WorldWideScience

Sample records for breakage dna repair

  1. Molecular targets, DNA breakage, DNA repair: Their roles in mutation induction in mammalian germ cells

    Energy Technology Data Exchange (ETDEWEB)

    Sega, G.A.

    1989-01-01

    Variability in genetic sensitivity among different germ-cell stages in the mammal to various mutagens could be the result of how much chemical reaches the different stages, what molecular targets may be affected in the different stages and whether or not repair of lesions occurs. Several chemicals have been found to bind very strongly to protamine in late-spermatid and early-spermatozoa stages in the mouse. The chemicals also produce their greatest genetic damage in these same germ-cell stages. While chemical binding to DNA has not been correlated with the level of induced genetic damage, DNA breakage in the sensitive stages has been shown to increase. This DNA breakage is believed to indirectly result from chemical binding to sulfhydryl groups in protamine which prevents normal chromatin condensation within the sperm nucleus. 22 refs., 5 figs.

  2. A new role for Rrm3 in repair of replication-born DNA breakage by sister chromatid recombination.

    Directory of Open Access Journals (Sweden)

    Sandra Muñoz-Galván

    2017-05-01

    Full Text Available Replication forks stall at different DNA obstacles such as those originated by transcription. Fork stalling can lead to DNA double-strand breaks (DSBs that will be preferentially repaired by homologous recombination when the sister chromatid is available. The Rrm3 helicase is a replisome component that promotes replication upon fork stalling, accumulates at highly transcribed regions and prevents not only transcription-induced replication fork stalling but also transcription-associated hyper-recombination. This led us to explore the possible role of Rrm3 in the repair of DSBs when originating at the passage of the replication fork. Using a mini-HO system that induces mainly single-stranded DNA breaks, we show that rrm3Δ cells are defective in DSB repair. The defect is clearly seen in sister chromatid recombination, the major repair pathway of replication-born DSBs. Our results indicate that Rrm3 recruitment to replication-born DSBs is crucial for viability, uncovering a new role for Rrm3 in the repair of broken replication forks.

  3. Protection of DNA strand breakage by radiation exposure

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Jeong Ho; Kim, In Gyu; Lee, Kang Suk; Kim, Kug Chan; Shim, Hae Won

    1997-12-01

    Human ceruloplasmin, the plasma copper containing protein, is thought to play an essential role in iron metabolism, but it also has antioxidant properties. Ceruloplasmin directly scavenged hydroxyl radicals (.OH) generated in dithiothreitol/FeCl{sub 3} system besides inhibitory function of hydroxyl radical formation and lipid peroxidation. Polyamines, spermidine and spermine, significantly protected the supercoiled DNA strand breakage by hydroxyl radicals and DNA strand breakage by UV was highly protected by all four polyamines used in this study. In polyamine deficient mutant KL527. It was shown that cell survivability following UV irradiation was slightly increased by exogenous polyamines putrescine and spermidine supplement. However the cell survivability of wild type (MG 1655) was not influenced by polyamine supplement. In {gamma}-irradiated cells, cell survivability of polyamine-deficient mutant strain KL527 was significantly increased by exogenous putrescine supplement and that of wild type strain MG1655 was similar irrespective of polyamine supplement. These results implicate the possibility that polyamines play a potent role in radioprotection of cell and DNA level. (author). 32 refs., 8 figs

  4. Random-breakage mapping method applied to human DNA sequences

    Science.gov (United States)

    Lobrich, M.; Rydberg, B.; Cooper, P. K.; Chatterjee, A. (Principal Investigator)

    1996-01-01

    The random-breakage mapping method [Game et al. (1990) Nucleic Acids Res., 18, 4453-4461] was applied to DNA sequences in human fibroblasts. The methodology involves NotI restriction endonuclease digestion of DNA from irradiated calls, followed by pulsed-field gel electrophoresis, Southern blotting and hybridization with DNA probes recognizing the single copy sequences of interest. The Southern blots show a band for the unbroken restriction fragments and a smear below this band due to radiation induced random breaks. This smear pattern contains two discontinuities in intensity at positions that correspond to the distance of the hybridization site to each end of the restriction fragment. By analyzing the positions of those discontinuities we confirmed the previously mapped position of the probe DXS1327 within a NotI fragment on the X chromosome, thus demonstrating the validity of the technique. We were also able to position the probes D21S1 and D21S15 with respect to the ends of their corresponding NotI fragments on chromosome 21. A third chromosome 21 probe, D21S11, has previously been reported to be close to D21S1, although an uncertainty about a second possible location existed. Since both probes D21S1 and D21S11 hybridized to a single NotI fragment and yielded a similar smear pattern, this uncertainty is removed by the random-breakage mapping method.

  5. DNA Repair Systems

    Indian Academy of Sciences (India)

    nal factors such as UV radiation, high energy radiation such as X-. Keywords. DNA repair, DNA damage, base excision repair, nucleotide exci- sion repair, methlyl-directed mis- match repair, Nobel Prize. rays and gamma rays, mutagenic chemicals and viruses. Different types of DNA ... be especially important in plants.

  6. Visual characterization and quantitative measurement of artemisinin-induced DNA breakage

    Energy Technology Data Exchange (ETDEWEB)

    Cai Huaihong [Bionanotechnology Lab, and Department of Chemistry, Jinan University, Guangzhou 510632 (China); Yang Peihui [Bionanotechnology Lab, and Department of Chemistry, Jinan University, Guangzhou 510632 (China)], E-mail: typh@jnu.edu.cn; Chen Jianan [Bionanotechnology Lab, and Department of Chemistry, Jinan University, Guangzhou 510632 (China); Liang Zhihong [Experiment and Technology Center, Jinan University, Guangzhou 510632 (China); Chen Qiongyu [Institute of Genetic Engineering, Jinan University, Guangzhou 510632 (China); Cai Jiye [Bionanotechnology Lab, and Department of Chemistry, Jinan University, Guangzhou 510632 (China)], E-mail: tjycai@jnu.edu.cn

    2009-05-01

    DNA conformational change and breakage induced by artemisinin, a traditional Chinese herbal medicine, have been visually characterized and quantitatively measured by the multiple tools of electrochemistry, UV-vis absorption spectroscopy, atomic force microscopy (AFM), and DNA electrophoresis. Electrochemical and spectroscopic results confirm that artemisinin can intercalate into DNA double helix, which causes DNA conformational changes. AFM imaging vividly demonstrates uneven DNA strand breaking induced by QHS interaction. To assess these DNA breakages, quantitative analysis of the extent of DNA breakage has been performed by analyzing AFM images. Basing on the statistical analysis, the occurrence of DNA breaks is found to depend on the concentration of artemisinin. DNA electrophoresis further validates that the intact DNA molecules are unwound due to the breakages occur at the single strands. A reliable scheme is proposed to explain the process of artemisinin-induced DNA cleavage. These results can provide further information for better understanding the anticancer activity of artemisinin.

  7. Sequence dependence of electron-induced DNA strand breakage revealed by DNA nanoarrays

    DEFF Research Database (Denmark)

    Keller, Adrian; Rackwitz, Jenny; Cauët, Emilie

    2014-01-01

    The electronic structure of DNA is determined by its nucleotide sequence, which is for instance exploited in molecular electronics. Here we demonstrate that also the DNA strand breakage induced by low-energy electrons (18 eV) depends on the nucleotide sequence. To determine the absolute cross sec...

  8. DNA repair protocols

    DEFF Research Database (Denmark)

    Bjergbæk, Lotte

    In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...... that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including...

  9. DNA repair protocols

    DEFF Research Database (Denmark)

    Bjergbæk, Lotte

    In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...

  10. DNA repair protocols

    DEFF Research Database (Denmark)

    Bjergbæk, Lotte

    that regulate DNA repair has grown significantly over the past years with technology advances such as RNA interference, advanced proteomics and microscopy as well as high throughput screens. The third edition of DNA Repair Protocols covers various aspects of the eukaryotic response to genomic insult including......In its 3rd edition, this Methods in Molecular Biology(TM) book covers the eukaryotic response to genomic insult including advanced protocols and standard techniques in the field of DNA repair. Offers expert guidance for DNA repair, recombination, and replication. Current knowledge of the mechanisms...... recent advanced protocols as well as standard techniques used in the field of DNA repair. Both mammalian and non-mammalian model organisms are covered in the book, and many of the techniques can be applied with only minor modifications to other systems than the one described. Written in the highly...

  11. Celebrating DNA's Repair Crew.

    Science.gov (United States)

    Kunkel, Thomas A

    2015-12-03

    This year, the Nobel Prize in Chemistry has been awarded to Tomas Lindahl, Aziz Sancar, and Paul Modrich for their seminal studies of the mechanisms by which cells from bacteria to man repair DNA damage that is generated by normal cellular metabolism and stress from the environment. These studies beautifully illustrate the remarkable power of DNA repair to influence life from evolution through disease susceptibility. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. X-ray induced DNA double-strand breakage and rejoining in a radiosensitive human renal carcinoma cell line estimated by CHEF electrophoresis

    Energy Technology Data Exchange (ETDEWEB)

    Wei, K. (Univ. Clinic for Radiotherapy and Radiobiology, Vienna Univ. (Austria) Inst. of Radiation Medicine, Beijing, BJ (China)); Wandl, E. (Univ. Clinic for Radiotherapy and Radiobiology, Vienna Univ. (Austria)); Kaercher, K.H. (Univ. Clinic for Radiotherapy and Radiobiology, Vienna Univ. (Austria))

    1993-12-01

    Cell intrinsic radiosensitivity is of great importance in radiation therapy, but its molecular basis is still uncertain. Since DNA double strand breakage is considered to be the most important lesion related to cell death induced by ionizing radiation, the relationship between DNA double-strand breakage, repair and cell survival was investigated in three cell lines: Chinese hamster cell (CHO-K1), human fibroblast and human renal carcinoma (Tu 25). The D[sub 0] values after X-irradiation were 1.73, 1.23, and 0.89 Gy, respectively, showing that Tu 25 was the most sensitive among them. DNA double-strand breaks were measured by CHEF electrophoresis, the initial yield of double-strand break per dose in the three cell lines was almost the same, and no correlation to cell survival was found. However, the rejoining capacity for DNA double-strand break differed. After a dose of 20 Gy, the repair rate was markedly lower in Tu 25, with a half repair time of 40 min, as compared with the other two cell lines with half repair times of 15 min. The results strongly supported the correlation between the repair capacity for DNA double-strand break and cell survival. It was concluded that DNA repair capacity is one of the determinants of cell radiosensitivity. Estimation of DNA double-strand break rejoining by CHEF was suggested as a predictive assay for radiosensitivity of human tumor cells. (orig.)

  13. Estimates of DNA strand breakage in bottlenose dolphin (Tursiops truncatus leukocytes measured with the Comet and DNA diffusion assays

    Directory of Open Access Journals (Sweden)

    Adriana Díaz

    2009-01-01

    Full Text Available The analysis of DNA damage by mean of Comet or single cell gel electrophoresis (SCGE assay has been commonly used to assess genotoxic impact in aquatic animals being able to detect exposure to low concentrations of contaminants in a wide range of species. The aims of this work were 1 to evaluate the usefulness of the Comet to detect DNA strand breakage in dolphin leukocytes, 2 to use the DNA diffusion assay to determine the amount of DNA strand breakage associated with apoptosis or necrosis, and 3 to determine the proportion of DNA strand breakage that was unrelated to apoptosis and necrosis. Significant intra-individual variation was observed in all of the estimates of DNA damage. DNA strand breakage was overestimated because a considerable amount (~29% of the DNA damage was derived from apoptosis and necrosis. The remaining DNA damage in dolphin leukocytes was caused by factors unrelated to apoptosis and necrosis. These results indicate that the DNA diffusion assay is a complementary tool that can be used together with the Comet assay to assess DNA damage in bottlenose dolphins.

  14. DNA repair mechanisms and gametogenesis

    NARCIS (Netherlands)

    W.M. Baarends (Willy); R. van der Laan (Roald); J.A. Grootegoed (Anton)

    2001-01-01

    textabstractIn mammals, there is a complex and intriguing relationship between DNA repair and gametogenesis. DNA repair mechanisms are involved not only in the repair of different types of DNA damage in developing germline cells, but also take part in the meiotic

  15. The journey of DNA repair.

    Science.gov (United States)

    Saini, Natalie

    2015-12-01

    21 years ago, the DNA Repair Enzyme was declared "Molecule of the Year". Today, we are celebrating another "year of repair", with the 2015 Nobel Prize in Chemistry being awarded to Aziz Sancar, Tomas Lindahl and Paul Modrich for their collective work on the different DNA repair pathways.

  16. Monogenic diseases of DNA repair

    DEFF Research Database (Denmark)

    Keijzers, Guido; Bakula, Daniela; Scheibye-Knudsen, Morten

    2017-01-01

    of a growing number of human diseases. Notably, many of these monogenic DNA-repair disorders display features of accelerated aging, supporting the notion that genome maintenance is a key factor for organismal longevity. This review focuses on the physiological consequences of loss of DNA repair, particularly...

  17. Exposure to acrylonitrile induced DNA strand breakage and sex chromosome aneuploidy in human spermatozoa.

    Science.gov (United States)

    Xu, De-Xiang; Zhu, Qi-Xing; Zheng, Lu-Kang; Wang, Qu-Nan; Shen, Han-Ming; Deng, Li-Xia; Ong, Choon-Nam

    2003-05-09

    To explore acrylonitrile (ACN)-induced DNA strand breakage and sex chromosome aneuploidy in human spermatozoa, semen parameters were examined among 30 acrylonitrile-exposed workers according to WHO laboratory manual for the examination of human sperm. DNA strand breakage of sperm cells was investigated among 30 ACN-exposed workers using single cell gel electrophoresis (SCGE). The frequency of sex chromosome aneuploidy in sperm cells was analyzed among nine ACN-exposed workers using fluorescence in situ hybridization (FISH). The geometrical mean of sperm density was 75 x 10(6)ml(-1) in exposure group, significantly lower than 140 x 10(6)ml(-1) in the control. The geometrical mean of sperm number per ejaculum was 205 x 10(6) in exposure group, significantly lower than 280 x 10(6) in the control. The rates of comet sperm nuclei were 28.7% in exposure group, significantly higher than 15.0% in the control. Mean tail length was 9.8 microm in exposure group, longer than 4.3 microm in the control. The frequency of sex chromosome disomy was 0.69% in exposure group, significantly higher than 0.35% in the control. XY-bearing sperm was the most common sex chromosome disomy, with an average rate of 0.37% in exposure group, and 0.20% in the control. XX- and YY-bearing sperm accounted for an additional 0.09 and 0.23% in exposure group, and 0.05 and 0.10% in the control. The results indicate that ACN affect semen quality among ACN-exposed workers. ACN or its metabolites could induce reproductive defects as an in vivo multipotent genotoxic agent by inducing DNA strand breakage and sex chromosome non-disjunction in spermatogenesis.

  18. Opposite effects of nitric oxide donors on DNA single strand breakage and cytotoxicity caused by tert-butylhydroperoxide

    Science.gov (United States)

    Guidarelli, Andrea; Sestili, Piero; Cantoni, Orazio

    1998-01-01

    The effects of three different NO donors on tert-butylhydroperoxide (tB-OOH)-induced DNA cleavage and toxicity were investigated in U937 cells.Treatment with S-nitroso-N-acetyl-penicillamine (SNAP, 1–30 μM), while not in itself DNA-damaging, potentiated the DNA strand scission induced by 200 μM tB-OOH in a concentration-dependent fashion. The enhancing effects of SNAP were observed with two different techniques for the assessment of DNA damage. Decomposed SNAP was inactive. S-nitrosoglutathione (GSNO, 300 μM) and (Z)-1-[(2-aminoethyl)-N-(2-ammonioethyl) amino]diazen-1-ium-1,2-diolate (DETA-NO, 1 mM) also increased DNA cleavage generated by tB-OOH and these responses, as well as that mediated by SNAP, were prevented by the NO scavenger 2-phenyl-4,4,5,5-tetramethylimidazolin-1-oxyl-3-oxide (PTIO).SNAP neither inhibited catalase activity nor increased the formation of DNA lesions in cells exposed to H2O2. Furthermore, SNAP did not affect the rate of rejoining of the DNA single strand breaks generated by tB-OOH.Under the conditions utilized in the DNA damage experiments, treatment with tB-OOH alone or associated with SNAP did not cause cell death. However, SNAP as well as GSNO markedly reduced the lethal response promoted by millimolar concentrations of tB-OOH and these effects were abolished by PTIO. Decomposed SNAP was inactive.It is concluded that low levels of NO donors, which probably release physiological concentrations of NO, enhance the accumulation of DNA single strand breaks in U937 cells exposed to tB-OOH. This NO-mediated effect appears to (a) not depend on inhibition of either DNA repair (which would increase the net accumulation of DNA lesions by preventing DNA single strand break removal) or catalase activity (which would also enhance the net accumulation of DNA lesions since H2O2 is one of the species mediating the tB-OOH-induced DNA cleavage) and (b) be caused by enforced formation of tB-OOH-derived DNA-damaging species. In contrast to

  19. Aging and DNA repair capability. [Review

    Energy Technology Data Exchange (ETDEWEB)

    Tice, R R

    1977-01-01

    A review of the literature on DNA repair processes in relation to aging is presented under the following headings: DNA repair processes; age-related occurrence of unrepaired DNA lesions; DNA repair capability as a function of age; tissue-specific DNA repair capability; acceleration of the aging process by exposure to DNA damaging agents; human genetic syndromes; and longevity and DNA repair processes. (HLW)

  20. DNA Repair Deficiency in Neurodegeneration

    Science.gov (United States)

    Jeppesen, Dennis Kjølhede; Bohr, Vilhelm A.; Stevnsner, Tinna

    2011-01-01

    Deficiency in repair of nuclear and mitochondrial DNA damage has been linked to several neurodegenerative disorders. Many recent experimental results indicate that the post-mitotic neurons are particularly prone to accumulation of unrepaired DNA lesions potentially leading to progressive neurodegeneration. Nucleotide excision repair is the cellular pathway responsible for removing helix-distorting DNA damage and deficiency in such repair is found in a number of diseases with neurodegenerative phenotypes, including Xeroderma Pigmentosum and Cockayne syndrome. The main pathway for repairing oxidative base lesions is base excision repair, and such repair is crucial for neurons given their high rates of oxygen metabolism. Mismatch repair corrects base mispairs generated during replication and evidence indicates that oxidative DNA damage can cause this pathway to expand trinucleotide repeats, thereby causing Huntington’s disease. Single-strand breaks are common DNA lesions and are associated with the neurodegenerative diseases, ataxia-oculomotor apraxia-1 and spinocerebellar ataxia with axonal neuropathy-1. DNA double-strand breaks are toxic lesions and two main pathways exist for their repair: homologous recombination and non-homologous end-joining. Ataxia telangiectasia and related disorders with defects in these pathways illustrate that such defects can lead to early childhood neurodegeneration. Aging is a risk factor for neurodegeneration and accumulation of oxidative mitochondrial DNA damage may be linked with the age-associated neurodegenerative disorders Alzheimer’s disease, Parkinson’s disease and amyotrophic lateral sclerosis. Mutation in the WRN protein leads to the premature aging disease Werner syndrome, a disorder that features neurodegeneration. In this article we review the evidence linking deficiencies in the DNA repair pathways with neurodegeneration. PMID:21550379

  1. DNA strand breakage and lipid peroxidation after exposure to welding fumes in vivo.

    Science.gov (United States)

    Chuang, Cheng-Hung; Huang, Chong-En; Chen, Hsiu-Ling

    2010-01-01

    A remarkable number of complex aerosols are generated from welding processes. The objective of this study was to compare DNA damage and lipid peroxidation in plasma and in lung and in liver tissue of rats exposed to welding fumes in an exposure chamber with those of control animals. Three air samples from the chamber were also collected to assess the exposure dose for each exposure (total samplings = 18). Eight male Sprague-Dawley rats were exposed to welding fumes at a concentration of 1540.76 mg/m(3) for 10 min/day six times on day 1, day 3, day 7, day 15, day 30 and day 40. Lung, liver and kidney injury was measured following exposure, as well as in unexposed control rats (n = 4 at the beginning of the study). DNA strand breakage [tail moment (TMOM)] in exposed animals showed significant differences at day 1, day 4, day 7 and day 15 relative to the levels in control animals. Malondialdehyde (MDA, a lipid peroxidation product) levels increased gradually post-welding to 0.4 microM at 7 days. MDA and TMOM both reached maximum levels 7 days after the first exposure. At the start, an increasing trend in DNA strand breakage was more obvious than increases in MDA levels; MDA seemed to reflect long-term effects of exposure to welding fumes since it increased after 7 days and was sustained to 40 days in vivo. Significant differences in both MDA levels and DNA strand breakage were seen in lung, liver and kidney 40 days after the first fume inhalation. We conclude that acute exposure of rats to welding fumes causes noticeable oxidative damage and lipid peroxidation effects and that DNA damage may recover after long and repeat exposure. More chronic inhalation and low-dose studies are needed in order to further assess the effects of inhalation of welding fumes on DNA and to elucidate the possible causal mechanisms associated with the biologically damaging effects of welding fumes.

  2. Mammalian DNA Repair. Final Report

    Energy Technology Data Exchange (ETDEWEB)

    None

    2003-01-24

    The Gordon Research Conference (GRC) on Mammalian DNA Repair was held at Harbortown Resort, Ventura Beach, CA. Emphasis was placed on current unpublished research and discussion of the future target areas in this field.

  3. DNA Repair Defects and Chromosomal Aberrations

    Science.gov (United States)

    Hada, Megumi; George, K. A.; Huff, J. L.; Pluth, J. M.; Cucinotta, F. A.

    2009-01-01

    Yields of chromosome aberrations were assessed in cells deficient in DNA doublestrand break (DSB) repair, after exposure to acute or to low-dose-rate (0.018 Gy/hr) gamma rays or acute high LET iron nuclei. We studied several cell lines including fibroblasts deficient in ATM (ataxia telangiectasia mutated; product of the gene that is mutated in ataxia telangiectasia patients) or NBS (nibrin; product of the gene mutated in the Nijmegen breakage syndrome), and gliomablastoma cells that are proficient or lacking in DNA-dependent protein kinase (DNA-PK) activity. Chromosomes were analyzed using the fluorescence in situ hybridization (FISH) chromosome painting method in cells at the first division post irradiation, and chromosome aberrations were identified as either simple exchanges (translocations and dicentrics) or complex exchanges (involving >2 breaks in 2 or more chromosomes). Gamma irradiation induced greater yields of both simple and complex exchanges in the DSB repair-defective cells than in the normal cells. The quadratic dose-response terms for both simple and complex chromosome exchanges were significantly higher for the ATM- and NBS-deficient lines than for normal fibroblasts. However, in the NBS cells the linear dose-response term was significantly higher only for simple exchanges. The large increases in the quadratic dose-response terms in these repair-defective cell lines points the importance of the functions of ATM and NBS in chromatin modifications to facilitate correct DSB repair and minimize the formation of aberrations. The differences found between ATM- and NBS-deficient cells at low doses suggest that important questions should with regard to applying observations of radiation sensitivity at high dose to low-dose exposures. For aberrations induced by iron nuclei, regression models preferred purely linear dose responses for simple exchanges and quadratic dose responses for complex exchanges. Relative biological effectiveness (RBE) factors of all of

  4. Genomic Approaches to DNA repair and Mutagenesis

    OpenAIRE

    Wyrick, John J.; Roberts, Steven A.

    2015-01-01

    DNA damage is a constant threat to cells, causing cytotoxicity as well as inducing genetic alterations. The steady-state abundance of DNA lesions in a cell is minimized by a variety of DNA repair mechanisms, including DNA strand break repair, mismatch repair, nucleotide excision repair, base excision repair, and ribonucleotide excision repair. The efficiencies and mechanisms by which these pathways remove damage from chromosomes have been primarily characterized by investigating the processin...

  5. Nijmegen breakage syndrome and chronic polyarthritis

    OpenAIRE

    Pasic, Srdjan; Cupic, Maja; Jovanovic, Tanja; Djukic, Slobodanka; Kavaric, Maja; Lazarevic, Ivana

    2013-01-01

    We report on pediatric patient with Nijmegen breakage syndrome (NBS), a rare DNA repair disorder characterized by microcephaly, immunodeficiency and predisposition to malignant lymphomas, who developed juvenile idiopathic arthritis (JIA)-like polyarthritis. In patients with primary immunodeficiencies (PID), septic arthritis due to pyogenic bacteria or mycoplasmal arthritis are the most common osteoarticular manifestations. In certain PID, chronic, non-infectious arthritis resembling rheumatoi...

  6. How quantum entanglement in DNA synchronizes double-strand breakage by type II restriction endonucleases.

    Science.gov (United States)

    Kurian, P; Dunston, G; Lindesay, J

    2016-02-21

    Macroscopic quantum effects in living systems have been studied widely in pursuit of fundamental explanations for biological energy transport and sensing. While it is known that type II endonucleases, the largest class of restriction enzymes, induce DNA double-strand breaks by attacking phosphodiester bonds, the mechanism by which simultaneous cutting is coordinated between the catalytic centers remains unclear. We propose a quantum mechanical model for collective electronic behavior in the DNA helix, where dipole-dipole oscillations are quantized through boundary conditions imposed by the enzyme. Zero-point modes of coherent oscillations would provide the energy required for double-strand breakage. Such quanta may be preserved in the presence of thermal noise by the enzyme's displacement of water surrounding the DNA recognition sequence. The enzyme thus serves as a decoherence shield. Palindromic mirror symmetry of the enzyme-DNA complex should conserve parity, because symmetric bond-breaking ceases when the symmetry of the complex is violated or when physiological parameters are perturbed from optima. Persistent correlations in DNA across longer spatial separations-a possible signature of quantum entanglement-may be explained by such a mechanism. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Recombinational DNA repair and human disease

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, Larry H.; Schild, David

    2002-11-30

    We review the genes and proteins related to the homologous recombinational repair (HRR) pathway that are implicated in cancer through either genetic disorders that predispose to cancer through chromosome instability or the occurrence of somatic mutations that contribute to carcinogenesis. Ataxia telangiectasia (AT), Nijmegen breakage syndrome (NBS), and an ataxia-like disorder (ATLD), are chromosome instability disorders that are defective in the ataxia telangiectasia mutated (ATM), NBS, and Mre11 genes, respectively. These genes are critical in maintaining cellular resistance to ionizing radiation (IR), which kills largely by the production of double-strand breaks (DSBs). Bloom syndrome involves a defect in the BLM helicase, which seems to play a role in restarting DNA replication forks that are blocked at lesions, thereby promoting chromosome stability. The Werner syndrome gene (WRN) helicase, another member of the RecQ family like BLM, has very recently been found to help mediate homologous recombination. Fanconi anemia (FA) is a genetically complex chromosomal instability disorder involving seven or more genes, one of which is BRCA2. FA may be at least partially caused by the aberrant production of reactive oxidative species. The breast cancer-associated BRCA1 and BRCA2 proteins are strongly implicated in HRR; BRCA2 associates with Rad51 and appears to regulate its activity. We discuss in detail the phenotypes of the various mutant cell lines and the signaling pathways mediated by the ATM kinase. ATM's phosphorylation targets can be grouped into oxidative stress-mediated transcriptional changes, cell cycle checkpoints, and recombinational repair. We present the DNA damage response pathways by using the DSB as the prototype lesion, whose incorrect repair can initiate and augment karyotypic abnormalities.

  8. DNA repair in Cockayne syndrome.

    Science.gov (United States)

    Hoar, D I; Waghorne, C

    1978-11-01

    Cockayne syndrome (CS) is a rare recessive genetic disease characterized in part by premature ageing and photosensitive skin. Because of the latter characteristic, this syndrome was considered to be an example of a UV-sensitive DNA repair-defective human disorder. We demonstrated normal levels of UV-induced unscheduled DNA synthesis (UDS) in four unrelated CS patients that show hypersensitivity to both UV and Mitomycin C (MMC). At low UV exposure, CS DNA shows a dose-dependent decrease in size. By contrast, heterozygotes appear to have a threshold below which there is little change in size of single strand DNA. Immediately following UV or MMC treatment, CS DNA is deficient in high molecular weight species, but undergoes a normal transition to larger DNA during a chase interval in the presence or absence of caffeine. This suggests a defect in replication or excision repair and no defect in post-replication repair (PRR). Pulse studies performed in the presence of hydroxyurea (HU) also reveal a deficient production of large DNA, suggesting the defect is in repair. As these cells have normal UDS and normal PRR, the basis for their UV sensitivity must be distinct from that observed in xeroderma pigmentosum (XP).

  9. Binding of Multiple Rap1 Proteins Stimulates Chromosome Breakage Induction during DNA Replication.

    Directory of Open Access Journals (Sweden)

    Greicy H Goto

    2015-08-01

    Full Text Available Telomeres, the ends of linear eukaryotic chromosomes, have a specialized chromatin structure that provides a stable chromosomal terminus. In budding yeast Rap1 protein binds to telomeric TG repeat and negatively regulates telomere length. Here we show that binding of multiple Rap1 proteins stimulates DNA double-stranded break (DSB induction at both telomeric and non-telomeric regions. Consistent with the role of DSB induction, Rap1 stimulates nearby recombination events in a dosage-dependent manner. Rap1 recruits Rif1 and Rif2 to telomeres, but neither Rif1 nor Rif2 is required for DSB induction. Rap1-mediated DSB induction involves replication fork progression but inactivation of checkpoint kinase Mec1 does not affect DSB induction. Rap1 tethering shortens artificially elongated telomeres in parallel with telomerase inhibition, and this telomere shortening does not require homologous recombination. These results suggest that Rap1 contributes to telomere homeostasis by promoting chromosome breakage.

  10. Titanium dioxide nanoparticles induce oxidative stress and DNA-adduct formation but not DNA-breakage in human lung cells

    Directory of Open Access Journals (Sweden)

    Schins Roel PF

    2009-06-01

    Full Text Available Abstract Titanium dioxide (TiO2, also known as titanium (IV oxide or anatase, is the naturally occurring oxide of titanium. It is also one of the most commercially used form. To date, no parameter has been set for the average ambient air concentration of TiO2 nanoparticles (NP by any regulatory agency. Previously conducted studies had established these nanoparticles to be mainly non-cyto- and -genotoxic, although they had been found to generate free radicals both acellularly (specially through photocatalytic activity and intracellularly. The present study determines the role of TiO2-NP (anatase, ∅ in vitro. For comparison, iron containing nanoparticles (hematite, Fe2O3, ∅ 2-NP did not induce DNA-breakage measured by the Comet-assay in both cell types. Generation of reactive oxygen species (ROS was measured acellularly (without any photocatalytic activity as well as intracellularly for both types of particles, however, the iron-containing NP needed special reducing conditions before pronounced radical generation. A high level of DNA adduct formation (8-OHdG was observed in IMR-90 cells exposed to TiO2-NP, but not in cells exposed to hematite NP. Our study demonstrates different modes of action for TiO2- and Fe2O3-NP. Whereas TiO2-NP were able to generate elevated amounts of free radicals, which induced indirect genotoxicity mainly by DNA-adduct formation, Fe2O3-NP were clastogenic (induction of DNA-breakage and required reducing conditions for radical formation.

  11. DNA repair deficiency in neurodegeneration

    DEFF Research Database (Denmark)

    Jeppesen, Dennis Kjølhede; Bohr, Vilhelm A; Stevnsner, Tinna V.

    2011-01-01

    causing Huntington's disease. Single-strand breaks are common DNA lesions and are associated with the neurodegenerative diseases, ataxia-oculomotor apraxia-1 and spinocerebellar ataxia with axonal neuropathy-1. DNA double-strand breaks are toxic lesions and two main pathways exist for their repair......: homologous recombination and non-homologous end-joining. Ataxia telangiectasia and related disorders with defects in these pathways illustrate that such defects can lead to early childhood neurodegeneration. Aging is a risk factor for neurodegeneration and accumulation of oxidative mitochondrial DNA damage...

  12. Drugging the Cancers Addicted to DNA Repair.

    Science.gov (United States)

    Nickoloff, Jac A; Jones, Dennie; Lee, Suk-Hee; Williamson, Elizabeth A; Hromas, Robert

    2017-11-01

    Defects in DNA repair can result in oncogenic genomic instability. Cancers occurring from DNA repair defects were once thought to be limited to rare inherited mutations (such as BRCA1 or 2). It now appears that a clinically significant fraction of cancers have acquired DNA repair defects. DNA repair pathways operate in related networks, and cancers arising from loss of one DNA repair component typically become addicted to other repair pathways to survive and proliferate. Drug inhibition of the rescue repair pathway prevents the repair-deficient cancer cell from replicating, causing apoptosis (termed synthetic lethality). However, the selective pressure of inhibiting the rescue repair pathway can generate further mutations that confer resistance to the synthetic lethal drugs. Many such drugs currently in clinical use inhibit PARP1, a repair component to which cancers arising from inherited BRCA1 or 2 mutations become addicted. It is now clear that drugs inducing synthetic lethality may also be therapeutic in cancers with acquired DNA repair defects, which would markedly broaden their applicability beyond treatment of cancers with inherited DNA repair defects. Here we review how each DNA repair pathway can be attacked therapeutically and evaluate DNA repair components as potential drug targets to induce synthetic lethality. Clinical use of drugs targeting DNA repair will markedly increase when functional and genetic loss of repair components are consistently identified. In addition, future therapies will exploit artificial synthetic lethality, where complementary DNA repair pathways are targeted simultaneously in cancers without DNA repair defects. © The Author 2017. Published by Oxford University Press.

  13. DNA-Protein Crosslink Proteolysis Repair.

    Science.gov (United States)

    Vaz, Bruno; Popovic, Marta; Ramadan, Kristijan

    2017-06-01

    Proteins that are covalently bound to DNA constitute a specific type of DNA lesion known as DNA-protein crosslinks (DPCs). DPCs represent physical obstacles to the progression of DNA replication. If not repaired, DPCs cause stalling of DNA replication forks that consequently leads to DNA double-strand breaks, the most cytotoxic DNA lesion. Although DPCs are common DNA lesions, the mechanism of DPC repair was unclear until now. Recent work unveiled that DPC repair is orchestrated by proteolysis performed by two distinct metalloproteases, SPARTAN in metazoans and Wss1 in yeast. This review summarizes recent discoveries on two proteases in DNA replication-coupled DPC repair and establishes DPC proteolysis repair as a separate DNA repair pathway for genome stability and protection from accelerated aging and cancer. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Oxidative stress and replication-independent DNA breakage induced by arsenic in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Ireneusz Litwin

    Full Text Available Arsenic is a well-established human carcinogen of poorly understood mechanism of genotoxicity. It is generally accepted that arsenic acts indirectly by generating oxidative DNA damage that can be converted to replication-dependent DNA double-strand breaks (DSBs, as well as by interfering with DNA repair pathways and DNA methylation. Here we show that in budding yeast arsenic also causes replication and transcription-independent DSBs in all phases of the cell cycle, suggesting a direct genotoxic mode of arsenic action. This is accompanied by DNA damage checkpoint activation resulting in cell cycle delays in S and G2/M phases in wild type cells. In G1 phase, arsenic activates DNA damage response only in the absence of the Yku70-Yku80 complex which normally binds to DNA ends and inhibits resection of DSBs. This strongly indicates that DSBs are produced by arsenic in G1 but DNA ends are protected by Yku70-Yku80 and thus invisible for the checkpoint response. Arsenic-induced DSBs are processed by homologous recombination (HR, as shown by Rfa1 and Rad52 nuclear foci formation and requirement of HR proteins for cell survival during arsenic exposure. We show further that arsenic greatly sensitizes yeast to phleomycin as simultaneous treatment results in profound accumulation of DSBs. Importantly, we observed a similar response in fission yeast Schizosaccharomyces pombe, suggesting that the mechanisms of As(III genotoxicity may be conserved in other organisms.

  15. Oxidative stress and replication-independent DNA breakage induced by arsenic in Saccharomyces cerevisiae.

    Science.gov (United States)

    Litwin, Ireneusz; Bocer, Tomasz; Dziadkowiec, Dorota; Wysocki, Robert

    2013-01-01

    Arsenic is a well-established human carcinogen of poorly understood mechanism of genotoxicity. It is generally accepted that arsenic acts indirectly by generating oxidative DNA damage that can be converted to replication-dependent DNA double-strand breaks (DSBs), as well as by interfering with DNA repair pathways and DNA methylation. Here we show that in budding yeast arsenic also causes replication and transcription-independent DSBs in all phases of the cell cycle, suggesting a direct genotoxic mode of arsenic action. This is accompanied by DNA damage checkpoint activation resulting in cell cycle delays in S and G2/M phases in wild type cells. In G1 phase, arsenic activates DNA damage response only in the absence of the Yku70-Yku80 complex which normally binds to DNA ends and inhibits resection of DSBs. This strongly indicates that DSBs are produced by arsenic in G1 but DNA ends are protected by Yku70-Yku80 and thus invisible for the checkpoint response. Arsenic-induced DSBs are processed by homologous recombination (HR), as shown by Rfa1 and Rad52 nuclear foci formation and requirement of HR proteins for cell survival during arsenic exposure. We show further that arsenic greatly sensitizes yeast to phleomycin as simultaneous treatment results in profound accumulation of DSBs. Importantly, we observed a similar response in fission yeast Schizosaccharomyces pombe, suggesting that the mechanisms of As(III) genotoxicity may be conserved in other organisms.

  16. Dynamics of DNA Mismatch Repair

    Science.gov (United States)

    Coats, Julie; Lin, Yuyen; Rasnik, Ivan

    2009-11-01

    DNA mismatch repair protects the genome from spontaneous mutations by recognizing errors, excising damage, and re-synthesizing DNA in a pathway that is highly conserved. Mismatch recognition is accomplished by the MutS family of proteins which are weak ATPases that bind specifically to damaged DNA, but the specific molecular mechanisms by which these proteins recognize damage and initiate excision are not known. Previous structural investigations have implied that protein-induced conformational changes are central to mismatch recognition. Because damage detection is a highly dynamic process in which conformational changes of the protein-DNA complexes occur on a time scale of a few seconds, it is difficult to obtain meaningful kinetic information with traditional ensemble techniques. In this work, we use single molecule fluorescence resonance energy transfer (smFRET) to study the conformational dynamics of fluorescently labeled DNA substrates in the presence of the mismatch repair protein MutS from E. coli and its human homolog MSH2/MSH6. Our studies allow us to obtain quantitative kinetic information about the rates of binding and dissociation and to determine the conformational states for each protein-DNA complex.

  17. Genetic ecotoxicology IV: survival and DNA strand breakage is dependent on genotype in radionuclide-exposed mosquitofish

    Energy Technology Data Exchange (ETDEWEB)

    Theodorakis, C.W. [Texas A and M University, Department of Wildlife and Fisheries Sciences, College Station, TX 77843-2258 (United States); Elbl, T. [University of Pennsylvania, Department of Cell and Molecular Biology, Philadelphia, PA 19102 (United States); Shugart, L.R. [L.R. Shugart and Associates, Oak Ridge, TN 37831 (United States)

    1999-05-01

    Western mosquitofish (Gambusia affinis) were caged in situ in a radioactively-contaminated pond in order to determine if survival and amount of DNA strand breakage were dependent on genotype. Genotypes of fish were determined using the randomly amplified polymorphic (RAPD) technique, and DNA strand breakage was determined using agarose gel electrophoresis. This study is a continuation of research undertaken at the Oak Ridge National Laboratory, which examined the effects of radionuclide contamination on the population genetic structure of mosquitofish. The previous research found 17 RAPD markers that were present at a higher frequency in contaminated than in reference populations ('contaminant-indicative bands'), and fish from contaminated sites which possessed these markers had higher fecundity and fewer strand breaks than fish which did not. One of the contaminated populations (Pond 3513) was colonized from one of the reference populations (Crystal Springs) in 1977. In the present study, fish were obtained from Crystal Springs and an additional reference site, and caged in Pond 3513. The percent survival and amount of DNA strand breakage were then determined for fish with and without the contaminant-indicative markers. When Crystal Springs fish were caged in Pond 3513, it was found that the genotypic distribution of the survivors was more similar to the native Pond 3513 population than to the Crystal Springs population. Furthermore, for nine of the contaminant-indicative markers, the percent survival was greater for fish which possessed these markers than for fish which did not. For five of these markers, fish which possessed them had higher DNA integrity (fewer strand breaks) than fish which did not. These data indicate that probability of survival and degree of DNA strand breakage in radionuclide-exposed mosquitofish are dependent on RAPD genotype, and are consistent with the hypothesis that the contaminant-indicative RAPD bands are markers of loci

  18. Genomic approaches to DNA repair and mutagenesis.

    Science.gov (United States)

    Wyrick, John J; Roberts, Steven A

    2015-12-01

    DNA damage is a constant threat to cells, causing cytotoxicity as well as inducing genetic alterations. The steady-state abundance of DNA lesions in a cell is minimized by a variety of DNA repair mechanisms, including DNA strand break repair, mismatch repair, nucleotide excision repair, base excision repair, and ribonucleotide excision repair. The efficiencies and mechanisms by which these pathways remove damage from chromosomes have been primarily characterized by investigating the processing of lesions at defined genomic loci, among bulk genomic DNA, on episomal DNA constructs, or using in vitro substrates. However, the structure of a chromosome is heterogeneous, consisting of heavily protein-bound heterochromatic regions, open regulatory regions, actively transcribed genes, and even areas of transient single stranded DNA. Consequently, DNA repair pathways function in a much more diverse set of chromosomal contexts than can be readily assessed using previous methods. Recent efforts to develop whole genome maps of DNA damage, repair processes, and even mutations promise to greatly expand our understanding of DNA repair and mutagenesis. Here we review the current efforts to utilize whole genome maps of DNA damage and mutation to understand how different chromosomal contexts affect DNA excision repair pathways. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. DNA fragile site breakage as a measure of chemical exposure and predictor of individual susceptibility to form oncogenic rearrangements.

    Science.gov (United States)

    Lehman, Christine E; Dillon, Laura W; Nikiforov, Yuri E; Wang, Yuh-Hwa

    2017-03-01

    Chromosomal rearrangements induced by non-radiation causes contribution to the majority of oncogenic fusions found in cancer. Treatment of human thyroid cells with fragile site-inducing laboratory chemicals can cause preferential DNA breakage at the RET gene and generate the RET/PTC1 rearrangement, a common driver mutation in papillary thyroid carcinomas (PTC). Here, we demonstrate that treatment with non-cytotoxic levels of environmental chemicals (benzene and diethylnitrosamine) or chemotherapeutic agents (etoposide and doxorubicin) generates significant DNA breakage within RET at levels similar to those generated by fragile site-inducing laboratory chemicals. This suggests that chronic exposure to these chemicals plays a role in the formation of non-radiation associated RET/PTC rearrangements. We also investigated whether the sensitivity of the fragile RET region could predict the likelihood of rearrangement formation using normal thyroid tissues from patients with and without RET/PTC rearrangements. We found that normal cells of patients with thyroid cancer driven by RET/PTC rearrangements have significantly higher blunt-ended, double-stranded DNA breaks at RET than those of patients without RET/PTC rearrangements. This sensitivity of a cancer driver gene suggests for the first time that a DNA breakage test at the RET region could be utilized to evaluate susceptibility to RET/PTC formation. Further, the significant increase of blunt-ended, double-stranded DNA breaks, but not other types of DNA breaks, in normal cells from patients with RET/PTC-driven tumors suggests that blunt-ended double-stranded DNA breaks are a preferred substrate for rearrangement formation, and implicate involvement of the non-homologous end joining pathway in the formation of RET/PTC rearrangements. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  20. Interference in DNA replication can cause mitotic chromosomal breakage unassociated with double-strand breaks.

    Directory of Open Access Journals (Sweden)

    Mari Fujita

    Full Text Available Morphological analysis of mitotic chromosomes is used to detect mutagenic chemical compounds and to estimate the dose of ionizing radiation to be administered. It has long been believed that chromosomal breaks are always associated with double-strand breaks (DSBs. We here provide compelling evidence against this canonical theory. We employed a genetic approach using two cell lines, chicken DT40 and human Nalm-6. We measured the number of chromosomal breaks induced by three replication-blocking agents (aphidicolin, 5-fluorouracil, and hydroxyurea in DSB-repair-proficient wild-type cells and cells deficient in both homologous recombination and nonhomologous end-joining (the two major DSB-repair pathways. Exposure of cells to the three replication-blocking agents for at least two cell cycles resulted in comparable numbers of chromosomal breaks for RAD54(-/-/KU70(-/- DT40 clones and wild-type cells. Likewise, the numbers of chromosomal breaks induced in RAD54(-/-/LIG4(-/- Nalm-6 clones and wild-type cells were also comparable. These data indicate that the replication-blocking agents can cause chromosomal breaks unassociated with DSBs. In contrast with DSB-repair-deficient cells, chicken DT40 cells deficient in PIF1 or ATRIP, which molecules contribute to the completion of DNA replication, displayed higher numbers of mitotic chromosomal breaks induced by aphidicolin than did wild-type cells, suggesting that single-strand gaps left unreplicated may result in mitotic chromosomal breaks.

  1. Mobilization of copper ions in human peripheral lymphocytes by catechins leading to oxidative DNA breakage: A structure activity study.

    Science.gov (United States)

    Farhan, Mohd; Zafar, Atif; Chibber, Sandesh; Khan, Husain Yar; Arif, Hussain; Hadi, S M

    2015-08-15

    Epidemiological studies suggest that dietary consumption of plant polyphenols is related to a lower incidence of various cancers. Among these compounds catechins (present in green tea and other beverages) are considered to be potent inducers of apoptosis and cytotoxicity to cancer cells. Thus these compounds can be used as leads to synthesize novel anticancer drugs with greater bioavailability. In view of this in this paper we have examined the chemical basis of cytotoxicity of catechins by studying the structure-activity relationship between catechin (C), epicatechin (EC), epigallocatechin (EGC) and epigallocatechin-3-gallate (EGCG). Using single cell alkaline gel electrophoresis (comet assay) we have established the relative efficiency of cellular DNA breakage as EGCG>EGC>EC>C. We also show that cellular DNA breakage is the result of mobilization of copper ions bound to chromatin and the generation of reactive oxygen species. Further the relative DNA binding affinity order was confirmed using molecular docking and thermodynamic studies by studying the interaction of catechins with calf thymus DNA. The results suggest that the synthesis of any novel anti cancer molecule based on the structure of catechins should have as many galloyl moieties as possible resulting in an increased number of hydroxyl groups that may facilitate the binding of the molecule to cellular DNA. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Estimating the DNA strand breakage using a fuzzy inference system and agarose gel electrophoresis, a case study with toothed carp Aphanius sophiae exposed to cypermethrin.

    Science.gov (United States)

    Poorbagher, Hadi; Moghaddam, Maryam Nasrollahpour; Eagderi, Soheil; Farahmand, Hamid

    2016-07-01

    The DNA breakage has been widely used in ecotoxicological studies to investigate effects of pesticides in fishes. The present study used a fuzzy inference system to quantify the breakage of DNA double strand in Aphanius sophiae exposed to the cypermethrin. The specimens were adapted to different temperatures and salinity for 14 days and then exposed to cypermethrin. DNA of each specimens were extracted, electrophoresed and photographed. A fuzzy system with three input variables and 27 rules were defined. The pixel value curve of DNA on each gel lane was obtained using ImageJ. The DNA breakage was quantified using the pixel value curve and fuzzy system. The defuzzified values were analyzed using a three-way analysis of variance. Cypermethrin had significant effects on DNA breakage. Fuzzy inference systems can be used as a tool to quantify the breakage of double strand DNA. DNA double strand of the gill of A. sophiae is sensitive enough to be used to detect cypermethrin in surface waters in concentrations much lower than those reported in previous studies.

  3. Mobilization of Copper ions by Flavonoids in Human Peripheral Lymphocytes Leads to Oxidative DNA Breakage: A Structure Activity Study

    Science.gov (United States)

    Arif, Hussain; Rehmani, Nida; Farhan, Mohd; Ahmad, Aamir; Hadi, Sheikh Mumtaz

    2015-01-01

    Epidemiological studies have linked dietary consumption of plant polyphenols with lower incidence of various cancers. In particular, flavonoids (present in onion, tomato and other plant sources) induce apoptosis and cytotoxicity in cancer cells. These can therefore be used as lead compounds for the synthesis of novel anticancer drugs with greater bioavailability. In the present study, we examined the chemical basis of cytotoxicity of flavonoids by studying the structure–activity relationship of myricetin (MN), fisetin (FN), quercetin (QN), kaempferol (KL) and galangin (GN). Using single cell alkaline gel electrophoresis (comet assay), we established the relative efficiency of cellular DNA breakage as MN > FN > QN > KL > GN. Also, we determined that the cellular DNA breakage was the result of mobilization of chromatin-bound copper ions and the generation of reactive oxygen species. The relative DNA binding affinity order was further confirmed using molecular docking and thermodynamic studies through the interaction of flavonoids with calf thymus DNA. Our results suggest that novel anti-cancer molecules should have ortho-dihydroxy groups in B-ring and hydroxyl groups at positions 3 and 5 in the A-ring system. Additional hydroxyl groups at other positions further enhance the cellular cytotoxicity of the flavonoids. PMID:26569217

  4. Mobilization of Copper ions by Flavonoids in Human Peripheral Lymphocytes Leads to Oxidative DNA Breakage: A Structure Activity Study

    Directory of Open Access Journals (Sweden)

    Hussain Arif

    2015-11-01

    Full Text Available Epidemiological studies have linked dietary consumption of plant polyphenols with lower incidence of various cancers. In particular, flavonoids (present in onion, tomato and other plant sources induce apoptosis and cytotoxicity in cancer cells. These can therefore be used as lead compounds for the synthesis of novel anticancer drugs with greater bioavailability. In the present study, we examined the chemical basis of cytotoxicity of flavonoids by studying the structure–activity relationship of myricetin (MN, fisetin (FN, quercetin (QN, kaempferol (KL and galangin (GN. Using single cell alkaline gel electrophoresis (comet assay, we established the relative efficiency of cellular DNA breakage as MN > FN > QN > KL > GN. Also, we determined that the cellular DNA breakage was the result of mobilization of chromatin-bound copper ions and the generation of reactive oxygen species. The relative DNA binding affinity order was further confirmed using molecular docking and thermodynamic studies through the interaction of flavonoids with calf thymus DNA. Our results suggest that novel anti-cancer molecules should have ortho-dihydroxy groups in B-ring and hydroxyl groups at positions 3 and 5 in the A-ring system. Additional hydroxyl groups at other positions further enhance the cellular cytotoxicity of the flavonoids.

  5. Mobilization of Copper ions by Flavonoids in Human Peripheral Lymphocytes Leads to Oxidative DNA Breakage: A Structure Activity Study.

    Science.gov (United States)

    Arif, Hussain; Rehmani, Nida; Farhan, Mohd; Ahmad, Aamir; Hadi, Sheikh Mumtaz

    2015-11-09

    Epidemiological studies have linked dietary consumption of plant polyphenols with lower incidence of various cancers. In particular, flavonoids (present in onion, tomato and other plant sources) induce apoptosis and cytotoxicity in cancer cells. These can therefore be used as lead compounds for the synthesis of novel anticancer drugs with greater bioavailability. In the present study, we examined the chemical basis of cytotoxicity of flavonoids by studying the structure-activity relationship of myricetin (MN), fisetin (FN), quercetin (QN), kaempferol (KL) and galangin (GN). Using single cell alkaline gel electrophoresis (comet assay), we established the relative efficiency of cellular DNA breakage as MN > FN > QN > KL > GN. Also, we determined that the cellular DNA breakage was the result of mobilization of chromatin-bound copper ions and the generation of reactive oxygen species. The relative DNA binding affinity order was further confirmed using molecular docking and thermodynamic studies through the interaction of flavonoids with calf thymus DNA. Our results suggest that novel anti-cancer molecules should have ortho-dihydroxy groups in B-ring and hydroxyl groups at positions 3 and 5 in the A-ring system. Additional hydroxyl groups at other positions further enhance the cellular cytotoxicity of the flavonoids.

  6. Repair of DNA strand breaks in a minichromosome in vivo: kinetics, modeling, and effects of inhibitors.

    Directory of Open Access Journals (Sweden)

    Slawomir Kumala

    Full Text Available To obtain an overall picture of the repair of DNA single and double strand breaks in a defined region of chromatin in vivo, we studied their repair in a ~170 kb circular minichromosome whose length and topology are analogous to those of the closed loops in genomic chromatin. The rate of repair of single strand breaks in cells irradiated with γ photons was quantitated by determining the sensitivity of the minichromosome DNA to nuclease S1, and that of double strand breaks by assaying the reformation of supercoiled DNA using pulsed field electrophoresis. Reformation of supercoiled DNA, which requires that all single strand breaks have been repaired, was not slowed detectably by the inhibitors of poly(ADP-ribose polymerase-1 NU1025 or 1,5-IQD. Repair of double strand breaks was slowed by 20-30% when homologous recombination was supressed by KU55933, caffeine, or siRNA-mediated depletion of Rad51 but was completely arrested by the inhibitors of nonhomologous end-joining wortmannin or NU7441, responses interpreted as reflecting competition between these repair pathways similar to that seen in genomic DNA. The reformation of supercoiled DNA was unaffected when topoisomerases I or II, whose participation in repair of strand breaks has been controversial, were inhibited by the catalytic inhibitors ICRF-193 or F11782. Modeling of the kinetics of repair provided rate constants and showed that repair of single strand breaks in minichromosome DNA proceeded independently of repair of double strand breaks. The simplicity of quantitating strand breaks in this minichromosome provides a usefull system for testing the efficiency of new inhibitors of their repair, and since the sequence and structural features of its DNA and its transcription pattern have been studied extensively it offers a good model for examining other aspects of DNA breakage and repair.

  7. Space Radiation Effects on Human Cells: Modeling DNA Breakage, DNA Damage Foci Distribution, Chromosomal Aberrations and Tissue Effects

    Science.gov (United States)

    Ponomarev, A. L.; Huff, J. L.; Cucinotta, F. A.

    2011-01-01

    Future long-tem space travel will face challenges from radiation concerns as the space environment poses health risk to humans in space from radiations with high biological efficiency and adverse post-flight long-term effects. Solar particles events may dramatically affect the crew performance, while Galactic Cosmic Rays will induce a chronic exposure to high-linear-energy-transfer (LET) particles. These types of radiation, not present on the ground level, can increase the probability of a fatal cancer later in astronaut life. No feasible shielding is possible from radiation in space, especially for the heavy ion component, as suggested solutions will require a dramatic increase in the mass of the mission. Our research group focuses on fundamental research and strategic analysis leading to better shielding design and to better understanding of the biological mechanisms of radiation damage. We present our recent effort to model DNA damage and tissue damage using computational models based on the physics of heavy ion radiation, DNA structure and DNA damage and repair in human cells. Our particular area of expertise include the clustered DNA damage from high-LET radiation, the visualization of DSBs (DNA double strand breaks) via DNA damage foci, image analysis and the statistics of the foci for different experimental situations, chromosomal aberration formation through DSB misrepair, the kinetics of DSB repair leading to a model-derived spectrum of chromosomal aberrations, and, finally, the simulation of human tissue and the pattern of apoptotic cell damage. This compendium of theoretical and experimental data sheds light on the complex nature of radiation interacting with human DNA, cells and tissues, which can lead to mutagenesis and carcinogenesis later in human life after the space mission.

  8. DNA DAMAGE AND REPAIR IN CANCER

    OpenAIRE

    Dizdaroglu, Miral

    2017-01-01

     Oxygen- and nitrogen-derived reactive species are constantly generated inliving organisms by endogenous and exogenous sources. Reactions of reactivespecies such as free radicals with DNA cause the formation of multiplemutagenic and cytotoxic lesions, leading to genetic instability, which is ahallmark of cancer. DNA repair mechanisms exist in living organisms to repairDNA lesions. Most effective cancer treatments work by causing DNA damage inmalignant tumors. Just like in normal cell...

  9. DNA repair phenotype and dietary antioxidant supplementation

    DEFF Research Database (Denmark)

    Guarnieri, Serena; Loft, Steffen; Riso, Patrizia

    2008-01-01

    -release vitamin C tablets had increased DNA repair activity (27 (95 % CI 12, 41) % higher incision activity). These subjects also benefited from the supplementation by reduced levels of oxidised guanines in MNBC. In conclusion, nutritional status, DNA repair activity and DNA damage are linked, and beneficial...... of DNA repair incisions were 65.2 (95 % CI 60.4, 70.0) and 86.1 (95 % CI 76.2, 99.9) among the male smokers and well-nourished subjects, respectively. The male smokers also had high baseline levels of oxidised guanines in MNBC. After supplementation, only the male smokers supplemented with slow...

  10. Role of Fanconi Anemia FANCG in Preventing Double-Strand Breakage and Chromosomal Rearrangement during DNA Replication

    Energy Technology Data Exchange (ETDEWEB)

    Tebbs, R S; Hinz, J M; Yamada, N A; Wilson, J B; Jones, N J; Salazar, E P; Thomas, C B; Jones, I M; Thompson, L H

    2003-10-04

    The Fanconi anemia (FA) proteins overlap with those of homologous recombination through FANCD1/BRCA2, but the biochemical functions of other FA proteins are unknown. By constructing and characterizing a null fancg mutant of hamster CHO cells, we present several new insights for FA. The fancg cells show a broad sensitivity to genotoxic agents, not supporting the conventional concept of sensitivity to only DNA crosslinking agents. The aprt mutation rate is normal, but hprt mutations are reduced, which we ascribe to the lethality of large deletions. CAD and dhfr gene amplification rates are increased, implying excess chromosomal breakage during DNA replication, and suggesting amplification as a contributing factor to cancer-proneness in FA patients. In S-phase cells, both spontaneous and mutagen-induced Rad51 nuclear foci are elevated. These results support a model in which FancG protein helps to prevent collapse of replication forks by allowing translesion synthesis or lesion bypass through homologous recombination.

  11. The chromatin-remodeling factor CHD4 coordinates signaling and repair after DNA damage

    DEFF Research Database (Denmark)

    Larsen, Dorthe Helena; Poinsignon, Catherine; Gudjonsson, Thorkell

    2010-01-01

    -dependent chromatin-remodeling protein CHD4 (chromodomain helicase DNA-binding protein 4) as a factor that becomes transiently immobilized on chromatin after IR. Knockdown of CHD4 triggers enhanced Cdc25A degradation and p21(Cip1) accumulation, which lead to more pronounced cyclin-dependent kinase inhibition...... and extended cell cycle delay. At DNA double-strand breaks, depletion of CHD4 disrupts the chromatin response at the level of the RNF168 ubiquitin ligase, which in turn impairs local ubiquitylation and BRCA1 assembly. These cell cycle and chromatin defects are accompanied by elevated spontaneous and IR......-induced DNA breakage, reduced efficiency of DNA repair, and decreased clonogenic survival. Thus, CHD4 emerges as a novel genome caretaker and a factor that facilitates both checkpoint signaling and repair events after DNA damage....

  12. Macromolecule oxidation and DNA repair in mussel (Mytilus edulis L.) gill following exposure to Cd and Cr(VI)

    Energy Technology Data Exchange (ETDEWEB)

    Emmanouil, C. [School of Biosciences, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom); Sheehan, T.M.T. [Regional Toxicology Laboratory, City Hospital, Dudley Road, Birmingham B18 7QH (United Kingdom); Chipman, J.K. [School of Biosciences, University of Birmingham, Edgbaston, Birmingham B15 2TT (United Kingdom)]. E-mail: J.K.Chipman@bham.ac.uk

    2007-04-20

    The oxidation of DNA and lipid was analysed in the marine mussel (Mytilus edulis) in response to exposure (10 {mu}g/l and 200 {mu}g/l) to cadmium (Cd) and chromium [Cr(VI)]. Concentration dependent uptake of both metals into mussel tissues was established and levels of gill ATP were not depleted at these exposure levels. DNA strand breakage in gill cells (analysed by the comet assay) was elevated by both metals, however, DNA oxidation [measured by DNA strand breakage induced by the DNA repair enzyme formamidopyrimidine glycosylase (FPG)] was not elevated. This was despite a statistically significant increase in both malondialdehyde and 4-hydroxynonenal - indicative of lipid peroxidation - following treatment with Cd. In contrast, both frank DNA stand breaks and FPG-induced DNA strand breaks (indicative of DNA oxidation) were increased following injection of mussels with sodium dichromate (10.4 {mu}g Cr(VI)/mussel). The metals also showed differential inhibitory potential towards DNA repair enzyme activity with Cd exhibiting inhibition of DNA cutting activity towards an oligonucleotide containing 8-oxo-7,8-dihydro-2'-deoxyguanosine and Cr(VI) showing inhibition of such activity towards an oligonucleotide containing ethenoadenosine, both at 200 {mu}g/l. The metals thus show DNA damage activity in mussel gill with distinct mechanisms involving both direct and indirect (oxidative) DNA damage, as well as impairing different DNA repair capacities. A combination of these activities can contribute to adverse effects in these organisms.

  13. International congress on DNA damage and repair: Book of abstracts

    Energy Technology Data Exchange (ETDEWEB)

    1987-01-01

    This document contains the abstracts of 105 papers presented at the Congress. Topics covered include the Escherichia coli nucleotide excision repair system, DNA repair in malignant transformations, defective DNA repair, and gene regulation. (TEM)

  14. DNA Polymerase Gamma in Mitochondrial DNA Replication and Repair

    Directory of Open Access Journals (Sweden)

    William C. Copeland

    2003-01-01

    Full Text Available Mutations in mitochondrial DNA (mtDNA are associated with aging, and they can cause tissue degeneration and neuromuscular pathologies known as mitochondrial diseases. Because DNA polymerase γ (pol γ is the enzyme responsible for replication and repair of mitochondrial DNA, the burden of faithful duplication of mitochondrial DNA, both in preventing spontaneous errors and in DNA repair synthesis, falls on pol γ. Investigating the biological functions of pol γ and its inhibitors aids our understanding of the sources of mtDNA mutations. In animal cells, pol γ is composed of two subunits, a larger catalytic subunit of 125–140 kDa and second subunit of 35–55 kDa. The catalytic subunit contains DNA polymerase activity, 3’-5’ exonuclease activity, and a 5’-dRP lyase activity. The accessory subunit is required for highly processive DNA synthesis and increases the affinity of pol gamma to the DNA.

  15. DNA repair, damage signaling and carcinogenesis.

    Science.gov (United States)

    Lavelle, Christophe; Salles, Bernard; Wiesmüller, Lisa

    2008-04-02

    The First joint meeting of the German DGDR (German Society for Research on DNA Repair) and the French SFTG (French Society of Genotoxicology) on DNA Repair was held in Toulouse, France, from September 15 to 19, 2007. It was organized by Lisa Wiesmüller and Bernard Salles together with the scientific committee consisting of Gilbert de Murcia, Jean-Marc Egly, Frank Grosse, Karl-Peter Hopfner, Georges Iliakis, Bernd Kaina, Markus Löbrich, Bernard Lopez, Daniel Marzin and Alain Sarasin. This report summarizes information presented by the speakers (invited lectures and oral communications) during the seven plenary sessions, which include (1) excision repair, (2) DNA repair and carcinogenesis, (3) double-strand break repair, (4) replication in repair and lesion bypass, (5) cellular responses to genotoxic stress, (6) DNA repair machinery within the chromatin context and (7) genotoxicology and testing. A total of 23 plenary lectures, 32 oral communications and 66 posters were presented in this rather intense 4 days meeting, which stimulated extensive discussions and highly interdisciplinary scientific exchanges among the approximately 250 participants.

  16. Chromatin challenges during DNA replication and repair

    DEFF Research Database (Denmark)

    Groth, Anja; Rocha, Walter; Verreault, Alain

    2007-01-01

    Inheritance and maintenance of the DNA sequence and its organization into chromatin are central for eukaryotic life. To orchestrate DNA-replication and -repair processes in the context of chromatin is a challenge, both in terms of accessibility and maintenance of chromatin organization. To meet...... the challenge of maintenance, cells have evolved efficient nucleosome-assembly pathways and chromatin-maturation mechanisms that reproduce chromatin organization in the wake of DNA replication and repair. The aim of this Review is to describe how these pathways operate and to highlight how the epigenetic...... landscape may be stably maintained even in the face of dramatic changes in chromatin structure....

  17. Mechanisms of Post-Replication DNA Repair

    Directory of Open Access Journals (Sweden)

    Yanzhe Gao

    2017-02-01

    Full Text Available Accurate DNA replication is crucial for cell survival and the maintenance of genome stability. Cells have developed mechanisms to cope with the frequent genotoxic injuries that arise from both endogenous and environmental sources. Lesions encountered during DNA replication are often tolerated by post-replication repair mechanisms that prevent replication fork collapse and avert the formation of DNA double strand breaks. There are two predominant post-replication repair pathways, trans-lesion synthesis (TLS and template switching (TS. TLS is a DNA damage-tolerant and low-fidelity mode of DNA synthesis that utilizes specialized ‘Y-family’ DNA polymerases to replicate damaged templates. TS, however, is an error-free ‘DNA damage avoidance’ mode of DNA synthesis that uses a newly synthesized sister chromatid as a template in lieu of the damaged parent strand. Both TLS and TS pathways are tightly controlled signaling cascades that integrate DNA synthesis with the overall DNA damage response and are thus crucial for genome stability. This review will cover the current knowledge of the primary mediators of post-replication repair and how they are regulated in the cell.

  18. DNA repair: keeping it together

    DEFF Research Database (Denmark)

    Lisby, Michael; Rothstein, Rodney

    2004-01-01

    A protein scaffold has been identified that holds a chromosome together in the event of a DNA double-strand break. This scaffold is dependent on Rad52 and the Rad50-Mre11-Xrs2 complex and withstands the pulling forces of the mitotic spindle during DNA damage checkpoint arrest.......A protein scaffold has been identified that holds a chromosome together in the event of a DNA double-strand break. This scaffold is dependent on Rad52 and the Rad50-Mre11-Xrs2 complex and withstands the pulling forces of the mitotic spindle during DNA damage checkpoint arrest....

  19. Repair of oxidative DNA damage and cancer: recent progress in DNA base excision repair.

    Science.gov (United States)

    Scott, Timothy L; Rangaswamy, Suganya; Wicker, Christina A; Izumi, Tadahide

    2014-02-01

    Reactive oxygen species (ROS) are generated by exogenous and environmental genotoxins, but also arise from mitochondria as byproducts of respiration in the body. ROS generate DNA damage of which pathological consequence, including cancer is well established. Research efforts are intense to understand the mechanism of DNA base excision repair, the primary mechanism to protect cells from genotoxicity caused by ROS. In addition to the notion that oxidative DNA damage causes transformation of cells, recent studies have revealed how the mitochondrial deficiencies and ROS generation alter cell growth during the cancer transformation. The emphasis of this review is to highlight the importance of the cellular response to oxidative DNA damage during carcinogenesis. Oxidative DNA damage, including 7,8-dihydro-8-oxoguanine, play an important role during the cellular transformation. It is also becoming apparent that the unusual activity and subcellular distribution of apurinic/apyrimidinic endonuclease 1, an essential DNA repair factor/redox sensor, affect cancer malignancy by increasing cellular resistance to oxidative stress and by positively influencing cell proliferation. Technological advancement in cancer cell biology and genetics has enabled us to monitor the detailed DNA repair activities in the microenvironment. Precise understanding of the intracellular activities of DNA repair proteins for oxidative DNA damage should provide help in understanding how mitochondria, ROS, DNA damage, and repair influence cancer transformation.

  20. 5-bp Classical Satellite DNA Loci from Chromosome-1 Instability in Cervical Neoplasia Detected by DNA Breakage Detection/Fluorescence in Situ Hybridization (DBD-FISH

    Directory of Open Access Journals (Sweden)

    Jaime Gosálvez

    2013-02-01

    Full Text Available We aimed to evaluate the association between the progressive stages of cervical neoplasia and DNA damage in 5-bp classical satellite DNA sequences from chromosome-1 in cervical epithelium and in peripheral blood lymphocytes using DNA breakage detection/fluorescence in situ hybridization (DBD-FISH. A hospital-based unmatched case-control study was conducted in 2011 with a sample of 30 women grouped according to disease stage and selected according to histological diagnosis; 10 with low-grade squamous intraepithelial lesions (LG-SIL, 10 with high-grade SIL (HG-SIL, and 10 with no cervical lesions, from the Unidad Medica de Alta Especialidad of The Mexican Social Security Institute, IMSS, Mexico. Specific chromosome damage levels in 5-bp classical satellite DNA sequences from chromosome-1 were evaluated in cervical epithelium and peripheral blood lymphocytes using the DBD-FISH technique. Whole-genome DNA hybridization was used as a reference for the level of damage. Results of Kruskal-Wallis test showed a significant increase according to neoplastic development in both tissues. The instability of 5-bp classical satellite DNA sequences from chromosome-1 was evidenced using chromosome-orientation FISH. In conclusion, we suggest that the progression to malignant transformation involves an increase in the instability of 5-bp classical satellite DNA sequences from chromosome-1.

  1. 5-bp Classical Satellite DNA Loci from Chromosome-1 Instability in Cervical Neoplasia Detected by DNA Breakage Detection/Fluorescence in Situ Hybridization (DBD-FISH)

    Science.gov (United States)

    Cortés-Gutiérrez, Elva I.; Ortíz-Hernández, Brenda L.; Dávila-Rodríguez, Martha I.; Cerda-Flores, Ricardo M; Fernández, José Luis; López-Fernández, Carmen; Gosálvez, Jaime

    2013-01-01

    We aimed to evaluate the association between the progressive stages of cervical neoplasia and DNA damage in 5-bp classical satellite DNA sequences from chromosome-1 in cervical epithelium and in peripheral blood lymphocytes using DNA breakage detection/fluorescence in situ hybridization (DBD-FISH). A hospital-based unmatched case-control study was conducted in 2011 with a sample of 30 women grouped according to disease stage and selected according to histological diagnosis; 10 with low-grade squamous intraepithelial lesions (LG-SIL), 10 with high-grade SIL (HG-SIL), and 10 with no cervical lesions, from the Unidad Medica de Alta Especialidad of The Mexican Social Security Institute, IMSS, Mexico. Specific chromosome damage levels in 5-bp classical satellite DNA sequences from chromosome-1 were evaluated in cervical epithelium and peripheral blood lymphocytes using the DBD-FISH technique. Whole-genome DNA hybridization was used as a reference for the level of damage. Results of Kruskal-Wallis test showed a significant increase according to neoplastic development in both tissues. The instability of 5-bp classical satellite DNA sequences from chromosome-1 was evidenced using chromosome-orientation FISH. In conclusion, we suggest that the progression to malignant transformation involves an increase in the instability of 5-bp classical satellite DNA sequences from chromosome-1. PMID:23429197

  2. Radiation breakage of DNA: a model based on random-walk chromatin structure

    Science.gov (United States)

    Ponomarev, A. L.; Sachs, R. K.

