentiation of the HR when the NHEJ is impaired by WM, either in the whole genome or in the ITRS, and (2) that this impairment may probably involve more targets than DNA-PKcs. These results suggest that there is an intragenomic heterogeneity in DSB repair, as well as in the effect of WM on this process

  10. Postreplication repair in ultraviolet-irradiated human fibroblasts: formation and repair of DNA double-strand breaks

    International Nuclear Information System (INIS)

    A neutral filter elution assay was used to determine if the post-replicational formation and repair of DNA double-strand breaks (DSB) occurs in u.v.-irradiated human cells. Excision-deficient XP12 cells were pulse-labeled with [3H]thymidine after u.v. irradiation (1.5-3J/m2), and the nascent DNA was followed during repair incubation. With increasing u.v. radiation fluences, an increasing fraction of DNA was eluted at a fast rate, indicating that DSB were produced. The maximum yield DSB was observed after about 24 h of post-irradiation incubation at 370C. Similar results were also obtained with repair-proficient VA13 cells when irradiated at much higher fluences (7.5-15J/m2). It is concluded that, at the u.v. radiation fluences used, the DSB produced in u.v.-irradiated human cells are the result of post-replication repair events, and at incubation times >24 h some of these DSB are repaired. (author)

  11. Mutagenic roles of DNA "repair" proteins in antibody diversity and disease-associated trinucleotide repeat instability.

    Science.gov (United States)

    Slean, Meghan M; Panigrahi, Gagan B; Ranum, Laura P; Pearson, Christopher E

    2008-07-01

    While DNA repair proteins are generally thought to maintain the integrity of the whole genome by correctly repairing mutagenic DNA intermediates, there are cases where DNA "repair" proteins are involved in causing mutations instead. For instance, somatic hypermutation (SHM) and class switch recombination (CSR) require the contribution of various DNA repair proteins, including UNG, MSH2 and MSH6 to mutate certain regions of immunoglobulin genes in order to generate antibodies of increased antigen affinity and altered effector functions. Another instance where "repair" proteins drive mutations is the instability of gene-specific trinucleotide repeats (TNR), the causative mutations of numerous diseases including Fragile X mental retardation syndrome (FRAXA), Huntington's disease (HD), myotonic dystrophy (DM1) and several spinocerebellar ataxias (SCAs) all of which arise via various modes of pathogenesis. These healthy and deleterious mutations that are induced by repair proteins are distinct from the genome-wide mutations that arise in the absence of repair proteins: they occur at specific loci, are sensitive to cis-elements (sequence context and/or epigenetic marks) and transcription, occur in specific tissues during distinct developmental windows, and are age-dependent. Here we review and compare the mutagenic role of DNA "repair" proteins in the processes of SHM, CSR and TNR instability.

  12. Recent progress with the DNA repair mutants of Chinese hamster ovary cells

    International Nuclear Information System (INIS)

    Repair deficient mutants of Chinese hamster ovary (CHO) cells are being used to identify human genes that correct the repair defects and to study mechanisms of DNA repair and mutagenesis. Five independent tertiary DNA transformants were obtained from the EM9 mutant. In these clones a human DNA sequence was identified that correlated with the resistance of the cells to CldUrd. After Eco RI digestion, Southern transfer, and hybridization of transformant DNAs with the BLUR-8 Alu family sequence, a common fragment of 25 to 30 kb was present. 37 refs., 4 figs., 3 tabs

  13. Repair of ultraviolet-irradiated transforming DNA in A recA mutant of Haemophilus influenzae

    Energy Technology Data Exchange (ETDEWEB)

    Stuy, J.H.; Walter, R.B. (Florida State Univ., Tallahassee (USA). Dept. of Biological Science)

    1983-04-01

    Ultraviolet-irradiated transforming DNA was assayed on a wild-type strain of Haemophilus influenzae strain Rd, on an excision repair-deficient (uvr-2) mutant, on a recombination repair-deficient (recA4) mutant, and on a strain carrying both mutations. The donor DNA had a point mutation genetic marker (strAl) and a long nonhomologous plasmid-derived DNA segment inserted in the HPl prophage. The shape of the inactivation curves suggested that only recombination was responsible for the inverse square root kinetics observed with excision repair-proficient recipients.

  14. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    Energy Technology Data Exchange (ETDEWEB)

    Ganesan, Shanthi, E-mail: shanthig@iastate.edu; Keating, Aileen F., E-mail: akeating@iastate.edu

    2015-02-01

    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  15. Individual sensitivity to radiations and DNA repair proficiency: the comet assay contribution

    International Nuclear Information System (INIS)

    Some are hereditary syndromes demonstrate high cancer risk and hypersensitivity in response to exposures to agents such as ultraviolet or ionising radiation, and are characterized by a defective processing of DNA damage. They highlight the importance of the individual risk associated to exposures. The comet assay, a simple technique that detects DNA strand breaks, requires few cells and allows examination of DNA repair capacities in established cell lines, in blood samples or biopsies. The assay has been validated on cellular systems with known repair defects such as xeroderma pigmentosum defective in nucleotide excision repair, on mutant rodent cell lines defective in DNA single strand breaks rejoining (XRCC5/Ku80 and XRCC7/DNAPKcs) (neutral conditions). This assay does not allow to distinguish a defective phenotype in ataxia telangiectasia cells. It shows in homozygous mouse embryo fibroblasts Brca2-/- an impaired DNA double strand break rejoining. Simplicity, rapidity and sensitivity of the alkaline comet assay allow to examine the response of lymphocytes. It has been applied to the analysis of the role of DNA repair in the pathogenesis of collagen diseases, and the involvement of individual DNA repair proficiency in the thyroid tumorigenesis induced in some patients after therapeutic irradiation at childhood has been questioned. Preliminary results of these studies suggest that this type of approach could help for adapting treatment modalities and surveillance in subgroups of patients defective in DNA repair process. It could also have some incidence in the radioprotection field. (author)

  16. ATP–stimulated DNA–mediated Redox Signaling by XPD, a DNA Repair and Transcription Helicase

    OpenAIRE

    Mui, Timothy P.; Fuss, Jill O.; Ishida, Justin P.; Tainer, John A.; Barton, Jacqueline K.

    2011-01-01

    Using DNA-modified electrodes, we show DNA-mediated signaling by XPD, a helicase that contains a [4Fe-4S] cluster and is critical for nucleotide excision repair and transcription. The DNA-mediated redox signal resembles that of base excision repair proteins, with a DNA-bound redox potential of ~80 mV versus NHE. Significantly, this signal increases with ATP hydrolysis. Moreover, the redox signal is substrate-dependent, reports on the DNA conformational changes associated with enzymatic functi...

  17. HIV-1 and HIV-2 exhibit divergent interactions with HLTF and UNG2 DNA repair proteins.

    Science.gov (United States)

    Hrecka, Kasia; Hao, Caili; Shun, Ming-Chieh; Kaur, Sarabpreet; Swanson, Selene K; Florens, Laurence; Washburn, Michael P; Skowronski, Jacek

    2016-07-01

    HIV replication in nondividing host cells occurs in the presence of high concentrations of noncanonical dUTP, apolipoprotein B mRNA-editing, enzyme-catalytic, polypeptide-like 3 (APOBEC3) cytidine deaminases, and SAMHD1 (a cell cycle-regulated dNTP triphosphohydrolase) dNTPase, which maintains low concentrations of canonical dNTPs in these cells. These conditions favor the introduction of marks of DNA damage into viral cDNA, and thereby prime it for processing by DNA repair enzymes. Accessory protein Vpr, found in all primate lentiviruses, and its HIV-2/simian immunodeficiency virus (SIV) SIVsm paralogue Vpx, hijack the CRL4(DCAF1) E3 ubiquitin ligase to alleviate some of these conditions, but the extent of their interactions with DNA repair proteins has not been thoroughly characterized. Here, we identify HLTF, a postreplication DNA repair helicase, as a common target of HIV-1/SIVcpz Vpr proteins. We show that HIV-1 Vpr reprograms CRL4(DCAF1) E3 to direct HLTF for proteasome-dependent degradation independent from previously reported Vpr interactions with base excision repair enzyme uracil DNA glycosylase (UNG2) and crossover junction endonuclease MUS81, which Vpr also directs for degradation via CRL4(DCAF1) E3. Thus, separate functions of HIV-1 Vpr usurp CRL4(DCAF1) E3 to remove key enzymes in three DNA repair pathways. In contrast, we find that HIV-2 Vpr is unable to efficiently program HLTF or UNG2 for degradation. Our findings reveal complex interactions between HIV-1 and the DNA repair machinery, suggesting that DNA repair plays important roles in the HIV-1 life cycle. The divergent interactions of HIV-1 and HIV-2 with DNA repair enzymes and SAMHD1 imply that these viruses use different strategies to guard their genomes and facilitate their replication in the host. PMID:27335459

  18. Neil3 DNA Glycosylase in Maintenance and Repair of the Mammalian Brain

    OpenAIRE

    2012-01-01

    The DNA molecule is susceptible to damage induced by cellular metabolites and exogenous DNA damaging agents. Reactive oxygen species (ROS), generated as respiration by-products or arising from inflammatory reactions, are the most abundant endogenous DNA damaging agents and lead to the formation of a number of mutagenic and cytotoxic DNA lesions. To preserve DNA integrity and allow correct transmission of genetic information, several pathways for the repair of such lesions have evolved. Among ...

  19. Mitochondrial Targeted Endonuclease III DNA Repair Enzyme Protects against Ventilator Induced Lung Injury in Mice

    OpenAIRE

    Masahiro Hashizume; Marc Mouner; Joshua M. Chouteau; Gorodnya, Olena M.; Ruchko, Mykhaylo V.; Wilson, Glenn L.; Gillespie, Mark N.; Parker, James C.

    2014-01-01

    The mitochondrial targeted DNA repair enzyme, 8-oxoguanine DNA glycosylase 1, was previously reported to protect against mitochondrial DNA (mtDNA) damage and ventilator induced lung injury (VILI). In the present study we determined whether mitochondrial targeted endonuclease III (EndoIII) which cleaves oxidized pyrimidines rather than purines from damaged DNA would also protect the lung. Minimal injury from 1 h ventilation at 40 cmH2O peak inflation pressure (PIP) was reversed by EndoIII pret...

  20. DNA damage and gene therapy of xeroderma pigmentosum, a human DNA repair-deficient disease

    Energy Technology Data Exchange (ETDEWEB)

    Dupuy, Aurélie [Laboratory of Genetic Instability and Oncogenesis UMR8200CNRS, Institut Gustave Roussy and University Paris-Sud, Villejuif (France); Sarasin, Alain, E-mail: alain.sarasin@gustaveroussy.fr [Laboratory of Genetic Instability and Oncogenesis UMR8200CNRS, Institut Gustave Roussy and University Paris-Sud, Villejuif (France); Service de Génétique, Institut Gustave Roussy (France)

    2015-06-15

    Graphical abstract: - Highlights: • Full correction of mutation in the XPC gene by engineered nucleases. • Meganucleases and TALENs are inhibited by 5-MeC for inducing double strand breaks. • Gene therapy of XP cells is possible using homologous recombination for DSB repair. - Abstract: Xeroderma pigmentosum (XP) is a genetic disease characterized by hypersensitivity to ultra-violet and a very high risk of skin cancer induction on exposed body sites. This syndrome is caused by germinal mutations on nucleotide excision repair genes. No cure is available for these patients except a complete protection from all types of UV radiations. We reviewed the various techniques to complement or to correct the genetic defect in XP cells. We, particularly, developed the correction of XP-C skin cells using the fidelity of the homologous recombination pathway during repair of double-strand break (DSB) in the presence of XPC wild type sequences. We used engineered nucleases (meganuclease or TALE nuclease) to induce a DSB located at 90 bp of the mutation to be corrected. Expression of specific TALE nuclease in the presence of a repair matrix containing a long stretch of homologous wild type XPC sequences allowed us a successful gene correction of the original TG deletion found in numerous North African XP patients. Some engineered nucleases are sensitive to epigenetic modifications, such as cytosine methylation. In case of methylated sequences to be corrected, modified nucleases or demethylation of the whole genome should be envisaged. Overall, we showed that specifically-designed TALE-nuclease allowed us to correct a 2 bp deletion in the XPC gene leading to patient's cells proficient for DNA repair and showing normal UV-sensitivity. The corrected gene is still in the same position in the human genome and under the regulation of its physiological promoter. This result is a first step toward gene therapy in XP patients.

  1. DNA damage and gene therapy of xeroderma pigmentosum, a human DNA repair-deficient disease

    International Nuclear Information System (INIS)

    Graphical abstract: - Highlights: • Full correction of mutation in the XPC gene by engineered nucleases. • Meganucleases and TALENs are inhibited by 5-MeC for inducing double strand breaks. • Gene therapy of XP cells is possible using homologous recombination for DSB repair. - Abstract: Xeroderma pigmentosum (XP) is a genetic disease characterized by hypersensitivity to ultra-violet and a very high risk of skin cancer induction on exposed body sites. This syndrome is caused by germinal mutations on nucleotide excision repair genes. No cure is available for these patients except a complete protection from all types of UV radiations. We reviewed the various techniques to complement or to correct the genetic defect in XP cells. We, particularly, developed the correction of XP-C skin cells using the fidelity of the homologous recombination pathway during repair of double-strand break (DSB) in the presence of XPC wild type sequences. We used engineered nucleases (meganuclease or TALE nuclease) to induce a DSB located at 90 bp of the mutation to be corrected. Expression of specific TALE nuclease in the presence of a repair matrix containing a long stretch of homologous wild type XPC sequences allowed us a successful gene correction of the original TG deletion found in numerous North African XP patients. Some engineered nucleases are sensitive to epigenetic modifications, such as cytosine methylation. In case of methylated sequences to be corrected, modified nucleases or demethylation of the whole genome should be envisaged. Overall, we showed that specifically-designed TALE-nuclease allowed us to correct a 2 bp deletion in the XPC gene leading to patient's cells proficient for DNA repair and showing normal UV-sensitivity. The corrected gene is still in the same position in the human genome and under the regulation of its physiological promoter. This result is a first step toward gene therapy in XP patients

  2. Non-DBS DNA Repair Genes Regulate Radiation-induced Cytogenetic Damage Repair and Cell Cycle Progression

    Science.gov (United States)

    Zhang, Ye; Rohde, Larry H.; Emami, Kamal; Casey, Rachael; Wu, Honglu

    2008-01-01

    Changes of gene expression profile are one of the most important biological responses in living cells after ionizing radiation (IR) exposure. Although some studies have shown that genes up-regulated by IR may play important roles in DNA damage repair, the relationship between the regulation of gene expression by IR, particularly genes not known for their roles in DSB repair, and its impact on cytogenetic responses has not been systematically studied. In the present study, the expression of 25 genes selected on the basis of their transcriptional changes in response to IR was individually knocked down by transfection with small interfering RNA in human fibroblast cells. The purpose of this study is to identify new roles of these selected genes on regulating DSB repair and cell cycle progression , as measured in the micronuclei formation and chromosome aberration. In response to IR, the formation of MN was significantly increased by suppressed expression of 5 genes: Ku70 in the DSB repair pathway, XPA in the NER pathway, RPA1 in the MMR pathway, and RAD17 and RBBP8 in cell cycle control. Knocked-down expression of 4 genes (MRE11A, RAD51 in the DSB pathway, SESN1, and SUMO1) significantly inhibited cell cycle progression, possibly because of severe impairment of DNA damage repair. Furthermore, loss of XPA, P21, or MLH1 expression resulted in both significantly enhanced cell cycle progression and increased yields of chromosome aberrations, indicating that these gene products modulate both cell cycle control and DNA damage repair. Most of the 11 genes that affected cytogenetic responses are not known to have clear roles influencing DBS repair. Nine of these 11 genes were up-regulated in cells exposed to gamma radiation, suggesting that genes transcriptionally modulated by IR were critical to regulate the biological consequences after IR.

  3. Functional evaluation of DNA repair in human biopsies and their relation to other cellular biomarkers

    Directory of Open Access Journals (Sweden)

    Jana eSlyskova

    2014-05-01

    Full Text Available Thousands of DNA lesions are estimated to occur in each cell every day and almost all are recognized and repaired. DNA repair is an essential system that prevents accumulation of mutations which can lead to serious cellular malfunctions. Phenotypic evaluation of DNA repair activity of individuals is a relatively new approach. Methods to assess base and nucleotide excision repair pathways (BER and NER in peripheral blood cells based on modified comet assay protocols have been widely applied in human epidemiological studies. These provided some interesting observations of individual DNA repair activity being suppressed among cancer patients. However, extension of these results to cancer target tissues requires a different approach. Here we describe the evaluation of BER and NER activities in extracts from deep-frozen colon biopsies using an upgraded version of the in vitro comet-based DNA repair assay in which twelve reactions on one microscope slide can be performed. The aim of this report is to provide a detailed, easy-to-follow protocol together with results of optimization experiments. Additionally, results obtained by functional assays were analysed in the context of other cellular biomarkers, namely single nucleotide polymorphisms and gene expressions. We have shown that measuring DNA repair activity is not easily replaceable by genomic or transcriptomic approaches, but should be applied with the latter techniques in a complementary manner. The ability to measure DNA repair directly in cancer target tissues might finally answer questions about the tissue-specificity of DNA repair processes and their real involvement in the process of carcinogenesis.

  4. Divergent Requirement for a DNA Repair Enzyme during Enterovirus Infections

    Directory of Open Access Journals (Sweden)

    Sonia Maciejewski

    2015-12-01

    Full Text Available Viruses of the Enterovirus genus of picornaviruses, including poliovirus, coxsackievirus B3 (CVB3, and human rhinovirus, commandeer the functions of host cell proteins to aid in the replication of their small viral genomic RNAs during infection. One of these host proteins is a cellular DNA repair enzyme known as 5′ tyrosyl-DNA phosphodiesterase 2 (TDP2. TDP2 was previously demonstrated to mediate the cleavage of a unique covalent linkage between a viral protein (VPg and the 5′ end of picornavirus RNAs. Although VPg is absent from actively translating poliovirus mRNAs, the removal of VPg is not required for the in vitro translation and replication of the RNA. However, TDP2 appears to be excluded from replication and encapsidation sites during peak times of poliovirus infection of HeLa cells, suggesting a role for TDP2 during the viral replication cycle. Using a mouse embryonic fibroblast cell line lacking TDP2, we found that TDP2 is differentially required among enteroviruses. Our single-cycle viral growth analysis shows that CVB3 replication has a greater dependency on TDP2 than does poliovirus or human rhinovirus replication. During infection, CVB3 protein accumulation is undetectable (by Western blot analysis in the absence of TDP2, whereas poliovirus protein accumulation is reduced but still detectable. Using an infectious CVB3 RNA with a reporter, CVB3 RNA could still be replicated in the absence of TDP2 following transfection, albeit at reduced levels. Overall, these results indicate that TDP2 potentiates viral replication during enterovirus infections of cultured cells, making TDP2 a potential target for antiviral development for picornavirus infections.