    2001-01-01

    Monte Carlo computer software, called DNAbreak, has recently been developed to analyze observed non-random clustering of DNA double strand breaks in chromatin after exposure to densely ionizing radiation. The software models coarse-grained configurations of chromatin and radiation tracks, small-scale details being suppressed in order to obtain statistical results for larger scales, up to the size of a whole chromosome. We here give an analytic counterpart of the numerical model, useful for benchmarks, for elucidating the numerical results, for analyzing the assumptions of a more general but less mechanistic "randomly-located-clusters" formalism, and, potentially, for speeding up the calculations. The equations characterize multi-track DNA fragment-size distributions in terms of one-track action; an important step in extrapolating high-dose laboratory results to the much lower doses of main interest in environmental or occupational risk estimation. The approach can utilize the experimental information on DNA fragment-size distributions to draw inferences about large-scale chromatin geometry during cell-cycle interphase.

  3. 40 CFR 798.5500 - Differential growth inhibition of repair proficient and repair deficient bacteria: “Bacterial DNA...

    Science.gov (United States)

    2010-07-01

    ... repair proficient and repair deficient bacteria: âBacterial DNA damage or repair tests.â 798.5500 Section... inhibition of repair proficient and repair deficient bacteria: “Bacterial DNA damage or repair tests.” (a... killing or growth inhibition of repair deficient bacteria in a set of repair proficient and deficient...

  4. Localisation and quantification of alkali-labile sites in human spermatozoa by DNA breakage detection-fluorescence in situ hybridisation.

    Science.gov (United States)

    Cortés-Gutiérrez, E I; Dávila-Rodríguez, M I; Cerda-Flores, R M; Fernández, J L; López-Fernández, C; Aragón Tovar, A R; Gosálvez, J

    2015-03-01

    The localisation and quantification of constitutive alkali-labile sites (ALSs) were investigated using a protocol of DNA breakage detection plus fluorescence in situ hybridisation (DBD-FISH) and alkaline single-cell gel electrophoresis (SCGE or comet assay), in spermatozoa of infertile and fertile men. Semen samples from 10 normozoospermic patients undergoing infertility treatment and 10 fertile men were included in this study. ALSs were localised and quantified by DBD-FISH. The region most sensitive to alkali treatment in human spermatozoa was located in the basal region of the head. ALSs were more frequent in spermatozoa of infertile men than in those of fertile men. These results were confirmed by SCGE comet assays. In conclusion, the most intense localisation of hybridisation signals in human spermatozoa, representing the highest density of constitutive ALSs, was not randomly distributed and was predominantly located in the base of the head. Moreover, infertile men presented with an increase in ALS frequency. Further studies are necessary to determine the association between ALS, sperm chromatin organisation and infertility. © 2014 Blackwell Verlag GmbH.

  5. Prenatal diagnosis of ataxia-telangiectasia and Nijmegen Breakage Syndrome by the assay of radioresistant DNA synthesis

    Energy Technology Data Exchange (ETDEWEB)

    Kleijer, W.J.; Kraan, M. van der; Los, F.J. [Erasmus Univ., Rotterdam (Netherlands). Dept. of Clinical Genetics; Jaspers, N.G.J. [Erasmus Univ., Rotterdam (Netherlands). Lab. of Cell Biology and Genetics

    1994-12-01

    Prenatal diagnosis was performed in 16 pregnancies at risk of ataxia-telangiectasia (A-T) or Nijmegen Breakage Syndrome (NBS). Radioresistant DNA synthesis (RDS) was investigated in cultured chorionic villus (CV) cells and/or amniotic fluid (AF) cells. In four pregnancies, an affected foetus was diagnosed with increased RDS in cultured CV cells. In three of the four cases confirmation of the diagnosis was obtained by analysis of AF cells and/or skin fibroblasts from the foetus cultured after termination of the pregnancy; in the fourth case a fibroblast culture from the aborted foetus failed. In one case, only AF cells could be analysed in a late stage of pregnancy; pregnancy was terminated due to intermediate/equivocal results but the foetus fibroblasts showed normal RDS. Normal RDS was demonstrated in the other 11 pregnancies at 25% risk either by analysis of CB cells (nine cases) or of AF cells (two cases). In some cases the (normal) results on the CV cells were corroborated by subsequent analysis of Af cells. The results suggest that RDS analysis of CV cells allows reliable prenatal diagnosis of A-T/NBS. However, amniocentesis may be necessary to confirm normal results on CV cells if the foetus is female (because of the risk of maternal cell contamination) or in the rare case of equivocal results. (author).

  6. DNA Amplification by Breakage/Fusion/Bridge Cycles Initiated by Spontaneous Telomere Loss in a Human Cancer Cell Line

    Directory of Open Access Journals (Sweden)

    Anthony W.l. Lo

    2002-01-01

    Full Text Available The development of genomic instability is an important step in generatingthe multiple genetic changes required for cancer. One consequence of genomic instability is the overexpression of oncogenes due to gene amplification. One mechanism for gene amplification is the breakagelfusionlbridge (B/F/Bcyclethatinvolvesthe repeated fusion and breakage of chromosomes following the loss of a telomere. B/F/B cycles have been associated with low-copy gene amplification in human cancer cells, and have been proposed to be an initiating event in high-copy gene amplification. We have found that spontaneous telomere loss on a marker chromosome 16 in a human tumor cell line results in sister chromatid fusion and prolonged periods of chromosome instability. The high rate of anaphase bridges involving chromosome 16 demonstrates that this instability results from B/F/B cycles. The amplification of subtelomeric DNA on the marker chromosome provides conclusive evidence that B/F/B cycles initiated by spontaneous telomere loss are a mechanism for gene amplification in human cancer cells.

  7. Recent advances in chromosome breakage syndromes and their diagnosis.

    Science.gov (United States)

    Mathur, R; Chowdhury, M R; Singh, G

    2000-06-01

    Chromosome instability is a characteristic cytogenetic feature of a number of genetically determined disorders collectively called as the chromosome breakage syndromes or DNA-repair disorders. They are characterized by susceptibility to chromosomal breakages, increased frequency of breaks and interchanges occurring either spontaneously or following exposure to various DNA-damaging agents. These diseases are a group of genetic disorders sharing a number of features. They are all autosomal recessive, show an increased tendency for chromosomal aberrations and to develop malignancies. The principal diseases in this group having a diverse etiology and clinical manifestations include Fanconi anemia (FA), ataxia telangiectasia (AT), Nijmegen breakage syndrome (NBS), Bloom syndrome (BS), xeroderma pigementosum (XP), Cockayne syndrome (CS) and trichothiodystrophy (TTD). The underlying defect in these syndromes is the inability to repair a particular type of DNA damage. A number of repair disorder phenotypes are caused by more than one gene. The diagnosis of these syndromes is made by the characteristic clinical features specific to each disease, but the definitive diagnosis is achieved by laboratory investigations such as cytogenetic, biochemical and molecular methods. The importance of prenatal diagnosis and our experience are discussed in this article.

  8. A lncRNA to repair DNA

    DEFF Research Database (Denmark)

    Lukas, Jiri; Altmeyer, Matthias

    2015-01-01

    Long non-coding RNAs (lncRNAs) have emerged as regulators of various biological processes, but to which extent lncRNAs play a role in genome integrity maintenance is not well understood. In this issue of EMBO Reports, Sharma et al [1] identify the DNA damage-induced lncRNA DDSR1 as an integral...... player of the DNA damage response (DDR). DDSR1 has both an early role by modulating repair pathway choices, and a later function when it regulates gene expression. Sharma et al [1] thus uncover a dual role for a hitherto uncharacterized lncRNA during the cellular response to DNA damage....

  9. Exonuclease 1 and its versatile roles in DNA repair

    DEFF Research Database (Denmark)

    Keijzers, Guido; Liu, Dekang; Rasmussen, Lene Juel

    2016-01-01

    Exonuclease 1 (EXO1) is a multifunctional 5' → 3' exonuclease and a DNA structure-specific DNA endonuclease. EXO1 plays roles in DNA replication, DNA mismatch repair (MMR) and DNA double-stranded break repair (DSBR) in lower and higher eukaryotes and contributes to meiosis, immunoglobulin...

  10. Ancient bacteria show evidence of DNA repair

    DEFF Research Database (Denmark)

    Johnson, Sarah Stewart; Hebsgaard, Martin B; Christensen, Torben R

    2007-01-01

    Recent claims of cultivable ancient bacteria within sealed environments highlight our limited understanding of the mechanisms behind long-term cell survival. It remains unclear how dormancy, a favored explanation for extended cellular persistence, can cope with spontaneous genomic decay over...... geological timescales. There has been no direct evidence in ancient microbes for the most likely mechanism, active DNA repair, or for the metabolic activity necessary to sustain it. In this paper, we couple PCR and enzymatic treatment of DNA with direct respiration measurements to investigate long...... that this long-term survival is closely tied to cellular metabolic activity and DNA repair that over time proves to be superior to dormancy as a mechanism in sustaining bacteria viability....

  11. Nijmegen breakage syndrome (NBS

    Directory of Open Access Journals (Sweden)

    Chrzanowska Krystyna H

    2012-02-01

    Full Text Available Abstract Nijmegen breakage syndrome (NBS is a rare autosomal recessive syndrome of chromosomal instability mainly characterized by microcephaly at birth, combined immunodeficiency and predisposition to malignancies. Due to a founder mutation in the underlying NBN gene (c.657_661del5 the disease is encountered most frequently among Slavic populations. The principal clinical manifestations of the syndrome are: microcephaly, present at birth and progressive with age, dysmorphic facial features, mild growth retardation, mild-to-moderate intellectual disability, and, in females, hypergonadotropic hypogonadism. Combined cellular and humoral immunodeficiency with recurrent sinopulmonary infections, a strong predisposition to develop malignancies (predominantly of lymphoid origin and radiosensitivity are other integral manifestations of the syndrome. The NBN gene codes for nibrin which, as part of a DNA repair complex, plays a critical nuclear role wherever double-stranded DNA ends occur, either physiologically or as a result of mutagenic exposure. Laboratory findings include: (1 spontaneous chromosomal breakage in peripheral T lymphocytes with rearrangements preferentially involving chromosomes 7 and 14, (2 sensitivity to ionizing radiation or radiomimetics as demonstrated in vitro by cytogenetic methods or by colony survival assay, (3 radioresistant DNA synthesis, (4 biallelic hypomorphic mutations in the NBN gene, and (5 absence of full-length nibrin protein. Microcephaly and immunodeficiency are common to DNA ligase IV deficiency (LIG4 syndrome and severe combined immunodeficiency with microcephaly, growth retardation, and sensitivity to ionizing radiation due to NHEJ1 deficiency (NHEJ1 syndrome. In fact, NBS was most commonly confused with Fanconi anaemia and LIG4 syndrome. Genetic counselling should inform parents of an affected child of the 25% risk for further children to be affected. Prenatal molecular genetic diagnosis is possible if disease

  12. Energy and Technology Review: Unlocking the mysteries of DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Quirk, W.A.

    1993-04-01

    DNA, the genetic blueprint, has the remarkable property of encoding its own repair following diverse types of structural damage induced by external agents or normal metabolism. We are studying the interplay of DNA damaging agents, repair genes, and their protein products to decipher the complex biochemical pathways that mediate such repair. Our research focuses on repair processes that correct DNA damage produced by chemical mutagens and radiation, both ionizing and ultraviolet. The most important type of DNA repair in human cells is called excision repair. This multistep process removes damaged or inappropriate pieces of DNA -- often as a string of 29 nucleotides containing the damage -- and replaces them with intact ones. We have isolated, cloned, and mapped several human repair genes associated with the nucleotide excision repair pathway and involved in the repair of DNA damage after exposure to ultraviolet light or mutagens in cooked food. We have shown that a defect in one of these repair genes, ERCC2, is responsible for the repair deficiency in one of the groups of patients with the recessive genetic disorder xeroderma pigmentosum (XP group D). We are exploring ways to purify sufficient quantities (milligrams) of the protein products of these and other repair genes so that we can understand their functions. Our long-term goals are to link defective repair proteins to human DNA repair disorders that predispose to cancer, and to produce DNA-repair-deficient mice that can serve as models for the human disorders.

  13. RAD51 interconnects between DNA replication, DNA repair and immunity.

    Science.gov (United States)

    Bhattacharya, Souparno; Srinivasan, Kalayarasan; Abdisalaam, Salim; Su, Fengtao; Raj, Prithvi; Dozmorov, Igor; Mishra, Ritu; Wakeland, Edward K; Ghose, Subroto; Mukherjee, Shibani; Asaithamby, Aroumougame

    2017-05-05

    RAD51, a multifunctional protein, plays a central role in DNA replication and homologous recombination repair, and is known to be involved in cancer development. We identified a novel role for RAD51 in innate immune response signaling. Defects in RAD51 lead to the accumulation of self-DNA in the cytoplasm, triggering a STING-mediated innate immune response after replication stress and DNA damage. In the absence of RAD51, the unprotected newly replicated genome is degraded by the exonuclease activity of MRE11, and the fragmented nascent DNA accumulates in the cytosol, initiating an innate immune response. Our data suggest that in addition to playing roles in homologous recombination-mediated DNA double-strand break repair and replication fork processing, RAD51 is also implicated in the suppression of innate immunity. Thus, our study reveals a previously uncharacterized role of RAD51 in initiating immune signaling, placing it at the hub of new interconnections between DNA replication, DNA repair, and immunity. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  14. Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

    Science.gov (United States)

    Hengel, Sarah R; Spies, M Ashley; Spies, Maria

    2017-09-21

    To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. DNA damage, homology-directed repair, and DNA methylation.

    Directory of Open Access Journals (Sweden)

    Concetta Cuozzo

    2007-07-01

    Full Text Available To explore the link between DNA damage and gene silencing, we induced a DNA double-strand break in the genome of Hela or mouse embryonic stem (ES cells using I-SceI restriction endonuclease. The I-SceI site lies within one copy of two inactivated tandem repeated green fluorescent protein (GFP genes (DR-GFP. A total of 2%-4% of the cells generated a functional GFP by homology-directed repair (HR and gene conversion. However, approximately 50% of these recombinants expressed GFP poorly. Silencing was rapid and associated with HR and DNA methylation of the recombinant gene, since it was prevented in Hela cells by 5-aza-2'-deoxycytidine. ES cells deficient in DNA methyl transferase 1 yielded as many recombinants as wild-type cells, but most of these recombinants expressed GFP robustly. Half of the HR DNA molecules were de novo methylated, principally downstream to the double-strand break, and half were undermethylated relative to the uncut DNA. Methylation of the repaired gene was independent of the methylation status of the converting template. The methylation pattern of recombinant molecules derived from pools of cells carrying DR-GFP at different loci, or from an individual clone carrying DR-GFP at a single locus, was comparable. ClustalW analysis of the sequenced GFP molecules in Hela and ES cells distinguished recombinant and nonrecombinant DNA solely on the basis of their methylation profile and indicated that HR superimposed novel methylation profiles on top of the old patterns. Chromatin immunoprecipitation and RNA analysis revealed that DNA methyl transferase 1 was bound specifically to HR GFP DNA and that methylation of the repaired segment contributed to the silencing of GFP expression. Taken together, our data support a mechanistic link between HR and DNA methylation and suggest that DNA methylation in eukaryotes marks homologous recombined segments.

  16. Stripped-down DNA repair in a highly reduced parasite

    Directory of Open Access Journals (Sweden)

    Fast Naomi M

    2007-03-01

    Full Text Available Abstract Background Encephalitozoon cuniculi is a member of a distinctive group of single-celled parasitic eukaryotes called microsporidia, which are closely related to fungi. Some of these organisms, including E. cuniculi, also have uniquely small genomes that are within the prokaryotic range. Thus, E. cuniculi has undergone a massive genome reduction which has resulted in a loss of genes from diverse biological pathways, including those that act in DNA repair. DNA repair is essential to any living cell. A loss of these mechanisms invariably results in accumulation of mutations and/or cell death. Six major pathways of DNA repair in eukaryotes include: non-homologous end joining (NHEJ, homologous recombination repair (HRR, mismatch repair (MMR, nucleotide excision repair (NER, base excision repair (BER and methyltransferase repair. DNA polymerases are also critical players in DNA repair processes. Given the close relationship between microsporidia and fungi, the repair mechanisms present in E. cuniculi were compared to those of the yeast Saccharomyces cerevisiae to ascertain how the process of genome reduction has affected the DNA repair pathways. Results E. cuniculi lacks 16 (plus another 6 potential absences of the 56 DNA repair genes sought via BLASTP and PSI-BLAST searches. Six of 14 DNA polymerases or polymerase subunits are also absent in E. cuniculi. All of these genes are relatively well conserved within eukaryotes. The absence of genes is not distributed equally among the different repair pathways; some pathways lack only one protein, while there is a striking absence of many proteins that are components of both double strand break repair pathways. All specialized repair polymerases are also absent. Conclusion Given the large number of DNA repair genes that are absent from the double strand break repair pathways, E. cuniculi is a prime candidate for the study of double strand break repair with minimal machinery. Strikingly, all of the

  17. DNA Mismatch Repair in Eukaryotes and Bacteria

    Directory of Open Access Journals (Sweden)

    Kenji Fukui

    2010-01-01

    Full Text Available DNA mismatch repair (MMR corrects mismatched base pairs mainly caused by DNA replication errors. The fundamental mechanisms and proteins involved in the early reactions of MMR are highly conserved in almost all organisms ranging from bacteria to human. The significance of this repair system is also indicated by the fact that defects in MMR cause human hereditary nonpolyposis colon cancers as well as sporadic tumors. To date, 2 types of MMRs are known: the human type and Escherichia coli type. The basic features of the former system are expected to be universal among the vast majority of organisms including most bacteria. Here, I review the molecular mechanisms of eukaryotic and bacterial MMR, emphasizing on the similarities between them.

  18. New applications of the Comet assay: Comet-FISH and transcription-coupled DNA repair.

    Science.gov (United States)

    Spivak, Graciela; Cox, Rachel A; Hanawalt, Philip C

    2009-01-01

    Transcription-coupled repair (TCR) is a pathway dedicated to the removal of damage from the template strands of actively transcribed genes. Although the detailed mechanism of TCR is not yet understood, it is believed to be triggered when a translocating RNA polymerase is arrested at a lesion or unusual structure in the DNA. Conventional assays for TCR require high doses of DNA damage for the statistical analysis of repair in the individual strands of DNA sequences ranging in size from a few hundred bases to 30kb. The single cell gel electrophoresis (Comet) assay allows detection of single- or double-strand breaks at a 10-100-fold higher level of resolution. Fluorescence in situ hybridization (FISH) combined with the Comet assay (Comet-FISH) affords a heightened level of sensitivity for the assessment of repair in defined DNA sequences of cells treated with physiologically relevant doses of genotoxins. This approach also reveals localized susceptibility to chromosomal breakage in cells from individuals with hypersensitivity to radiation or chemotherapy. Several groups have reported preferential repair in transcriptionally active genes or chromosomal domains using Comet-FISH. The prevailing interpretation of the behavior of DNA in the Comet assay assumes that the DNA is arranged in loops and matrix-attachment sites; that supercoiled, undamaged loops are contained within the nuclear matrix and appear in Comet "heads", and that Comet "tails" consist of relaxed DNA loops containing one or more breaks. According to this model, localization of FISH probes in Comet heads signifies that loops containing the targeted sequences are free of damage. This implies that preferential repair as detected by Comet-FISH might encompass large chromosomal domains containing both transcribed and non-transcribed sequences. We review the existing evidence and discuss the implications in relation to current models for the molecular mechanism of TCR.

  19. New Applications of the Comet Assay: Comet-FISH and Transcription-Coupled DNA Repair

    Science.gov (United States)

    Cox, Rachel A.; Hanawalt, Philip C.

    2009-01-01

    Transcription-coupled repair (TCR) is a pathway dedicated to the removal of damage from the template strands of actively transcribed genes. Although the detailed mechanism of TCR is not yet understood, it is believed to be triggered when a translocating RNA polymerase is arrested at a lesion or unusual structure in the DNA. Conventional assays for TCR require high doses of DNA damage for the statistical analysis of repair in the individual strands of DNA sequences ranging in size from a few hundred bases to 30 kb. The single cell gel electrophoresis (Comet) assay allows detection of single-or double-strand breaks at a 10 to 100-fold higher level of resolution. Fluorescence in situ hybridization (FISH) combined with the Comet assay (Comet-FISH) affords a heightened level of sensitivity for the assessment of repair in defined DNA sequences of cells treated with physiologically relevant doses of genotoxins. This approach also reveals localized susceptibility to chromosomal breakage in cells from individuals with hypersensitivity to radiation or chemotherapy. Several groups have reported preferential repair in transcriptionally active genes or chromosomal domains using Comet-FISH. The prevailing interpretation of the behavior of DNA in the Comet assay assumes that the DNA is arranged in loops and matrix-attachment sites; that supercoiled, undamaged loops are contained within the nuclear matrix and appear in Comet “heads”, and that Comet “tails” consist of relaxed DNA loops containing one or more breaks. According to this model, localization of FISH probes in Comet heads signifies that loops containing the targeted sequences are free of damage. This implies that preferential repair as detected by Comet-FISH might encompass large chromosomal domains containing both transcribed and non-transcribed sequences. We review the existing evidence and discuss the implications in relation to current models for the molecular mechanism of TCR. PMID:18291710

  20. Structure of the DNA Repair Helicase XPD

    OpenAIRE

    Liu, Huanting; Rudolf, Jana; Johnson, Kenneth A.; McMahon, Stephen A.; Oke, Muse; Carter, Lester; McRobbie, Anne-Marie; Brown, Sara E.; Naismith, James H.; White, Malcolm F.

    2008-01-01

    The XPD helicase (Rad3 in Saccharomyces cerevisiae) is a component of transcription factor IIH (TFIIH), which functions in transcription initiation and Nucleotide Excision Repair in eukaryotes, catalysing DNA duplex opening localised to the transcription start site or site of DNA damage, respectively. XPD has a 5′ to 3′ polarity and the helicase activity is dependent on an iron-sulfur cluster binding domain, a feature that is conserved in related helicases such as FancJ. The xpd gene is the t...

  1. Fragile DNA Repair Mechanism Reduces Ageing in Multicellular Model

    DEFF Research Database (Denmark)

    Bendtsen, Kristian Moss; Juul, Jeppe Søgaard; Trusina, Ala

    2012-01-01

    DNA damages, as well as mutations, increase with age. It is believed that these result from increased genotoxic stress and decreased capacity for DNA repair. The two causes are not independent, DNA damage can, for example, through mutations, compromise the capacity for DNA repair, which in turn i...

  2. The mechanism of the nitric oxide-mediated enhancement of tert-butylhydroperoxide-induced DNA single strand breakage

    Science.gov (United States)

    Guidarelli, Andrea; Clementi, Emilio; Sciorati, Clara; Cantoni, Orazio

    1998-01-01

    Caffeine (Cf) enhances the DNA cleavage induced by tert-butylhydroperoxide (tB-OOH) in U937 cells via a mechanism involving Ca2+-dependent mitochondrial formation of DNA-damaging species (Guidarelli et al., 1997b). Nitric oxide (NO) is not involved in this process since U937 cells do not express the constitutive nitric oxide synthase (cNOS).Treatment with the NO donors S-nitroso-N-acetyl-penicillamine (SNAP, 10 μM), or S-nitrosoglutathione (GSNO, 300 μM), however, potentiated the DNA strand scission induced by 200 μM tB-OOH. The DNA lesions generated by tB-OOH alone, or combined with SNAP, were repaired with superimposable kinetics and were insensitive to anti-oxidants and peroxynitrite scavengers but suppressed by iron chelators.SNAP or GSNO did not cause mitochondrial Ca2+ accumulation but their enhancing effects on the tB-OOH-induced DNA strand scission were prevented by ruthenium red, an inhibitor of the calcium uniporter of mitochondria. Furthermore, the enhancing effects of both SNAP and GSNO were identical to and not additive with those promoted by the Ca2+-mobilizing agents Cf or ATP.The SNAP- or GSNO-mediated enhancement of the tB-OOH-induced DNA cleavage was abolished by the respiratory chain inhibitors rotenone and myxothiazol and was not apparent in respiration-deficient cells.It is concluded that, in cells which do not express the enzyme cNOS, exogenous NO enhances the accumulation of DNA single strand breaks induced by tB-OOH via a mechanism involving inhibition of complex III. PMID:9846647

  3. Repair of Oxidative DNA Damage and Cancer: Recent Progress in DNA Base Excision Repair

    OpenAIRE

    Scott, Timothy L.; Rangaswamy, Suganya; Wicker, Christina A.; Izumi, Tadahide

    2014-01-01

    Significance: Reactive oxygen species (ROS) are generated by exogenous and environmental genotoxins, but also arise from mitochondria as byproducts of respiration in the body. ROS generate DNA damage of which pathological consequence, including cancer is well established. Research efforts are intense to understand the mechanism of DNA base excision repair, the primary mechanism to protect cells from genotoxicity caused by ROS. Recent Advances: In addition to the notion that oxidative DNA dama...

  4. DNA repair in the trinucleotide repeat disorders.

    Science.gov (United States)

    Jones, Lesley; Houlden, Henry; Tabrizi, Sarah J

    2017-01-01

    Inherited diseases caused by unstable repeated DNA sequences are rare, but together represent a substantial cause of morbidity. Trinucleotide repeat disorders are severe, usually life-shortening, neurological disorders caused by nucleotide expansions, and most have no disease-modifying treatments. Longer repeat expansions are associated with genetic anticipation (ie, earlier disease onset in successive generations), although the differences in age at onset are not entirely accounted for by repeat length. Such phenotypic variation within disorders implies the existence of additional modifying factors in pathways that can potentially be modulated to treat disease. A genome-wide association study detected genetic modifiers of age at onset in Huntington's disease. Similar findings were seen in the spinocerebellar ataxias, indicating an association between DNA damage-response and repair pathways and the age at onset of disease. These studies also suggest that a common genetic mechanism modulates age at onset across polyglutamine diseases and could extend to other repeat expansion disorders. Genetic defects in DNA repair underlie other neurodegenerative disorders (eg, ataxia-telangiectasia), and DNA double-strand breaks are crucial to the modulation of early gene expression, which provides a mechanistic link between DNA repair and neurodegeneration. Mismatch and base-excision repair are important in the somatic expansion of repeated sequences in mouse models of trinucleotide repeat disorders, and somatic expansion of the expanded CAG tract in HTT correlates with age at onset of Huntington's disease and other trinucleotide repeat disorders. WHERE NEXT?: To understand the common genetic architecture of trinucleotide repeat disorders and any further genetic susceptibilities in individual disorders, genetic analysis with increased numbers of variants and sample sizes is needed, followed by sequencing approaches to define the phenotype-modifying variants. The findings must

  5. Polymorphisms in human DNA repair genes and head and neck ...

    Indian Academy of Sciences (India)

    Genetic polymorphisms in some DNA repair proteins are associated with a number of malignant transformations like head and neck squamous cell carcinoma (HNSCC). Xeroderma pigmentosum group D (XPD) and X-ray repair cross-complementing proteins 1 (XRCC1) and 3 (XRCC3) genes are involved in DNA repair ...

  6. Structure and Stability of ERCC1-XPF DNA Repair Complexes

    NARCIS (Netherlands)

    Faridounnia, M.

    2015-01-01

    Understanding DNA repair pathways such as Nucleotide Excision Repair, Double Strand Break repair and Interstrand Cross-Link repair is of basic interest for understanding fundamental cellular processes. It also forms the basis for understanding molecular details of diseases when defects occur in

  7. Persistent damaged bases in DNA allow mutagenic break repair in Escherichia coli.

    Directory of Open Access Journals (Sweden)

    Jessica M Moore

    2017-07-01

    Full Text Available Bacteria, yeast and human cancer cells possess mechanisms of mutagenesis upregulated by stress responses. Stress-inducible mutagenesis potentially accelerates adaptation, and may provide important models for mutagenesis that drives cancers, host pathogen interactions, antibiotic resistance and possibly much of evolution generally. In Escherichia coli repair of double-strand breaks (DSBs becomes mutagenic, using low-fidelity DNA polymerases under the control of the SOS DNA-damage response and RpoS general stress response, which upregulate and allow the action of error-prone DNA polymerases IV (DinB, II and V to make mutations during repair. Pol IV is implied to compete with and replace high-fidelity DNA polymerases at the DSB-repair replisome, causing mutagenesis. We report that up-regulated Pol IV is not sufficient for mutagenic break repair (MBR; damaged bases in the DNA are also required, and that in starvation-stressed cells, these are caused by reactive-oxygen species (ROS. First, MBR is reduced by either ROS-scavenging agents or constitutive activation of oxidative-damage responses, both of which reduce cellular ROS levels. The ROS promote MBR other than by causing DSBs, saturating mismatch repair, oxidizing proteins, or inducing the SOS response or the general stress response. We find that ROS drive MBR through oxidized guanines (8-oxo-dG in DNA, in that overproduction of a glycosylase that removes 8-oxo-dG from DNA prevents MBR. Further, other damaged DNA bases can substitute for 8-oxo-dG because ROS-scavenged cells resume MBR if either DNA pyrimidine dimers or alkylated bases are induced. We hypothesize that damaged bases in DNA pause the replisome and allow the critical switch from high fidelity to error-prone DNA polymerases in the DSB-repair replisome, thus allowing MBR. The data imply that in addition to the indirect stress-response controlled switch to MBR, a direct cis-acting switch to MBR occurs independently of DNA breakage

  8. Persistent damaged bases in DNA allow mutagenic break repair in Escherichia coli.

    Science.gov (United States)

    Moore, Jessica M; Correa, Raul; Rosenberg, Susan M; Hastings, P J

    2017-07-01

    Bacteria, yeast and human cancer cells possess mechanisms of mutagenesis upregulated by stress responses. Stress-inducible mutagenesis potentially accelerates adaptation, and may provide important models for mutagenesis that drives cancers, host pathogen interactions, antibiotic resistance and possibly much of evolution generally. In Escherichia coli repair of double-strand breaks (DSBs) becomes mutagenic, using low-fidelity DNA polymerases under the control of the SOS DNA-damage response and RpoS general stress response, which upregulate and allow the action of error-prone DNA polymerases IV (DinB), II and V to make mutations during repair. Pol IV is implied to compete with and replace high-fidelity DNA polymerases at the DSB-repair replisome, causing mutagenesis. We report that up-regulated Pol IV is not sufficient for mutagenic break repair (MBR); damaged bases in the DNA are also required, and that in starvation-stressed cells, these are caused by reactive-oxygen species (ROS). First, MBR is reduced by either ROS-scavenging agents or constitutive activation of oxidative-damage responses, both of which reduce cellular ROS levels. The ROS promote MBR other than by causing DSBs, saturating mismatch repair, oxidizing proteins, or inducing the SOS response or the general stress response. We find that ROS drive MBR through oxidized guanines (8-oxo-dG) in DNA, in that overproduction of a glycosylase that removes 8-oxo-dG from DNA prevents MBR. Further, other damaged DNA bases can substitute for 8-oxo-dG because ROS-scavenged cells resume MBR if either DNA pyrimidine dimers or alkylated bases are induced. We hypothesize that damaged bases in DNA pause the replisome and allow the critical switch from high fidelity to error-prone DNA polymerases in the DSB-repair replisome, thus allowing MBR. The data imply that in addition to the indirect stress-response controlled switch to MBR, a direct cis-acting switch to MBR occurs independently of DNA breakage, caused by ROS

  9. Pericentromeric regions are refractory to prompt repair after replication stress-induced breakage in HPV16 E6E7-expressing epithelial cells.

    Directory of Open Access Journals (Sweden)

    Wen Deng

    Full Text Available Chromosomal instability is the major form of genomic instability in cancer cells. Amongst various forms of chromosomal instability, pericentromeric or centromeric instability remains particularly poorly understood. In the present study, we found that pericentromeric instability, evidenced by dynamic formation of pericentromeric or centromeric rearrangements, breaks, deletions or iso-chromosomes, was a general phenomenon in human cells immortalized by expression of human papillomavirus type 16 E6 and E7 (HPV16 E6E7. In particular, for the first time, we surprisingly found a dramatic increase in the proportion of pericentromeric chromosomal aberrations relative to total aberrations in HPV16 E6E7-expressing cells 72 h after release from aphidicolin (APH-induced replication stress, with pericentromeric chromosomal aberrations becoming the predominant type of structural aberrations (~70% of total aberrations. In contrast, pericentromeric aberrations accounted for only about 20% of total aberrations in cells at the end of APH treatment. This increase in relative proportion of pericentromeric aberrations after release from APH treatment revealed that pericentromeric breaks induced by replication stress are refractory to prompt repair in HPV16 E6E7-expressing epithelial cells. Telomerase-immortalized epithelial cells without HPV16 E6E7 expression did not exhibit such preferential pericentromeric instability after release from APH treatment. Cancer development is often associated with replication stress. Since HPV16 E6 and E7 inactivate p53 and Rb, and p53 and Rb pathway defects are common in cancer, our finding that pericentromeric regions are refractory to prompt repair after replication stress-induced breakage in HPV16 E6E7-expressing cells may shed light on mechanism of general pericentromeric instability in cancer.

  10. THE EFFECTS OF STRESS ON DNA REPAIR CAPACITY.

    Science.gov (United States)

    Forlenza, Michael J; Latimer, Jean J; Baum, Andrew

    Research has shown that lymphocytes of high-distress patients have reduced DNA repair relative to that of low-distress patients and healthy controls. Furthermore, deficits in repair are associated with an increased risk of cancer. Using and academic stress model, we hypothesized that students would exhibit lower levels of Nucleotide Excision Repair (NER) during a stressful exam period when compared to a lower stress period. Participants were 19 healthy graduate level students. NER was measured in lymphocytes using the unscheduled DNA synthesis (UDS) assay with slide autoradiography. Contrary to prediction, mean values for NER significantly increased during the higher stress period relative to the lower stress period controlling for background differences in repair. Furthermore, lymphocytes had significantly increased repair of endogenous damage during the higher stress period. Stress appears to directly increase DNA repair. Additionally, stress may increase DNA repair indirectly by increasing damage to DNA.

  11. RNA-directed repair of DNA double-strand breaks.

    Science.gov (United States)

    Yang, Yun-Gui; Qi, Yijun

    2015-08-01

    DNA double-strand breaks (DSBs) are among the most deleterious DNA lesions, which if unrepaired or repaired incorrectly can cause cell death or genome instability that may lead to cancer. To counteract these adverse consequences, eukaryotes have evolved a highly orchestrated mechanism to repair DSBs, namely DNA-damage-response (DDR). DDR, as defined specifically in relation to DSBs, consists of multi-layered regulatory modes including DNA damage sensors, transducers and effectors, through which DSBs are sensed and then repaired via DNAprotein interactions. Unexpectedly, recent studies have revealed a direct role of RNA in the repair of DSBs, including DSB-induced small RNA (diRNA)-directed and RNA-templated DNA repair. Here, we summarize the recent discoveries of RNA-mediated regulation of DSB repair and discuss the potential impact of these novel RNA components of the DSB repair pathway on genomic stability and plasticity. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Emerging roles for histone modifications in DNA excision repair.

    Science.gov (United States)

    Mao, Peng; Wyrick, John J

    2016-11-01

    DNA repair is critical to maintain genome stability. In eukaryotic cells, DNA repair is complicated by the packaging of the DNA 'substrate' into chromatin. DNA repair pathways utilize different mechanisms to overcome the barrier presented by chromatin to efficiently locate and remove DNA lesions in the genome. DNA excision repair pathways are responsible for repairing a majority of DNA lesions arising in the genome. Excision repair pathways include nucleotide excision repair (NER) and base excision repair (BER), which repair bulky and non-bulky DNA lesions, respectively. Numerous studies have suggested that chromatin inhibits both NER and BER in vitro and in vivo Growing evidence demonstrates that histone modifications have important roles in regulating the activity of NER and BER enzymes in chromatin. Here, we will discuss the roles of different histone modifications and the corresponding modifying enzymes in DNA excision repair, highlighting the role of yeast as a model organism for many of these studies. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  13. DNA polymerase beta participates in mitochondrial DNA repair

    DEFF Research Database (Denmark)

    Sykora, P; Kanno, S; Akbari, M

    2017-01-01

    in the nucleoid. Polβ directly interacted with, and influenced the activity of, the mitochondrial helicase TWINKLE. Human kidney cells with Polβ knock-out (KO) had higher endogenous mtDNA damage. Mitochondrial extracts derived from heterozygous Polβ mouse tissue and KO cells had lower nucleotide incorporation......We have detected DNA polymerase beta (Polβ), known as a key nuclear base excision repair (BER) protein, in mitochondrial protein extracts derived from mammalian tissue and cells. Manipulation of the N-terminal sequence affected the amount of Polβ in the mitochondria. Using Polβ fragments......, mitochondrial-specific protein partners were identified, with the interactors mainly functioning in DNA maintenance and mitochondrial import. Of particular interest was the identification of the proteins TWINKLE, SSBP1 and TFAM, all of which are mitochondria specific DNA effectors and are known to function...

  14. DNA repair and radiation sensitivity in mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, D.J.C.; Stackhouse, M. [Los Alamos National Lab., NM (United States); Chen, D.S. [Rochester Univ., NY (United States). Dept. of Radiation Oncology

    1993-02-01

    Ionizing radiation induces various types of damage in mammalian cells including DNA single-strand breaks, DNA double-strand breaks (DSB), DNA-protein cross links, and altered DNA bases. Although human cells can repair many of these lesions there is little detailed knowledge of the nature of the genes and the encoded enzymes that control these repair processes. We report here on the cellular and genetic analyses of DNA double-strand break repair deficient mammalian cells. It has been well established that the DNA double-strand break is one of the major lesions induced by ionizing radiation. Utilizing rodent repair-deficient mutant, we have shown that the genes responsible for DNA double-strand break repair are also responsible for the cellular expression of radiation sensitivity. The molecular genetic analysis of DSB repair in rodent/human hybrid cells indicate that at least 6 different genes in mammalian cells are responsible for the repair of radiation-induced DNA double-strand breaks. Mapping and the prospect of cloning of human radiation repair genes are reviewed. Understanding the molecular and genetic basis of radiation sensitivity and DNA repair in man will provide a rational foundation to predict the individual risk associated with radiation exposure and to prevent radiation-induced genetic damage in the human population.

  15. DNA repair and radiation sensitivity in mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Chen, D.J.C.; Stackhouse, M. (Los Alamos National Lab., NM (United States)); Chen, D.S. (Rochester Univ., NY (United States). Dept. of Radiation Oncology)

    1993-01-01

    Ionizing radiation induces various types of damage in mammalian cells including DNA single-strand breaks, DNA double-strand breaks (DSB), DNA-protein cross links, and altered DNA bases. Although human cells can repair many of these lesions there is little detailed knowledge of the nature of the genes and the encoded enzymes that control these repair processes. We report here on the cellular and genetic analyses of DNA double-strand break repair deficient mammalian cells. It has been well established that the DNA double-strand break is one of the major lesions induced by ionizing radiation. Utilizing rodent repair-deficient mutant, we have shown that the genes responsible for DNA double-strand break repair are also responsible for the cellular expression of radiation sensitivity. The molecular genetic analysis of DSB repair in rodent/human hybrid cells indicate that at least 6 different genes in mammalian cells are responsible for the repair of radiation-induced DNA double-strand breaks. Mapping and the prospect of cloning of human radiation repair genes are reviewed. Understanding the molecular and genetic basis of radiation sensitivity and DNA repair in man will provide a rational foundation to predict the individual risk associated with radiation exposure and to prevent radiation-induced genetic damage in the human population.

  16. Telomeric Allelic Imbalance Indicates Defective DNA Repair and Sensitivity to DNA-Damaging Agents

    DEFF Research Database (Denmark)

    Birkbak, Nicolai J.; Wang, Zhigang C.; Kim, Ji-Young

    2012-01-01

    DNA repair competency is one determinant of sensitivity to certain chemotherapy drugs, such as cisplatin. Cancer cells with intact DNA repair can avoid the accumulation of genome damage during growth and also can repair platinum-induced DNA damage. We sought genomic signatures indicative of defec...

  17. Phenotypic Analysis of ATM Protein Kinase in DNA Double-Strand Break Formation and Repair.

    Science.gov (United States)

    Mian, Elisabeth; Wiesmüller, Lisa

    2017-01-01

    Ataxia telangiectasia mutated (ATM) encodes a serine/threonine protein kinase, which is involved in various regulatory processes in mammalian cells. Its best-known role is apical activation of the DNA damage response following generation of DNA double-strand breaks (DSBs). When DSBs appear, sensor and mediator proteins are recruited, activating transducers such as ATM, which in turn relay a widespread signal to a multitude of downstream effectors. ATM mutation causes Ataxia telangiectasia (AT), whereby the disease phenotype shows differing characteristics depending on the underlying ATM mutation. However, all phenotypes share progressive neurodegeneration and marked predisposition to malignancies at the organismal level and sensitivity to ionizing radiation and chromosome aberrations at the cellular level. Expression and localization of the ATM protein can be determined via western blotting and immunofluorescence microscopy; however, detection of subtle alterations such as resulting from amino acid exchanges rather than truncating mutations requires functional testing. Previous studies on the role of ATM in DSB repair, which connects with radiosensitivity and chromosomal stability, gave at first sight contradictory results. To systematically explore the effects of clinically relevant ATM mutations on DSB repair, we engaged a series of lymphoblastoid cell lines (LCLs) derived from AT patients and controls. To examine DSB repair both in a quantitative and qualitative manners, we used an EGFP-based assay comprising different substrates for distinct DSB repair mechanisms. In this way, we demonstrated that particular signaling defects caused by individual ATM mutations led to specific DSB repair phenotypes. To explore the impact of ATM on carcinogenic chromosomal aberrations, we monitored chromosomal breakage at a breakpoint cluster region hotspot within the MLL gene that has been associated with therapy-related leukemia. PCR-based MLL-breakage analysis of HeLa cells

  18. Mitochondrial DNA repair and association with aging--an update

    DEFF Research Database (Denmark)

    Diaz, Ricardo Gredilla; Bohr, Vilhelm A; Stevnsner, Tinna V.

    2010-01-01

    Mitochondrial DNA is constantly exposed to oxidative injury. Due to its location close to the main site of reactive oxygen species, the inner mitochondrial membrane, mtDNA is more susceptible than nuclear DNA to oxidative damage. The accumulation of DNA damage is thought to play a critical role...... proteins and novel DNA repair pathways, thought to be exclusively present in the nucleus, have recently been described also to be present in mitochondria. Here we review the main mitochondrial DNA repair pathways and their association with the aging process....... in the aging process and to be particularly deleterious in post-mitotic cells. Thus, DNA repair is an important mechanism for maintenance of genomic integrity. Despite the importance of mitochondria in the aging process, it was thought for many years that mitochondria lacked an enzymatic DNA repair system...

  19. DNA Repair and Genome Maintenance in Bacillus subtilis

    Science.gov (United States)

    Lenhart, Justin S.; Schroeder, Jeremy W.; Walsh, Brian W.

    2012-01-01

    Summary: From microbes to multicellular eukaryotic organisms, all cells contain pathways responsible for genome maintenance. DNA replication allows for the faithful duplication of the genome, whereas DNA repair pathways preserve DNA integrity in response to damage originating from endogenous and exogenous sources. The basic pathways important for DNA replication and repair are often conserved throughout biology. In bacteria, high-fidelity repair is balanced with low-fidelity repair and mutagenesis. Such a balance is important for maintaining viability while providing an opportunity for the advantageous selection of mutations when faced with a changing environment. Over the last decade, studies of DNA repair pathways in bacteria have demonstrated considerable differences between Gram-positive and Gram-negative organisms. Here we review and discuss the DNA repair, genome maintenance, and DNA damage checkpoint pathways of the Gram-positive bacterium Bacillus subtilis. We present their molecular mechanisms and compare the functions and regulation of several pathways with known information on other organisms. We also discuss DNA repair during different growth phases and the developmental program of sporulation. In summary, we present a review of the function, regulation, and molecular mechanisms of DNA repair and mutagenesis in Gram-positive bacteria, with a strong emphasis on B. subtilis. PMID:22933559

  20. Premature induction of aging in sublethally H2O2-treated young MRC5 fibroblasts correlates with increased glutathione peroxidase levels and resistance to DNA breakage.

    Science.gov (United States)

    Caldini, R; Chevanne, M; Mocali, A; Tombaccini, D; Paoletti, F

    1998-09-15

    Human MRC5 fibroblasts, at different passages in cultures, were used as an in vitro model to assess variations and/or induction of aging parameters under basal conditions or following sublethal oxidative stress by H2O2. DNA sensitivities to oxidatively-induced breakage, rather than basal levels of damaged DNA, were significantly different between cultures at low and high population doubling level (PDL): old cells maintained most of their DNA integrity even at high concentrations of H2O2, while young cells showed more extensive DNA damage which developed in a dose-dependent fashion. However, young cells pretreated with low doses of H2O2 exhibited increased resistance against further oxidative damage to DNA thus reproducing a senescent-like profile of sensitivity. In turn, DNA from old cultures incubated in a NAD precursor-free medium was more prone to H2O2-induced strand breaks mimicking DNA sensitivity of young cells. The extent of oxidatively-induced DNA damage in MRC5 populations correlated inversely with the levels of glutathione peroxidase (GPx) activity that almost doubled when cells passed from the young to the senescent stage. In addition, H2O2-pretreatment of young cells induced an increase in GPx expression approaching old cell values and promoted also the premature appearance of neutral beta-galactosidase activity and decreased c-fos expression upon serum stimulation, both of which were assumed to be characteristic traits of the senescent phenotype.

  1. DNA Mismatch Repair and Oxidative DNA Damage: Implications for Cancer Biology and Treatment

    Energy Technology Data Exchange (ETDEWEB)

    Bridge, Gemma; Rashid, Sukaina; Martin, Sarah A., E-mail: sarah.martin@qmul.ac.uk [Centre for Molecular Oncology, Barts Cancer Institute, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ (United Kingdom)

    2014-08-05

    Many components of the cell, including lipids, proteins and both nuclear and mitochondrial DNA, are vulnerable to deleterious modifications caused by reactive oxygen species. If not repaired, oxidative DNA damage can lead to disease-causing mutations, such as in cancer. Base excision repair and nucleotide excision repair are the two DNA repair pathways believed to orchestrate the removal of oxidative lesions. However, recent findings suggest that the mismatch repair pathway may also be important for the response to oxidative DNA damage. This is particularly relevant in cancer where mismatch repair genes are frequently mutated or epigenetically silenced. In this review we explore how the regulation of oxidative DNA damage by mismatch repair proteins may impact on carcinogenesis. We discuss recent studies that identify potential new treatments for mismatch repair deficient tumours, which exploit this non-canonical role of mismatch repair using synthetic lethal targeting.

  2. Transcript RNA supports precise repair of its own DNA gene.

    Science.gov (United States)

    Keskin, Havva; Meers, Chance; Storici, Francesca

    2016-01-01

    The transfer of genetic information from RNA to DNA is considered an extraordinary process in molecular biology. Despite the fact that cells transcribe abundant amount of RNA with a wide range of functions, it has been difficult to uncover whether RNA can serve as a template for DNA repair and recombination. An increasing number of experimental evidences suggest a direct role of RNA in DNA modification. Recently, we demonstrated that endogenous transcript RNA can serve as a template to repair a DNA double-strand break (DSB), the most harmful DNA lesion, not only indirectly via formation of a DNA copy (cDNA) intermediate, but also directly in a homology driven mechanism in budding yeast. These results point out that the transfer of genetic information from RNA to DNA is more general than previously thought. We found that transcript RNA is more efficient in repairing a DSB in its own DNA (in cis) than in a homologous but ectopic locus (in trans). Here, we summarize current knowledge about the process of RNA-driven DNA repair and recombination, and provide further data in support of our model of DSB repair by transcript RNA in cis. We show that a DSB is precisely repaired predominately by transcript RNA and not by residual cDNA in conditions in which formation of cDNA by reverse transcription is inhibited. Additionally, we demonstrate that defects in ribonuclease (RNase) H stimulate precise DSB repair by homologous RNA or cDNA sequence, and not by homologous DNA sequence carried on a plasmid. These results highlight an antagonistic role of RNase H in RNA-DNA recombination. Ultimately, we discuss several questions that should be addressed to better understand mechanisms and implications of RNA-templated DNA repair and recombination.

  3. Arsenic-Induced Antioxidant Depletion, Oxidative DNA Breakage, and Tissue Damages are Prevented by the Combined Action of Folate and Vitamin B12.

    Science.gov (United States)

    Acharyya, Nirmallya; Deb, Bimal; Chattopadhyay, Sandip; Maiti, Smarajit

    2015-11-01

    Arsenic is a grade I human carcinogen. It acts by disrupting one-carbon (1C) metabolism and cellular methyl (-CH3) pool. The -CH3 group helps in arsenic disposition and detoxification of the biological systems. Vitamin B12 and folate, the key promoters of 1C metabolism were tested recently (daily 0.07 and 4.0 μg, respectively/100 g b.w. of rat for 28 days) to evaluate their combined efficacy in the protection from mutagenic DNA-breakage and tissue damages. The selected tissues like intestine (first-pass site), liver (major xenobiotic metabolizer) and lung (major arsenic accumulator) were collected from arsenic-ingested (0.6 ppm/same schedule) female rats. The hemo-toxicity and liver and kidney functions were monitored. Our earlier studies on arsenic-exposed humans can correlate carcinogenesis with DNA damage. Here, we demonstrate that the supplementation of physiological/therapeutic dose of vitamin B12 and folate protected the rodents significantly from arsenic-induced DNA damage (DNA fragmentation and comet assay) and hepatic and renal tissue degeneration (histo-architecture, HE staining). The level of arsenic-induced free-radical products (TBARS and conjugated diene) was significantly declined by the restored actions of several antioxidants viz. urate, thiol, catalase, xanthine oxidase, lactoperoxidase, and superoxide dismutase in the tissues of vitamin-supplemented group. The alkaline phosphatase, transaminases, urea and creatinine (hepatic and kidney toxicity marker), and lactate dehydrogenase (tissue degeneration marker) were significantly impaired in the arsenic-fed group. But a significant protection was evident in the vitamin-supplemented group. In conclusion, the combined action of folate and B12 results in the restitution in the 1C metabolic pathway and cellular methyl pool. The cumulative outcome from the enhanced arsenic methylation and antioxidative capacity was protective against arsenic induced mutagenic DNA breakages and tissue damages.

  4. Repair of DNA damage in light sensitive human skin diseases

    Energy Technology Data Exchange (ETDEWEB)

    Horkay, I.; Varga, L.; Tam' asi P., Gundy, S.

    1978-12-01

    Repair of uv-light induced DNA damage and changes in the semiconservative DNA synthesis were studied by in vitro autoradiography in the skin of patients with lightdermatoses (polymorphous light eruption, porphyria cutanea tarda, erythropoietic protoporphyria) and xeroderma pigmentosum as well as in that of healthy controls. In polymorphous light eruption the semiconservative DNA replication rate was more intensive in the area of the skin lesions and in the repeated phototest site, the excision repair synthesis appeared to be unaltered. In cutaneous prophyrias a decreased rate of the repair incorporation could be detected. Xeroderma pigmentosum was characterized by a strongly reduced repair synthesis.

  5. Nuclear translocation contributes to regulation of DNA excision repair activities

    DEFF Research Database (Denmark)

    Knudsen, Nina Østergaard; Andersen, Sofie Dabros; Lützen, Anne

    2009-01-01

    .T. Tomicic, W.P. Roos, B. Kaina, Mechanisms of human DNA repair: an update, Toxicology 193 (2003) 3-34; N.B. Larsen, M. Rasmussen, L.J. Rasmussen, Nuclear and mitochondrial DNA repair: similar pathways? Mitochondrion 5 (2005) 89-108]. Protein interactions are not only important for function, but also...

  6. DNA-repair gene variants are associated with glioblastoma survival

    DEFF Research Database (Denmark)

    Wibom, Carl; Sjöström, Sara; Henriksson, Roger

    2012-01-01

    Abstract Patient outcome from glioma may be influenced by germline variation. Considering the importance of DNA repair in cancer biology as well as in response to treatment, we studied the relationship between 1458 SNPs, which captured the majority of the common genetic variation in 136 DNA repair...

  7. Alkyltransferase-like proteins: Molecular switches between DNA repair pathways

    Science.gov (United States)

    Tubbs, Julie L.; Tainer, John A.

    2011-01-01

    Alkyltransferase-like proteins (ATLs) play a role in the protection of cells from the biological effects of DNA alkylation damage. Although ATLs share functional motifs with the DNA repair protein and cancer chemotherapy target O6-alkylguanine-DNA alkyltransferase, they lack the reactive cysteine residue required for alkyltransferase activity, so its mechanism for cell protection was previously unknown. Here, we review recent advances in unravelling the enigmatic cellular protection provided by ATLs against the deleterious effects of DNA alkylation damage. We discuss exciting new evidence that ATLs aid in the repair of DNA O6-alkylguanine lesions through a novel repair cross-talk between DNA-alkylation base damage responses and the DNA nucleotide excision repair pathway. PMID:20502938

  8. DNA Repair Mechanisms in Cancer Development and Therapy

    Directory of Open Access Journals (Sweden)

    Alessandro eTorgovnick

    2015-04-01

    Full Text Available DNA damage has been long recognized as causal factor for cancer development. When erroneous DNA repair leads to mutations or chromosomal aberrations affecting oncogenes and tumor suppressor genes, cells undergo malignant transformation resulting in cancerous growth. Genetic defects can predispose to cancer: Mutations in distinct DNA repair systems elevate the susceptibility to various cancer types. However, DNA damage not only comprises a root cause for cancer development but also continues to provide an important avenue for chemo- and radiotherapy. Since the beginning of cancer therapy, genotoxic agents have been applied that trigger DNA damage checkpoints that halt the growth and trigger the apoptotic demise of cancer cells. We provide an overview about the involvement of DNA repair systems in cancer prevention and the classes of genotoxins that are commonly used for the treatment of cancer. A better understanding of the roles and interactions of the highly complex DNA repair machineries will lead to important improvements in cancer therapy.

  9. Effect of sodium benzoate on DNA breakage, micronucleus formation and mitotic index in peripheral blood of pregnant rats and their newborns

    Directory of Open Access Journals (Sweden)

    Cetin Saatci

    2016-11-01

    Full Text Available Sodium benzoate (SB is one of the most widely used additives in food products in the world. The aim of this study was to assess the effect of three different concentrations of SB on the DNA breakage in liver cells and on the micronuclei formation and the mitotic index in lymphocytes of pregnant rats and their fetuses, as well as to evaluate the effects of SB on the fetus development. The results showed that general genomic injuries were present in almost all the liver cell samples obtained from the SB group compared with the control (non-treated group. This indicates that SB usage may cause DNA damage and increase micronuclei formation. We recommend that pregnant women should avoid consuming foodstuffs containing SB as an additive.

  10. Rad52 SUMOylation affects the efficiency of the DNA repair

    DEFF Research Database (Denmark)

    Altmannova, Veronika; Eckert-Boulet, Nadine; Arneric, Milica

    2010-01-01

    Homologous recombination (HR) plays a vital role in DNA metabolic processes including meiosis, DNA repair, DNA replication and rDNA homeostasis. HR defects can lead to pathological outcomes, including genetic diseases and cancer. Recent studies suggest that the post-translational modification...

  11. Repair of damaged DNA in vivo: Final technical report

    Energy Technology Data Exchange (ETDEWEB)

    Hanawalt, P.C.

    1987-09-01

    This contract was initiated in 1962 with the US Atomic Energy Commission to carry out basic research on the effects of radiation on the process of DNA replication in bacteria. Within the first contract year we discovered repair replication at the same time that Setlow and Carrier discovered pyrimidine dimer excision. These discoveries led to the elucidation of the process of excision-repair, one of the most important mechanisms by which living systems, including humans, respond to structural damage in their genetic material. We improved methodology for distinguishing repair replication from semiconservative replication and instructed others in these techniques. Painter then was the first to demonstrate repair replication in ultraviolet irradiated human cells. He, in turn, instructed James Cleaver who discovered that skin fibroblasts from patients with xeroderma pigmentosum were defective in excision-repair. People with this genetic defect are extremely sensitive to sunlight and they develop carcinomas and melanomas of the skin with high frequency. The existence of this hereditary disease attests to the importance of DNA repair in man. We certainly could not survive in the normal ultraviolet flux from the sun if our DNA were not continuously monitored for damage and repaired. Other hereditary diseases such as ataxia telangiectasia, Cockayne's syndrome, Blooms syndrome and Fanconi's anemia also involve deficiencies in DNA damage processing. The field of DNA repair has developed rapidly as we have learned that most environmental chemical carcinogens as well as radiation produce repairable damage in DNA. 251 refs.

  12. DNA Repair in Drosophila: Mutagens, Models, and Missing Genes.

    Science.gov (United States)

    Sekelsky, Jeff

    2017-02-01

    The numerous processes that damage DNA are counterbalanced by a complex network of repair pathways that, collectively, can mend diverse types of damage. Insights into these pathways have come from studies in many different organisms, including Drosophila melanogaster Indeed, the first ideas about chromosome and gene repair grew out of Drosophila research on the properties of mutations produced by ionizing radiation and mustard gas. Numerous methods have been developed to take advantage of Drosophila genetic tools to elucidate repair processes in whole animals, organs, tissues, and cells. These studies have led to the discovery of key DNA repair pathways, including synthesis-dependent strand annealing, and DNA polymerase theta-mediated end joining. Drosophila appear to utilize other major repair pathways as well, such as base excision repair, nucleotide excision repair, mismatch repair, and interstrand crosslink repair. In a surprising number of cases, however, DNA repair genes whose products play important roles in these pathways in other organisms are missing from the Drosophila genome, raising interesting questions for continued investigations. Copyright © 2017 by the Genetics Society of America.

  13. DNA repair: Dynamic defenders against cancer and aging

    Energy Technology Data Exchange (ETDEWEB)

    Fuss, Jill O.; Cooper, Priscilla K.

    2006-04-01

    You probably weren't thinking about your body's cellular DNA repair systems the last time you sat on the beach in the bright sunshine. Fortunately, however, while you were subjecting your DNA to the harmful effects of ultraviolet light, your cells were busy repairing the damage. The idea that our genetic material could be damaged by the sun was not appreciated in the early days of molecular biology. When Watson and Crick discovered the structure of DNA in 1953 [1], it was assumed that DNA is fundamentally stable since it carries the blueprint of life. However, over 50 years of research have revealed that our DNA is under constant assault by sunlight, oxygen, radiation, various chemicals, and even our own cellular processes. Cleverly, evolution has provided our cells with a diverse set of tools to repair the damage that Mother Nature causes. DNA repair processes restore the normal nucleotide sequence and DNA structure of the genome after damage [2]. These responses are highly varied and exquisitely regulated. DNA repair mechanisms are traditionally characterized by the type of damage repaired. A large variety of chemical modifications can alter normal DNA bases and either lead to mutations or block transcription if not repaired, and three distinct pathways exist to remove base damage. Base excision repair (BER) corrects DNA base alterations that do not distort the overall structure of the DNA helix such as bases damaged by oxidation resulting from normal cellular metabolism. While BER removes single damaged bases, nucleotide excision repair (NER) removes short segments of nucleotides (called oligonucleotides) containing damaged bases. NER responds to any alteration that distorts the DNA helix and is the mechanism responsible for repairing bulky base damage caused by carcinogenic chemicals such as benzo [a]pyrene (found in cigarette smoke and automobile exhaust) as well as covalent linkages between adjacent pyrimidine bases resulting from the ultraviolet

  14. DNA Repair Mechanisms and the Bypass of DNA Damage in Saccharomyces cerevisiae

    Science.gov (United States)

    Boiteux, Serge; Jinks-Robertson, Sue

    2013-01-01

    DNA repair mechanisms are critical for maintaining the integrity of genomic DNA, and their loss is associated with cancer predisposition syndromes. Studies in Saccharomyces cerevisiae have played a central role in elucidating the highly conserved mechanisms that promote eukaryotic genome stability. This review will focus on repair mechanisms that involve excision of a single strand from duplex DNA with the intact, complementary strand serving as a template to fill the resulting gap. These mechanisms are of two general types: those that remove damage from DNA and those that repair errors made during DNA synthesis. The major DNA-damage repair pathways are base excision repair and nucleotide excision repair, which, in the most simple terms, are distinguished by the extent of single-strand DNA removed together with the lesion. Mistakes made by DNA polymerases are corrected by the mismatch repair pathway, which also corrects mismatches generated when single strands of non-identical duplexes are exchanged during homologous recombination. In addition to the true repair pathways, the postreplication repair pathway allows lesions or structural aberrations that block replicative DNA polymerases to be tolerated. There are two bypass mechanisms: an error-free mechanism that involves a switch to an undamaged template for synthesis past the lesion and an error-prone mechanism that utilizes specialized translesion synthesis DNA polymerases to directly synthesize DNA across the lesion. A high level of functional redundancy exists among the pathways that deal with lesions, which minimizes the detrimental effects of endogenous and exogenous DNA damage. PMID:23547164

  15. Formation and repair of oxidative damage in the mitochondrial DNA.

    Science.gov (United States)

    Muftuoglu, Meltem; Mori, Mateus P; de Souza-Pinto, Nadja C

    2014-07-01

    The mitochondrial DNA (mtDNA) encodes for only 13 polypeptides, components of 4 of the 5 oxidative phosphorylation complexes. But despite this apparently small numeric contribution, all 13 subunits are essential for the proper functioning of the oxidative phosphorylation circuit. Thus, accumulation of lesions, mutations and deletions/insertions in the mtDNA could have severe functional consequences, including mitochondrial diseases, aging and age-related diseases. The DNA is a chemically unstable molecule, which can be easily oxidized, alkylated, deaminated and suffer other types of chemical modifications, throughout evolution the organisms that survived were those who developed efficient DNA repair processes. In the last two decades, it has become clear that mitochondria have DNA repair pathways, which operate, at least for some types of lesions, as efficiently as the nuclear DNA repair pathways. The mtDNA is localized in a particularly oxidizing environment, making it prone to accumulate oxidatively generated DNA modifications (ODMs). In this article, we: i) review the major types of ODMs formed in mtDNA and the known repair pathways that remove them; ii) discuss the possible involvement of other repair pathways, just recently characterized in mitochondria, in the repair of these modifications; and iii) address the role of DNA repair in mitochondrial function and a possible cross-talk with other pathways that may potentially participate in mitochondrial genomic stability, such as mitochondrial dynamics and nuclear-mitochondrial signaling. Oxidative stress and ODMs have been increasingly implicated in disease and aging, and thus we discuss how variations in DNA repair efficiency may contribute to the etiology of such conditions or even modulate their clinical outcomes. Copyright © 2014 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  16. Modulation of DNA base excision repair during neuronal differentiation

    DEFF Research Database (Denmark)

    Sykora, Peter; Yang, Jenq-Lin; Ferrarelli, Leslie K

    2013-01-01

    Neurons are terminally differentiated cells with a high rate of metabolism and multiple biological properties distinct from their undifferentiated precursors. Previous studies showed that nucleotide excision DNA repair is downregulated in postmitotic muscle cells and neurons. Here, we characterize...... DNA damage susceptibility and base excision DNA repair (BER) capacity in undifferentiated and differentiated human neural cells. The results show that undifferentiated human SH-SY5Y neuroblastoma cells are less sensitive to oxidative damage than their differentiated counterparts, in part because...

  17. Mechanisms of interstrand DNA crosslink repair and human disorders.

    Science.gov (United States)

    Hashimoto, Satoru; Anai, Hirofumi; Hanada, Katsuhiro

    2016-01-01

    Interstrand DNA crosslinks (ICLs) are the link between Watson-Crick strands of DNAs with the covalent bond and prevent separation of DNA strands. Since the ICL lesion affects both strands of the DNA, the ICL repair is not simple. So far, nucleotide excision repair (NER), structure-specific endonucleases, translesion DNA synthesis (TLS), homologous recombination (HR), and factors responsible for Fanconi anemia (FA) are identified to be involved in ICL repair. Since the presence of ICL lesions causes severe defects in transcription and DNA replication, mutations in these DNA repair pathways give rise to a various hereditary disorders. NER plays an important role for the ICL recognition and removal in quiescent cells, and defects of NER causes congential progeria syndrome, such as xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy. On the other hand, the ICL repair in S phase requires more complicated orchestration of multiple factors, including structure-specific endonucleases, and TLS, and HR. Disturbed this ICL repair orchestration in S phase causes genome instability resulting a cancer prone disease, Fanconi anemia. So far more than 30 factors in ICL repair have already identified. Recently, a new factor, UHRF1, was discovered as a sensor of ICLs. In addition to this, numbers of nucleases that are involved in the first incision, also called unhooking, of ICL lesions have also been identified. Here we summarize the recent studies of ICL associated disorders and repair mechanism, with emphasis in the first incision of ICLs.

  18. Oxidatively damaged DNA repair defect in cockayne syndrome and its complementation by heterologous repair proteins.

    Science.gov (United States)

    Frosina, Guido

    2008-01-01

    Cockayne syndrome (complementation groups A and B) is a rare autosomal recessive DNA repair disorder characterized by photosensitive skin and severely impaired physical and intellectual development. The Cockayne syndrome A and B proteins intervene in the repair of DNA modifications that block the RNA polymerase in transcribed DNA sequences (transcription-coupled repair). Recent results suggest that they also have a more general role in the repair of oxidative DNA base modifications. Although the phenotypical consequences of defective repair of oxidatively damaged DNA in Cockayne syndrome are not determined, accumulation of oxidized lesions might contribute to delay the physical and intellectual development of these patients. To conceive new therapeutic strategies for this syndrome, we are investigating whether the oxidatively damaged DNA repair defect in Cockayne syndrome might be complemented by heterologous repair proteins, such as the Escherichia coli formamidopyrimidine-DNA glycosylase and endonuclease III. The complementation studies may shed light on the important lesions for the Cockayne syndrome phenotype and offer new tools for future therapies aimed at counteracting the consequences of oxidatively damaged DNA accumulation.

  19. Molecular biological mechanisms I. DNA repair; Molekularbiologische Mechanismen I. DNA-Reparatur

    Energy Technology Data Exchange (ETDEWEB)

    Friedl, A.A. [Muenchen Univ. (Germany). Strahlenbiologisches Inst.

    2000-07-01

    Cells of all living systems possess a variety of mechanisms that allow to repair spontaneous and exogeneously induced DNA damage. DNA repair deficiencies may invoke enhanced sensitivity towards DNA-damaging agents such as ionizing radiation. They may also enhance the risk of cancer development, both spontaneously or after induction. This article reviews several DNA repair mechanisms, especially those dealing with DNA double-strand breaks, and describes hereditary diseases associated with DNA repair defects. (orig.) [German] Zellen aller Organismen verfuegen ueber eine Vielzahl von Mechanismen zur Reparatur von spontanen und exogen induzierten DNA-Schaeden. Defizienzen in DNA-Reparatursystemen koennen zu einer erhoehten Sensitivitaet gegenueber DNA-schaedigenden Noxen wie ionisierender Strahlung fuehren und das Risiko fuer die Entstehung spontaner und induzierter maligner Neoplasien erhoehen. Der Artikel gibt einen Ueberblick ueber verschiedene DNA-Reparaturmechanismen unter besonderer Beruecksichtigung der bekannten Mechanismen zur Reparatur von DNA-Doppelstrangbruechen, sowie ueber Erbkrankheiten, die mit Reparaturdefekten assoziiert sind. (orig.)

  20. Dynamics and mechanism of UV-damaged DNA repair in indole-thymine dimer adduct: molecular origin of low repair quantum efficiency.

    Science.gov (United States)

    Guo, Xunmin; Liu, Zheyun; Song, Qinhua; Wang, Lijuan; Zhong, Dongping

    2015-02-26

    Many biomimetic chemical systems for repair of UV-damaged DNA showed very low repair efficiency, and the molecular origin is still unknown. Here, we report our systematic characterization of the repair dynamics of a model compound of indole-thymine dimer adduct in three solvents with different polarity. By resolving all elementary steps including three electron-transfer processes and two bond-breaking and bond-formation dynamics with femtosecond resolution, we observed the slow electron injection in 580 ps in water, 4 ns in acetonitrile, and 1.38 ns in dioxane, the fast back electron transfer without repair in 120, 150, and 180 ps, and the slow bond splitting in 550 ps, 1.9 ns, and 4.5 ns, respectively. The dimer bond cleavage is clearly accelerated by the solvent polarity. By comparing with the biological repair machine photolyase with a slow back electron transfer (2.4 ns) and a fast bond cleavage (90 ps), the low repair efficiency in the biomimetic system is mainly determined by the fast back electron transfer and slow bond breakage. We also found that the model system exists in a dynamic heterogeneous C-clamped conformation, leading to a stretched dynamic behavior. In water, we even identified another stacked form with ultrafast cyclic electron transfer, significantly reducing the repair efficiency. Thus, the comparison of the repair efficiency in different solvents is complicated and should be cautious, and only the dynamics by resolving all elementary steps can finally determine the total repair efficiency. Finally, we use the Marcus electron-transfer theory to analyze all electron-transfer reactions and rationalize all observed electron-transfer dynamics.

  1. Molecular Mechanisms of the Whole DNA Repair System: A Comparison of Bacterial and Eukaryotic Systems

    Directory of Open Access Journals (Sweden)

    Rihito Morita

    2010-01-01

    Full Text Available DNA is subjected to many endogenous and exogenous damages. All organisms have developed a complex network of DNA repair mechanisms. A variety of different DNA repair pathways have been reported: direct reversal, base excision repair, nucleotide excision repair, mismatch repair, and recombination repair pathways. Recent studies of the fundamental mechanisms for DNA repair processes have revealed a complexity beyond that initially expected, with inter- and intrapathway complementation as well as functional interactions between proteins involved in repair pathways. In this paper we give a broad overview of the whole DNA repair system and focus on the molecular basis of the repair machineries, particularly in Thermus thermophilus HB8.

  2. Repair of oxidatively generated DNA damage in Cockayne syndrome.

    Science.gov (United States)

    Khobta, Andriy; Epe, Bernd

    2013-01-01

    Defects in the repair of endogenously (especially oxidatively) generated DNA modifications and the resulting genetic instability can potentially explain the clinical symptoms of Cockayne syndrome (CS), a hereditary disease characterized by developmental defects and neurological degeneration. In this review, we describe the evidence for the involvement of CSA and CSB proteins, which are mutated in most of the CS patients, in the repair and processing of DNA damage induced by reactive oxygen species and the implications for the induction of cell death and mutations. Taken together, the data demonstrate that CSA and CSB, in addition to their established role in transcription-coupled nucleotide excision repair, can modulate the base excision repair (BER) of oxidized DNA bases both directly (by interaction with BER proteins) and indirectly (by modulating the expression of the DNA repair genes). Both nuclear and mitochondrial DNA repair is affected by mutations in CSA and CSB genes. However, the observed retardations of repair and the resulting accumulation of unrepaired endogenously generated DNA lesions are often mild, thus pointing to the relevance of additional roles of the CS proteins, e.g. in the mitochondrial response to oxidatively generated DNA damage and in the maintenance of gene transcription. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  3. DEK is required for homologous recombination repair of DNA breaks

    DEFF Research Database (Denmark)

    Smith, Eric A; Gole, Boris; Willis, Nicholas A

    2017-01-01

    DEK is a highly conserved chromatin-bound protein whose upregulation across cancer types correlates with genotoxic therapy resistance. Loss of DEK induces genome instability and sensitizes cells to DNA double strand breaks (DSBs), suggesting defects in DNA repair. While these DEK-deficiency pheno......DEK is a highly conserved chromatin-bound protein whose upregulation across cancer types correlates with genotoxic therapy resistance. Loss of DEK induces genome instability and sensitizes cells to DNA double strand breaks (DSBs), suggesting defects in DNA repair. While these DEK......-deficiency phenotypes were thought to arise from a moderate attenuation of non-homologous end joining (NHEJ) repair, the role of DEK in DNA repair remains incompletely understood. We present new evidence demonstrating the observed decrease in NHEJ is insufficient to impact immunoglobulin class switching in DEK knockout...

  4. Relationship between DNA Mismatch Repair Deficiency and Endometrial Cancer

    Directory of Open Access Journals (Sweden)

    Kenta Masuda

    2011-01-01

    Full Text Available Some cases of endometrial cancer are associated with a familial tumor and are referred to as hereditary nonpolyposis colorectal cancer (HNPCC or Lynch syndrome. Lynch syndrome is thought to be induced by germline mutation of the DNA mismatch repair (MMR gene. An aberration in the MMR gene prevents accurate repair of base mismatches produced during DNA replication. This phenomenon can lead to an increased frequency of errors in target genes involved in carcinogenesis, resulting in cancerization of the cell. On the other hand, aberrant DNA methylation is thought to play a key role in sporadic endometrial carcinogenesis. Hypermethylation of unmethylated CpG islands in the promoter regions of cancer-related genes associated with DNA repair leads to the cell becoming cancerous. Thus, both genetic and epigenetic changes are intricately involved in the process through which cells become cancerous. In this review, we introduce the latest findings on the DNA mismatch repair pathway in endometrial cancer.

  5. Role of Nicotinamide in DNA Damage, Mutagenesis, and DNA Repair

    Directory of Open Access Journals (Sweden)

    Devita Surjana

    2010-01-01

    Full Text Available Nicotinamide is a water-soluble amide form of niacin (nicotinic acid or vitamin B3. Both niacin and nicotinamide are widely available in plant and animal foods, and niacin can also be endogenously synthesized in the liver from dietary tryptophan. Nicotinamide is also commercially available in vitamin supplements and in a range of cosmetic, hair, and skin preparations. Nicotinamide is the primary precursor of nicotinamide adenine dinucleotide (NAD+, an essential coenzyme in ATP production and the sole substrate of the nuclear enzyme poly-ADP-ribose polymerase-1 (PARP-1. Numerous in vitro and in vivo studies have clearly shown that PARP-1 and NAD+ status influence cellular responses to genotoxicity which can lead to mutagenesis and cancer formation. This paper will examine the role of nicotinamide in the protection from carcinogenesis, DNA repair, and maintenance of genomic stability.

  6. Molecular regulation of UV-induced DNA repair.

    Science.gov (United States)

    Shah, Palak; He, Yu-Ying

    2015-01-01

    Ultraviolet (UV) radiation from sunlight is a major etiologic factor for skin cancer, the most prevalent cancer in the United States, as well as premature skin aging. In particular, UVB radiation causes formation of specific DNA damage photoproducts between pyrimidine bases. These DNA damage photoproducts are repaired by a process called nucleotide excision repair, also known as UV-induced DNA repair. When left unrepaired, UVB-induced DNA damage leads to accumulation of mutations, predisposing people to carcinogenesis as well as to premature aging. Genetic loss of nucleotide excision repair leads to severe disorders, namely, xeroderma pigmentosum (XP), trichothiodystrophy (TTD) and Cockayne syndrome (CS), which are associated with predisposition to skin carcinogenesis at a young age as well as developmental and neurological conditions. Regulation of nucleotide excision repair is an attractive avenue to preventing or reversing these detrimental consequences of impaired nucleotide excision repair. Here, we review recent studies on molecular mechanisms regulating nucleotide excision repair by extracellular cues and intracellular signaling pathways, with a special focus on the molecular regulation of individual repair factors. © 2014 The American Society of Photobiology.

  7. DNA Repair Gene Polymorphisms in Hereditary and Sporadic Breast Cancer

    National Research Council Canada - National Science Library

    Ricks-Santi, Luisel

    2006-01-01

    .... There is variable penetrance for breast cancer among women in families with known BRCA1 mutations, and we hypothesize that this might be due to genetic variants in wild-type BRCA1 or other DNA repair...

  8. D-ribose inhibits DNA repair synthesis in human lymphocytes

    Energy Technology Data Exchange (ETDEWEB)

    Zunica, G.; Marini, M.; Brunelli, M.A.; Chiricolo, M.; Franceschi, C.

    1986-07-31

    D-ribose is cytotoxic for quiescent human lymphocytes and severely inhibits their PHA-induced proliferation at concentrations (25-50 mM) at which other simple sugars are ineffective. In order to explain these effects, DNA repair synthesis was evaluated in PHA-stimulated human lymphocytes treated with hydroxyurea and irradiated. D-ribose, in contrast to other reducing sugars, did not induce repair synthesis and therefore did not apparently damage DNA in a direct way, although it markedly inhibited gamma ray-induced repair. Taking into account that lymphocytes must rejoin physiologically-formed DNA strand breaks in order to enter the cell cycle, we suggest that D-ribose exerts its cytotoxic activity by interfering with metabolic pathways critical for the repair of DNA breaks.

  9. p53 in the DNA damage repair process

    Science.gov (United States)

    Williams, Ashley B.; Schumacher, Björn

    2016-01-01

    The cells in the human body are continuously challenged by a variety of genotoxic attacks. Erroneous repair of the DNA can lead to mutations and chromosomal aberrations that can alter the functions of tumor suppressor genes or oncogenes, thus causing cancer development. As a central tumor suppressor, p53 guards the genome by orchestrating a variety of DNA damage response (DDR) mechanisms. Already early in metazoan evolution, p53 started controlling the apoptotic demise of genomically compromised cells. p53 plays a prominent role as a facilitator of DNA repair by halting the cell cycle to allow time for the repair machineries to restore genome stability. In addition, p53 took on diverse roles to also directly impact the activity of various DNA repair systems. It thus appears as if p53 is multitasking in protecting from cancer development by maintaining genome stability. PMID:27048304

  10. DNA repair, genome stability and cancer: a historical perspective.

    Science.gov (United States)

    Jeggo, Penny A; Pearl, Laurence H; Carr, Antony M

    2016-01-01

    The multistep process of cancer progresses over many years. The prevention of mutations by DNA repair pathways led to an early appreciation of a role for repair in cancer avoidance. However, the broader role of the DNA damage response (DDR) emerged more slowly. In this Timeline article, we reflect on how our understanding of the steps leading to cancer developed, focusing on the role of the DDR. We also consider how our current knowledge can be exploited for cancer therapy.

  11. Both genetic and dietary factors underlie individual differences in DNA damage levels and DNA repair capacity.

    Science.gov (United States)

    Slyskova, Jana; Lorenzo, Yolanda; Karlsen, Anette; Carlsen, Monica H; Novosadova, Vendula; Blomhoff, Rune; Vodicka, Pavel; Collins, Andrew R

    2014-04-01

    The interplay between dietary habits and individual genetic make-up is assumed to influence risk of cancer, via modulation of DNA integrity. Our aim was to characterize internal and external factors that underlie inter-individual variability in DNA damage and repair and to identify dietary habits beneficial for maintaining DNA integrity. Habitual diet was estimated in 340 healthy individuals using a food frequency questionnaire and biomarkers of antioxidant status were quantified in fasting blood samples. Markers of DNA integrity were represented by DNA strand breaks, oxidized purines, oxidized pyrimidines and a sum of all three as total DNA damage. DNA repair was characterized by genetic variants and functional activities of base and nucleotide excision repair pathways. Sex, fruit-based food consumption and XPG genotype were factors significantly associated with the level of DNA damage. DNA damage was higher in women (p=0.035). Fruit consumption was negatively associated with the number of all measured DNA lesions, and this effect was mediated mostly by β-cryptoxanthin and β-tocopherol (pindividual antioxidants were also associated with DNA repair capacity; both the base and nucleotide excision repairs were lower in women and the latter increased with higher plasma levels of ascorbic acid and α-carotene (pgenetic and dietary factors that modulate DNA integrity. We propose that the positive health effect of fruit intake is partially mediated via DNA damage suppression and a simultaneous increase in DNA repair capacity. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Purification of mammalian DNA repair protein XRCC1

    Energy Technology Data Exchange (ETDEWEB)

    Chen, I. [Univ. of California, Berkeley, CA (United States)

    1995-11-01

    Malfunctioning DNA repair systems lead to cancer mutations, and cell death. XRCC1 (X-ray Repair Cross Complementing) is a human DNA repair gene that has been found to fully correct the x-ray repair defect in Chinese hamster ovary (CHO) cell mutant EM9. The corresponding protein (XRCC1) encoded by this gene has been linked to a DNA repair pathway known as base excision repair, and affects the activity of DNA ligase III. Previously, an XRCC1 cDNA minigene (consisting of the uninterrupted coding sequence for XRCC1 protein followed by a decahistidine tag) was constructed and cloned into vector pET-16b for the purpose of: (1) overproduction of XRCC1 in both prokaryotic and eukaryotic cells; and (2) to facilitate rapid purification of XRCC1 from these systems. A vector is basically a DNA carrier that allows recombinant protein to be cloned and overexpressed in host cells. In this study, XRCC1 protein was overexpressed in E. coli and purified by immobilized metal affinity chromatography. Currently, the XRCC1 minigene is being inserted into a new vector [pET-26b(+)] in hopes to increase overexpression and improve purification. Once purified XRCC1 can be crystallized for structural studies, or studied in vitro for its biological function.

  13. DNA damage and repair in age-related macular degeneration

    Energy Technology Data Exchange (ETDEWEB)

    Szaflik, Jacek P. [Department of Ophthalmology, Medical University of Warsaw and Samodzielny Publiczny Szpital Okulistyczny, Sierakowskiego 13, 03-710 Warsaw (Poland); Janik-Papis, Katarzyna; Synowiec, Ewelina; Ksiazek, Dominika [Department of Molecular Genetics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland); Zaras, Magdalena [Department of Ophthalmology, Medical University of Warsaw and Samodzielny Publiczny Szpital Okulistyczny, Sierakowskiego 13, 03-710 Warsaw (Poland); Wozniak, Katarzyna [Department of Molecular Genetics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland); Szaflik, Jerzy [Department of Ophthalmology, Medical University of Warsaw and Samodzielny Publiczny Szpital Okulistyczny, Sierakowskiego 13, 03-710 Warsaw (Poland); Blasiak, Janusz, E-mail: januszb@biol.uni.lodz.pl [Department of Molecular Genetics, University of Lodz, Banacha 12/16, 90-237 Lodz (Poland)

    2009-10-02

    Age-related macular degeneration (AMD) is a retinal degenerative disease that is the main cause of vision loss in individuals over the age of 55 in the Western world. Clinically relevant AMD results from damage to the retinal pigment epithelial (RPE) cells thought to be mainly caused by oxidative stress. The stress also affects the DNA of RPE cells, which promotes genome instability in these cells. These effects may coincide with the decrease in the efficacy of DNA repair with age. Therefore individuals with DNA repair impaired more than average for a given age may be more susceptible to AMD if oxidative stress affects their RPE cells. This may be helpful in AMD risk assessment. In the present work we determined the level of basal (measured in the alkaline comet assay) endogenous and endogenous oxidative DNA damage, the susceptibility to exogenous mutagens and the efficacy of DNA repair in lymphocytes of 100 AMD patients and 110 age-matched individuals without visual disturbances. The cells taken from AMD patients displayed a higher extent of basal endogenous DNA damage without differences between patients of dry and wet forms of the disease. DNA double-strand breaks did not contribute to the observed DNA damage as checked by the neutral comet assay and pulsed field gel electrophoresis. The extent of oxidative modification to DNA bases was grater in AMD patients than in the controls, as probed by DNA repair enzymes NTH1 and Fpg. Lymphocytes from AMD patients displayed a higher sensitivity to hydrogen peroxide and UV radiation and repaired lesions induced by these factors less effectively than the cells from the control individuals. We postulate that the impaired efficacy of DNA repair may combine with enhanced sensitivity of RPE cells to blue and UV lights, contributing to the pathogenesis of AMD.

  14. The cutting edges in DNA repair, licensing, and fidelity: DNA and RNA repair nucleases sculpt DNA to measure twice, cut once.

    Science.gov (United States)

    Tsutakawa, Susan E; Lafrance-Vanasse, Julien; Tainer, John A

    2014-07-01

    To avoid genome instability, DNA repair nucleases must precisely target the correct damaged substrate before they are licensed to incise. Damage identification is a challenge for all DNA damage response proteins, but especially for nucleases that cut the DNA and necessarily create a cleaved DNA repair intermediate, likely more toxic than the initial damage. How do these enzymes achieve exquisite specificity without specific sequence recognition or, in some cases, without a non-canonical DNA nucleotide? Combined structural, biochemical, and biological analyses of repair nucleases are revealing their molecular tools for damage verification and safeguarding against inadvertent incision. Surprisingly, these enzymes also often act on RNA, which deserves more attention. Here, we review protein-DNA structures for nucleases involved in replication, base excision repair, mismatch repair, double strand break repair (DSBR), and telomere maintenance: apurinic/apyrimidinic endonuclease 1 (APE1), Endonuclease IV (Nfo), tyrosyl DNA phosphodiesterase (TDP2), UV Damage endonuclease (UVDE), very short patch repair endonuclease (Vsr), Endonuclease V (Nfi), Flap endonuclease 1 (FEN1), exonuclease 1 (Exo1), RNase T and Meiotic recombination 11 (Mre11). DNA and RNA structure-sensing nucleases are essential to life with roles in DNA replication, repair, and transcription. Increasingly these enzymes are employed as advanced tools for synthetic biology and as targets for cancer prognosis and interventions. Currently their structural biology is most fully illuminated for DNA repair, which is also essential to life. How DNA repair enzymes maintain genome fidelity is one of the DNA double helix secrets missed by James Watson and Francis Crick, that is only now being illuminated though structural biology and mutational analyses. Structures reveal motifs for repair nucleases and mechanisms whereby these enzymes follow the old carpenter adage: measure twice, cut once. Furthermore, to measure

  15. DNA repair mechanisms in dividing and non-dividing cells.

    Science.gov (United States)

    Iyama, Teruaki; Wilson, David M

    2013-08-01

    DNA damage created by endogenous or exogenous genotoxic agents can exist in multiple forms, and if allowed to persist, can promote genome instability and directly lead to various human diseases, particularly cancer, neurological abnormalities, immunodeficiency and premature aging. To avoid such deleterious outcomes, cells have evolved an array of DNA repair pathways, which carry out what is typically a multiple-step process to resolve specific DNA lesions and maintain genome integrity. To fully appreciate the biological contributions of the different DNA repair systems, one must keep in mind the cellular context within which they operate. For example, the human body is composed of non-dividing and dividing cell types, including, in the brain, neurons and glial cells. We describe herein the molecular mechanisms of the different DNA repair pathways, and review their roles in non-dividing and dividing cells, with an eye toward how these pathways may regulate the development of neurological disease. Published by Elsevier B.V.

  16. DNA Repair and the Accumulation of Oxidatively Damaged DNA Are Affected by Fruit Intake in Mice

    DEFF Research Database (Denmark)

    Croteau, Deborah L; de Souza-Pinto, Nadja C; Harboe, Charlotte

    2010-01-01

    Aging is associated with elevated oxidative stress and DNA damage. To achieve healthy aging, we must begin to understand how diet affects cellular processes. We postulated that fruit-enriched diets might initiate a program of enhanced DNA repair and thereby improve genome integrity. C57Bl/6 J mice...... were fed for 14 weeks a control diet or a diet with 8% peach or nectarine extract. The activities of DNA repair enzymes, the level of DNA damage, and gene expression changes were measured. Our study showed that repair of various oxidative DNA lesions was more efficient in liver extracts derived from...

  17. DNA repair: a changing geography? (1964-2008).

    Science.gov (United States)

    Maisonobe, Marion; Giglia-Mari, Giuseppina; Eckert, Denis

    2013-07-01

    This article aims to explain the current state of DNA Repair studies' global geography by focusing on the genesis of the community. Bibliometric data is used to localize scientific activities related to DNA Repair at the city level. The keyword "DNA Repair" was introduced first by American scientists. It started to spread after 1964 that is to say, after P. Howard-Flanders (Yale University), P. Hanawalt (Stanford University) and R. Setlow (Oak Ridge Laboratories) found evidence for Excision Repair mechanisms. It was the first stage in the emergence of an autonomous scientific community. In this article, we will try to assess to what extent the geo-history of this scientific field is determinant in understanding its current geography. In order to do so, we will localize the places where the first "DNA Repair" publications were signed fifty years ago and the following spatial diffusion process, which led to the current geography of the field. Then, we will focus on the evolution of the research activity of "early entrants" in relation to the activity of "latecomers". This article is an opportunity to share with DNA Repair scientists some research results of a dynamic field in Science studies: spatial scientometrics. Copyright © 2013 Elsevier B.V. All rights reserved.

  18. R-loops and nicks initiate DNA breakage and genome instability in non-growing Escherichia coli.

    Science.gov (United States)

    Wimberly, Hallie; Shee, Chandan; Thornton, P C; Sivaramakrishnan, Priya; Rosenberg, Susan M; Hastings, P J

    2013-01-01

    Double-stranded DNA ends, often from replication, drive genomic instability, yet their origin in non-replicating cells is unknown. Here we show that transcriptional RNA/DNA hybrids (R-loops) generate DNA ends that underlie stress-induced mutation and amplification. Depleting RNA/DNA hybrids with overproduced RNase HI reduces both genomic changes, indicating RNA/DNA hybrids as intermediates in both. An Mfd requirement and inhibition by translation implicate transcriptional R-loops. R-loops promote instability by generating DNA ends, shown by their dispensability when ends are provided by I-SceI endonuclease. Both R-loops and single-stranded endonuclease TraI are required for end formation, visualized as foci of a fluorescent end-binding protein. The data suggest that R-loops prime replication forks that collapse at single-stranded nicks, producing ends that instigate genomic instability. The results illuminate how DNA ends form in non-replicating cells, identify R-loops as the earliest known mutation/amplification intermediate, and suggest that genomic instability during stress could be targeted to transcribed regions, accelerating adaptation.

  19. Chromatin Dynamics in Genome Stability: Roles in Suppressing Endogenous DNA Damage and Facilitating DNA Repair

    Directory of Open Access Journals (Sweden)

    Nidhi Nair

    2017-07-01

    Full Text Available Genomic DNA is compacted into chromatin through packaging with histone and non-histone proteins. Importantly, DNA accessibility is dynamically regulated to ensure genome stability. This is exemplified in the response to DNA damage where chromatin relaxation near genomic lesions serves to promote access of relevant enzymes to specific DNA regions for signaling and repair. Furthermore, recent data highlight genome maintenance roles of chromatin through the regulation of endogenous DNA-templated processes including transcription and replication. Here, we review research that shows the importance of chromatin structure regulation in maintaining genome integrity by multiple mechanisms including facilitating DNA repair and directly suppressing endogenous DNA damage.

  20. Assembly of checkpoint and repair machineries at DNA damage sites

    Science.gov (United States)

    Huen, Michael S.Y.; Chen, Junjie

    2009-01-01

    The remarkably coordinated nature of the DNA damage response pathway relies on numerous mechanisms that facilitate the assembly of checkpoint and repair factors at DNA breaks. Post-translational modifications on and around chromatin play critical roles in allowing the timely and sequential assembly of DNA damage responsive elements at the vicinity of DNA breaks. Notably, recent advances in forward genetics and proteomics-based approaches have enabled the identification of novel components within the DNA damage response pathway, providing a more comprehensive picture of the molecular network that assists in the detection and propagation of DNA damage signals. PMID:19875294

  1. DNA mismatch repair: Dr. Jekyll and Mr. Hyde?

    Science.gov (United States)

    Hsieh, Peggy

    2012-09-14

    In this issue, Peña-Diaz et al. (2012) describe a pathway for somatic mutation in nonlymphoid cells termed noncanonical DNA mismatch repair, whereby the error-prone translesion polymerase Pol-η substitutes for high-fidelity replicative polymerases to resynthesize excised regions opposite DNA damage. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. Dynamic regulation of cerebral DNA repair genes by psychological stress

    DEFF Research Database (Denmark)

    Forsberg, Kristin; Aalling, Nadia; Wörtwein, Gitta

    2015-01-01

    was seen in HC, but with overall smaller effects and without the induction after acute stress. Nuclear DNA damage from oxidation as measured by the comet assay was unaffected by stress in both regions. We conclude that psychological stress have a dynamic influence on brain DNA repair gene expression...

  3. A Mathematical Model for DNA Damage and Repair

    Directory of Open Access Journals (Sweden)

    Philip S. Crooke

    2010-01-01

    Full Text Available In cells, DNA repair has to keep up with DNA damage to maintain the integrity of the genome and prevent mutagenesis and carcinogenesis. While the importance of both DNA damage and repair is clear, the impact of imbalances between both processes has not been studied. In this paper, we created a combined mathematical model for the formation of DNA adducts from oxidative estrogen metabolism followed by base excision repair (BER of these adducts. The model encompasses a set of differential equations representing the sequence of enzymatic reactions in both damage and repair pathways. By combining both pathways, we can simulate the overall process by starting from a given time-dependent concentration of 17β-estradiol (E2 and 2′-deoxyguanosine, determine the extent of adduct formation and the correction by BER required to preserve the integrity of DNA. The model allows us to examine the effect of phenotypic and genotypic factors such as different concentrations of estrogen and variant enzyme haplotypes on the formation and repair of DNA adducts.

  4. Role of DNA repair in Bacillus subtilis spore resistance.

    OpenAIRE

    Setlow, B; Setlow, P

    1996-01-01

    Wet-heat or hydrogen peroxide treatment of wild-type Bacillus subtilis spores did not result in induction of lacZ fusions to three DNA repair-related genes (dinR, recA, and uvrC) during spore outgrowth. However, these genes were induced during outgrowth of wild-type spores treated with dry heat or UV. Wet-heat, desiccation, dry-heat, or UV treatment of spores lacking major DNA-binding proteins (termed alpha-beta- spores) also resulted in induction of the three DNA repair genes during spore ou...

  5. Dynamics and mechanisms of DNA repair by photolyase

    Science.gov (United States)

    Liu, Zheyun; Wang, Lijuan; Zhong, Dongping

    2015-01-01

    Photolyase, a class of flavoproteins, uses blue light to repair two types of ultraviolet-induced DNA damage, cyclobutane pyrimidine dimer (CPD) and pyrimidine-pyrimidone (6–4) photoproduct (6–4PP). In this perspective, we review the recent progress on the repair dynamics and mechanisms of both types of DNA restoration by photolyases. We first report the spectroscopic characterization of flavin in various redox states and the active-site solvation dynamics in photolyases. We then systematically summarize the detailed repair dynamics of damaged DNA by photolyases and a biomimetic system through resolving all elementary steps on the ultrafast timescales, including multiple intermolecular electron- and proton-transfer reactions and bond-breaking and -making processes. We determined the unique electron tunneling pathways, identified the key functional residues and revealed the molecular origin of high repair efficiency, and thus elucidate the molecular mechanisms and repair photocycles at the most fundamental level. We finally conclude that the active sites of photolyases, unlike aqueous solution for the biomimetic system, provide a unique electrostatic environment and local flexibility and thus a dedicated synergy for all elementary dynamics to maximize the repair efficiency. This repair photomachine is the first enzyme that the entire functional evolution is completely mapped out in real time. PMID:25870862

  6. Deficiency of the DNA repair protein nibrin increases the basal but not the radiation induced mutation frequency in vivo

    Energy Technology Data Exchange (ETDEWEB)

    Wessendorf, Petra [Institute of Medical and Human Genetics, Charité – Universitätsmedizin Berlin, Augustenburger Platz 1, D-13353 Berlin (Germany); Vijg, Jan [Albert Einstein College of Medicine, Michael F. Price Center, 1301 Morris Park Avenue, Bronx, NY 10461 (United States); Nussenzweig, André [Laboratory of Genome Integrity, National Cancer Institute, National Institute of Health, 37 Convent Drive, Room 1106, Bethesda, MD 20892 (United States); Digweed, Martin, E-mail: martin.digweed@charite.de [Institute of Medical and Human Genetics, Charité – Universitätsmedizin Berlin, Augustenburger Platz 1, D-13353 Berlin (Germany)

    2014-11-15

    Highlights: • lacZ mutant frequencies measured in vivo in mouse models of radiosensitive Nijmegen Breakage Syndrome. • Spontaneous mutation frequencies are increased in lymphatic tissue due to Nbn mutation. • Single base transitions, not deletions, dominate the mutation spectrum. • Radiation induced mutation frequencies are not increased due to Nbn mutation. - Abstract: Nibrin (NBN) is a member of a DNA repair complex together with MRE11 and RAD50. The complex is associated particularly with the repair of DNA double strand breaks and with the regulation of cell cycle check points. Hypomorphic mutation of components of the complex leads to human disorders characterised by radiosensitivity and increased tumour occurrence, particularly of the lymphatic system. We have examined here the relationship between DNA damage, mutation frequency and mutation spectrum in vitro and in vivo in mouse models carrying NBN mutations and a lacZ reporter plasmid. We find that NBN mutation leads to increased spontaneous DNA damage in fibroblasts in vitro and high basal mutation rates in lymphatic tissue of mice in vivo. The characteristic mutation spectrum is dominated by single base transitions rather than the deletions and complex rearrangements expected after abortive repair of DNA double strand breaks. We conclude that in the absence of wild type nibrin, the repair of spontaneous errors, presumably arising during DNA replication, makes a major contribution to the basal mutation rate. This applies also to cells heterozygous for an NBN null mutation. Mutation frequencies after irradiation in vivo were not increased in mice with nibrin mutations as might have been expected considering the radiosensitivity of NBS patient cells in vitro. Evidently apoptosis is efficient, even in the absence of wild type nibrin.

  7. Damage and repair of ancient DNA

    DEFF Research Database (Denmark)

    Mitchell, David; Willerslev, Eske; Hansen, Anders

    2005-01-01

    of early native Americans. Hence, ancient DNA contains information pertinent to numerous fields of study including evolution, population genetics, ecology, climatology, medicine, archeology, and behavior. The major obstacles to the study of aDNA are its extremely low yield, contamination with modern DNA......Under certain conditions small amounts of DNA can survive for long periods of time and can be used as polymerase chain reaction (PCR) substrates for the study of phylogenetic relationships and population genetics of extinct plants and animals, including hominids. Because of extensive DNA...... degradation, these studies are limited to species that lived within the past 10(4)-10(5) years (Late Pleistocene), although DNA sequences from 10(6) years have been reported. Ancient DNA (aDNA) has been used to study phylogenetic relationships of protists, fungi, algae, plants, and higher eukaryotes...

  8. The current state of eukaryotic DNA base damage and repair.

    Science.gov (United States)

    Bauer, Nicholas C; Corbett, Anita H; Doetsch, Paul W

    2015-12-02

    DNA damage is a natural hazard of life. The most common DNA lesions are base, sugar, and single-strand break damage resulting from oxidation, alkylation, deamination, and spontaneous hydrolysis. If left unrepaired, such lesions can become fixed in the genome as permanent mutations. Thus, evolution has led to the creation of several highly conserved, partially redundant pathways to repair or mitigate the effects of DNA base damage. The biochemical mechanisms of these pathways have been well characterized and the impact of this work was recently highlighted by the selection of Tomas Lindahl, Aziz Sancar and Paul Modrich as the recipients of the 2015 Nobel Prize in Chemistry for their seminal work in defining DNA repair pathways. However, how these repair pathways are regulated and interconnected is still being elucidated. This review focuses on the classical base excision repair and strand incision pathways in eukaryotes, considering both Saccharomyces cerevisiae and humans, and extends to some important questions and challenges facing the field of DNA base damage repair. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  9. Isolating human DNA repair genes using rodent-cell mutants

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, L.H.; Weber, C.A.; Brookman, K.W.; Salazar, E.P.; Stewart, S.A.; Mitchell, D.L.

    1987-03-23

    The DNA repair systems of rodent and human cells appear to be at least as complex genetically as those in lower eukaryotes and bacteria. The use of mutant lines of rodent cells as a means of identifying human repair genes by functional complementation offers a new approach toward studying the role of repair in mutagenesis and carcinogenesis. In each of six cases examined using hybrid cells, specific human chromosomes have been identified that correct CHO cell mutations affecting repair of damage from uv or ionizing radiations. This finding suggests that both the repair genes and proteins may be virtually interchangeable between rodent and human cells. Using cosmid vectors, human repair genes that map to chromosome 19 have cloned as functional sequences: ERCC2 and XRCC1. ERCC1 was found to have homology with the yeast excision repair gene RAD10. Transformants of repair-deficient cell lines carrying the corresponding human gene show efficient correction of repair capacity by all criteria examined. 39 refs., 1 fig., 1 tab.

  10. Electronic Pathways in Photoactivated Repair of UV Mutated DNA

    Science.gov (United States)

    Bohr, Henrik; Jalkanen, K. J.; Bary Malik, F.

    An investigation of the physics, underlying the damage caused to DNA by UV radiation and its subsequent repair via a photoreactivation mechanism, is presented in this study. Electronic pathways, starting from the initial damage to the final repair process, are presented. UV radiation is absorbed to create a hole-excited thymine or other pyrimidine that subsequently is responsible for the formation of a dimer. The negative-ion of the cofactor riboflavin, FADH-, formed by the exposure of the photolyase protein to visible light, interacts with the hole-excited electronic orbital of the thymine dimer inducing a photon-less Auger transition, which restores the two thymines to the ground state, thereby detaching the lesion and repairing the DNA. Density functional theoretical calculations supporting the theory are presented. The mechanism involves the least amount of energy dissipation and is charge neutral. It also avoids radiation damage in the repair process. Recent experimental data are compatible with this theory.

  11. Direct Observation of Thymine Dimer Repair in DNA by Photolyase

    Science.gov (United States)

    Zhong, Dongping

    2006-03-01

    Departments of Physics, Chemistry, and Biochemistry, Programs of Biophysics, Chemical Physics, and Biochemistry, The Ohio State University, Columbus, 191 West Woodruff Avenue, OH 43210. Photolyase uses light energy to split ultraviolet-induced cyclobutane pyrimidine dimers in damaged DNA, but its molecular mechanism has never been directly revealed. We report here the direct mapping of catalytic processes through femtosecond synchronization of the enzymatic dynamics with the repair function. We observed direct electron transfer from the excited flavin cofactor to the dimer in 170 ps and back electron transfer from the repaired thymines in 560 ps. Both reactions are strongly modulated by active-site solvation to achieve maximum repair efficiency. These results show that the photocycle of DNA repair by photolyase is through a radical mechanism and completed on subnanosecond time scale at the dynamic active site with no net electron change in redox states of the flavin cofactor.

  12. Low molecular weight phenolics of grape juice and winemaking byproducts: antioxidant activities and inhibition of oxidation of human low-density lipoprotein cholesterol and DNA strand breakage.

    Science.gov (United States)

    de Camargo, Adriano Costa; Regitano-d'Arce, Marisa Aparecida Bismara; Biasoto, Aline Camarão Telles; Shahidi, Fereidoon

    2014-12-17

    Bioactive compounds belonging to phenolic acids, flavonoids, and proanthocyanidins of grape juice and winemaking byproducts were identified and quantified by HPLC-DAD-ESI-MS(n). The concentration of phenolic compounds in different grape cultivars was in the order Tempranillo > Cora > Syrah > Isabel. The insoluble-bound fraction was most prominent, contributing 63 and 79% to the total for Isabel and Tempranillo, respectively. Juice-processing byproducts had a higher content of free than esterified phenolics, but the opposite was noted for winemaking byproducts. Insoluble-bound phenolics were up to 15 and 10 times more effective as antioxidants than those of free and esterified fractions, respectively, as evaluated by the DPPH, ABTS, and H2O2 scavenging activities and reducing power determinations. In general, insoluble-bound phenolics (100 ppm) were more effective in inhibiting copper-induced human LDL-cholesterol oxidation than free and esterified phenolics, exhibiting equal or higher efficacy than catechin. Phenolic extracts from all fractions inhibited peroxyl radical-induced DNA strand breakage. These findings shed further light for future studies and industrial application of grape byproducts, which may focus not only on the soluble phenolics but also on the insoluble-bound fraction.

  13. Metabolism, Genomics, and DNA Repair in the Mouse Aging Liver

    Directory of Open Access Journals (Sweden)

    Michel Lebel

    2011-01-01

    Full Text Available The liver plays a pivotal role in the metabolism of nutrients, drugs, hormones, and metabolic waste products, thereby maintaining body homeostasis. The liver undergoes substantial changes in structure and function within old age. Such changes are associated with significant impairment of many hepatic metabolic and detoxification activities, with implications for systemic aging and age-related disease. It has become clear, using rodent models as biological tools, that genetic instability in the form of gross DNA rearrangements or point mutations accumulate in the liver with age. DNA lesions, such as oxidized bases or persistent breaks, increase with age and correlate well with the presence of senescent hepatocytes. The level of DNA damage and/or mutation can be affected by changes in carcinogen activation, decreased ability to repair DNA, or a combination of these factors. This paper covers some of the DNA repair pathways affecting liver homeostasis with age using rodents as model systems.

  14. Intrinsic mitochondrial DNA repair defects in Ataxia Telangiectasia.

    Science.gov (United States)

    Sharma, Nilesh K; Lebedeva, Maria; Thomas, Terace; Kovalenko, Olga A; Stumpf, Jeffrey D; Shadel, Gerald S; Santos, Janine H

    2014-01-01

    Ataxia Telangiectasia (A-T) is a progressive childhood disorder characterized most notably by cerebellar degeneration and predisposition to cancer. A-T is caused by mutations in the kinase ATM, a master regulator of the DNA double-strand break response. In addition to DNA-damage signaling defects, A-T cells display mitochondrial dysfunction that is thought to contribute to A-T pathogenesis. However, the molecular mechanism leading to mitochondrial dysfunction in A-T remains unclear. Here, we show that lack of ATM leads to reduced mitochondrial DNA (mtDNA) integrity and mitochondrial dysfunction, which are associated to defective mtDNA repair. While protein levels of mtDNA repair proteins are essentially normal, in the absence of ATM levels specifically of DNA ligase III (Lig3), the only DNA ligase working in mitochondria is reduced. The reduction of Lig3 is observed in different A-T patient cells, in brain and pre-B cells derived from ATM knockout mice as well as upon transient or stable knockdown of ATM. Furthermore, pharmacological inhibition of Lig3 in wild type cells phenocopies the mtDNA repair defects observed in A-T patient cells. As targeted deletion of LIG3 in the central nervous system causes debilitating ataxia in mice, reduced Lig3 protein levels and the consequent mtDNA repair defect may contribute to A-T neurodegeneration. A-T is thus the first disease characterized by diminished Lig3. Published by Elsevier B.V.

  15. Decreased repair of gamma damaged DNA in progeria

    Energy Technology Data Exchange (ETDEWEB)

    Rainbow, A.J.; Howes, M.

    1977-01-01

    A sensitive host-cell reactivation technique was used to examine the DNA repair ability of fibroblasts from two patients with classical progeria. Fibroblasts were infected with either non-irradiated or gamma-irradiated adenovirus type 2 and at 48 hrs after infection cells were examined for the presence of viral structural antigens using immunofluorescent staining. The production of viral structural antigens was considerably reduced in the progeria lines as compared to normal fibroblasts when gamma-irradiated virus was used, indicating a defect in the repair of gamma ray damaged DNA in the progeria cells.

  16. Cranial CT and MRI in diseases with DNA repair defects

    Energy Technology Data Exchange (ETDEWEB)

    Demaerel, P.; Kendall, B.E.; Kingsley, D. (Dept. of Neuroradiology, Hospital for Sick Children, London (United Kingdom))

    1992-04-01

    The CT and MRI appearances of 5 patients with Cockayne's syndrome, 5 with ataxia telangiectasia and 1 with Fanconi's anaemia are reported. These conditions, together with Bloom's syndrome and xeroderma pigmentosum are regarded as disorders of DNA repair. Characteristic CT and MRI features of Cockayne's syndrome include generalised atrophy, calcification in basal ganglia and dentate nuclei and white matter low density. Neuroradiological findings in the other DNA repair disorders are nonspecific. (orig.).

  17. How chromatin is remodelled during DNA repair of UV-induced DNA damage in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Shirong Yu

    2011-06-01

    Full Text Available Global genome nucleotide excision repair removes DNA damage from transcriptionally silent regions of the genome. Relatively little is known about the molecular events that initiate and regulate this process in the context of chromatin. We've shown that, in response to UV radiation-induced DNA damage, increased histone H3 acetylation at lysine 9 and 14 correlates with changes in chromatin structure, and these alterations are associated with efficient global genome nucleotide excision repair in yeast. These changes depend on the presence of the Rad16 protein. Remarkably, constitutive hyperacetylation of histone H3 can suppress the requirement for Rad7 and Rad16, two components of a global genome repair complex, during repair. This reveals the connection between histone H3 acetylation and DNA repair. Here, we investigate how chromatin structure is modified following UV irradiation to facilitate DNA repair in yeast. Using a combination of chromatin immunoprecipitation to measure histone acetylation levels, histone acetylase occupancy in chromatin, MNase digestion, or restriction enzyme endonuclease accessibility assays to analyse chromatin structure, and finally nucleotide excision repair assays to examine DNA repair, we demonstrate that global genome nucleotide excision repair drives UV-induced chromatin remodelling by controlling histone H3 acetylation levels in chromatin. The concerted action of the ATPase and C3HC4 RING domains of Rad16 combine to regulate the occupancy of the histone acetyl transferase Gcn5 on chromatin in response to UV damage. We conclude that the global genome repair complex in yeast regulates UV-induced histone H3 acetylation by controlling the accessibility of the histone acetyl transferase Gcn5 in chromatin. The resultant changes in histone H3 acetylation promote chromatin remodelling necessary for efficient repair of DNA damage. Recent evidence suggests that GCN5 plays a role in NER in human cells. Our work provides

  18. How chromatin is remodelled during DNA repair of UV-induced DNA damage in Saccharomyces cerevisiae.

    Science.gov (United States)

    Yu, Shirong; Teng, Yumin; Waters, Raymond; Reed, Simon H

    2011-06-01

    Global genome nucleotide excision repair removes DNA damage from transcriptionally silent regions of the genome. Relatively little is known about the molecular events that initiate and regulate this process in the context of chromatin. We've shown that, in response to UV radiation-induced DNA damage, increased histone H3 acetylation at lysine 9 and 14 correlates with changes in chromatin structure, and these alterations are associated with efficient global genome nucleotide excision repair in yeast. These changes depend on the presence of the Rad16 protein. Remarkably, constitutive hyperacetylation of histone H3 can suppress the requirement for Rad7 and Rad16, two components of a global genome repair complex, during repair. This reveals the connection between histone H3 acetylation and DNA repair. Here, we investigate how chromatin structure is modified following UV irradiation to facilitate DNA repair in yeast. Using a combination of chromatin immunoprecipitation to measure histone acetylation levels, histone acetylase occupancy in chromatin, MNase digestion, or restriction enzyme endonuclease accessibility assays to analyse chromatin structure, and finally nucleotide excision repair assays to examine DNA repair, we demonstrate that global genome nucleotide excision repair drives UV-induced chromatin remodelling by controlling histone H3 acetylation levels in chromatin. The concerted action of the ATPase and C3HC4 RING domains of Rad16 combine to regulate the occupancy of the histone acetyl transferase Gcn5 on chromatin in response to UV damage. We conclude that the global genome repair complex in yeast regulates UV-induced histone H3 acetylation by controlling the accessibility of the histone acetyl transferase Gcn5 in chromatin. The resultant changes in histone H3 acetylation promote chromatin remodelling necessary for efficient repair of DNA damage. Recent evidence suggests that GCN5 plays a role in NER in human cells. Our work provides important insight into

  19. Patients with systemic sclerosis present increased DNA damage differentially associated with DNA repair gene polymorphisms.

    Science.gov (United States)

    Palomino, Gustavo Martelli; Bassi, Carmen L; Wastowski, Isabela J; Xavier, Danilo J; Lucisano-Valim, Yara M; Crispim, Janaina C O; Rassi, Diane M; Marques-Neto, Joao F; Sakamoto-Hojo, Elza T; Moreau, Philippe; Sampaio-Barros, Percival D; Donadi, Eduardo A

    2014-03-01

    Patients with systemic sclerosis (SSc) exhibit increased toxicity when exposed to genotoxic agents. In our study, we evaluated DNA damage and polymorphic sites in 2 DNA repair genes (XRCC1 Arg399Gln and XRCC4 Ile401Thr) in patients with SSc. A total of 177 patients were studied for DNA repair gene polymorphisms. Fifty-six of them were also evaluated for DNA damage in peripheral blood cells using the comet assay. Compared to controls, the patients as a whole or stratified into major clinical variants (limited or diffuse skin involvement), irrespective of the underlying treatment schedule, exhibited increased DNA damage. XRCC1 (rs: 25487) and XRCC4 (rs: 28360135) allele and genotype frequencies observed in patients with SSc were not significantly different from those observed in controls; however, the XRCC1 Arg399Gln allele was associated with increased DNA damage only in healthy controls and the XRCC4 Ile401Thr allele was associated with increased DNA damage in both patients and controls. Further, the XRCC1 Arg399Gln allele was associated with the presence of antinuclear antibody and anticentromere antibody. No association was observed between these DNA repair gene polymorphic sites and clinical features of patients with SSc. These results corroborate the presence of genomic instability in SSc peripheral blood cells, as evaluated by increased DNA damage, and show that polymorphic sites of the XRCC1 and XRCC4 DNA repair genes may differentially influence DNA damage and the development of autoantibodies.

  20. DNA Repair Variants, Indoor Tanning and Risk of Melanoma

    Science.gov (United States)

    Torres, Salina M.; Luo, Li; Lilyquist, Jenna; Stidley, Christine A; Flores, Kristina; White, Kirsten A. M.; Erdei, Esther; Gonzales, Melissa; Paine, Susan; Vogel, Rachel Isaksson; Lazovich, DeAnn; Berwick, Marianne

    2013-01-01

    Summary Although ultraviolet radiation (UV) exposure from indoor tanning has been linked to an increased risk of melanoma, the role of DNA repair genes in this process is unknown. We evaluated the association of 92 single nucleotide polymorphisms (SNPs) in 20 DNA repair genes with the risk of melanoma and indoor tanning among 929 melanoma patients and 817 controls from the Minnesota Skin Health Study. Significant associations with melanoma risk were identified for SNPs in ERCC4, ERCC6, RFC1, XPC, MGMT, and FBRSL1 genes; with a cut-off of p<0.05. ERCC6 and FBRSL1 gene variants and haplotypes interacted with indoor tanning. However, none of the 92 SNPs tested met the correction criteria for multiple comparisons. This study, based on an a priori interest in investigating the role of DNA repair capacity using variants in base excision and nucleotide excision repair, identified several genes that may play a role in resolving UV-induced DNA damage. PMID:23659246

  1. Polymorphisms in human DNA repair genes and head and neck ...

    Indian Academy of Sciences (India)

    Sci. USA 97, 9886–9891. Viswanathan H. and Wilson J. A. 2004 Alcohol—the neglected factor in head and neck cancer. Clin. Otolaryngol. 29, 295–300. Vogel U., Hedayati M., Dybdahl M., Grossman L. and Nexo B. A.. 2001 Polymorphisms of the DNA repair gene XPD, correlations with risk of basal cell carcinoma revisited.

  2. Dynamic organization of transcription-coupled DNA repair

    NARCIS (Netherlands)

    V. van den Boom (Vincent)

    2003-01-01

    textabstractThe aim of the work described in this thesis is to gain more insight in the role of the Cockayne Syndrome A (GSA) and B (CSB) proteins in the process of transcriptioncoupled DNA repair and transcription. Using biochemical analysis and live cell studies we investigated the molecular

  3. Altered DNA repair, oxidative stress and antioxidant status in ...

    Indian Academy of Sciences (India)

    Coronary artery disease (CAD) is a multifactorial disease caused by the interplay of environmental risk factors with multiple predisposing genes. The present study was undertaken to evaluate the role of DNA repair efficiency and oxidative stress and antioxidant status in CAD patients. Malonaldehyde (MDA), which is an ...

  4. Defective DNA repair mechanisms in prostate cancer: impact of olaparib

    Directory of Open Access Journals (Sweden)

    De Felice F

    2017-03-01

    Full Text Available Francesca De Felice,1 Vincenzo Tombolini,1 Francesco Marampon,2 Angela Musella,3 Claudia Marchetti3 1Department of Radiotherapy, Policlinico Umberto I, “Sapienza” University of Rome, Rome, 2Department of Biotechnological and Applied Clinical Sciences, Laboratory of Radiobiology, University of L’Aquila, L’Aquila, 3Department of Gynecological and Obstetrical Sciences and Urological Sciences, “Sapienza” University of Rome, Rome, Italy Abstract: The field of prostate oncology has continued to change dramatically. It has truly become a field that is intensely linked to molecular genetic alterations, especially DNA-repair defects. Germline breast cancer 1 gene (BRCA1 and breast cancer 2 gene (BRCA2 mutations are implicated in the highest risk of prostate cancer (PC predisposition and aggressiveness. Poly adenosine diphosphate ribose polymerase (PARP proteins play a key role in DNA repair mechanisms and represent a valid target for new therapies. Olaparib is an oral PARP inhibitor that blocks DNA repair pathway and coupled with BRCA mutated-disease results in tumor cell death. In phase II clinical trials, including patients with advanced castration-resistant PC, olaparib seems to be efficacious and well tolerated. Waiting for randomized phase III trials, olaparib should be considered as a promising treatment option for PC. Keywords: prostate cancer, metastatic disease, castration resistant, BRCA, DNA-repair, PARP, olaparib

  5. Principles of ubiquitin and SUMO modifications in DNA repair

    NARCIS (Netherlands)

    Bergink, Steven; Jentsch, Stefan

    2009-01-01

    With the discovery in the late 1980s that the DNA-repair gene RAD6 encodes a ubiquitin-conjugating enzyme, it became clear that protein modification by ubiquitin conjugation has a much broader significance than had previously been assumed. Now, two decades later, ubiquitin and its cousin SUMO are

  6. Altered DNA repair, oxidative stress and antioxidant status in ...

    Indian Academy of Sciences (India)

    2013-03-13

    Mar 13, 2013 ... Coronary artery disease (CAD) is a multifactorial disease caused by the interplay of environmental risk factors with multiple predisposing genes. The present study was undertaken to evaluate the role of DNA repair efficiency and oxidative stress and antioxidant status in CAD patients. Malonaldehyde (MDA) ...

  7. Review: Clinical aspects of hereditary DNA Mismatch repair gene mutations

    NARCIS (Netherlands)

    Sijmons, Rolf H.; Hofstra, Robert M. W.

    Inherited mutations of the DNA Mismatch repair genes MLH1, MSH2, MSH6 and PMS2 can result in two hereditary tumor syndromes: the adult-onset autosomal dominant Lynch syndrome, previously referred to as Hereditary Non-Polyposis Colorectal Cancer (HNPCC) and the childhood-onset autosomal recessive

  8. Distribution of DNA repair-related ESTs in sugarcane

    Directory of Open Access Journals (Sweden)

    W.C. Lima

    2001-12-01

    Full Text Available DNA repair pathways are necessary to maintain the proper genomic stability and ensure the survival of the organism, protecting it against the damaging effects of endogenous and exogenous agents. In this work, we made an analysis of the expression patterns of DNA repair-related genes in sugarcane, by determining the EST (expressed sequence tags distribution in the different cDNA libraries of the SUCEST transcriptome project. Three different pathways - photoreactivation, base excision repair and nucleotide excision repair - were investigated by employing known DNA repair proteins as probes to identify homologous ESTs in sugarcane, by means of computer similarity search. The results showed that DNA repair genes may have differential expressions in tissues, depending on the pathway studied. These in silico data provide important clues on the potential variation of gene expression, to be confirmed by direct biochemical analysis.As vias de reparo de DNA são requeridas para manter a necessária estabilidade genômica e garantir a sobrevivência do organismo, frente aos efeitos deletérios causados por fatores endógenos e exógenos. Neste trabalho, realizamos a análise dos padrões de expressão dos genes de reparo de DNA encontrados na cana-de-açúcar, pela determinação da distribuição de ESTs nas diferentes bibliotecas de cDNA no projeto de transcriptoma SUCEST. Três vias de reparo - fotorreativação, reparo por excisão de bases e reparo por excisão de nucleotídeos - foram estudadas através do uso de proteínas de reparo como sondas para identificação de ESTs homólogos em cana-de-açúcar, com base na procura computacional de similaridade. Os resultados indicam que os genes de reparo de DNA possuem uma expressão diferencial nos tecidos, dependendo da via de reparo analisada. Esses dados in silico fornecem importantes indícios da expressão diferencial, a qual deve ser confirmada por análises bioquímicas diretas.

  9. Mismatch repair and nucleotide excision repair proteins cooperate in the recognition of DNA interstrand crosslinks

    Science.gov (United States)

    Zhao, Junhua; Jain, Aklank; Iyer, Ravi R.; Modrich, Paul L.; Vasquez, Karen M.

    2009-01-01

    DNA interstrand crosslinks (ICLs) are among the most cytotoxic types of DNA damage, thus ICL-inducing agents such as psoralen, are clinically useful chemotherapeutics. Psoralen-modified triplex-forming oligonucleotides (TFOs) have been used to target ICLs to specific genomic sites to increase the selectivity of these agents. However, how TFO-directed psoralen ICLs (Tdp-ICLs) are recognized and processed in human cells is unclear. Previously, we reported that two essential nucleotide excision repair (NER) protein complexes, XPA–RPA and XPC–RAD23B, recognized ICLs in vitro, and that cells deficient in the DNA mismatch repair (MMR) complex MutSβ were sensitive to psoralen ICLs. To further investigate the role of MutSβ in ICL repair and the potential interaction between proteins from the MMR and NER pathways on these lesions, we performed electrophoretic mobility-shift assays and chromatin immunoprecipitation analysis of MutSβ and NER proteins with Tdp-ICLs. We found that MutSβ bound to Tdp-ICLs with high affinity and specificity in vitro and in vivo, and that MutSβ interacted with XPA–RPA or XPC–RAD23B in recognizing Tdp-ICLs. These data suggest that proteins from the MMR and NER pathways interact in the recognition of ICLs, and provide a mechanistic link by which proteins from multiple repair pathways contribute to ICL repair. PMID:19468048

  10. CC3/TIP30 affects DNA damage repair

    Directory of Open Access Journals (Sweden)

    King Frank

    2010-04-01

    Full Text Available Abstract Background The pro-apoptotic protein CC3/TIP30 has an unusual cellular function as an inhibitor of nucleocytoplasmic transport. This function is likely to be activated under conditions of stress. A number of studies support the notion that CC3 acts as a tumor and metastasis suppressor in various types of cancer. The yeast homolog of CC3 is likely to be involved in responses to DNA damage. Here we examined the potential role of CC3 in regulation of cellular responses to genotoxic stress. Results We found that forced expression of CC3 in CC3-negative cells strongly delays the repair of UV-induced DNA damage. Exogenously introduced CC3 negatively affects expression levels of DDB2/XPE and p21CIP1, and inhibits induction of c-FOS after UV exposure. In addition, exogenous CC3 prevents the nuclear accumulation of P21CIP in response to UV. These changes in the levels/localization of relevant proteins resulting from the enforced expression of CC3 are likely to contribute to the observed delay in DNA damage repair. Silencing of CC3 in CC3-positive cells has a modest delaying effect on repair of the UV induced damage, but has a much more significant negative affect on the translesion DNA synthesis after UV exposure. This could be related to the higher expression levels and increased nuclear localization of p21CIP1 in cells where expression of CC3 is silenced. Expression of CC3 also inhibits repair of oxidative DNA damage and leads to a decrease in levels of nucleoredoxin, that could contribute to the reduced viability of CC3 expressing cells after oxidative insult. Conclusions Manipulation of the cellular levels of CC3 alters expression levels and/or subcellular localization of proteins that exhibit nucleocytoplasmic shuttling. This results in altered responses to genotoxic stress and adversely affects DNA damage repair by affecting the recruitment of adequate amounts of required proteins to proper cellular compartments. Excess of cellular CC3 has

  11. Critical comments on DNA breakage by mobile-phone electromagnetic fields [Diem et al., Mutat. Res. 583 (2005) 178-183].

    Science.gov (United States)

    Lerchl, Alexander; Wilhelm, Adalbert F X

    2010-03-29

    In a publication that appeared in 2005 (Diem et al., Mutat. Res. 583:178-183) [10] harmful effects (DNA breakage) were reported to occur in rat and human cells after exposure to mobile-phone electromagnetic fields. The extremely low standard deviations in this paper, and in another publication by the same group of authors, prompted Vijayalaxmi to write a critical comment [Mutat. Res. 603 (2006) 104-106] [16]. An investigation by the Medical University of Vienna (Austria) was initiated by a letter by the first author of the present paper, based on the data contained in the reply by the authors [Rüdiger et al., Mutat. Res. 603 (2006) 107-109] [17]. The University published three press releases, stating that "the data were not measured experimentally, but fabricated" and that the Mutation Research paper and another, published by the International Archives of Occupational and Environmental Health (IAOEH) in 2008, should be retracted. So far, neither of these papers has been retracted. Only a Letter of Concern by the Editors of IAOEH, and an Editorial by Mutation Research were published. Here we describe the statistical methods used to identify the evidence of data fabrication. The major point is the small variation in the reported data, which is below the theoretical lower limit derived from multinomial distributions and also lower than those derived from detailed simulations. Another reason for doubt was the highly significant non-equal distribution of last digits, a known hint towards data fabrication. In view of the results of the University's investigation and the evidence presented in this paper, the Diem et al. (2005) [10] publication should be retracted, with or without the authors' agreement. Copyright 2010 Elsevier B.V. All rights reserved.

  12. Roscovitine modulates DNA repair and senescence: implications for combination chemotherapy.

    Science.gov (United States)

    Crescenzi, Elvira; Palumbo, Giuseppe; Brady, Hugh J M

    2005-11-15

    Treatment of tumor cells by chemotherapy activates a series of responses ranging from apoptosis to premature senescence and repair. Survival responses are characterized by inhibition of cyclin-dependent kinases. Because inhibition of cyclin-dependent kinases represents a distinctive feature of DNA damage-induced prosurvival responses, we investigated the possibility that the cyclin-dependent kinase inhibitor roscovitine modulates drug-induced responses in human adenocarcinoma cells, favoring cell survival. Sublethal concentrations of doxorubicin were used to induce premature senescence in human adenocarcinoma cells. The effect of the cyclin-dependent kinase inhibitor roscovitine on the doxorubicin-dependent cell cycle checkpoint activation and DNA repair pathways was evaluated. Roscovitine reinforces doxorubicin-dependent G(1) checkpoint in A549 and HEC1B cells leading to decreased frequency of double-strand breaks and to the preferential induction of senescence and enhanced clonogenic survival. However, in other tumor cell lines, such as HCT116 and H1299, combined treatment with doxorubicin and roscovitine increases the frequency of double-strand breaks and dramatically sensitizes to doxorubicin. This unexpected effect of roscovitine depends on a novel ability to inhibit DNA double-strand break repair processes and requires inactivation of the pRb pathway. Roscovitine, by hindering DNA repair processes, has the potential to inhibit recovery of mildly damaged tumor cells after doxorubicin treatment and to increase the susceptibility of tumor cells to chemotherapy. However, in some tumor cells, the cell cycle inhibitory function of roscovitine prevails over the DNA repair inhibitory activity, favoring premature senescence and clonogenic growth. These data indicate a novel mechanism underlying combined chemotherapy, which may have wide application in treatment of carcinomas.

  13. DNA ligase I selectively affects DNA synthesis by DNA polymerases delta and epsilon suggesting differential functions in DNA replication and repair.

    OpenAIRE

    Mossi, R; Ferrari, E; Hübscher, U

    1998-01-01

    The joining of single-stranded breaks in double-stranded DNA is an essential step in many important processes such as DNA replication, DNA repair, and genetic recombination. Several data implicate a role for DNA ligase I in DNA replication, probably coordinated by the action of other enzymes and proteins. Since both DNA polymerases delta and epsilon show multiple functions in different DNA transactions, we investigated the effect of DNA ligase I on various DNA synthesis events catalyzed by th...

  14. Chemical carcinogenesis — the price for DNA-repair?

    Science.gov (United States)

    Wintersberger, Ulrike

    1982-03-01

    This essay examines the possibility of merging the mutation theory of cancer with the hypothesis that cancer is a change in the state of the differentiation of cells. It is suggested that during normal development DNA rearrangements occur, concerning genes which code for differentiation specific cell communication proteins. These proteins are responsible for the proper functioning of growth control in a multicellular organism. DNA-damaging agents — mutagens — induce DNA repair enzymes, some of which may catalyse illegitimate genome rearrangements, thus leading to a change of the balance between growth and differentiation. A cell with a selective advantage may arise and become the origin of a tumor.

  15. Hypomorphic PCNA mutation underlies a human DNA repair disorder.

    Science.gov (United States)

    Baple, Emma L; Chambers, Helen; Cross, Harold E; Fawcett, Heather; Nakazawa, Yuka; Chioza, Barry A; Harlalka, Gaurav V; Mansour, Sahar; Sreekantan-Nair, Ajith; Patton, Michael A; Muggenthaler, Martina; Rich, Phillip; Wagner, Karin; Coblentz, Roselyn; Stein, Constance K; Last, James I; Taylor, A Malcolm R; Jackson, Andrew P; Ogi, Tomoo; Lehmann, Alan R; Green, Catherine M; Crosby, Andrew H

    2014-07-01

    Numerous human disorders, including Cockayne syndrome, UV-sensitive syndrome, xeroderma pigmentosum, and trichothiodystrophy, result from the mutation of genes encoding molecules important for nucleotide excision repair. Here, we describe a syndrome in which the cardinal clinical features include short stature, hearing loss, premature aging, telangiectasia, neurodegeneration, and photosensitivity, resulting from a homozygous missense (p.Ser228Ile) sequence alteration of the proliferating cell nuclear antigen (PCNA). PCNA is a highly conserved sliding clamp protein essential for DNA replication and repair. Due to this fundamental role, mutations in PCNA that profoundly impair protein function would be incompatible with life. Interestingly, while the p.Ser228Ile alteration appeared to have no effect on protein levels or DNA replication, patient cells exhibited marked abnormalities in response to UV irradiation, displaying substantial reductions in both UV survival and RNA synthesis recovery. The p.Ser228Ile change also profoundly altered PCNA's interaction with Flap endonuclease 1 and DNA Ligase 1, DNA metabolism enzymes. Together, our findings detail a mutation of PCNA in humans associated with a neurodegenerative phenotype, displaying clinical and molecular features common to other DNA repair disorders, which we showed to be attributable to a hypomorphic amino acid alteration.

  16. DNA mismatch repair and its many roles in eukaryotic cells

    DEFF Research Database (Denmark)

    Liu, Dekang; Keijzers, Guido; Rasmussen, Lene Juel

    2017-01-01

    in the clinic, and as a biomarker of cancer susceptibility in animal model systems. Prokaryotic MMR is well-characterized at the molecular and mechanistic level; however, MMR is considerably more complex in eukaryotic cells than in prokaryotic cells, and in recent years, it has become evident that MMR plays......DNA mismatch repair (MMR) is an important DNA repair pathway that plays critical roles in DNA replication fidelity, mutation avoidance and genome stability, all of which contribute significantly to the viability of cells and organisms. MMR is widely-used as a diagnostic biomarker for human cancers...... novel roles in eukaryotic cells, several of which are not yet well-defined or understood. Many MMR-deficient human cancer cells lack mutations in known human MMR genes, which strongly suggests that essential eukaryotic MMR components/cofactors remain unidentified and uncharacterized. Furthermore...

  17. Cycling with BRCA2 from DNA repair to mitosis

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Hyunsook, E-mail: HL212@snu.ac.kr

    2014-11-15

    Genetic integrity in proliferating cells is guaranteed by the harmony of DNA replication, appropriate DNA repair, and segregation of the duplicated genome. Breast cancer susceptibility gene BRCA2 is a unique tumor suppressor that is involved in all three processes. Hence, it is critical in genome maintenance. The functions of BRCA2 in DNA repair and homology-directed recombination (HDR) have been reviewed numerous times. Here, I will briefly go through the functions of BRCA2 in HDR and focus on the emerging roles of BRCA2 in telomere homeostasis and mitosis, then discuss how BRCA2 exerts distinct functions in a cell-cycle specific manner in the maintenance of genomic integrity. - Highlights: • BRCA2 is a multifaceted tumor suppressor and is crucial in genetic integrity. • BRCA2 exerts distinct functions in cell cycle-specific manner. • Mitotic kinases regulate diverse functions of BRCA2 in mitosis and cytokinesis.

  18. Genetic variations in DNA repair genes, radiosensitivity to cancer and susceptibility to acute tissue reactions in radiotherapy-treated cancer patients

    Energy Technology Data Exchange (ETDEWEB)

    Chistiakov, Dimitry A. (Dept. of Pathology, Univ. of Pittsburgh, Pittsburgh (US)); Voronova, Natalia V. (Dept. of Molecular Diagnostics, National Research Center GosNIIgenetika, Moscow (RU)); Chistiakov, Pavel A. (Dept. of Radiology, Cancer Research Center, Moscow (RU))

    2008-06-15

    Ionizing radiation is a well established carcinogen for human cells. At low doses, radiation exposure mainly results in generation of double strand breaks (DSBs). Radiation-related DSBs could be directly linked to the formation of chromosomal rearrangements as has been proven for radiation-induced thyroid tumors. Repair of DSBs presumably involves two main pathways, non-homologous end joining (NHEJ) and homologous recombination (HR). A number of known inherited syndromes, such as ataxia telangiectasia, ataxia-telangiectasia like-disorder, radiosensitive severe combined immunodeficiency, Nijmegen breakage syndrome, and LIG4 deficiency are associated with increased radiosensitivity and/or cancer risk. Many of them are caused by mutations in DNA repair genes. Recent studies also suggest that variations in the DNA repair capacity in the general population may influence cancer susceptibility. In this paper, we summarize the current status of DNA repair proteins as potential targets for radiation-induced cancer risk. We will focus on genetic alterations in genes involved in HR- and NHEJ-mediated repair of DSBs, which could influence predisposition to radiation-related cancer and thereby explain interindividual differences in radiosensitivity or radioresistance in a general population

  19. Molecular Understanding of Efficient DNA Repair Machinery of Photolyase

    Science.gov (United States)

    Tan, Chuang; Liu, Zheyun; Li, Jiang; Guo, Xunmin; Wang, Lijuan; Zhong, Dongping

    2012-06-01

    Photolyases repair the UV-induced pyrimidine dimers in damage DNA with high efficiency, through a cylic light-driven electron transfer radical mechanism. We report here our systematic studies of the repair dynamics in E. coli photolyase with mutation of five active-site residues. The significant loss of repair efficiency by the mutation indicates that those active-site residues play an important role in the DNA repair by photolyase. To understand how the active-site residues modulate the efficiency, we mapped out the entire evolution of each elementary step during the repair in those photolyase mutants with femtosecond resolution. We completely analyzed the electron transfer dynamics using the Sumi-Marcus model. The results suggest that photolyase controls the critical electron transfer and the ring-splitting of pyrimidine dimer through modulation of the redox potentials and reorganization energies, and stabilization of the anionic intermediates, maintaining the dedicated balance of all the reaction steps and achieving the maximum function activity.

  20. Breaking bad: The mutagenic effect of DNA repair

    Science.gov (United States)

    2015-01-01

    Species survival depends on the faithful replication of genetic information, which is continually monitored and maintained by DNA repair pathways thatcorrect replication errors and the thousands of lesions that arise daily from the inherent chemical lability of DNA and the effects of genotoxic agents. Nonetheless,neutrally evolving DNA (not under purifying selection) accumulates base substitutions with time (the neutral mutation rate). Thus, repair processes are not 100% efficient. The neutral mutation rate varies both between and within chromosomes. For example it is 10 – 50 fold higher at CpGsthan at non-CpG positions. Interestingly, the neutral mutation rate at non-CpG sites is positively correlated with CpG content. Althoughthe basis of this correlation was not immediately apparent,some bioinformatic results were consistent with the induction of non-CpGmutations byDNA repairat flanking CpG sites. Recent studies with a model system showed that in vivo repair of preformed lesions (mismatches, abasic sites, single stranded nicks) can in factinduce mutations in flanking DNA. Mismatch repair (MMR) is an essential component for repair-induced mutations, which can occur as distant as 5 kb from the introduced lesions. Most, but not all, mutations involved the C of TpCpN (G of NpGpA) which is the target sequence of the C-preferringsingle-stranded DNA specific APOBEC deaminases. APOBEC-mediated mutations are not limited to our model system: Recent studies by others showed that some tumors harbor mutations with the same signature, as can intermediates in RNA-guided endonuclease-mediated genome editing. APOBEC deaminases participate in normal physiological functions such as generating mutations that inactivate viruses or endogenous retrotransposons, or that enhance immunoglobulin diversity in B cells. The recruitment of normally physiological errorprone processes during DNA repairwould have important implications for disease, aging and evolution. This perspective briefly

  1. Aspects of DNA repair and nucleotide pool imbalance

    Energy Technology Data Exchange (ETDEWEB)

    Holliday, R.

    1985-01-01

    Evidence that optimum repair depends on adequate pools of deoxynucleotide triphosphates (dNTPs) comes from the study of pyrimidine auxotrophs of Ustilago maydis. These strains are sensitive to UV light and X-rays, and for pyr1-1 it has been shown that the intracellular concentration of dTTP is reduced about 7-fold. The survival curve of pyr1-1 after UV-treatment, and split dose experiments with wild-type cells, provide evidence for an inducible repair mechanism, which probably depends on genetic recombination. Although inducible repair saves cellular resources, it has the disadvantage of becoming ineffective at doses which are high enough to inactivate the repressed structural gene(s) for repair enzymes. It is clear that a wide variety of repair mechanisms have evolved to remove lesions which arise either spontaneously or as a result of damage from external agents. Nevertheless, it would be incorrect to assume that all species require all possible pathways of repair. It is now well established that the accuracy of DNA and protein synthesis depends on proof-reading or editing mechanisms. Optimum accuracy levels will evolve from the balance between error avoidance in macromolecular synthesis and physiological efficiency in growth and propagation.

  2. DNA repair in neurons: So if they don't divide what's to repair?

    Energy Technology Data Exchange (ETDEWEB)

    Fishel, Melissa L. [Department of Pediatrics (Section of Hematology/Oncology), Herman B Wells Center for Pediatric Research, Indiana University School of Medicine, 1044 W. Walnut, Room 302C, Indianapolis, IN 46202 (United States); Vasko, Michael R. [Department of Pharmacology and Toxicology, Indiana University School of Medicine, 1044 W. Walnut St., Indianapolis, IN 46202 (United States); Kelley, Mark R. [Department of Pediatrics (Section of Hematology/Oncology), Herman B Wells Center for Pediatric Research, Indiana University School of Medicine, 1044 W. Walnut, Room 302C, Indianapolis, IN 46202 (United States) and Department of Pharmacology and Toxicology, Indiana University School of Medicine, 1044 W. Walnut St., Indianapolis, IN 46202 (United States) and Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, 1044 W. Walnut, Room 302C, Indianapolis, IN 46202 (United States)]. E-mail: mkelley@iupui.edu

    2007-01-03

    Neuronal DNA repair remains one of the most exciting areas for investigation, particularly as a means to compare the DNA repair response in mitotic (cancer) vs. post-mitotic (neuronal) cells. In addition, the role of DNA repair in neuronal cell survival and response to aging and environmental insults is of particular interest. DNA damage caused by reactive oxygen species (ROS) such as generated by mitochondrial respiration includes altered bases, abasic sites, and single- and double-strand breaks which can be prevented by the DNA base excision repair (BER) pathway. Oxidative stress accumulates in the DNA of the human brain over time especially in the mitochondrial DNA (mtDNA) and is proposed to play a critical role in aging and in the pathogenesis of several neurological disorders including Parkinson's disease, ALS, and Alzheimer's diseases. Because DNA damage accumulates in the mtDNA more than nuclear DNA, there is increased interest in DNA repair pathways and the consequence of DNA damage in the mitochondria of neurons. The type of damage that is most likely to occur in neuronal cells is oxidative DNA damage which is primarily removed by the BER pathway. Following the notion that the bulk of neuronal DNA damage is acquired by oxidative DNA damage and ROS, the BER pathway is a likely area of focus for neuronal studies of DNA repair. BER variations in brain aging and pathology in various brain regions and tissues are presented. Therefore, the BER pathway is discussed in greater detail in this review than other repair pathways. Other repair pathways including direct reversal, nucleotide excision repair (NER), mismatch repair (MMR), homologous recombination and non-homologous end joining are also discussed. Finally, there is a growing interest in the role that DNA repair pathways play in the clinical arena as they relate to the neurotoxicity and neuropathy associated with cancer treatments. Among the numerous side effects of cancer treatments, major

  3. Low-Dose Formaldehyde Delays DNA Damage Recognition and DNA Excision Repair in Human Cells

    Science.gov (United States)

    Luch, Andreas; Frey, Flurina C. Clement; Meier, Regula; Fei, Jia; Naegeli, Hanspeter

    2014-01-01

    Objective Formaldehyde is still widely employed as a universal crosslinking agent, preservative and disinfectant, despite its proven carcinogenicity in occupationally exposed workers. Therefore, it is of paramount importance to understand the possible impact of low-dose formaldehyde exposures in the general population. Due to the concomitant occurrence of multiple indoor and outdoor toxicants, we tested how formaldehyde, at micromolar concentrations, interferes with general DNA damage recognition and excision processes that remove some of the most frequently inflicted DNA lesions. Methodology/Principal Findings The overall mobility of the DNA damage sensors UV-DDB (ultraviolet-damaged DNA-binding) and XPC (xeroderma pigmentosum group C) was analyzed by assessing real-time protein dynamics in the nucleus of cultured human cells exposed to non-cytotoxic (formaldehyde concentrations. The DNA lesion-specific recruitment of these damage sensors was tested by monitoring their accumulation at local irradiation spots. DNA repair activity was determined in host-cell reactivation assays and, more directly, by measuring the excision of DNA lesions from chromosomes. Taken together, these assays demonstrated that formaldehyde obstructs the rapid nuclear trafficking of DNA damage sensors and, consequently, slows down their relocation to DNA damage sites thus delaying the excision repair of target lesions. A concentration-dependent effect relationship established a threshold concentration of as low as 25 micromolar for the inhibition of DNA excision repair. Conclusions/Significance A main implication of the retarded repair activity is that low-dose formaldehyde may exert an adjuvant role in carcinogenesis by impeding the excision of multiple mutagenic base lesions. In view of this generally disruptive effect on DNA repair, we propose that formaldehyde exposures in the general population should be further decreased to help reducing cancer risks. PMID:24722772

  4. Srs2: the "Odd-Job Man" in DNA repair.

    Science.gov (United States)

    Marini, Victoria; Krejci, Lumir

    2010-03-02

    Homologous recombination plays a key role in the maintenance of genome integrity, especially during DNA replication and the repair of double-stranded DNA breaks (DSBs). Just a single un-repaired break can lead to aneuploidy, genetic aberrations or cell death. DSBs are caused by a vast number of both endogenous and exogenous agents including genotoxic chemicals or ionizing radiation, as well as through replication of a damaged template DNA or the replication fork collapse. It is essential for cell survival to recognise and process DSBs as well as other toxic intermediates and launch most appropriate repair mechanism. Many helicases have been implicated to play role in these processes, however their detail roles, specificities and co-operativity in the complex protein-protein interaction networks remain unclear. In this review we summarize the current knowledge about Saccharomyces cerevisiae helicase Srs2 and its effect on multiple DNA metabolic processes that generally affect genome stability. It would appear that Srs2 functions as an "Odd-Job Man" in these processes to make sure that the jobs proceed when and where they are needed. (c) 2010 Elsevier B.V. All rights reserved.