  5. Proteomics reveals dynamic assembly of repair complexes during bypass of DNA cross-links

    DEFF Research Database (Denmark)

    Räschle, Markus; Smeenk, Godelieve; Hansen, Rebecca K;

    2015-01-01

    DNA interstrand cross-links (ICLs) block replication fork progression by inhibiting DNA strand separation. Repair of ICLs requires sequential incisions, translesion DNA synthesis, and homologous recombination, but the full set of factors involved in these transactions remains unknown. We devised ...

  6. Understanding the Molecular Mechanism(s) of Formaldehyde-induced DNA-protein Crosslink Repair

    Science.gov (United States)

    Although formaldehyde has been shown to induce many kinds of DNA damage both in in vitro and in vivo assay systems, initial DNA-protein crosslink (DPC) formation might play a major role in FA-induced mutagenesis and carcinogenesis. Several DNA repair pathways, such as base excisi...

  7. Dynamic binding of replication protein a is required for DNA repair

    Science.gov (United States)

    Chen, Ran; Subramanyam, Shyamal; Elcock, Adrian H.; Spies, Maria; Wold, Marc S.

    2016-01-01

    Replication protein A (RPA), the major eukaryotic single-stranded DNA (ssDNA) binding protein, is essential for replication, repair and recombination. High-affinity ssDNA-binding by RPA depends on two DNA binding domains in the large subunit of RPA. Mutation of the evolutionarily conserved aromatic residues in these two domains results in a separation-of-function phenotype: aromatic residue mutants support DNA replication but are defective in DNA repair. We used biochemical and single-molecule analyses, and Brownian Dynamics simulations to determine the molecular basis of this phenotype. Our studies demonstrated that RPA binds to ssDNA in at least two modes characterized by different dissociation kinetics. We also showed that the aromatic residues contribute to the formation of the longer-lived state, are required for stable binding to short ssDNA regions and are needed for RPA melting of partially duplex DNA structures. We conclude that stable binding and/or the melting of secondary DNA structures by RPA is required for DNA repair, including RAD51 mediated DNA strand exchange, but is dispensable for DNA replication. It is likely that the binding modes are in equilibrium and reflect dynamics in the RPA–DNA complex. This suggests that dynamic binding of RPA to DNA is necessary for different cellular functions. PMID:27131385

  8. Repair of gamma-ray-induced DNA base damage in xeroderma pigmentosum cells

    International Nuclear Information System (INIS)

    The repair of DNA damage produced by 137Cs gamma irradiation was measured with a preparation from Micrococcus luteus containing DNA damage-specific endonucleases in combination with alkaline elution. The frequency of these endonuclease sensitive sites (ESS) was determined after 54 or 110 Gy of oxic irradiation in normal and xeroderma pigmentosum (XP) fibroblasts from complementation groups A, C, D, and G. Repair was rapid in all cell strains with greater than 50% repair after 1.5 h of repair incubation. At later repair times, 12-17 h, more ESS remained in XP than in normal cells. The frequency of excess ESS in XP cells was approximately 0.04 per 10(9) Da of DNA per Gy which was equivalent to 10% of the initial ESS produced. The removal of ESS was comparable in XP cells with normal radiosensitivity and XP3BR cells which have been reported to be moderately radiosensitive

  9. Repair of ultraviolet-light-induced DNA damage in Vibrio cholerae

    International Nuclear Information System (INIS)

    Repair of ultraviolet-light-induced DNA damage in a highly pathogenic Gram-negative bacterium, Vibrio cholerae, has been examined. All three strains of V. cholerae belonging to two serotypes, Inaba and Ogawa, are very sensitive to ultraviolet irradiation, having inactivation cross-sections ranging from 0.18 to 0.24 m2/J. Although these cells are proficient in repairing the DNA damage by a photoreactivation mechanism, they do not possess efficient dark repair systems. The mild toxinogenic strain 154 of classical Vibrios presumably lacks any excision repair mechanism and studies of irradiated cell DNA indicate that the ultraviolet-induced pyrimidine dimers may not be excised. Ultraviolet-irradiated cells after saturation of dark repair can be further photoreactivated. (Auth.)

  10. The RSC and INO80 chromatin-remodeling complexes in DNA double-strand break repair.

    Science.gov (United States)

    Chambers, Anna L; Downs, Jessica A

    2012-01-01

    In eukaryotes, DNA is packaged into chromatin and is therefore relatively inaccessible to DNA repair enzymes. In order to perform efficient DNA repair, ATP-dependent chromatin-remodeling enzymes are required to alter the chromatin structure near the site of damage to facilitate processing and allow access to repair enzymes. Two of the best-studied remodeling complexes involved in repair are RSC (Remodels the Structure of Chromatin) and INO80 from Saccharomyces cerevisiae, which are both conserved in higher eukaryotes. RSC is very rapidly recruited to breaks and mobilizes nucleosomes to promote phosphorylation of H2A S129 and resection. INO80 enrichment at a break occurs later and is dependent on phospho-S129 H2A. INO80 activity at the break site also facilitates resection. Consequently, both homologous recombination and nonhomologous end-joining are defective in rsc mutants, while subsets of these repair pathways are affected in ino80 mutants.

  11. Triple Negative Breast Cancers Have a Reduced Expression of DNA Repair Genes

    Science.gov (United States)

    Andreis, Daniele; Bertoni, Ramona; Giardini, Roberto; Fox, Stephen B.; Broggini, Massimo; Bottini, Alberto; Zanoni, Vanessa; Bazzola, Letizia; Foroni, Chiara; Generali, Daniele; Damia, Giovanna

    2013-01-01

    DNA repair is a key determinant in the cellular response to therapy and tumor repair status could play an important role in tailoring patient therapy. Our goal was to evaluate the mRNA of 13 genes involved in different DNA repair pathways (base excision, nucleotide excision, homologous recombination, and Fanconi anemia) in paraffin embedded samples of triple negative breast cancer (TNBC) compared to luminal A breast cancer (LABC). Most of the genes involved in nucleotide excision repair and Fanconi Anemia pathways, and CHK1 gene were significantly less expressed in TNBC than in LABC. PARP1 levels were higher in TNBC than in LABC. In univariate analysis high level of FANCA correlated with an increased overall survival and event free survival in TNBC; however multivariate analyses using Cox regression did not confirm FANCA as independent prognostic factor. These data support the evidence that TNBCs compared to LABCs harbour DNA repair defects. PMID:23825533

  12. Ultraviolet mutagenesis and inducible DNA repair in Caulobacter crescentus

    Energy Technology Data Exchange (ETDEWEB)

    Bender, R.A.

    1984-11-19

    The ability to reactivate ultraviolet (UV) damaged phage phiCbK (W-reactivation) is induced by UV irradiation of Caulobacter crescentus cells. Induction of W-reactivation potential is specific for phage phiCbK, requires protein synthesis, and is greatly reduced in the presence of the rec-526 mutation. The induction signal generated by UV irradiation is transient, lasting about 1 1/2 - 2 h at 30/sup 0/C; if chloramphenicol is present during early times after UV irradiation, induction of W-reactivation does not occur. Induction is maximal when cells are exposed to 5-10 J/m/sup 2/ of UV, a dose that also results in considerable mutagenesis of the cells. Taken together, these observations demonstrate the existence of a UV inducible, protein synthesis requiring, transiently signalled, rec-requiring DNA repair system analogous to W-reactivation in Escherichia coli. In addition, C. crescentus also has an efficient photoreactivation system that reverses UV damage in the presence of strong visible light.

  13. The barley EST DNA Replication and Repair Database (bEST-DRRD as a tool for the identification of the genes involved in DNA replication and repair

    Directory of Open Access Journals (Sweden)

    Gruszka Damian

    2012-06-01

    Full Text Available Abstract Background The high level of conservation of genes that regulate DNA replication and repair indicates that they may serve as a source of information on the origin and evolution of the species and makes them a reliable system for the identification of cross-species homologs. Studies that had been conducted to date shed light on the processes of DNA replication and repair in bacteria, yeast and mammals. However, there is still much to be learned about the process of DNA damage repair in plants. Description These studies, which were conducted mainly using bioinformatics tools, enabled the list of genes that participate in various pathways of DNA repair in Arabidopsis thaliana (L. Heynh to be outlined; however, information regarding these mechanisms in crop plants is still very limited. A similar, functional approach is particularly difficult for a species whose complete genomic sequences are still unavailable. One of the solutions is to apply ESTs (Expressed Sequence Tags as the basis for gene identification. For the construction of the barley EST DNA Replication and Repair Database (bEST-DRRD, presented here, the Arabidopsis nucleotide and protein sequences involved in DNA replication and repair were used to browse for and retrieve the deposited sequences, derived from four barley (Hordeum vulgare L. sequence databases, including the “Barley Genome version 0.05” database (encompassing ca. 90% of barley coding sequences and from two databases covering the complete genomes of two monocot models: Oryza sativa L. and Brachypodium distachyon L. in order to identify homologous genes. Sequences of the categorised Arabidopsis queries are used for browsing the repositories, which are located on the ViroBLAST platform. The bEST-DRRD is currently used in our project during the identification and validation of the barley genes involved in DNA repair. Conclusions The presented database provides information about the Arabidopsis genes involved in

  14. Regulation of DNA repair in serum-stimulated xeroderma pigmentosum cells

    OpenAIRE

    1984-01-01

    The regulation of DNA repair during serum stimulation of quiescent cells was examined in normal human cells, in fibroblasts from three xeroderma pigmentosum complementation groups (A, C, and D), in xeroderma pigmentosum variant cells, and in ataxia telangiectasia cells. The regulation of nucleotide excision repair was examined by exposing cells to ultraviolet irradiation at discrete intervals after cell stimulation. Similarly, base excision repair was quantitated after exposure to methylmetha...

  15. A eukaryotic gene encoding an endonuclease that specifically repairs DNA damaged by ultraviolet light.

    OpenAIRE

    Yajima, H; Takao, M; Yasuhira, S; Zhao, J. H.; Ishii, C.; Inoue, H; Yasui, A

    1995-01-01

    Many eukaryotic organisms, including humans, remove ultraviolet (UV) damage from their genomes by the nucleotide excision repair pathway, which requires more than 10 separate protein factors. However, no nucleotide excision repair pathway has been found in the filamentous fungus Neurospora crassa. We have isolated a new eukaryotic DNA repair gene from N.crassa by its ability to complement UV-sensitive Escherichia coli cells. The gene is altered in a N.crassa mus-18 mutant and responsible for ...

  16. Repair of ultraviolet light damage to the DNA of cultured human epidermal keratinocytes and fibroblasts

    International Nuclear Information System (INIS)

    Pure cultures of dermal fibroblasts and epidermal keroatinocytes have been obtained from a single biopsy of newborn foreskin. The cells were labeled, exposed to several doses of uv light, and allowed to repair in the dark for 16 h. The number of pyrimidine dimers before and after repair was assessed by measuring the numbers of sites in the DNA sensitive to a specific uv endonuclease. At all doses used, the extent of repair was similar in the cultured keratinocytes and cultured fibroblasts

  17. Genome analysis of DNA repair genes in the alpha proteobacterium Caulobacter crescentus

    Directory of Open Access Journals (Sweden)

    Menck Carlos FM

    2007-03-01

    Full Text Available Abstract Background The integrity of DNA molecules is fundamental for maintaining life. The DNA repair proteins protect organisms against genetic damage, by removal of DNA lesions or helping to tolerate them. DNA repair genes are best known from the gamma-proteobacterium Escherichia coli, which is the most understood bacterial model. However, genome sequencing raises questions regarding uniformity and ubiquity of these DNA repair genes and pathways, reinforcing the need for identifying genes and proteins, which may respond to DNA damage in other bacteria. Results In this study, we employed a bioinformatic approach, to analyse and describe the open reading frames potentially related to DNA repair from the genome of the alpha-proteobacterium Caulobacter crescentus. This was performed by comparison with known DNA repair related genes found in public databases. As expected, although C. crescentus and E. coli bacteria belong to separate phylogenetic groups, many of their DNA repair genes are very similar. However, some important DNA repair genes are absent in the C. crescentus genome and other interesting functionally related gene duplications are present, which do not occur in E. coli. These include DNA ligases, exonuclease III (xthA, endonuclease III (nth, O6-methylguanine-DNA methyltransferase (ada gene, photolyase-like genes, and uracil-DNA-glycosylases. On the other hand, the genes imuA and imuB, which are involved in DNA damage induced mutagenesis, have recently been described in C. crescentus, but are absent in E. coli. Particularly interesting are the potential atypical phylogeny of one of the photolyase genes in alpha-proteobacteria, indicating an origin by horizontal transfer, and the duplication of the Ada orthologs, which have diverse structural configurations, including one that is still unique for C. crescentus. Conclusion The absence and the presence of certain genes are discussed and predictions are made considering the particular

  18. Human DNA repair disorders in dermatology: A historical perspective, current concepts and new insight.

    Science.gov (United States)

    Moriwaki, Shinichi

    2016-02-01

    Products of DNA damage, such as cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6-4) pyrimidone photoproducts (6-4 PPs), are continually formed in genomes after exposure to UV radiation. When these DNA damages remain unrepaired in essential DNA sites for prolonged periods, DNA replication and transcription are hampered or mutation is induced, which may cause cell death, cellular senescence, and carcinogenesis of the skin. To protect against such UV-induced DNA damage, living organisms nicely retain "DNA repair systems", which can efficiently repair "harmful" DNA damage through precise mechanisms by the integrated functions of many proteins. In humans, the failure of DNA repair systems causes a variety of disorders. Dermatological conditions such as hereditary photodermatoses, xeroderma pigmentosum (XP) and Cockayne syndrome (CS) are caused by congenital functional defects in the nucleotide excision repair (NER) system or the translesion synthesis (TLS) system. In this review, we describe the historical progress, recent findings, and future prospects of studies of human diseases associated with DNA-repair defects. PMID:26493104

  19. Differential requirement for SUB1 in chromosomal and plasmid double-strand DNA break repair.

    Directory of Open Access Journals (Sweden)

    Lijian Yu

    Full Text Available Non homologous end joining (NHEJ is an important process that repairs double strand DNA breaks (DSBs in eukaryotic cells. Cells defective in NHEJ are unable to join chromosomal breaks. Two different NHEJ assays are typically used to determine the efficiency of NHEJ. One requires NHEJ of linearized plasmid DNA transformed into the test organism; the other requires NHEJ of a single chromosomal break induced either by HO endonuclease or the I-SceI restriction enzyme. These two assays are generally considered equivalent and rely on the same set of NHEJ genes. PC4 is an abundant DNA binding protein that has been suggested to stimulate NHEJ. Here we tested the role of PC4's yeast homolog SUB1 in repair of DNA double strand breaks using different assays. We found SUB1 is required for NHEJ repair of DSBs in plasmid DNA, but not in chromosomal DNA. Our results suggest that these two assays, while similar are not equivalent and that repair of plasmid DNA requires additional factor(s that are not required for NHEJ repair of chromosomal double-strand DNA breaks. Possible roles for Sub1 proteins in NHEJ of plasmid DNA are discussed.

  20. Quantification of DNA repair protein kinetics after γ-irradiation using number and brightness analysis

    Science.gov (United States)

    Abdisalaam, Salim; Poudel, Milan; Chen, David J.; Alexandrakis, George

    2011-03-01

    The kinetics of most proteins involved in DNA damage sensing, signaling and repair following ionizing radiation exposure cannot be quantified by current live cell fluorescence microscopy methods. This is because most of these proteins, with only few notable exceptions, do not attach in large numbers at DNA damage sites to form easily detectable foci in microscopy images. As a result a high fluorescence background from freely moving and immobile fluorescent proteins in the nucleus masks the aggregation of proteins at sparse DNA damage sites. Currently, the kinetics of these repair proteins are studied by laser-induced damage and Fluorescence Recovery After Photobleaching that rely on the detectability of high fluorescence intensity spots of clustered DNA damage. We report on the use of Number and Brightness (N&B) analysis methods as a means to monitor kinetics of DNA repair proteins during sparse DNA damage created by γ-irradiation, which is more relevant to cancer treatment than laser-induced clustered damage. We use two key double strand break repair proteins, namely Ku 70/80 and the DNA-dependent protein kinase catalytic subunit (DNA-PKCS), as specific examples to showcase the feasibility of the proposed methods to quantify dose-dependent kinetics for DNA repair proteins after exposure to γ-rays.