  5. Induction of a mutant phenotype in human repair proficient cells after overexpression of a mutated human DNA repair gene.

    NARCIS (Netherlands)

    P.B.G.M. Belt; M.F. van Oostenrijk; H. Odijk (Hanny); J.H.J. Hoeijmakers (Jan); C.M.P. Backendorf (Claude)

    1991-01-01

    textabstractAntisense and mutated cDNA of the human excision repair gene ERCC-1 were overexpressed in repair efficient HeLa cells by means of an Epstein-Barr-virus derived CDNA expression vector. Whereas antisense RNA did not influence the survival of the transfected cells, a mutated cDNA generating

  6. The nucleosome: orchestrating DNA damage signaling and repair within chromatin.

    Science.gov (United States)

    Agarwal, Poonam; Miller, Kyle M

    2016-10-01

    DNA damage occurs within the chromatin environment, which ultimately participates in regulating DNA damage response (DDR) pathways and repair of the lesion. DNA damage activates a cascade of signaling events that extensively modulates chromatin structure and organization to coordinate DDR factor recruitment to the break and repair, whilst also promoting the maintenance of normal chromatin functions within the damaged region. For example, DDR pathways must avoid conflicts between other DNA-based processes that function within the context of chromatin, including transcription and replication. The molecular mechanisms governing the recognition, target specificity, and recruitment of DDR factors and enzymes to the fundamental repeating unit of chromatin, i.e., the nucleosome, are poorly understood. Here we present our current view of how chromatin recognition by DDR factors is achieved at the level of the nucleosome. Emerging evidence suggests that the nucleosome surface, including the nucleosome acidic patch, promotes the binding and activity of several DNA damage factors on chromatin. Thus, in addition to interactions with damaged DNA and histone modifications, nucleosome recognition by DDR factors plays a key role in orchestrating the requisite chromatin response to maintain both genome and epigenome integrity.

  7. Inserting Extrahelical Structures into Long DNA Substrates for Single-Molecule Studies of DNA Mismatch Repair.

    Science.gov (United States)

    Brown, M W; de la Torre, A; Finkelstein, I J

    2017-01-01

    The DNA mismatch repair (MMR) system corrects errors that occur during DNA replication. MMR needs the coordinated and highly dynamic assembly of repair enzymes at the site of the lesion. By visualizing transient intermediates of these assemblies, single-molecule approaches have shed critical insights into the mechanisms of MMR. These studies frequently require long (>20kb) DNA substrates with lesions and other extrahelical structures inserted at defined positions. DNA derived from bacteriophage λ (λ-DNA) is a high quality long (48.5kb) DNA substrate that is frequently used in single-molecule studies. Here we provide detailed protocols for site-specific incorporation of recombinant sequences and extrahelical structures into λ-DNA. We also describe how to assemble DNA curtains, and how to collect and analyze single-molecule observations of lesion recognition by MMR proteins diffusing on these DNA curtains. These protocols will facilitate future single-molecule studies of DNA transcription, replication, and repair. © 2017 Elsevier Inc. All rights reserved.

  8. NIJMEGEN BREAKAGE SYNDROME

    Directory of Open Access Journals (Sweden)

    M. Y. Kagan

    2012-01-01

    Full Text Available Nijmegen breakage syndrome (NBS is a rare autosomal recessive syndrome of chromosomal instability mainly characterized by microcephaly at birth, dysmorphic facial features, combined immunodeficiency and predisposition to malignancies. Due to a founder mutation in the underlying NBN gene (c.657_661del5 the disease is encountered most frequently among Slavic populations. We report on a patient with NBS complicated acute leukemia.

  9. True Lies: The Double Life of the Nucleotide Excision Repair Factors in Transcription and DNA Repair

    Directory of Open Access Journals (Sweden)

    Nicolas Le May

    2010-01-01

    Full Text Available Nucleotide excision repair (NER is a major DNA repair pathway in eukaryotic cells. NER removes structurally diverse lesions such as pyrimidine dimers, arising upon UV irradiation or bulky chemical adducts, arising upon exposure to carcinogens and some chemotherapeutic drugs. NER defects lead to three genetic disorders that result in predisposition to cancers, accelerated aging, neurological and developmental defects. During NER, more than 30 polypeptides cooperate to recognize, incise, and excise a damaged oligonucleotide from the genomic DNA. Recent papers reveal an additional and unexpected role for the NER factors. In the absence of a genotoxic attack, the promoters of RNA polymerases I- and II-dependent genes recruit XPA, XPC, XPG, and XPF to initiate gene expression. A model that includes the growth arrest and DNA damage 45α protein (Gadd45α and the NER factors, in order to maintain the promoter of active genes under a hypomethylated state, has been proposed but remains controversial. This paper focuses on the double life of the NER factors in DNA repair and transcription and describes the possible roles of these factors in the RNA synthesis process.

  10. The Cartography of UV-induced DNA Damage Formation and DNA Repair.

    Science.gov (United States)

    Hu, Jinchuan; Adar, Sheera

    2017-01-01

    DNA damage presents a barrier to DNA-templated biochemical processes, including gene expression and faithful DNA replication. Compromised DNA repair leads to mutations, enhancing the risk for genetic diseases and cancer development. Conventional experimental approaches to study DNA damage required a researcher to choose between measuring bulk damage over the entire genome, with little or no resolution regarding a specific location, and obtaining data specific to a locus of interest, without a global perspective. Recent advances in high-throughput genomic tools overcame these limitations and provide high-resolution measurements simultaneously across the genome. In this review, we discuss the available methods for measuring DNA damage and their repair, focusing on genomewide assays for pyrimidine photodimers, the major types of damage induced by ultraviolet irradiation. These new genomic assays will be a powerful tool in identifying key components of genome stability and carcinogenesis. © 2016 The American Society of Photobiology.

  11. DNA damage response and cancer therapeutics through the lens of the Fanconi Anemia DNA repair pathway.

    Science.gov (United States)

    Bhattacharjee, Sonali; Nandi, Saikat

    2017-10-10

    Fanconi Anemia (FA) is a rare, inherited genomic instability disorder, caused by mutations in genes involved in the repair of interstrand DNA crosslinks (ICLs). The FA signaling network contains a unique nuclear protein complex that mediates the monoubiquitylation of the FANCD2 and FANCI heterodimer, and coordinates activities of the downstream DNA repair pathway including nucleotide excision repair, translesion synthesis, and homologous recombination. FA proteins act at different steps of ICL repair in sensing, recognition and processing of DNA lesions. The multi-protein network is tightly regulated by complex mechanisms, such as ubiquitination, phosphorylation, and degradation signals that are critical for the maintenance of genome integrity and suppressing tumorigenesis. Here, we discuss recent advances in our understanding of how the FA proteins participate in ICL repair and regulation of the FA signaling network that assures the safeguard of the genome. We further discuss the potential application of designing small molecule inhibitors that inhibit the FA pathway and are synthetic lethal with DNA repair enzymes that can be used for cancer therapeutics.

  12. Effect of gadolinium-based nanoparticles on nuclear DNA damage and repair in glioblastoma tumor cells.

    Science.gov (United States)

    Štefančíková, Lenka; Lacombe, Sandrine; Salado, Daniela; Porcel, Erika; Pagáčová, Eva; Tillement, Olivier; Lux, François; Depeš, Daniel; Kozubek, Stanislav; Falk, Martin

    2016-07-28

    Tumor targeting of radiotherapy represents a great challenge. The addition of multimodal nanoparticles, such as 3 nm gadolinium-based nanoparticles (GdBNs), has been proposed as a promising strategy to amplify the effects of radiation in tumors and improve diagnostics using the same agents. This singular property named theranostic is a unique advantage of GdBNs. It has been established that the amplification of radiation effects by GdBNs appears due to fast electronic processes. However, the influence of these nanoparticles on cells is not yet understood. In particular, it remains dubious how nanoparticles activated by ionizing radiation interact with cells and their constituents. A crucial question remains open of whether damage to the nucleus is necessary for the radiosensitization exerted by GdBNs (and other nanoparticles). We studied the effect of GdBNs on the induction and repair of DNA double-strand breaks (DSBs) in the nuclear DNA of U87 tumor cells irradiated with γ-rays. For this purpose, we used currently the most sensitive method of DSBs detection based on high-resolution confocal fluorescence microscopy coupled with immunodetection of two independent DSBs markers. We show that, in the conditions where GdBNs amplify radiation effects, they remain localized in the cytoplasm, i.e. do not penetrate into the nucleus. In addition, the presence of GdBNs in the cytoplasm neither increases induction of DSBs by γ-rays in the nuclear DNA nor affects their consequent repair. Our results suggest that the radiosensitization mediated by GdBNs is a cytoplasmic event that is independent of the nuclear DNA breakage, a phenomenon commonly accepted as the explanation of biological radiation effects. Considering our earlier recognized colocalization of GdBNs with the lysosomes and endosomes, we revolutionary hypothesize here about these organelles as potential targets for (some) nanoparticles. If confirmed, this finding of cytoplasmically determined radiosensitization

  13. DNA repair activity in fish and interest in ecotoxicology: a review.

    Science.gov (United States)

    Kienzler, Aude; Bony, Sylvie; Devaux, Alain

    2013-06-15

    The knowledge of DNA repair in a target species is of first importance as it is the primary line of defense against genotoxicants, and a better knowledge of DNA repair capacity in fish could help to interpret genotoxicity data and/or assist in the choice of target species, developmental stage and tissues to focus on, both for environmental biomonitoring studies and DNA repair testing. This review focuses in a first part on what is presently known on a mechanistic basis, about the various DNA repair systems in fish, in vivo and in established cell lines. Data on base excision repair (BER), direct reversal with O⁶-alkylguanine transferase and double strand breaks repair, although rather scarce, are being reviewed, as well as nucleotide excision repair (NER) and photoreactivation repair (PER), which are by far the most studied repair mechanisms in fish. Most of these repair mechanisms seem to be strongly species and tissue dependent; they also depend on the developmental stage of the organisms. BER is efficient in vivo, although no data has been found on in vitro models. NER activity is quite low or even inexistent depending on the studies; however this lack is partly compensated by a strong PER activity, especially in early developmental stage. In a second part, a survey of the ecotoxicological studies integrating DNA repair as a parameter responding to single or mixture of contaminant is realized. Three main approaches are being used: the measurement of DNA repair gene expression after exposure, although it has not yet been clearly established whether gene expression is indicative of repair capacity; the monitoring of DNA damage removal by following DNA repair kinetics; and the modulation of DNA repair activity following exposure in situ, in order to assess the impact of exposure history on DNA repair capacity. Since all DNA repair processes are possible targets for environmental pollutants, we can also wonder at which extent such a modulation of repair capacities

  14. DNA Repair Decline During Mouse Spermiogenesis Results in the Accumulation of Heritable DNA Damage

    Energy Technology Data Exchange (ETDEWEB)

    Marchetti, Francesco; Marchetti, Francesco; Wyrobek, Andrew J.

    2007-12-01

    The post-meiotic phase of mouse spermatogenesis (spermiogenesis) is very sensitive to the genomic effects of environmental mutagens because as male germ cells form mature sperm they progressively lose the ability to repair DNA damage. We hypothesized that repeated exposures to mutagens during this repair-deficient phase result in the accumulation of heritable genomic damage in mouse sperm that leads to chromosomal aberrations in zygotes after fertilization. We used a combination of single or fractionated exposures to diepoxybutane (DEB), a component of tobacco smoke, to investigate how differential DNA repair efficiencies during the three weeks of spermiogenesis affected the accumulation of DEB-induced heritable damage in early spermatids (21-15 days before fertilization, dbf), late spermatids (14-8 dbf) and sperm (7-1 dbf). Analysis of chromosomal aberrations in zygotic metaphases using PAINT/DAPI showed that late spermatids and sperm are unable to repair DEB-induced DNA damage as demonstrated by significant increases (P<0.001) in the frequencies of zygotes with chromosomal aberrations. Comparisons between single and fractionated exposures suggested that the DNA repair-deficient window during late spermiogenesis may be less than two weeks in the mouse and that during this repair-deficient window there is accumulation of DNA damage in sperm. Finally, the dose-response study in sperm indicated a linear response for both single and repeated exposures. These findings show that the differential DNA repair capacity of post-meioitic male germ cells has a major impact on the risk of paternally transmitted heritable damage and suggest that chronic exposures that may occur in the weeks prior to fertilization because of occupational or lifestyle factors (i.e, smoking) can lead to an accumulation of genetic damage in sperm and result in heritable chromosomal aberrations of paternal origin.

  15. DNA repair decline during mouse spermiogenesis results in the accumulation of heritable DNA damage

    Energy Technology Data Exchange (ETDEWEB)

    Marchetti, Francesco; Marchetti, Francesco; Wryobek, Andrew J

    2008-02-21

    The post-meiotic phase of mouse spermatogenesis (spermiogenesis) is very sensitive to the genomic effects of environmental mutagens because as male germ cells form mature sperm they progressively lose the ability to repair DNA damage. We hypothesized that repeated exposures to mutagens during this repair-deficient phase result in the accumulation of heritable genomic damage in mouse sperm that leads to chromosomal aberrations in zygotes after fertilization. We used a combination of single or fractionated exposures to diepoxybutane (DEB), a component of tobacco smoke, to investigate how differential DNA repair efficiencies during the three weeks of spermiogenesis affected the accumulation of DEB-induced heritable damage in early spermatids (21-15 days before fertilization, dbf), late spermatids (14-8 dbf) and sperm (7- 1 dbf). Analysis of chromosomalaberrations in zygotic metaphases using PAINT/DAPI showed that late spermatids and sperm are unable to repair DEB-induced DNA damage as demonstrated by significant increases (P<0.001) in the frequencies of zygotes with chromosomal aberrations. Comparisons between single and fractionated exposures suggested that the DNA repair-deficient window during late spermiogenesis may be less than two weeks in the mouse and that during this repair-deficient window there is accumulation of DNA damage in sperm. Finally, the dose-response study in sperm indicated a linear response for both single and repeated exposures. These findings show that the differential DNA repair capacity of post-meioitic male germ cells has a major impact on the risk of paternally transmitted heritable damage and suggest that chronic exposures that may occur in the weeks prior to fertilization because of occupational or lifestyle factors (i.e, smoking) can lead to an accumulation of genetic damage in sperm and result in heritable chromosomal aberrations of paternal origin.

  16. Metabolism, genomics, and DNA repair in the mouse aging liver

    DEFF Research Database (Denmark)

    Lebel, Michel; de Souza-Pinto, Nadja C; Bohr, Vilhelm A

    2011-01-01

    The liver plays a pivotal role in the metabolism of nutrients, drugs, hormones, and metabolic waste products, thereby maintaining body homeostasis. The liver undergoes substantial changes in structure and function within old age. Such changes are associated with significant impairment of many......, such as oxidized bases or persistent breaks, increase with age and correlate well with the presence of senescent hepatocytes. The level of DNA damage and/or mutation can be affected by changes in carcinogen activation, decreased ability to repair DNA, or a combination of these factors. This paper covers some...... hepatic metabolic and detoxification activities, with implications for systemic aging and age-related disease. It has become clear, using rodent models as biological tools, that genetic instability in the form of gross DNA rearrangements or point mutations accumulate in the liver with age. DNA lesions...

  17. Bi-directional routing of DNA mismatch repair protein human exonuclease 1 to replication foci and DNA double strand breaks

    DEFF Research Database (Denmark)

    Liberti, Sascha E; Andersen, Sofie Dabros; Wang, Jing

    2011-01-01

    Human exonuclease 1 (hEXO1) is implicated in DNA metabolism, including replication, recombination and repair, substantiated by its interactions with PCNA, DNA helicases BLM and WRN, and several DNA mismatch repair (MMR) proteins. We investigated the sub-nuclear localization of hEXO1 during S-phas...

  18. The emerging role of nuclear architecture in DNA repair and genome maintenance

    OpenAIRE

    Misteli, Tom; Soutoglou, Evi

    2009-01-01

    DNA repair and maintenance of genome stability are crucial to cellular and organismal function, and defects in these processes have been implicated in cancer and ageing. Detailed molecular, biochemical and genetic analyses have outlined the molecular framework involved in cellular DNA-repair pathways, but recent cell-biological approaches have revealed important roles for the spatial and temporal organization of the DNA-repair machinery during the recognition of DNA lesions and the assembly o...

  19. Structure-based insights into the repair of UV-damaged DNA

    NARCIS (Netherlands)

    Meulenbroek, Elisabeth Maria

    2012-01-01

    Repair of damage in the DNA is essential for an organism. Therefore, several repair mechanisms have evolved. In this thesis, the mechanism of Transcription-Coupled Nucleotide Excision Repair (TC-NER) and the UV Damage Endonuclease repair pathway (UVDE) have been studied. Central to TC-NER is the

  20. Structural Insights Into DNA Repair by RNase T—An Exonuclease Processing 3′ End of Structured DNA in Repair Pathways

    Science.gov (United States)

    Hsiao, Yu-Yuan; Fang, Woei-Horng; Lee, Chia-Chia; Chen, Yi-Ping; Yuan, Hanna S.

    2014-01-01

    DNA repair mechanisms are essential for preservation of genome integrity. However, it is not clear how DNA are selected and processed at broken ends by exonucleases during repair pathways. Here we show that the DnaQ-like exonuclease RNase T is critical for Escherichia coli resistance to various DNA-damaging agents and UV radiation. RNase T specifically trims the 3′ end of structured DNA, including bulge, bubble, and Y-structured DNA, and it can work with Endonuclease V to restore the deaminated base in an inosine-containing heteroduplex DNA. Crystal structure analyses further reveal how RNase T recognizes the bulge DNA by inserting a phenylalanine into the bulge, and as a result the 3′ end of blunt-end bulge DNA can be digested by RNase T. In contrast, the homodimeric RNase T interacts with the Y-structured DNA by a different binding mode via a single protomer so that the 3′ overhang of the Y-structured DNA can be trimmed closely to the duplex region. Our data suggest that RNase T likely processes bulge and bubble DNA in the Endonuclease V–dependent DNA repair, whereas it processes Y-structured DNA in UV-induced and various other DNA repair pathways. This study thus provides mechanistic insights for RNase T and thousands of DnaQ-like exonucleases in DNA 3′-end processing. PMID:24594808

  1. Disruption of Maternal DNA Repair Increases Sperm-DerivedChromosomal Aberrations

    Energy Technology Data Exchange (ETDEWEB)

    Marchetti, Francesco; Essers, Jeroun; Kanaar, Roland; Wyrobek,Andrew J.

    2007-02-07

    The final weeks of male germ cell differentiation occur in aDNA repair-deficient environment and normal development depends on theability of the egg to repair DNA damage in the fertilizing sperm. Geneticdisruption of maternal DNA double-strand break repair pathways in micesignificantly increased the frequency of zygotes with chromosomalstructural aberrations after paternal exposure to ionizing radiation.These findings demonstrate that radiation-induced DNA sperm lesions arerepaired after fertilization by maternal factors and suggest that geneticvariation in maternal DNA repair can modulate the risk of early pregnancylosses and of children with chromosomal aberrations of paternalorigin.

  2. Interplay between DNA repair and inflammation, and the link to cancer

    Science.gov (United States)

    Kidane, Dawit; Chae, Wook Jin; Czochor, Jennifer; Eckert, Kristin A.; Glazer, Peter M.; Bothwell, Alfred L. M.; Sweasy, Joann B.

    2015-01-01

    DNA damage and repair are linked to cancer. DNA damage that is induced endogenously or from exogenous sources has the potential to result in mutations and genomic instability if not properly repaired, eventually leading to cancer. Inflammation is also linked to cancer. Reactive oxygen and nitrogen species (RONs) produced by inflammatory cells at sites of infection can induce DNA damage. RONs can also amplify inflammatory responses, leading to increased DNA damage. Here, we focus on the links between DNA damage, repair, and inflammation, as they relate to cancer. We examine the interplay between chronic inflammation, DNA damage and repair and review recent findings in this rapidly emerging field, including the links between DNA damage and the innate immune system, and the roles of inflammation in altering the microbiome, which subsequently leads to the induction of DNA damage in the colon. Mouse models of defective DNA repair and inflammatory control are extensively reviewed, including treatment of mouse models with pathogens, which leads to DNA damage. The roles of microRNAs in regulating inflammation and DNA repair are discussed. Importantly, DNA repair and inflammation are linked in many important ways, and in some cases balance each other to maintain homeostasis. The failure to repair DNA damage or to control inflammatory responses has the potential to lead to cancer. PMID:24410153

  3. Needle breakage: incidence and prevention.

    Science.gov (United States)

    Malamed, Stanley F; Reed, Kenneth; Poorsattar, Susan

    2010-10-01

    Since the introduction of nonreusable, stainless steel dental local anesthetic needles, needle breakage has become an extremely rare complication of dental local anesthetic injections. But although rare, dental needle breakage can, and does, occur. Review of the literature and personal experience brings into focus several commonalities which, when avoided, can minimize the risk of needle breakage with the fragment being retained from occurring. Copyright © 2010 Elsevier Inc. All rights reserved.

  4. ATP-dependent chromatin remodeling by the Cockayne syndrome B DNA repair-transcription-coupling factor

    NARCIS (Netherlands)

    E. Citterio (Elisabetta); V. van den Boom (Vincent); G. Schnitzler; R. Kanaar (Roland); E. Bonte (Edgar); R.E. Kingston; W. Vermeulen (Wim); J.H.J. Hoeijmakers (Jan)

    2000-01-01

    textabstractThe Cockayne syndrome B protein (CSB) is required for coupling DNA excision repair to transcription in a process known as transcription-coupled repair (TCR). Cockayne syndrome patients show UV sensitivity and severe neurodevelopmental abnormalities. CSB is a

  5. Role of DNA Repair Factor Xeroderma Pigmentosum Protein Group C in Response to Replication Stress As Revealed by DNA Fragile Site Affinity Chromatography and Quantitative Proteomics.

    Science.gov (United States)

    Beresova, Lucie; Vesela, Eva; Chamrad, Ivo; Voller, Jiri; Yamada, Masayuki; Furst, Tomas; Lenobel, Rene; Chroma, Katarina; Gursky, Jan; Krizova, Katerina; Mistrik, Martin; Bartek, Jiri

    2016-12-02

    Replication stress (RS) fuels genomic instability and cancer development and may contribute to aging, raising the need to identify factors involved in cellular responses to such stress. Here, we present a strategy for identification of factors affecting the maintenance of common fragile sites (CFSs), which are genomic loci that are particularly sensitive to RS and suffer from increased breakage and rearrangements in tumors. A DNA probe designed to match the high flexibility island sequence typical for the commonly expressed CFS (FRA16D) was used as specific DNA affinity bait. Proteins significantly enriched at the FRA16D fragment under normal and replication stress conditions were identified using stable isotope labeling of amino acids in cell culture-based quantitative mass spectrometry. The identified proteins interacting with the FRA16D fragment included some known CFS stabilizers, thereby validating this screening approach. Among the hits from our screen so far not implicated in CFS maintenance, we chose Xeroderma pigmentosum protein group C (XPC) for further characterization. XPC is a key factor in the DNA repair pathway known as global genomic nucleotide excision repair (GG-NER), a mechanism whose several components were enriched at the FRA16D fragment in our screen. Functional experiments revealed defective checkpoint signaling and escape of DNA replication intermediates into mitosis and the next generation of XPC-depleted cells exposed to RS. Overall, our results provide insights into an unexpected biological role of XPC in response to replication stress and document the power of proteomics-based screening strategies to elucidate mechanisms of pathophysiological significance.

  6. Biomarkers of oxidative damage to DNA and repair

    DEFF Research Database (Denmark)

    Loft, Steffen; Høgh Danielsen, Pernille; Mikkelsen, Lone

    2008-01-01

    Oxidative-stress-induced damage to DNA includes a multitude of lesions, many of which are mutagenic and have multiple roles in cancer and aging. Many lesions have been characterized by MS-based methods after extraction and digestion of DNA. These preparation steps may cause spurious base oxidation......, which is less likely to occur with methods such as the comet assay, which are based on nicking of the DNA strand at modified bases, but offer less specificity. The European Standards Committee on Oxidative DNA Damage has concluded that the true levels of the most widely studied lesion, 8-oxodG (8-oxo-7......,8-dihydro-2'-deoxyguanosine), in cellular DNA is between 0.5 and 5 lesions per 10(6) dG bases. Base excision repair of oxidative damage to DNA can be assessed by nicking assays based on oligonucleotides with lesions or the comet assay, by mRNA expression levels or, in the case of, e.g., OGG1 (8-oxoguanine...

  7. Structure of the Rad50 DNA double-strand break repair protein in complex with DNA.

    Science.gov (United States)

    Rojowska, Anna; Lammens, Katja; Seifert, Florian U; Direnberger, Carolin; Feldmann, Heidi; Hopfner, Karl-Peter

    2014-12-01

    The Mre11-Rad50 nuclease-ATPase is an evolutionarily conserved multifunctional DNA double-strand break (DSB) repair factor. Mre11-Rad50's mechanism in the processing, tethering, and signaling of DSBs is unclear, in part because we lack a structural framework for its interaction with DNA in different functional states. We determined the crystal structure of Thermotoga maritima Rad50(NBD) (nucleotide-binding domain) in complex with Mre11(HLH) (helix-loop-helix domain), AMPPNP, and double-stranded DNA. DNA binds between both coiled-coil domains of the Rad50 dimer with main interactions to a strand-loop-helix motif on the NBD. Our analysis suggests that this motif on Rad50 does not directly recognize DNA ends and binds internal sites on DNA. Functional studies reveal that DNA binding to Rad50 is not critical for DNA double-strand break repair but is important for telomere maintenance. In summary, we provide a structural framework for DNA binding to Rad50 in the ATP-bound state. © 2014 The Authors.

  8. Role of Rad54, Rad54b and Snm1 in DNA damage repair

    NARCIS (Netherlands)

    J. Wesoly (Joanna)

    2003-01-01

    textabstractThe aim of this thesis is to investigate the function of a number of genes involved in mammalian DNA damage repair, in particular in repair of DNA double-strand breaks (DSBs). Among a large number of different damages that can be introduced to DNA, DSBs are especially toxic. If

  9. Mismatch repair balances leading and lagging strand DNA replication fidelity.

    Directory of Open Access Journals (Sweden)

    Scott A Lujan

    Full Text Available The two DNA strands of the nuclear genome are replicated asymmetrically using three DNA polymerases, α, δ, and ε. Current evidence suggests that DNA polymerase ε (Pol ε is the primary leading strand replicase, whereas Pols α and δ primarily perform lagging strand replication. The fact that these polymerases differ in fidelity and error specificity is interesting in light of the fact that the stability of the nuclear genome depends in part on the ability of mismatch repair (MMR to correct different mismatches generated in different contexts during replication. Here we provide the first comparison, to our knowledge, of the efficiency of MMR of leading and lagging strand replication errors. We first use the strand-biased ribonucleotide incorporation propensity of a Pol ε mutator variant to confirm that Pol ε is the primary leading strand replicase in Saccharomyces cerevisiae. We then use polymerase-specific error signatures to show that MMR efficiency in vivo strongly depends on the polymerase, the mismatch composition, and the location of the mismatch. An extreme case of variation by location is a T-T mismatch that is refractory to MMR. This mismatch is flanked by an AT-rich triplet repeat sequence that, when interrupted, restores MMR to > 95% efficiency. Thus this natural DNA sequence suppresses MMR, placing a nearby base pair at high risk of mutation due to leading strand replication infidelity. We find that, overall, MMR most efficiently corrects the most potentially deleterious errors (indels and then the most common substitution mismatches. In combination with earlier studies, the results suggest that significant differences exist in the generation and repair of Pol α, δ, and ε replication errors, but in a generally complementary manner that results in high-fidelity replication of both DNA strands of the yeast nuclear genome.

  10. Repair of DNA lesions induced by ultraviolet irradiation and aromatic amines in normal and repair-deficient human lymphoblastoid cell lines

    DEFF Research Database (Denmark)

    Stevnsner, Tinna; Frandsen, Henrik; Autrup, Herman

    1995-01-01

    belonging to complementation group B of Cockayne's syndrome (CS-B) showed reduced host cell reactivation. Fibroblasts from CS-B patients have reduced gene-specific DNA repair, but normal total genomic DNA repair, thus our data suggest that the HCR assay measures the capacity for gene-specific DNA repair...

  11. Proteomics reveals dynamic assembly of repair complexes during bypass of DNA cross-links

    DEFF Research Database (Denmark)

    Räschle, Markus; Smeenk, Godelieve; Hansen, Rebecca K

    2015-01-01

    DNA interstrand cross-links (ICLs) block replication fork progression by inhibiting DNA strand separation. Repair of ICLs requires sequential incisions, translesion DNA synthesis, and homologous recombination, but the full set of factors involved in these transactions remains unknown. We devised...... a technique called chromatin mass spectrometry (CHROMASS) to study protein recruitment dynamics during perturbed DNA replication in Xenopus egg extracts. Using CHROMASS, we systematically monitored protein assembly and disassembly on ICL-containing chromatin. Among numerous prospective DNA repair factors, we...

  12. Human exonuclease 1 and BLM helicase interact to resect DNA and initiate DNA repair

    Science.gov (United States)

    Nimonkar, Amitabh V.; Özsoy, A. Zeynep; Genschel, Jochen; Modrich, Paul; Kowalczykowski, Stephen C.

    2008-01-01

    The error-free repair of double-stranded DNA breaks by homologous recombination requires processing of broken ends. These processed ends are substrates for assembly of DNA strand exchange proteins that mediate DNA strand invasion. Here, we establish that human BLM helicase, a member of the RecQ family, stimulates the nucleolytic activity of human exonuclease 1 (hExo1), a 5′→3′ double-stranded DNA exonuclease. The stimulation is specific because other RecQ homologs fail to stimulate hExo1. Stimulation of DNA resection by hExo1 is independent of BLM helicase activity and is, instead, mediated by an interaction between the 2 proteins. Finally, we show that DNA ends resected by hExo1 and BLM are used by human Rad51, but not its yeast or bacterial counterparts, to promote homologous DNA pairing. This in vitro system recapitulates initial steps of homologous recombination and provides biochemical evidence for a role of BLM and Exo1 in the initiation of recombinational DNA repair. PMID:18971343

  13. Enhanced base excision repair capacity in carotid atherosclerosis may protect nuclear DNA but not mitochondrial DNA

    DEFF Research Database (Denmark)

    Skarpengland, Tonje; B. Dahl, Tuva; Skjelland, Mona

    2016-01-01

    disease-free carotid specimens from patients with carotid plaques and 10 non-atherosclerotic control arteries. Genomic integrity, mitochondrial (mt) DNA copy number, oxidative DNA damage and BER proteins were evaluated in a subgroup of plaques and controls. Our major findings were: (i) The BER pathway...... genes in atherosclerosis may contribute to lesional nuclear DNA stability but appears insufficient to maintain mtDNA integrity, potentially influencing mitochondrial function in cells within the atherosclerotic lesion.......Lesional and systemic oxidative stress has been implicated in the pathogenesis of atherosclerosis, potentially leading to accumulation of DNA base lesions within atherosclerotic plaques. Although base excision repair (BER) is a major pathway counteracting oxidative DNA damage, our knowledge on BER...

  14. Human DNA polymerase θ grasps the primer terminus to mediate DNA repair.

    Science.gov (United States)

    Zahn, Karl E; Averill, April M; Aller, Pierre; Wood, Richard D; Doublié, Sylvie

    2015-04-01

    DNA polymerase θ protects against genomic instability via an alternative end-joining repair pathway for DNA double-strand breaks. Polymerase θ is overexpressed in breast, lung and oral cancers, and reduction of its activity in mammalian cells increases sensitivity to double-strand break-inducing agents, including ionizing radiation. Reported here are crystal structures of the C-terminal polymerase domain from human polymerase θ, illustrating two potential modes of dimerization. One structure depicts insertion of ddATP opposite an abasic-site analog during translesion DNA synthesis. The second structure describes a cognate ddGTP complex. Polymerase θ uses a specialized thumb subdomain to establish unique upstream contacts to the primer DNA strand, including an interaction with the 3'-terminal phosphate from one of five distinctive insertion loops. These observations demonstrate how polymerase θ grasps the primer to bypass DNA lesions or extend poorly annealed DNA termini to mediate end-joining.

  15. Oxidative Stress, DNA Damage and DNA Repair in Female Patients with Diabetes Mellitus Type 2.

    Directory of Open Access Journals (Sweden)

    Annemarie Grindel

    Full Text Available Diabetes mellitus type 2 (T2DM is associated with oxidative stress which in turn can lead to DNA damage. The aim of the present study was to analyze oxidative stress, DNA damage and DNA repair in regard to hyperglycemic state and diabetes duration.Female T2DM patients (n = 146 were enrolled in the MIKRODIAB study and allocated in two groups regarding their glycated hemoglobin (HbA1c level (HbA1c≤7.5%, n = 74; HbA1c>7.5%, n = 72. In addition, tertiles according to diabetes duration (DD were created (DDI = 6.94±3.1 y, n = 49; DDII = 13.35±1.1 y, n = 48; DDIII = 22.90±7.3 y, n = 49. Oxidative stress parameters, including ferric reducing ability potential, malondialdehyde, oxidized and reduced glutathione, reduced thiols, oxidized LDL and F2-Isoprostane as well as the activity of antioxidant enzymes superoxide dismutase, catalase and glutathione peroxidase were measured. Damage to DNA was analyzed in peripheral blood mononuclear cells and whole blood with single cell gel electrophoresis. DNA base excision repair capacity was tested with the modified comet repair assay. Additionally, mRNA expressions of nine genes related to base excision repair were analyzed in a subset of 46 matched individuals.No significant differences in oxidative stress parameters, antioxidant enzyme activities, damage to DNA and base excision repair capacity, neither between a HbA1c cut off />7.5%, nor between diabetes duration was found. A significant up-regulation in mRNA expression was found for APEX1, LIG3 and XRCC1 in patients with >7.5% HbA1c. Additionally, we observed higher total cholesterol, LDL-cholesterol, LDL/HDL-cholesterol, triglycerides, Framingham risk score, systolic blood pressure, BMI and lower HDL-cholesterol in the hyperglycemic group.BMI, blood pressure and blood lipid status were worse in hyperglycemic individuals. However, no major disparities regarding oxidative stress, damage to DNA and DNA repair were present which might be due to good medical

  16. Oxidative Stress, DNA Damage and DNA Repair in Female Patients with Diabetes Mellitus Type 2.

    Science.gov (United States)

    Grindel, Annemarie; Guggenberger, Bianca; Eichberger, Lukas; Pöppelmeyer, Christina; Gschaider, Michaela; Tosevska, Anela; Mare, George; Briskey, David; Brath, Helmut; Wagner, Karl-Heinz

    2016-01-01

    Diabetes mellitus type 2 (T2DM) is associated with oxidative stress which in turn can lead to DNA damage. The aim of the present study was to analyze oxidative stress, DNA damage and DNA repair in regard to hyperglycemic state and diabetes duration. Female T2DM patients (n = 146) were enrolled in the MIKRODIAB study and allocated in two groups regarding their glycated hemoglobin (HbA1c) level (HbA1c≤7.5%, n = 74; HbA1c>7.5%, n = 72). In addition, tertiles according to diabetes duration (DD) were created (DDI = 6.94±3.1 y, n = 49; DDII = 13.35±1.1 y, n = 48; DDIII = 22.90±7.3 y, n = 49). Oxidative stress parameters, including ferric reducing ability potential, malondialdehyde, oxidized and reduced glutathione, reduced thiols, oxidized LDL and F2-Isoprostane as well as the activity of antioxidant enzymes superoxide dismutase, catalase and glutathione peroxidase were measured. Damage to DNA was analyzed in peripheral blood mononuclear cells and whole blood with single cell gel electrophoresis. DNA base excision repair capacity was tested with the modified comet repair assay. Additionally, mRNA expressions of nine genes related to base excision repair were analyzed in a subset of 46 matched individuals. No significant differences in oxidative stress parameters, antioxidant enzyme activities, damage to DNA and base excision repair capacity, neither between a HbA1c cut off />7.5%, nor between diabetes duration was found. A significant up-regulation in mRNA expression was found for APEX1, LIG3 and XRCC1 in patients with >7.5% HbA1c. Additionally, we observed higher total cholesterol, LDL-cholesterol, LDL/HDL-cholesterol, triglycerides, Framingham risk score, systolic blood pressure, BMI and lower HDL-cholesterol in the hyperglycemic group. BMI, blood pressure and blood lipid status were worse in hyperglycemic individuals. However, no major disparities regarding oxidative stress, damage to DNA and DNA repair were present which might be due to good medical treatment

  17. Age and gender effects on DNA strand break repair in peripheral blood mononuclear cells

    DEFF Research Database (Denmark)

    Garm, Christian; Moreno-Villanueva, Maria; Bürkle, Alexander

    2013-01-01

    Exogenous and endogenous damage to DNA is constantly challenging the stability of our genome. This DNA damage increase the frequency of errors in DNA replication, thus causing point mutations or chromosomal rearrangements and has been implicated in aging, cancer, and neurodegenerative diseases....... Therefore, efficient DNA repair is vital for the maintenance of genome stability. The general notion has been that DNA repair capacity decreases with age although there are conflicting results. Here, we focused on potential age-associated changes in DNA damage response and the capacities of repairing DNA...... single-strand breaks (SSBs) and double-strand breaks (DSBs) in human peripheral blood mononuclear cells (PBMCs). Of these lesions, DSBs are the least frequent but the most dangerous for cells. We have measured the level of endogenous SSBs, SSB repair capacity, γ-H2AX response, and DSB repair capacity...

  18. DNA methyltransferase deficiency modifies cancer susceptibility in mice lacking DNA mismatch repair.

    Science.gov (United States)

    Trinh, Binh N; Long, Tiffany I; Nickel, Andrea E; Shibata, Darryl; Laird, Peter W

    2002-05-01

    We have introduced DNA methyltransferase 1 (Dnmt1) mutations into a mouse strain deficient for the Mlh1 protein to study the interaction between DNA mismatch repair deficiency and DNA methylation. Mice harboring hypomorphic Dnmt1 mutations showed diminished RNA expression and DNA hypomethylation but developed normally and were tumor free. When crossed to Mlh1(-/-) homozygosity, they were less likely to develop the intestinal cancers that normally arise in this tumor-predisposed, mismatch repair-deficient background. However, these same mice developed invasive T- and B-cell lymphomas earlier and at a much higher frequency than their Dnmt1 wild-type littermates. Thus, the reduction of Dnmt1 activity has significant but opposing outcomes in the development of two different tumor types. DNA hypomethylation and mismatch repair deficiency interact to exacerbate lymphomagenesis, while hypomethylation protects against intestinal tumors. The increased lymphomagenesis in Dnmt1 hypomorphic, Mlh1(-/-) mice may be due to a combination of several mechanisms, including elevated mutation rates, increased expression of proviral sequences or proto-oncogenes, and/or enhanced genomic instability. We show that CpG island hypermethylation occurs in the normal intestinal mucosa, is increased in intestinal tumors in Mlh1(-/-) mice, and is reduced in the normal mucosa and tumors of Dnmt1 mutant mice, consistent with a role for Dnmt1-mediated CpG island hypermethylation in intestinal tumorigenesis.

  19. Is thymidine glycol containing DNA a substrate of E. coli DNA mismatch repair system?

    Science.gov (United States)

    Perevozchikova, Svetlana A; Trikin, Roman M; Heinze, Roger J; Romanova, Elena A; Oretskaya, Tatiana S; Friedhoff, Peter; Kubareva, Elena A

    2014-01-01

    The DNA mismatch repair (MMR) system plays a crucial role in the prevention of replication errors and in the correction of some oxidative damages of DNA bases. In the present work the most abundant oxidized pyrimidine lesion, 5,6-dihydro-5,6-dihydroxythymidine (thymidine glycol, Tg) was tested for being recognized and processed by the E. coli MMR system, namely complex of MutS, MutL and MutH proteins. In a partially reconstituted MMR system with MutS-MutL-MutH proteins, G/Tg and A/Tg containing plasmids failed to provoke the incision of DNA. Tg residue in the 30-mer DNA duplex destabilized double helix due to stacking disruption with neighboring bases. However, such local structural changes are not important for E. coli MMR system to recognize this lesion. A lack of repair of Tg containing DNA could be due to a failure of MutS (a first acting protein of MMR system) to interact with modified DNA in a proper way. It was shown that Tg in DNA does not affect on ATPase activity of MutS. On the other hand, MutS binding affinities to DNA containing Tg in G/Tg and A/Tg pairs are lower than to DNA with a G/T mismatch and similar to canonical DNA. Peculiarities of MutS interaction with DNA was monitored by Förster resonance energy transfer (FRET) and fluorescence anisotropy. Binding of MutS to Tg containing DNAs did not result in the formation of characteristic DNA kink. Nevertheless, MutS homodimer orientation on Tg-DNA is similar to that in the case of G/T-DNA. In contrast to G/T-DNA, neither G/Tg- nor A/Tg-DNA was able to stimulate ADP release from MutS better than canonical DNA. Thus, Tg residue in DNA is unlikely to be recognized or processed by the E. coli MMR system. Probably, the MutS transformation to active "sliding clamp" conformation on Tg-DNA is problematic.

  20. DNA repair pathways involved in repair of lesions induced by 5-fluorouracil and its active metabolite FdUMP.

    Science.gov (United States)

    Matuo, Renata; Sousa, Fabrício Garmus; Escargueil, Alexandre E; Soares, Daniele G; Grivicich, Ivana; Saffi, Jenifer; Larsen, Annette K; Henriques, João Antonio Pêgas

    2010-01-15

    5-Fluorouracil (5-FU) is an antitumor antimetabolite that can be converted into fluoronucleotides and FdUMP. Fluoronucleotides are incorporated into DNA and RNA, while FdUMP results in nucleotide pool imbalance. Saccharomyces cerevisiae is unable to convert 5-FU into FdUMP, making yeast a unique model system to study the cellular effects of 5-FU and FdUMP independently. A panel of repair-deficient yeast strains was used to identify the DNA repair pathways needed for repair of lesions generated by 5-FU or FdUMP. This included yeast deficient in base excision repair (BER), nucleotide excision repair (NER), translesion synthesis (TLS), mismatch repair (MMR), post-replication repair (PRR), homologous recombination (HR) and non-homologous end-joining (NHEJ). The results revealed an important role of BER, since BER-mutants (ntg1, ntg2, apn1, apn2) showed pronounced sensitivity to both 5-FU and FdUMP. MMR mutants also showed high sensitivity to both compounds. In contrast, deficiencies in NER, NHEJ and TLS repair had only minor influence on the sensitivity to FU and FdUMP. Interestingly, deficiencies in HR (rad52) and PPR (rad6, rad18) were associated with increased sensitivity to 5-FU, but not to FdUMP. Taken together, our study reveals an important contribution of DNA repair pathways on the sensitivity to 5-FU and its active metabolite FdUMP. Importantly, the repair mechanisms differed for the 2 antimetabolites since lesions induced by 5-FU were repaired by BER, MMR, HR and PRR, while only BER and MMR were required for repair of FdUMP-induced lesions.

  1. Sequence-specific and domain-specific DNA repair in xeroderma pigmentosum and Cockayne syndrome cells.

    Science.gov (United States)

    Tu, Y; Bates, S; Pfeifer, G P

    1997-08-15

    Xeroderma pigmentosum (XP) and Cockayne syndrome (CS) cells have specific DNA repair defects. We had previously analyzed repair rates of cyclobutane pyrimidine dimers at nucleotide resolution along the human JUN gene in normal fibroblasts and found very efficient repair of sequences near the transcription initiation site but slow repair along the promoter. To investigate sequence-specific repair rate patterns in XP and CS cells, we conducted a similar analysis in XPA, XPB, XPC, XPD, and CSB fibroblasts. XPA cells were almost completely repair-deficient at all sequences analyzed. XPC cells repaired only the transcribed DNA strand beginning at position -20 relative to the transcription start site. Both XBP and XPD cells were deficient in repair of nontranscribed DNA and also very inefficiently repaired the transcribed strand including sequences near the transcription start site. CSB cells exhibited rapid repair near the transcription initiation site but were deficient in repair of sequences encountered by RNA polymerase during elongation (beginning at position +20). Since transcription of the JUN gene was UV-induced in all fibroblast strains, including CSB, the defective repair of the transcribed strand in CSB cannot be explained by a lack of transcription; rather, it appears to be a true DNA repair defect.

  2. Base excision repair deficient mice lacking the Aag alkyladenine DNA glycosylase.

    NARCIS (Netherlands)

    B.P. Engelward (Bevin); G. Weeda (Geert); M.D. Wyatt; J.L.M. Broekhof (Jose'); J. de Wit (Jan); I. Donker (Ingrid); J.M. Allan (James); B. Gold (Bert); J.H.J. Hoeijmakers (Jan); L.D. Samson (Leona)

    1997-01-01

    textabstract3-methyladenine (3MeA) DNA glycosylases remove 3MeAs from alkylated DNA to initiate the base excision repair pathway. Here we report the generation of mice deficient in the 3MeA DNA glycosylase encoded by the Aag (Mpg) gene. Alkyladenine DNA glycosylase turns out to be the major DNA

  3. Fluorodeoxyuridine modulates cellular expression of the DNA base excision repair enzyme uracil-DNA glycosylase.

    Science.gov (United States)

    Fischer, Jennifer A; Muller-Weeks, Susan; Caradonna, Salvatore J

    2006-09-01

    The thymidylate synthase inhibitor 5-fluorouracil (5-FU) continues to play a pivotal role in the treatment of cancer. A downstream event of thymidylate synthase inhibition involves the induction of a self-defeating base excision repair process. With the depletion of TTP pools, there is also an increase in dUMP. Metabolism of dUMP to the triphosphate dUTP results in elevated pools of this atypical precursor for DNA synthesis. Under these conditions, there is a destructive cycle of dUMP incorporation into DNA, removal of uracil by the base excision repair enzyme uracil-DNA glycosylase (UDG), and reincorporation of dUMP during the synthesis phase of DNA repair. The end point is DNA strand breaks and loss of DNA integrity, which contributes to cell death. Evidence presented here indicates that both the nuclear and the mitochondrial isoforms of UDG are modulated by FdUrd (and 5-FU) treatment in certain cell lines but not in others. Modulation occurs at the transcriptional and post-translational levels. Under normal conditions, nUDG protein appears in G(1) and is degraded during the S to G(2) phase transition. The present study provides evidence that, in certain cell lines, FdUrd mediates an atypical turnover of nUDG. Additional data indicate that, for cell lines that do not down-regulate nUDG, small interfering RNA-mediated knockdown of nUDG significantly increases resistance to the cytotoxic effects of FdUrd. Results from these studies show that nUDG is an additional determinant in FdUrd-mediated cytotoxicity and bolster the notion that the self-defeating base excision repair pathway, instigated by elevated dUTP (FdUTP) pools, contributes to the cytotoxic consequences of 5-FU chemotherapy.

  4. In TFIIH, XPD helicase is exclusively devoted to DNA repair.

    Directory of Open Access Journals (Sweden)

    Jochen Kuper

    2014-09-01

    Full Text Available The eukaryotic XPD helicase is an essential subunit of TFIIH involved in both transcription and nucleotide excision repair (NER. Mutations in human XPD are associated with several inherited diseases such as xeroderma pigmentosum, Cockayne syndrome, and trichothiodystrophy. We performed a comparative analysis of XPD from Homo sapiens and Chaetomium thermophilum (a closely related thermostable fungal orthologue to decipher the different molecular prerequisites necessary for either transcription or DNA repair. In vitro and in vivo assays demonstrate that mutations in the 4Fe4S cluster domain of XPD abrogate the NER function of TFIIH and do not affect its transcriptional activity. We show that the p44-dependent activation of XPD is promoted by the stimulation of its ATPase activity. Furthermore, we clearly demonstrate that XPD requires DNA binding, ATPase, and helicase activity to function in NER. In contrast, these enzymatic properties are dispensable for transcription initiation. XPD helicase is thus exclusively devoted to NER and merely acts as a structural scaffold to maintain TFIIH integrity during transcription.

  5. DNA Repair in Despair-Vitamin D Is Not Fair.

    Science.gov (United States)

    Gocek, Elżbieta; Studzinski, George P

    2016-08-01

    The role of vitamin D as a treatment option for neoplastic diseases, once considered to have a bright future, remains controversial. The preclinical studies discussed herein show compelling evidence that Vitamin D Derivatives (VDDs) can convert some cancer and leukemia cells to a benign phenotype, by differentiation/maturation, cell cycle arrest, or induction of apoptosis. Furthermore, there is considerable, though still evolving, knowledge of the molecular mechanisms underlying these changes. However, the attempts to clearly document that the treatment outcomes of human neoplastic diseases can be positively influenced by VDDs have been, so far, disappointing. The clinical trials to date of VDDs, alone or combined with other agents, have not shown consistent results. It is our contention, shared by others, that there were limitations in the design or execution of these trials which have not yet been fully addressed. Based on the connection between upregulation of JNK by VDDs and DNA repair, we propose a new avenue of attack on cancer cells by increasing the toxicity of the current, only partially effective, cancer chemotherapeutic drugs by combining them with VDDs. This can impair DNA repair and thus kill the malignant cells, warranting a comprehensive study of this novel concept. J. Cell. Biochem. 117: 1733-1744, 2016. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  6. DNA ligase 1 deficient plants display severe growth defects and delayed repair of both DNA single and double strand breaks

    Directory of Open Access Journals (Sweden)

    Bray Clifford M

    2009-06-01

    Full Text Available Abstract Background DNA ligase enzymes catalyse the joining of adjacent polynucleotides and as such play important roles in DNA replication and repair pathways. Eukaryotes possess multiple DNA ligases with distinct roles in DNA metabolism, with clear differences in the functions of DNA ligase orthologues between animals, yeast and plants. DNA ligase 1, present in all eukaryotes, plays critical roles in both DNA repair and replication and is indispensable for cell viability. Results Knockout mutants of atlig1 are lethal. Therefore, RNAi lines with reduced levels of AtLIG1 were generated to allow the roles and importance of Arabidopsis DNA ligase 1 in DNA metabolism to be elucidated. Viable plants were fertile but displayed a severely stunted and stressed growth phenotype. Cell size was reduced in the silenced lines, whilst flow cytometry analysis revealed an increase of cells in S-phase in atlig1-RNAi lines relative to wild type plants. Comet assay analysis of isolated nuclei showed atlig1-RNAi lines displayed slower repair of single strand breaks (SSBs and also double strand breaks (DSBs, implicating AtLIG1 in repair of both these lesions. Conclusion Reduced levels of Arabidopsis DNA ligase 1 in the silenced lines are sufficient to support plant development but result in retarded growth and reduced cell size, which may reflect roles for AtLIG1 in both replication and repair. The finding that DNA ligase 1 plays an important role in DSB repair in addition to its known function in SSB repair, demonstrates the existence of a previously uncharacterised novel pathway, independent of the conserved NHEJ. These results indicate that DNA ligase 1 functions in both DNA replication and in repair of both ss and dsDNA strand breaks in higher plants.

  7. Effect of Amalaki rasayana on DNA damage and repair in randomized aged human individuals.

    Science.gov (United States)

    Vishwanatha, Udupi; Guruprasad, Kanive P; Gopinath, Puthiya M; Acharya, Raviraj V; Prasanna, Bokkasa V; Nayak, Jayakrishna; Ganesh, Rajeshwari; Rao, Jayalaxmi; Shree, Rashmi; Anchan, Suchitra; Raghu, Kothanahalli S; Joshi, Manjunath B; Paladhi, Puspendu; Varier, Panniampilly M; Muraleedharan, Kollath; Muraleedharan, Thrikovil S; Satyamoorthy, Kapaettu

    2016-09-15

    Preparations from Phyllanthus emblica called Amalaki rasayana is used in the Indian traditional medicinal system of Ayurveda for healthy living in elderly. The biological effects and its mechanisms are not fully understood. Since the diminishing DNA repair is the hallmark of ageing, we tested the influence of Amalaki rasayana on recognized DNA repair activities in healthy aged individuals. Amalaki rasayana was prepared fresh and healthy aged randomized human volunteers were administrated with either rasayana or placebo for 45 days strictly as per the traditional text. The DNA repair was analyzed in peripheral blood mononuclear cells before and after rasayana administration and after 45 days post-rasayana treatment regimen. UVC-induced DNA strand break repair (DSBR) based on extent of DNA unwinding by fluorometric analysis, nucleotide excision repair (NER) by flow cytometry and constitutive base excision repair (BER) by gap filling method were analyzed. Amalaki rasayana administration stably maintained/enhanced the DSBR in aged individuals. There were no adverse side effects. Further, subjects with different body mass index showed differential DNA strand break repair capacity. No change in unscheduled DNA synthesis during NER and BER was observed between the groups. Intake of Amalaki rasayana by aged individuals showed stable maintenance of DNA strand break repair without toxic effects. However, there was no change in nucleotide and base excision repair activities. Results warrant further studies on the effects of Amalaki rasayana on DSBR activities. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  8. Integrated Microarray-based Tools for Detection of Genomic DNA Damage and Repair Mechanisms.

    Science.gov (United States)

    van Eijk, Patrick; Teng, Yumin; Bennet, Mark R; Evans, Katie E; Powell, James R; Webster, Richard M; Reed, Simon H

    2018-01-01

    The genetic information contained within the DNA molecule is highly susceptible to chemical and physical insult, caused by both endogenous and exogenous sources that can generate in the order of thousands of lesions a day in each of our cells (Lindahl, Nature 362(6422):709-715, 1993). DNA damages interfere with DNA metabolic processes such as transcription and replication and can be potent inhibitors of cell division and gene expression. To combat these regular threats to genome stability, a host of DNA repair mechanisms have evolved. When DNA lesions are left unrepaired due to defects in the repair pathway, mutations can arise that may alter the genetic information of the cell. DNA repair is thus fundamental to genome stability and defects in all the major repair pathways can lead to cancer predisposition. Therefore, the ability to accurately measure DNA damage at a genomic scale and determine the level, position, and rates of removal by DNA repair can contribute greatly to our understanding of how DNA repair in chromatin is organized throughout the genome. For this reason, we developed the 3D-DIP-Chip protocol described in this chapter. Conducting such measurements has potential applications in a variety of other fields, such as genotoxicity testing and cancer treatment using DNA damage inducing chemotherapy. Being able to detect and measure genomic DNA damage and repair patterns in individuals following treatment with chemotherapy could enable personalized medicine by predicting response to therapy.

  9. Diagnosis of Fanconi Anemia: Chromosomal Breakage Analysis

    Directory of Open Access Journals (Sweden)

    Anneke B. Oostra

    2012-01-01

    Full Text Available Fanconi anemia (FA is a rare inherited syndrome with diverse clinical symptoms including developmental defects, short stature, bone marrow failure, and a high risk of malignancies. Fifteen genetic subtypes have been distinguished so far. The mode of inheritance for all subtypes is autosomal recessive, except for FA-B, which is X-linked. Cells derived from FA patients are—by definition—hypersensitive to DNA cross-linking agents, such as mitomycin C, diepoxybutane, or cisplatinum, which becomes manifest as excessive growth inhibition, cell cycle arrest, and chromosomal breakage upon cellular exposure to these drugs. Here we provide a detailed laboratory protocol for the accurate assessment of the FA diagnosis as based on mitomycin C-induced chromosomal breakage analysis in whole-blood cultures. The method also enables a quantitative estimate of the degree of mosaicism in the lymphocyte compartment of the patient.

  10. Diagnosis of Fanconi Anemia: Chromosomal Breakage Analysis

    Science.gov (United States)

    Oostra, Anneke B.; Nieuwint, Aggie W. M.; Joenje, Hans; de Winter, Johan P.

    2012-01-01

    Fanconi anemia (FA) is a rare inherited syndrome with diverse clinical symptoms including developmental defects, short stature, bone marrow failure, and a high risk of malignancies. Fifteen genetic subtypes have been distinguished so far. The mode of inheritance for all subtypes is autosomal recessive, except for FA-B, which is X-linked. Cells derived from FA patients are—by definition—hypersensitive to DNA cross-linking agents, such as mitomycin C, diepoxybutane, or cisplatinum, which becomes manifest as excessive growth inhibition, cell cycle arrest, and chromosomal breakage upon cellular exposure to these drugs. Here we provide a detailed laboratory protocol for the accurate assessment of the FA diagnosis as based on mitomycin C-induced chromosomal breakage analysis in whole-blood cultures. The method also enables a quantitative estimate of the degree of mosaicism in the lymphocyte compartment of the patient. PMID:22693659

  11. SAMHD1 Promotes DNA End Resection to Facilitate DNA Repair by Homologous Recombination

    Directory of Open Access Journals (Sweden)

    Waaqo Daddacha

    2017-08-01

    Full Text Available DNA double-strand break (DSB repair by homologous recombination (HR is initiated by CtIP/MRN-mediated DNA end resection to maintain genome integrity. SAMHD1 is a dNTP triphosphohydrolase, which restricts HIV-1 infection, and mutations are associated with Aicardi-Goutières syndrome and cancer. We show that SAMHD1 has a dNTPase-independent function in promoting DNA end resection to facilitate DSB repair by HR. SAMHD1 deficiency or Vpx-mediated degradation causes hypersensitivity to DSB-inducing agents, and SAMHD1 is recruited to DSBs. SAMHD1 complexes with CtIP via a conserved C-terminal domain and recruits CtIP to DSBs to facilitate end resection and HR. Significantly, a cancer-associated mutant with impaired CtIP interaction, but not dNTPase-inactive SAMHD1, fails to rescue the end resection impairment of SAMHD1 depletion. Our findings define a dNTPase-independent function for SAMHD1 in HR-mediated DSB repair by facilitating CtIP accrual to promote DNA end resection, providing insight into how SAMHD1 promotes genome integrity.

  12. DNA mismatch repair preferentially protects genes from mutation.

    Science.gov (United States)

    Belfield, Eric J; Ding, Zhong Jie; Jamieson, Fiona J C; Visscher, Anne M; Zheng, Shao Jian; Mithani, Aziz; Harberd, Nicholas P

    2017-12-12

    Mutation is the source of genetic variation and fuels biological evolution. Many mutations first arise as DNA replication errors. These errors subsequently evade correction by cellular DNA repair, for example, by the well-known DNA mismatch repair (MMR) mechanism. Here, we determine the genome-wide effects of MMR on mutation. We first identify almost 9000 mutations accumulated over five generations in eight MMR-deficient mutation accumulation (MA) lines of the model plant species, Arabidopsis thaliana We then show that MMR deficiency greatly increases the frequency of both smaller-scale insertions and deletions (indels) and of single-nucleotide variant (SNV) mutations. Most indels involve A or T nucleotides and occur preferentially in homopolymeric (poly A or poly T) genomic stretches. In addition, we find that the likelihood of occurrence of indels in homopolymeric stretches is strongly related to stretch length, and that this relationship causes ultrahigh localized mutation rates in specific homopolymeric stretch regions. For SNVs, we show that MMR deficiency both increases their frequency and changes their molecular mutational spectrum, causing further enhancement of the GC to AT bias characteristic of organisms with normal MMR function. Our final genome-wide analyses show that MMR deficiency disproportionately increases the numbers of SNVs in genes, rather than in nongenic regions of the genome. This latter observation indicates that MMR preferentially protects genes from mutation and has important consequences for understanding the evolution of genomes during both natural selection and human tumor growth. © 2018 Belfield et al.; Published by Cold Spring Harbor Laboratory Press.

  13. DNA excision repair in cell extracts from human cell lines exhibiting hypersensitivity to DNA-damaging agents

    Energy Technology Data Exchange (ETDEWEB)

    Hansson, J.; Keyse, S.M.; Lindahl, T.; Wood, R.D. (Imperial Cancer Research Fund, South Mimms, (United Kingdom))

    1991-07-01

    Whole cell extracts from human lymphoid cell lines can perform in vitro DNA repair synthesis in plasmids damaged by agents including UV or cis-diamminedichloroplatinum(II) (cis-DDP). Extracts from xeroderma pigmentosum (XP) cells are defective in repair synthesis. We have now studied in vitro DNA repair synthesis using extracts from lymphoblastoid cell lines representing four human hereditary syndromes with increased sensitivity to DNA-damaging agents. Extracts of cell lines from individuals with the sunlight-sensitive disorders dysplastic nevus syndrome or Cockayne's syndrome (complementation groups A and B) showed normal DNA repair synthesis in plasmids with UV photoproducts. This is consistent with in vivo measurements of the overall DNA repair capacity in such cell lines. A number of extracts were prepared from two cell lines representing the variant form of XP (XP-V). Half of the extracts prepared showed normal levels of in vitro DNA repair synthesis in plasmids containing UV lesions, but the remainder of the extracts from the same cell lines showed deficient repair synthesis, suggesting the possibility of an unusually labile excision repair protein in XP-V. Fanconi's anemia (FA) cells show cellular hypersensitivity to cross-linking agents including cis-DDP. Extracts from cell lines belonging to two different complementation groups of FA showed normal DNA repair synthesis in plasmids containing cis-DDP or UV adducts. Thus, there does not appear to be an overall excision repair defect in FA, but the data do not exclude a defect in the repair of interstrand DNA cross-links.

  14. Repair of DNA treated with. gamma. -irradiation and chemical carcinogens. Progress report, 1980-1983

    Energy Technology Data Exchange (ETDEWEB)

    Goldthwait, D.A.

    1984-02-01

    We have studied in vitro DNA repair with the isolation and characterization of DNA glycosylases active in the removable of 3-methyladenine and the problem of repair of DNA in chromatin. The second area of focus has been on transposable elements and carcinogen action. The work on DNA adducts with ..beta..-propiolactone was done to define potential new substrates useful in a search for new glycosylases.

  15. Responding to chromosomal breakage during M-phase: insights from a cell-free system

    Directory of Open Access Journals (Sweden)

    Costanzo Vincenzo

    2009-07-01

    Full Text Available Abstract DNA double strand breaks (DSBs activate ATM and ATR dependent checkpoints that prevent the onset of mitosis. However, how cells react to DSBs occurring when they are already in mitosis is poorly understood. The Xenopus egg extract has been utilized to study cell cycle progression and DNA damage checkpoints. Recently this system has been successfully used to uncover an ATM and ATR dependent checkpoint affecting centrosome driven spindle assembly. These studies have led to the identification of XCEP63 as major target of this pathway. XCEP63 is a coiled-coil rich protein localized at centrosome essential for proper spindle assembly. ATM and ATR directly phosphorylate XCEP63 on serine 560 inducing its delocalization from centrosome, which in turn delays spindle assembly. This pathway might contribute to regulate DNA repair or mitotic cell survival in the presence of chromosome breakage.

  16. Tribute to dr louis keith: twin and physician extraordinaire/twin research reports: influences on asthma severity; chimerism revisited; DNA strand break repair/media reports: twins born apart; elevated twin frequencies; celebrity father of twins; conjoined twinning.

    Science.gov (United States)

    Segal, Nancy L

    2014-10-01

    The International Society for Twin Studies has lost a valued friend and colleague. Dr Louis Keith, Emeritus Professor of Obstetrics and Gynecology at Northwestern University, in Chicago, passed away on Sunday, July 6, 2014. His life and work with twins will be acknowledged at the November 2014 International Twin Congress in Budapest, Hungary. Next, twin research reports on the severity of asthma symptoms, a case of chimerism, and factors affecting DNA breakage and repair mechanisms are reviewed. Media reports cover twins born apart, elevated twin frequencies, a celebrity father of twins, and a family's decision to keep conjoined twins together.

  17. DNA damage repair and response proteins as targets for cancer therapy.

    Science.gov (United States)

    Lieberman, Howard B

    2008-01-01

    The cellular response to DNA damage is critical for determining whether carcinogenesis, cell death or other deleterious biological effects will ensue. Numerous cellular enzymatic mechanisms can directly repair damaged DNA, or allow tolerance of DNA lesions, and thus reduce potential harmful effects. These processes include base excision repair, nucleotide excision repair, nonhomologous end joining, homologous recombinational repair and mismatch repair, as well as translesion synthesis. Furthermore, DNA damage-inducible cell cycle checkpoint systems transiently delay cell cycle progression. Presumably, this allows extra time for repair before entry of cells into critical phases of the cell cycle, an event that could be lethal if pursued with damaged DNA. When damage is excessive apoptotic cellular suicide mechanisms can be induced. Many of the survival-promoting pathways maintain genomic integrity even in the absence of exogenous agents, thus likely processing spontaneous damage caused by the byproducts of normal cellular metabolism. DNA damage can initiate cancer, and radiological as well as chemical agents used to treat cancer patients often cause DNA damage. Many genes are involved in each of the DNA damage processing mechanisms, and the encoded proteins could ultimately serve as targets for therapy, with the goal of neutralizing their ability to repair damage in cancer cells. Therefore, modulation of DNA damage responses coupled with more conventional radiotherapy and chemotherapy approaches could sensitize cancer cells to treatment. Alteration of DNA damage response genes and proteins should thus be considered an important though as of yet not fully exploited avenue to enhance cancer therapy.

  18. DNA-damage foci to detect and characterize DNA repair alterations in children treated for pediatric malignancies.

    Directory of Open Access Journals (Sweden)

    Nadine Schuler

    Full Text Available PURPOSE: In children diagnosed with cancer, we evaluated the DNA damage foci approach to identify patients with double-strand break (DSB repair deficiencies, who may overreact to DNA-damaging radio- and chemotherapy. In one patient with Fanconi anemia (FA suffering relapsing squamous cell carcinomas of the oral cavity we also characterized the repair defect in biopsies of skin, mucosa and tumor. METHODS AND MATERIALS: In children with histologically confirmed tumors or leukemias and healthy control-children DSB repair was investigated by counting γH2AX-, 53BP1- and pATM-foci in blood lymphocytes at defined time points after ex-vivo irradiation. This DSB repair capacity was correlated with treatment-related normal-tissue responses. For the FA patient the defective repair was also characterized in tissue biopsies by analyzing DNA damage response proteins by light and electron microscopy. RESULTS: Between tumor-children and healthy control-children we observed significant differences in mean DSB repair capacity, suggesting that childhood cancer is based on genetic alterations affecting DNA repair. Only 1 out of 4 patients with grade-4 normal-tissue toxicities revealed an impaired DSB repair capacity. The defective DNA repair in FA patient was verified in irradiated blood lymphocytes as well as in non-irradiated mucosa and skin biopsies leading to an excessive accumulation of heterochromatin-associated DSBs in rapidly cycling cells. CONCLUSIONS: Analyzing human tissues we show that DSB repair alterations predispose to cancer formation at younger ages and affect the susceptibility to normal-tissue toxicities. DNA damage foci analysis of blood and tissue samples allows one to detect and characterize DSB repair deficiencies and enables identification of patients at risk for high-grade toxicities. However, not all treatment-associated normal-tissue toxicities can be explained by DSB repair deficiencies.

  19. Targeting the DNA Repair Pathway in Ewing Sarcoma

    Directory of Open Access Journals (Sweden)

    Elizabeth Stewart

    2014-11-01

    Full Text Available Ewing sarcoma (EWS is a tumor of the bone and soft tissue that primarily affects adolescents and young adults. With current therapies, 70% of patients with localized disease survive, but patients with metastatic or recurrent disease have a poor outcome. We found that EWS cell lines are defective in DNA break repair and are sensitive to PARP inhibitors (PARPis. PARPi-induced cytotoxicity in EWS cells was 10- to 1,000-fold higher after administration of the DNA-damaging agents irinotecan or temozolomide. We developed an orthotopic EWS mouse model and performed pharmacokinetic and pharmacodynamic studies using three different PARPis that are in clinical development for pediatric cancer. Irinotecan administered on a low-dose, protracted schedule previously optimized for pediatric patients was an effective DNA-damaging agent when combined with PARPis; it was also better tolerated than combinations with temozolomide. Combining PARPis with irinotecan and temozolomide gave complete and durable responses in more than 80% of the mice.

  20. Melatonin: A pleiotropic molecule that modulates DNA damage response and repair pathways.

    Science.gov (United States)

    Majidinia, Maryam; Sadeghpour, Alireza; Mehrzadi, Saeed; Reiter, Russel J; Khatami, Nasrin; Yousefi, Bahman

    2017-08-01

    DNA repair is responsible for maintaining the integrity of the genome. Perturbations in the DNA repair pathways have been identified in several human cancers. Thus, compounds targeting DNA damage response (DDR) hold great promise in cancer therapy. A great deal of effort, in pursuit of new anticancer drugs, has been devoted to understanding the basic mechanisms and functions of the cellular DNA repair machinery. Melatonin, a widely produced indoleamine in all organisms, is associated with a reduced risk of cancer and has multiple regulatory roles on the different aspects of the DDR and DNA repair. Herein, we have mainly discussed how defective components in different DNA repair machineries, including homologous recombination (HR), nonhomologous end-joining (NHEJ), base excision repair (BER), nucleotide excision repair (NER), and finally DNA mismatch repair (MMR), can contribute to the risk of cancer. Melatonin biosynthesis, mode of action, and antioxidant effects are reviewed along with the means by which the indoleamine regulates DDR at the transduction, mediation, and functional levels. Finally, we summarize recent studies that illustrate how melatonin can be combined with DNA-damaging agents to improve their efficacy in cancer therapy. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  1. DNA-repair measurements by use of the modified comet assay

    DEFF Research Database (Denmark)

    Godschalk, Roger W L; Ersson, Clara; Riso, Patrizia

    2013-01-01

    The measurement of DNA-repair activity by extracts from cells or tissues by means of the single-cell gel electrophoresis (comet) assay has a high potential to become widely used in biomonitoring studies. We assessed the inter-laboratory variation in reported values of DNA-repair activity on subst...