  1. A cell-free system for DNA repair synthesis using purified enzymes from the Novikoff hepatoma

    International Nuclear Information System (INIS)

    Novikoff DNA polymerase-β and Novikoff DNase V have been used in a cell-free DNA excision repair system for UV-irradiated substrates to determine their DNA repair capabilities. The repair system was shown to depend upon UV-irradiated DNA, incision by phage T4 UV-endonuclease, excision by DNase V and synthesis by DNA polymerase-β; ligation was not included. Highly purified calf thymus DNA was UV-irradiated at 500-750 J/m2 and incised by T4 UV-endonuclease. The repair system was used to follow the purification of DNase V and DNA polymerase-β. For increased specificity, the parameters of UV-irradiation, incision, excision and synthesis were confirmed on highly supercoiled, covalently closed, phage PM2 DNA. Optimal DNA and Mg2+ concentrations were determined for the repair assay, which was shown to be linear with respect to time. Excision of the 3'-apyrimidinic site and the 5'-pyrimidine dimer by bidirectional DNase V, presumed to occur from the above experiments, was studied more thoroughly using lightly UV-irradiated [3H]poly(dT)poly (dA), labeled in both the base and the sugar, and incised with T4 UV-endonuclease

  2. Fast repair of oxidizing OH adducts of DNA by hydroxycinnamic acid derivatives. A pulse radiolytic study

    International Nuclear Information System (INIS)

    Using pulse radiolytic techniques, it has been demonstrated that the interactions of oxidizing OH adducts of DNA (ssDNA and dsDNA), polyA and polyG with hydroxycinnamic acid derivatives proceed via an electron transfer process (k=5-30x108 dm3 mol-1 s-1). In addition, the rates for fast repair of OH adducts of dAMP, polyA and DNA (ssDNA and dsDNA) are slower than the corresponding rates for the rest OH adducts of DNA constituents. The slower rates for repair of oxidizing OH adducts of dAMP may be the rate determining step during the interaction of hydroxycinnamic acid derivatives with OH adducts of DNA containing the varieties of OH adducts of DNA constituents

  3. Induction and repair of DNA strand breaks in human tumor cells

    International Nuclear Information System (INIS)

    The presence of radioresistant or repair-proficient cells in a tumor is often associated with radiotherapy failure. The authors have begun to study the mechanisms of resistance in these tumor cells. Their initial studies focused on the induction and repair of DNA strand breaks as measured by DNA elution. Eight human tumor (5 squamous cell carcinomas, 2 melanomas, and 1 adenocarcinoma) and 2 nonmalignant cell lines have been examined. Their D/sub O/s range from 1.07 Gy to 2.81 Gy while their extrapolation numbers (n) range from 1.2 to 24.8. Three parameters are being investigated for X-ray-induced DNA single and double-strand breaks; 1) the initial number of breaks induced, 2) the residual DNA strand break frequency and 3) the time to repair 50% of the lesions. The kinetics of repair of DNA single-strand breaks were similar for all the lines studied. In 2 cases, radiosensitivity was associated with either a high residual DNA strand break frequency or a slower rate of repair. No single parameter or combination of parameters, however, consistently correlated with radiosensitivity or n. Thus, while differences in the induction and repair of DNA single-strand breaks might explain some of the observed differences in radiation responses, they are in general a poor predictor radiation sensitivity

  4. Nucleotide excision repair DNA synthesis by excess DNA polymerase beta: a potential source of genetic instability in cancer cells.

    Science.gov (United States)

    Canitrot, Y; Hoffmann, J S; Calsou, P; Hayakawa, H; Salles, B; Cazaux, C

    2000-09-01

    The nucleotide excision repair pathway contributes to genetic stability by removing a wide range of DNA damage through an error-free reaction. When the lesion is located, the altered strand is incised on both sides of the lesion and a damaged oligonucleotide excised. A repair patch is then synthesized and the repaired strand is ligated. It is assumed that only DNA polymerases delta and/or epsilon participate to the repair DNA synthesis step. Using UV and cisplatin-modified DNA templates, we measured in vitro that extracts from cells overexpressing the error-prone DNA polymerase beta exhibited a five- to sixfold increase of the ultimate DNA synthesis activity compared with control extracts and demonstrated the specific involvement of Pol beta in this step. By using a 28 nt gapped, double-stranded DNA substrate mimicking the product of the incision step, we showed that Pol beta is able to catalyze strand displacement downstream of the gap. We discuss these data within the scope of a hypothesis previously presented proposing that excess error-prone Pol beta in cancer cells could perturb the well-defined specific functions of DNA polymerases during error-free DNA transactions. PMID:10973926

  5. Conjugated linoleic acid inhibiting DNA repair damaged by x-ray

    International Nuclear Information System (INIS)

    Non-homologous end-joining is the most effective repair of DNA double strand break. Epidermal growth factor receptor activates DSB repairs. Integration of EGFR inhibitors with radiation or chemotherapy were used in lung cancer treatment. Radiosensitivity effect of conjugated linoleic acid on tumor cells and reduced metastasis are reported

  6. Cell resistance to the Cytolethal Distending Toxin involves an association of DNA repair mechanisms

    Science.gov (United States)

    Bezine, Elisabeth; Malaisé, Yann; Loeuillet, Aurore; Chevalier, Marianne; Boutet-Robinet, Elisa; Salles, Bernard; Mirey, Gladys; Vignard, Julien

    2016-01-01

    The Cytolethal Distending Toxin (CDT), produced by many bacteria, has been associated with various diseases including cancer. CDT induces DNA double-strand breaks (DSBs), leading to cell death or mutagenesis if misrepaired. At low doses of CDT, other DNA lesions precede replication-dependent DSB formation, implying that non-DSB repair mechanisms may contribute to CDT cell resistance. To address this question, we developed a proliferation assay using human cell lines specifically depleted in each of the main DNA repair pathways. Here, we validate the involvement of the two major DSB repair mechanisms, Homologous Recombination and Non Homologous End Joining, in the management of CDT-induced lesions. We show that impairment of single-strand break repair (SSBR), but not nucleotide excision repair, sensitizes cells to CDT, and we explore the interplay of SSBR with the DSB repair mechanisms. Finally, we document the role of the replicative stress response and demonstrate the involvement of the Fanconi Anemia repair pathway in response to CDT. In conclusion, our work indicates that cellular survival to CDT-induced DNA damage involves different repair pathways, in particular SSBR. This reinforces a model where CDT-related genotoxicity primarily involves SSBs rather than DSBs, underlining the importance of cell proliferation during CDT intoxication and pathogenicity. PMID:27775089

  7. Xeroderma pigmentosum group F caused by a defect in a structure-specific DNA repair endonuclease.

    NARCIS (Netherlands)

    A.M. Sijbers (Anneke); W.L. de Laat (Wouter); R.A. Ariza (Rafael); M. Biggerstaff (Maureen); Y-F. Wei; J.G. Moggs (Jonathan); K.C. Carter (Kenneth); B.K. Shell (Brenda); E. Evans (Elizabeth); M.C. de Jong (Mariska); S. Rademakers (Suzanne); J.D. de Rooij (Johan); N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan); R.D. Wood (Richard)

    1996-01-01

    textabstractNucleotide excision repair, which is defective in xeroderma pigmentosum (XP), involves incision of a DNA strand on each side of a lesion. We isolated a human gene homologous to yeast Rad1 and found that it corrects the repair defects of XP group F as well as rodent groups 4 and 11. Causa

  8. A role for small RNAs in DNA double-strand break repair

    DEFF Research Database (Denmark)

    Wei, W.; Ba, Z.; Wu, Y.;

    2012-01-01

    Eukaryotes have evolved complex mechanisms to repair DNA double-strand breaks (DSBs) through coordinated actions of protein sensors, transducers, and effectors. Here we show that ∼21-nucleotide small RNAs are produced from the sequences in the vicinity of DSB sites in Arabidopsis and in human cel...... of protein complexes to DSB sites to facilitate repair. © 2012 Elsevier Inc....

  9. Pathway choice in DNA double strand break repair: Observations of a balancing act

    NARCIS (Netherlands)

    I. Brandsma (Inger); D.C. van Gent (Dik)

    2012-01-01

    textabstractProper repair of DNA double strand breaks (DSBs) is vital for the preservation of genomic integrity. There are two main pathways that repair DSBs, Homologous recombination (HR) and Non-homologous end-joining (NHEJ). HR is restricted to the S and G2 phases of the cell cycle due to the req

  10. Aphidicolin inhibits repair of DNA in UV-irradiated human fibroblasts

    International Nuclear Information System (INIS)

    Aphidicolin, a specific inhibitor of DNA polymerase α, is shown to inhibit DNA repair in human diploid fibroblasts. Although aphidicolin has no apparent effect on the DNA of unirradiated cells, it causes a large number of strand breaks to accumulate in UV-irradiated cellular DNA. The number of breaks is the same as the number observed following a similar dose of ultraviolet light when cells are treated with arabinofuranosyl cytosine (araC) and hydroxyurea (HU), known inhibitors of repair. Moreover, two-dimensional paper chromatography shows that aphidicolin completely blocks removal of pyrimidine dimers. These observations are discussed in light of the proposed roles of DNA polymerases α and β in DNA replication and repair and the action of aphidicolin on polymerase α

  11. A baculovirus photolyase with DNA repair activity and circadian clock regulatory function

    NARCIS (Netherlands)

    Biernat, M.A.; Eker, A.P.M.; Oers, van M.M.; Vlak, J.M.; Horst, van der G.T.J.; Chaves, I.

    2012-01-01

    Cryptochromes and photolyases belong to the same family of flavoproteins but, despite being structurally conserved, display distinct functions. Photolyases use visible light to repair ultraviolet-induced DNA damage. Cryptochromes, however, function as blue-light receptors, circadian photoreceptors,

  12. Non-homologous end joining is the responsible pathway for the repair of fludarabine-induced DNA double strand breaks in mammalian cells

    International Nuclear Information System (INIS)

    Fludarabine (FLU), an analogue of adenosine, interferes with DNA synthesis and inhibits the chain elongation leading to replication arrest and DNA double strand break (DSB) formation. Mammalian cells use two main pathways of DSB repair to maintain genomic stability: homologous recombination (HR) and non-homologous end joining (NHEJ). The aim of the present work was to evaluate the repair pathways employed in the restoration of DSB formed following replication arrest induced by FLU in mammalian cells. Replication inhibition was induced in human lymphocytes and fibroblasts by FLU. DSB occurred in a dose-dependent manner on early/middle S-phase cells, as detected by γH2AX foci formation. To test whether conservative HR participates in FLU-induced DSB repair, we measured the kinetics of Rad51 nuclear foci formation in human fibroblasts. There was no significant induction of Rad51 foci after FLU treatment. To further confirm these results, we analyzed the frequency of sister chromatid exchanges (SCE) in both human cells. We did not find increased frequencies of SCE after FLU treatment. To assess the participation of NHEJ pathway in the repair of FLU-induced damage, we used two chemical inhibitors of the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), vanillin and wortmannin. Human fibroblasts pretreated with DNA-PKcs inhibitors showed increased levels of chromosome breakages and became more sensitive to cell death. An active role of NHEJ pathway was also suggested from the analysis of Chinese hamster cell lines. XR-C1 (DNA-PKcs-deficient) and XR-V15B (Ku80-deficient) cells showed hypersensitivity to FLU as evidenced by the increased frequency of chromosome aberrations, decreased mitotic index and impaired survival rates. In contrast, CL-V4B (Rad51C-deficient) and V-C8 (Brca2-deficient) cell lines displayed a FLU-resistant phenotype. Together, our results suggest a major role for NHEJ repair in the preservation of genome integrity against FLU-induced DSB

  13. Non-homologous end joining is the responsible pathway for the repair of fludarabine-induced DNA double strand breaks in mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Campos-Nebel, Marcelo de [Departamento de Genetica, Instituto de Investigaciones Hematologicas Mariano R. Castex, Academia Nacional de Medicina, Buenos Aires (Argentina)], E-mail: mnebel@hematologia.anm.edu.ar; Larripa, Irene; Gonzalez-Cid, Marcela [Departamento de Genetica, Instituto de Investigaciones Hematologicas Mariano R. Castex, Academia Nacional de Medicina, Buenos Aires (Argentina)

    2008-11-10

    Fludarabine (FLU), an analogue of adenosine, interferes with DNA synthesis and inhibits the chain elongation leading to replication arrest and DNA double strand break (DSB) formation. Mammalian cells use two main pathways of DSB repair to maintain genomic stability: homologous recombination (HR) and non-homologous end joining (NHEJ). The aim of the present work was to evaluate the repair pathways employed in the restoration of DSB formed following replication arrest induced by FLU in mammalian cells. Replication inhibition was induced in human lymphocytes and fibroblasts by FLU. DSB occurred in a dose-dependent manner on early/middle S-phase cells, as detected by {gamma}H2AX foci formation. To test whether conservative HR participates in FLU-induced DSB repair, we measured the kinetics of Rad51 nuclear foci formation in human fibroblasts. There was no significant induction of Rad51 foci after FLU treatment. To further confirm these results, we analyzed the frequency of sister chromatid exchanges (SCE) in both human cells. We did not find increased frequencies of SCE after FLU treatment. To assess the participation of NHEJ pathway in the repair of FLU-induced damage, we used two chemical inhibitors of the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), vanillin and wortmannin. Human fibroblasts pretreated with DNA-PKcs inhibitors showed increased levels of chromosome breakages and became more sensitive to cell death. An active role of NHEJ pathway was also suggested from the analysis of Chinese hamster cell lines. XR-C1 (DNA-PKcs-deficient) and XR-V15B (Ku80-deficient) cells showed hypersensitivity to FLU as evidenced by the increased frequency of chromosome aberrations, decreased mitotic index and impaired survival rates. In contrast, CL-V4B (Rad51C-deficient) and V-C8 (Brca2-deficient) cell lines displayed a FLU-resistant phenotype. Together, our results suggest a major role for NHEJ repair in the preservation of genome integrity against FLU

  14. DNA mismatch repair deficiency in sporadic colorectal cancer and Lynch Syndrome

    OpenAIRE

    Poulogiannis, George; Frayling, Ian; Arends, Mark

    2009-01-01

    Abstract DNA mismatch repair (MMR) deficiency is one of the best understood forms of genetic instability in colorectal cancer (CRC), and is characterised by the loss of function of the MMR pathway. Failure to repair replication-associated errors due to a defective MMR system allows persistence of mismatch mutations all over the genome, but especially in regions of repetitive DNA known as microsatellites, giving rise to the phenomenon of microsatellite instability (MSI). A high freq...

  15. A novel function of adenomatous polyposis coli (APC) in regulating DNA repair

    OpenAIRE

    Jaiswal, Aruna S.; Narayan, Satya

    2008-01-01

    Prevailing literature suggests diversified cellular functions for the adenomatous polyposis coli (APC) gene. Among them a recently discovered unique role of APC is in DNA repair. The APC gene can modulate the base excision repair (BER) pathway through an interaction with DNA polymerase β (Pol-β) and flap endonuclease 1 (Fen-1). Taken together with the transcriptional activation of APC gene by alkylating agents and modulation of BER activity, APC may play an important role in carcinogenesis an...

  16. Multiple gene sequence analysis using genes of the bacterial DNA repair pathway

    OpenAIRE

    Miguel Rotelok Neto; Carolina Weigert Galvão; Leonardo Magalhães Cruz; Dieval Guizelini; Leilane Caline Silva; Jarem Raul Garcia; Rafael Mazer Etto

    2015-01-01

    The ability to recognize and repair abnormal DNA structures is common to all forms of life. Physiological studies and genomic sequencing of a variety of bacterial species have identified an incredible diversity of DNA repair pathways. Despite the amount of available genes in public database, the usual method to place genomes in a taxonomic context is based mainly on the 16S rRNA or housekeeping genes. Thus, the relationships among genomes remain poorly understood. In this work, an approach of...

  17. Rad54 and Mus81 cooperation promotes DNA damage repair and restrains chromosome missegregation

    DEFF Research Database (Denmark)

    Ghamrasni, S El; Cardoso, R; Li, L;

    2016-01-01

    -damaging agents, defects on both the homologous recombination and non-homologous DNA end joining repair pathways and reduced fertility. We also observed that while Mus81 deficiency diminished the cleavage of common fragile sites, very strikingly, Rad54 loss impaired this cleavage to even a greater extent...... the importance of the cooperation between Rad54 and Mus81 for mediating DNA DSB repair and restraining chromosome missegregation....

  18. Inefficient DNA Repair Is an Aging-Related Modifier of Parkinson’s Disease

    OpenAIRE

    Sara Sepe; Chiara Milanese; Sylvia Gabriels; Derks, Kasper W.J.; Cesar Payan-Gomez; Wilfred F.J. van IJcken; Yvonne M.A. Rijksen; Alex L. Nigg; Sandra Moreno; Silvia Cerri; Fabio Blandini; Hoeijmakers, Jan H.J.; Pier G. Mastroberardino

    2016-01-01

    The underlying relation between Parkinson’s disease (PD) etiopathology and its major risk factor, aging, is largely unknown. In light of the causative link between genome stability and aging, we investigate a possible nexus between DNA damage accumulation, aging, and PD by assessing aging-related DNA repair pathways in laboratory animal models and humans. We demonstrate that dermal fibroblasts from PD patients display flawed nucleotide excision repair (NER) capacity and that Ercc1 mutant mice...

  19. Inefficient DNA Repair Is an Aging-Related Modifier of Parkinson’s Disease

    OpenAIRE

    Sepe, Sara; Milanese, Chiara; Gabriels, Sylvia; Derks, Kasper W.J.; Payan-Gomez, Cesar; Wilfred F.J. van IJcken; Yvonne M.A. Rijksen; Nigg, Alex L.; Moreno, Sandra; Cerri, Silvia; Blandini, Fabio; Hoeijmakers, Jan H.J.; Mastroberardino, Pier G.

    2016-01-01

    Summary The underlying relation between Parkinson’s disease (PD) etiopathology and its major risk factor, aging, is largely unknown. In light of the causative link between genome stability and aging, we investigate a possible nexus between DNA damage accumulation, aging, and PD by assessing aging-related DNA repair pathways in laboratory animal models and humans. We demonstrate that dermal fibroblasts from PD patients display flawed nucleotide excision repair (NER) capacity and that Ercc1 mut...

  20. UvrD facilitates DNA repair by pulling RNA polymerase backwards

    OpenAIRE

    Epshtein, Vitaly; Kamarthapu, Venu; McGary, Katelyn; Svetlov, Vladimir; Ueberheide, Beatrix; Proshkin, Sergey; Mironov, Alexander; Nudler, Evgeny

    2014-01-01

    UvrD helicase is required for nucleotide excision repair, although its role in this process is not well defined. Here we show that Escherichia coli UvrD binds RNA polymerase during transcription elongation and, using its helicase/translocase activity, forces RNA polymerase to slide backward along DNA. By inducing backtracking, UvrD exposes DNA lesions shielded by blocked RNA polymerase, allowing nucleotide excision repair enzymes to gain access to sites of damage. Our results establish UvrD a...

  1. DNA-repair, chromosome alterations and chromatin structure under environmental pollutions

    International Nuclear Information System (INIS)

    54 abstracts, 20 of which are within the INIS scope, are presented. The papers are dealing with the influence of some chemicals, environmental pollutants as well as drugs, on the process of DNA repair after ionizing irradiation. Some advanced techniques of detecting genotoxic properties and some papers on the influence of DNA repair on cell differentiation were presented. Genetic changes in man, animals and plants as a consequence of the Chernobylsk accident were described

  2. The Nucleotide Excision Repair System of Borrelia burgdorferi Is the Sole Pathway Involved in Repair of DNA Damage by UV Light

    OpenAIRE

    Hardy, Pierre-Olivier; Chaconas, George

    2013-01-01

    To survive and avoid accumulation of mutations caused by DNA damage, the genomes of prokaryotes encode a variety of DNA repair pathways most well characterized in Escherichia coli. Some of these are required for the infectivity of various pathogens. In this study, the importance of 25 DNA repair/recombination genes for Borrelia burgdorferi survival to UV-induced DNA damage was assessed. In contrast to E. coli, where 15 of these genes have an effect on survival of UV irradiation, disruption of...

  3. Mechanistic Modelling of DNA Repair and Cellular Survival Following Radiation-Induced DNA Damage.

    Science.gov (United States)

    McMahon, Stephen J; Schuemann, Jan; Paganetti, Harald; Prise, Kevin M

    2016-01-01

    Characterising and predicting the effects of ionising radiation on cells remains challenging, with the lack of robust models of the underlying mechanism of radiation responses providing a significant limitation to the development of personalised radiotherapy. In this paper we present a mechanistic model of cellular response to radiation that incorporates the kinetics of different DNA repair processes, the spatial distribution of double strand breaks and the resulting probability and severity of misrepair. This model enables predictions to be made of a range of key biological endpoints (DNA repair kinetics, chromosome aberration and mutation formation, survival) across a range of cell types based on a set of 11 mechanistic fitting parameters that are common across all cells. Applying this model to cellular survival showed its capacity to stratify the radiosensitivity of cells based on aspects of their phenotype and experimental conditions such as cell cycle phase and plating delay (correlation between modelled and observed Mean Inactivation Doses R(2) > 0.9). By explicitly incorporating underlying mechanistic factors, this model can integrate knowledge from a wide range of biological studies to provide robust predictions and may act as a foundation for future calculations of individualised radiosensitivity. PMID:27624453

  4. Cell cycle phase dependent role of DNA polymerase beta in DNA repair and survival after ionizing radiation.

    NARCIS (Netherlands)

    Vermeulen, C.; Verwijs-Janssen, M.; Begg, A.C.; Vens, C.

    2008-01-01

    PURPOSE: The purpose of the present study was to determine the role of DNA polymerase beta in repair and response after ionizing radiation in different phases of the cell cycle. METHODS AND MATERIALS: Synchronized cells deficient and proficient in DNA polymerase beta were irradiated in different pha

  5. Photodynamic DNA damage induced by phycocyanin and its repair in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    M. Pádula

    1999-09-01

    Full Text Available In the present study, we analyzed DNA damage induced by phycocyanin (PHY in the presence of visible light (VL using a set of repair endonucleases purified from Escherichia coli. We demonstrated that the profile of DNA damage induced by PHY is clearly different from that induced by molecules that exert deleterious effects on DNA involving solely singlet oxygen as reactive species. Most of PHY-induced lesions are single strand breaks and, to a lesser extent, base oxidized sites, which are recognized by Nth, Nfo and Fpg enzymes. High pressure liquid chromatography coupled to electrochemical detection revealed that PHY photosensitization did not induce 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo at detectable levels. DNA repair after PHY photosensitization was also investigated. Plasmid DNA damaged by PHY photosensitization was used to transform a series of Saccharomyces cerevisiae DNA repair mutants. The results revealed that plasmid survival was greatly reduced in rad14 mutants, while the ogg1 mutation did not modify the plasmid survival when compared to that in the wild type. Furthermore, plasmid survival in the ogg1 rad14 double mutant was not different from that in the rad14 single mutant. The results reported here indicate that lethal lesions induced by PHY plus VL are repaired differently by prokaryotic and eukaryotic cells. Morever, nucleotide excision repair seems to play a major role in the recognition and repair of these lesions in Saccharomyces cerevisiae.

  6. Exome-wide somatic microsatellite variation is altered in cells with DNA repair deficiencies.

    Directory of Open Access Journals (Sweden)

    Zalman Vaksman

    Full Text Available Microsatellites (MST, tandem repeats of 1-6 nucleotide motifs, are mutational hot-spots with a bias for insertions and deletions (INDELs rather than single nucleotide polymorphisms (SNPs. The majority of MST instability studies are limited to a small number of loci, the Bethesda markers, which are only informative for a subset of colorectal cancers. In this paper we evaluate non-haplotype alleles present within next-gen sequencing data to evaluate somatic MST variation (SMV within DNA repair proficient and DNA repair defective cell lines. We confirm that alleles present within next-gen data that do not contribute to the haplotype can be reliably quantified and utilized to evaluate the SMV without requiring comparisons of matched samples. We observed that SMV patterns found in DNA repair proficient cell lines without DNA repair defects, MCF10A, HEK293 and PD20 RV:D2, had consistent patterns among samples. Further, we were able to confirm that changes in SMV patterns in cell lines lacking functional BRCA2, FANCD2 and mismatch repair were consistent with the different pathways perturbed. Using this new exome sequencing analysis approach we show that DNA instability can be identified in a sample and that patterns of instability vary depending on the impaired DNA repair mechanism, and that genes harboring minor alleles are strongly associated with cancer pathways. The MST Minor Allele Caller used for this study is available at https://github.com/zalmanv/MST_minor_allele_caller.

  7. Psoralen plus near-ultraviolet light: a possible new method for measuring DNA repair synthesis

    International Nuclear Information System (INIS)

    A new method is proposed to inhibit semiconservative DNA synthesis in cultured cells while DNA repair synthesis is being measured. The cells are treated with the DNA-crosslinking agent Trioxalen (4,5,8-trimethylpsoralen) plus near-ultraviolet light, and consequently 99.5% inhibition of replicative DNA synthesis is achieved. Additional DNA-damaging agents induce thymidine incorporation into the double-stranded regions of the DNA. The new method gave results very similar to those obtained with the benzoylated naphthoylated DEAE (BND) cellulose method using three human fibroblast strains, of which one had deficient capacity for DNA repair synthesis following treatment with γ rays and methyl methanesulfonate. The advantages of the new method are simplicity and rapidity, as well as the high extent to which replicative DNA synthesis is inhibited

  8. Psoralen plus near-ultraviolet light: a possible new method for measuring DNA repair synthesis

    International Nuclear Information System (INIS)

    A new method is proposed to inhibit semiconservative DNA synthesis in cultured cells while DNA repair synthesis is being measured. The cells are treated with the DNA-crosslinking agent Trioxalen (4,5,8-trimethylpsoralen) plus near-ultraviolet light, and consequently 99.5% inhibition of replicative DNA synthesis is achieved. Additional DNA-damaging agents induce thymidine incorporation into the double-stranded regions of the DNA. The new method gave results very similar to those obtained with the benzoylated naphthoylated DEAE (BND) cellulose method using three human fibroblast strains, of which one had deficient capacity for DNA repair synthesis following treatment with gamma rays and methyl methanesulfonate. The advantages of the new method are simplicity and rapidity, as well as the high extent to which replicative DNA synthesis is inhibited

  9. Real-time observation of DNA repair: 2-aminopurine as a molecular probe

    Science.gov (United States)

    Krishnan, Rajagopal; Butcher, Christina E.; Oh, Dennis H.

    2008-02-01

    Triplex forming oligos (TFOs) that target psoralen photoadducts to specific DNA sequences have generated interest as a potential agent in gene therapy. TFOs also offer an opportunity to study the mechanism of DNA repair in detail. In an effort to understand the mechanism of DNA repair at a specific DNA sequence in real-time, we have designed a plasmid containing a psoralen reaction site adjacent to a TFO binding site corresponding to a sequence within the human interstitial collagenase gene. Two 2-aminopurine residues incorporated into the purine-rich strand of the TFO binding site and located within six nucleotides of the psoralen reaction site serve as molecular probes for excision repair events involving the psoralen photoadducts on that DNA strand. In duplex DNA, the 2-aminopurine fluorescence is quenched. However, upon thermal or formamide-induced denaturation of duplex DNA to single stranded DNA, the 2-aminopurine fluorescence increases by eight fold. These results suggest that monitoring 2-aminopurine fluorescence from plasmids damaged by psoralen TFOs may be a method for measuring excision of single-stranded damaged DNA from the plasmid in cells. A fluorescence-based molecular probe to the plasmid may significantly simplify the real-time observation of DNA repair in both populations of cells as well as single cells.

  10. Genetic characterization of cells of homocystinuria patients with disrupted DNA repair system

    Energy Technology Data Exchange (ETDEWEB)

    Sinel' shchikova, T.A.; L' vova, G.N.; Shoniya, N.N.; Zasukhina, G.D.

    1986-08-01

    Fibroblasts obtained from biopsy material and lymphocytes of patients with homocystinuria were investigated for repair activity according to the following criteria: rejoined DNA breaks, induced by 4-nitroquinoline-1-oxide and ..gamma..-radiation; indices of reactivation and induced mutagenesis of smallpox vaccine virus treated with these mutagens. In lymphocytes a defect of DNA repair was observed according to all criteria investigated. During passage of fibroblast cultures, inhibition of repair activity of cells was preserved according to ..gamma..-type. Increase in the number of spontaneous and ..gamma..-induced mutations of virus was noted according to degree of passage of fibroblasts.

  11. Persistence of Breakage in Specific Chromosome Bands 6 Years after Acute Exposure to Oil

    Science.gov (United States)

    Francés, Alexandra; Hildur, Kristin; Barberà, Joan Albert; Rodríguez-Trigo, Gema; Zock, Jan-Paul; Giraldo, Jesús; Monyarch, Gemma; Rodriguez-Rodriguez, Emma; de Castro Reis, Fernanda; Souto, Ana; Gómez, Federico P.; Pozo-Rodríguez, Francisco; Templado, Cristina; Fuster, Carme

    2016-01-01

    Background The identification of breakpoints involved in chromosomal damage could help to detect genes involved in genetic disorders, most notably cancer. Until now, only one published study, carried out by our group, has identified chromosome bands affected by exposure to oil from an oil spill. In that study, which was performed two years after the initial oil exposure in individuals who had participated in clean-up tasks following the wreck of the Prestige, three chromosomal bands (2q21, 3q27, 5q31) were found to be especially prone to breakage. A recent follow-up study, performed on the same individuals, revealed that the genotoxic damage had persisted six years after oil exposure. Objectives To determine whether there exist chromosome bands which are especially prone to breakages and to know if there is some correlation with those detected in the previous study. In addition, to investigate if the DNA repair problems detected previously persist in the present study. Design Follow-up study performed six years after the Prestige oil spill. Setting Fishermen cooperatives in coastal villages. Participants Fishermen highly exposed to oil spill who participated in previous genotoxic study six years after the oil. Measurements Chromosome damage in peripheral lymphocytes. For accurate identification of the breakpoints involved in chromosome damage of circulating lymphocytes, a sequential stain/G-banding technique was employed. To determine the most break-prone chromosome bands, two statistical methods, the Fragile Site Multinomial and the chi-square tests (where the bands were corrected by their length) were used. To compare the chromosome lesions, structural chromosome alterations and gaps/breaks between two groups of individuals we used the GEE test which takes into account a possible within-individual correlation. Dysfunctions in DNA repair mechanisms, expressed as chromosome damage, were assessed in cultures with aphidicolin by the GEE test. Results Cytogenetic

  12. The molecular origin of high DNA-repair efficiency by photolyase

    Science.gov (United States)

    Tan, Chuang; Liu, Zheyun; Li, Jiang; Guo, Xunmin; Wang, Lijuan; Sancar, Aziz; Zhong, Dongping

    2015-06-01

    The primary dynamics in photomachinery such as charge separation in photosynthesis and bond isomerization in sensory photoreceptor are typically ultrafast to accelerate functional dynamics and avoid energy dissipation. The same is also true for the DNA repair enzyme, photolyase. However, it is not known how the photoinduced step is optimized in photolyase to attain maximum efficiency. Here, we analyse the primary reaction steps of repair of ultraviolet-damaged DNA by photolyase using femtosecond spectroscopy. With systematic mutations of the amino acids involved in binding of the flavin cofactor and the cyclobutane pyrimidine dimer substrate, we report our direct deconvolution of the catalytic dynamics with three electron-transfer and two bond-breaking elementary steps and thus the fine tuning of the biological repair function for optimal efficiency. We found that the maximum repair efficiency is not enhanced by the ultrafast photoinduced process but achieved by the synergistic optimization of all steps in the complex repair reaction.

  13. Effect of intense, ultrashort laser pulses on DNA plasmids in their native state: strand breakages induced by {\\it in-situ} electrons

    CERN Document Server

    D'Souza, J S; Dharmdhikair, A K; Rao, B J; Mathur, D

    2010-01-01

    Single strand breaks are induced in DNA plasmids, pBR322 and pUC19, in aqueous media by intense ultrashort laser pulses (820 nm wavelength, 45 fs pulse duration, 1 kHz repetition rate) at intensities of 1-12 TW cm$^{-2}$. The intense laser radiation generates, {\\it in situ}, electrons that induce transformation of supercoiled DNA into relaxed DNA. The extent of electron-mediated relaxation of DNA structure is quantified. Introduction of electron and radical scavengers inhibits DNA damage.

  14. Effect of intense, ultrashort laser pulses on DNA plasmids in their native state: strand breakages induced by {\\it in-situ} electrons and radicals

    CERN Document Server

    D'Souza, J S; Dharmadhikari, A K; Rao, B J; Mathur, D

    2011-01-01

    Single strand breaks are induced in DNA plasmids, pBR322 and pUC19, in aqueous media exposed to strong fields generated using ultrashort laser pulses (820 nm wavelength, 45 fs pulse duration, 1 kHz repetition rate) at intensities of 1-12 TW cm$^{-2}$. The strong fields generate, {\\it in situ}, electrons and radicals that induce transformation of supercoiled DNA into relaxed DNA, the extent of which is quantified. Introduction of electron and radical scavengers inhibits DNA damage; results indicate that OH radicals are the primary (but not sole) cause of DNA damage.

  15. Identification of DNA polymerase molecules repairing DNA irradiated damage and molecular biological study on modified factors of mutation rate

    Energy Technology Data Exchange (ETDEWEB)

    Yamada, Koichi; Inoue, Shuji [National Inst. of Healthand Nutrition, Tokyo (Japan)

    1999-02-01

    DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit {delta} or {epsilon} which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)

  16. Identification of DNA polymerase molecules repairing DNA irradiated damage and molecular biological study on modified factors of mutation rate

    International Nuclear Information System (INIS)

    DNA repairing polymerase has not been identified in human culture cells because the specificities of enzyme inhibitors used in previous studies were not so high. In this study, anti-sense oligonucleotides were transfected into human fibroblast cells by electroporation and several clones selected by geneticin treatment were found to express the RNA of the incorporated DNA. However, the expression was not significant and its reproducibility was poor. Then, a study on repairing mechanism was made using XP30 RO and XP 115 LO cells which are variant cells of xeroderma pigmentosum, a human hereditary disease aiming to identify the DNA polymerase related to the disease. There were abnormalities in DNA polymerase subunit δ or ε which consists DNA replication complex. Thus, it was suggested that the DNA replication of these mutant cells might terminate at the site containing such abnormality. (M.N.)

  17. Inducible SOS Response System of DNA Repair and Mutagenesis in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Celina Janion

    2008-01-01

    Full Text Available Chromosomal DNA is exposed to continuous damage and repair. Cells contain a number of proteins and specific DNA repair systems that help maintain its correct structure. The SOS response was the first DNA repair system described in Escherichia coli induced upon treatment of bacteria with DNA damaging agents arrest DNA replication and cell division. Induction of the SOS response involves more than forty independent SOS genes, most of which encode proteins engaged in protection, repair, replication, mutagenesis and metabolism of DNA. Under normal growth conditions the SOS genes are expressed at a basal level, which increases distinctly upon induction of the SOS response. The SOS-response has been found in many bacterial species (e.g., Salmonella typhimurium, Caulobacter crescentus, Mycobacterium tuberculosis, but not in eukaryotic cells. However, species from all kingdoms contain some SOS-like proteins taking part in DNA repair that exhibit amino acid homology and enzymatic activities related to those found in E. coli. but are not organized in an SOS system. This paper presents a brief up-to-date review describing the discovery of the SOS system, the physiology of SOS induction, methods for its determination, and the role of some SOS-induced genes.

  18. Protein phosphatase 5 is necessary for ATR-mediated DNA repair

    International Nuclear Information System (INIS)

    Research highlights: → Serine/threonine protein phosphatase 5 (PP5) has been shown to participate in ataxia telangiectasia-mutated (ATM)- and ATR (ATM- and Rad3-related)-mediated checkpoint pathways, which plays an important role in the DNA damage response and maintenance of genomic stability. → However, it is not clear exactly how PP5 participates in this process. → Our results indicate that PP5 is more closely related with ATR-mediated pathway than ATM-mediated pathway in DNA damage repair. -- Abstract: Several recent studies have shown that protein phosphatase 5 (PP5) participates in cell cycle arrest after DNA damage, but its roles in DNA repair have not yet been fully characterized. We investigated the roles of PP5 in the repair of ultraviolet (UV)- and neocarzinostatin (NCS)-induced DNA damage. The results of comet assays revealed different repair patterns in UV- and NCS-exposed U2OS-PS cells. PP5 is only essential for Rad3-related (ATR)-mediated DNA repair. Furthermore, the phosphorylation of 53BP1 and BRCA1, important mediators of DNA damage repair, and substrates of ATR and ATM decreased in U2OS-PS cells exposed to UV radiation. In contrast, the cell cycle arrest proteins p53, CHK1, and CHK2 were normally phosphorylated in U2OS and U2OS-PS cells exposed to UV radiation or treated with NCS. In view of these results, we suggest that PP5 plays a crucial role in ATR-mediated repair of UV-induced DNA damage.