  2. Linking Structure and Function for the DNA Repair Complex Mre11-Rad50-Nbs1

    NARCIS (Netherlands)

    E. Kinoshita (Eri)

    2014-01-01

    markdownabstract__Abstract__ Repair of DNA damage is an essential process in all cells and an important mechanism to avoid cancer development in animals. The repair of DNA double strand breaks (DSB) requires many component proteins including the Mre11-Rad50-Nbs1 (MRN) complex that serves

  3. POLB: A new role of DNA polymerase beta in mitochondrial base excision repair.

    Science.gov (United States)

    Kaufman, Brett A; Van Houten, Bennett

    2017-12-01

    The mitochondrial genome is a matrilineally inherited DNA that encodes numerous essential subunits of the respiratory chain in all metazoans. As such mitochondrial DNA (mtDNA) sequence integrity is vital to organismal survival, but it has a limited cadre of DNA repair activities, primarily base excision repair (BER). We have known that the mtDNA is significantly oxidized by both endogenous and exogenous sources, but this does not lead to the expected preferential formation of transversion mutations, which suggest a robust base excision repair (BER) system. This year, two different groups reported compelling evidence that what was believed to be exclusively nuclear DNA repair polymerase, POLB, is located in the mitochondria and plays a significant role in mitochondrial BER, mtDNA integrity and mitochondrial function. In this commentary, we review the findings and highlight remaining questions for the field. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Association between age and repair of oxidatively damaged DNA in human peripheral blood mononuclear cells

    DEFF Research Database (Denmark)

    Løhr, Mille; Jensen, Annie; Eriksen, Louise

    2015-01-01

    It has been hypothesised that positive associations between age and levels of oxidative stress-generated damage to DNA may be related to an age-dependent decline in DNA repair activity. The objective of this study was to investigate the association between age and repair activity of oxidatively......, the results show an inverse association between age and DNA repair activity of oxidatively damaged DNA....... damaged DNA in peripheral blood mononuclear cells (PBMCs). We isolated PBMCs from subjects aged 18-83 years, as part of a health survey of the Danish population that focussed on lifestyle factors. The level of DNA repair activity was measured as incisions on potassium bromate-damaged DNA by the comet...

  5. The emerging role of nuclear architecture in DNA repair and genome maintenance.

    Science.gov (United States)

    Misteli, Tom; Soutoglou, Evi

    2009-04-01

    DNA repair and maintenance of genome stability are crucial to cellular and organismal function, and defects in these processes have been implicated in cancer and ageing. Detailed molecular, biochemical and genetic analyses have outlined the molecular framework involved in cellular DNA-repair pathways, but recent cell-biological approaches have revealed important roles for the spatial and temporal organization of the DNA-repair machinery during the recognition of DNA lesions and the assembly of repair complexes. It has also become clear that local higher-order chromatin structure, chromatin dynamics and non-random global genome organization are key factors in genome maintenance. These cell-biological features of DNA repair illustrate an emerging role for nuclear architecture in multiple aspects of genome maintenance.

  6. Repair and genetic consequences of DNA double strand breaks during animal development

    NARCIS (Netherlands)

    Lemmens, Bennie Benjamin Lodewijk Gerardus

    2014-01-01

    The genetic code of life is stored in DNA molecules that consist of two parallel strands of coupled nucleotides that form a DNA double helix. One of the most deleterious forms of DNA damage is a DNA double-strand break (DSB) in which both strands of the helix are broken. When not repaired adequately

  7. Physicochemical Mechanism of Light-Driven DNA Repair by (6-4) Photolyases

    NARCIS (Netherlands)

    Faraji, Shirin; Dreuw, Andreas; Johnson, MA; Martinez, TJ

    2014-01-01

    DNA photolyases are light-activated enzymes that repair DNA damage induced by ultraviolet (UV) radiation. UV radiation causes two of the most abundant mutagenic and cytotoxic DNA lesions: cyclobutane pyrimidine dimers and 6-4 photolesions. Photolyases selectively bind to DNA and initiate the

  8. Polymorphism of the DNA Base Excision Repair Genes in Keratoconus

    Science.gov (United States)

    Wojcik, Katarzyna A.; Synowiec, Ewelina; Sobierajczyk, Katarzyna; Izdebska, Justyna; Blasiak, Janusz; Szaflik, Jerzy; Szaflik, Jacek P.

    2014-01-01

    Keratoconus (KC) is a degenerative corneal disorder for which the exact pathogenesis is not yet known. Oxidative stress is reported to be associated with this disease. The stress may damage corneal biomolecules, including DNA, and such damage is primarily removed by base excision repair (BER). Variation in genes encoding BER components may influence the effectiveness of corneal cells to cope with oxidative stress. In the present work we genotyped 5 polymorphisms of 4 BER genes in 284 patients and 353 controls. The A/A genotype of the c.–1370T>A polymorphism of the DNA polymerase γ (POLG) gene was associated with increased occurrence of KC, while the A/T genotype was associated with decreased occurrence of KC. The A/G genotype and the A allele of the c.1196A>G polymorphism of the X-ray repair cross-complementing group 1 (XRCC1) were associated with increased, and the G/G genotype and the G allele, with decreased KC occurrence. Also, the C/T and T as well as C/C genotypes and alleles of the c.580C>T polymorphism of the same gene displayed relationship with KC occurrence. Neither the g.46438521G>C polymorphism of the Nei endonuclease VIII-like 1 (NEIL1) nor the c.2285T>C polymorphism of the poly(ADP-ribose) polymerase-1 (PARP-1) was associated with KC. In conclusion, the variability of the XRCC1 and POLG genes may play a role in KC pathogenesis and determine the risk of this disease. PMID:25356504

  9. Approaches to diagnose DNA mismatch repair gene defects in cancer.

    Science.gov (United States)

    Peña-Diaz, Javier; Rasmussen, Lene Juel

    2016-02-01

    The DNA repair pathway mismatch repair (MMR) is responsible for the recognition and correction of DNA biosynthetic errors caused by inaccurate nucleotide incorporation during replication. Faulty MMR leads to failure to address the mispairs or insertion deletion loops (IDLs) left behind by the replicative polymerases and results in increased mutation load at the genome. The realization that defective MMR leads to a hypermutation phenotype and increased risk of tumorigenesis highlights the relevance of this pathway for human disease. The association of MMR defects with increased risk of cancer development was first observed in colorectal cancer patients that carried inactivating germline mutations in MMR genes and the disease was named as hereditary non-polyposis colorectal cancer (HNPCC). Currently, a growing list of cancers is found to be MMR defective and HNPCC has been renamed Lynch syndrome (LS) partly to include the associated risk of developing extra-colonic cancers. In addition, a number of non-hereditary, mostly epigenetic, alterations of MMR genes have been described in sporadic tumors. Besides conferring a strong cancer predisposition, genetic or epigenetic inactivation of MMR genes also renders cells resistant to some chemotherapeutic agents. Therefore, diagnosis of MMR deficiency has important implications for the management of the patients, the surveillance of their relatives in the case of LS and for the choice of treatment. Some of the alterations found in MMR genes have already been well defined and their pathogenicity assessed. Despite this substantial wealth of knowledge, the effects of a large number of alterations remain uncharacterized (variants of uncertain significance, VUSs). The advent of personalized genomics is likely to increase the list of VUSs found in MMR genes and anticipates the need of diagnostic tools for rapid assessment of their pathogenicity. This review describes current tools and future strategies for addressing the relevance

  10. Polymorphism of the DNA Base Excision Repair Genes in Keratoconus

    Directory of Open Access Journals (Sweden)

    Katarzyna A. Wojcik

    2014-10-01

    Full Text Available Keratoconus (KC is a degenerative corneal disorder for which the exact pathogenesis is not yet known. Oxidative stress is reported to be associated with this disease. The stress may damage corneal biomolecules, including DNA, and such damage is primarily removed by base excision repair (BER. Variation in genes encoding BER components may influence the effectiveness of corneal cells to cope with oxidative stress. In the present work we genotyped 5 polymorphisms of 4 BER genes in 284 patients and 353 controls. The A/A genotype of the c.–1370T>A polymorphism of the DNA polymerase γ (POLG gene was associated with increased occurrence of KC, while the A/T genotype was associated with decreased occurrence of KC. The A/G genotype and the A allele of the c.1196A>G polymorphism of the X-ray repair cross-complementing group 1 (XRCC1 were associated with increased, and the G/G genotype and the G allele, with decreased KC occurrence. Also, the C/T and T as well as C/C genotypes and alleles of the c.580C>T polymorphism of the same gene displayed relationship with KC occurrence. Neither the g.46438521G>C polymorphism of the Nei endonuclease VIII-like 1 (NEIL1 nor the c.2285T>C polymorphism of the poly(ADP-ribose polymerase-1 (PARP-1 was associated with KC. In conclusion, the variability of the XRCC1 and POLG genes may play a role in KC pathogenesis and determine the risk of this disease.

  11. Germline Mutations in DNA Repair Genes in Lung Adenocarcinoma.

    Science.gov (United States)

    Parry, Erin M; Gable, Dustin L; Stanley, Susan E; Khalil, Sara E; Antonescu, Valentin; Florea, Liliana; Armanios, Mary

    2017-11-01

    Although lung cancer is generally thought to be environmentally provoked, anecdotal familial clustering has been reported, suggesting that there may be genetic susceptibility factors. We systematically tested whether germline mutations in eight candidate genes may be risk factors for lung adenocarcinoma. We studied lung adenocarcinoma cases for which germline sequence data had been generated as part of The Cancer Genome Atlas project but had not been previously analyzed. We selected eight genes, ATM serine/threonine kinase gene (ATM), BRCA2, DNA repair associated gene (BRCA2), checkpoint kinase 2 gene (CHEK2), EGFR, parkin RBR E3 ubiquitin protein ligase gene (PARK2), telomerase reverse transcriptase gene (TERT), tumor protein p53 gene (TP53), and Yes associated protein 1 gene (YAP1), on the basis of prior anecdotal association with lung cancer or genome-wide association studies. Among 555 lung adenocarcinoma cases, we detected 14 pathogenic mutations in five genes; they occurred at a frequency of 2.5% and represented an OR of 66 (95% confidence interval: 33-125, p mutations fell most commonly in ATM (50%), followed by TP53, BRCA2, EGFR, and PARK2. Most (86%) of these variants had been reported in other familial cancer syndromes. Another 12 cases (2%) carried ultrarare variants that were predicted to be deleterious by three protein prediction programs; these most frequently involved ATM and BRCA2. A subset of patients with lung adenocarcinoma, at least 2.5% to 4.5%, carry germline variants that have been linked to cancer risk in Mendelian syndromes. The genes fall most frequently in DNA repair pathways. Our data indicate that patients with lung adenocarcinoma, similar to other solid tumors, include a subset of patients with inherited susceptibility. Copyright © 2017 International Association for the Study of Lung Cancer. Published by Elsevier Inc. All rights reserved.

  12. The comet assay, DNA damage, DNA repair and cytotoxicity: hedgehogs are not always dead.

    Science.gov (United States)

    Lorenzo, Yolanda; Costa, Solange; Collins, Andrew R; Azqueta, Amaya

    2013-07-01

    DNA damage is commonly measured at the level of individual cells using the so-called comet assay (single-cell gel electrophoresis). As the frequency of DNA breaks increases, so does the fraction of the DNA extending towards the anode, forming the comet tail. Comets with almost all DNA in the tail are often referred to as 'hedgehog' comets and are widely assumed to represent apoptotic cells. We review the literature and present theoretical and empirical arguments against this interpretation. The level of DNA damage in these comets is far less than the massive fragmentation that occurs in apoptosis. 'Hedgehog' comets are formed after moderate exposure of cells to, for example, H2O2, but if the cells are incubated for a short period, 'hedgehogs' are no longer seen. We confirm that this is not because DNA has degraded further and been lost from the gel, but because the DNA is repaired. The comet assay may detect the earliest stages of apoptosis, but as it proceeds, comets disappear in a smear of unattached DNA. It is clear that 'hedgehogs' can correspond to one level on a continuum of genotoxic damage, are not diagnostic of apoptosis and should not be regarded as an indicator of cytotoxicity.

  13. Elevated N3-methylpurine-DNA glycosylase DNA repair activity is associated with lung cancer

    Energy Technology Data Exchange (ETDEWEB)

    Crosbie, Philip A.J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Watson, Amanda J. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Agius, Raymond [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom); Barber, Philip V. [North West Lung Centre, University Hospital of South Manchester, Manchester (United Kingdom); Margison, Geoffrey P. [Cancer Research UK Carcinogenesis Group, Paterson Institute for Cancer Research, University of Manchester, Manchester (United Kingdom); Povey, Andrew C., E-mail: apovey@manchester.ac.uk [Centre for Occupational and Environmental Health, Faculty of Medical and Human Sciences, University of Manchester, Manchester (United Kingdom)

    2012-04-01

    Tobacco smoke contains a range of chemical agents that can alkylate DNA. DNA repair proteins such as N3-methylpurine-DNA glycosylase (MPG) provide protection against cell killing and mutagenicity by removing lesions such as N7-methylguanine and N3-methyladenine. However, high levels of MPG activity in transfected mammalian cells in vitro have also been associated with increased genotoxicity. The aim of this study was to examine to what extent inter-individual differences in MPG activity modify susceptibility to lung cancer. Incident cases of lung cancer (n = 51) and cancer free controls (n = 88) were recruited from a hospital bronchoscopy unit. Repair activity was determined in a nuclear extract of peripheral blood mononuclear cells, using a [{sup 32}P]-based oligonucleotide cleavage assay (MPG substrate 5 Prime -CCGCT{epsilon}AGCGGGTACCGAGCTCGAAT; {epsilon}A = ethenoadenine). MPG activity was not related to sex or smoking status but was significantly higher in cases compared to controls (4.21 {+-} 1.67 fmol/{mu}g DNA/h vs 3.47 {+-} 1.35 fmol/{mu}g DNA/h, p = 0.005). After adjustment for age, sex, presence of chronic respiratory disease and smoking duration, patients in the highest tertile of MPG activity had a three fold increased probability of lung cancer (OR 3.00, 95% CI 1.16-7.75) when compared to those patients in the lowest tertile. These results suggest that elevated MPG activity is associated with lung cancer, possibly by creating an imbalance in the base excision repair pathway.

  14. GENETIC AND MOLECULAR ANALYSIS OF DNA DAMAGE REPAIR AND TOLERANCE PATHWAYS.

    Energy Technology Data Exchange (ETDEWEB)

    SUTHERLAND, B.M.

    2001-07-26

    Radiation can damage cellular components, including DNA. Organisms have developed a panoply of means of dealing with DNA damage. Some repair paths have rather narrow substrate specificity (e.g. photolyases), which act on specific pyrimidine photoproducts in a specific type (e.g., DNA) and conformation (double-stranded B conformation) of nucleic acid. Others, for example, nucleotide excision repair, deal with larger classes of damages, in this case bulky adducts in DNA. A detailed discussion of DNA repair mechanisms is beyond the scope of this article, but one can be found in the excellent book of Friedberg et al. [1] for further detail. However, some DNA damages and paths for repair of those damages important for photobiology will be outlined below as a basis for the specific examples of genetic and molecular analysis that will be presented below.

  15. The contribution of CMP kinase to the efficiency of DNA repair.

    Science.gov (United States)

    Tsao, Ning; Lee, Ming-Hsiang; Zhang, Wei; Cheng, Yung-Chi; Chang, Zee-Fen

    2015-01-01

    Cellular supply of deoxynucleoside triphosphates (dNTPs) is crucial for DNA replication and repair. In this study, we investigated the role of CMP/UMP kinase (CMPK), an enzyme catalyzes CDP formation, in DNA repair. Knockdown of CMPK delays DNA repair during recovery from UV damage in serum-deprived cells but not in the cells without serum deprivation. Exogenous supply of cytidine or deoxycytidine facilitates DNA repair dependent on CMPK in serum-deprived cells, suggesting that the synthesis of dCDP or CDP determines the rate of repair. However, CMPK knockdown does not affect the steady state level of dCTP in serum-deprived cells. We then found the localization of CMPK at DNA damage sites and its complex formation with Tip60 and ribonucleotide reductase. Our analysis demonstrated that the N-terminal 32-amino-acid of CMPK is required for its recruitment to DNA damage sites in a Tip60-dependent manner. Re-expression of wild-type but not N-terminus deleted CMPK restores the efficiency of DNA repair in CMPK knockdown cells. We proposed that site-specific dCDP formation via CMPK provides a means to facilitate DNA repair in serum-deprived cells.

  16. Dynamic control of strand excision during human DNA mismatch repair.

    Science.gov (United States)

    Jeon, Yongmoon; Kim, Daehyung; Martín-López, Juana V; Lee, Ryanggeun; Oh, Jungsic; Hanne, Jeungphill; Fishel, Richard; Lee, Jong-Bong

    2016-03-22

    Mismatch repair (MMR) is activated by evolutionarily conserved MutS homologs (MSH) and MutL homologs (MLH/PMS). MSH recognizes mismatched nucleotides and form extremely stable sliding clamps that may be bound by MLH/PMS to ultimately authorize strand-specific excision starting at a distant 3'- or 5'-DNA scission. The mechanical processes associated with a complete MMR reaction remain enigmatic. The purified human (Homo sapien or Hs) 5'-MMR excision reaction requires the HsMSH2-HsMSH6 heterodimer, the 5' → 3' exonuclease HsEXOI, and the single-stranded binding heterotrimer HsRPA. The HsMLH1-HsPMS2 heterodimer substantially influences 5'-MMR excision in cell extracts but is not required in the purified system. Using real-time single-molecule imaging, we show that HsRPA or Escherichia coli EcSSB restricts HsEXOI excision activity on nicked or gapped DNA. HsMSH2-HsMSH6 activates HsEXOI by overcoming HsRPA/EcSSB inhibition and exploits multiple dynamic sliding clamps to increase tract length. Conversely, HsMLH1-HsPMS2 regulates tract length by controlling the number of excision complexes, providing a link to 5' MMR.

  17. RECQL4 Promotes DNA End Resection in Repair of DNA Double-Strand Breaks

    DEFF Research Database (Denmark)

    Lu, Huiming; Shamanna, Raghavendra A; Keijzers, Guido

    2016-01-01

    The RecQ helicase RECQL4, mutated in Rothmund-Thomson syndrome, regulates genome stability, aging, and cancer. Here, we identify a crucial role for RECQL4 in DNA end resection, which is the initial and an essential step of homologous recombination (HR)-dependent DNA double-strand break repair (DSBR...... interacts with CtIP via its N-terminal domain and promotes CtIP recruitment to the MRN complex at DSBs. Moreover, inactivation of RECQL4's helicase activity impairs DNA end processing and HR-dependent DSBR without affecting its interaction with MRE11 and CtIP, suggesting an important role for RECQL4's......). Depletion of RECQL4 severely reduces HR-mediated repair and 5' end resection in vivo. RECQL4 physically interacts with MRE11-RAD50-NBS1 (MRN), which senses DSBs and initiates DNA end resection with CtIP. The MRE11 exonuclease regulates the retention of RECQL4 at laser-induced DSBs. RECQL4 also directly...

  18. Mutant Cockayne syndrome group B protein inhibits repair of DNA topoisomerase I-DNA covalent complex.

    Science.gov (United States)

    Horibata, Katsuyoshi; Saijo, Masafumi; Bay, Mui N; Lan, Li; Kuraoka, Isao; Brooks, Philip J; Honma, Masamitsu; Nohmi, Takehiko; Yasui, Akira; Tanaka, Kiyoji

    2011-01-01

    Two UV-sensitive syndrome patients who have mild photosensitivity without detectable somatic abnormalities lack detectable Cockayne syndrome group B (CSB) protein because of a homozygous null mutation in the CSB gene. In contrast, mutant CSB proteins are produced in CS-B patients with the severe somatic abnormalities of Cockayne syndrome and photosensitivity. It is known that the piggyBac transposable element derived 3 is integrated within the CSB intron 5, and that CSB-piggyBac transposable element derived 3 fusion (CPFP) mRNA is produced by alternative splicing. We found that CPFP or truncated CSB protein derived from CPFP mRNA was stably produced in CS-B patients, and that wild-type CSB, CPFP, and truncated CSB protein interacted with DNA topoisomerase I. We also found that CPFP inhibited repair of a camptothecin-induced topoisomerase I-DNA covalent complex. The inhibition was suppressed by the presence of wild-type CSB, consistent with the autosomal recessive inheritance of Cockayne syndrome. These results suggested that reduced repair of a DNA topoisomerase I-DNA covalent complex because of truncated CSB proteins is involved in the pathogenesis of CS-B. © 2010 The Authors. Journal compilation © 2010 by the Molecular Biology Society of Japan/Blackwell Publishing Ltd.

  19. Suppression of DNA-dependent protein kinase sensitize cells to radiation without affecting DSB repair

    Energy Technology Data Exchange (ETDEWEB)

    Gustafsson, Ann-Sofie, E-mail: ann-sofie.gustafsson@bms.uu.se; Abramenkovs, Andris; Stenerlöw, Bo

    2014-11-15

    Highlights: • We reduced the level of DNA-PKcs with siRNA and examined cells after γ-irradiation. • Low DNA-PKcs levels lead to radiosensitivity but did not affect repair of DSB. • Low DNA-PKcs levels may block progression of mitosis. • DNA-PKcs role in mitotic progression is independent of its role in DSB repair. • We suggest different mechanisms by which loss of DNA-PKcs function sensitize cells. - Abstract: Efficient and correct repair of DNA double-strand break (DSB) is critical for cell survival. Defects in the DNA repair may lead to cell death, genomic instability and development of cancer. The catalytic subunit of DNA-dependent protein kinase (DNA-PKcs) is an essential component of the non-homologous end joining (NHEJ) which is the major DSB repair pathway in mammalian cells. In the present study, by using siRNA against DNA-PKcs in four human cell lines, we examined how low levels of DNA-PKcs affected cellular response to ionizing radiation. Decrease of DNA-PKcs levels by 80–95%, induced by siRNA treatment, lead to extreme radiosensitivity, similar to that seen in cells completely lacking DNA-PKcs and low levels of DNA-PKcs promoted cell accumulation in G2/M phase after irradiation and blocked progression of mitosis. Surprisingly, low levels of DNA-PKcs did not affect the repair capacity and the removal of 53BP1 or γ-H2AX foci and rejoining of DSB appeared normal. This was in strong contrast to cells completely lacking DNA-PKcs and cells treated with the DNA-PKcs inhibitor NU7441, in which DSB repair were severely compromised. This suggests that there are different mechanisms by which loss of DNA-PKcs functions can sensitize cells to ionizing radiation. Further, foci of phosphorylated DNA-PKcs (T2609 and S2056) co-localized with DSB and this was independent of the amount of DNA-PKcs but foci of DNA-PKcs was only seen in siRNA-treated cells. Our study emphasizes on the critical role of DNA-PKcs for maintaining survival after radiation exposure

  20. Molecular characterization of the human excision repair gene ERCC-1: cDNA cloning and aminoacid homology with the yeast DNA repair gene RAD10.

    NARCIS (Netherlands)

    M. van Duin (Mark); J. de Wit (Jan); H. Odijk (Hanny); A. Westerveld (Andries); A. Yasui (Akira); M.H.M. Koken (Marcel); J.H.J. Hoeijmakers (Jan); D. Bootsma (Dirk)

    1986-01-01

    textabstractThe human excision repair gene ERCC-7 was cloned after DNA mediated gene transfer to the CHO mutant 43-38, which is sensitive to ultraviolet light and mitomycin-C. We describe the cloning and sequence analysis of the ERCC-7 cDNA and partial characterization of the gene. ERCC.1 has a size

  1. Gamma Radiation-induced Proteome of Deinococcus radiodurans Primarily Targets DNA Repair and Oxidative Stress Alleviation*

    Science.gov (United States)

    Basu, Bhakti; Apte, Shree Kumar

    2012-01-01

    The extraordinary radioresistance of Deinococcus radiodurans primarily originates from its efficient DNA repair ability. The kinetics of proteomic changes induced by a 6-kGy dose of gamma irradiation was mapped during the post-irradiation growth arrest phase by two-dimensional protein electrophoresis coupled with mass spectrometry. The results revealed that at least 37 proteins displayed either enhanced or de novo expression in the first 1 h of post-irradiation recovery. All of the radiation-responsive proteins were identified, and they belonged to the major functional categories of DNA repair, oxidative stress alleviation, and protein translation/folding. The dynamics of radiation-responsive protein levels throughout the growth arrest phase demonstrated (i) sequential up-regulation and processing of DNA repair proteins such as single-stranded DNA-binding protein (Ssb), DNA damage response protein A (DdrA), DNA damage response protein B (DdrB), pleiotropic protein promoting DNA repair (PprA), and recombinase A (RecA) substantiating stepwise genome restitution by different DNA repair pathways and (ii) concurrent early up-regulation of proteins involved in both DNA repair and oxidative stress alleviation. Among DNA repair proteins, Ssb was found to be the first and most abundant radiation-induced protein only to be followed by alternate Ssb, DdrB, indicating aggressive protection of single strand DNA fragments as the first line of defense by D. radiodurans, thereby preserving genetic information following radiation stress. The implications of both qualitative or quantitative and sequential or co-induction of radiation-responsive proteins for envisaged DNA repair mechanism in D. radiodurans are discussed. PMID:21989019

  2. 1999 Gordon Research Conference on Mammalian DNA Repair. Final Progress Report

    Energy Technology Data Exchange (ETDEWEB)

    NONE

    1999-02-12

    This Conference will examine DNA repair as the key component in genomic surveillance that is so crucial to the overall integrity and function of mammalian cells. Recent discoveries have catapulted the field of DNA repair into a pivotal position for fundamental investigations into oncology, aging, environmental health, and developmental biology. We hope to highlight the most promising and exciting avenues of research in robust discussions at this conference. This Mammalian DNA Repair Gordon Conference differs from the past conferences in this series, in which the programs were broader in scope, with respect to topics and biological systems covered. A conference sponsored by the Genetics Society in April 1998 emphasized recombinational mechanisms for double-strand break repair and the role of mismatch repair deficiency in colorectal cancer. These topics will therefore receive somewhat less emphasis in the upcoming Conference. In view of the recent mechanistic advances in mammalian DNA repair, an upcoming comprehensive DNA repair meeting next autumn at Hilton Head; and the limited enrollment for Gordon Conferences we have decided to focus session-by-session on particular areas of controversy and/or new developments specifically in mammalian systems. Thus, the principal presentations will draw upon results from other cellular systems only to the extent that they impact our understanding of mammalian DNA repair.

  3. The 2015 Nobel Prize in Chemistry The Discovery of Essential Mechanisms that Repair DNA Damage.

    Science.gov (United States)

    Lindahl, Tomas; Modrich, Paul; Sancar, Aziz

    2016-01-01

    The Royal Swedish Academy awarded the Nobel Prize in Chemistry for 2015 to Tomas Lindahl, Paul Modrich and Aziz Sancar for their discoveries in fundamental mechanisms of DNA repair. This pioneering research described three different essential pathways that correct DNA damage, safeguard the integrity of the genetic code to ensure its accurate replication through generations, and allow proper cell division. Working independently of each other, Tomas Lindahl, Paul Modrich and Aziz Sancar delineated the mechanisms of base excision repair, mismatch repair and nucleotide excision repair, respectively. These breakthroughs challenged and dismissed the early view that the DNA molecule was very stable, paving the way for the discovery of human hereditary diseases associated with distinct DNA repair deficiencies and a susceptibility to cancer. It also brought a deeper understanding of cancer as well as neurodegenerative or neurological diseases, and let to novel strategies to treat cancer.

  4. DNA-PKcs structure suggests an allosteric mechanism modulating DNA double-strand break repair.

    Science.gov (United States)

    Sibanda, Bancinyane L; Chirgadze, Dimitri Y; Ascher, David B; Blundell, Tom L

    2017-02-03

    DNA-dependent protein kinase catalytic subunit (DNA-PKcs) is a central component of nonhomologous end joining (NHEJ), repairing DNA double-strand breaks that would otherwise lead to apoptosis or cancer. We have solved its structure in complex with the C-terminal peptide of Ku80 at 4.3 angstrom resolution using x-ray crystallography. We show that the 4128-amino acid structure comprises three large structural units: the N-terminal unit, the Circular Cradle, and the Head. Conformational differences between the two molecules in the asymmetric unit are correlated with changes in accessibility of the kinase active site, which are consistent with an allosteric mechanism to bring about kinase activation. The location of KU80ct194 in the vicinity of the breast cancer 1 (BRCA1) binding site suggests competition with BRCA1, leading to pathway selection between NHEJ and homologous recombination. Copyright © 2017, American Association for the Advancement of Science.

  5. Computational studies of radiation and oxidative damage to DNA and its recognition by repair enzyme

    Energy Technology Data Exchange (ETDEWEB)

    Pinak, M. [Center for Promotion of Computational Science and Engineering, Tokai Research Establishment, Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan)

    2000-03-01

    Molecular dynamics (MD) simulation is used to study the time evolution of the recognition processes and to construct a model of the specific DNA-repair enzyme' complexes. MD simulations of the following molecules were performed: DNA dodecamer with thymine dimer (TD), DNA 30-mer with thymine glycol (TG), and respective specific repair enzymes T4 Endonuclease V and Endonuclease III. Both DNA lesions are experimentally suggested to be mutagenic and carcinogenic unless properly recognized and repaired by repair enzymes. In the case of TD, there is detected a strong kink around the TD site, that is not observed in native DNA. In addition there is observed a different value of electrostatic energy at the TD site - negative '-9 kcal/mol', in contrast to the nearly neutral value of the native thymine site. These two factors - structural changes and specific electrostatic energy - seem to be important for proper recognition of a TD damaged site and for formation of DNA-enzyme complex. Formation of this complex is the onset of the repair of DNA. In the case of TG damaged DNA the structural characteristics of the TG were calculated (charges, bond lengths, bond angles, etc.). The formed TG was used to replace the native thymine and then submitted to the simulation in the system with a repair enzyme with Endonuclease III for the purpose of the study of the formation of the DNA-enzyme complex. (author)

  6. Human DNA Glycosylase NEIL1’s Interactions with Downstream Repair Proteins Is Critical for Efficient Repair of Oxidized DNA Base Damage and Enhanced Cell Survival

    Directory of Open Access Journals (Sweden)

    Istvan Boldogh

    2012-11-01

    Full Text Available NEIL1 is unique among the oxidatively damaged base repair-initiating DNA glycosylases in the human genome due to its S phase-specific activation and ability to excise substrate base lesions from single-stranded DNA. We recently characterized NEIL1’s specific binding to downstream canonical repair and non-canonical accessory proteins, all of which involve NEIL1’s disordered C-terminal segment as the common interaction domain (CID. This domain is dispensable for NEIL1’s base excision and abasic (AP lyase activities, but is required for its interactions with other repair proteins. Here, we show that truncated NEIL1 lacking the CID is markedly deficient in initiating in vitro repair of 5-hydroxyuracil (an oxidative deamination product of C in a plasmid substrate compared to the wild-type NEIL1, thus suggesting a critical role of CID in the coordination of overall repair. Furthermore, while NEIL1 downregulation significantly sensitized human embryonic kidney (HEK 293 cells to reactive oxygen species (ROS, ectopic wild-type NEIL1, but not the truncated mutant, restored resistance to ROS. These results demonstrate that cell survival and NEIL1-dependent repair of oxidative DNA base damage require interactions among repair proteins, which could be explored as a cancer therapeutic target in order to increase the efficiency of chemo/radiation treatment.

  7. [Chromosome breakage syndrome and fragile X syndrome].

    Science.gov (United States)

    Shiraishi, Y

    1995-11-01

    Chromosome instability is a characteristic cytogenetic feature of a number of genetically determined human disorders collectively known as chromosome breakage syndromes. Included among the disorders are Bloom's syndrome (BS), Fanconi's anemia (FA), ataxia telangiectasia (AT). In each of the syndromes chromosome instability exists in the form of increased frequencies of breaks and interchanges occurring either spontaneously or following treatment with various DNA-damaging agents. These diseases have in common an autosomal recessive transmission and an increased tendency to develop malignancies. The blood cells of subjects with AT, BS, or FA are significantly more radiosensitive than those of controls, particularly in the occurrence of chromosome aberrations.

  8. Elevated level of DNA damage and impaired repair of oxidative DNA damage in patients with recurrent depressive disorder.

    Science.gov (United States)

    Czarny, Piotr; Kwiatkowski, Dominik; Kacperska, Dagmara; Kawczyńska, Daria; Talarowska, Monika; Orzechowska, Agata; Bielecka-Kowalska, Anna; Szemraj, Janusz; Gałecki, Piotr; Śliwiński, Tomasz

    2015-02-06

    Depressive disorder (DD), including recurrent DD (rDD), is a severe psychological disease, which affects a large percentage of the world population. Although pathogenesis of the disease is not known, a growing body of evidence shows that inflammation together with oxidative stress may contribute to development of DD. Since reactive oxygen species produced during stress may damage DNA, we wanted to evaluate the extent of DNA damage and efficiency of DNA repair in patients with depression. We measured and compared the extent of endogenous DNA damage--single- and double-strand breaks, alkali-labile sites, and oxidative damage of the pyrimidines and purines--in peripheral blood mononuclear cells isolated from rDD patients (n=40) and healthy controls (n=46) using comet assay. We also measured DNA damage evoked by hydrogen peroxide and monitored changes in DNA damage during repair incubation. We found an increased number DNA breaks, alkali-labile sites, and oxidative modification of DNA bases in the patients compared to the controls. Exposure to hydrogen peroxide evoked the same increased damage in both groups. Examination of the repair kinetics of both groups revealed that the lesions were more efficiently repaired in the controls than in the patients. For the first time we showed that patients with depression, compared with non-depresses individuals, had more DNA breaks, alkali-labile sites, and oxidative DNA damage, and that those lesions may be accumulated by impairments of the DNA repair systems. More studies must be conducted to elucidate the role of DNA damage and repair in depression.

  9. Phosphoramide mustard exposure induces DNA adduct formation and the DNA damage repair response in rat ovarian granulosa cells

    Energy Technology Data Exchange (ETDEWEB)

    Ganesan, Shanthi, E-mail: shanthig@iastate.edu; Keating, Aileen F., E-mail: akeating@iastate.edu

    2015-02-01

    Phosphoramide mustard (PM), the ovotoxic metabolite of the anti-cancer agent cyclophosphamide (CPA), destroys rapidly dividing cells by forming NOR-G-OH, NOR-G and G-NOR-G adducts with DNA, potentially leading to DNA damage. A previous study demonstrated that PM induces ovarian DNA damage in rat ovaries. To investigate whether PM induces DNA adduct formation, DNA damage and induction of the DNA repair response, rat spontaneously immortalized granulosa cells (SIGCs) were treated with vehicle control (1% DMSO) or PM (3 or 6 μM) for 24 or 48 h. Cell viability was reduced (P < 0.05) after 48 h of exposure to 3 or 6 μM PM. The NOR-G-OH DNA adduct was detected after 24 h of 6 μM PM exposure, while the more cytotoxic G-NOR-G DNA adduct was formed after 48 h by exposure to both PM concentrations. Phosphorylated H2AX (γH2AX), a marker of DNA double stranded break occurrence, was also increased by PM exposure, coincident with DNA adduct formation. Additionally, induction of genes (Atm, Parp1, Prkdc, Xrcc6, and Brca1) and proteins (ATM, γH2AX, PARP-1, PRKDC, XRCC6, and BRCA1) involved in DNA repair were observed in both a time- and dose-dependent manner. These data support that PM induces DNA adduct formation in ovarian granulosa cells, induces DNA damage and elicits the ovarian DNA repair response. - Highlights: • PM forms ovarian DNA adducts. • DNA damage marker γH2AX increased by PM exposure. • PM induces ovarian DNA double strand break repair.

  10. Persistence of Breakage in Specific Chromosome Bands 6 Years after Acute Exposure to Oil.

    Directory of Open Access Journals (Sweden)

    Alexandra Francés

    Full Text Available The identification of breakpoints involved in chromosomal damage could help to detect genes involved in genetic disorders, most notably cancer. Until now, only one published study, carried out by our group, has identified chromosome bands affected by exposure to oil from an oil spill. In that study, which was performed two years after the initial oil exposure in individuals who had participated in clean-up tasks following the wreck of the Prestige, three chromosomal bands (2q21, 3q27, 5q31 were found to be especially prone to breakage. A recent follow-up study, performed on the same individuals, revealed that the genotoxic damage had persisted six years after oil exposure.To determine whether there exist chromosome bands which are especially prone to breakages and to know if there is some correlation with those detected in the previous study. In addition, to investigate if the DNA repair problems detected previously persist in the present study.Follow-up study performed six years after the Prestige oil spill.Fishermen cooperatives in coastal villages.Fishermen highly exposed to oil spill who participated in previous genotoxic study six years after the oil.Chromosome damage in peripheral lymphocytes. For accurate identification of the breakpoints involved in chromosome damage of circulating lymphocytes, a sequential stain/G-banding technique was employed. To determine the most break-prone chromosome bands, two statistical methods, the Fragile Site Multinomial and the chi-square tests (where the bands were corrected by their length were used. To compare the chromosome lesions, structural chromosome alterations and gaps/breaks between two groups of individuals we used the GEE test which takes into account a possible within-individual correlation. Dysfunctions in DNA repair mechanisms, expressed as chromosome damage, were assessed in cultures with aphidicolin by the GEE test.Cytogenetic analyses were performed in 47 exposed individuals. A total of

  11. Influence of XRCC1 Genetic Polymorphisms on Ionizing Radiation-Induced DNA Damage and Repair

    Directory of Open Access Journals (Sweden)

    Silvia Sterpone

    2010-01-01

    Full Text Available It is well known that ionizing radiation (IR can damage DNA through a direct action, producing single- and double-strand breaks on DNA double helix, as well as an indirect effect by generating oxygen reactive species in the cells. Mammals have evolved several and distinct DNA repair pathways in order to maintain genomic stability and avoid tumour cell transformation. This review reports important data showing a huge interindividual variability on sensitivity to IR and in susceptibility to developing cancer; this variability is principally represented by genetic polymorphisms, that is, DNA repair gene polymorphisms. In particular we have focussed on single nucleotide polymorphisms (SNPs of XRCC1, a gene that encodes for a scaffold protein involved basically in Base Excision Repair (BER. In this paper we have reported and presented recent studies that show an influence of XRCC1 variants on DNA repair capacity and susceptibility to breast cancer.

  12. The DNA-dependent protein kinase: a multifunctional protein kinase with roles in DNA double strand break repair and mitosis

    Science.gov (United States)

    Jette, Nicholas; Lees-Miller, Susan P.

    2015-01-01

    The DNA-dependent protein kinase (DNA-PK) is a serine/threonine protein kinase composed of a large catalytic subunit (DNA-PKcs) and the Ku70/80 heterodimer. Over the past two decades, significant progress has been made in elucidating the role of DNA-PK in non-homologous end joining (NHEJ), the major pathway for repair of ionizing radiation-induced DNA double strand breaks in human cells and recently, additional roles for DNA-PK have been reported. In this review, we will describe the biochemistry, structure and function of DNA-PK, its roles in DNA double strand break repair and its newly described roles in mitosis and other cellular processes. PMID:25550082

  13. Coupling of Human DNA Excision Repair and the DNA Damage Checkpoint in a Defined in Vitro System*

    Science.gov (United States)

    Lindsey-Boltz, Laura A.; Kemp, Michael G.; Reardon, Joyce T.; DeRocco, Vanessa; Iyer, Ravi R.; Modrich, Paul; Sancar, Aziz

    2014-01-01

    DNA repair and DNA damage checkpoints work in concert to help maintain genomic integrity. In vivo data suggest that these two global responses to DNA damage are coupled. It has been proposed that the canonical 30 nucleotide single-stranded DNA gap generated by nucleotide excision repair is the signal that activates the ATR-mediated DNA damage checkpoint response and that the signal is enhanced by gap enlargement by EXO1 (exonuclease 1) 5′ to 3′ exonuclease activity. Here we have used purified core nucleotide excision repair factors (RPA, XPA, XPC, TFIIH, XPG, and XPF-ERCC1), core DNA damage checkpoint proteins (ATR-ATRIP, TopBP1, RPA), and DNA damaged by a UV-mimetic agent to analyze the basic steps of DNA damage checkpoint response in a biochemically defined system. We find that checkpoint signaling as measured by phosphorylation of target proteins by the ATR kinase requires enlargement of the excision gap generated by the excision repair system by the 5′ to 3′ exonuclease activity of EXO1. We conclude that, in addition to damaged DNA, RPA, XPA, XPC, TFIIH, XPG, XPF-ERCC1, ATR-ATRIP, TopBP1, and EXO1 constitute the minimum essential set of factors for ATR-mediated DNA damage checkpoint response. PMID:24403078

  14. DNA Repair Dysfunction and Neurodegeneration: Lessons From Rare Pediatric Disorders.

    Science.gov (United States)

    Shabbir, Syed H

    2016-03-01

    Nucleotide excision repair disorders display a wide range of clinical syndromes and presentations, all associated at the molecular level by dysfunction of genes participating in the nucleotide excision repair pathway. Genotype-phenotype relationships are remarkably complex and not well understood. This article outlines neurodegenerative symptoms seen in nucleotide excision repair disorders and explores the role that nucleotide excision repair dysfunction can play in the pathogenesis of chronic neurodegenerative diseases. © The Author(s) 2015.

  15. 1-beta-D-Arabinofuranosylcytosine is Cytotoxic in Quiescent Normal Lymphocytes Undergoing DNA Excision Repair

    OpenAIRE

    Yamauchi, Takahiro; Kawai, Yasukazu; Ueda, Takanori

    2002-01-01

    We have sought to clarify the potential activity of S-phase specific antileukemic agent 1--D-arabinofuranosylcytosine (ara-C), an inhibitor of DNA synthesis, in quiescent cells that are substantially non-sensitive to nucleoside analogues. It was hypothesized that the combination of ara-C with DNA damaging agents that initiate DNA repair will expand ara-C cytotoxicity to non-cycling cells. The repair kinetics, which included incision of damaged DNA, gap filling by DNA synthesis and rejoinin...

  16. Genetic and environmental influence on DNA strand break repair: a twin study

    DEFF Research Database (Denmark)

    Garm, Christian; Moreno-Villanueva, Maria; Bürkle, Alexander

    2013-01-01

    Accumulation of DNA damage deriving from exogenous and endogenous sources has significant consequences for cellular survival, and is implicated in aging, cancer, and neurological diseases. Different DNA repair pathways have evolved in order to maintain genomic stability. Genetic and environmental......-strand breaks), and some of the most hazardous lesions (DNA double-strand breaks). DNA damage signaling response (Gamma-H2AX signaling), relative amount of endogenous damage, and DNA-strand break repair capacities were studied in peripheral blood mononuclear cells from 198 twins (94 monozygotic and 104...

  17. Molecular dynamics of formation of TD lesioned DNA complexed with repair enzyme - onset of the enzymatic repair process

    Energy Technology Data Exchange (ETDEWEB)

    Pinak, Miroslav [Japan Atomic Energy Research Inst., Tokai, Ibaraki (Japan). Tokai Research Establishment

    1999-12-01

    To describe the first step of the enzymatic repair process (formation of complex enzyme-DNA), in which the thymine dimer (TD) part is removed from DNA, the 500 picosecond (ps) molecular dynamics (MD) simulation of TD lesioned DNA and part of repair enzyme cell (inclusive of catalytic center - Arg-22, Glu-23, Arg-26 and Thr-2) was performed. TD is UV originated lesion in DNA and T4 Endonuclease V is TD specific repair enzyme. Both molecules were located in the same simulation cell and their relative movement was examined. During the simulation the research was focused on the role of electrostatic energy in formation of complex enzyme-DNA. It is found, that during the first 100 ps of MD, the part of enzyme approaches the DNA surface at the TD lesion, interacts extensively by electrostatic and van der Walls interactions with TD part of DNA and forms complex that lasts stabile for 500 ps of MD. In the beginning of MD, the positive electrostatic interaction energy between part of enzyme and TD ({approx} +10 kcal/mol) drives enzyme towards the DNA molecule. Water-mediated hydrogen bonds between enzyme and DNA help to keep complex stabile. As a reference, the MD simulation of the identical system with native DNA molecule (two native thymines (TT) instead of TD) was performed. In this system the negative electrostatic interaction energy between part of enzyme and TT ({approx} -11 kcal/mol), in contrary to the positive one in the system with TD, doesn't drive enzyme towards DNA and complex is not formed. (author)

  18. Efficient DNA Repair: A Cell’s Fountain of Youth? | Center for Cancer Research

    Science.gov (United States)

    Given the central importance of the genome to a cell’s function, it is not surprising that there are a number of proteins devoted to sensing and repairing DNA damage. But what happens when these repair proteins do not work properly? Cancer is one possible outcome, and a growing body of evidence also indicates that the cellular response to DNA damage plays a key role in the aging process. This concept is supported by the fact that many premature aging syndromes are caused by mutations in DNA repair proteins.

  19. DNA Damage Signalling and Repair Inhibitors: The Long-Sought-After Achilles’ Heel of Cancer

    Science.gov (United States)

    Velic, Denis; Couturier, Anthony M.; Ferreira, Maria Tedim; Rodrigue, Amélie; Poirier, Guy G.; Fleury, Fabrice; Masson, Jean-Yves

    2015-01-01

    For decades, radiotherapy and chemotherapy were the two only approaches exploiting DNA repair processes to fight against cancer. Nowadays, cancer therapeutics can be a major challenge when it comes to seeking personalized targeted medicine that is both effective and selective to the malignancy. Over the last decade, the discovery of new targeted therapies against DNA damage signalling and repair has offered the possibility of therapeutic improvements in oncology. In this review, we summarize the current knowledge of DNA damage signalling and repair inhibitors, their molecular and cellular effects, and future therapeutic use. PMID:26610585

  20. Recent progress with the DNA repair mutants of Chinese hamster ovary cells

    Energy Technology Data Exchange (ETDEWEB)

    Thompson, L.H.; Salazar, E.P.; Brookman, K.W.; Collins, C.C.; Stewart, S.A.; Busch, D.B.; Weber, C.A.

    1986-04-02

    Repair deficient mutants of Chinese hamster ovary (CHO) cells are being used to identify human genes that correct the repair defects and to study mechanisms of DNA repair and mutagenesis. Five independent tertiary DNA transformants were obtained from the EM9 mutant. In these clones a human DNA sequence was identified that correlated with the resistance of the cells to CldUrd. After Eco RI digestion, Southern transfer, and hybridization of transformant DNAs with the BLUR-8 Alu family sequence, a common fragment of 25 to 30 kb was present. 37 refs., 4 figs., 3 tabs.

  1. DNA damage and gene therapy of xeroderma pigmentosum, a human DNA repair-deficient disease

    Energy Technology Data Exchange (ETDEWEB)

    Dupuy, Aurélie [Laboratory of Genetic Instability and Oncogenesis UMR8200CNRS, Institut Gustave Roussy and University Paris-Sud, Villejuif (France); Sarasin, Alain, E-mail: alain.sarasin@gustaveroussy.fr [Laboratory of Genetic Instability and Oncogenesis UMR8200CNRS, Institut Gustave Roussy and University Paris-Sud, Villejuif (France); Service de Génétique, Institut Gustave Roussy (France)

    2015-06-15

    Graphical abstract: - Highlights: • Full correction of mutation in the XPC gene by engineered nucleases. • Meganucleases and TALENs are inhibited by 5-MeC for inducing double strand breaks. • Gene therapy of XP cells is possible using homologous recombination for DSB repair. - Abstract: Xeroderma pigmentosum (XP) is a genetic disease characterized by hypersensitivity to ultra-violet and a very high risk of skin cancer induction on exposed body sites. This syndrome is caused by germinal mutations on nucleotide excision repair genes. No cure is available for these patients except a complete protection from all types of UV radiations. We reviewed the various techniques to complement or to correct the genetic defect in XP cells. We, particularly, developed the correction of XP-C skin cells using the fidelity of the homologous recombination pathway during repair of double-strand break (DSB) in the presence of XPC wild type sequences. We used engineered nucleases (meganuclease or TALE nuclease) to induce a DSB located at 90 bp of the mutation to be corrected. Expression of specific TALE nuclease in the presence of a repair matrix containing a long stretch of homologous wild type XPC sequences allowed us a successful gene correction of the original TG deletion found in numerous North African XP patients. Some engineered nucleases are sensitive to epigenetic modifications, such as cytosine methylation. In case of methylated sequences to be corrected, modified nucleases or demethylation of the whole genome should be envisaged. Overall, we showed that specifically-designed TALE-nuclease allowed us to correct a 2 bp deletion in the XPC gene leading to patient's cells proficient for DNA repair and showing normal UV-sensitivity. The corrected gene is still in the same position in the human genome and under the regulation of its physiological promoter. This result is a first step toward gene therapy in XP patients.

  2. Efficient repair of DNA breaks in Drosophila: evidence for single-strand annealing and competition with other repair pathways.

    Science.gov (United States)

    Preston, Christine R; Engels, William; Flores, Carlos

    2002-06-01

    We show evidence that DNA double-strand breaks induced in the Drosophila germ line can be repaired very efficiently by the single-strand annealing (SSA) mechanism. A double-strand break was made between two copies of a 1290-bp direct repeat by mobilizing a P transposon. In >80% of the progeny that acquired this chromosome, repair resulted in loss of the P element and loss of one copy of the repeat, as observed in SSA. The frequency of this repair was much greater than seen for gene conversion using an allelic template, which is only approximately 7%. A similar structure, but with a smaller duplication of only 158 bp, also yielded SSA-like repair events, but at a reduced frequency, and gave rise to some products by repair pathways other than SSA. The 1290-bp repeats carried two sequence polymorphisms that were examined in the products. The allele nearest to a nick in the putative heteroduplex intermediate was lost most often. This bias is predicted by the SSA model, although other models could account for it. We conclude that SSA is the preferred repair pathway in Drosophila for DNA breaks between sequence repeats, and it competes with gene conversion by the synthesis-dependent strand annealing (SDSA) pathway.

  3. Influence of Morinda citrifolia (Noni) on Expression of DNA Repair Genes in Cervical Cancer Cells.

    Science.gov (United States)

    Gupta, Rakesh Kumar; Bajpai, Deepti; Singh, Neeta

    2015-01-01

    Previous studies have suggested that Morinda citrifolia (Noni) has potential to reduce cancer risk. The purpose of this study was to investigate the effect of Noni, cisplatin, and their combination on DNA repair genes in the SiHa cervical cancer cell line. SiHa cells were cultured and treated with 10% Noni, 10 μg/dl cisplatin or their combination for 24 hours. Post culturing, the cells were pelleted, RNA extracted, and processed for investigating DNA repair genes by real time PCR. The expression of nucleotide excision repair genes ERCC1, ERCC2, and ERCC4 and base excision repair gene XRCC1 was increased 4 fold, 8.9 fold, 4 fold, and 5.5 fold, respectively, on treatment with Noni as compared to untreated controls (p<0.05). In contrast, expression was found to be decreased 22 fold, 13 fold, 16 fold, and 23 fold on treatment with cisplatin (p<0.05). However, the combination of Noni and cisplatin led to an increase of 2 fold, 1.6 fold, 3 fold, 1.2 fold, respectively (p<0.05). Noni enhanced the expression of DNA repair genes by itself and in combination with cisplatin. However, high expression of DNA repair genes at mRNA level only signifies efficient DNA transcription of the above mentioned genes; further investigations are needed to evaluate the DNA repair protein expression.

  4. Genotoxic stress and DNA repair in plants: emerging functions and tools for improving crop productivity.

    Science.gov (United States)

    Balestrazzi, Alma; Confalonieri, Massimo; Macovei, Anca; Donà, Mattia; Carbonera, Daniela

    2011-03-01

    Crop productivity is strictly related to genome stability, an essential requisite for optimal plant growth/development. Genotoxic agents (e.g., chemical agents, radiations) can cause both chemical and structural damage to DNA. In some cases, they severely affect the integrity of plant genome by inducing base oxidation, which interferes with the basal processes of replication and transcription, eventually leading to cell death. The cell response to oxidative stress includes several DNA repair pathways, which are activated to remove the damaged bases and other lesions. Information concerning DNA repair in plants is still limited, although results from gene profiling and mutant analysis suggest possible differences in repair mechanisms between plants and other eukaryotes. The present review focuses on the base- and nucleotide excision repair (BER, NER) pathways, which operate according to the most common DNA repair rule (excision of damaged bases and replacement by the correct nucleotide), highlighting the most recent findings in plants. An update on DNA repair in organelles, chloroplasts and mitochondria is also provided. Finally, it is generally acknowledged that DNA repair plays a critical role during seed imbibition, preserving seed vigor. Despite this, only a limited number of studies, described here, dedicated to seeds are currently available.

  5. Interactions of replication versus repair DNA substrates with the Pol I DNA polymerases from Escherichia coli and Thermus aquaticus.

    Science.gov (United States)

    Yang, Yanling; LiCata, Vince J

    2011-11-01

    Different DNA polymerases partition differently between replication and repair pathways. In this study we examine if two Pol I family polymerases from evolutionarily distant organisms also differ in their preferences for replication versus repair substrates. The DNA binding preferences of Klenow and Klentaq DNA polymerases, from Escherichia coli and Thermus aquaticus respectively, have been studied using a fluorescence competition binding assay. Klenow polymerase binds primed-template DNA (the replication substrate) with up to 50× higher affinity than it binds to nicked DNA, DNA with a 2 base single-stranded gap, blunt-ended DNA, or to a DNA end with a 3' overhang. In contrast, Klentaq binds all of these DNAs almost identically, indicating that Klenow has a stronger ability to discriminate between replication and repair substrates than Klentaq. In contrast, both polymerases bind mismatched primed-template and blunt-ended DNA tighter than they bind matched primed-template DNA, suggesting that these two proteins may share a similar mechanism to identify mismatched DNA, despite the fact that Klentaq has no proofreading ability. In addition, the presence or absence of 5'- or 3'-phosphates has slightly different effects on DNA binding by the two polymerases, but again reinforce Klenow's more effective substrate discrimination capability. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Divergent Requirement for a DNA Repair Enzyme during Enterovirus Infections

    Directory of Open Access Journals (Sweden)

    Sonia Maciejewski

    2015-12-01

    Full Text Available Viruses of the Enterovirus genus of picornaviruses, including poliovirus, coxsackievirus B3 (CVB3, and human rhinovirus, commandeer the functions of host cell proteins to aid in the replication of their small viral genomic RNAs during infection. One of these host proteins is a cellular DNA repair enzyme known as 5′ tyrosyl-DNA phosphodiesterase 2 (TDP2. TDP2 was previously demonstrated to mediate the cleavage of a unique covalent linkage between a viral protein (VPg and the 5′ end of picornavirus RNAs. Although VPg is absent from actively translating poliovirus mRNAs, the removal of VPg is not required for the in vitro translation and replication of the RNA. However, TDP2 appears to be excluded from replication and encapsidation sites during peak times of poliovirus infection of HeLa cells, suggesting a role for TDP2 during the viral replication cycle. Using a mouse embryonic fibroblast cell line lacking TDP2, we found that TDP2 is differentially required among enteroviruses. Our single-cycle viral growth analysis shows that CVB3 replication has a greater dependency on TDP2 than does poliovirus or human rhinovirus replication. During infection, CVB3 protein accumulation is undetectable (by Western blot analysis in the absence of TDP2, whereas poliovirus protein accumulation is reduced but still detectable. Using an infectious CVB3 RNA with a reporter, CVB3 RNA could still be replicated in the absence of TDP2 following transfection, albeit at reduced levels. Overall, these results indicate that TDP2 potentiates viral replication during enterovirus infections of cultured cells, making TDP2 a potential target for antiviral development for picornavirus infections.

  7. The Modified Human DNA Repair Enzyme O6-Methylguanine-DNA Methyltransferase Is a Negative Regulator of Estrogen Receptor-Mediated Transcription upon Alkylation DNA Damage

    OpenAIRE

    Teo, Alvin K. C.; Oh, Hue Kian; Ali, Rahmen B.; Li, Benjamin F. L.

    2001-01-01

    Cell proliferation requires precise control to prevent mutations from replication of (unrepaired) damaged DNA in cells exposed spontaneously to mutagens. Here we show that the modified human DNA repair enzyme O6-methylguanine-DNA methyltransferase (R-MGMT), formed from the suicidal repair of the mutagenic O6-alkylguanine (6RG) lesions by MGMT in the cells exposed to alkylating carcinogens, functions in such control by preventing the estrogen receptor (ER) from transcription activation that me...

  8. Triple Negative Breast Cancers Have a Reduced Expression of DNA Repair Genes

    Science.gov (United States)

    Andreis, Daniele; Bertoni, Ramona; Giardini, Roberto; Fox, Stephen B.; Broggini, Massimo; Bottini, Alberto; Zanoni, Vanessa; Bazzola, Letizia; Foroni, Chiara; Generali, Daniele; Damia, Giovanna

    2013-01-01

    DNA repair is a key determinant in the cellular response to therapy and tumor repair status could play an important role in tailoring patient therapy. Our goal was to evaluate the mRNA of 13 genes involved in different DNA repair pathways (base excision, nucleotide excision, homologous recombination, and Fanconi anemia) in paraffin embedded samples of triple negative breast cancer (TNBC) compared to luminal A breast cancer (LABC). Most of the genes involved in nucleotide excision repair and Fanconi Anemia pathways, and CHK1 gene were significantly less expressed in TNBC than in LABC. PARP1 levels were higher in TNBC than in LABC. In univariate analysis high level of FANCA correlated with an increased overall survival and event free survival in TNBC; however multivariate analyses using Cox regression did not confirm FANCA as independent prognostic factor. These data support the evidence that TNBCs compared to LABCs harbour DNA repair defects. PMID:23825533

  9. Polymorphisms of Selected DNA Repair Genes and Lung Cancer in Chromium Exposure.

    Science.gov (United States)

    Halasova, E; Matakova, T; Skerenova, M; Krutakova, M; Slovakova, P; Dzian, A; Javorkova, S; Pec, M; Kypusova, K; Hamzik, J

    2016-01-01

    Chromium is a well-known mutagen and carcinogen involved in lung cancer development. DNA repair genes play an important role in the elimination of genetic changes caused by chromium exposure. In the present study, we investigated the polymorphisms of the following DNA repair genes: XRCC3, participating in the homologous recombination repair, and hMLH1 and hMSH2, functioning in the mismatch repair. We focused on the risk the polymorphisms present in the development of lung cancer regarding the exposure to chromium. We analyzed 106 individuals; 45 patients exposed to chromium with diagnosed lung cancer and 61 healthy controls. Genotypes were determined by a PCR-RFLP method. We unravelled a potential for increased risk of lung cancer development in the hMLH1 (rs1800734) AA genotype in the recessive model. In conclusion, gene polymorphisms in the DNA repair genes underscores the risk of lung cancer development in chromium exposed individuals.

  10. The Yin and Yang of Repair Mechanisms in DNA Structure-induced Genetic Instability

    Science.gov (United States)

    Vasquez, Karen M.; Wang, Guliang

    2013-01-01

    DNA can adopt a variety of secondary structures that deviate from the canonical Watson-Crick B-DNA form. More than 10 types of non-canonical or non-B DNA secondary structures have been characterized, and the sequences that have the capacity to adopt such structures are very abundant in the human genome. Non-B DNA structures have been implicated in many important biological processes and can serve as sources of genetic instability, implicating them in disease and evolution. Non-B DNA conformations interact with a wide variety of proteins involved in replication, transcription, DNA repair, and chromatin architectural regulation. In this review, we will focus on the interactions of DNA repair proteins with non-B DNA and their roles in genetic instability, as the proteins and DNA involved in such interactions may represent plausible targets for selective therapeutic intervention. PMID:23219604

  11. Mouse models of DNA mismatch repair in cancer research.

    Science.gov (United States)

    Lee, Kyeryoung; Tosti, Elena; Edelmann, Winfried

    2016-02-01

    Germline mutations in DNA mismatch repair (MMR) genes are the cause of hereditary non-polyposis colorectal cancer/Lynch syndrome (HNPCC/LS) one of the most common cancer predisposition syndromes, and defects in MMR are also prevalent in sporadic colorectal cancers. In the past, the generation and analysis of mouse lines with knockout mutations in all of the known MMR genes has provided insight into how loss of individual MMR genes affects genome stability and contributes to cancer susceptibility. These studies also revealed essential functions for some of the MMR genes in B cell maturation and fertility. In this review, we will provide a brief overview of the cancer predisposition phenotypes of recently developed mouse models with targeted mutations in MutS and MutL homologs (Msh and Mlh, respectively) and their utility as preclinical models. The focus will be on mouse lines with conditional MMR mutations that have allowed more accurate modeling of human cancer syndromes in mice and that together with new technologies in gene targeting, hold great promise for the analysis of MMR-deficient intestinal tumors and other cancers which will drive the development of preventive and therapeutic treatment strategies. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Genome analysis of DNA repair genes in the alpha proteobacterium Caulobacter crescentus

    Directory of Open Access Journals (Sweden)

    Menck Carlos FM

    2007-03-01

    Full Text Available Abstract Background The integrity of DNA molecules is fundamental for maintaining life. The DNA repair proteins protect organisms against genetic damage, by removal of DNA lesions or helping to tolerate them. DNA repair genes are best known from the gamma-proteobacterium Escherichia coli, which is the most understood bacterial model. However, genome sequencing raises questions regarding uniformity and ubiquity of these DNA repair genes and pathways, reinforcing the need for identifying genes and proteins, which may respond to DNA damage in other bacteria. Results In this study, we employed a bioinformatic approach, to analyse and describe the open reading frames potentially related to DNA repair from the genome of the alpha-proteobacterium Caulobacter crescentus. This was performed by comparison with known DNA repair related genes found in public databases. As expected, although C. crescentus and E. coli bacteria belong to separate phylogenetic groups, many of their DNA repair genes are very similar. However, some important DNA repair genes are absent in the C. crescentus genome and other interesting functionally related gene duplications are present, which do not occur in E. coli. These include DNA ligases, exonuclease III (xthA, endonuclease III (nth, O6-methylguanine-DNA methyltransferase (ada gene, photolyase-like genes, and uracil-DNA-glycosylases. On the other hand, the genes imuA and imuB, which are involved in DNA damage induced mutagenesis, have recently been described in C. crescentus, but are absent in E. coli. Particularly interesting are the potential atypical phylogeny of one of the photolyase genes in alpha-proteobacteria, indicating an origin by horizontal transfer, and the duplication of the Ada orthologs, which have diverse structural configurations, including one that is still unique for C. crescentus. Conclusion The absence and the presence of certain genes are discussed and predictions are made considering the particular

  13. Non-DBS DNA Repair Genes Regulate Radiation-induced Cytogenetic Damage Repair and Cell Cycle Progression

    Science.gov (United States)

    Zhang, Ye; Rohde, Larry H.; Emami, Kamal; Casey, Rachael; Wu, Honglu

    2008-01-01

    Changes of gene expression profile are one of the most important biological responses in living cells after ionizing radiation (IR) exposure. Although some studies have shown that genes up-regulated by IR may play important roles in DNA damage repair, the relationship between the regulation of gene expression by IR, particularly genes not known for their roles in DSB repair, and its impact on cytogenetic responses has not been systematically studied. In the present study, the expression of 25 genes selected on the basis of their transcriptional changes in response to IR was individually knocked down by transfection with small interfering RNA in human fibroblast cells. The purpose of this study is to identify new roles of these selected genes on regulating DSB repair and cell cycle progression , as measured in the micronuclei formation and chromosome aberration. In response to IR, the formation of MN was significantly increased by suppressed expression of 5 genes: Ku70 in the DSB repair pathway, XPA in the NER pathway, RPA1 in the MMR pathway, and RAD17 and RBBP8 in cell cycle control. Knocked-down expression of 4 genes (MRE11A, RAD51 in the DSB pathway, SESN1, and SUMO1) significantly inhibited cell cycle progression, possibly because of severe impairment of DNA damage repair. Furthermore, loss of XPA, P21, or MLH1 expression resulted in both significantly enhanced cell cycle progression and increased yields of chromosome aberrations, indicating that these gene products modulate both cell cycle control and DNA damage repair. Most of the 11 genes that affected cytogenetic responses are not known to have clear roles influencing DBS repair. Nine of these 11 genes were up-regulated in cells exposed to gamma radiation, suggesting that genes transcriptionally modulated by IR were critical to regulate the biological consequences after IR.

  14. Human DNA repair disorders in dermatology: A historical perspective, current concepts and new insight.

    Science.gov (United States)

    Moriwaki, Shinichi

    2016-02-01

    Products of DNA damage, such as cyclobutane pyrimidine dimers (CPDs) and pyrimidine (6-4) pyrimidone photoproducts (6-4 PPs), are continually formed in genomes after exposure to UV radiation. When these DNA damages remain unrepaired in essential DNA sites for prolonged periods, DNA replication and transcription are hampered or mutation is induced, which may cause cell death, cellular senescence, and carcinogenesis of the skin. To protect against such UV-induced DNA damage, living organisms nicely retain "DNA repair systems", which can efficiently repair "harmful" DNA damage through precise mechanisms by the integrated functions of many proteins. In humans, the failure of DNA repair systems causes a variety of disorders. Dermatological conditions such as hereditary photodermatoses, xeroderma pigmentosum (XP) and Cockayne syndrome (CS) are caused by congenital functional defects in the nucleotide excision repair (NER) system or the translesion synthesis (TLS) system. In this review, we describe the historical progress, recent findings, and future prospects of studies of human diseases associated with DNA-repair defects. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  15. Role of mitochondrial dysfunction in the pathophysiology of DNA repair disorders.

    Science.gov (United States)

    Prates Mori, Mateus; de Souza-Pinto, Nadja Cristhina

    2017-12-22

    DNA is constantly being damaged, either by endogenous or exogenous genotoxins. In that regard, DNA repair activities are essential for maintaining genomic stability and to life itself. Mutations in genes encoding DNA repair proteins cause severe human syndromes, but DNA repair defects have also been linked to several other diseases, notably to cancer and normal aging. Recently, new evidence has emerged indicating that some DNA repair diseases display mitochondrial and metabolic dysfunction through mechanisms that are yet being uncovered. These results suggest that mitochondria play an import role in the DNA damage response pathways and that damage accumulation may lead to mitochondrial dysfunction via metabolic imbalance and mitophagy impairment. Here we review the recent findings linking mitochondrial impairment and cell death to DNA damage accumulation in the context of DNA repair defects. In addition, the general involvement of DNA damage in cellular dysfunction suggests that these phenomena may be also involved in other human pathologies in which mitochondrial dysfunction and metabolic disruption play causative roles. © 2017 International Federation for Cell Biology.

  16. Differential requirement for SUB1 in chromosomal and plasmid double-strand DNA break repair.

    Directory of Open Access Journals (Sweden)

    Lijian Yu

    Full Text Available Non homologous end joining (NHEJ is an important process that repairs double strand DNA breaks (DSBs in eukaryotic cells. Cells defective in NHEJ are unable to join chromosomal breaks. Two different NHEJ assays are typically used to determine the efficiency of NHEJ. One requires NHEJ of linearized plasmid DNA transformed into the test organism; the other requires NHEJ of a single chromosomal break induced either by HO endonuclease or the I-SceI restriction enzyme. These two assays are generally considered equivalent and rely on the same set of NHEJ genes. PC4 is an abundant DNA binding protein that has been suggested to stimulate NHEJ. Here we tested the role of PC4's yeast homolog SUB1 in repair of DNA double strand breaks using different assays. We found SUB1 is required for NHEJ repair of DSBs in plasmid DNA, but not in chromosomal DNA. Our results suggest that these two assays, while similar are not equivalent and that repair of plasmid DNA requires additional factor(s that are not required for NHEJ repair of chromosomal double-strand DNA breaks. Possible roles for Sub1 proteins in NHEJ of plasmid DNA are discussed.

  17. DNA repair proteins in cells of the human immune system; Le proteine della riparazione del DNA in cellule del sistema immunitario umano

    Energy Technology Data Exchange (ETDEWEB)

    Frasca, D.; Barattini, P.; Guidi, F.; Scarpaci, S. [ENEA, Sez. Tossicologia e Scienze Biomediche, Rome (Italy); Doria, G. [Rome Univ. Tor Vergata, Rome (Italy). Cattedra di Immunologia

    2001-02-01

    Human longevity depends on the efficiency of DNA repair mechanisms. In irradiated cells of the human immune system, the principal repair mechanism involves the DNA-Pk protein complex. [Italian] La durata della vita dipende dalla efficienza di meccanismi di riparazione del DNA. Nelle cellule del sistema immunitario umano danneggiate il principale meccanismo di riparazione coinvolge il complesso proteico DNA-PK.