  19. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    International Nuclear Information System (INIS)

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL−1 and 50 μg mL−1 of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair activities

  20. Protein phosphatase 5 is necessary for ATR-mediated DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Yoonsung [Department of Pharmacology, DNA Repair Research Center, Chosun University School of Medicine, 375 Seosuk-Dong, Gwangju 501-759 (Korea, Republic of); Cheong, Hyang-Min [Department of Life Science, College of Natural Science, Chung-Ang University, 221 Heuksuk-Dong, Dongjak-Ku, Seoul 156-756 (Korea, Republic of); Lee, Jung-Hee [Department of Pharmacology, DNA Repair Research Center, Chosun University School of Medicine, 375 Seosuk-Dong, Gwangju 501-759 (Korea, Republic of); Song, Peter I. [Department of Dermatology, University of Arkansas for Medical Science, 4301 West Markham, Slot 576, Little Rock, AR 72205 (Korea, Republic of); Lee, Kwang-Ho [Department of Life Science, College of Natural Science, Chung-Ang University, 221 Heuksuk-Dong, Dongjak-Ku, Seoul 156-756 (Korea, Republic of); Kim, Sang-Yong [Division of Endocrinology, Department of Internal Medicine, Chosun University School of Medicine, 375 Seosuk-Dong, Gwangju 501-759 (Korea, Republic of); Jun, Jae Yeoul [Department of Physiology, Chosun University School of Medicine, 375 Seosuk-Dong, Gwangju 501-759 (Korea, Republic of); You, Ho Jin, E-mail: hjyou@chosun.ac.kr [Department of Pharmacology, DNA Repair Research Center, Chosun University School of Medicine, 375 Seosuk-Dong, Gwangju 501-759 (Korea, Republic of)

    2011-01-07

    Research highlights: {yields} Serine/threonine protein phosphatase 5 (PP5) has been shown to participate in ataxia telangiectasia-mutated (ATM)- and ATR (ATM- and Rad3-related)-mediated checkpoint pathways, which plays an important role in the DNA damage response and maintenance of genomic stability. {yields} However, it is not clear exactly how PP5 participates in this process. {yields} Our results indicate that PP5 is more closely related with ATR-mediated pathway than ATM-mediated pathway in DNA damage repair. -- Abstract: Several recent studies have shown that protein phosphatase 5 (PP5) participates in cell cycle arrest after DNA damage, but its roles in DNA repair have not yet been fully characterized. We investigated the roles of PP5 in the repair of ultraviolet (UV)- and neocarzinostatin (NCS)-induced DNA damage. The results of comet assays revealed different repair patterns in UV- and NCS-exposed U2OS-PS cells. PP5 is only essential for Rad3-related (ATR)-mediated DNA repair. Furthermore, the phosphorylation of 53BP1 and BRCA1, important mediators of DNA damage repair, and substrates of ATR and ATM decreased in U2OS-PS cells exposed to UV radiation. In contrast, the cell cycle arrest proteins p53, CHK1, and CHK2 were normally phosphorylated in U2OS and U2OS-PS cells exposed to UV radiation or treated with NCS. In view of these results, we suggest that PP5 plays a crucial role in ATR-mediated repair of UV-induced DNA damage.

  1. On-bead fluorescent DNA nanoprobes to analyze base excision repair activities

    Energy Technology Data Exchange (ETDEWEB)

    Gines, Guillaume; Saint-Pierre, Christine; Gasparutto, Didier, E-mail: didier.gasparutto@cea.fr

    2014-02-17

    Graphical abstract: -- Highlights: •On magnetic beads fluorescent enzymatic assays. •Simple, easy, non-radioactive and electrophoresis-free functional assay. •Lesion-containing hairpin DNA probes are selective for repair enzymes. •The biosensing platform allows the measurement of DNA repair activities from purified enzymes or within cell free extracts. -- Abstract: DNA integrity is constantly threatened by endogenous and exogenous agents that can modify its physical and chemical structure. Changes in DNA sequence can cause mutations sparked by some genetic diseases or cancers. Organisms have developed efficient defense mechanisms able to specifically repair each kind of lesion (alkylation, oxidation, single or double strand break, mismatch, etc). Here we report the adjustment of an original assay to detect enzymes’ activity of base excision repair (BER), that supports a set of lesions including abasic sites, alkylation, oxidation or deamination products of bases. The biosensor is characterized by a set of fluorescent hairpin-shaped nucleic acid probes supported on magnetic beads, each containing a selective lesion targeting a specific BER enzyme. We have studied the DNA glycosylase alkyl-adenine glycosylase (AAG) and the human AP-endonuclease (APE1) by incorporating within the DNA probe a hypoxanthine lesion or an abasic site analog (tetrahydrofuran), respectively. Enzymatic repair activity induces the formation of a nick in the damaged strand, leading to probe's break, that is detected in the supernatant by fluorescence. The functional assay allows the measurement of DNA repair activities from purified enzymes or in cell-free extracts in a fast, specific, quantitative and sensitive way, using only 1 pmol of probe for a test. We recorded a detection limit of 1 μg mL{sup −1} and 50 μg mL{sup −1} of HeLa nuclear extracts for APE1 and AAG enzymes, respectively. Finally, the on-bead assay should be useful to screen inhibitors of DNA repair

  2. The DNA repair-ubiquitin-associated HR23 proteins are constituents of neuronal inclusions in specific neurodegenerative disorders without hampering DNA repair

    NARCIS (Netherlands)

    Bergink, Steven; Severijnen, Lies-Anne; Wijgers, Nils; Sugasawa, Kaoru; Yousaf, Humaira; Kros, Johan M.; van Swieten, John; Oostra, Ben A.; Hoeijmakers, Jan H.; Vermeulen, Wim; Willemsen, Rob

    2006-01-01

    Intracellular inclusions play a profound role in many neurodegenerative diseases. Here, we report that HR23B and HR23A, proteins that are involved in both DNA repair and shuttling proteins to the 26S proteasome for degradation, accumulate in neuronal inclusions in brain from a mouse model for FXTAS,

  3. The effect of acute dose charge particle radiation on expression of DNA repair genes in mice.

    Science.gov (United States)

    Tariq, Muhammad Akram; Soedipe, Ayodotun; Ramesh, Govindarajan; Wu, Honglu; Zhang, Ye; Shishodia, Shishir; Gridley, Daila S; Pourmand, Nader; Jejelowo, Olufisayo

    2011-03-01

    The space radiation environment consists of trapped particle radiation, solar particle radiation, and galactic cosmic radiation (GCR), in which protons are the most abundant particle type. During missions to the moon or to Mars, the constant exposure to GCR and occasional exposure to particles emitted from solar particle events (SPE) are major health concerns for astronauts. Therefore, in order to determine health risks during space missions, an understanding of cellular responses to proton exposure is of primary importance. The expression of DNA repair genes in response to ionizing radiation (X-rays and gamma rays) has been studied, but data on DNA repair in response to protons is lacking. Using qPCR analysis, we investigated changes in gene expression induced by positively charged particles (protons) in four categories (0, 0.1, 1.0, and 2.0 Gy) in nine different DNA repair genes isolated from the testes of irradiated mice. DNA repair genes were selected on the basis of their known functions. These genes include ERCC1 (5' incision subunit, DNA strand break repair), ERCC2/NER (opening DNA around the damage, Nucleotide Excision Repair), XRCC1 (5' incision subunit, DNA strand break repair), XRCC3 (DNA break and cross-link repair), XPA (binds damaged DNA in preincision complex), XPC (damage recognition), ATA or ATM (activates checkpoint signaling upon double strand breaks), MLH1 (post-replicative DNA mismatch repair), and PARP1 (base excision repair). Our results demonstrate that ERCC1, PARP1, and XPA genes showed no change at 0.1 Gy radiation, up-regulation at 1.0 Gy radiation (1.09 fold, 7.32 fold, 0.75 fold, respectively), and a remarkable increase in gene expression at 2.0 Gy radiation (4.83 fold, 57.58 fold and 87.58 fold, respectively). Expression of other genes, including ATM and XRCC3, was unchanged at 0.1 and 1.0 Gy radiation but showed up-regulation at 2.0 Gy radiation (2.64 fold and 2.86 fold, respectively). We were unable to detect gene expression for the

  4. Making ends meet: repairing breaks in bacterial DNA by non-homologous end-joining.

    Directory of Open Access Journals (Sweden)

    Richard Bowater

    2006-02-01

    Full Text Available DNA double-strand breaks (DSBs are one of the most dangerous forms of DNA lesion that can result in genomic instability and cell death. Therefore cells have developed elaborate DSB-repair pathways to maintain the integrity of genomic DNA. There are two major pathways for the repair of DSBs in eukaryotes: homologous recombination and non-homologous end-joining (NHEJ. Until very recently, the NHEJ pathway had been thought to be restricted to the eukarya. However, an evolutionarily related NHEJ apparatus has now been identified and characterized in the prokarya. Here we review the recent discoveries concerning bacterial NHEJ and discuss the possible origins of this repair system. We also examine the insights gained from the recent cellular and biochemical studies of this DSB-repair process and discuss the possible cellular roles of an NHEJ pathway in the life-cycle of prokaryotes and phages.

  5. Dual roles of DNA repair enzymes in RNA biology/post-transcriptional control.

    Science.gov (United States)

    Vohhodina, Jekaterina; Harkin, D Paul; Savage, Kienan I

    2016-09-01

    Despite consistent research into the molecular principles of the DNA damage repair pathway for almost two decades, it has only recently been found that RNA metabolism is very tightly related to this pathway, and the two ancient biochemical mechanisms act in alliance to maintain cellular genomic integrity. The close links between these pathways are well exemplified by examining the base excision repair pathway, which is now well known for dual roles of many of its members in DNA repair and RNA surveillance, including APE1, SMUG1, and PARP1. With additional links between these pathways steadily emerging, this review aims to provide a summary of the emerging roles for DNA repair proteins in the post-transcriptional regulation of RNAs. WIREs RNA 2016, 7:604-619. doi: 10.1002/wrna.1353 For further resources related to this article, please visit the WIREs website. PMID:27126972

  6. Characterization of DNA repair phenotypes of Xeroderma pigmentosum cell lines by a paralleled in vitro test

    International Nuclear Information System (INIS)

    DNA is constantly damaged modifying the genetic information for which it encodes. Several cellular mechanisms as the Base Excision Repair (BER) and the Nucleotide Excision Repair (NER) allow recovering the right DNA sequence. The Xeroderma pigmentosum is a disease characterised by a deficiency in the NER pathway. The aim of this study was to propose an efficient and fast test for the diagnosis of this disease as an alternative to the currently available UDS test. DNA repair activities of XP cell lines were quantified using in vitro miniaturized and paralleled tests in order to establish DNA repair phenotypes of XPA and XPC deficient cells. The main advantage of the tests used in this study is the simultaneous measurement of excision or excision synthesis (ES) of several lesions by only one cellular extract. We showed on one hand that the relative ES of the different lesions depend strongly on the protein concentration of the nuclear extract tested. Working at high protein concentration allowed discriminating the XP phenotype versus the control one, whereas it was impossible under a certain concentration's threshold. On the other hand, while the UVB irradiation of control cells stimulated their repair activities, this effect was not observed in XP cells. This study brings new information on the XPA and XPC protein roles during BER and NER and underlines the complexity of the regulations of DNA repair processes. (author)

  7. Polymorphisms in human DNA repair genes and head and neck squamous cell carcinoma

    Indian Academy of Sciences (India)

    Rim Khlifi; Ahmed Rebai; Amel Hamza-Chaffai

    2012-12-01

    Genetic polymorphisms in some DNA repair proteins are associated with a number of malignant transformations like head and neck squamous cell carcinoma (HNSCC). Xeroderma pigmentosum group D (XPD) and X-ray repair cross-complementing proteins 1 (XRCC1) and 3 (XRCC3) genes are involved in DNA repair and were found to be associated with HNSCC in numerous studies. To establish our overall understanding of possible relationships between DNA repair gene polymorphisms and development of HNSCC, we surveyed the literature on epidemiological studies that assessed potential associations with HNSCC risk in terms of gene–environment interactions, genotype-induced functional defects in enzyme activity and/or protein expression, and the influence of ethnic origin on these associations.We conclude that large, well-designed studies of common polymorphisms in DNA repair genes are needed. Such studies may benefit from analysis of multiple genes or polymorphisms and from the consideration of relevant exposures that may influence the likelihood of HNSCC when DNA repair capacity is reduced.

  8. Radiation- and drug-induced DNA repair in mammalian oocytes and embryos

    International Nuclear Information System (INIS)

    A review of studies showing ultraviolet- or drug-induced unscheduled DNA synthesis in mammalian oocytes and embryos suggests that the female gamete has an excision repair capacity from the earliest stages of oocyte growth. The oocyte's demonstrable excision repair capacity decreases at the time of meiotic maturation for unknown reasons, but the fully mature oocyte maintans a repair capacity, in contrast to the mature sperm, and contributes this to the zygote. Early embryo cells maintain relatively constant levels of excision repair until late fetal stages, when they lose their capacity for excision repair. These apparent changes in excision repair capacity do not have a simple relationship to known differences in radiation sensitivity of germ cells and embryos

  9. Coexistence of Different Electron-Transfer Mechanisms in the DNA Repair Process by Photolyase.

    Science.gov (United States)

    Lee, Wook; Kodali, Goutham; Stanley, Robert J; Matsika, Spiridoula

    2016-08-01

    DNA photolyase has been the topic of extensive studies due to its important role of repairing photodamaged DNA, and its unique feature of using light as an energy source. A crucial step in the repair by DNA photolyase is the forward electron transfer from its cofactor (FADH(-) ) to the damaged DNA, and the detailed mechanism of this process has been controversial. In the present study, we examine the forward electron transfer in DNA photolyase by carrying out high-level ab initio calculations in combination with a quantum mechanical/molecular mechanical (QM/MM) approach, and by measuring fluorescence emission spectra at low temperature. On the basis of these computational and experimental results, we demonstrate that multiple decay pathways exist in DNA photolyase depending on the wavelength at excitation and the subsequent transition. This implies that the forward electron transfer in DNA photolyase occurs not only by superexchange mechanism but also by sequential electron transfer. PMID:27362906

  10. Repair of DNA treated with γ-irradiation and chemical carcinogens. Final report, June 1, 1981-May 31, 1984

    International Nuclear Information System (INIS)

    Work done in the past three years has been on DNA repair, on genetic transposition and on the effect of carcinogens on alu sequence transcription. DNA repair work was completed on β-propiolactone DNA adducts, on procaryotic and eucaryotic enzymes capable of removal of 3-methyladenine from DNA, and on in vitro repair of neucleosomal core particle DNA and chromatin DNA. Attempts were made to isolate a human transposable element through the isolation of double stranded RNA and probing of a human library. Experiments were also done to determine whether carcinogens altered the expression of alu sequences in human DNA

  11. Genomic survey and expression analysis of DNA repair genes in the genus Leptospira.

    Science.gov (United States)

    Martins-Pinheiro, Marinalva; Schons-Fonseca, Luciane; da Silva, Josefa B; Domingos, Renan H; Momo, Leonardo Hiroyuki Santos; Simões, Ana Carolina Quirino; Ho, Paulo Lee; da Costa, Renata M A

    2016-04-01

    Leptospirosis is an emerging zoonosis with important economic and public health consequences and is caused by pathogenic leptospires. The genus Leptospira belongs to the order Spirochaetales and comprises saprophytic (L. biflexa), pathogenic (L. interrogans) and host-dependent (L. borgpetersenii) members. Here, we present an in silico search for DNA repair pathways in Leptospira spp. The relevance of such DNA repair pathways was assessed through the identification of mRNA levels of some genes during infection in animal model and after exposition to spleen cells. The search was performed by comparison of available Leptospira spp. genomes in public databases with known DNA repair-related genes. Leptospires exhibit some distinct and unexpected characteristics, for instance the existence of a redundant mechanism for repairing a chemically diverse spectrum of alkylated nucleobases, a new mutS-like gene and a new shorter version of uvrD. Leptospira spp. shares some characteristics from Gram-positive, as the presence of PcrA, two RecQ paralogs and two SSB proteins; the latter is considered a feature shared by naturally competent bacteria. We did not find a significant reduction in the number of DNA repair-related genes in both pathogenic and host-dependent species. Pathogenic leptospires were enriched for genes dedicated to base excision repair and non-homologous end joining. Their evolutionary history reveals a remarkable importance of lateral gene transfer events for the evolution of the genus. Up-regulation of specific DNA repair genes, including components of SOS regulon, during infection in animal model validates the critical role of DNA repair mechanisms for the complex interplay between host/pathogen.

  12. Genomic survey and expression analysis of DNA repair genes in the genus Leptospira.

    Science.gov (United States)

    Martins-Pinheiro, Marinalva; Schons-Fonseca, Luciane; da Silva, Josefa B; Domingos, Renan H; Momo, Leonardo Hiroyuki Santos; Simões, Ana Carolina Quirino; Ho, Paulo Lee; da Costa, Renata M A

    2016-04-01

    Leptospirosis is an emerging zoonosis with important economic and public health consequences and is caused by pathogenic leptospires. The genus Leptospira belongs to the order Spirochaetales and comprises saprophytic (L. biflexa), pathogenic (L. interrogans) and host-dependent (L. borgpetersenii) members. Here, we present an in silico search for DNA repair pathways in Leptospira spp. The relevance of such DNA repair pathways was assessed through the identification of mRNA levels of some genes during infection in animal model and after exposition to spleen cells. The search was performed by comparison of available Leptospira spp. genomes in public databases with known DNA repair-related genes. Leptospires exhibit some distinct and unexpected characteristics, for instance the existence of a redundant mechanism for repairing a chemically diverse spectrum of alkylated nucleobases, a new mutS-like gene and a new shorter version of uvrD. Leptospira spp. shares some characteristics from Gram-positive, as the presence of PcrA, two RecQ paralogs and two SSB proteins; the latter is considered a feature shared by naturally competent bacteria. We did not find a significant reduction in the number of DNA repair-related genes in both pathogenic and host-dependent species. Pathogenic leptospires were enriched for genes dedicated to base excision repair and non-homologous end joining. Their evolutionary history reveals a remarkable importance of lateral gene transfer events for the evolution of the genus. Up-regulation of specific DNA repair genes, including components of SOS regulon, during infection in animal model validates the critical role of DNA repair mechanisms for the complex interplay between host/pathogen. PMID:26527082

  13. FISH comets show that the salvage enzyme TK1 contributes to gene-specific DNA repair

    Science.gov (United States)

    McAllister, Katherine A.; Yasseen, Akeel A.; McKerr, George; Downes, C. S.; McKelvey-Martin, Valerie J.