  18. Non-homologous end joining is the responsible pathway for the repair of fludarabine-induced DNA double strand breaks in mammalian cells

    Energy Technology Data Exchange (ETDEWEB)

    Campos-Nebel, Marcelo de [Departamento de Genetica, Instituto de Investigaciones Hematologicas Mariano R. Castex, Academia Nacional de Medicina, Buenos Aires (Argentina)], E-mail: mnebel@hematologia.anm.edu.ar; Larripa, Irene; Gonzalez-Cid, Marcela [Departamento de Genetica, Instituto de Investigaciones Hematologicas Mariano R. Castex, Academia Nacional de Medicina, Buenos Aires (Argentina)

    2008-11-10

    Fludarabine (FLU), an analogue of adenosine, interferes with DNA synthesis and inhibits the chain elongation leading to replication arrest and DNA double strand break (DSB) formation. Mammalian cells use two main pathways of DSB repair to maintain genomic stability: homologous recombination (HR) and non-homologous end joining (NHEJ). The aim of the present work was to evaluate the repair pathways employed in the restoration of DSB formed following replication arrest induced by FLU in mammalian cells. Replication inhibition was induced in human lymphocytes and fibroblasts by FLU. DSB occurred in a dose-dependent manner on early/middle S-phase cells, as detected by {gamma}H2AX foci formation. To test whether conservative HR participates in FLU-induced DSB repair, we measured the kinetics of Rad51 nuclear foci formation in human fibroblasts. There was no significant induction of Rad51 foci after FLU treatment. To further confirm these results, we analyzed the frequency of sister chromatid exchanges (SCE) in both human cells. We did not find increased frequencies of SCE after FLU treatment. To assess the participation of NHEJ pathway in the repair of FLU-induced damage, we used two chemical inhibitors of the catalytic subunit of DNA-dependent protein kinase (DNA-PKcs), vanillin and wortmannin. Human fibroblasts pretreated with DNA-PKcs inhibitors showed increased levels of chromosome breakages and became more sensitive to cell death. An active role of NHEJ pathway was also suggested from the analysis of Chinese hamster cell lines. XR-C1 (DNA-PKcs-deficient) and XR-V15B (Ku80-deficient) cells showed hypersensitivity to FLU as evidenced by the increased frequency of chromosome aberrations, decreased mitotic index and impaired survival rates. In contrast, CL-V4B (Rad51C-deficient) and V-C8 (Brca2-deficient) cell lines displayed a FLU-resistant phenotype. Together, our results suggest a major role for NHEJ repair in the preservation of genome integrity against FLU

  19. SIRT6 stabilizes DNA-dependent protein kinase at chromatin for DNA double-strand break repair

    DEFF Research Database (Denmark)

    McCord, Ronald A; Michishita, Eriko; Hong, Tao

    2009-01-01

    The Sir2 chromatin regulatory factor links maintenance of genomic stability to life span extension in yeast. The mammalian Sir2 family member SIRT6 has been proposed to have analogous functions, because SIRT6-deficiency leads to shortened life span and an aging-like degenerative phenotype in mice......, and SIRT6 knockout cells exhibit genomic instability and DNA damage hypersensitivity. However, the molecular mechanisms underlying these defects are not fully understood. Here, we show that SIRT6 forms a macromolecular complex with the DNA double-strand break (DSB) repair factor DNA-PK (DNA......-PKcs) to chromatin in response to DNA damage and stabilizes DNA-PKcs at chromatin adjacent to an induced site-specific DSB. Abrogation of these SIRT6 activities leads to impaired resolution of DSBs. Together, these findings elucidate a mechanism whereby regulation of dynamic interaction of a DNA repair factor...

  20. When DNA repair goes wrong: BER-generated DNA-protein crosslinks to oxidative lesions.

    Science.gov (United States)

    Quiñones, Jason Luis; Demple, Bruce

    2016-08-01

    Free radicals generate an array of DNA lesions affecting all parts of the molecule. The damage to deoxyribose receives less attention than base damage, even though the former accounts for ∼20% of the total. Oxidative deoxyribose fragments (e.g., 3'-phosphoglycolate esters) are removed by the Ape1 AP endonuclease and other enzymes in mammalian cells to enable DNA repair synthesis. Oxidized abasic sites are initially incised by Ape1, thus recruiting these lesions into base excision repair (BER) pathways. Lesions such as 2-deoxypentos-4-ulose can be removed by conventional (single-nucleotide) BER, which proceeds through a covalent Schiff base intermediate with DNA polymerase β (Polβ) that is resolved by hydrolysis. In contrast, the lesion 2-deoxyribonolactone (dL) must be processed by multinucleotide ("long-patch") BER: attempted repair via the single-nucleotide pathway leads to a dead-end, covalent complex with Polβ cross- linked to the DNA by an amide bond. We recently detected these stable DNA-protein crosslinks (DPC) between Polβ and dL in intact cells. The features of the DPC formation in vivo are exactly in keeping with the mechanistic properties seen in vitro: Polβ-DPC are formed by oxidative agents in line with their ability to form the dL lesion; they are not formed by non-oxidative agents; DPC formation absolutely requires the active-site lysine-72 that attacks the 5'-deoxyribose; and DPC formation depends on Ape1 to incise the dL lesion first. The Polβ-DPC are rapidly processed in vivo, the signal disappearing with a half-life of 15-30min in both mouse and human cells. This removal is blocked by inhibiting the proteasome, which leads to the accumulation of ubiquitin associated with the Polβ-DPC. While other proteins (e.g., topoisomerases) also form DPC under these conditions, 60-70% of the trapped ubiquitin depends on Polβ. The mechanism of ubiquitin targeting to Polβ-DPC, the subsequent processing of the expected 5'-peptidyl-dL, and the

  1. Xeroderma pigmentosum group F caused by a defect in a structure-specific DNA repair endonuclease.

    NARCIS (Netherlands)

    A.M. Sijbers (Anneke); W.L. de Laat (Wouter); R.A. Ariza (Rafael); M. Biggerstaff (Maureen); Y-F. Wei; J.G. Moggs (Jonathan); K.C. Carter (Kenneth); B.K. Shell (Brenda); E. Evans (Elizabeth); M.C. de Jong (Mariska); S. Rademakers (Suzanne); J.D. de Rooij (Johan); N.G.J. Jaspers (Nicolaas); J.H.J. Hoeijmakers (Jan); R.D. Wood (Richard)

    1996-01-01

    textabstractNucleotide excision repair, which is defective in xeroderma pigmentosum (XP), involves incision of a DNA strand on each side of a lesion. We isolated a human gene homologous to yeast Rad1 and found that it corrects the repair defects of XP group F as well as rodent groups 4 and 11.

  2. Mouse RAD54 affects DNA double-strand break repair and sister chromatid exchange

    NARCIS (Netherlands)

    H.B. Beverloo (Berna); R.D. Johnson (Roger); M. Jasin (Maria); R. Kanaar (Roland); J.H.J. Hoeijmakers (Jan); M.L.G. Dronkert (Mies)

    2000-01-01

    textabstractCells can achieve error-free repair of DNA double-strand breaks (DSBs) by homologous recombination through gene conversion with or without crossover. In contrast, an alternative homology-dependent DSB repair pathway, single-strand annealing (SSA), results in deletions. In this study, we

  3. Cloning and characterization of the human DNA-excision repair gene ERCC-1

    NARCIS (Netherlands)

    M. van Duin (Michel)

    1988-01-01

    textabstractIt is the aim of the work described in this thesis to isolate and characterize human genes involved DNA excision repair. This will facilitate the understanding of the mechanism of this repair process whereas it also provides an important step to better understand the relationship

  4. Deletion-bias in DNA double-strand break repair differentially contributes to plant genome shrinkage.

    Science.gov (United States)

    Vu, Giang T H; Cao, Hieu X; Reiss, Bernd; Schubert, Ingo

    2017-06-01

    In order to prevent genome instability, cells need to be protected by a number of repair mechanisms, including DNA double-strand break (DSB) repair. The extent to which DSB repair, biased towards deletions or insertions, contributes to evolutionary diversification of genome size is still under debate. We analyzed mutation spectra in Arabidopsis thaliana and in barley (Hordeum vulgare) by PacBio sequencing of three DSB-targeted loci each, uncovering repair via gene conversion, single strand annealing (SSA) or nonhomologous end-joining (NHEJ). Furthermore, phylogenomic comparisons between A. thaliana and two related species were used to detect naturally occurring deletions during Arabidopsis evolution. Arabidopsis thaliana revealed significantly more and larger deletions after DSB repair than barley, and barley displayed more and larger insertions. Arabidopsis displayed a clear net loss of DNA after DSB repair, mainly via SSA and NHEJ. Barley revealed a very weak net loss of DNA, apparently due to less active break-end resection and easier copying of template sequences into breaks. Comparative phylogenomics revealed several footprints of SSA in the A. thaliana genome. Quantitative assessment of DNA gain and loss through DSB repair processes suggests deletion-biased DSB repair causing ongoing genome shrinking in A. thaliana, whereas genome size in barley remains nearly constant. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  5. DNA repair in human cells: from genetic complementation to isolation of genes.

    NARCIS (Netherlands)

    D. Bootsma (Dirk); A. Westerveld (Andries); J.H.J. Hoeijmakers (Jan)

    1988-01-01

    textabstractThe genetic disease xeroderma pigmentosum (XP) demonstrates the association between defective repair of DNA lesions and cancer. Complementation analysis performed on XP cell strains and on repair deficient rodent cell lines has revealed that at least nine and possibly more than 13 genes

  6. Parp1-XRCC1 and the repair of DNA double strand breaks in mouse round spermatids.

    NARCIS (Netherlands)

    Ahmed, E.A.; Boer, P. de; Philippens, M.E.P.; Kal, H.B.; Rooij, D.G. de

    2010-01-01

    The repair of DNA double strand breaks (DSBs) in male germ cells is slower and differently regulated compared to that in somatic cells. Round spermatids show DSB repair and are radioresistant to apoptosis induction. Mutation induction studies using ionizing irradiation, indicated a high frequency of

  7. Photoinduced repair of a thymine dimer in DNA via carbazole nucleoside.

    Science.gov (United States)

    Yoshimura, Yoshinaga; Fujimoto, Kenzo

    2006-01-01

    We report the photoinduced repair of a thymine dimer incorporated in a DNA duplex via oligodeoxynucleotide (ODN) containing carbazole nucleoside (K). The occurrence of an electron transfer between K and thymine dimer is evidenced by fluorescence quenching measurements. K acts as a good electron donor for the photoinduced repair of a thymine dimer.

  8. The BER necessities: the repair of DNA damage in human-adapted bacterial pathogens.

    Science.gov (United States)

    van der Veen, Stijn; Tang, Christoph M

    2015-02-01

    During colonization and disease, bacterial pathogens must survive the onslaught of the host immune system. A key component of the innate immune response is the generation of reactive oxygen and nitrogen species by phagocytic cells, which target and disrupt pathogen molecules, particularly DNA, and the base excision repair (BER) pathway is the most important mechanism for the repair of such oxidative DNA damage. In this Review, we discuss how the human-specific pathogens Mycobacterium tuberculosis, Helicobacter pylori and Neisseria meningitidis have evolved specialized mechanisms of DNA repair, particularly their BER pathways, compared with model organisms such as Escherichia coli. This specialization in DNA repair is likely to reflect the distinct niches occupied by these important human pathogens in the host.

  9. DNA-mismatch repair. The intricacies of eukaryotic spell-checking.

    Science.gov (United States)

    Kunkel, T A

    1995-10-01

    Recent work suggests that the eukaryotic system responsible for repairing DNA mismatches, and so correcting replication errors, is more complex than was thought; its multiple components have many cellular functions.

  10. DNA Repair in Human Cells Exposed to Combinations of Carcinogenic Agents

    Energy Technology Data Exchange (ETDEWEB)

    Setlow, R. B.; Ahmed, F. E.

    1980-01-01

    Normal human and XP2 fibroblasts were treated with UV plus UV-mimetic chemicals. The UV dose used was sufficient to saturate the UV excision repair system. Excision repair after combined treatments was estimated by unscheduled DNA synthesis, BrdUrd photolysis, and the loss of sites sensitive to a UV specific endonuclease. Since the repair of damage from UV and its mimetics is coordinately controlled we expected that there would be similar rate-limiting steps in the repair of UV and chemical damage and that after a combined treatment the total amount of repair would be the same as from UV or the chemicals separately. The expectation was not fulfilled. In normal cells repair after a combined treatment was additive whereas in XP cells repair after a combined treatment was usually less than after either agent separately. The chemicals tested were AAAF, DMBA-epoxide, 4NQO, and ICR-170.

  11. Overexpression of DNA ligase III in mitochondria protects cells against oxidative stress and improves mitochondrial DNA base excision repair.

    Science.gov (United States)

    Akbari, Mansour; Keijzers, Guido; Maynard, Scott; Scheibye-Knudsen, Morten; Desler, Claus; Hickson, Ian D; Bohr, Vilhelm A

    2014-04-01

    Base excision repair (BER) is the most prominent DNA repair pathway in human mitochondria. BER also results in a temporary generation of AP-sites, single-strand breaks and nucleotide gaps. Thus, incomplete BER can result in the generation of DNA repair intermediates that can disrupt mitochondrial DNA replication and transcription and generate mutations. We carried out BER analysis in highly purified mitochondrial extracts from human cell lines U2OS and HeLa, and mouse brain using a circular DNA substrate containing a lesion at a specific position. We found that DNA ligation is significantly slower than the preceding mitochondrial BER steps. Overexpression of DNA ligase III in mitochondria improved the rate of overall BER, increased cell survival after menadione induced oxidative stress and reduced autophagy following the inhibition of the mitochondrial electron transport chain complex I by rotenone. Our results suggest that the amount of DNA ligase III in mitochondria may be critical for cell survival following prolonged oxidative stress, and demonstrate a functional link between mitochondrial DNA damage and repair, cell survival upon oxidative stress, and removal of dysfunctional mitochondria by autophagy. Copyright © 2014. Published by Elsevier B.V.

  12. DNA repair pathway choice is influenced by the health of Drosophila melanogaster.

    Science.gov (United States)

    Wang, Alethea D; Agrawal, Aneil F

    2012-10-01

    In nature, individuals vary tremendously in condition and this may be an important source of variation in mutation rate. Condition is likely to affect cell state and thereby impact the amount of DNA damage sustained and/or the way it is repaired. Here, we focus on DNA repair. If low-condition individuals are less capable of devoting the same level of resources to accurate repair, they may suffer higher mutation rates. However, repair decisions are also governed by various aspects of cell physiology, which may render the prediction that "higher-condition individuals use better repair mechanisms" too simplistic. We use a larval diet manipulation in Drosophila melanogaster to create high- and low-condition individuals and then contrast their relative usage of three repair pathways [homologous recombination (HR), single-strand annealing (SSA), and nonhomologous end joining (NHEJ)] that differ in their mechanistic requirements and their mutational consequences. We find that low-condition flies are more likely than high-condition flies to use the most conservative of these three repair pathways, suggesting that physiological constraints on repair pathway usage may be more important than energetic costs. We also show that the repair differences between high- and low-condition flies resemble those between young and old flies, suggesting the underlying mechanisms may be similar. Finally, we observe that the effect of larval diet on adult repair increases as flies age, indicating that developmental differences early in life can have long-lasting consequences.

  13. DNA damage, repair monitoring and epigenetic DNA methylation changes in seedlings of Chernobyl soybeans.

    Science.gov (United States)

    Georgieva, Mariyana; Rashydov, Namik M; Hajduch, Martin

    2017-02-01

    This pilot study was carried out to assess the effect of radio-contaminated Chernobyl environment on plant genome integrity 27 years after the accident. For this purpose, nuclei were isolated from root tips of the soybean seedlings harvested from plants grown in the Chernobyl area for seven generations. Neutral, neutral-alkaline, and methylation-sensitive comet assays were performed to evaluate the induction and repair of primary DNA damage and the epigenetic contribution to stress adaptation mechanisms. An increased level of single and double strand breaks in the radio-contaminated Chernobyl seedlings at the stage of primary root development was detected in comparison to the controls. However, the kinetics of the recovery of DNA breaks of radio-contaminated Chernobyl samples revealed that lesions were efficiently repaired at the stage of cotyledon. Methylation-sensitive comet assay revealed comparable levels in the CCGG methylation pattern between control and radio-contaminated samples with a slight increase of approximately 10% in the latter ones. The obtained preliminary data allow us to speculate about the onset of mechanisms providing an adaptation potential to the accumulated internal irradiation after the Chernobyl accident. Despite the limitations of this study, we showed that comet assay is a sensitive and flexible technique which can be efficiently used for genotoxic screening of plant specimens in natural and human-made radio-contaminated areas, as well as for safety monitoring of agricultural products. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Mammalian RAD52 Functions in Break-Induced Replication Repair of Collapsed DNA Replication Forks

    DEFF Research Database (Denmark)

    Sotiriou, Sotirios K; Kamileri, Irene; Lugli, Natalia

    2016-01-01

    RNA or knockout of the gene by CRISPR/Cas9 compromised restart of collapsed forks and led to DNA damage in cells experiencing DRS. Furthermore, in cancer-prone, heterozygous APC mutant mice, homozygous deletion of the Rad52 gene suppressed tumor growth and prolonged lifespan. We therefore propose that mammalian......Human cancers are characterized by the presence of oncogene-induced DNA replication stress (DRS), making them dependent on repair pathways such as break-induced replication (BIR) for damaged DNA replication forks. To better understand BIR, we performed a targeted siRNA screen for genes whose...... RAD52 facilitates repair of collapsed DNA replication forks in cancer cells....

  15. Low level occupational exposure to styrene: its effects on DNA damage and DNA repair.

    Science.gov (United States)

    Wongvijitsuk, Sirilak; Navasumrit, Panida; Vattanasit, Udomratana; Parnlob, Varabhorn; Ruchirawat, Mathuros

    2011-03-01

    The present study aimed to evaluate the effects of styrene exposure at levels below the recommended standards of the Threshold Limit Value (TLV-TWA(8)) of 20 ppm (ACGIH, 2004) in reinforced-fiberglass plastics workers. Study subjects comprised 50 exposed workers and 40 control subjects. The exposed workers were stratified by styrene exposure levels, i.e. group I (20 ppm, >84.40 mg/m(3)). The mean styrene exposure levels of exposed workers were significantly higher than those of the control workers. Biomarkers of exposure to styrene, including blood styrene and the urinary metabolites, mandelic acid (MA) and phenylglyoxylic acid (PGA), were significantly increased with increasing levels of styrene exposure, but were not detected in the control group. DNA damage, such as DNA strand breaks, 8-hydroxydeoxyguanosine (8-OHdG), and DNA repair capacity, were used as biomarkers of early biological effects. DNA strand breaks and 8-OHdG/10(5)dG levels in peripheral leukocytes of exposed groups were significantly higher compared to the control group (Prisk from occupational styrene exposure, even at levels below the recommended TLV-TWA(8) of 20 ppm. Copyright © 2010 Elsevier GmbH. All rights reserved.

  16. Photodynamic DNA damage induced by phycocyanin and its repair in Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    M. Pádula

    1999-09-01

    Full Text Available In the present study, we analyzed DNA damage induced by phycocyanin (PHY in the presence of visible light (VL using a set of repair endonucleases purified from Escherichia coli. We demonstrated that the profile of DNA damage induced by PHY is clearly different from that induced by molecules that exert deleterious effects on DNA involving solely singlet oxygen as reactive species. Most of PHY-induced lesions are single strand breaks and, to a lesser extent, base oxidized sites, which are recognized by Nth, Nfo and Fpg enzymes. High pressure liquid chromatography coupled to electrochemical detection revealed that PHY photosensitization did not induce 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo at detectable levels. DNA repair after PHY photosensitization was also investigated. Plasmid DNA damaged by PHY photosensitization was used to transform a series of Saccharomyces cerevisiae DNA repair mutants. The results revealed that plasmid survival was greatly reduced in rad14 mutants, while the ogg1 mutation did not modify the plasmid survival when compared to that in the wild type. Furthermore, plasmid survival in the ogg1 rad14 double mutant was not different from that in the rad14 single mutant. The results reported here indicate that lethal lesions induced by PHY plus VL are repaired differently by prokaryotic and eukaryotic cells. Morever, nucleotide excision repair seems to play a major role in the recognition and repair of these lesions in Saccharomyces cerevisiae.

  17. [The Rdh54 protein role in regulation of DNA repair in yeast Saccharomyces cerevisiae].

    Science.gov (United States)

    Latypov, V F; Kozhina, T N; Kozhin, S A; Korolev, V G

    2010-02-01

    In this work, we present the evidences of the involvement of Rdh54 in coordination of DNA repair by several pathways. Previously, we isolated rdh54-29 point mutation demonstrating unique properties different from the full deletion of RDH54 gene. Epistatic interaction between rdh54-29 and apn1delta mutations discloses the function of Rdh54p in the process of base excision repair. However, rdh54-29 mutant exhibits sensitivity to many DNA damaging agents including UV light, methylmethanesulphonate and nitrous acid. Such pleiotrophic effect of rdh54-29 mutation may indicate the role of Rdh54p in the regulation of different DNA repair systems. To check this hypothesis, we estimated the effect of rdh54-29 mutation on recombination and mutagenesis. The data confirm the involvement of Rdh54p in coordination of different DNA repair systems including mutagenic and recombinagenic pathways as well as nucleotide excision repair. Rdh54p presumably operates via chromatin remodulation at the site of damage rendering DNA accessible to the DNA repair enzymes.

  18. Nicotinamide enhances repair of ultraviolet radiation-induced DNA damage in primary melanocytes.

    Science.gov (United States)

    Thompson, Benjamin C; Surjana, Devita; Halliday, Gary M; Damian, Diona L

    2014-07-01

    Cutaneous melanoma is a significant cause of morbidity and mortality. Nicotinamide is a safe, widely available vitamin that reduces the immune suppressive effects of UV, enhances DNA repair in keratinocytes and has shown promise in the chemoprevention of non-melanoma skin cancer. Here, we report the effect of nicotinamide on DNA damage and repair in primary human melanocytes. Nicotinamide significantly enhanced the repair of oxidative DNA damage (8-oxo-7,8-dihydro-2'-deoxyguanosine) and cyclobutane pyrimidine dimers induced by UV exposure. It also enhanced the repair of 8-oxo-7,8-dihydro-2'-deoxyguanosine induced by the culture conditions in unirradiated melanocytes. A significant increase in the percentage of melanocytes undergoing unscheduled but not scheduled DNA synthesis was observed, confirming that nicotinamide enhances DNA repair in human melanocytes. In summary, nicotinamide, by enhancing DNA repair in melanocytes, is a potential agent for the chemoprevention of cutaneous melanoma. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. The Role of Long Non Coding RNAs in the Repair of DNA Double Strand Breaks.

    Science.gov (United States)

    Dianatpour, Ali; Ghafouri-Fard, Soudeh

    2017-01-01

    DNA double strand breaks (DSBs) are abrasions caused in both strands of the DNA duplex following exposure to both exogenous and endogenous conditions. Such abrasions have deleterious effect in cells leading to genome rearrangements and cell death. A number of repair systems including homologous recombination (HR) and non-homologous end-joining (NHEJ) have been evolved to minimize the fatal effects of these lesions in cell. The role of protein coding genes in regulation of these pathways has been assessed previously. However, a number of recent studies have focused on evaluation of non-coding RNAs participation in DNA repair. We performed a computerized search of the Medline/ Pubmed databases with key words: DNA repair, homologous recombination, non-homologues end joining and long non-coding RNA (LncRNA). The existing data highlight the role of long non-coding RNAs in DSB repair as well as dysregulation in their expression which would lead to pathological conditions such as cancer. The specific mechanism of their contribution in DNA repair pathways has been elucidated for a few of them. LncRNAs participate in several steps of DNA repair pathways and regulate the expression of key components of these pathways including p53 tumor suppressor gene.

  20. Alpha-phellandrene-induced DNA damage and affect DNA repair protein expression in WEHI-3 murine leukemia cells in vitro.

    Science.gov (United States)

    Lin, Jen-Jyh; Wu, Chih-Chung; Hsu, Shu-Chun; Weng, Shu-Wen; Ma, Yi-Shih; Huang, Yi-Ping; Lin, Jaung-Geng; Chung, Jing-Gung

    2015-11-01

    Although there are few reports regarding α-phellandrene (α-PA), a natural compound from Schinus molle L. essential oil, there is no report to show that α-PA induced DNA damage and affected DNA repair associated protein expression. Herein, we investigated the effects of α-PA on DNA damage and repair associated protein expression in murine leukemia cells. Flow cytometric assay was used to measure the effects of α-PA on total cell viability and the results indicated that α-PA induced cell death. Comet assay and 4,6-diamidino-2-phenylindole dihydrochloride staining were used for measuring DNA damage and condensation, respectively, and the results indicated that α-PA induced DNA damage and condensation in a concentration-dependent manner. DNA gel electrophoresis was used to examine the DNA damage and the results showed that α-PA induced DNA damage in WEHI-3 cells. Western blotting assay was used to measure the changes of DNA damage and repair associated protein expression and the results indicated that α-PA increased p-p53, p-H2A.X, 14-3-3-σ, and MDC1 protein expression but inhibited the protein of p53, MGMT, DNA-PK, and BRCA-1. © 2014 Wiley Periodicals, Inc.

  1. Monitoring regulation of DNA repair activities of cultured cells in-gel using the comet assay.

    Science.gov (United States)

    Nickson, Catherine M; Parsons, Jason L

    2014-01-01

    Base excision repair (BER) is the predominant cellular mechanism by which human cells repair DNA base damage, sites of base loss, and DNA single strand breaks of various complexity, that are generated in their thousands in every human cell per day as a consequence of cellular metabolism and exogenous agents, including ionizing radiation. Over the last three decades the comet assay has been employed in scientific research to examine the cellular response to these types of DNA damage in cultured cells, therefore revealing the efficiency and capacity of BER. We have recently pioneered new research demonstrating an important role for post-translational modifications (particularly ubiquitylation) in the regulation of cellular levels of BER proteins, and that subtle changes (∼20-50%) in protein levels following siRNA knockdown of E3 ubiquitin ligases or deubiquitylation enzymes can manifest in significant changes in DNA repair capacity monitored using the comet assay. For example, we have shown that the E3 ubiquitin ligase Mule, the tumor suppressor protein ARF, and the deubiquitylation enzyme USP47 modulate DNA repair by controlling cellular levels of DNA polymerase β, and also that polynucleotide kinase phosphatase levels are controlled by ATM-dependant phosphorylation and Cul4A-DDB1-STRAP-dependent ubiquitylation. In these studies we employed a modification of the comet assay whereby cultured cells, following DNA damage treatment, are embedded in agarose and allowed to repair in-gel prior to lysis and electrophoresis. Whilst this method does have its limitations, it avoids the extensive cell culture-based processing associated with the traditional approach using attached cells and also allows for the examination of much more precise DNA repair kinetics. In this review we will describe, using this modified comet assay, our accumulating evidence that ubiquitylation-dependant regulation of BER proteins has important consequences for overall cellular DNA repair

  2. Monitoring regulation of DNA repair activities of cultured cells in-gel using the comet assay

    Directory of Open Access Journals (Sweden)

    Jason Luke Parsons

    2014-07-01

    Full Text Available Base excision repair (BER is the predominant cellular mechanism by which human cells repair DNA base damage, sites of base loss and DNA single strand breaks of various complexity, that are generated in their thousands in every human cell per day as a consequence of cellular metabolism and exogenous agents, including ionising radiation. Over the last three decades the comet assay has been employed in scientific research to examine the cellular response to these types of DNA damage in cultured cells, therefore revealing the efficiency and capacity of BER. We have recently pioneered new research demonstrating an important role for post-translational modifications (particularly ubiquitylation in the regulation of cellular levels of BER proteins, and that subtle changes (~20-50 % in protein levels following siRNA knockdown of E3 ubiquitin ligases or deubiquitylation enzymes can manifest in significant changes in DNA repair capacity monitored using the comet assay. For example, we have shown that the E3 ubiquitin ligase Mule, the tumour suppressor protein ARF and the deubiquitylation enzyme USP47 modulate DNA repair by controlling cellular levels of DNA polymerase β, and also that polynucleotide kinase phosphatase levels are controlled by ATM-dependant phosphorylation and Cul4A-DDB1-STRAP-dependent ubiquitylation. In these studies we employed a modification of the comet assay whereby cultured cells, following DNA damage treatment, are embedded in agarose and allowed to repair in-gel prior to lysis and electrophoresis. Whilst this method does have its limitations, it avoids the extensive cell culture-based processing associated with the traditional approach using attached cells and also allows for the examination of much more precise DNA repair kinetics. In this review we will describe, using this modified comet assay, our accumulating evidence that ubiquitylation-dependant regulation of BER proteins has important consequences for overall cellular DNA

  3. Human in vitro skin organ culture as a model system for evaluating DNA repair.

    Science.gov (United States)

    Liu, Hannah; Tuchinda, Papapit; Fishelevich, Rita; Harberts, Erin; Gaspari, Anthony A

    2014-06-01

    UV-exposures result in accumulation of genetic lesions that facilitate the development of skin cancer. Numerous pharmacologic agents are currently under development to both inhibit formation of DNA lesions and enhance repair. Drugs must be evaluated in vitro, currently performed in cell culture systems, before being tested on humans. Current systems do not account for the architecture and diverse cellularity of intact human skin. To establish a novel, functionally viable, and reproducible in vitro skin organ culture system for studying the effects of various pharmacologic agents on DNA repair. Human skin was obtained from neonatal foreskins. Intact skin punches derived from foreskins were cultured in vitro prior to exposure to UV-irradiation, and evaluated for DNA-damage using a DNA dot blot. Serial skin biopsies were obtained from patients with actinic keratoses treated with topical imiquimod. Expression of immune-stimulating and DNA repair genes was evaluated in ex vivo and in vitro samples. DNA dot blots revealed active repair of UV induced lesions in our in vitro skin organ culture. The photo-protective effect of sunscreen was detected, while imiquimod treatment did not enhance DNA repair in vitro. The DNA repair molecules XPA and XPF were up-regulated in the skin of imiquimod treated patients with actinic keratoses and imiquimod treated bone marrow-derived cell lines, but not keratinocytes. Our in vitro human skin organ culture model detected repair of UV-induced DNA lesions, and may be easily adapted to investigate various photo-protective drugs intended to prevent or treat skin cancer. Copyright © 2014 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  4. Regulation of repair pathway choice at two-ended DNA double-strand breaks.

    Science.gov (United States)

    Shibata, Atsushi

    2017-10-01

    A DNA double-strand break (DSB) is considered to be a critical DNA lesion because its misrepair can cause severe mutations, such as deletions or chromosomal translocations. For the precise repair of DSBs, the repair pathway that is optimal for the particular circumstance needs to be selected. Non-homologous end joining (NHEJ) functions in G1/S/G2 phase, while homologous recombination (HR) becomes active only in S/G2 phase after DNA replication. DSB end structure is another factor affecting the repair pathway. For example, one-ended DSBs in S phase are mainly repaired by HR due to the lack of a partner DSB end for NHEJ. In contrast, two-ended DSBs, which are mainly induced by ionizing radiation, are repaired by either NHEJ or HR in G2 cells. Under the current model in terms of DSB repair pathway usage in G2 phase, NHEJ repairs ∼70% of two-ended DSBs, whereas HR repairs only ∼30%. Recent studies propose that NHEJ factors can bind all the DSB ends and are then either used to progress that pathway of DSB repair, or the repair proceeds by HR. In addition, molecular regulation by BRCA1 and 53BP1 has also been proposed. At DSB sites, BRCA1 functions to alleviate the 53BP1 barrier to resection by promoting 53BP1 dephosphorylation, followed by RIF1 release and 53BP1 repositioning. This timely 53BP1 repositioning may be important for the establishment of a chromatin environment that promotes the recruitment of EXO1 for resection in HR. This review summarizes current knowledge on factors regulating DSB repair pathway choice in terms of spatiotemporal regulation by focusing on the repair events at two-ended DSBs in G2 cells. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Resveratrol-3-O-glucuronide and resveratrol-4’-O-glucuronide reduce DNA strand breakage but not apoptosis in Jurkat T cells treated with camptothecin

    Science.gov (United States)

    Resveratrol has been reported to inhibit or induce DNA damage depending upon the type of cell and experimental conditions. Dietary resveratrol is present in the body mostly as metabolites and little is known about the activities of these metabolic products. We evaluated physiologically obtainable ...

  6. Cell cycle-regulated centers of DNA double-strand break repair

    DEFF Research Database (Denmark)

    Lisby, Michael; Antúnez de Mayolo, Adriana; Mortensen, Uffe H

    2003-01-01

    In eukaryotes, homologous recombination is an important pathway for the repair of DNA double-strand breaks. We have studied this process in living cells in the yeast Saccharomyces cerevisiae using Rad52 as a cell biological marker. In response to DNA damage, Rad52 redistributes itself and forms...... foci specifically during S phase. We have shown previously that Rad52 foci are centers of DNA repair where multiple DNA double-strand breaks colocalize. Here we report a correlation between the timing of Rad52 focus formation and modification of the Rad52 protein. In addition, we show that the two ends...... of a double-strand break are held tightly together in the majority of cells. Interestingly, in a small but significant fraction of the S phase cells, the two ends of a break separate suggesting that mechanisms exist to reassociate and align these ends for proper DNA repair....

  7. RNF4 is required for DNA double-strand break repair in vivo

    DEFF Research Database (Denmark)

    Vyas, R; Kumar, R; Clermont, F

    2013-01-01

    , and that Rnf4-deficient cells and mice exhibit increased sensitivity to genotoxic stress. Mechanistically, we show that Rnf4 targets SUMOylated MDC1 and SUMOylated BRCA1, and is required for the loading of Rad51, an enzyme required for HR repair, onto sites of DNA damage. Similarly to inactivating mutations......Unrepaired DNA double-strand breaks (DSBs) cause genetic instability that leads to malignant transformation or cell death. Cells respond to DSBs with the ordered recruitment of signaling and repair proteins to the sites of DNA lesions. Coordinated protein SUMOylation and ubiquitylation have crucial...... for both homologous recombination (HR) and non-homologous end joining repair. To establish a link between Rnf4 and the DNA damage response (DDR) in vivo, we generated an Rnf4 allelic series in mice. We show that Rnf4-deficiency causes persistent ionizing radiation-induced DNA damage and signaling...

  8. Adriamycin does not affect the repair of X-ray induced DNA single strand breaks

    Energy Technology Data Exchange (ETDEWEB)

    Cantoni, O.; Sestili, P.; Cattabeni, F.

    1985-06-01

    The ability of the antitumor antibiotic adriamycin (Ad) to inhibit the rejoining of DNA single strand breaks produced by X-rays was investigated in cultured cells. Chinese hamster ovary cells were given 400 rad and were allowed to repair in the presence or absence of Ad for 60 min at 37degC. The drug did not affect the ability of cells to repair DNA breaks and residual breaks found after the repair period were attributed to those induced by Ad alone. (author). 16 refs.

  9. Slow mitochondrial repair of 5'-AMP renders mtDNA susceptible to damage in APTX deficient cells

    DEFF Research Database (Denmark)

    Akbari, Mansour; Sykora, Peter; Bohr, Vilhelm A

    2015-01-01

    elucidated. Here, we monitored the repair of 5'-AMP DNA damage in nuclear and mitochondrial extracts from human APTX(+/+) and APTX(-/-) cells. The efficiency of repair of 5'-AMP DNA was much lower in mitochondrial than in nuclear protein extracts, and resulted in persistent DNA repair intermediates in APTX...... deficient cells. Moreover, the removal of 5'-AMP from DNA was significantly slower in the mitochondrial extracts from human cell lines and mouse tissues compared with their corresponding nuclear extracts. These results suggest that, contrary to nuclear DNA repair, mitochondrial DNA repair is not able......Aborted DNA ligation events in eukaryotic cells can generate 5'-adenylated (5'-AMP) DNA termini that can be removed from DNA by aprataxin (APTX). Mutations in APTX cause an inherited human disease syndrome characterized by early-onset progressive ataxia with ocular motor apraxia (AOA1). APTX...

  10. Types, Causes, Detection and Repair of DNA Fragmentation in Animal and Human Sperm Cells

    Directory of Open Access Journals (Sweden)

    Rosa Roy

    2012-10-01

    Full Text Available Concentration, motility and morphology are parameters commonly used to determine the fertilization potential of an ejaculate. These parameters give a general view on the quality of sperm but do not provide information about one of the most important components of the reproductive outcome: DNA. Either single or double DNA strand breaks can set the difference between fertile and infertile males. Sperm DNA fragmentation can be caused by intrinsic factors like abortive apoptosis, deficiencies in recombination, protamine imbalances or oxidative stress. Damage can also occur due to extrinsic factors such as storage temperatures, extenders, handling conditions, time after ejaculation, infections and reaction to medicines or post-testicular oxidative stress, among others. Two singular characteristics differentiate sperm from somatic cells: Protamination and absence of DNA repair. DNA repair in sperm is terminated as transcription and translation stops post-spermiogenesis, so these cells have no mechanism to repair the damage occurred during their transit through the epididymis and post-ejaculation. Oocytes and early embryos have been shown to repair sperm DNA damage, so the effect of sperm DNA fragmentation depends on the combined effects of sperm chromatin damage and the capacity of the oocyte to repair it. In this contribution we review some of these issues.

  11. DNA Damage and Repair in Schizophrenia and Autism: Implications for Cancer Comorbidity and Beyond.

    Science.gov (United States)

    Markkanen, Enni; Meyer, Urs; Dianov, Grigory L

    2016-06-01

    Schizophrenia and autism spectrum disorder (ASD) are multi-factorial and multi-symptomatic psychiatric disorders, each affecting 0.5%-1% of the population worldwide. Both are characterized by impairments in cognitive functions, emotions and behaviour, and they undermine basic human processes of perception and judgment. Despite decades of extensive research, the aetiologies of schizophrenia and ASD are still poorly understood and remain a significant challenge to clinicians and scientists alike. Adding to this unsatisfactory situation, patients with schizophrenia or ASD often develop a variety of peripheral and systemic disturbances, one prominent example of which is cancer, which shows a direct (but sometimes inverse) comorbidity in people affected with schizophrenia and ASD. Cancer is a disease characterized by uncontrolled proliferation of cells, the molecular origin of which derives from mutations of a cell's DNA sequence. To counteract such mutations and repair damaged DNA, cells are equipped with intricate DNA repair pathways. Oxidative stress, oxidative DNA damage, and deficient repair of oxidative DNA lesions repair have been proposed to contribute to the development of schizophrenia and ASD. In this article, we summarize the current evidence of cancer comorbidity in these brain disorders and discuss the putative roles of oxidative stress, DNA damage and DNA repair in the aetiopathology of schizophrenia and ASD.

  12. DNA Damage and Repair in Schizophrenia and Autism: Implications for Cancer Comorbidity and Beyond

    Directory of Open Access Journals (Sweden)

    Enni Markkanen

    2016-06-01

    Full Text Available Schizophrenia and autism spectrum disorder (ASD are multi-factorial and multi-symptomatic psychiatric disorders, each affecting 0.5%–1% of the population worldwide. Both are characterized by impairments in cognitive functions, emotions and behaviour, and they undermine basic human processes of perception and judgment. Despite decades of extensive research, the aetiologies of schizophrenia and ASD are still poorly understood and remain a significant challenge to clinicians and scientists alike. Adding to this unsatisfactory situation, patients with schizophrenia or ASD often develop a variety of peripheral and systemic disturbances, one prominent example of which is cancer, which shows a direct (but sometimes inverse comorbidity in people affected with schizophrenia and ASD. Cancer is a disease characterized by uncontrolled proliferation of cells, the molecular origin of which derives from mutations of a cell’s DNA sequence. To counteract such mutations and repair damaged DNA, cells are equipped with intricate DNA repair pathways. Oxidative stress, oxidative DNA damage, and deficient repair of oxidative DNA lesions repair have been proposed to contribute to the development of schizophrenia and ASD. In this article, we summarize the current evidence of cancer comorbidity in these brain disorders and discuss the putative roles of oxidative stress, DNA damage and DNA repair in the aetiopathology of schizophrenia and ASD.

  13. Mitochondrial and Nuclear DNA Damage and Repair in Age-Related Macular Degeneration

    Directory of Open Access Journals (Sweden)

    Janusz Blasiak

    2013-01-01

    Full Text Available Aging and oxidative stress seem to be the most important factors in the pathogenesis of age-related macular degeneration (AMD, a condition affecting many elderly people in the developed world. However, aging is associated with the accumulation of oxidative damage in many biomolecules, including DNA. Furthermore, mitochondria may be especially important in this process because the reactive oxygen species produced in their electron transport chain can damage cellular components. Therefore, the cellular response to DNA damage, expressed mainly through DNA repair, may play an important role in AMD etiology. In several studies the increase in mitochondrial DNA (mtDNA damage and mutations, and the decrease in the efficacy of DNA repair have been correlated with the occurrence and the stage of AMD. It has also been shown that mitochondrial DNA accumulates more DNA lesions than nuclear DNA in AMD. However, the DNA damage response in mitochondria is executed by nucleus-encoded proteins, and thus mutagenesis in nuclear DNA (nDNA may affect the ability to respond to mutagenesis in its mitochondrial counterpart. We reported that lymphocytes from AMD patients displayed a higher amount of total endogenous basal and oxidative DNA damage, exhibited a higher sensitivity to hydrogen peroxide and UV radiation, and repaired the lesions induced by these factors less effectively than did cells from control individuals. We postulate that poor efficacy of DNA repair (i.e., is impaired above average for a particular age when combined with the enhanced sensitivity of retinal pigment epithelium cells to environmental stress factors, contributes to the pathogenesis of AMD. Collectively, these data suggest that the cellular response to both mitochondrial and nuclear DNA damage may play an important role in AMD pathogenesis.

  14. Membrane association of mitochondrial DNA facilitates base excision repair in mammalian mitochondria.

    Science.gov (United States)

    Boesch, Pierre; Ibrahim, Noha; Dietrich, André; Lightowlers, Robert N

    2010-03-01

    Mitochondrial DNA encodes a set of 13 polypeptides and is subjected to constant oxidative stress due to ROS production within the organelle. It has been shown that DNA repair in the mitochondrion proceeds through both short- and long-patch base excision repair (BER). In the present article, we have used the natural competence of mammalian mitochondria to import DNA and study the sub-mitochondrial localization of the repair system in organello. Results demonstrate that sequences corresponding to the mtDNA non-coding region interact with the inner membrane in a rapid and saturable fashion. We show that uracil containing import substrates are taken into the mitochondrion and are used as templates for damage driven DNA synthesis. After further sub-fractionation, we show that the length of the repair synthesis patch differs in the soluble and the particulate fraction. Bona fide long patch BER synthesis occurs on the DNA associated with the particulate fraction, whereas a nick driven DNA synthesis occurs when the uracil containing DNA accesses the soluble fraction. Our results suggest that coordinate interactions of the different partners needed for BER is only found at sites where the DNA is associated with the membrane.

  15. Transient RNA-DNA Hybrids Are Required for Efficient Double-Strand Break Repair.

    Science.gov (United States)

    Ohle, Corina; Tesorero, Rafael; Schermann, Géza; Dobrev, Nikolay; Sinning, Irmgard; Fischer, Tamás

    2016-11-03

    RNA-DNA hybrids are a major internal cause of DNA damage within cells, and their degradation by RNase H enzymes is important for maintaining genomic stability. Here, we identified an unexpected role for RNA-DNA hybrids and RNase H enzymes in DNA repair. Using a site-specific DNA double-strand break (DSB) system in Schizosaccharomyces pombe, we showed that RNA-DNA hybrids form as part of the homologous-recombination (HR)-mediated DSB repair process and that RNase H enzymes are essential for their degradation and efficient completion of DNA repair. Deleting RNase H stabilizes RNA-DNA hybrids around DSB sites and strongly impairs recruitment of the ssDNA-binding RPA complex. In contrast, overexpressing RNase H1 destabilizes these hybrids, leading to excessive strand resection and RPA recruitment and to severe loss of repeat regions around DSBs. Our study challenges the existing model of HR-mediated DSB repair and reveals a surprising role for RNA-DNA hybrids in maintaining genomic stability. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. ZMYM3 regulates BRCA1 localization at damaged chromatin to promote DNA repair.

    Science.gov (United States)

    Leung, Justin W C; Makharashvili, Nodar; Agarwal, Poonam; Chiu, Li-Ya; Pourpre, Renaud; Cammarata, Michael B; Cannon, Joe R; Sherker, Alana; Durocher, Daniel; Brodbelt, Jennifer S; Paull, Tanya T; Miller, Kyle M

    2017-02-01

    Chromatin connects DNA damage response factors to sites of damaged DNA to promote the signaling and repair of DNA lesions. The histone H2A variants H2AX, H2AZ, and macroH2A represent key chromatin constituents that facilitate DNA repair. Through proteomic screening of these variants, we identified ZMYM3 (zinc finger, myeloproliferative, and mental retardation-type 3) as a chromatin-interacting protein that promotes DNA repair by homologous recombination (HR). ZMYM3 is recruited to DNA double-strand breaks through bivalent interactions with both histone and DNA components of the nucleosome. We show that ZMYM3 links the HR factor BRCA1 to damaged chromatin through specific interactions with components of the BRCA1-A subcomplex, including ABRA1 and RAP80. By regulating ABRA1 recruitment to damaged chromatin, ZMYM3 facilitates the fine-tuning of BRCA1 interactions with DNA damage sites and chromatin. Consistent with a role in regulating BRCA1 function, ZMYM3 deficiency results in impaired HR repair and genome instability. Thus, our work identifies a critical chromatin-binding DNA damage response factor, ZMYM3, which modulates BRCA1 functions within chromatin to ensure the maintenance of genome integrity. © 2017 Leung et al.; Published by Cold Spring Harbor Laboratory Press.

  17. The transcription fidelity factor GreA impedes DNA break repair.

    Science.gov (United States)

    Sivaramakrishnan, Priya; Sepúlveda, Leonardo A; Halliday, Jennifer A; Liu, Jingjing; Núñez, María Angélica Bravo; Golding, Ido; Rosenberg, Susan M; Herman, Christophe

    2017-10-12

    Homologous recombination repairs DNA double-strand breaks and must function even on actively transcribed DNA. Because break repair prevents chromosome loss, the completion of repair is expected to outweigh the transcription of broken templates. However, the interplay between DNA break repair and transcription processivity is unclear. Here we show that the transcription factor GreA inhibits break repair in Escherichia coli. GreA restarts backtracked RNA polymerase and hence promotes transcription fidelity. We report that removal of GreA results in markedly enhanced break repair via the classic RecBCD-RecA pathway. Using a deep-sequencing method to measure chromosomal exonucleolytic degradation, we demonstrate that the absence of GreA limits RecBCD-mediated resection. Our findings suggest that increased RNA polymerase backtracking promotes break repair by instigating RecA loading by RecBCD, without the influence of canonical Chi signals. The idea that backtracked RNA polymerase can stimulate recombination presents a DNA transaction conundrum: a transcription fidelity factor that compromises genomic integrity.

  18. Germline mutations in DNA repair genes may predict neoadjuvant therapy response in triple negative breast patients.

    Science.gov (United States)

    Spugnesi, Laura; Gabriele, Michele; Scarpitta, Rosa; Tancredi, Mariella; Maresca, Luisa; Gambino, Gaetana; Collavoli, Anita; Aretini, Paolo; Bertolini, Ilaria; Salvadori, Barbara; Landucci, Elisabetta; Fontana, Andrea; Rossetti, Elena; Roncella, Manuela; Naccarato, Giuseppe Antonio; Caligo, Maria Adelaide

    2016-12-01

    Triple negative breast cancers (TNBCs) represent about 15-20% of all breast cancer cases and are characterized by a complex molecular heterogeneity. Some TNBCs exhibit clinical and pathological properties similar to BRCA-mutated tumors, without actually bearing a mutation in BRCA genes. This "BRCAness" phenotype may be explained by germline mutations in other genes involved in DNA repair. Although respond to chemotherapy with alkylating agents, they have a high risk of recurrence and progression. Some studies have shown the efficacy of neoadjuvant therapy in TNBC patients with DNA repair defects, but proper biomarkers of DNA repair deficiency are still needed. Here, we investigated if mutations in DNA repair genes may be correlated with anthracyclines/taxanes neoadjuvant therapy response. DNA from 19 TNBC patients undergoing neoadjuvant therapy were subjected to next generation sequencing of a panel of 24 genes in DNA repair and breast cancer predisposition. In this study, 5 of 19 patients (26%) carried a pathogenic mutation in BRCA1, PALB2, RAD51C and two patients carried a probable pathogenic missense variant. Moreover, VUS (Variants of Unknown Significance) in other genes, predicted to be deleterious by in silico tools, were detected in five patients. Germline mutations in DNA repair genes were found to be associated with the group of TNBC patients who responded to therapy. We conclude that a subgroup of TNBC patients have defects in DNA repair genes, other than BRCA1, and such patients respond favourably to neoadjuvant anthracyclines/taxanes therapy. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  19. Genetic variants of the DNA repair genes from Exome Aggregation Consortium (EXAC) database: significance in cancer.

    Science.gov (United States)

    Das, Raima; Ghosh, Sankar Kumar

    2017-04-01

    DNA repair pathway is a primary defense system that eliminates wide varieties of DNA damage. Any deficiencies in them are likely to cause the chromosomal instability that leads to cell malfunctioning and tumorigenesis. Genetic polymorphisms in DNA repair genes have demonstrated a significant association with cancer risk. Our study attempts to give a glimpse of the overall scenario of the germline polymorphisms in the DNA repair genes by taking into account of the Exome Aggregation Consortium (ExAC) database as well as the Human Gene Mutation Database (HGMD) for evaluating the disease link, particularly in cancer. It has been found that ExAC DNA repair dataset (which consists of 228 DNA repair genes) comprises 30.4% missense, 12.5% dbSNP reported and 3.2% ClinVar significant variants. 27% of all the missense variants has the deleterious SIFT score of 0.00 and 6% variants carrying the most damaging Polyphen-2 score of 1.00, thus affecting the protein structure and function. However, as per HGMD, only a fraction (1.2%) of ExAC DNA repair variants was found to be cancer-related, indicating remaining variants reported in both the databases to be further analyzed. This, in turn, may provide an increased spectrum of the reported cancer linked variants in the DNA repair genes present in ExAC database. Moreover, further in silico functional assay of the identified vital cancer-associated variants, which is essential to get their actual biological significance, may shed some lights in the field of targeted drug development in near future. Copyright © 2017. Published by Elsevier B.V.

  20. Protein phosphatase 5 is necessary for ATR-mediated DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Yoonsung [Department of Pharmacology, DNA Repair Research Center, Chosun University School of Medicine, 375 Seosuk-Dong, Gwangju 501-759 (Korea, Republic of); Cheong, Hyang-Min [Department of Life Science, College of Natural Science, Chung-Ang University, 221 Heuksuk-Dong, Dongjak-Ku, Seoul 156-756 (Korea, Republic of); Lee, Jung-Hee [Department of Pharmacology, DNA Repair Research Center, Chosun University School of Medicine, 375 Seosuk-Dong, Gwangju 501-759 (Korea, Republic of); Song, Peter I. [Department of Dermatology, University of Arkansas for Medical Science, 4301 West Markham, Slot 576, Little Rock, AR 72205 (Korea, Republic of); Lee, Kwang-Ho [Department of Life Science, College of Natural Science, Chung-Ang University, 221 Heuksuk-Dong, Dongjak-Ku, Seoul 156-756 (Korea, Republic of); Kim, Sang-Yong [Division of Endocrinology, Department of Internal Medicine, Chosun University School of Medicine, 375 Seosuk-Dong, Gwangju 501-759 (Korea, Republic of); Jun, Jae Yeoul [Department of Physiology, Chosun University School of Medicine, 375 Seosuk-Dong, Gwangju 501-759 (Korea, Republic of); You, Ho Jin, E-mail: hjyou@chosun.ac.kr [Department of Pharmacology, DNA Repair Research Center, Chosun University School of Medicine, 375 Seosuk-Dong, Gwangju 501-759 (Korea, Republic of)

    2011-01-07

    Research highlights: {yields} Serine/threonine protein phosphatase 5 (PP5) has been shown to participate in ataxia telangiectasia-mutated (ATM)- and ATR (ATM- and Rad3-related)-mediated checkpoint pathways, which plays an important role in the DNA damage response and maintenance of genomic stability. {yields} However, it is not clear exactly how PP5 participates in this process. {yields} Our results indicate that PP5 is more closely related with ATR-mediated pathway than ATM-mediated pathway in DNA damage repair. -- Abstract: Several recent studies have shown that protein phosphatase 5 (PP5) participates in cell cycle arrest after DNA damage, but its roles in DNA repair have not yet been fully characterized. We investigated the roles of PP5 in the repair of ultraviolet (UV)- and neocarzinostatin (NCS)-induced DNA damage. The results of comet assays revealed different repair patterns in UV- and NCS-exposed U2OS-PS cells. PP5 is only essential for Rad3-related (ATR)-mediated DNA repair. Furthermore, the phosphorylation of 53BP1 and BRCA1, important mediators of DNA damage repair, and substrates of ATR and ATM decreased in U2OS-PS cells exposed to UV radiation. In contrast, the cell cycle arrest proteins p53, CHK1, and CHK2 were normally phosphorylated in U2OS and U2OS-PS cells exposed to UV radiation or treated with NCS. In view of these results, we suggest that PP5 plays a crucial role in ATR-mediated repair of UV-induced DNA damage.

  1. Germline stem cell gene PIWIL2 mediates DNA repair through relaxation of chromatin.

    Directory of Open Access Journals (Sweden)

    De-Tao Yin

    Full Text Available DNA damage response (DDR is an intrinsic barrier of cell to tumorigenesis initiated by genotoxic agents. However, the mechanisms underlying the DDR are not completely understood despite of extensive investigation. Recently, we have reported that ectopic expression of germline stem cell gene PIWIL2 is associated with tumor stem cell development, although the underlying mechanisms are largely unknown. Here we show that PIWIL2 is required for the repair of DNA-damage induced by various types of genotoxic agents. Upon ultraviolet (UV irradiation, silenced PIWIL2 gene in normal human fibroblasts was transiently activated after treatment with UV light. This activation was associated with DNA repair, because Piwil2-deficienct mouse embryonic fibroblasts (mili(-/- MEFs were defective in cyclobutane pyrimidine dimers (CPD repair after UV treatment. As a result, the UV-treated mili(-/- MEFs were more susceptible to apoptosis, as characterized by increased levels of DNA damage-associated apoptotic proteins, such as active caspase-3, cleaved Poly (ADP-ribose polymerase (PARP and Bik. The impaired DNA repair in the mili(-/- MEFs was associated with the reductions of histone H3 acetylation and chromatin relaxation, although the DDR pathway downstream chromatin relaxation appeared not to be directly affected by Piwil2. Moreover, guanine-guanine (Pt-[GG] and double strand break (DSB repair were also defective in the mili(-/- MEFs treated by genotoxic chemicals Cisplatin and ionizing radiation (IR, respectively. The results indicate that Piwil2 can mediate DNA repair through an axis of Piwil2 → histone acetylation → chromatin relaxation upstream DDR pathways. The findings reveal a new role for Piwil2 in DNA repair and suggest that Piwil2 may act as a gatekeeper against DNA damage-mediated tumorigenesis.

  2. DNA repair goes hip-hop: SMARCA and CHD chromatin remodellers join the break dance.

    Science.gov (United States)

    Rother, Magdalena B; van Attikum, Haico

    2017-10-05

    Proper signalling and repair of DNA double-strand breaks (DSB) is critical to prevent genome instability and diseases such as cancer. The packaging of DNA into chromatin, however, has evolved as a mere obstacle to these DSB responses. Posttranslational modifications and ATP-dependent chromatin remodelling help to overcome this barrier by modulating nucleosome structures and allow signalling and repair machineries access to DSBs in chromatin. Here we recap our current knowledge on how ATP-dependent SMARCA- and CHD-type chromatin remodellers alter chromatin structure during the signalling and repair of DSBs and discuss how their dysfunction impacts genome stability and human disease.This article is part of the themed issue 'Chromatin modifiers and remodellers in DNA repair and signalling'. © 2017 The Authors.

  3. DNA polymerase β: A missing link of the base excision repair machinery in mammalian mitochondria.

    Science.gov (United States)

    Prasad, Rajendra; Çağlayan, Melike; Dai, Da-Peng; Nadalutti, Cristina A; Zhao, Ming-Lang; Gassman, Natalie R; Janoshazi, Agnes K; Stefanick, Donna F; Horton, Julie K; Krasich, Rachel; Longley, Matthew J; Copeland, William C; Griffith, Jack D; Wilson, Samuel H

    2017-12-01

    Mitochondrial genome integrity is fundamental to mammalian cell viability. Since mitochondrial DNA is constantly under attack from oxygen radicals released during ATP production, DNA repair is vital in removing oxidatively generated lesions in mitochondrial DNA, but the presence of a strong base excision repair system has not been demonstrated. Here, we addressed the presence of such a system in mammalian mitochondria involving the primary base lesion repair enzyme DNA polymerase (pol) β. Pol β was localized to mammalian mitochondria by electron microscopic-immunogold staining, immunofluorescence co-localization and biochemical experiments. Extracts from purified mitochondria exhibited base excision repair activity that was dependent on pol β. Mitochondria from pol β-deficient mouse fibroblasts had compromised DNA repair and showed elevated levels of superoxide radicals after hydrogen peroxide treatment. Mitochondria in pol β-deficient fibroblasts displayed altered morphology by electron microscopy. These results indicate that mammalian mitochondria contain an efficient base lesion repair system mediated in part by pol β and thus pol β plays a role in preserving mitochondrial genome stability. Published by Elsevier B.V.

  4. Thimerosal-Derived Ethylmercury Is a Mitochondrial Toxin in Human Astrocytes: Possible Role of Fenton Chemistry in the Oxidation and Breakage of mtDNA

    Directory of Open Access Journals (Sweden)

    Martyn A. Sharpe

    2012-01-01

    Full Text Available Thimerosal generates ethylmercury in aqueous solution and is widely used as preservative. We have investigated the toxicology of Thimerosal in normal human astrocytes, paying particular attention to mitochondrial function and the generation of specific oxidants. We find that ethylmercury not only inhibits mitochondrial respiration leading to a drop in the steady state membrane potential, but also concurrent with these phenomena increases the formation of superoxide, hydrogen peroxide, and Fenton/Haber-Weiss generated hydroxyl radical. These oxidants increase the levels of cellular aldehyde/ketones. Additionally, we find a five-fold increase in the levels of oxidant damaged mitochondrial DNA bases and increases in the levels of mtDNA nicks and blunt-ended breaks. Highly damaged mitochondria are characterized by having very low membrane potentials, increased superoxide/hydrogen peroxide production, and extensively damaged mtDNA and proteins. These mitochondria appear to have undergone a permeability transition, an observation supported by the five-fold increase in Caspase-3 activity observed after Thimerosal treatment.

  5. Radiation- and drug-induced DNA repair in mammalian oocytes and embryos

    Energy Technology Data Exchange (ETDEWEB)

    Pedersen, R A; Brandriff, B

    1979-01-01

    A review of studies showing ultraviolet- or drug-induced unscheduled DNA synthesis in mammalian oocytes and embryos suggests that the female gamete has an excision repair capacity from the earliest stages of oocyte growth. The oocyte's demonstrable excision repair capacity decreases at the time of meiotic maturation for unknown reasons, but the fully mature oocyte maintans a repair capacity, in contrast to the mature sperm, and contributes this to the zygote. Early embryo cells maintain relatively constant levels of excision repair until late fetal stages, when they lose their capacity for excision repair. These apparent changes in excision repair capacity do not have a simple relationship to known differences in radiation sensitivity of germ cells and embryos.

  6. Genomic survey and expression analysis of DNA repair genes in the genus Leptospira.

    Science.gov (United States)

    Martins-Pinheiro, Marinalva; Schons-Fonseca, Luciane; da Silva, Josefa B; Domingos, Renan H; Momo, Leonardo Hiroyuki Santos; Simões, Ana Carolina Quirino; Ho, Paulo Lee; da Costa, Renata M A

    2016-04-01

    Leptospirosis is an emerging zoonosis with important economic and public health consequences and is caused by pathogenic leptospires. The genus Leptospira belongs to the order Spirochaetales and comprises saprophytic (L. biflexa), pathogenic (L. interrogans) and host-dependent (L. borgpetersenii) members. Here, we present an in silico search for DNA repair pathways in Leptospira spp. The relevance of such DNA repair pathways was assessed through the identification of mRNA levels of some genes during infection in animal model and after exposition to spleen cells. The search was performed by comparison of available Leptospira spp. genomes in public databases with known DNA repair-related genes. Leptospires exhibit some distinct and unexpected characteristics, for instance the existence of a redundant mechanism for repairing a chemically diverse spectrum of alkylated nucleobases, a new mutS-like gene and a new shorter version of uvrD. Leptospira spp. shares some characteristics from Gram-positive, as the presence of PcrA, two RecQ paralogs and two SSB proteins; the latter is considered a feature shared by naturally competent bacteria. We did not find a significant reduction in the number of DNA repair-related genes in both pathogenic and host-dependent species. Pathogenic leptospires were enriched for genes dedicated to base excision repair and non-homologous end joining. Their evolutionary history reveals a remarkable importance of lateral gene transfer events for the evolution of the genus. Up-regulation of specific DNA repair genes, including components of SOS regulon, during infection in animal model validates the critical role of DNA repair mechanisms for the complex interplay between host/pathogen.

  7. Crosstalk between Translesion Synthesis, Fanconi Anemia Network, and Homologous Recombination Repair Pathways in Interstrand DNA Crosslink Repair and Development of Chemoresistance

    OpenAIRE

    Haynes, Brittany; Saadat, Nadia; Myung, Brian; Shekhar, Malathy PV

    2014-01-01

    Bifunctional alkylating and platinum based drugs are chemotherapeutic agents used to treat cancer. These agents induce DNA adducts via formation of intrastrand or interstrand (ICL) DNA crosslinks, and DNA lesions of the ICL type are particularly toxic as they block DNA replication and/or DNA transcription. However, the therapeutic efficacies of these drugs are frequently limited due to the cancer cell’s enhanced ability to repair and tolerate these toxic DNA lesions. This ability to tolerate ...

  8. Acetylation regulates WRN catalytic activities and affects base excision DNA repair

    DEFF Research Database (Denmark)

    Muftuoglu, Meltem; Kusumoto, Rika; Speina, Elzbieta

    2008-01-01

    The Werner protein (WRN), defective in the premature aging disorder Werner syndrome, participates in a number of DNA metabolic processes, and we have been interested in the possible regulation of its function in DNA repair by post-translational modifications. Acetylation mediated by histone...

  9. DNA repair enables sex identification in genetic material from human teeth

    NARCIS (Netherlands)

    Kovatsi, L.; Nikou, D.; Triantaphyllou, S.; Njau, S. N.; Voutsaki, S.; Kouidou, S.

    2009-01-01

    Background: The purpose of this study was to test the effectiveness of a DNA repair protocol in improving genetic testing in compromised samples, frequently encountered in Forensic Medicine. Methods: In order to stretch the experiment conditions to the limits, as far as quality of samples and DNA is

  10. DHR6, a Drosophila homolog of the yeast DNA repair gene RAD6.

    NARCIS (Netherlands)

    M.H.M. Koken (Marcel); P. Reynolds (Paul); D. Bootsma (Dirk); J.H.J. Hoeijmakers (Jan); S. Prakash; L. Prakash

    1991-01-01

    textabstractThe RAD6 gene of the yeast Saccharomyces cerevisiae is required for DNA repair, for DNA damage-induced mutagenesis, and for sporulation, and it encodes a ubiquitin-conjugating enzyme. We have cloned the RAD6 homolog from Drosophila melanogaster and find that its encoded protein displays

  11. Regulation of DNA double-strand break repair by ubiquitin and ubiquitin-like modifiers

    DEFF Research Database (Denmark)

    Schwertman, Petra; Bekker-Jensen, Simon; Mailand, Niels

    2016-01-01

    DNA double-strand breaks (DSBs) are highly cytotoxic DNA lesions. The swift recognition and faithful repair of such damage is crucial for the maintenance of genomic stability, as well as for cell and organismal fitness. Signalling by ubiquitin, SUMO and other ubiquitin-like modifiers (UBLs...

  12. Colocalization of multiple DNA double-strand breaks at a single Rad52 repair centre

    DEFF Research Database (Denmark)

    Lisby, M.; Mortensen, Uffe Hasbro; Rothstein, R.

    2003-01-01

    DNA double-strand break repair (DSBR) is an essential process for preserving genomic integrity in all organisms. To investigate this process at the cellular level, we engineered a system of fluorescently marked DNA double-strand breaks (DSBs) in the yeast Saccharomyces cerevisiae to visualize in ...

  13. Effects of hyperthermia on DNA repair pathways: one treatment to inhibit them all

    NARCIS (Netherlands)

    Oei, Arlene L.; Vriend, Lianne E. M.; Crezee, Johannes; Franken, Nicolaas A. P.; Krawczyk, Przemek M.

    2015-01-01

    The currently available arsenal of anticancer modalities includes many DNA damaging agents that can kill malignant cells. However, efficient DNA repair mechanisms protect both healthy and cancer cells against the effects of treatment and contribute to the development of drug resistance. Therefore,

  14. Insights into Light-driven DNA Repair by Photolyases : Challenges and Opportunities for Electronic Structure Theory

    NARCIS (Netherlands)

    Faraji, Shirin; Dreuw, Andreas

    2017-01-01

    Ultraviolet radiation causes two of the most abundant mutagenic and cytotoxic DNA lesions: cyclobutane pyrimidine dimers and 6-4 photoproducts. (6-4) Photolyases are light-activated enzymes that selectively bind to DNA and trigger repair of mutagenic 6-4 photoproducts via photoinduced electron

  15. Human DNA polymerase delta double-mutant D316A;E318A interferes with DNA mismatch repair in vitro

    DEFF Research Database (Denmark)

    Liu, Dekang; Frederiksen, Jane H; Liberti, Sascha E

    2017-01-01

    DNA mismatch repair (MMR) is a highly-conserved DNA repair mechanism, whose primary role is to remove DNA replication errors preventing them from manifesting as mutations, thereby increasing the overall genome stability. Defects in MMR are associated with increased cancer risk in humans and other...

  16. Influence of some prostaglandins on DNA synthesis and DNA excision repair in mouse spleen cells in vitro

    Energy Technology Data Exchange (ETDEWEB)

    Egg, D.; Altmann, H.; Guenther R.; Klein W.; Kocsis, F.

    1978-03-01

    In vitro experiments were performed on mouse spleen cells to establish possible influences of some naturally occurring prostaglandins on DNA synthesis and DNA excision repair. The prostaglandins A1, B1, E1, E2, and F2 alpha were tested in concentrations of lopg, 5 ng and 2.5 microgram per ml cell suspension. DNA synthesis was significantly increased by PgF2 alpha in all the three concentrations tested, while the other tested prostaglandins were essentially ineffective. DNA excision repair was significantly inhibited by PgE1 and PgE2 at 5 ng/ml and at 2.5 microgram/ml but increased by PgF2 alpha in the two lower concentrations. The rejoining of DNA-strand breaks after gamma-irradiation was slightly reduced by PgE1, PgE2 and PgF2 alpha at 2.5 microgram/ml.

  17. APOBEC3G enhances lymphoma cell radioresistance by promoting cytidine deaminase-dependent DNA repair.

    Science.gov (United States)

    Nowarski, Roni; Wilner, Ofer I; Cheshin, Ori; Shahar, Or D; Kenig, Edan; Baraz, Leah; Britan-Rosich, Elena; Nagler, Arnon; Harris, Reuben S; Goldberg, Michal; Willner, Itamar; Kotler, Moshe

    2012-07-12

    APOBEC3 proteins catalyze deamination of cytidines in single-stranded DNA (ssDNA), providing innate protection against retroviral replication by inducing deleterious dC > dU hypermutation of replication intermediates. APOBEC3G expression is induced in mitogen-activated lymphocytes; however, no physiologic role related to lymphoid cell proliferation has yet to be determined. Moreover, whether APOBEC3G cytidine deaminase activity transcends to processing cellular genomic DNA is unknown. Here we show that lymphoma cells expressing high APOBEC3G levels display efficient repair of genomic DNA double-strand breaks (DSBs) induced by ionizing radiation and enhanced survival of irradiated cells. APOBEC3G transiently accumulated in the nucleus in response to ionizing radiation and was recruited to DSB repair foci. Consistent with a direct role in DSB repair, inhibition of APOBEC3G expression or deaminase activity resulted in deficient DSB repair, whereas reconstitution of APOBEC3G expression in leukemia cells enhanced DSB repair. APOBEC3G activity involved processing of DNA flanking a DSB in an integrated reporter cassette. Atomic force microscopy indicated that APOBEC3G multimers associate with ssDNA termini, triggering multimer disassembly to multiple catalytic units. These results identify APOBEC3G as a prosurvival factor in lymphoma cells, marking APOBEC3G as a potential target for sensitizing lymphoma to radiation therapy.

  18. DNA Repair and Photoprotection: Mechanisms of Overcoming Environmental Ultraviolet Radiation Exposure in Halophilic Archaea

    Science.gov (United States)

    Jones, Daniel L.; Baxter, Bonnie K.

    2017-01-01

    Halophilic archaea push the limits of life at several extremes. In particular, they are noted for their biochemical strategies in dealing with osmotic stress, low water activity and cycles of desiccation in their hypersaline environments. Another feature common to their habitats is intense ultraviolet (UV) radiation, which is a challenge that microorganisms must overcome. The consequences of high UV exposure include DNA lesions arising directly from bond rearrangement of adjacent bipyrimidines, or indirectly from oxidative damage, which may ultimately result in mutation and cell death. As such, these microorganisms have evolved a number of strategies to navigate the threat of DNA damage, which we differentiate into two categories: DNA repair and photoprotection. Photoprotection encompasses damage avoidance strategies that serve as a “first line of defense,” and in halophilic archaea include pigmentation by carotenoids, mechanisms of oxidative damage avoidance, polyploidy, and genomic signatures that make DNA less susceptible to photodamage. Photolesions that do arise are addressed by a number of DNA repair mechanisms that halophilic archaea efficiently utilize, which include photoreactivation, nucleotide excision repair, base excision repair, and homologous recombination. This review seeks to place DNA damage, repair, and photoprotection in the context of halophilic archaea and the solar radiation of their hypersaline environments. We also provide new insight into the breadth of strategies and how they may work together to produce remarkable UV-resistance for these microorganisms. PMID:29033920

  19. Surveying the repair of ancient DNA from bones via high-throughput sequencing.

    Science.gov (United States)

    Mouttham, Nathalie; Klunk, Jennifer; Kuch, Melanie; Fourney, Ron; Poinar, Hendrik

    2015-07-01

    DNA damage in the form of abasic sites, chemically altered nucleotides, and strand fragmentation is the foremost limitation in obtaining genetic information from many ancient samples. Upon cell death, DNA continues to endure various chemical attacks such as hydrolysis and oxidation, but repair pathways found in vivo no longer operate. By incubating degraded DNA with specific enzyme combinations adopted from these pathways, it is possible to reverse some of the post-mortem nucleic acid damage prior to downstream analyses such as library preparation, targeted enrichment, and high-throughput sequencing. Here, we evaluate the performance of two available repair protocols on previously characterized DNA extracts from four mammoths. Both methods use endonucleases and glycosylases along with a DNA polymerase-ligase combination. PreCR Repair Mix increases the number of molecules converted to sequencing libraries, leading to an increase in endogenous content and a decrease in cytosine-to-thymine transitions due to cytosine deamination. However, the effects of Nelson Repair Mix on repair of DNA damage remain inconclusive.

  20. DNA Repair and Photoprotection: Mechanisms of Overcoming Environmental Ultraviolet Radiation Exposure in Halophilic Archaea

    Directory of Open Access Journals (Sweden)

    Daniel L. Jones

    2017-09-01

    Full Text Available Halophilic archaea push the limits of life at several extremes. In particular, they are noted for their biochemical strategies in dealing with osmotic stress, low water activity and cycles of desiccation in their hypersaline environments. Another feature common to their habitats is intense ultraviolet (UV radiation, which is a challenge that microorganisms must overcome. The consequences of high UV exposure include DNA lesions arising directly from bond rearrangement of adjacent bipyrimidines, or indirectly from oxidative damage, which may ultimately result in mutation and cell death. As such, these microorganisms have evolved a number of strategies to navigate the threat of DNA damage, which we differentiate into two categories: DNA repair and photoprotection. Photoprotection encompasses damage avoidance strategies that serve as a “first line of defense,” and in halophilic archaea include pigmentation by carotenoids, mechanisms of oxidative damage avoidance, polyploidy, and genomic signatures that make DNA less susceptible to photodamage. Photolesions that do arise are addressed by a number of DNA repair mechanisms that halophilic archaea efficiently utilize, which include photoreactivation, nucleotide excision repair, base excision repair, and homologous recombination. This review seeks to place DNA damage, repair, and photoprotection in the context of halophilic archaea and the solar radiation of their hypersaline environments. We also provide new insight into the breadth of strategies and how they may work together to produce remarkable UV-resistance for these microorganisms.