    2014-01-01

    Thymidine kinase 1 (TK1) is a salvage enzyme that phosphorylates thymidine, imported from surrounding fluids, to create dTMP, which is further phosphorylated to the DNA precursor dTTP. TK1 deficiency has for a long time been known to cause increased cellular sensitivity to DNA damage. We have examined preferential strand break repair of DNA domains in TK1+ and TK1- clones of the Raji cell line, by the Comet-FISH technique, in bulk DNA and in the actively transcribed tumor suppressor (TP53) and human telomerase reverse transcriptase (hTERT) gene regions, over 1 h after 5Gy γ-irradiation. Results showed that repair of the TP53 and hTERT gene regions was more efficient in TK1+ compared to TK1- cells, a trend also reflected to a lesser degree in genomic DNA repair between the cell-lines. The targeted gene-specific repair in TK+ cells occurred rapidly, mainly over the first 15 min repair-period. Therefore, TK1 is needed for preferential repair of actively transcribed regions, through a previously unsuspected mechanism. In principle, TK1 could exert its protective effects through supply of a supplementary dTTP pool for accurate repair of damaged genes; but Raji TK1+ cells in thymidine free media still show preferential repair of transcribed regions. TK1 therefore does not exert its protective effects through dTTP pools, but through another unidentified mechanism, which affects sensitivity to and mutagenicity by DNA damaging agents. PMID:25152750

  14. The DNA base excision repair protein Ape1/Ref-1 as a therapeutic and chemopreventive target.

    Science.gov (United States)

    Fishel, Melissa L; Kelley, Mark R

    2007-01-01

    With our growing understanding of the pathways involved in cell proliferation and signaling, targeted therapies, in the treatment of cancer are entering the clinical arena. New and emerging targets are proteins involved in DNA repair pathways. Inhibition of various proteins in the DNA repair pathways sensitizes cancer cells to DNA damaging agents such as chemotherapy and/or radiation. We study the apurinic endonuclease 1/redox factor-1 (Ape1/Ref-1) and believe that its crucial function in DNA repair and reduction-oxidation or redox signaling make it an excellent target for sensitizing tumor cells to chemotherapy. Ape1/Ref-1 is an essential enzyme in the base excision repair (BER) pathway which is responsible for the repair of DNA caused by oxidative and alkylation damage. As importantly, Ape1/Ref-1 also functions as a redox factor maintaining transcription factors in an active reduced state. Ape1/Ref-1 stimulates the DNA binding activity of numerous transcription factors that are involved in cancer promotion and progression such as AP-1 (Fos/Jun), NFkappaB, HIF-1alpha, CREB, p53 and others. We will discuss what is known regarding the pharmacological targeting of the DNA repair activity, as well as the redox activity of Ape1/Ref-1, and explore the budding clinical utility of inhibition of either of these functions in cancer treatment. A brief discussion of the effect of polymorphisms in its DNA sequence is included because of Ape1/Ref-1's importance to maintenance and integrity of the genome. Experimental modification of Ape1/Ref-1 activity changes the response of cells and of organisms to DNA damaging agents, suggesting that Ape1/Ref-1 may also be a productive target of chemoprevention. In this review, we will provide an overview of Ape1/Ref-1's activities and explore the potential of this protein as a target in cancer treatment as well as its role in chemoprevention.

  15. Nrf2 facilitates repair of radiation induced DNA damage through homologous recombination repair pathway in a ROS independent manner in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Jayakumar, Sundarraj; Pal, Debojyoti; Sandur, Santosh K., E-mail: sskumar@barc.gov.in

    2015-09-15

    Highlights: • Nrf2 inhibition in A549 cells led to attenuated DNA repair and radiosensitization. • Influence of Nrf2 on DNA repair is not linked to its antioxidant function. • Nrf2 influences DNA repair through homologous recombination (HR) repair pathway. • Many genes involved in HR pathway show ARE sequences in their upstream region. - Abstract: Nrf2 is a redox sensitive transcription factor that is involved in the co-ordinated transcription of genes involved in redox homeostasis. But the role of Nrf2 in DNA repair is not investigated in detail. We have employed A549 and MCF7 cells to study the role of Nrf2 on DNA repair by inhibiting Nrf2 using all-trans retinoic acid (ATRA) or by knock down approach prior to radiation exposure (4 Gy). DNA damage and repair analysis was studied by γH2AX foci formation and comet assay. Results suggested that the inhibition of Nrf2 in A549 or MCF7 cells led to significant slowdown in DNA repair as compared to respective radiation controls. The persistence of residual DNA damage even in the presence of free radical scavenger N-acetyl cysteine, suggested that the influence of Nrf2 on DNA repair was not linked to its antioxidant functions. Further, its influence on non-homologous end joining repair pathway was studied by inhibiting both Nrf2 and DNA-PK together. This led to synergistic reduction of survival fraction, indicating that Nrf2 may not be influencing the NHEJ pathway. To investigate the role of homologous recombination repair (HR) pathway, RAD51 foci formation was monitored. There was a significant reduction in the foci formation in cells treated with ATRA or shRNA against Nrf2 as compared to their respective radiation controls. Further, Nrf2 inhibition led to significant reduction in mRNA levels of RAD51. BLAST analysis was also performed on upstream regions of DNA repair genes to identify antioxidant response element and found that many repair genes that are involved in HR pathway may be regulated by Nrf2

  16. Acetylation regulates WRN catalytic activities and affects base excision DNA repair

    DEFF Research Database (Denmark)

    Muftuoglu, Meltem; Kusumoto, Rika; Speina, Elzbieta;

    2008-01-01

    The Werner protein (WRN), defective in the premature aging disorder Werner syndrome, participates in a number of DNA metabolic processes, and we have been interested in the possible regulation of its function in DNA repair by post-translational modifications. Acetylation mediated by histone...

  17. DNA repair enables sex identification in genetic material from human teeth

    NARCIS (Netherlands)

    Kovatsi, L.; Nikou, D.; Triantaphyllou, S.; Njau, S. N.; Voutsaki, S.; Kouidou, S.

    2009-01-01

    Background: The purpose of this study was to test the effectiveness of a DNA repair protocol in improving genetic testing in compromised samples, frequently encountered in Forensic Medicine. Methods: In order to stretch the experiment conditions to the limits, as far as quality of samples and DNA is

  18. Magnesium coordination controls the molecular switch function of DNA mismatch repair protein MutS

    NARCIS (Netherlands)

    J.H.G. Lebbink (Joyce); A. Fish (Alexander); A. Reumer (Annet); G. Natrajan; H.H.K. Winterwerp (Herrie); T.K. Sixma (Titia)

    2010-01-01

    textabstractThe DNA mismatch repair protein MutS acts as a molecular switch. It toggles between ADP and ATP states and is regulated by mismatched DNA. This is analogous to G-protein switches and the regulation of their "on" and "off" states by guanine exchange factors. Although GDP release in monome

  19. Differential contributions of mammalian Rad54 paralogs to recombination, DNA damage repair, and meiosis.

    NARCIS (Netherlands)

    J. Wesoly (Joanna); S. Agarwal (Sheba); S. Sigurdsson (Stefan); W. Bussen (Wendy); S. Komen (Stephen); J. Qin (Jian); H. van Steeg (Harry); J. van Benthem (Jan); E. Wassenaar (Evelyne); W.M. Baarends (Willy); M. Ghazvini (Mehrnaz); A. Tafel (Agnieszka); H. Heath (Helen); N.J. Galjart (Niels); J. Essers (Jeroen); J.A. Grootegoed (Anton); N. Arnheim (Norman); O.Y. Bezzubova (Olga); J-M. Buerstedde; P. Sung (Patrick); R. Kanaar (Roland)

    2006-01-01

    textabstractHomologous recombination is a versatile DNA damage repair pathway requiring Rad51 and Rad54. Here we show that a mammalian Rad54 paralog, Rad54B, displays physical and functional interactions with Rad51 and DNA that are similar to those of Rad54. While ablation of Rad54 in mouse embryoni

  20. Colocalization of multiple DNA double-strand breaks at a single Rad52 repair centre

    DEFF Research Database (Denmark)

    Lisby, M.; Mortensen, Uffe Hasbro; Rothstein, R.

    2003-01-01

    DNA double-strand break repair (DSBR) is an essential process for preserving genomic integrity in all organisms. To investigate this process at the cellular level, we engineered a system of fluorescently marked DNA double-strand breaks (DSBs) in the yeast Saccharomyces cerevisiae to visualize in...

  1. Regulation of DNA double-strand break repair by ubiquitin and ubiquitin-like modifiers

    DEFF Research Database (Denmark)

    Schwertman, Petra; Bekker-Jensen, Simon; Mailand, Niels

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions. The swift recognition and faithful repair of such damage is crucial for the maintenance of genomic stability, as well as for cell and organismal fitness. Signalling by ubiquitin, SUMO and other ubiquitin-like modifiers (UBLs...

  2. Immunohistochemical analysis of oxidative stress and DNA repair proteins in normal mammary and breast cancer tissues

    International Nuclear Information System (INIS)

    During the course of normal cellular metabolism, oxygen is consumed and reactive oxygen species (ROS) are produced. If not effectively dissipated, ROS can accumulate and damage resident proteins, lipids, and DNA. Enzymes involved in redox regulation and DNA repair dissipate ROS and repair the resulting damage in order to preserve a functional cellular environment. Because increased ROS accumulation and/or unrepaired DNA damage can lead to initiation and progression of cancer and we had identified a number of oxidative stress and DNA repair proteins that influence estrogen responsiveness of MCF-7 breast cancer cells, it seemed possible that these proteins might be differentially expressed in normal mammary tissue, benign hyperplasia (BH), ductal carcinoma in situ (DCIS) and invasive breast cancer (IBC). Immunohistochemistry was used to examine the expression of a number of oxidative stress proteins, DNA repair proteins, and damage markers in 60 human mammary tissues which were classified as BH, DCIS or IBC. The relative mean intensity was determined for each tissue section and ANOVA was used to detect statistical differences in the relative expression of BH, DCIS and IBC compared to normal mammary tissue. We found that a number of these proteins were overexpressed and that the cellular localization was altered in human breast cancer tissue. Our studies suggest that oxidative stress and DNA repair proteins not only protect normal cells from the damaging effects of ROS, but may also promote survival of mammary tumor cells

  3. Immunohistochemical analysis of oxidative stress and DNA repair proteins in normal mammary and breast cancer tissues

    Directory of Open Access Journals (Sweden)

    Nardulli Ann M

    2010-01-01

    Full Text Available Abstract Background During the course of normal cellular metabolism, oxygen is consumed and reactive oxygen species (ROS are produced. If not effectively dissipated, ROS can accumulate and damage resident proteins, lipids, and DNA. Enzymes involved in redox regulation and DNA repair dissipate ROS and repair the resulting damage in order to preserve a functional cellular environment. Because increased ROS accumulation and/or unrepaired DNA damage can lead to initiation and progression of cancer and we had identified a number of oxidative stress and DNA repair proteins that influence estrogen responsiveness of MCF-7 breast cancer cells, it seemed possible that these proteins might be differentially expressed in normal mammary tissue, benign hyperplasia (BH, ductal carcinoma in situ (DCIS and invasive breast cancer (IBC. Methods Immunohistochemistry was used to examine the expression of a number of oxidative stress proteins, DNA repair proteins, and damage markers in 60 human mammary tissues which were classified as BH, DCIS or IBC. The relative mean intensity was determined for each tissue section and ANOVA was used to detect statistical differences in the relative expression of BH, DCIS and IBC compared to normal mammary tissue. Results We found that a number of these proteins were overexpressed and that the cellular localization was altered in human breast cancer tissue. Conclusions Our studies suggest that oxidative stress and DNA repair proteins not only protect normal cells from the damaging effects of ROS, but may also promote survival of mammary tumor cells.

  4. Differential repair of platinum-DNA adducts in human bladder and testicular tumor continuous cell lines

    International Nuclear Information System (INIS)

    The formation and removal of four platinum-DNA adducts were immunochemically quantitated in cultured cells derived from a human bladder carcinoma cell line (RT112) and from two lines derived from germ cell tumors of the testis (833K and SUSA), following exposure in vitro to 16.7 microM (5 micrograms/ml) cisplatin. RT112 cells were least sensitive to the drug and were proficient in the repair of all four adducts, whereas SUSA cells, which were 5-fold more sensitive, were deficient in the repair of DNA-DNA intrastrand cross-links in the sequences pApG and pGpG. Despite expressing a similar sensitivity to SUSA cells, 833K cells were proficient in the repair of all four adducts, although less so than the RT112 bladder tumor cells. In addition, SUSA cells were unable to repair DNA-DNA interstrand cross-links whereas 50-85% of these lesions were removed in RT112 and 833K cells 24 h following drug exposure. It is possible that the inability of SuSa cells to repair platinated DNA may account for their hypersensitivity to cisplatin

  5. A novel assay revealed that ribonucleotide reductase is functionally important for interstrand DNA crosslink repair.

    Science.gov (United States)

    Fujii, Naoaki; Evison, Benjamin J; Actis, Marcelo L; Inoue, Akira

    2015-11-01

    Cells have evolved complex biochemical pathways for DNA interstrand crosslink (ICL) removal. Despite the chemotherapeutic importance of ICL repair, there have been few attempts to identify which mechanistic DNA repair inhibitor actually inhibits ICL repair. To identify such compounds, a new and robust ICL repair assay was developed using a novel plasmid that contains synthetic ICLs between a CMV promoter region that drives transcription and a luciferase reporter gene, and an SV40 origin of replication and the large T antigen (LgT) gene that enables self-replication in mammalian cells. In a screen against compounds that are classified as inhibitors of DNA repair or synthesis, the reporter generation was exquisitely sensitive to ribonucleotide reductase (RNR) inhibitors such as gemcitabine and clofarabine, but not to inhibitors of PARP, ATR, ATM, Chk1, and others. The effect was observed also by siRNA downregulation of RNR. Moreover, the reporter generation was also particularly sensitive to 3-AP, a non-nucleoside RNR inhibitor, but not significantly sensitive to DNA replication stressors, suggesting that the involvement of RNR in ICL repair is independent of incorporation of a nucleotide RNR inhibitor into DNA to induce replication stress. The reporter generation from a modified version of the plasmid that lacks the LgT-SV40ori motif was also adversely affected by RNR inhibitors, further indicating a role for RNR in ICL repair that is independent of DNA replication. Intriguingly, unhooking of cisplatin-ICL from nuclear DNA was significantly inhibited by low doses of gemcitabine, suggesting an unidentified functional role for RNR in the process of ICL unhooking. The assay approach could identify other molecules essential for ICLR in quantitative and flexible manner. PMID:26462050

  6. Unique DNA repair properties of a xeroderma pigmentosum revertant.

    OpenAIRE

    Cleaver, J.E.; Cortés, F; Lutze, L H; Morgan, W F; Player, A N; D. L. Mitchell

    1987-01-01

    A group A xeroderma pigmentosum revertant with normal sensitivity was created by chemical mutagenesis. It repaired (6-4) photoproducts normally but not pyrimidine dimers and had near normal levels of repair replication, sister chromatid exchange, and mutagenesis from UV light. The rate of UV-induced mutation in a shuttle vector, however, was as high as the rate in the parental xeroderma pigmentosum cell line.

  7. Inhibition of DNA repair by Pentoxifylline and related methylxanthine derivatives

    International Nuclear Information System (INIS)

    The methylxanthine drug Pentoxifylline is reviewed for new properties which have emerged only relatively recently and for which clinical applications can be expected. After a summary on the established systemic effects of Pentoxifylline on the microcirculation and reduction of tumour anoxia, the role of the drug in the treatment of vasoocclusive disorders, cerebral ischemia, infectious diseases, septic shock and acute respiratory distress, the review focuses on another level of drug action which is based on in vitro observations in a variety of cell lines. Pentoxifylline and the related drug Caffeine are known radiosensitizers especially in p53 mutant cells. The explanation that the drug abrogates the G2 block and shortens repair in G2 by promoting early entry into mitosis is not anymore tenable because enhancement of radiotoxicity requires presence of the drug during irradiation and fails when the drug is added after irradiation at the G2 maximum. Repair assays by measurement of recovery ratios and by delayed plating experiments indeed strongly suggested a role in repair which is now confirmed for Pentoxifylline by constant field gel electrophoresis (CFGE) measurements and for Pentoxifylline and for Caffeine by use of a variety of repair mutants. The picture now emerging shows that Caffeine and Pentoxifylline inhibit homologous recombination by targeting members of the PIK kinase family (ATM and ATR) which facilitate repair in G2. Pentoxifylline induced repair inhibition between irradiation dose fractions to counter interfraction repair has been successfully applied in a model for stereotactic surgery. Another realistic avenue of application of Pentoxifylline in tumour therapy comes from experiments which show that repair events in G2 can be targeted directly by addition of cytotoxic drugs and Pentoxifylline at the G2 maximum. Under these conditions massive dose enhancement factors of up to 80 have been observed suggesting that it may be possible to realise

  8. Radiation induced bystander signals are independent of DNA damage and DNA repair capacity of the irradiated cells

    International Nuclear Information System (INIS)

    Evidence is accumulating that irradiated cells produce signals, which interact with non-exposed cells in the same population. Here, we analysed the mechanism for bystander signal arising in wild-type CHO cells and repair deficient varients, focussing on the relationship between DNA repair capacity and bystander signal arising in irradiated cells. In order to investigate the bystander effect, we carried out medium transfer experiments after X-irradiation where micronuclei were scored in non-targeted DSB repair deficient xrs5 cells. When conditioned medium from irradiated cells was transferred to unirradiated xrs5 cells, the level of induction was independent of whether the medium came from irradiated wild-type, ssb or dsb repair deficient cells. This result suggests that the activation of a bystander signal is independent of the DNA repair capacity of the irradiated cells. Also, pre-treatment of the irradiated cells with 0.5% DMSO, which suppresses micronuclei induction in CHO but not in xrs5 cells, suppressed bystander effects completely in both conditioned media, suggesting that DMSO is effective for suppression of bystander signal arising independently of DNA damage in irradiated cells. Overall the work presented here adds to the understanding that it is the repair phenotype of the cells receiving bystander signals, which determines overall response rather than that of the cell producing the bystander signal

  9. New Applications of the Comet Assay: Comet-FISH and Transcription-Coupled DNA Repair

    OpenAIRE

    Spivak, Graciela; Cox, Rachel A.; Hanawalt, Philip C.

    2008-01-01

    Transcription-coupled repair (TCR) is a pathway dedicated to the removal of damage from the template strands of actively transcribed genes. Although the detailed mechanism of TCR is not yet understood, it is believed to be triggered when a translocating RNA polymerase is arrested at a lesion or unusual structure in the DNA. Conventional assays for TCR require high doses of DNA damage for the statistical analysis of repair in the individual strands of DNA sequences ranging in size from a few h...

  10. Dynamical Allosterism in the Mechanism of Action of DNA Mismatch Repair Protein MutS

    OpenAIRE

    Pieniazek, Susan N.; Hingorani, Manju M.; Beveridge, D.L.

    2011-01-01

    The multidomain protein Thermus aquaticus MutS and its prokaryotic and eukaryotic homologs recognize DNA replication errors and initiate mismatch repair. MutS actions are fueled by ATP binding and hydrolysis, which modulate its interactions with DNA and other proteins in the mismatch-repair pathway. The DNA binding and ATPase activities are allosterically coupled over a distance of ∼70 Å, and the molecular mechanism of coupling has not been clarified. To address this problem, all-atom molecul...

  11. Computational study of recognition of DNA damages and their repair. 8-oxoguanine oxidative DNA damage with repair enzyme hOGG1

    International Nuclear Information System (INIS)

    The molecular dynamics (MD) simulations of DNA mutagenic oxidative lesion - 7,8-dihydro-8-oxoguanine (8-oxoG), single and complexed with the repair enzyme - human oxoguanine glycosylase 1 (hOGG1) were performed for 1 nanosecond (ns) in order to determine structural changes at the DNA molecule and to describe a dynamical process of DNA-enzyme complex formation. The molecule of 8-oxoG was inserted into central part of B-DNA 15-mer d(GCGTCCA'8-oxoG'GTCTACC)2 replacing the native guanine 8. In the case of simulation of single DNA molecule the broken hydrogen bonds resulting in locally collapsed B-DNA structure were observed at the lesion site. In addition the adenine on the complementary strand (separated from 8-oxoG by 1 base pair) was flipped-out of the DNA double helix. In the case of simulation of DNA and repair enzyme hOGG1, the DNA-enzyme complex was formed after 500 picoseconds of MD that lasted stable until the simulation was terminated at 1 ns. The complex was represented by the overlapping Van der Waals surfaces of DNA and enzyme molecules. The N-terminus of arginine 324 was located close to the phosphodiester bond of nucleotide with 8-oxoG enabling chemical reactions between amino acid and lesion. Phosphodiester bond at C5' of 8-oxoG was at the position close to the N-terminus of arginine 324. The water mediated hydrogen bonds network was formed in each contact area between DNA and enzyme further enhancing the stability of complex. In the background simulation of the identical molecular system with the native DNA, neither the complex nor the water mediated hydrogen bond network were observed. (author)

  12. Detection of thymine [2+2] photodimer repair in DNA: selective reaction of KMnO4.

    OpenAIRE

    Ramaiah, D; Koch, T.; Orum, H; Schuster, G B

    1998-01-01

    The specific reaction of potassium permanganate with thymine in single-stranded DNA was employed to analyze thymine [2+2] dimer repair in DNA and in DNA/peptide nucleic acid hybrid duplexes. This simple and highly sensitive chemical assay is convenient for monitoring repair of thymine dimers in oligonucleotides.

  13. Dictyostelium discoideum, a lower eukaryote model for the study of DNA repair: Implications for the role of DNA-damaging chemicals in the evolution of repair proficient cells

    Science.gov (United States)

    Deering, R. A.

    1994-10-01

    The evolution of the ability of living cells to cope with stress is crucial for the maintenance of their genetic integrity. Yet low levels of mutation must remain to allow adaptation to environmental changes. The cellular slime mold D. discoideum is a good system for studying molecular aspects of the repair of lethal and mutagenic damage to DNA by radiation and chemicals. The wild-type strains of this soil microorganism are extremely resistant to DNA damaging agents. In nature the amoeboid cells in their replicative stage feed on soil bacteria and are exposed to numerous DNA-damaging chemicals produced by various soil microorganisms. It is probable that the evolution of repair systems in this organism and perhaps in others is a consequence of the necessity to cope with chemical damage which also confers resistance to radiation.

  14. Split-dose recovery is due to the repair of DNA double-strand breaks

    International Nuclear Information System (INIS)

    DNA double-strand breaks are the molecular lesions the repair of which leads to the reappearance of the shoulder observed in split-dose experiments. This conclusion is based on results obtained with the help of a diploid yeast mutant rad54-3 which is temperature-conditional for the repair of DNA double-strand breaks. Two repair steps must be met to yield the reappearance of the shoulder on a split-dose survival curve: the repair of double-strand breaks during the interval between two doses and on the nutrient agar plate after the second dose. In yeast lethality may be attributable to either an unrepaired double-strand break (i.e. a double-strand break is a potentially lethal lesion) or to the interaction of two double-strand breaks (misrepair of double-strand breaks). Evidence is presented that the two cellular phenomena of liquid holding recovery (repair of potentially lethal damage) and of split-dose recovery (repair of sublethal damage) are based on the repair of the same molecular lesion, the DNA double-strand break. (author)

  15. DNA damage response and repair data with pharmacological modulators of Tousled

    Directory of Open Access Journals (Sweden)

    Prakash Srinivasan Timiri Shanmugam

    2016-06-01

    Full Text Available Human Tousled kinase 1 (TLK1 plays an important role in chromatin remodeling, replication, and DNA damage response and repair. TLK1 activity is immediately, but transiently, downregulated after genotoxic insult, and its recovery is important for exit from checkpoint arrest and cell survival after radiation. The data in this article compliments research presented in the paper titled, “Tousled kinase activator, gallic acid, promotes DNA repair and suppresses radiation cytotoxicity in salivary gland cells” [1]. The identification of small molecule activators and inhibitors of TLK1 provided an opportunity to pharmacologically alter the protein׳s activity to elucidate its role in DNA damage response pathways. TLK1 effectors, gallic acid (GA and thioridazine (THD activate and inhibit the kinase, respectively, and the data report on the impact of these compounds and the significance of TLK1 to DNA break repair and the survival of human salivary acinar cells.

  16. ppGpp couples transcription to DNA repair in E. coli.

    Science.gov (United States)

    Kamarthapu, Venu; Epshtein, Vitaly; Benjamin, Bradley; Proshkin, Sergey; Mironov, Alexander; Cashel, Michael; Nudler, Evgeny

    2016-05-20

    The small molecule alarmone (p)ppGpp mediates bacterial adaptation to nutrient deprivation by altering the initiation properties of RNA polymerase (RNAP). ppGpp is generated in Escherichia coli by two related enzymes, RelA and SpoT. We show that ppGpp is robustly, but transiently, induced in response to DNA damage and is required for efficient nucleotide excision DNA repair (NER). This explains why relA-spoT-deficient cells are sensitive to diverse genotoxic agents and ultraviolet radiation, whereas ppGpp induction renders them more resistant to such challenges. The mechanism of DNA protection by ppGpp involves promotion of UvrD-mediated RNAP backtracking. By rendering RNAP backtracking-prone, ppGpp couples transcription to DNA repair and prompts transitions between repair and recovery states. PMID:27199428

  17. ppGpp couples transcription to DNA repair in E. coli.

    Science.gov (United States)

    Kamarthapu, Venu; Epshtein, Vitaly; Benjamin, Bradley; Proshkin, Sergey; Mironov, Alexander; Cashel, Michael; Nudler, Evgeny

    2016-05-20

    The small molecule alarmone (p)ppGpp mediates bacterial adaptation to nutrient deprivation by altering the initiation properties of RNA polymerase (RNAP). ppGpp is generated in Escherichia coli by two related enzymes, RelA and SpoT. We show that ppGpp is robustly, but transiently, induced in response to DNA damage and is required for efficient nucleotide excision DNA repair (NER). This explains why relA-spoT-deficient cells are sensitive to diverse genotoxic agents and ultraviolet radiation, whereas ppGpp induction renders them more resistant to such challenges. The mechanism of DNA protection by ppGpp involves promotion of UvrD-mediated RNAP backtracking. By rendering RNAP backtracking-prone, ppGpp couples transcription to DNA repair and prompts transitions between repair and recovery states.

  18. The Heterochromatic Barrier to DNA Double Strand Break Repair: How to Get the Entry Visa

    Directory of Open Access Journals (Sweden)

    Aaron A. Goodarzi

    2012-09-01

    Full Text Available Over recent decades, a deep understanding of pathways that repair DNA double strand breaks (DSB has been gained from biochemical, structural, biophysical and cellular studies. DNA non-homologous end-joining (NHEJ and homologous recombination (HR represent the two major DSB repair pathways, and both processes are now well understood. Recent work has demonstrated that the chromatin environment at a DSB significantly impacts upon DSB repair and that, moreover, dramatic modifications arise in the chromatin surrounding a DSB. Chromatin is broadly divided into open, transcriptionally active, euchromatin (EC and highly compacted, transcriptionally inert, heterochromatin (HC, although these represent extremes of a spectrum. The HC superstructure restricts both DSB repair and damage response signaling. Moreover, DSBs within HC (HC-DSBs are rapidly relocalized to the EC-HC interface. The damage response protein kinase, ataxia telangiectasia mutated (ATM, is required for HC-DSB repair but is dispensable for the relocalization of HC-DSBs. It has been proposed that ATM signaling enhances HC relaxation in the DSB vicinity and that this is a prerequisite for HC-DSB repair. Hence, ATM is essential for repair of HC-DSBs. Here, we discuss how HC impacts upon the response to DSBs and how ATM overcomes the barrier that HC poses to repair.

  19. Rate and extent of DNA repair in nondividing human diploid fibroblasts

    International Nuclear Information System (INIS)

    Rates of DNA repair in ultraviolet irradiated nondividing human diploid fibroblasts were determined at doses as low as 1 J/sq m using an enzymatic assay for pyrimidine dimers. In normal cells, initial rates increased with dose to 20 J/sq m with no further increase at 40 J/sq m. At 10 J/sq m or less, repair occurred continuously over long postultraviolet periods until all the damage that could be detected was removed. The overall rate curves appear as the sum of two first-order reactions with different rate constants. The slow reaction extrapolates to 30 to 40% of the original dimers. Populations irradiated a second time after greater than 90% of the original damage had been removed repaired the newly added DNA damage with similar kinetics and to the same extent. Repair kinetics in a xeroderma pigmentosum strain lacks the rapid component and approximates the slow component of normal cells. If the slow component of normal cells is due to repair of less accessible dimers, as suggested by others, then by analogy, slow excision repair in XP12BE may be due to the poor accessibility of all dimers. This suggests that the XP12BE excision repair defect is in the enzymes that render dimers in chromatin accessible to repair

  20. Molecular Mechanisms of Ultraviolet Radiation-Induced DNA Damage and Repair

    Directory of Open Access Journals (Sweden)

    Rajesh P. Rastogi

    2010-01-01

    Full Text Available DNA is one of the prime molecules, and its stability is of utmost importance for proper functioning and existence of all living systems. Genotoxic chemicals and radiations exert adverse effects on genome stability. Ultraviolet radiation (UVR (mainly UV-B: 280–315 nm is one of the powerful agents that can alter the normal state of life by inducing a variety of mutagenic and cytotoxic DNA lesions such as cyclobutane-pyrimidine dimers (CPDs, 6-4 photoproducts (6-4PPs, and their Dewar valence isomers as well as DNA strand breaks by interfering the genome integrity. To counteract these lesions, organisms have developed a number of highly conserved repair mechanisms such as photoreactivation, base excision repair (BER, nucleotide excision repair (NER, and mismatch repair (MMR. Additionally, double-strand break repair (by homologous recombination and nonhomologous end joining, SOS response, cell-cycle checkpoints, and programmed cell death (apoptosis are also operative in various organisms with the expense of specific gene products. This review deals with UV-induced alterations in DNA and its maintenance by various repair mechanisms.

  1. Ku protein complex is involved in nucleotide excision repair of DNA

    International Nuclear Information System (INIS)

    The repair of ultraviolet light (UV-C, 254 nm) DNA lesions by nucleotide excision repair (NER) has been studied in the rodent cell line xrs6 belonging to complementation group 5 of ionising radiation sensitive (IRs) mutants. xrs6 cell line shows e defect in he DNA-end binding protein complex Ku which is involved in the repair of double-strand breaks (DSB) due to IR. In agreement with IR sensitivity, a bleomycin sensitive phenotype of xrs6 cell line was found as compared to the parental CHO-Kl line (factor> 8 fold). xrs6 exhibited also a slight (factor 2) but reproducible sensitivity to UV-C-light, while a revertant cell line for Ku DNA-end binding activity, xrs6rev, showed a restoration of both IR and UV-C sensitivities to the parental level. The NER activity of these cell lines was measured in vitro in nuclear protein extracts in the presence of plasmid DNA repair substrate damaged with UV-C lesions repaired by NER: xrs6 cell extracts exhibited only 55 % of NER activity as compared to the control CHO-Kl and xrs6rev cell extracts. These indicate that the Ku DSB repair protein in involved also in the NER process. (authors). 31 refs., 1 fig., 1 tab

  2. Hypersensitivity to ionizing radiation, in vitro, in a new chromosomal breakage disorder, the Nijmegen Breakage Syndrome

    International Nuclear Information System (INIS)

    The Nijmegen Breakage Syndrome (NBS) is a new chromosomal instability disorder different from ataxia telangiectasia (AT) and other chromosome-breakage syndromes. Cells from an NBS patient appeared hypersensitive to X-irradiation. X-rays induced significantly more chromosomal damage in NBS lymphocytes and fibroblasts than in normal cells. The difference was most pronounced after irradiation in G2. Further, NBS fibroblasts were more readily by X-rays than normal fibroblasts. In addition, the DNA synthesis in NBS cells was more resistant to X-rays and bleomycin than that in normal cells. The reaction of NBS cells to X-rays and bleomycin was similar to that of cells from patients with ataxia telangiectasia. Our results indicate that NBS and AT, which also have similar chromosomal characteristics, must be closely related. (orig.)

  3. Hypersensitivity to ionizing radiation, in vitro, in a new chromosomal breakage disorder, the Nijmegen Breakage Syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Taalman, R.D.F.M.; Scheres, J.M.J.C.; Hustinx, T.W.J. (Katholieke Univ. Nijmegen (Netherlands). Dept. of Human Genetics); Jaspers, N.G.J.; de Wit, J. (Erasmus Universiteit, Rotterdam (Netherlands). Lab. of Cell Biology and Genetics)

    1983-02-01

    The Nijmegen Breakage Syndrome (NBS) is a new chromosomal instability disorder different from ataxia telangiectasia (AT) and other chromosome-breakage syndromes. Cells from an NBS patient appeared hypersensitive to X-irradiation. X-rays induced significantly more chromosomal damage in NBS lymphocytes and fibroblasts than in normal cells. The difference was most pronounced after irradiation in G/sub 2/. Further, NBS fibroblasts were more readily by X-rays than normal fibroblasts. In addition, the DNA synthesis in NBS cells was more resistant to X-rays and bleomycin than that in normal cells. The reaction of NBS cells to X-rays and bleomycin was similar to that of cells from patients with ataxia telangiectasia. Our results indicate that NBS and AT, which also have similar chromosomal characteristics, must be closely related.

  4. A cell-free system for studying a priming factor involved in repair of bleomycin-damaged DNA.

    Directory of Open Access Journals (Sweden)

    Seki,Shuji

    1989-04-01

    Full Text Available A simple cell-free system for studying a priming factor involved in the repair of bleomycin-damaged DNA was established. The template-primer used for the repair DNA synthesis was prepared by treating the closed circular, superhelical form of pUC19 plasmid DNA with 2.2 microM bleomycin and 20 microM ferrous ions. Single-strand breaks were introduced into pUC19 DNA by the bleomycin treatment, and the DNA was consequently converted largely into the open circular form. A system for repair of this bleomycin-damaged DNA was constructed with a priming factor, DNA polymerase (DNA polymerase beta or Klenow fragment of DNA polymerase I, ATP, T4 DNA ligase and four deoxynucleoside triphosphates. After incubation, the conformation of the DNA was analyzed by agarose gel electrophoresis and electron microscopy. The open circular DNA was largely converted to the closed circular DNA, indicating that the single-strand breaks of DNA were repaired. When the priming factor was omitted, DNA repair did not occur. The present system seemed to be applicable to the study of priming factors involved in the repair of DNA with single-strand breaks caused not only by bleomycin but also by ionizing radiation or active oxygen.

  5. Arsenic Biotransformation as a Cancer Promoting Factor by Inducing DNA Damage and Disruption of Repair Mechanisms

    Directory of Open Access Journals (Sweden)

    Victor D. Martinez

    2011-01-01

    Full Text Available Chronic exposure to arsenic in drinking water poses a major global health concern. Populations exposed to high concentrations of arsenic-contaminated drinking water suffer serious health consequences, including alarming cancer incidence and death rates. Arsenic is biotransformed through sequential addition of methyl groups, acquired from s-adenosylmethionine (SAM. Metabolism of arsenic generates a variety of genotoxic and cytotoxic species, damaging DNA directly and indirectly, through the generation of reactive oxidative species and induction of DNA adducts, strand breaks and cross links, and inhibition of the DNA repair process itself. Since SAM is the methyl group donor used by DNA methyltransferases to maintain normal epigenetic patterns in all human cells, arsenic is also postulated to affect maintenance of normal DNA methylation patterns, chromatin structure, and genomic stability. The biological processes underlying the cancer promoting factors of arsenic metabolism, related to DNA damage and repair, will be discussed here.

  6. Association Between Polymorphisms of DNA Repair Gene XRCC1 and DNA Damage in Asbestos-Exposed Workers

    Institute of Scientific and Technical Information of China (English)

    XIAO-HONG ZHAO; GUANG JIA; YONG-QUAN LIU; SHAO-WEI LIU; LEI YAN; YU JIN; NIAN LIU

    2006-01-01

    Objective To compare the asbestos-induced DNA damage and repair capacities of DNA damage between 104 asbestos exposed workers and 101 control workers in Qingdao City of China and to investigate the possible association between polymorphisms in codon 399 of XRCC1 and susceptibility to asbestosis. Methods DNA damage levels in peripheral bloodlymphocytes were determined by comet assay, and XRCC 1 genetic polymorphisms of DNA samples from 51 asbestosis cases and 53 non-asbestosis workers with a similar asbestos exposure history were analyzed by PCR/RFLP. Results The basal comet scores (3.95±2.95) were significantly higher in asbestos-exposed workers than in control workers (0.10±0.28). After 1 h H2O2 stimulation, DNA damage of lymphocytes exhibited different increases. After a 4 h repair period, the comet scores were 50.98±19.53 in asbestos-exposed workers and 18.32±12.04 in controls. The residual DNA damage (RD) was significantly greater (P<0.01) in asbestos-exposed workers (35.62%) than in controls (27.75%). XRCC1 genetic polymorphism in 104 asbestos-exposed workers was not associated with increased risk of asbestosis. But compared with polymorphisms in the DNA repair gene XRCC1 (polymorphisms in codon 399) and the DNA damage induced by asbestos, the comet scores in asbestosis cases with Gln/Gln, Gln/Arg, and Arg/Arg were 40.26±18.94, 38.03±28.22, and 32.01±11.65, respectively, which were higher than those in non-asbestosis workers with the same genotypes (25.58±11.08, 37.08±14.74, and 29.38±10.15). There were significant differences in the comet scores between asbestosis cases and non-asbestosis workers with Gln/Gln by Student's t-test (P<0.05 or 0.01). The comet scores were higher in asbestosis workers with Gln/Gln than in those with Arg/Arg and in non-asbestosis workers exposed to asbestos, but without statistically significant difference. Conclusions Exposure to asbestos may be related to DNA damage or the capacity of cells to repair H2O2-induced

  7. DNA-dependent protein kinase catalytic subunit inhibitor reverses acquired radioresistance in lung adenocarcinoma by suppressing DNA repair.