  1. New Applications of the Comet Assay: Comet-FISH and Transcription-Coupled DNA Repair

    OpenAIRE

    Spivak, Graciela; Cox, Rachel A.; Hanawalt, Philip C.

    2008-01-01

    Transcription-coupled repair (TCR) is a pathway dedicated to the removal of damage from the template strands of actively transcribed genes. Although the detailed mechanism of TCR is not yet understood, it is believed to be triggered when a translocating RNA polymerase is arrested at a lesion or unusual structure in the DNA. Conventional assays for TCR require high doses of DNA damage for the statistical analysis of repair in the individual strands of DNA sequences ranging in size from a few h...

  2. TRF2 is required for repair of nontelomeric DNA double-strand breaks by homologous recombination

    OpenAIRE

    Mao, Zhiyong; Seluanov, Andrei; Jiang, Ying; Gorbunova, Vera

    2007-01-01

    TRF2 (telomeric repeat binding factor 2) is an essential component of the telomeric cap, where it forms and stabilizes the T-loop junctions. TRF2 forms the T-loops by stimulating strand invasion of the 3′ overhang into duplex DNA. TRF2 also has been shown to localize to nontelomeric DNA double-strand breaks, but its functional role in DNA repair has not been examined. Here, we present evidence that TRF2 is involved in homologous recombination (HR) repair of nontelomeric double-strand breaks. ...

  3. Nrf2 facilitates repair of radiation induced DNA damage through homologous recombination repair pathway in a ROS independent manner in cancer cells

    Energy Technology Data Exchange (ETDEWEB)

    Jayakumar, Sundarraj; Pal, Debojyoti; Sandur, Santosh K., E-mail: sskumar@barc.gov.in

    2015-09-15

    Highlights: • Nrf2 inhibition in A549 cells led to attenuated DNA repair and radiosensitization. • Influence of Nrf2 on DNA repair is not linked to its antioxidant function. • Nrf2 influences DNA repair through homologous recombination (HR) repair pathway. • Many genes involved in HR pathway show ARE sequences in their upstream region. - Abstract: Nrf2 is a redox sensitive transcription factor that is involved in the co-ordinated transcription of genes involved in redox homeostasis. But the role of Nrf2 in DNA repair is not investigated in detail. We have employed A549 and MCF7 cells to study the role of Nrf2 on DNA repair by inhibiting Nrf2 using all-trans retinoic acid (ATRA) or by knock down approach prior to radiation exposure (4 Gy). DNA damage and repair analysis was studied by γH2AX foci formation and comet assay. Results suggested that the inhibition of Nrf2 in A549 or MCF7 cells led to significant slowdown in DNA repair as compared to respective radiation controls. The persistence of residual DNA damage even in the presence of free radical scavenger N-acetyl cysteine, suggested that the influence of Nrf2 on DNA repair was not linked to its antioxidant functions. Further, its influence on non-homologous end joining repair pathway was studied by inhibiting both Nrf2 and DNA-PK together. This led to synergistic reduction of survival fraction, indicating that Nrf2 may not be influencing the NHEJ pathway. To investigate the role of homologous recombination repair (HR) pathway, RAD51 foci formation was monitored. There was a significant reduction in the foci formation in cells treated with ATRA or shRNA against Nrf2 as compared to their respective radiation controls. Further, Nrf2 inhibition led to significant reduction in mRNA levels of RAD51. BLAST analysis was also performed on upstream regions of DNA repair genes to identify antioxidant response element and found that many repair genes that are involved in HR pathway may be regulated by Nrf2

  4. Detection of thymine [2+2] photodimer repair in DNA: selective reaction of KMnO4.

    OpenAIRE

    Ramaiah, D; Koch, T; Orum, H; Schuster, G B

    1998-01-01

    The specific reaction of potassium permanganate with thymine in single-stranded DNA was employed to analyze thymine [2+2] dimer repair in DNA and in DNA/peptide nucleic acid hybrid duplexes. This simple and highly sensitive chemical assay is convenient for monitoring repair of thymine dimers in oligonucleotides.

  5. Double-strand break repair: are Rad51/RecA--DNA joints barriers to DNA replication?

    Science.gov (United States)

    Aguilera, A

    2001-06-01

    The central step of homologous recombination is the DNA strand exchange reaction catalyzed by bacterial RecA or eukaryotic Rad51. Besides Rad51-mediated synthesis-dependent strand annealing (SDSA), DNA ends can promote replication in Escherichia coli (recombination-dependent replication, RDR) and yeast (break-induced replication, BIR). However, what causes a DNA end to be repaired via SDSA or via BIR/RDR? I propose that Rad51/RecA--DNA plectonemic joints act as barriers to DNA replication and that BIR/RDR is only possible when the DNA polymerase that synthesizes DNA from the invading 3' end does not encounter RecA/Rad51--DNA joints in its path.

  6. Alkylation Induced DNA Repair and Mutagenesis in Escherichia coli.

    Science.gov (United States)

    1987-11-23

    procaryotic and eucaryotic organisms, including humans. Cells have evolved the ability to repair alkylation damage rapidly and faithfully by means of specific...is a 30 kdal protein. It is induced upon exposure of the cells to low levels of alkylating agents, a treatment that Induces the adaptive response...in unadapted cells . The inducible enzyme, TagII, is required for killing adaptation to alkylation resistance and for repair of potentially lethal

  7. DNA damage response and repair data with pharmacological modulators of Tousled

    Directory of Open Access Journals (Sweden)

    Prakash Srinivasan Timiri Shanmugam

    2016-06-01

    Full Text Available Human Tousled kinase 1 (TLK1 plays an important role in chromatin remodeling, replication, and DNA damage response and repair. TLK1 activity is immediately, but transiently, downregulated after genotoxic insult, and its recovery is important for exit from checkpoint arrest and cell survival after radiation. The data in this article compliments research presented in the paper titled, “Tousled kinase activator, gallic acid, promotes DNA repair and suppresses radiation cytotoxicity in salivary gland cells” [1]. The identification of small molecule activators and inhibitors of TLK1 provided an opportunity to pharmacologically alter the protein׳s activity to elucidate its role in DNA damage response pathways. TLK1 effectors, gallic acid (GA and thioridazine (THD activate and inhibit the kinase, respectively, and the data report on the impact of these compounds and the significance of TLK1 to DNA break repair and the survival of human salivary acinar cells.

  8. Human embryonic stem cells have enhanced repair of multiple forms of DNA damage

    DEFF Research Database (Denmark)

    Maynard, Scott; Swistowska, Anna Maria; Lee, Jae Wan

    2008-01-01

    Embryonic stem cells need to maintain genomic integrity so that they can retain the ability to differentiate into multiple cell types without propagating DNA errors. Previous studies have suggested that mechanisms of genome surveillance, including DNA repair, are superior in mouse embryonic stem...... cells compared with various differentiated murine cells. Using single-cell gel electrophoresis (comet assay) we found that human embryonic stem cells (BG01, I6) have more efficient repair of different types of DNA damage (generated from H2O2, UV-C, ionizing radiation, or psoralen) than human primary...... fibroblasts (WI-38, hs27) and, with the exception of UV-C damage, HeLa cells. Microarray gene expression analysis showed that mRNA levels of several DNA repair genes are elevated in human embryonic stem cells compared with their differentiated forms (embryoid bodies). These data suggest that genomic...

  9. Rad54 and Mus81 cooperation promotes DNA damage repair and restrains chromosome missegregation

    DEFF Research Database (Denmark)

    Ghamrasni, S El; Cardoso, R; Li, L

    2016-01-01

    Rad54 and Mus81 mammalian proteins physically interact and are important for the homologous recombination DNA repair pathway; however, their functional interactions in vivo are poorly defined. Here, we show that combinatorial loss of Rad54 and Mus81 results in hypersensitivity to DNA......-damaging agents, defects on both the homologous recombination and non-homologous DNA end joining repair pathways and reduced fertility. We also observed that while Mus81 deficiency diminished the cleavage of common fragile sites, very strikingly, Rad54 loss impaired this cleavage to even a greater extent....... The inefficient repair of DNA double-strand breaks (DSBs) in Rad54(-/-)Mus81(-/-) cells was accompanied by elevated levels of chromosome missegregation and cell death. Perhaps as a consequence, tumor incidence in Rad54(-/-)Mus81(-/-) mice remained comparable to that in Mus81(-/-) mice. Our study highlights...

  10. DNA damage and repair activity after broccoli intake in young healthy smokers

    DEFF Research Database (Denmark)

    Riso, Patrizia; Martini, Daniela; Møller, Peter

    2010-01-01

    compounds, including smokers. The aim of the study was to evaluate the effect of broccoli intake on biomarkers of DNA damage and repair. Twenty-seven young healthy smokers consumed a portion of steamed broccoli (250 g/day) or a control diet for 10 days each within a crossover design with a washout period...... mRNA expression levels of repair and defence enzymes: 8-oxoguanine DNA glycosylase (OGG1), nucleoside diphosphate linked moiety X-type motif 1 (NUDT1) and heme oxygenase 1 (HO-1). After broccoli consumption, the level of oxidised DNA lesions decreased by 41% (95% confidence interval: 10%, 72......%) and the resistance to H(2)O(2)-induced DNA strand breaks increased by 23% (95% CI: 13%, 34%). Following broccoli intake, a higher protection was observed in subjects with glutathione S-transferase (GST) M1-null genotype. The expression level and activity of repair enzymes was unaltered. In conclusion, broccoli...

  11. Protecting DNA from errors and damage: an overview of DNA repair mechanisms in plants compared to mammals.

    Science.gov (United States)

    Spampinato, Claudia P

    2017-05-01

    The genome integrity of all organisms is constantly threatened by replication errors and DNA damage arising from endogenous and exogenous sources. Such base pair anomalies must be accurately repaired to prevent mutagenesis and/or lethality. Thus, it is not surprising that cells have evolved multiple and partially overlapping DNA repair pathways to correct specific types of DNA errors and lesions. Great progress in unraveling these repair mechanisms at the molecular level has been made by several talented researchers, among them Tomas Lindahl, Aziz Sancar, and Paul Modrich, all three Nobel laureates in Chemistry for 2015. Much of this knowledge comes from studies performed in bacteria, yeast, and mammals and has impacted research in plant systems. Two plant features should be mentioned. Plants differ from higher eukaryotes in that they lack a reserve germline and cannot avoid environmental stresses. Therefore, plants have evolved different strategies to sustain genome fidelity through generations and continuous exposure to genotoxic stresses. These strategies include the presence of unique or multiple paralogous genes with partially overlapping DNA repair activities. Yet, in spite (or because) of these differences, plants, especially Arabidopsis thaliana, can be used as a model organism for functional studies. Some advantages of this model system are worth mentioning: short life cycle, availability of both homozygous and heterozygous lines for many genes, plant transformation techniques, tissue culture methods and reporter systems for gene expression and function studies. Here, I provide a current understanding of DNA repair genes in plants, with a special focus on A. thaliana. It is expected that this review will be a valuable resource for future functional studies in the DNA repair field, both in plants and animals.

  12. Yeast DNA-repair gene RAD14 encodes a zinc metalloprotein with affinity for ultraviolet-damaged DNA.

    OpenAIRE

    Guzder, S N; Sung, P; Prakash, L; Prakash, S

    1993-01-01

    Xeroderma pigmentosum (XP) patients suffer from a high incidence of skin cancers due to a defect in excision repair of UV light-damaged DNA. Of the seven XP complementation groups, A-G, group A represents a severe and frequent form of the disease. The Saccharomyces cerevisiae RAD14 gene is a homolog of the XP-A correcting (XPAC) gene. Like XP-A cells, rad14-null mutants are defective in the incision step of excision repair of UV-damaged DNA. We have purified RAD14 protein to homogeneity from ...

  13. Molecular Mechanisms of Ultraviolet Radiation-Induced DNA Damage and Repair

    Directory of Open Access Journals (Sweden)

    Rajesh P. Rastogi

    2010-01-01

    Full Text Available DNA is one of the prime molecules, and its stability is of utmost importance for proper functioning and existence of all living systems. Genotoxic chemicals and radiations exert adverse effects on genome stability. Ultraviolet radiation (UVR (mainly UV-B: 280–315 nm is one of the powerful agents that can alter the normal state of life by inducing a variety of mutagenic and cytotoxic DNA lesions such as cyclobutane-pyrimidine dimers (CPDs, 6-4 photoproducts (6-4PPs, and their Dewar valence isomers as well as DNA strand breaks by interfering the genome integrity. To counteract these lesions, organisms have developed a number of highly conserved repair mechanisms such as photoreactivation, base excision repair (BER, nucleotide excision repair (NER, and mismatch repair (MMR. Additionally, double-strand break repair (by homologous recombination and nonhomologous end joining, SOS response, cell-cycle checkpoints, and programmed cell death (apoptosis are also operative in various organisms with the expense of specific gene products. This review deals with UV-induced alterations in DNA and its maintenance by various repair mechanisms.

  14. Association of DNA repair gene XRCC1 and lung cancer susceptibility among nonsmoking Chinese women

    DEFF Research Database (Denmark)

    Yin, J.; Vogel, Ulla Birgitte; Ma, Y.

    2009-01-01

    Nonsmokers who develop lung cancer provide a good model for investigating the effect of genetic polymorphisms. XRCC1 is one of the major DNA repair proteins involved in the base-excision repair pathway. XRCC1 gene variations may lead to lower DNA repair capacity and thus confer inherited predispo......Nonsmokers who develop lung cancer provide a good model for investigating the effect of genetic polymorphisms. XRCC1 is one of the major DNA repair proteins involved in the base-excision repair pathway. XRCC1 gene variations may lead to lower DNA repair capacity and thus confer inherited...... predisposition to cancer risk. To address this question in more detail, we conducted a hospital-based case-control study consisting of 55 lung cancer cases and 74 cancer-free controls matched on age and ethnicity among nonsmoking Chinese women. We analyzed five coding single-nucleotide polymorphisms in the XRCC1...... gene: Agr194Trp, Arg280His, Arg399Gln, Pro206Pro, and Gln632Gln. Polymerase chain reaction-restriction fragment length polymorphism was used for genotyping. Carriers of the variant T-allele of Arg194Trp had a lower lung cancer risk than carriers of CC genotypes [odds ratio (OR)=0.46, 95% confidence...

  15. Single-molecule live-cell imaging of bacterial DNA repair and damage tolerance.

    Science.gov (United States)

    Ghodke, Harshad; Ho, Han; van Oijen, Antoine M

    2018-02-19

    Genomic DNA is constantly under threat from intracellular and environmental factors that damage its chemical structure. Uncorrected DNA damage may impede cellular propagation or even result in cell death, making it critical to restore genomic integrity. Decades of research have revealed a wide range of mechanisms through which repair factors recognize damage and co-ordinate repair processes. In recent years, single-molecule live-cell imaging methods have further enriched our understanding of how repair factors operate in the crowded intracellular environment. The ability to follow individual biochemical events, as they occur in live cells, makes single-molecule techniques tremendously powerful to uncover the spatial organization and temporal regulation of repair factors during DNA-repair reactions. In this review, we will cover practical aspects of single-molecule live-cell imaging and highlight recent advances accomplished by the application of these experimental approaches to the study of DNA-repair processes in prokaryotes. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  16. The Heterochromatic Barrier to DNA Double Strand Break Repair: How to Get the Entry Visa

    Directory of Open Access Journals (Sweden)

    Aaron A. Goodarzi

    2012-09-01

    Full Text Available Over recent decades, a deep understanding of pathways that repair DNA double strand breaks (DSB has been gained from biochemical, structural, biophysical and cellular studies. DNA non-homologous end-joining (NHEJ and homologous recombination (HR represent the two major DSB repair pathways, and both processes are now well understood. Recent work has demonstrated that the chromatin environment at a DSB significantly impacts upon DSB repair and that, moreover, dramatic modifications arise in the chromatin surrounding a DSB. Chromatin is broadly divided into open, transcriptionally active, euchromatin (EC and highly compacted, transcriptionally inert, heterochromatin (HC, although these represent extremes of a spectrum. The HC superstructure restricts both DSB repair and damage response signaling. Moreover, DSBs within HC (HC-DSBs are rapidly relocalized to the EC-HC interface. The damage response protein kinase, ataxia telangiectasia mutated (ATM, is required for HC-DSB repair but is dispensable for the relocalization of HC-DSBs. It has been proposed that ATM signaling enhances HC relaxation in the DSB vicinity and that this is a prerequisite for HC-DSB repair. Hence, ATM is essential for repair of HC-DSBs. Here, we discuss how HC impacts upon the response to DSBs and how ATM overcomes the barrier that HC poses to repair.

  17. Recent research in DNA repair, mutation and recombination: a report of the DNA Repair Network meeting, held at City University, London on 18 December 1995.

    Science.gov (United States)

    Jones, N J; Strike, P

    1996-09-02

    The now traditional one day Christmas DNA Repair meeting was held at City University, London for the third year in succession. With over 130 participants and a programme consisting of a total of 24 pre-offered presentations the meeting reached record dimensions. Attendees were from 24 institutions throughout the United Kingdom, and with several distinct research groups contained within the large contingents from the ICRF Clare Hall Laboratories and the MRC Cell Mutation Unit in Brighton, this indicates the increasing interest and depth of UK research in DNA repair. One slight disappointment of the meeting was the fall in the numbers of non-UK participants. Although the meeting in 1994 (Strike, 1995) saw an increase in presentations from Continental Europe (six countries including France, Germany. The Netherlands and Switzerland), the trend did not continue this year, with only Denmark being represented. The 24 contributors consisted of approximately equal numbers of postgraduate students, postdoctoral researchers and more "established' scientists reflecting the continuing policy of encouraging younger members of the repair community to present their work. The mix of presenters was particularly well illustrated by two excellent and consecutive talks by Professor Bryn Bridges (MRC Cell Mutation Unit) and Alison Mitchell, a postgraduate student in Stephen West's laboratory (ICRF, Clare Hall). The organisms under study were as equally disparate and included Archaebacteria, Escherichia coli. Saccharomyces cerevisiae, Schizosaccharomyces pombe, Aspergillus, mice and men. The range of topics was also varied and included bacterial mutagenesis, NMR studies of Ada protein, preferential DNA repair, cell cycle checkpoint genes, reconstitution of nucleotide excision repair and V(D)J recombination in vitro, creation of repair deficient transgenic mice and mismatch defects in human cells. The result was a very successful meeting which was characterized by the consistently high

  18. Repair of base damage and genome maintenance in the nucleo-cytoplasmic large DNA viruses.

    Science.gov (United States)

    Redrejo-Rodríguez, Modesto; Salas, María L

    2014-01-22

    Among the DNA viruses, the so-called nucleo-cytoplasmic large DNA viruses (NCLDV) constitute a monophyletic group that currently consists of seven families of viruses infecting a very broad variety of eukaryotes, from unicellular marine protists to humans. Many recent papers have analyzed the sequence and structure of NCLDV genomes and their phylogeny, providing detailed analysis about their genomic structure and evolutionary history and proposing their inclusion in a new viral order named Megavirales that, according to some authors, should be considered as a fourth domain of life, aside from Bacteria, Archaea and Eukarya. The maintenance of genetic information protected from environmental attacks and mutations is essential not only for the survival of cellular organisms but also viruses. In cellular organisms, damaged DNA bases are removed in two major repair pathways: base excision repair (BER) and nucleotide incision repair (NIR) that constitute the major pathways responsible for repairing most endogenous base lesions and abnormal bases in the genome by precise repair procedures. Like cells, many NCLDV encode proteins that might constitute viral DNA repair pathways that would remove damages through BER/NIR pathways. However, the molecular mechanisms and, specially, the biological roles of those viral repair pathways have not been deeply addressed in the literature so far. In this paper, we review viral-encoded BER proteins and the genetic and biochemical data available about them. We propose and discuss probable viral-encoded DNA repair mechanisms and pathways, as compared with the functional and molecular features of known homologs proteins. Copyright © 2013 Elsevier B.V. All rights reserved.

  19. Repair on the go: E. coli maintains a high proliferation rate while repairing a chronic DNA double-strand break.

    Directory of Open Access Journals (Sweden)

    Elise Darmon

    Full Text Available DNA damage checkpoints exist to promote cell survival and the faithful inheritance of genetic information. It is thought that one function of such checkpoints is to ensure that cell division does not occur before DNA damage is repaired. However, in unicellular organisms, rapid cell multiplication confers a powerful selective advantage, leading to a dilemma. Is the activation of a DNA damage checkpoint compatible with rapid cell multiplication? By uncoupling the initiation of DNA replication from cell division, the Escherichia coli cell cycle offers a solution to this dilemma. Here, we show that a DNA double-strand break, which occurs once per replication cycle, induces the SOS response. This SOS induction is needed for cell survival due to a requirement for an elevated level of expression of the RecA protein. Cell division is delayed, leading to an increase in average cell length but with no detectable consequence on mutagenesis and little effect on growth rate and viability. The increase in cell length caused by chronic DNA double-strand break repair comprises three components: two types of increase in the unit cell size, one independent of SfiA and SlmA, the other dependent of the presence of SfiA and the absence of SlmA, and a filamentation component that is dependent on the presence of either SfiA or SlmA. These results imply that chronic checkpoint induction in E. coli is compatible with rapid cell multiplication. Therefore, under conditions of chronic low-level DNA damage, the SOS checkpoint operates seamlessly in a cell cycle where the initiation of DNA replication is uncoupled from cell division.

  20. PARP10 deficiency manifests by severe developmental delay and DNA repair defect.

    Science.gov (United States)

    Shahrour, Maher Awni; Nicolae, Claudia M; Edvardson, Simon; Ashhab, Motee; Galvan, Adri M; Constantin, Daniel; Abu-Libdeh, Bassam; Moldovan, George-Lucian; Elpeleg, Orly

    2016-10-01

    DNA repair mechanisms such as nucleotide excision repair (NER) and translesion synthesis (TLS) are dependent on proliferating cell nuclear antigen (PCNA), a DNA polymerase accessory protein. Recently, homozygosity for p.Ser228Ile mutation in the PCNA gene was reported in patients with neurodegeneration and impaired NER. Using exome sequencing, we identified a homozygous deleterious mutation, c.648delAG, in the PARP10 gene, in a patient suffering from severe developmental delay. In agreement, PARP10 protein was absent from the patient cells. We have previously shown that PARP10 is recruited by PCNA to DNA damage sites and is required for DNA damage resistance. The patient cells were significantly more sensitive to hydroxyurea and UV-induced DNA damage than control cells, resulting in increased apoptosis, indicating DNA repair impairment in the patient cells. PARP10 deficiency joins the long list of DNA repair defects associated with neurodegenerative disorders, including ataxia telangiectasia, xeroderma pigmentosum, Cockayne syndrome, and the recently reported PCNA mutation.

  1. A deoxyribozyme that harnesses light to repair thymine dimers in DNA

    OpenAIRE

    Chinnapen, Daniel J.-F.; Sen, Dipankar

    2003-01-01

    In vitro selection was used to investigate whether nucleic acid enzymes are capable of catalyzing photochemical reactions. The reaction chosen was photoreactivation of thymine cyclobutane dimers in DNA by using serotonin as cofactor and light of wavelengths longer than the absorption spectrum of DNA. Curiously, the dominant single-stranded DNA sequence selected, UV1A, was found to repair its internal thymine dimer substrate efficiently even in the absence of serotonin or any other cofactor. U...

  2. Dynamics of MutS-mismatched DNA complexes are predictive of their repair phenotypes.

    Science.gov (United States)

    DeRocco, Vanessa C; Sass, Lauryn E; Qiu, Ruoyi; Weninger, Keith R; Erie, Dorothy A

    2014-04-01

    MutS recognizes base-base mismatches and base insertions/deletions (IDLs) in newly replicated DNA. Specific interactions between MutS and these errors trigger a cascade of protein-protein interactions that ultimately lead to their repair. The inability to explain why different DNA errors are repaired with widely varying efficiencies in vivo remains an outstanding example of our limited knowledge of this process. Here, we present single-molecule Förster resonance energy transfer measurements of the DNA bending dynamics induced by Thermus aquaticus MutS and the E41A mutant of MutS, which is known to have error specific deficiencies in signaling repair. We compared three DNA mismatches/IDLs (T-bulge, GT, and CC) with repair efficiencies ranging from high to low. We identify three dominant DNA bending states [slightly bent/unbent (U), intermediately bent (I), and significantly bent (B)] and find that the kinetics of interconverting among states varies widely for different complexes. The increased stability of MutS-mismatch/IDL complexes is associated with stabilization of U and lowering of the B to U transition barrier. Destabilization of U is always accompanied by a destabilization of B, supporting the suggestion that B is a "required" precursor to U. Comparison of MutS and MutS-E41A dynamics on GT and the T-bulge suggests that hydrogen bonding to MutS facilitates the changes in base-base hydrogen bonding that are required to achieve the U state, which has been implicated in repair signaling. Taken together with repair propensities, our data suggest that the bending kinetics of MutS-mismatched DNA complexes may control the entry into functional pathways for downstream signaling of repair.

  3. The Association of Low-Penetrance Variants in DNA Repair Genes with Colorectal Cancer: A Systematic Review and Meta-Analysis

    OpenAIRE

    Aggarwal, Nikhil; Donald, Neil D; Malik, Salim; Selvendran, Subothini S; McPhail, Mark JW.; Monahan, Kevin J

    2017-01-01

    Objectives: Approximately 35% of colorectal cancer (CRC) risk is attributable to heritable factors known hereditary syndromes, accounting for 6%. The remainder may be due to lower penetrance polymorphisms particularly of DNA repair genes. DNA repair pathways, including base excision repair (BER), nucleotide excision repair (NER), mismatch repair (MMR), direct reversal repair (DRR), and double-strand break repair are complex, evolutionarily conserved, and critical in carcinogenesis. Germline m...

  4. The EMSY threonine 207 phospho-site is required for EMSYdriven suppression of DNA damage repair.

    Science.gov (United States)

    Jelinic, Petar; Eccles, Laura A; Tseng, Jill; Cybulska, Paulina; Wielgos, Monicka; Powell, Simon N; Levine, Douglas A

    2017-02-21

    BRCA1 and BRCA2 are essential for the repair of double-strand DNA breaks, and alterations in these genes are a hallmark of breast and ovarian carcinomas. Other functionally related genes may also play important roles in carcinogenesis. Amplification of EMSY, a putative BRCAness gene, has been suggested to impair DNA damage repair by suppressing BRCA2 function. We employed direct repeat GFP (DR-GFP) and RAD51 foci formation assays to show that EMSY overexpression impairs the repair of damaged DNA, suggesting that EMSY belongs to the family of BRCAness proteins. We also identified a novel phospho-site at threonine 207 (T207) and demonstrated its role in EMSY-driven suppression of DNA damage repair. In vitro kinase assays established that protein kinase A (PKA) directly phosphorylates the T207 phospho-site. Immunoprecipitation experiments suggest that EMSY-driven suppression of DNA damage repair is a BRCA2-independent process. The data also suggest that EMSY amplification is a BRCAness feature, and may help to expand the population of patients who could benefit from targeted therapies that are also effective in BRCA1/2-mutant cancers.

  5. DNA damage by reactive species: Mechanisms, mutation and repair

    Indian Academy of Sciences (India)

    DNA is continuously attacked by reactive species that can affect its structure and function severely. Structural modifications to DNA mainly arise from modifications in its bases that primarily occur due to their exposure to different reactive species. Apart from this, DNA strand break, inter- and intra-strand crosslinks and ...

  6. Balancing Pathways in DNA Double Strand Break Repair

    NARCIS (Netherlands)

    I. Brandsma (Inger)

    2016-01-01

    markdownabstractAll information a cell needs to live and survive is stored in the genomic DNA. Maintenance of an intact and uncompromised genome is of vital importance for cell survival. Damaged DNA can block transcription and replication, processes essential for cell viability. Persistent DNA

  7. Biological significance of facilitated diffusion in protein-DNA interactions. Applications to T4 endonuclease V-initiated DNA repair

    Energy Technology Data Exchange (ETDEWEB)

    Dowd, D.R.; Lloyd, R.S. (Vanderbilt Univ. School of Medicine, Nashville, TN (USA))

    1990-02-25

    Facilitated diffusion along nontarget DNA is employed by numerous DNA-interactive proteins to locate specific targets. Until now, the biological significance of DNA scanning has remained elusive. T4 endonuclease V is a DNA repair enzyme which scans nontarget DNA and processively incises DNA at the site of pyrimidine dimers which are produced by exposure to ultraviolet (UV) light. In this study we tested the hypothesis that there exists a direct correlation between the degree of processivity of wild type and mutant endonuclease V molecules and the degree of enhanced UV resistance which is conferred to repair-deficient Eshcerichia coli. This was accomplished by first creating a series of endonuclease V mutants whose in vitro catalytic activities were shown to be very similar to that of the wild type enzyme. However, when the mechanisms by which these enzymes search nontarget DNA for its substrate were analyzed in vitro and in vivo, the mutants displayed varying degrees of nontarget DNA scanning ranging from being nearly as processive as wild type to randomly incising dimers within the DNA population. The ability of these altered endonuclease V molecules to enhance UV survival in DNA repair-deficient E. coli then was assessed. The degree of enhanced UV survival was directly correlated with the level of facilitated diffusion. This is the first conclusive evidence directly relating a reduction of in vivo facilitated diffusion with a change in an observed phenotype. These results support the assertion that the mechanisms which DNA-interactive proteins employ in locating their target sites are of biological significance.

  8. Biological significance of facilitated diffusion in protein-DNA interactions. Applications to T4 endonuclease V-initiated DNA repair.

    Science.gov (United States)

    Dowd, D R; Lloyd, R S

    1990-02-25

    Facilitated diffusion along nontarget DNA is employed by numerous DNA-interactive proteins to locate specific targets. Until now, the biological significance of DNA scanning has remained elusive. T4 endonuclease V is a DNA repair enzyme which scans nontarget DNA and processively incises DNA at the site of pyrimidine dimers which are produced by exposure to ultraviolet (UV) light. In this study we tested the hypothesis that there exists a direct correlation between the degree of processivity of wild type and mutant endonuclease V molecules and the degree of enhanced UV resistance which is conferred to repair-deficient Eshcerichia coli. This was accomplished by first creating a series of endonuclease V mutants whose in vitro catalytic activities were shown to be very similar to that of the wild type enzyme. However, when the mechanisms by which these enzymes search nontarget DNA for its substrate were analyzed in vitro and in vivo, the mutants displayed varying degrees of nontarget DNA scanning ranging from being nearly as processive as wild type to randomly incising dimers within the DNA population. The ability of these altered endonuclease V molecules to enhance UV survival in DNA repair-deficient E. coli then was assessed. The degree of enhanced UV survival was directly correlated with the level of facilitated diffusion. This is the first conclusive evidence directly relating a reduction of in vivo facilitated diffusion with a change in an observed phenotype. These results support the assertion that the mechanisms which DNA-interactive proteins employ in locating their target sites are of biological significance.

  9. Dynamics and Mechanism of Efficient DNA Repair Reviewed by Active-Site Mutants

    Science.gov (United States)

    Tan, Chuang; Liu, Zheyun; Li, Jiang; Guo, Xunmin; Wang, Lijuan; Zhong, Dongping

    2010-06-01

    Photolyases repair the UV-induced pyrimidine dimers in damage DNA via a photoreaction which includes a series of light-driven electron transfers between the two-electron-reduced flavin cofactor FADH^- and the dimer. We report here our systematic studies of the repair dynamics in E. coli photolyase with mutation of several active-site residues. With femtosecond resolution, we observed the significant change in the forward electron transfer from the excited FADH^- to the dimer and the back electron transfer from the repaired thymines by mutation of E274A, R226A, R342A, N378S and N378C. We also found that the mutation of E274A accelerates the bond-breaking of the thymine dimer. The dynamics changes are consistent with the quantum yield study of these mutants. These results suggest that the active-site residues play a significant role, structurally and chemically, in the DNA repair photocycle.

  10. WHERE MULTIFUNCTIONAL DNA REPAIR PROTEINS MEET: MAPPING THE INTERACTION DOMAINS BETWEEN XPG AND WRN

    Energy Technology Data Exchange (ETDEWEB)

    Rangaraj, K.; Cooper, P.K.; Trego, K.S.

    2009-01-01

    The rapid recognition and repair of DNA damage is essential for the maintenance of genomic integrity and cellular survival. Multiple complex and interconnected DNA damage responses exist within cells to preserve the human genome, and these repair pathways are carried out by a specifi c interplay of protein-protein interactions. Thus a failure in the coordination of these processes, perhaps brought about by a breakdown in any one multifunctional repair protein, can lead to genomic instability, developmental and immunological abnormalities, cancer and premature aging. This study demonstrates a novel interaction between two such repair proteins, Xeroderma pigmentosum group G protein (XPG) and Werner syndrome helicase (WRN), that are both highly pleiotropic and associated with inherited genetic disorders when mutated. XPG is a structure-specifi c endonuclease required for the repair of UV-damaged DNA by nucleotide excision repair (NER), and mutations in XPG result in the diseases Xeroderma pigmentosum (XP) and Cockayne syndrome (CS). A loss of XPG incision activity results in XP, whereas a loss of non-enzymatic function(s) of XPG causes CS. WRN is a multifunctional protein involved in double-strand break repair (DSBR), and consists of 3’–5’ DNA-dependent helicase, 3’–5’ exonuclease, and single-strand DNA annealing activities. Nonfunctional WRN protein leads to Werner syndrome, a premature aging disorder with increased cancer incidence. Far Western analysis was used to map the interacting domains between XPG and WRN by denaturing gel electrophoresis, which separated purifi ed full length and recombinant XPG and WRN deletion constructs, based primarily upon the length of each polypeptide. Specifi c interacting domains were visualized when probed with the secondary protein of interest which was then detected by traditional Western analysis using the antibody of the secondary protein. The interaction between XPG and WRN was mapped to the C-terminal region of

  11. Structural basis for the initiation of eukaryotic transcription-coupled DNA repair

    OpenAIRE

    Xu, Jun; Lahiri, Indrajit; Wang, Wei; Wier, Adam; Cianfrocco, Michael A.; Chong, Jenny; Hare, Alissa A.; Dervan, Peter B.; DiMaio, Frank; Leschziner, Andres E.; Wang, Dong

    2017-01-01

    Eukaryotic transcription-coupled repair (TCR) is an important and well-conserved sub-pathway of nucleotide excision repair that preferentially removes DNA lesions from the template strand that block translocation of RNA polymerase II (Pol II). Cockayne syndrome group B (CSB, also known as ERCC6) protein in humans (or its yeast orthologues, Rad26 in Saccharomyces cerevisiae and Rhp26 in Schizosaccharomyces pombe) is among the first proteins to be recruited to the lesion-arrested Pol II during ...

  12. Relationship of DNA lesions and their repair to chromosomal aberration production

    Energy Technology Data Exchange (ETDEWEB)

    Bender, M.A.

    1979-01-01

    Recent work on the roles of specific kinds of DNA lesions and their enzymatic repair systems in the production of chromosomal aberrations seems consistent with a simple molecular model of chromosomal aberrations formation. Evidence from experiments with the human repair-deficient genetic diseases xeroderma pigmentosom, ataxia telangiectasia, and Fanconi's anemia is reviewed in the light of the contributions to aberration production of single and double polynucleotide strand breaks, base damage, polynucleotide strand crosslinks, and pyrimidine cyclobutane dimers.

  13. Writers, Readers, and Erasers of Histone Ubiquitylation in DNA Double-Strand Break Repair

    DEFF Research Database (Denmark)

    Smeenk, Godelieve; Mailand, Niels

    2016-01-01

    for a range of genome caretaker proteins and their associated factors. These DNA damage-induced chromatin ubiquitylation marks provide an essential component of a histone code for DSB repair that is controlled by multifaceted regulatory circuits, underscoring its importance for genome stability maintenance...... accurate lesion repair and restoration of genome integrity. In vertebrate cells, ubiquitin-dependent modifications of histones adjacent to DSBs by RNF8, RNF168, and other ubiquitin ligases have a key role in promoting the assembly of repair protein complexes, serving as direct recruitment platforms....... In this review, we provide a comprehensive account of how DSB-induced histone ubiquitylation is sensed, decoded and modulated by an elaborate array of repair factors and regulators. We discuss how these mechanisms impact DSB repair pathway choice and functionality for optimal protection of genome integrity...

  14. Dynamics and mechanism of DNA repair in a biomimetic system: flavin-thymine dimer adduct.

    Science.gov (United States)

    Kao, Ya-Ting; Song, Qin-Hua; Saxena, Chaitanya; Wang, Lijuan; Zhong, Dongping

    2012-01-25

    To mimic photolyase for efficient repair of UV-damaged DNA, numerous biomimetic systems have been synthesized, but all show low repair efficiency. The molecular mechanism of this low-efficiency process is still poorly understood. Here we report our direct mapping of the repair processes of a flavin-thymine dimer adduct with femtosecond resolution. We followed the entire dynamic evolution and observed direct electron transfer (ET) from the excited flavin to the thymine dimer in 79 ps. We further observed two competitive pathways, productive dimer ring splitting within 435 ps and futile back-ET in 95 ps. Our observations reveal that the underlying mechanism for the low repair quantum yield of flavin-thymine dimer adducts is the short-lived excited flavin moiety and the fast dynamics of futile back-ET without repair. © 2012 American Chemical Society

  15. Excision and crosslink repair of DNA and sister chromatid exchanges in cultured human fibroblasts with different repair capacities

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Y.; Kano, Y.; Paul, P.; Goto, K.; Yamamoto, K. (Kobe Univ. (Japan). School of Medicine)

    1981-01-01

    Xeroderma pigmentosum (XP) groups A to G lacked the initial stage of ultraviolet (UV) excision repair in the order of A = G > C > D > E asymptotically equals F, while the XP variant was weakly defective in the later repair steps. Killing sensitivities were in the orders of A >= G > D > C > E asymptotically equals F asymptotically equals variant > normal to UV, A = G > D > F > C = E > variant > normal to 4-nitroquinoline-1-oxide (4NQO), and A > C > D = E = F = variant > G = normal to decarbamoyl mitomycin-C(DCMC). The induced sister chromatid exchange (SCE) frequency was unrelated to the extent of repair deficiency. The SCE induction rate was consistently 3 - 6 fold higher by these UV-like mutagens in XP group A cells than in normal cells. However, repair-proficient Cockayne's syndrome (CS) cells showed a higher SCE induction by UV, which was normalized by NAD/sup +/, suggesting that chromatin lesions as well as DNA damage contribute to SCE. Two-step crosslink repair involves a first rapid half-excision and a second slow nucleotide-excision repair. Fanconi's anemia (FA) cells had an impaired first half-excision and were supersensitive to MC, but not to UV and DCMC. The SCE frequency induced by MC (1 hr) was higher in FA cells than in normal cells despite their normal response to DCMC, and vice versa in XP cells. FA cells lacked the first rapid decline and showed higher remaining SCEs. Thus, part of the crosslink seems to lead to SCE formation. Caffeine synergistically elevated UV-induced SCEs, but not UV induced mutations in V79 cells, implying that SCE may not necessarily involve mutation.

  16. Defining the functional footprint for recognition and repair of deaminated DNA.

    Science.gov (United States)

    Baldwin, Michael R; O'Brien, Patrick J

    2012-12-01

    Spontaneous deamination of DNA is mutagenic, if it is not repaired by the base excision repair (BER) pathway. Crystallographic data suggest that each BER enzyme has a compact DNA binding site. However, these structures lack information about poorly ordered termini, and the energetic contributions of specific protein-DNA contacts cannot be inferred. Furthermore, these structures do not reveal how DNA repair intermediates are passed between enzyme active sites. We used a functional footprinting approach to define the binding sites of the first two enzymes of the human BER pathway for the repair of deaminated purines, alkyladenine DNA glycosylase (AAG) and AP endonuclease (APE1). Although the functional footprint for full-length AAG is explained by crystal structures of truncated AAG, the footprint for full-length APE1 indicates a much larger binding site than is observed in crystal structures. AAG turnover is stimulated in the presence of APE1, indicating rapid exchange of AAG and APE1 at the abasic site produced by the AAG reaction. The coordinated reaction does not require an extended footprint, suggesting that each enzyme engages the site independently. Functional footprinting provides unique information relative to traditional footprinting approaches and is generally applicable to any DNA modifying enzyme or system of enzymes.

  17. Genetics and biochemistry of DNA repair in Neurospora crassa. Progress report

    Energy Technology Data Exchange (ETDEWEB)

    Mishra, N.C.

    1979-04-01

    Mutants of Neurospora, presumably defective for deoxyribonuclease and DNA polymerase are being biochemically characterized and compared with the wild type enzyme to establish which enzymes control a particular function in DNA repair and other aspects of DNA biosynthesis. After biochemical characterization, these mutants will be also examined for their ability to repair damage caused by exposure to radiation, radiomimetic drugs and carcinogens. Also, a number of Neurospora mutants which are known to be sensitive to uv radiation or to MMS (methyl methane sulfonate) or to histidine or defective in recombination are being characterized for DNA polymerases and nucleases to elucidate the biochemical basis of these defects. These studies will provide a detailed knowledge of the different aspects of DNA repair and the role of the key enzymes therein. The results of present studies involving a eukaryote can be meaningfully generalized for similar studies in humans. Efficient DNA repair in man is necessary for the maintenance of normal growth and for exposure to the sunlight and to various radiomimetic chemicals present in our environment. Due to the introduction of various chemicals in our environment, there is increased risk of damage to our own genetic material (including that of our crop and cattle) and the outcome of the proposed study may provide a meaningful insight into these problems.

  18. Clustered DNA lesions containing 5-formyluracil and AP site: repair via the BER system.

    Science.gov (United States)

    Belousova, Ekaterina A; Vasil'eva, Inna A; Moor, Nina A; Zatsepin, Timofey S; Oretskaya, Tatiana S; Lavrik, Olga I

    2013-01-01

    Lesions in the DNA arise under ionizing irradiation conditions or various chemical oxidants as a single damage or as part of a multiply damaged site within 1-2 helical turns (clustered lesion). Here, we explored the repair opportunity of the apurinic/apyrimidinic site (AP site) composed of the clustered lesion with 5-formyluracil (5-foU) by the base excision repair (BER) proteins. We found, that if the AP site is shifted relative to the 5-foU of the opposite strand, it could be repaired primarily via the short-patch BER pathway. In this case, the cleavage efficiency of the AP site-containing DNA strand catalyzed by human apurinic/apyrimidinic endonuclease 1 (hAPE1) decreased under AP site excursion to the 3'-side relative to the lesion in the other DNA strand. DNA synthesis catalyzed by DNA polymerase lambda was more accurate in comparison to the one catalyzed by DNA polymerase beta. If the AP site was located exactly opposite 5-foU it was expected to switch the repair to the long-patch BER pathway. In this situation, human processivity factor hPCNA stimulates the process.

  19. Characterization of DNA repair deficient strains of Chlamydomonas reinhardtii generated by insertional mutagenesis.

    Directory of Open Access Journals (Sweden)

    Andrea Plecenikova

    Full Text Available While the mechanisms governing DNA damage response and repair are fundamentally conserved, cross-kingdom comparisons indicate that they differ in many aspects due to differences in life-styles and developmental strategies. In photosynthetic organisms these differences have not been fully explored because gene-discovery approaches are mainly based on homology searches with known DDR/DNA repair proteins. Here we performed a forward genetic screen in the green algae Chlamydomonas reinhardtii to identify genes deficient in DDR/DNA repair. We isolated five insertional mutants that were sensitive to various genotoxic insults and two of them exhibited altered efficiency of transgene integration. To identify genomic regions disrupted in these mutants, we established a novel adaptor-ligation strategy for the efficient recovery of the insertion flanking sites. Four mutants harbored deletions that involved known DNA repair factors, DNA Pol zeta, DNA Pol theta, SAE2/COM1, and two neighbouring genes encoding ERCC1 and RAD17. Deletion in the last mutant spanned two Chlamydomonas-specific genes with unknown function, demonstrating the utility of this approach for discovering novel factors involved in genome maintenance.

  20. Understanding DNA Repair in Hyperthermophilic Archaea: Persistent Gaps and Other Reasons to Focus on the Fork

    Directory of Open Access Journals (Sweden)

    Dennis W. Grogan

    2015-01-01

    Full Text Available Although hyperthermophilic archaea arguably have a great need for efficient DNA repair, they lack members of several DNA repair protein families broadly conserved among bacteria and eukaryotes. Conversely, the putative DNA repair genes that do occur in these archaea often do not generate the expected phenotype when deleted. The prospect that hyperthermophilic archaea have some unique strategies for coping with DNA damage and replication errors has intellectual and technological appeal, but resolving this question will require alternative coping mechanisms to be proposed and tested experimentally. This review evaluates a combination of four enigmatic properties that distinguishes the hyperthermophilic archaea from all other organisms: DNA polymerase stalling at dU, apparent lack of conventional NER, lack of MutSL homologs, and apparent essentiality of homologous recombination proteins. Hypothetical damage-coping strategies that could explain this set of properties may provide new starting points for efforts to define how archaea differ from conventional models of DNA repair and replication fidelity.

  1. Both DNA global deformation and repair enzyme contacts mediate flipping of thymine dimer damage

    Science.gov (United States)

    Knips, Alexander; Zacharias, Martin

    2017-01-01

    The photo-induced cis-syn-cyclobutane pyrimidine (CPD) dimer is a frequent DNA lesion. In bacteria photolyases efficiently repair dimers employing a light-driven reaction after flipping out the CPD damage to the active site. How the repair enzyme identifies a damaged site and how the damage is flipped out without external energy is still unclear. Employing molecular dynamics free energy calculations, the CPD flipping process was systematically compared to flipping undamaged nucleotides in various DNA global states and bound to photolyase enzyme. The global DNA deformation alone (without protein) significantly reduces the flipping penalty and induces a partially looped out state of the damage but not undamaged nucleotides. Bound enzyme further lowers the penalty for CPD damage flipping with a lower free energy of the flipped nucleotides in the active site compared to intra-helical state (not for undamaged DNA). Both the reduced penalty and partial looping by global DNA deformation contribute to a significantly shorter mean first passage time for CPD flipping compared to regular nucleotides which increases the repair likelihood upon short time encounter between repair enzyme and DNA.

  2. In vitro repair of DNA hairpins containing various numbers of CAG/CTG trinucleotide repeats.

    Science.gov (United States)

    Zhang, Tianyi; Huang, Jian; Gu, Liya; Li, Guo-Min

    2012-02-01

    Expansion of CAG/CTG trinucleotide repeats (TNRs) in humans is associated with a number of neurological and neurodegenerative disorders including Huntington's disease. Increasing evidence suggests that formation of a stable DNA hairpin within CAG/CTG repeats during DNA metabolism leads to TNR instability. However, the molecular mechanism by which cells recognize and repair CAG/CTG hairpins is largely unknown. Recent studies have identified a novel DNA repair pathway specifically removing (CAG)(n)/(CTG)(n) hairpins, which is considered a major mechanism responsible for TNR instability. The hairpin repair (HPR) system targets the repeat tracts for incisions in the nicked strand in an error-free manner. To determine the substrate spectrum of the HPR system and its ability to process smaller hairpins, which may be the intermediates for CAG/CTG expansions, we constructed a series of CAG/CTG hairpin heteroduplexes containing different numbers of repeats (from 5 to 25) and examined their repair in human nuclear extracts. We show here that although repair efficiencies differ slightly among these substrates, removal of the individual hairpin structures all involve endonucleolytic incisions within the repeat tracts in the nicked DNA strand. Analysis of the repair intermediates defined specific incision sites for each substrate, which were all located within the repeat regions. Mismatch repair proteins are not required for, nor do they inhibit, the processing of smaller hairpin structures. These results suggest that the HPR system ensures CAG/CTG stability primarily by removing various sizes of (CAG)(n)/(CTG)(n) hairpin structures during DNA metabolism. Copyright © 2011 Elsevier B.V. All rights reserved.

  3. Homeostatic nuclear RAGE–ATM interaction is essential for efficient DNA repair

    Science.gov (United States)

    Kumar, Varun; Fleming, Thomas; Terjung, Stefan; Gorzelanny, Christian; Gebhardt, Christoffer; Agrawal, Raman; Mall, Marcus A.; Ranzinger, Julia; Zeier, Martin; Madhusudhan, Thati; Ranjan, Satish; Isermann, Berend; Liesz, Arthur; Deshpande, Divija; Häring, Hans-Ulrich; Biswas, Subrata K; Reynolds, Paul R.; Hammes, Hans-Peter; Peperkok, Rainer; Angel, Peter; Herzig, Stephan

    2017-01-01

    Abstract The integrity of genome is a prerequisite for healthy life. Indeed, defects in DNA repair have been associated with several human diseases, including tissue-fibrosis, neurodegeneration and cancer. Despite decades of extensive research, the spatio-mechanical processes of double-strand break (DSB)-repair, especially the auxiliary factor(s) that can stimulate accurate and timely repair, have remained elusive. Here, we report an ATM-kinase dependent, unforeseen function of the nuclear isoform of the Receptor for Advanced Glycation End-products (nRAGE) in DSB-repair. RAGE is phosphorylated at Serine376 and Serine389 by the ATM kinase and is recruited to the site of DNA-DSBs via an early DNA damage response. nRAGE preferentially co-localized with the MRE11 nuclease subunit of the MRN complex and orchestrates its nucleolytic activity to the ATR kinase signaling. This promotes efficient RPA2S4-S8 and CHK1S345 phosphorylation and thereby prevents cellular senescence, IPF and carcinoma formation. Accordingly, loss of RAGE causatively linked to perpetual DSBs signaling, cellular senescence and fibrosis. Importantly, in a mouse model of idiopathic pulmonary fibrosis (RAGE−/−), reconstitution of RAGE efficiently restored DSB-repair and reversed pathological anomalies. Collectively, this study identifies nRAGE as a master regulator of DSB-repair, the absence of which orchestrates persistent DSB signaling to senescence, tissue-fibrosis and oncogenesis. PMID:28977635

  4. Report of the Working Group on Integrated Translational Research in DNA Repair.

    Science.gov (United States)

    Reinlib, Leslie; Friedberg, Errol C

    2007-01-04

    On September 28-29, 2006, the National Institute of Environmental Health Sciences led a team from the National Institutes of Health in hosting a Working Group on Integrated Translational Research in DNA Repair, in Berkeley, CA. In recognition of the far-reaching goals for this area of investigation, the Working Group was charged with conceiving a vision to facilitate projects that would apply the lessons of DNA Repair research to clinical application and public health. The participants included basic and physician scientists working in the various areas of DNA Repair and genome stability, as well as agency representatives of the National Cancer Institute and the National Institute of General Medical Sciences. In constructing this vision of practical research recommendations, the Working Group was asked to identify roadblocks to progress, suggest enabling technologies, and to consider areas that are ripe for translation. This report summarizes the rationale for this initiative and the recommendations that emerged.

  5. [Ocular manifestations in a patient with Cockayne syndrome and simultaneous reduced DNA repair].

    Science.gov (United States)

    Lang, G E; Gebhart, E; Lang, C; Naumann, G O

    1991-06-01

    A 14 year old white boy presented with the typical clinical findings of Cockayne syndrome. Photodermatosis was known since the third week of life. He had disproportionate short stature with a short trunk, long limbs and flexion contractures of the large joints. He also was cachectic and prematurely aged. He had a typical facies. The hearing was slightly impaired. The prominent ocular findings were corneal opacifications, salt and pepper like retinal pigment epithelial changes and optic atrophy. On fibroblast culture the DNA repair activity is usually normal in patients with Cockayne syndrome. The DNA repair activity in our patient however was markedly reduced to 25% of normal. On lymphocyte culture a significantly increased 4-nitroquinoline-1-oxide sensitivity (cytotoxicity and increased break-rate) was found. These findings indicate that the boy has a specific variant of Cockayne syndrome with simultaneously reduced DNA-repair activity.

  6. Cockayne syndrome--a primary defect in DNA repair, transcription, both or neither?

    Science.gov (United States)

    Friedberg, E C

    1996-09-01

    Cockayne syndrome is a rare autosomal recessive disease characterized by a complex clinical phenotype. Most Cockayne syndrome cells are hypersensitive to killing by ultraviolet radiation. This observation has prompted a wealth of studies on the DNA repair capacity of Cockayne syndrome cells in vitro. Many studies support the notion that such cells are defective in a DNA repair mode(s) that is transcription-dependent. However, it remains to be established that this is a primary molecular defect in Cockayne syndrome cells and that it explains the complex clinical phenotype associated with the disease. An alternative hypothesis is that Cockayne syndrome cells have a defect in transcription affecting the expression of certain genes, which is compatible with embryogenesis but not with normal post-natal development. Defective transcription may impair the normal processing of DNA damage during transcription-dependent repair.

  7. Fructose-Rich Diet Affects Mitochondrial DNA Damage and Repair in Rats.

    Science.gov (United States)

    Cioffi, Federica; Senese, Rosalba; Lasala, Pasquale; Ziello, Angela; Mazzoli, Arianna; Crescenzo, Raffaella; Liverini, Giovanna; Lanni, Antonia; Goglia, Fernando; Iossa, Susanna

    2017-03-24

    Evidence indicates that many forms of fructose-induced metabolic disturbance are associated with oxidative stress and mitochondrial dysfunction. Mitochondria are prominent targets of oxidative damage; however, it is not clear whether mitochondrial DNA (mtDNA) damage and/or its lack of repair are events involved in metabolic disease resulting from a fructose-rich diet. In the present study, we evaluated the degree of oxidative damage to liver mtDNA and its repair, in addition to the state of oxidative stress and antioxidant defense in the liver of rats fed a high-fructose diet. We used male rats feeding on a high-fructose or control diet for eight weeks. Our results showed an increase in mtDNA damage in the liver of rats fed a high-fructose diet and this damage, as evaluated by the expression of DNA polymerase γ, was not repaired; in addition, the mtDNA copy number was found to be significantly reduced. A reduction in the mtDNA copy number is indicative of impaired mitochondrial biogenesis, as is the finding of a reduction in the expression of genes involved in mitochondrial biogenesis. In conclusion, a fructose-rich diet leads to mitochondrial and mtDNA damage, which consequently may have a role in liver dysfunction and metabolic diseases.

  8. Regulation of hetDNA Length during Mitotic Double-Strand Break Repair in Yeast.

    Science.gov (United States)

    Guo, Xiaoge; Hum, Yee Fang; Lehner, Kevin; Jinks-Robertson, Sue

    2017-08-17

    Heteroduplex DNA (hetDNA) is a key molecular intermediate during the repair of mitotic double-strand breaks by homologous recombination, but its relationship to 5' end resection and/or 3' end extension is poorly understood. In the current study, we examined how perturbations in these processes affect the hetDNA profile associated with repair of a defined double-strand break (DSB) by the synthesis-dependent strand-annealing (SDSA) pathway. Loss of either the Exo1 or Sgs1 long-range resection pathway significantly shortened hetDNA, suggesting that these pathways normally collaborate during DSB repair. In addition, altering the processivity or proofreading activity of DNA polymerase δ shortened hetDNA length or reduced break-adjacent mismatch removal, respectively, demonstrating that this is the primary polymerase that extends both 3' ends. Data are most consistent with the extent of DNA synthesis from the invading end being the primary determinant of hetDNA length during SDSA. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Chromosome Synapsis Alleviates Mek1-Dependent Suppression of Meiotic DNA Repair.

    Directory of Open Access Journals (Sweden)

    Vijayalakshmi V Subramanian

    2016-02-01

    Full Text Available Faithful meiotic chromosome segregation and fertility require meiotic recombination between homologous chromosomes rather than the equally available sister chromatid, a bias that in Saccharomyces cerevisiae depends on the meiotic kinase, Mek1. Mek1 is thought to mediate repair template bias by specifically suppressing sister-directed repair. Instead, we found that when Mek1 persists on closely paired (synapsed homologues, DNA repair is severely delayed, suggesting that Mek1 suppresses any proximal repair template. Accordingly, Mek1 is excluded from synapsed homologues in wild-type cells. Exclusion requires the AAA+-ATPase Pch2 and is directly coupled to synaptonemal complex assembly. Stage-specific depletion experiments further demonstrate that DNA repair in the context of synapsed homologues requires Rad54, a repair factor inhibited by Mek1. These data indicate that the sister template is distinguished from the homologue primarily by its closer proximity to inhibitory Mek1 activity. We propose that once pairing or synapsis juxtaposes homologues, exclusion of Mek1 is necessary to avoid suppression of all templates and accelerate repair progression.

  10. A microdosing approach for characterizing formation and repair of carboplatin–DNA monoadducts and chemoresistance

    Science.gov (United States)

    Henderson, Paul T.; Li, Tao; He, Miaoling; Zhang, Hongyong; Malfatti, Michael; Gandara, David; Grimminger, Peter P.; Danenberg, Kathleen D.; Beckett, Laurel; de Vere White, Ralph W.; Turteltaub, Kenneth W.; Pan, Chong-Xian

    2011-01-01

    Formation and repair of platinum (Pt)-induced DNA adducts is a critical step in Pt drug-mediated cytotoxicity. Measurement of Pt–DNA adduct kinetics in tumors may be useful for better understanding chemoresistance and therapeutic response. However, this concept has yet to be rigorously tested because of technical challenges in measuring the adducts at low concentrations and consistent access to sufficient tumor biopsy material. Ultrasensitive accelerator mass spectrometry was used to detect [14C]carboplatin–DNA monoadducts at the attomole level, which are the precursors to Pt–DNA crosslink formation, in six cancer cell lines as a proof-of-concept. The most resistant cells had the lowest monoadduct levels at all time points over 24 hr. [14C]Carboplatin “microdoses" (1/100th the pharmacologically effective concentration) had nearly identical adduct formation and repair kinetics compared to therapeutically relevant doses, suggesting that the microdosing approach can potentially be used to determine the pharmacological effects of therapeutic treatment. Some of the possible chemoresistance mechanisms were also studied, such as drug uptake/efflux, intracellular inactivation and DNA repair in selected cell lines. Intracellular inactivation and efficient DNA repair each contributed significantly to the suppression of DNA monoadduct formation in the most resistant cell line compared to the most sensitive cell line studied (p carboplatin monoadduct concentrations over 24 hr that likely contributed to chemoresistance. The data support the utility of carboplatin microdosing as a translatable approach for defining carboplatin–DNA monoadduct formation and repair, possibly by NER, which may be useful for characterizing chemoresistance in vivo. PMID:21128223

  11. DEK is required for homologous recombination repair of DNA breaks

    DEFF Research Database (Denmark)

    Smith, Eric A; Gole, Boris; Willis, Nicholas A

    2017-01-01

    mice. Furthermore, DEK knockout cells were sensitive to apoptosis with NHEJ inhibition. Thus, we hypothesized DEK plays additional roles in homologous recombination (HR). Using episomal and integrated reporters, we demonstrate that HR repair of conventional DSBs is severely compromised in DEK...

  12. Enhancement of damage-specific DNA binding of XPA by interaction with the ERCC1 DNA repair protein

    NARCIS (Netherlands)

    A. Nagai; M. Saijo (Masafumi); I. Kuraoka; T. Matsuda (Toshiro); N. Kodo (Naohiko); Y. Nakatsu (Yoshimichi); T. Mimaki; M. Mino; M. Biggerstaff (Maureen); R.D. Wood (Richard); A.M. Sijbers (Anneke); J.H.J. Hoeijmakers (Jan); K. Tanaka (Kiyoji)

    1995-01-01

    textabstractThe human XPA and ERCC1 proteins, which are involved in early steps of nucleotide excision repair of DNA, specifically interacted in an in vitro binding assay and a yeast two-hybrid assay. A stretch of consecutive glutamic acid residues in XPA was needed for binding to ERCC1. Binding of

  13. Selective base excision repair of DNA damage by the non-base-flipping DNA glycosylase AlkC

    Energy Technology Data Exchange (ETDEWEB)

    Shi, Rongxin; Mullins, Elwood A.; Shen, Xing; #8208; Xing; Lay, Kori T.; Yuen, Philip K.; David, Sheila S.; Rokas, Antonis; Eichman, Brandt F. (UCD); (Vanderbilt)

    2017-10-20

    DNA glycosylases preserve genome integrity and define the specificity of the base excision repair pathway for discreet, detrimental modifications, and thus, the mechanisms by which glycosylases locate DNA damage are of particular interest. Bacterial AlkC and AlkD are specific for cationic alkylated nucleobases and have a distinctive HEAT-like repeat (HLR) fold. AlkD uses a unique non-base-flipping mechanism that enables excision of bulky lesions more commonly associated with nucleotide excision repair. In contrast, AlkC has a much narrower specificity for small lesions, principally N3-methyladenine (3mA). Here, we describe how AlkC selects for and excises 3mA using a non-base-flipping strategy distinct from that of AlkD. A crystal structure resembling a catalytic intermediate complex shows how AlkC uses unique HLR and immunoglobulin-like domains to induce a sharp kink in the DNA, exposing the damaged nucleobase to active site residues that project into the DNA. This active site can accommodate and excise N3-methylcytosine (3mC) and N1-methyladenine (1mA), which are also repaired by AlkB-catalyzed oxidative demethylation, providing a potential alternative mechanism for repair of these lesions in bacteria.

  14. Influence of LET on repair of DNA damages in Deinococcus radiodurans

    Energy Technology Data Exchange (ETDEWEB)

    Kobayashi, Y.; Tanaka, A.; Kikuchi, M.; Shimizu, T.; Watanabe, H. [Japan Atomic Energy Research Inst., Takasaki, Gunma (Japan). Takasaki Radiation Chemistry Research Establishment; Cao, J.P.; Taucher-Scholz, G.

    1997-03-01

    Inactivation caused by heavy ions was studied in dry cells of radioresistant bacterium Deinococcus radiodurans. All survival curves were characterized by a large shoulder of the curves. No final slopes of the exponential part of survival curves for heavy ion irradiation were steeper than that for 2.0 MeV electron irradiation. The plots of RBE versus LET showed no obvious peaks, suggesting that this bacterium can repair not only DNA double strand breaks (DSBs) but also clustered damage in DNA which may be induced by heavy ions. The genomic DNA of D. radiodurans was cleaved into large fragments with restriction enzyme Not I after post-irradiation incubation and the fragments were separated using pulsed-field gel electrophoresis (PFGE). DSBs induction and rejoining process were analyzed by detection of the reappearance of ladder pattern of DNA fragments. The required repair time after heavy ions irradiation was longer than the repair time for electrons at the same dose of irradiation, however, the rate of repair enzyme induction was almost similar to each other between electrons and heavy ions, suggesting that the same repair system is likely to be used after both low and high LET irradiations. (author)

  15. DNA repair and cytokines: TGF-beta, IL-6, and thrombopoietin as different biomarkers of radioresistance

    Directory of Open Access Journals (Sweden)

    Francesca Bianca Aiello

    2016-07-01

    Full Text Available Double strand breaks (DSBs induced by radiotherapy are highly cytotoxic lesions, leading to chromosomal aberrations and cell death. ATM-dependent DNA-damage response, non-homologous end joining, and homologous recombination pathways coordinately contribute to repairing DSBs in higher eukaryotes. It is known that the expression of DSB repair genes is increased in tumors which is one of the main reasons for radioresistance. The inhibition of DSB repair pathways may be useful to increase tumor cell radiosensitivity and may target stem cell-like cancer cells, known to be the most radioresistant tumor components. Commonly overexpressed in neoplastic cells, cytokines confer radioresistance by promoting proliferation, survival, invasion, and angiogenesis. Unfortunately, tumor irradiation increases the expression of various cytokines displaying these effects, including transforming growth factor-beta and interlukin-6. Recently the capabilities of these cytokines to support DNA repair pathways and the ATM-dependent DNA response have been demonstrated. Thrombopoietin, essential for megakaryopoiesis and very important for hematopoietic stem cell homeostasis, has also been found to promote DNA repair in a highly selective manner. These findings reveal a novel mechanism underlying cytokine-related radioresistance, which may be clinically relevant. Therapies targeting specific cytokines may be used to improve radiosensitivity. Specific inhibitors may be chosen in consideration of different tumor microenvironments. Thrombopoietin may be useful in fending off irradiation-induced loss of hematopoietic stem cells.

  16. Convergence of The Nobel Fields of Telomere Biology and DNA Repair.

    Science.gov (United States)

    Fouquerel, Elise; Opresko, Patricia L

    2017-01-01

    The fields of telomere biology and DNA repair have enjoyed a great deal of cross-fertilization and convergence in recent years. Telomeres function at chromosome ends to prevent them from being falsely recognized as chromosome breaks by the DNA damage response and repair machineries. Conversely, both canonical and nonconical functions of numerous DNA repair proteins have been found to be critical for preserving telomere structure and function. In 2009, Elizabeth Blackburn, Carol Greider and Jack Szostak were awarded the Nobel prize in Physiology or Medicine for the discovery of telomeres and telomerase. Four years later, pioneers in the field of DNA repair, Aziz Sancar, Tomas Lindahl and Paul Modrich were recognized for their seminal contributions by being awarded the Nobel Prize in Chemistry. This review is part of a special issue meant to celebrate this amazing achievement, and will focus in particular on the convergence of nucleotide excision repair and telomere biology, and will discuss the profound implications for human health. © 2016 The American Society of Photobiology.

  17. The DNA translocase RAD5A acts independently of the other main DNA repair pathways, and requires both its ATPase and RING domain for activity in Arabidopsis thaliana.

    Science.gov (United States)

    Klemm, Tobias; Mannuß, Anja; Kobbe, Daniela; Knoll, Alexander; Trapp, Oliver; Dorn, Annika; Puchta, Holger

    2017-08-01

    Multiple pathways exist to repair DNA damage induced by methylating and crosslinking agents in Arabidopsis thaliana. The SWI2/SNF2 translocase RAD5A, the functional homolog of budding yeast Rad5 that is required for the error-free branch of post-replicative repair, plays a surprisingly prominent role in the repair of both kinds of lesions in Arabidopsis. Here we show that both the ATPase domain and the ubiquitination function of the RING domain of the Arabidopsis protein are essential for the cellular response to different forms of DNA damage. To define the exact role of RAD5A within the complex network of DNA repair pathways, we crossed the rad5a mutant line with mutants of different known repair factors of Arabidopsis. We had previously shown that RAD5A acts independently of two main pathways of replication-associated DNA repair defined by the helicase RECQ4A and the endonuclease MUS81. The enhanced sensitivity of all double mutants tested in this study indicates that the repair of damaged DNA by RAD5A also occurs independently of nucleotide excision repair (AtRAD1), single-strand break repair (AtPARP1), as well as microhomology-mediated double-strand break repair (AtTEB). Moreover, RAD5A can partially complement for a deficient AtATM-mediated DNA damage response in plants, as the double mutant shows phenotypic growth defects. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  18. Beryllium chloride-induced oxidative DNA damage and alteration in the expression patterns of DNA repair-related genes.

    Science.gov (United States)

    Attia, Sabry M; Harisa, Gamaleldin I; Hassan, Memy H; Bakheet, Saleh A

    2013-09-01

    Beryllium metal has physical properties that make its use essential for very specific applications, such as medical diagnostics, nuclear/fusion reactors and aerospace applications. Because of the widespread human exposure to beryllium metals and the discrepancy of the genotoxic results in the reported literature, detail assessments of the genetic damage of beryllium are warranted. Mice exposed to beryllium chloride at an oral dose of 23mg/kg for seven consecutive days exhibited a significant increase in the level of DNA-strand breaking and micronuclei formation as detected by a bone marrow standard comet assay and micronucleus test. Whereas slight beryllium chloride-induced oxidative DNA damage was detected following formamidopyrimidine DNA glycosylase digestion, digestion with endonuclease III resulted in considerable increases in oxidative DNA damage after the 11.5 and 23mg/kg/day treatment as detected by enzyme-modified comet assays. Increased 8-hydroxydeoxyguanosine was also directly correlated with increased bone marrow micronuclei formation and DNA strand breaks, which further confirm the involvement of oxidative stress in the induction of bone marrow genetic damage after exposure to beryllium chloride. Gene expression analysis on the bone marrow cells from beryllium chloride-exposed mice showed significant alterations in genes associated with DNA damage repair. Therefore, beryllium chloride may cause genetic damage to bone marrow cells due to the oxidative stress and the induced unrepaired DNA damage is probably due to the down-regulation in the expression of DNA repair genes, which may lead to genotoxicity and eventually cause carcinogenicity.

  19. SERIES: Genomic instability in cancer Balancing repair and tolerance of DNA damage caused by alkylating agents

    Science.gov (United States)

    Fu, Dragony; Calvo, Jennifer A.; Samson, Leona D

    2013-01-01

    Alkylating agents comprise a major class of frontline chemotherapeutic drugs that inflict cytotoxic DNA damage as their main mode of action, in addition to collateral mutagenic damage. Numerous cellular pathways, including direct DNA damage reversal, base excision repair (BER), and mismatch repair (MMR) respond to alkylation damage to defend against alkylation-induced cell death or mutation. However, maintaining a proper balance of activity both within and between these pathways is crucial for an organism's favorable response to alkylating agents. Furthermore, an individual's response to alkylating agents can vary considerably from tissue to tissue and from person to person, pointing to genetic and epigenetic mechanisms that modulate alkylating agent toxicity. PMID:22237395

  20. DNA damage and repair in plants – from models to crops

    Directory of Open Access Journals (Sweden)

    Vasilissa eManova

    2015-10-01

    Full Text Available The genomic integrity of every organism is constantly challenged by endogenous and exogenous DNA-damaging factors. Mutagenic agents cause reduced stability of plant genome and have a deleterious effect on development, and in the case of crop species lead to yield reduction. It is crucial for all organisms, including plants, to develop efficient mechanisms for maintenance of the genome integrity. DNA repair processes have been characterized in bacterial, fungal and mammalian model systems. The description of these processes in plants, in contrast, was initiated relatively recently and has been focused largely on the model plant Arabidopsis thaliana. Consequently, our knowledge about DNA repair in plant genomes- particularly in the genomes of crops plants- is by far more limited. However, the relatively small size of the Arabidopsis genome, its rapid life cycle and availability of various transformation methods make this species an attractive model for the study of eukaryotic DNA repair mechanisms and mutagenesis. Moreover, abnormalities in DNA repair which proved to be lethal for animal models are tolerated in plant genomes, although sensitivity to DNA damaging agents is retained. Due to the high conservation of DNA repair processes and factors mediating them among eukaryotes, genes and proteins that have been identified in model species may serve to identify homologous sequences in other species, including crop plants, in which these mechanisms are poorly understood. Crop breeding programs have provided remarkable advances in food quality and yield over the last century. Although the human population is predicted to peak by 2050, further advances in yield will be required to feed this population. Breeding requires genetic diversity. The biological impact of any mutagenic agent used for the creation of genetic diversity depends on the chemical nature of the induced lesions and on the efficiency and accuracy of their repair. More recent targeted

  1. Structure-function analysis of human enzymes initiating nucleobase repair in DNA and RNA

    OpenAIRE

    Sundheim, Ottar

    2008-01-01

    In humans, there are four known glycosylases that initiate repair of uracils in DNA. These are UNG, TDG, SMUG1, and MBD4. It was proposed that the replication independent SMUG1 was the main enzyme initiating removal of deaminated cytosine, whereas UNG2 was responsible for replication associated repair of mis-incorporated dUTP (Nilsen et al., 2001). We aimed at elucidating the specific function of the two main human uracil-DNA glycosylases in vitro and in vivo to further clarify their distinct...