    Science.gov (United States)

    Li, Yong; Li, Hang; Peng, Wen; He, Xin-Yun; Huang, Min; Qiu, Dong; Xue, Ying-Bo; Lu, Liang

    2015-07-01

    The mechanisms underlying lung cancer radioresistance remain to be fully elucidated. The DNA repair pathway is a predominant target of radiotherapy, which is considered to be involved in the acquired radioresistance of cancer cells. The present study aimed to establish a radioresistant cell model using the A549 human lung cancer cell line, and to further investigate the potential mechanisms underlying the radioresistance. The A549R radioresistant lung cancer cell variant was established by exposing the parental A549 cells to repeated γ-ray irradiation at a total dose of 60 Gy. Colony formation assays were then used to determine cell survival following γ-ray exposure. The established radioresistant cells were subsequently treated with or without the NU7026 DNA-PKcs inhibitor. The levels of DNA damage were determined by counting the number of fluorescent γ-H2AX foci in the cells. The cellular capacity for DNA repair was assessed using antibodies for the detection of various DNA repair pathway proteins. The radioresistant sub-clones exhibited significantly decreased survival following NU7026 treatment, compared with the parental cells, as determined by colony formation assays (P<0.05), and this finding was found to be dose-dependent. Treatment with the DNA-dependent protein kinase (DNA-PK) inhibitor significantly reduced γ-H2AX foci formation (P<0.05) following acute radiation exposure in the radioresistant sub-clones, compared with the parental control cells. The decreased levels of γ-H2AX were accompanied by an increase in the percentage of apoptotic cells in the radioresistant cell line following post-radiation treatment with the DNA-PKcs inhibitor. The expression levels of proteins associated with the DNA repair pathway were altered markedly in the cells treated with NU7026. The results of the present study suggested that radioresistance may be associated with enhanced DNA repair following exposure to radiation, resulting in reduced apoptosis. Therefore, the

  8. PARP1 impact on DNA repair of platinum adducts: preclinical and clinical read-outs.

    Science.gov (United States)

    Olaussen, Ken A; Adam, Julien; Vanhecke, Elsa; Vielh, Philippe; Pirker, Robert; Friboulet, Luc; Popper, Helmut; Robin, Angélique; Commo, Fréderic; Thomale, Jürgen; Kayitalire, Louis; Filipits, Martin; Le Chevalier, Thierry; André, Fabrice; Brambilla, Elisabeth; Soria, Jean-Charles

    2013-05-01

    Evaluation of DNA repair proteins might provide meaningful information in relation to prognosis and chemotherapy efficacy in Non-Small Cell Lung Cancer (NSCLC) patients. The role of Poly(ADP-Ribose) Polymerase (PARP) in DNA repair of platinum adducts has not been firmly established. We used a DNA repair functional test based on antibody recognition of cisplatin intrastrand platinum adducts on DNA. We evaluated the effect of PARP inhibition on DNA repair functionality in a panel of cisplatin cell lines treated by the clinical-grade pharmacological inhibitor CEP8983 (a 4-methoxy-carbazole derivate) and the commercially available inhibitor PJ34 (phenanthridinone). We determined PARP1 protein expression in whole tumor sections from the International Adjuvant Lung cancer Trial (IALT)-bio study and tested a 3-marker PARP1/MSH2/ERCC1 algorithm combining PARP1 tumor status with previously published data. Chemosensitivity of cisplatin in NSCLC cell lines was correlated with the accumulation of cisplatin DNA adducts (P=0.0004). Further, the pharmacological inhibition of PARP induced a 1.7 to 2.3-fold increase in platinum adduct accumulation (24h) in A549 cell line suggesting a slow-down of platinum DNA-adduct repair capacity. In parallel, PARP1 inhibition increased the sensitivity to cisplatin treatment. In patient samples, PARP1 expression levels did not influence patient survival or the effect of platinum-based post-operative chemotherapy in the global IALT-bio population (interaction P=0.79). Among cases with high expression of all three markers (triple positive), untreated patients had prolonged survival with a median DFS of 7.8 years, (HR=0.34, 95%CI [0.19-0.61], adjusted P=0.0003) compared to triple negative patients (1.4 years). Remarkably, triple positive patients suffered from a detrimental effect (4.9-year reduction of median DFS) by post-operative cisplatin-based chemotherapy (HR=1.79, 95%CI [1.01-3.17], adjusted P=0.04, chemotherapy vs. control). Combinatorial

  9. In vitro expression levels of cell-cycle checkpoint proteins are associated with cellular DNA repair capacity in peripheral blood lymphocytes: a multivariate analysis

    OpenAIRE

    Fan, You-Hong; Hu, Zhibin; Li, Chunying; Wang, Li-E; Guo, Zhaozheng; Qiao, Yawei; Zhang, Li; Zhang, Wei; Mao, Li; Wei, Qingyi

    2007-01-01

    DNA repair should occur after cells sense DNA damage signals and undergo cell-cycle arrest to provide sufficient time for DNA repair, and suboptimal DNA repair capacity (DRC) in peripheral lymphocytes has been suggested as a cancer susceptibility marker. Numerous studies showed a functional link between DNA damage sensing, cell-cycle checkpoint and DNA repair. We hypothesized that in vitro cell-cycle checkpoint-related protein expression levels in stimulated lymphocytes predict DRC levels. To...

  10. DNMT (DNA methyltransferase) inhibitors radiosensitize human cancer cells by suppressing DNA repair activity

    International Nuclear Information System (INIS)

    Histone modifications and DNA methylation are two major factors in epigenetic phenomenon. Unlike the histone deacetylase inhibitors, which are known to exert radiosensitizing effects, there have only been a few studies thus far concerning the role of DNA methyltransferase (DNMT) inhibitors as radiosensitizers. The principal objective of this study was to evaluate the effects of DNMT inhibitors on the radiosensitivity of human cancer cell lines, and to elucidate the mechanisms relevant to that process. A549 (lung cancer) and U373MG (glioblastoma) cells were exposed to radiation with or without six DNMT inhibitors (5-azacytidine, 5-aza-2'-deoxycytidine, zebularine, hydralazine, epigallocatechin gallate, and psammaplin A) for 18 hours prior to radiation, after which cell survival was evaluated via clonogenic assays. Cell cycle and apoptosis were analyzed via flow cytometry. Expressions of DNMT1, 3A/3B, and cleaved caspase-3 were detected via Western blotting. Expression of γH2AX, a marker of radiation-induced DNA double-strand break, was examined by immunocytochemistry. Pretreatment with psammaplin A, 5-aza-2'-deoxycytidine, and zebularine radiosensitized both A549 and U373MG cells. Pretreatment with psammaplin A increased the sub-G1 fraction of A549 cells, as compared to cells exposed to radiation alone. Prolongation of γH2AX expression was observed in the cells treated with DNMT inhibitors prior to radiation as compared with those treated by radiation alone. Psammaplin A, 5-aza-2'-deoxycytidine, and zebularine induce radiosensitivity in both A549 and U373MG cell lines, and suggest that this effect might be associated with the inhibition of DNA repair

  11. Optimization and standardization of the ''comet assay'' for analyzing the repair of DNA damage in cells

    International Nuclear Information System (INIS)

    Human tumor cells or isolated human peripheral blood lymphocytes were analyzed in the experiments. The amount of DNA damage and the effectiveness of DNA repair was measured after X-irradiation using the 'comet assay' technique. Results: In this presentation the influences of different methodological factors like agarose concentration, buffer pH, electrophoresis time, electric field strength on the applicability of the 'comet assay' are described in detail and optimum conditions for 'comet assay' experiments have been evaluated. Additionally the authors will show a comparison of different fluorescent DNA dyes pointing out their advantages or disadvantages for 'comet' analysis. The usefulness of this technique and its capabilities are exemplified by showing DNA repair kinetics of human lymphocytes of different healthy or radiosensitive donors after in-vitro irradiation with 2 Gy X-rays. Conclusions: This paper presents data on the optimization and standardization of the original 'comet assay' leading to an extremely fast and practicable protocol in the field of single cell gel electrophoresis. After irradiation with 0.1 Gy an increase in the amount of DNA damage can be measured with high statistical significance and the DNA repair capacity of individual cells after X-ray doses of 2 Gy can be analyzed with high reproducibility. The results comparing DNA repair capacities of different donors point out that the 'comet assay' may have the potential for the estimation of individual radiosensitivity. (orig./MG)

  12. DNA repair enhancement of aqueous extracts of Uncaria tomentosa in a human volunteer study.

    Science.gov (United States)

    Sheng, Y; Li, L; Holmgren, K; Pero, R W

    2001-07-01

    The Uncaria tomentosa water extracts (C-Med-100) have been shown to enhance DNA repair, mitogenic response and leukocyte recovery after chemotherapy-induced DNA damage in vivo. In this study, the effect of C-Med-100 supplement was evaluated in a human volunteer study. Twelve apparently healthy adults working in the same environment were randomly assigned into 3 groups with age and gender matched. One group was daily supplemented with a 250 mg tablet containing an aqueous extract of Uncaria tomentosa of C-Med-100, and another group with a 350 mg tablet, for 8 consecutive weeks. DNA repair after induction of DNA damage by a standard dose of hydrogen peroxide was measured 3 times before supplement and 3 times after the supplement for the last 3 weeks of the 8 week-supplement period. There were no drug-related toxic responses to C-Med-100 supplement when judged in terms of clinical symptoms, serum clinical chemistry, whole blood analysis and leukocyte differential counts. There was a statistically significant decrease of DNA damage and a concomitant increase of DNA repair in the supplement groups (250 and 350 mg/day) when compared with non-supplemented controls (p < 0.05). There was also an increased tendency of PHA induced lymphocyte proliferation in the treatment groups. Taken together, this trial has confirmed the earlier results obtained in the rat model when estimating DNA repair enhancement by C-Med-100.

  13. Mismatch repair causes the dynamic release of an essential DNA polymerase from the replication fork

    OpenAIRE

    Klocko, Andrew D.; Schroeder, Jeremy W.; Walsh, Brian W.; Lenhart, Justin S.; Evans, Margery L.; Simmons, Lyle A.

    2011-01-01

    Mismatch repair (MMR) corrects DNA polymerase errors occurring during genome replication. MMR is critical for genome maintenance, and its loss increases mutation rates several hundredfold. Recent work has shown that the interaction between the mismatch recognition protein MutS and the replication processivity clamp is important for MMR in Bacillus subtilis. To further understand how MMR is coupled to DNA replication, we examined the subcellular localization of MMR and DNA replication proteins...

  14. UvrD facilitates DNA repair by pulling RNA polymerase backwards.

    Science.gov (United States)

    Epshtein, Vitaly; Kamarthapu, Venu; McGary, Katelyn; Svetlov, Vladimir; Ueberheide, Beatrix; Proshkin, Sergey; Mironov, Alexander; Nudler, Evgeny

    2014-01-16

    UvrD helicase is required for nucleotide excision repair, although its role in this process is not well defined. Here we show that Escherichia coli UvrD binds RNA polymerase during transcription elongation and, using its helicase/translocase activity, forces RNA polymerase to slide backward along DNA. By inducing backtracking, UvrD exposes DNA lesions shielded by blocked RNA polymerase, allowing nucleotide excision repair enzymes to gain access to sites of damage. Our results establish UvrD as a bona fide transcription elongation factor that contributes to genomic integrity by resolving conflicts between transcription and DNA repair complexes. Furthermore, we show that the elongation factor NusA cooperates with UvrD in coupling transcription to DNA repair by promoting backtracking and recruiting nucleotide excision repair enzymes to exposed lesions. Because backtracking is a shared feature of all cellular RNA polymerases, we propose that this mechanism enables RNA polymerases to function as global DNA damage scanners in bacteria and eukaryotes. PMID:24402227

  15. Modeling the repair of DNA strand breaks caused by γ-radiation in a minichromosome

    International Nuclear Information System (INIS)

    The objective of the studies described here was the development of a mathematical model which would fit experimental data for the repair of single and double strand breaks induced in DNA in living cells by exposure to ionizing radiation, and which would allow to better understand the processes of DNA repair. DNA breaks are believed to play the major role in radiation-induced lethality and formation of chromosome deletions, and are therefore crucial to the response of cells to radiotherapy. In an initial model which we reported on the basis of data for the repair of Epstein–Barr minichromosomes in irradiated Raji cells, we assumed that DNA breaks are induced only at the moment of irradiation and are later removed by repair systems. This work gives a development of that mathematical model which fits the experimental results more precisely and suggests strongly that DNA breaks are generated not only by direct irradiation but also later, probably by systems engaged in repair of oxidative damage. (paper)

  16. Genomically amplified Akt3 activates DNA repair pathway and promotes glioma progression.

    Science.gov (United States)

    Turner, Kristen M; Sun, Youting; Ji, Ping; Granberg, Kirsi J; Bernard, Brady; Hu, Limei; Cogdell, David E; Zhou, Xinhui; Yli-Harja, Olli; Nykter, Matti; Shmulevich, Ilya; Yung, W K Alfred; Fuller, Gregory N; Zhang, Wei

    2015-03-17

    Akt is a robust oncogene that plays key roles in the development and progression of many cancers, including glioma. We evaluated the differential propensities of the Akt isoforms toward progression in the well-characterized RCAS/Ntv-a mouse model of PDGFB-driven low grade glioma. A constitutively active myristoylated form of Akt1 did not induce high-grade glioma (HGG). In stark contrast, Akt2 and Akt3 showed strong progression potential with 78% and 97% of tumors diagnosed as HGG, respectively. We further revealed that significant variations in polarity and hydropathy values among the Akt isoforms in both the pleckstrin homology domain (P domain) and regulatory domain (R domain) were critical in mediating glioma progression. Gene expression profiles from representative Akt-derived tumors indicated dominant and distinct roles for Akt3, consisting primarily of DNA repair pathways. TCGA data from human GBM closely reflected the DNA repair function, as Akt3 was significantly correlated with a 76-gene signature DNA repair panel. Consistently, compared with Akt1 and Akt2 overexpression models, Akt3-expressing human GBM cells had enhanced activation of DNA repair proteins, leading to increased DNA repair and subsequent resistance to radiation and temozolomide. Given the wide range of Akt3-amplified cancers, Akt3 may represent a key resistance factor.

  17. DNA apoptosis and stability in B-cell chronic lymphoid leukaemia: implication of the DNA double-strand breaks repair system by non homologous recombination

    International Nuclear Information System (INIS)

    After an introduction presenting the diagnosis and treatment of chronic lymphoid leukaemia, its molecular and genetic characteristics, and its cellular origin and clonal evolution, this research thesis describes the apoptosis (definition and characteristics, cancer and chemotherapy, apoptotic ways induced by gamma irradiation), the genotoxic stresses, the different repair mechanisms for different damages, and the DNA repair processes. It reports how human chronic lymphocytic leukaemia B cells can escape DNA damage-induced apoptosis through the non-homologous end-joining DNA repair pathway, and presents non-homologous end-joining DNA repair as a potent mutagenic process in human chronic lymphocytic leukaemia B cells

  18. Repair and gamma radiation-induced single- and double-strand breaks in DNA of Escherichia coli

    International Nuclear Information System (INIS)

    Studies in the kinetics of repair of γ-radiation-induced single- and double-strand breaks in DNA of E. coli cells showed that double-strand DNA breaks are rejoined by the following two ways. The first way is conditioned by repair of single-strand breaks and represents the repair of ''oblique'' double-strand breaks in DNA, whereas the second way is conditioned by functioning of the recombination mechanisms and, to all appearance, represents the repair of ''direct'' double-strand breaks in DNA

  19. The effect of aging on the DNA damage and repair capacity in 2BS cells undergoing oxidative stress.

    Science.gov (United States)

    Wang, Jin-Ling; Wang, Pei-Chang

    2012-01-01

    Aging is associated with a reduction in the DNA repair capacity under oxidative stress. However, whether the DNA damage and repair capacity can be a biomarker of aging remains controversial. In this study, we demonstrated two cause-and-effect relationships, the one is between the DNA damage and repair capacity and the cellular age, another is between DNA damage and repair capacity and the level of oxidative stress in human embryonic lung fibroblasts (2BS) exposed to different doses of hydrogen peroxide (H2O2). To clarify the mechanisms of the age-related reduction in DNA damage and repair capacity, we preliminarily evaluated the expressions of six kinds of pivotal enzymes involved in the two classical DNA repair pathways. The DNA repair capacity was observed in human fibroblasts cells using the comet assay; the age-related DNA repair enzymes were selected by RT-PCR and then verified by Western blot in vitro. Results showed that the DNA repair capacity was negatively and linearly correlated with (i) cumulative population doubling (PD) levels only in the group of low concentration of hydrogen peroxide treatment, (ii) with the level of oxidative stress only in the group of young PD cells. The mRNA expression of DNA polymerase δ1 decreased substantially in senescent cells and showed negative linear-correlation with PD levels; the protein expression level was well consistent with the mRNA level. Taken together, DNA damage and repair capacity can be a biomarker of aging. Reduced expression of DNA polymerase δ1 may be responsible for the decrease of DNA repair capacity in senescent cells.

  20. Adaptive Response Enzyme AlkB Preferentially Repairs 1-Methylguanine and 3-Methylthymine Adducts in Double-Stranded DNA.

    Science.gov (United States)

    Chen, Fangyi; Tang, Qi; Bian, Ke; Humulock, Zachary T; Yang, Xuedong; Jost, Marco; Drennan, Catherine L; Essigmann, John M; Li, Deyu

    2016-04-18

    The AlkB protein is a repair enzyme that uses an α-ketoglutarate/Fe(II)-dependent mechanism to repair alkyl DNA adducts. AlkB has been reported to repair highly susceptible substrates, such as 1-methyladenine and 3-methylcytosine, more efficiently in ss-DNA than in ds-DNA. Here, we tested the repair of weaker AlkB substrates 1-methylguanine and 3-methylthymine and found that AlkB prefers to repair them in ds-DNA. We also discovered that AlkB and its human homologues, ABH2 and ABH3, are able to repair the aforementioned adducts when the adduct is present in a mismatched base pair. These observations demonstrate the strong adaptability of AlkB toward repairing various adducts in different environments. PMID:26919079