  2. [Induction by mycotoxins of somatic mosaicism in Drosophila and DNA repair in mammalian liver cell cultures].

    Science.gov (United States)

    Belitskiĭ, G A; Khovanova, E M; Budunova, I V; Sharunich, E G

    1983-07-01

    The genotoxic activity of four mycotoxins has been studied. High level of somatic mutagenesis in imaginal discs of Drosophila melanogaster larvae and DNA repair synthesis in human embryo and adult rat liver cell cultures were inducible only by highly carcinogenic aflatoxin B1. Patulin, a weak direct-action carcinogenic substance, slightly elevated the mutagenesis in somatic cells of Drosophila but did not induce DNA repair synthesis in liver cell cultures. Citrinin that did not exhibit any carcinogenic properties when used alone and stachybotrotoxin with non-reported carcinogenic activity appeared inactive in the test-systems applied. The possibilities of rapid recognition of carcinogenic mycotoxins by detecting their genotoxic properties are discussed.

  3. Enzymes repair radiation injury. What they can do with the fundamental cellular components - experiments with biologically active DNA

    Energy Technology Data Exchange (ETDEWEB)

    Meermann, H.

    1986-01-01

    A cell is able to repair radiation injury all by itself. It houses a variety of very efficient experts for this task, namely repair enzymes, which indeed can repair injuries of the fundamental cellular components, as e.g. the bases of the DNA, and even severe injuries induced by high-energy radiation, as for example X radiation, electrons, neutron, and ion beams.

  4. Anti-tumour compounds illudin S and Irofulven induce DNA lesions ignored by global repair and exclusively processed by transcription- and replication-coupled repair pathways.

    OpenAIRE

    Raams, Anja; Kelner, Michael; Ng, Jessica; Yamashita, Yukiko; Takeda, Shiunichi; McMorris, Trevor; Hoeijmakers, Jan; Jaspers, Nicolaas

    2002-01-01

    textabstractIlludin S is a natural sesquiterpene drug with strong anti-tumour activity. Inside cells, unstable active metabolites of illudin cause the formation of as yet poorly characterised DNA lesions. In order to identify factors involved in their repair, we have performed a detailed genetic survey of repair-defective mutants for responses to the drug. We show that 90% of illudin's lethal effects in human fibroblasts can be prevented by an active nucleotide excision repair (NER) system. C...

  5. A Cross-Cancer Genetic Association Analysis of the DNA Repair and DNA Damage Signaling Pathways for Lung, Ovary, Prostate, Breast, and Colorectal Cancer.

    Science.gov (United States)

    Scarbrough, Peter M; Weber, Rachel Palmieri; Iversen, Edwin S; Brhane, Yonathan; Amos, Christopher I; Kraft, Peter; Hung, Rayjean J; Sellers, Thomas A; Witte, John S; Pharoah, Paul; Henderson, Brian E; Gruber, Stephen B; Hunter, David J; Garber, Judy E; Joshi, Amit D; McDonnell, Kevin; Easton, Doug F; Eeles, Ros; Kote-Jarai, Zsofia; Muir, Kenneth; Doherty, Jennifer A; Schildkraut, Joellen M

    2016-01-01

    DNA damage is an established mediator of carcinogenesis, although genome-wide association studies (GWAS) have identified few significant loci. This cross-cancer site, pooled analysis was performed to increase the power to detect common variants of DNA repair genes associated with cancer susceptibility. We conducted a cross-cancer analysis of 60,297 single nucleotide polymorphisms, at 229 DNA repair gene regions, using data from the NCI Genetic Associations and Mechanisms in Oncology (GAME-ON) Network. Our analysis included data from 32 GWAS and 48,734 controls and 51,537 cases across five cancer sites (breast, colon, lung, ovary, and prostate). Because of the unavailability of individual data, data were analyzed at the aggregate level. Meta-analysis was performed using the Association analysis for SubSETs (ASSET) software. To test for genetic associations that might escape individual variant testing due to small effect sizes, pathway analysis of eight DNA repair pathways was performed using hierarchical modeling. We identified three susceptibility DNA repair genes, RAD51B (P associations with cancer risk in the base excision repair, nucleotide excision repair, mismatch repair, and homologous recombination pathways. Only three susceptibility loci were identified, which had all been previously reported. In contrast, hierarchical modeling identified several pleiotropic cancer risk associations in key DNA repair pathways. Results suggest that many common variants in DNA repair genes are likely associated with cancer susceptibility through small effect sizes that do not meet stringent significance testing criteria. ©2015 American Association for Cancer Research.

  6. Dual involvement of TFIIH in DNA repair and transcription

    NARCIS (Netherlands)

    G.S. Winkler (Sebastiaan)

    1999-01-01

    textabstractThe catrier of genetic information, deoxyribonucleic acid (DNA), appears at the macromolecular level as an extremely stable molecule as it is faithfully duplicated and transmitted from mother to daughter cells. At the molecular level, however, DNA is subject to continuous attack, even

  7. Genomic Stability: FANCJ-Dependent G4 DNA Repair

    OpenAIRE

    Maizels, Nancy

    2008-01-01

    G-rich regions have the potential to form G4 DNA upon replication, which can lead to genomic instability. FANCJ, a G4 DNA helicase, has been shown to be critical for the stability of regions that match the G4 signature motif by experiments analyzing its nematode homolog.

  8. Conformations of MutS in DNA mismatch repair

    NARCIS (Netherlands)

    F.S. Groothuizen (Flora)

    2015-01-01

    markdownabstract__Abstract__ Prior to cell division, the DNA containing the genetic information of a cell has to be copied. During this process, errors are sometimes incorporated (so-called mismatches), which may cause genetic abnormalities in future cells. To prevent this, cells contain a DNA

  9. Replication stress activates DNA repair synthesis in mitosis

    DEFF Research Database (Denmark)

    Minocherhomji, Sheroy; Ying, Songmin; Bjerregaard, Victoria A

    2015-01-01

    mitosis serves as the trigger for completion of DNA replication at CFS loci in human cells. Given that this POLD3-dependent mitotic DNA synthesis is enhanced in aneuploid cancer cells that exhibit intrinsically high levels of chromosomal instability (CIN(+)) and replicative stress, we suggest...

  10. DNA damage by reactive species: Mechanisms, mutation and repair

    Indian Academy of Sciences (India)

    2012-06-25

    Jun 25, 2012 ... guanine-guanine DNA adducts in human leukocytes by high-performance liquid chromatography coupled to induc- tively coupled plasma mass spectrometry. Chem. Res. Toxicol. 23 1313–132. Hedglin M and O'Brien PJ 2010 Nonspecifically bound proteins spin while diffusing along DNA. ACS Chem. Biol.

  11. Loss of CHD1 causes DNA repair defects and enhances prostate cancer therapeutic responsiveness

    DEFF Research Database (Denmark)

    Kari, Vijayalakshmi; Mansour, Wael Yassin; Raul, Sanjay Kumar

    2016-01-01

    The CHD1 gene, encoding the chromo-domain helicase DNA-binding protein-1, is one of the most frequently deleted genes in prostate cancer. Here, we examined the role of CHD1 in DNA double-strand break (DSB) repair in prostate cancer cells. We show that CHD1 is required for the recruitment of Ct......IP to chromatin and subsequent end resection during DNA DSB repair. Our data support a role for CHD1 in opening the chromatin around the DSB to facilitate the recruitment of homologous recombination (HR) proteins. Consequently, depletion of CHD1 specifically affects HR-mediated DNA repair but not non......-homologous end joining. Together, we provide evidence for a previously unknown role of CHD1 in DNA DSB repair via HR and show that CHD1 depletion sensitizes cells to PARP inhibitors, which has potential therapeutic relevance. Our findings suggest that CHD1 deletion, like BRCA1/2 mutation in ovarian cancer, may...

  12. Enzymology of repair of DNA adducts produced by N-nitroso compounds

    Energy Technology Data Exchange (ETDEWEB)

    Setlow, R.B.; Cao, E.H.; Delihas, N.C.

    1983-01-01

    The biological effects of DNA adducts depend on their nature, and on their half-lives relative to the rates of DNA replication and transcription. Their half-lives are determined by the rates of spontaneous decay, such as depurination, and the rates of enzymatic repair of the adducts or their decay products. The principle modes of repair of methylating and ethylating agents are by glycosylase catalyzed depurination of 7-alkylguanine and 3-alkyladenine and by the dealkalation of O/sup 6/-alkylguanine. Repair by dealkylation cannot be detected by the standard methods used to measure DNA repair, but it is easy to estimate the acceptor activity in cell extracts by measuring the transfer of radioactive O/sup 6/-alkyl groups in an exogenous DNA to protein. In extracts of cells treated with alkylating agents the activity is depressed because the endogenous DNA is rapidly dealkylated, using up the acceptor activity. In many cell types the decrease in activity is followed by an increase to the normal constitutive level. In other cells there is no such adaptive response. Differences in constitutive levels of methyl accepting activity in extracts of human lymphocytes and on the acceptor activity in lung macrophages from smokers (low activity) and non-smokers (high activity) have been observed. 46 references.

  13. Hepatitis B virus X protein impedes the DNA repair via its association with transcription factor, TFIIH

    Directory of Open Access Journals (Sweden)

    AbdeL-Hafiz Hany

    2011-03-01

    Full Text Available Abstract Background Hepatitis B virus (HBV infections play an important role in the development of hepatocellular carcinoma (HCC. HBV X protein (HBx is a multifunctional protein that can modulate various cellular processes and plays a crucial role in the pathogenesis of HCC. HBx is known to interact with DNA helicase components of TFIIH, a basal transcriptional factor and an integral component of DNA excision repair. Results In this study, the functional relevance of this association was further investigated in the context to DNA repair. By site-directed mutagenesis HBx's critical residues for interaction with TFIIH were identified. Similarly, TFIIH mutants lacking ATPase domain and the conserved carboxyl-terminal domain failed to interact with HBx. Yeast and mammalian cells expressing HBxwt conferred hypersensitivity to UV irradiation, which is interpreted as a basic deficiency in nucleotide excision repair. HBxmut120 (Glu to Val was defective in binding to TFIIH and failed to respond to UV. Conclusions We conclude that HBx may act as the promoting factor by inhibiting DNA repair causing DNA damage and accumulation of errors, thereby contributing to HCC development.

  14. Repair capacity for platinum-DNA adducts determines the severity of cisplatin-induced peripheral neuropathy.

    Science.gov (United States)

    Dzagnidze, Anna; Katsarava, Zaza; Makhalova, Julia; Liedert, Bernd; Yoon, Min-Suk; Kaube, Holger; Limmroth, Volker; Thomale, Juergen

    2007-08-29

    The pronounced neurotoxicity of the potent antitumor drug cisplatin frequently results in the onset of peripheral polyneuropathy (PNP), which is assumed to be initially triggered by platination products in the nuclear DNA of affected tissues. To further elucidate the molecular mechanisms, we analyzed in a mouse model the formation and processing of the main cisplatin-induced DNA adduct (guanine-guanine intrastrand cross-link) in distinct neuronal cell types by adduct-specific monoclonal antibodies. Comparison of the adduct kinetics in cisplatin-injected mice either proficient or deficient for nucleotide excision repair (NER) functions revealed the essential role of this DNA repair pathway in protecting differentiated cells of the nervous system from excessive formation of such lesions. Hence, chronic exposure to cisplatin resulted in an accelerated accumulation of unrepaired intrastrand cross-links in neuronal cells of mice with dysfunctional NER. The augmented adduct levels in dorsal root ganglion (DRG) cells of those animals coincided with an earlier onset of PNP-like functional disturbance of their sensory nervous system. Independently from the respective repair phenotype, the amount of persisting DNA cross-links in DRG neurons at a given cumulative dose was significantly correlated to the degree of sensory impairment as measured by electroneurography. Collectively, these findings suggest a new model for the processing of cisplatin adducts in primary neuronal cells and accentuate the crucial role of effectual DNA repair capacity in the target cells for the individual risk of therapy-induced PNP.

  15. Base excision repair of oxidative DNA damage: from mechanism to disease

    Science.gov (United States)

    Whitaker, Amy M.; Schaich, Matthew A.; Smith, Mallory S.; Flynn, Tony S.; Freudenthal, Bret. D.

    2017-01-01

    Reactive oxygen species continuously assault the structure of DNA resulting in oxidation and fragmentation of the nucleobases. Both oxidative DNA damage itself and its repair mediate the progression of many prevalent human maladies. The major pathway tasked with removal of oxidative DNA damage, and hence maintaining genomic integrity, is base excision repair (BER). The aphorism that structure often dictates function has proven true, as numerous recent structural biology studies have aided in clarifying the molecular mechanisms used by key BER enzymes during the repair of damaged DNA. This review focuses on the mechanistic details of the individual BER enzymes and the association of these enzymes during the development and progression of human diseases, including cancer and neurological diseases. Expanding on these structural and biochemical studies to further clarify still elusive BER mechanisms, and focusing our efforts toward gaining an improved appreciation of how these enzymes form co-complexes to facilitate DNA repair is a crucial next step toward understanding how BER contributes to human maladies and how it can be manipulated to alter patient outcomes. PMID:28199214

  16. Folate and Colorectal Cancer in Rodents: A Model of DNA Repair Deficiency

    Directory of Open Access Journals (Sweden)

    Rita Rosati

    2012-01-01

    Full Text Available Fortification of grains has resulted in a positive public health outcome vis-a-vis reduced incidence of neural tube defects. Whether folate has a correspondingly beneficial effect on other disease outcomes is less clear. A role for dietary folate in the prevention of colorectal cancer has been established through epidemiological data. Experimental data aiming to further elucidate this relationship has been somewhat equivocal. Studies report that folate depletion increases DNA damage, mutagenesis, and chromosomal instability, all suggesting inhibited DNA repair. While these data connecting folate depletion and inhibition of DNA repair are convincing, we also present data demonstrating that genetic inhibition of DNA repair is protective in the development of preneoplastic colon lesions, both when folate is depleted and when it is not. The purpose of this paper is to (1 give an overview of the data demonstrating a DNA repair defect in response to folate depletion, and (2 critically compare and contrast the experimental designs utilized in folate/colorectal cancer research and the corresponding impact on tissue folate status and critical colorectal cancer endpoints. Our analysis suggests that there is still an important need for a comprehensive evaluation of the impact of differential dietary prescriptions on blood and tissue folate status.

  17. At the intersection of non-coding transcription, DNA repair, chromatin structure, and cellular senescence

    Directory of Open Access Journals (Sweden)

    Ryosuke eOhsawa

    2013-07-01

    Full Text Available It is well accepted that non-coding RNAs play a critical role in regulating gene expression. Recent paradigm-setting studies are now revealing that non-coding RNAs, other than microRNAs, also play intriguing roles in the maintenance of chromatin structure, in the DNA damage response, and in adult human stem cell aging. In this review, we will discuss the complex inter-dependent relationships among non-coding RNA transcription, maintenance of genomic stability, chromatin structure and adult stem cell senescence. DNA damage-induced non-coding RNAs transcribed in the vicinity of the DNA break regulate recruitment of the DNA damage machinery and DNA repair efficiency. We will discuss the correlation between non-coding RNAs and DNA damage repair efficiency and the potential role of changing chromatin structures around double-strand break sites. On the other hand, induction of non-coding RNA transcription from the repetitive Alu elements occurs during human stem cell aging and hinders efficient DNA repair causing entry into senescence. We will discuss how this fine balance between transcription and genomic instability may be regulated by the dramatic changes to chromatin structure that accompany cellular senescence.

  18. Overexpression of DNA ligase III in mitochondria protects cells against oxidative stress and improves mitochondrial DNA base excision repair

    DEFF Research Database (Denmark)

    Akbari, Mansour; Keijzers, Guido; Maynard, Scott

    2014-01-01

    slower than the preceding mitochondrial BER steps. Overexpression of DNA ligase III in mitochondria improved the rate of overall BER, increased cell survival after menadione induced oxidative stress and reduced autophagy following the inhibition of the mitochondrial electron transport chain complex I...... by rotenone. Our results suggest that the amount of DNA ligase III in mitochondria may be critical for cell survival following prolonged oxidative stress, and demonstrate a functional link between mitochondrial DNA damage and repair, cell survival upon oxidative stress, and removal of dysfunctional...

  19. Yeast DNA-repair gene RAD14 encodes a zinc metalloprotein with affinity for ultraviolet-damaged DNA.

    Science.gov (United States)

    Guzder, S N; Sung, P; Prakash, L; Prakash, S

    1993-06-15

    Xeroderma pigmentosum (XP) patients suffer from a high incidence of skin cancers due to a defect in excision repair of UV light-damaged DNA. Of the seven XP complementation groups, A-G, group A represents a severe and frequent form of the disease. The Saccharomyces cerevisiae RAD14 gene is a homolog of the XP-A correcting (XPAC) gene. Like XP-A cells, rad14-null mutants are defective in the incision step of excision repair of UV-damaged DNA. We have purified RAD14 protein to homogeneity from extract of a yeast strain genetically tailored to overexpress RAD14. As determined by atomic emission spectroscopy, RAD14 contains one zinc atom. We also show in vitro that RAD14 binds zinc but does not bind other divalent metal ions. In DNA mobility-shift assays, RAD14 binds specifically to UV-damaged DNA. Removal of cyclobutane pyrimidine dimers from damaged DNA by enzymatic photoreactivation has no effect on binding, strongly suggesting that RAD14 recognizes pyrimidine(6-4)pyrimidone photoproduct sites. These findings indicate that RAD14 functions in damage recognition during excision repair.

  20. Brain’s DNA Repair Response to Neurotoxicants

    Science.gov (United States)

    2007-01-01

    damage, repair, and antioxidant systems in brain regions: a correlative study. Free Radical Biology & Medicine 2000;28(5):779-785. APPENDIX...in the mouse brain. Free Radical Biology and Medicine 33: 292-298;2002 V. Sava et al. 20 [19] Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner...neurotoxicity (Mandir et al., 1999). Neuroprotection against MPTP toxicity was also achieved by treatment of mice with PARP-1 inhibitors (Cosi and Marien , 1999

  1. DNA repair in plants studied by comet assay

    Directory of Open Access Journals (Sweden)

    Karel J Angelis

    2015-06-01

    Fig. 2B. Effect of mutation and of inhibitors of PARP1 on SSB repair kinetics. SSBs induced by 1 hr treatment with 2 mM MMS in atparp1 (red and in Arabidopsis wt in presence of 3 mM 3-aminobenzamide (3-ABA, turquoise and 10 μM HsPARP1 specific AG14361 (green inhibitors. (Angelis and Kozák, unpublished data

  2. Biochemical characterization and DNA repair pathway interactions of Mag1-mediated base excision repair in Schizosaccharomyces pombe.

    Science.gov (United States)

    Alseth, Ingrun; Osman, Fikret; Korvald, Hanne; Tsaneva, Irina; Whitby, Matthew C; Seeberg, Erling; Bjørås, Magnar

    2005-01-01

    The Schizosaccharomyces pombe mag1 gene encodes a DNA repair enzyme with sequence similarity to the AlkA family of DNA glycosylases, which are essential for the removal of cytotoxic alkylation products, the premutagenic deamination product hypoxanthine and certain cyclic ethenoadducts such as ethenoadenine. In this paper, we have purified the Mag1 protein and characterized its substrate specificity. It appears that the substrate range of Mag1 is limited to the major alkylation products, such as 3-mA, 3-mG and 7-mG, whereas no significant activity was found towards deamination products, ethenoadducts or oxidation products. The efficiency of 3-mA and 3-mG removal was 5-10 times slower for Mag1 than for Escherichia coli AlkA whereas the rate of 7-mG removal was similar to the two enzymes. The relatively low efficiency for the removal of cytotoxic 3-methylpurines is consistent with the moderate sensitivity of the mag1 mutant to methylating agents. Furthermore, we studied the initial steps of Mag1-dependent base excision repair (BER) and genetic interactions with other repair pathways by mutant analysis. The double mutants mag1 nth1, mag1 apn2 and mag1 rad2 displayed increased resistance to methyl methanesulfonate (MMS) compared with the single mutants nth1, apn2 and rad2, respectively, indicating that Mag1 initiates both short-patch (Nth1-dependent) and long-patch (Rad2-dependent) BER of MMS-induced damage. Spontaneous intrachromosomal recombination frequencies increased 3-fold in the mag1 mutant suggesting that Mag1 and recombinational repair (RR) are both involved in repair of alkylated bases. Finally, we show that the deletion of mag1 in the background of rad16, nth1 and rad2 single mutants reduced the total recombination frequencies of all three double mutants, indicating that abasic sites formed as a result of Mag1 removal of spontaneous base lesions are substrates for nucleotide excision repair, long- and short-patch BER and RR.

  3. Reduced cellular DNA repair capacity after environmentally relevant arsenic exposure. Influence of Ogg1 deficiency

    Energy Technology Data Exchange (ETDEWEB)

    Bach, Jordi; Peremartí, Jana; Annangi, Balasubramnayam [Grup de Mutagènesi, Departament de Genètica i de Microbiologia, Facultat de Biociències, Universitat Autònoma de Barcelona, Cerdanyola del Vallès, Barcelona (Spain); Marcos, Ricard, E-mail: ricard.marcos@uab.es [Grup de Mutagènesi, Departament de Genètica i de Microbiologia, Facultat de Biociències, Universitat Autònoma de Barcelona, Cerdanyola del Vallès, Barcelona (Spain); CIBER Epidemiología y Salud Pública, ISCIII, Madrid (Spain); Hernández, Alba, E-mail: alba.hernandez@uab.es [Grup de Mutagènesi, Departament de Genètica i de Microbiologia, Facultat de Biociències, Universitat Autònoma de Barcelona, Cerdanyola del Vallès, Barcelona (Spain); CIBER Epidemiología y Salud Pública, ISCIII, Madrid (Spain)

    2015-09-15

    Highlights: • Repair ability under long-term exposure to arsenic was tested using the comet assay. • Effects were measured under Ogg1 wild-type and deficient backgrounds. • Exposed cells repair less efficiency the DNA damage induced by SA, KBrO{sub 3}, MMA{sup III} or UVC radiation. • Oxidative damage and Ogg1 deficient background exacerbate repair deficiencies. • Overexpression of the arsenic metabolizing enzyme As3mt acts as adaptive mechanism. - Abstract: Inorganic arsenic (i-As) is a genotoxic and carcinogenic environmental contaminant known to affect millions of people worldwide. Our previous work demonstrated that chronic sub-toxic i-As concentrations were able to induce biologically significant levels of genotoxic and oxidative DNA damage that were strongly influenced by the Ogg1 genotype. In order to study the nature of the observed levels of damage and the observed differences between MEF Ogg1{sup +/+} and Ogg1{sup −/−} genetic backgrounds, the genotoxic and oxidative DNA repair kinetics of 18-weeks exposed MEF cells were evaluated by the comet assay. Results indicate that MEF Ogg1{sup +/+} and Ogg1{sup −/−} cells chronically exposed to i-As repair the DNA damage induced by arsenite, potassium bromide and UVC radiation less efficiently than control cells, being that observation clearly more pronounced in MEF Ogg1{sup −/−} cells. Consequently, exposed cells accumulate a higher percentage of unrepaired DNA damage at the end of the repair period. As an attempt to eliminate i-As associated toxicity, chronically exposed MEF Ogg1{sup −/−} cells overexpress the arsenic metabolizing enzyme As3mt. This adaptive response confers cells a significant resistance to i-As-induced cell death, but at expenses of accumulating high levels of DNA damage due to their repair impairment. Overall, the work presented here evidences that i-As chronic exposure disrupts the normal cellular repair function, and that oxidative DNA damage—and Ogg1 deficiency

  4. The role of DNA base excision repair in brain homeostasis and disease

    DEFF Research Database (Denmark)

    Akbari, Mansour; Morevati, Marya; Croteau, Deborah

    2015-01-01

    of proteins required for BER or proteins that regulate BER have been consistently associated with neurological dysfunction and disease in humans. Recent studies suggest that DNA lesions in the nuclear and mitochondrial compartments and the cellular response to those lesions have a profound effect on cellular......Chemical modification and spontaneous loss of nucleotide bases from DNA are estimated to occur at the rate of thousands per human cell per day. DNA base excision repair (BER) is a critical mechanism for repairing such lesions in nuclear and mitochondrial DNA. Defective expression or function...... energy homeostasis, mitochondrial function and cellular bioenergetics, with especially strong influence on neurological function. Further studies in this area could lead to novel approaches to prevent and treat human neurodegenerative disease....

  5. Assembly and function of DNA double-strand break repair foci in mammalian cells

    DEFF Research Database (Denmark)

    Bekker-Jensen, Simon; Mailand, Niels

    2010-01-01

    DNA double-strand breaks (DSBs) are among the most cytotoxic types of DNA damage, which if left unrepaired can lead to mutations or gross chromosomal aberrations, and promote the onset of diseases associated with genomic instability such as cancer. One of the most discernible hallmarks...... of the cellular response to DSBs is the accumulation and local concentration of a plethora of DNA damage signaling and repair proteins in the vicinity of the lesion, initiated by ATM-mediated phosphorylation of H2AX (¿-H2AX) and culminating in the generation of distinct nuclear compartments, so-called Ionizing...... of such DNA repair foci still remains limited. In this review, we focus on recent discoveries on the mechanisms that govern the formation of IRIF, and discuss the implications of such findings in light of our understanding of the physiological importance of these structures....

  6. Epigenetic modifications in double-strand break DNA damage signaling and repair.

    Science.gov (United States)

    Rossetto, Dorine; Truman, Andrew W; Kron, Stephen J; Côté, Jacques

    2010-09-15

    Factors involved in the cellular response to double-strand break (DSB) DNA damage have been identified as potential therapeutic targets that would greatly sensitize cancer cells to radiotherapy and genotoxic chemotherapy. These targets could disable the repair machinery and/or reinstate normal cell-cycle checkpoint leading to growth arrest, senescence, and apoptosis. It is now clear that a major aspect of the DNA damage response occurs through specific interactions with chromatin structure and its modulation. It implicates highly dynamic posttranslational modifications of histones that are critical for DNA damage recognition and/or signaling, repair of the lesion, and release of cell-cycle arrest. Therefore, drugs that target the enzymes responsible for these modifications, or the protein modules reading them, have very high therapeutic potential. This review presents the current state of knowledge on the different chromatin modifications and their roles in each step of eukaryotic DSB DNA damage response. ©2010 AACR.

  7. DNA repair efficiency in germ cells and early mouse embryos and consequences for radiation-induced transgenerational genomic damage

    Energy Technology Data Exchange (ETDEWEB)

    Marchetti, Francesco; Wyrobek, Andrew J.

    2009-01-18

    Exposure to ionizing radiation and other environmental agents can affect the genomic integrity of germ cells and induce adverse health effects in the progeny. Efficient DNA repair during gametogenesis and the early embryonic cycles after fertilization is critical for preventing transmission of DNA damage to the progeny and relies on maternal factors stored in the egg before fertilization. The ability of the maternal repair machinery to repair DNA damage in both parental genomes in the fertilizing egg is especially crucial for the fertilizing male genome that has not experienced a DNA repair-competent cellular environment for several weeks prior to fertilization. During the DNA repair-deficient period of spermatogenesis, DNA lesions may accumulate in sperm and be carried into the egg where, if not properly repaired, could result in the formation of heritable chromosomal aberrations or mutations and associated birth defects. Studies with female mice deficient in specific DNA repair genes have shown that: (i) cell cycle checkpoints are activated in the fertilized egg by DNA damage carried by the sperm; and (ii) the maternal genotype plays a major role in determining the efficiency of repairing genomic lesions in the fertilizing sperm and directly affect the risk for abnormal reproductive outcomes. There is also growing evidence that implicates DNA damage carried by the fertilizing gamete as a mediator of postfertilization processes that contribute to genomic instability in subsequent generations. Transgenerational genomic instability most likely involves epigenetic mechanisms or error-prone DNA repair processes in the early embryo. Maternal and embryonic DNA repair processes during the early phases of mammalian embryonic development can have far reaching consequences for the genomic integrity and health of subsequent generations.

  8. Are glutathione S transferases involved in DNA damage signalling? Interactions with DNA damage and repair revealed from molecular epidemiology studies

    Energy Technology Data Exchange (ETDEWEB)

    Dusinska, Maria, E-mail: Maria.DUSINSKA@nilu.no [CEE-Health Effects Group, NILU - Norwegian Institute for Air Research, Kjeller (Norway); Staruchova, Marta; Horska, Alexandra [Department of Experimental and Applied Genetics, Slovak Medical University, Bratislava (Slovakia); Smolkova, Bozena [Laboratory of Cancer Genetics, Cancer Research Institute of the Slovak Academy of Sciences, Bratislava (Slovakia); Collins, Andrew [Department of Nutrition, Faculty of Medicine, University of Oslo (Norway); Bonassi, Stefano [Unit of Clinical and Molecular Epidemiology, IRCCS San Raffaele Pisana, Rome (Italy); Volkovova, Katarina [Department of Experimental and Applied Genetics, Slovak Medical University, Bratislava (Slovakia)

    2012-08-01

    Glutathione S-transferases (GSTs) are members of a multigene family of isoenzymes that are important in the control of oxidative stress and in phase II metabolism. Acting non-enzymically, GSTs can modulate signalling pathways of cell proliferation, cell differentiation and apoptosis. Using a molecular epidemiology approach, we have investigated a potential involvement of GSTs in DNA damage processing, specifically the modulation of DNA repair in a group of 388 healthy adult volunteers; 239 with at least 5 years of occupational exposure to asbestos, stone wool or glass fibre, and 149 reference subjects. We measured DNA damage in lymphocytes using the comet assay (alkaline single cell gel electrophoresis): strand breaks (SBs) and alkali-labile sites, oxidised pyrimidines with endonuclease III, and oxidised purines with formamidopyrimidine DNA glycosylase. We also measured GST activity in erythrocytes, and the capacity for base excision repair (BER) in a lymphocyte extract. Polymorphisms in genes encoding three GST isoenzymes were determined, namely deletion of GSTM1 and GSTT1 and single nucleotide polymorphism Ile105Val in GSTP1. Consumption of vegetables and wine correlated negatively with DNA damage and modulated BER. GST activity correlated with oxidised bases and with BER capacity, and differed depending on polymorphisms in GSTP1, GSTT1 and GSTM1. A significantly lower BER rate was associated with the homozygous GSTT1 deletion in all asbestos site subjects and in the corresponding reference group. Multifactorial analysis revealed effects of sex and exposure in GSTP1 Ile/Val heterozygotes but not in Ile/Ile homozygotes. These variants affected also SBs levels, mainly by interactions of GSTP1 genotype with exposure, with sex, and with smoking habit; and by an interaction between sex and smoking. Our results show that GST polymorphisms and GST activity can apparently influence DNA stability and repair of oxidised bases, suggesting a potential new role for these

  9. Abasic sites in DNA: repair and biological consequences in Saccharomyces cerevisiae.

    Science.gov (United States)

    Boiteux, Serge; Guillet, Marie

    2004-01-05

    Apurinic/apyrimidinic (AP) sites are one of the most frequent spontaneous lesions in DNA. They are potentially mutagenic and lethal lesions that can block DNA replication and transcription. In addition, cleavage of AP sites by AP endonucleases or AP lyases generates DNA single-strand breaks (SSBs) with 5'- or 3'-blocked ends, respectively. Therefore, we suggest that AP sites and 3'- or 5'-blocked SSBs, we name "honorary AP sites", constitute a single class of lesions. In this review, we describe the different mechanisms used by the budding yeast Saccharomyces cerevisiae to remove or tolerate AP sites and related SSBs. In wild-type cells, AP sites are primarily repaired by the base excision repair (BER) pathway, with the nucleotide excision repair (NER) pathway as a back up activity. BER is initiated by one of the two AP endonucleases, Apn1 or Apn2. Three DNA N-glycosylases/AP lyases, Ntg1, Ntg2 and Ogg1, can also incise AP sites in DNA. Rad27, a structure specific endonuclease, is involved in the repair of 5'-blocked ends, whereas Apn1, Apn2 and Rad1-Rad10 are involved in the removal of 3'-blocked ends using their 3'-phosphodiesterase and 3'-flap endonuclease activities, respectively. AP sites can stall DNA replication forks, as well as they block in vitro DNA synthesis by DNA polymerase delta. Restart of stalled forks can occur through a recombination-associated pathway initiated by the Mus81-Mms4 endonuclease or mutagenic translesion DNA synthesis (TLS). The mutagenic bypass of AP sites is a two-polymerases affair with an inserter DNA polymerase (Poldelta, Poleta or Rev1) and an extender DNA polymerase (Polzeta). Under normal growth conditions, inactivation of Apn1, Apn2 and Rad1-Rad10 causes cell death. Therefore, the burden of spontaneous AP sites is not compatible with life, in the absence of excision repair pathways. These results in yeast demonstrate that AP sites are critical endogenous DNA damages that cause genetic instability and by analogy could be

  10. Germ cell DNA-repair systems-possible tools in cancer research?

    Science.gov (United States)

    Helle, F

    2012-04-01

    A major dogma in cancer research is that cancer begins at the cellular level. Because of this single-cell origin, evolutionary principles have often been used to explain how somatic cancer cells are selected at a sub-individual level. The traditional application of Darwinian theory, however, in which the colony of cells constituting an individual is regarded as a whole, has not been applied extensively to the understanding of cancer until recently. Two proponents for this view, Breivik and Gaudernack, have suggested that in certain situations the cost of DNA repair might exceed the cost of errors. This model predicts that genetic stability is configured for an optimal cost-benefit relationship. Natural selection is not expected to have produced the best genetic stability available in the human body, merely the best compromise of DNA repair and costs. Repair and maintenance of the vast human genome is thermodynamically expensive, and an optimal balance between DNA repair and dietary needs is likely to have originated. Furthermore, fast growth conveys significant advantages such as early maturation or cognitive development, but usually at the expense of replication accuracy. Thus, a compromise between growth speed and cancer risk is likely to have taken place. These and other ecological mechanisms have probably prevented genomic stability to reach its full potential in the human body. In contrast, germ lines express near perfect DNA maintenance. Although germ cells are specialized DNA-conserving cells with few other functions, it's not given that their proteins will all be incompatible with the somatic cell. One approach to study this would be to systematically explore which DNA-stability and -repair systems are unique in germ cells, and induce their expression in invertebrate and mammalian model organisms. This could unveil which DNA-repair systems are switched off in the somatic cell lines, as they are incompatible, and which are absent due to evolution. The

  11. Allele and Genotype Distributions of DNA Repair Gene Polymorphisms in South Indian Healthy Population

    Directory of Open Access Journals (Sweden)

    Katiboina Srinivasa Rao

    2014-01-01

    Full Text Available Various DNA repair pathways protect the structural and chemical integrity of the human genome from environmental and endogenous threats. Polymorphisms of genes encoding the proteins involved in DNA repair have been found to be associated with cancer risk and chemotherapeutic response. In this study, we aim to establish the normative frequencies of DNA repair genes in South Indian healthy population and compare with HapMap populations. Genotyping was done on 128 healthy volunteers from South India, and the allele and genotype distributions were established. The minor allele frequency of Xeroderma pigmentosum group A ( XPA G23A, Excision repair cross-complementing 2 ( ERCC2 /Xeroderma pigmentosum group D ( XPD Lys751Gln, Xeroderma pigmentosum group G ( XPG His46His, XPG Asp1104His, and X-ray repair cross-complementing group 1 ( XRCC1 Arg399Gln polymorphisms were 49.2%, 36.3%, 48.0%, 23.0%, and 34.0% respectively. Ethnic variations were observed in the frequency distribution of these polymorphisms between the South Indians and other HapMap populations. The present work forms the groundwork for cancer association studies and biomarker identification for treatment response and prognosis.

  12. DNA damage by reactive species: Mechanisms, mutation and repair

    National Research Council Canada - National Science Library

    Jena, N R

    2012-01-01

    .... These structural modifications are involved in mutation, cancer and many other diseases. As it has the least oxidation potential among all the DNA bases, guanine is frequently attacked by reactive species, producing a plethora of lethal lesions...

  13. Dose-rate effect of ultrashort electron beam radiation on DNA damage and repair in vitro.

    Science.gov (United States)

    Babayan, Nelly; Hovhannisyan, Galina; Grigoryan, Bagrat; Grigoryan, Ruzanna; Sarkisyan, Natalia; Tsakanova, Gohar; Haroutiunian, Samvel; Aroutiounian, Rouben

    2017-11-01

    Laser-generated electron beams are distinguished from conventional accelerated particles by ultrashort beam pulses in the femtoseconds to picoseconds duration range, and their application may elucidate primary radiobiological effects. The aim of the present study was to determine the dose-rate effect of laser-generated ultrashort pulses of 4 MeV electron beam radiation on DNA damage and repair in human cells. The dose rate was increased via changing the pulse repetition frequency, without increasing the electron energy. The human chronic myeloid leukemia K-562 cell line was used to estimate the DNA damage and repair after irradiation, via the comet assay. A distribution analysis of the DNA damage was performed. The same mean level of initial DNA damages was observed at low (3.6 Gy/min) and high (36 Gy/min) dose-rate irradiation. In the case of low-dose-rate irradiation, the detected DNA damages were completely repairable, whereas the high-dose-rate irradiation demonstrated a lower level of reparability. The distribution analysis of initial DNA damages after high-dose-rate irradiation revealed a shift towards higher amounts of damage and a broadening in distribution. Thus, increasing the dose rate via changing the pulse frequency of ultrafast electrons leads to an increase in the complexity of DNA damages, with a consequent decrease in their reparability. Since the application of an ultrashort pulsed electron beam permits us to describe the primary radiobiological effects, it can be assumed that the observed dose-rate effect on DNA damage/repair is mainly caused by primary lesions appearing at the moment of irradiation. © The Author 2017. Published by Oxford University Press on behalf of The Japan Radiation Research Society and Japanese Society for Radiation Oncology.

  14. Repair of DNA damage induced by anthanthrene, a polycyclic aromatic hydrocarbon (PAH) without bay or fjord regions

    DEFF Research Database (Denmark)

    Madsen, Claus Desler; Johannessen, Christian; Rasmussen, Lene Juel

    2009-01-01

    is known about the repair of DNA damage resulting from metabolites from PAHs without bay and fjord regions. We have investigated the six-ringed PAH anthanthrene (dibenzo[def,mno]chrysene), which does not posses bay or fjord motifs. We analyzed the repair profile of human cell extracts and of cell cultures...... in response to DNA damage induced by cytochrome P450-activated anthanthrene. In cell extracts, functional nucleotide excision repair (NER) and mismatch repair (MMR) activities were necessary to trigger a response to anthanthrene metabolite-induced DNA damage. In cell cultures, NER was responsible...... proposed for metabolic activation of PAHs involves the cytochrome P450 enzymes. The DNA damaging potential of cytochrome P450-activated PAHs is generally associated with their bay and fjord regions, and the DNA repair response of PAHs containing such regions has been thoroughly studied. However, little...

  15. BLM–DNA2–RPA–MRN and EXO1–BLM–RPA–MRN constitute two DNA end resection machineries for human DNA break repair

    Science.gov (United States)

    Nimonkar, Amitabh V.; Genschel, Jochen; Kinoshita, Eri; Polaczek, Piotr; Campbell, Judith L.; Wyman, Claire; Modrich, Paul; Kowalczykowski, Stephen C.

    2011-01-01

    Repair of dsDNA breaks requires processing to produce 3′-terminated ssDNA. We biochemically reconstituted DNA end resection using purified human proteins: Bloom helicase (BLM); DNA2 helicase/nuclease; Exonuclease 1 (EXO1); the complex comprising MRE11, RAD50, and NBS1 (MRN); and Replication protein A (RPA). Resection occurs via two routes. In one, BLM and DNA2 physically and specifically interact to resect DNA in a process that is ATP-dependent and requires BLM helicase and DNA2 nuclease functions. RPA is essential for both DNA unwinding by BLM and enforcing 5′ → 3′ resection polarity by DNA2. MRN accelerates processing by recruiting BLM to the end. In the other, EXO1 resects the DNA and is stimulated by BLM, MRN, and RPA. BLM increases the affinity of EXO1 for ends, and MRN recruits and enhances the processivity of EXO1. Our results establish two of the core machineries that initiate recombinational DNA repair in human cells. PMID:21325134

  16. The p400 ATPase regulates nucleosome stability and chromatin ubiquitination during DNA repair

    Science.gov (United States)

    Xu, Ye; Sun, Yingli; Jiang, Xiaofeng; Ayrapetov, Marina K.; Moskwa, Patryk; Yang, Shenghong; Weinstock, David M.

    2010-01-01

    The complexity of chromatin architecture presents a significant barrier to the ability of the DNA repair machinery to access and repair DNA double-strand breaks (DSBs). Consequently, remodeling of the chromatin landscape adjacent to DSBs is vital for efficient DNA repair. Here, we demonstrate that DNA damage destabilizes nucleosomes within chromatin regions that correspond to the γ-H2AX domains surrounding DSBs. This nucleosome destabilization is an active process requiring the ATPase activity of the p400 SWI/SNF ATPase and histone acetylation by the Tip60 acetyltransferase. p400 is recruited to DSBs by a mechanism that is independent of ATM but requires mdc1. Further, the destabilization of nucleosomes by p400 is required for the RNF8-dependent ubiquitination of chromatin, and for the subsequent recruitment of brca1 and 53BP1 to DSBs. These results identify p400 as a novel DNA damage response protein and demonstrate that p400-mediated alterations in nucleosome and chromatin structure promote both chromatin ubiquitination and the accumulation of brca1 and 53BP1 at sites of DNA damage. PMID:20876283

  17. Oxidative DNA damage background estimated by a system model of base excision repair

    Energy Technology Data Exchange (ETDEWEB)

    Sokhansanj, B A; Wilson, III, D M

    2004-05-13

    Human DNA can be damaged by natural metabolism through free radical production. It has been suggested that the equilibrium between innate damage and cellular DNA repair results in an oxidative DNA damage background that potentially contributes to disease and aging. Efforts to quantitatively characterize the human oxidative DNA damage background level based on measuring 8-oxoguanine lesions as a biomarker have led to estimates varying over 3-4 orders of magnitude, depending on the method of measurement. We applied a previously developed and validated quantitative pathway model of human DNA base excision repair, integrating experimentally determined endogenous damage rates and model parameters from multiple sources. Our estimates of at most 100 8-oxoguanine lesions per cell are consistent with the low end of data from biochemical and cell biology experiments, a result robust to model limitations and parameter variation. Our results show the power of quantitative system modeling to interpret composite experimental data and make biologically and physiologically relevant predictions for complex human DNA repair pathway mechanisms and capacity.

  18. DNA Mismatch Repair System: Repercussions in Cellular Homeostasis and Relationship with Aging

    Directory of Open Access Journals (Sweden)

    Juan Cristóbal Conde-Pérezprina

    2012-01-01

    Full Text Available The mechanisms that concern DNA repair have been studied in the last years due to their consequences in cellular homeostasis. The diverse and damaging stimuli that affect DNA integrity, such as changes in the genetic sequence and modifications in gene expression, can disrupt the steady state of the cell and have serious repercussions to pathways that regulate apoptosis, senescence, and cancer. These altered pathways not only modify cellular and organism longevity, but quality of life (“health-span”. The DNA mismatch repair system (MMR is highly conserved between species; its role is paramount in the preservation of DNA integrity, placing it as a necessary focal point in the study of pathways that prolong lifespan, aging, and disease. Here, we review different insights concerning the malfunction or absence of the DNA-MMR and its impact on cellular homeostasis. In particular, we will focus on DNA-MMR mechanisms regulated by known repair proteins MSH2, MSH6, PMS2, and MHL1, among others.

  19. Understanding photodermatoses associated with defective DNA repair: Photosensitive syndromes without associated cancer predisposition.

    Science.gov (United States)

    Yew, Yik Weng; Giordano, Cerrene N; Spivak, Graciela; Lim, Henry W

    2016-11-01

    Photodermatoses associated with defective DNA repair are a group of photosensitive hereditary skin disorders. In this review, we focus on diseases and syndromes with defective nucleotide excision repair that are not accompanied by an increased risk of cutaneous malignancies despite having photosensitivity. Specifically, the gene mutations and transcription defects, epidemiology, and clinical features of Cockayne syndrome, cerebro-oculo-facial-skeletal syndrome, ultraviolet-sensitive syndrome, and trichothiodystrophy will be discussed. These conditions may also have other extracutaneous involvement affecting the neurologic system and growth and development. Rigorous photoprotection remains an important component of the management of these inherited DNA repair-deficiency photodermatoses. Copyright © 2016 American Academy of Dermatology, Inc. Published by Elsevier Inc. All rights reserved.

  20. The hepatitis B virus x protein inhibits thymine DNA glycosylase initiated base excision repair.

    Directory of Open Access Journals (Sweden)

    Maarten A A van de Klundert

    Full Text Available The hepatitis B virus (HBV genome encodes the X protein (HBx, a ubiquitous transactivator that is required for HBV replication. Expression of the HBx protein has been associated with the development of HBV infection-related hepatocellular carcinoma (HCC. Previously, we generated a 3D structure of HBx by combined homology and ab initio in silico modelling. This structure showed a striking similarity to the human thymine DNA glycosylase (TDG, a key enzyme in the base excision repair (BER pathway. To further explore this finding, we investigated whether both proteins interfere with or complement each other's functions. Here we show that TDG does not affect HBV replication, but that HBx strongly inhibits TDG-initiated base excision repair (BER, a major DNA repair pathway. Inhibition of the BER pathway may contribute substantially to the oncogenic effect of HBV infection.

  1. 2-Nitropropane induces DNA repair synthesis in rat hepatocytes in vitro and in vivo.

    Science.gov (United States)

    Andrae, U; Homfeldt, H; Vogl, L; Lichtmannegger, J; Summer, K H

    1988-05-01

    The genotoxicity of 2-nitropropane (2-NP) and 1-nitropropane (1-NP) was investigated by measuring the induction of DNA repair synthesis in rat liver cells in vitro and in vivo. 2-NP strongly induced DNA repair synthesis in both cases. When applied in vivo, 2-NP was considerably more effective in hepatocytes from males than in those from females. 1-NP was not active in vitro or in vivo. 2-NP and 1-NP did not induce repair in cell lines of extrahepatic origin derived from rat, mouse, hamster and man. The results are consistent with the reported carcinogenicity of 2-NP in rat liver and suggest that the formation of hepatocarcinomas by 2-NP is due to the generation of a genotoxic metabolite from 2-NP by liver-specific metabolism.

  2. Effects of opiates and demographic factors on DNA repair synthesis in human leukocytes.

    Science.gov (United States)

    Madden, J J; Falek, A; Shafer, D A; Glick, J H

    1979-11-01

    DNA repair synthesis in leukocytes stressed by far UV irradiation was studied in 90 normal individuals, 38 street-heroin addicts, and 18 methadone maintenance patients. Age, sex, coffee use, and alcohol use had no significant effect on the maximal repair synthesis response of the control subjects, but smoking tobacco significantly decreased the mean response and variance when compared with nonsmoking controls. Heroin addiction had an even more pronounced negative effect, and this may be related to the high rate of chromosome aberrations found in this population. Half of the addicts tested were incapable of repairing UV fluences one-quarter as large as those repaired by the control subjects (5 J/m2 and 20 J/m2, respectively) in the 2-hr assay period. Long-term methadone treatment ameliorated the effects of the street heroin, just as it resulted in a decrease of the chromosome aberration frequency.

  3. A mutation in the XPB/ERCC3 DNA repair transcription gene, associated with trichothiodystrophy

    Energy Technology Data Exchange (ETDEWEB)

    Weeda, G.; Donker, I.; Vermeulen, W. [Erasmus Univ., Rotterdam (Netherlands)] [and others

    1997-02-01

    Trichothiodystrophy (TTD) is a rare, autosomal recessive disorder characterized by sulfur-deficient brittle hair and nails, mental retardation, impaired sexual development, and ichthyosis. Photosensitivity has been reported in {approximately}50% of the cases, but no skin cancer is associated with TTD. Virtually all photosensitive TTD patients have a deficiency in the nucleotide excision repair (NER) of UV-induced DNA damage that is indistinguishable from that of xeroderma pigmentosum (XP) complementation group D (XP-D) patients. DNA repair defects in XP-D are associated with two additional, quite different diseases; XP, a sun-sensitive and cancer-prone repair disorder, and Cockayne syndrome (CS), a photosensitive condition characterized by physical and mental retardation and wizened facial appearance. One photosensitive TTD case constitutes a new repair-deficient complementation group, TTD-A. Remarkably, both TTD-A and XP-D defects are associated with subunits of TFIIH, a basal transcription factor with a second function in DNA repair. Thus, mutations in TFIIH components may, on top of a repair defect, also cause transcriptional insufficiency, which may explain part of the non-XP clinical features of TTD. To date, three patients with the remarkable conjunction of XP and CS but not TM have been assigned to XP complementation group B (XP-B). Here we present the characterization of the NER defect in two mild TTD patients (TTD6VI and TTD4VI) and confirm the assignment to X-PB. The causative mutation was found to be a single base substitution resulting in a missense mutation (T119P) in a region of the XPB protein. These findings define a third TTD complementation group, extend the clinical heterogeneity associated with XP-B, stress the exclusive relationship between TTD and mutations in subunits of repair/transcription factor TFIIH, and strongly support the concept of {open_quotes}transcription syndromes.{close_quotes} 46 refs., 6 figs., 2 tabs.

  4. DNA repair diseases: what do they tell us about cancer and aging?

    Directory of Open Access Journals (Sweden)

    Carlos FM Menck

    2014-01-01

    Full Text Available The discovery of DNA repair defects in human syndromes, initially in xeroderma pigmentosum (XP but later in many others, led to striking observations on the association of molecular defects and patients' clinical phenotypes. For example, patients with syndromes resulting from defective nucleotide excision repair (NER or translesion synthesis (TLS present high levels of skin cancer in areas exposed to sunlight. However, some defects in NER also lead to more severe symptoms, such as developmental and neurological impairment and signs of premature aging. Skin cancer in XP patients is clearly associated with increased mutagenesis and genomic instability, reflecting the defective repair of DNA lesions. By analogy, more severe symptoms observed in NER-defective patients have also been associated with defective repair, likely involving cell death after transcription blockage of damaged templates. Endogenously induced DNA lesions, particularly through oxidative stress, have been identified as responsible for these severe pathologies. However, this association is not that clear and alternative explanations have been proposed. Despite high levels of exposure to intense sunlight, patients from tropical countries receive little attention or care, which likely also reflects the lack of understanding of how DNA damage causes cancer and premature aging.

  5. Inactivation of RAD52 and HDF1 DNA repair genes leads to ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences; Volume 42; Issue 2. Inactivation of RAD52 and HDF1 DNA repair genes leads to premature chronological aging and cellular instability. SILVIA MERCADO-SÁENZ BEATRIZ LÓPEZ-DÍAZ FRANCISCO SENDRA-PORTERO MANUEL MARTÍNEZ-MORILLO MIGUEL J RUIZ-GÓMEZ.

  6. Antimutagenic activity of casein against MNNG in the E. coli DNA repair host-mediated assay.

    NARCIS (Netherlands)

    Boekel, van M.A.J.S.; Goeptar, A.R.; Alink, G.M.

    1997-01-01

    The effect of caseinate and soy protein in the diet on the mutagenicity induced by N-methyl-N'-nitro-N-nitrosoguanidine (MNNG) was assessed in-vivo and ex-vivo in the DNA-repair host-mediated assay and liquid suspension assay, respectively. Of the two proteins only casein showed a strong

  7. SPO11-Independent DNA Repair Foci and Their Role in Meiotic Silencing

    NARCIS (Netherlands)

    F. Carofiglio (Fabrizia); A. Inagaki (Akiko); S.I. de Vries (Sanne); E. Wassenaar (Evelyne); S. Schoenmakers (Sam); C.E. Vermeulen (Cindy); W.A. van Cappellen (Gert); E. Sleddens-Linkels (Esther); J.A. Grootegoed (Anton); H.P.J. te Riele (Hein); B. de Massy (Bernard); W.M. Baarends (Willy)

    2013-01-01

    textabstractIn mammalian meiotic prophase, the initial steps in repair of SPO11-induced DNA double-strand breaks (DSBs) are required to obtain stable homologous chromosome pairing and synapsis. The X and Y chromosomes pair and synapse only in the short pseudo-autosomal regions. The rest of the

  8. Emerging critical roles of Fe-S clusters in DNA replication and repair

    Science.gov (United States)

    Fuss, Jill O.; Tsai, Chi-Lin; Ishida, Justin P.; Tainer, John A.

    2015-01-01

    Fe-S clusters are partners in the origin of life that predate cells, acetyl-CoA metabolism, DNA, and the RNA world. The double helix solved the mystery of DNA replication by base pairing for accurate copying. Yet, for genome stability necessary to life, the double helix has equally important implications for damage repair. Here we examine striking advances that uncover Fe-S cluster roles both in copying the genetic sequence by DNA polymerases and in crucial repair processes for genome maintenance, as mutational defects cause cancer and degenerative disease. Moreover, we examine an exciting, controversial role for Fe-S clusters in a third element required for life – the long-range coordination and regulation of replication and repair events. By their ability to delocalize electrons over both Fe and S centers, Fe-S clusters have unbeatable features for protein conformational control and charge transfer via double-stranded DNA that may fundamentally transform our understanding of life, replication, and repair. PMID:25655665

  9. Modeling DNA Repair: Approaching In Vivo Techniques in the Hyperthermophile Sulfolobus Solfataricus

    Energy Technology Data Exchange (ETDEWEB)

    Blanton, J.; Fuss, J.; Yannone, S.M.; Tainer, J.A.; Cooper, P.K.

    2005-01-01

    Archaea are found in some of the most extreme environments on earth and represent a third domain of life distinct from Eukarya and Eubacteria. The hyperthermophilic archaeon Sulfolobus solfataricus, isolated from acidic hot springs (80oC, pH 3) in Yellowstone National Park, has emerged as a potential model system for studying human DNA repair processes. Archaea are more closely related to Eukarya than to Eubacteria, suggesting that archaeal DNA repair machinery may model the complex human system much more closely than that of other prokaryotes. DNA repair requires coordinated protein-protein interactions that are frequently transient. Protein complexes that are transient at extreme temperatures where archaea thrive may be more stable at room temperature, allowing for the characterization of otherwise short-lived complexes. However, characterization of these systems in archaea has been limited by the absence of a stable in vivo transformation and expression system. The work presented here is a pilot study in gene cloning and recombinant protein expression in S. solfataricus. Three genes associated with DNA repair were selected for expression: MRE11, PCNA1, and a putative CSB homologue. Though preparation of these recombinant genes followed standard methods, preparation of a suitable vector proved more challenging. The shuttle vector pSSV64, derived from the SSV1 virus and the E. coli vector pBSSK+, was most successfully isolated from the DH5α E. coli strain. Currently, alternative vectors are being designed for more efficient genetic manipulations in S. solfataricus.

  10. Bridging plant and human radiation response and DNA repair through an in silico approach

    Czech Academy of Sciences Publication Activity Database

    Nikitaki, Z.; Pavlopoulou, A.; Holá, Marcela; Donà, M.; Michalopoulos, I.; Balestrazzi, A.; Angelis, Karel; Georgakilas, A. G.

    2017-01-01

    Roč. 9, č. 6 (2017), č. článku 65. ISSN 2072-6694 R&D Projects: GA ČR GA16-01137S Institutional support: RVO:61389030 Keywords : Bioinformatics * DNA damage repair * In silico analysis * Ionizing radiation * Plant radiation biodosimeter * Ultraviolet radiation Subject RIV: EB - Genetics ; Molecular Biology

  11. Expression signatures of DNA repair genes correlate with survival prognosis of astrocytoma patients.

    Science.gov (United States)

    de Sousa, Juliana Ferreira; Torrieri, Raul; Serafim, Rodolfo Bortolozo; Di Cristofaro, Luis Fernando Macedo; Escanfella, Fábio Dalbon; Ribeiro, Rodrigo; Zanette, Dalila Lucíola; Paçó-Larson, Maria Luisa; da Silva, Wilson Araujo; Tirapelli, Daniela Pretti da Cunha; Neder, Luciano; Carlotti, Carlos Gilberto; Valente, Valeria

    2017-04-01

    Astrocytomas are the most common primary brain tumors. They are very resistant to therapies and usually progress rapidly to high-grade lesions. Here, we investigated the potential role of DNA repair genes in astrocytoma progression and resistance. To this aim, we performed a polymerase chain reaction array-based analysis focused on DNA repair genes and searched for correlations between expression patters and survival prognoses. We found 19 genes significantly altered. Combining these genes in all possible arrangements, we found 421 expression signatures strongly associated with poor survival. Importantly, five genes (DDB2, EXO1, NEIL3, BRCA2, and BRIP1) were independently correlated with worse prognoses, revealing single-gene signatures. Moreover, silencing of EXO1, which is remarkably overexpressed, promoted faster restoration of double-strand breaks, while NEIL3 knockdown, also highly overexpressed, caused an increment in DNA damage and cell death after irradiation of glioblastoma cells. These results disclose the importance of DNA repair pathways for the maintenance of genomic stability of high-grade astrocytomas and suggest that EXO1 and NEIL3 overexpression confers more efficiency for double-strand break repair and resistance to reactive oxygen species, respectively. Thereby, we highlight these two genes as potentially related with tumor aggressiveness and promising candidates as novel therapeutic targets.

  12. NAD(+) Replenishment Improves Lifespan and Healthspan in Ataxia Telangiectasia Models via Mitophagy and DNA Repair

    DEFF Research Database (Denmark)

    Fang, Evandro Fei; Kassahun, Henok; Croteau, Deborah L

    2016-01-01

    Ataxia telangiectasia (A-T) is a rare autosomal recessive disease characterized by progressive neurodegeneration and cerebellar ataxia. A-T is causally linked to defects in ATM, a master regulator of the response to and repair of DNA double-strand breaks. The molecular basis of cerebellar atrophy...

  13. Assignment of ten DNA repair genes from Schizosaccharomyces pombe to chromosomal NotI restriction fragments

    NARCIS (Netherlands)

    B.C. Broughton; N.C. Barbet; J. Murray (Johanne); F.Z. Watts (Felicity); M.H.M. Koken (Marcel); A.R. Lehmann (Alan); A.M. Carr (Anthony)

    1991-01-01

    textabstractTen DNA repair (rad) genes from the fission yeast, Schizosaccharomyces pombe were mapped to the 17 NotI fragments of the three chromosomes. Nine of the genes map to chromosome I, but there is no evidence for significant clustering.

  14. Infliximab inhibits DNA repair in ultraviolet B-irradiated premalignant keratinocytes

    DEFF Research Database (Denmark)

    Faurschou, A.; Gniadecki, R.; Wulf, Hans Chr.

    2008-01-01

    affects the cell cycle and DNA repair in premalignant human keratinocytes after ultraviolet-B (UVB) irradiation. We found that infliximab-treated cells exhibited an enhanced G2/M cell cycle arrest and increased apoptosis after 10-20 mJ/cm(2) UVB. In spite of this, the level of cyclobutane pyrimidine...

  15. Nuclear localization of human DNA mismatch repair protein exonuclease 1 (hEXO1)

    DEFF Research Database (Denmark)

    Knudsen, Nina Østergaard; Nielsen, Finn Cilius; Vinther, Lena

    2007-01-01

    Human exonuclease 1 (hEXO1) is implicated in DNA mismatch repair (MMR) and mutations in hEXO1 may be associated with hereditary nonpolyposis colorectal cancer (HNPCC). Since the subcellular localization of MMR proteins is essential for proper MMR function, we characterized possible nuclear locali...

  16. Shutting down the power supply for DNA repair in cancer cells

    NARCIS (Netherlands)

    van Vugt, Marcel A. T. M.

    Phosphoglycerate mutase 1 (PGAM1) functions in glycolysis. In this issue, Qu et al. (2017. J. Cell Biol. https://doi.org/10.1083/jcb.201607008) show that PGAM1 inactivation leads to nucleotide depletion, which causes defective homologous recombination-mediated DNA repair, suggesting that targeting

  17. DNA repair gene XRCC7 G6721T variant and susceptibility to ...

    African Journals Online (AJOL)

    Mostafa Saadat

    2016-02-20

    Feb 20, 2016 ... Abstract Background: The human XRCC7 (MIM: 600899) is a DNA double-strand break repair gene, involved in non-homologous end joining (NHEJ). Polymorphism G6721T (rs7003908) is located in the intron 8 of the XRCC7. This polymorphism may regulate splicing and cause mRNA instability. Aim: The ...

  18. Role of Estrogen and Other Sex Hormones in Brain Aging. Neuroprotection and DNA Repair

    Directory of Open Access Journals (Sweden)

    Sandra Zárate

    2017-12-01

    Full Text Available Aging is an inevitable biological process characterized by a progressive decline in physiological function and increased susceptibility to disease. The detrimental effects of aging are observed in all tissues, the brain being the most important one due to its main role in the homeostasis of the organism. As our knowledge about the underlying mechanisms of brain aging increases, potential approaches to preserve brain function rise significantly. Accumulating evidence suggests that loss of genomic maintenance may contribute to aging, especially in the central nervous system (CNS owing to its low DNA repair capacity. Sex hormones, particularly estrogens, possess potent antioxidant properties and play important roles in maintaining normal reproductive and non-reproductive functions. They exert neuroprotective actions and their loss during aging and natural or surgical menopause is associated with mitochondrial dysfunction, neuroinflammation, synaptic decline, cognitive impairment and increased risk of age-related disorders. Moreover, loss of sex hormones has been suggested to promote an accelerated aging phenotype eventually leading to the development of brain hypometabolism, a feature often observed in menopausal women and prodromal Alzheimer’s disease (AD. Although data on the relation between sex hormones and DNA repair mechanisms in the brain is still limited, various investigations have linked sex hormone levels with different DNA repair enzymes. Here, we review estrogen anti-aging and neuroprotective mechanisms, which are currently an area of intense study, together with the effect they may have on the DNA repair capacity in the brain.

  19. Human papillomavirus mediated inhibition of DNA damage sensing and repair drives skin carcinogenesis

    NARCIS (Netherlands)

    M. Hufbauer (Martin); J. Cooke (James); G.T.J. van der Horst (Gijsbertus); H. Pfister (Herbert); A. Storey (Alan); B. Akgül (Baki)

    2015-01-01

    textabstractBackground: The failure to mount an effective DNA damage response to repair UV induced cyclobutane pyrimidine dimers (CPDs) results in an increased propensity to develop cutaneous squamous cell carcinoma (cSCC). High-risk patient groups, such as organ transplant recipients (OTRs)

  20. Pan-cancer analysis of bi-allelic alterations in homologous recombination DNA repair genes.

    Science.gov (United States)

    Riaz, Nadeem; Blecua, Pedro; Lim, Raymond S; Shen, Ronglai; Higginson, Daniel S; Weinhold, Nils; Norton, Larry; Weigelt, Britta; Powell, Simon N; Reis-Filho, Jorge S

    2017-10-11

    BRCA1 and BRCA2 are involved in homologous recombination (HR) DNA repair and are germ-line cancer pre-disposition genes that result in a syndrome of hereditary breast and ovarian cancer (HBOC). Whether germ-line or somatic alterations in these genes or other members of the HR pathway and if mono- or bi-allelic alterations of HR-related genes have a phenotypic impact on other cancers remains to be fully elucidated. Here, we perform a pan-cancer analysis of The Cancer Genome Atlas (TCGA) data set and observe that bi-allelic pathogenic alterations in homologous recombination (HR) DNA repair-related genes are prevalent across many malignancies. These bi-allelic alterations often associate with genomic features of HR deficiency. Further, in ovarian, breast and prostate cancers, bi-allelic alterations are mutually exclusive of each other. The combination of these two properties facilitates reclassification of variants of unknown significance affecting DNA repair genes, and may help personalize HR directed therapies in the clinic.Germline mutations in homologous recombination (HR) DNA repair genes are linked to breast and ovarian cancer. Here, the authors show that mutually exclusive bi-allelic inactivation of HR genes are present in other cancer types and associated with genomic features of HR deficiency, expanding the potential use of HR-directed therapies.

  1. Synaptic proteome changes in a DNA repair deficient Ercc1 mouse model of accelerated aging

    NARCIS (Netherlands)

    M.J. Végh (Marlene); M.C. de Waard (Monique); I. van der Pluijm (Ingrid); Y. Ridwan (Yanto); M.J.M. Sassen (Marion J.); P. van Nierop (Pim); R.C. van der Schors (Roel); K.W. Li (Ka Wan); J.H.J. Hoeijmakers (Jan); A.B. Smit (August); R.E. van Kesteren (Ronald)

    2012-01-01

    textabstractCognitive decline is one of the earliest hallmarks of both normal and pathological brain aging. Here we used Ercc1 mutant mice, which are impaired in multiple DNA repair systems and consequently show accelerated aging and progressive memory deficits, to identify changes in the levels of

  2. Synaptic proteome changes in a DNA repair deficient ercc1 mouse model of accelerated aging

    NARCIS (Netherlands)

    Vegh, M.J.; de Waard, M.C.; van der Pluijm, I.; Ridwan, Y; Sassen, M.J.M.; van Nierop, P.; van der Schors, R.C.; Li, K.W.; Hoeijmakers, J.H.J.; Smit, A.B.; van Kesteren, R.E.

    2012-01-01

    Cognitive decline is one of the earliest hallmarks of both normal and pathological brain aging. Here we used Ercc1 mutant mice, which are impaired in multiple DNA repair systems and consequently show accelerated aging and progressive memory deficits, to identify changes in the levels of hippocampal

  3. Salidroside stimulates DNA repair enzyme Parp-1 activity in mouse HSC maintenance.

    Science.gov (United States)

    Li, Xue; Sipple, Jared; Pang, Qishen; Du, Wei

    2012-05-03

    Salidroside is a phenylpropanoid glycoside isolated from the medicinal plant Rhodiola rosea, which has potent antioxidant properties. Here we show that salidroside prevented the loss of hematopoietic stem cells (HSCs) in mice under oxidative stress. Quiescent HSCs were recruited into cell cycling on in vivo challenge with oxidative stress, which was blocked by salidroside. Surprisingly, salidroside does not prevent the production of reactive oxygen species but reduces hydrogen peroxide-induced DNA-strand breaks in bone marrow cells enriched for HSCs. We tested whether salidroside enhances oxidative DNA damage repair in mice deficient for 5 DNA repair pathways known to be involved in oxidative DNA damage repair; we found that salidroside activated poly(ADP-ribose)polymerase-1 (PARP-1), a component of the base excision repair pathway, in mouse bone marrow HSCs as well as primary fibroblasts and human lymphoblasts. PARP-1 activation by salidroside protects quiescent HSCs from oxidative stress-induced cycling in native animals and self-renewal defect in transplanted recipients, which was abrogated by genetic ablation or pharmacologic inhibition of PARP-1. Together, these findings suggest that activation of PARP-1 by salidroside could affect the homeostasis and function of HSCs and contribute to the antioxidant effects of salidroside.

  4. Analysis of DNA repair gene polymorphisms and survival in low-grade and anaplastic gliomas

    DEFF Research Database (Denmark)

    Berntsson, Shala Ghaderi; Wibom, Carl; Sjöström, Sara

    2011-01-01

    different DNA repair genes (ATM, NEIL1, NEIL2, ERCC6 and RPA4) which were associated with survival. Finally, these eight genetic variants were adjusted for treatment, malignancy grade, patient age and gender, leaving one variant, rs4253079, mapped to ERCC6, with a significant association to survival (OR 0...

  5. DNA repair gene XRCC7 G6721T variant and susceptibility to ...

    African Journals Online (AJOL)

    Background: The human XRCC7 (MIM: 600899) is a DNA double-strand break repair gene, involved in non-homologous end joining (NHEJ). Polymorphism G6721T (rs7003908) is located in the intron 8 of the XRCC7. This polymorphism may regulate splicing and cause mRNA instability. Aim: The aim of the present study ...

  6. Physicochemical Mechanism of Light-Driven DNA Repair by (6-4) Photolyases

    Science.gov (United States)

    Faraji, Shirin; Dreuw, Andreas

    2014-04-01

    DNA photolyases are light-activated enzymes that repair DNA damage induced by ultraviolet (UV) radiation. UV radiation causes two of the most abundant mutagenic and cytotoxic DNA lesions: cyclobutane pyrimidine dimers and 6-4 photolesions. Photolyases selectively bind to DNA and initiate the splitting of mutagenic pyrimidine dimers via photoinduced electron transfer from a flavin adenine dinucleotide anion (FADH-) to the lesion triggering its repair. This review discusses the consecutive steps of the repair process, from both experimental and theoretical points of view. It covers the following issues: the process of how photolyases accommodate the lesion into their binding pockets, excitation energy transfer between two involved catalytic cofactors, photoinduced electron transfer to the lesion, the splitting of the pyrimidine dimer radical anion, and the fate of the unstable radical species created after the splitting of the thymine dimer. In particular, mechanisms of the splitting and restoration of the original bases are described in detail, and the most probable repair pathways are outlined.

  7. A data mining approach for classifying DNA repair genes into ageing-related or non-ageing-related.

    Science.gov (United States)

    Freitas, Alex A; Vasieva, Olga; de Magalhães, João Pedro

    2011-01-12

    The ageing of the worldwide population means there is a growing need for research on the biology of ageing. DNA damage is likely a key contributor to the ageing process and elucidating the role of different DNA repair systems in ageing is of great interest. In this paper we propose a data mining approach, based on classification methods (decision trees and Naive Bayes), for analysing data about human DNA repair genes. The goal is to build classification models that allow us to discriminate between ageing-related and non-ageing-related DNA repair genes, in order to better understand their different properties. The main patterns discovered by the classification methods are as follows: (a) the number of protein-protein interactions was a predictor of DNA repair proteins being ageing-related; (b) the use of predictor attributes bas